ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 10:26:17 &.(6CHH Adobe_CMAdobed            _" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T=sʶƱ-h-꣍zya G{i._#R5״-l ~{tn~Kj{mmAwG'M2Đ$IIPxּ rzem,{tVuvrY"ߤE4|sbx68ǛLLK{|pzh73O>[_?Mb+~b}V~j[1IJ<\r\i SdR |O`iz$=6LƄIp{w\̴e?˜O[X>bHk&?GՓ2{j w?XbﹱXM|Os%>%W9ͅ{  }<@oVz_Wb@=X0kv.sEvc 'uc^M9oNw:@o D3$zl~lylM0whuuyY6c޳sF@y"8Ntk@9 5a e[$]C1?W%d}wö~rг_fmUn$H:4" $u 5{[5\Q9Yqe]CAgt]]KkI?7W&:Cxԯ#cd~htu矒Nxݯ\wa[{4 !ØD%L<=Qk[k?k 'HӴ5@IПȦ2 ;!L矊Tfn:GmLhI{Ξ*!͉]S{xIBJgĝ?$#GLa !8ΰRRv\w;u*fV-M!GH ln~e3ߐJYه[IcSvP .y^ʶW[㋜#͸3uпݵo?ws?m-ޱ,2 Y[+k?c+\teB14s~">gWҬc}ms73r&̸躳2>ېE]?xW5װ:cCzf=)EB={45$\jQMX,e{e=ܟo=]_UUc>c>8uކ7▞?+"ӏEֺvXֵߺk7Lys:= 貒`Z0pڸ .c7h.l{lZ:On Yk@.f}yRP5ٔXfUvyٿ_m22]<|OBޢá3O!!O\X|:{OHe6r`B;17<9h {4ٽ洐A_wWLֱnUASFeIѱ?[=fחhq):(=?q]-:I.htH3XW_%{2zs5 ROL5ǎX\犞"u[Xfq"@{#EԞZ6[I#k7]}JGqy&wC)#nĴ9:ÿ9qǺvzMGў>9H;%u5CZ6UJq`KwWm]mڟ3[}~CqJ*"\?nֵOQ0pg[pY~R~v6%x~h =m﫹=Ak]鏴&Oku"(8U[2KEeOgz^:>?Z`vnUhk5}suqT'h/ңsgԍ :3I[G:"72h6u %I#''̪5u/Q ݻwrUHM " 4"x♭hlѧd߾?94ZGxPsX#%A/Q׺JdC[n5C=Zq-9?N_ĭpuo9ISko©w'oI ^Q{a#E}#kv׹V\#s[=zoiF^r9ym_C,{Ệw4%~Hp?Xq_+tJPkonv^e]e-}uk^ۺxNmfݗ54 L ldE׃zUák,8 wm^]?55v- kvP 4j,s+%1aa#K_M.O׺:?K5=Y15Wun+dkګS;w¿^01W&dv7/6f'`xoOLqF;I@ A $"5xk: YcC@fj5P=ѧ޶< l6Q=!:*_-o{p~[G*&:Kۇ`\qsFM"?iP6jqEH'AKg)kLO!K~h4giK@ ?=(bf[ǍcEl,g􋿑w<2<@'VUN}ձe1XqD鿋[qmz#զQ{]׏MtRݵT;5k[j徠}] ^v^mcҘ>_5֣ÚvhlTI%)$IHrhƷ%/apň#V3"K}/v3v/BH>hIQJ;[w]$ .3z\K~Kt5 ,[_?Mb+~b}V~j[1IJ<\r\i SdR |O`iz$=6LƄIp{w\̴e?˜O[X>bHk&?GՓ2{j w?XbﹱXM|Os%>%W9ͅ{  }<@oVz_Wb@=X0kv.sEvc 'uc^M9oNw:@o D3$zl~lylM0whuuyY6c޳sF@y"8Ntk@9 5a e[$]C1?W%d}wö~rг_fmUn$H:4" $u 5{[5\Q9Yqe]CAgt]]KkI?7W&:Cxԯ#cd~htu矒Nxݯ\wa[{4 !ØD%L<=Qk[k?k 'HӴ5@IПȦ2 ;!L矊Tfn:GmLhI{Ξ*!͉]S{xIBJgĝ?$#GLa !8ΰRRv\w;u*fV-M!GH ln~e3ߐJYه[IcSvP .y^ʶW[㋜#͸3uпݵo?ws?m-ޱ,2 Y[+k?c+\teB14s~">gWҬc}ms73r&̸躳2>ېE]?xW5װ:cCzf=)EB={45$\jQMX,e{e=ܟo=]_UUc>c>8uކ7▞?+"ӏEֺvXֵߺk7Lys:= 貒`Z0pڸ .c7h.l{lZ:On Yk@.f}yRP5ٔXfUvyٿ_m22]<|OBޢá3O!!O\X|:{OHe6r`B;17<9h {4ٽ洐A_wWLֱnUASFeIѱ?[=fחhq):(=?q]-:I.htH3XW_%{2zs5 ROL5ǎX\犞"u[Xfq"@{#EԞZ6[I#k7]}JGqy&wC)#nĴ9:ÿ9qǺvzMGў>9H;%u5CZ6UJq`KwWm]mڟ3[}~CqJ*"\?nֵOQ0pg[pY~R~v6%x~h =m﫹=Ak]鏴&Oku"(8U[2KEeOgz^:>?Z`vnUhk5}suqT'h/ңsgԍ :3I[G:"72h6u %I#''̪5u/Q ݻwrUHM " 4"x♭hlѧd߾?94ZGxPsX#%A/Q׺JdC[n5C=Zq-9?N_ĭpuo9ISko©w'oI ^Q{a#E}#kv׹V\#s[=zoiF^r9ym_C,{Ệw4%~Hp?Xq_+tJPkonv^e]e-}uk^ۺxNmfݗ54 L ldE׃zUák,8 wm^]?55v- kvP 4j,s+%1aa#K_M.O׺:?K5=Y15Wun+dkګS;w¿^01W&dv7/6f'`xoOLqF;I@ A $"5xk: YcC@fj5P=ѧ޶< l6Q=!:*_-o{p~[G*&:Kۇ`\qsFM"?iP6jqEH'AKg)kLO!K~h4giK@ ?=(bf[ǍcEl,g􋿑w<2<@'VUN}ձe1XqD鿋[qmz#զQ{]׏MtRݵT;5k[j徠}] ^v^mcҘ>_5֣ÚvhlTI%)$IHrhƷ%/apň#V3"K}/v3v/BH>hIQJ;[w]$ .3z\K~Kt5 , ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$@O )I$I#ՇenjX^!#RI&jvWH'UeC2 (M%cSmO Ǻl32|2= J[6Ŏz tWm; `(q0e'a<,'tVGRRmh%KY$)J~oG9H6RW$sVx$pM(ӄi! [6$pmX( m%Ɵ`%I3[A]kcyqݰ'Zrru'aj_`$x'L|W:Է0el~ܙ$RY-|\DW.ˤ)Y-~ d;B˲&gٖ#jeM)Jc|NHeLVIvɾgH=I q;&_$PIH6x$RI$$[OHRI$$(IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$J JRI$II2I঄I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$Jlh%_ϷWh]J[$blJ=XvBޣU^IWkkD a<"HfGCsyOK4n5dKDږ_LS&P-G-'Q)TdVJrͣDTR.P.L z!7r++M3)f*Ŏw \;PW 9"Ro#h>z(B6S$Sza@aS)lNYxB*Im!> R-ipNڣD\r;,Y(ҵa$*SVnqו:=0$ $jp|B3K\ $Q2[AVPD7 M2C)@GDdmTJRKi( cS:'DSkgos)"qQ&;; |EIO*:-ajwN#qhc4BA*pC]K<7TmTRM> <3"NE=dKJR0y0FҘ5+E*SdxVT;6O*)s)fVyhS{e\1nM@[Ai!1ꍔ{qR!܂z]JBvR+})JdW> cXZWH.uIj\K}]:Ԁ5rm> 45܀JQ[xIFR8Dz-#SX\J|Y$%%/)5[Yq'$`KO&ZMs%ğd.K*vDoFއ]yJBmY=DZAT_Kڇeۂdcz(DhC8!W{qpKxQUҟ~㪐JxGF{U4΍S Gk06=J-THOrz4Q~Q6 JSBuU-tj璯5T jVQܖJxTE)Egwsu)YGܖIgNָDď`2N$JTN5GJcN;IJŤrRXAv5O-8ę$-˞i]3ze1+:e_O{I u.SiMujnH.0`JXʤ+:v;A=\Ai$({ܰ[Gz l#ٓ$w'ܲZCdA#ڗeQIj;zKOt+ڒ&d?e6yRwIh{R]$Ҕ)d+ I)YI-vA)I'ْ&ۖ"KptGc) XW&I(R[æ 7Z}2IFJ[ %t?6td8QSl> lw~P J\Ivi(n)I\ߦO==c?0x%ğIBJ[ < qaWR1j<1iC_wfc`Sz/+}BƯI 8%rދ oMuSz WR$)\-tğG-\A%n\wFq%.${$w$+Pح񋻴" `;%ğcŒJ;-˝ct-'q.$ ܰӞyO[V z}% nXc8O!炶;(K^YJV0m[AJ\E^YJ[+=H-ǔRWR!) tR=&nA\E^YJR`ɻ7웼ArWrSm'"˙] %J\JbBR!<݇hқ]1Id%Nj47%s_eJotaxICr[2ixSzn]Ag}C_wfr[- m> 5w/UGvi!)o+|m> =>?G+D3 .UN/ش0bLPޛ\KGBޏk~@8d$,wRopI%!QIiE%a#&XA]:E,㪘 CP .>Ά8KcLޞ8DoM ݒJEwN*y 3.0BSʌ{uMASOR$rcJ]ur K?wҤ-˔ ߺR ߺWYF8KWt H8ɜuQ8 Gt ,0-=Kj, RM <}SHCOL~iP=>ui"R.L\?4W]TFB\j2]qgJ[CǙks,>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$@J5X[BII .-:3ª$pM4jzehctf3[fV L{d1+&.Cp(׋Uc8N`p;$}D`qJR)N2RDI$Z$}wH{N) I U-)4b0)8ExS%iP1]I~`jPC+S=c),.{4kI-NN}!Ħ9GMjԶ'ܘaDwtoKTŢR+ @ %( MzN);J&:D-/J'ʐQv4TF`(%$<%ccZ()ҕ'\9R"%/H!MhKb[!z<|p(JL-$*e ² G`IA:>Ll1B)Zr<ڛ)P &:z~I7vSiHos>IK(L}&yj6⡹`Z5; 5x)$PD*?4TP90SP۹MBbbRA?NRRI))j y̢!ÄK*3tޙMDV)%D1BLF$M!(KjoGĤ+#qIZ*ShJ5@'xITNĶ?L-(&4O1bJ]$)QBRRbS fj_n%/4^SLT$7Dr}vR5Q* SPޚeUlp\&Q<$?尠O[diN$ZyQ-TJv*RyM 0Х KdQڟ@_t-4Jb(`o=:+M2L\R qL*&JO !,=ҥX\1p BBTM3NUR!W~PE-(%F=/+:I翘M钦B$R)HUryKL #j@)JJ8|Q=9ҒLSJ`-(¹zhZitGrR)!0U^S)JT7'ײϚ设|~ KgA6UA("c#^dVKzmG }ʗOBJVVДǴiH‘`o% QR PI<)4(s5KU)rDLИ\¢S@$җ [iJ R oRAZ(O)nSKh<(zD$B Y$S,<' QeOu!sO#TJҔZjAL0 rt?$JR E)%)!A-2xIjQ{')N'xnR(tms% L(lo'UEqKg-T%>%<4q)[HBVĤ$Uvp/:sVz'PײrXySeN#c{{8#j 1*0{@3IخyUd&s!i P x3 Hr\eڣj åGhJ@WFVKG)& G )I@6Ug'B#j%hx Ƣ@w)8荩IprCUYi8!H ^BI&Fu-i%/)&K%&htO>ϤtIJ&$J[|R:*Lj+))Z1)jxPkGe#P<'EeGj%6䶒VY{ȅ -iJT#D2C%![V-TJU9USҤ[RJRfx{bTcFT)V70wR8rxp3&ISJiCs 6$+-ۢ*,$R12֢J ֓Ω(`O%<"8T%jM7 EX9 :\cVKdBW, օR_m?IV\0{B`JVTBmCR=a uh'ǔ@Aeq yM#L)ĝR1M:(2F3etS(-h5CuqDG)8KDʘh %)oyLK E-JRx&9J$hRIH8Iu) l4R"%)_X)>RXO<|mn D/c`KiN[*0a9$?O_$ސpc()-@QoTyL)(`COkA9tt(՝$%JZ<{S 9V7BR R[FpOeZhPld;iS(RҊ[?F#hnR}cU ݩSg:8oQ[}np8١TaBupI$I$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$ks )I$J7JNiQu: eII&$` w`zAq[`q9#D6xo4(z)J@`Gd.D@6 jADLn'D8~d08pR.Jp)RJyIIBv D4 R&-R ah(zqʟҤNyM)cS Q%+hJiOJAn|J}RoH)2)z:릉)R-%*@pTqkthS蒙s@=RMIH G1X*ڐ5) =ҤTV͝RA $OdV &Qqk~`쑧w)RJyKr&5'm &$b*C@y$I$JiLI+Mμ!kIpN@i*`7B}o%2M)=IN֩J NܯiVSJpčh#T%W/&9ÞP[ Җ8d!%*U->HP%A)So([`O(JC$k)`%Oe#`R BSgD_$(Lb@pIҥ)L! F @M!iSnP%D<ʸv۳E&P)e\ ;^m3r9 5- ߽@ IJ J!:mb(+M*RҚ #\ODCUhEOdVZě5СlzyBA A瘔QlSXG %P3)j@FP+mr>*AS6Ρ*M2~ B8x&e9&S$C)C[Pk䜱EKprBi [Gb9Q2xHRR))-SvLI<1r<:A!\&</P@ h9RS)')'/~o> JJVД% !T5JҸ)J(zBSR'BK[&)XD!kxC7΁%.\T jT;z(VhrTƄvԧp+'R9MUS F PTvd) X-gb)JiH!R_hg_ioE-l)l>)9Mt*''z5KU-NBk9-E?^$%(HTBPwl|q &*K@( e yO(~S$ZRBPvxvL*Z&2uO!^RRҚTL`9m}&`p<d&>Э4(fBԺHe)nA'Ptk jU2OS)#R؉* j~Bp!=v;gVU:J5P-JVd@#U9{jRh)O;)3rVPڣ()xF[#cRZSO'XHꀜX9FkJe(JAڌi®ohB!I1rԶgdrc{[.:p aRH(EvI'YN@^""% =f3HrR򔨖yKb7rZ5JLR-P@6"ĈM"uJL>T|҂ਗhtB}hT6$)'Oh;Ң+6򂖔TL[ܩ4S'40[4L-lrA+ $ZS 'p)L&09Hʉ3"7}ʀ1!inHvC(g `<&{ScCNX~(,~-0U`HKo)åI͑ UTRi,m̈́74RPxSMvG D}6$RA#QScB_$PPSu 4N SKD'UQH*cD\~)ưu0,Ϭz5Ê7'J 2%V[DRI%#M2I$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I+Xd$#AI$U@'fuUu$T}1xTd!Ӫ$a+R]< *L^FfK $>pn'`c|RV H5)IERmNITW"SmJS( JQq\ Jh FR [ FK*;ܢ+Ogܣ5 9oJiO)@N@?$5Fq)I% #i?@AJ]$$v gܥj"ҙ@U,D4$59 ΥV!DP.= T٦cXg $J'Tn J@Ӻ]t*SBl%!!Dr>hhVS)@*.h)LMdNJTͶTsIД=y(ҭmN!>dJbExN)IaI $Z)ϊNx%MАJR.B]DQ\Rm@jPR)=.%aqR,ze)J &U4# ҵS)JTDP ?oY:L&uKT)L8l) SmޯvJ(iJSL@HV&HT'Dj-x S1r[S ~p* JiM:'5*_jq'a*ؗ$ҥ顡)RQN"a( j"P :( $kT_seGd5U[B}̔Ū,(iJS hEQO e#Be%/)4ɐ~)!2J}>H.@V@s X^\9 BQT4ΐ3Y;ςVX4)P%] U@f]VfJiQR@ua-.Х0|R৕I朹)<$](H$>y GŤVJTUN5NY )[R%"FBR{itQ.=rj R[QO%ID"!.%)8DMTJR &坔N/)Jd@h J)LSڣU!H5'$ VTrmɠJk>A-w*>2.۷p<›7d B>Q)JI&)JL J)oq\ P)M*%L#m4i䕪RX;r\`"qS)N)24H5JKI |Ql䶑Ω#jdY'ILD kRHEΉ1)!IP Qji'S [ǎIR(LT[[2{| p $^BiLPjBL ѡ)*nM1!'U )“`jBZE)LKʖ0lHL䧵w(nkD* BRѢ(Od RR?ڞxO{S)Y:L'R2e}f4' 6ڛ`QHSF+E$6D")}Dܣ8QMP䖨є)S` xR %-8>HIBP98dbY~Ѵ肭\%)AOT!D7dn3oJ)AF ૜4M6*iR+[‘sJR&Ks\U)Bh2!<{s@&))[R$S%/D& )m%SbNAhĐۚGE?M}2Hʉi;yC*Ms\} gշC)T1p:R(†B(g!X'$'7|S +-&> )qN@rg LiwUn "&=[P5a6~hDQ۲*HTQp1;w5D65Q"x(8T.0WIF "4wE9SZ[};m%Eߢ|#d_)C?T8kp RI%an$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$.05Vw۬@I"$IQ;o0V'Fku~hKk @3:EQ/P.ͧ)7@83ʌ[1a22SNN: R # I)n‹Be0(KpN 660-N$- ()AMtꧽI%*Z&0{֓i'R*;.UGF$@0j@#jpa0ryMuKiSa(!)LuP&oN9MXV !@ M$D8+ z3 tNքmT)%@UԶ3!jJR% s ȡx( L;o TbT0ZI)H98ERۂ4 ohЩMהp)$lhOsʟCD4JJ oT&g8$#$l} D?3w0%+jm)H8EԭTQLJN|![:1 S(  EY6~)^R6vhB %@&y:$`w"K+%*H6Asnb׀0D%}wrR EJ:d6/q )R*M` A4NΈ䚕1pLjI* " u:(Y UayqR['=DvӬlkB3f>IV5ԃu-),L_Hp$ڔ(:0`L۵LJr֕'f;L N%!)g FAQZLw7x*Mk'CJXy P;㦡1 T涎 IT$Rk@E`PF[:%VQ-'4#Fp-{5$1}jM 5;ʋ8Q{#JxHA݊b}7!()bJSnO51*l!-EZJbM仰Q7XD+N*XE[Rw%U,:ʉu$ʶi q(ڸY@OVS`;)GRR&a-+$O^M)Jm aM4IJ$6?2Dsjhto IDIRSCZIL^8hIJL(DLl=(r7̤(NtMF=x.L+J^ ӷ) kH2Rh>  7$$J[~ ly- *ԘZ$@<02R>*$BJ@JqrP8$,Lta9x/LRJByJTY>I: ƨ)+U R$nNsHc(ې)egǚcJExJw)cohިکxHڥ*"~IQHui1۹AKKDH\'RT4)T4&B@}"{cE#BL&ܚJmP/"Ea0G% U(G*$g '|a0VSA&!xT G c]R&ޖ)!4uOo.$pR@8R:)n⍄QLCzp -> "YBhORv\8LVj_i"6[p, Jbc Qo(Afwh;+- ]*DʄG M2H"@y-d;#ڦN~;(wk8Nu-?eBl0l%6ݺTx>I!hM<\Tl{XL!tPDz) $H!Z{OnN>(êhJ&0%V2ۧ(DO %Sj 0 'Koazg' pA9êI`ݗ+ԆF^F`'Ɋ4^游HsLw#uK,zԓq.sV\I$9I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JJRI$J:7A٭P$H┺)$‰,0]2V52V&lFL^*%ttZ-kF_:4 ]MYh %;Y)>(Oȓ6x 4HRT>*$FyD@dITEfR)JM-yHn! % \L)KD=$Kt)9JIVL\͝RN)Eʉ~5IJ3:'k)m u쒗{wLtӺcbB'J.(N(7&ߦ" R-`ԡ:J{nvxIKBt)oo'Z8 IJðL/ׄO ZI)(#N_+UHЅĔ<GPZ$BײHxJ`xNotiO=BKDl8Hx%$)I$hHt Έ)\J@S!0jMt'OΒP[I(FɞcI&{(:JRR6KrxKj^roF9KThږb>)>J.U-mKj٧Rm<[ڥ胠/G &%7'ےܖОHP#KUX[r[x m?mWuM.)*֐R1` ~{$"pi!RN$AO)?;h}6(JjNZJqTjRESIJqwbS @)4I+UBPƉmdiPIJoJFILAh.RR)"^F<( &¶^{r9Bҩ!-ɡ)B pFhGu j%!Fa4OuQ4!aL<C{OP\imQ7IK#D#dDh$ LI+| DLH~/`p MD0wBt'Q$ݣ ;TѹQLpd(Q\!Nr>InRTI RS%0:(L {%(`hli2KJ N=H q!D ogplVE]LZTڄ} H*`hL7umJ5OCn h6DCcI;H/$ e2%EPZn:@0)0y"8jA5C{^L;.2Oe^NDnet Rc5L'iSd *|,4INfI$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$JMѢRRI%:Ujz]u :XRI4q, k2s(`o avM2lCcԲPs:hi@D-ڪ &S5Ϊ ʘ)Ɗ;z=]*<@BT7-DŽK'I%-tߚIT$IŻx cSl8h^RRŲh 2pDN #4<4KL)($r(8@I"Ar`ÂjV%1)1()On;)I&M)H4$RHHD(RRHM*Q)n%3PuB)88iR7h=b44;#HO}hqEDZ+U|Rڔ.CuKX4%iA(iU)ܒ7PS=BS"\ L#\ L^)J$)BPoP7)%[J4x Zu:14SRTpnŬ:A)l)VA숔NS C[@AVXlO<v{GD8*U)@O(EzGPT[)Bh?xhJ^&JJnEu]l q BKEj ܁rs^hB)e -x'/pP!>K8M >H4KyBoM;E'KjRrCPV qcTQ/ t! 8V$RKv)I-N+w&QX{(!EDKhJ=j>Jb?5$lO ҄֎h!/S]F^| (V-(MARx1n0'IK Ҥ(K"'WJJQL5Oo5NF:!iZ` ~Shi'61(n)) H4m wA!{KcIKJa4M3ܩ:R#$/Ir[␰ئ5@NrR:"%)L] >}~j1K-EA) :; q2 + 5( oU=7;aZ瀗BJr[7 GR֍HBAw )>)ze)&}y4uV%2k=chLKjB$L&L@$2y%9Jly?:-R׺bړ(D(E%>JZ'p=( !#S<U2tO RE ')@gW "מQU)S0= t$C c$!0PΩj  $ZJPT)@#{Od=ÿ*lx:<$tK 䜰 E%jmM)J:79R lVKjI(?ųS-R$/ &5S^yT))K Z qZ! IL%"ySmR;@7ܝg*U-@NVϢe1D wN4cKd)$m{F] 6#c{$!'"%0 U2 L^ׄ崻FEI&Q}e&ICTTܖZ^W-S*̥JRG^ƪ'((wTdX5-)K=C|Q jxjQVԡ4 vqW5a%2(^vKӓ0~t*0/I显D9{BRx ` jb٠D\FIN{/vMǟT}[;(IJ$_ПedJBcTk%I`KpJJi*~LxE{)p!(Mi(F:FN+k5% S(Jw&PN*Nl5"ѻ>:~H)A< $h#@)1بA%*gД8LDre;RRDDi4mQ"Z[B"~PT-ѡMTKeRLtD8 v;LO.'%& 0a0a#IKҧ`5Yivse*V%Ej! ($IyHQC4D"yB2UZ~i%D1+z/09ZxآM1 AS¶z(:9mqxԪP|J#uA)"J-,N,*W1]/\._zsL!Yg V[I$%I$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$t>ߠQ~x’RI&UR}nÁE%I$I)I$I$JRI$ID$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$ $$J)# ; wܤ:vA…TI*+?r&6f\xV1 M)JrW~`z.iM,g;RWwW}#$w%,A7=7}]~)q_v%o %7IW>~x⯻%nXi-tvs!?/tdmJIi7}|]AǟKwP]$Ҕ%C0%QR& $+I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$Hc $ I$tϢ%itnJVT!Lf RIfVV7I.8uBXBac1SJ*a>%II$'9DXF(J)*>}<I(JxO{焽$$MMTĸN1=R)N';k <7KpΩ$슖-R'cEM%F,AN-bO0yzcf-ť6ҞR&@<8IJؐj[;@!6@И 2e&%*{~r꒗%2tMĩ9ˇ~QR JA<$Zoe <%)$Ж2D,<)[6Ңa432* m9DɋRRI )*$%-t'$9b>J-IJB?rNKcB%)#LT 슔I' %BRBSHiv߂nRT0%Զjbh]QU$ RWXƪy:!=F(Nּ̘;jP7NۜIFܖԋAE0tq(QRJ}$EÄT$\҅*vN(HJ0drNn"Tc)j鳂T;Usl h ' (O sY@B ]W8)jmZ8VsyLR-"@ HV$Z!X?" -Jrk*/񪇣"RQV@> )%K$l7|vI GyO(p>%0p:pSj j&$H WmZi))NQ$(Ot$Sq{D8bI[RJR-| WŸ#D屢 BR=:+O饢 ^xD5Ί$)}mL 얥6 .EJJQ<%$^E@PI:\s`xSn<( ɥW-sRX R %kYhJB&gcҔ7\,)Qܛ_HѯP͠8J(2(AR\'"hԧXRSA@4/8^GUPe)JmmASze\xM$P^RД *M% BCii*JdВp'U= ;(md:Y"O |2]1yU)I(VNcUoU.%JbOjPoct%9ƥQAO&Jm YKzM8BTc'xJ#@<%Ȧ(O B MJ) p?M7!h=R$HJY$'JpD 'RiO q_yHOܫ pӾR䠕(Nr P\dLS%1؜Hh(d8pt bF;dAtM u2Tq +E)M aM{&9 T}K4U<(xyD4)iO(|TC DR2R9ljuN^ =Cq궩AO)n3cH@Q6c[LX@)STb4(ٻNFHX8KtjDίa;gB.炘थ÷ S9J[1#aS4Aς*Pl'׺AÔ^EB>S> X I6SDwIk P_'N88Щ Ni 5 < MOג@Q!13!)jx(>)H^t{-"1ƒ]A۸}6mGwnR'u3̨6 u<"7)~C 5s㲐JDWTpM vD3@w)3!JT;mL5IȖ8(p*oPkKݧ=R~-NL:+67B!ZRzlik]Ykr5N/nPZjt xKuNa.<a⮚E̓U=@EN粷~MxN )%\bA</2.!tֺF/O9GiDf*)$$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$I)2负Vq]!yJ"֎7f}*M)kzU-SphЬ❰5M,G@t*Qj!™8}v JRРxi۠6Qx"VuckD Զ%0+I A(Ҝ@:5`I?0+!MyCW{JR&(䝘GY%J<VSE8݇K4} w *?qBJ<=֜P;ܒK1W?0΃Q+N }>,8茍\V]!hn.2b14_<9ɿcZN @K)M)`gN:#煼*!&]}JR%``AK15 .O;IBSR]]0sAYٝ6 /puZyYt-ay44ɚ8IiLUI)h & whJoy)qDTL%$\I JRHSuZF0# UL3TԋMB!Q )iJRM mdDyB%/)I(F or {0)9O@68U^:)>4 2D& R*~H8L<%jRRЖ&R.'(iE $)H5MO%)$nryqw`J$L7wN5:=RI$O4TEd)nkBO)BApS% $*~S*ڔ'N,pO<@> Rl`%:JdJBGu Őu *$$g4BxM(<)))I% 6bxt2J;J$4I*LR}SQ6ॵT8JXyUKԟ`Fj"ؗ%S\rЄm{1S )& )G*Me/qRJҔ :J[jJJSJ9s,4(~[RjT^d=BHY G"@B¼*2 4*[ڗЖ)AMD8 G?Jm͂I4%6xMdS;$$TEz'3| j -zq-FǻApҒiI8"{q$: )iO)' FuC7v:)5:$c-T6L3l4O 9*;RRڧMyQ[^{=S 4 ^aН씍q%jiP-smH %)Q8N5@' !%)$& %8iOܧqBK2I_u&ӻPf`$bLT7G(%C NJHbdd򤔦sSꉳ]JEj@RRp{)Ɲc%Rd_%:nYQ$DdN)J.RQrC$j5Pb!%.ҝEDNSXK"a4HNǂdlLӲݑ$ &@* }ʯS¢Φ%J,.0;amJqZ&v%W&x r}m+MzvP!3*%xmI,F)5p#HIAGƷsuIKO5CDB5pC/FJlEG2\CgB*nJO0=09H*I${UtI$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$>inyI%Z;"l^Su\eL@sS.0I LR@ RLD`"w;HQ4Ju(mR N,䔤(I8bx۪1ʮM%-)&Rӯ DJأceڝRH&%8*'n$E@) %)&Q4Sׄ>e%.$5$at*!J_IK,  = Y4Jt]a& vLOۄ2p2=`)BJT$2@B}gx$$21J< sIK)$7U|hV6ʭ!I|7P d䨄5tI:uE)$S6&I)N*(>(ZI$VLqiPkTf`e"QJgY=|UE ar0UmTܧ {mL%$ hh“B&Rp;`I@ D$%DPjD$:){B RxL' x'RRJS(A 9\[Ȑ!2pSPA*IGP4/$A*uILQʈh];mA))tS5in$.RCA $yN8D ܢ>i 'P>e"e0E N:)U1cP{H=щ,B$ēAw1tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I8cWkiI I$bo@WQd9ڕP-d 7)2R8!2Vi Ec9dKn0vQriLBRT=񢆄ꚻEL h!m4RhJPS92%jI%4R J#tT:JmDHJ$l$n\]@vRk!XNG87 g))yO j; Rd(A6TxJJ[mDb@r%<Nؤ&tL@"OnUJS;!qbK’HٙK[q*U(RJ\mT!ÔiVBZ ԌZDnHX{;qO)Rħ hL<)ƈAx0VvDdhd)Jg䣼J!A;i>0OiKrĦ腢J*T)Iy#S+ߢf%,\89hL+2% U.RS ԃ%L?HxI4SJdR SLu$$("m)b)yNS-lDN{@JL)LY "%'D%jRI )p-IK(*ĥ$h{gPxJAJRG >"6֐LBpUTaHXbPRJEIP%'TҞm(@))I%P#]G} AVPjJ}$ޫA):d49kuSA1!%)$BdKfD$^R!;Gnv椥%Zi<8$"Gdζ 7$e8j%MƩ@H{I$IHm:(̄슔S-`$/$ZJZJB29xg:& ҉KJ[Bc)O  (Jle%$ iB*!)JY(JMa6tHIJ$5R0xI5))P$œHJTIEvS$ОSJ4R#~EyM1IKIXUBxLJmʱ8j肏L6LU*M(iBtBR- LRa-($蘶{{"S%)yB{BgT R`SςxJ!Q >)j KnRcKd\$n%**rR%XkG2p{8R[R86ɽuʎ*U)nN!<`t AsJiTXD+  Fy*,`A?4QlM U{.`lr8yIeL$J2HkTNC! A% M,JA)@초,/T"XG(A m mPI=cHpT]PB™BiQSQ5R\ kj$$n HKBh67^DE#)(gipA'PuNg*vB ;gTܤd| =my=0)~ czX gnNȂ3'dS*urΥDWk9Cx*[DŏA4kW) Ã\$k)G\yםVygn2ۏ6wۺen-XvP"aU +sp h$$Ge]qlOU9{O 1$B|lZ q>{#865=_ MP>.ReLߺ[>D+$=h utnJ/y7GPem/si1bU(H*%M ;v6O!2Dy*14)%Nn2 '''[+5@Y8 RIx=ZUuDu%12 udL\I$hI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$~(*LԶOd.@x$[{<04P{6X 'N'&aJINƆ<.H)'LR퀜5">i)I$y!EXL<$1F״%_u[7@@NS@USґ(S5I$8*VIM% JPڒI%9N L(&Nײ7̢^GtRa3rtI@Y "PQ!JSJwjH3` r P)IJFV3*.