ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:27:39 &.(6HH Adobe_CMAdobed            Q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?G&&;!>!MAMX6lxd5I{mz=;"HX0]y@=W6̬ѶEZ0mcKVI#u Yqpxpd>ϥx;2{[=/`o~wLvxkG.: |<יִnjoGelOWo5~?]Ͽ卭̯nw'4[[icA3&>֟.E?  ^ݸ ]O} Exuﮃ!5\v>?3wbT}y:O6Cv;4fݞڽm9>Ę#q-۸gKH&ls$ ]q)|%)v]5u\:gCvScjoE~-+3o윖m谀t{2}x8Q\0KYqy.Vݛ7{ppuj.ʮTH{5uc&UvX۶Z=', SM:z`x8Ӯ,w6~G}#dYevi9ۃ~>'):xń7Mg@\汚ܦ͸[և0Zhe?1q%og2s˜U[cb1ڶlU_$]z0/]] >'}cM{=ʮoD}. Jh/QƗnNk>ˮqs*(?cnN.+ ƙsnJ WMG;[^^MTkK*eNUg-kMC2ۗwdsoOVO}BkͶۜ <5o{n6?ޝwN鍱,㰿%ou.?KuRC̬e em1?ROkpgYw2,)d]YkӣSl[:9O u+nEZY[m?FV4Օc H~ӻېsiX懸ݏ?bDɔA:k4֎WmdZ;kE]g+}heWxp>{nJˍw; qh{8O>W)78E-0\|Os'H=_M]*E.u}_Q޽{?15 6v];-ZYOϑ9:aۓVʫ so3g:ΧytR gmkYs)\[M;q36?dcߏ~f=C!sC)+.cG._zmvLeu.i?Fޛ}_{^ gVtuZfkHZ^eƳ3-4w+ĎM7IugS`s\=];wҶºʩ7X˞AcE?vׇ\Mu,!k,,E3](z?WMD bhd[^Kt#G4V[-4\,SZK .aӉ^3^/Ϥ~#iGoWZ>[}d=p:ssjs\6jm;]sѿ w;Kp}wk$<Ƈmu]k<+N#e$hˆ}oR׏Mc>?o-K~wL&- obvRW_nܼjc2L nomcҡት8)+ϏYE77kZYu^4;HwgjкM9wec7jkXQvWX.s%gu17mumA}k\Sٷڝïf>3/I^7,Χ^6yv}VZm>S]uP۷6 eɬow_}_ۋXn3}aΩ{Z-ޭWSVWz?ae*ĽY]C__=_SĈ}g کkwlŰ1ֹ=5k3YnT,%¿N2YK=JԾZ{6r.sqpuF??\/O}V1%!FڽK?IA*ބy~c\7F7gGLfWOCM7>=Rk.mw\ʭ;s+*Ke>Mtݛ%]XW:AطunF_K⌯8}gVC<]Z9dC6;I۽*i7ϫZMaܪ,vKjem\+xuu;zk4׌ǩ?wwO.V C=-2C3p&@!ۖOexFFU:q1j߀FHZT ZX%a9R:g斞~sSSguO3tcDXkadS}[c$;Xswmo󜄸hUx.;wBgOTնѸ?ǩWEo'RCϲ+{w2ۧ3ֺP_Ikrh9ٞnnoc}֋ހ%ƧnQ~˄ԣeT[kPc"IuGc.Bb"Hz_={ k$n rC>֞^-MY~u?DrwX]Vl_"[,>{-Ng>q+n6yې~ӝmҥ!%cQfz>̞85c}/msjڿA2z?Fꎩۍ7En޽̫X6M]7~KŎZEMOmf=L-">||Zӱ!MAMX6lxd5I{mz=;"HX0]y@=W6̬ѶEZ0mcKVI#u Yqpxpd>ϥx;2{[=/`o~wLvxkG.: |<יִnjoGelOWo5~?]Ͽ卭̯nw'4[[icA3&>֟.E?  ^ݸ ]O} Exuﮃ!5\v>?3wbT}y:O6Cv;4fݞڽm9>Ę#q-۸gKH&ls$ ]q)|%)v]5u\:gCvScjoE~-+3o윖m谀t{2}x8Q\0KYqy.Vݛ7{ppuj.ʮTH{5uc&UvX۶Z=', SM:z`x8Ӯ,w6~G}#dYevi9ۃ~>'):xń7Mg@\汚ܦ͸[և0Zhe?1q%og2s˜U[cb1ڶlU_$]z0/]] >'}cM{=ʮoD}. Jh/QƗnNk>ˮqs*(?cnN.+ ƙsnJ WMG;[^^MTkK*eNUg-kMC2ۗwdsoOVO}BkͶۜ <5o{n6?ޝwN鍱,㰿%ou.?KuRC̬e em1?ROkpgYw2,)d]YkӣSl[:9O u+nEZY[m?FV4Օc H~ӻېsiX懸ݏ?bDɔA:k4֎WmdZ;kE]g+}heWxp>{nJˍw; qh{8O>W)78E-0\|Os'H=_M]*E.u}_Q޽{?15 6v];-ZYOϑ9:aۓVʫ so3g:ΧytR gmkYs)\[M;q36?dcߏ~f=C!sC)+.cG._zmvLeu.i?Fޛ}_{^ gVtuZfkHZ^eƳ3-4w+ĎM7IugS`s\=];wҶºʩ7X˞AcE?vׇ\Mu,!k,,E3](z?WMD bhd[^Kt#G4V[-4\,SZK .aӉ^3^/Ϥ~#iGoWZ>[}d=p:ssjs\6jm;]sѿ w;Kp}wk$<Ƈmu]k<+N#e$hˆ}oR׏Mc>?o-K~wL&- obvRW_nܼjc2L nomcҡት8)+ϏYE77kZYu^4;HwgjкM9wec7jkXQvWX.s%gu17mumA}k\Sٷڝïf>3/I^7,Χ^6yv}VZm>S]uP۷6 eɬow_}_ۋXn3}aΩ{Z-ޭWSVWz?ae*ĽY]C__=_SĈ}g کkwlŰ1ֹ=5k3YnT,%¿N2YK=JԾZ{6r.sqpuF??\/O}V1%!FڽK?IA*ބy~c\7F7gGLfWOCM7>=Rk.mw\ʭ;s+*Ke>Mtݛ%]XW:AطunF_K⌯8}gVC<]Z9dC6;I۽*i7ϫZMaܪ,vKjem\+xuu;zk4׌ǩ?wwO.V C=-2C3p&@!ۖOexFFU:q1j߀FHZT ZX%a9R:g斞~sSSguO3tcDXkadS}[c$;Xswmo󜄸hUx.;wBgOTնѸ?ǩWEo'RCϲ+{w2ۧ3ֺP_Ikrh9ٞnnoc}֋ހ%ƧnQ~˄ԣeT[kPc"IuGc.Bb"Hz_={ k$n rC>֞^-MY~u?DrwX]Vl_"[,>{-Ng>q+n6yې~ӝmҥ!%cQfz>̞85c}/msjڿA2z?Fꎩۍ7En޽̫X6M]7~KŎZEMOmf=L-">||Zӱ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$H@I $jTli A4IRI" I)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$ En0RI$D҅ҒI%BkuC^mMoJ#8JI$e}JI$ `JmI$nOge(aRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$JmIA$agq5!I*+b>!MMHaTITDp"I$JpG?4 M)$K@)$NFRI*I$JR RI$֥jRI$Ч ul ow@ ))$Y6 ,sI)ԒI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$II쒔I&IHVIJI$D= gJRI$0yRRI%]%ge/RI$$%0iI$0ڜb1 $JJٙJJI$zKCKRI$Z><RI%ڟc|RI$RZ{Z;)I$ +0购\R֣,3y10J[Ѳ?#$@(OdƎV0eq)yh0At PWe6M[S #Ep]a*[I?z BR*WΪ<|0.8HCiMg?i!Q{8k!0d7՘<  .]-ШLMem:Ȧ&&,6CcD&%)AzI$%1IJI$$ҒJRI$$$II8QR$$NҠIʧSl05-p%E'e$K!$S1$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$=87%$x?"ʿJRJ%ἔ?rz[?N%> $>'Sn--~'".IjKYp) vR&tǮC4I(4/MZ6丕JI$o%?Oܴ%)q*I,E~~壹 KTIg ,) [uhꘂI$0<7+2VRI$}!?؝JRI*b>)}I%ĚRI$}?؇:rR*$JR|J:R)$Al)4YJR)$C5~ BI!jRI$VO!YE$J)"yKR$)UbSf$5᧌r,r(() 7ڱPay%-6ΜKd] &8jGdR ܹbpWD@K>Gފm-ҹ8L13P=3OdsIOdaq춾TKڊ>Sn o2݈ z p7aФs}`SUr.lr]RfM8W'N)8\ _Xu 1OIVńx0|ij5{2+F‹!o)Uհ%HWEITԔ*SĐ4L$ tS …DH9Qݹ00!AڦڭPHhڥ1pڭ)4AMwB6޴+)Q^vD2m$K THh5C5bTZemrT8%F"(jMY)lQ74I R$ RI$$<$IH$I' d$$R AD)5)$Djl;S*7Ƞ7JI%I)ԒI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$dJ%LQci?$I$+]>%8s IJI$ʢJpkdvP]$YI-&[xh@.$ҒI%{Jpk(`y9IY{;:v 6~"Zƍj?~R12[oj|{)2ם\~.8GdR` -"@t_eEoRm{;WCe-NVI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$5UHPU@)$NQu-wNJI$cqWN?mIQIX~'T I$RI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I%:Ϡ~>IJI2R$\>Iۂ+U.I*iB7~Y@,&I,cI"}t%RJtO?>iV)K4IW|ģJRI0?xDn5-? 5;x |TMb 6Zy*ީ?E=Tk cDq'Ϊ)WIn@uD6AC.Fm;f2s'C+pXڵ'T+['Bݏ_J #kFtVf2 \_lw 'a& SQI$\I$'ҒI$I$$IZx+2;6>U#aJ/l&+uk(F548J3ZnlmM N2@RLlX(Kjp#D5Q/zZh$(SHC)oJK$BxJA'M !TN+Qm\DlܣP]*akU<3J=R5'E,a*&g* iHR_QAPޔUK@JCq `ՋSD$Jv.]$(Fc# %TkAXb( pXJ_HDfDwS!D P^ -JƊ@<( LGdBژ)EA4SDŽ&ݹ@T''zީ iR HLBL1%3TE%=Q N*gDwUP+'Q &p/Y:IJ}e$Z IڦAsBi(eEM! % U $G!AdyLqihd&֢H8jiO)2GhmLo T C/*T`R:?B(O2laH6NqTljUnl& p$dRI$ RI$d%)$NNTI)D'AJI$(aM%I$k(Jx~E]L6c*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$=@쐤I$&ĩ$N pКRI$@yIJI$}mw!Oޏ)UJI$_/AIZI$jp(WmIQI_Ц5VRI$ اLj$H "zM?$J )/)zOIJI$R;RRI$$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$ʟgi?))I$$0lɣ䔺I#=$b`)>JK%8YcL" `|Ej ڡį5IAOR9gLdjTe{eQ$dP9N-CgO5-䴝 J* ǻe:lIUyw%4ًeI %Nׇ}*IJiK)I$yI)LTI$S$I$II$O%)$I$I%)) ӭ҂J_@1vH8lUAcKOk[~vQ^ZQUYԱw xTViJi:J:;xRv}-,Se3>5}[9CIgヷpA ڕWUhT֢E-lzfI ș:* @.bd0m$证ձ[v\xEaRI2s+$I$$I$RI%)N2JRI$􂯋!s[:teZ4=@^6Q( z'ݰR-LuNM[OtRB+IY$LDjD%1P#v|)RA!&-LA<(Ð%>FhiO6d(n 5)Q K=ɉTƊv**P `vLL_))r!!$(NAEJN)LM pR(>,LTlm*US .‚)ʖ ).:- J J}SO)KnmW !1:HUeYo ~KtM "TcTp!E ~Z)_E.%tV my L2N (fIDjHBe%8b{&p %6T}8EP%4pSʈCi O|(pp הL,'e)UIP,(Qt e)E%]0U%Cl&pf yPO*kV֦2:*`kP$e$ RI$d)I$Id$N R )I$*A@)TIg/G*Rfw*JhI$I)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$v I%)$WBƲFE%FE/RI$SJHRI$I$TI:R<$I2I$$I$RI$JdRI$$$IʊI)I$yJTRIJI$M)JJRI$h<RI(X{(RI%]خC4v*)JVRI$n)HکI$ςJ'TIg$ m<&4%j$JJGgVRI$z-KoJJI$4M>I*I+[GVRI$$oKoJJI$$E z,JJI$4E z JJI$D8bVRI$$ O4v ZI$VRI$ @$I,Z%j$K9%@J<RI%+VRI$AO+ɒRI%Ki)l>^O)ZI$y8JJI$~IZI$τh&JJI$)AW%j$JҟiW%j$Jx VRI$/K M)$T'୧IR_tj\J$J8%i$JٟV%j$JٝٝJIZI$W%gy+iRI%WKVҔTIT33մZI$wgI%j$Jٟٞ୥)ZI$w%?]RI%KN1l<t%)ZI$0n<7 +p+U-)HNq>tGrRRU)$iai>)Lj$K1%X &dTIPIh6Mo%j$K1%-p܇ZI$X-Z~! hwҩKTJ;~)OX-gbs^Μ9c i(G3-gi!;)$QI-vI%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$RT-|RRI$${S)&I*+C w*C%RI%M%xc5HP*I*uQeV] nKq=Ұ+**pV~ub:= rP.!'/q%=3O2(X} JSLŠ-?>R1~P9ȃchP}w$)I M0~j@%"M*2 RI$)2A$)$Wpټ[5Y=<ݮSIb0gXxS}tKD-ڣce 0K@nNj&R Z4ȂLZRswpZ}BE1 ZHtVܪV(G 携eRF.̣'w`== y\EktC=!:oIH1YBk9iL0,҇^%j l,pV*dpKo*UW0z#mDWOGBL-\~L3Hn&++#Ƙ+#7Ю[:-,>7B+q]*GSpĻ 乧O?{$&tXX}kUӫ`a2CKbc,Ϭ?I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$ B[{hN!!I$9LBbTI$dRI$$I'I$RI$:dRI$$I'I4()I$t$I'I4I'I2I)I$thF%ZI$4jQ5j$JI$4))I$ I)$O)LJRI$RLJRI$$$$I%)$I$$$IJI$$I%)$I%)$JRI$$RI$$$I$I%)$N R)AJI$L*RI$I)I$PAJI$&NJRI$I$I%)JdJRI$$$$IҔ"$I$dI:I$I'LI)I$t'AJI$'%)$I:d$$K:dRI$ҒIBI$dRI$dRI$$JRI$I$RRI$$JRI$$$$IӦRI$TByIJI$LIRI$$Fv$)$ Ihޤp+G]% nYJ~0nT:%i٤N)M)$$I)M)JJRI$SʊI)I$r)$$H>9HIzv0QqltLL$Za$[ΐ[[#]Gi Z4+[]\:rUc ' #n( $HN n鿸;Fʨ,$ZU1-dV}K?40&G."  @TudD y{Z?T?z+:>iqivL:&IІzMiv5k`yꐽqݬ?oE.$S6ARAC~ԩc+ ([ʣRk?JG%P=Sz>wް[bhgȸ0$| Hw[,:~!`~Ӝ8|?vt3-x-E$Noiìc$4A Ey60 ?x*J;p"WF~NCBRd%*Joh $SI$$I$I)I&NI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$PI$#1;p!JRIUWX䒦+oZitIgB#qw柞@C~ U)$U[8ƩT)JJI$oܐ$$IRI%XyJH I$ a(%Zm vEka5I21|h5$bJV8 B"I$%<[Ƞ7P) I0N$ɥ$$O)&)I$J2IJI$&I2JRI$8LJRI$: ܣ ;Cˡ s)v)D ^\Ѵth=2aXK{0U t!i %% fBy00Q@NU0{G)$he\ i}djԙV,\f#T/GCufH4BuQ[ [ !ff>BŲOTu!"Y"wb2K]s}F7߉[B^eoCcHSu"V^.{EM*>fxky$Xܺ>Йp/{'gx2V~HxSh;Y)L(C 'Uk})T\#̸Es!Wy0vT'F':h#jV*-qha'@ $Jm;RJY OsJ  {eI3M )A4XJ)LpLsxXT4 DJQFa$t|ILTS ) Rғ)(vB& (iH+)]Q_TlY#hkU2HC{@F 4uCeULS+ 24IT!.{I xL [nF?r_XhJ*hcVL[ŶGj$l(7#r+4]sRd4 BōJP%NU D$1pbw[W <+& B4F a%$Э&%[tڦ)<$1)J*ZNw$$&%D,A:&')r@c A$͐|)2tTZJιlɪj)LIH)rI8N: RI$ I' a@)$Mvc- i!b) JI$I$֩$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$5%X@쐤ISĩ$QI9LI$dRI$&NI'I2I)I$t$RI$dRI$&I%)$I:dRI$J:)$RTYVПiM,&jI$44PT&%$:jo\, 6II$)@X|nuzN@TdY$$RI$IRI$L%)$L}>’I(LJRI$tIIJI$'LTT)"’I$!$cRoI%q$HI)1l RI$$)I$I$JRI$IRI$I%)$I:dRI$dJRI$$(IJI$%ԶRI%ȞM锕jI$RB$$IS%)$O]EȟcrV9aACo{ءccwMFRg)m>'RI;O2>?#'G8+*;O}Sz]gBޔ扭1)AF(-%0$*/ nZ asNq\JH$ϗb$.V9v'3_i7 E.?(GS۱:p"pj;ai҈{Ė}?+GGE՟(QdGb~ LlpK)%m2ZGP  XE%I4UV_zzc˚>iXU)$UWZZUl՘x `I&)$*RI$I$I$I$$I$I)I$I$JRI$I%IIKtVYs,ڞG%.iC~U57=9[iA-#% eʔI$R&JRI$R$I$JRI&I$IK$I8iqJ]$&Ih=;0?0({KA>{@䔝ؼZtI= f}"J[g XU3LD_]Bը;XU*RMy%8UM<*cv?2)BJNJ ǩފP+RBtyQiAJI$R$I:EFRI:I$$I"2O&V@I%W4'M'LJ*S{'I:TĠҲb SF<xJR U;h9UKNd+LP:&R~ F’I$I%)$I)I$I$I%)$IӢ!WKGu?L& C*/q~ )94BD:%%/XR[FӚII;'V rhP{)5c̯]yDn|U{1ҎܩХmXQ6ࡡ}gzuZZdC9G}nR8Hc8j}c+7t+/hיD$! A/%=>* t~*"5lao4'_luߒɒ9<))ӱJ4L%u"{x:&eHFߌ1qP8HH$#AiS#Dy(E8)8;Oԫ j gpuLƑ%0$d%i{'J05N3⢟E2JdvƮ0D)S@&QLRM0lpz(enl"5Y ب~ ixqPkȘGu~ IUOu}:'L$; y:@`Q qEA٨Sur+"Ķ*VK+3?H+&==NiT|OElip$F:':UIm[F9ˊЧ@T(Υ6ZeIj\4m5=f+6($j^v}A*5VBuA1ʵgU d8݊`=Y?k~4Y9ײr,qWT79v`7ֲrƎQ;.c|TrgZpC$z * TRI$$S$$IҔ$$IV)e&IZI%U+,?EMWa'GVLabJWK@Aaic!)O UgΫ@E6#0SU]ž JiI2MQZP.Sh &N2TJrL)BD/s P $PuL\SJ] )*iEm҂&RU{{JBwF0h)b 1ihTk|(a" A"Y"R~(EОE Nwދ x,r04)[¢ kUX)НGz2 VPI8LTRSI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$ U_~(KdԒI"%I$bID$I&N)$I$IJI$:JRI$t$$ILJRI$$IJI$I$)I$v6JZCd4d&NlR L:5RiN怜?MKIe!tI(Yjq"G }LSՎөGZ&+MDq.t(6Tnl4hKav+(e`c nF4gmbuDYШS-EBv:$ 'SQWY10,Tzj_$`Ιinz[]ۅ6t; p׀w8@&W*8O#۞ {F }O{/]+4PW^sqWoMBq.ΖrxN\D=^O+*\0sy]G{!Y,@cB%&=NM>X-1ƊG^Àf.S.%,vu&īU凘 اNs#@!)* K[Xdq'x.Hpc1m n :4ra: 8}YA@y&{k͎UߕPsFiU~NV:$IE $钔%I$t%))I$@LAJI$M)"$IҔ$$IL%)$H)JpRRI% R$$I)LRRI%9O%BS$Jr)RI$eDI8rpe@'%)$Dܖ MJY$)*}k%ic;hI\$U,괃 ;Yt X\IDgLÍJD{RY.9dk|T]ԳH.i0ڛ0̴IYa&[$Oeqh:rVm<)vݥ|[?ҰwA*mruH=uk@TBdY\yJKVUL}ߕ,q GM% o.>Lk䒄Qj7U&vV[{4y"hN:n)1d?Q}?$Jʩ4h??&DLFQv͟4$%+*OgvyN.V ,?AX=E=QP%pZ߽f9mجVc|RfmU RR#[N$:C:~(sVuT+]uAY;長=q RfFKUoOwGIO섨??qfC4m0TfUs~\c\>h_cV_CSX:IWߤ~h16% S1 v;;F7~(ͷGKr[HnT;?*V?w Bܢ\@`\'IIϔң)$$JR+RI%9HFSJJRI$4RI$I%)$I2I$$I2]҂xIJI$)%)$I$$Ib|R )2RdI(@Ʉݩ$Q0(җI$ZQJa"dJj)@ "<)7 khU_RQ1U8˵ T\xCp!82IS;yCR3 I$I$I$IJI$I$RI$Jd)I$pU PEJ  ]3]HFa 3#*nak9cI]{eZm *uj9-Qh;PIRdP}]D![fNݕD7"nZ`jCRCH5㐊و!#B3H*[#P "@SVGbeN k;j!Wqj4P$iT-B<=ʽ[ctVYX#U^n+`w^\I+73 y 4U XSSZe(J$&xƜqTh ĩTRM^Rq`a  ;WG$i䞽9NO IA,7?pP .#]%9uD cMtL$"p׺=GxRDUkNT p ;I@T~I{4#NjL{l='\(Pb|n5+Y5 䟔;x>\tZ{O<2r@P}]Y ԢK z]ƋAiӔy'vt9^oE!ZmR%ktGHЬe`%[n{tI՟ X`NTy>(|uA}^AUuztB m8ytU\֏S`$IFmZJHպvT򟸞5ʤo t*,h/ &vOpY587QD)xN+CM)ɒ:(*8;#hV 8M :'xDN Y4Q!Cd'o*g^S m)&IIA9d:IQ&L'q Y:@'D\gĉNp,;5!zyMNA8O BAN3rݜ D& KSQ,o n@E5 )6G k/`tQENƹ n><EpR+mA"QhNGs!)LLjH$&SA 9P@\.*U,’`D\ +K QDTHW^ڄQiQҜvZ Fe)lV5%g=4:qX ;Bٵ5B53zWuJaի:N-R|Y,;:[ {t!tms^4B'1zf (ʽcµ˟\ v8vѢ:)[{R "J4!8'-$(Kri@KI\ҜpG]:GaNz &i\aJP@NB(l FJѰJmiA9Rj@bڌ¨E7# Y:d0H)$SNeHI8R !I)I$R pTI)"|VYY;)$@I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$bUucFI$LI$bI I$EJI$I$)I$tI)I$tI%)$I$IJI$N$I:I)4jI#բ8 Ba`RI$UEͨwQa PaX)8cFo= {)-IL&H0w:(pdM16=~XuYN [Pp00B#(#JmS$T-iT_+vĭ6ke֐Zւfn=b/{ .O+8su64OLJD@LW:Ǘ~#K>> %IhJ8- iPA#xKkpPlQ2 SRXy_-5 "fm z !]< BBD("vCvTq{s?J|v*L{AN೽-5U3Y ZnrF]XV[k EblX ޝQǚE'YUjSBE6fw`˿U< ?zV&[ vGYF!T#De O.#C;]YT-wTK ÓTu7Zx9R|r=Z:sZ<2qP(d/wxsd+~l ߄cFb BeM+"2tŒE `ʡ]kafR+%𝵨m$@mJmQ"i+Ld-SxBڒLB!>aԒd|̝QRN'E))ʥNJҬBI%kBK EB.&겁 i+;DYm=L 54mSI^MPkrA@r[#HB~8k~ߤ1)聡j9Ũ۹=܅+2V{[]VE3FmS1(IM-0TJtI2I$TI' IJI$I$$)$LҘhRI$' br $M)I$"Y(JԤIE$fH0I$I)EJI$S'I%)$L$i'DI3ZJ/3 x=<F7%4dJQ{R;@&P!)9AP%!yrqIM'3Ɖ%R}FLUL[&-qGkR+ν3lP=T8D a<'@8jE ;(ƴ"6fiL!m.Dd4I@v溆3 - zT6aihH( $rI$I$I8NpTI$ *ajvlR RB0WCYB5 lANBi-gZ o+9QsˉlEw))aP:(,ZT{^@C j3c\5A,5 nR.aA^P׺aIpP1Kv0 }h ȠĎ5S;J} |HiGx t=;+X:WBe^ѹE muRBmv'I'*I$O SxP)aJI˙_0/EW+8K:U$I4ؙY¿_E6xWn{\ALBvEl@a(]c>W}W?In$G-1=.a%Xl! d)ʮQRI<$I$% RI$%I)I$I'('jI$&RI2fKr`t]v[ZCV9χmԇuͥ`(d+-پߢ8 qd/IuIXNRqN,n3_ԍ]lL熈n•muP 9#VU4p.wt@Jg ]+0l4 l)\Ltjxum,|B\Vf@YR&E$EkT䒤IXn.2JRI$Bp$$$JS  OdIHTe4IJI$ZkBˁ@Y9pRd/0 @Q°#)rVsPͨSGV0< 1H_p6ңPlza! ՚jI$[9CS+`lI$LTI'I2tI$I%)$I:dRI$IA: RI$1;z%s> ֢jAEQ!kUKO`7HL k>5%*PAUmDv;H[hr.xv*啒4U_S]j2WSJuN BdY1N pSjIiS?OV_+:)W4[Z%UM;`pfSLRcςӿ^ dX`(D϶H:XGCn{u N(D2٢㖝5tT߹|V >jK j| Aן(0kg78F\R2k $LqvB5u JKxռ;-"g Mn("p% tۊܖK`A7{֓)vO- PR 3 m->H5 Bi !oq l;rn݁MeԨtRm#@CڠL9|~(M]tJ̶o>Qs f uWNw\")\t|=:YDzj@9ԃvPir @ert&f 'HW*t},cu0zroun⵭,*O̭#-0ICe:I$<$I&I:dI$H$I³JK&Iic:9ZV5WTh99 hzMr}#SmD 5W-vJw0!UKl"8!m$)'HTeI%- (QN7|[2ҢI _>!=TQdA^ chB}B.%D&QBA:xS.Qs7&$&A$B}.tBaK:&T$y 3/1‰ PlI*!%StVk;+U?E&3eqbBD*8°u u$1U邐SM2 b/EԱ 'IVj hV)H(M>(.UîَRGä`꺌lASAY]VC}6OUp`,,U =Sk-Xuxw1,6X]NseLMSKZ>+umi\WJ}W]}6zy_d\ڟLN!gՊ[j8F3w\xYyyCnThU[;ʱ uhb -jZXqTћ eB"eUp+*JY%J&ז:FB! Y"xQ-IL =JRI ua(oTgv@T%HQ<=+YZ6&R )Y֩ZZWB9#ճvڡ*mtI8R )JRI$ pTAR%I$*`H)I$x"ޤ?K RI$I)V)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$bBUuo%BI%29QL\I"9LI&LSEJI$'I$I$I%)$NI$$I$I)I$I$JRI$%CUJII$[Ϊ`UaFZ!ItȌd5Xυ?:Q aiI1p 1Abc#XxMJm|( r5Rc W^ uL\&nLB@:&6OD荪yI!:&'A%T_ ʮ3q 2~_Wq0nJyr.$Bk ">4-i4삝%WKuUZqڱ1 gH~hSIi&Wq4uq:!Wh'k  qWMdugqrX $0FUݡqѨj`$ Oav]u %feuc2NS.'2̙VOBeb ~u(h -1qMsHD%Ӹ<,Кp&=ۋ@]Bvov$Buv@hQqWў]'ovfkx LVb2^HskdC{qW< g- Tj4}jI7G T[*+=ajPsIf=uqlR;=$`.o\a;U H`8JT/&>pTtʣj6P-'TV8RTҖM3r }Q{+MpP&@}u+s *!=EmC_ B4bv[ƒeqЪ̬B lvDqkuAuQ)ea;]jXf%nU7D[NO K#UI:2ϸ3AOҰlt]]k .q LD)c/`.,Dހj}' pzT::7hlxUӄSrI$J 7N#@?VuD ҒP%;z,ѦOcKntցe+mb[(N}^nk9UmFNB!=c4 vKm.S5Gea?;\ce0H cX1;/J 1p Q݊ YAoR?Rmka+1а`f9Dž@(vEJNI$TRTI)B @$JD)JdI$BHRI$'IJI$$TV.+w8.IխKJR숆%T؂ׂBM4@B&";#nw(F*Y#(FxWN.̏볔+2J-C$% ۳'B@{C3a'DVXB<4LCI:e iʭwZ!U .Rdd>!hYTvAu $JuU2+ٵCi(RI$gVY َyDT3$gU:mэݠ]/ٙ@Ya;K絼_'>v˗1Bl8nConHUz=t$fLIp8m;te&&{d8Gu q:( Hv?!wBUW%:B>({B^m3k-|ҢY g[TZآ1Wp[d)8;AQagնyW--0 ,׺{U*Vkt-CWkQ د Axjrݽڪ@W-d1lFZ/[CD@PS/*N!T f(!Try!+I4!5"xLEZI$Mw<"+*l'Q I$_V*P@HF]_z8^̂1:!MO |̤M4ڭ'u0dj|wjN᪹`idx^HiQ /: c vLqϠ[A@\Pmpj CC]{+Lދ`OEWr-]c7"J"R% Z\<Kh~( Jy!j~J8LLB0SBr$x6,#*ݡ'͓x*4 RgrtP[쬍e"G)c5vpM!E(QC q: e!`k4V<)nOKJfBfKFhyTsu_H3nu LwA,QIN۝knC lsH*y+u4UGaTC`Z\]M643H#[5us$y..a<&?'wUDY8CӮ+ܦ\~8f* 'YHp;Jg TZKLtg) ·ceWs@U%~t: ԒI)2pTI)JI$E?k`>IRI$I)V)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$cUY>%BI$RTJb$Id2HRI$L2*RI$I$I$I$I:I$I$RJRI$I$I$Q NRARI$x YBϥV?jddФJV[xECJG7V6OH&=^\(j6KG«'',B`,8XdѝvcSԛ#@>X(mcmCuY i OᦿmWW8Qv84?*Ч4I[:f_:*ԝBʶ4(n(4U)PC#O&@H"?W찷]Y|_P]e?ePyUrn+Vn ǚŶy* .%a2t3S+O05pO)tUla:P,@"z ;hb$9YY^MzY9 c,IT,d"^T6[ nK,hK{׬)"PV۬l!!rKQ}[B&PyPUSPSwRh\W\tTɉPsF) Wd!:%!t$L)[b(`}# '%64V *ĝxM46NToBbJv(ctIAJgJL^ɲٰTIjWIV7<,Z pxmu;79Y2ʝܬ+*'I8-[@Ug4vJ<+o nԬnUN Ž/o:*Ρ:pR@5GiF*8z YD2 eyGaV Uo% u 1"SڏAjr?Z6 V1׷TOEX,t3:b[UgVMDǔB!-EkGtŲo.t}w4¤yΒvkh284AIMe8aixOo%Fi*[~ a%6a`>JvH` Od7 jLX8S-'7DIn4$,<@t:LġDMO{)N<;'RBxLBw7H%$i1)53z$vE :4¹CBHBB$bŤ8VdYhd`<.uM Re=mP )#8K|O`ռ!ՃkⵏBOD`m s ̒DOM;pm"(WFnD hlZSqj*4UP%fN'I$NJI$8*)%)$R$$$II$I$-JJRI$a}%ט>V -G-م)M'xBc a2ĔRJNg$9N#T:Z$c0Ԩ}IuJmҀ6T , >⇽ÔSu)Hf8Q(TJI$>Yt'LeI2e_rjxSG MK'))S#)jePZF/HPRDu ՏB](̠ Ne`ÖEfadl !4R(D6j\ j1ikV+tW0{R(GG WJ[$e#fdʯ}`kH}Fy!N\V]rAijt6.a`N޺ZkZUrbZs#%eVa%-Lbu5K ]Bu~iXJp( +AHEESE2$INMS X :z~*ݍJRv9C @  #=2l8QH(F8kI$6T}](>tLmwRNo%" Ωmյ*tRI*U#T֝6҂29ĝP2gO RI$=iB!