2ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 10:29:12 w &.(6HH Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?߱׶T[}o*?YM}6Z\ck[nǛX_A{ZPkKvzޅA<Sh{As_)G1m6[lg܀/ jȤK.yTnPcLܪ}TWjK -^ԔkWn3bg}E5,5z/: w 阸y6{Pv[ݷn3}UocmW!ݵ7Eԭ%:AgZ8堓mk}NeӛSr[i"KNÑSד_V^S=G4Z8mf!4ql}.:3uؖweb}˦eE쭺m]F%4ks5ͱ0^Q4d<ןny1c3M)zrr}🥪~l[vx,OWҷv$ؘ[>Ѻ/W80s\j޴RC^֍O"<BJB(zV_?ZgnR}d,tv[ohGPwA_-v=W_xxidN6twWuTˆFK˟Yf?L6]hoy'h,դ<8 loQHd1 0ce7t'v[gM&Haw{?qTyQ_.EIWU=kU4~6ܴ`:PM_^@mv F@gL ]-+Ackw- sIp]{vӱ9%kv3AO=zw66_,mk{Z=veU5_ sw`s_oAvOPim09 C{sOUikZCX%ΰ?Ĕ>N_MnM]Y6dWps,9ۨgn݌?k`0{X۠G5^@!}rUGw*[S ZW>L_g]/H%R6X[/  Rf]E7c 8׭A]&fYq꺜!?G5g3~ŐCKާ?9.vdfavPeNu>-7n{麟/DƵjqtiڛZ>5?>Aȭ]vPYb⾣U{tzgnmV,"ƯZoqN92\ntUw{iVieauG#k~=_KѮgnoxvcYk\Znsnȭ7JMNcRsnbUcqPi~S~w\>֭hFV]u~ nb5i 8-XwH^cc>H mz_S}X >vM7]xy u n&Uu\Ý02dA!ŵ°7mmٳçt:VV:V֍?mp1~)̓xU96?67AGӬbjx:*vܧ_oo[JKøPYKn k[3.)F vsWqmGݿΝߛ?OV{vSXh?^./8Bڞ#`EHth@kb|+W#QN֐t a>1r6د-nx۲~\#풸χq~H6n" U"Mu ]ϵ{۬gZ.?J{C_a w:F~Vҭy1.ul5eޤOoW?kk}7A#dy4US`Aa{ F;;wPYCwYv(}\g2Slcrywf㶺nݎgh!͵ͣ8ծqj>uX:rGcZ\;'mnɑkzkj7ѭ馑) e5y>.~I?u0ݛ7~ӣwo7i]|Xqo1ٵˠ ?2X*chk`sq? gRޝ1V;,-{ktNVU6Qk}6MnU&:̮S82mIYYX3nF?}VUFmŁS-?G[[K즢&H{FYgҏN.Yb6m kvߠ16l:pBE↜8nl8z;Oޣۜ*A?wM"{=UAݸr~8dta>3`u^@toON̞фjraeSM5p:F̻;~Tk 8wҟYX; ͤcpjS3wH"d͛u Vh$ok]c\8=5s6ʿR 65'shq;讞*^hn㻟kRq umvNүꏵ6?x8?ac.s\~֗{qhc}\#lc͖Y̯~sE;sĬY#~䫽R˘Z$DAKv_c~ӺycX+MSVQ/5dWZ=5ſKcNVfA8EvMly@P%R$sڽ8s]nh_WQX`e n}Ǻd䜪uh4S :6QMy?s޴pZݠ15hkDgk9W3r:7'Buxe7DnqSYՌsiYg3 napGuK]{HZ5Xp`a.MvD֓By v?kmeXKCh;~lsUԂ*a5ݷ_HZx8"?\vzض ,U:mZƝ[:?7oP:UP N:kKxZޗI0z&1svi1w[Kuι:]F\[-Ԗ'rf{p?/sRU[֑3 i WFD&Lm޸q6X2jlEw_ޢg\em{_k ,-ϏoE o6xz'۔$鵶zmiщ@  {_0˃];erv 6;gB pQ /+Mѿ2Oscց:}.:|Uc#A lbCgժ+旰O?,f=r=LS-m}² ;ZVNm`y:y(]Sak%p]cƆkkGN^vKH )mwkVDtt}nb˸XƂo< Zv?h6e`5߸؏Rm$$IGMߟI3dmLv¼[o ;=?r^ͯqVh(]oZ,Iͽ6w&#=SKk4=;?9K}/':>E}6 'ԥ uiplGn3۲޳rP~;PԃnPPqp 7ݹ{~ϜKokZ_c$HkP:i5##ҭcOᶳsk1_S̈sGn`EJ.Hh:Am!?RNdzjG)镋K}Y{[z X<-OImkOQlwi?,g2o&7t#CRmv6}gSQ.uߝ{a{,йz;,nnzIhѺ/W80s\j޴RC^֍O"<BJB(zV_?ZgnR}d,tv[ohGPwA_-v=W_xxidN6twWuTˆFK˟Yf?L6]hoy'h,դ<8 loQHd1 0ce7t'v[gM&Haw{?qTyQ_.EIWU=kU4~6ܴ`:PM_^@mv F@gL ]-+Ackw- sIp]{vӱ9%kv3AO=zw66_,mk{Z=veU5_ sw`s_oAvOPim09 C{sOUikZCX%ΰ?Ĕ>N_MnM]Y6dWps,9ۨgn݌?k`0{X۠G5^@!}rUGw*[S ZW>L_g]/H%R6X[/  Rf]E7c 8׭A]&fYq꺜!?G5g3~ŐCKާ?9.vdfavPeNu>-7n{麟/DƵjqtiڛZ>5?>Aȭ]vPYb⾣U{tzgnmV,"ƯZoqN92\ntUw{iVieauG#k~=_KѮgnoxvcYk\Znsnȭ7JMNcRsnbUcqPi~S~w\>֭hFV]u~ nb5i 8-XwH^cc>H mz_S}X >vM7]xy u n&Uu\Ý02dA!ŵ°7mmٳçt:VV:V֍?mp1~)̓xU96?67AGӬbjx:*vܧ_oo[JKøPYKn k[3.)F vsWqmGݿΝߛ?OV{vSXh?^./8Bڞ#`EHth@kb|+W#QN֐t a>1r6د-nx۲~\#풸χq~H6n" U"Mu ]ϵ{۬gZ.?J{C_a w:F~Vҭy1.ul5eޤOoW?kk}7A#dy4US`Aa{ F;;wPYCwYv(}\g2Slcrywf㶺nݎgh!͵ͣ8ծqj>uX:rGcZ\;'mnɑkzkj7ѭ馑) e5y>.~I?u0ݛ7~ӣwo7i]|Xqo1ٵˠ ?2X*chk`sq? gRޝ1V;,-{ktNVU6Qk}6MnU&:̮S82mIYYX3nF?}VUFmŁS-?G[[K즢&H{FYgҏN.Yb6m kvߠ16l:pBE↜8nl8z;Oޣۜ*A?wM"{=UAݸr~8dta>3`u^@toON̞фjraeSM5p:F̻;~Tk 8wҟYX; ͤcpjS3wH"d͛u Vh$ok]c\8=5s6ʿR 65'shq;讞*^hn㻟kRq umvNүꏵ6?x8?ac.s\~֗{qhc}\#lc͖Y̯~sE;sĬY#~䫽R˘Z$DAKv_c~ӺycX+MSVQ/5dWZ=5ſKcNVfA8EvMly@P%R$sڽ8s]nh_WQX`e n}Ǻd䜪uh4S :6QMy?s޴pZݠ15hkDgk9W3r:7'Buxe7DnqSYՌsiYg3 napGuK]{HZ5Xp`a.MvD֓By v?kmeXKCh;~lsUԂ*a5ݷ_HZx8"?\vzض ,U:mZƝ[:?7oP:UP N:kKxZޗI0z&1svi1w[Kuι:]F\[-Ԗ'rf{p?/sRU[֑3 i WFD&Lm޸q6X2jlEw_ޢg\em{_k ,-ϏoE o6xz'۔$鵶zmiщ@  {_0˃];erv 6;gB pQ /+Mѿ2Oscց:}.:|Uc#A lbCgժ+旰O?,f=r=LS-m}² ;ZVNm`y:y(]Sak%p]cƆkkGN^vKH )mwkVDtt}nb˸XƂo< Zv?h6e`5߸؏Rm$$IGMߟI3dmLv¼[o ;=?r^ͯqVh(]oZ,Iͽ6w&#=SKk4=;?9K}/':>E}6 'ԥ uiplGn3۲޳rP~;PԃnPPqp 7ݹ{~ϜKokZ_c$HkP:i5##ҭcOᶳsk1_S̈sGn`EJ.Hh:Am!?RNdzjG)镋K}Y{[z X<-OImkOQlwi?,g2o&7t#CRmv6}gSQ.uߝ{a{,йz;,nnzIh ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$'mNӽ"6l0! q{_ULUK a>q&{kk62Q/Rn30m\{iU]>4T..( :RAW+4w;V %@W3ZBR1q{iN{k:Ya#Ǵg_L!N$FU?;oM/;oMhRuP .=7k?g JɍG:{i_ソ4Kw}ɮ1VZ`t_ s/&ސi {Dwoi%w\{i.q&Klp{Ko> HXEQ/t\{i.q&^H qGL!HO[+]WoM/;Qk9TrS5-Qi C!-dSXcv niOKiOZcZ?HǴgL! mcNHT?T@ソ4Kw}ɫX|7|J_ ?&) o(7RGc>{i>q&fh5r{Ko>2C0~b{y<.ciu_ソ4U]˧`耗 K=7k?g*,h#$m;W74w;O5%.( :2}=DN14w_Kw}ɮƇQD_ s/&JBƭOKwk+}WoM/;oMt C[i+C!)Ybֲ ЧvA>s?Ow_Ow}ɮk$IK=7g?g!ewn<14wo;Tj$5>丣_ s/&HJV@ƽSא5OrOw}ɧ]WoMtp-iRc7g?g!g=hg̡4HW-4}ɥ4}ɮVӯ {ki i7q6c\P_L!ؔf: nGr\&&74ϊgK=7k?g*o'D}C.wi_Ki_ソ5аu- qGg_L!)HTZI"sKw}ɧ]WoMu xqM '.( :mM7{>{i>{k]2J']ÉF_/&(H vYOw;̸>Ю[xC=7k?g ) gO6UM4wm:o)qG_L!p n+Q,aO0M$4+]WoM/;\dP[nqG_L!%x&n5UWəw/iu_ソ$U]N2>\q/{9?z}-s[ :aڻUKiu_ソ5ڷ% #Xo>pKp\>x!<4w_Kw}ɮ徉v+Cn)n+qi>gD>>pKw}ɥ4w^C{Ko^pKp\.n>τ#iu_ソ$U]H{iUZX*ߩH#1g? 7n(VlA|4w_Kw}ɮ=0{Ko>p n+uZGy-.+iu_ソ4Ow}ɮԶ}=ۿ;˺q&G4;oMtc?ׇx%@QŜ?u%+.hp2#?4S?{j>VѸ :i$?;oM/?48_ /&I/?4T@~ q/pg_L!I$'_W?{h%"Ǵ3$HW?{i^ɪ {Ko\?RI$^ɧS@IyF_ BI$_?;oM/?;oM8_ /&&*&&Bg#q/y?dN&&&=7o?g PIRSSН+i+C4*?Sw_SwW@W3(&TT@ソ4T@ソ5y$=7o?g CIQSS\{Ko^$5:}ɥ4}ɭ%q/{y?HK7iOKiOZL%q/{Y?J e4}ɥ4}ɭǴg_L!:e\XOw_Ow*F_ /&N ?T@ソ4T@ソ5@W3!0N{iNɢX=7o?g L/?4T@~ dn=7 )$DSKjOoM xN8+i+?g I$?T@~SCI(3/&IjuOoM/?;oMD"7@W3$JSw_Sw;˜( )$*Sw_Sw\Q/y?]