%SҖHqne5 0@5_IcRhNS6_[[?:Jf6jDuOd䦔`ꛠ {|@)Laǔ)31y|Q- 83-B2gBX&!o,Bd{I(VۘA%V\<0yB q\pJ&!HOQ^ue6ʋUwHGt2 RF/ YIƮ(XwILa$$+eTV=K*0BD&YUBDAN )̄Islk ՙ;EX/ I$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$Jl $J +_ѫHJ@2 Jb_f5t_ȅV+ѡ l×Y&Q.Mbч/*}2vFoe:32ճC> eS Z2IJq%8D  Q^S TYBL2iAHR+ SsBDۀP%0r閄.w(f[S))@2u)9恴G}[)8}v$@J]$RL4J|8@"'IL9!h()Ka57ZtPߒHY& O EpKzP)BxF68Ί姒NQN;S̢NR )0peF@ %iJJIHA@{j`M:[M8 j4Ra EɁQeEܢzpcn I\oH$ʉ:!.F<5.5N BD$*$TG$,RI$NTd8uIK'I$}a)6 !P$BR{&*R{BIY$# L$IRcS P$4H;$*]4'Ly1D5IK8wQq'GA)h R5)Ōjt$<뻀8Ql)hKjt΍xM$JhO$^%6N$U(JR |-MdE44%7gui[(Zi⫶x9LC9@u)!p.H0Tw=T_QTQS LJRIƊz(x#QJQ :IȎR-|‘JZRIChMAIQO Z&'ITIM!68Rl$҄(<('RIJiM(BxV6FBL6IW=$_R!hRܣ-CK~h(j KxK`O8%Ce`!INUh NY{k'D*1ڗ;%I׽KoUm(M6\IG*8P%@JL1PKT(NB$)%%.S3*$ڀ!T8J©ZR[k V `k/LhZiM2 Sr K<,GriHE/ 㮉j -ҚkxR͍5IJe* Ȁ7<qtRVMR;9)GR-KhTe:d AbL'tɐÝ1sH@Ӻ%R'4p%GsyO$*AM.*`v<) &!mw);`[>A+U26L kH> jS"BRB="24rt)B9!II(V=',uO MhRJtŠf;uN.o~T^ JP)6:&&i:#M>S5; M1MvϹ ߥǂA hNCJ*QD$GH:C8()hHJ I3\)|П̎c)0B$htS>I JZ;L*;d'0S I0%9Iײ0GIJ=PȬ@H,Z@SB!; =NhL F@Yâ!ǰqvH}M9U\uVlkUn#']xeYi=՚[&F懶FgcSKӠG=ՏVES z;Klk^񌒢㱡ʖ9q$lI$I)I$I$JRI$I$I$I$$I$I)I$I%>I$:>wg>\?Kf\?8Rdh EP:K'L&q ?"B*Rd'ȓ}L( j<%I<p䣺@N`J Y(I$:a/0O*RRJSiHrO`I;O- oy*VDmA c:LQAoXf?5q0+kJb7)-Jcd~?D%e얪^@LJ[|R Q[D 6J]%jڍ()d!y-IKIMNZeHIKTDI$$xg5$LBrR RhM $:~Q?utT:1 8LS)b]$O)FR I$)LI6IJRdA6Imco'wG[b|S%)D<(nPK^I|T1IN )MI)$LMS8bI$R{=Bjz M)2Dz\ަ1ZѲO Zp A*Ml&5~𘴝\֒xHJy)KՃ $o|hILCFVy)(X|D/kt$*@ &^Ds?XtLBb\)*%?@tCu\wAZ+rm<R+hԅ>a<+I u))ҕ#cOl!$K|S:>jUJI2JI>0 *LR^Vhx꣄*A lGu6:UR#6R RS$)^5GR,U)-JRФG!1/L&BiJT7K{r*Bx$*M)nC# $pRJa}4NIΨI%I۪Y%@;$ܔjLJtYemc\pRtJl )m'NJohXN9I SBsLU)m*0)O E&-Sn'YIKJRH5-)k2%*RJA4MMIHQBऔnPiR.IJڒa;^`8IK%<&S uQ*6F)nSCG%@\!)5 U*I)QoO1{)0JSb vOy1J^SJI&G) dEHI !K)P˻ʹ<%X > ]&6 *@x ̨L1LZS[j RiM-@1Jo]À!7bE1t%%" gA.yhRtB0pIՈ :\ YPZ(V)JR`(:d&B(I$hSRVL{{8`Rc@I4U BI }=)ospM*2H^B$`$h%+U/)J'OdE/ʀL)&)JSBPj>J%<_r[%R>T'Z%*h:y"z~)9$^R i"JBdL籺R((b*BSZ8M%i!Xq5Dm'J#n "0l)^)CTD$:0 4 :D?SadĄky)+rQq,$Q!%ah$m"bl)Ҙٯ[4j %)(Y*B$RxM) ШL'5i(ZYpn)J)T-`TY;k+M2TwJDʮ*Rc%jrR%(!TNEuQɉ;R T.R,ێ{[ے>$5V)z~i;Qs ӢEw%*U R_OQ†æ(c>T[ Z5 .!%.e0C #[GILN6:SH$JF6X4D ॴ$@ m 4BufY0?t.ILBF@!ƒ&QE.Ne ixZcKӀt)nAkϤ}B;"ndjN)xQN a`A:> $/6J@HӹܨYh:#N*;V8 K SgکxK) Bΐk8Q[AAL6頦2P=!/NN(%#A+Ei k= c3V_rRadR%S)L u;!DN"KN5Mj9#GphQ A;xJJ91D(jufXdhú*dTTZ<) sy|QXB [l$<\#U -x f Je)(5~iƲ~)\&))TE!8 FÛ%9:B <)'BwNɃ{"# (cU"'UowGsDwJ-DY'tC6& L:skԔ=Z#X3ʛ L%I&5Uoϊ"8Qۤ eY D|/,=z bZ۠Qg+u0{)5trBS2]*O Nd||PƅY ŏ.ױAw*>0I<JDƁtH*^jN\ߜAR%S%> B#Z !hRhLqp¾ܟP, [.51T@5 n( :Xd&ijZڂ FL|WG4fZtV(岢WṊT=T<&N;Rj&pZF>Edx(dCQő⚱]=W(t wd-Lep-Ur-;N l#=Um@ \M"۴荎=1HGe~GUpZ8Ǩ{ke#sB|l5jh0yhjw84I$I$BI$I$I$I%)$I$IJI$I$RI%I%>I$z;<:_ L͎[)1NQcD2!DY:dJp'U8aI$G)BjN9IKp✙qP O )Iy Ljx,I&R`o`e%)$S䨴#M1%)$NOd0%I6 Ke*& 61.!,# $2hӢ DeQIK% \S2R1od-LnPA u>65L$R'A dAۿܐRe%@Ԣ=R )ZS$JiL)ԉ!0y2xAsK EsZsIY=T4d3z)Ɗx'O*LHR$I$RI$'%I$I|BE&>!$$e;U jΜļuAhԤ ɐېגLP;؀NR-a() :&$)mRN[diPA32RU,I$ ;> 'HН%#)(JRN!d*.t%:Jiq%d:\"zB'4)*q)/%e@{LLGdIHuH3 wNRRHP,ЫqA\)th=sKBIQHng@Q;!NB(di ЛaaR6=Ӑ`")$L5&6b 9%,$'Zl bD JZI%O*3ag):d$Iu$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$II$$IVhƋF̠H )tRI.XowܫƀJ3[4ɚ8t‰qQ&Vu=)xqk>WGNn@ٞ#%&tM0u `Ǽ @&HG#_7HY p"8@x r.U xHNM%F rMd!@8I0tA+j {"X'զT)NOeR˝aࣸ6"ъ"5)BI  T(iJRM ) sc{$)JP';>6,)(NP\TxPu䗨!*E O BFS%@Xg@ !I% BBR5Υ@o(;SIhRԨ>$JrX4n@IOKs{$t!^Szt c )I<%" ԶPpQ:'4 { R YJA}yP*n%L4 :+BSܔU'I)Rh4|ڒI:JqNq0VL%'JbԽC4jJRԧ0ң/>Id蔄rhJRIJR €ӂS$%'5-IN $)N&Lm )\ c}vvJ~tv7tWs6V:iz5ʧY~+/u֋}D4XD>k)/6IЂWAuJp).tSsϊ1mnwJ㢧V~ÖV]`n=V5GKf :ȬKhjÝ-ImI$I!I$I$JRI$I$I$I$$I$I)I$I%>I$_-,ӏ[ ٳ|It]Qz#FOTM哄†O9H)QRI2SR;xJtA!Ft)I$H$ TNN@6I&Q TỾ*`uQ>’ &bwDn7l$&.Pmrr B璤1R N8}`ꐹ ABj)m*RTC'@p1$Mb9(Ǩe"Ɖ)xK&"0#{iT S!tܩ$I'jXF-h$-$?Oꂛ`NR4'Җ救txZ%cg>p_U!ŒI(NJ$t0)$N(A*I$9C ''L2G8Cm.y L=^If %H`RH!q3 [H9:A"$9 S'%*RI1l&B'%$)LF{"rI vP9IJI$Op#)IJJI1%JBR8{SLJJ^IMrgE-)R$EjO\BJ]2pv+A4ȳ q.QM*- )#R&95r䦔orFe*&_4JQ*@x3)AR =2 %)y(6N%ܧƨGDwK҄J `hD5:5E S"SLi3;XJ#iR)M%N0Zh&JSj8%N )H8r(GeUDaRSO7IBv`uIVhQs{joLZ6RV`&6;$T H0(JR ) (E!Ztҙ$TvOV%IJKRRmDL7S6^}PS$С24SRcgTsއLUj.N*A'OmȕOfmhEa:RPC :lF SmyJTe:o7IERLJ'3o ;-4R)J-o!yB{GjO0"%D p<)re)}1a) &1E%Z$Х!L:t 'SHݽBВ}L iD )(PB$D4SdKQƸSsےR)I(Q؜U?RyLITI4$ז%-ө `R,5EK&JT\tQQ-)J`$9;* w D8JQ09pcPU3ܑ*8i -uvƩ59 )9-hU=Ӆ jԜ$JySDHZxW%4UIhDlirR80cMZiLSJs%i%%S) (ĩ(Q%3ʗ4&JqPXh */d-T)J2jY{QClAS)2FPL)7sxD;Х0 9JK`$ cT ̀wtRRT(O9t!r$LHO{"e SNIJMK꿀!D0˔h;RGt-RsXt-x]Q꒕E!2'rU3c %=ѵRILLJ:f˙:p0RS$*:KSJ@:!a SܤHR4I;IL 00DBxYJuBFrg45-jyRN 0הkUq#*$43HQ,s&@8J[zpAJKb Â!2 pZ5J;(j(xFǕ_Vo[(!&*}HxS,A:m)w%M&iD)nQwĕ"vt3J(I72 CM_ +Uv@mWp d" keI[*UZTВ #cQG@Mr+Y> LI$zYXK{Ǥu&)ѤIEd T|puNB$o3N(pIG MQB$COpЂV%$II )! ($:Dj! $ԠIO)Y$&'ǔrȩI^0} R aI$W.I$iNRI$PIRI$jq L1[, ~*v׵ƱM3I!8IH=I,&gU' b> !E.$O)IE{̔J4В )'So"@P6XB.3T) J:Iˁ)nop8|IJJO {ڜ9A QU % B|'MM 'IA06\RUtR>hbNRMyM*\j ܕ"Ԓt Ts!T'0$q)R-L;9H4"\R&N.壒 Dk%}D Si@VJH-<svP% e: Fִy)hKlM:y*lЍ"ڜ)$Pg|RjPR?\ׂ JdĤVڐjRK'"xICw`,y > M})PҘ |Cc[ƥAuD&JpT]C4Ôg@R'FI8Ka vbNLjRR$A(mkxQ'X:KO)[(RR$S0"L  ה$9vV΂%+J$IMqXBw .t$<4G%_o9Ӕ4 S @B+j>Ӳo^ EYIKTE NlT  oVO))iҞNhגr8$h@`L64RRBnS_cha #beBH$; @S04Snc5$  jSm^Sr(6y )yM)MœP=Cƒ!bSARI?ED64O[pƉ)yH3RyH )d"'@o&鋤htKՍ )~)%M8H~IY-aLBcGt!?Z jJIN5O V'Q~Pv a%>RX6iQG2*SK$!T&sh/R8 vl4 s!%/(L%JTG4M8V;m ZZ$TyU܌]J@>HکJhM[TA%'Xî! RS"Jd!D{MtCT$JEBL&%H2R}v5(EPfRT:NmDxDZ8Ns{{(%ҭT)FuoZ;!4O.[-SD금H8$!$aԔ]G$ ZiZ*-`R`ݬFmR%1J4L|v&B5 .>I!y hxL*@\\dB*MgOt %*BD(hRʓj撘Na1rf0S۔z)5(V%eBA:4r{N *A2O kIEҦѠTAmRDwSi34 ݹD1%-tO ~BllH2gT%H4)4&6GR;$2LRH#c7KDx4H{SJˢ% I 6DJmRD cR-4ٴꘒL< J%8P߰ď%1qy|S(!r$hP:p\FM nhN))"<JqtQT╪MSj;"LB.>))*<':FeOlh5EkDIFa )ʐ4Ȕɹ)@Wzm[$aBKi)"`2 RuA%{%/)nLOJ$ ~M8ɐ<vkCm hʛ/K{>*L " Rlp&2 I2J-٠#Ɖ U3)nKԄp)KFgU{a7)y&2u/Y?I[%udXvQSPC/]h跺oAP_aKaMKi8J#kj ¢\T)kNG QiH'JTnʑ04H&iu!9`se2L`cTwU4FBi A-rBGt[ vSx UTCsҤ: FcA?D)c9ڻc-Ѧ 9:dײT*oʮD5K^YeOp!j{qF&vELRn+^_:$9-=JFD'Sa3*`j!JG抙51)NJoPp|I|yDZEj9 )I<6I$zVzg- ٱ|E&)C)JY J>R#];rI$~AI[ƩnAH $) μ'@)IJ$Ma]sRRD*[&sdnDK( Y8)&ADaB)4d"BȔ9LBZtI3g@v4DPH$^x!!*AL$%)F I!<R$(6LD$ )M bS a)tT`"ZT}f&>Рls6y%*R<!a}̤@0 '\I$ RI$I2A*I$ BJ;)1Nn :ēF AHhENL  I$)SS|RN"RIJ}q'I*I4Q-8)ΝL GRRd$H' .hN{$" !ϒJRI$D(#P:JdxSz,i,-RDHrJ:(?ōB!LQTLZLPRҜ&*>\@V6MMPTQ*ѭhMQ3IFS꫍ >TB$:Jr10:蒔I80Q% [r*LB7V~s\ӄisCPW I%#QI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$ʝaIEI7G{~jфڴ@3 I&&KF7I}@qmtZo: uL2% Q"a1rI[x.*MӲnY$I!"GpEJJPÕcP|ZDL|t@IK$40O $)lrIRdM[$h5ĩ~8@ALftO>I*GKIR hPj\%2hJT j"9:7}3DᰒZI&<g=)* $@V@R EU/)$0pL]䥰/H$*I)JP)AL2yKh-@/RSJ ~ȁ*.JI^SJRZ$:tE JRuOŽu*.@M%)D CQ S $HhL )I$pɅ6:b& IJP"RLB#D (wII)[R-)$c sg)[Jh*R(wL[I&ւ)JQu;/EKёJbyMO`&% f*Nc$"T4Z ~)IL@L-))JHne-ÄG)7<%J))IJa87U'A!A 9ΉILbSvIu*Mh 33!4MNv=q:K[ @&aSƊ`i:A'R3:T# 5Q )TCIvI %HBk l cGOY C3-LNRLrc~^ @ZY6{kxL2T?Dz"Y:> AgJ#1Kj瑠S%ߐٗh@@u:+u4bW:T|e*.QqSk[f)5 TwbHCs] Ԇ i Q*Ort''p:wEK%$Ȓ;iӈ$)<#-b\%BIv4IV1phyG`r['R~Hi-B<bSs+<էF dVY@1.,ޱ^1_o@lJn(@ԩӀ-:p^@ċz{UXL`Ϭ 2$Ϋ!6_%fUҶV&#qM%/U|S=3nȆ`Zŀ ǂ聧A}+h*s[CU:j'Y/#˘XϒCm"g <[P䂙 ʷi{LtZ AYtc#̥wJ Htu!^M..k kؔ:nXDK>Ab7Gg<#xBnt%'mnj$^t(JguXFoKxѢ,[ ݓ봉@~SRഴ\jԛd|V)`+50Zvʱ-ErhN$8ANM]$ :crPw"ATL(1a!8 CWj#T(>T|PKHIIL\77NBD)> ,iմORd:,LoM([iKNB@ B^FZt=Bɳi$^r-'ouL1\2@imLׅSQ,y!$I=I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$"<>"dl1Rb1V!G:4Q7 HL[){$<hH{%,$}N9 씉4'PTI'!IaBIM(|))t)]# !1|mOLxKq GaD {9-St7AʞA,thk()d-! h4Cv+$RCz}VqL*5rrH O `)t'(Q+! FI$;LJ߫tZW2L1N'LI)I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$U| .<@I"$IhV1-kc\Xd؇/Kۼo2jebK#D4&mv Q%4"a{ʋ'DL& O'TRPKIR`tE LJTPS1ȢFZiyJTS遪AQDd$e)JfT[XT~M֒%gD3[(V&P>)=Ӗ)h)R9%6yH9 )m'M*3 [{@䤕$RuHXvA*IFJyPhNLRJ]$Kh:N'$ITI4x% SC.'I()7JY<$uqL+[<)5'M)(Ad Ԥe*$ԡX08PR)*\ILNCR ᄡi&DɈQ6sZbR<''<4jyOEKJZ "uEtNܒIDhH > B(&LPATiLJrQ`jk{y6L6 JY^k ASs6+S"SJbcTP9 DN*D7OJdS& w*A+[:˜t) 4$p OADQv q'K #k!dj9RMxHT FD GqwhEKM2jx':88O! $,r1ndsAL%+$Rc"f]S?qӄ¸񐒔ѵ"RQXeAvQHJrpM:}}*$Ɖ)h)S&9<NΩ"'({KSTDMRTNGhZv@+OtPsIJħO nxBshRmg4IK' p5E0?rBVRmɥ$ۧNCħ AJI$TeQs1u/*%aH "!HȝXx`܂2RBܤRE0!F'RTII8L)6DJ$Bbt7!BJ]$: A3hd)%)!#D?W TO1+S$Bu$dPַ2LTJ2R&#iԦߒVRTATC "~H #TBR3>%1{xQ 3(T8))h J::)$ 5 -*M%,BcrB&a0JMN ;`N(S m#DŽF4))e`‰V>I-i# k(dQiRN45(!$)$0hq($$ΪG &H #ׄi D$&3N&aRt)!/n 4TI)02uMFIJڝ1)L>Ia&`RKTJ 4>4h)6ה7=4Ω`tHnԨp>*L!N,lLtJ go|±dV nQ) IJ#ݺrA"SjvQdd4Cyd %& 8djq G -{dFO*X) )0PQ$9VP6@ׄy!qSx1J@MI YP-#]9SdhT"#D+7}rիЫBYBY9awᛒ{eе5Uv*natV}lI(zlν ?}!A2#^pP*k#TW~J_RcA$j,6{Zc ]은?5Uta /pw@6U{37}$'\DE-'WIX7A٣xB;uU-8wBq1O(>bZ#@w@0TCPӂô,$ꘒ5R 7"0dL"nm+RIJ5CXP]sd"@)9kq)n)!@*E>H:(u-CĪw^ =LJ@QE-K'AIF7! cRb ըHPpVjce ?ĝa8AkIGbq0ÀX6{IkYm՞efgA4 c5;ԉuT^Ib;*0hiUӲE}as_Yyd[xڊ_ i$H$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$>F߂Lt߂dl1Rb1W$!8#Κ! X'QN=bxO)(]$RJp`"; "tI$4Sx6:%rcO;N!IP#%+I$@_|>֝S)tE#* 0QR[DP#uMK8QN/ ]❆] '%NB0KIv<'6&{2 R J (qT8jJ[l'I2f { 0W4%)u(/(4Rp8)1LDtɶʜ/)Jd6(&q %/)' XyϿV $x,\Y% ”S![R%뤒IBPiJ*RI$yKO$ׄI.R|BdIe&N}FT IH,`HMνnwN3NyIJI:bI$5थI02DNI%X8$$'LBIPRI3GP'Eġi{ܘ RLD8쓉#T*RI%dӕ0'  Z)yM &xi @MRIH<8 H!SrPR$"!q2JI%1ڞF$@IJLMj`O qB{pQ)BQD&ND?$;1UkHB*`Bn%& 1L)ANd8%Cjlw`[)xVlpr\Rsҥ[ԢhS/-DǺIsDxT%:Z)%)5 E:p"RZTaIזbRg&MͰR<2BR$|g&w(I);@k> ᩽=ڸ$%IL)qQK0HܠQ)spRR9(XI  nN v2V B*Z)(e ԧ gLI%2LJp8lНFV^|ӷAIJSD WH@oϷ-ԧ;.S T1rt>*ڝ'K& 5KhѦA )yJRڔ"1r+jcx*ʃO7v@bJ$lM.')@FlvʖRk!6%AL8T$)O#D?j)Oh d'8D9p ;I9Sh)A*I:e"Z)tNJ[T:JBТ\|TR$-(O))Bq-6'nI)L\S P"kHBLJri'TJ5ڤeI)$tT\+I $M*;T$"񦈂 JitҢJ(wN!TfjfJ)ragr4Q6r (Q(Q*$ S*xhTjQpO E!6L\N(5td"XhopЈB@N@M)|SdruPiqN[&\e+t%$a)SgeQǍJ`OIKS ƩhuzP 򒖀-[8>S 1=A甡$18HyDk4J7hU*LJI5D IJR莳w1NA.)J@I9 &%-)NCۡ"C%)!\bv2@ 'M)(>DR&IIiNHࡴ觰)G2t1v꣼s)Pe)BI$':j)QH$d䙝R T)$t CuB("r=R4T`-Siʔ$_4L `)8OGttQ"R1HeCrrA;je)L%&%3Xڼ8NHn@q5R0RL_h'l*إ`N #H &+n?h!PJܥ F&!x%Vۤ%'[T j9 3)uS Q Q\QJN1t!삦kS'))bRHR‹B㻀6T #^BS)a%.$; TvH)4HאX))(0N8D4)!t J]:vڕtyĎ>9p5NȨQR]%ʑ q?⥷$'pRHF܂&)rBaǵ |S.0 II*0\w;Y:)hR&>(*SrDDžQR;R.H)Ds@"B&I0bɉR%3F$A,hl™L)I%E ׺ $ƨHtDt;$2:0 c]Q5JԤҔ%D6y8h@bu4R)nC aa4S)QɋY^+ %H1Έ%w:wILLr+nB{=tQkcSpC60f3'4D- ^T )(L 郶otԯ)p%- c8O>rG b`$LvKLĞB;Rk]32<R 1#Ajp*fcT5O:S}A;L4L%)JJdF䣿 Q(:4™IKԶLc,J*.K4H m.(,nNB^A^ ʤ@;c|;mPwEHbGjmUWآ. JBvGuN`†Х^N3Զ(c^cL{G@& opII;&Rl=|V|vW.h*#ArLU:+!B6ZG`ݢf[5)`;%A:C_  ?HY}?p;E Tzc•6PHU5W.}ۮ3i:(Z!5 ; $ eJvHUX>*}6 =mZUQ4E%*HIr|ȔƿVh'_ҫ.ҧ`BPS)%24H7LF$k9Ln$H2/$Fêj^a%^xӴhѢw+{|a\S;ݛxY/AƋXcIY̬\(:־g [kqB"ʖFcuQf#Vp\SԽUS۞OH%$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$:QXk{7A2{69oIthDTHCptI2u[t$9 SH yHAK$2&`#QGC!3;TI1 /ffSwÄI)29B:jӧuB)H(a)1mĦ)Xv7tPg0q敒}5)CDL4N5RZS5STnڨZrid* *@)!I$'@9NPKO cRDx-t%R L6R*\NR-Roy5%,<I9PLRkcYHh:RV&^|V+/C) *c1% $"$P&HRI$:mRJI$!$>!$L,# i9%'8#VOwLp!L S(d:I΅ % 9Pix& )d$Sw*lpc"P d R bp񹊾4Ò5 C J`h-a ZWJ懤ӦNJVI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$H N֗ W"> LJ~IZ(NȃU6ADND(ʩJDS̢$(TĄ(Nϒ#`QKL R d3[%RiNJ`Kt I&)mLF7TGU)R$Lƒ OH6&1f.xnZJJّ*2Jp#kAS>G'4p*ք᧺iO*Ma! .3DL4NR!4I FH9)'/ G)^JEҒS%%&$U0!:IJT|TL[ Z4:=RӦ!"u Vrk )<?U܍K͚h  -> 5 De@v$JDy 4CdRcv8Q ~w$S)HS)Lt:i%"%<+-cGdRZ&ҌT]!=(PnБqB$QD j<ALR>📢k.'d8AHd5RJɥ#[JLT?P<{ YhJ! J@(N!2L{\! bRBxSFdgn*U[Nt”%L\74S4I(@I ôBuo#C<"FC*N>ՠ*.)1$% bA)N3"Ԥ $`b|Mf'vM:BʗwL&O3Za`?%&Z>Hj@xLέD]H3&?{A:IK#P֘<%LPb4'{LH S@ȂtZ:B[#׶!"c/k6Js]ky)ݣT'ipSTɮ~ͭpSn8 vN+#5P/6K v*YMfN,J;{bp ^IQ,; tEs? E/|Kd,#D(V7Q!D ']NL0cZv Ȕdmr$vD%mR!U#b7pa=Gtb~OuRKa]kH3L@XٻN[p= JT0:DR|G)tm3E~IktHcBNVn(N.T@Sss%U0qBܧdEF !Xܡ xSiP)0VgPj9d) *nRFe "R ,[gd`P`UtSuZ*.N!mxG*/"p$X DvNBPiQ@Db`5*ID7O jVnFv 9F阥?%BMWDA"*2lf^#UYiqLcg2fRpx>YU>Jeu64 V)G <ƥr2e2I+sa$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$6߂CӏL͞[*LS*d7,PاL(L$( INB$5dS$JY:IN$Bn0T&B RIBtMPuhvJLМ;!j]2RS5$lGDJTSv40IJM&'6)DE.Bs:aHl &L'8dhi%tjdd)))IM)(6f #R#ǒIR钔Q&nvR*SR)A5Ȓt  nnR8tR'$(h)-;iwqCEEJE4;AR/`N $%8 pI&N| R`I1D&EJ$NR-%)))LTB5)tK [8C!A͔}C%2O*T>4w ewS<,rL5Q"%3H DS1LlBGAKGBNRt9P Il!H(PJRI TK%L CiV(t0[?D&xHN8IJJI MOu0I$ [!sYs-t\e>eIYI2uIJRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I)S0Љ@-L&!T*fLjI2bP0zkj DMADI)L@%rl$HIRRI$R4hJJRt$|;Bq )I$04N2@.JrTIH69OR$} JPp8BswPsTT@B'ڤJaR3ͼ - eD<ʷ`Uc Л抣ZրeI))\( $8DTt:h:' lcLRI&&tEktX!4-*$JQ"=߂)gt3Ʀn"!*AdQ*RD*$%KgJ =j)Ja 7%ޑA (I$hR3JRt& +=4w2 JDhH ǎYdt0RB@)%NۺCpH=*RdL"! Tg Q)&JP2aeon)xMbISm^;aB$0KΩt9JJ^9R24!Pq %A$PhS F f)tɂyTĨLIJ)bQG}'U u))}#O {(E‹_Đȍ@R]p >Gt0R&O)@AP*RɊZexC`p)NФuO &Q6JkɕI̧E#o !XaSo%1$)Bp*DN+k")P44R xR -`^ RК raH~IVT%*!$tβtMư9s@b)B4Sma)4y)~LR"dA rixrNRH'⛾)`$B|5ߚ`- D& / vIDN   L_wLE=; 9I4$f:P6k*RyJ';N9 !F47NL()n=M!O4%%.%8 ;_xNi XL$JQ SwS]*;Jn9QU{w;P{CT'y%'K4)$$:=.ڠ [?Th$lqCIJHVН$ma&(BVT)7* +R;j8‰rb%8lƪ=& ڊM!R TSʈzVTM& cTFIRTJcd&8NJD-QJLFRC 3=-T$]\I&@@w:u۠CiGU3ܐrMlrtR}wD'`5NhT<*LINt$OnJ_$S'DV>i)I'S<0f$OtLfLNhSTIJ:e4IQ;I^(@$)(M9Tl)10bS<xB[J]. LoI6Z)O>y(ĔL8N_ =EKB}JbPF;hhRmc@q)BrDh;&y"=D{Hx 9ɛ^% Z&Iڞv (OԩrӪ\}8( b BbP[CXdL$G*UZYn$$(gH%R}hM tJHd Sr PO&SF.@(ڙ$ @D=~!T\ P8Ds6B<%IxTLlTj)JrMgB\\@G"Ɗ$= c+IJy%SLHS4y A<΁5LxjM Q%E4:(SE LG'n&Lh5IJ$)%-9N|1 D&Z`JZ -JI$7c~ ٳ|It[iELQwu }tB!;BEnSI$TIE$RSₔI$$IR&s RI-Jv2tIo*N7SD然ێVBp)9ޓt5fLʄ<3DR)LT,JpejIKxRR>M*`$d)AS ;#){-E$E΁>iy*{_dxJz蛞YNס0"Ja^ WJz48O!KpB\2GX<ܔ 7'QccTw%%{Tx$=Kr9E?|)I)V+lԄeZl,3fg{%7_ h! p:4RNPffI$S$$I' $I&=)LvRI$5OfQ$@@ 񉦱 D@)) %QC&'BvRC }w]2d0–@Ѡ(}˄UC)Je@3]IRp3b7D}@ W2A)>y&YKe\9 j0(nMd^R)Bp 4ȐJT)KQ,&- )yO*)J)DB;(8*e)&Nk )b':PqCr; t” .OK*NhNJpMM̔2.0)&!D$IH$x6)I$#[I:iSA*L2ZD=̮ >KˉRi] )$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IsB^`rf@eŌuRI(b6Gd1u 6ShA.~) ) 6u#A%.B?*RR)윺>IsJRI:AХt:;ZG )d5I:mABq“YSn){$)N]࣡I :Px`?RG}RI2`-% AKIBI$S:%)$4xpN;L QRH$H;yۚ Y"So?H HOd2dt(NtS BJtǟ"8BL4TI2.u%@i0RɝˆU4E̖d@Di>9Nᢄ#T tdBrݨIpnRkDQ`#6/>*$Q*LʙN'--MS@-*"Fr>h)!ʘlw ZP6dLi ;ZG)NFj *PRq NN%)$ӆS5I% KxJA4%IsS9E~>)!bt@ O' JyNRI"B0?’O8>*m1#t꒖.H (" Y:v'ˆ)BH^MJ(B` O0:% hn$0rkO(4"tIJѪR*l'Dk DM$`Q;MhSò)e $$O`e1ĝD'cgT{A)DAAqOS5%; TײJ\Ą`XBjΩǸhAiXI"0Dft(7<D%v1w*›򘹤@Sh/m jPpL]( ן"GĠ8%vE Q8Q.&4̧FM% TJR:'9O Y  p]Dk &"D!+U/*$LxD`{cQR:!-C@e(D !tS 7nOQkeJJcraDZ nBd : 4RAi>L1:)Ģ'I2hS eEP ґM)ڥ4^j)S(3QvPӎeI@6*^e(QRd6`ƂT4 ͮDbdj`o8sΉ;)[MXL8Ou[bwRBq% )5(]4vFZOJU!HN=򒔒I:ƉBI$5 FhR7)Qq8lF+R%.JpH0|SHҒb4REI1 R3gOmY$=e=K O&2_/8B. 9;7%1|TQqMvKJI]$QxRp )~Sp^ij9?:)6;R$ Nփ|$\"|SMS iTRIK KqaH~PRДo4 qWLk)NHo(ڙ9Q@nw^ ꫉<u*TYm`!cfiZ[ږ <%4)65 @ΊA&TR.DT BL<ӝS$Sp8Hi"$,uRHq!3Ǐ4$&$RRऔxD„Q$N<Sy KSp0JvDk;jRR*$L28Sv<;qAJ.<( $*C6'( iD;B#HH%ԩ&)i0orNBI R@lѹ%-ni+S‡u9Гƒ :8.  4{rS8U*D3%yShLR*d)ʌ Ƅ#S TڨÄI얞B ^RQJw64R úJ\9:(bu10S[r4IK$@5EDARPpEKǙMRjvDž&7OŤ{N)gxPpg^ 2NԏT&%JvGkASe IK<9@ $y)NAJ`Kul;p):p*.`@ TV)!tܛiREq$:eA.>iKT0N &E6 C"(o%0 L!tchsaVkdE3`)w(V*ܪ3t Gu:k ˘! Rz&Px'=6nTt*9n wZX#\QAz  v8E=Igӫ1cI;[Adh~Xi O!UAM A?gi;, ?zd 82$*_۲mĘ%O$9%UpE$Rǣh* թ#vJ R) BrT'4jhQh--K'Pq8:HCg䨼m2Z% 'Ppe:'!!NiI)(7JΪ{+c@RI!9 m%;IqOSbqy5Rs>JDBqjTVTڟb5P RLɁUZTcw[x(K@D E@ Ècd.^Qw{tֶD*VJk :o )0u\;*0~U[:}l?^.Vu)*ӰwS:z\NN v)(@ˠ M3r{i"k“dƧ \ ˹TZ%6Ns)\R]6x!.\3UΥrN;g;5OxUTYg|Q_a0!:I$sI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$|F`U.y6mrQy`7|D'LD4y'i|QB)&OvvQ'˺[qJ]1 (Si^L dO'@JД$RRkA.?$თIN 4IǔcFSIw%%-)OPHAFB@ȂLP mR$%)r(F4H>I2J]#(L)#lY? had'4R@k .GJZ24Np`nRKHC-QRHd C"$0N2t)I'Lt)I$h氲:hpmW!12vU1nh Us}W_sH4UŮրBLB/ge߹Ẓi nF<$_?