<2I$I$LI$$I$I)I$I'IJI$I$JRI$S$cmh!s+wARn ʫѷqDBGV.i SxUqeZn\".#<  PQg{*u`4FmgTP%"N'^rd%{cbA@{ (:SHLRHhz&hxOst( `o(O3AvD,WFB($UcLwvYoUCjoVW cEf֚ i*,% t7_i0r=gmrL F?I;C3ܔVt)9ETE(H\=T{ q'4[>[#^O=#@vPAhב #g\$_F>T& $꜅4ӱ3ǚut!3!# yIpk|A* GWnΰ5$x7ss$T5 GOcw!0ja+ '5LJxI!-pÙZDWk>j+':֒EA~H-saq^CZW+%77m4kg[L)H.N["*[SB;EֺԒI('HIJI$SaPN $I]+*RFHTHSQ!h4.3UDP,RI%TS($$I (I***J%"i!H6S`ƒW @ǵR")'B^Mh8sK8 4V6[K"Ӵ)U^UҪmWϵIhbR Vy%]F+ |By-[Bv[1kX#ݓMLUL:.wk(V\f)6W!s BI ߶K|V-q+ ?%Yk|6!N!eG*xL;vZyDc4 IXiuZZV 5Z u+ͣy []O<* -=oh*ESȖy *BZesʵ_'ժħA8*`Rhz:m'*UaM@F)L)LTI=‹qLWDjSHJgK DA­Y{E_Tr*> ()SRwQjث^tCJiѴ#dik FiN‚DPJ(pȧ67%)nB/s+rXYe- Y,lbTKJ^(K&*Q `\4RcB+@QkTTf"V)ƨ?46JNlJv4L~ RW 6 V`QINlQThD1' ʥW Ixђg*@ »pUd[)u$uHjfRI$ IMI*RI$ m>r9Ÿ(II$I&Jd%;I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$}UO!BI$rTL\I2dBI$'LI$I$$I$I)I$II%)$I$IJI$I$RI$* TI+Ԙ]ǸB⬰ט(|dri~UܗktQP\Bhր" UiG{K&tPn9$F#($j5Ylf9 dʃ-yZvہЕG'%~ m++m.؅04&{)EpM%b'D&<+tUo2TtH62kY9o4#Õ Ob$s9F![nJe9k: 7;S69h.0gM%1C,8h:(o4B}ݧ9qK5x.TၯbW_nB?!U!ʩua"kv૕P4S4!E8&1Z@ɬU;[!mJ̍ (x AtO`:=)fcz})%9mhWh#UvߪqhN_Qi7A#RK29Pr`J֫VJM5r] cD+{'A汨hߊ?ިU5WUFJq§Cb#Eut(I'TBL!s8$fQ~D>& bˆ'W ΁Dx@ʑHYnbXCS}¯n=BR:. lgic,R-8*7ӅsFB q$*+B*0J4MdQ.fqg\moLʪ- %B+*Ep`^fuK;W8djuRuR`=0QQ4sXE)%ѷE`j_AuQB;uI)+V#ATgf<;TV>O"FY59Q J3hxheXZ~hls` <|*WuRsB!p!1L9W"N0RKV]N&P QEdNg"4F&5}dVw#Ty)S%'ЏX;ic Dh fLΟE DƊm{-&~iSvW AU ĝ'Oo$$%=Vk&sL O'M>;n~ qDS C<|[giDrJ*<-JsEE&ZAii}ʮUD:]$i 'I 5n좚ğPI98P)5.qI:tZ n>*- ?%8S!Rr?夢nlJ ;ڮU'kuB &D%kYQ:vV,M0uQ]_:H !L JX0|ӆ2NxSmԠsSShBSR$V6S>0p<6w\w;@ UʑioE&xN_BL`Kigsk ݐ#ʈmSQ)%c'9AA,4HV0D.w8JܲJ64t’8RM JyO\I2I'IJI$I$IRI$H{VnJicBU 8]:Y!g^ !U4+7"٫ v"uLbmO;s;H {D'c% <4nS JIEfc 1p*%+U%nC]=AU+$ 4(y j%iPx*,DIDҼ.1XٵxkE[)IQqi5ebHD.d5DDZsv:|y]]_{[LI[H:%.{\Cyv쵖s=c6 G" ɷkQ;H\N( !RWoNᾯ2d/BݹqArm/v[E/Z3c@PI iLSJrI$%<&)I)!A uA*LSִg/kG~S˅䰖7Gsnth +&TΚ+5l%ȴiU÷ qit7W4VbB3fU '7>h3j +4Z @vD"ˠ B-=v: #I`4Lh *.pi&E` dNJԢV!ͅr Ka$:dI$$$IIsʤUpw y6Rb1WFBQUthKv))D On(jiZJ&Ңʥl"9HJ)R'yֺ8"ԝ7*@&N,|AL !E{?U Kh(I%qo?E沵)M ;AuDU}]j"U{1a٢-ynTVpB[FXKƨ& ]sUv?j`PRm|%Ž4Tc v_}!Lt?-Ze-ߘt+8ꈋIJ<ߔ1:q-:qYPjy*UrZj4Wd*ATkh9W,dp>qj<)W(V0ODJjipN*QQݵ1%JĨ(JD#ݪ,VYn!2,;#TlvCJ߹ NDeE'_5imbL,wT Dkiѵ* + AL\ )鍀RI(IH(9\ ' $ӢQP%I$<)KhF$W\eYa NSBt0`Y'*2T³[AT#Wd"%*%M1 F #a)H!X*sUuĀHL + %@syn4I2qiH(TI)R$JAH)RI$0Pڈ RI$u*QZQ> -K ԒI$I'!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$}Jt}0AI$SDש$L:I!I$ddTI$I%)$I$IJI$I$RI$&NI$I$$I"ԄZH*I$ TV`<0I$ĩV-EGGjSIXTL(9Kpn'[OK^ i7\$jiS!5s^wC? /iUgBt !65A-w3A} ?߸0n㵼a#NP"FDT-xݡ> u oUfQ*!G3l“cYU2ȕ;DȚ+ PmۂvIW(48ՂB+d!+H< N$]*ah:5թkl?BևsV7'{"Bc{nc1OysۺqtXThP5pQᦪ Xw6yV0U!P-Z=Ֆ]'#; jID]=meO(DTe uQUSZ㺬ZR%i6 }@ v\6'S;[g:xLX@)& -zL7$ I$eH!bRuZ:&,pւ4Q}?4Լƨ P[Q:$0PX_cSf`n_ܠW%R;*;̵3Mڈnc1cyT,NF㴢WKТn<+.gpT2=y4URXf[nU-X?i5<&e2ZM{Ox3xViU#8͗A@-kàP}d;_nouO1{)!a /o1וdv nDj[{($IuL!7Zڒip T;ZX%Zi$OyT3/ju<%&90<(}#@dg@|0ghO a_2tgoNLs;[:_ .RNLXi13T7RŤS?AvN`3gn"B7^U<#I2gHWl` ){]$bv|lp*m*k+6^ +xlZ8.\t[9q{Q*k6eMvl IE:I'.RI$I$I$yI%)$NI3hVI`${)ߢq+jGe`?*#5iky.iVĠ:RܠZ vKHfGun,Y5I5fԙ tNg85smm~BgHt#Y!+mDEcX1pNKS\[_:aYZ}aI4}9HmMu1$*E PVjd9XV>s蟒 D52 P^i$fȦNT,,: ʋ;YQnVwP|w:⧋_uo  wT1 >j\-%ydI 魼H,ޚۧhE  :P}j㤍 #xj5uz{9R Ʌ3XG*M05;L@א<Ȑ[Uո uMŭԉS4QiS&pS{w!Mx&kÄw9M%&-N$\  \CD*.a'Ur-dIilS6<.d9=G>hfdd7*$҈%UJzA|p{/4*cy>ZN.E$Ɂ\d{Ln"u뮨%a5{a.ЧN1 ?~58MְNH2{g[@UvHKuf5Din[q5<ϊ&4QC|ꅟNҧc"7UC<#>ЪnoxqB2:(;6㳢I3xNI'%I$I$JRI$I$I'I$RI$I%)$RiQ <+XLɍI-LKO8ŗ( &95ݺa8JA_j)#{7!AVm Ŕn*K );; )/=XcTp'g84Y@T$P{cND&)N<)V bS(UgnJTVYJ(VN|!.iڄS ,H+ " rt(?q92iVL$U*ani_4L5ԨXTj;] l64 `oM7HjN:v' N))IZ%nI$H))$IL%)$L2tI %XʸG I-z16zY!ȅcQޢ>*qEiו{m.+:Κ dR\YwRfRj7q3(8sqi9hi૴VtJw@(4Ӵ9T/hB[uX}F$^)d2>IcQJ.&;*ͼ3#_)PL6P!k)!l.fsi'GhxI'7H ڥ$2|+I kꙏ5tD~w yMwfIh>: h+޶OkJϱjq`P"$YۧO?Lx-z:Ji|PeV+cV)Wu.f y NΝBn<X[u pu\KS68UK3e1z@vh 8D ;m08ʛ܄NJ$NS$$I7:HRI$aE4 RIY0j+QPwtkDuX0j.xZ:eXʪl nv NC|Y. Wu={^u>+eఝd&U7u!0xD6x+#2iۋ Pc7պ:"f\[qӦKg" Jn3mnîc-涗N%c乿T(շ!zC{KF.xg]`sBi²Юk ~.쑓9}69iEcL|>WOc GUKuPl&VBLz j(̀eلOgRcZY%(LBD#7A OS`T;"Qx`pTG(Rr ;a5ڡΪE۔ jyL&*T!X@G 2GVR$Bv-b$&I+nUH$ T% %*LU& A˜b\"A `B ![BRT|-"B{@D!HrYΨN+b ?DA+H D%6hUs [O !d6b*Mc@):X*mEtI$2p$IӦNTI' d%)$SM )5JI$S lۭn+I %$I$ITI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$W*$JLQRI$S')BI$$JRI$:IBI$$IRI$I$I$2tI$<$IXPAI$ZJ\%))D(l5O WEmk@Pc, YgB p;+ @NѷTڸ9uy[`ۉGDBˆ"SH̡a+O !ۆKBB}P 24 `㦁D)mpvs Fdj9 N+8J> -ς7ـwB͒*ϰ))m: k5Eme-P*) 5Y'9U-d Th#'Zrk H2H -M_wV aI- VfCV}I*29E *|5Z$d]ƷJ Rp-W6JՂ`+ W([ӂR&ƍ'W1 {T\tDL\_!UhZhiPkuGh{ASuUL⋺5BkcMj~㮞j; 7T#"\'r KHX Ag6xZ6FZ}=t3!ec;Q?տn0|[Ԕd+vNm5L+."x+q2^'H);xDT&84kC  `jB7I %$$,.ׄ _iD@ % >*L0 r5 Vm<ʓ*-"ȍA%0%|i⼝NUAt+2W;XiR@MSVTIHI$I$%)$I(I: RI$X. y.wp Ҩ4&L)QȰW퀕]"Z|s(kN A|8xW<@f߿䯊G H8ĎoM)rХѬj5`ϊPl]ڧs䦔]%E92@!3k^u#T\~H(r%U/a o`֦ SUrU;/DF$({'ʶƼ$qA70g25)*/E qvLƟ8P T$rOV3෈B45 *u~j#x*tGZ;mlf!g6a//kKmH]ɳ{iA7A^K_@ D ݺ<}?, lJÙY8ViekQt|tt%oq  gt]P'#|>yIw N8֒~CA2'3L)5JSV cڵf"Dž3-Bm u?\ e?yB Nb.kLP8oW&(*@s(eO/]ϕ(ARn$nxvVxSu Km{df "iGP!ITզahf* L/ !VEV؂wM(.95Zv,J,緂Mʕ *ź g0TEGe %ܤKFC;)Iu"J 0@V`G')Eq 5/JFik> f%9GG,}\^jp=%UsOUk {W<{Uw**@܎θN'LE$RI$$$II$I$I%)$NNI'j%FAI$Ѭ]=#Vr!Q&N,oeQpDc)j]PpUwXe8З PY) WZ$SSeݒ#ESLX@L#eZ\Q|a{|q%Z UG2 n>nc$L5g;YWIJvg4?OݩF۸±Ur7JaV;z |=,|1D|&'T]K:KMn~ jo2O@;AGt$ B4X Q塕XTJ}H6Z,@xI9S& ;Q悑n2`tRouvTxV}Q`ܤHoQ"$S]Ul[^վ[4:UӘ~)mB!\Kƍ2Yj=3>۝vdGD`3 X`+ u5̇'p[@ip>UDt!=2Y7Tq΃twRliġ6RRV?Cv3h9mbWZ{F%E܊ϯa)1o"u HtUm$XSQs@Cd^G2xB"m $"T\cSSي yL& (~ӵ,uB }Nni&iŭ:TE_*uRIV-[5 2T!!cDV >~f%d"dZ(vOeRWL-z6 USdE$,&J)cDE2J]` T;"xw`\J$!U Ҝ=6لiA:M HN ]J $L&!6J)$6V\LXlQ,E)ZEef)Ťp 1vbm"PCÓĪ^GueJJeDL6Фm`+[C{C!@, jU&I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$_*$Jb*5I$Jd2(RI$dIJI$I$RI$I$I$I$$II$I% 0I$Й$HViPtWh.AaRbmڵuVB-sP{asԝf  yW JO٤H re&< n1` `2aD:xNgr Od :Y T$NХbaw!XW2Pt:b REU$x+)SªuS 4]ZЮ*,JWQnHʶZ+"5Zyk\F\EG8S6,t 6P$2d)$O)JIJRI$ #,TITН%mV1V;_RDތH@@2* j4j T KP]Em $fGuD*&wӂ) k$&Q{ѧ}),GO;)mH5QĠ;dҜV%-(8X)V Nچ reZKH,TCLoۢL찫Υ T/te2f:UWUg&6'L JQpct^LUZ Zصq(xZշb0d<uSYWNH R!.d&ÿx@%A;Gt$$ HlpN y*5:*Gi*n(RCa]=@z@V5EwR4xAY^G( "6RHMmF㦪t>*Z)Ç54FQkF-#@-w1HC[ CDYܭQ$(0AS`oeaPuVK ckwcbwkR \u& "7^SX%4Ih xet?v "!@c)F.ez, v4QptGZ׸ftCBw:lP*%̠4As[]*rLڨ_ %g0DGuesNx%: Y obcj"%*\IY=Fb|`vI¯v! ܔ;#D%8%uV1h-p:&ON5~VRRy B'~%V ZIUϳx̨X}Hu*x;h@pݨHph|QYmT>ry <]ë́j--h-vTat=ƒh $+6o P=5e32FEFSA(N.qP֩-RckuO'-P}M*&bO kdrx`R^ȥ*0vhZgʡkH DZ›:)WXU(׵uL5U2s]cWiq;YS{7r䫆IH)ij+Rvb:஺*ۛrKWt,U0+ʘ} TnkKs54ڎMPȩڴO>K7&Z>kfpj}:!H"\ Z[E`溧1{h1.,pji`<L\>l#UdK^A?/J]:xh݌3'RKJs` )ۜR2!A$j*u{.M5+k@[vL,fWV4 unc5|p\c@OnJ=<ǟL<8HRj*„[p1Pl"+c4AM=>#("T]/qNlq mnDG:uݿ x,VI Z#8eb ?h} G%j\fAʧi:5Ⳝ+O:H7tmAT5жX4`v^4Pf CeհF3oS3 ײ?M|Y&\ WeW?w)\}URF%޻F9`(6+]kG9{Uœ).pm{mn54_S̼|yAlOnP8'm䝠h;+6 $)* w\ikUV*EΥ]¦]%M" <56ڠ7 \tWcT,J{" K.XS pϽZY;d;wC{A N]v]RcZX\tV;kh:m!x.w=tYnk%dCf; 2Y)(Nr$II%)$Nd)I$I$JRI$RRI$WhrQRI$009SlƊ3QI5&)`wAu{Uָ1[m1 -'2^Zcqa]f TIe:_:j쀧T'8(Bb -r`XNLQ!کLbTvʔ$TOBS ViQd-gIHIGhƫmb˶zոk{dH -;5*lyEVnf5[t J!EՍx?J )vvnFT@fn myfh2|{)=ʭ;@ToMRHկ1 Ls殱¡-\tLM b Q+]X.kjFF,e Q,̣V_A 'T,'jD'Ek75KHH')kxXJP#L :(xVLRNS%>I[AFi*%֧""6 Td*2SU(= @@9N Jaf8u VڧR<& `!)8(gQLI0) BT. I$L1b6ԒI!BJ{HIJI$' $JM8BhV@$[2绺ߤs}5`cTHr L$I;@-smzϏ ,V@٩B$99;pn3uo2\|8;Oc9&eGp k.:vJЏhD?*{ˠH# y>*' (nL<&"[! <H t$}%J"TmHc骹!k];:T34+!և jR4wNj\-{, (1#I]B8[bgS ;)¤LπԲ$[:lNb0 P +=Z WsyY6d}DP't2s#\~iPAy0q2Hs-9u}Ѫ?F !lɓ/GŁ};ϳUqYg%fDZӢ}\u EVŠil¤:,VftNXaʹCFPp+k,yAiu|qK 58 :E" FԤI@>ԭJI$BvBn%I$mv\GZ΁B$EA$jGX=RDjF+UMÄWÓ? ]Vݵ7DU{}XsJu^]E؆S}gW#=V[mtFʭ#s[=׏oRlѡ]LgjK(l4@M{߯uѺH\H.k.6 Kf3 }"|~D2<ڎF~iڀdclȓ3*iN5~D [׉NBo)pG&E'{LK|J(tzv'܀w*T+mK@I9r<aF^U[+ _k"5 m:asa£wMp:~O]iWW#Al.7@fC!O[V|ܜ0Uێd{}qXV>n@A֗SݿF w H0@o'ce͵VUwϳMeJVu58C%M2HRI$I$RI$2pI"VuWqTԫح$DjÑIuNyQ s"SJf:OOD;nۓ(%NRLH:YbRn+T铤Ҍ$#6Jx-yF"JtB+S)J}vQݨ^V' 3*>I(k%):deIL%j"ID6T2^)>r`=BKJfKaRRid$Dj+{H23j*Ҏ O'u D ڵ- *>ҡMUW:΍is~ Ne@MU;OPݫ7?$7LІa&J+^[tT\S\e4B"] ':e:Ym*dB*r?m0HEgLʉxPN*!2e6LZSJU BRgE NARIDEkxFkG XJsP(Olp$ V F^ZaBE4J2IL*3y [jAIVoܪ]j꽶FK`H tv{*̕tQI$TI$2tI:A2yIJI$pJRI$"5 ) TI" nwpcKO!WE$K%+k5kQS,RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$_:|RRI%l)e$J)I I$$2*RI$I$I$I$$I'I$I$NI$8RiII$3B3T*n姁M%jI6|qù [<)cxVnЀ,dm ++$GlT2-桳`@+OsHU>,R_/>J_]v4+*ZQUg>jk-ÂA]aj6βUZj3:†܍ x,ݻ'UY@ ,p2E)"4j5(E{x*rM'Ӣdr: {?4*^ӣxMJ`E-K'eE:sZjbLGF;#<Ω%!whRo #TF8rJB! wr<,kguP׎|b\40sx<8P.֋c ;BD x"6I&o(&x zree.ର8O ڏʞ ~te 4So3~?+GVh:Xmo1#߰e=B.5dl0uDZ5a:/r}/,oQ1拙/n w2XkH WfS"qipTqa!:?bk `A LNLQ@q䥸<tA胧Ӱm;"RHA 5 ݻ1F$D4mQ+1IdmcK vƒg> >Uo3]S.M%)> *mA1Q ^*xqҤJI%2jex]ؕ1ӧ+vW4깞E'U*ȬxL4UZ3Cd8:&l#~{i?嵙ќ`Yckv2%ƵD]T^ZZu5;iPTۓ4*N3In d'V՗$N_VTs x#BCyV(6uAg6$~D% 8@ !Md8l%Sq ܝW6#OaĤOLPkei*$8L zfϑF5Tm:?ThFYz@Z=ϐgB OQ)kv TID\|[r S9"? KO>ԩY]m`:hPY#_{FPmPߎp%oD'VÂXP2CP!YfmL:"[!;,۰nhM@ugGnCK˛.{I7g+jp;Co+/m_fPd*#O;2oMaHtx֛En3Aoe::weWW)TNhYTG]f&YӵyʷT_nU1"t<5 Gs}cwi؞̢2De%Vs>I*R+״>%V1ۜ;ZT/25F4+J&ˀquKbH:e4 `حL|i$@Z};ਘ ̓)I % G~[D̴S! kuYyMlulHoҘs%u?Wz;:pQ[dCoUB{b:yC%jF+.od3j1)Rdhmo*.I}15SvcZc_g'úǟk ۵Vp%5UL[?Uvi۲V>@U n(;NU8%>;1ߡ]+2֟>NhsGt*1˝2mU[_vc3)VG#$]hœmȥXˊO-AS6jPȬa Gep4wHxl;U[)o3CO+pirx /PAЉgESÑ.Q;uU)HtI2I$I$I$$I'L%)$I$IJI$SJ$J<+V*%&)~D8U(;zm#U'FzryV7raM% N\!8R\/5'0RLQkU8'U(ZXܙ@ηo nC!9AI)'ިEn^HbWtIA ILg:pgH(H:rCCэQ'kOl+.8V.T-$Y&=;v' |*@!W f2i2le\k% j` h1 j-(XN+u9M62Ge]_![evyHإ\{\ mYU~Ҟ3MO :ײ/Q5B6#DFjO\Vf[T;:bIzR > jd= ;'Q6*7ǎɒQ44M#`ԏV\7xU׼:UUkD*xn24 G?,^Uf}4H!PB"% ELQJI$4LxI)4$ا.$H:=Q*=KXС2*HrM;U˼Qk\ U$Wq UZs3SJEeyT33{aUnvg 5XㅗV[Z u1l{ENWIoMuV@Qk,hAN77`VR@pT;LtU2~*ゝEHIUl4QD+mtt֑0p!\ILR\ƴ8&U'<`Tn :jdA :yOcVn%gⵁk 6*t:<)6P*e@I&I$JI$8lD`TI"ZUd\ԋbQ6\J`l!XaJBtM%tb>uSi& dQRpaOkJ+ )!PźJ3I ˆwdiH0QHY$.x ]H&HXX'PJV،ip$4TɌ)$I$$I$I%)$I:d)I$pTyIJI$P @$JaLj 0I!fQG 1m^J̬Wi 㐥I$ I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I))I$Bd2zI%HI I$&N)$I$IJI$I)I$I$JRI$tAJI$Sd(B5 RBI%Dp<=iu8 o4jk 4IYL]k`s,~I {&6 XU,!W׍CKMPde^=[Q-ƪ@wR5iѷ)dBvkF!!Cr4llp,Y S̅yp[NOD`F,EiT}굓சt75G![AJ#a d*98~0W[ GkE B~cUs_.{:T+R d5DVZ$UIڷgIM_[cӂD+0D+)h;V]ؖVuEYai~VD*FR]Ji*<~ .Ct;ʓ.*v!@Tmm%<2<|>+OOZ u 6ńs'" H1u*e tn{!9І: Hġ6 |Qkna4Soz_H[N>QiSZ9iC;lp0o0@+c$zC~HxywUhߌZ4Y9 ,2{&uh,LLx]= |ps,tl$NWR!\N gRWkQ. xɞ% HӲ^p;$D7pɟvZ̀k/5p'.j|wMYdxh(Jaz/nk_' *Xyf,VhVSNx"Y LgBTx-:2,aW&T:LYI$V:ҭb٪ B!M1]Mua% V_ECfVK+'DFGfϸxUDDG( ˄c]Su ai拿w<CH'{[CuRe&tJLIr`jZcTϴGQ E/N)DZߦdNwr5u> {u='̃ʑq"0$ۯUk]Qo$Ot*c3̓>*MD: t+!d-@t#/l:crdll ۯ:e5}= ou+'Qӱ[tGyQ"&*EӷRAh0vIm֞X_@~C-ކ{XLETxX8mXYY>j;Ly];sT:nJRҶlI,,t~gDUL^\9?rc@AZzf&  _w2~KOxe<-<^UI#ՌU1pHg#4ߙV9eu0ӧȱ#X=\nѡMvKi-Hoޢ2fImr@MWXw7tnfP.ϊ10ca(ZJ>4,ߴJL{]){iUnf مkJZnARodx[.,Z,uՆPeҾד]MnApKl]Wnή> J  luVN;D"뽀Bɨ4+l1+y8ǐFHryJ=ǀO&!T;O#O$ pkP]`Εf7JֱR9Oom *0K 0nqDƭ툎ۚk0ADy*|8YFuJ>+c:56 7t84[bC--:賭]*/Nsw F5 KpSdBU- h*o#cGbc*y̍\1. tGek{FK| '*6mUD ?ixmNPSe S$)!3GEUR+ υ08DV*z15LSPUg0Tk;ݵI)B^?x% C2b٩jPpUI ,vUu ԫ\o +lt&2E 5ViX&TV(r2+S΀Lѓ]`((DG I -NKG`gp`o ;/^?YkEMh/ ca\u:jO!Tc?nB0fSc߱xM!|):m%lЁs-}R%YїvrWǚ1\*-k,!*$tSYliի 6]Tzc[Ycu&T!ru-:emh\ܔt6qj}Y?l,"DWsv\/L{t YDՊ΁\,d yc#fF"h Ղjc|SY\23nmJ심&$ñ5@}!h|&&PktPB}v8%M ̑JTҢmhFF]#EVIh\U}HTpOpʅ%Wsa_{cVH6`S J#JZ !Q*'Q! L7&)$C" s RI$yLIj-LALw;D‚ Em[t*xXy<&vS$OB~=e`{#k6DchZK Zp[ӄvxU°Ps3úAd[9eX \*F꿩&nb֓dqW1oA 83Ao #O($5M`#Vk &&t 7*T r$4*dcn=1>04AS+xm'WAi{x|Kzk8 .vRjQOkGZoQy^`\ĐE2[Ϋs1вm:'o)rklYt*lrfuqoӘ@g\NVfo[u臓ĕNU:O KS|ڭ6"9sFrT'I%0IRbtSh($LTyR:SD$$IJp%<$$Ip! JI$DBʃ$J%0NS"$Jm|WqH"Vx("P)R KƸ}-o kFU<,yyE{ vE۷rhxYTQWٌtШ@HTuAhWKG(DVHr.= VB%BI?zSm|E)D O (OF/ (nPKI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$H{$$J4JIkԒI(ED$II$TI$I%)$I$IJI$I:I)I$I$IJI$%h]UJ%o&*Q{%W5ZU 8Uoۛ..<,@OcZ[p6g_WW;#9 Z5l2m pg.%kuVI{t`ឡLjv2P$_{&iT(vnnU.dw]#:{q\͇+Xf[@<-ƻ}PVU[xč+l5 G$=WCG AnZ9T({LOulc$qPʛ(Q@upE/p PUF|(KfX.8U,lt2V^+wVmYvl$sR2m\;*PD2 * Iu$\nǒFFs w>cf<4 jN'C!4MuL}BIUiմj4׺lռ!ܡ$"c⍩-ts1ǁϒ}|_S-8,iw D ]h=Omz % dtw`Z?;F]ΊGO J_P-O?GyI7H t$ vK` Q.E tZH rOg?^|Yv9UE4FBP?4>8@R7iYYLh$z!*A6top-*H>]6̱ANF^N%TkŘ*LiV0VfEBBqOW+ i$LI$tz *EI$zEB˷m^:.KL-+ML"[i*=zF4dƼ.oiiт;7ٮc ݧ LHONm.u9/w\wWI.Nq^ m:I #a]5fu*m10c^N@C/ Y&9Dw> ءh0̣V`mGU-YJ;f8V:V;$+u4: Dy 4 ,08A-tk=VI'H}#h<&ߕ-I s=~ O= 8*L$1"4BIf Im`hSmh@&4 ;(.'7VXz (r``іF1XЫYKN FʧV#h.vxW^X{ ,՛~30&aof4` @v{tǂ^FD s eM VI&P0zs8=/l5 .fRmCR;f[aNKEUiaW1n^HP;-ܬD̏5\}_Q3ڍvtpZ]wC,FCSP֐Ә U:Iƫ3U<{l{ ٱQqUh$vZ%v]{&>O"$ ȑބKqA'TDp.pWX|*niU@]QW+YTn ӘxKGR?Ҍ1d9ۊ龮anngC|wX;3A"ˢϭ}@K#q'h9C04*8fQt[wCk,VeyRyadk03p_C1 lVADDi 﫻Iۯ"eɅt2s~ vӸ]&F0kO W )eL9"7|9iޝԆSt:nl PE$+UxXʠ)8z׀gͽƹ$Tմ!܏PeT$n%YJ@l6ֽw(77 DGrArUfn%%,«n@μf"'U+k~qRo U)mxO^ȏʵ[ZXi^ُU`meZ_Th7naivYT伸s%\uVz S-ސ@)$~z~$j%an#MePmwb6B2[\Bp*ѢT@-F;p*4XobBgT HI(HI$I$RI%6BY B;+JI%v& 3[:.!GjJaU7ЦcE$E)N %ҰٶH14VlS!A:'t ֛ӄbS6>^)IAI#S}zuNfxeN8 Yed$ `!-8Es!na`5!BY8@(ưIU3[H&W!-cH%ڭj:mlvc&$ zZ g}bh?n[]}0=E8osƒD/E _n~Eԓ:$ޱ{#Y H}a BC[:xs UI+Ņ<8BA}h\c]@3 :}B뾯?IӪ[UwउBìঘiUQג"P2NUB`ɲAD)^12UgE Z "P/UYjRpWHU(R÷Ꝉ70v W*Efݒ[fYe+m`aN%;J~(yPmyt<4UL}j9a6ٸh iMXڧʮtPpEÅ]+O(BkO( "\ %!@Q IR N.SIA.#9%KdFSjEI&N8&Rz(2$II:JRI$$PI$I$$I$dII$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$bw?]YHRI$‰NJQRI$N$I&N)$I$IJI$I$RI$$ RI$BRRI$z] cEMj4H7V5FC=$tY`HyD"Khߚ5G j:#dFB OCZm*mp>CUi:wHcS?MB7\ %It@uj4!4FkU[@͠ PД$XP^mQ3A ˆ)@%A!Ad'M)-Nl\%*drzvhxTj!7NVMNlt:,ΡOFmŦV?R;`U_׏aB^%Fl8m='QY:Z1>.j7jDu%Uc ts JFGpX {d@6 s:xV O+08Jk-Vd!U]wO'I-&ru],!sωB,ԨI$BhRI$ m )$O lfGQ4I+x5Dꔋ[tZ f9plCAA蹤4QՆ۹eҳv;q-]MCfe55wP8cznn4*rn YLZXUNJSq.8E~[]P.@S\B)gdBB{qi1.V7S7 @Z4X7ovUŪY-J+_ rVgIbQ,nU:+-;t+e5gZl#GCX3#r"Ac1GpR!2 u͑*Y҆ L/;L.$4G%,[v:UY(AOt`]uo ,4Yxv ZE] }]|S~40%& `vL\VY :(:"I&ӵ䜺 pgS# 7IIL(=3꽖ƈ2%R eE>۹W;Ukt/Ἇ$7Y=<[YfsNy)›uԠ[ȤcO v\sl Ւ꧅nHbA¦~ȎVM(;6EBa!hQQ* oާ~HP2+f63,l'o En/&="bt;@`Ru,nU\F7#h* %K 3.;Vjv +I x ǰZ]eeg׭}~['-Z8Rzڙը#|y(.)4*I$S=rI$$@jTI'hT|I+p]'M邱6'- Fp"-b:[ m⊜.wXoIƨ=Yf?% \[-x3:2}"p 4Cun{@1 /avZ=CԆk:)Q.2~*DwVݱ?Nf#!W~3:*qXcπq$jWٓ_#z uPREڎZ>|i>H9ՠ7VTz)9]|VvAֲ$̬k"ӴI4v [kYOuēOg>4LbM6fd|Um"5RkS!8}P nyVNID[==]GhvCu+u纝\Eq2A\{'ą]ƹ7FVSt[xX%ܠcV:%K tC9Ep܃uI+=Fry+Ve]n y[uh,u^Ф+ _A`Ä~p?FIcOcˈ Dq'#RINrqiHNֵcAs>čJZ)5]pRU{:gv<*ۧॸ7RUkIh$&_uJ$J`Pn>[88j2YיV*Sm\\cOZ S΀Z hgP7>}v((/(vDO F3 5 =(̳Ybe!t>? GCGSgY;WR"tqc~'E_Қec_&VU~ӫak~S%txZt4V:ǕGtP"'m+Zl u&T~ϒns/%XQRu&k~ Uer:{.sX 7næ,Hum#TF&wў8C=;!] +Ch ,1'[ܹcys_5?{s%sWuAC+\%`?SgtQcV7hǻM}7+6djڟh5枡kÇ޺OݯU|T@ mMMr]wۦ!hvI@8zaiݯ8Cq&SA\G ğA:U<ڋ*d<&IQ.NH{Ӯ,Agא$Irpup{# ;[Ҭ;*;6E5H\_N٘I>O#$͉\Uht@`+=C sڳJ#MϨceC;e!U=`emNZnE{nm g#69Ɩ}W&?u~atj_-?%ֆtZ]ծ4U4ܕ׳ #G++G IԬ߫;_|͜nsio*~l~eY\>;vcf6}S4ZWO\Cv+]08^`\_ImA.1^eQL ;AfuOP/ٝI-F# =Ԗ:ʾ+BڠhY5JgQsa%1 6V ڎ<"KJrnY^K`dU ݧkH;S''^RxC-uSQ<4Z;:h D|ʤa<V(lsR5 px!9hTc{ ?KT`XeaUj, 8I :v=+>ѪkbB*T{!_ȞJ$Yi$ЈM D&O\I2u&F╠$J %TPFcdVI&0zBU54 Dq1Ȭ9(8*tyZ8UL tpd?S}hUG1 \1tj9EcaTcT#hׅTT #r*Astz|dDgƤhF$J`y/{Su%0.rjZyE,3x@]Gߵܣ__s)QHkL-* \>| z2BGVXX4Z=@cI>k Үnä~GƓ P%*ݲϒYUKX¤Y6ZEpM|hUHgA0/Pa7)@+GUGe1Cm@K(b;s:Mn{$ O[m>dLku?Mg!.jYħiܧ]M U GLY1= Y iT: };t7U,uXv} 1Lnj Q}(VՑbJ"Q*U\ W^6h*aa)k+_U⩿UG\5] 2CvrfGDs :a:$vXqMF(زȮWop?KX YXKzU¤ڥ0!