kExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:26:59 4 &.(6-HH Adobe_CMAdobed            u" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$o$J]$IJI$RI1 :IStrX;ʅ[S>x;gm%_;dc;G c"\786|L)/+-q/;y$GRᑁa.e!TNCkw7sTTI'TI%)%,\2쿭=Z̗sV.>څ9# H^x־voL-q"CdkƠO߷#t߮}\FA.0ŖX,8cYoC'uқ\Nc[x}_닚 ';ocU[G[P5r yt'Rv u1Υ] rmuY~ujO#(cӹrbRv@CIQN[XI?r:s\H5c;(f[:5;7fYyB9_>V=ckGU;c*?1{=Z0\]ƀGN2sSs(zyOwSߵ͞v3{Ժu?2Ο~M v>XٹNZg\ 7OCt&>̭?Ƌ} ,-e'i2CҗbRcOkDwwmqݸ4_Yn귌 14L?s>'ECoPOk~ SrZƓ`9sL#U H?3rw'StvK\Mvjk}G%G:fC}h8,K2[=&ͬG7nrfOsg«t긵 ԪTǼhPMBDmTx(EǃDQV+a7|}'4 Kp :#WFZkZ>AX|\Ɵ7_/l?ǺXdRS#3S?(NoD1 {Vi7wH?D3 ryR=;՜cco@6c]߷TvD:RJ}oWN6WhN%pۻk7}[ VXZᵀT7cL&-}#+F.WzwW8FS;tϮ..[#UtG| Ǵ|[_.$Vg :qs]Q#_6G$Fl஭{"HRmuvSd7*sʨ=mfpE hx[v-v^gP"g[ZrǬ[D3ޮ'3SomrxweWKmU6ƑToJ?f0xcu)pz#M'' ƪϦԭ>( u%I!NAV]súf^= roKU~C;?ꘒ﩮TוE{@Hi:^V6C2h ?9.[,Sȥcc]cKw2?ъҤI9TI%)$IH-̦=7̐" ~j΃tÜinwZ\rz7S X, LvF?$(Wk8"G:徭p]L[)u-ul۵gE<4@cV> qd䢗Ir+y-n*m^@kF)ѺUf 81u b$n#cO3Ӻu`m8;|_&e*;UNEwk_>OooWa?;IY_p/w5, mHb5]GIy:9[W"t񏗛Ա0뭹72khyۻo8`y$AI$k$IOTI%)$IO~\r=g?,G_O[7p6o,c9a?_gTTw^(ܬK]gdf:N;ٽas[;r&oEfW1V9wA]\Mg/1+Yo9QtUs0UK 6?1II9?Zנ}bc0km` 1e-\ W"b γ|Z_M(],pOҊnJَ49,c?=H#M[#;6|_Vg֯OW:7?g"M9c0}Ά(]/C?ϩJGI$JTI%)$IOZgY>>oٲ{l;cx}fڧI+?_?B_Vy0Gqr}jE~͕SZձ+y]g3*ّ ekFh֍X>ZU?չ"MnԶ?nuogAl_e&P Ѣ[UP65T~gtYVz9z{,Fj}Wo`S;O~yR#F)]>l q@Գn/:miv1ߜӷ^KoOzҿGEiM0r"uf]>Ƶk`Q?3&2S$HRI$Tʩ$ꤗʩ$پ柳נ;V3ל$w\.DmC8< >lW϶~g)$mo}W qw=|Q$ߋ_נW4=ŭenזxl\2Jh=omxޓN27~~ W|PgF v4<ҳMLd~I|r_*Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMU 4workbase_foto-12 4 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong 4slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong 4urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM Iu`- Adobe_CMAdobed            u" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$o$J]$IJI$RI1 :IStrX;ʅ[S>x;gm%_;dc;G c"\786|L)/+-q/;y$GRᑁa.e!TNCkw7sTTI'TI%)%,\2쿭=Z̗sV.>څ9# H^x־voL-q"CdkƠO߷#t߮}\FA.0ŖX,8cYoC'uқ\Nc[x}_닚 ';ocU[G[P5r yt'Rv u1Υ] rmuY~ujO#(cӹrbRv@CIQN[XI?r:s\H5c;(f[:5;7fYyB9_>V=ckGU;c*?1{=Z0\]ƀGN2sSs(zyOwSߵ͞v3{Ժu?2Ο~M v>XٹNZg\ 7OCt&>̭?Ƌ} ,-e'i2CҗbRcOkDwwmqݸ4_Yn귌 14L?s>'ECoPOk~ SrZƓ`9sL#U H?3rw'StvK\Mvjk}G%G:fC}h8,K2[=&ͬG7nrfOsg«t긵 ԪTǼhPMBDmTx(EǃDQV+a7|}'4 Kp :#WFZkZ>AX|\Ɵ7_/l?ǺXdRS#3S?(NoD1 {Vi7wH?D3 ryR=;՜cco@6c]߷TvD:RJ}oWN6WhN%pۻk7}[ VXZᵀT7cL&-}#+F.WzwW8FS;tϮ..[#UtG| Ǵ|[_.$Vg :qs]Q#_6G$Fl஭{"HRmuvSd7*sʨ=mfpE hx[v-v^gP"g[ZrǬ[D3ޮ'3SomrxweWKmU6ƑToJ?f0xcu)pz#M'' ƪϦԭ>( u%I!NAV]súf^= roKU~C;?ꘒ﩮TוE{@Hi:^V6C2h ?9.[,Sȥcc]cKw2?ъҤI9TI%)$IH-̦=7̐" ~j΃tÜinwZ\rz7S X, LvF?$(Wk8"G:徭p]L[)u-ul۵gE<4@cV> qd䢗Ir+y-n*m^@kF)ѺUf 81u b$n#cO3Ӻu`m8;|_&e*;UNEwk_>OooWa?;IY_p/w5, mHb5]GIy:9[W"t񏗛Ա0뭹72khyۻo8`y$AI$k$IOTI%)$IO~\r=g?,G_O[7p6o,c9a?_gTTw^(ܬK]gdf:N;ٽas[;r&oEfW1V9wA]\Mg/1+Yo9QtUs0UK 6?1II9?Zנ}bc0km` 1e-\ W"b γ|Z_M(],pOҊnJَ49,c?=H#M[#;6|_Vg֯OW:7?g"M9c0}Ά(]/C?ϩJGI$JTI%)$IOZgY>>oٲ{l;cx}fڧI+?_?B_Vy0Gqr}jE~͕SZձ+y]g3*ّ ekFh֍X>ZU?չ"MnԶ?nuogAl_e&P Ѣ[UP65T~gtYVz9z{,Fj}Wo`S;O~yR#F)]>l q@Գn/:miv1ߜӷ^KoOzҿGEiM0r"uf]>Ƶk`Q?3&2S$HRI$Tʩ$ꤗʩ$پ柳נ;V3ל$w\.DmC8< >lW϶~g)$mo}W qw=|Q$ߋ_נW4=ŭenזxl\2Jh=omxޓN27~~ W|PgF v4<ҳMLd~I|r_*8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$PI$ks;O椥$$l<:[hI4!QIh~Ht2 U.rIh%1C*QܟrI^wK#;+)QU.iI$rB]$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$"7pRI2J:u_ILE4I1x 5I. [UTz!S$cboO~[6NV%6l . O 28ktz>*MxUi@z1U!HodO@bxHV*>W7oRUA\)DvWM@vQJrmʠN#ohU 2x] b%J̄ꡰ?z2S œ4)RBoUVޙc'ntc@#Pb I8HY] 斘".',|m:Ba*7UY& ׇ*)'--0S&!I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$0=XYJRI&] %jUUpX'p(‹Xm3D-+ HpB.0J=}*KMO&6c1ʢQێ+e‰i< ҭb"\p(>DecZX`EQu!:*X쫚>n5Ekp>)*ӵvj I#AI4FstR<TZ9өkR?o!(zQ䤄< :w*@cy'D}#DZD$d5'FUϻQ/x;Zt([7w`j8Ex )m!#i:pPK|rF44#Sm)xוX5yR0A<<s#@ :tIny*q=L  <AI,#1.`ԨýΙϏd!gH46x$s`}pi{EC{Dy" .(`z=U!M AsgP*$ެi$Qkpt+?6֗0CX`Wac9eu..ۣ%]]*[rT $aae ԩ$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$II%)$L#1OK{&RI(px j֞%[f#[D$h 3-<[F;B< 2EW7(RWKZw<' `UM#br`s D8a'MJXQ7J xhJm 9?C|G6!$3ux1]Kf10N0w$)nI ״O(n-Ѝ|ΩA>VI@4$I'3m40SR> ElD;'qq8'Jdۅ`sLƵ&-SQ #)A3Jd^GsHC-k1cGmcJ&%"@НSΥ%3jtL LƊ@ @hNˇ^?^R;_ T[.p9LFQֻI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$1JVr y$) Pm*XLSK\c׋eD+Ln?HAZ#Y)*fpP.P.T+l%lgZ"0J *1vGeMl6 ȴA8;w*@uDP2xIL;RrF qS{BkM|fr~*/'5Q⿹H:jआSĨE !@ϊ}@H0) i&Jbt*:A'NɋLvE pה~QRF |PKt(QA1Y ޛ%Jlmh!㩀c~3@F@虬Mq3+75Ru!;(*I'7%7\)#4SƴjuU}gGNo {\ɶjJ`'TIOT4sSw%6nxEtF^)R\u(9(%Ķ9?rp`|@x)Ɖ)8Ou{ɐG8' v4薍4NvAMiUdS9KB5-`G,t y4H{w7QՃ.הR2[%3$' e@ӠOKEQsKN^^RǸ@DkŃbE|}r!>4Ox18'd'EV>Af\QKϺwIoJH@:ƱFh~C:5NRR%.Y& p;)52y:`}SG ;J]==%ꉴ#CHTt KAJ`$B$S/iqJc$ᤨ HW!q>lT]Z*$v*J35XI$LB$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$"W>IJI$WYy +u(ҒM)T#Sx ^6而أªdTKnYtEXgO^ ;ZS"oCܘ]4j=у$. eɃB hӝxrPJmqQRMNx: S y2bBUsM%qݬ Sֹm'lj"t$N䟒*T$ۃtѮ12YBtO)xmTۀ0sO-({$$p%FNҔRk`k@G T.( 윀tBHRF#v߄_IJotOd]|lF -W )hX{0O.l4LOORײo3yMLvSk|<"L;DwR{,v<} TKG=-'cKtAIE󓇴jD9DD= uo@J4E"A wrRV܃)u2w@jo`!D(hw7u4T>dar]K X| {`WWED GƢ`JL;{$,%WZ$'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$ʜ _O)I$UTzc{UЏ M.iL\;K]m7" ܏ H{i?HJ <*I)JFPj aohGhJJJiCܘ 10h4*RBڔ&XD )A2Tga*S2I1'TF|B}z9(t-$@ p%8pS |S4(N(@&{h hIL@)I>Ki'棳w%%q D6 G@GG%i yHjJ\ 8ƠjvH2<D?S@N#Kv)vړafSzp@9BJf/tD Bix,^5 *,\{TXQUڮI(֮I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I'1@ JRI$0ô!qhiJBޗa›zI]%SKpM,l( U2IGxLl  R8 p"7hH~LlX-±ݑGMy䭱@ cxT҃|TMJ38N lnL\ĥwU@j b($d!*B]$H)%05H4)88'k /)* sL)5 QIY: (H<(hTKHHW;k?J>*aҘ5֍Z($ }BB#x5EVh\΂R: G'TcNUEqEꪗ'T D&Бk{})9pn/([xH9@΃D˜40RC0<u TDoON)D= f Jo4j:' iD:'">)$.#UkNcqSu#| RkZc*HvWÌzcAv!$DGT xPRFbvfAvO&1a:&<Ģz$lqh؏*d CQr^4IIYl!IӅX'NBI(Nr5N,q4_IMujpvZ˞ùxU-w 5ݠ upo3'q'TӡN)'C )}GiBntP tA8)ȏQx)Ti:kAl$)gb kƇ^l'i)fRRAT]*-n8'&NEK8=O @u1Np uO}Qs\tIL y$oP~k`6X}7 Sc%3HCF)WA:ʙ;&-= BSRxpMA1[wZO@6uRpJ{RR薘:GQ'FDM.s@DȝA(O MFgxqZ ))vȎPR:Mk0"N!pE *.hA"8HU2B*IU5 ;A<|R~X wPpv4vtIIc>M3:N{|h|{o9ALyOq:OMpq>I&%$JJ]u* gbJh@1S]x$`AR$͈%)g Es<I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$p'6~䔤L ȅb&ۖrpxZշ xULQܛzmNvFZ{-Ҧ)*P/QV3:k0ޔ$f‘BmiE `G* z (UA¹<JmP(W |B'm"uZϊFU}D\Ir>I%%%.<()yN!%#;(7RDzaA'kO`"uiM.QSKux$}5nlܤZa'A̍HS,$H x"0AފCm ; ~#TQMB#F.Ө5?P;BAv*!]ŽxS9QA%$6|Aykjx:{%SIhR՜j॰D~*;@@\=u)8Js5%Ѽ CQip'& |#ॠLOJHn`KݫRlJR-Nr9;-tS =<: A3 ^(1T$Jf\#dGm'+w>I'B{$Ѥۇ R:k撗y!;$XZ>ntHF$N8M:骖߄ $ ˺x]~s'@yHT4$ny$7$sOC,"6>iF D&;'msܔDCMҙtcwtTv%K2ZTIҒnRtDiDi”=RMƿy &?*oh֩ ;LJMdp5Bk-I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$Q(űI %rc$e- M)$қzʅ6RF"6$1tkɅbɕ*mNS)MGrVZ+jV=$'Rzͫ]=5R>hҭ1|(EU*bl<92U6j^ UF p@>P/ JwtQLA&I(D37H4ILn-Pwp wR1 H44ֻws)NJq?8 L)loyI A#U(?F `Gh kS:Y:>J[tBsaeѩ7%!QvO#&Ĥ3A `r 8IPyhBE"@:'p`|RxH%JL 3Q.ܧ4ԍyRkD%3( xN!G 02N[P`};#^"4ALYЈ m~(BF<!yO mp|RrѠKLN sq w}!rgHRS2x?( OBA>?% ["ent0P!Mrɷq HC\67 ^_TZ9%!s'OFQ}9dH8v""ݭ)!Шq3w nJr()cFmw)l> jX)rۧ*d\ICvy•O׸J4!9n=R۫t:=PGeAA1i@Q'ڜ@&q%$6m8Lv65HѪp'DBid7!k4I1Ltʜkd30ۇ))dnS[9 D|RyI2@L3@vL)-Rx'a-ƉHÄTvAH}ӾiauL`H ek]k|{(@6~J@LI#MRG&sK -t><'N9 >ANdA))}D9Sa0h&tIa'6~ ){iLI"7NbgTX1GljAuIKߺi?r:1In'TU/"gRRBIֵ$k dnH<>iFObR8<柤< -yĂA:JJF`#0ikuI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I' 'I2Hõ5Y"*$rYkGf#k$͉z92Wwm 㟂O%8ALn{Ee330p|ֈiomT bA.rJHB #g|G M$F631xµ!_<'{#JloQ. %/T8L {i!>5J@<]x)jt(bmX&6 6$;Pp 7j) O?$0v*BToID~T/=ƒBX1s8o ĦO)!,i`Hp {RugRx2ڤĤaIƊ[ H!b4R;TcY$pp%@qUgZlf({Kt)mQS'Rm䑢}ۇUs\8)aݠ$xA{'PLA))Ho~wt:ݓ:B$kbJjC~ )&0Ӣy ծp_{`BDK-.$NH`7Jp% > %NJ A(O:w&&BC TwI cӯu ~J2e(䒓@OrY\'vO–t=tL j:wB"AS{w4Qriʑl;N )$Ja!?F .dNJI]%'{%  )P"FqHeГ]$ EI~ uB&t3>5f;'"yN[R I C?(ײB5)k tQRy:)\8( d7&m@s`@ЧG"TvD"DkDޘpH״L)4Q Ëy3;e%20}T\4I|n <$F )`= ĝ&@Ij$v>Zl|" q$'ₙo#Tnhs>N|iq) vJ'$8kBc/h1%-ſKG)ޛpHuIK8=ʍn g0晤wH $$AELip;{ ,Hى3\g cCD$ "҂xݫ>` )YhBk:xBaЦT" çW:x) ԸʇZ!vꘝHpj;"kCLoyT5!8U&1RRc4 <#P:I%INBB&3))mi?::dY>I8FL'#%-[ڟD( 7AϚfQ'Tpd$È9˹%HCݢfGt%&c SqrI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$' .0%%)$Jdt[vcJ[ *o%!$,͟VnAPOrԑ[I  U~GS$?Z{', JT9%m+%?1qIR$tRS}34*I4I$IJI$I$RL$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$KZO>4$i p=$^g]DDtKwǯ 8ޖ84 m`"ST̔ rq0h 6*[ hJDn3An< DVF)ԧTiI $1?GyLTZ5O)!pm0 M25<(CBU0#Ti&H$AL2I>gDB2T=t:"/xyԎTAA!H2}ׄPڈ*iׁpĨl{(VNiiH6Am׏@B]x&}!A׵)gޒH>VQ6D3{fQtI͝ 0R4:8I>4H(`!}T hD#hkN&x/;UDI.Kւ5Q DRӺ J疺A:HTf`pdl=q> KI"$%2{@ G2|fTZvq$ΪJ+v͝1ucO$jݼq]qxNj!<iHy'*Oب:s5㸈ҡUHQuFF;r)5ogJZ4=i'FG* [Kh`ШO%$76iP VνŎe7 5$yNy%-HTYH$紀@2#_5-ShQ ^|S 8Q$ ns.&cO'6u zS蒘Oa=%QvxFGp<ŠS;t)6RRA[0e&!x7И3tN)΍IMm:BNfmh\ pq3⡩(AH%3a4UwU깮o'O6)D9M%$#S3;!Z|Tὓ7&qQ{%~i)"hy)n5LI2D)rJkno&TYcFӠ:4$Ξ dDJ ))3%;0Q=dvI(JR.0X`mѱPa|Ct=u"Z|}I DJl:6ƘiMkbgġp'hv M!SHH&L/Bg#"699Cq'^CxTFfD Nx*1J  ;BOHniB: 䝠v8a O(`!F1>J/["0'U1 )x%]pi&ntfr$ 5IH3 )DʖGi<$ʃ IB\A<?CDz}G9opypTE A!`*3)yB}YIS0fTiT}c*'9yHRRg5!6wѕ {'Hi%,-#N ~ZK:x<4x((R4~(V;H@pHDRBJfHL */{ d;p{di DR#hF9PA)oszM?$#Y씁Γ) TR\ R"%2bX :)5!䑓wH%7dTHg 'sh5ND g <0fKmpˉl*Ox%[$%^"U?Wq+B֬fI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I+886f>)$ RI(>7;@B58v4]gO^={ܵqpL+ vI'l1|yTs'UX}v[ 3 JC{FS /leuDx2)QZ 2V{) |I `F026–L5%&sB &6n<9sQowAЄJ HPDq]ۅԝTO51ڠ3 'ɜrIi%%LHJǸGRh|j}dSpIIuQ ~hE_4G׿@lΪzvHjon)6.n jD(RlV|B(!;DR;As>C=2Zw"DRlSƺ otAhNngI A1?)9!>9NZ;%A33p0tkޞ!et6(İ RZ$ @*v@ m2ɵvƍ)$s ^C4v \%Iw=- <̤?D DĐ`m 1 b{`ӹ:TawS> $0Ƕ>(gc0{-l>`!EմjR4OxS"vIuiE U'5P5M) ,}h9B f~_bLlp@tɶ9Fdp`i67%J5QRS?fSĂu- "o$xGܞutJ%RkƳ2kGoI2Z]7L%RhM$O )s0Dw Zk ^ uJt'Hj<$Ax(;OEt:)L)ٔ˛!" &6<i׷)%XD`QN}P NIi2~~LBA'4@hsrN2;DdAԎTD.DSu*aH)%rK]TA}孀;&<8H%3!( IJ Q )Z"6/$xvDq& {]>JO)NI)3]F:ЇX@{Ii~)c ɕ-Q1Ӫ \I#0`!6PDB+w{߲Lu0A"pLGuKT^NmsZ ND  #Nl#^)}ۈbmFǗj8zF?M%Ch:J46%%98KL;4RF*:&hxRܢ|J*J\4'D8yC4ȃ 9Orǂr;DW~(HwQ};A 'xQ!I%,XG:!=i!?irpH)Gq--@ԍ:jJD CO )l&ր#hc˜|{+XD(I"'A*SNEdhJgt˾).4 q \%醘|){&KDhD\ټ``4S.'>R:T̒^gf1`!4 IHH!1]B&<ҰKN鐟R;TF@IKB{tkyFt7RS>b$)rtQw P4!9מRS=QOsJy2p7HNJHN%8'> .`|Zy}.R: I :'JCAt60$5#CJIZi:S'B. z8lݨ}ku:woa˟ oXI,,(aK!I%Uk$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$]f7aw Fx~ik?*1jk!)AXX]g鱺|Sn-| y^ mE1;[XlJMvQyi KaSCwo{ς%CBڕGV^dBA!u'5+Sbh&Bpu AК;+\"DITu 9O%0OꕀZh ex)'E!%6_p> {K*m`Re'cƒQ"oLe܎%$hѯ=F&f>lBNH5 )ֶX5: 86s3/g&PÀyPAh)^SJlzE5& Cu=a^|)4O".;$;y y^*vnIP5ȀY>IO'epFm IUkyh=&s6P Kl %6FeVs>4D:F+"!$M}iUF#T!gAs%W,=zƩm6._twH?h%?TjI.耢r g2 }ݔۓ걤qPu+~jB2fFGOrTtEا*7NSs6wu&4YkTKŭZƨ㔍ZBVTfv GAT?W*<(>\JvY 'p| %yarGiPw灣.zcN$p\d4ti H@p{xALq8.jHɐ{%qr樞xj>@DG!WuK\|ےq/ŵ JÐ~ۜv +G)wS Ja%~k~'tj Ձ+G4k\K= 2}j-ʯRcW|wGp)#RA : ZZ@wMoR$7KpUD~5M#ZG!$.iN$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$ReO $H -Aw?rΑ[u:SJTpQ|*+u@4b< HGl<ҵ'&BJbVS OuF&+ aX:!^ƈҭ9Ct#dp4("RLjqJ@S9ǀUgHqPsTSz&N*Brגl1JF?v=MSJKFE@nDLLAOM#!\0{`d$)69!nw En#q(D9E![@H3 QCD"Om*O QC*R̽ې”*BKv 04IImdlJ[2to7oܦ. 9!VCvAJL-"0oxUas(Ahhk@c惠P@c\ 4'u#op hw)#pGluII vs0pk5ϟL=@ !;@93:{qN4{ZQⓜdRɭ ";y&AFop~JdJLy߬|PC\טxƑ |to "anD8cSET>;%/T;Q}FJ 8aIH:\ ;hȍ:A!Hh= K~h'RtJTL@=ʋX5 ei Ԧ.𜸿u NIL[X@L}Y~* ~4!Z"tM[SAlfdIhQ{76Do4*Bdj c^)kw\ݎpQ;ξ*{ E1CY'"53* kH-ݯc²7Gt6 nmG 0颋N$WrGGW~'mJƇ3ݨLyIOS=5ELurK8"Hb闑Sj`x!;M i]w>*"6kj9livzIY{"0yCt1%LnJg 4(Y&f (9> u][%D87.Z=-T,kH|OtRƓȩ O!hx㒒>$A(|T@I>;0Ky>I,At^dim>#bLm44%2kYYx]otQ @LkO))f5&ANׇs۲{x&wϏbt#9۬7hAN ;Pt~I GYR.-)u))øC NښP!B` DANbRh4iQdH3 )ӽ|R8R!;&dGg8jꂙI#Lm"!3_" C|RԚD8J9Ő6۴\d!8dpO#Z8m'b;6I.:C m YTW~&k pSI4]NnH?HKxIIA $vKG.e8|RA6~))#Gy}oL8H0G*bMmHJj%%3@CՁ iQ%?Dkm;#NKG06H:8vP l(L4 9h TGrˉHPs&ghQILK ,-a->j[Kb|<X *SZe9l%6<ς& Z.[=TO=-#NN:x@ ׂ %KnKF)m$ꘘ&936R6442dcr a!'s[e%*pp&<;${e~63Fv3ЦJgč5MlƼʛC@ꝺ>I!i:OVh|TIy)HFK@ hۢ cdt-LksI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Jt^IP[VUNȅTNu EdJ7N%!O't410ha4V2]lTR719<B]f]ª5O_nraR,lrXk=YhQQKe4RΎU.1gew^ҪʃL j%'c}=s[<¯ufGYPSLħRCkL4' 7FƎ` Jh )#+ױ)ݎ:$H_ku!)մꝩlumyS:7#ENJ4 ꒙0QNPc@1?H4%h& '"Gh쒛 2cA;OX =X ot# q>J^DJ7vRGtT{H?QpAС5C:$5Ӳb$T~ԅ2\G)5tIJ LS~ k m &Rg4̏4E a': 1'N5# )( . }$ "e3IoB,ҁDvAMnJ$6Xeqw !8 ;v슛#"}.e3o ۦgU (ʞ2S6nhRڝ4-7kG?ɕb%-%&yLU`0kY"SEKd6Ac몋߬4Lj`J`lFJEyB\N5fdwAk}J Sc\x#g4))̢$TBxpǵ-#v鶎H"HTmq/ỲYT6<{\8QٮdjY A uJ~fuYZ :k#mxA5M`+B9D)2 GT{wTIԑʛCHT;|SlWlxNɝreQ5;+iIn\ /X=D>U4)°HvmPzM<K x)z#^USI^k F:#$8Fm"B-'jˬG .|]&^:v0d蒝*Z4'Rn^N-qR|Lv4iqЭN{#juەLǒqdzǵB 4IAwOI$y-KrF;c>Ipб柼/DF+U:!C%d25&Mv\DȐ\gb4KW%h*C ,V疘%?ڈ'nG{9Һa;&Rpdd42c9ht+w.}_O`ⲎFnkNpDZI|v;ʃ+u%:gDnI=A-JJsOڝ$TGЄ/DNz6[*c,00-ۧ8Ki%\eR tX-LkYuI$QL  !tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$[%Y=)I$UWJo}U(bڞFV!m @ׅ&4GLJd3I)3[[#/XZ74IPiLK E07Q)4BbN%JfKq1ed ٰH'#XBYHNVIMiզ~*i\5˝XIFLѨ1hh \tP H8xO)XL A)aCQ2Cm0T $À)0:y&]v1II[KP0G2pjkAlOLaa9Ѥϒ0tOL}Ver7@iTd EP=dBɞSGhDSaՂvQpA9Gd4 )@N[#_3D)'}#RRͶgN91G?h Hyi$rJL+h%Aۏ~*NkTI4Ơ ui9:IIe9:j;΍Th[LdQXGhN:~)) q'OsE`AO L&kMN Je'ViBh5S8*YÜpNQ.Op; )j{$|DiaJg!3·S tOd 5<hZ7#}lqsxR`f1%žAqILͤ} >)mw@xFNm Jo%-k=MAg`jcRh'e5wR:&%8 p%#l?v04# yϚcOS HS& Pq>(hAA$ :#StpRROh=;\NxP$N9LHv%GtSg^S&5\<vNJ5͘%l Q,BpNRRM{&m$>>  ~J@ˆ *gc(`iP-k#|iS.AGtcN`puY8TPiumH6`9LJ@@NHAJ n{[0sP5RΓ8U24EKPdD4[l_|ArhAM)k & Cf'KwI #9 )˃2/(0y(5ÑbYS44"ms…x9 8s5)|t)j5#IJqINH t@hCA3ѧ f;sӶ)#sH-Rޣ ݫ!@+$>5N%&{gV}!]OD$Ab>*M#Ή5 ICpB`R+;uMeFbxQT'TMt))36IMP$}"tU斖 )j;rGAù@ktVhZ wH kG%k΄&RT'idTjGPi]G 9*$Jf:Nָ gPq |@*S$ Nׂ4HD*D1&$ @M %/. '"1lR;$5Kd qGTtN]GE גdw ( wLCKO=7u#Q$$#4s}ɋy Ea8t.t:'s9AH Faj#/.n5 }' 7vI)dD*K uyRsТ\+k ФZt 7A yFv &'@O)rK&5"Cu@=wjSPr%0s3A•p8xR/#@NI tO ALZ'wHL&&uRh} 80RHH%%#%ѧܙp5oi)䒔"gtwDs&`hyrmݐtwD"Uk= gv%k ԍUfjS#Y+՝harծtUT36Twvz.7YWSm I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$A%)$EƠXrVַ>a:Mt`YkZVRn=R;3v ԲJz EUupğJ%[#¶afb7W=#v9*BSTqx:τή\KipM|L]:(uHj|@$uXw\94 Dl̤Ka;%ΪAMEL$ 5 @'8 `:%:'*ean3mN? *7N֐HH>%A":觧dII[úBa"ˢI1ΈM‘i)6+h:ςqJdw` 4)#≷_JlF eLD}p OtH"~(oE<)N|SbW&{"@T<;A‰t:Jp ui;[Džu[{ݤBM.2R P^[Ϛ.$ZP\MD}@+Smԩ H?S6Iy qxL<9yRSpXgE"ʣU"}mЀ @6k0k )K\Ap3cdnU_R'Z.OipE?蘏4DBޠUSz> + g+6RrB4@m{TzHGô zd<#HJ])oPB+9Ɓ3n 7Jú_:\9@>raHVDl>Ms?