%/?;oM/?;oM^ A.( 2IA2SSQ $I H*Sw_SwS=7o?g QNN{iN{h \{Ko^I2H?Sw_Sw:J_ /&IBSSB \{Ko^I2HSw_SwvjǴ_L!t YOw_SwQrW@W3 7juOKjuOWR= %I@)*Sw_W?{h@=7o?g :_W?{jJW@GI+W?{i^ɪ)%q/pg_T!I$5z&W@WOI+W?{i^ɪ)3/*I_SKjOoMPNǴßS$J_W?{jNǴS$J_W?{jLR3/*I[SKj?oMR*+i#?§ I$_W?{k5$=7 )$Z_W?{i^ɬ\{Ko\9?RI$?S@~OYI%q/p_T!I$OKj?oMe$ǴßS$KWj?oM/5W@WOI-_4S@~RI\{Ko\9?RI$S@~OYI%q/p_T!I$OKj?oMe+i+?§ I$_W?{k('J_ BI%5z&LǴßS$KWj?oM/5W@WOI-_4S@~RI\{Ko\9?RI$S@~OYI%q/p_T!I$OKj?oMe$ǴßS$KWj?oM/?5=7 )$W?T@~SUq/g_T!I$5z&W@WOI+_W?{i^ɪ%q/pg_T!I$5z&W@WOI+_W?{i^ɪҸ3/*IYSKjOoMVI+i+?§ I$?4T@~d3/*IYSKjOoMVI+i+?§ I$?4T@~d\{Ko\?RI$^ɥ5z&ǴS$J_W?{jI\{Ko\?RI$^ɥ5z&W@WI#^ɥ5z&W@WI#^ɥ5z&W@WI#^ɥ5z&W@WI#^ɥ5z&W@WI#^ɥ5z&W@WI#^ɥ5z&W@WI"^ɥ5z&W@WI"^ɥ5z&+i+?g I$?T@~SCI+i'?g I$?T@~SCI+i+?g I$?T@~SPI+i+?g I$T@~SPI+i+?g I$T@~SPNǴ3$J_W?{i^ɨǴ3$JS?{iN{j Ҹ3/&IKjuOKjuOQI+i+BI%/?;oM/?;oME$=7o?g I$T@ソ4T@ソ5 )$RSS$Ǵ_L!I$?;oM/?;oM2t=7o?g I$SSI+i+BI$T@ソ4T@ソ4J_ /&I/?;oM/?;oM:I\{Ko^I&SSӧJ_ /&IGjuOKjuORI+i+BI%?;oM/?;oMI:W@W3$%?;oM/?;oMM$=7o?g %?;oM/?;oMM$=7o?g %?;oM/?;oM2W@W3L&&W@W3L&&W@W3L&&W@W3L&&W@W3L&&+i+B&I juOKjuOEI+i+B&I juOKjuOEI+i+B&I juOKjuOEI+i+B&I juOKjuOE*.+i+B&Ij?oM/5Jd=7?§ KWj?oM/5W@WOI-_4S@~RI\{Ko\9?RI$S@~ӏPw]E>%+i$C9?>/*AWi_Ki_[I+i./&RTX?Ow_OwNǴg_L!)J}W}WI\{Ko^i,;oM/;oMoǴg_L!)J}W}WǴg_L!)J}W}WH{Ko^I,;oM/;oMoǴg_L!)J}W}WH\{Ko^I,;oM/;oMoǴg_L!)J}W}Wt=7k?g JU$?4}ɥ4}ɮ$=7k?g JU$?4}ɥ4}ɮ$=7k?g JU$?4}ɥ4}ɮ$.=7k?g JU$?4}ɥ4}ɮ$n=7k?g JU$?4}ɥ4}ɮ$= 7e)T\&{kG_R$Kol12_Ipg#Tؒ щ!Z3nK~ʴ|OKFX+;sTZ>'pf/z_ x,? 8XmIZ%S+VED:Ufaw(ۈ D}%Xsp?3+\cU&?n|S )*=DY^B<'Xu5J5O. z *ATg30}"o"SpYd⒚:8huLXxh;<!/B5D]/-.(b%'pN^Sn'QJCX% |TPH4kRsdO |ݸqg<$ |m~( g0? $%@p]0ѢQ3i-DkO#jhQED*n.a&Ok<tILCZGJOX֦+Js:x!2æ ) 遂|Q]_!@wN6 t*/O-:I0t*PLRR6TŒvU65wԅH0DZSն~fa$lUh&U~-]h"%W{;*;X<rD+0Qڔ|{Jch QHS -77Y1(v)ʓCsI/`*i:O(A^iyWEMUjBrt!Jw0Y{5liU.1ĔG9d #BZK[K|[CZdwDSqDm*"6t:"Kd)/YfXo;8"USCAP܀HV=E rc@{:#4h-Wz&w~ * H*ʃ 9ڨו]3àA-MS ^!&9S;ls-iU>[aIUBJƽWI x#å3y*p2;2n:J-f!(ǐ I#/*x䠕mi(-!ua5W [I6k+"6ˆscCʝVơ ԓ#V[ A4TtII8T.k|@lqHwӪeAEDw8Qϊn'IvIVp WXYWnx!e'vK`%f\ܙWNc x*c`85𒒭+3}>jY&w<ljw>*Tx4X;Ef]tB.SOTaGW0*\s~V΂U6XîI$HD!8IRI$yLuNbSPID<$JD$J%8QN )I$ׅ6hTIX{Xb LS(1N8Q(NL9LI$N'IJL$I$N$)dI0NWL2pSI IK&NH)& KdAeA!pBBr ќ)wNI L 9L:;E I$I0uNI$I$$JmEh&$&N4 j!9po)%I$RSBJY$*IˆR %d$P E QN"RB'L`)$$I&)I%65%)$DhVQ%@PވPޒR *A L9.B.ARtg('($LI$$I$I)I$I$%)$I:d)$R ˆRIJI$)ID2RBI%) $I'LI&)$(RI$I$I$I$$I$I)I$I$JRI$&)ژ$ItI$$$I$I)I$I$JRI$I$I$I$$I+-*x $)$NI$$ILJRI$$IJI$I$RI$I$I:I$I$I$$I$I)I$I$JRI$$RI$I$I$IJI$I)I$I$JRI$tRI$I$I$I%)$N:I)I$I$IRI$I$I$2tI$I%)$I:d)I$I$JRI$t$$II$I$铤$I$I%I$I$JRI$I$I'I$RI$I%)$Nd)I$I$JRI$$RI$NI$I"$I$H)INI$$I$I)I$I$I'I$RI$I$I$I)$I$IJI$N$I:I&IJI$N%)$NIRI$;JRI$d1I$I$$I$I)I$K\z/q)&;QmiD)&"*%I2I$I$:JRI$I$I$I)I$I$JRI$I$I:dI$I$铤$I&N%)$NI$$IJRI$I$I$I$$I$I)I$H_+*6ʝǛo);>NϤ>+ щ%{?N/? ԒI~ʔ|]RFGTJ>.zCDKe0hNVct*zUGci 5%5Pfs0D8)%J-wPpw)ɏd-:'DVpTMDm6[{#_ao?4{*MPOqa1h+y ]X,c{5Cph+T|0BCЬѓ:V[E(DV6ȇCyYc+He)VӶ2ύI#PWsZvC.aբ~* {%Jjq aVVb ?$EIJhMc+9jơ 4#*Tli2%%-x& ձpwNM'MF)*і)"=#Q;@uLg əI#T~BN =YޤwRV " NJnLX ϧ5ѯuf U5HAET`K`C77Z *ީO uyB FJJjc[O! 1J!8o8W:V9$$J*/L*C{Jc{ȂQk.c<`$_c| jrURyJIW[@0J5,mRhKE]zHlϗm:R*^8tjhAO ΄xMcwY -4ـЩ}ܗq2BS;߳[*gF)&, ̇mQ'E/p228%[8"UKq[pIT8QZy/uFBl(z*w3YLf;)=>5Sv.Rp* ƒ8k=5=sڸ[,=N> [f vVlx):whI Mgt%~)ʣuS3Z| $3IE$@Wy:Jݖlq-R+ZT paWsȞS[k;P_PyI DE Ai-57i؂&xMR.Q{( $&ۊGU]V$`T#nIq:-Ή,廤! K`XZ8L㨁 Z6)$AܜdʦΞ |‘6dp;Yw*aZ3#0mU"CxQ{o-lmb5Wέ:˵-xfe5tTōn,q=Ohh(тIiÆ )C})HB3 =*7a(SC鸸F[ZZ=w: "eF\èU6Z">jMTMeDiUݢ>OaYcY>Ћ<J_<=h0>=R]ͪAR85\"S 2Ф+m#h7J57C2Y0 +qH%oZ\ADfIo!I7$}Seok)W &mϝò3@gAN_&xV(v<gjG(d;dY(d4I Ԩ%aubMT-n,ݨ䅦ۑ: q_dUmbbJWK{ieO :QAk@WvDčD xqCt*seRc0(*A$8I2^5y(ndsAJeDakL[gkgS撗uTƘS-$|Q[NѦPDJ@[1)~!`UoBqhYVa%65\3k"B˭Bİ 7:![? 2`4Zqc`i 7 %V3KB&xbn[dD^!W}LpZWdQ :$5BǼk:*&˄=CΞ dj,&K'] +Y& ܪU✵Uc®;|{KU4pV9\ 7cP) Ul;YTmvk6FWc\9S>Peu5H'}nc4:v M QA 6DKD74:')ۡU-sH$hLz i jgI6s(;S TUö< ?@mFL-Ip$Q7:Bm;Lw@5L1Z%6Twd7MV{5Fٴ!P} G*Oa:"ψOV<ڣ]0մIڣ5Bpn$$6]q[c@ iUûwP #S2`W}d6@$.Ѽw*']%5w5~ Щ$DkʋkpѨC~Duq áC$%\u` <86Ak+5 !lju+q$v"?QA]¯S 2y&4H1۠pO:~JlP_SgUZ料OL8}Oy+ &2ʛOJǴ<8PE Jp 5b~jh$OAՓDLL$HgDNNI$a3r1AJI$SJRI$lF"I ֎ė,LQZI(RĤ)HLI$I"`J x1JRI'G<4Jbw$! qa O;ɖ蕪SoT\]5e0h}i2Uź<#hXf*VGFNNU}fusdy+ߠp*{~ r l)0T®#['F$OI;k7RI%~ʴXԽu;W-GU^4F_(a~T<,ZDž&<lR54jBmIШi$@ZIRf4#Df58VyCc;R%$~)Ls[s=č hGN D,ݡDtL2uѵ84) L:hasNAV6N "%J\vZ\4C :So4H1#OB*Yּ PʉtjH*eL+h2< Kr](*=1^ ڛ.ڶ]́w#zCw J;ǎhja=02H(UEZiEdzY-["5FہSW#@߽'V͆#DAA4 yQG))n+ jV5! 