ίU`RҤ.FRm~*Mk`tYU842_uڬb~e[ YGۡWj hڳ%@y6f[y׻w%dd 5>ƍY#g(ykm!3HΓ0Hsv_)ENۦ~(.|[&@?VTzpFkv)"dm%byO:!zD7Yb4 ?,;åZ%KET ,4*aϲ+ZD͓f@1TKQ%v(gOnޭ2rf[ATr3;Z={~()V8DbO3K²+<̧.qqԫY7:*2TC(m|#Zl*]$QڐR*))I$%BNso`ŧE}0@`uZ}| =A Tr^4L 9 ѷ9woNsI-*fvSǤZ#DJ鑪3(ԡJ?VmK:[ *%eg %Rd֬+^\uO&˞ˮkxZXw*8 ^k̡ʑM)'I$ I$$IH-%)$H6l AJI$d"X Q,$ZyDS|VTMS*Jѽ> I+UL)$С=ңD2 'LJ9K'I%D2*RI$uQ*d&()I$ d&ErI%O P ZI(&А)($Vk1ʷM* UN8j"Ve Um8 !DWw 6 A5HHSǂwjtGj+\ 8i)®I)*Ϣ*)aKzdϲ4T; m.^U1a(P]a,pZr"KGӒ&)z Ő5@ؤފ U7(Y1oAק zIR-1-^%^dⰍ#\?U)Ы2_N[$ wA1ʃ!C8jLRqI7T;0AIK)T4EĠHBy"`6%6TxTlv%V@ugFr\ q wT䝯 s;yOt4Fk*Ri+i0@۪jOyQ4JNI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$gĪ"eBI%"R)I&)!I$dI)$I$IJI$N: RI$IBPI'ƫ$$bj_UbmhL% ݢ332|)zGU?>‰$ `F˚a PeN{%U6IDbd虍)f(F(tTSea>TkB ptrgʖ t <'sC4APNBWΊ%AvU HNգ:qjR܅]Uy-|]o8CD,@%pr>?DǤJI]>\PyxA)ǂo Z )$E680TI&H $I[)B!$$Kl#RvC' j:Kk;nL~=rc sH-\QsvX6A J_f;.2 f1蕄αmz\zp%^B@k'_6i1k3i< VMe4T}J$O%t[iW­@G8VR7{{,S'H.tD5$*!HBrI"0WSO6Q$yb3oPX`Dnyhrd-z~'UW`Tsn0BPakI!prRI$REH$$IȂ5DEn瀂I]c R^NG.I:s+2dHIU8 M׭l}6q಺%]ik޺i@Kix<.ctD^> =qYc-sy躦y a.>[kӠV1kpZ]Sn5F >*Aá} 5>ZeUx~lu~ide6'XZ}24\cí$x#;[=,=.1Hrrv+uw(ZVNqJi" uNn+tTݕ}'a.B4VH=8o y$U&9 ;3 πZt8,]\~)P&骖RQs{'>( 4*1M5L)>)}Ġ<=yݧ O6uP-\;BA>(:?F< dzC+ZJEdذ :Ǡ!hcy+k찲zy^Sle^$+}?G ;raPZBӣwZtچt#Ee+mPer++) f<vgsGN!)KC*k 'q@*VbN0?,SU {SZǐ XƧurLmn@Q#ĩARuHAUl3A@OP vV/8וVnFVߏ`Rr,|cdBz+<|uQ02@l}b`ROA<Ӳ<:xc8O#F81Z rzLE Tsq> z9R'u*") 5ԺI'^L*Ɩ4PBlrW6=*cUOe5ϝkI d1HQf}W;q+2y%X,c̻URސeqq5N=7Y٠*<(̭#G4̖6HTdMA( Y {#dGT/PjoO:E=S{KNxݪuQF(-*:Cէ]{b O/0d S(<0@8lZA#vLOR#+;w"$<Ȇ ?i\2uЮӑ}TO*Ut|h Ъ%BaU Kd:4Xlk1[`th-|;|Vfc+|4hUPn嵼lV LЈZ`MU|]59\ .J Jh2eW7lӏPh\_>rYPkKOub [05UVPȔ5>H!p:e{oBU] *} E}A=8u:?Jw^c& AwIUӌ,Ne9vhV!nB,+Y'bɒ]^Zǿ6n9[uw4y+M R~XdDձ bc2*|aK=)Yek%eo0Yh_:"ZL*䩐5LƆD!XYU-L &h@@k*!ՌTq(v૳S ?PcENn` suMoV|3 SnQ!Umd6 zބ@ %!rzr^)<3ͨBx &awdĪcMQ B9l;"xQP.$6<@ou4Bs) JvUn 3{ZO L]n;*ezd9;'we.^)bB;^ѠNJ}0wCH(a:$;1Oj=u SJq$~DCWTtII ZZR E-74+l \ءe-~IA!#Z s 2p`R60i6{&{̏5O#6ٍsk~Wj]$bNۈSe}=P2\%8-% #knF uZ `nB%`R7(dJG];Q$y Kt')$M 0JdTI$ %%)$M*my  'LQKK,`Y-ƪ,a-|ZŠ>$">kV^~HVj%C ecph\yT/ɭ=֝nhAV#ދ$$aAI$F'IO)]$L9K>RI$KA8I I$ CG݊ Y$锊nyKSϊ RI$op$x$$J&OiMJI%dL1RISYJR$ G$$B!FDsaDRI@SRJI%H'NI)ƨweXEf)1 uX*yVk< -i2g\(kk&yוQ< HbI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$RWlI$$ɫI$$BI$$JRI$I$I$$RI$JRI$U Ͱ ҤI[mL[ZФB+H!TcB$&*E4+c@T e"VShO<$3(ZRtR% 6&N#_uJ\QAhJ@ 5C,(mfHܫUu4$oTx,V/i iRe1Dm\.֝?5כ*7лY'1qۑ\JoNvTUGUOoK2 :}>UF8Buu ȭga8T]e?rP{E51=˛#Eã3QQݒD|B] @[4ODN'Ox(e32'U]ޭv~rk-T:8r]j Jxd~R|ܠ?5ílHb ^mQP[{~9XDAVc+ 6A:/8VTJ(NM$Cڤ'+U$L*MxIuwaUnq`JHP%$qT>\01E"A /V畼A%1`U-;Kx "d]ՆZ+V/k>*Y{At V|T=2D$9 !^<;A);. w)m4 /#had;g`_dFi^ 3..܊@x׃ߢ9G,\wBѦA!GFho}&#Q#_j>+ & VLuEm.@uj-xמMt)A:ðS<ǘQuUVܩDLIG4?U;%;$ N<옖:KLROU.! o#!Yj֔|;yJ֞^L\eR6KcVZORDq՚ʝON=2W7l%lc8x+kן%W@^>ŒY)5A驳Ӗ<,gG:YMi V]8yVol&uN sKb w>jbͿD ʧh_k۷h:(Exmǟ(tOo%AcYVƪ4v{uho|+S 9X2u;B+"]n>{u#Ucd*2p%D(HRWI$X%ZU2U7rM)1IAdWZԑ))VVXYa U(mR0XYiUq:Ze 8RjGu R@Y w+ k?reGdBtP )Fcp$ΒTZ _. $'ZTU}BnP'TOU+ZN{ZΪ>+Rڵ A`𳋉HF:-G54kWʧiBu(:QLaM* 5mGa˜S I2<ʉ),1k`RkSJS)M1ʄ}.5R#O| x&0 .tBYB$ JI$)I$ +e "4RdZL`) LSXJ^`ߊm66dd+"T}&熍JoShd9ڨ)*Sb^Ij[ԦU2<:&%[KڃTD6ʉ|Gd I%R0RI$2#pJI%I<'IK%N%+R&I3BaFXh,%I$w 4Z8DkF0d !Z=m qmk!R¤WuǀRb"^Uzz`4][wT|P8A *R%3\/drp^I TRNiRI$j6P)$BS&KeRI$%ID)4ЂI%N&I(Х OdIAD8MEJI$ `BR)$P ?$a~TDԒI l#iI'A-M d&W)$Q!0jZꔐM)$BUh35t d'O'e&sPu%FFmp֔@!X6&Т2e0aSmd95Qum@ dmD(dr# RCǕ64C/@ӕY<)FRߢH70Q9R_ZG!7J6Sqa3^]*E<ROdBAA:u(7j g0Lst6TA%QE}F*F}!NV#NYĻx$E{o:+:s=܎UF FhQ qS/= Kc|Tq (2\ߙBwUK);; 6 .͑NJ{L o(7%a.ͯH{$BҊγI%B, nn z^uZbc̫ ʭ1zi-!)VW(TE!))BP{|B!<"gDq3Pl&)nJԖ Qq$SNJr@VgvHFmq-ޡ(zK)<S8_f1 *囻)Xg %A*bQ}Ӣ[ D ͺSG#!sB]EIK%7P\: :QE4> MXS~wQJc ZtdBp]Bs![-Ce @ʮӤ*`@}JArl-T@h( (EڀyQ[b:N'A-)Rx$I$ҙI$ !+RI$8HV$H;JETKR)$A!.P!)$NjEa@I$իo=ݎ~8 %KiI&NI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I))I$I#2Ȃ-4IUI[41HVbPI $I'`毕J. I$S2 RI$2t$)$QIJBJRI$$*RI$I$I$2pI%)2tI;J3PT$H*{  )I$!|JRRI$A$%)$N7dI')LI.S.BJRI$/%8M )I$l'<$$J0')$QH)ڒI)5ZcWK^Ѣ`>VJR(nqeArq@>PJU`R;"х+ȅM)T b<%+a ёI ? 7*pʋ-Bj6:EKj[a)$Cڐj$$GIRI$  IRI%S”wJRI%S p#I(St!I$J0> D%%)$P-<(np()2u L@ Z%]tC[2, ɃWr9Ȼ]>~Ju("@L\\jmGt{9R6WC^&JVtۅU9)?ϢL[ s4Ӏ\ _P"utSsFZ`ՖÄ8ax^N?,>ݕL@,dّm=0NFt" XCҺiFHBJǯ{Ahԫ. Gǻ^|{:ծe 9kl9ĎTSu5l5`P(=E8rWGU\>ci:7u(j.h탉z C׿qK&CHuk3)$iRtgcZ-hhp d I4'"wIJI$WNWR xI*BȨ\pQR^FK,`++9Ť&Su:oRmR t(]Dh ו4az&G =V(qa]ĢLíSeյ8MCREά.{?dV^-vNbaZ</S nET2:>>̧Q$Y=d#UdjxD,4lsUZp''&^H7^K@=P[KeLh Al]T*L< yy H(n$6yqZ7h]*{6~fp*3}C]G*ܣNL~E'?HvO+{$iħA"ܠTgyHy[\g:P< YSTB (H)[dtG}pbHMuo>@e-n;ecw?V[x\$KqdI5lCwUUCTc!I׮ ZdJFO-,[aˣ$16T!- \U<#L,>7rwT+諌qw)S*V;u3t=9>`hGd֟i I9JF6FOkuuU&5Bm .:h>J1!+U%%LlˌdF"g䫹+IQm -"Z1Gm7$,sQ:IX$Vh*$=&0HxU ns̨7#t 6y7GG湧S%a s*Mp2{*"LZV4|_s6X7E A%{%Xv!8]l}L{2 Ӳ/ zjW@%hӊ#qԍU>eqʹ7UkRG +r 5 ά\`{΄,/OZʨm>7*F}8[ iTuŠ>$詹w eWYKGߐU|Y9.*N2蓧Xnwx. <zտIcֈZl*Wn5vFÓǷA++ 59KǸǒͱ4{pjRuD j (7_tsD;<3m1.ם<"4.6QZ9_@IJo+kxUY Ӊ]gPn秊0A|hcՐ_/S>06ĻNc[.pk$yGyuܫY,ܣܷq #LӁ܀G10m@'U0v6iܢ@2'L1´l+Ȉô8BbyLcc]R/w\wRt.(W੻Cpܨ^DDcyqןVZIƇOآ9j|,4MQRlrG6kAxV6O-w o2UHUl͑i3`:,;hAU؞6^I2ud:ƋZ;MRMb\bUpWk#Q cTo[s\5SkQTFnNl?RBI"3;C2)m@%#SLwkA['5:PIB{$6@W)"ʷA^U( SscU;mwb:x4ZVKɎX<-0,,AD$' .yG|(r2 5f=İ&fI¹f6م6l`&J.rNqF=oM~؅ItJ5ktה\ kyQEIj7P[)T)I$tLRI$)M>)RI$TЈtmJI$४ntBԤIFHLR$JE3\h)I$yNוTILaEϓr!DRI$1T$RIF)ZIeKbhSۦ)t& -4Gb><-$)QN{AG5 RRTe)AkRJe)JJIH5NBJ^RHMBbBNtHKRRI$?4/I]2I$DT RI$C&Jbd$'I$eI%vBjI2b9Qԫ,di U{,u$ I`ה+];r1(LlQJX3Ot'^9@ =ZҥJ+rh -; =T78\G}0pVpJxINۘuqzO/朙Ll Rt)ju0/*aW|%}hcg)9*^0 @ qH !zԛoRBP&rΠ B5<* ٶm'K_<%q)PNsǒ&phBnN΀'J;:-ЉZ$X>J'=h_~;;XoKGܦ7 FW:B9dLrW18}\$ӌ&C/kx;r#d)]tycn{(ouf ^ dtYcB>h{<1xѺ"7 y.V/T,>)q_{=Ks˨57@v"SnATQaFLb8nv|uT|)P*; fp:oh:&4V@@ƅH^ЏUgHYuz%i r(v3bVss[qέctv'$L0v Y܂JB\ei-CpT/>ZhFecL󡂛oM:Ätp؃(7,ܕwMVwEiE:"!Xmh,iԧv,q߬x|YUfXT3*> QTv?/wÀU:,Dk<4XI Vnn{Bj/ЛG]XpVmj)L0zZ\fGbBw@哳,q==o'^A1b@2~˂>kT\~AP1iDXɀ0>?ȬwP$(g+4&q`XgZxk~BbгeC]~丂li?=zB Z~a?4M%I@\Çޜ< }#`Ғ)I mR؜Ñ 3 %tHN}$)$B!AP! I$SaQ)I#^=LwH,UQC^ݤDI&I$TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$ѩAGvHRI$E4I$*mz))I$1c,|k5n9MxjRI$Q¸S\P@)$B)B TI(j PRI$=mLXI$ &]QRI$8JڒI( P$$J*@% @$$INI$I:PtI  )I$hO R!$$J5K!$)$M 8jI(@)%$$Q'ڞ!I)$Qڜ4H$$ISm#U1Z$$%i,: {R"Nb\%I%Ӱ?H+/1 <;fBE9q ADݢrAy-GSHP! j$eIu^+G#3k /X +Ey߲n`+ҿ$>  U3hZN"8Q $QD1郪gpTI!B,(JҺICKj&MR&I@6RԭJN$(O ph ZI2J.REKI"vI0 xTxEpRSLWSf{-Jt;q.$r!k@or:.3Xҹ+͑?E ArjZA%8@sbR(% P]ʓT[HSG r9V9#Ik nOSPZ{ZeZcA>ު>ʲk.Qf-tqX_f5`psX#IS1-UmqQv Y_#jIn7|UVuwE"Z5r-jeIDn*WqӣtAH.aYM hnʍAU-D'U4}"J:vYrZ$. s|Q2F乧侽Q)ۈ`Oޛv؉M'S8Ht}l8YX6ehav Hp:d3cW8:Ϋˡ cT($-q&u(a ]Qrm;4UECN&5QGy5gmi> 9ړtD$T  Li)͛dƺ&g xwC5ǒ\h*/p3hjGUX '@ARG5P0@Wy>qTDLⲬk;i¨ʯea9iGEͰiR| >K [P&:v>Z(lk(6Q"!O6=G@ӖA'C*~'$!gLjnZt:#Ztv`L*%v3Z :b'+-2|V{V\cbBňF;2 D byFGЯWdp鬒h()3RQqDPhB*w+Y %8JMR h @<#FP*[S>ؠYyGt1o bB}2JAN7"m;+dzk \?ܨy foP{Z6"ג#B>|VH쨜F7box %ap2tFIEʩ[IԍU"{9D24Qvq Pv@z)0 p`QvD!;,LPKM/0N7AHZN$Pv2 7$BawCM4 =o ! C+;f#$mvNhQ1B-;t)ّ@I%A)YgR4DRp2 Hަ֑ZW(sL#lp4(ؖLPZ k tMhUrJ84s\ RIk2\y"zS?Lkx\P/:[X6PZu@-emjLic㶖Ё lWAwjT#TgTT6uT2IKt)"I$D";$I5JB;y@&I"ڀ(d!"6OX,\BuAShEkA zɽBL F>xC.p҄jX/xj3T2]o`Q.I@/Q=S(AHK J P)H:TLe.>%xLRMSnGd1J%P%*gR7wq s)Z%V)cT)%jd6 OX9LqL>hNk~ )t%0(YPiNT'mBU@1ONEB7f ^V^I)삭-T}PPuz5(Oh *{pVhæhLX!ƨ%0)Aa*%IϝBq(t<$TLwQq'P&9!$):I"PKɁgSܚ|>LY4%&L'8C.v?4/EcS'C!!1 u]>ah䴭gD!EBYCِEd3wҹ?~V~+ /wNRW͍+fno޳>('n/lӝEe:bTmy a֌AmY9[@~ BiC= X[RQX䪦J{#2ɷsvPO_ϻJ>ցG΍Nm-]eM>O Ďe|ceZw8fo}lӱW 1h;>AV nTnVscZ4Q~%nYi Zΰ{Uwd:CRGuk+v rwQ|Ls+8JmR0g R%|-*[Ҡc%)$Ǿ}o)6jxN{7P=>V% V~OtT )V% Va&CzC,Yh&{,.Ohv UʖRа}жxcKeX2]xYcZ+׺alu[:S[oI:GQwyц/7 l!"0 lHZX#"b˙,#>RX;Im#★eQ>hJI>}7Uju6Ufm"AʰjVa3N⧏xh v.llc û.Z]|:qC =1w!'cv[U\En3wU<xG9#k:ժձVٍ]b ha;vu/9D9x32{vCK]LJLw*a_j#xh<þRtk Q%邺:>((pwz@VauK 9C9s!D$wՈ$Y~Ɵk3PC~8=Ug,]<%<UnQaLh1gմ> Z1;e s2H;FZAw D|yxWy+= ~E|{L_9}5t߯5XC2$L[r=G?NCe$z}^r oJz_Kh}O亯sV+Ø`WW^CCuC$*gp'?R` |pVK\ /.*#rLJ.F3q%$ZJ-ppeI1)LSPI,ޯ1T,'GuI*$jI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$RI$r))$QI<&IJI$N d)I$L"6SI+ 䒤IL6- $Hň *I$Mj%K=RI%Q=@I!zi4`OkTI J`ޚBJI$E,<&؂I(DmIJI$`wNZRRRI% ڤI(->IJI$bTTRBФ$'*A:J]2I(MLI!OOj})t$R S I(ST)I$WvԬPZ&Ҡʿcܫtc;&ŐkʅR(O4h{ ܓ@k`Yrw SHش1F"M[F׍9<!b [E(.i -:!= 1opiS")4)B,L HpSup#IA)j6N(I$=RSᐒI(TIS$ܒI(mKl$$$2SF-%-I2tMGj1odA+RI$ eJԺd镬K]U %7gBNF++\oeSQUj!0=}:xB:*%aQ.]H]l 4YqoXepkTʐTq. -+ԾET!X+Jcʋ%S Q)SsCuqʸecU.FSʦXdrQmK:ڕ$RS&S2UH: Y=M)JaJGQڧkqL!rY8\|DGP{( g!n7/AW[~AiԦ%O a;oT269I.< Uf$6Q)v9iA5BiyzOVl]%RWlh7Z FQ&r=5^h mVq [Pjr:c\I+T8^c(:;^xF[E=9nOAŝetƠuQu- gTSDx,VhN &߫NqB=as9u`2!hʐ̅VYӺ^s+|T5pplm& DŽfH1*-j5pjeǂedY ς̻9䔒.\ԏQuD4rm֧JnE"yW6|7IHJCrv =j91';-v?rA2B͹Ś9mPǞezNs]0|:`/8`~M0 ,P|Pa+Ir{JrcC:%vsX?dkkCdX=HL>'C*̣j ku &y\UhbGdm24GJT$9Ғ\!R~2>AG9|!yhN$(rUqE5NscFG)DzB)#S~̬x'tc0 +55#a<.C ʉ1+mFi"ySdwO}r|bWEE'$x}e7rn\xJ<(HJk3?~j]W;#[Ω&Sd\{ ǁYs035},Iv'jV|k1O$Pu7CGeݖ5yBVY !OM|jQm `^dm:xXVk<ݜ=AGQ*GN7hI6tZq1w(TO*֑eSD);*2U^s $md1-sa4,:0FqtB9ɭ1--r_%guVB$t[ &?#ENx~e%q8=s9,,/[r#B y-8U3}UYU$ } 'EW` 7UDx+w\*#P:QsBγ0yNsФQ+N %\DMsNHXB§k ܋g]fd4} m#DxӞpiwhEWxDv9SS*&4'Xs\a?) 7"|Ԛ-e!0FZ‹ !p#T){久QkG=љ_pUt 7a29+{$:%[anX59Z}i%oԺ3vk3"}UwpZHUw`㻲hSOk&LǂǛiv[üQUJkX-Ӻ:k:fUUCɅ /ܾ< #\h.0ׅh ;U W)iL3XMhеv͂{U)vf5'܁f4U8mP<LȍVU@yp򹮻HkAX̠^i`#t]W'qg`p .6,-hr=Nv9D cXT򥕒Ǹlã <#)zaHsQ:gSI 'MRZvNd|_Vf$)׎B`gTMLDwN$pb5L9$;ʛH:ޖТBb/P"&#6sW}EuUr2 G~B M,+,P/Pgge\(ȥ !@sD7wx BI$hzL$$JI5Rh)$KAvTG]si($efUcqE\ IDɟk[@"bPLBJ^]m5HO:&RP6\!ctӭvuC.˱\DpXtYl`2ƍ!_cøUVR8=Uf@Yn-ZiIE’ 3:JzI%5IR JԺdN"ǒ$&.,X:PN(nDSKjHp)#eThKbH1oN<еS#] !Ц('-bD&QH)tz\y@Ԓ|jRڨ>tǑ0R-0*t0Ip1 !Up+iοi.TmDYk̄ޘ9{4'P DedJ(~ճ%UIC- '@ B~Զ9PwRG m Lc/@gZ\TNU\%TxKzД1JFxXG( In'Kw~3yrůĬ?QDGa*Ko#cM(RIǗ~ }%z l(q@,nG*}w%8-3֯ '6RB<KC)VrΔc&WT/Vr\!ToK` I+é]/6Tw%.SK`RI^wQqLs?[ ;B}:J,ynKBP%cKw KBP$Tnw *R'I\_3GƲg=՚'ͭTt2uMVʇᢩpU"I<%[E$P'HU{kq =;TGen,$+5ՙaąuR]LpbYMO \*T&U\ >ƍvೞ +ZU=-EׂfX1y*WRꝵܡAO\$ܧRRTRTI>k78Ce)$!IKrD)WI$Wai\+{ zuVN𣖻-9V7W#"uA/RʭsAN*@JA1FÂNjSx 2YNfV8v*.O fʉqϊBjz NpEea>(Mϒc\^dr`G}tFjv>1WH<> ­v&Iԩ \QgerrpTˣe{PL! rJ☕.I)nJSNJRI$)L(JRI"STRIHPi%m`}_{ҭI&&~wZZLCV{.xcfP)e !,[rXS tϧY+Ku3NNh\4XC~e J&pqum oU4 5;zUi@=]S~+ ˉ\N WS0եKUR=>S/ҊVMYnէtѭ uTa˱K$-:6iSn*2׽`#}Um$8ܷ!26d9 pZϴWS ̫8@-m Ztk2 m.!EAHx)U_ĿfBѭ۫T1z {*k-:bu|vl,DB߭gi[nC{CyKBo׬q?C~aq v>@9.G] ; !tf xF5%ey}9vb-:*əW-O+,xQ$Aa2*JY(NѮYeY jUЈLUnJJa1݈tBY]zT:cKJYSI$iS'I_o'iSx[^ RIM\ΝFhb}LK|$_֙ xI$I$$I$I)I$I$JRI$I$I$QJI)I$uC6;4ú$IdRI$$JRI$yL*RI$ (i%)$SܜJPJI%9JTAO))I$yN I< )$$Jab;PBI%eEmTJJL%|9`#C,Kzo )d&bz\*N MT7ۉGTIW3D;)nUK$%|/Y*┥ªY$-}|Jc{ ܖ8 Z,o$B.ˆ9Q-p(J$ǫY+w.SRIjkׯ49<ªc BKC֯!udDpJI-?ZYa)RE1KU$}3,M>)pK[gcu\YRRU1KU$p_e(O Wݔ¢rZ{ITN pR'I\nPiU2&VzpK*ax:K&8W+NJyrB҇U<_-. 6ϪcӯCo_#^Tx1<P1Y5]$ÈwAV3~$#LlK*}VϼmsC|Ym{<bؔ#خOyOyS=8Vsf;hR]9Qa fv\.s+%Xޭi%cr.D*w^EIk;Q?ue%.aOUlOUoK"z~ilSIiLz?qfS)pSimRIi_P鴅Զ$[) 5Y,DAiQs "$^|G %8r 'K,ۘ$USrXd2{t).x:X߽O֤\?|P[`ה[HOa(]h` LPzuyFty%,O43hBu!6,/P)z.tR|[ސ%/Aa8%7H&a-lx(0QTwK YX5z-[b{,6k%j7+ryW=(?!t V)s4 Y\Z*{jT U/E?׸UʬpUWঘc) ˢ!|.S }P-ԲѯT>L)x98D|P}.i]þgң1:;nl"V#Δ3<dL\d5]n3-56L};:s؄Ə)*PǕ.6~ GXˆ.&+g b߭Uo4nRkCNwx64oos][ ̑ϬxF[CCyZ-pvZY%@UFUD2c]FA;b8@r6^d=VdQYLݔt$&\CVEYt3M_*ʮay*5< +tlkx-JzS.N-4uX_~A?ˆ`4OHhJ޲kqϒ'ְbPCom>䆁AX|SQi^Mς%l1pUSv0q1sB-SmHF2oaЁ]s# Z͉F )c@!+$ʪ{vB%ciC8E.'0 tUiq7Aܨ6ߦ R8tU~AD\a+5N%USZC9'jRsȃ{7HVW+ġXv z s2VItCN뙫(w$Ul-w>teՠVS]6$ m[ndU/qV[cR\DVOY.:gTINo+@wg8ӺKA|[*y[M)X ;(z39C6Ԩ cT3H0hR =MDz15Qe<(oR XBbT&GceA}\n $yaСԨz^xTleH)yZ6CVaH3iRRU9t5ùFЦj!Hiʁ(9炈(AxD"<'@0`!L')O5vS < *QsR% -NU*i]-pYHl§fKV}O*xG3 Us9UX4*:w2& c*MUm] cǷP{,؏*ȿq3/_xV8tG#2Lmxt9xnc$ WI"C1\ӧ 9kD$cD.e9c,pO²{A#m$ATZfDݧR[Ew )R9&R?U):J©\lup}UĠ? $R\S[*2dJN#G!;ÂSo|ca~Z}[oUkzFM\XU:i*lد5;蹧RkH! J`e:mПr[ [Z!I&N)$'O)Jd)I$t1)"$I$RI<)2JRI$)JI)I$RRI$򔦔$IҔɒRI%)JaG򒔒I)HJTe)IJI$ҙ)$R)I)yIJI$"T(!8:JRI$#EA,{`g `\ ʺD^ G2vkxٍʻNUbFU~*>;l j67@_Yv?[F0eI~)}: :m[ (VIJRJI$RPRI8StVqM&LJ]5B;6\νJt:iy/yj}a9m#{)<Տv;~敭qB±yHV+eF<<1#hUwunn DW{OtWXkaQkB)"-ms1zܗD-,|ûʀk*8ׅ'UJu*ƀ 둨\EqW[r[Xod+st+*Z(nN#hIyHkKjuNiMOf}Ʊ`Jn]`y!9"Ɲ xos^ .fP.Bk :1{Hw È-ks7&XqNI䠾QI Ii 0A+C ˸UӸ\cyPƑL-Drm.0iV_ӽqGe6U1r0jy,^kZ\ n 5A"Um4\53Fm@Puav] ;P@&I}npwq}1Pi%v q-[#@n0u@)0(`(!Z%g`ښ=m .V1z=-mVk_jƁ)ʦ$DA2qa, { I ۄ8L趪nՍ4\F-l,4+ ԱH9b 6΅U@pV7YYY8JC^i?X+n}]̮Bk>C򮣥A\2jslW8,+I~̆t@nG/ g^{l+/M,<X÷FѨU;ulnK:{ YUke!wB;,.4OG+@ -+Ƈ7PWŶ뾮u^M#se"a1ӔI$Q+| $&NRB(J`ʈQkqk!Ehuv,VzE2I0NI$I$I$$I%)$NI$I)I$I$JRI$I$I$' $u KEق\u ZI&HQAs7u'EM\~ZG ka{dWiI"p rKcCu^L:쀄iRtO{E{ۃ}?HiRp\$Dk$*JGNs}{uL4)$:I$*RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$H TB2%6I I$ʊjTI$I*RI$RɒRI%$)RI$JJRI$TRII)QJRRI%$4))I$yO*RRI%9JTe)IJI$JTe)IJI$4)I$yJSRI$I$$NuI2RI'E$I8ryQI%)$O>RI%=nRI%"RO))I$~RRI%)M=$I)JJ)$$JrI)JpTIJI$7%(jRI)JJ2$Jr JRRI$MnCܔ$H鷨JI)I$)FRI:yQ)$O)JyA*I$̦.M)$$IJRҊI)@JyIJI$ܠ yAJI$)QJRRI%)JTe)IJI$)PNI)JR RI$&I%)$I)HI'%))I$yN$IDI)I$yO*2JRI$)JI)I$)IJI$)QJRRI%)OA$Ir[SAJI$A`*B";-o^gOd*yb7ucdpV%X^ՎKGHrZe=q OXŲ+۾vH ?UKmd@(S,˄,q`^dw:J8%$|bP} < PO7c?VjU$ɲ-*7Wkݡ\dFGO ۤjՇhFڥ62v Wnpt,PR2!x^{J{.0Wyf~N 7(S9NVy<Q,ka/NqBt{H]ُQ8m>L茱 ay/?IudzrVa/B݌V7$$1Zt[HKp>i` ovS8iFx#%8A\]c2$y-xЭke#XYcVҭ੟?!a>ZkPYmL~9bż=!Y*Ѣ器. >LqZ'#+WÚg*Alg AwMU,cuI\#Kcb珚o9=[KpO!ŋ%DWy~{O<^C޺tZ[ݚW+)(8C;ȱ#dZx]jef4hS wR' ͦ> .xv)R~7 ?[مrHPxGSAGz ͇]${3Tco%Zf:4Hpju ڱO,P?Z]kG]z+E>~R(<~b4C>cL*Q1bJo]ɹۯ'X09sƵYX:-!w=k= zz\UJ 9[oƗ_> )Ki ]vVϫ,:jS\~j_?ô*}s<+Dv,}-<%+"ZUgc4p)p'p*$WٕS nV3 Rmr.SiR&rҵ]O1/;ħ67Sry%5:|Vō<㐤x B{QղME9lr4h'-QBg\o$;~X9ca.S]# ې)͏zи|շc?f !9b4( O ;=NW,0b{(8Vn<#33H@Yt"ZG<ƍx*ѕx}k߫HSn0J`\E?_";| 8dk4Wj~o@ Q=]}ANFVWИ՝AfU5܍QY^ç*kl)8VtRo#>->%K#(dwʸ?5onqojNPUQ0/aB9d*A2~JDzåNw[:vVP []L-3Zm0Y?a:@^I(& ZtWZ!v!0IG=aŴtDD`h{!64)C@:oVpאLNdU!9*.8-5De9[?ެ%;E*CPV8#QR i}zďZٙAΕ^VraS{jK#zbJj@7觃IIGR:;d<8W6Rd" eIXYwA|ߍELCTbɃm7H$vTH5Vd u$)9(~QE%gptQciFCx9'4I4ɮ!"BvOѬ)$*fE" ULg'8xS E &TvUĨ+d%HbG) L*khC92A:%Wv˜> ;'T) t &0ݨ3LlS Xw;|>ia[Ge-nm2]:Çpwµx(yo tFbjM_ ~zi P9BroU["}aa77W\~I)i;8wC=EuW_C`BIvU+ֈ CFn@H%ىP=M(X;spq}dvExh]౲:w_tR(}[=@ B́jS~S[] (ny<ϫjXmS&(NY9[YT[(WqWCom:c~IU=KnS1hcgWe5 Nhkf3th$SXJE$UL=_< '.4Hj|CD=g֪Xb!D,G;>{VZ#tA\0ANH<9˔Fs&Tx!P/M- 6nlKl1̎U6AR--Bؘ(#"H(T˷*!CodQ67fy(H =Եѳ jp]* ̎JvN银`a# }1tҵ:Xmq˄7uK%tvw2H8"ĤV> .pu\ӯ<iuBb5 CNxL24ms8Β]BnçdG;Q." p?L<~*Z&$Fd yNH 襶GV]*%ہn 7Xp ҕ;.#| ݢA&[4 )sl& .She|kΎI}M駊plU~+,M΍%hB`#@S_YȨ@WxsԞDJ p"f>*zM 0Be+O6ѐ kB1ޜ?o~|=͂I.B} ~B^$%jcu\ o{Bxs{2S~憮7?*)}Okl5`f,jߠ0W:]鯤꩹hTIBIȩtI$IJI$I4RI$2JRI$RdI:R$TI$)RI$JyIJI$R.RI$$JRI$SJIIH&L$J#괩_CI5M+$PxE%]bŲc_iKuO%_˴x u>2-sL)$ s{ݳ)6Шl$0iOk3sdUmg<(U@y@:8Vw̭ŧ^r3C*6mtK@(Tʛ' fc9+Ñ]dA~KhΘHE \T%Z*s0]s fUb;KcP0[:( GTr4E焉\0{T2[#϶0P/Xo)nrkcSLf[ycWj?U1iuȣdaY A,)hBj p^V,$hA]8:*R$* XҜ"vWVU8@D}v4ٴ 15!7kS >Y~KE=Z&9S.?Tʥݛ*.(Tͼ'7mPuӢD1r][ V$!