$C8 }A /q Q ˁTI  C}-oNekucTblpo5͟th25\ gKyAJ&6hADM8Ca c>nS7  DJĕ-f3SRW*` eJ`O$k#ANJ{s5m uQ.hB.!LChLaIPj9IIv~jͤn167B k7`H h;lZIYt8vC3CLZcK}Ȭ#wޒLZ㺭aH 5yr%;])_H@TBc=OkЄӪVXOG$Ȓ@NTR/|^Z;!aq'Rv1!ha C |RS`2t7[ f&9KGIJ:)w$&- )qc68q!D ,3=>i)+ݸh@& )1k;[-eI_ xb@Ryv"3`!Ɵl{ʀ e斑29O'ѩJ#>jRR7Qm'@$ QSFv?Dz` G2[{Ep:TH|=BN j[^M>Z$) P*n> )֞ehwC wDwX=YC. 8%&IuIIvAL^ġ5vQ<SR SDv\A "A$! wwhII\T|S '%'44s8iШ2 5Mu!8:$^]#SDy&:Tola0$:-D MPpk ;\,ݣ@wB{0AkND[8 4 JIav "6'z۴~JL[)sΉG>I05ALf I&9- iN6H8p*:DHQ)Q0;QQyP-&DvQ-=ž5iO>nltY-x:jmh rbeLVZdj`Jl@RkL>r#/$~*< mTIII G> v?ɍw-AT@t-S'sDRS"@oԦsH-P55v;iniLcSS @(89 8:#ʁ֏lT@:joJJ|ɓ䕎,!,8ςm7k%-[ʑj&[Ʃ)3vh{yl[t5ܦ`kB0jr%/$ r䙤'4H<ӈ"dJ Y.*.7y#hNMbeJyR#l  e[1@N M0R"9'vF)ЏGF5NTZF"8%N* Ή)#asʈtnkH[!$vD,- NGc$JpXv5"$C"T\dp~)N=ptILpoJ&t#3848pN:wOwQR$Vn%ni!+@3$y!xG: $IH< rV!uSc_(5x+x< 9SG :]N֎Eg#_69l7C>I(pJXq >:('I0g@ 2ɈL$QS8bcNbhc56oO!LᲂX |Jy*3 h.s&ǂw>6wIL3'{x$u 7E- :Mdu5P6KDg7y;Lئ<'p- ALY{|T+p- R@6i<9N5)yRCd3 ŪB@!Ί-ɞ%?!-r# JJ"OT w}i&;tO-Gi A)%9yX#3p1r[v?-=L$<'hS-NR[/v¢,A*0N p#$ )/7?$9j5 '` n&v< (%bt'_:8$^1g$ W ׳FVI,#DIoVH1?cSI˜`.E-arJI$NI$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I_kk]F$fAɷѬv aD9OnߤDU!@*z ]}rW&54k"s$/:Hw=#yHRrbt:9%Xϰi"<،vև7 2ƗuD) R8ySH_ )8F9KhԔs3ssjns{>9L Sd4H#p1`גw) <BJ\\;Dվf8vO M|ʌJq#){$2^78 tK68IWqgR]w˂- 1pJr3DþԤǻv8>U1|I쒕80#4{27GJ in2EKpyNO:$5yi˷3ϒi$ j5[gRmk{vOEK5$< 7q씁*:L |RV:\Gު6b xCE=ËOrXOnxx?% JJ`o8找5iU :@@h'P A%!7.pӪ{Z}' %){̑Be<۶|oD@ >S5>*~iI"CN`q&A*R(բ`Pw .>C[X=;JZ֕!CCFUo۶0Q7ire[o궀CH'h e<@GXv vDӅqk;Q1w]e,0\>+9Y:q$1q&Ӡ|x:FC8 jAʘ!4@[ fh\ UZ Y b'{h..I3 :M ~Z^ս]<_ԯ@~6);*ڴ{I(U\.MǾf«:~Jw?WE)Æ!ߢЧSq)ݡnSe,CNU(4l\wAGt}cO z%GdA kTLRC-#R`$!3h> E۹)z{9Ψ3%A96x eIN$D0{$ʀpfZ[:wLy6l(@&Q^'PB(J xh *Ϸs`H?*!i&)H[K]0*JmJ^jZ燶'_%&}`~*Nc\'AH:HJ $OĤ܈Ӕ5wޛhDk-:&!Cv )}rt'sLϒ2I:}*U8S%nIKKZ'1ԔAwS'TXA5N9ԤiK@ڕw?F .  >nI4;vN:Tc:\4 .sKwBUd24$26JNU6%%m`-tP$4H0 rR9i>Ԉڂiw滔(xR:ڈT,tt ԢcP,f$l=67߹-tfO($R ӏ4Zv#'!vݓm6$IpL {z{O|T Jyn!?ioq7h</k@9:) S')IIFIå .° 1vP, $6Or&{̹!I+cAH _kV="G)ƣ@?G!< NTK NB<!D&LhR`{bCGt.&<xIRK9Kڤ=7t)u!~;w$8DHRAJQS\|^vwu9 x:iCwO> =ƃ(> >8$n]ĒZgy*O Mݸ$kHaKq$h%Α3]-CZINx CNRS7RH`e$4{0AM3[8)%V9v"g╖h yXw7A䖓M 'yI LhlK5IQ}#m 5)G:h C̸~Eă'Ah> (f͗{KnӐ#S0$w0kJXqLawngR-e[=2?ܥ>xh$::$2d}bƺFT/piۢh@׺pDJZ~^*dx=Ӑ]7lqm)X읂4)) lCo FI?ޘD:rBJHCxN0P\և j 2 @, Sk۷x tpXa;GMd3R|S+o #1;si$DKk>wH6M244nN$:KѴu)l~wMc`?9MrOiNGxAJks;OLܤL6H> omFH3%.FR$s> .tזv645Kt5xELƾX9HZ5"K5|ۄu !.8AM!Džw*Z$Hd"B*J@iPsX>4MOr~)]SJ kSmrsxߓ٧M*&; F'7LHͮqa 3# ॷMS8 "E |5L, ~Jps&۴3O-JO%%/^ܘl9'I5k}'An88;t*"x();p[k`"`&D$ pJD%);Fph T>)H4x"c`<<?$6Vƙn{#13┎$L{i@+yfA)B׀)O>) :$66;HR$h1N IK2߇-ҥ *_e6pDj Hw%5øhI`g4H(mig>)?ID %.'{uIjO qh0px E%1JӡaA׻hݡ8Qk <"<S#HY[ǂ-mķCi&Dʋ e?!'q )7n(ci 3)% InT`mˌ'1R5-pFѡયo )j'CDAJHA~ 2OJCAP%3uN uAL(o-Rcd$톦0B Jf㮊$VO!ac):}Ro)>Ԕ1^iD7ʉ:<)AL QsDYIp9L<8L4Y5"O@/. *g7L$'M~@8@=LI৒ lt6 pG*Sn-e1@IqiE¤>pL7}4% Z:Ͻ|㉝Qrݗi@QNV|K w`ѿEmհVRI$LBI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.n0q}.a /u)] _kk,9qZ&Ggu@+GyTZ :p,ΰUVǒ:ޫⷺky8\Veʼot;]vBK"m:yV}8$W3lΊ$񮺤H;ITiDIF [QxJe1%3eMtuԝD~*d=vP>@<'._$x)9NYթH6R"wɁo{B >ime7iHFR@dh 8O " 0BCR!+XO@C&A ꘼*!SB)H_܌]'lvX@4@`3*H *ec1Jl5-LN ,;oaw e-  %'4O8$!9k :l|$jJVA?Nt!` }!d0!8Т@[YFԝ(~H/qIi io5wӡ@d$p-&h&uR{&ڒ$nusDɓ_`ЛSwHĀ> 6\d/dƤ%!9K'dNZ']G .ׅS<*yJRs`׺wX4 XݳxSq @cD̩l)%gwp|Ťm@ fnj[0w:"$ M_W0ʩ[g%epBʑ)m)J(m84 ^@Ii[H)))DIoܜvm;\wAڷDJ_D)1pY Q!;_VkDyV"EKl$mh SGkDI8'S<(;Nr'))3$:|KJŪaR#m¬'^JN{Z4&T|TȎtô#H6 ӑ 8lh-wΩ o Ku(tDt 1$jyʬn'|10RRF]>*A^-G)μ$@<")Y )lF-F}YZI`-f 9u+^U;r.2Q`k<٠ບ>0~Zq.i ;?8SR "8+# yg-o̮vQ6G<-;Jo 75N(pn&?P5ϐ΋͟^y vtBu) *Ǔpͦ!8EVɴUWkG)n@uSUf j8mcm4liʏҩǷGw GjOܤFX 4l a?zs\a s!0Q%GdJKDlDӷdrfS!ptOb*>{hMO&xN+1D))w{34v.N ״{3[TB965ɄTiIE_@I! D >(Mh:mQ53|@%'}Ghd!YʆfQ;cEacI [p*B\g_$|7p:uk\Yɂj-exLcIIxq2 O.P;#*l,$[!3|Q[;HˆIJkA<9=D*h:6 ݧ܋]N < FS\FѠEL6AUʪK$NkMƬ8$LjZd{RNI)v4l|W։f9H׻P` )5qJnxI$! MNER\րSqM`=[&bK{r:Z;P揤Ҙ}LB%mI))vO%T]881Kԝ`; GiJW[R6>*NtI:ƒs%;;ft'5D,ߴ8x(#Ot:fO|#C4 H& 93C%26Bt,SշGk)PDCG8aS 2iJ^I=V !qw4: ,$%xU#I89$&*[CNt%5xdžFǻL'TH84TkoYp"<5h=P۷ &&xR8%%%OȢ˷Skvpww&vyJ\57O6=C&Lx]èP)@~i<~I){`{`N>pYR ݧ r:9Iow~{!ǷQ qN3`u宍@";FIL@ڏ0kj#w'O{f%Mc|̍J5 E왲RRš+#9z{!GpA 77N;`nS({r v$@D8òiiI Kt{i!3u xO@$qվIa'x%;xixNᮝ*p5ײa{' RS'N [ga3_7Xry!' *d1L~SĂ$ vd|ccHHxMd]l ypl@j E"HHj)ssXdk|R9pCqR,/p3i. H!%.Xڝt'%D: >*/:y)  )-H s sH& diq4mH-RS=⿥H5!h8u0A0l 7梤Fꩺ͚yvPHPhg-e Фg6$,`hJshGt@.i 5T @ݠKiJdvxQ3G'O"([2D-cYO  !|&A>J <ÙӴߔslSƂ ~9Hr>䊘6$xO"F'fZtR3:GA!%(mO 4ֵav`Ƀ:m%ς|a8dm߬lc ЍuR۵iRk$&ƍ!EʴObcPYN&IL 0!X{vi@Ŷ9缩y=JH!?$IK ZOg k:;dxu)+R$ꚦq'[>htD85&HD;$g$ov3؄: ^Ho7wu9&B;BJk0IL5) kq$t0A&RK]"W# 8OW`d꟎SIJwH)KN 3 0uySH?~RRM庍AD!D0A":'Rw \t;CMPij(sZe<;MBC)y'H-vƒkdˆH)m%%Ţ;O*V45 ~xQ$mTt—`'VΓlm:F*pLx>@{lm HA,#U ''YJ8rِL)#DQmԖ|S83C\w}-\A$S@F%vT*L( ئ.)~%$ -h? ) pJE{"RR㰘LErxQiH:Ɖ8"B)%xIJ-sNaq.o .#/Q9br63c=.<'*ԨX|i]L= w:z;[uBdIBII$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IIi_nN[Z ^[@\o5㑬xz4$m?zi㨓*b G{uZ'lhkgd’]+;ԻyWi*xzz|GE %5N:Qs|P^p4M悖|R 2^:):clR#y9Hf;agXc6Hy8O> Q*0F%.mq4Mq=JylH)ˁѺGtNJG̍5S&I /y|ڢvJIL͆t❾;lsC| c\  ۔J\jSTŬ$ \2c(DrrԣMRb5tTa^{&3 R9  fic0Gܝ04LDN )-v7OJ &>INGd&9N '6t";"RRvHk885|%4~t)0)O({GtNP{$АKJ07sgO5 #RO Hx$OscsgLquQ3D{&R]t~Jt4(G$t c]wRWZG"^~MqGuL.k(X5s=ן>8H:Fm.10< ᪨K)łD|T[`ԉm^$&|CQS eɎ$"$:Y{Isw Hg.n7$DQTMQR_Pm <a#sgsBO)$zr4%AByHXwhH(QKhASsI  u0]ӕ 04 1"L>GUT;LMG)HW}ư-=t%;D${w*$$#3 iq@0]c$}?*nAO#s 5rXۜWXu3hy}u >*k;j.?q?1-v84Wc07p:]"+hhSYkAU;7 T09OטGV7ՌJd$WLPe?.?5!Xʞ4QMft|:7E`16֏EQN! T3yE 5 餧RMM.KcD1ƨܩ"*u^IQ5yNX[\awJםdkبDu.Rc,pG:low$ց)gɯ3@ mL瘁3@|'x dUO'TT4H\w 53$~ nv01f߅ e#&@?8Rpn9~BfDI ynߢLxz`jRn4t1G $:Hwu~DnMh@B?F3g_4sςl9t'][L"osDIF0O0|;U C5:H2- ü  { 7OV=d1{t:#) Jcu8 ѩp {ʖ NRfj?)IsFgu!)1<ʙDL q%2nHv2An#i?rrXdT6FM=Ӳ~BcIIB1*L$`=J`IJa1$lc2\J ou=N{O:&k`p1Mhn)Ya{|<|S:DQ>Fl@:"XvN|[käI&{\ gr469GTyC!HHV(Zn&1ơ6p9IHk5=~;Lw#[H|C[7hɀ-0SM$y%.H%Eq "4kdv{li2Bʐ3JY]fFOܠûw%FOBvJB{@43 e!O(`ykH@ 'iD9 *%0}v6kB[ ?50|ZO%" @Pdx'jVv {)0x&!%# aIk0(ENDtw DxhRFKJ$D&N7qR><&iJc[ѵ& H;;]3&!?*.i=S O93ΒȤ&D6H?KPk}0{A{x(ςA|S"R0Szˈ4{6Ǵ'x T'n:5_gXp?EUm'LBf!1 RR۸<> ociۻy8R{{Ontw)ゔy Jbϴr3~`,wLZ%S$NDAr;$xwI14k<6@RװKӑ))~i1ԩXA셹GhNܘtA0krߚ[t=55 Lp m1:Bmvǎ%D)4kHt =nOc $S 'TK~ `wI ki)#-AG KvM,/Apڞș0o#]GvinRy'{'DJDhS5xO*H=A .ySk L4;T Z9x5@7l&<S.'Ol,Pt(zZ + "kV*ݠTZ:RIDC GnPxH?=˸L"5(KGpIk%$y "ԒXW -ӟ{I>Ң@ {L|JFۈ'-U˞] tLA*Mi!7 4A DO>)eH%'.Ї!E(L;0`(Ip ơ$u G' .$$CLt 7(Te%$f`ia( u: I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$&N꾨NxNt}˩\6'`!&9}h'P$g(wۈ<1J(Gi!J3\%ƈ>J]C`Mh2&ITHjjjzz!&I B9Lߺp#D:ôhTd%"K?UjHM0TRFoT2)N j\ p))hapɴIA$}_lS*fִ <ԚArEy$D ܤYtIYq$a?JJ$OH @n #\&>!61'-JRIp0H)${20{(mJMHK;|9@7A'c/%'0>i)h&8*u~fPuQ"5Ld[e%kHzNc OiUä=L5 a%j#䕾A65ʊ~~ILGy y4ISAhTژRK2A5T LZpP!-S:E :Cs^$)GC]S6DdFEp"`t>*0Bu( =R}܏ 4&g^tHL &rI |Sk`y(>xI8=a%3iݔk!D6;S JH_"{xB9@k bͺ̄ЖݪE/JgNsMPD Hpy)Q)DT܄xaqi{)j(DB ;y(Ӌb] L A(&#h( _(Y$%oJ,w{'sV:&fQGiԫN]լ|K<}X~h n L$Gy]]QVY]!4H@\W2%|g{{e\GłwtI9@CI^OA@1)> ~MlUn8j_H*B@DbEk6Z&+9Bb[7}ghj~:*u~ TI'DQK^0dZ5~r^|jPͭ Yq!'T8i#DƉJgUPݵ44y(o:@y Ԓt8<I:"V< 4fG%1P\ 'GA%J7+!mjR7K &R5wJ(n}#S)F>S(i0"C0M25&4_Mѧޝag%3 ӧ ND#5suGa[v$p2W3#{]E=OH e; =ӑ-]ЎRyj6 .`yI}`'em'&}[N)#.*>tFxˋםwFSGy&Jae-`k)u{C|C)@Ԕ 5px,}| gP2;)vF:ktH9KPa<<=rDb瑢f6SMTMTD$?]9Rf48 tԴ)9&s'8D3dҤ'V12BUT<+Kr*ww$u04RAФiI)4$PvQn(2|T#h )3 cakġx8op!H04HNR{, Q6~%IHШ5þuL S4vSm槲u:$hyϢ'^fKÄ\7A$~vG mۨ䤦pAW{ɍA9H2ޢH&S㴧f5))$uFlxC2ei6 S.:SwC;蒓[C^?GDV2< SX\c Rd ;)8fy))k U9t<{Ao V5I$J'^RR&pR44Ykb`x{cVvIGv[1S-;RS+C:?1@r7,iHӔbxJ7ȴ8T6tLK!wPkT^ < ;$LhRRGKcph0w6n:a&F'$&kB{:!E&eVKnrㄇgO'PO4̸?WjcIuiӸOYohѮ)MSDD%Jdϟ ZAk"#!EitIL,otNzc,`Nng&DJvpOF$n%/ ;tkaFEn@XfF4 "sI'b{awM>$Li~d vFRc2u>I#RԉAL֙< (5A#?vďwޅ-#@)AOӀF$i}7 jghPL94ɟ4C&u슓XAk WdYhyi N'H?W81=(& crF)HN H+wVZOq=ԝk ! wJ H;XIhj&CL9N70Qc\@x>%%B}KiIL؂8A3T@/T "D̤Z#be(\+>-N֗4Z,x K{0$b̍>) $pJF '8mj|SCTKQ2')8l))ExNC\;|M> f|;$@hNxJI$@(.s:/4}H9$7MAHATAcIIQ3NdB I9l0BAjqJ`$2t-=O] 1䞪R`;'պJC-'" l0911윈HBELILXIJfe Zd4pshiݦԜ#̦ie1r|RR*_< l.p a ja'-Rt)@%2x!H,!Ž{g[H' ` -$8{yrm?E9Sq $&6Ɲ$OH:Ѯ);FDhueH XHh84L ڂ$I5)p70.k;=I?Nә<&|*Z& Rik}{(Ȕ)#3@\'l`xkæI)* $S'MTDL(Mps#{Z3p' 6!5pHtKN0a8PVdqR9%C D%#H> FӪHfv&ڴn4Mo> $ @#U0xHIIӸn:'d#@sl54+fFH:h@ԤoxcwN{KA|ւL pHwIK>[As@stvF c7!$h@F%,at(X4!'84Q&DEG@IRfk2ɑU=f$r9q?X=>I5wNC9~ify &&hE,͖;|S<94XHOHA$KA@Qe7qcxPt'E kʐ #NSl)1<n)=ޡ=qTm" [ $ĥepG3χ?H Dw -R&<Oq! f:vKTHR pa;uq/0jM-fIQcT䒓p#M=[L%jlwOe\$ۢHod6>$BDJͶH)u?PbECWGpV>'fZ1Xeē梘dxNw#,;I.k{ɣ`8IhuHBϔ@wC_ш"X$I $I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I:e}Zhn-~*q2tF%Zv[8nq:% ꖵ0μWII\'.S]a¿ &J% u0;溡hD[[vjU׾uV8~atҰDDb8Rq/:RrhJ{'JIL:!(.dHniN7FysN<8$XkyJyõDJ/[;N`D ,.t\r% B eոjtQN9Dy;@$(hOR]Xӵ0.iI1jpҔ$4.ˁ@=Ok@ 0u <9 H,2uTCA I']j(M D"elXzzH{'$KtJSZ{qR6;hcUN &MKweIIq0f!AI ͧI xJ$RAߩLN~itSʌH]Iqƪ`4T'<?ؤ-ДxJQy^ kPah=ςۧ^pmO x9<75R7}dZ ܕWZ |TCZ4:[ /pt*.[7Y}JˆQ{<JKeCONN&(Louw)@ DILO!"~ ԨƸuP-p0\!(< RVL'tm|a$'0{`gHDs6L蒙4ܝgn>JO8'kAIĴr$ 'T 2ĩ )sklvC6e=΂$ >E,qQJJlN?HqX\Dj!O>Dħ (*T4n4Qu2<lmköhC|TvN%JnIRS#em;xΊ"cATsسA5`F(ltRs2q))|(U2pKH(M)"Z!w%'{Ѳ7l ;m/y3'ͯȟ'B!1S$t4 N 1; c!B;)4 G#_JIIQ {;!={qp ( GTr)9IL>09jMi;A!8pI68)@$y))W{~ηc& JYq2kCDɄpLv|jb#uD IAK= S{aNJf&iU8<@rTA-uPsTP<YHs hgȵ OQ}}RsbuI+{e!XlHW퉓{%yПqH2Rۋ DƠD0S!> {;L7 8L9H% ;ȬvRG $5Ƒ~F:kb蒘cKO(oliyDO/|Զ>NuQ%!6ݵ|wn־Kt#^$> !II tIK`8 x|HvNZ h{<= P@B IIZX rI 1pӉRx8RiQ&t:))$I2)=NDw2{Bx=iTi{!~L N7])Ȗ}6F-nv0`,vINC=ecqw<=r&4Rs4͍it?a;8 py:(+8HN%# 5RֆH[13ΩĻGAFʜ9tH$v)eNډqjCru)BmݨͲw |G(ls2Y^ɪ%)7Q4B@M ) 1G`@rg )O [@=@3▃D3!%0}2K{R.upLmL7$1KnyJ$Gt>Iݡ )x2!3wi!$5ƞE( !S JQsOikwIӲ& IķtN}%-k0`&@:&5T.5M))h̴ƑQX5Mc᠙)qi˸H !8iIKvB94שwlk~wb-݊nma;?Fea۬jnh)DL"a&p ? 3Ħ`=%3!;R,NtEaCDxXi4?zjy0 H3ujm"S2%2vA7cNJ-$q Dn#`#'t.i:F`|i=ϒE;_p6xII vI*sVI*k5@'^ݓV6L{#YMRl%3{{HI0,#yN;> K!0h HfX@%ޛHwBs9j) ǔ)nc6t'լHX 5qH8SJx;&~))N\ `mlA6$H= O):R RJhh10|Fa'qI:euO \iئ$"{;*P/Q塥(='qₔ\'˴$DFU $u g$[Ҝ!N̻լjG ApHh9)KuEM^`uvxAȝ+cl!Qa 7 R4AI9o:V'Y!@L< t:'0x@ %hG -!1t78  Iț4 Z`:Uv ; Fm&jRS;  sk px^KHʋo aN)q<Mfn P{LB`)ĤGIL~ԏ`4Q:TT!%RVPߡp :y "tCؤ"W 7MɽBˤMA_ʲqLRFO nh0d:g5Zc길 >sω_\<_k78*43aػ7S3MN9kr:wv2gM6p77_}lʑcOfmZwXezStҰwԼ-o8<^ OeAww0Z``0+U,k\|^r6AQ{}#׍5ws6J]þbĂDJj'\>`}m']\JKp4^X~U헦Is}gk *t떄O3tpVw $oU~FV KmTt aw%p΂J:̥8,{y|E(O $.d$I)I$$I%.I$I$$I$PdI$R&NI$I$I$$:I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$$))I$z/H B; π[KOzK  Jzӽvǂlm }LiPycEA2U|vU3 WZD~wdBy&REHݠ^|TK$xۦ(TrBSZӢE}C=#Qd` H) S'?sv6 G(~ؑL  J\u%$1kuSc]tLzcH3[Ѣ%(RgI)%b_a8ROe=[qSDJi vILX6Ò"DS6\dҘGTy*MCaח8-e|0]fO \s'UO'iD,=''xcu;q;VEToL ɑ ,̓*[ڜV6bpҭLT hsaqӎS>uA,4)1$fSO?ܒ8|몋&\ ?Q9dBv{+^6ꣲNU3<=X8~'7X!٠%IuF ⓬.A^z\C`Fa;@PI a(d1{<O[C!&h.SZIT5X5'^氈X A &k2eNup@ӇBOl fͶ(w7kpKOKnƹ ) ;xJN'DT."tPqd-pG sOEl-G()NP3 '@̲R=h$B[}x=SjL*g ;zvByLARP٬$8Rq;@1JHn0; $.@J@<'h RP F'F'ch$quF<ԷࠦUV4ĩna2`V&>N׀T] ) *ecN72'KE@L&yHcD"8xvzJIi=*Ę.vê,q `IL4Eh )Æ2ST_L8rf|TGAK AWȯph!;$pDGu׷Rv!MۤaII*X  4H3 w;<' DxG 4{O6E{  K|A>Xc^S}Jl|}`HTpwO>FQ֮'*r\=ɋA%$rD7Tx 52 2iZ`s!K|H 4X eN`>I8 h?pQwn%)۬{ۋ@R$)/䝬̤6y<:$/ [R&$%GN8LçXuKp'R ,l Fv{8Pun ѳ~[LSq ЍO 1e䒛[۲ZG% -hhGE ƃ^ƾjEÐa)Cu;wBmN&&T .i;&1T\p tRF8)VqwDys78G(d⡶ Ck&:&p JlqcrmP|ONu9̉:8)R {\ȴHQ!p`ɇwBxn`vKi`6%{cPRRr;br{Kkʍ&ZphLԔØDvS;@ sHT6|<Ë[O0; ;:eIpuD,57R kAiȓCc}e1))3IHJ˄a@5EcKy h:mS $%tӄqse'( =1^Tk*o.O!B"|Sn3y AAQ DXM;'ޤ 왚j T6!IRkm{}? ,hkpLB= .Kr%$}ڋxAC Ɉ$ $DxBoq>AIKpyr#HPcD29QQ)L9ϒ$9S#U4o#oQB{Go+%$x'a@ ID$IK?A۸$W<0KF! NL9~GS o #T`ȩ"'QцJ H-SN u)Db`y$ѷ߻< AI!0SuN,min>R4$A`ۤw5@M?4Β?H:$Ԓ8 c>%AqoAR驂 Tvd4fD>"yED 8$y-RWcx}o;D k 5A1 QD JPx`v45B!X"8*>$-E:f%Ot S@(hA#fI0uQp p)UѢJOh˹CfNpT\T^5 HI{gUa<B% >2LFL$NxJIJ,/|Rs]u>0v 9S|R $BJYp ;@Qu-%1 J!%/ LH*mx?3 |PQ NR8=G$! dxۡ)JXĖ*d wt֐ *$' Qu!VI0y%%A BrTAL˦~HlyNsdq߸A0PBva3B*d\MnA4?QoSAKOFuWAE6!ڐgkܘQs`bh#BV?kd&bğr=61EȟL~8}˰8]PW{t.k ΉGRR|Gg:/r'jCӞ\h QwUh?͎cwYT+i}'`{0Lihvz]75@W0\ <ܷiEPMO03%GGg=eB%uJHɎ]!HC5,H> >^-p?_A\H~ѭ;zN10*'Y>jM :.oexKmOwBD&m;tHp5Pr5gE3H\);7AeT`Mjh%.$pUMV0Ȥ2^OҀnO7/?要Qv0?4gY>ʷ4ɍO:j7} `zAop>x퇩Q$RߪnͿJ8 gV$"!s-{aJOaEo IVfuNDʨr4)C4I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$$))I+ѺcBжqu,^3.Ѳ^cmq3 k.ˮ>lw`2]Ч{`KZyeΑ(`dwx'Kӟ$k9HIL@%'ŢF&͂Oy`CU"6W*{5j Aa肘4<rJrLT 9Me-M )JjtL4㒜 vKXK]ILĴRhd xR撙6c&KDQQ#ou*p`hgWAoQt")SLp <d)r:LDD)ƉD70$F<%1.RBxۜ#~ NnΈM`הoQj >'DļƜ zɀ`c@Lx:=Üsw<F;|'EJ)L8ɞ䴟P"Sd*Hـ ͐<| $gH=[ h)fUusi"X8kL@ݴǿHct_V|D wP¥g֊Z';qߢLIoFؚl.֛, l-$rfq%5 _.^@>rGC4Ny:;N?s0ө2HDku$|K-3Or!Wu_#Y`4SeCg|^V-?Ɵ P4]Z VvG\ͶDN+y01?r-{򷰾tX! 8(*>~h~'TMR9%KqF )'D>i).΍  jY;hm AS'P9wIK6B 'kt*oc5*>I7@v[4%-Bߡ=z;n >HQa knjSFxRh3-ILh&Fvvn9P"(0t))zrd)mk pݤfkd&/IC -psgQ#DnI)>ZXY\iL]GP{$RhÎ]1 )-Vnǔ !ݬ;X7sfg*Ž$FktILpiiN!Z;I*Ac@i/i{Bp e:9RSdƀ%3&|PjA0\`A{Rk e$s nk.}0CYյ>:"S)%9FM`hb%W-67XPT[ts~|@Sxx1-x_t!!mA@' nRݨLĂ`:>ŭpP~gU "[N ٯ@S:))/vm$hSUgd&^5t!IAM'NݼhXxQsZ a&t:"tNFRR0p}ȩV[kMdH {ˋ0c{O#– 4IL{$^ɋ9B͟H:*AN5LZ#) I )1ZIA"uN׼i] ̅ 4hJ5BJSmk j'i1D%ĎɴHLᮅ%2u#g\JrIl82Zd)A)R ZRBk6_I{ piyH:{,3)tkF)H:%2G2e` ۴ii.gnEh0!/}CNe%$XнXT"jvhzF>"`Dhۡ )f3[iqa%/S,p)IQe(MsL$ \OLF5RHs暦I]:CA::<읍 hJ]Ȥ$}AΪ7Y[T|O~I!?lϟ k<` À!#0a )q?]!9 Ope!3#E I{c)j~iF)#\gP<{2a'Z};i0f!8l))tGBi|5ߐYӪcfS(I;)PlI{R]7iNZ{x#+K w)m!")MRݥCCmᯏ s?KBk^!  SNm(g>|y5: PmVPL\XA2ѢD{$8Ri)s^a̱9H/ "Hk*$%%k;'cn]]Ϛq5KoU8N)vIK#Mk ~5" fI:'$`>*VDwN.nx(fFHA;B:HIK᫣jaN @øTK T 9tIIEM`whK|a|-vvyNuN<JJgq{ > QS-:)2_&ANZ;$}eGN4jUiwpE۷ 4$Pt{ M=1ԧNS D,i$=ГQiu0#o)IKnuIL䝮Lj.O ,u RiBBƇH";Jwn $tGNL<()Ƣ oxkA-PpOOsn4'1JbîE/n׺! &$x%BIS~ iײ]'*-nçmR!><&)5uIJI3^v(ltuu4i@J5LP*\$McP#@>h#D:)mnIH]!J"4 ЋϦ8'LG"QS+t-)hH6D$vPj{%څd%+}Gk׉6Ť< $=EH|^9AKsA(L`$h M:mk>HUz'ղ@CwPIcϤR !3)ct"1za]AWq?<[rR;J)#:?DTǝSYʡȞbA.I5MiNNLS/MBSN)E!Yh"i-%ɊiIHv4SkdG}L)LI"RޜqMd䑨Ri uLJrS$ h7BAR|RcDB]#>rv[#ڥ21(m2 v<"% JSt㲋O_yH4'ǔ\)L)mwohrJhBw0!H87RTցL`$„AP)\#jea-GoU\\cB@iP!%-&hRSwsHBNAEyr;BbR:؂lpgCuoe!'U:'piJL/󀧿M"wD=(ESl'a+Sm4mcR $wDh$8 -$Þ 2d :(Qp?` "A7Mk?hi;4 )}):@dJ#i4۲AgAnpvYPqڤ/Nu1qPf6"|S4m*fd{&T\%_`č xZoDzC$.*X"GmcxvUMrcVvl#jt[$L~P8)њFAs6o "y#.h!H:]CE.