'NT Nd~U=RBCGaO0sAu P%) `SvƊ=Z]TSli:*mk)0GAt!H9{:L&OlJ)%w"Av>&& hS[P#@wJOiPVsh#\ىU[JCLkZ-*gT~K)2SuWw"-Aj] (Dm`A Ll ѧ 2 iP_i"#Ļ_hanFfaKTIIlդZʃc;dp5)=_{M]SV_#6iV0rNӊ";Qѥ*HVj?5sNփbX >փrCneI GNAEY TXBNp:p(`,9 gQ$X#t:$tʉs))ᢛw_$P-0F5$ yh1 %)Ap ACkIH@m}ܫ:mU=Dp«]u:wNw\i$hܪtmxA-'Ӯ B㤪kwf7w % oH5 찰{zv_[4Eh<1(a )cU@t0ilc<[ l |ӒF)p!glpxC'Rd&˶ …7h+Nk8hrPMѰ;u=ًlRf9{DSW\NY&|ti Ψn*PL|%1KPMۊ=Yd8T6ZDB')g (P8*Ē#Dku)`Q0#0Ѻ]p?pEf W, @:0mU>4_q{R.;L*XwC*'UC) Ypvswc68I)\vi~wB;ƳvDRBh1L\r klkp;[Xc{t=RNVCLBuRNRSfG1ⓛ\9גmTuׅ=IH,fCmA( pn^~UCQ i0RSy5Á܄c{gM?Qsu:7ĩYPN+*hM8L)n1ޡI̧a3K g卭|?V H90mϹ9CZ8\ĀcPT LH“U JF5%JD&;{k]}btE2 TH9y>Z!1^{&P^6}@rb<ժ gP֐8U}E_53i꒛Uѭ,X㦪oVySKN{HW [SǥiZ}9ILt謹Gi쇕}l!OuX='R HI 렸QuEWZq Fu*.{d,CAQ{]S~3J厯dE Up %I$)$$PsgL@RrbI&$RLf|RI$hI)MI)I$XGj \#0,LQd&(N*.po)vBgOH]$y ]n@VA~*5q+BahKCI~ji5  U'#r"Uh<:.3EǘKލ̡9 k};8I,-%%6c B!p:*櫓.F{qlHޡeMuV5O&kO D⒚\Lv-BQymN>*V*Sl-j2l8>A<rj֫2\: BArp(s\ݛH Ƹa[g^ ɿAJ= [=GI md~iZD6Ϗ kc+lú=X*dh?+ Gm}V؂ѡ?4Sc#J}Vqj$keW713(),ԨdTH|W?gS@*o7B?աڛVZgΡ*Ϧd@%6 9-aŏӫPFx juyM/x9 ]O:׾ҷ^ Gk=dZ}pPS]8i|rӪ8hXݮ,=;{U1l--Pб[(fc٩VzIWJw_ȝKZR̳[i 2%3ج~ӳ(L?Ŕwh@|GϧԻ5H赀\ӵ$=R{Q[(ފ=?[1 >*]bb<;f_MI󣆣UԬw~zߚA]-aT=3`<JA&G _u[. pv;ݧ$rMkk#bGPUIW{QX+gSߧ ?P5[Wu]})-Y= V{yIqcu;[X0{ RV/D*I0(ԂIJQRLSTD$JPSrILH$$!I$d9M))I$Aa)I$+##1*LoD(nAJR ) Hf Мo@PT2uU%I)-RI$$I I$I$RI$'I%)$L2tTI8RQ A%)$NLRJI%TʁI I$JIRI$ɓIJI$L2(RI$I$I$I$$I$I)I$I$JRI$NS%)$L2tI$I$I%)$I$IJI$I$RI$I$I$zRI$DI%I$I$RI$I$I$I$$NI$$I$I)I$I$JRI$$$$II$I$I%)$Nd)I$I$JRI$I$I'I2I)I$tI%)$I$IJI$:JRI$I$I$I$$I$%)$I$I*I$I$RI$NI$2I)I$tI%)$I$IJI$:JRI$I$I'I2tI$I$$I$IJI$N:JRI$I$I'I$RI$I$I$铤$I$H)I$I'IJI$I$RI$I$TI$$AJI$I$RI$I$I$I%)$NdI$I&NI$I$$I$H)I$I$JRI$D(YO)$Y $LkI$I)I$I$JRI$?v:>4Gu 20NʈS$tI$:I)I$I$JRI$I$II$R$I$JRdI$IJI:dI$I$I%)$NdRI$$JRI$I$I$I$$I$I)I$H_+*6ʝǛo)IH|TTr?1$gBbIߥ[OḒI/~ʴXԽu";.GGKQ2Gpe0anṱ<ԶMkP tEm`D7tV4NZJ#9):|Rc¿ip❏58;B*;eթR/Uf)n4\N'QZl "&TGnQ'Ca%e(@M|b}tB#$Z ꗧYjUd"$xxL` "tC2-VMmyHed= *v8ψR"\ j@!Z=Cm:"C4Q"o$ ,E\̘ .[u$;PcͮR:uO]teA4TUp#H5[r HJDuf9?'X[T[`(GwSAUXa#L}.V{\tZ`W/FtP[%(*ڽG~9 >N?FTd6~!H lUcZ>V;YCK I::G ܝZH-hmU[(o2RS[t[|sFbu)Ξh N.))/1 x)SkvjuW XRZo$\mqJ֎ s %#Ăs ALbQC2 !gTd:-lOv4c^6eC qC5h&<&Έa`T2L!DI" DL9{G(̲xD# ]X(Z$=ҫ fUhxDȕd]~V;FΝC@ciBp!i˲%Mhƽ]׷q[ut`%4DX+ @\ MUFZy" 5 )v%Yikvk!]u2K&5C6hH$I64h\wp7s}Q y&Z xnܩIê=V[鸖Gc h ;WOt*㭎껯T OW~Hvh"U$VE r^$vշw nMIiT  V4\FK B8VMH4%Zفϒ,<Џ]y"Xl%U'P9Y aAyQ j-ny1-E~Ӷٍ|mtPh #t?ZDRwЎM`l uTFg̡Qۤ&7T$ l> 5BM"}#˻"*N3[h* ^"m nVFwMV N"hu@UnCFdJc1 3pMY $|lr ӓ?RfCLw:x%iQfs5݀P!&cmwtRk03!I'X:rANXD γNqLOd==`xvXo ?o`ХJѱ6#H>j juRi RJ=)Ri(kS}Yl%3TMnEN#JmQ RX"cT䒦M 0 <S;iX59A\| sϤ8&zWKLk(Ȣ F\`h[Z8甞]1IMGiݓb<+N΢ : }# 9H T2_"zN^Ɛ̢x\:,۸'Ha.ѽ6G@ۧkUYkLx',.zO:ꁈYS\y~aauU/%q C4铧)9LRJI%SO E I$rI"I( #IJI$ʛT؊I+,Gh@.X)b8LSΈw?ke0Npw:+Z0 0i~7HГ P& |]Xk lG6IJiiD8J7x:|Xzr6anƿGrOG״$:X7W[?K~H@fjĮs h2 LoUo W><ֺ]!VOKs2udSc݁~/dy]m.*UVHH D &. oۗGԱ.71i,Apk+6LXX׍E_hU. "}ZPŧqgʭW`믊^;{ }6ӰO2Uji0G !v ;Ru c7#hՖbLAA^h+jCiZ8ysA>iR>:9n282p} gIX T3H2 =׷pxkHs|7̏pսu&qYTج}+%p5 `ݾV1BV5>O]c_,Hy ;#X١+l^${$tKkh;1oukwd{0mY{=6>KیԼ'c/}N;vXI+[3 8r4<"#JeCZOcc˲kVM.uk-ZF&\3~C*ZYB)庯>%mnVs:k]W7Q^gL42ѰҺ[^5W "~*Uwoj1H2D""'0:EmqiFj=|P#blyc]e?8P̶mOCcdB~;_QSέǗ[.}bba_\wcYA- NS:]G^d;$ oI6FQ[nsE&&ӞCoa?~z.:k::UiȊPf 54hd':2͖4yZkp?*XvCאA&}Kv<ء5n k-8(60D?Bpzlhxp}g.h{Tzf->I.2[1<|(K^=GpVNWJs}qj)eXd)ak#R 87*%t]S7QI)!I$I$RI$%ID$I#P#RR)$QZX\Ĩ2S)9)8L ȅ@AID)!9܁o :d꫔TRZI2d$$I$I)I$IIJI$N$TIH)RI$t$$Q*LIDI)$L:dI$"$I$I)I$I$JRI$I$I$I$$I'("I(L%)$I2t%)$I$IJI$I$RI$I$I$I%)$Ii%)$DN:IRI$I$TI$I$$I$I)I$I$JRI$$RI$I$I$NI$I$$I$I)I$I$JRI$$$$II$I$I%)$NI$$I$I)I$I$JRI$t$$IL%)$I$IJI$NI%I$I$JRI$tRI$I$I$铤$I$I)I$I$I'I$RI$I%)$NI$$I$I%I$I$JRI$$IJI$N:JRI$I$I$2I)I$tI)$I:dRI$$JRI$I$I:dI)$NI $I$I)I$I$JRI$$IJI$I2tI$I%)$I$EJI$I$RI$,'ডo?TId$I1I$I$$I$I)I$K\?v]ԃo(6Bt:k*r$N:dL%)$I$IJI$I$R'I$I%)$I$IJI$I$R$I$JRI$2t)I$I$JRI$I'IJI$I$RI$'I%)$I$IJI$F_PQWvT<س7/IJLC⢝H|W/{?K'F$_5$~ʴ|OK@ʴ|]RVAN? ?XDY毨+|I;B0G*gwQj kF]~+ʈctjsH3U՘H+'iH:Dv4C4ߢU-ǰ@:lad,Sb RmsL!6sBm ie?t:!Jp\g^ Ɉ T5ׄc ɱ!3,'*U'14"U߂EkBSݫ%d?F*ZjoR=x56V-!5X H\|ҥ[dgb6jiDEEc߄Jm #ᦋP&ص_iRnCq8Jny(?àZ[ֹȩuc\#H*>y%J76]+-p6`~E:cEDbLAM6uw%jv!#قe[G7ڛ~ rchkf:]'<e%j;JqYqg$)7)h$J ADf)#V؀q-+-J:caRV=$05V`ngK#!<Df6|V^![З?$SUSsO)3$VY~S[}3ʮ`1{t`y $ʱ> y)W>!-Eف*~BCۡ @Q9r9**3 !j  $ N;:&oPpкR=9HKsZ$TWn(iӄidL#0aCΪc0Phf!D\TL7UFtSe%j"!@ᷲ7%Lv ߀'P25cEnB';j.hH[؄f8k%QG##Jbk ?*'eA&=EGT hN#nJ8 NUlw:_ahZi4@<+bZЯ;SF%ReCO)hZL< &r' tNޠLsJ!GEjqga*1jhOꁦtç<jq\I`#$*ިAvG+/ND~ht)X>jsZ̷Dy"\YI\eot̴%={:mxYH<ـ\h-:l["O):Wh)EgQN 'y)Zi!ɡ  %Z U/󤤪fY)yQTNHo_I.'znw!#Z>2ǂ4jY!:q,y:`IMf$UIkFĝZ \%8:+sx7ج)vLX[y$2aAyVIJ8R%I4̰x(1ʬkg\5Fn':vZtITVaK=}@;G(?j%&7ʭuES3cPc\#'?T& \T7٣X7È90'6))dvRФJgjF^Aqʶ*4*4{7J5eTׅMvR `w(:%h -XRP ='Mϸ[ѣs9(=t rٽ2jZ&a -Q~!YnH4oO#^ƸK۹ȟgGGN#!!t;k!x&cO%R㮧 ?j"?$4'kCD Cl:)զU!Zgd'NS)&!$QH%E)$PII@RI)I$$F!6{)$VXҀ5FP\LS(*cvGF %ShEJ:k<*kǚ  h%pYdՐC=+gGs = ջ =W  6Q=[ AE"z(7+2[t?Rn+yx\KIv^ouYa2i VetT *E'T#bRʆm/Ť=ớ蝻u3@qxe5yH "eGh?KO#vg&;] omT;}lU[o;uXwd4:_L6WG` us9Zpʠ&1QYuVju{[[H$MUO@qos u:+r$4 BޝFKIaYUxӕ]Ro;yKP\N)sytڮZ;b5`?uQ+"w^w ><Ίcaۅ6n:"b6[Fcd7=6*>ImcRư\ - xqˁF(Q }ci.