^fvJ]I :e9tlKa -wulP'- ~$WV25(1@HQl~`S:E$$@2,IҔɦRI%0Qxp쪧- Iw*gUj\ջX8nc: ƴcd. Aۻ vMyigaDՕn$pTuG҄\x~HsX] [#gU= ndrVQ7{d(<P`i}ɰH%Yjp>DbkQlwX\үdgmig)*ڔW6N8,ApǺkv;LQUƶUiiQLtx%m7- ³e&4"7sH 6bV#llk\{\F[|7RGx\NM6Sai СW5-OC!W|e[h9A(wൺ8 ՠ 3`|+5U-As]1'^S9{x6dryu0.".7GҴj:*2[Ly|l;Zd%Te[m4ꖞJf4HVJZm-yUz{+srjMKB'Ou Buɾ sMw*YuzV ~!DbV .d jPtAݷNQRR4o" lz1 P鷚%Ș׸ FId lfhP{hl 6zf_{#phI$I$$I$I)I$I$JRI$I$I$I$$I+TT6 I$IRI$2tȩI$ddI$2tI:I$IL$IJRAJI$I)$I)I$I<)$IfKgP c B%{Ax0()$4L RS0G .Stx"8mJhyIL>5u:إ5vO4XIJ6y?yu fuHBꓝK6(-+'[Ơ8BHsx[X{{,3tyV:FCUDLz=BUm#EtC "ì.,*`ô+ӶvKuLzoLZ[i9Ixxg[Hi:!ichɤ qƫ"Uc1@92A#DvI/YWkVʲW6>?Sqi> ͜ɶދ-`mO$ү=EoOpf*s WqwA_#"ct\|cw) )iH'EuZZ|J;2X^t W,%ӎʀ hIhuSϭL&s//%ּGhq'mHݡQ`& I%$2DJ[0{"A0G:p))7B@ .)J%1?)k=.ZǞɜP%oL2n]0WZʦ6Z*Dk`ZHoUV-Vr'TSG֜ BhprD~IaKk+3'S:\䦒3K1+,A;*$N4y!C\44@]i+ -je3];q"tuu-) S˝_TˬYs]x\d8^:ߩ5ɦƺx*V6'.%[ x땏 [-4M3 +Y1.k~ Iv- k 0LwnhP]{yRߵ*?K'nߊ؄z]Mr¤aAq2z/AUz5.Ӕ+5izst$Q{(oK;WIh!y(OtJ,~.+{4Ŏmo uޑ+JZ^j@pWht ,݌vW33?YF 7\ ې=Ԉ$L"[zP pЦY-,:4?Z8bs\kMǞ{*s+㩅?;WCqZg?Zh߬Wyma cO[/quϒm+d8A8xT?-GXPj0J ^mH1XgS$|[ _W1+}Ƿ3 UIF(uc&A3:`$iYOlj+y!=.joqU]re#x^s\|5yWk't7Jk~J.#XjB@XԝRJil{u$`RI .D&RI4)dIKrpP%)$GcEwLVunz.-w\ɒB\$ByCu?\y¬QK@!]emg!Td |IT3EdceuܝŢ +#>/q!A&4"@)m<ѴO qr} L'D  CIPm@)mH (RRGe㲇ck?[%Q TS3kJv`gDe04hc‰l`>h%pw>(xw4|i B}䝣TOT^5w"9Qnks#\8cCZtz~)D$hD..*NL(#Db4R$*"a?zv|v=ʃXLH򜄓P*I0eʐ:|@$אQXq!8%N9IMwwtѹUBuik>Hf?=ߏ > aNp$ IEY??0$iDsxGl'H5Eiu#kL xLyA+XO2g?^yݹSa'& Ųmx$d :̿K=jA&NBPS$LPjJRI$2RI$ɓВI$I"$II$I$$RI$&NI$d)I$I$I$2pI"U֪l`pVIJ.0Ti<+ ХʳvGGt"VHU痴fKI_u% R/17Rr}=LZ|&:vF BlΟ%:>Nq*!Cq6jJB ²׺8HT :A:)7ܘLSRάZnJAff NtUƈج(V#I7)|T H-sd#cݼ`Ek>h嗷T W <3bl[n[Sc8Vcnl+gc?i?$>e9jtWL8"aqns:)l$7RYnh4 0{HݒUTe B(yV ;77Kg)e8(dF M)I/x[llp="tYs_`.v]jef;.B\eWu z:J\CΤ'X?j|ZGpc;Z-ůcve:rFfDjj0uh{RwGc ~ɞˎ~yDH:Ǽ0rLA.E^lpewha+)Vn#KH[+Ւe_i1VqNrg"P J>gjvP$)QRv`TZ4 2`øH#^LZF{l肭0Bƴ {$"VgB -5யS+̨  MAƛ0ZGPS85E]W c +8J5Cx*Vm\F(#"TENiP"nٝxosk#9ջiZT'bSmD",aqՍ5Zu6Ru}f5HwX6df8%i,o%Sjj %I$p ChG(2t[dltou֪h>!?DZS+=$S1I$I$$I$I)I$I"ՋeiUsG$ 4IPtñⴙS+ѠIJ$HbNFNJH]I$d yA*I$KTAJI$I"%)$LtJRI$ROO )I$`J]M3_޳9(DiR` Ia$ewxUu>jI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I+T}UZℶHRI$$II$I$B*RI$I$I'I2tI$I%)$I$IJI$N:JRI$IJRI$I$I'I2tI:I$I$I)I$I$JRI$I$I))<#b?!4-/o)@%I&$%T1J=3ʁzO Z(Wf*hi% 'I$I$JRI$I$I$I$$I$I)I$I'I*I$I$%)$I$I I$I$%I$yI2I)I$t$I%)$I'JS$I)JRRI*I$\RI$JdRI$$BI$I$I$$JRI$I&I*I$$I:I$I' JI$&I%)$O)JI)I$yN)IJSJiI)$NIRI$I$I8HRI$& %)$I$N0RI%&Kp.ѪIx.3kadVffkk\Ωm|g@l1_ 'k@NKALSo`,퍭m;At#&I<Ӄyo4(wm>_R,O$AD7)T\{w)7BgR肖ۻOd7<yw<)R.F|R))ȉ鹠OѺƩ'r@wQ;Sh %K#ϒq&2} pXld'EcAw'Q˱VU6>Jz6 JD IW0ݐ,sSvY]'kA[ULBeک69q=cz9WI2Ghʎ(ei=ժq(tSE-G4i 4fs8*}vH&4Z蜍gf;dDR䧍x! )`oƤ[=Ā+H3|Aoj9 #^TԦttnC"zdk3kSdy 9NlԨC$!"I;$f'hT )1ONR,CE΂$ϕ&|$D$t%251K{~?Q3-:x -{4e)nIpeGDhwukJ:ƀ̡CܚSK$z-)I$>z[RI$_PHP)IJI$7[<$J{.P.LJJRI$JiQܚRRI$@/QS$$HK@ܖJI$TX>JI$w+/Qޤ,BP%|L] ABLSIRI > rbiJI$bP7%)RI#K&ܒI"nMT7&iJI$%-䔤IOr['ܒI"JJ)$RP*R$JFI%)$QN )I$0iqC!Ž1X qW/at]A\"fHi8E$Լ?KW?vG'Urς04R%C^;&N5 vf FάgPa vRSU/·5Xu. YA Ҕ%))wP 5=P>"8 Jgj12)zqQI'L@vLhL{cQ:m۩甜`jIwq0uMyO`I񪓃%uʖwM,C¿R{duӾ]6pXR#)V0.W#L|܉]aQus{Lv6˫ MnyrAײ59z/559u7.g}XGBO$>Xz,too 3V:VNGO @%(|;P2!F$QIJJHRI$dRI$I$I$I%)$I$IJI$dI:p)I;V)gk) LSZUF[QQa!*4Wx[$,[*m}ӞyVm] Q;"BE 7F2g_Lj W47֕*odOXV)%TP l(=ѢHuxM%ʠAUֽ dUN|TF1=WU,*9&PU2FhXaEN.P*EI$$JRI$JS$I' S^pV\1h"ԠkM%M8+{kWw6ltƞ)aыf5XY1F2 k0я^v5m:WݍTI2k<]YJ^"J9i%]նХGZ;L.nHȡ{,`E-Xj5Pٝ[({_Q}0 G&]%Us7f*jC `*y^jTGk2\&%c>l3hmBձnQ#T=Ɩ ׿s+K s<Ec` Q'pJρ\u)Pn`P|D!;I$I$$I$I)I$I$JRI$I$I$I$$I+8D5YXP;$nISpPL\I1LI I$$$TI2I'IJI$$I)I$t$I'I$RI$KxkPRI10G9]Rb㲮 R鯹ORg$p^u+)$[}3व2I$OJRI$LO )I$No贕qWNa7%I(o&]C޲[V,:٢߫5M ɕWuYIDʌ=( RM) d RI$ $$IBd$IJdIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IIړ*)RI$L%)$I$IJI$H$IRI$d$$IJII*I$NI)I$I$%)$N$RI$I$)$NdRI$$JRI$RLIRI$$$$II$I8I2tI8O (睭RRI2mџy<{TW,!|vP a.dٽ^ApฮfmӰMM"Ӕ+u'9ry)wRE N& >CxAL tvN\ |Mhv<  t2X;Dz~uܠL.[|bQR-kʓI׉ӓ'ǒ@Υ-И&u))D;Z)64:A:НH;4NQtRs:DQ ]1v<jTv ,w?N˱Dlt>(yj0vB@I L>iۏƀOܥ%Kw*/io&D$ǀI@>)Ҟh )bu- kKc?Tԉ- H|"{qH)CA"tƒ`Q $<"9i$4K-:hH$Ô)` iy@@ J!&B (GhT)R|E ( r9ELDph <@.!Oyq# Jܛw~)@{gQ>1O;ư$i"bB:| e$ :BL Ac*AQ6bR΋#uFc3NU:U,ae!cMEA!uW?gt,1ust]L hkDO*&YLT$LJI&EJI$<$I'0NI'ScK SC>д:{}TJ -BWc ?k-KK,k+.UG钹B4.Η],V 7^& oW51V@*oЈC(/l:d$I$JrS&IJI$R$I<)$IJR%)$R(I)I$yJS%))I$yJSFpBI4p WqkeEx4p@. 3$XTVv¡~<%T [)rׇpJe'4TRK$I)JRLPRI$)$R򢔠$JrJyIJI$JTe$I:@$<'%)$WUAւ⻌@4y7o+MMTR:y \oWTzma-ltʐ(Z=@%aC=+K?܉$.죯 <bR ̩>I DvO) 9w`Sg_7|TQf&>jCA#Ijĝ@Q;Ŕb43 i”*t V7L[I:'iT[Ɖ;MP찏 )5F#JI\=|^L|q&pG>q %n<|%3GX:d;NOgR8L T @?ޢ7>z"2#h@NѯNx*:qDx$PePCy<$#^|)4ap%-Y;>?0#P6wj`f5|R&i 3Ӧ4Y34Gt'v3S#j;jĎ5*IOitsg &$4Jۧ>i?թTJY)O*=R0n8`'<@uJ.;:(M;NA$v :E΃~ LuEIMOyݧܦӷAk ^ .iЄųi mU<8ΖOꅄI\\'Z`ryW7Ia 6΅{ue{ dsv"E:9ZmwsOmV l?-ܠ$JN$"$I&N)$I$IJI$I$RI$$JRI$t RI$TJPyIJI$cB04Y;- v)'D2R$*S2 "THT(H&颎Dd&&)lӄ7bUKx*cYC-m?r+J̭i-Z"m|K IKl]?Iȭ1 Cqy~ȴeI$I$$I$I)I$I$JRI$I$I$I$$I+,Y$|G $)1N "TAr:I&!2r)$LI"$IN%)$I<$JRI$xLpIa8l n@*I4>2dXi+'wdl/{]/h@*BJ3ࡑթebe'dXX]WY!xr fDLQC*wUECBγ;Z ms9\]%R`hfgWH3(:=U KU1nI2{-\  oHe!dኌ_k0'爛,uwXhkV(k7xHFżxUjLxN!]h X ZQRN~K>l$rW:hآpJW[qy*7I?H:S1 LN)g~CdywUh>SwШpC6B"9'}RƲ T]y)%#oNHyc/!Rg\$Nl{f@gx&x>SEȔTO " Emny@A&|I'H)ϻ}4:0cNǺN#Mx?H!I@H$ yRd9;S NB0=Ri)r }܃;O~nA<*0f:)ײuK#,cS8Π$$x68U|ZQj*BNyR16μ!K$ݼi3J.Lt!OJv>-"5@T0+W?NEֹ8h᭙DL+U!Ui7P52 C #_oD R UJI$Ī8eYakJ<) .(I$bE$I)NJRI$)WY~׺1:[k%$JL xY}P6Zœҋ-ᶰ'V4BerD"Itlə=Crk2;\a'Up4DVkilU ,XK:25Z#{J&>~ Yw΃ w\M#Ѣ{ y]p>@ uPX"[ 4G+VaLBE9)I$ҙ#*RI$dRI$e)AJI$)E%)$JSJRI$F#]iNj&NEjt0\k}FCa/~˛m1z6֐+FA$vj8CIVF<&$IS)NPR:X$8ƃS#O(>y>wRPM0:tiEDQ [#B;(̨IRR2k69OF9q: Ls~~J30⊐b 4`O0Z$x) Q^9)yx qke6 ;w*N*[r|Rl[Au7O>jP_Cpݠ'` Y(N~(pq7DHY હ2;+G~)ԩ*!LI<ôhVܢ9tip~%LhtS (uRR@pyAh$?1)N@S|d* DNL\T"9S&tL(;cdNI%TǺ4P&RjhhL]AF❯xBJc FMqR?r[&& sdwo ˬ=N˅,";֗s:]], z>VZ`źITJO UJ)(I$R:dTI$IJI$I$RI$$$$IӦI)$N $NВI+8fek$@L%dBsA( 93uD &4[HS*'tdjZYeItOj9 !a*M`ɬyh^fS%Rʳ`\ʻbd9'RjZfV?Nsv]5 HT3`PQtJvRLCyiDٴIQI2u|i^Ϭ7DkNMq䘐u|AeeB\Y=PpWFO\u@T}JiixehU:U0l ru։. !s+a$WC]! cVz#hAzZKMllt3v+Śmn(Y8.5[X p-6W.X}G`2~K# uNݗ?:֝a] 0R}Ah4CZʱz'FKykVD Wf`iHoGChmnmaW9Be~*}͑e~ )E}RUˋ9[J7)9#@&:ScOtO r9XRtٍ\CaIfB G2 RLRI$RI$ݱ$I.,tW]A] F'A<4tđ~Aǖv;& YROKa#Ec2D = ;g<A(Hs Xi fZ7:Te1[k!a~ր;nU;BUX&’t96/Ѵ$'OHiSui@b*hFT!ZǯrJ ‘UrmIDnaQk4H)ک nnoBk4- pIMhUReHޞIlLoPJ [P7|p+aafuVЫ;b4U:'}%Xt*}!HtKewm3.g3"E{36 ,WƊ6V{Ycy kuZÄ\vmJi"aR׵+śwUV3s5}p>u=3!]v ;+"}'R jyL~Z%[R>Aph] .3*(Ҙs k7 E6&([ܒI"( JJRI$- I)$O)L')IJI$)J*RI$d$I$I%)$I$$$IM $$Ip$I2A$RI$I:JRI$u)I$t'IJI$2)$R TIRܖlw=QM-R'Ia9 &ZKXYQXE)$I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I#b/ ./$$JځR**5I$&NS$$I&NJRI$$JJRI$6=脤"RI*O%so%->c˄UHfWik4׋~Y}ZO(c=X4} ld)U) qY{'v5LEvS4œ T_(zt#`S0B $uԺ2i(t4l=. D@Bt7!LBzTI%F! #`E!I]GHh;-r?Hisd[ӶBg"x޴ȼ 1ԣ]C8zIS_ ơ"1ب9ďo RJHNha:P vQs#)BP|̄ן)=8tOrl8ILoʟ\IL$L4:(nKv<"%3h |LUVvv9>O%8I DFꠙyK<$_?0$?cNǂDx$NdCq<9L:xhMtO.)Fp`Ruq} ƷCaNE@4HiZn'Wd>ALA#u-Α9kx^ui0>+WAw!rU;!0Cu$L:HI$d&IJI$NdI$IJI$:JRI$CDTI)XmMz49@1a iI&B% yT]W7ӏe/.w(j YIR=E&X+5WTބǹ4-[Z'﬍%q⢜BoѫRoFn!%[av!rlh [ZQ>Q0S(%LL*u _sK cdaT]nf oL* YـUdHY)G"WI$I$RI$I$I2I$I$I$$IB[))I$7RF<`b~3q0fK $Wa5\af:"GDlhJ"J,J}3SgOIi OBPb $\D)\sN>5H5u.Ң~1RU K }c3zNڶ[?T *O@{OS^cD[ n%UhQc] w^`P,˼90RS7lq>QY^m ~d;Q) Q9]gJΛ K]X2g-a 쵺F`&OM?*VC&M–`.⛅H 0e  v"SY&'S o%DŽ,0?L<њ=N;JcDV<R?!utsPG*_EEHLc)3 WkCw;?O!8I,Ef#)8O 84A N ."yIKbbI'39MImPmd`7#[6vT>! Po)G5xAcY P E%5I 9Wi.xΞjD#EnUd4_%?:H-/EұC\ -!<yintܭ@퇉)R4z^Cһ{'Ucr~Bu6jZز^㦱?H@^ OR$ o 4 >b]{TCŐ$J.=raHY%1yp>H5R[oneIFz.p}WkByL05 4liQ4H蠾diuT/c'ׄ_4qh9HD򚽁`>#]'nks?ۈ&9Гy Jt4w(IK>HùJpG I >`r@2$G'FÄ!۩qn41ILEJ()g!7G#F x <DP2l;ԣ:T}NN>I3bgtIHAiǒk@z~'J&~@;N>!2SQ\0JҒIBJ Fgo2I^%PQOsK[{| a|:Q/7l]Piq5CutN<)&yNZm~}[;TCH),ingdT60:$'o/vZwZ e'MH\\xK ~rAFtՔ6ku"Vfot>h"WTIW:ưT!</VԔRNS'!I$I%)RI$&I%)$O)JIIJI$I)IJI$JRI%)$Fմ q\*jR}9,&5z3"QybL6;ETKHid>"u+ w;D(ʓd3'+: 5S,Ǻk:ʑ:jo*!Ǻ D_ ã1vH G}TT%0v{iFHY) A<0e 1LJpΣ gRdN<|ku쇸) ($Rj᧚FsDyr4w) H 9=MKy<k-<HQ<:SiI ikӃh{h]4=2Q.Dߞ;pTp5< L"vk]-^'N>DTj+I3c5?ѷuº*fcWe6&  @20R.Xƒd%Ik%$ uI hĤ^ɴR{`gD6.ipn&;Nfk)m/|hQJϰR.3'NhtI(;TgI۪J[wc#*/'] IE)"I4AK4$|Qwm`h"ZdB4J`Oc u))gU.3$}1G$p $N=;ۢJXqxTT6ωI~0iL~?q%7BJd|~ 䘀<6Jo9^r@ӟp&*y2-Rl3L81ʈ#Rb>I"S;iӰLOgN$[0xJ@ײPk焉o2tρ*PxIL'|?pC@yDnxA./h]FMw.s3dD8n@&L.Sbzzgqp>N|5ΐ Cu$% $I&I$RI$'LI$I$$IL%)$I8L$IԚQ+l$J?icU}ֆ7E%JSPvZ~=F F\ aV3J+$J#jF'kJmCUk,'CR5Jۈ)LCd99l|`uw'CAV 9UjX)Z_JyShp+ /5A f;Rm SoNh1l@fPl}&;&!Mײ#2AЬk~5;+5gUf)UsQ[ֆ:[5S͙FVꇂ+6 d+`ly,tHll`u\}6E&4]'\4sw糭5e8-׺uO׺nA8ڥTisC8ՋX LTI-o Uo:`VwS ܫzݡ[U,zCM65\Zt1 ͍\Sꋕo46A-Gє ".BT^Z8V%ޞ#EfEh䣰2J 88Ts F7v@WIv=s`f[ j3, '{:Yd8]y{BīZl%a ,'4kͭafcUr ZK_^7C 19A]@jtj'Dz LM":-:ߤ?*Xa+5\TdNZ-f o 0 JdI&O BxAJI$!PTIof +w)Ӭ,]-S@a,4v7sL__.(/6pײ u~ {#Th ː˷$J0ΧtfXqГinZHj;p^ ~Ut47E #g9h}l{1 g_Kv$ @QҸ{ө:\tW>FzYqD,a_ekex@=-Ku*iO <-lzE-PFUlg셝V&uK{@85 +_cA 5Cӕq ¨E-S lOmVCwz 80z[ kbmh8!_0Нz-eu~{u!֑%r:y K\aҞoU &-.ճ 5%e}dv@ 6^SO*M oVL}_/>gE ֍F>˹$鷤UPP8RIzi'I%"☕JRBI$4))I$t$TI'Қe2(RI$T%8A*I$)Q:JRI$$RI$JRIJI$I$RI$S'JRI$'LI' I%)$I:dRI$$:JRI$$tI2t: RI$SI*I$N d%)$R RI#1JX =T[naDDQ:eXF*f5I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I#b? .7$$JP*e@ש$LN%G^+)$UӆʿgG[&!7wBM%*j-Dv Oao e-M3Яm =l3պ;tU0zTNi {cDi-߬" &ܣhęLӮ~j >[@~> ]BL$s1A+I?Ri |Ӄ&<R.o}6kƽd"5z\ 9NL$u?w&42?w""'QbLordJQ^wN`ih8IJ#Iwv2c&˵~'NDJ~TF)[^|R G~a/h |S9@V7\e%DžDk&Qo|: &rA 7W -w:tJvP 깻XTQ&TI$$NRI$I%)$I$IJI$L$I2p% %]ux$TQsDY9-NM@MuN^f8g h%-kς^7Iwܩ[n0;jDvW`l oukDh?=VYk_g H4a2F7i#Q?X1ʯewnI۸hPS:Sq۸~("㦰PvI-$mQL(. NtrSRcvN">@47qZLf; )Nuպ\.l5N3U;K b^5\.+dQA>+^( UҲN%Z(q O/q!P}e*J LʐNLZoZ&9({ÄǷNqݬu)1v9< #7fy')L&|8Q ;Γ<$t)!IAj#)xyPa Oy()(O1bRRWwLw>57tH>R|J`ĤJD iP7yP'Dj;'Kw  Jj$3oӎm2v>rgP*v[ko<.o+%9Qi%ˬ8O:F 2 -wP {#m & @@NHNFGpk%K$.CB~倂Rz\"D.zѾDzdi.u&& '?z%sRP4 [Tx.ßPio 80VtInEl1Z T!Տsxt G,2<;,x yT[UڙIR 0#PtcN @APTL^Z}$$ ?E8%5{!>t2xjgHlOP/=A<30)M5ۅ;)8`'5>&{S9 9IKqۄ;ݧԦ8AԎHNӺ':] Q Y-_U0< ΁%0"}ɚOdA)=tR$=ˣU-gZx#6ô h4#,]@ٵrw2+ ;ƫۻڌ7Zz2gEƋeI%*I%)$RI$I$I$I$)$I$I8[}cpYC s*UA㺰tZ. $u)-N#sˎp A*tNZ{p{uS\*^QPk!8gJ SaUǑ=t<ݓ#P4J5O{ PD&Qh5#]xTxC{{lZG6= qʣ8(IA"BM`L5'77ZV}@L~O!`g'^O'<$Bb]+vi[8זY5`Fp*Iakôʭ*3e7x(J7aײY}:FnX5iB Re! XMVC-ҳ: 8 DBfEc[a:iΜjvV@/[v(PIDa;XSn@n nA{ RW͒+G6:]z- oB򔔜4I*  A:A|tOQԘZ* Jx4LJVu-p$趭ֵc8kYPHC6$n7@-١s kr^>\Τf/X$^%oIz$SgȭóniEs`TQ0I$JRL)$LI$$I$I)I$dI%)$I$IJI$q!!qJyRs{;')ahꗥ pdk:f DhTOm2܍.> 7lARn0#CL n' kJ$yŠܧΜsQgk6@;S7A +'䂘I ii"sБH7wp ƼR焂}3?z`.in@!܎FѢ#' "SDgsH'Ax'yJJVƎuINJF|X@)ǚuNٟ%L[Ou<{F= T0摧 cxyvh,$ w%0KTFTL[pݽFeY6Wp{ujOL,^Z`pKB̧R]#W - W'֗k0lD!i2bciq (ZBٸF]EEXsȅW˒Ze oi)$4@[ /Zd-EmVsk^3^-Wf]I/#N]~!gL*?ِXAMc6PT޻>[Uf D: .˶Eh윍\:Ci V`:VQ{BfAoݠS6Ӯ?k{-7 Za45s dU6> 6#DYj?oُwtP^$JS $qj eZ;pV%5'UDw:l#Yd*!Z,G TaJ$$% )I$)$KS3p Bn ڮ2q(0nCu Q!UD- ʵ]UZL3: qiZ[خ/tv_]]C,\KZcV%I# 68Nĥ=BcOʫePdUzŒ' pFԶ4otFS;=0wD7S#a$s S5ϔ^ ;6*mԫ~^ʋpG$@\/Q469*Wk!TͬJwN(de3H U1O{NJҲ]% .x87)/!TP]~~SipDSE2ut?4WF<'.k~c_խ*s%\Ds1)ˬpQiUd07@c)hT֬Z_]'1"UOBOoBKZγaf[>KzbM:],OYe-g)V P.(;.JIE$T7%%)$R.Q%)M(I$E4')I$))I$hMr$)$MRLI$RI$TI)I$)I$I$*RI$I)I$tJI)I$pS$O)D'IJI$:JRI$IJI)I$IH$$I$RI$I$$I$'IJI$QN JRI$\)I$Ip)$$I $ItRI% R)$U:2Þ [h\C X)lU$Hi$z$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I"}0IJI$2TguI$čQ<.Ϡ~{&W;!I0UbuդvB*dV F!M[zՌ$Ω3\>03$w?P/ W +[)D%]nǃ'Igv̞!ybh~p≯u/;:|9So3:"D5J!(%4zrByh2w:4$ u)ϒ`5I)?7Ot!`LcSq>)hT$vvZDhgIvE$]g %p yk`\u(-*LI:cV*4.;Sv LZ LT.I$I"$I$dI$IJI$$I. \'P^ )g;\CV浺ީJ 4Hp*l%O 2Nlv0O=?QkQ@`<4S5hB߼u'Yirgc' ZQu% [TNj&G M%-}ݒi^i~+@p? p'^>E5n9;&ЂNvLZk@+!R6e]W-ppqxJ8Lj Ӟ+[hg+w+{wuyTTVD05>']+ⱹI"'LI'{)$[ l WGr{= \I]/ռrJ~{P긿hh'Bmae;Zq4\5yIRl4ԅc3=_d D0層&׿R bg_lxxʗm'r 5:>[$kN@qIH>^evZ 3>H˵<&tDz*` >s8iF;HU u'4'9=?ˇuLF?g;ęSNDN@pTwjdi?EXkG>>?&D uUTj$'U,V l'PDPKS?Dk=E<#7Hkݭ9y*S*; ,cZFN %,tLTd'k$1N]+q27.-j9_i#q uo-ף zL #ϕuHԝ|TX DN^7i FvZ xߑq묄-'KV8n?9iA>ϳQ/Ǻ@RTG) %fkhhS$㓪xh#I(S(E|i3` E6ݺ J;BJbu֓ϒZi8Lfܑ#悙DR#ݧXGOSiHǚ~)x悗iӳӺGIic1yQt9BsD)CNO$N5twdH7i*/TԈ~(>NЏS~+ڎ)mV~M$,l^.AAVqpl sLH5Z>qiu\w+˭xD90!T|cHi|;hL ЎH$I$HI$I&I%)$NI$$I$A%)$G [xXJզLhY5*>r}R@:jbT+N7mbǶJߣS8! ւ?9:O>DV+pG-aDc*FC:ʓ~@oC Z#|TX8FӺ;L [7Y$ 'B9t1*/hw %<>ѫtB5% kw‘?+MܢO;15E.ȡlpү(*-nIԧ۵ڈהIJZb۠ު iwP̀cLk_ǂ+L"!J\9ΞgYL'] "H-sG:Ukv(L=roq(}ETeuN$HI$I$JRI$dI&I:dI$I%)$O)&NI'*u@' %I$>en׸y.BPpP A9\Ξ d>WGh2R{pPt'4u/GꖇIآ v:vIKFc{'N&&aJH׺U!TOtJ`$ CNyh;`NOH ʖ>>)4&ɑS:iNi?zxN~ ntM2?}IHٸD@$G &4OĕI*fyIĘP i'JE)ST?r([lL7s3"ci"y?  X[je*l΋9DtW>챺~'trLZ67)R* T&I$ $HRI$I)I$I$)$KIJI$I$RRI$$ RI$IBI)I$xG JSb EI$ZƳjΩB(d7pE-YX c+lp@%ua܊c[:e a jsZ%2d8 yplxBc+f*?Bj: s\b`=5F͍:ϩ s][pԽ= bBD4:Hs0ީu{-P\PWy4w:ez]Ձ*.:{`jK``8!TeGy7Zd_ kgdsƪ:#;!85-̄zjjV_d8*Tl# V՛th[Y׺L,r7Vf@U Jx\b4!SY`DV^[U^窐Z ӘӺpP\UŰc2>TeƊ2Ç:2YWHQ@{lTexx;7{*< ::r%9c*S:uRA:h#f@m9@ nTH5yEѠAK:zpRgVjtGxJJLJ1*՝e#D%<)EK9&T0uF 1qmZhn) \ҰЏh*&NMRI$H5HRU)$Ipte\0h!JSL^=bNeφqB<% pweZOph 6V,p YH?hShyBڧ8*_Mh ]NwBss ,X-{EqFP @O15g=:wZR_kGTUǒ<%X7οUˤ(t윎_TqRݧ-!0Cⴺw[8@ wVEOo ~*O[8 Wq zZV1x@f;mpf}fp!e6yBuz ?z-::mǭ4J"$N~a we(ZH(\%aIga; ViϢVq)ضO?rsy l$p=ҕɒ!2J]$NRI4%R%)$L)%JRI$JRI$)I4$IOޛNM))I$r)LI'LIJI$%$$$IJI$$I$ "$II/4I$2I)I$tJI$I)$O)iO))I$t%))I$IJII$RI$I$JRI$$BJRI$I$RI$8LJRI$)ˆNRI$$IRI$tIJI$L tIHG^&(Mu&NI[7;ΊI2tI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I"c81 )I$T P*3$I龫Sfas,껯゛-f91~tkV;"TpniǁR*GyhRh)pe䓌:$|FZt?zbTvvЊ'B?S!ПvhF1O>iRn Jb`t9P;$\8ng*-y>tԫis9C]yXTVO+ւ$ƽa?F#Ө.xI]36o(.GpY*ULdЌ[ %)tI :xM(I$CEјM>k,-%l)-TGU:4U24*[J{I:1n09v{Ϗ<lg39ӔvߒHhc`tOI3NpAN$C@"?SݧcxD!I* uM2eTV n?iilN{& NJ %={|\;z9Q E8ljS>< #O gO ;V“Z&L3'ʋI GGʘ Q ·:v6uT8\W_W%:ZVټrprS)TI$$$ILJRI$I$I$I$$JL0et!6д:cvQR/d*sH+vV#ECOܬRxO+*$q9[RuYNYEB9L[X HI?#{NhS AE)!11Ewò{uL!Go얩Ҕ2R YPGaR٬<4vG?RwM#G%"-mOݸT#=wZ6%~xN}N];#2<`&&FKG. Lfiɍ'G(k $l e܏.eXfA*7Ĩ4 Ah #kHuwc?JOsY=6*:SUٲ~\6 ܳG'̃PHޟܬƉJVo0dw> E >0" V% H /2]UFU:5H!VAK.eUy~`wQs8~m5N50'i^K;<]7s`{}yQ &'?V "tp\%HQ "t>DAGNp:?ے䊑1$d`i;!1ډ'ϲvۧΡo?;y@) {gǟ`<eYc}{!z'ϺQ_ETѮRme$x~r) ?KXQc =ݣ譭7M|T.!1[lH#]r̋@cKC KY { _^ZõrY.q%Fw_><|*MUwn" F$ꢝ2s"$I$I"!itk;|cIB{7Dcv-gRq}u=I+ap YHx׶^C Q]) .k4h>dm&;x<b\6#Ǻ`>~i7x ƚ$Ny"OCcS8_5  #J<u?ڕbb#C~j[ 2Aj87HHy$t~))&~A;X^}LnJQWI%Xs?Yk $PY8LkN48YU:vV6_۷e2KDV;qY) *@BIF -d).ZTI$l&4B IK' &@pN'I$`wryaY1("eQnʲYN}<_W q٤V#%G'sdLos %}߼T^Hlwg ѧxNA)A%p-5H$xSH Ğ{aL]̟Q?p߄ xZA|S9Ӭ#L${ڧ甹? IJ[n-<먈h~NԎxMʑ5vMd8= rӹ[RٿR^Ǻ4mxNJ QAT$IU&(O a%2gijtcnC\ x+zOgMeD sOR@>fulsf}%۝wJ"֗=7oo%S'ˁs+UТ7+t_i2\y4@&OE<}#+AR mG%j0UwG^dӢxRtQLIRI$I&IJI$$I$铤$I'0N<BI%kڪ¨@ш2Umli.잿b`(;(}1Z;g݌\cEc.":|>Qv14'*v|gVAZVLARim74D8OU|AU-)mQnErR-3=gTG"y*$KBN 5TwҭzܢΟbHS)O  @3&Kh<~zg?ڢ\4 )%u #O.۬@9s˟uO:h J*Nܩ4;Y1 lwܧ%ž$VG? 7|U6t"uIׂ ;<jZ ?Fs$#gݳx&>)HpS $Z k@Ekc!DE$.\ Ǘ(i pF: 3 iHOU]&DsX$< >23Miu"? 蕈nT1#ث:c-gi ˌxjѡZULW4P";&(ﳙǺ鸂5P9=$|JVm^afZݥ43d'PSP$$II$I":I)I$dI$IRI$$$$I$RI%dM&\wՒ.Bw* Ncˉxߩ4il#AԵ#S - )L5 m> ]~&9Zw:wLۧ7 |ϟ Gu$)% )!x0><'hMP.9G܂O˺;)&i[e8 @@IIZI!ڞO!'nNv'' 3hJ\}<<$oyLLR2Ѣ'LY<t!9H05N8ILI$$<(?rN "NI΃Q]ȁDͮ3纑~N@<!- 5 A@ j;(S2pw "A_=&<!ΣD|P5+IR|iSnQ63U-A yRk~hWZӲ}D7LFGC2{5wkR/o1iuMƥK̤.㴦nG(E%3ݠ$O&93BH:s@OP'TRC@|Q;|D)ƓS;q>LR>8RBGRcK'Z >f5H9Ieuګ1pU=>H\DxYq8ҋ,P/=@1W&n2띸ꀞ-nE+e3Z 'NuQ$9JI$$$I2I҄I2I'IJI$SRI%'AJI$ BxI%)$N>IN3@KUIRɅQAh5 Tr P:z+-0ZXJjdEV(_g2t Ñ41[5ZoS4*y(8IЩ"lod!