*cZep0m2#a+%xSmb$1*[$YyA"=L5#\BiZ>NkR&d-N[kƄ1Dz 'rBCm`1 6H24{USY HMU) IjtېȒ=˜Lk^9k % PV:-]nD }-|s%R4|T]^a\sN.)v DmdcWs6e#A*Ep͐I+S,Le9E'siXYv|{{լk5OݺlgU}]`^~PT7O%Nɭ2>N/a#jtޅor<]֘R{, =#?[Q8^dDr:liu-.R{)qkDy'C&YXTq-PA $$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I :K:;Ÿm w7`_ &zkQR`gFR |S:&cN 8?)GDMq3F6NXR qd 94T=)=(mI0!<'P s& F*7C~X uNYw``|Ͽ[gL' J8FIo}ɜhHL?NlW{t.ęKrY]*K:-鼻S3o/ xQm-eeWߩ;,M5S߀dujf^ VUZđS +7tVHO,_SLYcO A;CuuVr:U`Lđʖ s~8,f7Zc+Ս BuQ&BJv h6qFH/t TZ< H*Lt:#T8vEx|Uk<߸ja m8@ׄW7КfJLCΟ5N1.q=/.0ܨclm=n 2!%$!AQfD%UqG<_SJJu 8WBFRH["N$4 7 BSBI5p@12I My> !+^ ǐ Zx'WRcX>0RS!+.43ADkb5Pw/q4S4*%۾!$N`ԙ>BISk=9*;)өg$$ýji#p]Հ6aF.sH[U~jsS4R7Gܡ~I#s ѼQo`'T{Fv! O%〒#;#Bc}G0XuNcjy2u L7ܦvDv}%0uo'Msla5 3 NJ\tb%$0> i=rJIhBEt\`LN28 558IzmQ,*AŮMd8)8IIxsv@ + 4Li!;0CInvƖ;O8 4OTd{|J/iHrϊ`Ok\5L*椤qih@K ԲwdU jӇhTk*/~u )qx}deL7gJvk{%y}I͝A'$7N^Tfu*ca &8P.!❻@4!LIEUe%%u-w2ϼZE^I"v5)I#^88n%#h))Wi?ꜥMM si3f5jLs` $KO}RS'oSulsdSc?7'c$ _l:5N렏i# jIꝧO4Ōc*:[EL@ wH[&2RL8Me ǁԷϒi>%39?@%.˽e'7srZk⧼xh-%L ZAR2kk>~(qaଋA{$*  ;]*D`&<)$jesX4!3j HӄtЎIk%{j #NɀT0u2`D/=*-xP4eK,COdšD3&2 Np8-Nn=H> IЄ c;$S_T8Ibaw7 T$-J@A%,YCK~[c_t8L\ SLTD 揽9̉dB"CNY8Gp:jSv\OEim?Lk;I*Djs}&R AHL|d7ؐS;<G$) m}ٔ<)y26DO 쭥ۇ VˌZ#'|Rmt(:Q.n|}#pQnF&RRKLkCrVͳ#kp4Ԧ3!S8@ה~0E^:NIhLG ){Oi]ݐh&\Lx?KԴ@=O۴]HM )r8P: bn4 5%DH'LmH))kkZH;O] oe3aqkۑE'RSjR-!CfZ׎w!&_RwH7txIKT N8tQ/,{ N4)⣷J]ǐ`Rh; 9 bӸwNM-:'¨]| X Z=iA)4 ke?IJ֍N0@Z/uuQi" J`;LD|GdS'٨ii"19ŎL]$xJZhOwIC$Tai5汝T@2.vMJJL簶$OP 㱟'W[wSkk~)8 dW$9J :([xq?Hx& <9Q: B FC=OOyxOCli*Py S y:x"4KsaGc (ӎRpO[@>C#NѪ\(RRq @ӄrD| jwA)rRS'O2{'i'h9рiʔj58:%IHKIYL3OPxDvP{t"͓28S4ʻCk۴kqd֍cE_v0@L]G*GL R)vnNhJsq%HsKS(&#Je[5.OhPN p\ARƩ)מAF5i*ᦶ BysaDpꜝ!%k[DxKXu:k6N&^l8OUĆvƩ<(+;GrIu j˄x]?JdkwUd X je:Sml_Qu a$VKg٧V~D?}X~I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$&N>X]È]n9'Ro9Z>PsM8H6Ɩ^ԶyTsZ#5|y) Jr+;g]tn㢞M-tΨk<ԹN:Q$R!bZ7T6C-[b _KSE<:ΩuL[RR%Qx{D'. &/&@'??BJbDqպNӸ@Q8!4 _f kBY]uUT% $܏pUݑu8y?L'tY|嘢Y?{2*:^F w쟭K~o]ʹvl& x-)`n sJhoVLz[:„`SsD !Z5+:K[ P[PTZވSTiIgQ'TX aL{"u!$'P$B㢋2t"l )7#ߤFq(mQߴƤyB& Ƿ@!'Cohݪ  Jbwu$̓:&~iQ-}="Oi){$|D$|;6x;Z)#X;AI,<'_5vKdxbD7@%HWA$𫼗<|g4!yNn;) )Wap-v6]-i[h' T-ӲJM1e #܅.>%HNxr߂]归Sl;]B͵D) D?3yn=ӚILp३oohQEF CeM$Iiӕ2`}6.ui!^ӻ6cqo˔'sdLAQ4EJm;JvK+~jC($ SI t:yRBX yQ&Y.Ra6uNpRqp'S-H<(p%Q/qS..1w8) BJd*mm \6p'H$|Br %DS;wvIpp.$TX'&r}Z#$F0\ {2=3Joe 7MSyrkڙ034:);bGtD's:$`y(RHÞ}OqO#M> N`'sura KH]OtRxIIjv(hѺ,s=H 3ސ6ç ae-Ɖ)g c6{yCKcv NR0R&x%6Y>}4FD͘&4Ҥ@* AHɀ "Ly|B3C y˘Dx?0dq(1pe(0ivFo1&斞|{L)8k1xJ_,dׯ)G{xٴQq;Gdjfa8U gTMcNBah5~:8>6}'4@)<'Lt=SI>*u˧q窉w)DDm'[^"|RV|V92|5C*Uf'NSn5Dh<OH=w ̈́ v[{LDf;JdC4H+^ $&CG`a1 ꓁)).n2;Z5*i=nce~)nGQN)^$qQ kFU}HO\9)nt:au &pɚ R:|Ig[x+^6)\gNirtJ`'I E  `ؙ  r5)4JK/Bsy>cFGޘLiDhRJh0'_kw >!5ojSt4 QLdy˼!x<4=~ 9ϻT#5o "x@)69*MwdJ_dxRtBOH٠(a;[)PRP} Q  8Hk~LJD*U; zl\`NZMㄈGt))-q"t)\ x}o'O'<& Jd$o裴CPTl9A?%uH8 9IIKD۲A 0lt@<2i p wx 6֐KyI>Lu2p;&AKŭ R?$Ѫ}rR$ -hz[uTs{$ݦTAJ%$F: y$N(uMZRB4ċ j>!Cy1SJ@JIf׸Gx(tuMcߊJ[v@RoR~ xiUߒ H R%W R3ޞ;Ö#xK Nc]X7UYqgJ:}mڢ60hp= K[Tzhӷ*ʶϤVc1#p]hBpMdSޭMnʭii+ TUf`Dn;QLL!#4 :hUߟs%)Cx9rbTIMR{Ĕ[JbLJTjW(h*AHS(;4J`&eDŽkJ)(B6WU08NtMDbS&%1kg6OSkG Occ3)%j]5)5 -GA1NM#3hRiBI&A25IˡMRK$["O CA)?úbSR:4Ro'` :-N )xIK;ޝς`L{&JDuIK:Ft:ꓓpR9H ʙ$'{~ H%,NJw HqDJM Q))r {PkDkHO [R"RyRkCk4H (:{ޞGe9=*j$ gT)ga{SN)@!G qy=$#NRL蒗k68HJws(y %)H'>i!l=qPu~&u Tuȧ=JVmXG"'ܨDSu%&ADwNͻF rnB@HAJD{aA疾$(n!E #NQScsaxYAL`D:\)VuALYp_,(LMtǐP|TAL3t|9C`4).Љ 9FN)d M>dQyЪkp=i&`%6pg)푪I판=6Ai)@*ִ8* d #v3 RAԦ6 -vQ97ׄc D5)a'B)T ANYZCRp{ZwZ-"dILvI!%2XH% =Ѩi}?9MwdR$4{(AvwӬ7Aܙ#0*HkpdML8&|*[j{^ p0 ׁ9Jܨ>+T,]Z@VQsYiq -Y5$lx,j ԴVΞM<wu,>XCAQ6 X!a@ӧ Kv āve/I ͬ>k!ùHh|ߚp{$H1I$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$ IUjI$¬4/J_X4m]ºH/S5,#ze uĩ:*UҔ\IׅސO.D!%jimi4nKzt )dĭP Ki U&ޖR%e~ȯħ_ZxIz[w&JITnKrIgbPOm3&4Hr}|r,#n.6tbOpS(ҕ:GCa+TJJԖi*W dw\K8uv1ëGܕ+2H^[8S4}gRR>IaDt΄ ,Qޖ垒h:ALzeðITY$BRD݅piQv-Դ]$Ҕ$iJR&N$IJI$I$RI%VVh q\W\h7^үeJ[2UzWzbt콁 oxV'Uh vR -P0Ɂ}^xO]@@;HUс %tky(Ҭ9#_ʐt6$hZ>01- D:$ ձ0Iq 3-l_MqtZhl`#[d?.(Jo֦AOiG{K08T+ 2>쏬a.>K?m n w ]gd4zŵ#Aࣸ-~Z#̪9k*JZԩepG]Q HZD;qBp )S5;LʙJ@AOxC bwhp<{hQRB5Ȧux>Z> Jp9]"4D#TMN=$M$5S"}] 7Iw :٧Mow );v(YԒCnp:fHy?6N(liT["AEH־ VMd!paӠi=0)'T;w`,K`@JݢdwOQ믒 LILrLwȎ$6wX0m0ФC)8h{ iw )zl3q0F®ɰ~(0 hlcuIObF)gXl%)7`o*S!3w%I/]yX9^{py4Ki$&O܊clĩ9}j!|ӗ7h S|d= v[>%κ)4nnv t 9IJ$mx*˄'T=S+&\!v?% hjS5e āD$6'C ]v;%Otņ|RRucuPּcvd6<'RǺ(`\b%.-BOà\$#vpӔ ܤ3ĩ@h<\$qg" @ 'TmEL%ݸx>GA,"\}BqM05I{L1Gy@kKD{cq0e4ˆy#jD&4I)C_m`駇LfZA2@| {F{go:eCtLG%0s‹nAvFCxhIIms&Aυ\A0} *4'R)IIloX]ďOY{'~i kDuRۮD JHK^DCa!! ;9Iu.N֖  )#v.TEBxP}$^!8Tʷo53_tA8C HߑHG15; I-xyێ35ܖƍ IO$9NOI :iq',Dr0ˏtVln‘q)s$l2>}*LuW7ᢑt7C>{뢆5&"| gA`2;gX ƙtEmFѧHI< o}n-쒘6R[gva'T,ҝ8 H<({ rIL^֑HQsIX7COQ R-&!"%/>(@&Zƃ2<e{F i&&RS&A?9O{\Uג ʎgU ֑H";>JeC`7<6"<xO;HL牐S M\pyJ(l3x&#T;|S4))Z᷺k'QthX5g9*DӐR|J^ڴQ^`]^ > {LL%EL B߄{RRFP.y{ 9jI%HHY]|c ΣTj6NqDH'ix$YO=nOb'oJaX$y]ihn)-4pA#FKxNOIHLnЎ+4ʌLFdZSfG %^@ GqNCZ@:0;ٷS&btQXfA)a.:i J$9iDRa*1%.l; Z&yCs6H " n|S'EЧi )jKPeMw7Tnc^O(l!ϊn{)248= !y vZd$@k=i|yQܤ-#D$۩ILcCvm;# EνQڦ"8OƪLII}ciRe%;G@ HBxfHIL[.SN'w%2qhC5Dh8!<@H&dwOJb\]R'oϔ$N&\7'(%J\uH<TITgh,1>tM41cB'9-RJ9O>' ̑J5y&Fyj ,׫xV6 XQpI1QKS3~)̴{x(uM 2>)IҙHLAuIKkϨdrk ^ s=9ʅӯt'vO) wwqݭ#oyQkYHXA!0J!1ӍPR`hK.L|H*fΰ][`$vm8ġ']z΃ő)&)5źr#y!hjI ;Xx}"w 3YFߊp==]: $)<ʋA '_HP D)!g=Aq  ǽJ v| Q2@R8OOp~I)36' _s w hAMDȮ  0{NH7i) b))w4 Q>q% '%0^C Rȍq<)&)M(), hAO`"SR;RS'o:D)5'MS6G)p!JRRN-%M:"7$(x)W*2SsShQS03L&e)vzT%=ԀIJA1^%OsHj?r}Н"SaD@$Jn:AP" JQu]ޠ.q`sdON\NҎ˽)OsZӷyU +u1k!OĔCΊIIAIl$C[ * u@ݼRkw /"VLI}9EIuRk+2MT uJkl !uQ- J{颪0X7A8 lkvVd8ࡊH{SV6Xݲ !hiDj]L[tKk'i\# [daa-v(3г Ѯ" T:V`ɨ$H-RI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$,j{@jL F:X= j1X@G)Z7!t_&;ߐY:G􏊮ڤIS0$IMYPMޡ(\p{":%O^ƚy1} x @ySmR|R}ҢL! @AkLT<XS * ƣcƊAz& $%$.s ֟Ǻ։hxQH! $CIh~2L!Uqs*)Ghi|I-h:7_ sǀ)a3>)TTvS5H$ߓFࣼA>)ƍgD;\֐%F4MajiFS00D\F OΧAILk:/qk;pPR`mDTȃ䝗E֍5J:H&|RP]_66{$|ğlDuJYrwuԦE9O^3dM$t)oS{rz#Q1MP $4/kžQ`1sjPe%#;AeJ3SVd#GGHi4"vDJpѤhT\:Bnն#I#i'Td4nT@#DrPG*]pJfCA'=Pt'RndRktO44zr8Ad6OQ>\|S2J5Ը>yMJT\A )}>*@ó`v34]McZQMp2 )X[Ô:ϤvQkim tMC8*AILE)׸H2;YaƑH `oIK }$\׺C 5urh;5%)@.  P{F4=c1u1qNA"Sx%&x25&[w,$RDӢgOM'RRv<3!:$Rf}')C DƉw)D9IHZ;=p_zbe'D=B$'SH5IMp5IR~if7i-u4KHHd6{fCIaH')867GD$ZN_$wȎuR0ƻt<03 $О)\= ӕ.5NfII%H?I; ^D:;omLH}~t윲 Je[KLƪ&.Ӵ! kAi$HɆ) m$BILC}> NA `pKtQA$AR RJ[)4##P!HO!Mבgx@#$nC UK]LAO*Z'TZ@!%2kAo qhͺƸ)2H2 s -GhKZ>))JCLOCd|T$iMִD3Ʃ؎>=.h &bR$8{3S6q B#v HHQpDZאQXGq]obͼSw)N&Gȑ} 'w>Hv0>,k IOGB gQi#rC lB:BE =S;Vi<!!&\Ai#Tᳪgs dZӦ얤@xK}#N;NFH68lj $-dm@U>wHL;ßd TRpIIl$  .s#HL<"%%'1 H;kD8yUk2%L@Q;L<>j@$x(ϚM4U:<8쓄k R1kvNJKpBbw H"If|dGDpd)5ĺxh$%ׄe$,Ƈv `oȞA?d4S7<=;CCD;|`uuH {IIK%5=&(Oh4{6<~Im'PΎIj@5sO>*5[AJD&"B@k `$!&G#_g$rb{&" iNL肒'M>IX7FmÔRBe2|9s@TH(>5xip$*$j>L4k 'TV8ڠ<'-?$"ΉqIdxHXF<&-ˉa1 AiFpu%J]9ǚ[Ç ZSH 4iJBJS{ 4Pqy'HH:$ANRpۨRF)>Nc32\e*,kI.H9D5C{2=t%6qFtEI p ud Y[(ۡB`!<{$tRPK)[; Riu$Fg d) 5IIOV9Mg&i%t Rh`A&aO`㹻*6:3yL' '@%;P$  'J]Q}n0ԱOk`3r$!pl^>PV5Xh;?o\ɳ@> )pYc-vRh9EԿ%D*z*x?cq?4#gM.XoMhUoFrHD=X+ *~lFƍR|&SI'tmYnq@IQ#THJLrJQ%HpNY)JE2*c} N I!*P[:8I4>)%g 0J@Ja2HVuO5 ΰ %:JAJH4wQL:4J{&!99J;\4 IJ:!LMƊQb߽R}-eD?^SrdڧA%h\G b8 !kN[:'!!V-2A=qB RyIGu AkD҉I)6xqaD:JNdJL@ALōP3\Mws!;Nyg΀A% QRV'x5x7<'ڂV6"hӿ%6|f("Q*v@ B6~ MvSmI)Ct>(m EgDS$BHdׁ D& S`Ʋ <Z8bON8R!(Jg`*.Ӆs&0J JJ!l`v#5v  n$.Tu/OIHMOa%)n w'q<j9Oh*aR/-1 rĒRPdF&3/-ӉO?xLr ZZWs􂙏&=纃̝$#!Hl4$ʃdq3=i' $L-n8;|XF'hj`βe3۬%I!2n=ݭ)= 6)I))()5={C!n-Ji*ARa pߞTd{DPL8:Q%ς[i ( tk)4u-aD7YMڒ^ݯTMlh,40>R&L)B*UI35\cAF (lS yS&t*%%'m yZ ;o܌_P $vyRQIvYcY "`kBF9h$T><AmOcTA킟Rgdd^ Inx!3MT 0)G(BJNݚq#8vH NE (S⻎2(km I$X[$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$$GN78Xiԙ:5._ U,|j>jvcNJv̛~г2"I6NMV5 ZVHkH' .2u%A l{wӹuDiѡdB1`'BI|{rD(p\{*~Sh0 B 5 ˵@h%ȬT6Si]vX46fRT*[Djl2ܡ̘PhTK` mAI\t=y o=MaPT]-RAin K})z&>L(d$̩=ޠU}fQ9)OdtӎdN`FJACp*<8GGIII䀋xUOOgG`N[*fBA%6 |!0|re ;N̕j9EMTʨ֒5R 򘰎dT\$v|: @;|Us%#;X92~uEّCS%Kg@w@qUTVęQSGmGp@!L0Z6S =ӗbʉyI]moE%;{Jx<8\V06p o@qV6ήU vQ74a:QmG)kƼ:$!aL'kZҝԺ`'5HH0%"8‹r~BRD*bƇJs.K!st1(mp`"J!OBWݴyN]<ꁹm.BC%2hJ$B{yiˀLX6 UVtS,h2ЕՇqJmjntUC{8KtSgDG'KL $'*.0i@); !M g0u(}$B'P[ T!04n.6쒒ne&<Esxpnx'˘t<('M";&#]nѩ4Ƥe0[DrO1`RѠ#p|4L\I8 g$=R*m-9IKn#S.Ш 1V68{cRۦch>eH'C l T ]{=IWkȟwAχj*o>nTM1*Te>inB$tROJJG(Z8@PlǻDӴ&Z&RRW9ٙ'kCkDF;TɃ4f4IIm,#L;u2;i7 N D^Jeu o /vyst ("n0\c(-$x@yС;v֥JJ+ip(6ևk78Fk+-09NԘM!ܔėt虮iЉ))jnZjܓ6kReo9m3H)wǒJP;)kpD >>*NF&H?x5OpR qݬ&O%C쯤ʳ;J+>8~ ɎBm`wO @N)^~R6NGyp8@QRh[$,yP ϒ๺ĦX6"Lؓ )&sUÇu+ ^c&uJAHpOHAllԎS5wHIwD)ID RcH:vSFYCOdi\OMtx$5F4UVIi#*d9 .Tf> O:ls-iA~=n@1{AEmHAR#Y 5 ,2xN %0a:) ĎT,&p NӸHݪJMqn0lu% k}76H:C`GbLN &Z5iФM mOt`xYsZsx3e=w@! q%2xX 1VwEr<<'hƸ )&v%Bk|FMca{E/^NgNU`@N~ !EPT^\xLKn#MM]G=7G)ޒZؖ9cfA>N1Iyv0B`u*\vM2RS @TcAcSp sT\BvtHj>JgS͎rO^G^Io.>?a:혞&9h58LI)+c\uxIh&u!qvBk܎S͒Ȑwj4AZ5੽5x$ RҜ7QJ]9Fw g%Η4H 6"ñ;wP "h#wIg}Rm^u+GD:A'ѼV.cw@24Nx$xi,>%#_NRF&JHZL|!EA3ZuT5Iknh#HLw0(v üb>"$9;&iubD`t7Еtc3'^頟4e%2b> L7ϕ=iKĒ[I44J#~ڤzi:xAtہM|{ѡ)ƝRy/  G#ppxR> D$OcgԓHWSnJb{5 %2\~):mw* 9l&4H1MILGHA fS u"Bft$ gC%0i,:|cm2F8Ik\giNռ#!  ;"!Θ mjӴA Ep x$"ƛMQj%ĝ !]K D%2LAiXA5fʝ=k L/he;#^&So))% 7I-f;:,r ˑG .4ILݫHv#Nꭍ2Z9 wHxMH44))i kdCHo(1sn[BbB0`S{(1 B\XxO ZxHIL#wmxwa@>{ )%JSs &Bw{y(Ku|J|NB#tOELIv|JTCrM9K;@~3-pR&%k h'R JHdҙGuk<6;$X4H,l.Q/m'TГ]vR6%. 6VGn. <ea3x!"5SLBHgke3,id~Gzݡ w01)pp Ifx"wǴuO.oT DIKPA5JxintH NtIJ<Bg"Hݶnou6G>>&u"pOIc$`Jz^ 4#!x4HHH5%C6w&;pt\'.S)$un%rPcIQ-gSR%'vN[iqaDƇn(:jN<R -v'yT 3B]sA9I$K:Z-L <$J8 (r:'3‹m%49L\ꘁʑoܐZm!E,ltC}̬I |W34g,rij>*=1WcD†YWV`{YyXBݪQBf3 $0w\n2%!Q<$l?4EJ't)SưM1ʌRӤ pt)@< $-S0p8S!-FJbS)Y p@)ToSI(m<=`Hiۄħ% S&KKxNDJtqQG^&:|RL̞I)?SjĥDB*_$3}Tیa9Ч&SOJH]-'̈Ӓ$AQ-QNɯkNŤ7ixǂ8Swʉll!"b/Wy =:iI&lঙALONOu0ݠR" cN%JS]6$]NӢ *Z IMrm(lIlS~4B5N=Xh;u Ix&=i$BA-v' lAa͍өR$DRHͭ$OHl3i\HLݳTΆ)@5Ox6!;l{>*$ -qD1h&K# "~j.qo3H{QॶB` JJ\qd΁Ax#;\`6O2i@G^DŒx E<&t) %*@$D4$,?gA1%4 y&oL/>@q;b#PGtϑQ!Au)J JבA탯*de+ R9 Dѵ%(i-c: 7o9LD u"!%#1❦ hsQm( & w(sآ 1TRjS64 'B-*L"~ ^IN!5K<|Ș#Qs%F繧N S%'yư &ICM&IrQRC-vI1S5feD'?'T%3pޘȎBѺrTcf% ${%%2/SXN;T-N BfT񤤦O1ǔxЛ@#G [t۪JdX$ DŽṾ)LHhO*;A:$fu3JFc|TbyƍmʋL'i܂Y4%/SFrh !0IJp$BoS^5)8i)7hZOS[]'o ,p #$y%"'TŠbLhy*0Si9LY&][$mu@DpA#)#>O )+]vDϷP>*u̘E$h)ALk5Rc7x:}1HFRfOqiB9 "qs +9mxZx^B}LwtN r[Qr逬XDL(n5k:% X?Y{rq0H]U<,LgT%ƀB>g}ipVI4X׽A^VհC*hFO$EŃI$BI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$RI2rm rWWSi`c~o-*O) Y U+]쏐td Đ Fm{ZKD{"T)͑*5qjAR'R8P- g}~ )7] o 5T}Q`AC wP#m'QHL`z<)n-I>%@ Cj&Ɵ`8))3,J~_{Li'M9VʌϒQ- CG%Пv $׺P;rTsC,lh $"I%&<pA$Pܘ)ZHS{i)#*{v^ȐR쩿7D]`%EV@J d }179tZuV9Av]lrYgq&H4o<fvՠ*5KVlC5@vc6Ekw?O)VY!'Aork*>uFYBO8GlƩ @&R%4Q}4PԎLJ 0NM4HJHlʉw)aL0Fr䤆^gNCtL!SFPFKf$Tt:^ PŞ(m긍T_V IIKƤLh^Nt uߴ@a!ΩGcb5`IIh!fwImL'אa)p=R, $g*X)Xk<}p3י1i="B^Ѡ%*_Pֈ( ΃l6[ 𒓵Tu“K"yMkTx0%23gY?4:O<(0=ʋNӢl.Ѐd&u=u(oW\DwLZǶN;7TT?hMq':|ʗH$UBCthL )iDuWRs@5`qg옉R~M(Mdd-&='1y}I 5a$C6șj{e2 .LkBbgTxࣴςJd2= iaxh|9|R߷Bp-SFJ[{* QSiwaSe-QmpH쒘 A%-3Cp7) sCH3o)s[ueg$H P7#B <tH"4Өɶv{|A{ᮚ9Rs=FLNmKx]2c]-xԧҿv&wDBD rI H"G?I\,#S*67hODŽ$֑:9NDrcyRv:L7uyELI'٠n6#<JHQ64jêwB& r[>ԔƶvI䀈ۜDbu2& |RlIK8AWwGk@:B@)`NRRvO$¬Qw8r='g{r@xL% ɓƩ)mI Lx'Q.KSH H>))pC{ u@XP9~uNc)Oaf;~* Ffײp#S“aA )˔M6]"d7 %N h6ޛ1x2{vp%%!4> 3'LJY"GNn wOiq\ִ44<. r|!1cx*-IA@|s.@ ߞ t)5IKCJ;m$w;,m!<ӺNOtśA dIPab[{yBm'DH1n htD?3 < EcHY$zdr-ʜm AO660vz@;e,k)"dGd&-վ;s%3Q <94ILiBm";\"3pӞ--BpE’/,tH=$JDwDe͍4)|FxNDwR/6af=&ѩHB:49Nrv@!Ԅ>'o(b)/SޜX9s#<IRt3)Ėh qp$U,۴NV ̤Ʋe9L%Dܒ=שRL)*b}# iC2Ӧ@=*,eܞ5]$ʌʎ<'%%!|zS12KA Ħ.S *1: v% p{$eH*68>#GG) T t$@H7O%]AL=W8gH )۪Z|SGhHkOԤ=쓷cIMm9L_N#DN)򒖭E&86C&8%3Dx<ɉxIKO1ݰ,|xN+}ңo*\D<Ā7DIiB+{2HhA Gt%;'BJ[tGԬ{ckFHw2H-0I1\)u-HOtü6!Gd ĴGH8>i%$qB _p~)75NS4sI" Mnu%${™(mceؔXkx=k" CEhe|۲`\{Ge;/8AotkI4?HxR: $@=kq7Dp8 Gdc^7 )QNl>*4ѫP{ה I-ij C߄KA,$!XHKd|RԍyL<Ž)}A &9Zd&Fi83C"2K/Y*$@𔝻PikƞzNhJ5"l8K~ [6守nP:lgU%6"`,@j_<肙bh$|gKܢ-.@Bb%J {IM4ꓜƙ'HIH)A *@v))Y  wH=D% K4;ZR&SؤV_:ʋ1b7[<(Z'ϒJJ6OQ4\<X]469%).pЩ{0yQnfI 74w#E)IIlj8@hO:wK((vQ"RBāωP&AKO({vB`)A&-$̎$iv=׎Ȍn$NaDjILKQHpAӧM.&Jv`IL0!Bw7@NJv~)m>JZ99aGqF3h@:C [SsJX9Kt*lg#h 4O=DoxO d'9nBA:M D )#_ I&8 Z64$H)NuBז'hsuLdӄgZ83 H,j_w0G8 6u~T4DeFZשYm-`D(~޼YV0.h?" I_L-+g"JhBrJK@z\CqYYrgiVZy`o ;WT $ׅ&wLNrSJX;TjcpR %4I6yLtΉKꥯ #hH#ƈ'%=SOt:)!x6R8JRMR)4p{$JdJrhiK"e%1:xL)wN%, Q%$Om%2Rt S>@ h BRR29I*]sJX8K󯂌FOơ4IG(v9QN 昸*&yH)BZaLȕsN {ϒhJcP ;iGoޥ['X)R>I9РLia3NJ` 9묦蘤L " *Pi]IDI"T\j>9DQOt%3HI~*D&!2kg)1n?ݢwܙ2r<D";H|7@S-IJ-RW-ZH{ͰGɒBnJ H ) i y0Th r6 8&#ݧ(6pӔD3N%@NJf;ƙ:rI9 v()'YJ ڧ ͝<q"R:JmwOcuE#pm%.tN%:AIKP%H3H)! uNNT͎p&u % wAH7ۡ9 [`JbIL˴ >& ǚp7oxHfJYL 8AJhT[$*g?rdAiS$"`TIK4~pTdjd̘T@j`Ժ)|=Ev7MĦkLL). pOha8NɃ.SS`RR 2"CNsu.JV "G)C$( BD;&JdCNאc\= O;'3ʌiN)!(@QPӒH(h1P N@N`D$í%:LLp2 1sDlY>Uw24*bj.tP̱=9ٝjc{FdI$5I$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$pn#LQPD^PU%G.[NYd rE#ȃ"%Ppdm`r*nLig=1v8Iq<8ВӎƸDm]R}kcivh?$wQ.nHW"TA Kڬ2PݑbIV_8I)(3)fHoCqsL>9'{Z5*rBQIIZЧH w 9q8tj;9: 62$3A s,ׁ଍yKkGuEfZI'$jK 6Xu#@s~Gj3c'C9@6;K>&|T=J-Y ," BxWi @wU}%65%8Eќ zE-JlQy'Y7mB&UK"VƃG (c0cg**{^㪘Y-ڤxUmo >%Ɗ~^Q74hEV6@V&9h;,'{@ ZOd`3[₭ˢw*R{S›*w!\Bk1fKNnӕ4'L Jg٤x,;2A:% "d%N)&ɂ oTeI! "Tl;A#$4k\nUC\i2[1uC0F)wSCe)(NGh7/~ ^ &N uEI_FsNm;wRiDtRt̄[Ûid xkp:rAq9fΩ)ټHeՍum-cd&e4Pԉ):UZL9EkѠ'hZ8TjS&\G'N`)l1 <G()wRePPx;0;kkO1w^T<$XK9OXKy Iq½wvH6L'4Lג'gY };KPO} 8:pXMq䂕4Ц4Υ9RKM pRiԂsO)(^- wt2׀H*n*!'8ݓt[ϊuwA>XrpsߥL6iEfÄ7;״v)l3p uRs))-?]'=H!F"# #VOCLWDx\[f~h P08:$[mԙSlxWu@0;J(IؙH5><\uIKmLF-TĻ_t6%5ݶ<{'t̴xxnk%ck)ݠ3N #YJJX5o?[v :N4q'`j` O*Cۤʓ " Jd\\Opjϩ!d1xpxʁpPݬNA3CLp鈒Uqka{)TPC|v'L<Sj$y4yrDp)NMRcL $ #$Mu` }*OŠ5 Zx`{T$pNQoMIT Chn RH;(1I׏7RD 8꘴HiR.@dΑ'O*fq3LQHqHߔʛDy=M"[Af9 ̦{gdQȧ{AӲhALpBm B\I ̝a(4wNZf5EJF`22%$FMm2i*GC RkL$ak=^qn4=) gBTKO :,Bv=A2h{!<?)<$=3u^'"?44kvtPn?rQjLZc6)w8W`-3<1hAS^>i SNHY!(N: NIi0VcI  V|{-HIRt c„yRڒ=ŒX%ɫ{K"Z #nO8QDB꒒>pc1:( 2l?*^RBMH)_g-tJrX|$}'5w& GA+VYe]5#Gs%O-nOdܤtRڤ!