ޕ{I4!BBQ= TSC]$;oA C(]$ۂ[|JS_S"@ܪ)s%i^Ua->i'J VI$t$I$$Ie18vy A4)Lt ߊ&;Z v_D'B֗p; ZVU'VZaWIY%O5ՠPZvNdJg&?)fD"b~()I&NP㦩3 mnƨILĐ%I% 1fxGhBP;RW& nP5Bgi &JS'THNND(ĘN$I2ǂHܤI$% O()E2tʾm+s8VT1QXJhlOt:I${YI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I2ҩnH#LVNmMxiA(}(IN1JtHۂ\k5r'I)a"14Н)N FGt S )I)Ldq}guIJN$Mp<$$쒗HIyD"iIK$"$p%T3dD*PH;!<} KIRq)QR;%9h (I$ yLI0TSLG!%.:bjg5'چB buN<'-NNR (Nt)ANٍBd !t$M5O]aJw0L%)()hEKZ"QEm.V%I/U:yhE02{_IJI}?@I]c ?ml%iM¬)'x%jd MP|Q *{|Rsv)%r'. )G $$MjR𒔒IgDkp:()tBuX<5PyAL]fNN*>R|PM{"`Cv4ʐnր4HITko 5NtI-D qQܙ8l0{&4;ķv5 ԝi<N&|hRI%038 Np)iJ:ם`GHL%(dRjtLu d)PI$}`<RI$ѯ~NiIF5&D{u@1)㪋Dh18 hf ԹM%Ɉ:kϒ?rF{7NBr1I$ tS;DNg2E2@F x$J!)#)|B8өI4JtmS*cՂe%-PSH~ mi/L*Ly+R਒k c{("L2%E)mMi?zHW LI"T̨6IHRDpqDN?S G);a)LG`LWLa5J>K\RQs)s艴rRSBbTeUjICp:#JR5 exNP<%mM&S-Lq,_$L B XhɄ&IL&R/=JR@O~))`I$Fn*@J*RIJdNTNDRI1M;$JILh$#5J`iMRduC{G%WHNTr5cM!3Fcv h)t<)!"DAPs$c CczѢNA*%GgHƘu&l5DuD׷dk!Kt "{QqQZgCRN5 'M{NAH4Oy"QE$?4J Q0O!GTTu@: L)~S"HL[ &|tG$+w@x<'"gN0Lt(KPRrOEO=mEJNa‹xtj MӗL8IKr#L@*-9)'DI"2ƅ%.gBR\[ϊ;&/EKϊZ&Kn]FQfA))rBmtNZ Yc; M:ZJL#U 4w&>(N1ELCm ;&j!LJG]Gޟ ?1Hi7F 2nӄ'E >ZJ1 C(a6 QϽ-#U`as+Uc"8Vy ZMm-Jo lV:\f3y@Rvc̓賾ʹlf¼?KqHM=IqТQ`Jǭ䈞5(#`*=}Y?W܈v%htrC#z^rk=*Wth4P O y9N&f|wq$:0Ɂ2~EOLyg%Ul$g?p#Ijb0D*iHYj)LhQ)R:[xQo CD=5Nv].Vk"P>ԝw!AAOQ%=IMP '(uJ! &*³Kf*+hN;-f'qFjI/q<&;QnѺ4rS6L,*ڸ{ v=6{{(5p:%jI%QP ߀ʻGL4*} gɎLM\g/zU$TL>ЎHԝDzªCFSI'i ]-stM4y&Of+RbD.YFvN ҰRQN<;9 N[yQI>t)4 HI+$PďPFF )A:d!+Z;6AAIN+cO҉l RxLFTI@>BIZN4rAN OrIBP5PkHt trJmlK^gЂƍRca$abUw4U3 ELP)5C{E+JHJL++=mՁN0Id#LIi!YNFI=d2,I$$J]:d$I!tIJ]{3ȬȻ?-dK h0*jrW?oĬX]M&j!29/9d#M߼߲ntvNj|>XJh.e[XܓZ&O<:@<.j_jѾK nmLRO<}O1򺟵r_rƤX߽m~h.dbٍ:H[unsU:* >w?F*uc)~d$3I' $)Y$N.Je:惴VL^t;FŦBd4ScyJN dX!f7a=-oINøDi U{~!4'n|P;3 DDŽ#eͽP&SwEJE:p濅.`RkT8)4x'DpN?9|potRIBID;&{C$JHӢvHY 2v9H7j8P`$Jy0|xP$)T$hJJY? L4 4骎$/)IN F@OrVI:Iá;@rF$Bnh`"}lJ@  sLk3P4*v$MpS$4NTFRRZ$% $ԃg FJY4~SqMHOkʓl:inh'^@AJ:$%E L[5kK J`}~ pBLNO;(>pE yS>h:qH?L$!?|9ܕ)(N5ȑM;otOdQT E€{D"nDx*IΝ %( Hi`e: 0 Il yQw:"D3 ˠ)$G.6#)I@ 903KG))IM߅-@N{$$bSѪp;&IR LB;Z=35J:9n)5ġ`@UI02FJxS*bJ L4)w*AD5),RJRO ()dI) 㲉R>e*'I-dh ~)!P'x&&tJcDPRМ$3Dh1J 6P)Q*$$Dn;&'q=l;:L5%BR$@S I;Lr%"۔LS<@'$IڜOC 4,R[S *PRJiH9pH˿"HRQ);ITܕ0$⊔.;H I焔M91 gq "@ ӯ).e *cTcT R$M24SIK)$}i{'#TdNJ3fxrRJCwpL(^*qXI#4BtG^ldSywDrʑ=fLNJ)P9CcK~ upBr@#QdDF믊Jb<]  @v(lwWJe\92 mvLPKSOTɔS "׺̔Pe-h7(=۝5)<&$D28RBKϊmɉ)(i(MW{  ͧwp S NRJSJMhHtHs=R)M )GDK @JRkjbP>omGtrSo8WFuA&<ӂ5ME& LςfR JXR)cTw<)iI'Q{7OT %b%*&% d$;&eIQB 66πLpST)ySF!N%+\]M2rhEMƪA ΩhO()d'> i \4A')%ED=.['o4#xELƩ 1B`uJCMSOPRiEy" )r%1>)0ܓy3N]?4T$JPJA&T%$tIDא{`w Jo> r4OEK4k>G0g@|w˥;ILg"e8Q"5L2 Rb%.x p6Δ~&VT;' LBb;(fDgcRsrg:ە `HDTlFq뢄&xU/L-Z1G.YM uQF}#Ϳ2-V?E7y'?HpxdhQ}CdӮcOʓ5%3d"$Ktv&G5'PGdKx"!@<ʑQ ɝ1ZIBiԹ 8F1jQ$S78N!de6$OÿAaщ[LV)k!:Ei$N42W-~zъUvCU-!{Vxc=Ce-{,\IquJ6>k7tVFet*3 d4i vC;'.R^0}10#LlJ@kcaE7*OR"C4 %'Q%4eAąo &Vi Lf̲Dʬ Ή)xl!mD*=~gCF/$QLu%ٙtxl"uZ(: K8W콌Yy]M@|P@T2cTс}..]F qSa^f=ڄGfU%E k7u!3$r@ڧsFʬá% j(L#LD t ug^[pQ{MfZݎU[]k k!nB/D;ĵ  uU*PcuV c<ZI' &PZ;"[5M$¯{X s=KNԍ,o )MS6K4°LfФI$RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I'g#⺌nFM|U(%87n,S'n:kMJSI$NpH $JA+dA$!JRI$}|SƜ6AL'Ex&^AH(8%3TIK$I(L5S A*LIPq~Mh )I`!IvKkֻkDzm-nȐ ֩.pyʖOTqʖn4{ZӮ5Ui#EK *-ĞU1ulk'RFחCUa4> ZΧE{ v}FM-2A#GG,ie86M~X-nn0FȒ9(vI dQ-$wEUh%M38 ҧ$ҒTSBJ!JrR>%!⒗I )Q.%*BIBn^Od@\4%F0'RN@P`"<Ԟ 05Q$o!%($R%I퟊l3 osAE@<^sp6pB*R@&8):* 8S$<{RRO"OdwpI'(]$چ#Sw!!R)14Rw`)~aN'I$Ok)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$R RI%waG- :=A lXGbTSRR/HG #I5I$1 L\{NFB#kq%,$ $vXZ!ʘ|hԔ\%2G"6AT %yQԧH:ɉ> @J Y:I&qn*.`#)(:+N0UhSTC ݨ:A8Ju=K$$IM8;fRc 1$DkKƁI hԋ-+p> `i%H(8M~Q萙LY›JΐhAKH&)7EHC:@D|!F֖5(pStiܦ*[G NR!d#mJTf8 @TgXmA (nPZ@8 S4a3nH1IؙmJS))$t3b;TɄ;, `XU,'c%U $@Q.l@~j2G)4S/)'Dc_Ge^4RD),Jh$j;@pnPT-`})`THNبς@Gd=jlq4PIJ4PD: %4xBH.?t($B{g%1:) Ip?Bc 3'ȨI w M :~@&Ns>2$$$IJcDI'.s)I$q &c}Nbe" D yL ?T$tSh%BcQ@:bSkvX%HALIQ&RqLT UN'o)D@Q`߷ݯt؄v!p"#uR$@"PJ(LRQJN;ܒLBxJCjOLf!-9E $?R$.:$%ID$3I  XI4wh׸AT[[#4ILJ@O PaTSwMNR`I'x8)$OTDM'))dJΊm4(SʛNH%dI1QNF!GRxC&92RRsuOLHg%'he0/JIM\K(>xHN $Bξ vTn$(LƇ uE,$ u"`p#:dCM%8 )0!$x[um 5qiK$7scx* ZIp D!;PS7ݡxN'P٤HY3yO))b> E JJmkLP |%,Y8NS@J+ZGDM)(B,F0 ȕ NPZ(=C@RJ ` EL="%)JJB~ v~?rJY:nT3pcڛl<Sr!;A=X?r0l|lRtH QШGD"<Ct+Bmx)g4Q&/)L ;[3uEqNBI J>+'Ns)dSN❀A)!M/SAG$#['4PqB*\`'"T_ejP@)@РDp)UKAOC$铩'4PԘ sĤ2~Ф{(㺘t&%: Oq=FJmR>)&)׺MdIK&"S2Syց3u4bv ̤ǂb BZʉB| Fx 2x )qr"H@%3)bB1ԥ&&rߴmTtT#N&~O:N(NB>(dt)L[rn@RR )4IK'"R!$7B!ܴ )RSv_(PAN9Dw`cD1Jd)(T65 jA!$@L<ԷBJY()H ) Ή)@Np v@pJZ!12R.$CLkQ0="\߽ rD"Se4rRd5Lݦ{2%(ꑐ92+ FpmJܢ\IQs4ƽ@ôV0-JWLc(֍d¿u[*nk.k)7v֗Fj֗淒_XsfP0ߢ[Dh+.B#a*x0" IYSsDQ*dh{(Q =]*.RcEKB92 "*IMSU5CIxʽ^;|4LbRmWCCqۡPȘiTrsQ Ǩ\V~c 6 Z(R PK]S5C_?Ǜfg}O=gb D7mR6wV5<&~*%(?%В3"Ld ;#T t(s>aW!*)*wA(k1ĸW}ږUÚiӤW߼*EHPy% κ@K 1@4^lS4haRh1 Uݽ(d4H ;Qi@|8Kh%.D&)9>Ȗ7IT=Џoh)hQi:!L<'We+rTTC0*. B- /:V GFBmJ{\^[,{)ֵe &OuֲʝUB|Ԝm`;'êk$Vo,7+Q"ea2sAB̋ TvC֗k:V ^]-Ղ!+ldGt&OHd<& a&v|L 0!<ʉ׼ÎNqԧ!pc{&Ѣvsaƅ=N'q@2D9QVx'v}3M I j]"0?gD֍GGQ i5 *2KƊ<"cUO╍lkmq':!][*Xƍrfӄ*o-z Mh II=I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I'Uh>K]Mq)ςh.\'L$!2JRtTБI%)<Ҝ-Z 5 \ɍf&A RmH eXiufHapȑPyC~~k0[6K?5~5V絮pD_VmH*A&n0v=IYȱ[g&=?߹m x-i# շ#k?ԻlƏkm5_߹/UѦPoRm@wj}k;R{Rz;|p\cO7K~qi/ 5FXB;ȧH"#ړva o}j_d>c[V/H"a}]JT ۂtp|Z?c%u20$2tY$d&I)$锔 )(uj rBR)JJz›AZj ܂Vks{vK9Qy9K]3]T[ c3YN|NJG&iwx'0 )^I%IT*Nd4I(([#vd%2t;!?SpEKp$EkaE TIF*t,+M  $Iu$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$VGBhdhߨ'G T\6I Dp#'S/qI*I)M$-?zv1ϒ%@AK'$R9[˹*[dJ*Y(NS83I$I$rII*M N%HOJY$2ԁ[LqiRĨ9LiʬL)S )@"(4ka)$O)N|$7=-AK)4ΧGxQ{$S۵M`G͍R꥝MI4ʕn#;vA:g=%(͙R)MAH0Q&Tmn `">$A QRS'TF׿*0ѧri %e۴!IJ*H4  `DK _djR03ە !8 jcX`-2S*w)Bt8+BMv<{$Ī]{)`:  DiX) I4| &(tIKFsJY.RIIQ*I> !bx$j4IE1 wPRӢZgD:@$J3GtFBzbi"PSS68I7]UB 朻MxORD(JhH<&:𒔔$R<5tPxSnM*Y1)"zb%D4ȉkUs#ܠSĨĕ0ΏCyOQ;Jrt2uKRۦ$$$$iIAJH"$GdJILT RcR)&pND < 7 C*`.cDPN8DipYJ\Ѫ3L=S;ABj% nl~韽L~cऍu0 T_*Y/b u8e4鎈!t'IMDUT$II:dRwtN'J&T|JY)NM<ɔÀ9IKJSSwN$I0)H{yLk1AKD'sNq=B*Xj$%)̈́dfcL:Aſ$.:JNEKʉNCN;A*4)wM;G)܄Iv4? \&:(8B##^HBIKҢ yNh< M0 dJ#Hh $Qa 3(% R/ #^靨jTDβT&ʄ9bHV& {"8$6O,h'`*%!0%1O@$QkhE䨰'uf XvN.&'`Xg(ܔZ̺{"5$ w3UZȖ,=B,RI#tSH ) %d2guHշ mJN?r ܘA$rTsDS$Бt$&5Cn>H)1NR%HSĨ7L ALcGH䘎.xɝJ$hQRk8H"K{$$;Di s=LҤ“N %D)sIPLSe7hNDI,9N"T5S:! IK9D)rCq”Ȟd| Z IE5*,SwNB")O5*`(B#_ RdRSLA+jSy %?u?z@~)N vM)JDwO3gڐ%-N(.D)(4A J#OdJ)‰L''M-fR2i=I~ 5L%)8 @AQ[ϊbӶ 9vK̄ɓ.:mMӲxIJ N8#Do:'E$!Mʔ$&)JR5Ҕxrsi JmJ\ ڶaWv[sh TΧ?hQBAݨIʈ/9IK$R))O)'Y @AK%?rthNTDpdvT$KyEN8лLJJXiP.7q WLvDG}Pg\R0N{'M)vIJ%7)B@=( 'iR`'T0u9C;'5FU$:~AFFH )nmSK4@V;L |S?;"'fSܠӦ'hyI H:X'!Jv žt3E;Gp~S#-g<.I$\) Br RB4QR|ˁ-)ߠL)ƒ5ScHR mҒX!"uQckS|<2H!۔͆BHX!C*CCsPtN$ܩ0 m68kabGsQ?,JGg0%P 2;u,QiwE8S6Vͤu)R6O)_9Mr4 ͷU:ƨoQCQ5)%sn>6S #S{ \9Q/#Cp `#4Lw!>SyM0e*U 5)Ϻgy&s^ N$-J@۲o56"sD5$.PE7pLBII$L!56Lm&Of+Rb1W߽3j…$7PEs&eӦKUg!(h<4L;J]2RI0(]!TfTtɵPڤBƁTvA+iM-j+q<)}#myPuoq$&>)#d IՑJXT%2nN@EJI$ڦ8Cj#SJVL1R$Q `ϷRRrS%QEI6ooi9 ̔M E2Хcv(eMڙ<݈6)%4K+C"to CKݼnRR\jP7 osA` LHD}w4eF챀m@<*6if'Q/ 6;LB?MnȤJ.W醍 ^׍NoR%䚄6'%[) ?xC$ O}dI:H)$ItFOpqq*RB>'J $7I)ƪ)3Js *6)& &% ٠D)t2pHU'V{3H=)bД;%-p׺`=M]R%)&FA%D0Gc⟗ PHRO( N$8O:j)$5Kb (:A`pI0:hꘒ6uH<'M)!THTuTA9LI$ѻSxNl,RNeuho )+(! ׺3PSl= e ;Gq$N+%XG!1*5fB%.CL'Qi#AʓY)ɃފLCOCq (gRtjhN$:uP$&SLF)%dNT  )In/1)tH&"@νRN<8IЀ qM.BRrfUGCxT.8i%$O)ۯ*;JR1R!2i Qz%I)Q I2NA*0Z͂'Ja$&!^ mTgN *&SiO4)7SQp}b9>()DJPO ǚo?D0x^ĀyEKςR褞 )NSm% hJ.F'ڔ)N JRnbR'hKbp!(L%))5ܥ0)'LDN@i)L𒘃:':*L1y(5vE6DQ5HEKI~)I 6O(%bN5j4iR#N|R%$9Sh3=MĦ rI% jٸ'vrV28Qj 1rjE HJ7 &~h)d')'GH:DF'AKBb)r߀;"GdR')F~lƉG;;%.4{" <>i)4`})F{&3h9` < !Md@O;u ix*hKƿy8H 0hpO(*%S()g `ByH'{MKr[4T- 4N9 x+ B'i9ɤ(Ms#%=3u2Q--WſhlFi) 9%HZۖpc?he^@4존ml5%o*Cvv֗{n[CthӺ6( Uʚ!FMrA2tn^7 _"N]vOwLjxR|0x ' Nӯ)07qhUz7X<ƨޙAy^|,tGD)vLUZ\#V8Oor YMwUu)K:V'V#DtMw) L&NRS%RrFlpRD!P4*f <\e32x'P;3ZC>!NJu+0&\wy)D\'z!WtB3\Ԋ4=TD&RU.J[E@Kd8Oc7NO U^CX9B}tUSm]O 8F)ay)=ӆ :R)n-O ~֍9IӹcDB q2JS)#C]hT*M`s$vEK\ MtxintNZ& 蟄5pN tHTx$[qHWDfB X`@ sAQ|lI(wxU0OXt^-B"Ql(G<&y$6R>Ke0D!&]cY SYv_1L3kLjTwuN期h1 W*D+nj|Qp:ЩpTYtI}M.{tKWJ5P}0mvJPipNӪ02tR. H\JU8yEHҔLM(ۄ$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$ i W}0叮yItH䬯]\]3  IֳgCP Ӥ~XD{Ʉdک$]&F22J0SIk]_A4% Z.=ҦdcihLRIlTZ3a SIj{HfR;O)*)ARIk |TGrBAJ[TZΨrTNU[;%$۩?r3A:)Vd( >8I-i?rˤ,`îɌ'VroA𭤶fB eS(OE N+n>y¤cGPwt.5K7cQ6%ROU+x7°^,R$ie>ڜ1.8UezL;Hmcm#GJYa$%gI+ɗEQySnjp!ג{󚵡<- 6Y)ʹ0DI):INV/@8 q&3(clwqjQeռ\ }hiLiT%(RE@9Ð< &7kGmX U%xۍ!e=eA6g\Ҕ;u۫! Sar6?aoQZք_u@O*M)$)Q9-oj#׶}28Ԁ 7|!$HI,2_6:2Iծ,,uoh !ޞ)iZu5 <;if7V hQ9]T 6~ǷXd)PF\ĸC 9sx$$AuIF7hܣE a?FoCqZI3VmH)FwwH9[wi%XwO{eĒ@7n_PE4Ü?+X 2NCgUR7ao%]LCE8M fRA"L$%6fbOUɑjE/Y!Sږ[sy0ܐa-7[T0R?8,-GYEIkVg,݁-."h!x)6{DnihfПhKK_Dk}鷴h+3 GP FAQ0u.Vf#Əi'432dJ$Ob%${h2*Kcq4IXw)8$|W%.k !";U~k?xh`u(Ij)}ޞ7Z8yHwNŎo ImMnYjke(%!<% X4nf^8m6 L hA<$/ywbPԞ6<UmtI$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$N&#a7ui$ 4L11Z~Q& '@ +8M;A"ut(S],٨0 !)g4,9]x!-$(8E(SQ +V?MGI(D)fV8NJݵ%dT:Zʖ&& $mr5I$% =TRRINmQe$htAIK>a (pVI4(l<)xQsI:SI2RR۵2ӳNQjyAKwRQpD%*f" <)90i1 ed8IUथO a x0#cIKvN|S!g^{=Fk*dLmU8@ !8D4~@D<$ȕ$qFS:(LiLO u"NԪoǷC)LSאB%GTӆD'M)Gu(4EKBtN&~ sJ3X d)!tI4vDcVa|LJQo*f(oUaD!$ID)%KoޕgN $&HL_r0KRBP$)4TAN"5A #I#[a +6BIlhXʑ % g4t행 ;{<)N4E L>IĐk!EKISoP-M RbEȰ ji),O)1NR%HS/̀$YdJW nLRhI&JZ8y(T8w'De8#L:I+韤@N'TRsTtE I%/`[<$B`IJKT*{9<'ݩ)h)NH8NN(aیI7)P):$J @*VAyJd=$n4 :c-Ѭh T锚tod*9V4 B*DNCALRӍuM䤘 Bn8>BD6Uy%9Hq'%hI$ d#TPIA΍waBDꊔd@H3*.R*.E4@y(A%\B[(nҦ tx))G(](H$@ |RJ$xHERR $Se&*;dd1)OsH۹E4n|RH)53ܢ$Q,DH)7!02RxAJLS{|Rp2S`MS%)ƉGM$&)h";ySi()It3ۧN2|g@x8jD)ަpxJLI&I0"tEJI$̂Q%]DaM)`TJb>gk]=ZihTȭO1AL5j# "tVMvr*k'H:SfXN(\[DDHCUV_t#s _iU(C#NvCR/^#DBw>j#HA`<#!"PqJZ]:¨/*ӟ .]%䃡 c vQCXDMD7]>ǁ@ȩgOnSO›Aq (0ƝʛDk%,t ^TOލT`.(sUsɔA0K`ֺOtP6>Xe 5EHTbF|T79Rh FC@Q7䒗P(!Xݯ;"k@Пg4 d" H[۴#B7{(uB*XDpQk S>Pp|SDI)Bbwʏ*M'jXJ!$vuR`Bs*/'(@i\p ))IjH:uALJR1 Pg;~)m)iӔL|Ҟ9@c84G(MÑ PMMTX>Jd'TBnSEJ)JiM2T`pKIKĥIp$$|S@SoAKwH%0TcNnt| d5O)@' h$) kI jrR vGR5Ra%,$~ %D:5AK$`')-K]G)z'+'SUAR®TBg\^{h>Ln4Mdu3k '`uTH'6%2ӝRRД$Tt)=NJZR!-'DL[ MiRPAڝ~ Z?riIJ%8H$ʘqA&$DR*% #Oxme)8!(848-8dp{E c MS! !4ʑ:_=ZA1jAK&vfDgN;Q|8_J_!\ S!)%3tOH蒖SD'Hjp#)J ԥ{{|ӷ^xJ4cP$R:H)S<A,x:HtCyۨXƮ aZƁ"aIf%= B''e hS1 8V0A h]=OMpp2@RvֈT 4yUNqVnhi 5bSISqݠT:yƦa] a,ݘU2NyU2 0iM'닜c>G)ѣ| $ʕn1 ;`@*C6؄iKU7[L[mDpu ЃfIp :;(XB % YGՖU&VABhUP‹ J }RVBIhBZ'H3 HӞ`N)S%4s  J $ERO +W$4gDBpZx'R@I 18Sw%&d}.9)WS;ӹZP%4P\n>$2n0UK=dbˣCs> n@6DpUI?HEmm'LxQ4쓜yP;D$Ɓ@DphuD)0Ȧ#BI'iA(2FUvX\տXkc3Pf5p+aNJM<6P*=oP/"|)Yy_MU2]>>+"]g9Ѻ)dRG*]{$uKǰ@NֹS¾@Jתtpk܂Jp a]~(fȀBnhGlU.N K~ " OPhP>#A|S΋[$&~> N!^jjpW$ZH=uCj#t|ÅaTJF$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$aUUg?p)$WB!UqnI($%RI$$$$II$I$ IRI$:A:IRI$dI-  RI$9)M $$Nm)$I8H'TI$ 0h`.IR)$-aJSƉV&d&tҒP$I$&JJMfǔ$BԓhIQGw6k=SqǙa*4<$-[vtV94[pߏ ;ep4lQSZ;B%4]h5 2 DZpiMѺ4JdݓSN 1ʙ7RRsؑn"*$ 1˭cAjj{h$$ʜ TS>wZq]m||S xYk2S&4H& 'KK>N[H*[;gQ0 (N9aEI3}#*IIBH)dI:I& !dN2G >R;"҄Wu]:I*TI"I$$I$I)I$II$$IL$IҘiI$bHdI$ϊdĤI$d"$J%DQ*I$JʒI$J܈N5|NI$UL"d}2?$I$EjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%g>Y miIt~`:eԂl>m-kV2G NNKNۉ ՛\I(Hę)48$RI#TDo ,\TSR~)jwE3jwI"$sСJbJZ(@'JKⓌ⣷IJI$y) CQ%)$R6c&ٵ%- tО\AB:Y{ןRR!:f5)Hv(M Ni Xq<%RH;#B= 4q)XCFDhsIjdSl@:uLuQ{R@3*6CRrR8<`up<%1D[&gu'*,NJ-d JYNvVA< L*ZCuRR Gt3):Jh(R&v!:'is:'j%/&Lދ^ݾ]:9N LΜ)Bbۯ)fÉ߲!r SJ\|T`T&`C%ra6IpM na5dpSJ*& (Nʬ2Ɗ yIAFi00aE N *QM KNbTA)!pI)7a90$IJ)&N3.2uIK' $YO~ܘ%,RNi$`1^O'LB@b|S@1N{J4I*bTX{@F4';x[PC d.$J~L&sG3)$Iñ< T~)JRI$@yH;w$ $$h;:IL;S$B;~JNC. ~ ?$p׺JRI%)4F -mHIt= πTa@:$RLu6?DIV!$e& UUiRBIBD“ LD6NӔ1I%*ΰxF10x#S67YIK4Fv(SxAJIJdQ 30A n / e3C˺g?Q?5J|Spy"Jrt($|*X2!Hi%m0<;w'`9AKF&< 8a' 9x f"LJG kʋߺv!JLp'NlSi2<&*E43ƈa R);Ӆ"~j%:PO (A-J!KtO(TDm: [ rLhcrSAaHNlCAh%.B_'TFmݒRw@tR' DE #H)4I`m3\HDꚕQNDhIJkCh;R3t0Д)4wJSLg0;"t9 ƃT pSzg=h{ہIX:d79MEJ1RQD9;yE"wi)br .;C; [IFwS<)&?l6RR(NBbT=I΄yHAK$sA;L LN)bE2yGt'B l)IGQ)SgOv8O$' :[&Jd@2)hUkGyFv sɎ$2 BtH6r|QBh(N&&k)PJbR:& ˃DȔ˵(F@:1-;Y3!sҫ|"{*D)`5OހjqqnE 8JaIhFQt6h)`pSN9I3;U= $"4|$G>I&;HhMI)c z@JN3J]$xyvL5! )I)!n:xV8)MDDaLO45?6(k7vw8R*Zӷ#ǟ)H uHqQqY?p @\e%1/ wH}4 =@j6Dƿ(AKa |ȠIv o?GT,FyZzwxe ^ep>^ΙUKZ#R҅)wP&DJ:kh<+{kZ>Jh0D6Ln=_\gO*kX 'fHvdla8+::Lb#g ̀5 lsͲ<Ri[tSkRsgKp:;YLFѦ'aÄ슖GO2u&8R#MLjtNn THDc_)< A^Td2u**lD2uJ Vwpk 6R$UVc5~䵺"vB#}ph8tϚjel 5 b$(lheѧd\cStJnљT܀>O"RNҐe4+Gtޘ#Uw!$vU\|ӳ'NtKe5h(&H,5O ǫHUlQͧj4J}= + Nj;'tr1-Pq=AH;<U*6 r~v- ^r i>*Vݸ5eەߢʳ u\x YFrMNp|J=Dv ڷq ZoyCAX4cwMq>DfD%V5=w֋IY:)kDT5ޣKQ*8:; _ޙ֑ZܒMΪKa8)LkG[nM[Dh3lx~X:IC>xSB> PIB莝PD)ˆD ʳa*mO-z,gi(5k l|jӹX=ԪE#2q@J:!Z4^xQ+L`>!t-v> a5GnWQ2ՐI)lI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$awUUHMYI%| PVI$LpĤI2tI%I$E$$I2t$I$$I:IBxIJI$ )A*I$TBpऒIJڙ PJI$-6⒔I&cJH.TLD'IV d1QRN\B:`ۘmU*陀))F1ʚJV3y4<ivT V|)'@+!X ؛)JJ#6i*N.s75wܵ҅ǒ6Vm~ %N]m9{U^?nUfA@I'(PPA%))LP4GA3'Y"E-=TKI$"$Id)I$tJiJjI$2iM(ҭI$uQ(-I$E2iJQ[jI$%)LJ`QZI$D!*[jI$e1E I$J EDI; yD< wPI$e / +19EL$I$NcRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$YyIAI$qN|1L,|--G**uh7J$ PaYB'&RQN&易!#/)$}pcDt)IJI(9O IJI$䑐dZRn$IJaʜ2I&$=RF)@JI$+lN)bRh '& Ok%rB`0:jnBU+`JQ)bdi$`Q>*Πx$$)ĩr  :$#PTv몕Nmb"B )iJSOu)F (,S)(L$$ `%)"!8HEE4$Cp'H;AN)np#Dgu)>AI &yI E0 H-u m()2LDcB N0;"$$ 9hT`4x%.R )Z!8)$Jv㪋N\Ӆ:$pI8 LIM1;(TPJSr<ΰ@>))I$N`wj=JJami:(P>)KJbS {GKxkN|4RT"y#;: &T\1 r4')oxy A()k) PZPUIC, R?(P2Β 9ODƖ?$ @Io M"Sx) >ݮJ]SZfTm%7⒗ XH M䨰FI'TP6APKvHQ&T) `|죐63^t9v$"ׯ)^R P14:OtV΃"R㪓P:%`Sn5nkS{()PdNd7-#G. AtD`Je@Q!'[7;RxB/G1!W%FcT`vR + H v A!K0ΡN4 Ʌ p+!Tu@$ JACYDe͒):񤔋dN>hw JEnΩ1ܤtL#@R °>X.l$jU.G& _ 3 O#%(f u):̝^BJZ G 6T9MK"JE1A#C|\@R*AA ,U@ײ% "(R`hh"L]%J~ԱyO$j!βǏ1k^!IJtPd L3k=6=LT9Gvp)ǁRa$ru&nJJQL> "ُv?5t1AL(5"8y.N 5N64Dr-S4Ac`~jG5,SIr L:3M)҄ Guʑp|RGt'?ה·: &"q'.kM'T)hDrFUgpaj"Ķ<J]P@:'ID56AE NRSw&yhR@&#TԱqQ(tÄ;fe ⡔ӎp0UcV+0:$Br!qtp>a0u4 JT'vdpCyIJ&11JAHId$I)g> 4I.~) RRE S 1Z)R"5 ?@A ԡ"P#n!`A*s*& 6?0NMyB` #^9\[(;X$b=f .ntNܕWW{BƤ&{-*_QoO-2@'(+7%Bp$}#BXu:*@H(0;+7;AmGS qr*;"U}CsB0!0/>,l݂# kIxI < DqzsxclhI$aqUՌ/SeeTI-›FhI BJE2{)$L$)I$b)$$I%)$JA: RI$'2t)$NxM)J RI$ҞRRI$4O%I$h%<' $$I(aA TLVd8D.CH&< %Z9&UzKCwx l#BӺ$xGK,=5s 9ո3adꪦcOy~wf&WCNڶ9$vN˜̠^]d7OSz<ŷ*>kwOy3}9yV} LwD/imܪ|:6؀Cܙփ1${-`h,A~CI[ýYt4* Ŕԏ]$=09fjXƱtѤq IH;mMs@h $jNl(\F +e7X򿒨*s AsFͧiJk]f7$*rW!$[,{G r;uFzn T] U[o`88s}ASgQnkYQ8aY-ooC%;&ٷtBok#4@뤲}.H|D5T)&@ IV #a=º7n*FѴ0U[scig՞oݏ$ $I$#$IRI$I'IJLI dfOr>jE 5=dJ$H%)$HN%)$LBPI(hRJBI%)I!HEi I$ e2a)$Q E2(RI$ JHH)$HBrTI&)EjEQRI$pUլ*>Ps$I$I*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$ItR#PEs`Y}si`GPwO(mʛ:tJBcC 3)N' "ZRJJRI$@;^Sh4.8JHHEKIBDJRI$@:R`I4V>)%INQZ$B(v(L X %;Jt3(.cI9LREqpJt"8 KXABudy HSD-ly5I%)!mS1h%8$$H)>IJT'))9Ң*%('Q9SFaV WĂ)eOf$vM5!