^`B:*Og׷IO)Z( aQlqW(0!3qJXS`e9pST8|VT*M)g D'FctNѴs |ОK'RikQ!:I˷NɄa^9FԤM( )aZF IFSʃ|k%E#0 4h1_"Bȫo Uʭ^d)HQRn+K~Cp ^j1p%E;@O;$k ForyAy3=Txʓʓ[$m0keo`wn6: {<*, IAs;VVs jtT2kBRU&+AF'T0W6S !bpĭK)A R VuZXq$KQ}g0djӒZ^c .U\ *v r7W_poĮ_}a3>+$XoĕGGhSn\d cU0K4%r`bu"rTL.o+zk- :]uV@bd `N3>_{`\GRvAF -*ή x d3Y0H>It'^M.=UHhO*k,<"J}! JnqIVOު Í%WuLwa :5!i<n!AI$I$$I$I)I$I$JRI$I$I$I$$I"c0Y撔I+FTQש$Gį԰UMh^wK8̮zԵɄ$,Ou˝nIlW!qqZ_]ZgP`iKtw#`TfӴ gtObtN)^L& 05jVI@J*Sdj{! T ùHM> XRڒ`N؍@S-:xM‰0S5H&vGc®b<4G8m5O&i= OwY 05c!:f. natS2Q&T -- KKWQcqYAuN d2t2GME*I$zE8lO2W^ %0ΞikpPcȠn9`}-x#I^eg-HܪX ']~| Н4Dڨ26AtBw Z R.(}L`:IH[ƣ3$?Y 4e>KEu ?*5n!ǚN O>)n3ZBhIVM~C0Hs0ty$i)dr6tG*M:4'86gj$QsT{UN IJvG?*:i>_E0Gp槢JJbO:yIL46u) @RޠSY=3a {#%JMz!%hT . o*V8vˏDŽ'' Le;I%6X`HUcQ44A?Fֆޞ!M@rTH{u Z4IE.L|9n"I?=T|a eJ#0㮎{&{݂"gO;MO(I %1RJQ`kd#'K6Oވ̇j> 9mջI;O:)BgxILjgaѻ(eĒ5{[ߓN"*qhͤkt`^)4Q  sx(> {<=OcAiZsG#*ۣHH<XH5ntj㶉:T4o3T.S% 7kc5J 5%L M|xh1xN+F@Xyv|Jk#f7O`bH (v_wUNG\83"tHR@rm\IX:Jٴ>d*gܨ)5}sRcu{)51 JfLD+7>JmwxEۄߊ*mʋB.`=!>eI=y&go4D!{!H4=~"ֈsN|A$r`))i R2|HI1i0jumEBVlTqk`G(n;&-M3I?$~(NcxSm@yB%Y5@  fbVcoqP`4EEQlРT$T\F1eM|f{{Ba0,]lc-u[Y@)$IBI$I$I$$I$A%)$I$I$JM0TI"׎_²/C_= ),0%K_\ _LcϹhWNS7M"ְ̭NOO0]1u0<Z!8i.r3t*AcRϒb !8AVATF+7iSa{"gH>!RtF۽d7iN7!t˶:6?q=[鯗 {5|G=jP{BۄΚ!ZGnUg c>kR3$;7nHQv*_  SP*XSvQhxt*MS> 1?ܛPRq y"c80*`#&}$0N8O HAHy'ku!ωDx4DT0"?R"Z?H)8Oo$4<8'KkrsФgʋ2vGe Μ?%p10Qq$7 &#Hti]X1UNGt bGDZ ثY9p6O*"i"E >I%HuЦ5| nȨ4R?rS})!@:v)7wG#A5ʉ$kBN5jvth{J]SW'8Q\Kd( ֱ@ߊX TФS')I$bB&I(M P$)$L'JRI$(O BJRI$!I-9I*I$a8 <$$Ip $IM"($JLʗYBESmj$z*zQ)D&*L^AP֤)BI)rzۢw)!cm&yL);NRiJe5L|7[K> M`$V5eTK:tB(T$J)R[]LΊ,- uԇd 7iv_S:Z(6 HOMar&NmJҺIJbSN+ܒJdnd=mplB) /&bP) O(c^ Bê; HS]m4wK? I3E EwEN3)`'iypl#m%[mi : :5A j+KCDqYv:w\`0\~9 8ʩt]0Ģ>p%EBA[;]/Q& @O{7]lCD|_QߛK9xג76<ĒU ˕˳?*14} %1c}Pc3%uZ@d*m3/);2 -alm>HR5ה˛d9>(\ ù"L\ 0q%3YTNS~k>Ft0_fЭZ:}ŀ\ni%Ye.'X'H q.袺ə#ϕu{:pRJNUH4&=Xk&&e`4Yh<@ڨz2\0IVCZ쮐DU@m2_a0 NpMTd":GgML)=В~*G!/-rߏQa2+S B 2mVV׍Ba/U8ǑW1"/e`"GOi: U0?5*))9I$IRIJI$$JRI$NR))I$d$$I$I)I$dI$)$HI$TI:I))I$t)RI$&JI$I $I҄JRI$IJHI$I$ RI$R<$Ir4I'NSI$I%)$I$AJI$铤$IӨI$铀I':tIH(-I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$[/xRI$u?U2%ʕrM9-@,_C5m*{ T4P~ "g@)p%$ĘN$pFT9S͒YۨB6H6S)6a8S'X"Gt9 dq|T&4EGj R@IfD. L A> x@O{&<)(!ܗ%$|C$PkAcHWEA`v-iocI1!mtΰXC%#){|+:ޡKK lkJ6+ TE|o lN.g;o)GK䨟$Z_;)!1]^n A?s o}-\e[A>1z0E*@ii%.;+q8Bq xGRS#M m-$")m*k˺yyڎS;r_jbL!Bm\4v'& &rn8i&cH8<2(<$Ҕ芑o]|9)mЈpkc6A>I192)!H~JRѬu-f_#[ #&Te SҖgq{ܔ6?d=kilI3nS: DVo~, Mx`]&bcO⛀;~ 9<8:4qQg S4-L$5`0Oo5vFQ!hN?ޓ[!HA- raW'MҞ6D7C$2((|?rDICa)쒑d(Qn{OPw(n#^TA #R[˅u2H1?@OލDa )ښ8&cFμg0CߐDt#J5N4QA([' K̙7V'q'ݒX.'#cQpJ}0R.ܚ;r0V`pnS6Lx)E7~)I%9(NNyQvPVt3d"[~jv x=q'B}?D>]<Ȑ1Ɖ8PR*ړwoꧯK3}LyK)TNwGAP Dg\*#AHޙ >3]y(m^CiiR+ѢVNgVr1( whH%M31nEYlTFQq׿aWɨDX"-~q\]ÿYCܬw>*>h;.s5Vs0_VB@H;f F-CkdPSGb'RRI$F붾IFX )bgS|UBꩻpGi> ,%yDv U]:|e4%q=J|yHjQ Ly`(8{"78?IG@wR$4:c%14&x(ݤG SJxru ⟞%9!$QK)É{xĖfO541{M|y>1H~$0<N`;wk1Q UD? Qq_F&JAkvAPGi@[[7Cy.o8P*mc^:uuX46r[[8w0[VkvG*3 $vSl:)H823TQC6d1 S{[(m;@ NBjRX#UfAqV[b{Ɖ?H)I sb]8c_( ƊɃo; FIE8`*@v Ixl4Q>Cw8|!i'|-<#Dr<ä܁\;gvLZ>*`mƟ$?)RI+A-C˧8C۶|)'ۤAp`F"@N4wP *#U^6tȭ$Oc~1hbd;s;ZeCkJk={ׂ<+mlsXd9T2FVc\٧e'y&"⸻Ume=.Vo$,9M2I$I:dI$I)$NKI:I' )I$pMFlBI1Ltk h& [S?֘ lhDG_I1 E.ܤEҘW"ee|-h1ⓛ& &3PJԻ>dfOUr`j p|{))S$yw)"]+ t5v'h0<R ErUm*w@ Od`L$xf =` y 1@T̾DpP{黎4vdJp `y$9i0= I%!yNAQiTR`"$R.r22CEh: f5 N{G&0'S-c!6&ܖLjI(I 0'9> I%K`:"xNZ<Nph 8ǂa.[ 'i n*mkc+%+OĪ)T%ļTC<%{˵&c1ئ鎜4LtA,ˈޝ㵢H:$p!3bR~)i#31 rw'Pө1w5S>IRs\OCaϊ}d!Jy d*i'Tb|J5gPf>M`b?-3;,~6khuѓi*H|W@pSk)JxJI2I(IJI$&$RI% )I$dJIJI$&$RI$ВxNI&'(IJI$BxR R JԤIENѴ(TTRQ.!A#TW7XOI2R :$ڵDme+RR<&PRɡ-1x uMsvWB(/ !Bl c}Tzji3 E>p-<&ԷX jا@tS.Oc3= (ŝ.#`_*vYu~*#y2jfu)Fާc> +tQبv32qT.2\q‘$N].O1hSYYViD1ld! kj AVFQ:ooIZ]"A gc  A̻; XjZ\KE9?*ӽG. kCqq;Dۏ؋5ݪvE+FFhS f}5Z?b[)کe'-ΥPOI,8+$̋uT;!]hւRC&#jFwMe͝ugb7y0u='X$Z5Jfe ݐ d'p8{+0#~u+)D9tNxUU30)^2` ʹm+oC[J&%R:TkM-CWG`V퐯T#!nc8I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$OXBSI$J&=ޕòLJ" t̶9W.O^WV!0\{{I`G~b Z[$Eӄ䨈OT:i&7X5J{G'}!gS%";$ٸ @uM1! uKt]7D RܩT>0 jn8l  |SJrN%w 4TW%VU*d&o.lixz21R#8eU8JV V2;lѦ=mx`$q_X2k .%KBN{]5]Mg:S`pWkҰhRs yQ2$I$I)I$I&NI$$RI$$%)$R"6JIRI$+kES.Ѩ@n%C/6%_& CNVJ;\yS6 [)89h"{E%w&cuYxvT> %"}Bc iq$fljm'R_ !I5r2$e\i I{%7<"R H1H8vLa7']SIuZ 9A yy&5Cf4 68U;~:@dq?%aFx +-淈u?>+4tYK.c;ԒbB˹AesymzEZusBtȯ]$I$IJI$ dI&akt++-UlS'!I &N;.4@vC@4MK}cxko1lqn_w-/qY{\g$ʋpJID׵b{%o.Ho<O)amDy 8x~)RSy)V :y!|{D*lmCv,ޱf㿊&&uXjL Vt I.< =\^qE4Uy&#Z+hrL!<(t SH ϸU0AMUETPthTŪwRv( Zb{$+p, UÑXRP Ka@IJ!xc6շ^ Ghz PsL\Z==ISk"5琏C qC^(.t'^]$h{ j{AZuU*N|!KmF,+C>#3g!A4Ri@.?z]縓?zۯ nVQIɩN,'I5mW$sy0J$E v2FPF!_D7JInhpaCwoP{V3k , $vLuw+ L!cc\+ZCƋRw:$II&I$RI$I:HRI$:`JI$TP5&)$.2ѰV\f-8P<„TLG9ەd߰'3rHohE/1{2Gpv9 4*\"RthyH3抑&vơA-߸AtMVAN%[ASĺt†!Zt #C)fujrj-i:7AK{i樵p[9IiIYuix-vD{9HdxBķ⬇B%Є=p4n0>j5\vWGG\Gq?"` xvUM|TN]T@Hrkd$w晍lϚNRL?q$;FS$Od'H {)y9N[$/RI2 Li@߄)p fѪ`==85yƫ 5U˄KTtig光~H~o5Tj4qPʑ1R'I$a%(I)$L<'IE(RJRI%I:PI($$I(R𒔒I(xNI( R I0µzAF#j. QsMeJ%ӢFhSx Bve n'yW*trTg6H6]"DkvGdq f\J-0BpK$BaQIK [oTJ+#TVEh{*=DkANZ ۢwF;ms\IPkHy(O W"P`<ڭѬ`<,>X@訖&{@VBp$gdOd?r( *¹G )7J8:$]f4jSA:_Ur"sbuhfPqrw"UJ0AoP'観Ju#WuEX9fމ_/$t:lyM"TO+86TZvuZIaT~V]>PbDtR>*cU,6sJ.1m)POr}8G$ Vz)՜nS1ϊ.~6` 2W!9 'mG-.W֬aV.oS ~+a.rqhܒӬ*8IIFי"3( VcDaH:!{a[])4Rci=3,䪝Â.BBVPFUyBݝxlVJ7Ue@ҷAwơ1s,2 ƚW[S+2\=FvGgUŴV˨n47We(n;*f*x_+8;s4'fSXv_[pe{9ʰktX 5?=A( }GR3a@&KJc|tpx {a.xN֪(cI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$$RPq?9Kue$J)$RAJI$i{@ʷmp+p{$wV,ai<;߮[8-0 Bbv 4je7ߟ۸~T1iIL5G)$G>i9?rQ<'4Q*S :Ψ Q #H!1*/pHVliHk:+8Tǁ@nltlBAf-c-P{41X8ێ8OV"JV^#2<*X47@ (4E<ѢHc‰zg%S ŎTBRNZTNnbהXUeF  \[SUk|hWMX搹 oD5Z,WIp%]X{D5JkRm!sWkf|WLm-{]_U9VNxiNkU#wߒҁաsftGp5*LAU R }`-`T~:4p;~ +O|h5}Ų R Z;Gb١ Ut>*tExTXaSv>cQ-lH5Av>>)#T:_:wRC!cI>#xS'S:OeZ&NM;3:4M 8?܇> R~RXpy \|@uo`;& ;9Cƒnòۅ䂙4tSw7]D0;E 5.k7s/e;{xX9d"7y;8+c`p Ʒh.s)FPS $LS'LI$I$$I$I)I$I'IJI$UPVkY` $K[ k$,%ks) `2Hk-q0@VjgX8UlvR(nUz<4Yqq 3hۊ[3|"ʘ=) nAuK5?J$V tL$&rIʀ;KiԵH:63␞Z65F,;je>hR$&ܚޤ)c#vHWΐ;Q6ӂ4v١)!j(j5~(NQ 2; *nӪg04Ȣ!꿆F>*D*oVqk^O8w@ph4S& GU:TM"]n4ΧXiW 0'Y߯e* CV$oɎU|oԑ0iC\шp@>(kIЩO'JSysLA rxRyp)<$s"TMCaLu(+|9bfu6D=&% lHG d뤒I$HI$p): $JtTl 7Rމӽ Yk [H6T`ߺ̷eNapJKˎZ>)L>i4ww8=iVs7tǀR~G8y0}> %oMIk C#yx(;ywH@H#Mp?{}] k'IBPIsĔuAotb%,4踿l& ѷ˵]'JhERent|BbW-FWNtXXpw+YG)>~J@|\H;GV i=D䠼jKL@7Q95 wLu0g>5új?P@rh`0ǟ%NQR{h` D 5B<Y yV#HV 'h{  *s>ub;1U ĞU"y LUltsW{fU$-ťjy+R#Mh zz;[xb ģ>G XG*l:0IC`F(I|Zu t+/)<>_exdNQD+tF7^ZqF* p|J܊((ath#rx*ԷkAy2F(eKF<Ɯ)g]yR M XP#M0yP$ay5TaMܨI2tpPI$t)I$\'I$$$JMVOTxU -H밭%UX[, KKD#9K tvatyqB@ 81QJkyL>ZyI׿d)vh&D}<@AUvh.=R 9pt'GMeYl69u"Vb:k\ʕ 7,=SStAKJΦ;Z:Ep%WM$˳7>;C핓sr@Rq/_Ոf>K>K[+*/ui!$!#&{kFR~0G'U ; )xLtHi!,ptF_' O*mhIJO$R-;&*S5?>&IHw):t9v'k rI R5T,dyRmhJhԙ#wI#T' PTP Nq%5SO$|Tlw'XȠt&[ G0HUz VZ h?9[ūqAUrt4<97jXCjӓUxQUN$(| .1ϊ.eVׅyEFYkQH3@@1sL>壔w;^u*/h'qϺtEPXS:r,fUNg@Bkd M^lR#Ϛn"~SRwnMۨC v[I A)5wRit%TjUjz6ru qCysLjCS >o+Ek<ռ 1wtY0?-hBDӯh\ѶT>:\<= GHmO 7c̸qw(;|"”'I%4L$I(P I&J!%)$QЧ I(BQ d% ZI()B$$J0) )I$)\I$PkU^WGӛCAeEtphP%\Vީ5UBB7r@; B4]WeP κ*쨂KJ;%Ve֊*L+R'DGX#9CgtSq"UVCJq%M3O+jRCs㺗(651nʜ T% \>T!BKL*cu*[; AU/0Cu>+:mSox:_Nq2 X5ׯ'mCy!CԳ<.m9ڒlG-:)p ]# CAW:^\E9_-qKe>kQ%n+.M(=쌃U*攏J| -R88myY+m%ӏ4~ z$W?)%I1VO|z} %}%ާPU k~`܊CQp Ȩ{p}ׂ>*ë>K{')odIacOiilT^\slowT9RauF9ZYS^6]t!Y,zlnhQ"/' AX탠Z~*յGDQ0k-lSXUϳ2ˏ +uo gUv7kVhL8وNMUZl`p ,<9!AչQbGNֵU8ᚢQƣT+`v3 duP͹̰Mq.(6C૗knK  vp tCo3"c%/un}ߧl9`fi2!S`Jlu 7;ۡ@u%O%ZZx+n3v>kbe-+x \_O~3]V6Aн7$vsFK]w+ \fgMev"<좖@ G-sٔ]E4')nQ"\ꖏk{vP>ߊp8I0ڿ9~JJzM.(x۴&EEG02|VZeCN%8 : n;IpwٕdVHU![PYS8$wh%;m%B֝JRZ`GW0"2 0(햀KF35Ew%YB.C|4PpY>EUn< c)⵨.-`p<;F1PSHz祸RLc:(gWZO+AqD*@944;|I¶D$2awe&i =TtR6R 'T0Bq yd`ӞT>*l*I!7ə,2 @ccU@5BѢ[ Hv {x"gU p}'3A ,[ֺpf\:۹~+ iv` m0P\$I2tܤ$I% $I&)ȩI$I$IJI$'I)I$:JRI$t:IRI$I$I'LD$$I$HI$t'A*I$IJI$t$$JI&NI&NdII 'AJI$QR )I$pSiNTI'I$RI$*) Rd+8l~\ߗj ^GhhW,5&>kZU?I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$>''P1>#nlIE$AJI$]D8⼱ۇdp~I$-JjX=[;vZKHU`i> }wZ湛A7S S5>*ݧhH3 )t/H̟2Tu1e7ah`hc%^@]g@l+nx]OcEB<Bc|KZڄ0)ծI*t7EZgDt yA}a ɿSB۷4 Ȼz, d0"ȝVTa:3,sujHY3FD!`*N8 ʸkw4訒0ЌXk 4+K>:#uEY:xFuV*t"Ua~ )EFh4=@F~Q\ς3rU P gNTLG?>e ;$jt׿%RʬǷXD86A`HsHk#K\%. `7k‬dq@*PI$2tRI$$JRI$I$I$2I)I$#\ꩅ.xBI_h-IYtp m`mH1ʘAk(T=3HqMŌ8JI-S$V3Dfǚ4z#@Nh;=$릿btwtM ~It!jW.x4cE r;k(T@OPl7̪ow'HXpܠ\Akgi(nr Djɀn`>yvV>D,r܌ !&5sƿi#YA\!&'3ER2߮8Ct>*w1²i D.};۬yK6s>-KX)6G!n:dMsG=:twh9Щ [p4)LGd6 ^=qhUeAIt!=Tƶn:<[(G8gN A`Ul >Hv4Nܝg y#Vd*mj;$(ZYiOܲ-ai p8/ >jТxD,,F:9|PÓQ:|Q"RV<)U$I< ;L>)%$@Q⇳iPS4o@aa)D)#mkJwzN1ÓP%9S:|S\ +YY ߚ~7 ǚO"1vP`q%!߷>J%]- 6|i n!p-B hTW@t\UI\OJsx;VRL2,I$'L)$SO 5,HV=QQSJLD-ٷU/p@ztLPr:待E\{$XW.;~PHO3Z <$pk|Bv' Iփga:ΊP8O ]^8S{" ;NJ鑠|S'`gPԤq:U&A eπ(Â~K=V@5Y)kѥ$k\[{hns\ؕFZ8PiP埝Va_.YOprԢ<h2@><_Tl'|}>=g0%sw`wD0~!9$ O~%JCL#rc!.G)T^<" .: ?1S\=yHs hBærouy:,e4acx 3滞GH#w%tU*١U*ů hB]SZ!I&V+Uv0B%EJ'PTJôD7]Z2?AAVIw\fu;^t$+tej{68 sgIDJux5A;GOeBKx Og>H*_(!#DI(h:hʛ^^u9S{džMKwIni9)7daC"a&6yNiy);xjxQwFΚIڤ4@G a$ >q?I?Qs ԧШH)j4ShA$-h P2!WLXFn'f{xX9;^Atq p\0~7ڢ2a^Y9ׅs6=+kB1:҃ltYmU.I(E:bI&$"$IN$$IAJI$O 8IJI$ۺƏ5W\~E;xAF$ ?ВXd@3C{AcC(yB"إtyCL jAi*OrJ[GP|D-,=WOw / t4~כ杣(kOaT=G1:,zA[W'4SkAvĎxL܁;n[SA)C"$rOAPuPG(Ͳ}Wc;=mkyDūh/we:+lIKMDl>^2TX-h8˝˅PcA" vU=4|QrY`H$Brv^D|P w->Uq/EUWO5ī#*X!V@7rzJY%[%QIn"'ݱs9%3S '5I,*UߔuvPcϸwH"Ʉ%bA1 <#K+(6DsUtS[cvWwMQ=&ӬhoJ ,V< Q{F׉/Y%qL;ׁC̞k\,|%saBi Zޫ9k̄}P’X¡`hSМI%O P$$J)ԒIE7*pIE(O IJI$SFV]IJI$҆5tsA!k`HFe P}%TF.zէHlh8Gk4@ 2Guڵa:,ZMM @o1.dO+cu,0\u]?]ZP쐬8$E D,\bt+Gl!TԀRR@|>iRؙj0znԤBRģwCV8!nW *vU2V]ٶۣ)w]L+(SoV4 sϸJbS(Xԉ(ptdtLuQ-R%1)!I$ $J@$IBbM))I$&>Je1TI R)RI$$S$$ILJRI$I$$O*OV[:HR $~Ɩ ͫ" O+j_I,0vWHeY+?dR"Z;&sCBZv cYpd>WA$Y9 -tc/.FO\V]m6- m9Qx֠~7]=@iH٬ 9-inPL%N a;wWYf<p*o}5pk1(j`4k+W' <5\\IJq#BQvMlĩZӲ븀f^sXuei &Bwv^{IǡlRC[WXی u*EI*2|xD-v}$|7:x+ط`s 'XIV]ݢʤf^L'`AWM`(58:*|6Ty֯)ŰJ.Xy =% z-:5,n*ٶ9ڵ"Pc`GP "=KHʴ񦨭us>j=n{΋ov%f]">P*:#NE)"XmhU:l7%^ H!4) tN]9,ETSH4)o :R>4BmzT0$gۡ7Ģ[CP! F`6 E|ef(00J;TP?&^o,ܪ̕<'T7@SUw{Bs!Qkdր9R>I(`-Q8P@n.1!bu 5b[Yai5E.=o jSpxRE%I$L2(RI$LI)I$IIJI$$I$%))I$x $JRI$)K%)$NdRI$$$I)I$RI$$TI'N%JRI$:d%)$I$IJI$N<$Iu)$RN `I:tJI$80I"_cVzM |r:[,$DIHI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$6'+Vj2[ I$Jd2 RI$)o#RI$||!v;"kt+k[lV }bg U:;o L@5ELK0sPjOdPgdLwDNuIp*ik+֙j-g_@߲EVr|%v>_(h$j)?H8-mu; k ,ݢ6E];!iM 0U1EBFUA-;V7cBB{.o燎uv0\6 ſ.H8> 0K_݊2EabDvQII&I9JRI$j Cϒ bBBI%. !ZDt6- hꖮ}a|\׿gΣ`/5̴JuRQMvEQ7; v4~b;qCBIK]sP.Is9J&'JPHA<ΣNxaO$vPL$e8u(nlj3DT3qw(IilQaƢutи:_QG. >k 2xV+>p[e;iJ]W109Vng`B6!P@)En%xЉʽO#OitIDZ9hIII0tL9v7 o?XX} R`%S0NyR<(o"I:BK>;(KLuM:JD?MAIC=w=oݿL\$dvRxk.`׀Hݸx i7A!PA*߫n|ͧVvsԣYw0Bb^[wi:TkK{^9QirЭMAs[>ZBbc ,Wgj{B{gLJg2kL+n"RSiR>+3ib 2es +o F+SZZ ˥w&O'韊c; $(EJI$$ BJRI$ .RI$IAJI$ؔ U4< RI$Ք`rQ}a%_&.Q;!bUrp*K(^ڵyZ*aI[x{e\BmK]Uxad6x*R$O? YZ^bu) E8 w0]N?" ӘDjI@TIUl`Vnv<ض@ic\" zASy J߂t$D6OT藺x3¼YTvOi'Dnr Jah=*hq'*w!_p,T/i|'N~R: w <~Ym> g*rf!?)FmqvZ}c^| i$i'vN8,-> 7LW3mΐa. D6S%H(;"ΡK?6wF#TCS'AI]dw.ϺoNOr)ЂA0$#U̒wA)^nRJJǸ߲Wy 8U{|Ks!]G*~c'Hs-,Jx(Sju~t{(&uuc,vh#2'#8H'I$JIc:U,8<5vZeuNarx4NT2#0gu+>sW[GW78XXWsWGŢ 4V [XD!J ܪdžJ{gdgh,]_$1Zu}Rh9ĭ+s#HB[O9Kr>`Elϭ8/#M{]:2:+1VBߪ}˾/;;D~[PmctOŴo8WCJf e5(&S <-G6G+nS)uqY*ۼN.2[EmX5<=B/kU|-(Ns LclZ`|mgDfQq&U&3v gN?d  ouqV6&JҮ#V[|IYK~K'V6MQ_pVEiտkujmNi,LlrA]WjSiW;M6y `DjKm]/q]%VAXƣ :kËA\qan:.:Ըhx M#S 9Q5]RQM\2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$.79Tp+nLऒID"$II$IIWC~%svխ=7<&e)Tޑ [CBh`5[M>P-q? ako Jp̝8RPF;N\ͳ1z@i T`$TtU rB滅,j۵Bz`0%bcW"~+dO 'Rv\N!Dχ hS$I9#w)^ )I$Ksbc=00tj^\xhEn}Ƚ[6r*!'a5N`RvClg5Al3R/> Mg`g桲yB8pA" MƼ6 u'{<'+-ǩ?6y_s@ggsKGW'Z7sktJƻ7G(Xj*N%&<Ҡ]- 9:b e {+dȄVP<*YVӢڃ~;ly]>8#B2ug ѝڔX{].%fo+t.cfV 4|IO S@$4IE6 'A嬢kHv5uhtޞFJT ٘g4Jii6u)atSFx8Uz8bB]t,(3a$jN*I$$$I2IIJI$HhI%I$tV֙Vj!$J y[aB!b6-v֒~y'C*-[hPl#OdúvK 6~rZZ@ln~qApM \8S`x|9x#=v? v)HH:x*>O I_zxiʃvOJ% o>"DxZѦuM[[>qqiPe% x)80pսV3{[̭Ν4j;"4WOD0gײp"GV/vAX5:Kx>έ՝;gf۴Z%RgܥX2Ko;v$>dI[xvh-ӿ+u{x#iltl2|URSy)S5D7Y(=% : (<}КWwSbI@c]v5GE5ƊI{ty'>.DDr[wF@YJɭO&D4RϿѬ;ID=lm'Zr-~CZdu ?ZedmlNUtP_#EVrզ '2 X AVSi㧂VOiLɭeU-`Zʵ@RJhi36$wM.Zy]äk{(B"DC0h9XNn~' B(:(U ԟp8T;#6vʈ$j!#*.%&s[ƃȔQ;xJh3B$øUfavN4ntiݿM */$p#@ʑ|hm~ :L:üvC#Xh `r^.XW*ABb£J?L9[ a38na;cB !BLwu: I$J*RI$c7{HAi=c7;DҎI$՚Iv4Xvt-xO;xJ\Dxw:ʶ5pYjLjL' &ڒZ=dVwa8@ϟӀ@yMc䃤n8trc sI" LnP."5QysDOxPk;{7Q\6IE;>1> ^R6p  EluUeժulvUЖpr !+ĸPyԚ,._CX\ *$+*BS`A:JII4$(IJI$BIIJI$'I?))I$Eyi?ﲎڜ|̗N;%R S1> PmuMD%OL֟3RhR# >Uh294.gM7P,UJѠh{ R)YZrx|J C7SU4D O WG1u ٵVHu+Ukq:Z_29PuQF g2ty۵y&%4Ǹ9N*1"PƒAEd8GxJ4#$#\;)=!k2HbkΧV\ +Gd !H"H)L:y>!B4){* SolTw` UsϨ㲵h*NJ-O k.E-sG":jy%9?ۧZ&'H3v,kF?& q<),B`X VNe"]Bߢ;Gn k<+5< \TZv%h.E#hVFf;7r;xҩwTgB0ELp"^\0n;sq =Bn') NLkBl^32cƃ:Uv4'o Xœ d6mȯ syO}ۥj8))5FaI"{>&Hᢔ eE_KVXC bDsμʢ4GOeADzikJݚTr{Ju]`;IZx4Gs@\V8H3~?$[PLfu 'M )&%)$JNIRI$$$$I)I$ӔI5R`)$Z;6\6\T:?Lk@symHw Æ)$[u6cEt֏%<@/4{׷5H'3IǞH fTHN,2~2&&uTd\eVT ަ*V ti5Uu:-,Pg5R ӕUӕ&%֢1GG4F*&ƒZxE}莮F߽ʈ]a<j'=0Au±U_IUzFTID(j>k%z.0?(vYT5]nWNuvGhFL+#+9V5ja<:CuRU?)%8 cGONC vѪ-o*..~&w)"ܧ7sOZ?9l*,PO]aWIANS}yYcr4Ӳƿ0Ja=ӱpJ A*Ú@' 6d85SY ,6; +>Q\ ']Q+%buhR׽al8 v`{@5B!jY"Xo2~=[E$Bngj/;vΊ-ak&nJO -BB эpku0Ѱ{\|ʦG =5Ώ(^h衼b1>ccw6P hcP^ߨ+6{W92{'f'O?F5)X^)Vsd&?" ?`4vDoQ S1aH)l#QljNˍfA@M>?rͿ4 #~¨W %l.Vkw>`3C"Q$p#䲬Uw7WP| 3Cxb6s\./]+W-fseQܛ,*۰G!xpӖkȫvw1E72"U3Z{Bl$6aЙp1 }Wx0o9*˩&>z6AXGys߂y\1Õ%-fоmM=ۀ A]WL^fHvwIjdX9 uz8p3:]f,oS^MYhugx7R[15YS|f3-/ ~i;z'4E]dI7? EJI$&N%)$I/IHRI$:b$I L$I\4<L T 2YsXt纫iOƿ+I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$&>**~!]rd$J%2r$J)$I){ HTUs@$KwZLs#$BݦDueݗ;pݤ}8p܌Ef|T^4Jw&!N 7;>\> !k?ܳr,ǭЬ֧(. ԭʚ0'[ʠw##VࣥDʆalV૦vReHBoRd菌=?zJm?$9|Ig\:}; π5 >u[FMS\VdgFHEǾYc.ʫ5J [EOÎ=zG0%yQfTvl@6k`X~bG%lb#VZlrzD7Ul8h~1j㱟7rj"m;x 8:0I2ѡv4!(D)Xw:Q*p `=HIKԙN%D}(Rp Y m1H<(.i62ez6)p#Շ*@FߊA-ׄഥ~U$Y͑{ L;Q?U~ D JqkŐOe-!itZ$TQ]P[AOFp՝1 $IRI$iTj T[8N8]Pm p$;ETrdJ:WTw+e R$*E! ?EJ4] l% o΅J#U`j#8SwD!@ShIiS+.A>Sk}FΟ@DUq{NEZ[n8:7FRi{a+UNUKINa-|w<8쯱C3vYsHEkaDt6RlL›\gMOLT ;`x2*24sLUi$΅7'ABJy$Nvg_24)=Gs( 4mې*>$I(y РB>*w>+gpS!IZ؎T}R?P%&OQ5!=jzrQh[ԣg(N:0ԆTNMuZxVg $,꥿޵WECTR$̪x1:~ 8SNc|{1+ɧa4/.S"u9v"Dϐ'Oh#T0v$'7qdthU;߼ɼ 7d 4 Gn KD-|&G^Ԫ4/> B [ik=[wV\#Yt >r@U&~ <ÈW>0Sj{+6YYΔ Sn^.9֪v3Z&'ZI)mKJ0n$lGu?TDܦ2ySquLqe\pׄٷt*lj RH4b;ɷy,U Di!4 uO ӁS2Ӳ'`kSRkSm4$'R9QsO#xR fy(W 3@|:|FJEAP\uP.#df*!OxP-G*0Te:8ᤕy4`#] r!D"4¯mz5W xS tRNX֪&xEs4 j vRGuQ%#pWPY; f!P'( QfQHj$Oƹ{uG'U;t|KJf 597O3+{;:uDDG4Ar]qOv3]?I@LN ̶@i?5&2<2?5~ i=l4+['Q+4 (ntL8xtXB'A2lR ȷMI$B $$Q"<$$J)'I%)$I$* K|SdtR5Ni]v az*xyDvK?淺{ xH*A1RhgM{!! fHDrSМבLL.Z$ܟwhKگ= a+-uVjjvuV.tr@o*NH3_'i:#v}!j<%Z´h!Tra ;Y'aրOӮ4 Ü vCsJ<4NJc!Wr)=Xt#( $ԋٲ$*VT]2Q`, |RSo"KcMT^'~+$UjHmJ]sǚyR9N 맒hLtLC rJL'[E?wa'OlSDOO4kB+ lj@@(%-xmF;˿8 !VkCݽ~>J k9PÄqP,bKs3; ;]*uR{>'_o5!}X2~*Jap?;&$M&ESL"6@r 6e*FT4(8S`AM[6S-C)[++ u, ^4@G9.%X. D޳|V-٤Q\Uի.j/Lxǥ}Ul+nƈh4wNˌHuDy>` $G:.