~d;(8n L{)4n%'$ݺe9.iv降)I=EEG)TX\̓WJ-$k;#hUIpd`ju;At))wZ}Jf5&typ& (@N4N"G`Y0F奠8\ q 1alivCٸRlH $L7Giܤ\<~I0mb-3))ă5y ^ی״ӯPT$[h;`xB8I&?|:Qwb8I JKw<C&4?z6'DuLI5쒙%&8bU%<*~/N sQd]4IL 6@ zH J@PNS:& %|}{c?7i:LDhPü|SĹ{t!k#pR)JJYqh`nb NJPB`Hs Fwp8{*.#$8=4Ȅ(W:8hॳk'x$5ARNǒ !Op3Y0@;%8I*q.]R.n:왶5;HjRN2tHJ^k`@ v@5(m M9MD(H ̅'`.a(J*DQZ5LxH*'TFcP))fCO2ׂ!l]HgTS%26 A'l Qu)LՁkzXLʎYb:*Ъ9s~WW;J[ĬDeA[ é@С<`ٷ_ʃnu8O7sEP2H`U^%Yh;TG,xGKg̬n Y1x0kƉ&mJڨ)KtN@qJ{ 2GE)|ԉQ3~v%1jP{%BBS%9tR"D Ɯ*.),}&, t%Kv tQ12m,[J^~*mB& N&0}R̀twKû&qLR&RRŚ<Ԇ 5J`huM)J*Z {x #MTxAKI PZ $2|)R TT N;HZ7D#TT)!a) :wITTY9Sp2T];ev%' JJX:(%AT6̟0?404'Sh5(4 ~T}(vH RICMH)Ij~T~&rw N5ԤL Mw a$ TKZ8LZ eH4T({LEyB}A1)&>IiR)#RRB};!RNˁ>  tG%%cc^L9"i#S!:JdPRŭtOOR| vc):)8&T{\#4tiMH\)8Jכ > yLiDIIK]\҃Zڎv:IN Nn&0 0YSw#5oJL%>r D O G ͭ@%=D(0>gDE"#P$v (=F$p"n|46u*R "= 4 v1M=S :{$F4d|҉> RL?"\%0,suZ;! {%3NSBq dֆg$@  ~*.sL$"GMl9ѩ ,p;GsCQg0(gT:ˀ35jMs"1 4Ax v4@THI_@cFGXK=4`amq/ӶLu)V4}ܘ`4 那w6}hL:n`!L9b5sve9 ыc|^pD7s\ ^_ͷ<*cBܛ?Vrv^p!vkqc> Иe!$ILI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$=kvTwm6v>e VFU̷cW?|ju)UIwRS"T QG+{JwF7F Tmmm+#PTlǸ|JoU|VunCuMX4NḺxWj96AD4+:ENh^~CG`}E UFn=,,r}ISk#m TZFU ҅ sЦe[3]4F`!OIJ4d bUt%B @B BRS8%&6m?3nP :u@Ԥƨ'SI!&yvDPG|sDL*CLW>IX撓Y`+m7暇:GG:mӵI;Ih%7MDi 5 $U[v4*ݵ$ǂ'R` w):j j=C=nlؕ\pJ9K&<4`aqNCϊId6(ԬØ-[Ɗ&L3$ 6)jJJYf%9k+ h3l{w' i:'()isLBuDxP;FT[Y5B~5EI,W~K=;D䣣x)D5ISj4M$ИKq(iqO`)%E&FJ]ŲZyP sLGR#s4';R -H3p2yNa%6h$7hIEh${ɣhnB})l##%3.;Pq;ߏ?[=(HLTH\#NOX4Bq{j1')"yLF$/a.kHǞd*1, (rT~JN1t) n y #|4NhtKRd$&77_0})5>$9v~Pyg8p!%#:L) lq&9(l<[$"Ԧ$'H쒔זcƳ3ʉzv I:>J~n pRR{Lv!|PC;8hJj)6!X$Ξ sRRD$\"4MmaTY0?pN5OJP>C{ZD督A&4a"Q'NI1 Lk`(: -&*AKbo40-q;'/hoL \|Q9n"М HL2#IEd6#NxLL$|C~jUt);Jfd 0BqdcEC-ܩVIrLp~Rkc:*nq-*.s; 7ap4> Gӿd p~*r$Ua- -ɵѴhi4 4957>iqa#rJde 9 y<H@cώKtjrNIJ{P0Jֻnhi.kGQvR#H{))v9L"Wn$5xc)C'D<iӔ08svޔ7dsI#XO:꒔\?3HT<@ ǒd;Bf{'7]N!%1{þ;[ oyPe4Sǂc הJ\p'ZnOqq%A@<5LZ"S"ÜeKL9Iv^۬ AۄM;t)QfduNxO ILH`KJ@%ӧ5NBq8`RS sc:Dh><')L)sI, a GDŽpItQ>Iq1$v(-'ЙSa=Tv6=ԃ{u#nqY) rƜGxLH!;A9%j Jd|%6IHx`Ɉ4<Ȃ 5-'H\b<=Lqp 8Ta kF$ja0l fbޠkb!mᨃS$jx)`$AAKQ#PGe]pR0L 3puHh|R{Ho -X $puJ%& >hׄ2[$0Z x)\II.#D;tBLs+gH= %(h)Z>i^ƣ_4hARIJAs >$9X05Jy L1JLʀn| kak&aD=44yK>( v*{˵ Jr R::$v;i.S  *[ u0k %*}tѹǔỸ'\x| ^hBӗ{':~8jr< HAANgc:D~쥨:'OJK0  ^y*DGj=N4w )+[@Rq;q2*EAa"(R%3)v= @'7lnJJnaY߲4W.-lv*c!3Dh;'ږԕLtO|$d^}ĒS: Tj$ @vȝIM><'ygk)ZDG]8S4HI HiZ"JpI 10n*\;[.)lhS&1r`%ILZЩI !vHӹ/0<)O$<@IDpO43'S%DA}N"|RB\$&LS ER"Lm>)鑩Ck I&kHJ8;H4)$AEIA8NU[-%7%<2Hdg:M<)v[wj`pn%;4=(;*#h\-y8R %&13 Plh4TD9A%/Y.$̗@Un
y%DTi*))}D7hG;08TƩnHRxIL~ tH*G:y-^8Q-!Hq()s6%HZ ׄ22G12uLBNslUyI@ʍn'O|ƐG )!P2>OϊyaSN> IJğ O)d >.2yHp؂F`;uݐ$;q0JR> Ȑ}ȟ;r#^ҙCJr|SAAK DJp%'mk%gSNI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$@O )I$I&}։ ].ﰍ;@M)2E(5*h:@W,5UƧcEOW9Hh'.}nDMU|kst4M甸B;6GGWn>#6T _hlN(6SQU)mpTd*@|u* ;{@KpUl萠\@YtDeBQg[i#Pi'׃c۩4v ژr5S I?-j1S8ptC{ph I >ihAbJ(i08ti$2FKU{2xϨ;0y 8{JݮFH cv0Fc^> XG_1orv&հo媦!'IiG m30 B$Z{d5dn!L7hlv 腁7qJ)`hI ݧlO )a7>^'qNݧdc5)Z>rR 3G^O%-z$%AITDhOJ4[ |RR!+\Iׂ~kZ$AOJ[$,)NBJQ;5H3a'Lp3N-%;-k9 oth09(nl_ 9D9KH!@qa"ͺ“@p$Ssx虖 N5%2ĮѺ` H;v0Oe" &IO!;D!ڤ@'ILZفʉVg60<XC,`$IMd8tnCniIu#(X<'E$䜶LRRcӺEeS}5{ ~)qkalq=ԥ hhR-$Ne Vvj \[xls{*-cxOA$Qi5LJ "I$tLeA'~ >h%klJÌF|>'vR.$HLIJLV\t%2s>j^vm:1ZvO43p4*p-0v bxh8GRk@ЙO3Nc%#<&ÜƟnѣlq8gIˊ*ISqҐ́Av3᪶ڂDe&)H:~JYsZSX'A--Hyו %#^ Gy'#BJKltiaY %>Dm#НPS?M8yQXt ݵ\5!4=tAr&4O x&#DT1CBb\c2 -p]L"OdTm;9 lI$J%s қB%39 g.{If5:>j o:"15p ^)ᦾIq `?DpDy8ƥ4e-Ӫ_$, q)H)n7wIL\JAspDtJF ES#+X7bt"I*.JHێp$2#gDzkl.0cHZ'T ;SHLQRy(aa4Ψ48)9Θ@{.)T9F)`om<.)QI 㪔t܉%"(Kt%)- t" ]9P/`A4ES|sS6:\ 'Qߙ@vMw> SjSLJBJ\ij<j^fT6(WuD8wGd$6 \7h"O(uzâ{AOmE8Ƴ /3IgSCFnlnF'^#$vF%xR:r)vTP9^ѼHIwN vJS R,PRI.ao3k-l;:4!6\k> -D49Ka%$4 r;\fjxq<#^SMv<$m&:'V-=$rT\%_pO1t|RᢧNy !ةRt)ki$Ow ")$a/S-CtK%xIK$ mF3tۥ$Ѹiy{$- %OR)΂SOb|әOILIw 蟝|{jJxRC2`:8H% `!%*9h*q0LyAKrq Oo4D$Rp%-Khwui/4ۥ? ~xA,&tLӺPG3 ;R#1H(QppNmKib iIRS&V# ؟ 䧱%" rHI) RI(#]cC!4vRtM*Ltd.P Sy?*$N))S߹NxA``μ斃B8Ɛ8LdxO%D6S1 ^O>gYAuN"|HxTs [tOp&Z4)%RlĔ𒗁R3rOb:t*W'R-1ĝH $NC]Tڢ@j684JALT(R QaNNǶNwH9> S/L:TZ*.`w2\$ 5Rh$h~ :B`N&RKT<5IJZB:Ant}ⓀpJ~9HA*MR/ i /i6Rw72Rʛh<6 pi>iS\A2'HL(a;D4RS7$|<ƢBNqG:s@ ) N  DI%)-2 % .rTcOw\GN uD˶goRQN8N"R7Nm~Ipt~Iƅ7d2t sd ).9 /2dN Fm{OAy(9#kDʔ6`Jak2D Ps}5p.2\OMHPcTGp ŧ9${ :$ syv#R.hq_5#RDOu-'MPR Dq<'$HM6HxL8} fRRwm {h]S<ʉhidvLyT\7CAѬ:'- ;(8%*4g3#_d@S:~Ʀ u" 1))$ڢ@'$ 7`c'~)SDl$h9;DԧSG iSxtM${prآ7h3{6 |ODۢ&ZPRf3]ӡBH1Ӭ!d8`=T\5d')2[mJniyF6 {(4RtB! ͣKhP pW=U{!yXv?zMD>/Q=> k<^54 "|RI$&I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$IRbۭЈRI(*X¶4[*DY='%b@A=;GF[5W6C|i!V63rK3* )zdmM%HɴޠIh^wPh lw⬚c8jѢpS78&C/P <@LςDCcAգ6@$Jru A$ZAO7rRR͹h=JH!ĒH(}`@RiV򝄆%1:!Nv\^ 쓽9E8<)UǖsvM{[g;u;ӹIwt:‹jw" n7`"ȬKA!9E`B<t3&DC`Sl5P9 @ v{!><{9A,$DBv60m j,w mwcU;y1!Wn(Ζ"?|iLf9ԩG);O%2?*{Z 7AT\CrHsH:;|*gOT\4P|:hQ-U#Dt'3< xCj8)<,#k9JmOtIHcRh)) v|XK[,;K z : P JBj9^v+s<ӰulGyQ[dQyRf%3t8Gt`tRmF"Ó94Odd&u2s[N0l;{v`-kc05OhRLR@[O |Ḧ́HTcD3~OwQ:$\tL)ccScP4O]{'p'T䵧T. %|S=cm{ [S '&Z`L$j=8`))j]AʚdAS}8$( {@4)5IJcqkIve y2|< K.Tv*0Y2ɝ (抒{m#U*ʚPp)4R;x#Tk0&:xB}H.i!*,|3lun#4k0@$KLFV8#iAD8iGS0NZcS$A%#n7`?r)pl>\-U[^Oed"p`sstkTӹ'g4Ho$0 Iτ(r:ѧtTKo*u5 JBTF#)%u(^gp]uipHA;i|B'oGeb #Y=+"y};H/4)9Hk$S䐤ÎNxyu>j@GTu%.汤{@,h@<ۣs!)>ILr& bsZ:xSuzGG=Sc8v*En bdGu7l &8'pM:$\> $D§͠A~J{ jChpOe&25=ߊC[ cBD/l薒Zx̦D7YDH4M hu`̞Eսu,p5[u @jJY8>\&cKOx>=Խ"vLtgTF):]NF%/ ;j04C#Tm~uJ3h 8Ӓ͑1lpw3_Xxi=R lFmOyO)n?$@DILwD6~\'0>5TƸu(ƺ$Ґh>Tp'+ 91>T֎Q:!40^[d[ $QAp Wohۤ0sƉX]=$n{j~nK8y{`uŵy)R H)wk2Ƣ(iQmhDACQ iN%9ɈBJm:ll$w 6A% It86Z&$d)&T ?( )BPAKb<JhJS"n) %"h)ay %)M ))`/0Pa&GmGd&ה\ $E%+ OTL$R;B\$ӲRi8HcT $R!9@;|JE$RBO)3vk⛎$5Jc@꒔H:$Nd>)rR#TTxwO<}B='KA*Q N\|κO"R!!T%)xbI"鎉Bp4>)p:蓜HJn&#DS%+yRl$> I))gTL  :(DNEDSD)(%5MӀuA0.R !GC!<Ja@wL4?)K"HL93K* a81 *SI'1@]%&8H7/&qwim8'"SRS=8  6=Bg0&MVRk:hDx<üVDj:Fyns T`IIKM p|j R0S!*e(L'Dp_JB\@Fd|D$'4hݔSgDLT!ЉL ȈQDᠤAg%3wTsҐO SK{jfF&5Qq>>vD9J|ޚcY sIhN.Sl=@梅tA ) 5M"/ÝJwH '#(a]L &8nRK&BV:y@7$t{{'-RhRBB> 4)?8#T@QrLi8:@BQ)!BIJ\ K"'"'D'JPtj{ %Rn#IDeHxi^|ZsEOo7jxQ&tIL04< D(CjLG!PR:$_[!sDk$A)%Drjݷxh|0#^6wu!$kF[v#Q@4Hm||a3@a8hAJe"w@m@*;%:!'TW pJ{rv@fO3sI?RiNALI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$;d@$ U*@3a%ʃGH"i'EUzp^hV[cbCyaRĠ?$UZeq6 ЄCG9l기ΈxGuO'YBc]c:`+> 2I`>ip֓3)tFKysS̢B "P6*&O& 6IS- RhOdФGI-uIL^ӿn^A%zwRO I ljP ݧ x9h3R4II`$l[_0<{2ITBAƚ'$jk5?E@ڦ}kPvSZ~T's@8N'(]a!4yԨY#!pL)oSAk.XpkDj>e9s^-璠Uurx OI.)iIKX$A9̓!DVk E.;Up'tC-tq )lmg2*x4rSLm@ 㓸'wF™sF᫔c7 $p`'@-0!8%0G%1#NSdå3 4'5󦧴BedJڍRSf[pIyp[kxBs]p P~ 5YFi0u셸_Ʒ"<{€Dž-4jT2L~%%vL3S@> =2Ĩ9q9djRdwNS*nͻ]0{!aLw kyM!)Rpt-IL:,j{!TK" KרV]Xu)4m0P>h=]{n4+O]q"4OvSaT;'DrTP9[A$JuLkS@D3  T 6'' #]h8L,-e;jp}?qe)?E e@. #okk(aO)NH%MIIp[LPvUdϚ64H*'U-Z!0;^A:ƟzXISs 's&5A uv1xlm GErf̍>i)Mּ$ D٤TMd:NA9w`Iy{wsh0`q`.ZXX Ҥ/H'vH]v;[%#kpy>)}Ql(g05Kd)Hj%3{߄?\"Gla;!i R@ޣǚqjRS7A'ѹG x ?ŢdIQ{h瓢` Dλa:X8hJTDJ6:"@˂50tN#CC)5{jq5t% `4E` {F; gTA O*@9Jkې>O^]dG~j^ o˔ ]Np:I:On4 jJHZ֝䡸58 zb4Z9k)'_'M*25%)= U|;EDb@s#TVm~Q6p{U:6NA3cDs%,hkAsI#EiB%gcdq0P9H< >i)vk20gwp:wRtI9LCǿh)bFВpe> eI2Guv<)S Ɠ É$>{Dd﬇i3k^u<SOb))`<c7@S#E)Xg${*f2ffGH@x)J 2D3i%ٹ$y&.k@tF h:8IIpf;ɚkyH0S)tM%.Z74eA D^5> fH0$:wJWpBk@h(90e6)hҒk#VLHPV&Ǝ"u)$I Nxq1L@'vRC]0nRPZ[9Y(u. ŵR"" ` AILā&;smXӹ'spsJ@4HpɂObo.|#O gihqI vHy";HX> vNIVܐM'qRRϰ 3#D6NCqaF{.aA:s(ú/K)њ4E#MWGv=ʓhƪr6\#ytkPq䮟*bhL\z^[ndauDžSY!?Py #z`=M i@- i0h'KۊN?w #U}uOy-+N3+=!b^UχBҢ+Lp0&0k|B=R%7 /YsOP~;^&@Q=>uh'#`N-hls◵"jw I6H:/MoO':6tS;/8pRo ՟z镟r_<wt\xޣ`Jf 9 |,vGgzÇUtLnX T3Y Hϩ}*Ð=aR괯9ug媬{t,!h we\ cTm-!qV~dU3o.KUN4|;E:mF~ Hϩ" {8Hok+I._QYv4iq‡/Y)pɶ:QE$?roA cT䑢tޠR*f)5=D5RD!R**@uEr#(TQS NL/LD>I TpX#ƊgbTLCH @s%1Jc-e!d)ܚRL T>*@k ')&.> RK-RYNHKT{'4)8!Fe)HoNIRj[Jy6Ğ4O ' LhI(ZgTrA ##Qdǔ%(8Ω]S r"IJ J3 $$jfH(@X1<&1)h qJL%M[ƞ*pBȘ %ʓO擇D@:"MΘM'a %| %#HbLЛf@TH)N䤆Fm{0a3ɝ!h4yѮ%2pqإlG1p38O 9)x%v7E<|Tvu<5&Z$M&$|t>J'DGt`qJɮtl'`'fRY<)DCH TI4ǘIK#F AԍPӨI)h&))D=5i*-P qԢ TƁ7mgS%9NAהHILX%jh8Ck7i> b;!0o ֪m㈒dRݥ:4쮛,EIqtj{h]jѦXvI9RPKL/=[=ҍKȀNjVyiz__0}懕)B̛s ̯I^/̶$I5I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$]nhS5x>S-!IvFkW E3S5- cnSXUWdvR;KKֈ#RڸL6蒒A^y) 1,,jd3tN`yV@f*UOd$7YHK[S~Kr 0 PX78h:(ZӷTP karv^Gs9I3Jݯ{CvO[XCkyKtL7Bdďժ^"L 0n}#ZH )W N {x"1Έ G ?XYʛkaH<;$uuÈ?Z,>‚t 0;E~:C  |Irv8QEIfjuOμ)CF.[]<ӡNZ`ΩzIw))Ȯ%A1`gq*)hzܤg!K T E%'d׺M۫ZI{/:.n@6Ov e& e%'uЫcdWY39#cTSh;Ɔ!%.ܢ؆d͸}[2IPlC=੹87()lLP+8Jdm&yR$kǂ<J*fƸm(uZ\0Ӥ%*$ i=r'Ht#Q{4#PCO;2Î]HRd2 1a$>~p;..1l= )^3'P;HHh5IKH ť([6A&gEۜv`;Jb8'v $e&!i;\+%hMi.p~@:ht RS6m^d˚K|=A$vSvI5M2d$DJEy0fyI ʑ'_!M~d &L4QwI 5́اk:~d7d3 {uEuNƗjxH@3${ELQ_{%$nꖃHIa;DHlJJQqvP~ƍOܣEn|Kc #g(7M7O4Mv5boH1S7f$vXgA# :xNH4HkHӤגLhY]O%(|ĎR1`cN:dǺ(?A,#Ph3!?:qk MkYʈSzmZȅ%&X)!fדOsǀP61rTnBZ;ŽI+6iˇh2Hp9K@JJbY#DX%Ga x>$wNZx)F!.L]BJbS쿖@ALQ;tN:,jBJUk}%&^ fg6Ơ\ 8Go fy%10<@*u8 Uge^HhkQ۲`$IT;$C[ĔMz|8l5aZA Ya&8hp3o␄:C_*.$$Dq@G'NsHp옹$?5 -\Pc˧wH $ԉJ\SQ2cGuwNǚk%N Q$$jQ ]A)24S)S84IMvȉx m~\dj#WcNS)'0R༝ vM"ƴLʈk @2 NDt5w#BP6G҃* CHX "NuPLxs^b"$\;P] >K-)!D:Vp:@#D 5ۉF(۵)HP% ƥ$"uE3XۉG`5!8# 2|{% wt#TGm<0!П=rw(:p3L~ v&8II-hc}!𗽐&H+G:yc d:7w <#MyHn Jfli;xS9vÔVFѡ%$j8@F<3JPsI[I<)co4NDd':⒒\c*sDp]ijR4D~LNҒƆ5-D$qD~ -:&$'2u )g?s;Kliܓ"36Z:L[Ʉ;⒘A`B-Á 5)_ hS7E"?91柦N _k'@K. tkC7Pd)VHGD袑;o.I0A'zǢݼ%!JIR 4N0wumm ƒɓNJk\0GG>_NxN!x(~p:n${LLR.).!GژLyK_('DB\'RS!cݮ#p:yIqAa00  6F$xvC  ~" ZBvLFD#TZ'lOi(\6&liMOJei ob{N^a`dpTjxSD;![۔yqoe "T5#Gԁ@{ݢgEDn(0R$P;\'BϒDX6K°#` fz'}*ٌjVs-j.cx ҢlXu6R ɺ|ێV7pMgtBA<+ÝQ#NX^_ buGMFAَ < %;SR;+ WNn("MPS154Ff0ʃa_mRLS#Es`>mpU7=1rtת(%e–D$nIMoOl)V'QX-Сm)> ^T.ԷBRrRù== HRqQ&nILv*ϻ);T`E31#D )@iJTe"aFdaL0r65"BbBJDJY PdOdtN] nP_77WKtHFT(TP=.}*~J)aq1p⪓ Mqo ? Z?H~һ[-#h!L DU.Sջ HANGE3i~et;{$oYwOjՖOd.O3gԌp?A]^mVvwRdJ[Nq@ߞWdBrϹjjqKr\#MPq>2X$ֆڵ\_#)K?KM"&#Sw@ˈ5>/&wX $6/QQa y&KFv5~1ӷN5x(%& #.lIL$)a%,Ga1*dGmJr{$ d4JF{'"5xLr*P<'DH0$R6%a a"j1-BH DOX(dֶ!);vNJk_Tx0TB$SJIdpb0G)1Nܥ& 3ʓ)n۬&DNxp--۠J47%8Rێh) a#0ӕ;@$)}$ĽFe 2&TOO0Smrč{h< o9A5<)A:heS32A7ILBbL|Sst|S)ǂpH;}z7Sl;QRCq@$ph'])) wS{v! H m6A&{SÄ%9ۣ9DhM]Np&j`BaeB.$Z pq4!S6c ڨJ*nsI`Vw$V>hNڡ8eN\5Ukcୱk+/<. t]\T6?u!ֻ=gԌm_t%u'ٰ{[ $II$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I+/ 6kB YjI% JZG{-Wݠς Q,nh5UL2 LPӪ-)W :'tBlpT,9wਲD48ZټD蓢Jt@3Bnwe#\V]nfIQkGQ%B#Dhp7P0kt6!HpǞ0OjH3<FR IG Oaiiw G)d{TѸI%%m:ge5ӂ#Y4TY>$Hn\4C!RRSb=Kmlxh5dk)DT̿FI{mD6opd\mX“K%Oet9 D;G L))3$2O2kK"'h^F@ [:NZF߂QH$ev rEh%CPWa55 8k%-e5w3kc@*WcF:vk-Cx$b');_g %259C'cT+|{ Ȑ& T$cTGtc4.-qN7ѫTZ10'E IIm=Isē¬֒1dp*[D $6c qiqw'$urJY0uli 2co>)coU3eU" ꒗-]>!>Cen繄WK<)j ~DTLE 0"|ИYQkIq1,|Zd||uKi:S5:'9r P3>}Z)'-Ӕ;N )`L.4y%v lx#hQiI%) pxԧLo#DANơ!"17[Q~6;Nx>=Ӏ oc^yOr*`k($6vV@nk1IϓƉQi9!)x+&Awu™ k]`2 #SDN@IJqkB%òv`ĸ) 'sS-a%)} GFϗ S9^a"NHʎSHi)pBiZSR>}w )g΀r,/%MߘYJCHAKSIJwz`qh-<vO`'ݷP`0SnRx)^u:(6%Ay;ӯN=S ZL4rcmQi;n5]CDHK!9"5Ц%.^ J`E-tIIpR-D&sG!1'@! 焔ʷ6G%J8䂇Xql LƩlMIMY1qsc!6ARNclNt%ƥ*ikC@H1 &ÄQRtBw4 ;$>A{J HIak]!1yhݬ@}Nv\*G~<5IIgW;<99J{O ;j10H윝mPn: c0o"x)D S03*d֖H; Ƕ !4MtA(q2lR!Aϖ!8%$<%FԼ'I _`JKPxi柱ouvIS@w*MorvA+= [FǒvI*U=ƩFH{D(\j 4T -:B# !J %;&$1ID>ķsBvlơ5mZ'TRLѮp쒕>bAkl&SFIra%15;i8vZL!wdhS7tKS0ȗ CT}4"Q5R柼JH[$GdoAZC TѢEjS={&' |{zN.)N9N[p5%3i+:I:B sE))kI³?&)(mJZl=›Q%O2bTe%,k杢6:R%42JF炥*M“@)HLL&!1%0DyҜCd9:"dO*dfR#K)ia;AEeDБ:5h*h R$`RВ 蜎G0\8#R1H𔤤S?!S릉$JaFB[{ 't杤N^'i1:ܛCT6ԩQq fBE!vN4 )q=yu);J \$APTdI7"G R"O 쒘 CTH)IJX 8vPR))SI xR4NRR $t C$%9bgTjH$2"))&%3Lt')g$T|%)K=RHy'"9OdxM JJX<'(?4%7d H@(o Cp'%32[o : P)ܤD%ti'NSjDB\$E"JM KGhSr$S#2da)<&))!4(ȘNԊRR-nJ} hRh4Q9N )9rE1 )P $)KrhO$[kx)1Hu|ZZ8BqP p)$9zH-<}&Qyjӗ!o/)vXR^ -(& ];:.T;@-ПqC mSsʫ uNR ne?tp\pqKp|i.`<ӯMNsPLii]X 5y3>ʲXGE!^p" Vp߹uW.ޫ{{3Dq>?y@hWYCY*W[ ţ+H>;(;qev]dlgx'eB;\;`SA<&[NߚN-m54@ѭ-Gy%:Y?#7:p8J"2uw|A#E'A? 1(Ԉג$4N6T8Hq)8BDHO#AwѮ-LΩOe8f4Q'yDHDR$QRnZD 4_KhO:hD$ RRI$ِ蜴pDMhZO E *f@uCA l%&/O킛:Tڵa-Ʒ$ܧHM4 r)IJ{R#k5p&2o;S<`#.xIRR "SȁPp;LS$ 8Rk{"%).hϊ ƒ$`\ c o c`2`ARܔޖ fOda:tiabSL'Md$li翊vD4 AHsG&%܎ i炡X'RmGD$R$q& (t?M2LӮi1FQS"${NTYQ $LvQ n0tN|xPa%I (n?4r׊}̰@(nڤxPӄS{Vka`Y9'4)gDJce$2k6}F4~IRO'Nȫph)xDjNzhƲ >*H) VqX6uP`!o}[vFC'Vɟ%=L27A;\I<ȓfIom͔1A $I$BI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$]fΙjwr,ԝC"-*eWfq:V?AQIFme=j;$I욗2'^&UWy&dd4]P`mDZ)NH4#E/:&rL|2cfIA-.C $j5U5J@sFH !D#OOPlx-ҝ :RF >B;|RJ` 3W?ko#࠽{{S-7GU"L $rSza`ۧ*5X t-έ:6DOt)iIKP\@uIͰȧ4lwJv%1tRu&B S@0q6 S^x?4&uBm~a3GdAӄ2N1 ߝINmhAMu"$P|49aJg♰e&nX`kI AV{\?H xR{[>*ApNN(m^T:6Vb`T5n+ߣ HЙI) EѧyIL-{k3Odd}: bL![< p[Nmdr;pgMԔ%H9HH撙 `<XAe #&T R8QsmnlfTd4ӎ}KHp&CD<Aٴ4آjFmiA6߻Fߔ.H.R@kIkA-hP 'QQ%(ꤥoi'Oksa?(i.|IɋCN10#*Pj$xk쵾iT 9eD>kTA%3C@n$ eiG&_s}g vRs:)4$ _f8pYj4=W!\ͦ@q:&{S iIL'Vc85*>}F G:9M arR7V2G2 }cNPS`ҥ-hNS2<@Plp-O2tP4%8$'s=pi (8< nxON"#D$&$ ]6Jc^JCR̯XzM0i0úN 烯hi %JGUNdSc 8;a'X$Á98=q=DqAQ%2{h'AĀGU4nq!'KwO65 )) g:=)Ӹ-!)-ײih?JJX㑨$)5Nk0[Y8y!-hIMƜR@#l0HNٰNU73p@c05D2%!4.nKf&u;\ob9 /ykPx<$ŏiC,"4<KZiGdtPTF(5l*Ckۦ(%eѶ>A$iLDʐjͲGsT[{AmaI B@Rk`hr}x%)>HZp$EkCC $8)@Q::Aܩ8Oxx$u$HB ÄԤmyq.ngvQU( 2Jfo&o& Ot]#B'k ^R@&a ODYi3蝾8|;%.Qƪ6k:PsÌ "WJ6ꛞ8O &R =OcE ]S;t`Rh-|Qip$a$`Cd]MU S4I:O 4Cuʙo|ABhILMA:Xݻ|qx|r\Lۂ<Ή@)2e%(!r\ a܄lɲ6Su#tNJ`w'Nv$)DVC Jb[29Q ZP`/l:\ NॢD$8=6`ו]ǂs;}a(G%&- 2@/Q!A:sILZBi&a. %!) )BCDYZ֍\H;A' tsV$ti:&J%!l zrS=\6`Mpg S2;{=Ѥ [qWVP#w*m0nԨ#<K4 YkFxVː)ew@vcu?r.{fUf㸢7)&Ɲ Է} RJvƩ AHS8IK'Yg%<$ڈ#n3>.QUjLqV~$^<B#yLKZ =xZ )((o)iA+j ǡ`S0:"NNk>cQvXIvD OނmcF'ٞB}w1)JbIL\>8Ip1!"͠>iۡ鵅T*%%. 7L&4D42a/4a%(!K|{l&'(:@1K MX-R/"!4JZRIK sJ` 8O<-1&HIKZL1(VvLB{wJ*0; px Gs))q4ΥLS4TT 'T${FwnhTi昴RM))l ;H8Diघww:!ΞLkMϒA8NF$ 4&RqvnFy$ tO'ˍB}w*%Llrt% `prJe&8읻5NFhxѪJP~\"@hQ$4h%" yH BG];&A<$%, <&A):)%/)PѽӒ#Q2Te%.þ6%"G"II BvΉSBILC$T('x$&wn(28RX0Kj\'IK5KpMʌQQʞ@KGqׅ&&MRS#)FHQND RS knLAhQЩ  M)r<&<*rtG4j'(I>JdG*'T܅7R@6<ʀ:jJHH;J5.FvT4()(O$JSx ;)I2s(D %GHMR)ô@Q4Q0BB)M%>R [LdɶQ.!>D) JVИ4'U6!}|<Pnƭ9?t )a>0GN:-:ZpX0C)rݫ2?V;H])+zvu.|06>*vҀIux0:9re6U\]Fa4 > ޽cj}uߴhpDf]N8}ޝw@ z.