}A &״O(m6gnz]jq]|ûj$&R)kn"[6&0o)Z4Qi21D͠! I:+pHd=Sʀr:kt r^\t mځ󔒸sROsh#lx{4kEP4&J@:W^{& ςb<)8"a$( :Lx$@40vZ7? LJau4:BaTI:P~  ʁlRRLJ06wkЭZt V(eB)@ph@Bf{.3[ 9Qd!L/3;4iALN5@DMG(I4Ω9C)$N)q $I rQ$rA%,tq/$i)IBIBEDh%)$?&'L;U$Odt Qf60Sy,PRHj`/tC)|ڦז 5IJ&qTbO$HL 8ˇ(5&RR"1!0nxMcx.!%)< SDkr8djRJ$HH<c@M JI7NQx;LJQL!;H;D !IjijXgR) )TABcjs)rO) "`g8R(ꤢN B 8)!pNxSq8a)dp R:!k❲BJRID#n-Dj9NfhOADҤD'pLJJRI&LJ$R1DIKMtÙ(|<$:L"S= PR'% >Invj$&9ܟCCJRI$)TX5@b*1Ld#HjJgSs*sKU{2i;JD)AZLȦ *mʈ`HP%1Sn GĦ!$N}|a;gT))hLBPi6jؕ6FmAK4m<(o UX y)#D*\$ʓJrpL$$)܁ʛ< %,tQ5"LL[Hbx!AՍ50:Bpt&)8nT#`nNCTTcTHNDI!)Ku꫹4矂+3~tH)|@DYQ{N*Qluh{ΠA:x~D%-2~ SDQI]#3umtj _y<'6B'G~wl$(8֊"OPu&:]0[DhKOQ%%/S)RE̟\DBJ\uNzR.0ƝQ)E(H0ۧ |IK)H@3H1AөvRQ ECPQeEʔ*]D)R(>nIpdᰑӎe1yOJ\ҟJO 1MI'F!sDE#*LӁd I14)b OcϒT OBJ]G+@25E&*75-su-?JT&d))4:HU䒦Ϊ$KΝњ)KJqƒl $~"V 0JS: ϒ;a|>*IUiR(0Q̈Uݩ%jseB nDTk>&RbNtnJe*U}*]D[M4v*;ka#Ao >(;U"C(KQjy> :%*L@|hyOa yR{gT dAC"\5 Pm"8C%qY;T%A*ur\dnO7s@_$cT: C;}5=q/hiS25wsWLC@o=t $LJnS*OVzN?հh8]|ä+l>W_w>KmE͂z{&~ ,Ҟ!ē'O%50V3kFtjq0Z; 9 f*)Sz4UWeS OdwNT7p2&kwvPq AAs=TL5O \ 2!3Rak3بZFSbkGt+U5$ >׹ݏ()48ԨcA+XBI%3A2I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$"+2kMŗI$=\n }UgRQܖS-`~"Y$RTa%tRxQ ~Jk%SD9I5AMdQK?zc0-PU%f>P^Ҥ,~$$JbOe)J=:AO^3-?zJI(=VV7`1ITOޒ3ID:R&h(+TtOc68&$7&ȅ ֈäiԆ OHۊJVp1GciKe1Y\+/sV8Di@~U&Ƈȓ"$ 6SXdS;%KS&)alwN' 2dG)>41 )hKcI$pSF%(;)hFR9wE$S[\> i$qMvI2J[hKhSw-h*)SI5D$X6Ʉ&Sm.sK!ۈa-`II ױt'6JoQDIʓxpljxIK z  ^ R}=r" CIL,'t Qv=nZ7x. r;|Ib$wM]脕jLʘ`dd_ۘ솝HT{9Ä4%s=BF=vѺ#2p Y&)N*%Mqc[K.@JȴBQPnJiWrcqHC MPpt1%FW9S QƘ6Q=.KȥI ?T%8W*x(lq*H/~&O"[=4?~ RD7%S)VOO_*Wf*@y4?OTI!RI(:;b+OE=߾WH$VOppR=.ݹ2I6¢SiHbAoފ,2I4T*%Xv MVI)Ub+}-t$F}CHt%+3;khq=gtI$I=I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.%c+eev2кX0z`DAD-PϊXMe]2t䀜'Qs ISIJLL%"$It!4BwhOE LSvIh&N%t)I9< !|TeRI0"TH$ Q+ .uRQ2WB Tꝩ2Jvp ZyNS"&<'Aym=f5D25EKIr@Kc-*ByLAIKI$ !9ApA I4:J&(n !*'-Rn %ǷiA HHRuj'voQǟuN-s$mftRVhjInd8 ;DtĶSJ%`G(LB#h*bS)')q?+ޝit )o-$&⫶ư;\ݛN)N !xLgT3WwPX[}<5QkEK'Ӓ}T_SKyvI&{TU1 8ςHpBuD5M.*\~TF焁O `̤[ifdCXI3x'[3j TǙxeb*\'6Pn7C4HVB:!4 EbK[,1+B05=)_wQx@o#n(q>HU*v<\=RFpR"iD)0SEH(2HNt$|T%u읭RJSH M̎@CIRt', :JtyQ )$$*Bq'ƁF;I(O$:I" *6#$X .*AE3I;`!.R ]kx撗I"RHYpTBD6JMSlp53䟐!%.AN UnfQRKNPuևsA@71%YJEKL*PT\ƝH mxx!Kd{6 JPEclO iIJI.Sp:ʑrJ[$N2RxIJ$MT (%IMUhREI2 9%;Ze>!(I"%I#fH`b}tD~!['Gr(QRςc! *[|m_jupBNNm$4RW'IE,LyIDRx (P^BL?H@RpFOf柊V^j"IyK4$N'^Q0nw`׽JY)c@#DrЃj.RsƇR@)j` Nj \L${7{4iӺ*br0ʙc HIʀ.6tJJJc.vSi)w|4?Iq?e^{^]\맂wK V qʃ @)12Ab=R=bBTf_go))O1TK}ASV 4sj0N fYçt(Kn7`1|H5Î НT Dab{)Zjؓ ]@)fU"eCԎjqOe :S QNA%8Mz*P` \& (Wd9CaG?zr)ʉNk׺PRҤS!GȩJ^g~*Rb3T{< h҃Ĵ&$~()GLTHHS*~;k*#C)\)Kf]P5,JtJa*A:H=r%6' $BJQLS(p-OL|Z;@8 c o4Noe)PJЙ:HOn{(Lj$ħ:NPk)tNC&Ꜥ9H)[QsMڍ5Q_4)GRcki4=.W%M`((;D1sY@N L)b)ʋ S{4.SE2ZyCҜi&y$Q([ ;3`8ELRP (B%b$ϒgMN.S$)lh2;$cPi$t JA-g?%)Bm8vGk(hhO)h`i$91&"|SDL,tKi}^ymDqJW)})'KpƗx&sxI[ₖD n(.:J w# rSYNpT ڨ 'nQ!T?zgi~²4owDaݠ&,^QbT6< $\=HD 㺁'DRM*wT®N̐dPE8M)G[<#4 NT Ί xwC0Ԕ)4G)(DxA:BO}R8!DS֥dBpBJSLAH&4;@&x)pVas]yΩ!'{yN"uQq5^eɭi.|b@|DsO1 7ADG}cBHdJiJSLA(#tŨ)쒀LxA$E=(.9RDy2Dw5I&cDQI$sti{xӕLuELY&j>I+xU,[SOQ;Gu @*PIDĠum{ !e,ZXw;uZFЬCWhg+S8jF)m?sҳ:{cReW/5D^%F K*ͣvm@[F>pJ@Zls&LJ~jFe hRAۯd-4Psdh6h6 ѐer˝SR!uQ5^o8hcvOe+v]Wsu ma쟎dϤ ݼJىn6vhOϒI%;I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$:9W:[jٓ&NtUuRUr%$2((TI$1) (tJRBpPR'LTPTI"4E RJJt2Z`ڈ P‰a/n'I;G(!kRRiRo$tGn 3M qKe(6)N L4‘g`iPdBD 4JtnÛdyMf9@svS@Lj1)n=ҒbpNS$%):I$$$td2JRI'I$2JY:I'LI)I$I$JRI$K*MH*TXMD NuA5s(d4=TqkK ;r^ #@;$i69w}Uiݮ!!D1+RgY 3#Of(Y'tA3?y\Tq'!Z{s\Fi=jk,\ָyJ񬹿g.[Fÿv#Zױ4nFtXv+}GokiOo;،K[.r6T7 S7(vP}d^Mc;PHb[U, q)eHs ~tǒRc ΜJ#q^-kQT%) i{$W}x(}yX#i2( ku>cb{1,20Qݙ)(ԩ2e~oբָAS Xzecoj%edJcT^c$ VnV{Qop\ VtYNӢ(XEa`˔D8(UJHerSz^4-L%Ck^=?%zZ&@VW#`-?H ;S@)mx(;oRp<Ʃ)Z% JQ0L EL(17i\]ЎȔ)E92HSzdν: #JB[AQ gErTg+R@ )!V)Sy&FI$R)y'#IRI$>NQs%{a  hI)$'{5LcAJLSϊv!LfIJ:'.S3Q MEKGI(iRU' y()tĤ)WJlT4{]T'3UIgT25P\m'X슔H:S*54475 d8q c4%TU2 Ҋ ACyul̙FhMs>) w)0eMڔG L HtA;+zX孍uS]''&JDj~n;R5%K#6~H}D08`N[̨< SFO閰 R3Snx9^)pg"ce'Rq=Jtx41h>U55elU;tRշhwvR>HN$ x'GN)6Z5K0N1"' QkJ*㱠8#K Ήݩ(os#LzC^G}*$JU'tGdD"~C:T1f$~5#:̐<yIK$ FУ9C\5@|PwIN/ "tE> {\u&th|TF@9Q|Н xDxРg@j' M#ARR1I~HNJt<*L;(&%-yDە83JL{LiJ[J'iA0NixE %$4jA))%I&씠>JySkP'2 iaУ::iu%? %L--" O:N ›TSFlDk#ѨEsrRD3Hz8v"JǁQ(Q \B h`2j&&{rSJnhx(Vy%(&I NBʉ:߫{(|SN1r!0IRlRvjIQHpT{ ΧNBH]4;DÕ' ~ D h 'T&Jn~I7F}"#IK&e>Iԩ[g#Aq.L|ƀbI*D~:&h #Hi'I<`jk_Sr'Nƪ;s+%A8pR(?TG?.WVpoP폒 $<ΥuC&|Q<$k!0%6Ivr&|y Mv.:j5n:T&#TF< 0ߎU׸L32HA(Oo Tb!LF;5\gQ$ R85L4IJ։āa0 E%19'|4GxSuz&9TCN|>iN A%Difa9Lҟ9I)i#u3ₖLHK3&#v?Q#rGOlB WLH#a24鄼nH䘻D' %>Ƀ`jSĦSa$PI)pzjԢ%)(;ANp"JshRHd;+yQjO<"ͮJ6NO8h) NhQlZ- ǶXCȴ`-8BA{GmpG-vC˱?i}NʢI:Q q\k DnQ5!UZBhu+>La{@ŭ~I[})=\TpE IihK|.0ٱ`N=KA'@;,/ >ʓ#vj]\{T4᧊3#c79C"[ ,8bZ4Rpw# P7E[{*W:cӀS:8hw*{VYnA$BVfmЅ]̂h1CDS:eQٖjѾw\0e}B4N'>Zqq6Dj "Vi̅qhv1} FJwuUmd}ƨ9Mff!|*2TH.S.% s  l Ea 0VTI$I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$tU v_ I$zR%5Jd] )`S9LR$M>TĐ S#AJQI"N&{IL%`JRQ)$KH;Aw d@I+pR&!%0px! ]2SsCn" Jɓ*3d)8nCDNղ9Qke k$(h7) SNa $`cQc|xGq s|Umta7 ]Bb4)ZlR` xLZybk#R[w{Gȩ rS RgƘ״K_m`ɟB| L?`I'A 9$oo2*`h՜k,,:T5 LJ{γNv1 4k)YmulHkOS-}HlqK92-#sIW!nw%:,v״c Og=cgB xY_*#Vh4qȾ]|#髴n7% "IIRM)J'Jn J^RL{Gu,icǿӾ$Iʯ`l3߶]C~iA4'L*6z~Ae -I >$incڧ upbeՍO@cƼY;V.mY1_OSK_Ub4. w6Dp67>-}'|Gjl9Uk }Wv|l?Ȓa1 >/DW;i{HMum[+}[C$nen۬??t,wSSʬ5Er]Vhs>|@ڇcCNWrSD@)RHkp5tjBJd SyLRR8H 5B~tI8VjhGSpGH#ai;yQH*QH$$졯gg2A833[# TI1YС̥Y*!H%IQ Jeȭp IDRr HS(=inR铅CbaF[X$RS$ӪMppJ6G:)iESjt%/)~Qs)H7MDǞpRJgtC.{)nA %$ ܨd#ϲ\` ""?*JT{'8F'r+'D=z5,.J*.)=AC۹Ь9O-!j[we.ԹD8{ k@Tdmܝ|S7n>NRR>IHy0ZZ%LR  mf:BJT@O2tęSͺÃ)RIRsgU&}"=E{"R^'Dչ֩8-r1[D{)&Ny*I#LƉ!;dL8$otP VKukF;AR5kv GjLk@@›D4E0NTԡ.)ݦGpJĨ9tS.3*RtАIp2T!IBt; J!;M8IJ p<@(t%ʑ8\J@ꂔd35EbxIJ (x*W04O1n@O}`H\ NݲOtbTih')%r7HAA.㯖DJi$T;% h[q%<$ILfTH,Jd0 %`%.hN-q9qrttE NdZSX|vt#D5+E$:yjTB! RL9L9JG*UwI$S%-P3ĞPRAu>*ORj5~".o*\e[/h'-~ dF>jvBDjB*M)6)D4E Ngt3Z][uIJLR&%-!0Oh)$%IL[';I)1JRIjS|ӒcU)RI"5TKA%Hpt%,IO)BV0GuMiuEKrF=B8D*t( GT0=vUW58GJ]1IQc0P,ix?N Jf I4O%R'^)t4wQ>@IKJR$6R3)4vIJI$cG2T4NxRB&$t6{"$Ҁ4t:2IL[ϒa u)<N5I*:d;uyH$ p')2t)T#Q()QTT% JA-* y H)("3]P`O)fJI$TJ3-A:!E8IK2 CV[2@B IHkGT/ΊDo wz (h4H}t<ɒ|#IhUXQhBJdTRNJ.D!u:(%MLJM)3!p۬# %DŽ@p?mT'P+Š9@$|yDٻV-efS7h;KsAq NIL\0|$L{D#7$ׄ!׈#TT"P^LG p{'a Mxi()E1#)$hִkƚM1G@)$ 5Rk j2GgT6'fK7_TIs8vX.Gb$[ XX ^JXT.>*-bC@0c8EI%DL+`! #C ;삗qGBp3O4;üR :D[ܣ4l YG&*d|T "tP 2A&[AL9%Tmk^6:P륭wp}&I;@ԢH)9ą5p5G5SR#I tS&+-A+UH՝sOr5K<5FA #QbKS`<=~H=Rj;AaRxAK)RpEP,-As@O#>JpRA*ADi‘J4N-B%)'jAHJ+944$ꚥLrSJM(oSV⒗Q M!@tfON )NDR۠$㦜"> /DꂖR&N>.i* ړ`"`꟔#!L4|@gRFJyLJ2`G9CP<)3T3D(}E LR%4nn$LqQ'OiTS R:LT t TN&Ti~i̥Le3M'pk4⫊IGs%Wyt4 bT0F`0Oiq$)vt:IR)) @8cKD:cPv(ILl3A'*$H*wL| H0oM9QLAEƒ:!Jndx1 <H@{Yx" TV4K&Vm恩K_ 1?KDVSb7I*l%OBS Q䢄thmڧx3 w*.!| hAojl4J鯂ځ%L܃KD@\@/Uy<㶱 )LOGdطm7R~C;Ad 8&NA5P}2Iv JZ= BX^lB+Z|>uBAƅ*JlV1fYNYe pW{f{)|8A{Ä f[6;ԇRh왂%&KФ U4VRʍύw;{@D,ʱ+wh$p=셑{^}1u[zM+G[rVXmwBTvncApҘ]i;{#VcvP(5;iV1EtU8)[4R5)Tusq^TX6 I$t~J6;2b“'LWCX[)9?)$RP&p*$it $iR:Jf;I 4RHwwH=j & RAgNJv\dI*N)*)X~ )pji^B 2$̍S4ȅܤ4 /T=$(%IĎRx$Ha &f H\$4HID =CB$!;.:hps| U\W'Se#QNND,h)X9h j  DXĦ!'I)B<ޜ<ބ-3Hx43!*g09N ޢO%6C(TVҹ+mqq:*J)$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$j\Qn Rv9<='t‰H$НA鵄uKBR$H|mĈMTb?ޓ$G)0RI)CyRt4NΩ)`uh$ ^t!$“Di)$B$rtPp:ʋ K$Bp=6(N>V|RR1NfcwE-aa{J[RRZ'w'(Y"O \^cn%Ly>tMND+mgtVDM*S*)1l$JTLa-*D02uaT^P K`5HݡnمuSV 9MgPrN'Nu(5J>ܢ$Rq %ryJ#&)I;5N% d@I $“pS()tҒd&"ODa>֑$&ʍۘ}d X\RRI)ƉOLz Z&R*XKhhN, sgh1 ĹIܒG|̨  ;-u쐗k))HL֕ХS*TL`$yJ9.%.dqrp>J3< Q % /l4Jn9L(p) ̥β0eNa*R锚߽'d$@FL蒖% SBLl)'I(L@?64&F4hJ1)&%V$psˌ\ZSB\`67o u*mM_` KeV-"T!k(Ax'UZ%Ya* !IZY1M@8 ' I0 Sv $N"RN}9;tHN"rR iʎƞDIIM*$ώh*@$$ OMnEEt'A!葈N paW$)O*[n@NL iL)+wQR*te-dI| y!CX!"0$ڝJŠQoՑGdvRLbTk?=Ǻ( >)%$d͒s=l.{ 'Wkt*=wP ֊fiNJ uyhI1O )gI-'v3O#UNm\lnKt3.:~()T)AKH\΀fP%*S%X3 IԴˏ8 !B'R*]8C'HTeϚ=v tL"<(.{!^Tܢ @h 'g')y< %3:T|F.zk u0VC TC#ġO8S6DPPn@Pi(P.$@DaRD;4* )H蚤g3fSv9tuӔGv%E%;Ț{A%1O^DD]N)S2#:' k2N B XGd~T1$E ";w4)ѪJTSgTf $Kₕ?ca OLʓlD$NTAI,NG?H y\~!JD{#nr LG}Ph KII'TSA|!s (SG)Z0:ɋ] h)s#(Wp Sa$heDL pHP~$:P;w)r a@:wN Q)Tx/)(i)3"A삘Lwho\6gN?ܑ;AL\u8םO9A>$ IMS0N';njQ00dǶ)DꘙsT5?MctqRb?8jf\R\(X߲`:I$t6/w lɇ LS+uwjD=ʮ1)J Z<cXAQ;{䍡Pe%{@ &$4ѯ'2[@%Glħ.3|`|RJ$7*|{BvVN)n ԁF)p;OQ)g#'| ɥ†$w1ǚ#9 + 5%'kZ.Y^j6GIVkiĐ W$T,2Y@AMVk\N\$P7GCvyw) tş՛OT9um`$~^$?[V>#5W8_m;ptǃeeOVr_%16捊 qUImp3?t+_BJ39G?,d4f%&;!ےS_oaK}9I|qwJX:5qwިpVEcVV_ Ekt_>e QBܫ"|R(A0LAZʭ2 /i#RfTX%WtBRiOQ9Cv%! I47!F)i2H)pTkDkA:Ӣ#IOʱ(j G>倨d3VepNk:L'= L̄B:@E {&&xLd(ЗВWJS )m({e75Nl;(9RRJAR-h:9!RL8CRq;B(Z l(N%)(I${d82WQpbRjs]BI$i$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$|B v]m@<#wجQ);PS3E!FPNhL; I$$ꊔIԌHBq Y$2'd|\GutTE$菰!0l"S[\cI+RN@j:A꒗ $A' T@{$fPB`SPe&Ly$(?SiT2'X&*;¯D9CqaI )"tT:R&:%,2u;h< ۦ)"RH–'͞;Ψ)iHuSOʓG0ӝT`hLJtTg 4LT`n"JJT)e1ch$6&>h(RuIK%Od:; re;@7&(2BA*ٵy*v2YT t!m.?NN)|E0NS)NG KyP߾JvF8,Ke*#D(@8B eJ50vBk5'S%w0yC:)9~tK=A?)x 8IU;?I͇a(I\O4)%:fsMh|R*-c))z84 kⓏ crDKBG*:S& "PE<$#dSB(RI$H;$ba|RJ&M* %@{mnIJ@Ʉ)4(M&$|ɎL.q&e0)bBJR@BI$A)΃GhHRRHHj8q+iP*RkTM{'_Eڤ4STK#Ct+[A7U2/) 1(*;`>!0'B򔤒pܓ[2IDƊ|*)&LƊnAE+`#NTQ T*SR ᦚ!)B"# )IrdX` H@cufJ+Tb{mb5T"`k% ҐRY2($nJyhR*QBxq4"'Eq̑Ng TR. @'9 2@w'⧷J]2xM*%JMjx@@AK2^j\Ly-IJO E"ni )tПTj'PaI)O]ݡC۷<RБ[tCD;IJև LcÞ!t%(.rCP:hD))&I%'II8IJHE Sh:" (wtIJ) <n:JP✆1p%I›t{LF ]!^ ,OG4N_Sk 3AL Qs TRx4Lt.$ )L)2Ɠ_CH&p0jke}Ch)hR`u0T$Bw&49K@{{18?4P7BJQp3HTE-(I\Puy'H)g %8vPITN!2]3]$IQʈ-.-il4pamQS-`?H$wFLDOdqpT6))wL{SV['@ha2a DRKB+tJJfh#ʐ^tUhۙQ}EL߼vDD:Bv 'kmRo))E)HCekBEѩ%0<–<'(aJ7wALCΪjaSq{JJQH$uNB-b5Ie8;`a1v$Hm;ADn@)JG'T1K-AJqT@twא7opyUr૽DN M :(@$'(4@i $(5*myDʋ.=h<&P ( Rx%3)OA"tRh1 |TL%cDBJZS{J@Dx<<&ruF~ F9M̘!81 N`|ԛ1)dS̔M0`k 5IL;k%2 H70w8㲈kh'w<8/9pBg 58H;+='tS:)#;)%*4";Ei1kf! !9D =vx=1DN fAFα)D(̘NMtPvDFIBBjC^TI%F *y*Ȭ/:!(CRt4U l2`/1ND)I_JbSJ$0!>Od M>)%i;>  :bR6A SbR$ JDi棐wG?E'iT|`/: (7$aorIEaTTvSp=A;~]JM= >CÓoo4 ܄3N &sՍ4C5J 8CyU8T,|4t!0IV.P #lBU$jVBB/u E&7YTvwNR SD1M#@*uMS)gILZGhH?IP24(!MT&TOLBn$"J T))J'9Y3c ( &TDGޠ5:5(pyNpA:IȖt@K5w<' vIAt!Iۡ$*HyZb3vTbF"uϐ~2e{>()Lw5 7.7Do*MSʘLZ (iӪf1w)ݿC!L6;JwYS&lMոYN㾨E&>(8!S>M4t Z *V5vʟ( yU甜~u)Mhr0l4! p N ҧBa*h(t* , jbcf.SeFoSurW+zm`isτPBMuWmksFW$I'1 $I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$'rZ] -pIto S5PnE2 jtؔ)&CSΒr-SIT۶-h\S">h^iO> %H>I#_41IZ{$H' O- >J1ju&l8AJKR~TpH#91ai:n> M'T6y;PRӨR( ";RNE{n*5k$TKGD!;6CAv)($RQ%D5c9*vX,# س|ʫuG; XuU+Qd)1LIJ IO Ғ $):@$I&IKI'ߏem*X55i2R#`Ɏf(Ws,;XO2$tn%kF!RLZHS*?tm~%+)-9!ЅaC$%do>)௹Y-pyUl龠,cmzLnytmV$IωMx#xeww(nfUs %^.UDC|SowGY-#<,~e'3)c˝6-+}4LB4c>!m\}pݱ'(\ق^F`'p1";g s7izwXe4p6$xUӮtְi?.} B}+WxR])+p0-QwcOe.+H ܨn)rN$ SJI<tF G@2ʗtԍ c hTlJTjJSL[J(b5]<9OO n^ƉjRJ}1rƃʁq</]9D0tB$A ,E m1(^ evj†A}`pYm=i#!*Rt3J2 r#1A!9+e̳B*\$1# P7{u Kiؠ杢QC. ӪpuN;g6cX))A-RHZgOe@ĕ.c.=WG J!I $RI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$f_fu}=۩iQٷʝJ"Vx2DIw:&t p IQ  ӠL (}$LhO)'qA$ N;%):dB@k*; g@4IKґJC:.<LRR'I3v|i;FO )GTL5Rqׄp 0FD tP"ZIN☘Oad8q2B*HԒj};;5MvA@AL|v&eA,F(lGtN2!ID c08JHEEX< D9;tҡSHSpۧI #OJras`3tijkt#T7\Q*eD2Q-@(d{o*n[K *2ALDq"Bt_Sl%Aq l>H(D Pk~uF48))⦢ Q6ȒSƲMR"RLT5s*-yIK L'9NL|ӑEƴkwRS '&T$I3^NN(d& KV>䌆S1򖣍RRKIND&I $%;dh." Ԥ3H=$)$PS:JOnxLQAD `x.i Р(eޙwDpU@>BA#dOi$AL.ײr R)퐜m% y5FH$5S쟏2k(Qec:bcs5 l<)?rI/Bl1=NmS'v&)8rq!Xk-y'&KD|$n#S[@ qj[GGh>c& /Y׺g2 !Ym`A|PHZlT(NygD'B u0a2wCylPn!5%3oўDL0A5 !NMGj֓3F[䒔xR&5CqAи&; +FELN{Tͣ-`!W$ VRtd$PI0<":QkƧt-2=T0!%$.0԰0iB7@pALIHW:jB4B$9imnݤ~EZCT2L&%0: `k)_ILSǂ?e)JqH:9AKBbCA#nn8tS[;l,n"HХ .& o$E0%%3L Jt#:O>?$jĉHJ$ƪg7(Gt7sOsftU@LÇC57]Ot3(LpS4uNC$yI=b<| TJQ:'w'*Gcx)4D mPsG <\:'hDP}RhAN <S삘%HAI$)Tu2'K^{JNӄt%-MTײzJAaMʬǁORiJ0$G6{虠pK)4Ck;W_~.Fh DƒT8ǐ4fĈ<ͯ{B)4 w*.ZЄAh:x*H!LúG=A",i4R]>hpS!<#94A,%Hh;'Hxpm(BJX甌'q8qP0{$BtҌd!Q5"J !  GQBʄu(:A اE*b!;TvU68QRi2"PRնABb| G06ryRXAJCqQ$P'=DŽkh^2r>(TƼ"{whhBFAtTcrkiYS5R: tH鎀)C X=UB@&F5/Dj$S'qLVQ:! {"~?T(j>lj'Di QR(dB~Jr{O) h|SΜB@) Szu5T @h 4r^5|Txϰ0p9?TȉAΒ<5΁R85T{Uf5 0c[AHvZ|PqVЉU #BpsV"c@L|y([<#U`1 qDPSo))+KR!DN$ju@ qE tj;:X~]vAx6NB;MF%I5% F˜TT(KGe8)e:D<5lgjyYEHYV9YyӼL UF؁SBJr7N"㈓`Hg@zTvaiJfdFjO'Q#qZ/nFе7T `XY.1`٢mԉ(D&y՝0`*lÀ58NJ'7?D!;=ɂF)΢tJznEٸQG`u^%h=(Y|rfXXpO5ޛqmm>eZQ{^^DI)-s| CERL8NI$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$:1t vdjaI]CCa1h*8}% EdPr)F@ǺbIJ rCVIBrHhBtE(&= C)DIJ0KfLi(da)r'5ߺL@JDtjA €jRdL5N 0)]RDE$v 8JT'L!D,!h䉔h/*A+JLޤK|RqbMTgj^R!Dܜ9)q{Bz!EOaE; <=0~wOCNZ½x0 ˜4RF im]W&09gbv*_NVٿl156s) {J"wwC(NI%Х(EJI$SI4% :IRI$wTU HcI*9)1Y !{yYJUY%0ů >2G<%U%*ñ1HK#ڟe$#l>^TG#O8~xK#ڟfIm0{-Aa Goޗn]1yPLcY)V>oޢW7>uKT K6;X?rKw =R^mwhouH~r1E )%q))'EJ-om#Z(o6MG☄LQ iQ "<B*d`8B$Ps\LȵAo .t 'HQw)PuEKp IjE/brnKrhOfּ\ <(8IKQ$UAtVP"(jAO b)HT[Q4f rОowZC<][ꑢ6\GIjC@WIBTDIJRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.Yl6{69cRRĩkLph׀oNġQ&))p2J'(D"I(N'Lӻ8ۧ RI&QTK >:&$HMʓNIKI6SGJ~>))dI&2LYiШo<'svIJ%3L ̄n1lTIJrI>)5$x$BIJJlyO#BB$FT 3jvHk'DBWN 1:" 6hdCT3⒘TL@< WS'8)::R.~ @vDf5&Y*RI"TQ!1|CFK9AH'T*4$hQS00 (j8)=&"S)vQ!3A R%GtQB*dAL;Y#TPJaLB0yHNִNbaIJLxHㄔ)%$8C<#gYL[@I*NʌruLvREK򘤒Cd%%BbX8v:JĘ굺pw O#U5 IZ!0N?5-{())bFn'E'bAׄg P*bT[)T'iU k{9^ H)%~ !tL(%H2tHKo%)$)n"|Ru @ jH$T]' %.H mDv%)1Nj0]Rs&2OgjʝdU{)N $+t !IRNe`i(UsxwRĨmTB|vhOTEDAKh$.dGhR~*65$rIbO M4'&‰&uE.:!8"Bt77U6DKG'O6)1': %䔤#Lj'qFaTa|*P0!E>7kʎDoT6ˎ\{L!L]oxG0!8{! C4vSVNRII4*vEH )cpD6IJ4RRb'MF֗x$aKԟa4 _E9@$Sn7&K%~! =\k""dSe o%=8ht<(H)SI)u'/d^'kg@*H41I7DvD#?몎3L5LJweUrX:|$ʷkC-.UW>;'8!Hh+% SBEmª7J][?ը%﬽9V*-@ɟdp4N pʋq)5Ps➒dʋDSJdO r5;$s^'ZUNCD@)S@|yR`4'-a;Io*YH(@1DA"{(dE-~HhR }۾9R7 ip#O iJbyNLy!YwK3"Tqo)>ƹA^V*nj3܉RG!ON0I*%1cDkQ2SR9N`QB &%L6SAH}5+L:b|@HIKtRQ.gu"5ה )@':ɝ#♠yS"qkj9IK&N|s{HkHSh>pvUF'yD"uQ7:rMtF:JJc*GDmÅ/?G6~?*dQ~1$8Oax6VZ'ǂJ3u*xqImtDʓ_\=6<68 )g׹)͑)p<7L ;=R{cOc<I nf Q9vZyȞ^ ʭ tz:IE1W2kYf_as4sx+69QnVYg^ݎ%hu;.i-ekQckl'Bl4NRM{F!;OuIļgV"eZwkJX ]`zftv6 |VD;:P>7L%W;ײ5:7D 5Z_UBj+,&F.)o$[ וa/is;vª+]v=vp:,j pl#Ȩ4rsWZX"4NHpjl_MBdzl4U.muC}s,cVHV_M`oQ[kk`(oXz>*ØKXc6h?Э~?r h-Љ_{U.5 ܪ̯qupdګt'DòY`@49*l74۬ 3gtBE RqA<(7w*=C &s@q읔:睠1Hи@S Hi- 7d2րⲫ/:*XÆ[t*E:3I]»k |PM^%V]=-WzlCDyMkpCefQِK U\F[LP^#CSsCʃBVݨ2} d8Dc]U| -\k7ZH!fcI$:3f֏F>$%.)1N6QKD&Ur酓$SnS)5%wgjI \w("ʓ"9TnH" dYBN7>jMy:6Wbc'7(=]AŒw )yH6ke#DT$IgD{}ӷ< XHknS8& M { ꒔q)p4RE82VL%9Jl''TDŽI$jT!4IFSN@> !IJI{B`>KI*%)JN*Tav*SnLSNpSed Vtۂb ^cƟ`c h{Blfp*;,,pT[ttI U@kVGlR72urJh` Pc.YGC9EJs 8kˆ2fTt/p' )}<:Dhl)!A2=3j` X6BhQt:&O鷂8Xq“~d\N AfJg=tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$Z˜Bol!-pRg'Lx]AR ($i$RC1Ssv%D))t)\)Z y$'M)ӍOPu |IJL2[bSI Rd KR8O53RR$msDLI*R$G&:4$蒔IBHlf8AkK4|PtH)mSdž[#pi3 !R=G rN9S&#%)2rMsD4Kt5~Lm=]HQa TuHJTɟxI:d$j5H%)2\$wd;y$֘*A>iD~ MluIKH@-'Kt:RANwR.h?4Th2IHkI(IT ìx$%+շsH#EZmh.V18*v΀>gU5`+$D-O:B#@ yD8Μ RܦRF@9ڈ Bx%,9N4LQ 0JNƉv.I$8&ۤbRRR Qn RIBdLH<׶8E uR`ו6j` )T$RLD$&k]1HnxEc@ 9Tʓ~*@a:A%-ARkt [: &N y:b N&)YALr>@k *uZ;I(CzfAi!!