ށ@odYmm@<̧-vaf=%ۛ_@擷S v<꡸:镮! xƈZnҙ`'k\ 9@E-Smp>[;FgT)ωH~ )q#mݓFmGd3ۤ |PS)og @UNBenAC!)4ӕ+5X:ASDžnT xkKMSe=x.j vXĢ>b8K:B]V_VwZ2к_Tc0|ְ˫|2D}Q#Eg5Š [[S*Hk!a6V/~rn Ev(8PߔxZ3xZْV`eIi IΥ D1RmP-lm!'q#gn JdA )8}phԎ%G,G;M/lVA.8)آbx>ºCFgRo>+~UOc9.1آPTd㾼qތ7^G(d{FU@L \.=.'EX3NI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$vp>jY)\I(Hԩ$QI:dI8R#Ԥ$Kcݲ +~ (i-:m4*)hTXXvGO/5UYcpVd+O[o)ӠmB̴-k')ZFde-)ab54 %F6) S:FyRG ̦%hPuA%(=*!ȩ[NjjY"vm$6VJ#NlT@G-Z/-Ip.GU/i\veoy}ܬ>vGúu):9N[өJ;\ ${o+ԃ:ؒ~ M3)4OIKz@{FpOu^AoFp09T2&e!T{dAU$a+8A#w&`{UoSnրcYIYVNk&fZ5h(9òG8Z ;ݕBV~Bv*{DSpC?04m~'Tn"4P-3(o(TA:&*@')tI4' !J;$d)M%HRI$HʌI'#JQF k:/\%)*Mp]XZ$m1!dؑ IBpf{XfH(\I$$EJI$I$RI$ФJRI$#5(Mu I$Ā$6X<UEM h^ 1 {fIeZE8.7%X=&}\qIDk|fHS :9B t$$i‰I#gBNGaxD>\' .״ rJ 8t $ =-:;ɭ~P SyQpЦ6m.,j5c"C4^H3~䄩LJ* piڪ gڭK66gD!DT+T ߕKZ+TFǒQ HH \gqۘUwtTBt&Bg5FH_DNK(PU`3(Aਉ՚#FtiFTfµY Tc2!EUwkUH'eH4)HNC#]~ E *o%4KC[>>jAVw8JܦhKtp%ʪ_Tt:~= ϸLB‡@‹iXd)ن<_ BثMA[idBrBUg룻H#u^IZ۔Vs^B3-QI?SHvf"oDphS-TK [4=Ș*-~A< \6JGqN@>:s=̟ .;zcO1)rG>Aʐ1!G~߹ *Mԛ Lrno^0;;- /w4)%.&9p'= H%1ƕ2a1(e^_p(5֠P:)ʭc焊Bv(P4F vuBD'p%By0jYҦF?3V`j%oUG# v+ o}FV:oWvᢷt`6]XX⾯!z;ӲL]kL9_יed }`xY\ hu<1fЩr CkBID"$IlaGnGeiI$a!ѱ*WJTmc T4lXY~{:JTreBc) R16A=.gu&|Q|NQE}pF4&8]yvU|LO7<›)C gK͇OUpS|~*h#BpaI6;ZO"߸ XWk ΁WxUyYS $KCj'<{7eS!H-M\0| zu3:o(*,S奋 x!u&%6ťuv6@0y[ʛ](ջUPHFa I 'EKHTl8WX|]r>Q7Nʚ˵=j)-JiB%0ŐJTIF~hXG6#N'f'\ǗO}.ǁ4Ǹ J%P&nFP`yU--x,^]Q4=} m0ӎ!˚=]&8B%ߜI ' HIJiP7϶t\!BvOQmzdN<Xd&?X;'¹(eHVt;DSY ^dJ&3YE Rƨ׭ȐPwR4lSBY[j\uO{pe8H_lsC.8QsD~)$K/Pt 'D'JS-N I~I'!(II̞X{(2Ί$h[2'^ =6㲥{"5sz #-l蹋СUrjv-^{S`x.۹V vH SKb*J҆ i}0)J_^8c@@wX=W@}3?RMXy__W?E&cDJ6?U. 0߂|1{0aecKN!U~|8UPG i};2hGb[\t\n=:<Ɣa %hZú[ex tcl@q QU`'+P4U#lSIS2 (n͂bmӬj%s.m9C +}Yi@49Yex tm. ZOcm۩zϳ ډՌ'S2GNy=z.y]6GiWn3k q:/ur7U+Wq?9ꁇr0uN!Âh0zN.^  VN&v~+u 7 D(!I$J)$$IҞ铤$I$I'H$)$RF«QRd.}6mpUin[R,1hgtd{sF[/- JwU[) ou+c%/|JwO~ehuƃCaӳ/fYʕv UIl/lΚ, #.ΜBƭ 9,.$IF.OQ]\tVNcA)dD =QyH2jz.{ʳN?I#M@Gf#;S3i 쫖A[T6IE&8+Z#dt+@&U+(Η Urƶ*98. ٖcBaztXm,x|C|UKm. 2h3亃HU}r`V)٣a\0ŚGRaTꓪZ _?ܣ:>YX1=@e ssjB#U:H]/,zN5j8J%x[&5BחLSBIӎ":YHeh8Vj%x(422 qAPjF* Hgu{SU-J# t -q F`C9ᬎ [+f33=M+*='HRhה-Lq#ih>Qƴ4-ISeP$'/Pv&ؿ#sL#cd6S|+ɀW5B2p!Dh5d&+`e ;Z,*EBNRDI2t7I$t'IJI$L$I$"PJRI$tIJI$$I)I$IIJI$I$%)$L$RI$? $I$xIJI$N: RI$I$TI' ƩI$I%)$R ByAJI$$I'I2I)I$IO)%I$CȤZ))$Xii2i,2I$I)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$JTUݠ. I$SJt5JI$$HI$tEIJI$Z%Ӣ(Y4)$ZxpN 2Ʉf :ZGTT#l@BA BtDMQ*RI$*VUceXca$(=TUPBm;FGd 6fP\S0Uխ;=AmZ:M\̟ 5 Mm9t-v:4ǓMHF8D JjIxTYNٷv e54qx(Lf;(k-R~֩Pg0#(.?T'Y+dh3%f)N㻸_jwGQo\/k4U/NU`@Ɩ=%n#81׬.2q}&9)-l7EcWm<,e8*˳_.- hR  BNИW WD*IIm'TDqT 6;#&#*Ru'U&R Hd$`T\铤 eL̨(. N$]F]cC#l 2tƆX YJ-25СE,u Ó ]{8T.xq ̂B& S':'OJI% )I$IIJRI$-CɡΫVژPTkn4XYZ~<.BhR3 y@"3f4(ŨN )K]G1+5}ܫ{)LuI"/$wO_KPåǂt]D!B8)>^= TT8S<$X@r:'V8A}C8j1 a4² cPotp>]Նy%ZTViUڄ+Gx RʄBϺ|LSnD N&|Pv.u!uP-kRtEk^i?uWk@u"6 |K+"rUNI'B@:y4u.{UKUg]DKvm254zNK`if9i<.6IYt]kF0aAVX'e2I'NRI%&kZAQf($W5H]GN˖ j"5[- uZt\^鞦+4YyčVw E67/pEO\ZS7Q5 +|uGr rgإhyx|V?ضLE0d2>* 򕠹մnoI@Z΃U1aچZ{!:e8,.`#PHưk:vWg B]T˂n:pthmN&RxgC,O)vOCR0{9<Ž?ގa -iv{IM0TӝOdVLr lJzgor[uR>J$KTkgRK O@li|QqYSs}bx`ħGe>f="ێݽr'I$@*K; g)elu9fumo4OFV"$!ĞBxE::&SaGU!z aL̅{j!4 -BPB j4U{Z 'DG XAL$wbnqXqfO=WXCx$' .PTcW[[ZvX1g0b\""(̉eiPPv7UݝfHL|l̗(-ݦ,E-Hԝ͟#ds$,.6hje&xe$av]-r+)iQnc]Us)ؕ4r5 ^ߚu[@3w44OmYe5dP( e8J^uPk3WC]UԜ vN UiP"sj+'͎+'M{!S)l0B m݂{r Wà'X@IM(˯q Vm:Aqޢj)nC >8RݹM Z*G}(7:۶~BSº.~@ H-y%6p8S``@EfP›L&@sUmwa*ǫQ>A dVS!0)*"AF=N~bt,GTtP/X x-KVnx(lnndi`=W9t],w\t73;A:`GO"$I|)$MQ(NI&Nԡ R*RI&Wn/bOj`T&n!tuB#ȸTb)>BHeee>~|P;:?%X&%zCþ< Zf+Z}\k.0~}h?+jGrI)TK۹\` I+}lҳ߂:veg:s˹+:Y$U计 ) =&w׌ X][+0sɅZCݩڏ l Kݴk€jKIy~ 4#Uܢl*5nk.+YAjزm\ΈGoȻ^jm@<ŷedN4XVR˦vIN[&-mڑR&` {"zPG%D:1o o>e2V#X,qGCQE#Lgc8XW ecGm()R)t0KԤa!N#Th)ڒmO>)Xv%&TRǔ)PR(xpIHi- *%p:'pAv-!0aDz[Q7AAȽ\;|ѭn;j]CYq:; Ì%qZu*L(1F7Iǚߨ^qC{:Fa.Cy)nh9ߕiEQOvMqs+q6˵V7[LU{ʳcVFX44*ֳTZv=;zs\e"m1y-LL YK}ujwM.xWdxV R k+.Slp 3+rf5ֈMKgPHwFt6 &9ʫk"TM%M:7%w  h2$*CvUPϧP5(mܵz_OpQ8 !k*l k*]ѥUɶj!ѺȞ(^CBNK~2%U3x'!% ~D-+؎PلOvi5`TS+ nR,j(=52;Q6?|꫶G1wCJmNȈdb4|UW6bxcZ$@ $W"S}mUճqW2 ;3 hܫ΄[zO+9˧t7nˀ:+c*x66 8I9+I$pI&$$$ID$RI$IJI$BPIJI$D$\$$I'M RI$ВIrI' $JRI$I$I:I&I*I$NtI$$I:I$I'I$RI$$)I$t$I'钔IH6% RJI%;X[H++6Nu =I$I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$@JU&49W l$J%2bTIE$)$I2t%)$IITJRI$nJeSbaRd+a"AA3e$J;S”&ܒI"3v 3NʁV°L"Xmr:FmN'#Uhd#H۸jR#sP-'x ``*5*x<ԓBܿM'7Khv3$՛L|!kUAnD8ŇxoMΓ{!m# ~à<qī/x >aDyBs"e'Jv_Zn>>j:g5' 1hW&KuؤK+:Jn[l5O 6V/䗪ӠU-xnz߸iM D(PevSw?l&'6;TgR9iC{@ʰbBgݲ>Q5ULsZg]cWrAf2cM>JgTY m:I䡰BQuPpQ> {TJJ-Oq'$HqTPpX*SⰥms*W8Ӽ[ GU0ALQ)6td)@RmEtF#}ʞn';;;a +.,7K]FGURd7<zkqi'*.Aj74FB ;|w <.YϱǂAHXXU5CUC;LBE).TPƊ&"27)û A&D! JUza!80R`tN 2!r[Qq ?MA #iSꑱ>i2i(5:(3HJL\!CVE|r+$JrbcUe U!c=uNGxTÑAh5Tb |շ(>q #XM4 LpbCsVYP`"H@>Rh (U #U86P]$ ^ ,Z xFvkP-{iaqԋkO k23ߣ<];s|Y%HHFCo7nw(aIĀBkJ(g{(RǩӪqM()3Z$`Sd%)(mR85RR"S;[:kUq%$ ]մ{Q,kA +誜 ( '֓ZMrH/J5gTpU1Q%vid8Rw@q%@U3p6jLITiqYƋ JW9乞7Qj}[}.]N!y6C|w}A!)`ERn$Z]?Yk2/ncVk>W!¹dFi)2`cfۖ~;݂5FvFi*h"OYUܻC^F(V^ʬtU,K* x‘jQH =L2F"gS Q 'L,遯;$6! Ҽ(Ȃkj*hLz|V決ݐó,wKMGy ţcj s 7+NHEJI$%IF”% )I$@J1Β$.0;m%2G MU `gXnqjho 6K ~Aqq%ǒB4}K#{ ?i)˧ κs:p BA$.=G IyK)mI+tbBNplx(mġ42A)!di1hT d'EL\bw|H#E@BRrJ:d" DrϷǺ ߴH!tB"G)5>=(!dZh\HJlMOdfGIj$)&#$'NФp2x#E&2I&gH5ׄEh'L (/`g*QM0S)M*bG.:Nt)N)ǔ')N8@%2I%b%1O*/t2t" NɄI:m )UEУ:Ma<fR$Q,-s6=N8 *DU |ĞW:JLwNDNmth7bIӺbP-N%|kS!nN]!"u<(-#"UvĶAV($?rt*OL7Uvwh ԡL&A07 *3={~U mGmPcETS>&/YWQW mlnuIޛ9A#+ /"`2[Xi& Ag Ծ4]Zxx"+2a7HS9Br6s~dLxDz`NK?mݪ4&*$t5<) "!8K@ )R$8N‰`CTM)`5<(h|$wQ- <ㄎ%LxP{H{Gb\' "5ZM.Ik !Di>ZG;TNYw-s{X09W!wC~## kHQz\IN agTJhRq%*[P#TQ  F'TL$7ԚiS@ʋ۔FSm3gQ^Yo-:* t'EZ[Wp g2.˜Z}_kĉם'MK²=]tK6}E wЦeAh̓5;nWN~+VleyoLH,+1=oG+;!T8zGQi* ܬm:E$II$I$$IJTpRRI%²N< -Lg@Ӱ2ҚB}Sj/: _#vPTLVkkخWohu:r£1FN;!+*pNJϫIq]SF #*~q/ q^pD(|O-=!HL"Bu'ɥ%)$I$C)$I:dJI$$HRI$8)&IJI$Z8~f)Ё"ԡc۵M%S-`!YL.jtXybz#yޝ8k+'*#EKmDw_}¥<Z Jy|ƽWf ]DL{D >!3H?DUa|ZxBIH#}~ @' *žU| j:Zz2롼jtft:r:1,@m]WY w +Zw .ThF!WՄx*Xq6A8z(iK'O5HQNާ-7/r] O*X ɏBڋAr$+chBn#FJPH YV^cXIqW>]:{nT\K(ݤ4F8i f3p1+5V'KuHu3Q{NU<|Vw[a?MdU0ʌHA9Rc׳]0eM\{ eD6Dj[ꋱ0K\l:I-,MӐ&;-*O?U& ˣ 7?4M%KZ Q\I1´ OyBB){Z!P`A eu]&ο%ox2x?%uebebӪ+0FMַ ƈ*CFٔ+zcvJ0lׅ],BIJx߰uKaԃaxn3xJѯh $L>YZeͰ%%Z_ZdOOyYC$V9t*1v"W@JEdC{wu.Cyۜ6V0}XQsƯVbHULfuS:(l5>hfdhߕ0nw wUlwd+)m۝:zbdrvZ´z];^08U`FÎND-t1k%ڟv i[G1~ef #8.o]W "ּ`WE),0Pku bV[)̈́XIFNHRI$H4A+RI$IZ8$h\B@$H|% $TI2dI$$II$$I%RI%)$I$IJI$N$I% '%I$t$$I)I$I$JRI$$'IJI$I$)I$II%)$I$rI'I/$)I$pSdRI%0 }fi #] FԤIc$fQ>GvWS,RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$v4IIYůh{Qfm JzI$$JRI$t!I$dEJI$I$RI$]M$JO`>L,&N t)ի$J@BJD)efƨTȬ0Q9!V ېdcrQAMBz։]{)V o22EZ@O+)k T{.2ʨ]YW7r;j;J[5Fɬe7B-zcl9ue&(BucU:qUŠAwYWU/f4Re$w>+"kNnSRgZ}f^ց+$ : K}J1 d?@nR|P:,|UZK/hNE'vMpd@*vW9VxvUaWúBs*m2 sPLBD%.IJ= %I'LtNWI$&2TaIRtM)$7 @`Pj)d껇d29NjK$d$$rI)ݢʓB# T*EF.I&<')$Et!{»NS Z;YhCsj`+U|Vvxr5bx,.r$;.VN+˰I S*cԴAcU:bT,T\"eNH<{1]:UBxUJ#9lVCIliʸ ЙXt3J0tI~(R8hWhHe@^b{1#fJ pҚJW!:xm 쫖FI"d7DŽ}DžK$OVfuLP6P ɘ?zɰ@%l_ppN"I# B}ɛuZA]0|}Vx0غސڱz`&u=31:KB/phC+ua'u_V9kTM^HKVxV(Ȭחj yvF_[aղuKkJ(@L~}мݤ`OdfX8[!Gx}s!*V8Ii}IOEfSIp/w2:-V}#*>*.V,{eNX{hhVteH]*u㱤Z64aEkU0$%tFF%7[hoe#Rh2T:M?M :8E'1)Եu @NJ 0uJ "D}v ,pkO-/yzZ{E`;wvh%>'lҥS̴y)wwn{GU/psܻ"xBu[>e0*E>^\ GEzU:u E@㪻WKūT^rT~P^pˉKފk %{;icx|/Jn]G?ګ: ^gSޕ&f_?*?C[yPߵ0~pK^fs,?gޒ=%?)tV /Mm]۔ g;s-o?zT@6P,ռkby ԅ=ԅy=o*ZZx[ţpBSµ9{GI[S]>K//OV4jus[r7p.S~g[tnB V#'z~'ī4[xWplU޻6hS2 0:?N-Ȓ ֏hBKt܏utG'c6onaz/֟qL ʶ]6:L1$lP)q3K+wCjTÒ$G\پ~Jmx>ts [F#%DT|6 D;DpA @J.8>jG: ki'Qo H[NM{#Ix'ST.SI$5AH[PoL'T}4:^)VɷdBpDYks8# a2,scQ sg:+8XXj בBejZ[#1ۚWdr^S sB %Ց? ^?Ghs{) a ࠹u6 u灮J T]cLv" 45%nrUm[Ru6S=χd8);D@M a~EӴwR}q$T@+l ;k¿[Q.Ke[ƃjj2/{NA]FHksIlpt6Nݴ:Ku-{C3 q=)Q)J(%`xODnjp-Y9,!kAjU&4^;]wլVr5{|A~xT;,L€U HOpkmN+#taz-'Q }e|aIj31T }eʡ #'W⍸Vzز\88+2 ѺgڱIe"R^餒IR I'H RI$:dIJI$N j tIYͲ,+\}h~#Udʛ`!eXZ#ez/U*I*bƆRI%)Sy$I$I I$I$RI$& RI$I$I)I2I)I$+ţ~ ׾(.ƿbo?ܯ'0Z #lN RhcU]´vV+oNƥ6EѠB OLk[5{xo.v"o[IrXڑ xB@xKcM Âk4t; XkƓX B{IU:{%4jФY}Fvۍ֍4s=" ح Z<T | ׼qTۚ }ti'u!u4[@?VH]"Z\< nήӷyYټ?#.#`%M،yhƻ0Ka@;NP6]ZA.^4{)Vf?GD?NC8Pw!J}d & vI3R + $vIs7;Y-H|VWAj m<E 6e 5ЊdPXQzk/ 3}W xMCkxe#i * NB|F[`FDe>(\kX.q%s['BPPcÎVY]^˿eU>RN'l:mU(lҩl(c*bSe)˭@l= 6@Ue)z*VWdlǂ>exDi+s8:BVN}W4V\ۖꆣD;M -~;úma1ǂk 5*EEm2]4HPl2h VK,i:ZxY @Qk ZV5j?z e^Z|<5[d%W@w; *uAiS+3M])nRz }D<3αRghOgX977d-$ 6c;(6]G_&9ݢ}|TkU7K%8tZص;ͬfЏUEJ3oQ4RM*GvH|Z2 Z_ x8 ''=5kqe7,>LkSn>i-F °W[8׵v\ҏx /NV6X =Ke10eVf_V ^?Nmb\2Zni=Gth!ΉXn3ꀃZ4U魷Ѫזi⭱G>I~iN9ycE kW%ѬnS ȭJ:Oѧx==MY,Ubdnlr͞ %'D:I$I$$I$4I:JRI$I$RI$tI%I$I'LI&NI)I$tJe%)$I)I I$0NI$I$$I$D$$I IJI$% $$IӦI%)$O)QM))I$" *9lpڧDI*$z$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I+9g{撔1hf7mj]RFU:5Xd7P@UI)rI%*)$$I$HI$I$JRI$$I)uVk:*qZx{)4LL(jҤb@a3uRFi % JdVUGiIibB)P!Ǻ3U3Ju8\p<# 1ЧaE MFềL;;@!Ī˶+5R4qQpi! wl]ӨJ]VsfQW̍%VuV=o;7{t:>v7s^DZمZr@PJB=ėQ?eߟaPN+  Ȥ7.6%*V> <d&æaE@FwJA)IM%)8L&*Ld)0ԔLJgQܜQ x)(BhIs0D%(Ntܢ;$A:AuRpFkIk֠WI2JDxD"tI4B~S“DQJI%6X`\P5JQ IH Bc,.@-;o1 2м[0+Ȭ::8,.q9TIVYFnn'*s,ʬv+ k&x G((v7IDhIT :וEQڮ:PO3 ]n-0;+ $d"WʨBiՠ'lD2'O*{%qVmY`BFS]- Pp!6?Fbl pj;+lsX^YJ0D+!8+cmΪ#&SLD({[caQF[ @!aI[GTzi:LBք3- GU 3V UF“I$46 `T$u#Q ;TG*=BMQ2촰ksK,S7De=mT5#zl 2`T&4MNkIK",yt* 3` ( o.0 ycsO:u @)PҮpuG8 $7Aq O.S5RZt*lP#]kep4b4!p^ur$ N90=GX;ݺ)ƨ){ M`9uVn~cUi3DhxD :#DY0"u㮿$H1s;Z|V۹ ʴ")az\Hsoh}zVXsH|Kճ5U]X@-/d݁YՍJ(i3JnU@E e2˧R~JMwEFl(ل;O%CsԎ$k!qx,HN8g6?D:{" ,}}M&:!JJw7G[ Rʁ|jeH[cS)(MRPAGʰ`g.')u/ Ӻ^쪂JL~F9#IMX_Q`3qc|HSoRkAPw>2TZ% %JfCP94Ц#5I,Yr )Jix J0L4BMb(*S28L~Ԥ) Mr:xL%'?4' %!4RhTpCN [ԤW5֘cۺ2Oe쉑Q#Ժ]$.Ǐp"HN]xOu8Y09x>Uղ1F9Q`RsF7k_[N:uuXeihǰ*U*ʷA3r%徲d eWXޟ7/7||Yē1S!FRq b峝vl JϪkT?B<&,eKx mh /ُ' *d({Ҡƨ NO+ZUXN~IW+K't{#72 ɷy'yM" w@Nĕ৸?Y 5䑭@?A+#.umq*xLnIEM)RHND ]N/ܸ͠smcʴ7o9\EZ2NFίgұzu+WD=z?@H?ĭ*n5:W[zjh8g^g;%N?zJ&7ˌ2_\iOW!:laNێ8Q-R9gqa߹w.ECYY_X3/|%-RC^c6=g s'Щn?JřwYA/=MtET*&W]_A|"'Qs(BJhh HN,G(2L\+#?C0g[L.M=D'Qsth.+GF:,;L- unP-SYq$ 2pCSOtJ$RrHI$riLJRI$S*2RRI$@UZH*(R:KkdWq#lb}e=I Se*Ay$=XyQB%VM2 ZHG>(RseP1Ce/h"yB8;RƟcdyL?wޠ;BY|X`Y;@ٕ`o ~I69^Dg8{V+zMi8){cg^*`Ki>lK-:~и~{y{8Qo~0V0z&4}8iwSݢ].;.?'pH/_"x>^׾U^rl7f|!&:QT]Dzm>%SoeVusEڭUMFL_iy*\fL /:bu]A]Gt^rn x W{Ch` qqisMm2- c"ZPƘ BFBQ\Q7P5*+P $oM}Op1T]QaH?/c!ͅONv-uZS`.InS >f=5U!1TŐ4D;vR S9Eqgedܕg#jg*1^AZ6 x'90t9]oJg$ MXT}&f9^0ϳv`3)9 3 pH%|#P'@<א㢪.TSCk)V~*L|}!4x VHP. Fڨl@4s E\t=-1*R%LBLJ^3lx,L]̓iGle]x:wCC"{.-@HJaEyOϮշ;C'Lp?3eD}Hc9A:/0Ȩ<^,04Xd$ rQ:MAUiF ʏI$LtI$$N0I)$N p$I'$I&:NI$IHRI$IJRI$dI$dIJI$S'I2I$I)[E]M@I$vYW1xUkZ6uaAX]Lvo%t.,Lskn cd6;SU85<qH5 |@m#c4y5D)J- a=Tn$33櫚˜W+QiC3&UhM,Syu;1ݺ*.y;"{`D@@&Z="'"dX[L5gT8i_pn(R[cqxTs4䧗~$Hu Ӆ^ˀԔ; ) ֶHܯш;k~hL?OeKN퀲`UlTAM#ƠAX;';>]a,ޡ=kn*u4p5B>0Zn֝T,{*sSZ8T4Z% KGܛ$i:U8φXվ=NcSSvwD \@n*642r^\YTaCy= #wB.\uQ:W} (Ȭ "Bnî^3@#h%ĪYCpqyU,x?˲ Nө"f>GiYvVhB! >* {H]\d8Ij=⴩ppuUO(.]ncL Zv-5?+#D+"\a1rY!)WЙgS^Ǻ`|U[ӟGu*ٷ F>FLIqӎ.뮾)u-b`DCAPӪKJZ'+X6<<>HV$Y3>V_Lƕcc{#c9M|HKF s.I^C6{"=<7==HLC<Wy?}Q_OJI$ ?Nm ;\'jHV̊c3w J/'q"pU|XH(jEa.,#s4];.7Lynn~![GTU;ivVUI$I$$I$I)I$I$JRI$I$I$I$$I$ $JRI$b0^-԰j;yysttwQ29V}ףHhNQ_$J rI&N'IJI$'<$$IBpNIZ`'U=]JNQ 9 AR*h[ . ̗8"͖$hUTvTDR2BI@QXA*%I1F m>(aڢ3TBNN B DiCM QGt;>Bt=cLH:0DIvL+խ2>&hM泾lo<%=@BdߚG x9*Z$x@W r)ebHlJUc|WCxRGTT51jp N2Z/v*֗"D6tW}b߂FQ9laE˅=jIz`l[ ̫4} -86㹧A{G!n߂_IJ0г~8?ޏ߻.^lvt7r~FAjDh :Ǩ; \0x}:|?*uLͪ0ϫT pB[9XG9){e1P6 $y 56v'_fT<3;;AgQx4Qv%Y7D߱k=67sowryC.|ֶ=?gv^zQ<7o X]t8B8_88B#w.iCz:%7)w殀X#R8V>z֝ ^@]뾫O~Pt?n'jtU^ܘ J*?&Tq[K`lp/~ tx?B#7ΧM;p5c*]J n{mSugYߕΏB"bjjvN/N6;rSmy<rq^GP WK_27R~!c`Q1rp}e$B mr^i7$;0́jN= 54]Hͷ$nmA%µz Piqݼ<7A>G1`#K']5L+w }WG-ꋎ#t%Šx`a ڈq_Qx¬t~@Bw^'@E^s61Oc-v}CaΟ_ YZ.a(=qPw\w<+x\Y:QsFV jhAO#_+9R{[8= \Rj=O)XF6f n£Zeq]Qpo j~Y dl'?UUagܺfrqmwtx5T.嶺#~ju?fRΧKVSP^yqь@A?XÂ#Vo zpO1Yh锳豣2X;\*5IEǞ׋Oq܌FtG*˂j.{'1%{Qx̧juG~|J='B>PMBĮ|jZrIԷrD|JE@hluQB퇜ox͹%a/L.?w\ oe7}Si]? ?wR\repE|d(nxW_%.^i~٫rk)}{qyns`o][B[(gjRIJ >s~(ΰОaO=IK?eU-nwK〰~З8v%M6q]Jw.`Liy Kׄ4OF݀xl(㻿 B'ET/? B=j&=jаЛJC61>b?5 B=f(iPttrQx҄jJ 7nlց gj:KKLs7&RA D#'Z?k'cxY޲ >N*:YQ9ePSza?W]|PݔJmQ6-`O)$(;(]P/AV$%d7J6jL%oNN24SܖVW~Ou!U %J&Nԫ=̈08 0%_/ty P!hw(6`gcO&޷x^?+c|J4$J\:̚Xs_j-ۙ 77POో-?>/FS`p-K>FTϺ.q%VLPSW ʆS6GĤ(N())I$yL)$NRҒI'$IMkt at]"ւBCv6+#*hVʣәf)"t+!tpU3K~CZX ~FdsK)3n"BuIo![k\9I%I$ɓ )I$b:hIJI$LHRI$<'RJI$@SN RI$:()I$bTJRI$RIMjӪv)I %'IL{ P%$D%~ޭ}HTI%#e a($ז9:*S" - (ث(ٝa:h=7hcL2`1'Vc*@tx#u[orC+Ѫ>yL[`贸MMJޞL%'} tj2F9 VRfX"IB6@+eS孠-..x5<Ś+gʐ,=zy̫C^+G4괰z{<* e!drc twuz4CBQOoYyT-ȯlO8iM#v[F+9 0յݡv.qI̓)Ijx*67I ) 6YKhAQ:4uA.D--Qf@<k%«m^ь#|8-N1$d~ WȋD<O-ͦcDra;3Szvkz7P81gQ\LV &u=џT{kT&k\.qDW [@~ {Q{)CdGH9CO k oQ4M5 ӞKIdxlY Ԭh4Ӝo s>.[* #ŏ;I$I$$I$I)I$I$JRI$I$I$I$$I%cxo4 M&I(1SJL*I$Ó(rT$IJ`BI$<'JJI%O [SJRI$ RI$xpRI%v!\ea\BɈRLl5HS%5eMZDŽ$P(~ {Qib'Y J(@"0[SD-fPR.Q.EaDBNr!8PHhkiICsH#JgA* (j>&J!IS;+R^Jg2 v4&)$.;4&9B2Қ-``*HQ2Ф|K0SʀpHrT~)RC2LlL]e;A J(~ ()#:xQ$ 7_(H#z.QplJ[qQ!)!7qOA_z\% Y@=F* j#Q-`t7?E?%&Xxaވ<)'EguqI g pAP-<LZ@noca5:=M){e4~]LEF\<za騳?7[oeV} oOŰ|PlDcV7OQͧ@_iAΔf4p9ծMgx*#8 QwQ#wKGep~U梞h!kФ:CB;0K9xTOra*=f U౼4"aڮH|#i+g`DRp*9RM\%'DOa}rzrUudˎ}_WAGN*OY+]]B7!ǥ۲Ml;*'H1Z;Rصjo Yh$[/{j[V#2VOS!+U4N1!\O 9 z* ոO T%1Gde % PBc9YhMꂭt0 % P5O뢦?³ BZcaf $k pʱ B9i}}U8KTx,\הV Gڊk 3tK׏Jʭ(ZjK~ 0Sz&z/@# Opڏe7m;BPZcVh/U%ZHOdGz%[7:JOdAQ nA6% WYOh BtʍKI6ЖН%=}R!6UkBP%p(/IV% VNA)䪻܊-d$z#y* RI$ze_r[BI$sq)zr[RI$XPw%(RI#e#lJR)$FJ^Aܔ$HޢT̠JyEJI$z2$HoUr[RI$oU?)IJI$TDJRRI$oQ/QRIKB%)$E/Kz$$H&Izb9JRJI%=ɷ(JS()I$rbS~ c߽%)$AqP%Y N:sTIUSn C)XU)$Y-AEM.$ҒI%V-p xj[ 1roI$# k &k'I$RQ4JRI$_ nC%.QRI%=J JRI$S(})I$D&QRI%II$I2d)$I8I! )I$>#wX1@s}.=PÙtGV 0%s=SvU]SJY{yP$ 2ۋ*uQ{Ra]V4 CNtj XF%3BYPƃ*{vx(BN{)Ǻ !`C,"Jb;-<-RB26' t+kFkuU޲1A zۗYBŶS]T XH J\q蒭:(I:b^I$4)GhEJI$a2 $$J I$S )I$@'%)$Sɥ<$I'LPRI$% BHRI$$*RI$IpJRI$IJI)I$pJ%wpa)2t9EihVqXUZdÒ(9¼s\LBU %b3\¶0"қbѹ]Ǭh +1 \o0 P,li)ޢTJ\AL4cJ)`bH"B4aa9VqX/ 9Uɍ Iu1Z Rj!Mƪ>"as:sk6u>sVdk㦅ID!7ISZuM>Y䓢; gGu1D$Z$(i%dg O}TNDHȊWg>\Gui ^^Խ~ꇦ:uE~c;. 7dvH0InRɬ})UƆ +y.ώ5Sa($5;j!MK{cޯ[S?gx25>\*  HB] ꍠOk:#Be{ZgN SugU2&pUz)~IDr>0yDR)4 wjih )s2O*xQ鯉S61ŮU}2t3lD S^P~p4TY̰Fɖe'[Y6!X]N3tʳ *|V&12`#D:ݻ:/o Z)hdP1- ʱPUguAt >HNds3TfU]% 'lYbGuA:+\X'(.a:)U?ߴ$ b2KӅvPX#*t,~OJPGVHi} t4rW4zn#M@9@q>Q+k,y '!7$2X5w3+ع!{yYmqEܡ9!g]&gbO6C"L̫AߪMEr\^ͱ?isx-q2?N+-kZƮ 7TE6u5 1Sl*ﱴ˟Sx}+K&keUb׶a6FQy>K5K OuaPe6:V_H,KHջat}8Ʋ$ާF{,zG)ݖ4UmJxS+t,Ln~8Z8suԪͯwMS~4Z2*:i$FM:bU^RonhKTvXvPYvF\)5۵%ԒA粭oT7 )\VYl"5$&r~&/p? 1%HU 02J.|vP R@ctz>>y5nAd!EvYЩztW^᪜luvzMgK,V]YL?zDL@Yv =re|CZBvLK YU1*o !ˋL͍+kyQqq,"\_3^z]ڭLGd4UXXW VhtGn@ΊC*6H*CA##_TT,-wUvЯ_S'¡scD]J2l ֥Q/S XG*}ac\ctb5^v3 D 2zWI$JHI' I1)JBI$(O )I$hJRڕI$`= ))I$F-LT?rLBPW谕bgѬ ]%<7΢cGf}aVs*cT-4% 7$XRں#- Ъƣh #Sb3ߛH@UJ>V:GB9J}r|6oWs|zV מtwp~a-bB eѲquxA#)RUsn^<ᨩI$I)zg>%)$L՝͖8yULjoX|TI!ITI$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$Nx4G: M8"*iʼXhJbR PI8 IRI$4"<%j$HAapRI%xO %I$p𒔒I&PI$t)I$@+,TpҒI$^Vjx U.Ioģ1j[>^1Q Ln?ny,?=8"*\|PwYqѡOR^E.Bb W֏-Jq9s~ }-K˿o1g;xjv魑kK |;(sOcYKDrF+'%-e4Jo5斊 ٞVДT~ŁM4pp~Ќ`B>TWJs e3?zN3 (ΜyQ9=UåԛӘ%}%ОvfJ.VqDؒ'I_9~j#%P pI_=8ȟ5@=MAVI]0-*ԒI+FUMnEVIY7*njI$lz|E$GcYK@.H%)$GJQRI$}oS|IMM"RRI$oS64-ݒIԔХ)))I$&C)$D߯)oC%)$E-[%JRI$ħޅ)nI*I$KBJRM$D߲[IyKrܒI"oȤ\RI$B۔