{NU:>mD^K^8x=|UvySG^*-r*?4Ezw&s S83-weUc*j~AWALi(bA]cNׁ+0qRJp"E|]Y>W?aZ6gx.a oWCִ!4*ɶ}GyWN{vPos|]Ʉ뵟Wԩ~4Ą>rD4;XMxX ǻu$;FI1p(LH" n%JAkdKX4( pxS1Q.); ` A-FF=.uLt<Έf0a#Hh7Ԕ )&; G Nu7N27H?hה<('ѼNCk46ԥ)<0r5H K$'XtBfr0òc'$S=3;AGҔBxM9ODR\"ByHɞ8Q^?$ cBR# U :h[2\a&|%$(@'KktO{0Sħ$N] )b yQh RTö44#'qڤQ0R$pR)8L}ɦ04Q$΢0ȩryQ-$7Oi0'82#D paR7rI$ؙMI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$dN֗G@ʴNi*I2fg$=#7mII42|si.^4]Vg **C?3[,$Z>P?W +9:!: B2tЄI( e.|5T:p'{Z9L%$p@ w4I =,:t .isTv:^N"Gq)m Z㮉>A+$yw>5ǶFmL5OdO.q:(NP:& ӄ6k!3}?*4&I*VX$y(ĔÔFp;(6G)))v I>%uZK@s`kk @dE ;$LyIJxuNAyh;^Cx?zrC"Tk3IJmP:q|: U~1+6Q-ptL$[k78`te {e|iD_$Tɖ5'LNct#Ϻ49Mh.yAL;NѡyQm|p8שShDEr M{"NΘ;FJ.%gU#{-NQ'ĤA!;$4n" mCZK]4)<@U2J$e1;\lqFsIhGc gq( 4H8(AI :]3 vhCy0L_̒hL t ;h9ZݺXDs~Q:xV"ZZ&1> 'e-If$Q~D" rS ׺c^%N!/Z%Ԩ>8'mm DpSjLWs@][<8 Mv)ZF@Nw#HIis_ #Y왴4s.ę%4:t)ITRu*N|'0HKvc ddƶRhϐB{ 5- bT$&iғR:AŁ@10><&--v1Nq<6psA|ԫUܤ6 A M]U4<(R#IHԤaݡ>T1N0tRu %a6#D+)k '<"zv %8'T͎e8|p蒑0<) ,$qC|?*myP*Zd&6Z1⏠78!IigAQ^TIL,ͭJA(f?М>)Dxָ릪 .(>FH tQR q tTHʁnYϐ잠yvNn; ;k))H|S\q$'$m<:4Ө7YSsG2k&RS'*VGS| '68A:BJ['!%1uß4Zr͢Co-mB~dݤ!AtRdLDL[IIM֖A7t(/{Kvzal8 *^I@׺Jm4:e"Z&Q+1KH% Q _"uDfxIJuM9oq&2ZeE`RsA&çt"RV4VfyLέIit'J {L"tJ]65SN6ld lV:o-&F {%Ra&vNx$AIL 5Y'B8Ѕ[Y; NRݮ’ocԎ|l @ chu&4HMbbT`ևt-MIsS"R0T{C"e3dH:7s@#Yꍭ'w:=yRiQx쒗}R{ ̞[)FH%%#mnks( qRl/3G NĻJSv2!! <4; +O`#NJ@>I$o-w>$cW@yQ!9^&4H% c|S lH 2NGt;xS#KG)"Rp$$l@8ӫS]xMY9- TMe%!lnhS[ Hv#OL-fSk;qH:(8?Pͅs':'i-(S_T (X $In%&q׼)ٙHcC9"JG[-Z vZ?G0; ׸Coѓ=' 8(o$g*eT$jx-gR=ԩ{:T#Z[ x>^ nA jtX6 0$$8pLLYn$AyѮ&qs%1LAn9wtƗ~؁T%|Ie\ZtQsO NDܩA:YsO!=:"6RէBk|%) )/ vTE" 7`Ԧ\S?a;lpu<ʓY.23#'।q@LJa|öm'N$nFmLp%2"m :j Ag N@!"#&lʀ.^ ЎPnAiL1R#$urX5B 3v8)rKNS:W8 %>J#T`x)Ҙi BGd7CNAHF N )HJ@<( H%9'De4))=O4P4j5OBy*% h]6mxK|8B}჎|)9SR ǖcⓃ_䛲Q*\ L{JLRs9CKT=_'H3r;q0I 5HXIpom:1[ngM=k gU=h Fk %ϗ *q )ƖyMSCtDiL4)Yi1LMNI]BIRIK8kJ٤(n2JpI -Le#vht#GSĤF%&wG bdDi5UHS. .$lI>üaaQ>HF>)!KjJIh5'wCQԥu"#U!%3v=G0n&.2婢9ILbj"~Ig(hSڐN)q/(A΢{!&DL[))4x#Zu%3ܦ_P%J4C-"u|蔅@J'%3B)O {te%$ܛt cɠH4$a#2 H H)<$'y&&9HH4IJ L G^s!7P⁺S!JGf5v mU+:SuWj7;~ ?X\bm :;C+^M/sOi.Ӓ$Ue1^V[uA :\ΜdQXRꟵ #ܹ޹Xu'pom yRktW[χk i!Fwϲ`묿Ok3Rp1p5ӃO[4Sy$ @ J)S\IS8nd:& 10v@UQ .&c$F”#X:ig<R>'I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I#cِ$pn4j`tru֭n*\n2ǒxn~]uhLS3nmPcc|0qL!"'TmEN xu:ɏ rO JR;f9S5(!'cG<Ģ0s&$B{AIH:ʊ jݩ*M:Ae!xAUhْj;Y:xN1Ewhm)*oh+uhR7^ܯ D gÐtHi:O9 'TV-EL;'֟@Ra{agIXe@%d1,:OVquCፄT쎥b3:#P(m'gf]o碋(RTugs,gAoU?!wc.BEgx<ΜSgP.9H +t{AؤkXKUSJK MhDoRt2XޫG8$vSu7!u O>+InYb}GH&e_WDX0NÂT v]2M lvrvƍTh$:fK/5@ CcSk{F\2FJwhZcD^{p*zfxOSipxN#U-h?O_$\4q ~>HB.ntRhI j% %)#eMU`dīMj- ѻlE]֟jv8׈N]S TDP|XJml|eAᮕ!_DkT ԑLl41BvD uoO# (@Ph|xUms4aA$#“yRRk [{N2ln$VAqnL&$Gd{xvx`:  hq_$hԁ{-)m$h()gd9hGt(^mvI<0fI1rͺsLS LT6d8'pQ&Z> ^kF^;ʐ? gڒv6LPLjeFrqhBp%&5T7"8uos@/nJ{*cq!@1y6ʄ4I9LN}ɄΉˤhGRkAӝTatCm{73DTD!1dǖG|vtƸ?v'_Hx)T$kJd#E׽?w1k-x'nHT 6aI͍R F {IO^@$vCy#@& pLxQvRtSRDTurKg O(ڸmN)dr߂`$˸N N!$tt4ǻQsvvOHf_4rCttJ*]VI h'RRk,;.2Q 'IO;^:$"Qװ05`!D3ԤUU;&L %i*s4|S1PWm!YusAٽ:r(F$5RdO:$Qk].J;Zָ܃v0uN~ iMH#cĦh68kI;VɆ$K~i$OiqpklAS wS  x$kRa J@^[͇ʏˎ|%e;nB{sP{G#wHU9(RW[=@AVDPݖra3g "]u7%E54*-saSig80&q )+5忕;[<&X$k<4P:& D) 40o緊\Xl0 jk=2RR}=7:ZVC{"r󬤙BwiEHim cg6N#.%ge4;G*/0|H)JeE{>S]x .ӂST$&l̤linOx5> !mD!1w25 )3#s`xՒ^}7 -|͐8>*gIBy$y%fCk虒y)$Q<3⒒c}|Cd =ӴobuO0pkI> )@A7ksS쬒|wCFg⥻]Bm;蘐RRH C\~0Ig9b $4iԝ,!Z8SmaLxE `^zT񤓢EI Zx#!I9{lsO*AΡDhpژ4))Mȵz8 /iϏxDtg k,AHpWfCeA?Br!)}Oc hJf=# ޜ:Mh)$,\F<;L">vX0si$A &tNGH)v8cw$ *(D|"6;$t %8p& ;'MnʉhP#S#T@0BJHOUaxRlVIN+՝|ƉΪ$AH1y kv=Dc2 >ӵ4ƐxR.k:䧲Ix:pu{o>-akf#@E"$j"$BJlVO#S{4CV}4CbyLR7r@suC۵ēʁw<7Q1›%3)2D%e`&;o!;[>O}f0Bdm  9R<Cʛ\=4P7rU@)%XAI^:\F( 6hKȩkL5E,LSF(gW;ND?$ $l!IΏwea(#} c)S0CA#t9}beM`<% ڗti-L77hu3kch{"7K!-Нq CyU,TW2Z޸<¾6Q[[[ M:F k=>kε{fCY{ς;pxD"SOAwS'D(K4 q&ݢ5J\ۯ2:vN[jDQl6ꥴ)m5Dmf%HLxȈSk7=PFR+@G=l>*[R%BSJ*Bk$GD4D*$JE%"iEc@<")LJ`|S\Q6G:\9.0))f‘^#SsIKdI)!9ivԣ4CठSE'BiA%$d!&4PK'RpOlJv5:1$tN`$$;ƹ TuuC#N'ٯx Jִ:_VA1(O%!S蒒{d!E#O gMBdŪd*$5Re@k4EC@ G :<&e%&cu f?*Iډ`㐣 'NL4$Ի^?TݬwBavځ✂G)J@jG%3H6?pv$J<;Ȥn׸hOygZ?sJY#RaEqOStCG Q:#w~|C7o|RqMƪE%)q`lT;~ CIGe`u4M-vy `5#RMtN!wR"aE4MBBDk )^Z}*@· 1O)K56TE )Aw##DkM!%.I2ҦnE> ; 'p$IB'gu&QqRJ<S/]Bx4NײJNǸ{N ~!5voF@9RtRoAsݢGDD>IL;aI,\4M  rH#D:\kjCJpNf^>%`h !1l%'TBJ]z'>.C9OYI0 ;$ZI_4Nq9T) C] Jg"dswH՟4!13*CD0 lb9P#ty(ʈp 4eEPƉCnlN fy)xEIfgBZP[hO!ʄ'@x$:Tp'N.tT| x A;RQF$LΉ0d&hxڒP8MY?1po?5`_`uLuH HGAQk&xL'Dʐ)fP6L uKtG<$"j) tȢ r;&sB <1IIr$ T"> JuAIGӂyIL]*FV!+b4'4qP4슛5)$Ts` 9.~i:=G)e'B4Po}cT7<5CpL4($G v3H))! hpApJ NZTLDB#5*$S S,;N)#H9 'S0ku*JJ[LZPR]y1u&;h윂Bx%%/LɞciktO BDx芘 !dNFhB'<&$r5 Rڠ;ZF-"$&%% G@ *%o9M)f/=ŧIQs;-!L(: Mpׂ3GhFJHHRRIPkBgIMՁQIIJ! Je8&Q!4 ĎDil,q]->WkT V(=C3m̅a.ihqs>W+tfpHA_8_V/y r2+nS v .}\vk= > nq=7F4s! 5#_Gaf%.>):-$`hI9@TA0ˊ2{ y Mc,QdI(6d*Sh ?"U.|{hU'!ժA$3onAA y"|$1'Ɍ™"G6mq%;3&xNj < e&4*OtjuJ –! RNhaM!)HH4nQLD9 Ptk?9S KK0p-we0ôOtJ%6hg!gX"7y`uOm8 i!AU<D ~Ԧ;e :%LlF Em{GH-h m~wH#@& |7-$ELd:lF4$WD;mh'= zρDuRw:-\,@qIIVo;:ʪƒZ p@u^%F8 *v(}8 +e.HUj0VFvg\KgSK}{eǀ3-v^I%uK:#䨩 6cA:#爬s=k]b7@qX:I$j$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$:/HmuGD HUs/5EWX>^;o=eZ4.#D@h&Y9lsz v12㯉@ ̓%HnRaV Fw.-K!@)`*5]T P #ks2y%0s2 ;X[߲mV~UsICBpTx!od7l. Ӯs&{<[H!'AJ߷=۠8|Uv 3'i'˲`Ԅp4U.}C y LH !ڶ=V i)*i%6a|QYk*dSqq!ܠIONЙKx#`xuLk"DlLgÕ&\AA4%0xh SgIVw6R[(`TMה3;Y M2 AF(aI(tA鶹՗G;pRRhۨ* : d )'ģu临Dv"wkIJGk}ØNm5jKF_;$(h?$T}mw]\vU}1T:P)QghԡH1]Uc3Oj2Hb7 ` wVɬ3o0d)RSK!Ǻ#vKLO ˪1|=i:S5!9t2A 7@6MyNL G-cdI=@`TȝKd) %;NCXmq$=]QsGsL^RKA)RM>3n%O"q`ӂJNq9)S8 Ìm%OT8A1:.ti@윂 Ś5L\{jnILk5T~vK]-Mk6RYa&_q%*́P4d:I:(: 6IEyRt4KpqEKyRN߼*n昍$S4IGreF;PR{q SUDzlyOt]a(;SntltE0sHzZ KD:ߺC2Ǒ#Ehf6}j.<>Ώ S[9e%38%<7C6d25ȵXͤJH4w%R6i|!{lv*BHH!pq.| _y'K\ m?y}>|$[- Ɠ{jWzGCv(7h>jmbD@X)4lAp hkAǀUtmg^HMG`rqT ꘸ BL31>2S$jr6 Nw@vSi3iwޚ`UP@yZ-!)=I z6$75Jk)$ m#&y-L\DJdz ߺA(cw2G%N88i~Jn~ߤMgYQRkJbsH'C@"k9)9CI;' 0Yjx=x%#u.xM{%X`y"6F)?x:O R|R7D%&1 COs'2<) Ờ$%!O9H1쒖sENȓi\}̨J0XAd(I'FԌ;Nh )++kGH}cI ;uHc(0a)ˀp.DpDBJJ׸NJ:;(5eTD)-qD|e,+e&O]`:㲐! y)8h;$Ir$h슖sXJ ܩ #BK|.00Si:$=v*N`}a;۩{x(O}!;K|Ӹm)Skp[Qc S,sN{ XZײh0tII^YE[#NTyQq(CM3O~)[i|%8`KO)7B;"5xrQj2xQS X≇f9{AiLѸ^ls!z{:8OH:)um4Ǚ=qh C} A N3E)n&q#NZ施u4WgmvIpRRD4ٹ(\a?46F$ "T]lIKl:#Bihcf*[Dh8{^ a׹SKc& l ۤ"BJfѤ''MAkigDOp$TW[ ;ӯ 8 ,27!@IgR{&5 )H$*[]vL5 &a>NBQ7LOޙ<(̄)(ILȇb5L(Kv=ʎ> ) -Dž t=}I0FL88~>uJJ~nSPwt!.rJb7@$LNn:$ "Ff@[NiSUV'RZ xWQCL9;&h5~uy*;RJg>%ZNM=JA%Sw_w o̕)M> R޳dYUkDr)Q))nAJ5<MD*3%[?)5=)PM= !2-@ mlϊ*2gDiH ?4Vq0>Ja"Re)윤LgoL2I&%-$<9֓x&iLbL04IIk2>)ܦsY%sO)KTRH4] hyk̈́LrS*dN ui&eA"t~I*lL#T%sOr `)pL[g\ݳ߷ .vnR-<$PӃ̧ v 78B6vL'0򒙸>[͚ m6wIrJ]ԍ U|5NdC JI)"t}cYB :Odb@@4LD$vwԬlAx6 u a>b!M4$hOh 8hSߝ{Fit?EmyBR wN=B@]j}$l.  {@$"BNh%& &M[n 0׺L*AQ=|Tvޡn<|Gܞ`Lq> yntk93kbND[IL<"Vc* } MGr$Zܩn.B5܆L,ppΡ"`Gd|Sa Y']`'QLD{Z:pRvtAG !f(HJ@$ssKO!w~8:$ɢyH5ALYe3A~NBOvQMYLN&'S>JAu@?5& Kj` ;$Dh h4N$~(N cpt j JAQ )vtT뼁NP\;J/)nh!N=RH=# k&{ۻh49Jf_ h~ bׇie4&THӏD)EIq ȀQ{fFGlxR&ke'6mx(W{\@.8)촂$y&j)7E'#w6#+~…k 5SD<)lNtBᧃ›A6뮪n&=[h!#]PPM3yvBbHh>焔͖Σ@ÝȘM#}ICC$B[)%C#N~0XYɐ>?zJ  ]wM*b&Rp'TKp5Cqyl1`Pu45MSk0xQ.N'PlRf|;(=3uH8xHcDS& J\{wxHv4NbG cTd( CIJx'veAPDn9h=@jveWsIBwnG! Rkډ# ֎ueLViD;zGGQ{%Yt!@w364Ihk+O@դ{)`)2-p{.v@Ӕdu*fFIwo#)b "W Ψ1dJ| 6;_ce[Vp> TJj/beu}=ᡬ7Q^լVnl8{EHMh.fF6u v/@¯ UBOV tI$ՊI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I'kK%N_{$tp` RIIYGtT:W@uԼ@+ ̬Y̧AX}IuJ\\ 4「;GCB(ZgϹFw4fD($rѩ@m:E5 )->%:6f5/,XZY'ANJlѯEp @RI(HsR Bs%"k?$t;HT|rYwU70n?V<cC 9L얜Se;BnP?*y'~(.p< ` nF߮V|N/n73@e;G{)I6{ Q'@>i$:is@*KH=A JvHH$T4"9\4Y=OI9< C4QsgA(e4x_"8L&{Kt5E>): ݺ;ۨJwcdu ZGd$75A0NPSdqs X+cZ* : Q_C QCEMJthOmJ(L_cZ*/{\CG'VP.+啉.!'HO 6{Cx!A.vqܓGJ6V=py#V,U-x*MAy$@>i(),kt:*69my*n g#HP3!RKݵ䆓<۳R51%E@lK)4<9L9<^kh{BV w耝{pvOc;@H k(r*@$mű>_Dpcui E~ `F~J.0@IRR8@P67A$rH1 *Y<OI1=l;c"#pqkX|[Xx$@,HP8AM$)85DZmkF U4fBU52 Qkd|:I])5Eۤ )zfʷigO(k@|e~ ۡy $w m #9yH&ci>)#qL(2{'{Me?P9!%3Gw(!qܤ-$GLx: jOtN# s[$cOQ;l71T mSAoCڐpLΜd#ߜK Sν'TK})Vw3A Lk%1I.P7#~!DoN[!1 TI*Pg48\ABL{g2O<&IE˜hJBִ Rx3H` qw> tЃJw8k ;ih)v@=Ыq䟏$`ptI5:΁Oܤv<$<7aJkcccP<Z:[))%1cA0 8vj&'P6[  >O&> 2/ILVO%8oكRDRoL iOXND$A'Y- :ဍS@'$#}ky=) +`TKjo8sS@Rs& tEL]U {Q^|'_nyvRuɶΑFmTÇreDG)Z7{$H<AuOѭuDyw?*cRtL ) &L Q6tpjHS.$)KNgE't{%2#s6Ay |x:]8Su #^x|Mt )k"kF'[Ĺ5w?^~*D0v'H5">Hlk 8QYd hT~<IJ 9 )k~;~E}O {x C\t jLx"BaRRoL>] Y(# -:SL: msN Q-}Ct_"$r{8ŻxIJk[ TQ.pvQ{[.6hu $jB}$ILrPXk]D56yDvQ&' 3i%%h%?\y:DH*n%>)#&Sm`$A$jwahl47'!gFPyq u'{3n$0H Jiu RRSΪ-iwi2R!$wp48iN<,IFa9MJWIF&~iα {A8L $T" Qip$vJu wwIЧ E%,vm: Cb{ALSJTcIL @6K&ARܔ vN5%('-`OHBD8 HhcN(vYih"y 1ip$**" -$*M{HpF"GHNw{x4vOiBbw)<9IL?kpA0{ 5XF2*UӮCRp⧴ {(k[wCx@=wiN:ƉTZA2vqU/*dɇhTuB\TyX[JK &tLmy;{Od04ɈNۛi =K䜄ӟn)0OME) $8Ls;,y1bA`q:{TAQ!%3#Inu =vC$~**@j Jcx=&TlF #8:"9ۄA07vC~;yӄoJH,D^qgCiFhtgk\HI(;%ǚ )/I'%^-3uj鈑 4IHۉ#Ne3b'rݮQ8bB^=Uнm8tP׿*Q tijIMO@Go wh:c 0M%$):8'i ۟Ik)G HOd2 牅#dfBFg'RJ;k?TJA5{CLZhJl5 12$}ꫝ4%9ø> H\!4"ϺL@\=kXwLyF!D™IHÄ0 +y:Bt:3杻ND3IAD܉JH-$CkLC0ߒh"b`^i&N Ln ҏNayxvPs=_pv_D4=FRV8h <#|S"{ri'O JH_wvQ (x$tJԚ-S}7x!$5C->9RRKem4Mk>=Ԡ#U2xGitۃkh oTSc{ ؉$Śr{Ս# hj6w(b!ip8sgNҥ[1WtHr;`)!,jfy*̰?$FX<NJ%JlF4\ ,L#TR N9۴pbP:@J}O=RwxQcD|1tfdxnQ%'u^ >G!5٪STJJmXI~ [?܄S“:S4O))Dn郧X\9N= o*SKoF%'t~ $t1gg | cʇOI&>) -IM~*Lԃؠ1@k=F:'#N$~* 5Ci2'ʄF T;-))&7Y H8A40,k{hRcTxq$ \DD킘 h;_:$)Ӡp*zܒɔ鮨`)19?'U itnSyF vOMw~iЦ'RR VU%X@Ԅl[͂H!HÁQ!hnuk=pZ \9 )Ëe&qӺ~QwOB@4 FuBR `dp#?jmmzj>=L|Q׺dz`H"uC&\V5do $S: tmpvc@)n k=C@3eGFW>*q:[?Z{X}☿xA*jHc<0ͳTbp̕q q bd S#D# -LOܦڬ<ӹHTN9Aq`F)J X'(=8I$I$$I$I)I$I$JRI$I$RI$1_[9*8ȰVJOIl=tcz4x 9\VͰr@B}mqF[pe<7Q tmY6&CA%An`TN9E;CcƁ() oUGYAkbhI;{hIxL])DkcNlVuuWa9R[1%IL#?xr=y9C"eJݣ" pDNRR-4X-Pe<{ewA" 44ƺo^ <s♻X7:@1$$8EIkmMPܫ A5lȵ\^x; $e(GiIIp[GM[iԈPKdy"  D[%<))}Hnje>h4vΪEB@7HT;v4n.Kƣ@Py#dΪ&4 "ʱ]rG0NYx;pt4("yN~@nװII ǹ*ݲC4%3ɝ7vAsGo; p"R!NLY DWiis^>J Gn'*>+vow([pb 1J|"ׯX>JiMV{;CZ;HqCy?&Dp$撛B{c@l84O\] Ħ s5P#qS׼IJ슮1x`߹CSĒ)oaN)9)%!X4s^SCgh%;2je8SW[;gK@+ԂTpH!=qmNydntz']DM 5H:v&JEkK,jV Ln1  \Đt)}#HB=M5XemHwZ׷P5 i[}'=KZQ:Rk^v'qȰ:}5%STLKUyEX=>i5@%q *D5Tp $x2Od{؟3:i)xE nǢ>"! WFѨRIܦ\> 3Tu.XU[q;Fnrw6Hǔgr IPrZt)).UOͰ`õ첃S IAThFa%3v5m\>)o7u]R9V_` 5;Xa1q;AAvjM\L ǀtDR2[ 1S0Q@>%AE.C z< l}rh.I<';BJf v1)\`xEĕ"HvD%4L& S &LgT9ӈN)$5P7K_SSmh"L`(4G1R%TkqqQf4ݲIL2ra,<)hLē߄WہttSpm 4@^G0 lLt<S*۸6,'^ FǝIč|S7ò%*1l` % 3N=454x5$iJ_x$@RkÛ M p  O#O)> )v?YkLũV\6Id vGiO#QH}IDȝ@I,8<:߹Lk v?pL#xd;O+^vD6wxiAʌuEHx8#\}l'J!clG87 OiRG4L fAI!Dg&)l:@wll[5CIk,uz!HG}{l&ޒ;1L6v]6Ȃ L #b I.iXD{A$4 L+m2 |5)7p&Z,p$8'D00Bxi!(;Sd쬸 ߷! ; M:) ))QOCh=ly(duIP‹\8%6׀6CJA[\NtGTA0r> .4 $򊘵 ӄ~iI%XNJ`c@ Jn5 ) ^Oٴ SxS }% rՎIAP,qm mpT?& M Z&:'O!%2Ap-[T!PX  )٪A;9{$\>):h{ 3riLAapmO#˕-kkOJ A0w߄Fւ$my>@Pj}@|W#ħM *`ڇD{^5G37C ;dx'Z&1`^В~B{@x*M$40- ~>))+N8πS{mS KJ;!6 Щ#Tž)!Y'9̗* ii;LIO!7 AtKQNGJ_G)4#Q <(RRXINsbe0x ӨLR0^B͖΍?zk8ugg!!DH<$'S f֍Ô~%^ AQxKR:i! H$k)֙`cT&RG4IϙCs5ڤoL izH %.L X3 %ޚeFBP% m*CSx()?I蓼MAq!gUPҊi H^IA4a ' )mPSlAݥo :f1>)' QJfH*0mOb<w'T8!IK׺JmoPi Ġjt<Qp#Rs&))-o҂=ݣVGhtDN{mG0ZY:8#T&I)@8Υ4ҋg`ΒݑU-!UwXL L%0]J#1X97 nl.3)9%g]oުnjʐcLx&FѮ8Ou;2\a UbH*)ӐoU? edLtUۂ6;#pJi[E~(T0*-'I"oFSIHD$bS4B_% !4%Ɖqbe10 [RIۯtO~nQ)N,y;#D'&DӢT v)M*31(ҘF7R}7 RL"@*S:'JHҘ@A {{vH6t*R0iD0uS*peJ)J|B0G#X#0uO)ELC@;&wdAYoNl)1☙%,1B78I)0m>5LtH%(W.Щ]dK1I.RRl:6>!!ȑ L!G yO)$*Z \1Ц"`t׷Iݡ[@t ok):F$|Rg@:G q0a#hT2[1:xfHhJq8KtcK$J \wO$zFN؃NJhBIG܊;ݠ04Ô*#U(i)q :OI9:v[Ì(:ۿurp t)JLHQsx$5h@Qsg1 .L뢉ALIfE]4DQLNx"$ RI3 2E$򒙆 ݯ|P䟂<$' %$iq! !8S Jdׁ2^̖v'6C*0j.RR] _- @O4 T"huR'(%~̅ D>( `8=650^rFiqJfFHЩr P`wQHЄa81hOۺc$xr 2;!NMvS SNn2cN5 ;iQ"p59I whT<0<wޠţ>i:$$*Maͅ])%>\Skp$h#a8vh<j|7pe3"/}QJX iw!8q#M0Gm6 H{k$x 0H b;H #`ۏN&[ࣰGc.4S>%6\O x#t8Up g6!%/$ѧ )?S;I>h`H7@:1'91JJ"iqz( V3>)E0D"u^舏_Ի]ewe tH9R"yALD'.Fv n*%w'pRP!y'G?L矤O(Cʐ)EM\f!/ѧRwr3pcȧ $}.t66p{!s+@Hji6>!J$JJf_Q5d`y10Pac@P&!+S`ۻMx% Ɵ Gpe+Ѻ| \(G .DHR RLRpec]Gܣd4{J,xQ2ǒjmRV4&?7Y ]WI>*FvMΡD !Ao%3q2Cu.;7 69 Ɓ1pGoI+;iSkà -8;iL|N40OHS^>H#HBq@o)Hi||S;òAB@*!|RS:On5Ak{p%8<I4AILK2;Ή` 㢃=e!a-JR2rAIpsEč4C*N&xMYRp<$II^I8;@=* &%;wv(\jYvgltOd"d{vQ$z4vN&`)'4ϹEɝ{!ہd(>( uQ{Pol{BiMÈ77hا L${}@#R ^ g^d @R L:jMSrI@;Kfb~H-%QNwtPh;"JN]W6i 1EړВ\t pY#f=HP{S?\ݶ\7 x].poo պ; В^O\ðe$kUzHK |ߪYj;e8["}6xfT9zVOzQ'K.7ȏIg"t̐$OEzG&Xh>#zE+fuU9Syg#®0 |T2m )Kx*Ӣ=&H6y^r~7}hεK gFoOc+Gծ-EaRe4fu5 XI$I$$I$I)I$I$JRI$A%ka˅ciԘP[KeWopNv4Fxg0CBkCXKRqsz_X0J-\N縮}n `*DII rAMC6sIec'"i%2c!.08,<;$‹ZD'-'U:DvM$湺w]i%ܝ?HGpkct%v;x:58>4";[%3.k@> "n3̩NH'R<JbXZji'ĩ;{q-muB/]'gI4N%1ls[Y1zF lO9%9; Onڨh#'R1>H)%X{}R@8Nysg)Ky8hk撒2L{wCuͺviʃ,p x觔$ݴ|p+05X`ɌiNhaBJf6D(ٺuNܖC]@ 9hy.nZJڗ7Q[Vj?Dj8iw0ʔx,&}߲k/<MI@! m  kx,RS-2 xGNq-#F[O`6P?6HDkI'iě68RokmI$n Cx ȑk~iL ^~Lp9e >%'osv aɾ(l iߔijȐt hkɢZ p“O%H8wLH=Ss}6L:9:m`?>&1uط/Gæha Ds!Z/LF8)@D$)Zdn:;+8yY= ! h@ħq΍O.>AD7YIIS1 NB-`򕣆 nGd[IδIp-O,; CX4MQdo|S]T#׆yI n*/~ى*$;i)YCv;%Es!5$hgH88{8IIE$#qcHhbun7ai 'Q'w|Te9 { יJꓧJbc}bgT" JPnvLi?Qt쁷ۙ<&ԙN 9))!-Q@ǔi2|LHcD y 綩$Du潄ˇ 06kpvKiSn#Qy/$A!NI%6Zl#gH:m:T:Jb& 'ӺAyA%$kq(7t)hFys>Ӻg Dhq[:&:hRgElsxԓ )6eL( QhJJ@@w!"|Fa+Gc! %P;'t|J*]h'p Κ'kPL: ɑ'MMd;p !#$^wg+ `.h ; `/׀~‘a\G)iusN+۸L?܍[HtӪP'iDT[0t(dn 9c@u GwEu-sJ`'H)KLBJcY:Jd7KbxS}!Va-hmp@> O) l>)`))ph0|'D\{hBg!y{KAۮĻQ$Υ;dh8OPS-wT[KHk@]>?Fѫ')AFmO ؤokKv nlH $6l;52AAͰ4w`Yc :;!N'^3:̚GTT 4/Z73O5v\ dݬ$J{G yoR,c'N%HҗB@HӔהtkƩx  *V85]S@03))}GZ# bu" %-[)08Q'pהTTKNtW+>؄pN%0SqcƦ:@㴩QـIMkDƩ蒘I;_ߊ!%" MKl "{RS-#^BZTA71oe;Bbc^zwKjSkw m)`4QlD%1II\Z4N\8>*/ Nfi{l;$' > 1L>iT|s?33tp[ZOIS@!%#<` |R5=GxRA䊙;gE@nhs(Bp ODJ I4i(!焟cu :[Њz"[f(EFI -РEn.@ $N)ʉNBr4II;ND+$:A4%Gi"LJIѤ"zw#RwwS}ߔŲA{NR$kp#`svU7qSh!-!+Sfw;t|B 4" t" TZ5;S|PJ{ % @(&>ᢜ$(ʑvhL̀K:0{JBG:/huXf#:#7)`.gDi-LꕷVj %KiwQsrv {]@d,7X$'Y`}#()&dNN޲HGT˶.wg$ĥ Z~iDBJ 4#ܞ;'$ R&JiSR)(AHۧ "J\TL0pҜ $S)9D!qjx?I)RIǂPuDڨBE&tH7E&LJiKxKl$> IB;GxhRbyHtTJIK9)N.Ru>{)@R]:AD%))nzbJs>(dQƢT+DlO L)I m-葮A)jЂJD (pVk6`xS0wp(D^S5>^)ˌSsw Z}(90ɱks`̂y;vHq<%,'t4k۲7D&NyLnD2IhRLt )@re AyO&RRHHN htPN#Cd)BI)H%0;[a bh)8( =| ^Ɯ=25S.?E_Z >I) K\; `diNɄwHr%2xk tǷ{úNi0RS;ʻ`x%N*StLuE )D3nւQ[`{$6niJh*_|RO>΃@A:b׍S >)']R)DȒnhI!