^RCa"2 )E$1 aCoyS";qktR:d J!":QRhH'L;L(%"'(4k'()nHD׆4QCA5(WY.,\RHNӤNt0puMS:&R(KPXCǺ-K~?aH{(4O vx(VyU $#50gN JQ)G) nyN##JA1 Rj&o)ΐ'T*Rs `xLvR" %dXA`8<{QׄJ׺[)hw"TD. % |CIVkdT$:Cu P&SΰbuFh#Qd#^de%12vh̥T#IKi:"JVLAE4)K9 " m}B)z^9% TB`O hr hw9 ҅; B&T%(N:S58:E$&FsZDƪ%J A+ASJCEKU=T2h<&%)KgRfnӲIzI[r0k D9DhN У9mT2Oh%5Qq%MJJw ƁD)pQDhp!,TC& %&u(/ ;H;3~lB+L13s VZ8Ukt*H_"KB+eC%JǹhuA!J!%*Jv44SIQuqlhU#o5RÏ wEۺwCPvY)L.9U\d;P0xgVsy'È FE#òLi'FxL\6BFݓPK5R.1 <$L& W 1Š|$= h Q@(`n(5) 2ON'bt;f' L4bfV )IR, Ɔ[^HILe<:'U0DTT$*&Rs{x"mTH:$4T”ȑ@dxO]q_ vI*4H &{HԘOX!Tqx(| %'7g4@RH*Q$؍S4E4&'᪔!ܤLF4K悘R))*rdcMA I4SP)FG}$67$Nؠ*D3q\O"Ӫ DQ)M2HRbG3~'E&>Hxv߂Mv<$XK@<|{5 LxNCiDR=ʞI-삘p105Hs'E z +*\ n($jkwN 8S.7T1vPZBy(R?ʑD \%/ !Ή vHuLtI:ROǺ^IKTg]^Ox;e$zrOSY*oG(ˏwH/[L|d ǿ (j|Cxvs| ){$Mwjt|2vDT]Ɖ[s|yqРhyTFÊWyZjp Ul2Ly5UwNùl0KD4HbsuW_~Qt{|er\*Z!qkpim&㵃ڮ?,U\IױAYM@ZǤf0qLL2Z xGd,@o8 jMv'ЏrM$2 q SyX<@%%.ÏJT,$<8Sc7sKG~ukIKL' d4B_أ15 i^;Q{2 #5L`A*dB@RB P)j@BJʝc[+h璄."\F+Vp-ޡfh-q*hr6ܡ^9NHq@|W8VsL6q$xCx0LAN 7?]8(NHg"Lpn p4fmw'uBBOxBoɀ 8M]$H0sCXLpUkx<)=n"1\9ZTiI$z)ytE̘Rb1]n;9:?2;]bB@$RN}# UNh:=G)RJJV>h!IDunOwMU2'"?GE@T޻ڗ{>i`Ig12[BIBj`Ec4$ RsS9tnJ7)R.HPL NI ?;ΉHBip%4Tt? MHN&UrR>()$@Gup!p; }<ŀꥣhqQu%*AKQK hL)z))iR S1 HPx))I)Js5ܤ.cxjh Ԕb@rw -Z)f/C 7)771c?u74ƨLZSQ>)nS6W( # 2I+>)C2S@R Z%*2Prh@2Bif<'4$FiPāCDFa@<RRNK+)H#Y) 3TOB׎*R"<l…{jcfRfS vX=9'ژ9 pxNEd'> R26 & (.[%B!J=Å8)A JH*-hLrB{:\X|v:~ ^q3TAQ5:xI+;q&L<' ؾtV=kĔ?Nڟܢ sJuYSL;)AhRէUa<@L5%-)$gEr؄S$ dǚar"rDyJBbMY[ڷsQ靣%Ne<)Jyݩ@N{(.&kD'E07Qv<'xU*&)R>w֟ޅ;rtMsÉ 懰q?"QRJRJR-<'=-BD4%*RI%jX O(XGV3QZcO)'@iƧUC!h(D)& \`߽>ӹ)2rpx1L$ Y$g8 'Fam5R!"y $G DƜ&A+&N)E <9Ci@')'!EL{k jJq XG)ĦDuRcP{dU$w c܍ƣ"4:)I%)9EP" %Bʌv*e$!'Q_ bNFKg緎WUʱ\4V6 iI暊rd*^'pq(:QĒL"f>-ct%.)V.=6O%IG+Eܑv9I6q#d̤8d#wx' ()I6iMJvɜ/q $(5 N0\=*Ӫ%z(sEIԔa{9<Kwh[Ӱ`LI)2|pLEkGVI37N*L2{Z$xIv: !=6fTFA"a#`S^xiNhDc%)kt3Id$hkvk$wR"F0Z<\N&y!S {(JJ]S Q$U0Q}6@U%D@@i'j;Zdn A.9*LN胺lCxh͘ ME .rYd7HXʷ= `&cRJwiRP CO&{Z`kܝJM3Jv;P`b4Cv%XU bguF`OMBUmY‹Zvk13ׂ_y-*m#3dPEscEZ[. 8DB+]#D~Ô2>HD)] t6lwSƘ(Dh64dF6XCˀPArs㺹\+i,4LѪP_gO>4-1[@Dn3I NΛ!]]6Gu.Xd3W^Χc'*uɓ#,;T]xg2tW1{B i&OC?*:P3!A<-vq @u_ 8VMm<#Yǫ{L`\FhKgI$t\uw0>{RdCXHSՁOr%$d7i &Gp%.2thU$ &y0.)wNTv!Y*MqMJy RR4( ISm)MA}".M)heג{ h V)ѢJV(4AS~RsшZU2@_ E$4R !+'KpM)哨ڠ&N' R,8)5)t0'Rڤp)&T kAIK%$jctBBJjyqpDT 9Q8-tj*>()y mO8I:0PL}FRRDĄD(bPS'S=J#`Si?P#IEߊg EEE(NI%)$$IJRI:I$I[L6ZU}%Kn~*턀gRS#Be<uPEvS4O,l $BD:t KnFMD< o(d>ĈzG<~bԢK &U~v"Fm٦ G(ţNvԤC H>]"dCu(5]84M +YDVvP)T(PUQaNð<-aF;u%-;TEyRug"Qk 6BF:#ߢ_M5I+jih2emU$jBQh0@.Hq0$Eʘ4 I*#^RٕVH>hx!IChMQB3 `B @Ub#UXN$uN\g"R$S'E1YPI.ɥ I$ZW.=ԉ9$KjDHɝ!6x(9䔩+)5(R4Ky)bTHT% &1@42TSJyPsI:(ˌv9wU5{uD%DuN#iHԣh^R%0)h}^ . )*STS@E#$%)) x9pҔ9$$TLR'wo>i)I$TN3 N9@Ds:܃%TC?(F%(9<*\%Bj(IRLt8mR% 7N7-.$4|ErN売-ШV{hacQ,2BxShj4H8S ^RIN$Z@fj@))dN"bBRb ;$$9JCGtt1'y $jRH'1ĩݔt $I#ITE.R>jRHMh3)1IK$I éc0@UHVR~E!cbZQD7? <ۨSh)! %8p<$uF)J}K)'ocT3ILH)\',.r^cUh>5USvEKn 炦d/3C44{ yEM PMv4(/ۜ,!t'VuEIGvtLJc<Tʈ9%.d!4Zχ(fJa%.ङXdOl)ipP'NzĈJC$1dEcZefNiIY1Hn KZ;TX7O2Q$|ѯu7UdhIۧbTĝCT%Uj{HȞO(RZݸ(?hj V 4F{7*xWcZ?H𩹢uH!]<Ձ>VBje:d j؝yTB1fLBio>i:p2"PSbgNBViis?xLZ`I$8n. Rkv;(oA tgCyELۦM^N4D4RED!D<G wE |UWoaIPPd'Op'T# )㔉'P:%0:v JJP)JI)4#Ql=肘&{Qf5>> ~d6+DBF dwܚm$=ϻTiQ:hkH(r%:S! ֎G h THIKe$HsN}co8yJY0?)wLu)IKji8(JgsR8G.ir7vDj&ڇH=n;9` SLBLBpDkʑ2g@0&I*IQ %H&ELD!07T%.1@y@I:"6 !!D_0)fI'W)ӔgFixLR!egG%7d3{Y7~4UApUIEsD JBT6"}Ą2`m=e@Q\%3u)äj~h=9&sMyCe!4'tUte~u\IUh%"TP?4G p5XYث9䳭yVcAH|5qxT*d 18 *"*<hxbur;HORmm2\Kӷ/;%( |'걐H&Ґ C2}z+@DOZ"DVvMn ,qGV[tRu> Vڄ"="x"?,P=8>b*;O (f($ӿd' "Kp#&ШQTP@(07JӟNT4Ou*j+rJ +{F.L5z6ǘkdS~UqL<&cC%aS[i)ށS4R_k;/9XN5|ulq7aD'! "!Ʀ'GN5S?KAP]CqXt@3^Au PR\@[xFB|JAk-@EL.'X]gkJx7sNP-^mFcmU#Rpi nr$JPPoDx @3h > UN[ZkinЫK'T%+Cc3&*Kh!wo6 neABW=ᾴݿ 0~kBV]d}!p>IeT<:%q g2 I$i$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$t5oI]+H_ ]bRH70TJA7H^j%= {GM %dJì< MO>()Z&>Л`Rk," q8zP.O))bZ–НL;'H`PWԣ; '$Ð8vd"D5e RMab&f&> D&8pd$!$=F }%LX hh"B Tm=vBpfd1` <6dx$ &$ )T H"h1aD![ 6T;^Tܑ%*.M"mGLZ$,()}Jvf0BAEL9! # ^va3yI͎8Q) tEȤlqҁ#v`jSA `RP8M-I$RR!I$Id%I$t$PJI%{u*ہʭ>pw?iS 3_K4>a3㴤,w6[|ӚK A:BR2Oqk䒖-)@ ` 9ܔZ%/sRRy'Z t"T_\TyR $ .-&e~J5)IK*.BNqN׫ ʠ斝v.FAo)iHvS %2%4M)=sЫ[lrR$ʜ$t Gd@TTI܊Ky?$jmKL<)$v옸@NJ5QG ` 5!pD!=|7;9 )& 0TpO*d7$g(eJ M8(CE2 LdrN*{ &s'@kl&Cx#TtJZR! l[(=bRҔ L Yѯt l-Ѣe; `WB>ShR-h7O A:sxg%VkvRsAw.D)m

J׾e$x AgVKUhNv4)2ZT4&P RD)Gg)k)c%.Jgp)[xJրL}B;KL:kʔDQJ B+sF!H^QyO2d%:Mh\wHq HQr&pC<(1Wd-:\7:Gu ejQng_E]Q}Uh GYHH MPK;n 4BD;IJ!4Z$FIm'_9 RRJntKȵ-$&H%*aAr"R)=یj#n*/jM~jhcCP4EIRLܞR Ω$ks<$N)4RkcTJ$L&$BbRp$"h|JiRy#s S|Ob8Q<')#)'S @>QiOe$)<4od0tIK$ \LӪ0eaRwRCtU.<x}-l|f@4ÄJFӈN5"I$AQ0RI.Tpo G^9AK$H!NjR$Q B[^?TIJJK-Ĥ NJ:$Lt0ӕ-PJ$B0tEX*IH^$!@?^%K(Gc AE| 4HDA=wT*,:'{*-Mh8D q:p#r9RĢ;*%d+y(;x'#;(uׅbd 8XK J*Y nը1ڈZ(~V斸WOS y!A'ø\  {]$%D FNwyR hD8 B jUc'0#qK^ ?*JagXCdT!0or=R>|QMlC*Ɗc%DfN]XEIJHڞgnsA@؀l!:p8l⒘6%$yLL(5O2I<{&0Dpݢ\p@LOgs)IwILKwJO "I S{#%䒜;YT{u䨵S4M)SkKx$S T L! Q,Cp \D͞) xQ4%)"H] m$iʛ$S<9LSD2;(A#S$ㄒL9{ JRd)N2')a"h2ri jt 3 H%< D0 %g&0$( Q> d q)ouGL%IP4 lthHNNuPn F%k`iT͇r}jiΞ Z' iΉN-:$L&S* u\؈QS"D)N)2uHG*DJY5)ZF/t_$tHImL(S>It?rJ`8ɄIga-k5V/&Uc xTL9H)dnsς]s6l'm(Bk"Y),TGP:hitПHݻ)ʘѩi~"#xALOHn&{j@i˜$;?Ox#B[H*Ί w #s8k#UaM~J);fj8(/k04Rx{()HFbJ E'EہѼ8 %. v]˜Es D(NӿCvKS7Q)xJL'jv-R.$xF{<5X@t R{I l~pELDH=p0F;~7Wu;Q <\%.ȵr'JZ-G`i𘸎 =Ԟ#>h%u5^*x,:0CUt .uC.!D?$7#TPMhV˜ S#xKɀ9(tz{W^vod6MChL_cSY.z6g&3n6|=UTqYDۧ(>#CAzӪWZ!e*(2A![K\ܢtCϢߕH 2D P;®S;um/~+Y" =EsOp:Ma^ @\^S Џ{;ܴnEV@\s,I"*I$I$I$I$$I$I)I$I$JRI$I$I/I%>I$:3A%',~p:bLOxLFI(3“ úJRp:$P@5)QRjx AKI1J B Pxi) J\&>)J!]' Gu-%*S%\LiA3-A*I$5aE+jHxL)D=8$)E*Pr[ O}S< G@ %Ghܤi QptI$T)"Tk6/'FܝPRFINr#M%6-Щuiy 7u994!NҜ\kAAJ)O$gK}T̈́] QR.uL_DK{{6X{Mxd(H ƫ2^N d&I$$BI$$ %I$ITI+d>q]UCo~*S^2 ,L!rtS m n)@&.{8L.xڍP\J*QdD)&ZQ7x&0S P A tcEHFVNJ-:Oqw(Gh!`jdu)@؝:tF5>(JbyM)nRw#U 8mIO(%[`&IuE kFNk.䤥 2J~RRZ8ZcFi)LLE7~hM)H$Ot)&R$&sC(/kէDT5N!=琧[abTl^h]Q#-pD)zr&Hk mN|:PT#XyrHP $P.ƺ!Y VfgtGA }1Rc݃Ө,ԒIL箒I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$>V୦%' ,(r m>(f*˄U: =DαN£<5NHO>*@GiIIxHɊ$&ppS( E M.A*e)#TN' nEJ 4$gU)%`L3]EK R ZyD{8ҥ("S4!L(BS%2U -BJ6H Y5ySuj%MD@.L%4k(]$ 1)}]򒔗)(Fa9E,n*UvKHSiiGpVx@%.FSO‹\;aDqGs'PPS Sʀ*RʐaJ'D|/%2iMwQsH:)r )yN IHR:R$*J@ ӔI&8:6jT:H{)Pf6 )H%HlSm)G OT.RI$#^SHLJiJa)QSD/):FRMxDhTX$SےQpN ;80i*;OcˆϒAJh.:(QoiXa*#-ȚBL*2" h2#'GCOpJr4M9LaUeH59RS!uJ@PG J^RM!)NuMTN4LIM 5FƲCI]K4;!3aX|ae7 WB+E,̰+ҳOf4Gt!F- rTKcBH^Sp%yh()~Ra:'#$, I%)$4NI;$S')LkmӢJY<(ꝮI v(ճݩС2DFGjƪ6C5*3wR*IENTn䒖>I'Q&5)'w6BxSǵZt)Z([ϸx¨ H#"f>iNSP O)O)ޘ4T˄E<18lT=$Ʉ)$ O lRJS"υs6'U tFP)Gq\cE o:,MwJŽyCsB|8<8%a)V(4r$)6@LSN;N$I|!<–5L'PRI49 %~ 9tO5<$Ʃ)9H2u 8uEK'"(960uH۞Rܩ [="e<-=n%)ו0 )Ac`$I=N)ԦǴ;X\j|@։))p{%kL2*6&@yqtRlk╩vIs@5QHtAkE(.ӄf!IRRR!4Ʃ5ۓ:@GJN Eh 3sa x$N u ;x2㵣A=̓|Pmt7)Ӑ;LݧSPHxQL4IL#T)O^Ska홉B- )Z$Psvu'5 AP 1䒔LhS)HNLj:⣐67)5H^cN ^<')C )cEcwݯdTCNor]E4Q9'O rc98H΃4MJcY([\wF<% xL:B$q5nB9yZ;B]]RP0&DryD"iLk1Ω:PRS8S bR)$a ɟN˶F}HY$iNvI$S*u7s$L8O"4@{S<Q)!qyLȝI#$ $*=I"|['Aӧr) L]) Ny ~r3ZI"VutEKIDNJrcAFa8*oasfBȔnwS@uB#ȞS T=* 0ittk PRBb FJf"?'nǒIK &ZNI1kALT,vփ ˎ2 - lksU+YhUBc!LnQW;Ь6YRhL3A<"$D0N)rp 1%\u<1$ % I>iƺwAKkoH骓\gT^}"O}IK0ߝe;*FvͣR"iT0X)ZjHq~ 7 T.0ELoQlmh :!f ;ӱ`85FaS6=2)jsUSp"<Я'^,'e!;|vD,Y~rv㬪1&|Q| >~(:&#D>^iT,þ[l J6}$TɼnN )Qo:xRVV ZUJf;̔ʝrW{E !AyN?"jT➐l|hQ .[%#Jk\2cE]w8BcyJ@ԣ#Uh5K:Ϸ#oW^*_ ϸO(1V6{@-26AH sˆ*Grgcw>#w+bFa4*FmD"d3~c[yϻg tGz&xp d8Be=vNkϹ֓/fRzC>% #TzeMmS `ןU*8gn}"޳O!39@0fciwVƦ{yU-nÊDB2-lp (mkw!XŸN&4~EbOtB{$SCww-="\[#EfX6`e&q%Ypؘ& JX_~VWVM1C5y*]g1uVY3*d'?odμ(8蜇ceZݮ  >!63v:Ub G)9K쑪8tU6He W pU7I1Zul}-M;hU~ƀLu7PԽ]ssy=)ZlsNZ9!| [vDW}$QDvn(ަ~=/S~akMw-#Bk)~Z0W}Lwk0UK|Zc$xlݒ~+.?NZ|9]I$tI$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$wEwزb“إ&ND:Jd$7ࢊ $MRt*#E)$$L(ն5PiS/(&=&Jz J^JĨ5J@ XO 'R"Am%;Y))dPk t'kc[4&*!ȍ2h쓜rLBiJ Ng9q“j #T# L\ƥ3!L5 ƞR9L$!g@54\)'Mݡ1%@R v*R [G)ϊa*FyQ/.岟 s))mx &RLʻD;Nɞ%2.QRNaSLj-bRpN>Ri"ƲL<](7PrD{ TOEp[ RI$I$)I$t ()$NI)$Vzp>F;?[_=%Iag AM)ą^OtPHDbyL<(A%C2]܄!)? GdZTQI0p Spi$b%/k$BsSIQpT! l?ZPRt*.S&BbTF) P %4FpT6c+S JTAO[@0d1 P'~EMΚn KNJ:*7RGA֤24Nàӓ q1Od%j]1% tLGdTRQN9VpT|#8v@rU{'U`!jdq:#@5H@wPX &^OZIHB-Հ#QNJ#̤eJPN #MSh5l(9 ʌy0S-!1J^%? :)ƨ;4쒔T#gYG)L&$F#Fm.Ӕ7s#P*/ocIh:QAk.\q`!9ELʊ_>A [ iMD(2M`' )'RS>S vMk'IEm~^ZKAJ>cCN~hAKQ)ɘ#BR$@L8ϽM*^SBE1SkRw9 ;^T`AALH0RQ Q| gPa`2HU !Uy!m3T䂆§* sKkvhw)(\{p%͝F4-3=qx)0=8PwD{D-$( ^tJaDЧ$$ $Z # QBJJD !C`tN[<}AL4odxJ@øDI`;TTS?*y#Es$ ]ߕCQL*j"Am'׉jc͈!WrAU^=ӁK[ S%W~GQ #*Ax'ktR)!y4LJb& )5)K̦'DHL<tRhɉ-L[ kILƚL&:E2tL' N)r@ꘔs)m[$RiPSnG|:vC#Enl`kNCNkEmNH 0#UWם̷l&uU(G[\ vG 4 OlLZII2#ܝ)63[ >ICFD>j{ mfSj)#=!3:RRI$xMNe"eF'B|ܣWfC{ e::R7h?zQHYvTh IP$BN <^\y( UOyqׄ@R"Hvj@64Dē+@D ):).SJi)LL4쥶~ D򄔹)&҆gLhNVIGdH%kh&JuJZ^fcj4K~Z&wiY[:, c *AJ*= v2%P1vRhJgDB}eCPxו. "%2I2~1qh!2L$@w4I=EqGnBǹqӲ*\T1y&VSUY"!k?tIKh/ 9Ѫy U{Z@={{xkx ,kA3ٻ '$A]?+ ]$j+'MRʃ"W,lZMm%U{mkCfu*IMmJ;4*ayk쉏₧P^e 8 uLT3KrgN hML0NSJ{(FBDӄ1iʑ=4R0mydqn٨APR-|EܧSwpo&S0dUO8p*e y#蝭m*N*N2|SbKF3lC *`)o)5e21v|SNI8ƥ;$LNJ"9Ekh@gFϔ25& |biuY$gB57+ /h~7h BSOt*û6Qlh)v9ONϊu U5[j|S|۲jy'UX cfNHsAL,i`tI쓄~) ,uVx(7)s"*[ޢ5":JE@iNQj'T% Od{XOq!Ǎ1MT)l l|X슙vQ)Q?#G<']˜j8@:x$I Ljt"u2 p$').ɓ#]>R7wKq'^)C7'xt$BH蒘SI0:IQDjn= #j!45ELDRGaT2lyy{+FL TѺ@'B`wMb U\(ؖ墣22aSڄ_~$wz&bhyRBc'o4Du&IJЄ'gʄ0הFB*^!3)$<8*zRN!OMH0դ)1a4M=&"5#SR'kK:%ڹ.xMi'4I']"yJ5 8tRRᡰ8Je  "4ȨF) JQP0?e-4H '0N: IJ>\%xMh D9>O~O))s=\t e7ñCi@y|3ZJe PG05vI9Ge= {NSA1Hc;"so]aiBþd$QI4))<6$=D`;(ovS<&1R;) ƊXo-yo˼*W 3o~#fg*u_eFn2x)9t Uw44'p@ C0~֘4(qXBUCIxD&}'G,UX>n#wʮC$c#IYqnp!G)t*^t ING=8K=0%Zֻu 1aIPgۼ@?[SvשUl6{׀y*qgq+M&; YZ\4TegC!P(PRmD:HMauiGUJ?ۨSyRR(?$*5qwSTPJJ4\G EMk5ɷ/w_nëu!r촍#I$a:mXˣDP!7!)Aڦ`='3R4J$+B#}fpwEmi=*OjΖiBuDp: CN &SI$)8 FIR`DmKM.z[~R+J&ܛrNgӎSAKTwx'ԨQ D/[H(qfSRט< Rkw*ZĦ% e0)4"R0/'қIJږԤ'Ow hE .!A !hE%.E8Mn!w2B%VJS' 0+iuYvѴ0w2?VR *Ac$Jw5tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I)av=32.!X~+ÚSe&XUn[LDWvZ =:G{gE\:Ah"QYLwu4?kOI=2o)pT7J3pYIL% e@;]BS|vAR-IK4M[QLGg1%1S S!8=V X$pRdQS Ψwg4Xv5U)m>H 5>Jm'nBxp[SƉ5Bx'^&I #S I d։HyLDT TdN(NiddJd Q| x&\*OiZ8M4SM tU:B;SR4 Ӻ{)+ߒ˴鉔[()@@B6"9LZ[ELB} J L'Q _DJAҊ%)H)m;v p'NRJFT$4!j5@ EaN,e "L(8- ꏸ;D;dpAB dI{-h> INJbI)1ʔL!I qNQH '@p7/0$C.=Ԛp4RD H ,nU'R|SIh(DABp:))LALj!ΪmNAJD]RJ:pPn ))ײlKd Q,gcA:#縶>TŏGaPmDj#p*IS90A{7r5 uO!N ~*e0RC6=Zdxa$PK|G)6a"5Cp`pcjX]ARw7Ce0qڢIF!kn0BuSAL?FdJy4&D"@LINGtkctZ!ωHv~4S" f:UG$w(mdh9Csq>A3@ l%N  ൿDS3[8aVm"dފ !1M  a$x[ГD -FSS)tM IRuXc;Eau`0:A?T۴ϷEEZ}8GƱqrD)hT`[R{@JB c dGtE(T\S@) rZ:mU G ˩'ALA'%Sl<_2,`O5[ZqP˙c4i"6U5E߲`!/X3. LL4cJT yL) 0f LSA>idʖ JdRmD'8DF-:Jdq'^-YK@&4dYf [䅍ÿMVVC5'Us0|U' .|T1 p\ J'ͺ)mS2a6:vR$L Ri)yM\%2%Gq=><9#" E6Br DGdEl]腩}Ҙn@8l -͝S@꤮r|ʛDNj|6F5Odd.MҕI FS ʛ+'C*(dxH* .t&sB{9N WZ7{n(,KC%X@yڠA&BFSoy #fLwz^bSJtGBHF*WW$9AL5<@$ ո&t*["DIuJN۔iH))<DHE%%0d=()2=ʈSMpPRRN yD!Fc8SkpOC*Aڨ|S ɕ&3QhOxS~2 $NeJOLxIKBZSjOB0 _AQ)Ή|9KHL ǁIJwmgD);R0#1Nz#N$ XގaAHRkPFG!]qp\<Tc7;BLwVhZIFNMe&8p'D;Q 7R$wL;jXAQ.L?{S JY  R(|EO0N:9!'x& <"{)sQ:rotdK AKd:K~I0ǒ`JqI8NH9R- E5EOe3kF;@ Hb^TfH5I ;{T=r4ԩETv+nᢕ(N(?NQ c[B -T۪Q3?M⊗4[we^McR4K|P6U=Ld(⒛@@J[ !s y;,$Zb=8vX1A 0Vfi i'Eg:iaQx w:x/d U|}&" VY T`cuF kDjP`2t\aqiuΝMF%A(ihZEߗ&bN]9+D5ɝ]~D7MtT)_g\uNR٪^J=RD{&/ ;p#@4'D n;Bq#9AXHj tCj "mhXXu (u;lѬx!c<0 DZyF~a [ԘСfbQ|BG*ŮUKς )<ʯKNmE*|7#')M`RE"b#2ԫv"IHC˜)BU=OdRpCv0E S(XHk,^T!;̨AL@=AEER]ic6Jl; UL<^$vжOth;\x v,׫gcGd<LYfkV;&-pdkDY|jGeg0? ZI紕q^ b,QFqikV$CM<9e.%^a;8B0QCzju5*$Uxӷ2*U4l2`j 1 @&LCt[ ӪU\Z V p%-kGV 2R3,alq{rݑa{q:Y^4ER :UkWi(.9Sh>C&~kgwl;B{0Jr#R}Gx1o4f^uPĬɳdclU+`okACr}ZiyU~[dz-7>ĵ f{Js]@ɍPX2SX[ )ʎ.}Ӻ{[p HEUb7EO?֩V1EM_)*c@uZ}/5t g6:е:^@iWdVk:ACZX:80Vb,e@e:oC|I$I$I%)$I$IJI$I$RI$I$I$I%)$_H$RI$Eќ=BgOJ.RQrp@(䫺,! #P)ENn-!TnCX8;D%{!`*C}q5초'_0ۃVHKx)ۼUv:"Xfb5X̨JF8V=a&\F9QAHjQH erO5ҘPMiFfC"b\ { ԨC%ApelʗګԬxOĨC(~)B3JlLl t#R-'E#`!3JOeH&}|:jۥ4 "hЅ3$AÒ<)A$Di(I * *PH2tID> E:>0 b:'wo|$蒙nPˏ`"ӺZ*vu= -vv}۹VvA n'<Ldsrp)S |RӺ`ܒ4HPn:%/y<$HR 9–ċ4%,])r@9hJ`۩Jwq%$xH DrYop |'`j Ts)HI$Xe mp?5 uLSc G$$DBpCs1F8QO( !#*)Ct);i#!1 h8Q٧2'D |)RQO yTTմ W9մu]'bjξ1+tٹyA TR}:`8II4HT`rky#4JD+=*@A%3ԈB5E $iw7UBMQI(9ӧ>+F y dWN4RM\uE6cQtvRh^JS'TJ5RcgD4Q )L JRcXP㫌i$)@L&oHVy)K(c!;ڟ"iK//K]ND@01C$)l;a7 E"4S2ݜ} u>*<]USnS( S-1g&!Hע Un; =T`H*{ (qXNE2 RWQ:TD;jemTgQD:xBLR>a%2%1xHmtHR_*M JLJxxg| =RPTw-ò=jnX"=ݔX5+RP;w@hUS&<[ F.OB nqq$#[v mOKt !yt> %{S4Dl\CZֺ 10e㦅Mq mO$h7b&S(LJ 1RS xHG!<69S䒗H Nn_Bi8WhwctY5gǺt3졗\gNr[;, !hHZ-cc쵛 jOddjrL DtQ,$SR:8 "($vzgh0i%*t<SySaܦY{($Q߬x)'ND3gM?'PTB:?@wԔP4D- $TTJ4)7#EV iXch)yDD`$kH Sh!'.:(bO =5na9<1`Bo ܟiI :8r(%zjxQ `)$HVd*cTZ#wXVVϊ<0vWHqURp'갻n5d){gGT Ir|ΣaIK;PR4t{vN@}e%2:&sSQiI$M[=Ч7.uL@%"l< <8=t>߽%h)dPRke'D 7qNt))bOt;LDj 'u){(~qMH( BRT0&O G@PqCM&7$MLx5 dcb*լ UlAH.-Yܴ foGNׂpu= tƉ'MQ hLD$MR:L#L|ԏ IK&*GJ@  xaƀ &irw_O= Ax>1BI(G') )DhNtQu*yQ^P ML_ }2y8 0K@-|&ȮuF{7 UL[dTܒ <6Nʢ{=K궯` wU ^-2E윆Ml'%4tM/pQ&Uj w)H]3hO 4w`;W6w%GcTw 2z%q,QGokX )ejUw w2< UuXe1&S5Ot5p<"AO bBݧTۢmY<q_,sOd5QvXp!!5Gܝ;~E{RR3NCc^b ~bPMG^$$h \ӮO'huBh({[%[\`|C0eJd0Iܓƒ49i*mBvjwv%H8%D(4: AhHXwweg;B!dn^\v 5cvY[ VgvL ?R?zs4E^R(~u0`Xayw3 \n0~+5Ĵ `AG~!鯁Vq, ?IYh w[<|@:0w%+X4UCS\Nd6;AA|=$wS0tAD&tB%O~UqUz3gryYW<-@MgN*H6u}byC~1q#S\nddƒ3m%ede"wB=pR> v;EQL9M=d=nb?stʪ}3@]I8T$ܫuR֍ǐ4w%X!;=c\֒&_P6CJUn5h{u2TTbTt1xooȶ >)X%^ࣈAQhw=--V T&[(H$^}'Emoʥf8 EuBMS׉`]H[L1C|Zm`vb `Eɸkw$"Kff୦kC@$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$2I)TIH u}>U-h\$+?]|ԕ(89Xł$j^wR$g0ĠAaYIj (P*RRC3PUΪpH Zʉ)HI[9z7VUG uS` aB[(1V=_g*"7z JR1@D-d"p)$TLy)I# RI$\Q>IRI$A: )oJT L-A6 JOx#*@rd8_h1MTZ7ń$0D%S J^qa uA-JD`]ʃ2t*øJtl9dtɓdI %(O ZI&NA$Vp_4vgJ# ˀQs塤"a ڻ`d܈-:SRHx$rmM lԶ)nKM)5&p(~JcCL$]hl'Ld#K_uUQ15Ц29D V^ xBz?yM laHHhV[ ^"Uq-Q*f!B)5D% tPA<̤]M>JiB?Qߤ-qHJ0ohRp whbKGW"$Bp25SǒQ*b`h^BJ$ILK|uKׄ1%L\OOfRMɴ(4L$ޢ,B;,t*`-PX)V+AwFS({ODž\8Ԭi\>+E\KO2|ɜ)5DOu0IYrI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$Iht7OsC\z6ktÒ ً f\BNBI%KB8OtxHrڇxx`[H5E5DlwN욕nNZE]"R,Ŧd$i Q=Ӈ#f& QS#P{KNwIݢ@ F*@F7Ic7: $|L|[x@ħDW]||T :x #Q>mӢH{Jl});p5ILE*׶QTRpʏ: zaDuN%%mr& 欐,²BN5 vQZTx-;R0pJ#Od͆Kh5 ˇg76;"5sI焐#~H|AsOeYHV-DځGveI-c'6gTS R8R0:P)/F BM9-JyN% ʇp+GB{#ȅꉡtRTG:!FcN d Q`  {xA:x+vNJk`(1~nh'ڜH{25<"6F(T8|ʃ\#DQHLtI0a >]~i)rL ;ƦJg jc!7Ot#^k)%%3"T7E*pG}uIL`'9p J#dhk@p۬퀬8H*EcKDrKB-D 껛uV hEԔHh4@#NȠ`K% )LPe4ϒq1ODzJ^m+XȞҩ&uR5X26c VM0U[Q4(YJ$Vn@- wѸp[cDFҙ''u Q'M> 8:YpV4BJUg|%4Ldž(nn5F{Vs$Ot7Έ,sU Ih{-ԻO$ѢL$NhxS՚b!ħu%&U:J!dOSuILqβ5CSZ &NhhQ\;(IL甚wȔ~*-dV-s'80v$j))Z,9VKx(h 2`{,:VmRJ]\;ʃD@CstB9OH( 1IkXIL=Uhv5jc:8!cv-L[䕡 f+tDZOЫ-Sc;ĥ$c\).hy<aU'28x,\A֓)`@)Ȅ':4Une?h>H5ΑS蝵%ad}P?Dx*ȱ>h&|XK]mq)S@ЕO籭t(u cO3[JGPy % ۨNKe1ɈwDײGΩ%/#@jQf* 4Mnˋt`P  dH9tLwܧ[g&G?G}N.2QNQL]X505O+S"a)SnCۦKa:vL'TwbSn0NnTO%%(LOt@vDpTZ=ȵgAJsCyXSsЅ`?"TlArUk$<9 U^Q[dk)IPBvˎ&?