&JJ$Jd\FRRI%=ɋ($RRI$8yQqI I$RLrI'NT RI$ yP |PJI$MnP)IJI$$$ )JHRI$L]*))I$ JRRI%2~ۼe4$Jr HINSJ I)iQ%)$S)TINSL(ΉJ RI$)Le)EJI$(L%))I$e2 RI$)JiIJI$- $TINRܡ)$$Jrt(RI)nRJRI)Kr))I$$ 򒔒I)JT%4$Jr JQBI%"(JRI)nJTe)IJI$)Q%)$RFRIJRJRRI%)JTe)IJI$)QJRRI%)O*RRI%)JT%<$J[ O))I$*2$J[JRRI%)JTe)IJI$-2JRI$-LƱ4w!i$Jh.Jf-,IEl>q*I,iF;8qJ.+'Qr74@> Or`O %\qd6V6ZwMzvQW$!{|S@/Q.F8V 'JTS;ICoBwb㐠BTi&˓Jb$$NJR&IJI$iHI$5HBI$ &)%I$yJS$I'N$$JRd)$O)'IJI$L BJRI$U0Q*sVRI&$Ѩ3lӀ` < )b(5->wTw%s =GeK\NcxTa9[N|~S6i̧nk$-=-Mp[7z8 A:)BſxEm|s#b5?rw"uS`i2ײڑbt7Ty Sh :!m!H:t)nL|SQo@PN(>'FP Df9eYa(-NPnh׺",J5NA mqFI1I >}O tփV;}i -$8pfA \p4VNiv>C+>4P @`d(8UkS\:tɜH6@G.*6ʟ*}Y9Zƣ!shZI?foP]XBs2/Oi 1wBǤmjLp>*ý8-b 'QN&UFkw5Or$'j5HIMG'_ A <&aOBA!mДܺXnw dfG.Abu,soG䭳*iU5o nl8.`KH"9>*Yt1U=w8lBtED:A p5XhIxxJ!(쥧tT'< AӁ}dGnsb8[&a[+0 &טu.v+LjYi 2pD:է0*u/bӔ88+ :WY t5g_r>•kd'$$I'I%)$Q)IJI$$I)$Nd)I$I$ RI$$"$IH$I$I$$II$TI;Q SIYmnбUwҴ!2n-*~ 74mЩcr31]X9b@v[]"V6E_EdʵIR.J82w^H4H㶺@t+Ic@­\Z݃U&˄t*ZTKW&Ѝ艍b\=ǸZbF[B :YQ(}H+jc"I F Guoy]VpUnI?UZ[9\6f9+~m\w. iѾEr5Y⓪*$Y`L>4msR'x# hӴRgK(nf`fT'Vv)Ȯq:꛴_eASwArԲ6\_@(u]GZ֐ ͭT);AFۥfKB1K e|uZ}1ӾƟ$|lOM#ݱmf40 Y*=MhS璁AMLn|D]cDk^ψQEg]dtVV=Tšlaet}'N_A=}M(ZaUjej ÙmD, h64+YU1 Ut뷺ԣ>iVd=G0;`gKq%jbT&veu8G=W+{R}"Z-w}_6@'NT͞KǯtcD!X,¯gZȳ$A+y=D . vFS@ ٔ%^5Ӝt"<$|qf\P :oHhX~1‘7CkgN wwVoioY%.| Ed?f|{J?cK>cW\O) *F^uCewI.'=.t}e6 ۝NտI^[jǕgWEKsXVkB}cz~+Ml.=]ZOå :nyI솴 _fnxXu ~(bN_tUi'Uv-fAtE{<}!B#Wu5 \8U#IEƴry'N-f5(j 3*{Je.*ynl۴RSHDJQ@kD9UsH\I*)ٰ@RI$ĦRa&V$eS]$-od;!xHS&ǵ^54\cD3[kq.ʚqqQ]_8Fg!?":Q :\O\W3_;~dv]X*L힥{=J}t6ru,"t>%7O,<+Cp`8'uSء%V^ϭ 8Tހa'LIVb)gftLF~d8N=:s;4{E9EgDdb:}_.d _<.PJIJTEBӨy Nδi[נvˬ=C&?9r^Otl#>vށa?.h`O.0Pw[p#qHd\!K%Qr'/B =ys?h'D敧<+>ɗ35 ۏv[mt;]СAKPjX\IG-L%酾:d!XK5Q9"w pk,Za[eu|Z~K N,~ߎctF!c,Y]0w*]BY=BKf[X]K3~cU!! ]YΑTBvKփU22͞]$-RI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I)TZUM1P" I%`փ`?53_j)SaI$p̬Z@22)zS)I$GܪR)I$7Ί)RI#zSJRI$m)RT$Hz $JI$[JIKr[RFI<)IJI$R$I)JRI%)$JRIJI$$RI$)IJI$JS$I'ҒI)I$I$JRI$PI$DrRRI%9O(r$Js)J))I$i%$)$RFRIJRJ{$$JiL_IJ~T%:JRI$)IQ%)$R (꒔I)Ή=IJR%)$SBREJI$ɝR NI)nJTe$IJuKwiIJI$)Q%)$RCJRI$1iP%)$R!4I')J))I$yQ)JJRI$HI$Id$$R RI$)())I$FRIJSRIJI$RRI:dIJI$O)IJI$RS$I IQŲ'E5DroiI$_Oh|ƶQܢJJTI"HP.M%)$DܮbϔZlB#E)Bɍ!z-mPO$WHZ=v*PBGKN%KA\7(+=EnOQM\EH=҅2gsĩ \y8OӍqJ q%_-KhZ}d'84e HFFq:]Eu_M`gEsxEnIՆfW_$6gVioaĻ$]D~Ur:s=ekRYdYFV)sL,*n E2 I Z $?B RI$J^hcARI0(Z~hCoB'jl$~У:^߽f2Apjz;G:$TM6UR?Eς8NQ}l^Hm3rmUDX5 XZ r,sjqGudhr!2nCFpa]s2'>'U~Zy WÛn3)j p_Tq=}w&áҭc*{ig۬[+ G qyOiFޞϬo :ڜuaS\HQY@Ϊ=<^ȭ4ARKl.ad,{eςuӹBXu@9UhSD'Y!S8ZD;p;n܀uBxU-awh%S@Bbn;vWX5M(\Gpg eIUGI(, Yk;gHDmQ@LM-7Rm@%z W-8HUXEp&B(*n; k߂xaB[p@OPۢI(PfHI)L!$JRI$bD$$J%F+c]Fϣ3:.cl:0P%xIm{IjhòV0DOc4 6e^iS|f[&ZcDa!['O73a qW]I{ .*Nb?*w)@@FA=#q>dwFh##aB*$Kߢe"EctwUZѸ4Yʂ`e\ZxuYx.0<-zh2t]bְư9+c47@)CVm#$܎4IRt= )PptLJJfEw4賚|xrk6ƗA\VEBYz侲te HHAMU+q3]Dr9!zʀ{+INm0TI.:HRI$RQ!%)$LIB*RI$:IRI$N4IJI$I$RI$d)I$I'2 RI$$RI$NTI)]nQ 8|Sd1N+܏G &X;M0#r3ѻk^!j4Ekw['Z`*"Q:tNas9 x a#];+ {t 3Nܮ@lJk@M6N#+}de:h> 8UVƨ[ҹVۡKrlKZ{ypG&A[AIA֖UĿPYWl0A.!V'0{VW_FyW+ Du>-{uL#EǓ  !c =}uDu!U2.k_VXC f#-*CpƐD%Q*] Y/,f`~O)"E^7{cwD_yq8 4hWJjns7\<huEywۡ+s5`&6:y <1msQUz ̀Jm."%b8Ïn뱣॓Ъ?@<_YuJųkTs\]3#дO]]5`ԅjX2dgI`DD3+?XbBZp>∊|# Dǩ@g+JvVP߹wVYRjYmIA/qA/nI[o.D+~RL5sɉHh@Zf3IlYםUVwT *M.w%o"YeBOuih)$tI$$H$I% rI.R<$$I$]{!jRI&E78]`X6Xv%Sj`!5RuΡlUP`ye;׼Z''`Rޓ:jhu T:>>t~b.ltrq1ZʪX ~O]d+2+lיb15[ ,>%f%@NTުgm5y9jŤa')*T}DA.w j0[ڟj{ M1[Peb´o|6F҃ @#BPM nQ.AH4SO DPw&ܒlO)BHޡ:"ۻjxN.R;K$I\ |r_撖:H^_ )dlQ/A/P6O))d$M*;U$V=T޲TE$VM&«=RI$lCuEɋ)$S/Q.L)I$I$(RI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$t$$ILIRI$PE59 .-~VuJڝ (_8 c\;qYP R5j{Mh4OHzd=<%U6?ƪYXF%<_agR 0gJʸ $@tI.i6`:Ѝl*@t4̕K6As–e,\wòۭdUGkg)`v9!tlһѹ!g?ƶ]ZenOMÖ9RCf7c +r+Ȝ7nYU >tg!.X׎V4Gf8 GZ̚_663)ϭӻV{&I²,|*mjHp[@x edc C6VǺzVN/6Q/okgԧ"iӕ2miR(XHEVvV+3<;aHW )^ꕭm`׽מo˅ %.m‹uAh=Y#Fjn) ]JK5<#z8PҁQ%ڠTZ P.S3#dYZN8(p+vITEo<ՐIhCc*~)=@P#mG)+1eNU9}IV=hGo5&Y54 rXy@kQ.YطAU]{Ap1J$(IRi#E^կD'EPhpclٷp,gAqT,Qmf'yD..m6;ÐL ݦ`x~<֙ruWWAMCvMA\ٲ40PigUAEm[|}dA{#X_:yHSw@-$%ǹ$,a I;>܁ݟ|yJ_$d+n灡e"G R&NE2xN 7G>'䝮-CdFWZ5Di7:yB$84OeSJ}S*EGtf؀cH8q 1A'AtT=v)[nt[$N,Z&>a晎Wif.InS$}!_?aSBΝVJ8 qU'ѷA$F¯p>Z%jmZÖѭ>` $~8oBup >yN*Bm:ʐӅBhZ7ʣ-U)RPR@LBdˤII$I8I2I&O)$I$KI$I%)$L$RI% !\nMha;g2[ 1N"5WVM6ʈ}AU[%a tW{{e"G)SITK仦A)o-3v(28[\n,|,ƏiZ"Vװ1*ӺLK԰MpaCZvXq MUkUC E%vϏ IZ6:_;x h䑢:XRZ?Mk^=~=V5>/߄J*xcUack]u00}: ]VlɒwKm*jCB %X8ŧ{!%hSYK0z 1[7n*< %d/h]-(8Iqp1ۆa%mRFun2aYmm`Gn}T7V>gX0qҒr.'+ckD {ˎTR)$tLS)RI$I%)$I$$I$I%)$I 'I(O NJRI$J!(AJI$:I)I$hJID+;kyIJI$҆+ktX,Ћуaݣ@& I]Vn3'JϽtws=ax:0m*`'uu|:*!dVB>JR⬉4CsO)ŀ U{od˞ Hh{qV{F%_6I*o;N %W&UK:GdS @)h(6#u +Bp4Bt =}"X˝R:>N.=\Y[J>^ĮΗ5N TƁ[a USmZRƷMLl)ipbUm8V> BeZkn⪛qLI<:~B)BHʎT7&.IKBxI:)xP'-IR%)QM0J[(nQޒI"nM 65I :HnPޣRR'IMzzJRI$_?%-RI$RD䔤I1zrbIOy*%(oQ.IJI$˔K*$HRI$]6LJ4$JD%4iJI$1)E I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$$$$I$$$I$I)I$yJS$I'I2I)I$t$I'I4I'I2I)I$t$I'I2I)I$t$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$II05IJI$ɒVj7} ?>] uP}f *uZts VBKS^#>3Hjs@uo$]VkW4ugFƬ[~bO%{v:.Md4;EɍyXƵ471rg-2I$AӝHt߂\rVUAI$rIRߊ!e*I$u>0Bܔ$Hmr\I"oM@%)$S M))I$(%%)$Rܖ I%)$RE$IJSnLIJI$RJRI$RFRIKr[RIKriM)$$JS 'I$'LRRI$-29QJRBI%Jc]Z (l !M1I!𒂓 ]Z#'xI*I$^e8n)I$v%3 hT2I#TDB;(:r^ S5*`4cYISv^T,l2Q`ʛ}Blc}@4J+(vhw~%iuT Yy3 [[uCaZ reCn3tYƠfoV!iZf6\궺v${EUl:otDx&E%X{0HrXm"[ACmz.aΞWI%͆jR'Z\x\P^] Mv-ΓʛaBûFJfu|FO s,4alVNk۴?Um~QKc\L2.=wV.ةݞ5V Fwl(WLPj VpmxVY#5xK-lkit<[*9vB 2hӕYs#mL 8@t\BhHSY]VuwKV]76nTYqhRݤa4=3[hk[mf` WUksTߚ7L.oo v3u{R&c`hk kE'm~)=Ih<7AAPH ;3 XS@RCeHioQdߪƀI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$H]~1V^M|hQ攒2lph0qj?yoIb'kKJP!/?pZtJѭkGN,GWE2={~m7uW;n?5Sr;#hQ˳hmM l4vS ;Vd^pֱ.)X%5CIrXS$5~5k ΃Dh1Kz\VVW;0KkA:9יW  CtΔ7rTwmYuIQ~iv.twybJ2CɱRd ˵U܁hRZAx"e TU>tQ.!}$vO4G@Q Ct{yDIZpq Y3GB6ueS=0 6f4Q,= eeQw=7r!ηuuB pMB58*3I+҂e{`|&5EMrmd}9Ƴ1YVV8><$WEnۡ-]-aqVQh.+ޗ⚻u8NV'^aUZ7?[ nv ?YWS'y6/J6nIʰO=Eo$a{Yg cƪF{K,+so3I-ה8)@K@jn16&?ti)B7P !k6w1r[m^U*u?nʭmXMYۢ+PiV08*^E&";t}.Pl\X$ S9^X');I >IZI'I)I%)$Nd)I$I%)RI$LI&)hA I$&N|EJI$$I)I$I$JRI$I&IJI$JJRI$$J\S$I1 Ӥ$J$$'TItV+.Wb[N/^o>Rxeq^usκ/A݌y5v{VRnt<-FS5"TudXO_$Ɏ5ǎ7ž-84x~4 ymwkFʵ@<'{:oVl w+k#a`24G돨L! 9T{S!0ѐb8wOyA8oJH^IdH-V4OnQ9$jwY^`ÀM&̴}ˡv^4x(V䆪sxTfapKΞyxY}FYI4TOTs$nȌ|5}:`»OLF(8-n 7܅_$W Oqbd}bu목]EO޶!E[cvUl8lf嶠C J䲮?ԒO~sOq!`4Q*J'P6V2oϑP"4:O:HIK28n*Lhiy>(VU̹!ҡCrû6|>fdB[kt6` [0OQyvndTaM(v(F6 7GtQiǑO9"OEuv傫en/ Ubէ9&-OWODL:#牀. $4^-<;*|KU˜ _@+FFຶ5pvy eT\- t"A(:^ƯhU8T*MuEFN D&TpF b#l! !IDX]U\V|;[r f+*(@G d'tQLI*0Īv0-KZv*+H0p6eܔ7dU GnM6iʇ2Ub܊Q vN+DmQ/샽GrGKj ѽN^uH$ %2%3 $*)tT'O)AJI$R*ܒI:J{PݮB*Y:I)(((JJRI$1wrmi)I$!r2ےBI$B{RI$M%ɋRI%2ې˒ܒI)(̨&IOw1rҕ)I$*%2R)$RFREJI$iI2JRI$SJI"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$u>ӵ+WfO-(nEhPv%v޴ ?r$,p:S8A€;RƥG|Eމ&'QaX4EPliTO0}snЮ +)7t0}^7Wܭ{үqm&)LΤI:dI I$I$RI$IJI$:JRI$RRI$JdIRI$'I$A0IJI$2tI?MNI$I$I)I$RI$.RI%)$I dI<& $I'K/$ߑ%)$NRI%)$I H)I$~8VhEU8$jLBtøPۤ(`:=I"lq”ѹ$EJ Zx">+8T[u4va]«pO Έ6{x+Yqd 7lCRxVX@ #z\ʯc N X԰9F5gvB@LhX}g$T im\ZnٱƊ8q CpcUKsaKxQ&$H mh@kJ>j1rS!`HS/k&>)`|r mMպx0APa=E %YNy/2zS#CI>)_ f4;iAݢeQ,BdU<`Lm9;]eD[ np&G= ܜݼddcW1⦔f ]7FI"Z];7ptH.CD|N(siRiM*h'NTTTC I9 !)x)mˇu14pSt]c۪!iQL2bH@J'+6tS \y"O wW"Bۭ)Hkc4 Ok5_+ Tl&9RB)퓢rՓe '[T§UU /n\-jj_\_ʣS:J"_/ȒzI$$ВI$$JI$E:-Ph &&t;] [XAhvIhr2m-m\o$0X$ ;Q% uǍ\qqv*YHjV =̃seF͚Bv[Wc RQ m;<XPM'MF 't'd{ pUhVaG;'E*~Բ:-KT;zc+;Q{rh"JtJOsiJgVh6uScK*]$\I2RJPI%)Kl'%)$MMJ~GcP&G7{ V8 /Hmux]# I*MGA*q2>/"Y5j[zg&׆z.VԷA*>GJz܏tkecwmbƾ%fQG&^Cgq~V5|.|01hPƏų %Vu$!-[~GuŎٺo͙Wh%ќj nnκy?zmd2=t5{EmyR-F'\^u(GrIrq~cnwe-CtDO24;StDҒp)(NnIK'%- H%)$)F|n)!d<% s:%Cr[RН$rL.I $%"RI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$Hboi?iHCJ7լ ?oyhY#k=M೯)aw.E 0OԳqVZiքZ 6;Ick\{2Cv y#fapR{jV'*Gϋh(KoHz<S"^G 2wЊǐIQmd"ұk~YNJiOuZ8yVSw?0*p lNZHpa2~U1{D(oSIMm>ƒr*@)[ .oqi|B0 SzAL ZfDz.iRswtm/^ʼTKGt|V;G+V4Rm*a4:HEl Z ]Pdtxe] CwQ) NDq/w(,uRf% ft zmj4TWdiH0fxoa`6UljtI~uۋ%Z7X\UU[xbP²[SI1I( ԒI&N5I7EJI$%I*I$)$|RI I$I$%)$KA$I$NI&$JRI$tߕ$I$IIJI$QORJI$%RIJI$)I%)$I7O\pI&K)pI'Le:I)I$IH$Ij^IOܒI$I I% %)I)0Ww7R+/Y%&N'H4CA*Qa3Ir^}HDs^ WcK a2M%Fqj$EػĔZ-ݚSY8;veѷ+ +7r{?Iki4F1d]/*I:Jd Xu92uEWu 1 %Ȳ&Vv]%it-UB;2=vʻ`ƨm ouaWK⣑ӚX 4 ԺKp;AS9%艓Үnp,h,y+Χr.k0Io|b+^k𾡁ÇV y-\V-vfռr3uf~lzos#eZ9== C:MeBӳK9eM 4 c^T iIVtVRD).BxG:\ s(Z4Z!E!- sɠo ŷGGeSۆN,)H;jT̒-p:\?am:X!2B[3`+Ͼ ]P}+빮D|jzȂs(-$ Hp9jt{aw!|WUd89tOM5՗3]Mx\I-2ޡm#T-C$rz]Qk|מu,k׆Z^8X/aM~ c(, =BZ%Bʚ5C`bkJĵK+ȗ!^xN+6q5OkDO3h__vY/ұ韣uAq-0xV 5~en }D4w*0eߤ/SKt݊vJ pzBVVD&=v'3KMM+.kӡz_V5i kuCMe u[䌚[`NLI'# $I%E$JRI$|'LQBI$dIJI$HJRI$I$I&NdI:I$I$I$$IӄJI%$!I%)$Nna)$]6E3t0V'ժC1ZV(z<6p9C_9u\r?J+q;vMRhR)YՂ?kƅ@:O!*GZ9=8:tRf3GX(LpD MU51O>4Ak4*^I& Eo}~iO'xʛV˔ y(bgNM( a%?)Q⒗ qT! IvE 'XS'Ѣ o EKL%N?9€$y&?xLF))M<یpyr])ݎgPLy#Tlǂ Yx'BU~ѢMο.4 !5j/ŇivJ> ?Xw]OK#_s:VE1M~.=ܮ.^0ޙ[#֪_ yVMU'(˄YU0vP@Ym}쬆Ʋ:vMl@yf+wP Ĭ<ݪw;\Y/ɠS =n475<Ҫu:qUpɬS<*6O%YQkCD'M\Ut0~dX&`M ]%=guK%q^|ΊkֵQ"ä\o74-xU!zV;~[4ރx)u;J 5y2d 똘M|]robr=ieCkDJ it*NtQ6J t8M:J /s$7\{9ڨMvbVCB a(F6CܚP1 RڞR.LOGtIKBxNң! RRН$S%$)$)jJiQ)d$:%@1))I$SJb|R'IL%0TKBI:JrҒI)Kw)"$HoC/L^I"nM wp䐤I6=*%)I$&۔%4$JrS(nLJ RI$JiQ%12I)ҒI)(ʌ(I$*2RI<$$I2I"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'cI<I-lOZ -lVn~r"$7]%RE:'aяӲ?F~ O=V=NyCm]$EG%EBmVly}/&ߣYVg^J4VO@ G\h8( ]Z}D=urB#b;3n޿.UYgӨؒ c;iv ]ԧQW}Łls%Mg\st iT-Ⱥw=  @;jcxNH 'S@S0OFe%MF8ρDúaTuyC"U e1EDA[uUNCOB RiՌF>ji=0l, UU.-Me6UǂTH<,cxn33HY=A4N(oid-6倲YƠ:䈈Xa[ݎ M vci <2uUPLVF,ߍI'u}kԙ>h4R4절otO SլPjw:+t5|T[ƐH@@.kƑLM% Bj v"{"%ڙ|_ hn *WTK 3 F3-0F *:w 뀁"DJ:V7~כkKkc̕I(:\d5aU~ Cv @y"O*)rI$bI I$H$J)RI$y%)vI%)$I$I I$I2q$I$2JRI$I%)$J|SI*I$)I$I)Je$JI$i%RI$ 򒔒I'$%)$HIJRI$$R*JRI$II%)$N)$GdI.S$$I.ɿ"JRI$$$I#5WSRAIt['qHTppu+RbD;U,$Ӝ(lf%gh U^?rU@v׍)6j9BLf6&T+Y<(`Ǹ+CXP-jg>HKI ; u~*y 1NƠ zplS\wT5X@BFo ;%A]-!qgK'k66K6]F],(YXvJTBu]$ŋ^VI<.S+9hZ NOTcMNeq4  ]T4hvS}Zn%YJIP{*%mW#alFcTi !B׆ +k2AZᴅO lE_=5}V}eUXu x[}[Τvr]SrGPtTCgPzC gWg2Km?UW;Mf Rud Ӳ!Rq/璥uP'I2g@!<d 5}-|P`P-]dM"!$6\#O, s2 ܬ}'V.A!w O'zloOvcn.;t`6|՗oOGO:9C&y8Ȑn n48&R06 y4k{ ,_ ~;Xxy*F5`s}V)6cy^-}|a] R/c5Efi$pN-ZӚTR-Uz5ah֋]vߠ-~*Ukn桙6N$:T3RVWPE)yY}Fn0gN]-`ӄϡ2AkJ]׬N&>g=qnUnA|0SVP"%SkJV:7r^[r h8[4>sFrѝ].Bry fXJ]aYs᠙8]FuA܉v7LQxV(:WeţTtܦ4_ZZF*=؎8rkgqK;-] f r[6vGaS aW\ `G sgu]5 <:d|Ω c1oh S!ƒvʲks\O6v.Qh6ATt ;Ai.&[ FOTf!5MP_9avxk}LN7%,;h|uF:Tfd Bm Gs%ކ[:vyH([5)6$@H6L#X)&`|I(nԛ&v4ue HYS ,4&?sd)AbT,%!PAR.W'DYA4&GN53tDoeV#{VXkwrTU<91Q*EA΄'qGj%ж0hoR@hB}J͹04XNUzͮ-ռ㹥VgkTL*=^'Z٦FfCѣhWhՍ[]`BGD!\|V^MJQ[cĬIqXR.}JmQZmmf,@~1p` yІ!WWywqnPտI*`*AC3 5ht\͌< &.KP4#:X#>U %$^xmc`ÕWI G#KndE2>֓MeiYy] `X]+(䮋 TCpAm\@U2t#+#[oIv;A>I:]?<{~KE BԿ=V!gݔLnL\b}Pǧa/+fJXxJ)jxN)oL\TIJ|RBН$iHTI$4iIJI:Jd(a1()d$?zEQޒ'It(wL]:ISM D)$E/L]⇹DJRI$_☻T2Q/IJI$wJm\%)$E/Q܇1rHRI$1rĤ$J{(nL\I)%CrmRI%=ɷ(M()I$rSJ*RI$4iIJI$1))IJI$2I!I$I&I)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$JMaw4t[bQ )$}'U[T2~եWa)Qc9`7!"J_ϓ媣oz֓r .}C?GAIQ0}γGA;3uv\Eu6z#^o@e>+9VqM<=_d;-¶`LJZ8@iddG-.>'@_UAQ GN *ApٯQJ".ڍ1`P{"VPRL!0|Ҥg]QͰ֞ꑴ&4Kw WSvobrwo-p2. VPBtN.YASnDrO LyVyQ,}q%gw!pA1ʃ wZop<*w5V UCO|%uX٭:Si-\Vc:W+$v\mwOXena{v%o(S')I$)$RI$҄ȡI$I$&I*I$I"%)$LRI($)$I$I%I2JRI$I2I~D"JRI$I$I$d%)$JRJRI$ II/o RI$"d$$I%)$N:dI?L$$IɓSqJRI$A"TI)NuM I<:JRI$UΨnt΢6 5Z6],u /QPJ鍠 wrV<|T<1^'E[*u윖j亶8<7@ܫӾ ڤޛ+_&5*XG 3.u&mVSP`}vEx\.R%*`䅵^Hêp,4W9kd%nGR 9 $* V5uYa ['P÷L&]۔ NSWe]ʻEh61H*3F.@Z|@*a]#+n6IpWKe6Df.K6rLX8ɹG7 S\׹jO9&,Kg]Uν/$v=?F FUMANazf%f_CL@R$JnJVEƇ❶T~Dα&R<% @dWtwZ4ȎvEZZDjGDqju-hdͦ[Hnp\}HWK,:$Cnl8vMs˂ ʐ+m`[$:l\_Y;I;ac64'Zo7A w D t7¯usB'JK=vb˙,2|8VtW*#pvC˶ETDomVû}W^t Sl Xd7-2FΛdx(L$R1p iw _&ɮ7)T܅1[[9p 0@uLȳ-5F.;)`=u:zt9 r%ۭ[:Zdک|<Gv?egX⧒~hFɵ7kHtT,6l uD(9%t@Q ό&ܫxق:U ݺQH]\7skLj׈1Sv q5n < w͒i&+l|eS:H\~e;M"~KZ5 G&k\7[|d/WO="HuʺNSk!z_NUADҤE=km$I$JRRI$bHI$dҜI I$)$tLI$I$$I'LI'LI)I$I'IJI$: RI$TI' @QM @I$wUq<->7;- ~E@5\4y"4$x]? [%iEʀѮ82曎uI,ĐM# ˷NNJ`yQ/E?O{)1K/cxXf=#Na=$^3i (5V;vLdCm㺗ҍqҴ3)4}ԭ=!d:"7i9РO4QX0SLh@d xDqP&IE,@<$1VJeWp(RI $I^ZP$zKeXegI)rJI]2TmkSsXݍVDjQxo(BGuSB|?O]tp36%έےN uu$,Yk-`}-Jχ`mpΈDciwy(-̍+=vLoqέ~J/Nng̡q/הsPA)6E$;FʤI `RI$ @ $J*Mi)'bwxEI$-n}E?"\CSIX rwPǣߘY9[ph;uU1h 0\Vm6jct̕mkxRF Lվl?xs8+rZYPdg]JV+ݫVNSL' :5Cmn˟6vhO%Tc8 !P.ή ԑV/sg~]jW`'ZX?VrNa ֵ׻3Yl[ +`] cI.eLq;-nF85騑V^O\{g *$M%x dݡt_Uq%nt{o2^1 Uʄ0B,'IHҘI)JbB2))I'II4TKN)d$)]<&.IJI:Jdv;BВt Gt5 $Nt\rJRI$\!wQ.IJI$ !L\I)Q.Q%GrHRI$\r%%)$Sܘ@6䔤INS(JiI I$& JRRI%=ɷ(JRI)%*$J{JI'4I'ҙ$I<$TI:dIJI$JRI%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$w?LPRZ4t<-,O:RZe]$7jJgU '.q%g^3Wh(Xs@unhϚcvS "3vK>ܟw h$xVtRAX~KIJz&U6>*_Uv1[?@Ns"!\NNNϨpd(l,L,z~ < Pt&uQܔ",ZfOa?/_*S=e4 CC@xQk@+Ш;0 ;T΢'@\#nDl4E]- .5JQ2)[A'-YY8;Q/jϷ4BͼTЈn3 |&R=peyqVy<7ܭJJ5B 0@*&&_l5jDJgN TȀLGeUݯݶ@V,hʪ:j\)(KPI@T=A2JDj¥ӦXlBBI)HVy<%B(pc--" ,| 9VmګLxxEF4 ACk B}[JAehȄž)å@:)$bI$$ILJRIJI$M_<$IK.tI I$$JRI$K$I%KI%\TI$dRI$%IJI$K)H$IOtG?K$)$I/$I)I$I|R)$$IM= %I$c$$IDIJI$~DjJRI$G(Ҏ%)$LHI%)pJRI$A)NI$91Me3WEрh4).K : G,lxԐ6k4)ౘ!<8vU:C=@|JzPYQ::6ooeӰO{wY #eVV= sFB}%6IXۼ*P.YXnxRB[CT a9Vֳx8/oGɻ҉F=Zk|nBm$$@.ukc̎𹫺c^WWa;<:O*o'` ߣ! 64pr}rO|`_>1Xiظ-JӴ)@ 9 G&=3{$D(;'ZǹYvZ"<փ_[F cPFR1 9jK.㩰2@^uidjMtR5m3%6Cf Zjvݔ K.~|BDPڵfgő:#ә3T]Vy aK4 ]6{V#l+#Ą+-4\&k|:9uf>rExFX?X0{K. $*%Diq]nƏH @?nNۮȯ.Ȩ(ku|W wUYӬ~T2%:-Mw!piJ*x3k{%aLP< :Ș@~;Έڙ$x!&NGuRI$I(I I$L$I4% IJI$'I I$I8H% I:yLAJI$_վb@YL Pn#R Nrs2ŐkPX?YIQK=|۪^{wNc]~O 1gwW` 3¡!Y=l1N';1U#-txW+ad}ecYrR^64K@nSv OmI.2IȞay::^+,@jHZMKڢrWyft}N\O)r1šJl%D2IY:I$xI$JI$TI"xЂI+]{wA?Ua8JJYyOM s+ P,Y!ʷWP}B&V{]\ }O2@!Y>u{`%J4.09ڔ"M\V7%.^Md}Bf=l-䊋v[>JtR&׀4BI&Ik--'{*ѻlaJI1 ruLOl,b}S{|jT+ddu%}uǯHv'@>eYgpU:FMA#0VUH<f}BOuSJ KK5D:\{!<"1i8XG89ce~lK 'UْIEKjtT z& xzlϮ#貟2qte?MO$( N(Wu0{Qk} V̬Dnfduk0<^1rw 읕 +R@ybtLhO-ʮKY=qѺjO@#%>yr>(}ܮ# Ry0>;RuC$M^8LQ.QM)!`!<$2r0꒕ $<:&.%,$#C.t7k %ѢHY$"nQCwrrJY:I) I)1wt2jI$KKJmȪԒI"(Pܚa)$SܚT%6jI$˓(&INS(nLJHRI$)BRTIKrbeFRI:R2JRI$RL*RI$2I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$i: Q±⒔I $+'\6е$ܚc `XL7⺪>:= \b׫,Ҥl ZHncjZ/ kcgR,!}`jRa: ~*M{@ 2Hk4V[Mm`|Q-)р圷%+/ R6}; & y["G XQH :JK-o"~(Q1>RrJ´joIR D) PE4Rx XR.+jfRWI 왥ӺWfkb0 _M> R;,@XZjN̼׉e^XNEbSS69yUi4k3AȡY)m.*,)R]79)7}UWfx?%F)%hV4B-Q'';-^+7k ;s?_+uV6o%4{κ-^KVecdp]]VTt*B^mjUgTD($΅aDh<((&.Xi[s1[s#DX[sģGtٻC! > *v*; ]bQyiL{A?U `BN66DHCp$|Vv44(V]5, 2Ӫ/a65VH=69 RܬK .W >uRt\N0.25Vg-Dl*gGR$I$cK%@$$I2tRI$yRIJI$$!I$q#:fK Ӻk[ĠvR-XM3] DPH#Axʋnp?*^txhu O5 BѸN8摨G9mf h7iNc2 5UfvI.8jakWp{={U*m ǥ~xuNݐ\sm+p9څsIaR[M<@ׂ sςc%+TZӢ5eU["Q+h 5}:Klh\uspi4<`ӹۼ֒ckuql9g+zUc Nk*]C՟%>)R" ԰ov,lB[2<+kϮkQƐYC4ܙ)žStkj>Qr7<ת*>>]CZkqq:쳒[̏w10z|ӥYf5p?ǒ|b,`V~gՊ}ZVGMJs-"Y*-m;C&߱ciՐF&] q Ouy`t!tnt3uK}[tWihs~4ܩeL0Xt?LxA 8VVֈM\iZy+!v)J|V b4 E;iS͓߅tƢXATGW6 5۠z܌{y11Xۮԭ-X5+Gb7`{ʵk¯5+6k{*G _Wo`O}&Xf]aT!l>Buވd**r6c :2%k*# B4{D-\;RtW,}N9s% TG׶ V=Y?