=9.*mG~Emmpv#ۊ˿Hyŭ)Ŏ r/u/sZ=Rd Ȓ V~s(ZspV/M#@kg E7s F'IHSEmm z; .]I}R4,Ś8LYawbb.OY' +9NC,saL6}?3c[p0o7Ӥ;ΐ;e>5ĝ0 6BNwUEEu@8l$BJMDT{u6{y%4o%HClBxCa{PQY[ 8uʣ@)J.4t;DOrV_!I5BVisPJ'\H-P=ПvQS/iOh#+7YL ϊhNE:Xƺ|Wƥ6 IT>QU57]]L "$hlNۜ{^紖>)aP}5>)0 F]u@⒕M. ;Dp= UcN1Sv#I)/('8v*mͱWAah+Mfͨc#]HU Uw+6Y0BD{Z Od/TlՅSU<j>t9k )5m$U<YlyU Deal]2)}UbndAg3cXR;F>*LJp ZrLtRt*pV H +8V]!E4ĝSoܠO2zl,8*-:±kp< 27d)*mb6Rc)tQ3s'3 jaIحU[t"4H6`{U|-sxW=gwC}@N==Iw#@qU̙$u!=VoӶ뮅gEitL"ʥ]āB"T`.h`>j;:ςߺE!k@T@'ZLH]8Gӕ]>'Ն\@:p"ʬ= @IKۋa%KYlP{:!̡2lz3.I'}|pAU*L;R:5=EnnnPo#sF$?L=׆?c 5(l()܇ oFP:JmgpT?DT*+26Oܜu6 {"\`@Aիkjh-6/; jd:\![@ -NQ-@PژDAH:p+%&$K[v]{-#Xo]"q+dF4SH$_U~#Hc^P*bwNgkG;p6 5Uhw*Sg&5Q"9n)fߴiܨ>j~vL ksi RuLH)c%Cy-%NKhC}a8ꊔ\Nn%> :' )4d`n❃MI\ ੹)QQfU 4Ψ8Q1A%3Qq/xoݢnJv縃(~*%DϚj̤'!n@Ӳp۴rUL<UR3#]E%g0)fCcO$+8N<][DXuqUlmXv%l>@FM! Vͨ7tX5Lr]k|?d],*C 0 s(.Ӳ.XSPN£Xv)pe@\iVkЫUu!ݠ<+Z,wίk_hޏ䮖o(coޛv)ޫp B/4\I |UM$LWM:m9{H-q5 ^ʛoi;xeB{}M[8atSyBRSSw=ruAcyw OfZup3}7?K:iՑc ̮FljoGmL[ /E"iճ.iQjru!bmp]-U"ƀɍ#VnCV;'7̤Rj$8>=~C51!)6]ܫ};2.5؍DZAXm{q[H2cT]GXx5\_LnA{Y7cЃYmkH ([| y@Ps i({50A*Nv[dH0pU_@!BخX)zƁscCbPMUH 6C1Nm{::p+Gg1ÿzM#s}̉XyW wAjn5 iYDZaYwVs"S`y_jje`}.o?;,cFq._Sl߿U.jђ ص]"tAfK}UXk c~>iy GUր5 J ՝859@:6q^+vU=j^[C\6(.vOtkU;7WTpMblXh#jYV}Zij)u^5-ȧ$*eL-6 N9X`k:թL8 ue㬨KyҺ]EUw4UouRl Ac_ YN;-?.tAЕ-lVV+ψ] !QTx~Z-kR)r y.>-USHm9PS*$)$R mPjRRI23BAIr@IA)IdL)($73l):d꣔T$II$I$I%)$LI$$I'L*RI$S )I$I1I*I$JR*%$)$Q))I$dI%)$L:dPI$I%)$I$IJI$I$RI$I$I%#ŠdIE:d)I$IAJI$$HI$I$JRI$I$I$I$$I"҄JJRI$2tI$$I'I$RI$I$I$I%)$I$I I$:IRI$I$I$I$$ILJRI$$IJI$I$RI$I$I:IIJI$I)I$I$JRI$$IJI$I$RI$I%)$NI$$I$I)I$tI$$I$IJI$:JRI$I$I$2tI$I%)$I:dRI$$JRI$$RI$I$I$I%)$I$IJI$I)I$I'IJI$I$RI$NI$I $I'L*RI$$IJI$I$R'I$铤I$I$TI$I)$I$IJI$I$RI$I$I:I&IJI$H)I$Hw}SC*RI$I$I$I$RI$I$I%t\:P]Gu [:8H'MeFLRI$R'LI$I'L$I2tIJI$I$RI$I$I$I%,t$I)I$I$JRI$I$I$$RI$L%)$L$RI$I%)$IEoAF_Sbܿ%)3>_'F$OI;k7I%~ʴ|OK֕ls*?/Z۠?/<_O}U N[X}.WLJ*myP@.$WAU-t&=D *A*@>SU35ɉd[a-!Ue+8fҶng!,GU:l7c+Jufs_T;ׅN!Ba*Iݢt[Rst:!9v 8@ HnsLQ78Qk?0OhD%0$(Ei(5V-#覨J[)3Q4̩t$%'qJD}RѻG-)cDSerA @H4w-ú mrR0LT {hntB,qšM587ILT2xP$LAQ{ vOD%$ek(4(d Dwpf 97K2ّ *YFggghVل~8Ix*> ',bI>JÊ!hQ&U TwcVUh zIFO(uj].WhZ+/0{j:V^\iP.6@r,c(ӸsO[hIM3Y/NfY#xV$yCMn:h|kdw?^N$A΋E7^ +;%kVmtU"=+^ ۈIMy[M͍AVy˵ Kqgt!t=AI-:KH))mkEٍJfX܋[B] ׺P_R8SĽGNSV{i$VqsbZ>jӬ6X+䅙y*A!]"\e=},>;Lk7;cp}p 5Ykv;!Ev1'4 ]\o*dBnGpu]) ~|Ulw9´I"Hke[fo$k, r{"UZ5Q F%e?moI=o Cc^;&vR&uNwOp s/XL)mP N^))i.:OLISm <[ v&3tXhDeL""KaFn{m 6 &PKkB$gnXӚ9>HRsABqL˜at> G^p v(N{FHQ7+: %ډ~D`-۩DS-mc^ڈT)8?y Gޫ :Ǚ=-cʋڷ;@`O luSz{;Ew0c;B؞:jԔkf8:C$cBmfwJ u+P֒6ǚ:vE Y|8$Qǟ5۵ja$y̤Fmh.IgwI! tK JMG0YݡIJ1˦$kS oܢɝqU `[Sd@ͮk^DFh'eik VqyiNC%0n}~9Gi1-)${(]]W sUg^%@m wGpt0%6+`Jo8 ;B'.* ȳ3m{\*hL#A{JrSmE{! JgO$guL0oj+,4jjXu[Xv=еCKy@~KJV9Un=&45/lfNSZ-"#$৽γg_2^YOk&y*fkIFshY#AE\]8Nʣ*m9r ,A*6:Fkf52өYp䭰NOmeO%cƒ?HY^ÃǂƲzO*}#(N:):(LJIRI$a0NS"$I&)$I&)b$$I"ֆ$TIY)(9OK|JW P"" IS~ąsKhmetjx\6jd,a;5M!u[X\y\[kU^wp3Y!uvWq\-ۡ>r=FuU>Un d{u}]ư;Zx*vKG~uv3`7h3+$ DlKun@X9G՜+k6K`Ov8 ^+Eq#6?\lݡ<ʃXMuSǂxjslls'%5L8iz 'O`i>`ռ|ͅH:mk6Fca On'YU1 ymtnaD:RZjv=>gWC0_xml~py_z.Ic^ w!rg0XѠxs7k  <_8* i0e|a6'<[{'Zܳ)UzV渝ן􌮟a}M&%~Yl5pFk}J w\ˬsvTi7YS7gѦ2 {_ҭ6Dһ5\crȞXv6f[ fƻp$HYxVgWq?V=m?Ejp7KH${&NUF邚ˌIy/p$=¿DE$4@ݑMt;B誯\kZ>a kvw 9'~۲T-M wj0k=0s_TA,oV8p dR 8Ky@;VX- >\6?u-F=<_qXKO>J\\U]e-;Rr:'جSC񟫁9iߐO?ޅ3/yt,.. x>d2^4Mnn%o +D(h]> 鹶Uc[[xR1r:nF>~>EY`1v=՛AøY}Gd fsG(dx^w+.{²_Wů8 C5-xgں?蹊g΍ևIYa+k~g79+~ȍ{]#Jй 1{ul,jݍi R1m;#즎\rjo,>ӻLwZ0"9 .l'*My#{yX%P~8a;J~W߲ >_` {+=ִz.; 9ivx8!RpЮwtb:[Om/ im!AQvk~-;j7 ͧ cJMȕӟw4Ȩ"RUp"aòFF&N!1$%EI)T&N\TܠQC ށgA铪Q*NQ)-RI$$BHRI$$IJI$LIJI$I$RI$L( I' IID"RBI%9LI&I:dI2d"$II$I$I%)$I$IJI$I$RI$TJRI$1NRI$I$I2I$I$I$$I$I)I$I$JRI$%=)I"I%I$I$JRI$$RI$I$I$I%)$I$IJI$I$RI$&NI$I$$I'LJRI$$IJI$I$RI$I$I$I%)$Nd)I$I$JRI$tRI$I$I$I%)$I:d)I$I$JRI$tRI$I$I$I*I$I)I$I'IJI$I$RI$I$I:I$I$I)I$tI$$I$IJI$I$RI$&NI$I$$II$I$I%)$NI$$I$H)I$t'IJI$I$RI$I$Nd)dI$I%)$I$EJI$I$RI$I$I$NI$I$$I)$Yi$LkI$I)I$I$JRI$`> ]7MaGu [G@NʌHI$:dI$I$铤$I$I)I$I$JRI$I$:I$I)II$IJI$I$RI$I%)$N$RI$NI$I$$I$I)I$H_+* 6ʝǛo)IH|TTr?1$gBbIߥ[OḒI/~ʴ|OK֛\wIgVzn>ӹ|YO}UpUC|0S@ PAC 'Bᤕm"LO > wM->A ]hTÇr2xIH5D Q-=8r\Ѩ,W/l .N -7UJ&![Wza!]yT:toD ,(c#EU/+|IT yoPM6, v+P6`8v0h"Iy'3{p@Ů4{ǒL:)Sf*= ax HP%5O`> niB .at:T顀p|Se %F4*h#,x? ~75qmLOd+)a0 4b5 62 H2P1sˌt_M À #kCdr;mr) a$̢ZE;6Fj.l#Ev;N%A!MN;Q=pJ`uf ʋ-{RӐb֘VjsllXW~ʪ]5`~DY;Uƴr}3P jo0a@TI Is#U/PO011*^=+@OcZ7~!5:vP! dn@+6e*Hш+CJ. ub$$k_r J@uB6nQO@ i-XP #RޥHo4P"GVH2{&`ei|}M >o ]Q24!0KuOe;)z6@ 6g$`*>: ѠDXƺG;2GuSvP㫊 k[UwwK#uh6dJ#li p𮺭` yIHSpʚӨPn@6->VC>! ^b<KBDJo,ϊ̨dg >& O%%5 :~tǂ; ΄h;RHF^$#VQ_/fTi=罵v2I"Q ;\ڏF;OGik%!8"c /c$} > d2"|8ClRSQ`:gN@ GN u)PnD4*!I;x"NN{'}J>(IiSu|S8?tue$3+eGҴ[ zַB?sSpqh CΨ+Kښti Bqs#yZ_ouk~Y]$C~&$ APM^Jg ʬ0GL.