$Ǎ @xt)4NA@`-悖25Q'OIM{$ HRkvH2LxO(3:q ӅuGFDi<m'e_"{*U`aD3pF!B:It Jr1dT"M:'&vDQROjv HRAqs7"ݢ9SnNe5I8$h{ĉ))Q3Z;(ΰXKGƈ'^Lyg )Na3p0<_%&uIK!"ùLr %Dv IIKrޢH LbcNt RRk) HQvӴ @rHL%MñPpN)vi F{.mDL+x 6±`NJiOnV`#G9BN+s@:, c8%OxL1H5VyARRD7Sl 0|BcK"[^JfC.;pF/ÅUs(0=xip.o<#Ao2Rt@kj9e@"!;BvMPbDŽND`2nJt0)sYL*Tx)u – ܦ)%ntRfĐ4îO?yAK-zn54xOtRS#XLB[A‰0THXLI^ 49*K@R NSfS!?(a %ўgl6ky( p'VYg!Z*o |aԨ5Xow 9qЙDYީ#Q{G^p!{^-XQ}(:"2Q&9v9'jF )Ƥ@ޙBu0<'STH'DGGd:DyhR[*O:(kw 5A{Ѭ PJN(L-Sca|ߣciRFI0.CY*L`K I;+Ep rx w d&w #=V6~+e0O !cO?Q;@1_ K<c "ה~,m\9+{IPו^ʋ_ૺ=W7euB~Z[qgE8TۣQ?*0HʣZtP)5`Ꜧ_euZpQOyF! թKֻcuhUqkI#3ȑΒV#LUXS")f!ad{K"WaE;W XÂ`:]ΓO;a`V {N+> HZ544Ag;uq%JGcʸ"UaZZaQ .ϊ7a&I+]5״;h漴-l~aG$/D';F~{`**nbˆqDưK$ПxJB3liRKL$!Jc 9 q yEk0z"hWHDPmpRNHe,E^M~vex/ *gCLi(6iiԄ% YR@SC^Ug0&\6G0V !$-KkQg99T:B(LBJ]4$J!4afR$I(ȞaD8tpIJ:bL)q=N%)&?IRstA3|a2撕`|1͞O4ƳV1RܤiKGo.sZ<h%:iZI 5|`A= z6!a =x}#R2+cʕחC!xsG1%sx6 Th'xK]J+II?GFz~~(+)$J[GFb?7Bb8wI$\1wUUjDc5*)b:.PrΈo(@&5NN3 ΪEEťH:))}~IJd58ܟrx *PE4rPIj4]#VHP=`xR*nHs^;IP mV$[s>BaD$N-ʬNLsTf2X$1q@;^$!8 dj(Ԙ)K=݊3Q?k*vcm*gIIJ.J3!I:)p$§wELHx.;( d#Ya>!+JL h9B\E'BJgʌ(0&2P)%"<J4p}`Ur:)S!e$cpA@ Ҙm氥)) oq)J iݢ Z@&RR G΍- Z⟏`PS $VI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I;\Zdr$It'5u,k!y1Z3Y=Qg~P[F㹼w5ۢԋb`7|TA^Si_ -UȢs7m$w  |:Rua  THc`dqs 6uEiS˽ V[Hxl0l:<ŽSh> [¬à,'TmyxbLdO*_; RdMT\ͦJfI<$i@p'v%(lD )D sio(lKH:D>I)|pxCEr 蕎1wT<F((2ݻhYUrVC4 &{jt<1:GdnT=☀<GHT{B@NmD*#Q%%.ΣU3Ɯ*D|fH5y() "JDÄ́W88m b5)IIKp`Jb!"'kTuOr{\|;!S= /Cut=C&n"=rt⑨8j<$#+ o%.m-(i@0c9p3#R}&4@˵(*F\\ֽhf!N5zV+{'EGcah07*?_dJ@J4 Ӫ7DdJĉ<*w>ktT-fӢ5F5| E- @Pnh)4 )RMKvL $9R@& exQL'xQQ"H84C(PEt1C>HDUCt)FtDku j$wS a0H/F$ }/$7z'IpLJfHLLѴ2> Sk<$k撗%3x&aJNrcHwD!)@D`(S*-WV+pT*A%0gҞ1Ma. hR,K&kY 'AϚԁ?ވȢ*|4P9N{@Rκ%JaJJf |NvQ&BFmn9L!0t2X7x vIH]1 ljEۙ!VKa%"un'(Jz@7RHGO2B{m:O]0u׍uRciϭiL4Q{tVӨBȠV7?T22 DfDʫ|e]ǣcOwx) k:" ~TgGpB\|<6a)(DPY$D xRh e k@.1β;|Sɀ%2iA=ԦxMvLD9A *eA۪ϊʋ  !C; wRyœI:ɰALѵGRqH} JzJNt0Z֏aL 5 DTvCIl,<A%[G @y&ja$'pQ_TJvN UܦH$D(N2H#T 'cdSH+ Dj:hd5yDp&O)N`pK@$Dt!F㔞4Q^RC- LLIIHZXBϤUljHpڵo>4wYީ G*UUgV#~;%Wp#V?YtT,v7FP1WlU 1vZgz #7Dj !1l<>AS'vb4))[BD{Dx%я5wӎcUz>K]eLCT\Vd4hH W5~ɫ޻{ ])R4hӤHSvS]yq-#UR:³f-E6ȅ]# ̤WhDGPݺ5Q<4vPipq,:@e {HӷdtHSC@i"tȭ>,Rk 4TU#I(b^v&I>*5 fU!M4ZX[:c 0i $9 )>Ϲ]SwJlΰX`%gv̟ 0 Z!D-`sVk$hy@s@Exi O4!g#JE@,mwSL;vK"B-!YƉU ASe%NsZӤ|Y!K0<9*ٌǤsM&&7N jf3"&6=vtYړ΋g!tr(1Hm⬳qq0TٱՆMEz@!`KOe:+v ܅Բ[F?.vX[`q\ۆLw)iҴU,KB*Sl{uKg4)X8Uѫ{\4JžQ2Z[kJdtI$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I!8QI%,t۝{8{F\cD]GmI%{_-X2[bIp&:"ɽ0gC(AU\Ig:,>);%8<9w[_WܜuGr.]$=SGmr"Kc0\I{A?z`x"$1O&|O\I{A_z`҈kb 7K {\ȩ.]pGrI!EzKcђ]ICGpb$}~-EIu c.m$9|!KcQ] ڳe+$}G2wG)?54d@`kΡX#wGSIj&Y|,뙖hl#ਤ;jM I#YuM?4"y%2HVII$I 'I$I$I$I%)$I$IJI$I$RI$oI)d:HͺZι,?5A$(RhKoKH}b!,2mp :(GrQXy =cB*KMX#ԟ?ܲRKvO. ŨG4값߾>6q,OCJ2KSr~|0rZ~K!$Ge{PZdSz*K\g?(\)$c^B,Hc:orI^bx"$ş˜Dz -$Geq˹EjNN堣ql'_lhH?K$: ¥Z (-jV~umIN>x2Ko֪ҭz͈ykr!E?x^B:Ko<.1"^UuvF)$+5#Wo{Oq)!5. DvGIwwsPAk#ܻpސz:P2wW0:@}iwޣأTtd2684y.^@ %gYk2IQOuaNI$RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$z7WOIyܺƉSeƘ-P[!TJ)u} ad*5㔬B%m%FVΣGwBMtjۧ#O Na<%]`mtQ#Y]Tjӄm;^gbC^~ 4&&A{gT^d$&cB; L - -w4ZSqܟ;: ‹,U=؟3\Kn Iu 9lxp9yR߿?؜jG(½Ƴ$[ Ο.I-weTݰuN/HTCXf{- ꍥmr ςɪn5 yHXO alJl`j?]TN I1I%64rBJ i"'6qQhBSgN g慡w> ;!}Z}?$ϣY ;g,rC*3$+o΋䭌 eZrj~5oe'3uMe4(S+4N@PY$F깮LQnIM*#RS5!U cTֲx%0ct S;H'ƷnU'A@Zƽ$|J$Rܘ4}y" ZLz@ib1MyPۺJl/Ut;"ȞDASa$HO1 %#]!Ajp |rvwPHL RB;N =dr)l(YYlШ``vMAI*8>ॾ56iq$rrH@@ ujF U0tByEb+YhQnH!kAMG)dh %Ry荴j㪍B`y7 FU[kόi .i?z^ԕNf&BfMi&8YK d'*w<50[7P&u&?Rג"썮Ɨ:A ۷Xʬ+ߠ!4uD$6)ߡw~q:M>RH#DՈy*`sP;UB*^&Bm-r+U2Oe\3kS}DP?;u=7m0]R}5+La(ϥS=swk:Fς F#h%Sme 1Zc@n-Wͫȅ\:69ۊ} 5I- {ֱGe,].O}D9EI M@RPW-, @:Y5 {CYB89Kp(}5HvNY!1vI*yF 13<M xƞ7)m{E&0JS/ ߕFǀ`rc9lcz[vVC]9M4q쉁k\bt Yuʆ={ ki!Jh;t*a5N=hTjkf] Bnw;G=焃dV3S'F}.UYRݢOi0Pf4VjR*Z5)S{rXHvDH!ҧȘSbR\scԃ&R"4B2A"7DכּPaC xhn%D&pyx hnTǚ=1ϡ%=Gh%s(nIKt)\A}9<2 /{D2#?APʅ`'=YEIE'BcgQpAI|vSlSiNNgrLhRc;1) II)N' !QF$1$X AV~8!Ky67Dzxr@P I ^|+*e"J˱$N c!q[f֘Yo$(e<+FlkGeX/s7pUSXˀ4\ܟV)hǕ67ELNJST‹c=bd&%'LʆF;w0ǚ})) * x'61'$Gb>*uUfGKӅ]Lsx+ Ί7U-:%ScSEv j|%Fnp; MDHEnWyU떟4BF%B wjp±kIUd xVg`#kVm:r k:~E-wL7QԦexHR)4%H;SRJb|TgT1m~)RJ=ܢRc|R,5%$/'Cq#CO;N@w)L.$ᦩ|T(8^+ה?ؘnvU7EVBAI*TtV 3M9D ֐$8IK]P?78;{^h.o<W07\֝S2҉C]% J-o<#L|R6슛O"e<x;) JIf4iʐgxL8ƜDw`R$&uL4%]N>jq*x Q^t?C(0Krtâ j^ƃTI#TAׄvᯂ`Gt 7G io-i?N HW6ɏ^zfޜ UN]wp[ŃpBtNf %D;(@ԩL JetwpeLkId*: "N;Eڑli3u ɝR lt]-q>=)EI)':<p(>h6R%!d4I<&\ # 4I=Ҏ]hЊ4R>ҁ5i@6q )p3`[Ic \ C^@j~8W=-cw7C_0O*,FSR!(wx|uܞѪgl@D6 N]Cq{)i*xpu0k,7BUZy$>iRIr.f C *v=\ 3%IQIMMUġ: OM`!wEI;9';MS4_ 2^}Ō*|4IIjt:4@H vkLT#]TTrl@vBJb$aH7{GG*N|զlJ R : {%XT@ sGqₗqZ )XtPa FD&kG#DZHAT 8v(V̀eGh;$'9>I4tALÉ׺R'TۨHCi1i$h;tILr([_Hkؤʋ3IK=Фôy=y"r8DۢF͍$0N(MdJAK# Jf]gD;ML{!ٮQvְ 15uLuyH)v׏gΰtAw N FTdWKD} t(w -P[瑨Dx( ~ `b,Dʓ){rX<(|˴U $ @ ܩ [v0S m*[x 0d✺(n9i=ldI"d@P`$+~H k'7*CO% e$ڨ>r]4NJ{-s$>֒<A UD7S:6O4*$TD~ÀS0'A IOk78p8S)@ILT@a,33y9d&pNSntII"8%<(r iµqiࢥC!T£rhrX l,DSBTZlB't4luQsSsrqp QS <=)'DZ.pS/$8(vYTX2; ӕ740IQ /:q .09DPA産TS9ܘ`NJ:+1eG8΁_fO שRݔsf?xshp:pUag\K҈RJ _dW< jt~ٺ xLXl7!wD SOmBh2D"R 3䊗&1!&Fkq?(YڨΡOBD yN;$ÈM{(`#;B"薺tCp CDOEJ10ez{$R:(`ǀ$&KoĬUv ܯh׀^xFē598v\cRUPcGQ~S= Q&JPJ4kpa@ieEX?Y!1~骀vR B;(.|+vѡ75LPs5q$k³SC8άnTa1TBV LjxPkw>5&5CB&u+ "ރ,Uj4>CcC=X;S9Xu:wOsdh=ŦPH:i|Ix5f3։X6Fb$i[Fa`|I3]!<pc㾩-K5GZʹk°P,lJ5N.P$2='eQ̭Dc :%m's;xU܉N)'qJaFgTFٽ]+`0UgWJS=1=/5ԡ Z]6ez-'O52]u@VHbuaU+j0a:(O";-I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$]l<2K)Ma 9}>\ :8 h95;d4|',qIip */48ĆW  I$;"-!hۏMnR[p`2m\ m {d4Mo/{Lm+CЁ2t<}c;,_4/5 *`$! SiZ|7*'$HPviKp$ a]T>ѡ0t?tvf-GLf |U nlVXh7qS|R| '$niI5ʨ_]Ų9DQII.1is6I(piҫpR}oq_3Kll_v1'Un[D0ԛV2ܰN೪e0\tk`HZ-64h+C{sd5@ʩԀV-L=XևVsq6s>eYmb6_42Ormw ]Þ cC[ƃJ߻g^[@&C8@IiPN'c )Q;]V {1dx$麹s?r@dAQ,*M!UNmږ f-yn2-l( (!m&>{^mNxܢYC}q%T-QZ'T,| 8s`o$a#d%_/Qsv{|l'DZF<8$¹[}'2t!KD ÌAAQ?!!gp$؀tg]GtXϊ,$4]tD1as=:76iU2xզS)bծqh +"9g(ʏQSsFЩd\+5uD6dR!,c|hU:{waZE! )4VwKe@7[Z?P~J(G1eU=%stUj䝾0^9nΜ*&'E#Y!;:RUyV[&5Q!E fQ_UdJC{NˋN;@NkP5=4c\5TеEodO[-nC$:NV~tY #rw!n;%1 o`HnL (ekG[@ nʃĨRbwުs.MVVdž2cNIY6[+VKK)ڊmrŀʳG\kj'rm7U&Q*LD͉<8Cmf]H & uG)?vЫyNpAݔ224<)G ZuΣ Պ`kPe d*+>*K-d> l3FOnQ zݺ{Z *3/io`D,E͟KwE5w4Sm|%RȴLvJJk n%4KOM:Pv*/X5 uI rVgC(yPx<øwGma惪U%$\e<jkZiga习&aZC$z'H y!J#w qiJIUhT6HO *.hxTh-h-h|Ӹ?*trX"a/OiʓQ۬QSۄ^{/.m; UCC54tILwcE5Ri{\ T zy)  5VH'Df'PɒJcB*۬?rraS (x5LtH %Rw '&L$[)8B@w%IRSd 0:GrTKu;lƞ)VdVݐ\-m='tKn xUYCder,ǙrApM9Ѭ-Z;,:+]5\ CheRUqEǰoܪf?XW'c+0&;S{KI`5EN<^ݸNN;Ή!$#s`k%= <2 "> Pp9$ǏdPdy:)3yAo(BE+;p`ĎQCD tDӠ5 K#lV I:6J\9h>~T !|5fz̮*zAI4TG(8T[F<7ςk>h:D9PGϊjyӐ4vU 7s_ςI5Q;Jr]S@*YRC{#P'}!%/Lu>I8AJ|S: aHN 0:AHВ{tG#b !]jLNRB# ]#F.l8McJ@(.((.¦ٍ;/׺JYC`>::'G)}#$HӐoJ%$&Z*8 d+%QP וQSU!Wm-88HIªˋL Vݠ-1N\SmRRHL%&M$PD"e@IAPpRyuSs!IΜѹIkN (|=~\[C^+Ltҵf7?c+VqN =2BmqađBwӧ Yn` )xBwm(o <ډvh2}*n">HN )4h3! w"A;̻R%tMC6S(IKc2}tL#aql ѤưҒ“߬ɝip'J";ۿ"uvALf r9mԪa H iRfM `S-;h^L> 額sU2&|,:xV5$/tL"<Ξ*9G07ӕtTBP:i*M{*-U9J -\~)ko;F0BjU1ɀ*GƒeI_46"'Dg fIoTM$qhl Q8H+tA0gE+@@"ٵ@4h4Q,IDL[SnpNn{JQC"1Tyxkaݫp7(Nh{9F7o&%J{+v4*E5I ݮ*Τ>7v=^@8 FU %kRgmp{ZBu+vo(璀 ۚƊ02"Jjb7< ẫvV69O:UATnikE#ensva3xs$vDvjamWiXp6bRy q!&{JdtpIIҞ<m0%*c =DŽ̒N$'RB[u{D 4 T7vR!D''\%%+cw;w7۠:#:tCp8“κ肑%8ԢY%FMSj탠9 TI Qq#Ra0>Cdww){}G)qeqq񄔑Mcd`uC̡8t2t7Yw+}PS#[#[ T ;haSp$Wj{3@d‘I%꒗:jyL g8''Fw:]ZUD\4|L6ml3Why$r,.c8*$C #_vEP1'-=Ɗ̝4Q7ȌvJ얍IPl괰.Rs+Z']׺53Ms-;vC36MN{˪Oc7 VnEu>H/$y#dڳ5Y̢iëL$pnP,sdThT4<z[k}eFf#eO/VvSK>+HQ_k#ad *R\%EHqٳC? :4#!FùSΔ5CdKT3HN%3FDjTPj2Ge(h jV{[QfhF[>(e"2P] ;D*^R]Ehl,G2RY)Rp`mL/yJ׶DuϬM'|ƆEOJF[Zlm#qy{կGp;(fm(!#dxHAs٨Qn襬w _QF+t*lsct+D>Pfn`pЩ=$DҀ۲A )n2J:AT)B8OuKn:5{(aS*\Ukt~Q\%X0v!T8' \cTS5rZƫ#=d Oӵ% vQZ(;r2xpl n 2Hh#U[G<UU7{e tZ [P{dڮX\Z FP`m)btE}r  ѩa S.ƚűBۉ%rWs}DI1J ׈Ue6=H n1=+rkl9VكiUgUF *q+5{^τ:l$cuJ=G=1ߔR#FLI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$pxVYW RM)$콕UaU{yqUΩ'"iT3F]^p܌Ν-rkj#2B&64rBY Dh. 1ߘQk-ڑ ? r4*}'| ߪIU%ɴY⑥ΩZC@и$:9p\۲!_BqEիru:5i'U&W)_)hUK:?@,f4-Ίp1+']G:@Uݸ<P9/ o UHbh#Y}.A1yEگS{V)ѢaՎH*3xz]&]L=`i'R UyA]);Vg0 !y*-!𺋺6-ⲲXw!CUY&;LO]`v/N '૖=5HCv<>RQO3 y 8n+Yo:&F*r;(!E|qT͠YA]&A +T6c;YBHkOf5?EU2kׄٸVnSp *,cG\ vFu[!"mVmv{1*Y?%Pe5gȄ7X ¢g<vaXВ|[^b ڄBV]*n#fei;,2}XsxB+G2#EZ;$/Gug&X>k:]-."HZ=ODZ-VX$O*y|zZʥhZ8Z#l(-c& 5T!=F laXƑS7e~tPڄwbU[uTVv< Vuft-7̉om&?53YU*db#4tPiu `#NR5iQQ(~TcCLP |뀎t,~vr_.Wn8j<56cI< ^X~*֒5tphe%mݎmtXJ:wTud IBk<8E٤6;Y-JВǑ$xT]xktW ;F "zSry%:ƆĪw4* {9?Hc)Sێȩ_i{S=s >| BB VkkjꬸcpPsLW[6\;IYp~{qR,>T?ޘб6LCuScOޛ`q!X"Q,xvI) x:5ѧKuUMogϼ)V`µS Q"Us{t6Yym!$O*͚F(YXb|=@@:n~eԑMz.w]iGiAsVyGiNJHUCo H.+Wut+4?p5banELh;eA(j] s 2Rs4E:+m!=6-~2Jl V{ÛyGC˹LH(eEdV6B`_C"<;Lw;=A`蘂XJhqӔu#sL&[%gז7^'Sz}6ƒdw$iwOS ` BsK8D;>xJkU-u=gekMOubHDGSrI!44.x 2I"1CFv'9 lgW- 'Ep/Mlpڰ:MuZ|U}᪯TvF 4aN%I*Un:5%ÄBe4:]< IW 5v3#U' T2a&!86_ }tLKI-pA:'kO% %$* O)5L6 $NС )`f%!~Q$gcyH۪O5dUrHFHmlqʝ PG)./ѓDsS hIA; R: I%,@~ G(.;L'(| yɎÄcR kʐSjS[Lr4AK$a;G)E&NJA VU04TI\y$Go%Edf-XkCvi]PCZǍ, .h'4ԩ4Ί$pI%πCpT %>$0v_9t({vKQ>;6~))w7@yPF=ڞV Hq%9*Sm p :TKuO$wP>eAqL&5Rb:$$'%H<%&٦!49Gxvj\d@: ;*wNVO 2l1Z YLPaC:z> C]!ivǚ";)+G@, jk 50nFh ӎX/0Uli5ʝ;Tz$kQng58~96Ŭ%$8"a6kUE;- 8U3Z!+3_i\6JD70TRc(]SG (niRZR8ƅOi"$ʛ]:Έ;)1{e%0dLH1ѠNƝ%M9ӯt;OpCp'nQ"HNI%2OTv)* xB#:(m"5ILˌPY'M짺uq`Ө?$72APsCS6pG T(I {jTa#TtN- o߅( H\@ hA$W<(&*b$` Ba Ӻv xDPOg:5B f oe22VCu Q"!"`-pЧjyo`̚wz?5oJ/'^_UnOѝ Aqf+%65V'd!TyT yJ9ȴ@R;VN`)pv[⫽x2eB$B&$DRLc~Ֆ5@E;uVg ;Ss H'Xڕ=FE&V: 8[C{hT`r2aY=+|CD옎̐<%B(\@r(\:$TS_wq0FS0=~Z<ҟDw(g$o%'Z#O,ow 읇D"򅗝V}ꤏtrSJЧ Y4"OmA㕝h\7ĬhO, .~[ |PMGu$ RmKxN> DޭVlCP52(yGfTk;}܅]DŜ{)x&RCw3#RexV7^獎ժ>Sl-:gE&_=S`=+.dI! Z=d'$Tk xOQ{S KL»y1꫽ &~E;:ppGuN !H:)ӂ*&V!p8"lJMd:Di5~+';.:*3Ek>vSK$:VC }YSWm.tƥEATGdS;ÚVוg-lFmhtyD|KJJ[;fUOR)yH)݊j{y6lFaJ{u׼j\w`Wqk%Uӂ ;@N%T=:Gppn ppp9Gh f\9$螖ұlȭ6+yn󵚎%PPA3[ (\J!I(v{sm2Vu@jHFsMջ__6;pߵ \o].Z!5֟EZu*7d,\qC6:H-NI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$vI$&+[]c|GQ9% \#kdU=_s:㝥^{}\*gޣ%c̭+X+ί|eu1XfSt ʡWGǫVV@gd\Yp٘LITͻu*%B)pQ)!w|)~%O2;m) Fk:=M-:⫆'ʲwONbkSpaۈ uS7%B}wtg )haEd BasJ hVͭ~([+>EVQp=BONrJVegBtNN/'c;kA*ce&㻶[xBIIuF4ndƅ w*gs=UuAN*K/3%!;eFo`[@U>l5pn&0jOn%S-ѢT.D fG 7v*r',M2xC*ˈ-M-;KdO*תU pPMv7yDzL*ä)z-*IEd:3cE JoY[^jLC>Ν,g: +&fsEKYP+¶!Ɏ)S\jH6=M lu4Y.XBOUK^|S(𧌷XO4QZA_F(R2KuEӢ#*H:H~I ibwMFP')O @\NóyHRy:((0kb\N?]dox=F h 'asL,̬aH]ot KhEc_iE\N_G7,fN'n|m" B[¼~N xTtDvTnxNҴGeA :?r [ez8 'T5C]a´):u2/`:VY5  ^S|XgEfG("qe6շEe!lӈIuGYdFǦ_V D|cM%[T${ aL4Oa&;+TxR<Ezr*e״Ir3-s!EUi0F@G%)juD,-,drW*v4vQ~0M4-gH)q:nFw7ӿ-=!f:4r OĎŕ/iޜu[G }.ڮEaJĻySv>jd1Ԣ{oY*]?S C8qhJHE"Ba ?4ҦY&G*V9ZQMBEG/§ ՍYթpއuBL8wn?5^X]/OZJAo).1|y q׍UwݺńhSwKNw$PK4$'h'sE`kq44B;Tj⬵JD_$L+lϮւ£Pkt)۱.?cvCuvؔ E}Fk<'Nۙ$;*xNƀ` 6q[lUl.4To۬jNj] 5Ixf4N$w%=@)hUk1 rafd͒ijkU~p_Nu956'gNh¶AC59۲\dVc3LcNS/;EIMO<(1IxQI.òJ4`f3 ?t °T uUŤDu:O(BqӍUK̐ `KV]TZ4_ ixJAG΄BEP$r9Fnïhl+PxˋOP-Tji @{DyP%!d|ߊH$8QKx*;7p'T_L n ! cDqESӝ;,x(m;xJBt x M+4A iה4R>hxP<9,IBURpik\'VnH2taгI)IL#亇^\>)rT\™&eIS.tg*/~R A11JQ|vЧDB}OH*ݿ % @DaJU@pO}iAݧ(n|DaF'Jk<[ƺw (7PBs r@8V<{>4 <-HS;IΟ8TKgQƀ4@9$÷=E~)lTXump7ݬlO$T7}%'9d8SClwtVBv6OZ1ϖ`|y,o `x< V:շF1+U;h"Qt N qt6OƁ;]۲ uNOAHxUK uIAx](vI>qT"JALᮉ)mGkD w 5=mkjܧ^2RS']OtY {uCPjF$<"gEDw))=};9P@e x_ю[P~ Z vҌ!U+J@ZҁH)j-qrfQZm:Oܤ߿[=MY2RKޙ#Aq'_t7^-$cFv <):nW An(w)\:N>0HPm;Ѥ$a3[eK{D00 %A))+jU٬*F{H%Lh"&PxOQ'<4HxEK֑䑹OƪMD!EņcEhژ&;(Jw'kS`R:hhqΖao`eZ5 Lor詸քFEM hvQ}Ѭ#L:5]/zFy!Pg,t{S'3߁Pip!FEv;IKUc*FH{| 9&|߹:Z?> 9 2\IcN>ųvAu% pP~;Yy1۪~ߤIM,"ז%4-ЍJ[,i$h6'BLH))NA>t <\{[w܅~'V6tU U8Pl*gai V !B8Ym;cu5zO`CF70\XuHh}b$C`.s$]W֬ͥCusx *:$ul䨷"uZ JiBi;:- A8u²Z#ku uh܉lVhrzcDF5<.jܣ9B1)A૾< F3qaZ Cc"'.SX{*vӯ Nx!N9L.u`Ӫk%LΨuRaX}BLjDcpaN]%#Ue"sd T {>hCdf8Xϊ5:sqaxV+ۨU.c3p˃hh%3*luߠVzOժ -w?[HhI"IZvS;FI$H)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$J#-7Ԥ$5Z=肻 nM ]? 5\m n7;sjf >짒N ;GGh:QtKХQE! )rBk@J EKt%nafp #X[ƞӚXR/N'Jn:lƒ5<-*ŭ Uyn' *M#Kui}`@n<{#no!oF6$Zu$JjsLq4@R *=B! o7!;Ti2*mʥ WCv|rON$J郘^Gb1yDm `SGb}XC~Xmg/D!2y38M ;vF~'d69T~#!#-[ұZxGgI:WPmlT{&W3Lrm$dƥE 5I|Qd&A"*ТxdsSgCW<6)QW@fXG }4LpB8`?[M\%\M8 b;+cB u) «/\R)h!9̰S(^OXm!D4r@Q9 *j}t*:R~*C?7وCp%GU[ IA~scNU?GMJEYW[6(} 6ٞ]d7r[JF X5L.{,=> ̦W$X 4xFMNDk)`pe/OAV2eqC=MQmIX{5 d:Oe+; vJ8ޛmkNuSVt2>(?IM ;` 4S AgnsUch}asP9NBi8&mVHiۯ18(@AVڧ=r~vf~ed;;Ou]B}$BmQ=Y,|tVk:HAٝmz̪.aT M@5Oz %+35y$&umNk`Hl#̨[K]'W{6dic:y$}McH)ZmDg^U{Ԓf.?]k *ոب:j5JV0wUes;!+H vZwU-0J6z2 2,dj|W7WdbUںx8ʇ< GKDt*Ol:P,h!ƲTv`IGk;0xvGRC+YL4VO*͍Gnj\;)BQlBVA::u8XXHZ/ <ÿ8pXiVaݕKTcOOTl{\y>*`u(mu:vvfDj[V٠+r^tgݏ3ʕxN\suHV+MfKpnQyYx# %e2 6C!_ 6psvJl[,$1d|S[LKXPVxJ VzŌs$ dnakb-otV:#nӴ Bm12<Ҥ5[qx&s89X+pmt ! B*_9Psnrm !&<эo,fJςc&hR{d >4HxCvpJG2 ![4Bs&wòMfH>I)ǝy*'_Ƞ,쑰VE4FXB' (Aq+@6Y $p1l )uik#&:'0U'[p +lhmmMm׮T&VeV#{ LȌJeZc4Hz 5P&c h>!$kΨLH(Tv5 ;%5n'Df B@Xl8V y!;*'@{ utNGu Hw6ϸDȵ52q#Q捊.vx!\e0|PA` 78V1\5II`\gg }-acp xVQPU˴z(4*)M4KQ{`t#^:+qD*}9#rzGA.)Zx$y%%(8mhTXI0М rѠNaxx Z#^%EFƎ$6+u'Q9!ѡJJ.Z|)V<롉Ax&5zOGtX$­;tHt:gݻΚ%9lx䒙QLi5QlBdvEs1g:|1h(Eo9Ps]qSh1RB3$M#lALvM'(†@O0-?rRƚZ0 2'L[-p(V?tPBElI$~nMq ΐEH#O68 L _׽:߬NpheE8XywILKI!ӱ³&xVEЦHq j|Ijr5!\-'@VT;~k (;|JjF˘<ǑP|dBL5Sh_%3a*e<\#Rai#O4'jz~Nʡ{$ol$*nMSp:tljttKkvԭէ k  E6y'M:熍LѨ׺w25U-t9ITĩ,h)B<ԜaA!iԍPC TH;I wUȐ3LҕHLK i .H ӡP.!! zfQ=G ic 4oRy =*MqS)CNKu!!Tէ]ALF#TX ;JmXۛ$vRk塮%NHG=5W☕Ҭm܄ږ`#V>ͧ j|.:vF [*Z1INpnGc]̡p@ L~+&y' ̄ J["Kka6Wy򙮖àʓڜ6 5!aY8 5[)>(-u,.asXᣲ5d@q4xШ9 heOsqq%h)ǵfX\dɒGOpc tJVé#k] e@89 \4yaѦ?l]:%B}37骏&iX2XH 6Ow3p*pFFAIKUnï#BUiqU{4'A]ޛ2 "G)ĞQEMz}!@»Hqyx y\Q~ƀ8 ][$5YzLu:-ͦhOeS2hpɎu ;~YmאG!Id.gp<};nNҞ+8js*7`Gi&cU}o :á{mI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$dBC'tTI镨.t D}byP 6G19 |Q.IǑHh#S!%"~H@>H$:5)R)&[1J9!"\5$@d dښe! -؍|Sr kL9wܟDHJRP-.H5i20Shw)xmу6 Pq12` p`': )'ROip$j~)HJ{BJZ{N[$&hLwSI4Od)cf9-$0 '.IK]S1@%&dͧ@t|tALcBD0c%'Cƒ(9b!UKlwr?]A i?r t&G# \uDjXuLsUDJ(q08f[X@QIj[8Ei .Ѕ`:+Wm{p\NQ6ʅspƨ)24cm@i0{lyÃD7Ih\4qEMųǽ 2;b񨠁eM3Ql1y<&|SSL|nZ ,FhuD$O ҕ) R D8 Ds?v{cFMIH_ :Bh) Mho<6y)) S_1oQ=@;Z s HC!I쒐2֘Vk 1V[Dt^0S"@Q% vV7 ^uO;0S2i H9:C66`$LlyH5;Gяe8KnUݓPE7STmAr}[; #A)}@Tw)4Hk t/vDVKZN-:;*!5oo攔FA 0E6@#Trԧx20 T-'8w*]9%izmwX4 ) `P~*\%k="e9T1-꒚LL%YaI4拼םPtKxh6C~8<q-Su#lh]%HQfؓ N@IINsc^ H32-o5Ģo`i<=#@k|!Ao%I;[ yB8pJV7V}<{wWӪ|9Ukv%3OPSxAVCL_HqL !u)&yjn@Ղ4Y q7OxVA Rcl:04s|gcY]E&*oCy")VŎܨnj_I5S6J,ʉtrH)LY?@CqhxE/'*)B-i-2iJ=Zh'"{ CNA2 k2r"}hqq4x#t)`0xQsxQ}E96׏%H&O)BM)7gS#t\- m㺯S8QCRv  jdʳ LI!Ssd,W $#NIb,hO*mcD׬i;:ܟMOhzp\a[%9`1 NS~s8i\8joO{plIrmA-ø+]ςNN<ƕY2?yVF5ZS *t~*D)RVrB{oA+/ WrCu|*ƾkMЅ$hSOnΧFDmw.5Y\/ڟ^r5=v;撫d#U1ZuCe;Y؝QY']T!;Uِufݔ! c4W]\qoA%:lˌ#ՑBfH:;8Y#XCsІvV:2.!bd+,iGюv0<F]Q'faDoݩ:[Mi%Z5(OtN4 0> 8e(@RB5)Jn}Vv .(V[xݧMq*ntܮ8{`95L#@ݨ[TVO# BIi~Y^YT0E.E+FB D$v VeګȉQqST!vYNcloɼ}M!f8[B&4NAhh\bneoc{IB!@{G v $ptNx;% gr_M6G(%Q _1/` !DZƉ΀_2U˧DҖ_5͎F5 eA ʁǂq)!C(V! (Vlکn" r](7q;]HY}n $54O}$(O(}'np׌u dGA*.1*gbAĪgqWS/*}x+aJ}m6u Ο>4/Jʳ!