|B[`n<A*P;%IHL{ =ߝrH(Q 0p:"&5 p Qd'"u) |RAl44ӯe 7xH3JdӼG lJcS#jj,!B4 ;& qHɣI]1<4FXw(~~rkw 4%59&!$0KӲ_h 4;S%7d2=j5ţ_2ѿy\H rDwN[ni= Ҝ[ jI;:RS31 P,hx! %P'%.J )8`tS -DBA#: uMpT6$3c 4 jex%ZzM<$))VDy*H>!;ݷnSmi 41%(MrJS\q# tw聻RN)4H |D-k8N$v¯ͧ&X惧D7Y1n{R RS3|nCt¯Ȏǐ C ClSے͈x%6 !DtӹPd.,p !r})y0%%}7 O0{:xWP'O4'&㔈TDiJfI#; ?r 9NםI>w7n%'p5CAא;(z2"]d\I()PD}fF~Q*Ĕ{m `qkf5RrcbּFN4O4D'I4'>Ti88I:xv:!0R"%2<gpbd|Rl"<SH R{(my2Ǐt!1d F~!)Ib]Ɠ⇴Gw%G4di@%%0;xOnZ<$w@F?G@e%, e3a'EƼ47n{$["Bptgq#2-Mc!> šbĩD2g$&lThILLq>;|4Mw1=&xNをc72<`h|G?d?LB`#qĞSI )#,R{D`)G>)jٔwRyH- RH"<a"dU2 :vQ!<Ƅ'&xi,v.]JEẁ&2HIӒ>i)#1%' i w~R8>=F8)Aᢘ'%&^ %rCt%r:B P<9|<ݫd4 3_Qa2A3ʑߔŤpYH(b"+wNZ'МMʐ& E kaL# :w3IG:'4ORK+Z Nt^9>I sb>IƚJJdY{E8)'Mg|JNJ7rIxpK 5t Ad۽3-xlw8 A f?8A%I1:I8nly:G҃Th$Ou]vQ6 w{ꝺD(/{`蝃sEŮ>t0 )',yI,״#F4 2M{h/GKhL3=Rpàq<DC-Zl - hF vDp4wn l5 dSyI ";(?" &{vN;:V7w$!(Ni2Y[NT Q6 iSgCT4: 4 Al;,kϹC 8{ Xh[V>uAӲ]cEMkh'TV{ 8HUX]-c!Nnxlp+4X]j&Iء[F,eDBۘI$B$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$]_Lo<sԺ%z>8@|tes=&zb5V$3}{H(+@'-hRuNQ2>Re'P7Sm'lk|̍̀HEGq& OTȴteRI$2 ;2Q%.8NiRWf|g|wM<{CʥΫK5>!f3@z_5Y㕯N'sW\$FhB5JB]+yQP`SHxQ,> !h.qw(/dxܐ>I@ph9RiL@I o4;at9XDqy *-tMq5C ̦$EI{@.%6CC㲰osܢ,;BOUˀHH>Hw40]TGnq-6An?c@IsӐݑj`e&D($)%{w)YSgόgשƊkDMĘ&P 4RI j nl0tN 6kcCLEN@=5D!F̍Gor0LQRw.hJjG3ܤF5#_$4I)#D\@0 &h(Z<L=f CDvHP-!Z;%&r$j8O><>ISGpyIKm|;O];[0XDx) d&gΥH8|JIp;vҝj[-o=>$;'kC6yAOYk`su vC0ZӬra"@۠<s?6rw8HuS5Ta?xTk4q9;IA{)lϸq L@욷?pgDu#E9쟿JX05*IWc-->S95"'A۲D7]L'))fp(6$D=M-> N($N"kk )QnxdOʑ2 Ҥ̔?RR0s=F{@Cd0I xm"I"0 !IOT frlsD# SIS ۀԨXEDmo|Ԝ6y rd&q=DC7ǺNx hG7O[F뮼(F<ԔkE p ȍd&}jb{'h2whH> Jak]nv( (8\ ?r[`ħqDS|Rv 1Ɯ a'7eap)5ҀN0$?7tkH>@0sSqdn##i %{HBy$Ͷ`xò *%>yIH = L).F>)O0Ω);n?)5NpGO@#_jG$$@'4!5ﮊ/:u2Rh]Djz:K=ȐxI|'{S 4(yI4F5@fTD R>IpKlIGtw iD9Ldu}/^xC%Gܥs!98H]S9NJn6mv |Ӓ79KlrHyRGg"`->@Itin! 4TO )Lp3KIHCZ=j<)$qk&f ƀdBBBZaH $N-B ;:DrRR@R]IA&S-ЖSh J uD7E"4R:S:Pq0l,;̉”B=R]2{kIS Pf!N䂦MSJmSS Rl#`4mR'&'a Nx$lk 5^E%,H?z¹bÒnnP6n 'IIJrMdd hxIΓv ς*lv0l;μk$O3*$jGd"JLlmvǟwcGvMɂ CQuAL&~ CxFD5فi4#RӤ"\T|{ >aFP SxK⒙`| NAP#iA"':‘RL$34wÕk=>}=O~%R-AIFty G'7HJ{r}ݒ"RRW9LI85/M}HI(:$sĄŏslN|S=N{&!4뮩ΧD)%N0cYS (lHw9-"FM Fx"<C2!ںtOy9Aw h{HԤ Q)4EMk]f|y 6*pC @:8Ix8H8S!6R{ *1D {1Kp" <RH;߫է_'ry윰& ߅'7DN).KG=NX>_*s[ӍTZITF%2a. v cH)K|*#u;4xjl^ )Pu !oA£$I/!#TF| | GRH#_LGe 9Bx &撓<48;7COq‹^׻Q#FmTd'T%.-{H$q!A.ih3wP) OIM=n0G##C;7 {xtJi6Ԓ'/qlC{`}.GS*:@E$$a-@&9*KJ-vx< 4R)/'̦yx' d ה41#]RRFʐ #x\<0n# DD9H>=`%1 p4O !q8T i w*$8DkLt:p@ӆR\wv>(7qIwP6D%E{)) hFߜ:|`gVCs=C~$ #TPB[,D7~|Su % )4))(yXtی0/)T1qLӻS$ml|<=1{HlK"LvILXGDH 2@Ӳc9Ge#c^$3y~)!(4(W<?p'}"GhSܩ 4ɮD‡$` L'dƉ*f#G|RBW :!MN@ʵnyt;PI?yD{'Jr\Ȃ4&/>p|\ 'ܛs]16TJf h |oisw~DF iA dGH[?Dhx$(15ݸ4y #E2؎FS?Q}$xE8Ae͸tyIrfmԋBv6xI-aķ^!lFy?2u~J$*lڴiSGqcD#X/]3'LS$wI `R6n!yD L~ DƐc1n%3yhxLH.;jPq?nI8'ӕ3ب$%pir g:hY:8S$7(?/38 BH"g@I'xvOM 9ZbK/Wt" Gr#IN_(b;Jߒbx9vIPkTG[HOHJ |5D|,Ug=~D$ $F; <$Ֆrw&fS\vD8U|B#}7;c |k!%P\<,R~tQh6 !J.Aے㹣EJv^w+HRwjAH:S{ |ӊi2\|pkm\8 )Y twү,~amEkI&]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$IJI$o!'Lr>z $)v2l)/c:;El$c~eE#rva({yRg p>|Bsꊙ0kΝE`O. ?R !15FDžo^^DbKI3^"Wa&jNtIJa|5D)[38m>TZ,y 5SBẳBɈĎGyB:HѬs2Z+$gER6ey jk!%i/P決rXSnvI! ?';st1ӶtG)ZL#[1fYXuqGtVmԀGL ۱Pٴj՞z9D2x"5deЭMHC#AƪC)۸kdUٸ˸E{Y`#--d"TN1ē̬{/Ʊw!_<;*}JM=WNMO;iQcH0 .aÜF­shV/ Ml; A'h4E,cçG4V 7Cl-sh 9vܢ50x>lL4A66NQ`s 8 ?H]EtiJJY2AYue  ?a0l5 ){.|'Df̈́{(8I1)ӺD@PS:˙45QļjIiwq<2wQײy2 : u.<LXݥ1RkZN_\Rs7j,~ IKJJEU鹰9TxT$,swzZ'}LTd(4<#s˿ia3?WZى>d6Na@>I@xaZ;({.y'&7q9;H`$ZRR Gܧ53o)F*aJ]׶;wJp&<, <g7荠~)Rke@M3%IJx!nڥ]‘RS>I;M r}Zt)!GwD$VtAQS LƴonYIDG:m$>+h0Tgq z̀#8w0qT $$dhI ^loB`~{4ZOzoKG;F?4͹2ۺ[FL!S$R-HwRl hvkZ>z-p)OpTCŬcSz.·FuM{4> -aÅ0& 1Eu%"4zH+kssLΚ"Il%C~;O:4<sPJ;4*nLmӅ'4Ou OuN&H1ocI`~i)pcv0.oq {\8Y$LKPL$A?|"8hscSM,`m%&[̤'0i*{t%)-Z&2+a׉`Z|SG' 6h)dD L=.4{|X ʝ:e8D(@?{ao1\ʙy$DLҝLH)$`DFp iB{s8q:#YHu $,6,ZV6I 3)w Lp % HS>Ak%{$p^wN{K#\A#)\ kII$`7) $'hc)XV lb\qjpw44ʉ:)%F0XͼF ss']T & )t8>hv5ӉNIBwHk))K\S:4*E5)L'\hL*U|F w;N{@HdHM$ >+v=q4O\~E4HIIYoACx?gwLFR'o!ؙN9%Fwp1 cBSęIJi{ 66OmH8 F=÷)68D:$О s?ܣii1xpMN9O %xgPAƐT IM8aL' pvD$r૒KQ6x$ٴX"UC{`m융b}XU6h6ڪ㢁 3j j}qekU]pPc bo&Х2M7HeSt C )/ƪ@E47pT>;I*ӕGm<[Sf|pruJ[2^D@a{q!6Qt#4YP]0gB.ֈTR '{JB֓pʉpS4Hܕ)0u!-dp %BpDh) mވg'vS┅N\;%J`@$'ȁ0}.Sw&%SN!J6"w<'Tf=p(0|RӀ1EPR(<s<'E&I yQܐjRD"/jR|4xSب%>))=bxR ˄BII)l|aD# -途ȩupH2B;tO$i$ФB`~T1RH`e%0svsdr ݽsIDP ;W6 )L )i-3:'s5J|'4I%.< ̒A0$<%%,tBvR$JI)vh NSHAhAD5Oh:`R" JGy4iܤXAM9hBd& ).N;D:ǂ_!࢜$ g{nȾCQx;$|JJcA׉"w L0a5ׄMH5 !NCXAL4@!TdćSc\?%Rp'ox=:L!M4{`|Gb0q%1*d]>y)9PIt5MCòS=p>))} k |8"6a2@-J;B4쓷wPx0LD7)Ba84) )iAJ$&OiQc`Y%0.>柒iM9!4$a>dCk]JY#S$p rc`?PIׅ =̕ټFi'))!> _:QwR!9:&ѣ%%i?z[N8L$a8QG*CTIK̞{8#J ]$'H*F;$ˉ*!74=]LKQEO}Rk#I ,@!D L0 )-϶a' w 8IOʐƉ JS5;(ȞqLKqnx$Lh?JbepgG6cI?rLn]0JvRVRf%P Y!Oj0꒕h.o8qt~hPZ'FS4HG%1.v87(uwBC< cR9Lu0T 24ॸ=㯖ZH1=X`DܩA&ByS:qiTP-W4rt#I)(R@: " Ou#Tj ND SfgvC<ʃ,d PmI:w%D8ܛY$IsPq{thNASS>IDʓ9@.h&sfcS[tʑ>&$P x: (Mv0t'~A4wcII74pl,; pk|OAx)D )FvߤѬ ?DP[2gDe4'%3\ZxT a ('OH&:HRXIMnDž1xd2G -x$%O )-ME=NTON8)H %<NɎRRG.#04u0H %<)%!ۇ)$בQt y <ܒ;ܩ̷@ QՃ*wx a-N"@EKsC *1<)v ƩwRi "H-0 y 8nFv1ٟ4;;Zp%%3~晐gsZ$k&yh4N1{&ۮ)f=txMO^ K ~۲E'AM|#Cq`#NS톙)68R{O>oi؄ XD2PO9 |N)-kD1h (67v$p@ǚOH)\hx'4NSk!"LPòf64Kl't칭fR#@Ӕ D}nЇ8Pa不uSmh6F )ؤz;|S8#'tI);%p{253>&Md&&p*<>tII'oվJR p!ڀ'(GLfԊjRe%3#L  `(=|&1)z_4Mh?zJf:<М`!=m[kaݽ4:)r撗,'v9Mc꣠ O蜷]S1/'I)m^]:!IQeiq>*18lrDJJx]f{B-k=ѫ>g uR@)/@Ot} P8˴$1 JIR#Y<& v%2жKkX#͕L{a=]$42#E8D馉/i:ȄsAτ-$BQ2ْ8$_i>AD;s܄ i?r`: *H"0QRr{sX)1wNS~I%)&ڝRsx;k)F1΁{8-;a)OhcS#s|?*$$.1Ɇ 78t)%ur@&=e9}9Qxp%$#昻SΈbeY'jI5~*DJJNvƩ IPD= !Ť3({DLxĄ24pBs[xp0G㵻⨗CV}ڞΈi#T"Kx"z%eU;ɵ 0GgAk}Q'pL>";k JGfٻ %TGIV\ h梦72v{x+ey. A]1+5l[6F?"al*)$bĉ$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$Jt0*}l?r1i YRct=:Ww_[Z'UVz$)$w+^O-I\XcAsyW9=tևm(atŬ&c9Rֿu<q]AT:mOw$̤{NwGBH!1I:T͍`5B:&R R:|RSXo20(s~iH#L`ѽ:"&WsI"njRR"G s]$8wu"%1Pj X?3L|@42TP4#5QEM`"ƝhB˵H'P~"O HLxJem`κuōA<R-T̬٬ϑH09Q@Hf9Ȕ䂗{Q$Jl6}XA`VݎEi&#HH\!Mv'9>Sqj#jshbuOdLbt* .j|T_xccF)cL?$?+Lh;(D<5jQSdXd$v8:] G1vO!ƍll4( %K(M[]@(4q,;Bӵ &ڌ MqRh@jgR2e$!92@I(dh擘 d@̉L A^=(O^DANOcc\:vQ?76#n$J{ϒDRK6\HHL LJ;@yAC1'IDۀ )$@C~qy/Ip0S84SD1v8y' J$)} d+\:C|gDהΰY]S?6 1hp쁐@ 1X;*& qФeͲt3LYJ̓JfgوL [R#TݡgĎIP` 3$f;'<蜉𘘁3hi %pw|Q{f{TSs|yJD‰);uIK >) ,g4=f$2 5L&uCZZô<xy\u' i'ټ'D;kIH*q."3$.ZDxx jۤgGHK'8IH;gzMexvM RslHhcEZbx Ƨ^i2${$oc\uJ%ߴ0a)p:W#P5Qu)>9> nY! 4QR']:G%%,CG " ,T{ByIyAK>8 /l=gK{Uէ)<&n$iJf˙O O CDnğF:(8'@Rƽ8rZ<=H4'5A{C)iv%1iԢ: )ꇦfO(%ohh'H:)x CFU[kJ[\I(lg4!DODTliyPHtn;&as5Z"Sn))%N y fK |I$ûj%tQt$>OR?5+%O9wm!D@'g4ƝRJ/v熝;q!])5Ln xMII 4G#H!=GPt\IX&GD;6xELl : N*$̎ ny )9I[1DIKd@#_>Zwb;P`HiNbe"JpF@>:ֹ$" #9E1%-Y\5d?3x)j`%ILwP 8#y@Qg%-qqs vu1:ݦO}X9)) 8H$41)Y;KrS 8h848ǂ xR3ς@򜄡%)Io|OGu(R%%o`ky! bv;IS-IJ6[ءڡQ-NФ ZSh.w@'Ud{SVGBg;H*4:uB> =M+U'/9AʯC,B A͡ǀ'&i4 BϷ1VδUv)zr7LbXprc*b`tBv)Q-\.c! +&*:t(R46BVm O&Dc4@%L{Bҳ&0蕆'<)J*@@L/BgܤtHwx]))hG":S6oqSn g*>#TS BR{(nL)M$V})#Q'% Kr*@k){P "9쉢\2Rܕ)K8lOD)(CXD?NaD#q9#䣪AѢJD#D4'V7ye#JE0T6Fc L&BrT^ IB#_aQ-:vGnTx&ޠ*R=^QLpxL$$)ͺRxkN]`k*$(IH(*pʑ3y IHIL[TI$JS)ǚƉ˼BޘT].$d{*2e$ed$Gl)S2ÞA4ӯӆ7X$L|y$&a&\;IS%">i *M[78Rh1chk@!BA9HhTOHMGEk;=ۚ9i4)E'^e("u zlD:hI,F. 5 x|ӴjLgTZH)wBi%D2BF0A4兎߷([ɞMI$SDHN);N\0.Nhox&)NLGtLcSʓG4#^%]uטhf%H))!tnwA֓BdD҇AHI-niÄ#9I߹L!8NuO5<9`:<\DXT  qg %hs]O(>[#Īΐy~BR!AJЕj5!D APRN$e6Ë4h4CB ו/P<RiKjQۜk:i8z$wHyLTjmjT@2;; 7WLD$$⒓5B~xS.hlLpJU<҄rRQwȑ!E='Am$& R#K J%$KtDkBsgM_$H6RRvQ!Ky!;?ԝd DOp4H 0;oA@p'8L疻N<dhѤ& IK7wN[?w^o2;D󦩾p )\^wP `Q s'=yMvR-3)&\') W`-3̓OdA6L1Фmy{a5v[wN{G4Rq%6Q\7*ASxNYx!{DI$I$$I$I)I$K^yͅ}Oi4Oẖo\?9h_n `q캊WZa *u0 ;$e;.y֋/.{b=}Ѥ&$)j5RO m^`8HApkHPnUtrpNuH蒓 w̝T7N\"fy"4&R#jJjI$h8qx@V, e_H'@ALF)fp&{#Z$@m 5%I% )(*c۠ILKqǿh@xah-z1))–j5)nߥȀ$(vy֙9)Kvd6!'SKnB`@$8IGhE ݢmRCi:T'RMRƇ_> GdQK;YݼE~ 7d#P?*x<7qE$-nL:@I>AI~mx)I,Ǚb, Gr4rhw-R )}OO;OyH#'kM1 qEx+{md{CeWv~ (Dq‰JN+;L^)Ȁ IcpD:%.Т54EI}V3!1 !6CNT( H:*jj{>) =1D&':p_ {{ʖ3k̹?|IJSrSx>:+ikTƏ~@=;w}aSμ&Kd%h-kt|Mdado4]{9Ff}eUZ@Eߕ4O݃K#7b/<wH4M$#TPx6" {Oyw1 @%SX؈ODt07VAO`vgDĶbb|TCEfD6ZuNʚT^#}S2zuK9EHE,qRJv-k)$Cu0q%Ѧdu,CAsVvVnntR/:4q+mxX6z7?ÙtJjAN㢌8))T MmԐҔR\ZI:C.ڨHӏ7)C45P{04Ko dĦr#BzwcT$T[07L;1e)iʌ5Kv=R;t1~ja6$i[ɴ&v%#s?: jJd`);{T! #R?r{ہRS*%Hr @ 3ʟpi'Eӄ<)!owl"6Ӹ>0p>(,'Gf)P5IL}7i3ܦ,$hQuh;H\H#LT\IKøOaSAc|g d}Q*NO'&OrR JcSt!N?Xx0^'^?CcM*Ml6S:Z^u*5矒zHF3ĤZRۯdDW{&eiۻ "p|d@M;wMh '3E]RS"Qs@Dp{ hZKQi>jaǁe#7*@$(ې9=ҬWfr-%O)&w#bu P~g• n?D V hjku2w;jJDĘ ]Ya 'uq0 G!}dF7$ja0&. )3^+gy>Lq7@210*d|ӗ΀FoeҊ6]iin\ITpwU"d]ce#k6!&2'TD@46 & (kTCXLNnʖ}|DO;5NJYĒ%0;kRu-vH %JtȔY0̨˝k$#DwNL"# `> }"[@V[ -!9!%.D67%: !$xH0蒘81sbxNIZI6`%:c!xwH:Gjt(O3L|J4R8H*;v|S'p A R ʆ>ipLp%-|S"ufI2^5J'B#CN5IKɝ!*!8j)K~DyKCJ_g' 8l$&l$/ݧqˁ .x&%$SB W 'SТƅ3jʷ̨T xRT"HqI0^Zo30l$NW:浝5H6tVsBΜQW햟#pVFGZc *qpaDf;t Qh QK?`V@۝k!s%f75}8L\s0qY< ;uƇUR!,'J5 UN]⣼FZ&wP*^ICoTM0%CvDiVw.TFKe4ao)pГE PkM(H죺JbSMOiDc{HH0MEBpEscP9S0TMmL N(b  M9 M-*e%tN[6eY6ƈ*AoLp>)"IfPgApDvx)芭;r2CU ZiJS09LGTm6[)zt jmTRp=ߣFmdiҘ2HYbE)=$k xޙhVPp$(ɹCޖ*N8Bqds㮈4! Lx8^;NNxR80!)HipHc`wS&t L|Te |RRixMIm5:u)I,#HL#@v7Ndmhu$S2,8#DܒHSsǒy`Rĝ4I̓)lR 2NkATNuF-bdjt''%-`unBLh#DґHHQ@A M`S LfxrS)TYXSاB<4H1IKll(NOppDqR 4DHςwo4 wdJHIK{\e'OAp@~!9\t0qM!?0I~ &dHU*g*Z$AHq#< :)09~) t 5K?)%fu*A۽ )R#`蜔J9{747Ð)rh4N:e4@29HSjBS&iM[&;t$|T[)=DI+=N ;@h) )@̹ct:vI'[w)N8Mv?HavϐSkx0Jk4fyLFpj $Bp (%Q{%.BG_ra4)%1>㬔6#A9Ф52|{&vS6HͮDOR|R8 >VZ\65~)8H9%!p.]'G'M%Iwo0ӔDj0[G :oL}(i$rS;焏E ֝'^U[F"Gat:%)@ ̈́C$ap"dI#p{)9ۼ@ NJms6"|Ft3mg5q;^;vO)))A9NGVnA䔈8NBJYv7nFu_5 焾 $Kp !THҙ #N2|R29h&DŽ~'DZEӯe OR#H))>'g&>`A3SmBJIC+#YNq 2D#ᢞχe&)mJ]l~)Y@7ξ!9vhN"|k!%&&HyO1{hc8im!;BxJbslpSSck'άӲh'"i)}18{OޞκxA:tL' $TIImc3d7i~#,T+{ &r2p M290xfH:ji:I2mLcE'<_$4dķfD$<iTBf M`\.)ݷhhx!<Hi9R*H.&1?3d4<Ӄ#P%N y=po!_ H6$Tddr#I \ OsͯEkvv2KJGU(Qi$] Lۄ=ŦĢn~pRS8hI4 {7Fr zZ 3#N^L]X/;ݫQ.߄O))HʜӴ{ .ql>$:FvE"?A@?B'Py AswMޣ=:IH=DwI DusK]k3ZfG-'sQ:$NRS*ߵ주U"Ck%̓F'G R?wĹ#DۉR2@$SQ&Oi)LCDAϓ)h{DN$cCHH> )a:ry^5F@IŮOyNDS6QsdO v-w'{ kĎ |K 'ILHw,2" pwoc*ƟpkH@(%9jy)xY ׷n0H>SǏ)B!?$~)Ê&:V̑Ƽ(P~gQ:)4N `Gu82JY%{On&\4' -YLBotBgUKA t:=vL4׺6DZשׁѬ1:m<+NuC`E r *Uݼdp'Qd}襖5D&dUj-hײ+N#TƇT'8IJ`tûxڒ9($0mtj P 2V+굽#Aضi8-^;Jc%k)X$d$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$KH8qBRJ˚{VW\GkR508Pm;NJO%sa~gt4Xޏi ư"DhBq*AP@' v\ Aϭ:P:$JIO ))!aПM~ $$0ӨH:킔ɀA:sM4tNOt HJZ0K.MsqIlיGcIݩQ5'@Pc!;O$Bv1T4 ʑ2 :Z}N-|QѲNJ.sǚxj%#IJO&IiS0pNJx LJIk>Io~&&O0?p Ed'HPS2{ښZL% .">vHȩM>Uq:Oĩ4>%Rs\F:$}FJQw s-Fd?$ޣ ''L~T7%}S[7SU?D#LqxKn%4&RtTL$at \>eFߊ3I38)@.ԥ )>H hE$>L A LjS AcA}Iۧ@< 5(En#C5*1vCp lwHOR3,L y*{G mJC@\x |dCx !2&Chv3^,h:ٴhK2@䨰Ʌ_ϘYuKcs$]Yr9j^ݭ5\Av5t +owEo몑:d:LKJ2 Suc@]M-Ф&J RB{}Pa͍NܡdV'N':Byܤw *͎4i z@ElDwDrQu9% omCo@@Ukvh##|8 U O69 CCC_^Y2 NK@V#n !z*~)%FUf +.CUx`p't %ڤYk-<([Ѫvc䣬zFۼIIkA$h@ 5K\aB;$f DH/5ILn$lDc\}E}4RS۲Eh4I NK̗v(ˇ ǒvKK3SnDԢEl1O][HKsҝ5'k#`RBg3h$p;I%&d eyhIv0?G}/iH 5R0uILlNJw; !=;JKAiI {|̏% sH}HlX :pdJiФ{6pnk#3Hao>|Ɯ$NӢgx)xGܒ'co{D<%Dpq:ݦG*D{AILrYH-liHtSʕx(:vJe%!Ʃt ENLBv984 ;[i1IķNr9ǒ )Mm=pS$8Mu-A%dIL>m$ 'V *Mth @4A)& AQ,%ڏ sTGⓁ$t !c^9L]ۼ;'͇S >#r8y>DW3C\I*cqP b#RS?$S 8>#]HtK_> nN1 "B Sk.HPnT:҆涷mv10%"CDKX))@sgA,7J -;78HryЩGg?~b D$CúvI&k\ Jh?$1J{5Q1>ӯyNݬ0d#CI$s~LT@:6٘)Je2y `5Kna9DsLJXH|@ΪNh'L RS7H{G Y %BpIcPr 0IǗȍSHOR)OdIL@b:{Q8oޥ8L[{&@q!z Ψ B@' O )msTID78J bECs"PEew ]=# 7H t+kJƟhOl6t LtJ=tG0'u~V5I\՝vFܗ٫2Vexwea8IW&.G,xCuzgrw_<0,B$],o:%4_ L:ZWeHМ3)s)4MU HNDꉾu62a1(Z #P){)BR%:6MnQvYrTwJDINEؤ h s"a@$])R STC!HTKGt"-`%>=m"ND=ѥ[e3|4TM6HQ1KӍRy'&Ԩ)#Jb:$ajsQ&tܢNɔiLHS:E1JRR=ND25Sn4HQ)p'V I ϸHNSDꔦ%"#SA#OS*.) 3̀1rPKIvPtIB!.%1IMw}Ӹ@v&BbO<$lr'iJbgȨ&RM )( `J| RR%3 @T=ž7&-$BQ⒙BoL8h4IuNSTaI*غD!y(VR^fxO-)&-JlE #OnF)GIRum!b2Bo4v<vH)j8M ND2!y|dJv" s#kuNȁ#KqwJԩF9%$--Nk<8Ͷp &:N2Z|L 1tC.<ZMa1vJRIL\gPHFf?"xJJo JJ[tC1hκT&D|T)H6EHIvvTn>i|RT1`LvOIMR:DGnCO`r Sk [OrRRMw3su l.,q!4%2Jb)52G 1'Sv\;&$ >iL:Jִx(OxKii RɜSΩɎnncRʎi\ s)Gcpa9 tQȈlZ@&Hr F%$1,HJyitJԠ:%nSLDH) vI60B].8LuKo. 蘍<\Hm\KZHq%DTR/c'4x@2(9MyH|R#T̝ ZAI .qpwjݿ@SSKO Ϻ_Ν^e#0R RxIL Ot >JOg'i'R ;RvCcBTħ1uAJ'p-<Ò5LϏm"ָ颎*$Ȕe 'DA;Ge/G TAۧp8Mr`p qqvxXC: zliotH Ф@qהT^A\G 1-!3= (ZS)) 4'\Ӻ!K`8E)$ׅ=ێ.kYtp‹T&{ 7 wW8Rd{ E&[JqĄjSZ׷ZP;#@?&889(ӢqE!)yLiyf^Zu?VȎ uI1!;u;a5Sg؎(/Ik>w ~h))H<ԭ9qIyS# K^jwH&S "{$S8#DzzϹk GpHG_$DYYoeE;Gs'&J`:`N*DGS7]f-y`ae p-;r &[ 0Ge+Z~wJʏw ۟ Ɯ'JLhqjNSsMtţpܖ4MI9lI+dŅm<Y q%Eoigĥ"{N(Q0R5;xZHW'F.ƉJ`#NR>>*!hhS ':rlsO1?i%&HX<6{xAq $cDx%$vHq A*4=Rul{ݒ7DÀeG-%1nNSSP͛I~ m;Db<RkR|ӱĸ~:mDso1$k=7wnBpH CC1uu 4'mmc7(OvOu"6y> (C|R4@#m !S3۲iĦi$Od$wu"&a*~= ;P>><ǔG:LhRxqiEM-4 Y R"8예$Ma2`I-"G0{A" p<Nt)D6Lc;պ2OTM塥ʛTQ OHԡFTFG(Xh_svh4wUw1 q#e9Խ F f OePaA.@G )50`]S'A´_d\ D\`.=,tϸ--linb2nh $I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$&;CkOpLOaWal X||~R\IJ߬U<qw V} ΩPױutO   4:y:'!NuA/7@*Y sD9da"4i2g^9RVfc 84c`5=0+%h{]O))ז׹ڈ*ő\t17`!K@JbPR?Q1KĘgו O# )g6(fGy(H=OGwh5TR\erKfOt{hЩR0L$𔙹#_574-'Th<)Jp@:4N8IJ-3cT>*Ϛ[Iꥺ4 )FJy'hvM<ˉlxSjyK_ X5$4GRShxK !"$ $GSum&@d#>r"`$ X}1@q% >|T4Ou-;$JeHbfQHa H>}k6wSI:rA<&>)w5S5:&IKa4tBPILqyGx4i~Ltm;$4*fם9qG)BNRn`HJJGqč#(l"Z'Ԥ}ڥh))l&UJ[`%-AF# @H X3T[ov[M1>%%WdjOu_>u{-M@ة%t⻮pd~nxQ6YtrprS}!UY587*Yl?=!GRd0{K#G|M9QkvuI E;@w3lv4H5\N}PYY#π*QOqN1E,$DPw{RTnH 4-&iZw8pɇ}/<"XccΑ"5'H5$&NDО8IHCZi^|#[AHB!=C6whe;@@HLKud1> '{^K/x(-vH}JT 䔵7(sKd>(OhyȄ/s=i > %KtScNTV47]) <%@;ҒcTL=-#' ӺIf16Z3H?[; 6Gd^ƇPǛ4pYlCN@Ɖ:8 SF9NrNRa $e*{6iq&ٍRS(c'iI$~*Nc A08(IN OW$DwQj#&|>I0|$ JZ !r7ە IuStc1DlkuD;%JRK4t|ABce asH;y -)ĎPK4<K'E7ShP> :a1H]hRlRh;kMB(~)O )۵8AA>"a>5RR&$SCH< &JS$aq#-}Qq4$RΘ骋ۼJx$TL5RPR;Jk`7H:)N&B~ht;M)mKjJdU!;$pᇄFAר( ^#nfi)1*5LqYY T9Yስb=JFg'dIeu*Ը๋E %LA4*xu(ܔ"R_L0hV}^XJJM LhoJ{ 8KraZTa:驽!