>(t:9OohEDwHGvUW\DyԄOJ6$3IM $ <}[PKlA`R D>G@3#Eű /Pw}&5!9"0H'U<Z,#!Po&k[CӀ;#L0G!~H30C2e8BJj:5'N7otd<j"9޳LEo6+VC'D&1.q?&[h0 ->#>)WcK tutORCo#*0@h^5<$I@wp΄kx?&܏49AhC5hÝn㧚wS9  H!k${FR{>;mnhzytnpEhc ;X<*G6>3ZJ5oIXtO$MsL ;Qz.YVc@ճB~|}$hln ~Gq ::<+pr~jM-+-3hQwQ|i*vP: }u4cgs;R}/wĢR}& o:`ED$$I)$I(E$I7)mpI$^h򒂒I%e@. ) t@\~ E5$H('C*o}/{pTMftgq4iRUwR,kCyiVwv{\lv+wƏh~%t:t eg{~?Ž:>).pqyw >o4ceO_ eЎo0\^dxO]KY -}]&S_-pZh}}|M09^IqD7/$(gBͣ+V6JKlwgDZT6H pwp G# {W2Z@ yc}7k T*o!kuc׆}0EM !/@Gq>kF0 .W-ia\Z)me]Ь?w`<:_*cD3+6fhծ-ꃴ2*L*-*xd.W' -Z}qJi ";3hHӲk{/Wxx5ts˄-PeCd+,ob4ɫyYcB'SXoԮe:rOY -a+XFV;À[Z+Mȯk vH!) &@ŽUe͑ULk`gHZ d4|:U\a촳kcHn ψ+ E8m'EzNЍUw{tFGFgAfmf c xcZ3U:k)aكeۘrYwi=NJ$J`7@"t2:^ƏlrasX`v @ Cͧqô|+a# 7$ZnCהci= ޷nKq@Gr:5oգUwKKT=6Ur0}]eh4oSG(Y m썒PVL0w:n w@Po![*_xt⇉iv*w7qe;pa|̳^gOgbp~u.b}u=7M3^5fz7r;n!f Ok qhdZ{$VNwcUǴDuۆܚCi/ZƎ FoUkp$p}VUt:9V^_kHGuh a ߝ׭^MHP XyG$5s &{KO.kb:@on`E ͬ[a<ct}?=ӯ+ k]ҟ3=\xDj.n o ^2mylYf"#*NQIAeA)Id M2 J!:,Gz !t铪Q*NQ)-RI$$I I$I$RI$$JRI$I$I' aD)I:b&I*I$JR*%$)$Q))I$IIJI$$dI$I)$I$IJI$I$RI$I$I BIJI$JA"$$I$H)I$dI)$I$IJI$I$RI$I$I$J{JRI$d%I$I$JRI$I$I'I2I)I$tI$$I$IJI$I$RI$I$I$$I$I$$I'L%)$I$IJI$I$RI$I$I$IJI$I)I$I$JRI$tRI$I$I$I%)$Nd)I$I$JRI$$IJI$I$JI$$JRI$I$I'I$RI$I$I:IIJI$I)I$t'IJI$I$JI$I$I$IJI$I)I$tI%)$I$IJI$:JRI$I$I$2tTI$I%)$I$IJI$I$R'Lt"$II$I$I%)$I$AJI$I$RI$I$I$,EBmTIeI1I$I$$I$I)I$K .au;T$;J:o%[ 鬨I$I$I$I%,I$2I)I$tLI'I$RI$I$I$I%)2t$I)I$I$JRI$I$I$I$$I'L%)$I$IJI$I$RI$WvTl]:;6,R>3gBbIēK&q$_~ʴ|OKJ2F*?/ZR|/z_ x,? ,:dTyjsG!?k>eb˙ɔ-m[HHap`-@0Wc> ~-7ZbJ4"u&k y ùI 5)$R 2 ,dhmJ!VvdIiHg8,s9Rp`I8 [ g#r{O븝[KM }-m}I:‹u RcQ81Vͮx9hb]CV4˽Re|FU85@ߚ=Ed[CLXȐuJe0IuuH=k-R,qM:UZ*Ht{OugTw*VU-R (,!U Q[[{" }B&u;GuWWPŭ܄]6௷8}!qև,9 T-g`0*Zxj aQjÿ Rk(#VSNާp2U0dzJŬv -DAhiM+UͶ]x(b]J4̡->৾HqV#IJH%> 1]Wy+!ʉjX<ǚJ`1[?FxQ/qDa\;GuY&}MktIHNeX BדNגUڅ1ꇱToz.TK'0lݡ]UH$jmD'UݔYX%hv:ZoYen *T*t`=\׶f>(DN%[˾-5vTRW-y`YuEZ%+/zz{GOø?+uӣ$[w!%.D֘'U)jQUִ慊&@5AW{̩aS5‘SýBDTdPS[jB;[:շdoK` NvQ5 )[yȓYiGv &XADTRS 5R\4D Rk*{beFAS~QIw05rQ*źrT?PqK[Buad&D9:n#LSh»W@E>ֻwF>5TɷOe4L&dAH @ưx$$q{> )8(ƻGjgWCu ɗ{C~ܤ4C};+fͳM ""Jsaԝ tA5ĝBHUvЕnCxpkL|湢4+QdB٭B (XFf"uQD|#;@tH1v8HL^ 虌۪)5|RRO^ ەiP/HC,k3ZtTgS& sDtsƁ&d</k<'8gVyiO 6>()*mv5T {c Vc:1LvO$JJ6%?eS( Q;~o|K>*Gq慥^PFn%Ck k@AU<*'vV'@݊.Ƃ6 }ͮs֖pGTv:( 1QCNJVs5[l{Ȣ;tPm uH DBXR؞QSOˍyYײut,JaP]jh%Tʦ %hw  >+{ W7 ̦uMhFkd ڎXJɷ9ą7<@4 ycpLBى0Ju h;!4W'Qd' ad-vuA߲n@`Ji>SVE!scU'^X=0F8G斻A3 o>iZkL2Q!̗4xp:~Df`Nr+M:'A<4H:7\A?4ktYg<C'UxiD-.2 4ll["ZL)3XO[fƨÞ7D$$8zdonPv?]AQq(utŀ; cZAȫZu1Fy(,|xx;pȩmX%<$*Y wqW,&`ʭU9Rkh#(iIV JqG$'Pv D ks<U>#4ieL= aZ8L~^vCb)h98Þ<2~h6uIȁUm՝HM΁k*vn!J )}sJz_WGJk$xWR,rw[iѯwDki>E_-&cƒ*sU[*F<›z;QWb;=cX S}2);;9Zp3Kk~h0}պUѵ&eVZk; 0|K_R-!׸xZ;@3jhhP[uhE7 \>iQWEqB^s,r51Kr¤v8pWW׵4-eX%^epܱX_S['U<]`An4@{a!8 j;ɐ(t8m@T>kC(ڇx≎}:`B RI$^ I)$JS$ $IpS RI$("DTIYg@a-c9(.Y1N`$P>QU))lKb/)5Gh:VWvNuˬhX8 \ہ&=,5ۍ݃VՍ]Of6-%Ϫ9w޶}[hfO$9:jw {],\oy+CP.-$,p*sw0S V-`DGcY$48;¬qGt FASi-r#܇cnoc _O|woRݣ%7p ?f#2YҐx´pel|zuvFY!{$j 䭞`mv4Hzg>YDnm q,x0j΂ }ĵsm>k׼x%].K +Fsr[t<1j sFlR~ԟMa 밳CɃ+*v5¸?t?V VYo?JF}Uɫݐ[ SoFݍ)$~3''ڠnEJn6gD塆 PlIab0:%w-4(%xשֺ-IdGò/dn`g3${~`dlkzwW,xMꍟ%.n'[{VnY,5[%y_osKG ۻ\+>wPS*n-9m0>kF>9sa=B:rwZܦgR܂z0w7B]q5\64pS΍`',xwد3x474V[ !òo7LQ-YS~E9]Q8vMn<MűUAdDau>՞G;Q*-~I> f!wEPZz/v•Zqkt|^YI6_X:C;*OJs[^ۥ4wm~Koq(lw\?Q`\r]6GEs4,Αm{uIH.7 ]܁t8s1YnP(0QCڂހwX ꣔ RZI2I$I$I$$II$TI$ )I$R !H$$IJRI$TJP)!I$LTPRI$$JRI$$$$I$HI$I$JRI$I$I$I$$I RI$L0IJI$H)I$dI)$I$IJI$I$RI$I$I$JCD%)$DI$JI$I$I:I$I$I)I$I$JRI$$IJI$I$JI$I$I$I%)$I:I$$I$I)I$I$JRI$tRI$I$I$I%)$I$IJI$N:JRI$I$I$2tI$I%)$I$IJI$N:JRI$I$I$2I)I$tI$$NI$$I$I)I$tI%)$I$IJI$N:JRI$I$I'I$JI$I$I$I%)$I:d)I$I$JRI$$IJI$I$RI$$ RI$I$I$2I)I$tI%)$I$IJL$I$TI$$RI$'IJI$'L%)$I$AJI$I$RI$w'|BI%I$tI$I%)$I$IJI$]Nr˪ҦT$;W%XUVS YQI$I%)2t$tI$'IJI$I$)I$tI%)$I$IJI$I$R'LI$I$I$$I$I)I$I$JRI$IIJI$'I$I$I%)$L"`Hyfn_ܒEIH|W/{?K'F$_5$~ʴXԽuE\VK?/,? 7v<,B^ίv1|{AQvh@@ؤ)5T 6q7i dݨ<ג#^B@{)U`h-vcTD8R}drQIcqkKoMZj'۹M>Mt)=v 夤Nd5n\@;F҇k.©{v dTuB> fL,XYn&˝#ӹTDB+Ą K+ gu!H^5 P=%N"vdj9E[,7<ִ:7|lo 2\jm]A1|PRHxUGVv{GhU[3`?i JdͻTx z6@8ZtKUqavMtB5&"OEݹӷsx0ߊs IL[DK&n'])D]` &W)[^u%$eACSSqyq)6F!05IL)ge r|B[; aS}`on께ѠUu9¯m(,{%YeƟ5jX >+1ă¹FҨ{67QZS,LX I$`#YUh>#AphWRsZ}ۺ`{j̫ y:>> D )0| A-g k$ a!OL0dwQp5~IېZ$#oME#ok }  #Nj,t9JûƜ2Fzgu:$2<†.Ad4 $FkoU}"!Цy;uյ0R+}-/S/vO*m{#\44HQ Ñk#lS`\\A& 4$ $6nBq`sUs{8mL<蒒>g歌meg񮰦4DU"kЃ5 H%6n72m0V"[aӨn!IN(hIImf&aAy(;(/2C{4;]$L%7D6Ckdu$@dd8JȂX_̔ധllPN,㼭o۰ y*]m?h#M^m:;+/[Cݫhↈqoc =SMtp3mdҸz4ؒHRƹhi5:=ymc Gց%P`j,%K썒OtdgL>︟u/M*oBxϙQcx}\ae$XI:Hn{P4IiJNU}'A!A@VO$$PhTNr I&~v!̓JRI$pDOtCpWu$)$舙ה9r)d8-1O` ;l;v P0+c;*V뫏bdfYѾXh7CRZ>J[І맄6М4$OS9L)vTI0O͎{$F)I$h9aL3MRRI%;&㦀"8p RI%C'.L~0}aYV8x #+0YN58>%il?E 4GN\/k qL4;qK +"(y٫J/GknӀuVpicX_#PtzsF@6LiB_EdZ*i#MU]]y.z,ĺk2@+CuJ+?O.F+ sO;LuYdeu-!cNVXy(~/f HZ\Ey"u4YA1\mT]C{Mi=# 9XK[vLFZ4NfֵYk\6OsRϟ>J+[t*.z|,v4=Ƽ @{=;鴰&Gb[-ՒOEvs ؼK .