۬#Kmb8G `:8似ˉ$ _e{4 q\~+ɃDsPs묡 )\5Gee+;Dmuvt|Nl0=L~5;pY"T6Q#%h6 \BJJہw _Y!괵 B3{ X=՝8D撚LqB pk Uy=ҫ{+p?8BmBN ʛV&sõ !&N&׫OށLH kwUg6KMgd'ȂyF$5@}QR\yQhӓT5<ڴu(muhca2B?NRn%4vBG`13N]@`vv#P\s 蒒sC\;];!RƐW)܂Ѣ" $ni綊OLgV7 0y-prq9;BB40կ -aDZ=Vj. N{\`x&{H>I8h\&SW2$ƖO܉Xmo--+ւFfDcyIvI sá\cΑ)YxEf>*~D{H s,&m[|L>=Q:{Ww+aTmKJ#,;ocˏp%X;8ZR@e]>Ah{Ωrn$SD&U0U 4v i$H!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I+}*S%z+ NSW4M$vca|cWan..;H 3L\D$qeRS(M%0uIH`!V}eh+903xwXBJhul:9ƧSԧ&LpGt0Dy)>0Dh8O< #D򒘀OrZ>x!yODcTo 3$q†u 8ǂ:'!%.4uQS۵u*&n:B<%*bgwN9} TCy);ৠ7T4T֨NvѣP^X0 !Xn&JKCA N"# X|w] 5Q ֞BETEMr#m a5;2ǏAF#B`%h ~k0$wSv]10#vhh%5o{ 4'?W׺%7z"ddXxCR79F_;A$wVSA.ts#;LXL L^ë$8S`HJLfghO~]W6XkZ *î Xutԭ7FGoTơIx}2VbmeeU^PJD \5~-~O?k?TheN>mz3*->'D(h294{Ii%5];E1њG{Pf3qhaIxLRxS;S{PSX}Q1zu |WvlSS׍ ׈Wɐ5N eQ೯vhZ^奮y-TȲHJ8IS\<ԟM)Żiy#QgòxFhPi  MvUϨӨ29IMQv|JCL A- is4Gs-:)N!'TvW2yj~opƵ4(gt$T i!J#odBrZ9!Ov!" 9.a]IΓ=F5QiF;LpܢT%!- HPs$y(a{̀Ҧ4)(AX\[LkӸ@uN/Vǐ!6un8O!:ԯ Nq&Kk}NM12xL Dď%55䩶2DxxY< (`)ݸ !tHCtfX kunTk,˄36cD)Á !m6dY[As SN;%xp纍́ד/oG~T0y^g{XxSv3?46㒙 DhUn IRkBJiYFh # v)1 7PwGA ǒ6D䝵'l`)4 `j^OL7'bA|{gةRFݜmߛL"hAH _RtwVN 9Ncc^ *B rbH1."GdΩ x'{ ))i*ޑ h $IrQDhaܫ>)fGtC:α%9t&kϚ-]C%u&`J{+x&ۤYaTdINPR_{WP3iD?Շ8@v# &I$$v=1̫~ .Tv9-TDDk񪈲akR9J($I,Rv.#/y/> ,>. ^i@ RwNK@2AoI'C:B}N~(%⡵vJO"ۑ[N($ 3KT()&ONΒA*xxy6`WZ2G.$0@S79p;F&DT=>p%&p (XZ1nmhS0SEK #j몰Z]i4o 6ϊ`t\ElO'Vc^ 2 %IӨ%'S;[SrM~ wVxJ{64zNӬt}Z-|ѲtM(}$##/2V#Dý'H;C9T"yGqh1t@iDhvwTg:":ƧNWyX!KʯΆ[0<i@N6S=h)N戍*qiUrXV} VVkK"Qlh1yb-9Wa~^"|T_v>= )*s:pVɓZx}2H 7hd -r-*MӢe :GE G(KzTj b9M;>MbLƊZYUFZB;nA 뭙0fF/-G)֟\K[&PUDU:.4ElvTӹ &RgDhN`lGK .}q.$Dp@\@KЍaR1fvKӅsr`4W ⮽NYSÐt-N9DGm`8[:*a)NJ%w̑0O(f@sǨ]NyP٬t(wHLJ@~i`h䰝ԉT[M6(J_$(D*"Y?ohyLsA1TUW:,e`hG%Uud/D5a= 7nPۖ#ꝽpJxL(*-BfcU; L75\`<n1(gwZ>}*U&:Y0aS2z&LezTMb4+6vb=Vu λk -qYvDa RNv09+IVYƷQ'S,#^{ \8vMO{!4u)Yky$Noa: g$NJ kuGU/LT [5J즵Ž+*δ4*t%WuP'uJHnZIq4bfhEEl.x+O q:!5{gϤeb%u:ʻE;Oc|-SBw)WYv(bs)ɶU2Mm$ _d^XbLW #ʴ' RvCA'B,;UTILk]@A}ꅢݚrpXUf8pcUnIrl'RmsJUdQub8*,%oƎRRK\'pS"D*A(R9mk%$06*Q.d( B}dR´\FS+MUV7P&U/kuqE pL$+Y:2:wA g[>­v& LXbCaܬ۫I)lA s\V,êƂ6^KҒ]Uy] bdM`e=x$[Aq!]iЅxp#Ѽ˷6OrgYZà?r Y4*w3U=008L(P%'-Y'4O#`AKJ =BXTݿ4B u!%6 @qN9INѠ#WL֔hK{6$73ʅ 1tY dd,nB+Iw1 e­EX(Yqk5bN5rQ#*e}DUH ŏmUsOy5xAMkeK!5U;In#aM`_icfNiڍޫ+oTh,.(:ɐE̱Ӏ;pw Mfdk*b^@f8gsB#E7 39l)AI$$H<%8xQ BBJ)Fl;SD]\!9)tX7x>40cn$eq(94P΢> 5D׻|RRF1tHtUi pmPYcZtꖍc Sj>59*㫆>hpNC]Vh{ =(4́]Qw`~SR<$d*pC4Æ5]/#'XR Vp#$\'D D1'4J}'Rf?3~r@RߢѪf;f O6yLtD)ww*m#$iN[YRgTQlJd^( _&BP<𭓤(hc2kњ;,F A>%Jlq3 O@<)NT $"A5iK6"Zٵj߻QxB湿GEK }30;QII`^4 #RZ?"4 w{E.+)wnyޑ}uͧW4nn١rwTNSbyps?Z}`_;0ois~e4*>< #$i{pZ-y> GP|T`N42 -8*cAn ۅT՛\6mq.pAgLJ`I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-/ڽ j7f7/@h&H,N>Ku;m>KKN:j@)LnHQ~ 9tL jxL5Rta%2{do=v1w-2u$1$&|{H\Re(!%%WᾹbTFUo?vָʋ;EP3ITX@E KOF>jtG$\h'RS@yw> ;"ΞVW|TD(?ERSN\Ф__lopa104q~8~&w+ouOVZ͝VA85ݼ)kJh:ͱ> &kr߈iAƛO[gMB=TS$5)m;9nAxDvkuݠBA2AEH`Hl} c|GuI-cAQ'4Q~piBJH䖝:<ua~ɃuLrlgznqv^Xڧk2;#ĒhTRSޢ V<8(vx .te s0A*{':~ݲm±Dr a$ 㯚@)VI )#F .d8Fӏy桐3󃇈DB%B }Δ EO M{wg3l[FʰIt>S@$:XDqk@<'-S@'e9葆꒘RTXv#TҜhuKpIL_Й'sjN)AO FfuI nHVZyJOBƙ 10J~f#۫"~!4򓝵Dx(A*h4((=pt!vR۹F#T{ 5&Al&TˤD4605Iۨ'-)D? t'PLkv0k $S#Hs()lHJvR;L$xx)9tk (JJFˉڟޞ&`ĩAU'OS FBJVo}<d:B_xݵď&۬۔8L$i]$S<6ˉ;8@8rυEMv8F˴(=I=]@ )7TD׼f{-Py # |rN Ra5_Z}~,L \$IӅZ֒`RntQ l5Q~pƴO*4Aۤ<*F~cG mDFTΩ!#h]RRрH1ShK>@0$=s̤l`scR]!?""'En";>)'࣢yIH$htbUq:)w@|ΰ> Dݒ;JLpq`?AKqn"Q kCP5Ac|Oa Ȝ;Lse|%$%HjRiN6F> [!S$Bp'T"vRnIHZGs显 di1J7vAƈ! g&Ԑ)yN$O=k%jCFE߇╵GMDy(5\!Nʘu*Ve#@RB"d)n)N`$_EZKO7V>%JyrF#FݮA3ouCKOd:'?@c⃵ R$k*SXA$pO≳vUuǝC,k 6oX(5uGkSVi#IU@qh_TS;)N&{(nФ]Wmt@m$C+AbT#Cy܅0nq(BE!"tDqyIøퟁDkLq;9QxDgΨw@4V,o!Vx!5)Ól jF[&H<)@xi36{a [ cHjTJnapibMU?8%cE :蟂,6n2;xD{Ku 42L1@:wS $43ʳ^)saF#D]6ú%6SLIR~'^uDHk6uD$G(9W׻Rm+ִ7B%!ۣ疤,AB{#3@oXs㹀!W͇;j%]PYUDQKF8H(`R*~a \Z4Yulw<۴|4L"'Io+3q$42ΊwpU,Fh5T>滈[mz#p~>j7O 2Ѩ^hnpFkt]X=ؿ 4('M^$ ubfDw\ķ~5U-ƙ%8қ7g3`"tBoX%^ |U&x]6'hvc\cU &N{iWpFuXέtXU(v@,-:{Çe;NJc+I5=PlS}()wTgBe Tpa !O%X3Q"1Jb_'M{h G$s۵-'EO#Fm'+hzJY;'k7e'vUl'u+'{(zT7>#rYMꑨ(בӴ vp5()-8qO\YGs*6B+8h6 ,NˁYM@(G apS VpiX2g)*UYa)z0-j̓mͰCH7a wUm<U5<Qv :@<%|eQ~8:!:&"A26wE d@VknuYDJqdqQ3(3 ڣN}& &IRku>n4(=4LQ&LL7`@kv ƀSVςBB-,>IdP/p-$%jĉC!8x#<%gDծL·SG*U4|9W`"`Bvfʩ yIJvٶt:NsKwvu` Q+Uj FNi(:IYqLtva?d7j q)\Ӥ?Ү!QɆtgTί{Eq1;Cs5,pR^NUoxHH~̥׺ࢱ<*2:o +L%&dU#hU3IF 9+ v_41hS# C>)geYYg*0HcF\^-v1pJ.ǁ>=ҴoIsVH];y>EM돦I͒Vz 5VNXI(Ukmh{x*i$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-ݔ LgWrҦ v[$#h$ӓ;wSu0hR. q'HSI>))kC*w>gl^~HJq⒕]$`%5StK>\;SR5W!L!;.KIIc7ڢ=8y vV?J-n<;0Jpw0c ;OrTjZ̎$+Vc=t@Gt]cwtsx杕x"V\ ™yd4(T1L;mgK #ѩBu;4Es|04UZx#2M:,p$f aSX>-vU\KΆ)H%jKeO)kxCworgI_=FЍNnRHBו J`ԡ?wa! ncؑH8E .D t蒗u`7s !.约\_&4T$ o Sf_ HGk#:[ ZUPn]:%!D0$$"k#ܤ@>mi ~'ĦcG'"IPK%$q'ߚ!w~D"A$ǔhh׺pc1N%u:FȄ5'p.oĝra-JaH DI@R5 x٘9* J3#^$1Q2L4 O葨㿊N2uHQ%*@  f 42 ||S䩃=S (o8@D ;sGN'IDž&J $.yc"9RD :}NUS^d $.I'NJ)d6gN*-7PJ5Α:'g:ѱi5Wa iܢh>B4By))OqվJ *j,vp2!So2^@YH:S]}b U]]>j<Sp䓯Xua66x3IbR='yQ"L$l5E`.<lDq˜x <ȎgU) #k05ILmii}%?T{o5琤CKF"2&oTuru'TZSET@g)$ۥͽrpkHHi4s);5<$DSBJY$@: lp|>i5ӄ0ST2RwdV j lTT{ !e[}Ԟ'_otiN;S)))is> CZd%Gt+`'%0H @ n9AHw'NZA=[H4-Du5*D~i'hZeG~ ; uJDkʎt<"čZ<!H5>jcNKS'4F">Ѵu>kƾ)y'lJLkDum }lQ}/[hiSR$ӏ1,cSƽYt#5wI:r *k7 7ǻU$j'_((7u ۠L< j<1Hਖ%S-$w}{ !.hxm*@XfJ@ڛ6=fq9; Cq@Tq&\Nƹk%;&r6w`/ITScH$jEFQX?ʆ$Bth8H&ݤ@EbֺC6SS%LbRݦ{IRbb?ء5 <->AP!H6~ s4=C0AB}aݾcj@I>ksI:6ƪ*V:]Q8Gy8ZO*4YX߯TF `hSVdi:m8W wAs7: D2a-(JjlݣEDbR5h4tPq}#47ܣ[ Sp)k>JUư,'<QI <VJxnF&<) ''8 O"ufV`Xt<›C!MyF"yC- O考c$mlT6lt{X׼Ȱx @sW( >O`R0hzaӲ/X h85,˜Eꮇ8M;t04S6m5C./ԠƒFr#^* \ѩƃtXƓ;ud fS%;^{LN3IHYZ< vEV2ӯ0Uw7$@ @#?m ղI- 9L1XeD]2x.4QsA dOuxwD)"U{4ix`!*q5S$~i} >H)-uT[Ij\+Gg`*sY32 Z%gIpr C;ڔ6q8)H ^%Wn}b* Ei*m@ɞ |h*iX:!0KWOk <>e!lS6'NSF0(Ӌ'q49Vƺ)Z׺7j#TSa?ۧ]T49 $6Lq*N?Զ B}ӴŒHR$ƐxZ :{V^'G n У4IMI;]oGץA01j0\LM4D >~I@i~2Ѫ0 \ԆDܢAC~T@Bc|o*M-$VZ6)I[ӹY:RFxO'hG8}Aj ۳|iCk@8))B)P8e BNYmLX\5TI"&ܯFFΜBul2RkB456G @@uQ8A Aݥ*Vx!^ж.p"YcSʻԨ>'d8@W1 ;){L-1H'D )"!0r[%GղUP-5`%=M^jĔFkD|RPk<&Smat xcXkP#@)DI p *;< cT?9ĝ+[HZ̨:ئ8jRTd3(݌tQT-S *Ɉ?wƩ8엠GHZ{uSD'٣PƝAS7L%klxU(&pF;2t#).Viߔ|GKuNڻG T;EI%xA]DfKObf #V{qIB8|DAHS}!IoAu7~-$w}b{F'}ڀnwiZR#YGە1Ѹ󜾳mK*O+.PU7U>:3R +?HGk+`U=Jvvwe@#cGޣo_ 2 ʱ{hdtԕT`rQ^jrt%XfKk`>d̹.|6cE_Ao%YkÚ;g[PNA{(M;)Եq=m GoGh:»M,*ͤG}  ٧*SCN~1\L#g:9CT7N-®Cc7B#T9opS5n'6u )#mR悦EJ- ;\5N#q3S X HRgo 18hu U$ 8Fiݯ&G(uY8A-7-w6!X4\*\`BF`(ü@'tWZ 揤Bi<"4AIJ*U3̢xgY@u],kG #No9jS Ȟ*OK]V'Bp]"!U,܁l@Sţyx !L (AZ5XXGUfq(1 DU^KxB6k-{V+iTnF#B) uEJv4Drs`mvm?>Q-j i0֓`yxѱhtS2*MF6 ?k *@ؠLVR9`3' &&HT1Oddhr%1>%D*iM^Yn j:[[ mvx]-EI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-/ym/A`ۥnKv<6[2Gd9K|q`丫js-P5`~!L\!Q#rOH= .jT @RpHI %3 쥸0rAJc撒$Gf'U&~%$Nڕ 4IckdnM`#iLj;ʎ RvۧD ,N= 4))S) ҝGM|Rh${OHM)imc]"~-NHEG+1G2VXKO( S1 cݭf S $) RRϥīoO}'QkM'9"w4Ԩ;(IKn3#V}<?Kݸ>(Է|.AOn)¨B{) 8A i'2L*]3kqtS*mBlF%Z @4969RjPk=PSFcǔ"8+[O\DxwA}`- ۟;~xkp1E))=MeYf^|d\oy:="\Hx&R'%(7hTDIXDmp`%Ǹp΍\I1!1h9RIM.T\ILKB]MȆB9$ȍ9X4sܩa&JG%1{"5$ِ&e0@*`*`fBJDm<3Xj8))6&yNïJGG °FFryDI-#V~<`qS$8K2:%%-NJHȮcNJPw4IK|@G N[r^Q~ACqv26h`j;d4R'TwR"t QsȾ$) uH #U Jb# B+3niѩUXl!Hj-0x1SMh Lhv*EL;;5S )f4'XgP hW- wC-s$SGL!2y'xiUv7xDMAڢQcgN5L)[%DrHdi{by kC |6hSbHILǂlQ2آ8݌.R'v o optG5}g@(o%1̉ i*h"K4 D('1xQCakΑׯޤ<6#@'L}TJ&]:x!vS=7ûq|L!H:$qQ"4 ԩldrJFy枻 _A{)Gx[ G:4)ŒIKv S=: 4O5ILKC ! #Pa0=s"28+F1ǃ>)R|IP'k))4@DӴ'6y1%1% 8 'M>Z/ tʋI8()[_ 'I$@NC'Ea)L$2tmp:7@rT\a%T ROVO:'F @%0{FGf$Dsd<89mʐ'uQpPS{ lt'7Od@ad*{T\uEH k7ZuHWǀ )Z$`D4ysOΥ"Ld XnI dK;~aFƵDy3ʈH8p1*.fƆ\@n_Q?ȭti@;xg;Y3H:#P?ȆDe{O *&G D 8IMK[c"Ht=jm/-H!# %.RR΃dkgA 4_X5;|PIL-&uV>sӼ|P-+bS5L.=Ψ) Κ` wU4r}ʋt>I8yR4uODiN Jk!$pf{(J ռ]_<ILL_8U88Ѕ@ב(CtA7j5*@k+C4U!77p+KE,l_/ʼ*0E讲@=jՒ׉H|ҥ8W} cgi2IlU yy@F =5<"2DG@Ӫ)GUKPk%ڊy%Eq"$j]U k9 uk1|O&$ *5TE!H;)4;^S-kHU-8IB g]>IVKuQ׿ޡ6{xIMJ79,ntV NR(O]eC`l$P*ic9ܓhrLLE-Y%oN{t[TͰn'kGtia2tBNU@  iZ}$G*Ell|ӵrl*Mt%Js\-*P#_5vWao8^y4DR9﨓Q!jU1ӯjINQGC"{$^5-{[7E=ڹXvGt_ =zAHn⊐kZ {TY^  xE$CuYUϟd@e:ziWji=Vp 40hZ :;muIaRظ`0<3ZDYF.ԏRi]Jd"M~@g HnX`O$riQ% ZnM|Rkr!8|5^@#Ä4{|<1`i%wڔ̷AA.ЦM6ײ# 3*.{c o/x;II')uԠTT݃H@0Ѥ+n0iԩ9݊oSJ }N%UAX>e9qQ g p|T d 5( asuE0̒C{#4 EouE9'kJTh:T5L1lO]2jO(xJ\<ИP(skDY;ed+VBpcM8FvJHM)(%5̓@X kj*.|):4D Aw ˫plhx)yn0#IHVѨ$;AYZx JGэ $vVb'M$%:Od968 Y. |U:kS}o:yݝmR.RU}U wRxPX |ԛ`GmhUB9HpF6AoOs UN3JxSVSO$vTYKB)";.k~>ɰn?!׸4UY{(޹[u.Sc'qh+(:(:1cAUzLz#8weB^0|H:D"VtIP>G k6q<9DS8Jmu u;u-'O5{* k=Іa&9E xuYcTGӦvL>(m$xot^\SMS`D2O6vcRQǚZv̕J;\{-!Kb|SYCFb; ̓R6)Ηn>+Q Xl#txWM8UC>Nq][:wycLFJ{P.K9˭8d]mN#Q'@SO% !JdOt6xRIJZ<@ղXVnk?0LH(S:hc0õ3{"nl?Mt}.tl95l1))9;^KAyxuonGܥsw#hq*8R}#hK̎4^aeuHws\\N1^ Hn g#]c>Mz4wWj4;P紉 €05B/%ckܡU6EUMN"uwmyrDaxRi ؑIjc{+{=yyi:IQO#k#SU2N<3&%܆@UـZt머E&ֱ@7mTT2- jqh$z̫2$q T.<'|NI[97YlI1q'Uj/Ln8$`h4C"e"wS슗i6'YL;LwQ7k*Qbw(E5'DKp#PL'Yw%I-;Dcn*ߨ ) =ÃCZtDg5|Rɢv NAB ,e%,YTq*tqdRQ>T}&졎[uDPXltqA^gw5mg̨]igxIM =24cD[oq1É _79f[]-prպpqx km-Kq_gtWk=jg mᜬE+,68ڒdV='y::I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$uõ{M0yGVO @ZÒBB *r?w+ %}JdM|a0j~%+ G<[I,`}.!pi Wѭr;0gcG%wP(nȵI^l;~EtN4vN@ q-rBoY>9wuI1+bDNEo =J]G=\F@Tv:j9TsYN^<.UGȭ8.j\;h4h/):f^7.$zqk}Fs4nyvn3:&k `O.$lzQ#Q964S9YǤ :>eJ}RW=/ڪݨp\ qNHG ?cwܣ+,wܽ;`M\I?x}V~&-p!Oי9rܟn<Wg8}Fxreҗy̯N]nl 1{=_zQ#wN-|=I|BB;Ozh?%[~C~.$vz锗.̋[Ï5|WwT  ez> 59ӵ;~;=Ij~*M{[1-#BBq4 'ckoܗ;=Kkti_81IzS&!߹W sQ^%oQn+R]ỀGo*<s.KӇ0>6;^Ϩ؍q8_~'._o?EP?^|/9Iz?14XG1{ė>'_2G!r󔗠?)p9+ {ė߯֎X҈{>{?OаEmf, {K`V~q+KMy/cHh_Ǥb7OīYi+ZyxA'byK{-%k~I`ضiyKҿcc+oܢJw\[%;z%yK?ccra˘'.%}=)~x/q cwS,ukٶB+= ?ur_g_fGܟ`GRalDį-5︦4X9k~<cY.%}%+*C*t%y`熟K;u?%į=L!sC>䔾kyks>#k+EMBME$\μpf^㫊1q%[qr㳘K՞B\J߃?.ߣ?4pƷ ?r^ܽfr%į=4\slݫȹ81XxiYW}ݯ_N)k %ăE*&ַ7I*F\y\ _V36}Fτ.Xy:Jۙ1BQϊ\Iq"wPmv\&9u1})o!Qٱsg.lk2hA O!bHI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I+]0NC>!z+\^ WV`Wf/'lu.3!kERr/k&ӨS> 1 gOe ɝPOHdFG'Dh eHJDN!F>I)xwdMu~H A{ FN %fLITZN<(D{kIL@$XuTc QRR]ʰ@;I#R1"$⒗Ƥ)Àe;$Ooh(%%2I)KʆnHP9@9L-'.'H ~-a%*Ioywb4NJ Jd5 Qd~ 'Si#x)<Qr7w.<&78{Ne%DSNcU&髒RFo;<| l dXrOtfߥdLĤ|føIKw>SFcc@7V%О 1*Ll>kʋ >J@I0|x>-4x$lw(40D)PSO(ôwӑt B@R|R<͍pc|LNO0Tੴ%,U{\nN/l"x(;-MT\PSUwyB;&8 4G~P2% ;Ϊ.&%1k`ù~@D@+u1$y' 'ahS NDndKOMN%MqkƒHiMwji2h%KGM_OJcT;jDsISN>߂}4[S&yQ!8HLjm1$|\'*M M;S)) r)hAl'w9Bcr1 6>j,~G /:6aGs0{$ZASE6(k[<v1퉐4 %@=e e9p&pw ]zeE$&yKh% A'T>iIH$nФx0&{y)  QBc@JYD24iqӹݔAB[e&VH?hf 82 RBKiJM#=]%%#x➰?8)Wr1䝤DjJ\3wp #Fk}  B;ۣDI)ps:%矽IΧBtL$P{=F%%1И) #v]6<$'y!{'p}Ħ&8LJcKZ49ȦmA3Y=TjRDA04I"9Hy8m1a) .t~{% c+F)ٓ&xH KQR:d)o)vIY0=pIӸ my)ٙ!ɂLBJBxς[Z$S"5f"vTA'DΥF!~@:KM!׺'mS-{'1% |Sq 810#N"'I>߽L8HLL'v r9MB+_ajUlZ'Ī׻~I :o:HEKQ-4ЫL{47isi=ݡy$pcHUljd.&H@xL):)ࡷ!R14(5@x*P<'qsL*RՀ\{BJM NLhUtH$/$9PY#F&ֱ"GT'*KG#[.aܛi>nM."aE(x#HW:A-c-6kcR)hSixHIL7@r|wW[͏hn tl!20#TN_A*;"Fm֏L8:47?RFA#4NEGQm~|$PR&ljNC9V!AT bH @&))OQY{<(& Oǟu6y3ƪR JPݭ:; )n :p2cCx':~JcVuK6}Ghj!߁O)8: q%0`2GhԦ 6rO(c];8Dݧ(Np)d>JV 1c",c7S8΅Cx&P4mNzpX'ѸOdޙ _9tp`|wIo=x*M`$O>jA/RL.P^`(֐LyV+%tri <Q.;D t  B)dtԪV:5߲oA"!Ax:+ w~IݨFUct!R7Jϱ(}cT&u068D$cNq{*nvT_V{)cC:(=!:Km;qD4"c=~H`w S~aּևs_/B"AAqHIIh Cn|Hh#-b`0J7h^ّ Ftᗰsj0Fr ΝGߪme1D<%$Dq?oܴnŶ/l*h>9E"T6u1qlO [ho7O%Y{ {maCE{ ^lգT++{ tR#Tٙ@عT2[UZ t᫏vCB!iBmBNXdȿ8\ao`uM;H?=v8#5DTP̴|))mt ZL|֡fSvXȰi Ɛ4 Nb] TGd't;i.3:!_L;Q=NЀ$d꒚IFx9NVװ@MLe<Ǹ5ێjjQmwmD+-}H{c9DP=S. `A<ƾQSU/yl8:ǀS1HجCN I!Fe<)m:FuTTV֗ak|{ 7G3%$2k #Qh8R !OtXCpZc 4(披[;*|ͤ yI()n!s&[ R dșH;MRCTREs qt'=,S:p'RWuE ?hP,;Dk-! ߄}Rw7GYx܎ )J3Jk>0#PD+el4ȭL^ Cɏ )K#fchD0{$9FsDpI>MQHcqkw-*Ls_g j&A粆N#5\43B]d:|[ĩIrDt)KִَmU@DTofxAUt!01EMGѻ(ܫm`:zdōx@IJcT-0՝Ck>*uIN}|K5;쉄Jb*SPciNJL.Qh=[^<#E 䨝?"CĤrwH(kGQAG2So4*ki=-d8)> Rk2J$< BktGNѧdwTTN ) .36 k#xIJB ;D8D$#8lG0 )d>WTXNI' ެw+s' `vv =Ԅ 'RRRݭ h䘁R*L6)tH!1p{(iL8J؃"9$D>&rdHF3w8 :\z F-:L9KDr<$1~Q~Ef6n>ç/CE}EJn9"AהǎL'u'8M]tħ"%-m8 m`A@~)~P{w]27:.rRj-BHԕMe=Ɗ vHJw%:w7O?Zdobl{k*;') #CwH=*c ƻ{h8u鲙#{LyTȍO #E&yH:$"*V?^edk9OxMqa%ڔwaL0ʭ]N99ihebU[G3ZzvI8J ANǂ@lԄCs)ttI OU|5̦jG߲5: {#^{ qi#o%TR }W gƝ(׈q[ (n|DpuScQcC~9" @TʿXe =%+{!y9=UL14o*@4J̿]CU:9}i;Xx(TqB:k`PZ)PtfC,zMO@YNg!eʲXVWV4eHZ?Ndh;]uheUez%k6 4K5m6;fe*c觟mysΝZ阇$xѱ oFYKC DI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$bz'J=JF7Wt|A&|{V&+d{Z0;>S)PB, ߲vSNKdno`7A* BCU I!(P:JS(Tx'` H%%)$KA)|N pt183cPto0S%xR$iۀӺQ)IJu zs$$BS%%, J7{(?)K&1lN!A)Bp 9h# Dj[N!ХER)D H]̟`BiJ$ !<$@%1 %i!K*n{ğv8Ĥ7<$5$Z!=!4M @MpRRDѮYP{ jDZϥPlen.M9ǹ]RsB*/` CP zm*^pbGe`mRp򕣅MޘQuaYWRpK\+nGr63(͇_kY(ւ[kۆ2Jq Ǭ7BIƩhoiheI J3 |衶yIL6w@5yn%8 \K{'h$˵NI&ILCa8Bx9)DŬ9ГDiRrIYTD!3Äf4LRN%(4wOBZ-BPĤCJ[ Oh $dj\8{Tq3b!:B%%3kj$Ot͖>?L-%)bJZ*R"ySa'k)0Ы{ )v@Qe( Rw%+n'a&  HHI wb=Mu $&t 'PJJHHRd8"0B<':%/&t-sRdɍb;źΈU ks_ pt|7SQ;k>=$s=7#ꤘ$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-_ݔIH MISD L@Q&:hPROOM1Ri.B?MSN%HEH 'Ukt̔\Oo%&8wJBA:G3sDd)Z RsnߤTƼ$ R&=[Q{tzkk[;x'1tRRӸIKzxRi ʉl gD|yyNLL%%HQ :$5D QgOz4/s 恩f89q(5NЅw2%Oly\;xWzxD9$O$QRzu1ϒ@ a*+kTȀ8KyQ!%%,D4r(wQ\{ӑ✶xQ: S )a`LtSnAoRO MO4hx(8t ͣwX Ï>1:BFD(@']RSCfai$ oKlyZp8LKR؝y6F|yUlcyʐk ;)OS}d u%*݀ 3xZH{o N"i\IIxKw{ec-|TK m1|HL{$ #f8xt*${ߔDEC?r4T͡!%'-S{.iYa+3YۦmfA xTu29ێ7svMEk{P%L8rxOlVQk:FДkZy=v{UI>DiRP8 A`'4@ۼyALZ=ED5P㵦y)nHT4HM7-|#13<*@ TJa7A9 :y"C<"!ۄ~ |e| (n 2Z3Awt vR-& H*F#6SE!CHqr (yA;rO)۔ӺpIR~(al@! F R5x1⋻a:`S i<*n`0GkvCe;w<4<ʃ& *l<e;Gaݢd&};tEޠ]IL%5 5&[}# B7$t߲RgnpOP^&HXYFP{\ Q'Nm&u0!%"_8kϗXokƦ(~<))5$~)tCK,ׁ>jò\Ϡ;Ѣ`JCcǀQed m2O oxdhEiqa! ]RSV[ 57wђHw=Ē;3OBq Jfky3c`@T].:ʀ;=7Q@pI%7'n  [CFBb Dإ IIifu7P{v3Z5sG'D3$ꭶ8m<+Vql5]Y 4m',{t4IHͬ66-UQ ' 2AL] 6Kx"&ݬ$Os`iœ1V3Pc(LxM"yN]:زƨ$1>v@(LsUwdCI0]?DMV0{A qkapL@ߎTđ<%h9 (<AI\\|Y gD5'TL}gRBomyK%$ ;AJZ +,4 ruPng%#$v֐eq<@s'EidRS$΃`t'R;|pS?4Rl.h nx#@ㄟPAIAFIḦFռi0ep|Rk8;B->%@*a=h "7vyV1kLhT&8EawC"CR-nHRy=%qwV>|P@vҦt ~ة@HmS)ov;W&Gq!I"LRRZ9.w;y:m@J%IuO#Uz;+ߢi NQa^TäHNLh NN$`Cc\q ͎1?j١{NrP-Ѣu9Pk:I oG) a{`'XUzwo>?CCbIAE$;Րڄ9BNTCS1+%Ʃ:R )s?:hZʚ ;@&u='"TOsvq 2A<+V84m 5<{Qc9 IS)-V@]TCQt?4|L=a< d领IMzµ}`8xit(`D)2 uK_S,pVH">&4Y㪪2IC#l(bDBHv?g681<* SQ!@ n5; "!8|peI)tJc G!Aǀcgph3=B "{$dMS\M,:)VΞvzHj@HlR7j k |iБ nw&ݪj$moŧ';l0"SKAJMՠJ?q3-ӨEH}׽>(4h|3["5Cv *OsDIKt$=],,tstQ=Os_rc@v(bE0uYv+7 xj\7Fܩ5lNjhnG#q @c~IMAS_᪍ 4ZWC@49B4}r$;imG0 y"jQYk6c؎SYP`SۤDxN(>)l}wʯ ICIU2 =qU=8):$AIHEd1nK|^`|;"t td{[@00RI#(!nsI#X4쩭viİe9'tSnE(Sx<*uR,h󎲓ru10t)`|S De%#De):kJuڧ'$6Nn?jXL6 Jt'(#QNZ DH:H*'ĤL#t}{Ah%9kNJ5m*R-#}6:U:1Vw=oѧhQh.?SKԀ5(QV9cw;Y趽Jw!xjSM?(?()Oiq.q;C'ArE|w*Cg=$L]8HdKx1QN>jWWԔI>9PN ku$j.k9R\5R(nxNRRb$^}"L`쥯t32JFZ^d@Sm)̝a@w%kKN;" $'x"8L_0O*SAp<ԙAn2 GcI`JeIAO4=RЀ^Gf!>4y@%5  l/Kx:{4ϒNb qSmIK00s V 6EmDĆ5n%%5\8#Zlof; B^!MiJ6d yytQyG8<tuɷ R> %2RBp@{<[H 9'P`GMË2PҞc .|$H?d!]A=І_r( R$vFG=YXf V6 {wR}3}p<(a4Ih#d;LEӌKnqYXKIy@ǘj`tAio;*n۞ߒ^t>tv'FKL׍e%7.