*q)DRsX5H=K(χ*r4!A~*EAR.STgB=v_%=}riCpKVJr؀yH4%HP۴iVDJx2Ld(-dDk&'@H{`ky(n #E"`L5)%J`}^NJLF0Gu.GvI>)nEJkLJrU 0y)LL&)STi)$%><>)&&SC[c )1$t &JF~NXxD $JZ&% ;~)@ PUM<LXwpBm40%[TS8RSn3hpu[{.CӬЬ|U_U) ʱ݄Zp ;(;e+|yJnlڝA5zΜ׶3fkv։Y%5R )wOGvI(I$OPZHQBmI$4)gNȩbaڈdI{&qI#$p$ &V>3Ƨ:Go 'w O ΐRT$Tk(mhQcLx)(JD#XSkh" ;P[Џr@M)&%/h2 \,lw :5=aς\O%)iOI~;5'`0AE?t 柢 'N:dJ"RRκ.) A9)Gxh81JZs%52Dl #_%9|SƩΉ)3ĸH(L{L' @| &TTR HmA~hݐZ 7&D{|P A!IK?*p`hTKJcm.i(\dS~Є"[L))CCKښ蔇`(l:ru;} a#%3m~]3w{Hv}{NNSNGi$nlXKa-ߥi0"N2F{Sڶp:;k$I&X~Ȁ4gT$%NxQkIޟMd N2SgQHqNF&KT .'~h g  v HtR04थkM0#RHs0pw7v%%)7BCDt4~*@(%8ӔIHgdZXNOA3)P~IE X>ENSZ׶Ϻy 2sF{-5j.lGnLI-HJ<<5̀|{)=12> 9&t7:8G )>䬚`95 z.!8:& ` .#l|T-=P~";5Kfp'CxHK]<S̅5%*4'D$;%@45w |Tx>Т%d$@Jx8V\[cCHpִS0uNIHLIL5IOc+##ʄG$$h)qILxcF?KllW{۸G܅$)4J BIf\}0DLu.kq̦&t)8e%3lnbtAQphg碍pFQ1 QR,G`É= s @>*! a?HL ;i-> !c`9IN JH]fNԬc"Gϣ;ktM@t )ikb4"Y ;sLj 1TH u$J u >?*mK"RS/ jskOB0{-?ʐ0uNb_ )>C~\!͖|c@~!'6OQBJZK[jNR;:@P ƾIIK䃠j#m^|AR{"8 7H -)zJd !pןq2=܂Sl;GCNb9HF)4֐>* I.>&#UM!"G3}MNxL`Otq&8Pi3/M\\A# DȉOn&tKlIK0I.6A(ǒݽ #ӒNjG)4qPw9};I MYŮ0;y$`' J)ބ Ȅg ǂ cA " mG&JPpwx4փF$w %R:%.ǝ} >Ѥw }b4*ZSM1I,y$(Ct "!o 6 I1Z攔מR*Hdž Ϛv[;NFRoǝTu 5CI!3G$Z~ q0N ou ILsy>[9F >*6^LquSf R%iS5-.{>42K|Qss(|%(V =F9R昺B F++D.RmED u6J=c "BDAD'"( KTk/08jI]-&bk5 3QǔowtS#,xI GudD yQs\]? J{$i!L05 h-xseASV7B{hЂgX\JJIX:z Z>ih{SV1R:fbv5?rJD'5Sa 3 4(x$^`;d<iDmAO)%9I$I$$I$I)I$./p%y3,c\ X|?)Y. nsiߕ}bn#B{:ᦊuSa ú׏aQֶZ3FxvV 55|hPa->"7,Q}Ec"i:K`')HMqڠ6yxSmƿ%N 0]e%368{#Qm.c :Κ):lFJ'U<⒚{',;gTkëDxŌdLJFN&{&өIJak=Ν{ÝS Ԁ{'Wc}={M 'i!%5>INvkH%NIQ)IJ>JcY$ri$)lOqnRRhQ%} ? )OJ`#JCtS' C~%1NrM>InJYq$5'tf5u$4:ɉ'E.> PBaI Ĵy*Mk#;v@&0xKqHxMELגdA'l e0 8\hTSLLKωIVIA$TM'AJORuNl4mn4}CJNHIKW`sc[c05ڈ#駰ԧoܝI|RG6}  7{ x4HBG^Rx$]atL4Ist'{ș%*EmL42 Imk!}I"xi {S;IJN #F8&&"F @M b.|k%c^g_4$*XjupàjV5(>wj tXV3Dv[8;NH!#PJ}cE-6 0KZ[rwK*!5>2<$>lhMc=H;Zdi`;_I\CIIn tBJ}+@jmPu!S*sQ2K {4#ЩHcmԍJ{+n_HW {MDU;!I֞ɯs^)tS]m^1̉Om4E~&YizW)#T+Z6'}^s#ƖAvQILx$M (X ip׷w;˜#B ND&5<6I)ǘIK\KrTٔ-O&l!)ǁ(-.h ;sCXd!6i!XퟔR,ߤZԦ ̧: $;MQ[s2D7Q |yC4m0SRG))s\q%00ƒLRRTHo3 F~j%p?4(RSJY}9ΰL)^|Pu2a$k%,\&cTu:Y.-$|"[bF_%1cü"X@$Bf1LT;qӄ2w~*Iswɢw7cN;n֧#DmҞGtRkC&>HSs&}@vN4Q x'.< A%Xky?3.0@Tݣ)SL&'4JF}9l骑hN%)P'E)JĶNMS%)pJmҕJ9g⤣)5M=La>( A$u3CC'@RfoqJt)RDiH8i?$Fǔi'HТI924F)RiSr&]ʐ=% #A qJ`F4A3oBD:$xIK94D=ԫOLHbtHPRf;F N' T@NOdڒhDs3G$"ANwtEKyv &HIӵ N҈LJs%-['$IΊ-b;$t vM:ƒ]3MĀ%'MIKzG8Asn29OHǂbL~5MRGD%" >I)}#&{;ֶuyMI yO悙D `&slmQKI$HEIa.M`') ЄTHALփ‹^}YD t!A!!@H.SpQRL  h!!hqx2S ) b@*lwds1ИTͮ.B dv#H tOΩI͍Ry#YDKNS;(i~Lc}<.ׄe&ʛLt*B;U#(SĄ=<{5PBH)jiII\<9NxeaAmBmR:` I)NȒG-PIBw9Na4F9IJhp4B`a&AbwxJqwI =-'R ƒ@7!'hxOa<%2]  00L2)D'II)K3]IH<_䑎Sh`wDSHQ{M $?XU2ij@S$SsHU>j&)4—;H^NIW ;f{DZA*_hr<'#%YFz]GHHH3y9RU HPMD(?>|G% ガPDyJnKmC=>`V <&J8[G0qLƀ~ГmPXp &LZd/YRm^|SNVjp4!"8쭍S*Ry۠'F~ \Tʜ#Unyi _jUn0$>ТiV#%G#FBCO*C!hnD2$VKDPv}.uDLvHP0)5/`=L t9*˱a۶OAB#LhTu*;)@RncAGLkN5h0a <%>)D|ӤT;_.FI$Ĩ>iJ`(x. #ntjO"1~*"ٲ?$hFϹ%*/sLݤƧMU61Qie#@QR۰اits@ߺ>)pPPuQ)E:x+{H.0{DmdÄpS))&Ds | L'5M8BJes^n.=YcOL~ H@H)3 :^CxN憍x;.E$ *-L<-@# $΀x)!'kQ:򜄔,= U F ,L)hJGNPS8s| $D~ٓs Gi50) 5lpGM|w!>I-'p&$.qi{R.%יP$Yv%?x&RRC "Kfeh 9 ݆O> 8WCil m'8M0IJkTa3k/vR`d" ÒB'1'~H=3i4j 8BIZ)Y LOr%JGd@;ܤ AHm>H|6G5QP! #N A )! r]K@)T훿"N{^5ORׅ;(!vINDA&3gRe1lJ*]fN u~KO=֐=ǒ%vn1i1 I[By%J_ixtV45L]iʤAhLs)-%2s'蘟Qk\d ȴ |`xhhR (()k&<hq..Exkn@Z=O)ǚ2cT組zzʉ<W@y%GGHN%%+-|yJ`sC=OkC_4_'lF40)x . p{),%MciBCOh1o& HLE |ҵMw6I2)5ͬuDֱovJ >iH<%*b6}|R!I4L%RSK%ú8V^$v;ɉ4C Q'ۯ)|RIJ׺dB"Z 4D&HuQ2u*`tˇtOO`O3^Ĵ#6 AjɨT[ $jg] {ĂtQq  ''JI[X8&}&1dy%k ם#!0% TO-HGdKkm9GS] 8%' ;I$"L#ITmLZ@D"5Q}l'{;M h4Q:q@v꒙9{{rp^YOOo!.)`t%3* o vN&>0u`C9DweT$fyD){kcDV㶩kO%"ʝמimWv11t:%H倶gC L4ɭ@ܡe^cC7ϙi2`&IZ9?Jd ysC3k\;"䢋YùR-cDLhH\RR[}߰~ DʵyekPNDǹ.㲛a'F >ÿd,׹ԒOHLDN%P$ݔlys)s%Κʽ@&:IkL|ŠSPOd/#w7MuPNSsVH;(UflrI$I$$I$I)I$Az7@s|!y] L]L)1_.7V3E.u]澶}{)<õC|P#U>{sf vPoI-[Ϥ[:n= >aG.O"tAƉ6O(!6=݂z@m/JW@[M nRRK'GxSGAp:wCcĒIJ M蒒H$]T`ⱩA/kL$*m{'d#a)$Rl8 MgOu]䣸!M AI!SSOzS7 q:#Hi$Rqw~;AF\# `xHL5' $/x[βpx ! \FD7vN7tv'vJG.R"8AJ5N;H5NzSR4"hNB@Fpu4F I\%}Ђy;[DV=(N@ДB`)%*A;eMı% ѡԀZtsT` )\BE$A뤅#du'!>)O uIHDŽ ԄwgjTkh*&G$Tĝ9Rs;4UͤS$[Iv))f?d߸98TGRF)Uհ{ޣhqѤG!x=.:Bi)LC hs" vKh`D#%;!-NBp! uXKl昱tJi ;H; ˾Tj0KFrcjR\ѽOܨuP`ʰR2"hӺ);>[C71r"8/V*=9p:ʹ[@ 0-@D_ sLPxvͤW}| wς ;O)-R{ P5}y'U*lqcEӸ”t$__JpG; N8"^4)t@"R9IHEq9F&65$x4HF$|RRR55'pHN@kSL>A4o$~߹kK}QH?Q `Ή9%?$/%Ciyz p=ig=025ILlud%N9~Ǻw49?$52DƩ<'EK ݠT8Rn>ʁ7d%A]@)@c 5OL%'`'C _s {Bj!#ŤjyLH%)YM5ψLv];wh<怡 :xTns'8{`j bAM"F ){Fx)KpOgba9Q$J`4 (%A'IEhkZS4*D"S {hh^x !8HP']'L>rxOC쒗`6hd9$7T HԦrhRMC]lJpuC-߯ a(d'4n&cШ˄%8$R8<$ou-7!ٯ()8)xwLI:!;h2:$Kl3AT4BhS %IؠJ \r+3Z އpҌޟamnUf=W6 bwJE,qVkM3 dX*3oA|f.H OhY{+aX"%kօ)ÓiߖqϺK u*=5Z-N0Rf}f?hYv]oq3`) 5KPR3.RQ:)SvPJQ# k{0H*$HAΈ;S< Lg_ ) mӔ"uMDJfl;`u6uPRjb#jdFN>0}ALD>7|0IAkHhlwHފ|<" [})o!}{tZǚJS:yhI)TuE<0hRl! @HwIJqrv'+=ݼkt'd$Sߺy$j<Ԙ5N!5ijQ2FT%'aiן5I:i@v ڑ2wܝ%)-1Gqn5 >iNLuR)Z'dvَofU.l2?O$'𛶩)4 UnYB5`i&LN蓵FkvÌiD[ NהBnpӏX\6tx( &%Jvysjnn!It~{HGT‘2%%k\vEaD BQ[y< )wX7ATNv= SN2Jb5*m.=" hlarmP\z4E`Gp`uLvD)R_hAׄ[›]x>*$0S`y :HQ)nI$F)#;Qn6LLR@S%-Fa#Gqo5~'.vD!$82Q*sX A |R${pa/P,A䙶z&]ŒBbGd %0q:JFPXӲft)Ɖ*ٓ3 Q.h&ڤJD$o)m4aJL~!9 4IIUO Y MI.|SwbyC2I ~b-QhQ<L^2s%$?KHO$N׺t%9sTC]R+hs@]d}"9ڸ[r]yDRS}šGi+`4)Bv$kZZ Ңf}! mx;r yCyL|=BΘ 0JAQۖZ7LRhFhk$T1ʸ2O)SNDħ*UG:=;[yו j:U{O볉R0!AV_X0=f{D%:{]4U}PWk\ACnAUиcHLlzn*|씨*{Xw8Ek"uz%dG#gTU_K**&v|s:~)~w{+.*dU¥tܪٺ^$5Z߱BoHnyU8'ǔ/]*ED)-gRЅA-+cևS xR'h#K}-jEzHB\f {-s5E'P vfNM:AIJ | 8OZwwAS{x>ӄi%y='^t53`ݹvӼ'B" A7}jCax:eR;)dNRweA)쒘?GS* t$q 1RED7DIL]c#z#%a v}SISqE,3C*aôi$jS>9S " l$k%85R{4=;  <'hi9&䠦;w9I]x-?9#_)pSJ>1v4Z֢:I 'wI3ĥ=2ӱ#Whv;&,@ &PhlI 7SB~ڤWS`%D*p\ 8$nL}9Jc3okPR4$@'S']8NFG)' S]LSΪΥ'$==SVҳ}e)#Dq]5!asl^H~%ڙ vDni?g断 )USYԐƉCmdxiT {;e gPMlvA(KDp& &Aö.qt#B& FC cSvHÍ}|5w{rB> H/$(-vALJe=;g#w$vlLJbT-&@2p&2RS#\8“Ƿ# f{Ȗ{"f [ǒfAH6ȁ{&4yJH$ ܁inqR>= tqVwIFk\Lt~IN8=ʎ|2} 8&~IhrkOLS[$w=&Z9O&St))TYԒ-`pJ2+hBreGxBQ>_JJO OЙKNJ{ wq?F8qq$ %Kh\:`$J;c['Csjjv&'2tFO~<]'AAKs7p$Oedm ; C! uԧ|hHlWsKL73wu=蠸=x_.@S-)%<SlpI4o~JJkjas -)go m¿q9/;wPP@ ItI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$Kl1-y Ϋ5Ci[jU{|z-uXfֶ9* Hj_2x f촺.k~ƹ$I YuRQNi SI!ʘ;xN撐8>~{%pMtxyˣDNNtvIMv]&7Yڝ˜R;_ JDi?$nF8L=gTAsY:8O*1%$$Cth!B$ %6H\JIQt$HdI|T''IM7=J u"k, SRR:(oKzJkx!B` *_f$OLIܧ ĤΉ ȄT1CO U9l*>'&cC\B @8wž* 0%/] aRDwAAG{7VAT·Dݒv˛/*mw#=^4-DHQ#o:ܒlC .{Cń햔BBJcT%82RJrXDAL@F9P#J`4iS 7OstQ#"@lalcT堍T5Q"EI0h*"492))&mRktUc`"Bg0)ҖM!aTӢdh;05(vdXeDV+![q0LuO;LVnGZ22~T02!HJ"dHPzAN!-yY`;aw+,k q4ym%U,H"LrOv)-ǓMUR{ h\O*=f`TҌʚ )BKeT˺KIC (r/%d6Jx#Ʊy pH>I#DMBaI KrDJFn3D.Mʈ3H, dn'%D:R%*C'2ݼMSj1L#JbYxkgXDRsEM4[`k`ʔRwd1%))fS%y)Q92Q- )DiF{%(Z'-i<}8N\SΊ:0kL! R"R$(iJiB!nOHR:&) uF*D@R ;st?bILJZSF6<8))h$%BLA #t&H3) D.S$4W:pX̝JL#*EF@H&DPv왭|Z0O a4'5t*s:h$M=tljIL8}.SG 'rhHjIHS3O;xrfqJ;e%2c'I䜺tٞ| $L= ! D9ILJuEaB>iΩ!-RSx\!0;HDҥ"$JdY0%c쟼#0yOP& ֗5 3;)N%,dRv&5S  %%2eu)쓩Ic@$!Ӡ1e'xjZ> &[&>!>T5&$ aH}?oܩBgQR2WLC4B'R1ƈ 2x.Cpu)Ƅ3\u|HLa3DjTDIL W8r;kb5J!&(RS+8y"N,G >mI" S/SY{;|Ż [0>!0:DHʈ0 H40&5T7T&GT8HW3)` n -<$CCLmxH4yvӄdcNRRL;R{5`] v#pDvHxJF8He'hOeD*9"dΉFhr$Y'kw½K"]INt;F,R5o@ ΐk ]κ~TbL)ڒO>-i<v)Tg/0yRiE]AE(~SXg%6 w A7YOXm6NKID7|SI$);ONOk= )-")ӆ(B&~jDt6(>Pp=2NЩS }Bg{GhA-UE čBZ H0))_eA'd5;(|SGu;+-(II摠|TB!ʭ.0ZL 斱)-9L&02p-2ڔڎPJHK]CCNvN=ú`uK$nfd`'^ xA&l$\~t"Ĕϒks`LȗD *qiĤp B ]SVS9R & lƒJsaoP>~ mxjAn a4JS OW ״;`'- O )bKc/P.;f@NDZݩKlj( AQDx'iI= )|#Iӑ(q {'X0<%@84!6{ Dq ١t*/WΧ;"QKvA ;UM8Smp rqLTv1HBnFj4ŏʗ^9(d&AVؘX!-k`+ :LД_R1@Hi~ƬT]C!^.ۣPi$:x+2Dpâh&:;vYҮ`&ٷ{={F T\by}I{Lw;B] W!Α F%-VxsKx C 4.Se~`m^{IC6█DvMeMSP-|O®2{xTrqC1t"ZG;:m&@(EQ)4Y5'Tndۉ DRN#CbI<7#Qx&I% r:q,"׽o`|ם8MX{ %ID({'ja!%!97V9!Lk S6J ꒖kw7| STDjek)X32u09F;|nӡ"llJO&TLkRSZ#Y(`n$žcvȩ{LOɎ9Hu8$#kehְi fQ}-k cB JO)%wKIx&.N- S}QxO9"yrה/i{v&O*]COloO1L|BC6T4Ƽ)4{%dSyI$(nS۴ {ʍ1$"ZdvMezuXJgXHo@I҈SO!-2=D8&q02~ )l3 ,CG"CATІ?%=TGJ@G1wܒi ߩ'o4)9LݧT)i-403%0{6 d &4R\K;w0? `Аv))ѣ|-sȒ>iuwQ ])G :vIKX,xQiI'T²}#Qk]j x8SN4 t۔w Oe5hNLIMHA )z^Mk5 |K dHK▓̤&tIJqA---Gr686O Lv lQR}vhX`! S2 |eK->d.y o8Ɵ4Ɍ,0)aG*@2 ߶eEv8k v^SOn;S G}x)9>f8Iu#I$$Z808OM2Rzq2j.v{kʋ`1 ;8w~'IH}ELێݻx(:;t$J3&H#c΁H3H,Bv œn 4p؞Jp!!1 ƟIHYQc;$P8㸏уb@$So'P!>DmuILk@䀤hk`9.2\tktM{Òǀh3:Bg9 )mpdWn~~*]♂xE)05)$O d>52`xA1%19N%IQ:%2aD3%A⇏M\H&Iۢ#Asw8$_hT5x94N)L78!)wBik_567@"5$wLL{x&ӯ)8˴Q3c6}*{͍hCmg|{T`}H뢃1$pK[ R,kX)ֺCƜ F`ٹ 4)|jy*h埴LGucLQ¢gW3 b4]$J i; _R mk I$I$$I$I)I$H{[h(IAT )EpRLK7"%^䀹/Y>t.s$vROZ,Ni{:]:sT .)6cTCGx)b7BQQ;OR ) ikݫу\xE 9F(%stRxJ򒘉5>I)za;S:ǝ4?E5${$iˆ"àlhp Ա6'̍AN@NcI3 )8kA!Mb-ѠN$SR 70 -h.h*?h`BHhIIKA%3i:xZ s n#qvRolx(I&4`C$R~ CPyit 'Wx5a%}̀‘H Q3IH}ǂOxo %LM6:L8LL ? ,kpTFw寂 IDRFcRs^ւ"G*-.sxL?1AҊI 7w7xO$4#Hj2_LvE-rFy)&uN )x d7De5>#RI0)'%%}N[Hl'>1A{ $"%2q᧐Y#WMX|_a JtJJL I'Ɗ;Dd=gd$Or&IK1125O.;~HJ $F)fG &LHܝ'V=*Mh'TJQtB3`sI*.?)B}acZCObzΡ jW:Jƒsro/D#E[Ϣ) Е#PD'5ƳNv5iOݪOh+pB GJrӸQ2=UI"3HSjh\${ÛsKQ28ⲟemZyU'0'6u&"~_k䒫 $Z-tVXu 4JuyN`jR[-nΨq* A8"5Ssܤ%4M[h:yH{ MGx4<$.p6JJ[f65Xm (+zZ-ooz& Wj_ 'TCifLrr<8"uH%1E # h5IH* O`'BΉ)>J#U"ԥ%800L1&:)rJS)!a0R4$QS&7Rpp $))N >i۠O1i BJZ _ԋ\ $t0)ljG>%Oӟ$S%-1keqQ$'ߕ)L ILwm>B7h$nuOtB*X. :)7O1:蒙7inl8hLI)_NL{M4{RvIo<(AS@)LuN41$蒖$-Jp!I~ * Ʉ3 vӠP,nsmSR4{AQkobE8J'T 9=n-0G8=:j=&RS0M0dğ4nR)AJ`N9hhHù%ѢQ"'T[<'p1ym1"`gD8F;(=DSsDtM ")pL;R\LO:SOQ0d:.d9Ny&~0R -)IKHpFў<1Fa sp\{@n~IZLlגwEI4:ZFD( I 6)%/%ӷE!pkuTZL Z} k )xp_IÿI;{& 9KR5%& 6;'!;@D9h}S&{'If8Mg@ vJmB*$ KN|%Lp$ Ujkda,ߐh)F27ljIRq) .ڧ.;''3;B^MB;DTS@p;4~hNc4 RR0t2T[ <5\D ';E1$j撘ncDma/LGd4)ǟ 'Jd%S>IyL:27u!6R"yJg8IHi3Ge#^-MI<&R)<= 4ORkA)]xN?Ű5IKdh組;f@&[ II*Y(&ȧah׏ic?tG%# |xN`{F5(Lix&iud`& N<գ5q H7NlKw!9$w瑨=66{9AkQhh|0jI5%3ҠLtl5]"]HgU:'9 $JJI] Olvq .mod GhRcHlhR20II7t1k*5`juK(!"cD{w{IGt*,of}~E6c⛞RSi6vw*E {'<8pCtDQ%2ջWHah*y}UigE3paI̝xKlj* (?rAN!9$ӯ @)`Ш5`GxRݡGaN \tR:Q,mm ;UZCvC$|k|UM%7rOIxԉ+-O}V "H8#ZO߻P<S$D.kǹa B1K|C%;rtUo:kuHiW@zU.P<'@yyR4@8lNjYiЍ~' m?Tc7d—C]"xR7xF}N`wi? 8RK'5AaDF߲%{#p% #T Q!DuO))`@-q3J |Jm;\N$:,5ip B_`v"I;jRRdfgQ{:iP;'/M鄔_ÈPmeeNCRО3#59"$&;GJYvsXAD:Ň>; ()vT%vM39N\"GH9))MVۦZ2qԤIwLT=01 bXyJ=FAi2'V\6 H;lT}|DkJvei'_3cjPJh1oL8mBV÷96)z$%'i[2d_$8E#ٹӧܜ1Y UhOx Oy<k 1m0w{x;48(1Rq#B%3V3v$,,;Jzǝ~ X%Ѵ55k ` iLBHIĴX 6=wNd%>IILHI$xO'$SA)sˌ HkcI#& tOrJZ聩Q`N i-z4zPHTj'SR ~jqCr@;A6RFa<7xR(|R%+Rv㬎A˷ mf )NiJ JZZwbӴL7wj5=grj; 9Q8 ]Os&[#Mu4ڸ_9I'Z*Ohw%CSΩm U6XmyBkbMZcMHHLkT0uR h#KICmpD yw'K׺:r|Lmnn?:c#a$YLkLp$T-%'Q f I|Z4:lnV洍d%Ή]4 1#0HpkI&a5݇iEcH%)8`wL }ONFԵ-{ѦG`I PHl 5\㮛T ~)pcKvJIRR$z6]o{TCvm+$yM>T BVEbAB!ܧRMl"Ǐ0Um-p,ip91| Nn$ )gMxJ ȵ7yzOC9.82V,UOTr.[Uٯ%YI$MZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$z{Zq*B@`uT,hR c¾:k ][]BC'ViԯT+ӑ_<гM*`(S{?* {Z;U." a6*kW1:wU`$qĘ11,@<<i%!vL @IȨ!HM8R&BHBƍ^@=(A2⛴'yyELxtS\lj{C 2"ۮr4\r'R>?rW jDVVLj8㵇Nl9SiuHLTZ7A= )sXd9V)iWE |j9IJ>)Fx$$C p#pRЄۥ<$&ՙ?r0ra0NKt.IٿF> -Ԏ~iLhЦ(pưsŰgJ RqlRݪDʈ)Ɯ$T~ IS`%9>iLC8(;l]D;drbGU}uIMk)ދ-<^?GJhSJv焔$&x. ;|{77VN$NBRSBn4'kL5Mc@LA$DưS*ƘsOƁ$%=S.'r>e- 5U2str(uVC^nj\蒍]|>+L&=idb Gum.u> Ϛh{.kN-?qsfO 9S $|` Fls¼ӬUqv–)0j 5Ǹ*{L~5>5L K(Nd)uEL BG+U ܂ӳ'vqIAuVw4OA*`O9H2׈Q=Qy&.$m@ʒGª Gn ~)v,͜AYwe]i;O@S}.d5HN$$TOkZ4RJSG*A1Dj '& )%%/  EnNSL h4NJNh}ہ.S'(0AФtI ";%=RU ;Iq8h#tHO FA<ljؓʋy%"a-Б*3"LoRGtRḩDmSΩ%pa#N 1-Jt ›B)L]r(f$rxSm JaQlHe9*2nTF$p{i\9Ę͓XRx.vZ7NSDΩ)$L&gs׺M`oE- )`!9H>)ms{hԘHB%.)M` l{H"[dH5KD$9w K4 >d#:ӄ%0Jc?p"# RH!$Q/ p ^0iQ:JCӯJOhӷbDw)L4N JbH4O[Dn(ըsh0R1'48]۰QtKW#Rs`Ԕx'5Ie%.ɓ-ƹA (5m蜈Ҟ%%.,1N&cH6DTCt2ONEJA8{Mv!%$3<=ε{|TRlwpQ-T~sDԛYuRm AdH7)9|--!%2&q\)2h%MvH"4N%7tKƽi;*;{"  :XeFײL I0F"CAh<&#r_GDHU0JbEyMdwS4  LS&QO]  (Z]1;%2irgR ЦAAMB )a<a'rn"dςc✀tOBrLAIL[cK,aa ~H&2)$+$ONocd&:@0 8IL"G\@UfD&,$Jו.8H68L5IIq`J$}8A'sO:' RR@Kra@7AMYs > !-$ƽMוO ) ILT l8wp9T{*$8'$D1:C\>!F(zs0!18mT\'TAII+){renJ}/G3tФXxSP_n0tsRHp 'MyLI!HJb紼p eImfu' IlQAĩL ĤH.[/,?HdZ鮊#D:$e#DԔt6Z{(>CuIq28%CTfRRf'{;ʁFͼn fsQk?SH))1.p-T\K M;TF[c$elyroP6w6[acP)m5$yccO L(}QpZ9O9N'T7i pDs~BRl”JN B5J[Pˋyr54KSGJH6pQ@HAis-E=eT$ 6&RR 8 "ΫS8CIt/k`N$|A6O%)$VY[*e! G4b):Jx.f70|cf 0D> .{(q&|$EH6 X!ԠY-~($L[ )5JH[MXj(w[wH(i e3Ni)Ls 'qДKXvxu<(hƊDw)9 )5ݻC$rlt\ GGhۺQ%%AN:8JI #IQsDhd S @4`ZwK#vwU{ \)̖x#:Dps$/Z 01A :H*$}-BAIT꒒1ژuuDZ;&\i'O Ce1o0 [w&ٿA"$N25@ܥRgJ էHJvB7Ub!1Ҡ',בRNЭF=ELpBU@V}Āgwtx-s)Cc@U" SBn!@۹ dNЏZ*TrK`K M:@jϺ9VeVu)*ܟEyN6B֯ǪU$6D'9xJa kI F¯vG:scprR:pK>! UʇH==r:X0;g%< v#J:_DL <);FtNL:$$Xul6$1ZZ~RmԘ$|R D$fI$I$$I$I)I$I$JRI$6.SlV`)J60X I2.*Ƅ-jJ|1Y /542? y;]-Ѹ`x#sooq-; < PS8MI j㺹nS|HyhMS Fh9ڞ m,:'y)%D  )\f{΁GtGDUNwXGkSkJ|R7b14G`8EtAKn*r\@@;EG+@D%LU-cQIHE:v*l`I3MڏHGCHLѸ{?uO]ot e4Ot\YOh'p2` ^4LLHrzc߲ sb85립\SNcD&ӴOj\K)6Y?) CA%$+I ".n4&TH~)! gDG0@!Eş8RisiH8&S=S;t5 )q0H'3a4:$..tW*ýJ\iLuJ))sx$Cv9kSn %9|JJeg0R{%I>'!W42&e9%4a%!B@ Y2F>*eh rSL fPR:{l1)Dcdj x\xR٤EH}G2O a͉_\7l8S Ja )yuFhpSOrˢSN4)GD|ɖ%5X/p3L/qeoTƯAYXTR@S yF)^tn1p%Z_OUIg-~R-C ⧧X w+]"5G(ʺnV1 I5;^ {tNkzףsf8Wlw Dt+HLS]Oe; _c 4zۇ*}G`^QU:&Q(-,gUқr#R8wD)qͬ OAgT'K[?d\btS)ql >iګ&}T<")ۅk;L?ib,oޡg[écgₔʰ Qҟ\ATIm!fY媣6 xzHVK5(qHLNW'g]='#>m IE eIeT{Z$ r3 aYR !# 9RL41w[%9Tᣀ"ܦ|S:eHTTr&'IEL!KL=H7X<7H JX hmODLmrDS5%y! n%/dpuIR"X#):&Hù*%Ɏ 8@ܩN!DzRґ@R'MyH3_?29='N)ILt㺓ԩ@yAʉ@HRRF \{BaIYO0r`RmfrƣI=LtIW58'rv|!O@%hR'BJF{cpͣNS8@?$`Gt"x$~T )1h8ILw;ns;ǒ89nu0R1Q$>"<ҔQ) JBIJ k),n3ìMFJ;' w84Oe]Cd}h9Lu'$\,0JL!; D'wytRkdGУ>ǒ pׄ%"DhNi@b}GL48q7 IL_ CwQpQї@H6IKC i `4A{%2hBSJ^NS8K'lێ9oe(# R="x)?G{x 4DB>IJęw>(I';!:%Di ql)ql;Co|;q Mݮ3Dƅ#N$FҬoj]04A|r<'o))=ĸLTK 773Nx'A/ i1;wIJ^ p\$=uTLݒ#@5L{艉XuڂaR{4i>p #TD'W ;kC$tĆ;hPR)q3$ə=xL@5VltTNP `|RS'G#T{~o=1p) :(@*DhtIJxSsZ1CQRA9&$(Or<6/MqI>)x)ρIJ.. Qo-kN۶6&I, %824J#c#JMߵ*;v2|PH@%Gp[i!%%N@Qk#O%;]jDI $JqJYѻ2ͭEd‹ $ B08L5cZv=۲:?TCg|9II_imJ!pα EĞ6cN{ruAwOxR0 iB'E2OHӔ'Td{):{tw> HD~FHϊ@wIIX] 9Eݐ}3A E}yH N;%&o'R346[⚠), HӺMY[ JeSZ,^D;kHZ\Z5I;A h43ڝDzjUL=dpN j9*dM9&%G^MfGpT{X$y!1l:0hȑTL)7MBD$S`JBV;PT[XvSNI L!