|iXA3u:, N2sƈعMSuإW!;?j&zIAoFeiӺrh~`߁I 5o S=VFgT #Bhvm()6ZsGl9 q嫟4;ލgG K+ ?"5!0 p^צ}muCnwy]6z;l|WFkK};wݗD{AU^?Ә-u?Q.\<[WuFG+Wuz9@rܢkS:&BII"I$$tI2I$I$I I) JRI$I$RJI$@I&)rI$:dI1I:dI2I$I$I$$I$I)I$I$JRI$R !H$$I)9D$$II$I2I$I$I$$I$I)I$I$JRI$%HjuwIJI$RI$I$I%)$I:dRI$&NI$I$$I'LJRI$$IJI$I$JI$I$I$I%)$NdRI$$JRI$IBI)I$t'IJI$I$RI$I$I$I%)$Nd)I$I$JRI$$RI$I$I$I%)$NI$$I$I)I$tI$$I:d)I$I$JRI$tRI$I$I$IJI$I)I$II%)$I$I*I$I$RI$I:JRI$I$I'I2tI$I%)$I:d)I$I$ RI$t$$II$TI$I%)$I$IJI$I$R'L$RI$I$I$I)$I$EJI$Amd$)$Y$KI$I$RI$I$I%4ѳ%J*®J YQ)$I$&N:I:JRI$I$I$I$$I$I)I$I$JRI$I$I$I$I$I$I$I%)$I$IJI$N:JRI$I$I$d)I$H?+* 6ʝo)IH|TTr?1$gBbIߥ[OḒI/~ʴ|OKJ-s_TZ>'teKe0YiijwK;J3#L!N…<BKIn|a{F5Т/B'"ùcͰ8W+Xjیm- ."2g*Н}tTHVwy)ᜬn04WqlmQh6mCk Z nCK w B=P2 vnUbsOҔjfdj2E@t9cuIBup }^4Yݪګ-tjf\{A!fY\]^O x~v{UK1HwPJv&Twj̗4{^}p$ R}Ο7⒚LǾЭ3Xi:%d[l|MtRZ;O!Wu(6B^})>L8($a jiE?;]B3o w@{@T4@GRRѹjBY^hpƒ3€|6AMoMnߤQ0̞RmAJԪ2䬛@T3j[&}[R$ID~Gy(9-KQ[^Ѣ+C6<*w;gڴӨAsZQqkF}{ĎU9DG:)õS r=JPCoƪݚ8@NrC˻S64:&5F.:8|%%0}$GH\:67c6Ѫk$ 9? Ky23/lHDkqʨU_iDmrJ/q%_$7h¸,kB}vU c;NǏJk`v\xXiZ[NIA}~ lF H:JCm1IX;T_Tփ ^Ji\F4YYY14׃#^755nPeCO-u]A=W"%3YnP 0™~Ψu|nZۤBJGXCE]3;f2$3]SԈ k!!' ]Ax& ({. : G IAm-|IQ[RAkQdQyo2r>HpDn(g0Vv1[@ P}!Z`Jl@hTA"7PvJFA%1sNO({"4)(ɴqS.i)ILܓX $X Ay*o5Mq?J\JT}?26ibߤ^CZ1$9JTKeD 02 )&vX謓JHJI)SUf#뺳Dhg[=24x>Hx.@W>2*uzo5PmM@G+$8x Zь+l|Iy2I2J))J]$+`*^yR>W襒($,SL$N6=ڪxebffb*u--ᔛH\^v{kf5Um!o;w`PING<:d}#c*lV^y(9?+[(Hvg{ +*1$@(%>6t_JU %K۸8 'k F&tŒctͥnvRQr 0h,&BYUYe{|Y ;tPhMDw@kDG<&Y&O!P}38Rg ;AmqCK _;@AF-cxY.tDȣInVNEӡZXmali xm5?L"öIw{ji#sxX=sёPG?Q{FYZVXcQ.jIlZՔj~-Ȧոǘ*uViM,z 𲺞HofzӶab7t~֍VPpŹ~\[+Z3{(Y0<d~j&RC ))WFSʻY@5K 0yI(@kx s LK=9誊\x$AnSHZLULCN %ΉR#6rm_L ~4)Gme$)$R'C \+* zI+ nވfi'3;|K-.Q=M`<^-L@Zic[L,j)RmiS MAYN2dTN[BTs5=AZ[ ImT9DJ!n=( lj[>(+Y״B~`f$| ["OTncqֆ rdu:1%~AU&xТ)$xz 4Й9@*N0;Ʈ@8v̤f!`SA64s<$Pk9IZQ5}v?ࢳ9r#zaVvYc{$X*(y 0q2X#}v%!#`耧-ijcݮ1Imֿ@RR?EktO mhs;(jL$K@$B})B{) _jpPF~hIKm@Sf_il"&>h4ja[ςIbkb<Kg'] jB-3AHBkDۑQ0ॼSmix?a$ ??=2Nۘt 8/tB|pT8nI <SqNv(Jp0TOP 3q\@Ф)|8okt'TKtQ29Z `wj1RNuNL-:(݁[ƪ0>G[Siqh#D-DSjl$|Ռ6Z:.z7XJ+\i*-٫.,I =F04 u<ƺ$JI$5DV5LtRI䒕)$ LtAhIJM)&X**.v{3Oo%=5U$R.% sDڕUB8v0;|?u_D@Bϸn8 &zjtBfKm%Yl{tNIkK)Q.HI<%=~%@{ˆʯwۏ˪IXY}lj*ĢY+X5!b:Y%f@4BkhBlwKDQP?4WYI$.>M%f>*#pO] uԔԎ/PxM%|b82OL1<*d[utl}P9KpRJ+ox}ӧU?X8qB Ο5-(Z{GTÎ|A&'8Z[L8A%// }GP `0#Ne}%m {R9*UIhA~=['kw ;:^!dRxtMvtu ?ضmdAcVA'\qO[\64<.@`p ¼Y@Cy V#x3ȟ v'JfwwIkC`ݎ,>dxhc*^5j7@ Z .sYNem%dr]eVp\[tsjţ3wA=rz(3XpNȕ! ;PIVxdSyN*gR6KjTc LCgjS4OV5H\qN6G+:%6+Fw/S*`쩅r]AՑWA%L e6.O`Y[̀'$C a$I6u ¢UddѺdn5ۿ9uXsZkO/$KX hgHV&F+~^W@o [z`󎓜`osL=+E;ƮGGY$Zdt~{, \nǙӢvn쏽a|}|Sv'S66`w޼MnO}eG6m$ mH!hI5hۧu6GQaC[.1 o0{q)Y׼ߗwhҒ\jw]Vj?9niPs4#wA4 㨃1rAj Z.v罄I Z{a EwTakm'>A %Mtװ9i"Dio]IcHUoquwù% 5*a:WɇS(VQf14#+nssj3v>hbՖ$j?@)=DTVWq ?Zsw~n~.7Pƺ4MTnu57"cY6YA4pgY#i9S}3pD:0> A Pg]MۥOdkןQ?8?a+wHi|/ϰdS:w+5e{&gOfen=]yS`亓uֱGVZ7<QsLs6$w@kb{[;-=Vkʵk{C0B"'tn: FX%*iV++h ϸ&ĽPjc|V~R%&]õ\wS8iO ; nqch gu * 9:MNFyY~HRΨ4<gЗV4-?3 Zui'_5<.߿YfaۅaPWun^uE#/;³MRk(YY "cd3&mfZBI"*I$I$I' J!H$$IFbTI(S$$J%EHIJI$&N RI$2t)I$dE I$I$RI$I$I$I%)$I8L$$IܢI:I$TI&I"(RI$I$I$I$$I$I)I$Ju"VI)L$$I$IJI$I$RI$I$I$IJI$:JRI$I$I$2tI$I%)$I$I*I$I$RI$I$I:I$I$I)I$I'IJI$I$RI$I$I$I%)$NI$$I$I)I$t'IJI$I$RI$I%)$NI$$ILJRI$$I*I$N:JRI$I$I'I2tI$I%)$Nd)I$I$I'I$RI$I$I$I%)$Nd)I$I$JRI$$RI$I$I$铤$I$I)I$I$JRI$$RI$I$I$I%)$I$EK$2I$JRI$$RI$I$TI$ 2ge$'Lg$I,RI$I$I$I$$I+KgUYT铠$I$AJL$NI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I$I$I$$I'LJRI$$RI$I%)$I$IJI$F_PQWvT7/II2v}!\OI/Пw!SnK~ʴ|OKַ*?/]?/<_|ꊿ{UYn!O('O5 %Gmx"T]h@p=Y<u:Osϒ5e+MC xf\΁ OhqНSCž=`\ؕEƄr}o&E6 ̠6J3#cFai%kg3]Ft@qT>jF@QX'Cj8J{px=CyUY vӴ-,pgF"Lj}/S:k䔟՞ōiςLA ojw,4'Cs#QjHWRC7A=%@:OeW"$ټAql25ק?yX3[yej"!8/V'XbpI~k-~ lZed&:{ 4XgY*[N*c{scUӼƚ[n04V13Q5QKٟi iST;y+OcLfSXOO Vzcv \~se8*[@ӷU55MnbJ$m#\k>;q r>y =퉀FQ6[O$n5`x:w$)naڣ=D~0.vCɐ[7B)2"G1'E69+Ryf wiB6?/D %gNA5;"M~ݯ{߸ be`/KΩq$D3y3 Tn1I m:+``D':Fmȡ=3&  L{LN\cHxK.Se On<J)́ E75Dq@CpZ4LƖxMLT@-$pO @0e-u)mJN:JP&q$iw'vZrqRS-Ţ`k`4gIhHfq,: 2D܅\r B+HoW60B4ʽP@&8CqFvӢPs"$*'*E*U;h`D)?VavZ@l*<ʍyvDIN)ʲVUl N@Ԁzuz;!T-4?>SX?5ߕ VgLeCu*#Ă -i2$,:*$W$jxJz]yPsM(Zސn!Q@mi)TםuD4$=ǰSj} U6 +1"IzE溽]#76Gފ JxPuL ULSTvK@]>h&У]*gd6Ø8;|pG1@Y;T ;Ek:3wi[% <G*V'$)pA$Y:äw%)D&Em{]=ѩWk;*5[%\yxA\%3Z&T|U2~1V>sh!Ywvm*NY״ҞKՋmWk(e>oΈ%r~ :*XUK%դwBlʪ?5NS?R Ƹ;D +ܭu<լJ6\uMQ0=Ait4>D;tUG'zNemq-- 5{}_X{q]Q/C C$odgbƊ= XZ.nװn-&7)=֝iXy7=wh5ʝ j S/voe k wt<.xqI`  )v=i2Zfw- -(Z[x+ +XtYDl)f;nlmaX\[{$B>9wi0{,z,*6qiL1SC\4՜.ƧlZl@A'u_&D Z 5IL׀fT䛭VF)ٓl8DsIh{!eu΋oGPEo$\@?Hq\gRnIJ[%PBu;Υw2خ[tTfS\ оթ[:iHG :Vu6z:P}~+/ \j5֖_?