ֈ&?t2ּm:Y߉ -h'k Mlj]c~k_\D`l)דG<(ΊExH?00K 7shŚ;]ÉFfnj vF)AO|)ĘU^}TyI )a:J*wkQ{伸Bmdd41eaY-R8BJMVA hBAn㕔A4i{j) 07:"QHIH tH\Ĭ޴w6nmpa\wqo¯mhTL꒛ߴ\ S撅w {-2\ƴh<}*u߻N 䒖HxF<-6=`ݩ쓴>\ H 1,ҜXZa%8WA?Ca'Er_T=.n߂LJ< EUg,4uۏ8A .tN>'Fӽ9Tuͮ칬l~Ah:"u~,Рϊe6DA-*vY=J-^qW1 A j4Zy*/9nrN؈Z5զU^xW*dNFcT $7>I!a'i_]4 Q lwCZ)UZ2 KI-է,-Hr}aY͞82k5PC X6BuFxCpaYP[ʍHP;LhA%3{-w\[n|`k#6_el8'E=! S-lp -L5+0f "' n{✿s -w~hJ`ǵDTCvN-JA z.wҞV>jgE;'Z!EZƩ5r`Z79:d}ׁ\P!VYs&q$!?P$hN˲Ɵ?VjnZ~ &{ m4nIsudWO=g\w>p/`4i Vm1`,AUAߝ<9oVE׾I%A$l콆7H,WCDI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$R3~(jIۗ[G$@&q)-;XOZ[04F ӹ|Sg3ęN;!)-b:pOt$QR8w?( |M $I'4JR$JcD|eH2SD)%\JTmT3RЈUN>M׺*>r9O6RH$*.h' AH&8Q b#1$$ RL5NF@;$~hhTI$Jm&ҜM))s@MhTC#K)%0] NvQ<'Qa%0q" P-S D$AO'1%>[[#RϏD4Żyx$L09I)vyHNd uPS HJYәKioܜ  (YD.T(M4s:ݡAUp Y;` aKDLSϊjVΊb b" [qQRU05V!*%yRe(I4hV3䩓%Y`~ tVH +kG`\w=R " sr8BvaMKtiLI'Um=-В4AR %JdХDx$cTi@S%͍TbS)gL#ŦHȖtLj;6~2򘧑ILNIRi<HovPDpB [m$*m&uUpI UeJ":Z)kH$I/RI$I$I$I$$I$I)I$I$JRI$I$I$I$$K[wfY~\B왠2GfP;hy W@u]bU1.N$TNF<&ߺgj<!vOew <>8QVԠ ~`ph?4JY3Oo DA1s,"F`*!'ݡjf3o)JX7?LvOe8ÐcxŒ()6!A\#IM4?)YEL$]iH؞T H@8N"PSK$NU$ &9HF|Tyq3`0p 0 @3ljyJc onOy2ɍe>uO2oG8q>i)Bw\8:x\5C}-"]mS9)\"O{5Ɲ $Ϛ9v`.=HS䊖kF BD=ӎЬWT +;'Y+v4XX=]%LPS^zm`=*\#- FƞJ.GĦ$EIH˜Ƃw!0xOI&DscS>&lI@ 69J#NT>H)(lsʎ; vE#|H* nӧ>i:O< #ʱs7ȨE@y'|nALՠqR=)@([cJ`w;TAZ .;!{2q8ߔkǦݝSWw߂UH+3cKP4JΠ獎@ΩE'65PNk\FéB o-:%ƪ'^uIH.$T&R ZS)JF!Q;V c<$)RIJBpZFФ[' f4HGtā1a' C"AIMrH>,)8PASB[xvccB谐&#U0ցB^u5׿tOku:$UXvȍAz"6\$Jt{N'RRTd({1jl 톏s^dd"9wPp-IL[-|tӄQcXr^68j5lx p#7wt0 #uIL^I?$ ,?VAdr6xgwN: $aP}Z䧫tIu$;XRsM0:S:D .#i#KtSts5R$N5&.@-h?K7 6׼t h#@{p<HԣY,fAGs?RyL[:8IH@sNr#m-;sC/0Ky\Td鎞I)#idOk{Z@tS D)vM!RhTӾ#AjTao)= l@eHJf!H7H)) " ú-KwBsۛupEL$ULAFL S1c7$S)n>i8Tܦ));HX1ǝQ >i H p{'Uw`s5FqΝ@FR/'<$h5|@E#DŽtM:SS1N9848p/' ]R*.p!Ɖ)q"-LΨNH:J}ݔ?50IL>)n &5>)>HuN$ޤn&DAAU gwRl.w~Iikv@UDLJI;0HEsBmܞS]Is)q1ʦHƜRFӡ8Gݠ!=cHLSio AMvIfTJc5=&M|%S ^ t]$5=eSf`&'D @v*n˳FԢm;G<)UX> d+71X|5cG;UoJ'i§kKG\Ǩ KUw|GiTtRC Ae2<{YPp [$*J}?JOGE:U reMGTmˍ)4Lj}iA%$e~k 4_KZ\R!MӪM$6Ӎ4Ik]d<?8QʆpZ@Mn't(LNJ)(oaj5Zەb[xvMP{bOK AК Di3k⒛OcsO?%ZֻP#+s=Ǵ+0];Dh 甔羢a=@#~rk1P<#⧿Ǖ)R4vjd4@|GcIG(F&~d0uH9F&ۄ-i <):&ߥ4ND8'HkƄ}xdg  3 D죸ĥ')v TL5DZ aGhl7{% eH:RJG!4m5C,4 ΣUѢxIk{ 4|O9`:i?$ҤL N@Ӕ(mXF;DTxݣ|Lk䘳ʋZTI,YLβZѬN.+H v4!5TO)pEJq '=SdLI00%".p>Bue1) a T[ )k!<9&K]s!4骈:|T- $a$ԩ4ة8‘A 6Ļkn>@7 =xIjOO~)nIL6EwЂjO>y EG*[N  %k'#A{NݓGҍ])DIH Kk68A%0O!KȡDŽRR7:s|I84(ƱAה"ewޠ'A FTK% jV>_2AA,s~uip~*89) I =nrLkGOKk%8$ƇRivm{GC3[Xstwq*fgTۊS#!q ) Kat'BgC|Tp?${L|Ze0~p?Q ߨ#N Ru09S.|1 IIO[ ܐkK BH:O8tRrXϯnENL *`vOAT~1MQj -'`lʜk%"cyHa%".еѿ̞@N'Ĩ~T_akGJmI#Q :qÆPr=bi 0tbELDwI-U,%uǀm/y/q.{6gMSɔiFL{cG0--:r :JcvԏO I?%3`~)vɝi-H@ HARti >~ @UFq'V&XYEk-~;n<j4c+L7i O0m'3 L ;TOeeZ cTv~?RYpm,lvZt)E]"GiV8v]oSiG ?QHi Bׯ%BP5M٢ˏ!f9X4Uk+Jw) VqyϠ9Rî'j6CJ# C}J%'htt]?hEfUA}y SKDC%.+p'IꯓckL<}gykX;mp Af0:RL<$-r9ׁ·VnT2uI! oMo?vT́rl!^6eF`VCI%;OށRLFD,"Z"Uek5u\X#˜t2Aqaa)qvՖc#ȟaT4x:#AugOc?/h;"b8v@[Xw>& B:QrT8));*רv4Os!guO g!e!NDx8 F#_->7w!UhxpG-|si =IsɕMZH(5}ۂ廃Mjsy!IN{ToI$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$~ o+)m}RlOJEfO)0ʶy+$R 8Q%']4읾Bm;*DǞy' <)R:q4HH:Hd@)^ӮGr (DI<$RS N6xM2`$  O I%(BRBSBP n1x=0O$\%M׷u*> M<ВpOXDBk*d%-{(H9)IHh$ZA|Sl"H1 :{A!:pQI<%%%?t/Pϗu6=TܧLR <'$5#T04NhN bJJYM [@#:vRJƚ҈că)A8Oi)";&1\H (:<(I)pth!0jIfjE0C{6L)$ '(&)%0. IR rr`S]'GSqUa0ҞcG* sغW>+ 2FR2 9RvQi2E"%(e&Rhh > )}!&ڞM)))x5'O.$%$čܩ'kTSBmS$n&t'Bx i`u A?IK:4ySSQ=jЎ3',MR/!9q))̱F.%/1ڕ@at)'<)RS6Ӧ 6@ CtcND@H91qBMco)5וR'JIvr Cx쬆i("iha){#Ͱ*li)Lvxƅ'&0nK@K{*uw<hiH:;h #TJbwhOkn||<'bQ0q1.8JL{#)`΃TNT jTv#Dyr\һ; ]cx9qAB I$,I$I$RI$I$I$I%)$I$IJI$I$RI$IItIvW(cm£Ӫ!2L_`:=ʇt)wR9QS*0L"NnL ?*.=I $RnJHChsG撒&Rs#2|uV;N LR>$D 3Ή)D uRu#ABޚt$$& ynԨH\vH&.IJurtKSmr5'6a!6!{u%;'L.g0< r%-42HIKfJgn ׁdA=" D8O )J*d*Xu39idr䣴DT0&unJ32vLA ƚ>)j "Ԧݻu'n(57d W:*GGȚCvADL0 n-@==tL5O#OTaad&p 9Doa4vR`i);,DMt1ܕ~p7Ds%J|lR_mh DTh$A%1RLt"1@Lm10 H@|R*Y=`vyvW%#UF̑(h: np 2vSeΐ"\ѷ\;S28V>'ƾ !'.ݨxILiu7\ggc1==*n ̤@ROA<E6>h~Lޜj]0y*>E'dCuPeA)L8i8)=S'PWn"O<={A (iNptIM*.yg 읯 ԧT@Pl7{~))l OZ\$' L3}P{NΪ-nu*eďl4k+tķT٣FBmM%-1H?H)sJP GMИN@-Ǘ d&$805MdS sOb$ :"cJtSFRSP )N<@KER5IJsv";ߊAO攙G LuIH;'^}61=)ɎʠFMIOs !% '✒tL*mӒRJb͠;ʑnJcvQcl$8B:DNH=RSuGXsN;;1 Mh#TD>ΝXA)) G*Xx<$leJ8Y0 >>) JY;H(?HntJZDA)f %-X&]"U[ƭYB!8ׄhn^v(i4hRINkKFPȯA8Esh J;(u JJZO  THNӰ%$ B@ &s!yP:DrJar3Z8'±<)NPT *g^<;^+GbCESgILחG-= (P EPϒsƩ)3hny>*-;Y$v8q-;N '0%,wLAtSlrGl@y(ةp%%#l1Qp {"yowR|Qg:ZRi% B݃uOʔiL@%1'iзnpobcT|yNÝqʄ1$M|SF꒒{y)#54Rw)n<{Ljl@#INdNS5O*#I= @sť^S ?))w%,kij詸# Sw 8)RSh4F̳o'}]HLHN#w)8q ˀE"' 4+{E'h T]SʌN84T o(ςR R{'EL=(I=)$Ğr|5CuLD-|uL.9'2וukh Q#NtTƷQk~i A'/BJEm!B|.ӿ&Xq["O tJnrѱq*- v ?*fVD1ξ rg4?~ $FΙc@Ϛv L\v-Pq%|0<ɒs ӨA}&'Cl24DO))Z@ ̟)$?J[vR ӲR9k4Law?rmEy߂`@JD%$ tP[ 96K.!$,gX[AvN23P暑05ূT\8qMIHHQ=MG ՂAT5%$hR&} {\Kὁ}Hv<ԁ=xJE#sZfLt(tiSSJ|L$1QcxT4羾?˜f:j=HLt甔5>]v{bTַRho<;&&t<$!%0|8|9"易= Lii%ɬ$r4RL;⒑X?_di#1Fs(o|h;#IQG#5u8 ?54@Q[3OTI3qz$k &Q@h׹Qp p5H4T}{i$(A`*. <_R$JaR' &Q a QqTKp! ,.tQ+lw4 UcO"4Έr4IKu!Ay:"7tO3‰!5@"~^(AŅ8?"4Dz2`R`Xt 3*# <]t[Ɖˆl)Cmp(\cDu ĂDiL%>P rOJ@L"!Uq(an;S4J1[ꃤJ`4kJlG搤wvS д3hBEyRʁ)43mms4䐞\wi:#Wf84n$S׺#xB:|JiVmՐ{x|RmD t))lGڸD{k;/]~ T䵵[$O-K7 *RMZBX5N6:u>*NiwmG84*|TTN^Aop]΁*L) W}OI#5^Z'tX'r`yBO (N'2{?m"gvqO1k?<$m`]?%7}{%6@Q'h;Q'E(`‘"yIMPAä#$i&+na-a㒤44vBIIf olZP.<w7.w;glM"AFgX;thAݪinNOr:.3*F\"  hwڞ{$'QTw%1 RqPxHsxlJ.< AH'iQ" Du$xS- O愅ReÍ~JduGw:HH' SH)Ih9$\2Zjܒ`+e={q&.yF(!HSSÒ`>зkeMgb㖺S!=% *S&`+UQ=p] H'; tSs"*Zuʋ,l$6LGb;dp t'Ϣ'RLI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$?ndxU}M;%T _)Vi*ʧG]!9 DɎYq=ݹAc}hwOxQJdKGt9?nP}CI &(I߬fܧXB$骊J[BE%&%D&ԦLyNJRvf7^>)p)ILD&q&;ၧ}R ?IHń9Kc=p윔2t0 cTJSIH$XIKic) %D[0G`#ĥL#%I)q́NF'Cy1"N%-[#()n`xH'LݦOyQe")&]:):(Rdi@BRRSpa5H@gƓk2dzj!\IgTFrt&N )@L BA %]$ׅvR$*-.rnSJyLBJfѷ̧uQ TR<$$HTútM RM㐠O>)H0::'Rs}IQ's|cT)K*pI8)Tj#H2ApIH51{D)옔˝L15 i @'\*ᄇ.:;:(!4Q$'SJx8 `V ҉jJ kOtG08 KZ;;'oe@l[FN-t(LwiH)O>*TTc4AQNeOe!)!R[tm#*e3 $)vU"=ջw 4 YL %:%O)YsO!S`A@h׀3S5!RR#h_t olyu0|<3pS,gu7cN öH(Xd qKvˆȁӗss !{S[F%I(pwVv(Osؒ`wJ!!hRBr<.I`4qܡÝ2 s*0~jD%RM;El$LMtk S('A I$+Ly ?<ԋe%,Z`Ir@o^."$k 4cTTRBJlLhtCxC!RR> )b\d)9h5Ix;'j˕-(fLLfIR2u )O }čºƴHJp3G)$S 'TRSӠQ2Šm̟0<)8M!%%0 =!8$I'>5SrIK2v$m|y;]O@!8))v5ǚH==;_Ab{") rs%5IOca35U  ( ELwNBNhc|M0ӷ{u# GȍcyNGd'7>ӷi8Rf$m n"JF#E&HVko:ǒPBJd^\{B{h xhv-S䂕eDIR6{tQ~O;K v}))bwqL";O[O(H%%("IBcS.'0&`yH" OZCK4ЧÃ1$&pDH>I)v<d(e*o%G:2|SLJGr‹ZALq x%NV[kmDxDR&Rx|H>ѻB`xnT -)ɐ%rUI[ dǚD8L521vO$$(#≷t:PSTH:{$5)) &:ISZvwjM?rF"BJU8Dy!Z &l:$rI]w2 )d9Pi%p'S kkݨ!"68OSJ\<;NOa|;Ab7%n;SruQ:R@O`:k4F{4L-7" = uC/ ~)JqIL ̀I>)2O>J.$8IגJ^E@DsWX^S8vd8Tv꒑KZc682͠=CB>(ا )$#_"`.Ͱ?>\KZ LHO985R>"t7H~;q{S<wK#E:[iHdh"IP cҢ9: |kaqϒ&DwRQPCI) Ô{*hh wj $W:fõ.Nlπy'򨑧4~I=%$$k& )znp̨DjuRCb?ڦǧs{6JJAu@([ժŻ4"S 1ߛ%T{'˛ɨ:'gd a~hXX^2 T> eAINۼ}=Fcv jtl`sV8<"G*N=R7&8֪ƭ{-=ƨuQkCÁMD: IH`43nOU4A< t|TdN2œ}Cѐ]:vh J^ƚa$ǐ!' M#8ۮ<)<#)᣹V#OtN-49*c;`z}'w(1h|Ѭy Q'OeT%1.qDRutab Xtw>%%m`Ny?ÃeڂSfg̩Zwc_%5DNj|'s*=y Qoʞ`? =9Sjl p5Сd48D-4xPpeIƼ\w>I4 ˷ U{hvN@ )T|Wh/q GEL"u>cD} ?0<&y/|qv.qNiÈ{KžsX~:)NÉG5#'c .4IH۷s RQ> B 1sLEƺ ƐI%BZt(ɞQ8DsS>E%3`j|A&&g'IO;p|S)) S4|T&'MGe0 H>4I̦vNR>I)wVyLwiƉ"yY&Il7LL k "=Ԅp:+c4<,*u[Uh}Dk!&4<)4xLfs"IPt_nBF%(|S268$S,>J30a*R`Nly瀇U8`J[kgT3['6= Ф+V;Cu2Dbd?ò><vK[\>!AIB*o!NIS0+C9Ujkߺķ$7ʎS4IMA]>'8Ei{(uNo))Ou˪h(Ս~FzWЭtAXQ,x<8][,aQlx;vhu,G8'T}gkaڨ³wQŧkKtś'wF#[ud y>Z>E,gkmjJDo%!uU^INJ茇;ĢѶݪOZ&^S£jl ."֞`p q[]"cC‧{v"Bp2tI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$? }K[_6Tu?xS0֏5sb%5(]S5|Sr'2c@'P'N_Hk1 SI< 1ķP{G r1ILhL^ Y#FJ|.NNIKY&S~TRIJ ~rD&R"%%);0\ O F7t )&5L{'H)$R2焷Ct:=NcqL RiT&7 Bp!.IOM;% )Dk̩LNSHbS BC]Si'[&:MR:H!3NcHIRbRx~ʑ>O ;" .S'ILNU @-4&'R1rlr-.D#m THJaFYiu^"O[xJJ[U#HH|sc[ʔ$tM)%%01ȞFܔ%5H. Fߢ6 L8O1},]E_hV%YV[nvM)S"+nCA"Qhp:M*[ bJ][CBMMu`!@cvM4tA J;)%/@%]pT RkRSi_ܓ^|hQr`œIMzؘ D2e®!–9iQɔ.\ p\Cc 9 p_)8%0`t;A;RS tILO=Gd4@P` Nt\+> ^k݋`W'gCOg}O%{pI$RI$I$I$I$$I$I)I$I$JRI$I$I$ y\%).Yp㱐mtywDy%H\d>QR\xࣩަڛ'אkw┆JCf3fu$x%* ۵c%yg[ |/% "xFi)1Dh @D.<<5ߡ۠M*O2DhO/&|cCL}>ptS|SN5'pS {2TlqHi;%UQhihӰ .nѤ0`$<h$i)@)@IHp0H %F{) m*gռl[Ep;'4Jk IH &ݠ$ 2Ct%q<$hT kFĝ.8%Ov!UTwy5Mb[%&$m(sxB?9"WfAhLuDФxk$$VHfTqo̍ĝBvTa@@Dsdh7Z<Ί*vzNiEEO5Pl"k^lkKNʳt8Ox e;5MJAH9"R[anc ݴ>*fmBcY!8B g]n.s洍H*V8 - wq`v@NAx(QS:'=6Gܠv@)53cE.|gSf|>) |t?b}A Ez93X0|LA@:3@s h< >i<.uQg$D;ݐ缍T$DHP-/:CD:$' [})>(`;\NiR]T}b*2G#D2S̄΀a8)):Br E*;\L8)|{` l~ ۻ*#X鴝RSJfv6{()OJc2wJSI|#␒! bJi gE5ILXHA #rFmt<|L!Kchԧ~䒐|HFk,. Ħ86^?D3.䦙L$II)Hx#T, odx#Y<4w)ܣ$;| *DŽXkt(aFw#DRSX8EŰA|5Q[_%Y!ix*1Tʛ;())&'TB9 h0xQ)e)vIJhp>>rR]bD- IKt9ړn ">)3H5Gl=ά e :)4HSN)IK:AxC{ۮhFǃ-Q)JG@i>):Gt =BIhN;򓝴3ˆT5;L}J˚D@ylTL4MRRMCTdx{huMikJZ 8>AL~*w8moQJO 퓪JFZb sbƍciC6s{LDP q:vIKâ<ƴ^pnNb{GzMdR.3Ef fJ]NxLHʕl8@x4'RѦ@dkX$:e)& !2+MH;Z vMtr$lx#B'de(@VNĔ]kF6~Q8;|x(xRƨ)&!D=04W5>hP6{&%3m<Fg9ZЉN$w8Le%0|]-Z4 ;B#N `Bpa@OS+3Qh: 9FV.lʶKA< FMcNdwI-;[(`ȩ%* Wun~:@?;:6ςJVdGgUʃK8.Qh w:NRk^_ϒhd ^ $Rɥ3LɄ󦜦tRpB?IH ;S1#T:vZ@O|.S!F<RA:I^@:\LT+OSpFh)h|S;[m*vĕ,w"k'MPFDxA Kw{7颬>xtn:A!O ijA[d@%/Eh?sG_;'4)4tQ*]1ALcKK>iq! yN@-T"S".o92TZ^,{Ģ: !&Ӯ)8kG*@@BqZ&^\&ts :yqTm{F`CpNE@*j5/`@잶n<5 |iبJDI5pI7A;+}~MvƝRѲ)0X QRu| VuxH-x3:̧.Kti᧚ Ŭ{7l${@ԣRZ'x.lkpI8܎d$MBhEqx#A::vH]BN p )o;o٨/Vi~Fb HD׸91;N⒓&gDѢ~aq=|RiN{xIHX 󿐜;c"4i;# 2S̠˚2u|g`&I'60-ܜ슗{/'wq1{)Qk& bCDNJd#Mg )ZwtzmN qЇi\!Zff@m=ˏd:Re}OėoNԪ 9agaj21dFh$8LNIhsH삚6: "?OW;SF NMdC>^*!pA?j-y`'Զ KT\쒗Vj@hL4JS0P%2$7q$j{a y>j5S9*lB;A:r"7^08V18UȓOTr[=YmATWK (vz}g]G'(Y_q[@OO1qavO?HRZ8x4KLj4EeMA*OE:P#q%${6McΊƕ<ͬic8I'D2!:QfGW0L\Q頸nw܂Z]c[ۺG:Xm_> oReOԟWV5rb{]㢭pKt3$rV;CD7S\{ZC-5!]=MiqYUu0^|@.U⦆TVجTz@RӨ^sXB.˱OEE7@{·V륏31`J̘_gF=8ԕc$ln;  D&؝d]Zݬ(Y y}K'Ek YyYZն5B Wljd٭ͯQςfOpwhvݙ*ٳ2樢 La ;V"I$IRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$ߩi>@թPgyguGտ:n{aCYLN{M BBi$~O~5TRSk 1bPlh5))DȂ 4xR%$A%1<'$`~H6TF "8}ɴYԾ ù@QB3Re$1`jS楹64' IH=dOhD`<:'@J`e.tIKƒ4L[HD!L'w )Mp>suGMAS{7 TR7W}e])LЄaۃSdǼ#LSΉl=H (O!$<ʓ{!=Bt$xPp'- !"R(JKŸ/ *Nq,m,o@. BxMl2N3;g6 ꟎yM)b@)iAo AtNƒdFe8MFvS8 RNi]<`L $Z )NtSƇH][G8x4Qˉ!%#pu0sLxt ;aLkvaf m'))HlSu}WܠۺӻtEQ2'?̒DSJHsᳶ9V?Vh;bѴbtꝡji?h*1\DCu윰$ܦ;s `3>'t$R6 !{qnqpG]:蒐yLՆ `"Rk* "2 L]gN;05TI!0մr8E nmBΞSek;I$)%c*5'BPB{˶&(L)pTHP:$gTq1L)ɄAL٬e&2;uNJCT⊗%A3@: 0CQ#N3!|$vwjG*ӯuXSB;k d 4jJMk{-2!,LCi-tlAH쥯t$ ϵH ~b룠&jLׅ y$nl.1*mI3\uu&O(rIM=R7qBNKBG ]P$O Rg(dJjnY+v$)QZHG "aEjJl~1YPmcF<LȀX j⊗T YU^Hi[-҃U{N^`xA;L!AKWCwQӪ[aU+7Wƃ AFaKxhTD JF>t6#)6wCkKP))Sp!8D$=@=H)`%%{ڞ5Ro1wwe2!)ƪ[dBqdpkG`DDП5Kn))J Mc!F&t`0v-P>B^jAH%,'2`q .ai>Cy ;7 %0d&cH*v:ui;otPg(u?s]a'M~(4KA3eNh>iT]ה܈))!Ѷ>hs$!XkhӨ)jӸpA[X>: S(s峩RHd(;Bҝ#D>hnԁIK51r|xL~E'q[Sp%-%0O*Pks&xLΉ)g~Mc]L!@{Oh6|*i` =SypC6zgx0AD:Q*moܣ:J50>hX&1".#Vp )H=H#Jb58 J0k1~n ?3Bm9I7%, >jU$s R6e>S'U墓0 I2$ ݶSDJMuHD$ACtPqt2 DΙ!yKAp8xL#S` 0͓Hm"R.?1&s VlqtIn:p`LQS/Oc (L;N2IJ֒Nࣹ> 5()d ȉ(uOޑtHNOd3XH< gwA`[9eGIK^!%7景D u<@釚~RR<8QNSuL41Q#%)Kn)4y$LX$␲ nxOh;@o)%!C0qTmGPgU&tQ&RS#`ۧ3<\n5Cs$GvYpd*n-Yk|'ST6S%&-@/`6UK)8 ):yP'Y )Vs\@Ǻ84'`O/@&xEL5[t ~D)Na1))yA$ q=Hy ;0"#m>) SA9*^Btdy()>) ){\d_o`ڐ;@MO RIr.#]<@&|ݦ2T$p36ƃ!xׅ7?@L4JJ]1qTDpQ2$: :ʀ#Tu.Q">)5ݴ"$pH$ꙎuNpI(F(x=xS7Xg]{ϒiߊ@Rߜ؍5RT S;wnBsNnq'NT hxO $B .IL7LVYk,##N"Αʜ$FII ;U; \t}AZA.(:h|QC )25>> 3a]sA3 FBnw|v <&zJPsXTZ9RvЩHtQyD EMaPoy)= )AﴃCDq1ϊpqBgF$l5:6EMۧG-|?s>! R - 0>M m(mdH9JJBN[-'t93a$L)pR,CI 8%Wx~Hi==@6"2Lu!m tJZ}?x;@O[ S-*N"tA 2mseBm":Dƪ81(BPC?#IIw38<9Yޱ4 e':̕;N4<|]@4*/GvD-P R0tIHiD+$5UIGRi-%Ӣbd(LGeJfwQAgt m:)S׵|U7_n&{GLiMT$%$ۼ#APF6u:ȓrI8撙S 6!L7FF 4 QvtQ*p'Pƀq^H04~*.1)'vQR|RR T'"^ϣLNh;S0A hp9iݦNīaX "TdGJ[SwiLS&\I0["U;h>jl%/atXEHohawikwG;;ekȘL}9E$-qjح PGmtE@#yNѤIKX=68kɩEة=w'Umq>B+"drޘƑHoyquu<8O&!1#DN)8  gG [ H1j=0ׅ!%3kq\o#}ɜ`<(sȐ@=h1 AILmq/Dc{]v4|yI3g2HhJr'SN)qcOfk$_L̘8LN5<8{ȝύPngD 1 SG&4Dq|=?~`0*!T@'!sd!y#D0;#Db{ D $.KT"J k'suOc?$U١4uSLi`\A0!1Bb)맂JfӰHuB{@5ה#ĠYp.:4R)IIIF3'$'k@OhrL4k0@||~TĞ H:xJ`묭ybT]Sl^ւI>-]i'S@$p)RhhѣpFgdLTCJRWn#$l{LyyhϹ%ڟ"r#E)4_Lݧƻ}+Zp[_cAxhv2~bc}g-IP2I)D!4JL*u'VqQS_?58}l* rwX]wǹܩc$T̔΢ JEr ξ 6!7pgEh9`s*US^J!d7-}G>+@BNRd8|uMvWa, 썆p%] "sm2g~ sF5Zt;edBh8 V7D^'O5EV;,GnAWs{f#G^@V,gj /9GĬetk.Y"c7GM~;|@ic[E.!l$I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$d*rUq?zٯU,&Z#)$9& N֕-)!*/rhӂSJ7ILlky*{DD { $d@I1t)b ;\l{)BD&<)p:;;&"}% (IKQjO )DTBmtLKH LRS$ĂCT T4~i$@&>|pS RxI)RĀ ROu7EA0O8 A))G)*;B9p%JIrZi(2ˌ L&( Q$pA50 @~n#69$rHXҪgvJӣ]Wcx"P+L <($ nNWA(T&RN$Y;HSBaMa\eѣJ*@wmtkG-a[cEҜ dw^5aQ<ܜ !1kf ^Fm~5H>pQ6%3+wAvQ$&)).񬠵tA1NԢT !uS9uCILOdӢIBIS $kHKvI>ԋxILp?1`;mTA>T`$ ))W~Y {)Be2<a%#%Y#GhQba A))uJD:B58H B"5%': 5@}P;XQ TJlre+2՟GF<}-~)o#)}@^ѱӣ-F##-x-,R;$QӘSmRV#s-nX&ۼRR4\Cz|kӷBtqڦ, zGp%/j 7C }ӴG4νQtywsa11IH~ v6I3H1H.LH %llB5mu TY^Ehsj<,yYvȕ}jWH)mrGp.@ n-c4Э\Wn,dI=$I$IJI$I$RI$I$I$I%)$I$IJI$]wMdxJWU4%K ~+ed}c P$NcÔ]$P 0(r_XhPsͭwr1lO@$ /atT,S$ʊ KEΚJ2ox¬X(F5]MJt$#&̟;uNv=ԁ))ȝM斘GJq)%'~q" Mi>J$xC)} )sN>PLE.;(Br Q)StN@Rpi1){x'-]vI$" I<~]?$6BI&<1L쒘Hp{&a ixI[B?A uR}ML&Sx$'OBKM652 A$]ncq#Bx%6)sw4u\k* >!U.o+`y!d\)1⧏ہ 扴0 )>#Y;1Hu?PA# r*7ow1 )8$|l`&LAUST#"nDl Sg*4]ZGd܄wqp,NRoκ+^@,N7pv! ,Oyi!0HR8C5 kS{LI!$&$zƉ%3c\>z}QP$IB],s$5)aا"{ꝠIKZcCVwiP;yF$L-ѠԔܞqIIKƈ~p?5"6yǻA8iP4IKWX`; E, 'RsܨӵS)7e%3+ Du(vKKS rO X$KXCtI:i&\֒GE5ZKm~tM8 yWâ{ v?zTX%EbFa=QtQㄹIM{̪l8{V5p{;xt΀"f&RRc]`AUl3{)<kj\)h$ v9;EKYt=u/kJZ*)P)ݨ&"{opZ9!XkFO k69%`SG%$p#D3DO)D-RR$Q'c'->i Og2R)vw'){!(nO*ARR0 I H< ^l׸ |e%!$ ێvT7k/!)1Ɗ@(e0!%20L'h槴}/ vН!5'jJ_ٷi8B}Zb{*OR\žD˓ )3l/ $±"H,3EzˆIt.O))zq,_<ˇ> pߣ@&uHr5))bD7]%'Dʆ8nI#̨tnNt1j0 (A(dˀ OS[Yƺ꙾gJ`j4Fl >*$KrĝTjdDtI-l4Og M D%<)mRRn!n5NsN$-&DS()+x !`q<I( Mht7S)L>*ZRťi1 6DxSiOM;,Ri*blO3 y{AC:G" 9ǔa$<5 {K*5?I;AwD68ءU+5&h'X#NRSrhk6R$pP!t3 ')R{$H IƊ$cS&O^聬3SF" :FA:hvHjO`PS9 ^t FA5 8 c%6߽%-Sv .: {_?E&yR1 sIN %$mM蓚@It2|Ja#S73ISs tvK<'L Ki'ޣ<IG }9LDND)%J%ƞi1ÉPlpBr @!%3qwr{ZvNu S5v@IJNc'$9(Z\'I'Ip.vD~))*5J61C+^h2$xLR)LisS{ic>|&.:O`XNCF1*` >J8|(]iE:.91D)Dp#%H'(H2N 'O)<<HۢJ]n!C( o}Oy·N=:%/CHv?K Tr4iHT8o*OT0ƍx)>)U4$@)|eLA11(NςbR'7w=X@Ph}v<4_(ASjC]TuAIl N dUsA2GtpkI2GjO![K슑8zFx*W/>%u/5ItQq!(7Ӥꜙ>䂓Pkcc2QNӴ+KZjiݯÁALp`xuY1kJW8`j9& 㲘|(43Jv%O`gw[Lo$ihe 몑82 O|PRp *$̔5MN=Te-{)yה^'}9J@KZ`{]:$=kSV(,nHV['VIē@\+C5#ִ}y%3&wƁHyI%&H42%0`| -e';f;J}&"9ILʃ$i  w<$׉Ӄ<$߀IRIH8&58$ƟTp0tJ{* `)B}vh ݠ:WS OyPc?j_ٺO)w;Q&QSq8m`@[>%(i@RfDA)<7h yr%ѡiۓ)D'AJ3 ťu4K)NRjdhH-7S򟂋 gJfhH"àL՞t:k" `ri-]5Xo3!eF!R~G0{1ƺbBi: V`n)$yNƇAe1 #sۡ^ƫkdJ ll;t<~*}[0\Z6ژw4|;[ECѪ^L32n&g5Ƨ_kWD;YlOw! !67n) K]1mA |XIst6Z=#^F5k&v޻Ha@ ljx )%!QwYWxxkb;+!0@BeZjԓ%'sic_sܫY9{^v@T G)r ( ySI$ӋwUPnkcuRa>KaduA_[[ R LsߴƀQe>* # @)DyIH['c8Ss^t 6=/Kb8I muy 4{cM'ĤAҜ9%1/-IzH{\p & JPrrws ë{`'HMS$OJ\7g< 8n$L@ Nx({)& r$UtD?r@iA4JJ@)JJg1Sȕ]o 蠒¢D$1 ʭ3-2CN~))q4R{'$8A ~&O G\Jg=KT3NA)ˣ@ [(o|$ξtn3(.?)%#-uh0G(;'`5Og%(X%u*Op@ } OTBt$ǝ;;O1q80@@ԩR?$g=`UKuzCvpE))Q9:)ɏ',~)PH&{J}i'RR^T %;BN$?*j.ޠILACxW8q{-pF/t-[D% !ƝJQD - %j JB7vO)9AjBd%0{=7w3&=h`OSR&<8jJ]a+4T@ ġ:4T`G"Sai׺n5񪛚<$YदtL2{!Wmv=?DKD E!DyNN)#\bDA*-7r]^|Zݮ!>j \`ςo҇:)?Ww9-ۣ&%"k-$'_ '`Gd奆D