%u<C'Gti$e h*'t v ~;1-W@<'ړT쐀47:jT;q ǰi>hn50N[r)x))6 At@K LR$&ۦm) á%2F ' q;2cúYTS))-ѣ; [XBcp2KHOUդ! %^T)|SΰtP;N aaoPO-#U"@C%"n0$(5k5?"=g@H L# )ww4 K ޤ[ $J骉IL+v}b $@$x )H`"&T,$8AκݓSp%&sIӂ 5 wnޙ/ $x$64T;%1);L'w45Ө*)4tv & NDʐӎPS'MT[an`Bp/oCSۢ\4 )+ln ;@M Kt& y /D9npMJ{rTy꛲m$iP)jZO:VcsH;|#B`cA<Έ) CdBHwLXt)Ѫ$TTcZ#@[:DL'mov@ͬ=ѶZ\tLL(X);C%Ӏ4f95Gr{) [3d 9IY(5VY1..nXf4ݨJ͌N\ NEHa/>I=kL@>]XMt{@%У R EIr̻!&HFm體S  ;))ɟikF>pQBI$J" NP k,V,!LNJk-p}2@S4Ϳ Rq!Yt{F! lC:57 npOUu,iS7Md;'dI<Y.u`j0T5iM$ I$I$$I$I)I$I$JRI$I$I$ 2I)I:KYrkA^M0?ևa4Up.gb9O^ uϫkh0\F^/z}wߋ SpzyLaUƐ{E%#LH 8u=SYX#c`!Hsvm~9V-wH T$ 3 Ag⣱eX,c:P{L6 SJZJp<'RSU>'(48rg $&JZ }f40z].jD;E"SL8HA2JG[ & ==AxLk”&(o#B`pԨhdT! )Cy$#5*'Sw4Ĕu?rQ*MO)`>)骐v2#JW.EoqI | {B{(–yJH3G*UjJ8k ;Kxw)5P' JѷT0DZ!O;yNHJ@!an@L[AD )&NE9.2tNuOe)쒖i#E)q%1#dT@ D&d)ɄJILR1@MF@gHHL⒖dOY-^TΑ_9GP$JJFoԧiMbJsDQS"׼c==gᦉsdAL<;mhS$S7") x'PuL5HMpRS'5O-i!LӦDúE- RELk'RJTvv7/$ntI 2g NJZ#mPR`r9O8RairN!!(%4 !A_AI&]R R0v֐ISY^I=НnkIBC(IK@ B'w{k>O0'T*b\I we=B{ӱ|SPG AI)oHx^dEjLƩG(Jx )pT׏<5)OKa:Q;P _5&{$%"h$$B0ҏ$@G)BC]O);(AKŀ93`jG*@)b$D*XI\N7۟|R>|jRquQ-djIL+P #^Tt)m CQ=q.ӄ,.RpqS1ۉc 5&%$2OvxMKq5]L'U#E$S\K#Ud<; NkF|~=v ShZ8?G,?(Pcn"o%FA@Jr@>߽'#ԋAk'd4LZcT H&RS1c\G1ˆ]La6x3|S RyRS6=AG $8Xi,QZH.)3k#XP-|CHCH!Дܢ#D4D${Lx+u.Ȥ dD )wVI~r ]SOuŀS!`{(L:n Oަ0`]OTp]uFtbOe>NʤfyR3&.JE`A `tQTh;ud)wJ$jP=Jb aStHɘƀ}q$;%< HR(&%II{NuS@[@L꒘W~Ѫ/HLDy.h%n$Ώ8$T@*T$Z׶t?'5nxM 9OT4Q:$.#jx ˎ$Wlĕ0 )&IRcZ`Ly5۷)D~ {ID$.&KdYH>( :L]:΄6D$!fSHa+ Ɨ nQֈXKwiK_pwOsq'R¦ pv1@'^_$'Y.[R@%/aiDRZ$|wʏʄ$dnR̻@/h"'8s a繻YNJ+lu;ܡ p@%У8yKRS1FJ0G BI4`Ɉ093d B,tB)ݺ@;9&Jr%'42K uR7llF6i yNjsJd05AL'Nk 0Gx4LP\Z *aZua6L8wJZ84gcNgD0hԞ/#QRB"t)XIL uNJi?A-  ΡJB}ȵo& Gpݺ& MRK&1nEq):p Qa/N"HBH]sIIk^`Kia3Ѐǵ"uD#Q-IIC\ 4:JLDm '{&㔉irw|!%2lk\]t8v[v&]oR < Ԕ;yIM*`NJ1kj w> 0ty2S)#OqQa$1cgQoOhC2F>nR<& $h:CRGܝhjּJ`q[Soۊn9O >ev 06Am5Rk(8Sq&cIԍB, uRωQqP#?p TRRk-Ir5LxE2)oݢ@R۬QRvΈ^ʁu)f?HM}cZ3x2l `hO#o'Ai$TshݕUܔ7Q^7(l=Sf>hͩ UhwJ89 KƍMTxTz>ureD_^%jbkA*6VW]ԞJ狋SL&ɴXBI$I)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$->;tNKC{8q.p#ǀA\R]Ze^:#̯=?X!!vX=NNЍoٽ?9D/NUfH?%.wӱ䓡@eS)y{h%07AZb*{FD!u SV  oaD'NgDx$cLTC\~{D6R /9O$8M> !!= O(*Og)  3)h*FCl*D l!t6#!jJ+ Da 50iqL_IHDOq 1;h;U9=6IUCvܬz4Hӕ0$M[{EJcAGbyL RۨkSHRysxЏqDH9NFI$i wRc-0< fC+ t)B*,P\u muFC|ԤHJW)%0(5o(u3E sJRRST5&|w;SN"F :) R%$~(`WQ.sNqr'@i-&>K;$ׁnN$;@_S6-5W)$L$IHwA蝣q=d;4D'JSG41:ƝAN=(5I1lD9cGEhL w(Ή"k@0y)L\x(fH SyQwLL%Bep+*Mh?4½){1Fn>hjxOtH& CJ`SPJa'uKn"`3O2!Eh$ P'E#D EK* t)H*0FW;HL9 ixIH [KnOtL;J\j8H*S91<'H ND|!H)tIHR U?H;Z7H 1)xI%#s4>wNiDH 4ȥ!"Bh HIKms$8r\LOSÉ?"ӢHNʓ@S{=9%>vHba7'$hx'>JQJgzd;]IDh}H.:kgςE80DJbxQsIӸ*rt!&<$ $72y&H 0b9HG`%>JSɎS]wrDSkD~8hpv9QځʝpLʛ"GpID!鼸x8FS&KA*` O `OpQ)sL1Ч )Ci)9Qp T: JbROr nxO Fj._G&;DjR8L\-b5j7mR'epQAk?L$yDKy$I" G<-kl{ M!䆑Ӓ2dDm )hJ4INyH꒘@Ro -;9d109$hcuԦ0 PkH:uH䔑|5GE"KTuL9䨑HZ51H#[ILD$e%#-&!OkHNcD?)TSpT"En)kJzn^Arre$-B^Ө6IH )G HxvN`M=)%g}3sB}:hd& `>wI L4Rxh= D@R& ʔ)N)oG<&6CR JvL{y {!8``h8K}gT8ӿTC$ l䆩JUMSn;HCeMRᷞBYؑB5Hj$6:uNHhuNpHJQ-TהIH;DN r ]ݦ;A!8)h9Nֈ%&s 7 8){PnwML8jRB Hז8 ;e_-$|0R"5J & *]>]5n%5)n/w wJ!)urD:PrtR#IOcw"6$hĆi) ]/hi520iG 8 =3g)1iILp"5%|h3A=w2vkRO<1)"Ԕ̴WLʕ{HR.-muN:'SEŎ$WZk6$" xR>)I:U&ZawJ"57/d) E tg;\> XxQcZ 6N)j2@ГZ Ru?$h25$BCAԟJbZ֎ (=㸐[0 h J :'HM'([7syI~wD5uo)BnГfR&NStDvR~ 6֖HDL[:ke!)" {4xuiܦ$  ?ΰ1晇w%\l#nw4@ DɄ\7̸(UcpiFQ@ 8=ŭ )'{~))vG>)C_YECIT{RRÂz Z]YS6Rw0L)!$I;wD\ j;x5 q5N}Q0|RS\6F)\@:5˷j8S-^J`wɀD;v@'wd%ϊiIڗiO))+kt:6A?-@ZG):M)B} rD$m#C\pBߔa9QQ<ӏzJLDHtI`cr_"8.)vcIwyiLYdI,Ƽ1SdhI$iN'VepQ\a&#KG|R'^꒕[;T?DTM4m "LLQ%BaSsII ]Ou6W[]۷qH{IcAH <CdL&JA\ sF uѢNbu1i:$)Ŏ{ɀAkX$& 4x'pNSʫop_$ΒKȳe ${ҘJtDC05;\>-R7L<&yOHyJ%%$m6‡:Ahq*3d'T xDś]3cpvPee8PlDyBpTTّp@.> .{tԩM[y RK57@c믚Yu6)YK+ȦkC G [u('^PR[k56^47dF$yK`eAJtA[68$"\ 4}e/Q v\)0#l3(wmiD❵9o TSA sPXR5CE5g=a!?D|d @$hvu#PkgB]SB̄ȆrQ} C{@pײ{䍥>"7qŸ ~A04(;\*㯈UsTG5oaB5:הx e颁ɆHon{3&'Y?x蒙5lqL] 5SBE*$Js`5EJex ǖ2TA7^k]A*Veo{ĥixm6هeav"S5g|zG6zoQ'Kwҵqh6dYnq?GĶyX"̑7CumhoMb5&v%FEEʧo:4W5VR{%E$V'I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$.>UYJR I%a}p/hxЮ3[- u^t,2AN넜d`?#&"WQ7w^wa]oE2Xa\ə*hWf2ǸA /꓀.5ʜREJQ@,w'I[$=dTP:O nwNnRCC{uQ0wuSM%FS!%5pZńp >_StR% NhoB3( 8TLvM撑9$j7#C"G @yM ' G[9a BhNtHiE Ë4;4MX. d+k,&@#>ik:.\{;|[)H TNOilxʗ1%D|SdD)FS2(HIIĤ7wF=!5G) N $N)Z)yS3Y-_ O))%,׀g@+0d"4I1ʄnN9I4D )@8oM]p7%90 !!))tqI1$QpgS%&SBG$NBr4O\m:˓ \꣧nRILC @Ѭ3q$% !4O2*bt#O40̩9ҧ<ԚgB8LR)RR+is\x',HNQq'-5C}y(lΪ5G~"Gtĥ|Lƻ#FӮ&. w0D!)A.#Oq>jH''Jr ~`L>t6U1wQ XgpA1 25{(6<-ݓqRRR!N\8;B$:' h0Bn8O>)ꖝRH |SK})xţl!$AOL>a%. {{GvQ8pJvg !4}Ag 3HF@4TkIM"e?))w?I. L1Hv1'Ή#xķdɫv@I*2+1L Zte%)1Di"BMݸBgXZ$yH4O"dLI%)@ #N {ZN10᪓di6dL<fEEBr wL,.:u8/%0iۻ^{%[אė;NL꛾ωMƉi)$TAkG̩CC<'s79-;M R"]G#G:B#? .)HTɣݨЦ-.tRm}R/q;t!)1 Nޑ1 cw-~(jxNôKR&m$N"SRXS1h#G!'$Ot<$oYo Mh4|JkG 'TfRS 5 jo`~H =Lt ȅE(a36\HJlFh"$}t:1b׺b6G0wDžd m/n6RR:oyN|S Ai ))) vmd:cAyHjO<'\꒖wpsyPaapx$$N D 3$ %c5=-Hx':A `S yIKl,k^ƼN SS}[L#. OlL&uBr 8hTTN<'PR7I"4ldG̶$:%*$;''(JQa'C:} H9I6@pp쟃 g|Iq-}Т%|a-&}c0NdTs{(wj[9 .lKpl$tL5IKUih;Uxw nHw >)JuL)qAL=?i9a-!O`$3Kjo:'a7"a7:!w{$t5i\r#H"HDw70$α&q4)D$u09 !FP$XCyOW;=DILE8 $ ) #`4KN:H%";4 64$&kF։)qryKl%%+h{@qS2v7h> h'J$A}J~<;)o-Aٖh=4HBJd <̍;in৮npx(SDgIJ--R 9!廤E:XZd6&SSYz 7r`*aN\yM(ᢟ<$|)1;@/NCcTZР {4&I 7Q${))),l'd8vOM !IH;wD:S#Qp1Si r;$g*]KT8a[IٞɻIOQ38_j{)088Qg-ঈHND4Y.wI1P7~N*BAJ#>MRR'Cv~)Bt?H- O r]RSZ< 8nwb6@@HL u)Ơ,q lv{;[3ke2 A*K_-0#@6 Q3Y}z>"d$*DBMALkkhm5o5 v0f;'%'%20;R~ޝab"u R){&|JvL '䝍Ço<'pT)-<"45 9Uj@ES"R7Pi(6Ks@1tO$`h4ΔdOJl26W6KZ9DsܚЀcDa0%*GNIL,hGe7n9=Кw7nܞ5NgFIL&PiPͦ͵xwhe'&2~)IU{)H'+5Ή 5dGH2{$;jPR0?F㫠x&5xkp')G)8EL{@Zָ~\\5p4L'tp}IdPѺe9d$Xw#L`$T~5l&:oJg@I lfcS1*U8K#%3pӕ)H%)04-Cd<):G )5qO(X@R8Ȗp%)l$`{y Rmc󏻼(jKO0u"T hsv=GixR,uX; -*Ja[lyN@:)s{I2"90گ5E}ZcV-=PqU< cP䤤~Wjy 1$iMnֱʬStAЎǶN(D)47c]IUBGvS u3֬{+ QzdHNz^xq]򕪒I$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$v,$"Uղ;k̒b'+1)C.Yut8~ +IM"dyB.i~F$fZo^y-l4H%ix4k- 6s'$BIz2XC#"ÝfX\+ *pUC!T,i'QfcOz~4Q>,Xo"\%aVYHOa!շ<;r8]?VG\N܊l>u+Slw kWK),J`8I|yU:Yk~f<&E3,0GTm?J8'P7 ZA [IN/DANj@Vi#T1Cu7O)N!ySPkqKa-> `v T@R>*- 蒚f & x"Y[!_5&)RS^!>9[iSLg` 8,ۡ)TiE~ߩ<xBR&S$,);+١T%& ^HzʘEH.0Deʻ[pAI<%!ARaAs;VEctp|($_"|"}FN٬F#4ByȽ AvJmpvjBpg*EHmfK -2>_Lv qaƉ>EH?IAS%0G%!m`})1p GIo'!Ô()@ԔK M큪zT4LSO 9IHCwMIȦ\ƸT=0~) SB@S*Y #'RvR㺓Dꊔ^ v*d:C mb`:p%#kIiJ {u ]C@" ]"w4u ANpNEJ>-$BY軱Ш$}<x'%D bu%0uQ;QkOkA- 1iݡR$?&&Be3 Ev5pNNHIHQ))+i?wVDMf4*s Z8I͎L;q mHĄ)-={iH"RB&&xL]`d:dڽӤ):{kF3 %ĝ qoc$vB~)$F*TCFtE.BpR39q^?4MI0AR3)LhDH"MkbBrP HD5& t<ʈ3xS LZZ|DCm~Ӵ(HTϚ#H|;ER%('T)%b; aΜ ($nAH` 5=ݡ־SSHRS͝OdFD&Dd&k֍4;(2J\ ϒ.i )icB K)Llc@=F%G}5S- |t))'Tc hMD56ư<~ u)rRsLArgJlƮC@IQOۯ#RRIG60@}YhMrw :'ׂJQvw nhjPOIx3" IHXF!%䑗 RL_$'tL*wJ p|ԅ:cHN$T%2J`$'S{0@wgOp- Ӫ\ꘞ)as$ S0h2O*~jL )kY'PgRFs {{ʝ4NDɟ~ Jb47gnnTZ;0 .NxHQ>ֲ$Qta3+ wwI:#-MtөELٰ5qj?D LCAyL‡>)JI[kfֻ_N4ۚĦ{lAJr|cIHSDO$@2>&"N JU[CK ~Du"@dxXZ .uHSj>i FHhcԉryOޑ#Jb؈׼wQauNHt"<$v1P_Z30{ x)&הOR'J5n򥡀L%!sܧQ-۸EL&!1c\i >=@Ot'AMO4  UHADy #U0JJPs\L][F DZF3NZJX?aujm%OupѦ Z#YJ-oB?a;'P{lm1Y?*>@0|TZthTHiIPy;ϋSǺO#`[%3ͭh;)ݨ5YېTkX2[ۺxjbLAOcv%m TƆN )J5-) О0os6R Jd;`KK5SkK_}QIM}=$ÂMQ[aa!#$BG!)7C=zJq#Ne{I: TN'RĢutLCyG0f<ĕғM;Slq#tg0. HO4.(fN|TɃH @:)i<5Oeq8P#I]TxA r5,!%VkO59 NHm)m *YfB!|t1w`Nkh))k$ j$fB%yH ?Om 5Q:|$CT?O{6CS\9';RLp$Jk 'QY0GT~ֻT~ٝOfyKHښ$'e^0k 8><e`$j0FӏY8A ćK$F?q8djʑ$H:"nr<ʰv~lkLiTC%E>Jr ЂZX.ʨfHG%Otkj8H ХxE,_LhvqI)Xڐ$#D>Iɮ5jlə[xOSymg_MR:xN9%1loHQH$5 H:$NFH0B ^7 8`:w>Z= cH'թNLr-`wOKå,{@O'ˁq'i>T#YS{~))@zgCd4Κ~jN#s ИLRLy:I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$NI$I)I$Xy8uO JI)HwQ]cCDIoQ65W[kH'D.EUm2[%RԬre8}ˤIvX^+y-{GOL+P$`,ytx^ޡECVZ׏i/'ܣџ~9iZltuo^K*2/VC F}nά-ph5qFl>P=&y^odA> S(>s~ z#P$sDuv >+PH;oZcUhEO*{)iޑwqx' :py*Lwဃ:0{p: ))i& .#aT5<)7KAŒ]R $wx"l=؍ C" !'@ǒ\J{)%);&@Mk:`̈́no83@M>)8EL\TTi:k<4u'7q)7yJ Heqġu!5$N8!%"dڻF{$2զH4Z'T 5Ap$%ouJc Jʁt"a"a4쒘dhf4H%E<ˆ3*bD&4 N(hh'4HY%;Bp 6in|'%*I$r>N䖾)׺EvBma͐vJp 1RR&# ) <*MhwH & pS6Z<ԧ_"Vc( cMLڋ-2g'uAK1uQf6;ƒ' HENOJbI@LZ\"#@xR :A1)R3%5I &Z4@IqЧh'ئLLjSU=gOLHT@ktܨgDzm-B_.aI 5O@RftIvFg )47*OAS,wRyR& DVd 䜃;{@[ 'VIK00&dStĢY`s̎$PcaH@?T$ _ $Cxs:'*)FY2{Vո 1u~yL0l=8%:ɋdooxZpiSčI5lO4lfdoӺt0ɏJFӯLXhII'iCF S)R  )F v3}XꝬsOdNHc!D!JXTGp|'9bӪp5tw܈`h ZAQV&qBr[tT&B( $F\A4v?4%-AYLФ lHL\,g:#R @{mΨ :P$R$ovo)}F1:DcJF\n0Ml6R.;v $ $5Q" JcOS93+-(uKP#%16/k$P52L])#Ґ:BIg["x&;|S9dKCKjJLJAsHb8Et8n o'JS‰1 RRDP4IM:A*"Y~ɃqJ_qo=wcXNOGwNBi0))`?|PX)N];G 3H0v+tE,:T⶘f5ĦRNA <'hsL58%H{BJfHhE Tq J!FOtNDC;Cac=x$Dpn30Wiv~*1o1OͣYʑN%= [ciߴ)w?iQe A%2 'EΨy-D$/ tHd0%Dg 9Ԧ&Rx )?F9^N :iL!I%2pxnL:S♦4$ʐoq| =T 8\|4DcIpT\tݤKP cIM )a6jDJVV d%#E)jnRT )DO8I{(:&גkEI%2Jsd"ѰFvN :'DH/"=9\p%L:ĤR<%2}mi\vv?F PkEjuT:)a.k.:{iJwm>)wG4)Nu( ]L@8'>4 Y?F#2 Gǀ SrLO (` 1(LasCO!Ok>wlLFp*D`))`NLؓ['Iu)n))w4[o8A;״6LRpR )8 JF㰙Nt IKLi:Ne%2&GȠlդ) sN,cJ1L[OR"\\#&?Zd`XRSyJTIqS4_0t)` )Q-Ƕ)!kj<Ĩ<IҦ;HVѣ4%3$%%1p5NkgB5;ߺKpkkHQ83tњOe] IT͍Նj8L9) '!GN CcϺh.J;$LII "Ivtm%xƊ$i iHxA5Qa!;\{D粉yp~)KPS*q>eApGD1 F$RcuIK;\"SHtHOS pSd[sQ.3HĤLR"N)#incO pl=k}1PZ)> 0D p;6E; òj{yQhNBJa>5{))"Ccq1;y"'Dx$CD;_op1)y&IK$Ҙ̩vIJݏd6uv=FݻZ" ''DJh%/<u@BuI">$(:7^9 vih{$kx%YAiǙM`$qi|Ԫ{o$CG⧸$OdK6i|RR-vx 1J' G`=" [OcEM8y&9Eoh`I^uH<4pIKp"{ml-ЩIk;D~#SH%"bTLĀT;Kh#uHR4{G ͍wM@FW&IHxR-R {aC-wq`$㦉 N53s4ߑ5L% p|ݡ (0HhT@$&]Bs $JN5MOwv{tM{{(AmЧӔBRwUpzLl\H813H1#JS'c RvGO'3A93'xQl$-'I>JT㟹5$<) k~BMDho8v$n 6>`cښ}v$N5M%9nu yq)\TE #D@ Kt>ԤJ`4:'DŶ0s<[[X&v;_iy)[OS' I< My~{wP3W<&L%<}oJ\n5P/hQ-{hDJ$DTpqw9ӵ a յ@s$ٮb?:l l!x k(.xD !|PjTΉμ$ ԡm`2u'haɌ%#@!E4I)r[ ]tzZ\ @tLRS!\:~ m˜dy(2ǵ+`{pC/aI*6u(d-]ΞwE%-f+VUiyJ,N /V7s`FIP 0nx-U@|gȅuFK*˂rQHQQEO\VI$B$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRd$ԲqUc<UIJBc] 4+ˋ9 HMYW12AݎW"j]u̹ i䧹yu=C"5qf}<Ѱa[O |!z}Wgh?]0erw`}n-,o7_+DtKi:)5t뾧y~}#9Ufm6 {cZZAIN&LkegJʨêtl{ 9>P)$XfP7UciLk1O% c9$&.MDF'A$ ;&tՃH$GAp$|KWܘIw=1SL hp$5Z۵P{ޭ,ߧkiܧ~"J*@aq;FB@f{S`p4) y&P*j6FxU֍ Y D4(%$5õ0"n ;"ǝJq1L%0nDl!=m$Ài2b#)NP%-BJW$D*ZB$%1ʁNSU&ILX\t:"T\rED;JOv3L& HG5O6*SڔSJDxv1hsIQ;b$SHHIӲxADcI)Cu֒B-sH?zyLtҐ'DyO%plp0!-9NG1R$R 9㲌t 4 ))Ru.1C$rOitO} [a8!Rh(d@Is] J'%CAJ[ߠT}2 8Gv遤Iob %!yILGޢ^]:h|`$o:'%&IL&1k:k) 12N)wMA6״$à# "R#)<.LR)nLL4hӺDSIOƅ" @r \VؑOu!ӶI(5Ob y%$ᮞȚLnAHgP$O!4O" <&'D.< ״ %!>#NɄΩ $#+h ?%-J6u3ʅiveH 䘻rJK5֝'%4tm^D8(dԒFj]EyuwAI÷ |9OHDIK᫾0~ium:( ni AL& !M{79<)m_3E݊`?䔦W$:8Pl{N4~n&3yHDQRѼxx;Z`tNwCX9KicdJ@ȄBM>IA+\'T̡{ t:0ѻD"SL Ma$$)xo(a$x)ra!Qײ}RS-pQ$QH`Lh@$NdJeq@'J֒\ rZdjJ\x( ۸ȗiG?R )TuCf3!'xQMG ;SLiĵ=@Ha!k.:i[[:&IXi&tC$n'il Dq R)Ƈ^9 rHb\*6͆jGu';H=194H> )tdAx"RX}ÔҜO4x$gwYnH*Nwg?><c撘'xNȨ3H$lաGc'-2"-.A^)3BR=;uSiIJsH-=T֑up DΉdH3I$[w8lHԒq@ӄΉHܠSKCC uk‹[HvM;I 6 @Mbfw!L42 'xh8KlJJcCy Ly)>4RmtvSt'o4MB rD;pq0OV;aO!0p p1S}$BSNFq|4rJa4JYۛD&ckEuCA? ruyIL hls8"|Bf4m"@pPw_ >š6'.xILok$;ݮNIhIN 9Re1)iհgB|qfO%<>wvPDS]JgHN ࠤ3 "u vwRk%cr;!"cN|H:q x2<; 1H0Җ)8Ɓ8B0RS0[ٿzLh$S؄78g0hsIdBAp5IL82t> ExEֹ{yM" g%0q%E v)h;O9n@ڜIL0S5;ѪB懀ML1vDy0G7:|;"V l)fג`5LJp7DILDig>!"BѠJii'ڄ-%@8I|0FFsx'TT-lLvrH;s{Xv׈HB[JY2SCK7yNdA|RK'/JJT2i˼NZb MSf{' vh5{hyD>2O(a اiS'Dd1u1sn  LSDR&j%J?zkGQZze! GtJE:"8p!3olx)2IHmhI8N%"Zgxq1J5@>2^ޔ&v;.ILC ;]BLHR GbuPTVn<<mH'HLJM9IJx'ss]u n81A>h:F)FuD@tIHt|;'.0<|}P*n:hxɎ9ׄTʹhC hA4b;ݡ3 W TxP4Gv3 @&vɎ4…; t:6MΊN柔Ē|RC}e>{|4PѢ8ScZWn4)m1H2RRZ5PH? x 07;(p%Bw 'ADə3T,xv5.@$c#T芙W~ mnH~Ey ^|zZ20";2Ϥ@P}wN-Dx&uH7DŽ#♮=Bh%Eט zKTcD>dn4AL!MGoXj槱8:#5J>"N}'څTq8 *;c@xJ|Sܤf`4'@TN%}Qc3:7A p51Jl'A,j'8 ls)f8H 䖝AILŎ HACc[cN?FTvo$ŢtR#O %dvN4(M{I-&@GO {%~D())-hH$ r$܎ <0`IIl yx*o)< X̃ KMhiI U^v ?@  M=HyfR-#^BJLǴ'ѐ<\Hp $H :&AIY.ssOqC{kLt " LO%s%?$ռOI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I)$I:IJ5Y! LXrRI]Vw h1V(S4AY}Y·贳{ֲK]d3-LY`=)I.y,4l^Y`~ `n~1[Z}rdm y#a+qnG4;B4+lxwlI%WyKoׇOZ$~$'G۷dD+wL=|k~Vii%";ZIqo ?ZǂVbk0ɝ2ܭ !6DJr Nz&tcۓ pIN& Oȫ&Ӫ?P`-eGtG>gDz7wM6T4ۥ-RNNi{ryN$FΉ !6!a!3]kyJG)蛍RۡEp:q ;'"Vp >GvdNçR5HIL,p:G0ƨ9HH='tNN%"%E08J5kF^9R@Ӕ9NDCO nnnH-݊`AݡS 85<Ή9J*HGC BryphM3$ ?LnhTm'06O% lsoZh'H׺JHD*'h" u` ;\uR#I<#-F%,ǵ,-&56%i`)0N!jO:BJS'o#R )\gF`%,׊Ƴ2ә' g-iR蜘4J`7 Ɨ]hXH A:%)TsSmX1<ܔ>i ?pБ's'0TCFCA" BPRG9cw`'HT\SFPth"2J*fn8{̦}ڄ7jdolV m&:Ji2D&Nb, #k|ԸM-$4IKm5DG^c%a9&B[$gi;h!Hth7C$s)*<<u*NQ'qi'NNx-cD)kwAC7I.HH$uIK5 tNIԨWND㤤u& uII!Sp_Cq*y%wH8-M h5NNIJk mi^,:-\a3A{t9'ԵILY/'a'qr#I(h|5윞) JHF dc& vRlY |L%RKF B!昙F]GPu) )))mK~Ԉ 4Nv*/sbc_% \i))oJu<)5C@ $:'@HwIJ5:(h3=sw ǚ1G)Zv %,CAveu׺$AidiRpB[0.qK []LH IӲnNc$$`ô<};4G֝ J|xH&51n%- IcLEht[q#H< 4xRS Oq}IaPBm<$Jk)DķB왭$#ݿ@< '>@0w$pJw= ΐ5Z lǟ))Z` F">$D MƩwIJOgPF='y0I6ST'd^)z/5h.ׄ;hLDꂕkT jL-g$ &%9$蒘` =_KluC`k$CN.$Ap )4F#2![k!3ksgz);Jf1tCpϏw9OT:$uׄ': )AGܐ";4Ee4HIItEIC 5^[[N UVԹL}肑qwHILAioJٹFqʌR.)kGWFFun,-hlt%B))'e;ڑ֘$vID6JI%/[9=i{&tOVd|StJ$蜐;$)@ ה?%]_'S OblyJtͯ13#IaL)`ep>D~)|R) >))Uɖru5cГZ10<t ))Up:Ț)_ςwY F'$n;E9X= w O ;42saL3w4Ğݓ'A H$t)%-Fk6+ `z<Ƨ iALZkL8iReBuO |Zr`u xN |Sj5))vnf>*/_wgɉRocRyLN 0% JDA'N:{zai" p0.uLݨw*=XK=2T }gDg(H۝0Si;n)>o2F}{\Gf^TAѢN;R̝9 J`IJg[L-h3إex ;^nTڑR'{ 1 9%ЧIrJS+$;R痰 hIZ D鉑ćnaDƶZ6u:74dwQRn5tԂ|Y1D Ɏ@ȀJIlj‹aK"6 o=pNƩO$$5t:i:myMH8Ha"Ԉ9h'I@I*!۝ (F%$xhwY %^S}RdrTdISu ;]RRPLNkpg& OKJi3f`DJ\6Ef;S*p`e8A1;J~R5LycH*X@xv)%$D#J_BdOR̀5OS n5K~IB}n%"x2ctMƘbRT$ln QRkB\O(S#)yII Y'Uq|@瀞 o'_^0>j@#ID Ѫ}uH>Iԇ \k%rk 5*:QvuHܧ8QII*%-1'X!NJpqS2O9z(8R'M5NRSH{pB dbRoM5Q8lwO۔45:p/m#FCN$w2Ɨ &k{'T T`:x5d蕮Za8߄ ZTR AljVhH<&-3 ̈!-*bZKc$Jk@kBsv< zP&'M'Dl4qݨ<Zu>Aͻ`'Vx;ѴӲb&ٮjNͶ9ۡO)PˠG%L, <=;SO-R0C$9P;0wcЦg'29I `o3\X'z}̀hqM N~JeΥ4O%q: ԺJܒṢOt74 S1p*NC)U;"_S}"`u4a[i.aRk6U\wXPs2W'NV>i߰p]Zaqt*G(nnX:8KEjSyY$+5=0gSWWZG2SfEt{] !J5I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$RI)IRI)d$RI)I!<ݑS[NM3Gܦ_SʬmN"RI6Q;sZGV=K>y%:KȀJGI*plM@-;b9T3n$P ʲ߮'pJVy}N {m[YT2{9y.4/IxZW`'\B )&k?m6y?WshY-Qv%L?rLX 7'y_Y5xWp_Y䍅X|9*&ϊk.<_U..tiZ'+K:^ @;y];\N< ?hq pfry*?Q[~jx:(uqGc{Z=#3M< s}|QGN$pPҒ/ANJz\=ͅe'$@ܤt<)"-HsdVa@qž!)[Dw)w$]TdvO)!ui kyDRTtCrG̤ t+y%;`jy":&Omϒ!|<s)FgJHD