$;X05Lmi\r;m.q͏RSEV3E$7PeC4>jAdIGǬ]kX*}qᯒ*Hzoo$vǂEnxg4lvUY^㺯eA/U+ jJf=2?J6y$U+l-><7$OX@ ,JlL[=v>)~HhP }[Ocio4VO9#B:bSVC [3jg rwtwtOjگ.UfcLJvM-itb~ƙ+CmweڋFUw4[",/լd7SX 4i msmakfRkv &uQK"v ;[WKLNJ_Gk[4SQgxA6'ĩ6VVo)9ʕz HOQm:,T΋¸?*L5E!!ö,*)Ttչ w2{(WmVs Dז "<+.ZdmצWoASsBB!a>IHs 1P["L$ NqIH 6be&8J37 pBtJƑʂ*F\a5O[O6GQi#$򒕷~ nh:D.'Dsݰ>hGy#t2eCfAJӠAHvMacTU(4wIIce1q*3cESA N)|&B2R.|k  [V ULhU^Ibzc`XBצǹ^TD_*V1OtϽ۸3pS]c.DhH&*/a5#Q9l8JdJ#䒔8 `ԦS'A);>i#%1.  ~I>>Qg_cdHH.RqgMz;Ym_[SLvL2gs?Ihq٠L'vwܡ0E'Ә(!Mt!cΐRJ1@:!Yc7q$2 G6^viPo!%5kLyQ[}TqA'BdGN Tk\4짾|tk%0ߺ Y 6@KB.7e2&V&ה I(agq 6]TB^  !y&G#"#Jfô8Jx{vcK\T-;d*a4+ IMZ" P:aH[\^u`hq1NC5!%6(k[AuD8tL0QxDHIn0j7V4E1DH@{?*5&T^_XuI5܄jDʦi}!O=ZfU OwI%6p $܆਻($ |T}3%^ hn)NۀD@'p $|>JF|VkV6UABbW4cc-wlRpcRx6%QLtX٧eaV3M@9)v߂D[.䦮b s5ᮊmhĠ]=ZJvJ%.1 @nxJX:[ߙU%d}hB!k\sX D,΅ditj ?F4Uh2Z<9@`QT,z"UY+TXa=`o> +g(آw4F,c3sP9.p㮍[-U&vYK|8ZuXʟPsH|öIhltBUZѩ!c 0sI%<$EBKuvdI˜9IZX!b#+Tԯpd꓀dcO`EOx~&9`-xŃI%qNӨ= rJ})k<KR0d"WW XHNeEU=exc5gMIt4ULPMu8*u;O}V3@`UiCM +2}\|'IWM*4røN!fYV1qRc$ʂLV'TtMTa $$Hz*%{jQ.I@'Zf,|&TmH_KiP6BLqUwI=H;+ƀ ,U$䩃:K{CQ:\4E r@:G4Gme|JJR]V٨ocH+^B rPܜ F\ G u4*9ٞ􆕃(ْlj{ .*USuqONmcrG|uN"~ 4)!z v?"I@JNt&vV(NOtQE|TDݑl[ /shR鋻(oݣD0VqD>:c `F܁ v Zu#,dv*-J JIו:Â7_ށR /LM2 rq0gUM̠$*'_6!p'5ȑ:X4mƊڐ~ѨcDd *UedCu9oD5"qqD~ZCQOlH.kN[WMW-<&s47w2w"JbUMG2 *-=AT1X$I׺0骘` ʃY ZָF1mav$766Ϊ4ûd vCe47W+4`ɤZ7tfPhay^%6]eQiպ|.wFnAidA$ |{ sij5͞;d6Ucel:gt:M>iVp8kvKbecي맲U- ɷX!gtfU{GK{xC!f9i4`;)dV ]4sEW(t{ƼdMrȐ{Ggc@pkN񮐞K./x,t\;y,~v+VsE j/kN̮;5n,hbu]ExV?GTkt-QV8FKO˨I4iG$*LpIC˰a߸6Z7ea_X<ϵ#cmqiQnPǴ >*8 t1H WjAQRFvPOgbo 8[t: IC5iTnǎv 'BuΤN 7 tD} :;O=5(od&'HR %p5 L[|QYW!5me/Xv%]tD憷#{ #^>C~{UiЁC\D(VpۨSNJqSѹђU [K}jc[SMS6Ӭ^gֺq:z<}ohh3Tnއm̯Oc.`[׿wSqyp$cפJA8Q I)I$tH$IQ*EDID)bI&L$I2dJRI$$BI$I$I$I%)$I$IJI$N'I)($$II$I1I"(RI$I$I$I$$I$I)I$JU_))I$"IdI:I$I$2I)I$tI%)$I$IJI$I$RI$NI$I$$I'LJRI$$IJI$I$JI$I$I$I$)$I:d%I$I$JRI$I$I$2I)I$tI%)$I$IJI$dI:I$I'I$RI$I$I$铤$I$I)I$t'IJI$I$JI$NI$2tI$I%)$I$IJI$I)I$I$%)$I$I*I$I$RI$I%)$NI$$I$tI$I%)$I$IJI$:JRI$I$I$2tTI$I)$I$EJI$I$RI$I$tI$IJL$NJY$L6~J¯$II%I$I$RI$I$I!#"9]u_D|] ԫ?䢧LI$I$JRdI:I)I$I$JRI$I$I$I$$I$I)dI$I%)$I$IJI$I$)I$dI)$I:d)I$I$JRI$d$$I$I)I$H?+* 6ʝǛo);>NϤ>+ щ%{?N/? ԒI~ʴXԽu[QhǂQ,a>xX Ll G*KgK (mg ],ejѣtLtIYocƮT2 _3G`odnSMJNưsCʣ 0J;3\8xVK"(>#+®*|{TsƏ01<(%Π4v>*l-d4ohP%D{k纟#H cP2JFfXaY;'0A3RRĦsdDbrA Bc*lxH%* +ç*M)LE@O*Pim3muNZ gR' ĎB岺Nzdh gR}bq)wo^a5M& ZV0S9W[ r#BjSc_D4:/ {}d՜;$.iN,a))~{;^ 'ƫfƟh(9=5NvT ycG(i F6n,0{hCuEi2p*3&RW˴iL^ fy"McA0m@!*\-nu/([A pgkrHZ{~$BҦCt9X+?oo(xm =KWLNs,BE6s=wYɶd7a=9TÄnFDxRtX9NGCkZ@<3k4IKSeqJVVf K|pYkjtIQQ|Fw 3ַ1CvSfn~DJ\QrZ!cğy(vO*OoP@W4HU|f\]cRtTMM@?HG5pxݹۜ`,.@x{ݩRZB^Xo>y+d,oCe{Z$6@O?TPVl jPj.^Y:p]Gem` i"a4hlA*Us@"5ItdI%I$I$RI$+cDj z iu]yKCĎD;)f80 WvZmK ۗ]XmV2suK&m n-$f⹿<|i\UjGɒʢ-!'ō7XM*ԆIM堪. RR77~a%luj8js%"4Orp|~e2@X!jv G05)%1KukFTkX$ ٬f4YیYS1(a$aK\H:z(#$Xbw!SeOpma:Um wSUN x }zN)cX;w ),N%V&=Br,5) l;U[w4I -*l C%)ɓ$<<HIJ:I+ 5Sm _sQ\5V)'tR~-\lyoQ DJ4Apbʩ~F{U *Q@@Ot0ra%ȜuPZ;#OD Ss7$] ŭ='c!L $ +N De3^QYg Eu >+Oh!W^%7%}-k!*8"9X=2S58+;9X#[.9urUir ib?ԂX}9ez4[9-:r(I7+@;kc!"[G !, fPA*ٙ.mj Yȳ@Yo &r{nX쾭1Ӣ\DΰnƳ鰑~j뫙ۮ#?eupi5>mYvu }6ݖmEߕ Qz~*L/cn}ze>5~ddoZW C)D+5z@P{ߵX!Tc GI)9ps[$KNZh2aK&ݺ&k iƈ/CITA<%?"jh!Th:X@@tI;^d'@/kwЪ'iթb{Hn)ɫt:i1\RO,gѾ\NkSI<#ʖmH+</ :&iƸ^+oyWh}דu<3*Z8+R<[EMw˝cdtI’RE I$R TI(HIE1NS$$II$I2dRI$$(RI$I$I$I$$I$I)I$Id%)$RPS젂I'I$JI$d2(RI$I$I$I$$I$I)I$JUZJRI$I$$I'LJRI$$IJI$N$I:I$I$I)I$I$JRI$$$$II$I$IJI$:JRI$I$TI$I$$I$I!I$t'I*I$I$RI$I$I:I$I$I)I$I$JRI$$RI$I%)$NI$$I'LJRI$$IJI$I$RI$$IRI$tRI$I$I:I$I$I)I$tI%)$I:dRI$$JRI$I$TI$I$$I'L%)$I$IJI$I)I$I$JRI$t$$II$I$I%)$I:I$$I$I)I$I$*RI$I$I$I$$I'L,t*ٿ͕aWlARtzI$$I$I)I$I$JRI$u}\y nUܕiUw(鬌RI$I$:dJRI$I$I$I$$I$I)dI$I%)$I$IJI$I$RI$NI&I$RI$JRI$I$I$d)I$I$JRI$6ʂ"GlY$C;>_'F$OI;k7RI%~ihPuh:OT9o)ޗ3O}QVVJ#Yʘd6~;VuI]MЅ0:Z‚.ૉ-T{) [iRm8dzZ0ɬv XlĢv)RƳKW&h;1]YYź$LԨ*Pb<%8>*3ثuW:!>4* Z WH(.|tF m7Gj)z] h!BΛS4BLY$z{iqhV`h?Y;0W􁔛xm>)US.!øHIZFxf{ׁ:%LvO~jPUt [OSY{!k} @$J 2̏eeeYYW%CB-~+ Ehݳ%:@w0i wRh>NߟfC*6== dknmp-w%NÎw3(0"(kjNpӣ{؀0ZUXt!P2 {.\ p n@ì\Y*YE=$(ʒH]5&'h09[+uӖ)%w$it++hCc^<51撘?Hz|V.p-JxY,e hOO}ȑ 4+>5%haׄ<PHmq\D_v vo^֗v&EeV+vO5i߇q~+sP0nO 9QVZ if E`2 {+Lj'<_^LU1k< :e–3ok@BE.]! 1ಾb p׏Z0Yj7X2k1IT#neټ;]-5#2t乏>LaH:黬HB3Gֲ&u^2+ y/!縶O}ꥎ&_i}r t-#J/ONLTi 8O1v[;g5B{4Οr{A S:@=(Ӑng*.kD﯒'7evA:'/{PGt` KƭBѢnVHWNcQBil+F,2NY@+gI9C&4Q-n[C|@Fd~! 1]E--hb27>H xOBIxC%cS3U'Dk"4EMX]!G}#UZIRswJ-Dk)3)9| ίҶBIhQάGeJVW)L5I$I$$:JRI$I$d$I)I&I$I%.$$I)dI$IJI:dI$I$&IJI$N:JRI$I$I$I)I$I$JRI$I$I$"aHyfn_ܒdCП_?1$ CpI$~ʴ|]Ry:?TZ>'`;Q1~UC6r&'HU㴃E nrJIiO C M8U㕗G7*?eo[ٚ5BMpp T 3"vSY:[y*.$jyFMdʓna"}.~[p{ٍ RVvRS6"ѡ5UfXeZ gYf">*'ͤ;kkYC۫N8R1@?