ۻ[ײjwe&`+t.zc3vN$3RA+;#6D滻)8R6;WC\moXu1⅓AL1AM'w>he]@?ȍi 7@v\VhTxB 'v^8H2bz ->Ѣk:w7D:x׺ʩ\Ľ Mv:N&8SwK3m VG܇p$ NmlD(Av%ˀէBm Hty'h?1+W\6^$j̪\G`9| 0A9V6d b;+{t:ێNkdQ+ ^u|8'ǟdي8U;4-ǚWR=dM]Gs3CeM ˜Na:vf:1NM68^] buO]6>{*`POWh $&gZ͝:< YYKd1^dq?Yx-#S=;KRvJi>VC$5Llk9+Sw@~kݬH=rx];O/NamVWZ韝S9pUm57s=ΈnpV2`qCBHh)[u!U[s):I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$ʝgI( 0 +,}oM)$T{5aU%S͟tJiI$=lZ!oy*~ mR1JZHT!) Hh,-BXZX%(`zLQvv=jU릫W`(19rH\SBV'g<d)WCBJ:nkDEBl*A9`<qy,]+s{AGDPyFlZ?izo^!0Q f5ljiP22M=tUʨΩGEm쑀$!Yc zXdU6R`%E,S&MpI `Bs"*vDxY.~~1KhOGW#k}{:APk(@(WTsEffcd_~ЦKVw(rVd~cn, .KZ# ՘Veo[X :;Ut8WAYԘЫP1EqP뭼JO0mU%OahV@&{(>/FMj^UJ?ܕ]_m4 L.!>$L׾7RqZ>71ZŘkOvPkg~|טau_a}aeH64pOf^;`#wA*N*- @V{:&ւdIU`?8r:ejЊR]lϒ+ώE1#PX{h"cuC!k>ܬ[*q:SikuȇpZ$8*9.K Wdghݐ㍇R%uBNl+ tVf6QxW3ʐFQYۯ`^ hC*$w$|TsFDlmR5\EvZ?1*B3TAIEE96xܞ$ YҜpu8'8P8tC$Ri'B8Du]>bSЗnBwLk].km[w4@|Q+_)KI(k Zރ];% Mw6AWs^H^o􁟊N,.?HJ%tL6\=-T!d vm#V1`YJ: g0΋oP!+tZ+\}[RC×`FWVULj@cjntTlBRKWyWPN_a{{=N^mj bID([!I2u&ZZgt'C> hGP(AR] @n-tz.!3͎8 闛\Z-6O} A äuXkĮm-p+HG5!_zl$IrX(+$,)f'd`b:24Ei\3[]v4;1j**S$]K=*=ir'm5J˴!GcTUE:6E׃#hvnC.,+¢vG't^{+@Ymc8Uv[ˋPs2\hUmp^rZ M`j]!M=% }[Ψhh"BXn;vU60 k9M*)oQgxBԣ\eT$kDRe2 @aS*"kh4賺S{*m.'($GK1$^gECK_69VN_ց_`$xVu.[ ;%KqJr (:'asvkc6$C&ae?fT7iW2\D<ޞdu1ydĬ]qUMDZd%g"ݚxx=N2DmEEʡ!j>UqZ2gWq{A3D8Տeݷ3q:on GcXu"HUr7e6Ti< a+ʃ;ZWrNxT]_S<ݥ8%!Ifai!%I$IB}dI$ RI$Mzq 1 LL(t'GQt*,1Z9rZ.B2%9L)3g7W;\<&:jU%S~Tp7okqMTky¯Cv5`SnJuV1r.k%DF5GZB/ a50춱E[b$Lu a3?6xBvKdǢሬbxW\ Su** eQBp(N 8$A$I'ԩ$LrJRI$  )I$dI&:I)I$@'K𒔒I&ȵNJ{w?I&$ Jװ'ܱ׺k> B8 D1w6ǻY_pmok GA˻.֬Ji`j*";跌=KKlkO+3>f y΋9Z}y\T\` G- .+-mcsKk<E ߮tHlpw|}1>?Is8Yޙ@2d\U,熁 &ܧX}ڨ IpQK[4 Ju.re-`ZO8L?=瓢6k8}_Ư@{Vk47Z!5!>j̨r5X#qvV!(VТ*()) ,%TM]☙IL6B$\T7&<<'7((4$(NKrmӪi:(N$‰|hI)k ((F!I$Fa@EIK$$BDCt&ܒI)Qܠ^\I"wQ.P.L\I)&ܡ1)!I$rb)I$\I)T%1)!I$riLJiEJI$R)JJRI$SJIRI$&I)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$IBJJRI$0ķN0> $H +!H`J¨$URV.RI%I%xaSg+,r/mSKakfx-> .3#ְNJ*6ft*V,TLcwHHDDv\I+W}^Svb9Xs:oPNp-Lw%BYJƆ@mxs_"]Y hW-$IE:ϔ׺xe׏ct f%D:T\,T;D ԿIV,{Uޚ)$LpFĩ[ Vd%cd]UJz^~p:\= Im6:NFgyCq+wq*1Y+O(12L"cq\tP{A @$᧚#+oifiO,GU;É;]B{4%j~ CK^q .Qld(DmtSU"R5H,"4Dx*(.a&;vS8&쒗#_)0@uQg2{ BAB[uRY6`RTEqS!ZѷPTP7St2;[] Ea\]i.}O:\ە,1vo;8n欪xq2hFRI$$I!I$I% )I$dRKIRI$Q)$I$E/HRI$?I$dJBI$(IJI$ % $$I$_I$$I/ʒ_"JRI$)yJRI$PI$$RI$N%)$I:d"IRI$BdӤ$I&NgI$)I%)$I)K.RI$Rc**MAJI$Or?XW#l,x]}/եt6I (s+||oJ3\Bl.qW4!=fK,2g\BIӺd(S:~+:+Bv8`8ZTei.Cv`&dMY508I$2ȕD 53%t  \.#kyYTꮝN{h;O+#?6 QM+mUX}K?t ?"ˏu:&.+wNT<]]ʲʚpUTZwcWe.D:TbaqEhtcsi*LSdZ*aq캾YHV=%K5[XU 5Py_@X64VSzS{&!Vƶ\x^g]<]_. w0.]ԹڟWkݒ͖/*A![,\V Fɍ[tYS^;sh%Z9Ήc1iec!9]`oh+bzQ=9nLd/oGj@o*.@s%v[9L$[VK3!67%|_{@5 Yª/N AUt2 WuZX0j.ZuSxL}Cvilwľt6IuU-tLp)7Z*Zb;8,nskK ƞ]_|WX:~+G#桸Ac,2[h.h\7jxI{tTOԯ(u##Lh]!ڹVkzh#M!LI_W|em;L O౨̸[Zckcd^ݯ0^ݾ [``hZV8 >2I$LpI I$Evo jUc.-KIցJ%P)4GdjIC -W4 Y˪%BV<40 V%8 ? a5DP4 Yc2Rolk)IPvhdM'UƖ "Ȅ%bz\,/xk6T9gK)S~ 6NEn_W=}Р%gIuh$)$jTI$uI8I%)$M R<$$IO JI)I$d$%)$I$NI(cL϶%)$ʵSߚksI].F%1Gt m&\QF ו0<,_yxm`Vo; p6T۪#V/bamH5+?Uro{J:m#j5UVB=Rvej^COls> Ɨ4 cvÀJ‹t #+r38NwKvFO EpyQB߻ΟPqLJonZ>6!ۼ!<+YYd}3*ң?$ (ScZ:u"1:R:J@RR& )hJa4$)$w☹%,t((Q/%,$7G Qܒt rmȡdGv;RIb2!D%)$DܛrےBI%2۔7&.IJI$Q%DIKrbT&R%)$Rң4$JRFSJ*RI$SJiJRRI$2HI$yI2I!I$t$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$P+q%)$QILPKx$$HI# KO'4I%da) ~XU)$UWF;U*I%E%J?!EcBVRI$RZ~揹-q&I,tJI$o?rDZJI$}]I"RI$3~qF5m?4RI$.LS $I)L%)$Rҙ$I:yQJRRI%)JTe)IJI$IR%)$O)ҙ%)$NiJRRI$&I%)$JR$$IM)$$I)LJRI$I$RI$$RI$T$I$M))I$}SI%)$O*l膔$K[tZbW%0#hTVR@W]sViW^c*]iխ>Tr+ PݎһF:B.R=hy(KV|Hq^'mw !;jJpA畞έSmqS\Pv pSnb^N:n)uJߠ(qj]*#]*>jD%?SpCt򤉵S* XT;WYkܢƁXHA DV"e rlX;+VXD6[Hp-#L?K*›kJ0ƿH܀ q7e 4>`4@; V־4G*1uzl$<C .p>!I*?%/:9Y-jq0Ak`c8q&V-\i(9oJbU:}4mt4*ƚ(R34SԾ";T'k;*LZ kkN5WKdvES&UeTe|tj=Ŧ Y=S(L-|l&r-@YVXr +/껌BXݡY8XXAwwQUpefJoQ!ҫf+V  /l -…z";*8ʽ9b:纷ԯg欛TުK)osj{:hθL7ZJK,4UjWhRID {Kse5@RaEtn {Ced2/*dkDUc[NyC59Oݺ2j" 9!8A]QE達]GH9USt#ȵ7h?$Ӫ?X/5FIΙErWZmBAn qVnD)f'p؏b5#o7zޤm1+0궹Y`\ƿNH,h ]eh}rU^KDPKLn=,ۦ$ dk.{e'Fio囅ֈc_;X·g~IUSn3 9Tm$L8V~H2L mJ2K"J$pFNJ, LJ~OUFb=FRu K57ګ[f$Ӻ xQnKlwYӡBQ)2D*ְ>Vr#*\p5 /o0>*9{`[4=\ʷUf:EcP4\K ~SYYx4k@GSSUFd#QIyM&tVŭl42RXk&bPsԧ0J>[S%g3yAoGd+^ICvuRLhIFUHJUgSdKXho*e3ú,lF  R7nhO_qW1¹W+U ^\޷ HgtUۏeeA$UJI$.$I. ҄I$NRRI11uwa{pgR ݗM-/2>%/pW]OLvqf55Dv2ez,7fnI0.+_bQݐ Ѿ ٙ]|ԢKkn\<7Q݋"{~} s*/CȁCbcDkBΪuN!2-/,]Փmδ+ꅎs^f83a.pHnsU]re$})3#(S r+?ЭB@]i@ePn*%WD>{+.uu[;eAt'j,EWq3L]iAK'% D)du"RRRВt}„.:HRI'R& JY$!t⣹@)I'IE{(nQ.HY$)x&.($$HQ.P.Q'TIvr䔤I1rwt$$Jeқr%%)$S%FTw&INTfe1(I$ң)I)JiQҒI)JbSJiIJI$)$$IL(RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$/05%Xq)RO+I$oTN#OLeJI$/+Dܖ䬪I%;)JVUJI$F%~%Hb;O? JVTI/O?5)JR$Iz5MW<)YRI$ޓ?t%3}R)$Kg#[?t}JiJԤI?r^?t}JRI$^?t}zLД)ZI%3Gܜ8&JԤIJRܣ)JJRI$)2I)I$yJSjJRI$)JRI)JR$$I<))I$(RI)JRSJJRI$)J)$$J[JdRI$R)I$t%))I$tRRI%$ɥ)IJI$$IΎ *OVU;- /4Oz۝yn2$W0kugN|ykv~TbпC:f;OrYX!_m'[I˜ w$p5`8RtF}KݡR""5vVX4 V9EkDrBQeժ!4lQ,AQQ&'FLvQN|fFϿQldBQ:|Y5ȞUwDܳǔfT fW'*Zy8-kc^C(^^ ,19ux*]1-oh =;ЌcC6(%N#MbIhQ )o-ײ-t]Wnќ$TP߽[cDy!4@fM* $h|S+8G G#EaU{L{YD cE'"uQ)ˆ5,FH 9cCL6YOy*Te,wn7_&=lձ*.e!`v"W7' w s>=!d^5C,pLEY{~I1nT}$ۺ.3C[kTaw`"3-.:Zq[Wp(#)%I$dI%)$I$$Ip)I81n nuTSi TcK@SLWvV6; W0o08]-6PA:wuln|1ۨ\wtv;Y/Gs^O%^5(\uOَhc*}7;wZakk-@R028 MCSIJI$hA}ĝ IZǼy߰tPbTZ41q*Y,ez7BԞe*6R%mF_8^"L4@7FE4 >Zvn*4&Ukp68ǂ;} Vf^0kEVz`|Y|hwktS6ZK8c~0  P6$yPqNvIJNJ\)(iJ' E)1 -&h_ZNǬR+tBPiAn@VLu]uU\tXHBk"tBNsNQzMX,'6U7c1HOB.SDYTp @A@0mE.{QSBcc\XJJ3t$ k;M)1Ni!rI%kP]Q;tRl͡dYyNe;@^ [h@< 8 ^QVgFm X?F*?|خ2D1~Nѯ f[:hmi׺]2].3ī!E5ܛL3ÅvI=Rȧh}.;f]tzљ wBe Eht1i;˄ ]zN87{ ?ՖVJun)}4aFR!2h \|%K/3(2s^21u\xZa%kbWȴd5S]#mm#(Ii9JŇ#xs` ޽ *`xYxV(īƭ!>W -}yGǖ¿_%ֻVh |ռn~Ga#NƉ5FUBA]!#\L8tXRߦ=J1>a~|J{5&~WWeGk5+m>hR<.>%0δu>Q¿wSqS-~f/C58^m h ֒7)`Rڞ™y&:";StKtrmò T% (R. D(hI:P RL꣺RR$œܡMJP\@@I:HT7DtSܘBT BI$M&/C.Q.IJI$ tJmȩI$tܠ\IOwiPܘ%)$SMCrm!I$QܚQRI%9MFSJJRI$JRJiIJI$)QRI$2HI$t$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$h—LwN7?VX ú$$49 ))tI< : RI$$ĦIJa)L%)$RE)IJI$)Q:JRI$SdJI$eE:JRI$2$I:yL$IҔRI$&I%)$I!I)I$yJS%))I$IJI$RJRI$ IJI$iJRRI%$JI)I$rS&NI$tI8HI:dIJI$JI%)$I2t!I$t$TI$I$$I$JRI$I$I$I$$IS $$I$I)I$II I$I$RI$I)IJI$NLIJI$I$RI$N%%)$I bI'I$IJI$NE$$L$BI$O)I*I$IRI$p)I$)$IA@4$襶Fi uL0(Qo - dTq$Ϟ; iͱ=SsASL[)Pɔth%ঘO Ez( V;aN^ړGd،~ F ]ŽA!scd*݂Z Ǔ¸3X}d74dT]Mkjl <8*BBWxTذ$! [" [CxSq[«sP]ƫ_ CpL}6V`o+eI%^ج)tP=Q p\^ݖNCX;EXִĠ:bhӒ8Xk?\ c>/y{=)s}?H|xI]kky0ulէUda8 7L(jΩĺIqom<m1`Vm*gV=@^o^e8 !v0t(s>GSI 2qi+`}`fmo!^}Lw*'#NtBvHa:iqdLBez ]eJ<"4Yr+iY{9]SuI9ߺͺSQ5%L ¯zX TFӢԲ9EMQl04*Bvfֺ[X<=W3;\FFCqs6v{߹rQljM-"dP$I+lj[%$I- J{Uhp!V}½ #fHweUh]G鸦owjYEW$|Pr@X2-|E9+7u۹W2qwi#cYPaw.*PU[[6hRUAQ02 %)15dX׻c{">5=}l0YatVT[4iTe"32*61i($z;zSUikfgu}%E>T3dmc(KIZpaXYkro<- _9vjc}U6wEd롕L4޻5X?]QY2a|`?z£~SkGtD Evz@Ԭ߬8x`x$v 38N$OK7kcW;ZT42iaʵnQz eMfkݩ)[.E]ʲΝauq& 8) h+3}%Z޺Ə`Ϻy%ġ!9՛GLOw[apէZMf[Jg0n;V-uk@"ʄ(PR':((ΉJJZIԉDP% RۥDВN'R&'DztwIKBI҅2A1w~.Gu w})hI:H9CtIK'I%2^] !I$rb{nIJI$w()$S%DFS $JD L\I)@1(I$۔%)IJI$&JRRI$JiJRRI$LI'I2I!I$RI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$qZek幹`d3W:vgX|!z4mS!Gj-y(L\I$ m*{ꕩI$(Dڔ%jRI$PtP%)$LTJrS$$I)%)$I?*)RI$JdJI$I$$I$I!I$I$I'I2tI$I%)$I)I$I$I%)$I$$$II$%I$tI%)$N$%)$N4I2I)I$}MI)I$t$I'I2tI$ $$INIRI$$RI$I$I$LI'I JRI$dRI$I%)$NIRI$$RIJI$I JRI$I$I$I$$I'RI$)I$I$铤$IH$I$I$$I &I*I$I"HRI$I$JI$I$I:I %)$M Iq))I$v+_"wY +.lYc!=3OKDra*$I;tMD*|ΨWBEC"(v=8UJv|\X!Hjx P)<SBL5SV$TFԙ̧6!`緂!IwI<@= Œ!FFBIuNӦqB{QHT?D- ABTn~6tVjx$$X$9V-Vr!L KB.53k }I!j oSq*{%U. %ҕg*S/+#P6PwM? bp$BP˥"$jxN$]*:J[}I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I+ؗc"텚G!ob=jo!2zj$ tn!<&.fdc›^RBI$rGTI$EJI$N$I:I$I$2H)I$tI%)$N$%)$NI$$I$I)I$IJI$$IJI$I$2I)I$I$JRI$I'I*I$'LJRI$$I I$I$RI$$JRI$$JI$H%IJI$N"I'LI)I$t(H$$II'I&JR)8IJI$I$BI$$JRI$tdI$O))I$d铤$I$I)I$I$JRI$I$I$I$$I$I)I$@I2JRI$.RJRRI$I~TI4'NI*I$yD|Sy$$I|$)I$dRIJI$ sI9RI$7~BI$W<*:D"Z&w .GōgWN͇:zj Zd)4@0LG O xXl3: 'z"VQn V)µ`p8Ȳyi\uF b $Ȥ(k ";zc [ϒv CSնNd;*%F$qdxK$֓dՋF✥c@N_RQ<Ԛ5GO N{+L%bP,1nP.|{uE>COpUh^CJKzӬʥ=|%3?5{X(e-cu<(6?Tr_'`D !A!9Cvq2pQ$;IP ʅ fC‘1jܓkScê^1۰;iFf.Ь|eJ̰AmhWQqGv."uf"?4-:U>'kJѷ'UY:dDGeXHUe!ddkStV2Z4'u$ 0 \I2^I'$$II/4I)I$RI$KRI$JRI$E(JRI$I'$$IpdVP] RI&BMCԅ҃;j*B~CTh&~γH=[s} K!eVytEGӯ^ː~#'DYX X, 65—=,|VgIXW}%t7,U;z`agW& oePGVݏ:sÇV@/V?%tNk=Ԅ(j9mt,Y_;caD{^cO uExN<٬}B{v kLP1ݵ82l@TܤL S:HV C؋Q CF*NeP|lWXQ!&I4N IVI$dw M$UH6QvbZ>)ZI(lSk!3PJI$88W|iTI]vHP%$4ID78Q6I$ILrI&H?I%QₔI%tIJI$2t$d:I)I$d"IJI$I$)I$A>R%%,'I<$)I$R$$I$H 09IJI$ɀ jct~%mVk ZL~e8u eb}nn<9'eGLȸ|iGOV[\r"J veUP:-pY3 p~9μ.ѕ5GSլ@0+/s%W)j'6 'iCD"Bp7DBO4Dt˓J%%*N)JmzEK'JJb*%JY$)wL]ࡺwjI7&([ܒI:HИP&ܒ$\tp6RI%="HRI$ǺmeҢ\I"<IJI$ %)$S %(G)JHRI$JĤ$Je$bRRI%"R%A)E I$4ҒI'LJRI$)EJI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$~ulwzNG,RFAʧ֬w_7$*uGk5}YnY}"P]n'N>F%m"G Ճ;ׯIoXӹƥpp.2{ Z{!')RL2IBHI$IEJI$I$RI$I$I:I%()I$I$I'H$$I'LJRI$$RI$I$I$I%)$I$IJI$I$RI$I$I$$RI$I$I$I%)$NI$$I$I)I$I$JRI$I$I$I.JI$$I IRI$RI$I$BI$LJRI$IdI$I*I$I!I$I$JRI$\JRI$I$I$I$$I% J~)I$b%$RI$I"I%t$$I)Z%0I'$J)I)$I"C%)$KԥrrTI&N:HRI$pcTI]5osW,9[3 'ci8q ؽ(V5ZN4Od1']SR=NΉ1tע+#W6m+^]"VHיJa&`j(? )Uj >Se9 Eυ t:tYLBtrgUnbr D((mD)F" 2b?G܄Bl~UV|;2A*) Dh ɈWhIa{D|%_'lJu&7vQpۧGs2B6=Ίk$*Ņ"5@[2OMtSS 5x*McmGeF̳Y tMvIglr@tU4X}Kt%Pp.9֌YabVZX5.Raw~92$B /|noXGϯk av7r L VlW5._Y,UEnO[ysd@ry{,̶G+ˤc"?{aDE#Q喏5ueI$"HTI/Ș'LI$OJ*RI$$RNI&J'&IJI$ $<RI$J#⒔I&K'Lt$$I(OIJI$D% ')I$hK)"I$RH$I$:dI/4$)$MzPJRI$$)RI$#$RI$H'I*I$TJ/0UQyt]74AI$zRƟrӺXƞ+[L +5R&O(Qc7MJ3erdk +#>ǗhsF!Jf"$vM[n*zYh$ SvSDI5ru*5B{9Oc9*w( BZ=O-،5pU>[y㧚~sXuWf h;l\pF#*:vI3+e^I5=΃wЪnfD"J)d ovQ $4pR:zsS i q.ԟ5SiwP.¦]δ rPpkY-mIt Ĥd&p?hG?d.~V9@N+Iufaq^Z-eP}Һ'乫1v}Q;T-`&FDm)*Lco୴<*nTCI0pNIրRP 'JE-L\%)$D4jb^65Rğʺ]%O/a~+ 75W*]VzVFIƟ8j#[4h4NY 5ٿ[$50mͿ 2?D[tt\p'čUV^u<#{g}m'qhamq1ȭ7+3hhV Zo\MS?Y.8]xR2\1SMh$Ӿe6k>QnEh1idlt72IUn J^_{륬x""9%BS8 Bu=ң$1b,xIKr^JShI& を._RR"nQ.\Oޒ6Jb䔲tS/ۊL\I)iDoL]))I$&ҡK%)$E.Q܇1> )I$HC L RBI%=ɷ!J|RRI%=ݓT )*RI%2Ĩ)$)$RҘȩI$yJSJI)I$yM)EJI$dIJI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KSVwL6^[cCW.X;?"d_#fPne.^wnAo髜=xdHgdĺZ~''U:'4," CF#6+&N(RI$$BJRI$tȩI$IJI$$I'LJRI$ :JRI$t $IHRI$&NI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$2I$$IL$$I$IJI$I(I$)$I$IJI$JSTI&NI)I$d&I$HI$RI$I2xI$I$$$I'I$I2tҝ$)$I$ )I$I$JRI$IJI$$IJI$KHRI$'𒔒I$$$II%)$J#TI:y< $II:HRI$.R%IRI$ĶIJI$M)'IJI$H)%%)$N9VϒD6B)E].=îV&d*(^ʤwG#5х1nA(NŇӶ%T?r#"LI2,~VfQFR@ y&RLVO*^\!PiR{j4 5DPy8T3ur4Tlǂ &#PZe踗t_?F!N_Eqk@Q~/32TX"yC7}oV`U.|1S^z[qkG+fƟ02G~LxBbI!|!pDiv6y8H5 K9pxi  wO3"# {|QȍtujtwQrg^!UZ^!dƫ{>+Ƙ`jջ=!rTc4F$>T-rr|VHvEe=2 iQIsXX6ϊ[bD;VLVS!;-:4* r) $LKI7I$$I&NJRI$$IJI$M IJI$I/$RI$)$%r\Lk5e 65֝t l5cUӎ]yQ,'NI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I+=?1w֞Y$,ik*I.^ܗ6GU zcI&NJRI$$$J)TIE$JRI$$IJI$N$I:I$I%tRI$I$I$&IJI$I)I$I$IRI$I!I$I$JRI$I$I$II$I%)$O $IRI$I$I$I$$I$I)I$\LI$JRI$ti$$I$E%)$I$I I$I$JI$I$I2t)!I$I$%)$NJRI$I$RRI$I$$I$$IJR$)$O wL%)$I(tRI$K(I%)$Kt$I.5J~%)$I BJRI$.R)!I$R\|R %I$P.S$$II.8IJI$NrHRI$[ku`5W6:u.)p,,P, -+)\|3{dwUmG^Ec-i2aV>i?T7T] NƉ!:J b kTEv X rNBѩe#Xu&O W 邬FVaL {iVHU[\ftH@~'DVuO26G;g9h[ufR=m9V,ZJŶ`RǪNֶ3 [`}%Kki* 'm~2֍ENz;BJg\q2yTlt\gKʾBM6s%A[T/Y@/s-hjr\8 f^[ߎ(9gP T79F+k,#K 9S/ƺ76.UOW81yӏk llq/ps=o5RasO6AӤnyU_y4uՁXs V>W Jsn⩒xUPm3|fc7eb2IɔҒI)I$dI%)$LO)RI$JRRI$$I)$NIBJRI$I%))I$I$$I$$$ILNI&I:I)I$dSĢUE`'RL$iV/+okq/-tʖOZ >JqlLLwrG]}6SIZfO 7/, ?X/9jŻ5]1>2r3{>j |uZf_@Xێ]?3(m.p<2H('CS~O$8Smm̶\I=ɕԠ͠mQiy0MRH+2W8JYLnS8MIW^Qtyɤ,z,ѦO떿FB.q'MGຌ?Vm!],Lh7w+~ *W+.~̷٫(-cwW8liraa20Em Hku;λ1sWD-v~cP^ඩêbCd(`O %=%:}ɷP:rGrHY$B2(nD%)(I%2"8C/Q/RB(N!wtt(IK'I$BېIJI$ &.=;RI$BPܘ$)$S.BSnQܒI)nL\OIVIOt&.PܚRBI%-n))$R)Q%)$O))LI'2HI$t$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$xpr!P5 D;I$e"$I$I)I$II($I2dRI$I:JRI$I$I'L%)$I$IJI$N$I$铤$I$I%I$I$HRI$I$I$I$$I$I)I$I'LTI'I %$I$ $$I% $I$t)I$I$IJI$$$I1HI$I$$I$I)I$I$HRI$I$TI$I$$I$Z$$IJI$I$I$I$$I$dI$(I$$KRIBI$$RI$I$I<&K%JRI$t/4I$BhtI$"RI I$KIJI$)~ "I%I$IKI7M)I8=G(a:HRd.^+)cnwX8Y&rl+ɥ74 %6jSg8\QaYB]f^7BĶZF:yy/-[kr'R{&Ʋ 5E"T<"YvPQ^ 0Qj]ⴺ}V_?%kͧ³]ğDH=wXʴǴ꥓T\<+jc?[;q7fp  &|QU{9Q/ {)`^lqc |5+8=u%xRBdgnW/n0=fhÕѴhk7 ꨼ʵKpdN^K&sF jЎ`,)tcY$>a8i<.mkjt\S DY 3xᗒv7$z:nFI -,OgvMҏϳ6_]Zagf}eм8'_K/}O"N8XVq^5Tc@GT\3WK}{|؝JY_a|{`00b l*<*Wu`(BE{AN̒|;@p2VJ b@C!\N?;EY?B}c|xc^{koܯ vmCRK<|h Z}W2ݣk L}L˳W@Bg\6h\~iZD@}Dc~hS3 jp}'*]%6n?b|(DsTKLJ Npwb Ĥ:t4ڢ$)JrpL\t˔K rJY$"&.C.*.zHRI$\]^]))I$)r2SJHRI$\\\RI$6ےRI$M;%6䔤INSBSI)L\)%)$RҚS$$I4%)$N$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$J MgE&<BI)$W^ Š|XU]FI&N$RI$I$I":dI4% $I$:HI$I$JRI$I$I$2I)I$tI%)$I:d)I$I$JRI$I$I$I$$I$I)I$I$JRI$$I*I$I"JRI$I$I$0S$$I)$I'L2JRI$t$$I$RI$$%)$LI$$I$I)I$Ip)$$I$tI2I$TI$RHRI$Z$$$I$E$$H:JRI$dH $I$IJI$'LI$t?H$I&?"))I$Iq)'IJI$׀$)$I/4RI$I$$K$IJI$O$RI$$IIJI$C/ʒI)4YeJG~׃:$xBopFLhoj ] !hDr5'5 %;]YiP'XYIiӲV^2@Xq) ZM$JA)#F.D EBЩźvcYREJ%cVHFF?XׅrȐ\ckH>jۦNfN;ˠpQcD#PUnRxe fcIfg}=K-wE%xp55{tH 8ռ# 9DL/e΢~T]=|9DӅikUyUjf3=O u>K%]} =+&^@yx%TR#h] c@3΋Qc?&­uѠ}^O<ddZe8h˩;*cA B 'Ur/- ౙ9ӵK{*#`yHNYy]AĐ2,&IRXb1Z܉$>ݹ]7I t+~u ,utBɔβxF\2=j颎؈H6>솀qݼhXV RA@au-I.)׮pqhi%)$Hg CUr zWNeM5OxlR Ĺ;$:c`>ЫtF1j׃[;B[g]UB,l[a"ˬygIPx#xINX}ux-')h30Ghdt^ށ;G!ݠṮtLcMH\W@:,lQvl]Pѵ ԝ&![%V ~+˿6WBhZC"D*d$,=H4d6-(!$$I&~)RI$ɓI$ $I$P@D RI$i'E^Ċ@1 T: hʩh·Z6J\O*9vΒtPKߦ@Ы `pSXU7vWA/eZ ۯ*.YF'EP4Ӱ: u;)Ds(2nagCtH[8#Kf[ nn+Hiu!H0+?{*[ .08F}-wau_,ǚúҳ h tZ='2lñU13)h]WJաk0/qײ2-7<*yYeĪȁpU?:6WXT4y"%) E*I$%)$N(NI% $RI$О)%)$QH5%)$MIgaq~^a`)Zb%QX_`>CR@J~Tnq'h0c-NA>SX wXq |4ZTq<4R;Zf\ʆacwn#yOQȼ*3q>dXӣ>A$ D"^}{̊Zgoǝ͎_:nj$h8 $J6Z։$G#S\B:v&tԔ LbtpkZL]ԛm֝tB}K,+>hTߖ~%+^1ywc˳] i>pWsK jĭjCm՘ߣʩgYhd91W?ꃌeW,A#oNm|Uߐ˕}*%敥ϣ*la<#ud!nMxAL)$_'DۉCܚQCO P!t((&%%- BtJb1rJb] Bt&$- IOriI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$XԻP{vUq25j$5\6XNꙦtU'2 dI$I$I$$RI$ɔLI&)$*RI$I$I$I$$I$PI$2tI$O )I$IRI$I$I$I%)$I$IJI$:JRI$IpIJI$I$JI$I$I.IJI$I.$I$dI:dBJRI$:E1IJI$I$RI$tRI$$I)I$pPJRI$:dI%Q "$INJRI$I<&IJI$)j$I2xLRI$|HRI$ҒI'%JRI$1{I&I?)RI$O$$Iy$ BJRI$$%)$LI<$$IKjJRI$:ITI $)I$II)N>II I$F%зr]2͖J:MR-U"BU\@o -&KDpjFf'DZtU:yq#x>k| y.7V)­jYD5੅Bv#\UpRk9SHT=3 R'`2Ƽς Dk(9Ğ{YVPKGj^%YT\!Ot8phyDǫse(ދmp'š[!W4HE$79ӰM:hլ(dv@MwPyTZuQn\h Yk,˃H>[6EEZ> *ޡeC{O~U s #s!:zoS5ܸz/2Cibh'i kS4h v.d$,=JOnU`૊$K)$HI%)$O 'Yãְ5BԒJ681C[qE5VF?1NW53c{T ]*H@GhNT"J0 l!0'@.M3})'G)$Mc~4y4;uA ȈS @.'6?n!.@aDQ. 髂ĐeH#ۢ`8|\o v *9 x3'F^wHOݦhea'O6K&5Br)oL}Q-UNXHXwA%iFQKJ\I0I:HI$d"JRI$-CT% cTIlb) 64Ai:\\4 lY@xo&u%g *lԝ%F-ҾyZ85u KH z4?h&h(lmZ <#'*p_@u#],-0W=ֽX'F^RrJ/KVtˮ!{ nCvV@Z=[ L2 R1p +M:IJIRI*I$D RI$Gj%x[O%)$9)-z]3WhC- ]1hrƏ֮OM XvWHĢ(KKt`Ʌ25\]XZJ~G쫩NJ<$>H O]}Ga\.TC&NB~Rd2~%^~C+TT펪^' 1[ %c5䵛Z<@ү čVT E`DKo Z]TiHVk ϒ>l}$ xįl~ M4^_F³_FnܺR5r柖hJ smcW} ̻ YgH^*B3k E[e@Jo\@Y(!k@y Oo\?K_0v|Jڞ3,(Pܣ)%N4jxOD<%1'ˈ(r')nЦ$$:Ĩ|N)LJt/IJI$˧YM|蘽%)(N!v^Jm݂JY:I)L_zzHRI$\ GrJRI$^^6TIOv&.IJI$˓(&܂I)(*2QRI%"e4RI'ܔRI'2dTI<)I I$JRI%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$