ީgnk W骞%-}^vC$'f@=ҴSt:TlqG*Mrcx0"ǚ]s%kUCY`i`Α*k Rb {OxM8 }bFR9S4n7w6*6^FېOR ktT& M7SusHژZuUk]yt9U_KY7u z@o U7i~M_h`>JlЩzv<*Md9y'teO X^zezƋQ8EFkPI썄Kh).U5Fn;BVfppU_A!AOnN#PVkVkc[Swp&,EeNޣf@Ӆ)7;O"֝dfʈp:v ma7";[ Ik#^hA0教N[k(]Ȅ]JX`)wyAR n&RҎ*l~^=KN13P;2=۲,t|jWf`yrf8uQu[#Dk<$s=a*#luJtg_ѺVFTڄK&d]Pݡ$xD{p0U{OW- \eWrG+P1-laaY-<к u -mE8[TWRcY> Oe jvI[+>*_fXqKU.ۧ{Reګ;(7;_kk|Ht 㦃 OmokC{wVzzOj{{dhGU}"buVrNUf8)EgQ6;m"5OX7uڇQ[1"uc0Plԇ 7J(U nj gSXu6uW$Qiה0lTKt:y gEðHf`*_o"tY%À 9Rp#}+8vD W0._5Bq+}y=3XyR[&S|;+cmMK9iy,S?!7+i*I)T]TNJeJ-TKR]4El(J JcT%@`$&qޚjy!ڟ'甔InXc#HU  RR$DM cݮ+lv܂7BmA$U J1%Yomvem:+8,!RHJ 7k3u 7~ iYisuBJgG$>#B11X8-GS6): u n?$ 2%5AYV:;\\L[d,jp0CԱ\wUG ʮW-iGip<,Hk;5YgG0y%o/c;~{@\>=7B 1oŕ;tEk;Lazq#̠5Ύ#j;@ϻ8t# *ac6 h[kp})k+aVڄ=k?l8Z2[21CodmOCuy )p'Nel.!zwSZ^Ai]wMgR6;6kpSXx|S4ĈBJm[rWC$S| pq54P8FٺA Z5HSt"ddUh D $k(0Mpu UN[-lOu~%! &ZloG -9Xź mf;{h7ăеX^$W?[=ꏤfOmUcS;'V&pjV3*{Hw1"R:*Gs&)dWG-vYXea~?Ef#kn ǂ&cnRXOq#-L !~}Wnij.nW.zVH?z97HiZ^9 j9 A4큯tJOerْ> Fv3aA|A m#ܳr1oV Kw<cNR G$B7hmj"8Y 0R--"ArGJ9 Oc:Rafr{Vq)kXn-}_)!cdΩf0 7t@ɱδTcg.#{H:=0 a慊^Ru[` w$o5(n5 {+4Ƌ#iy60g3su1ʸ$|֮md۾ \|4uX 4x.k1;+>N:kIͅ`ӅᤠMwPp{*.Cwҝ%IH:CDe&r{Jd&'vٹ!׸lP˥N(S*vD衐}pT{i8μoQ|2Uݥg}ZY~i?Dh&h" e tٍBR[R.{Ov敐6:TnaK: yOÊ;lkHMYLe0yQ'|&gDR ER*lg枖mF7t{= v>#@0{{tP6Ag>ia1<H:x'ķ{`PCrH#@6Qme h:~*=׵ΐ t'~ -fH`j&W/RyX5"O;W^$NI$$IQ)ʉI I$9 I(H)I$dIJI$&NS"$I$I)I$I$JRI$I$I$&NRI% T)$I$JI$'LI$I$$I$I)I$I$JRI$TI"$:IRI$I$I$I$$I$I)I$I'IJI$I$RI$&NI$I$$I$I)I$t$I'I$RI$I$I:I$I$I$$I$I)I$I$JRI$$RI$I$I:I$I$I)I$I$JRI$$IJI$:JRI$I$I$2I)I$tI%)$I:d)I$I$IRI$$RI$I$I:I$I$I)I$tI%)$NI$$I$I%I$I$JRI$I$I'I$RI$I$I:I$I$I$$II$I$I)$I$EJI$NI)I$I$JRI$I$I$I$$I$I)I$Jog*͟H*I$zI$$I$I)I$I$JRI$_WjmW]u*VW)H$ĤdJ]2II$RI:I$JY$I$IJNdI$I$I%)$I$RI$I$I:I$I$H)I$I$JRI$I$I$I $I$I)I$H?+* 6ʝǛo);>NϤ>+ щ%{?N/? ԒI~ʴ|OK֙chaf}Rhu(ޗ/>aD-5 lzOu6$FT)($!m hVbeih $vYXtVֳS+,ReDUu-ƒX0fE3ҢL&-VZ+E[*Ͷ6 ˵VmvV2k qt7k8WVW%y%*xZ\ v0Sq:r@(P0p\C6h`vR*?L{Ni$ "fJ-|;^gNʻAR0J<-*,i;=;-#XPP.qI gH=oi;eIֈ'x=&04Gr}΃IM߸mU{ f[ kI'3֍4 a0HZZ *I.'5?I("ߴm,yi:0]$Mxl2t@"R0 JlPI}_ɴ !#ITcKgwuII}'@( rG'nKdwQ<N >9S0 )<հ6{ &{-kK8 lAt7^" wDmmNS #&۶ 3\@.WiQ.kj; Kuj'MJVl3'ISe-0JC[I6K^ 1fQ^q*1 jI՝Z+]IU(^.;Mj#6Z:DI+ ӲPT.$; TQlha|QtRnݻ+qp {(m᧊}YWû(usI [K4{+Xzn5J\%Ne,Ѭ1g[_K'mrvTZ ȦYmxnk5Qe!x?­\5^ u@2}AwPԁ*SFtԅQ P%@ݻdGH#FЂBj|oNE7oPٕÌZ1:H?f4& ~4Q){) [T`O"*D(tLxx c㦨-t 'R H)R $ِ]3?C.HPi.%ò $A\ѣē%6(i070 .Ɲt2`*.ԍV88NS@t{A2Gd6#fѠ0eS_4N۽3O) S 0SFN A{͙'E}4.q,iot@~\ *YW[|>ϋ N*&q',`rQ)`o{ T~#p:IY^۾sx׆Pfn"M[vZ4P7T:{I <al_^S02׍$jMV>%ŏ.[c 4. (kk3Yn,yo gWܥg8.v<+{ nG[`VvV;B,wNgOen`]tE6Za]#_%3&tNT_5*4 hG2>H*)J Z#a `V%A?װx*ag>`ʍ*F(W Usq DkAsK%OT Bֶ-ppT#X"G+^Jh)ٍTlO 5FtƋB ӿT qȄQNtܩQ9Qv+qWfS'C` l|YM06 R(JI)"08B$U"4T:J&4‹g$)$Ogb[RR:d lQ4t&Nh 925LڃA.$2IJ!AhkJ ̩%, &UFPZB+.㒭zG ƪ&!%S)JTw%U@3_%,:xeM;Y)*uL@, cc+ǪWmrՄ:$hhYJ=YWB߲c:u|J[iNc:#\H|,A:wڲzmn.JtU.#.>R"YuZ7OB> U2N JLr&9eR~|* rR) '"€R )bBQ*a!5ʻ 5DoceU{ F0UDBtPS\[GtM=ekdx]B;IR ӑˆ*x+/u'ŅʟCꇧ_cruARA{"4w䒊ళv Tsq͆޴iC}fW:pÔ[ȅD[1GU<2PrZ!Pɳ8-[qL~jy ,=9Op1<-Urzsl;` qt*z>]ae@&CגW<-~ء9gTv+(5]#^44v0CIr*ηÆ{[W_'wdHV9pCu6W Y͘*8;ktkM9LFKSuv;Rt?7IUwf@?6[U,})%7 p0;}0c{A [;4$h F%3ci- n.q1kv׵^؂5ֵ@Vd5$hmWv3Eՙ$.]{o t&KP{4u'?ȍῺ?UlocWvz;k Ts0I <.;,ίeX9t8ĠSM`FbuLl#8M[hNwtUj'-cw89+Tَw.BoC54{xmgxy΃HC Ueg\뗀$ ;*SO$è;oYV@>o`F>*M'ʮƴ:) Kf8wju6ze04 E+hKjs̐L(ZLN֖:–To<$h~խ *sN{;(~\I)68HN4弎e7âK}H&DM92HƈƣU@%f+W.RP G@GUhIp>1fRm7TPö|d^G⫴̼3cC쨍;H-lB]<#!!ZpV T<#ƻAc\8&Yʑ<\TXw~@$.0kBtQ-ې>(, kF-SϚTY!:[3R=. r7jR[]جR v@QN;!'dK0'oosςTjt`+ŪPI.04axE*E uo)ShՐYnU]L?@ƃ*UaƩ3]VI)B%$ƃ"O*naTkshF#Z8 .$CL,Y1(Hty)Vu-Z Cv^sw !C<ȕvNI #Tc%KsRL7ltMX<@Q!VDX hc Ja#F'k{+,l6 -yR9LTv9c )Emz7UOtI:AS-:RDb2M#(s2ރ^@ Bnv 8#P{"A:,|c"Bkk$haU;- bvp#[E `8tAiks@6[Z)qgNpGn3ZFzN{?yzJ)mNiFQh;(|awr nUAq,0m AK~wX}q゚0NNh)v#4]Dh׆_%V[(JP~Tef΅[ӱf?连W$BzvcуhSZ.U* mv)]m>ݺƩ yA,X&As~&{ =Gn}&1JS$!\Ld<<&`91] D%pIA zs*RCDJ}-;|¶̏$||hFF/U 'lxՈi.T+PYD-@v}2`J}&\RI0W.Hskܝ{&}6n׺jc`Wk8 .+sy)%6L|QنV˜L ˚kcP'Lpv䷶VXۚ>;,lAGPvfIj< B#rѪl ~y.k+#\uǂDuNݮ)XlcZ|S!x l!Bt\4_BϒU-<&$$["A#NYr +j›Kieա+O;kڳ‚K&5)~:sagu }8 ŽOmǷl9PhT:}<[oDv7GjSE|Qis*swK#6:+M߸atk[:^޳pۻBI}9 ۄo.& %i3yEQV[dXMaݻxuNUȱH nqp h?5vV0ѿ&Z3ZJ-ujSV6gLmJ>k]-;H |`&uW yBnCC&Q,Lx~ \V§PHpM+C * S(1}'Agnwk ̣9jy jSΊqw R:81[:ͺO*;E2@:^HuO!s;IU !͔Jp rubRLBq )DU60̙Fn}Im6BoM 6{;Zt1( N:;h|JFDx >5䫍ͫIj5yX %} !V[i-`j7maN AIMLNܿ%_K|#Za8L;@;gޒlo!NVUts#N.Q S:e:|*kX!Ɖcܒ7_~UZޝe OkH4b%Ww }>H9=J8IV z<|G'c@%]*c2,8hIdES;f|(R[=VNVEéCaUXi+w2u ŭ+7 *AƸSHA`8䤠6SRX8B9s4S@D zABxA4N iKpI, )8(MT {JPDBnUHJdTIN NJ)LJq8Eh QWmDAPJ7rQUkB#4]fVajbVIM{\]VOv[@$;촪7E3Цx\qs(m0DXeĨZUg vZyԺj5NI=Kc@sGiܴZ^F$ҹ?R &;7jvAXm>IM$m5 {kCA+ d,&zncLiJRG H<ء"TiycDdbÆ+.(oem(X$B[3_]5l+]w-lq^zfo ́|'p Q0IU5J EsFw_6{hJNGPi`1q#Cl4=ŇOT/H$O5!ڐ4B5 C X4J`{?Y1ֵ{Cȫc)2ZHyn@P^K q+H6>VWϷfO%]1[gPuw={uR4e=kn}"V1% $ ScV^։cq|& I <<,R^!w+ԫ b0+4S9R"9[m#梵#s$ݸ!Ot PDa#UtGD|TBA#SlOGpn)K#U&aOR#"Pl#o9sE0aZ5jVO*[Hr;gA J3xPwB#A m+2\aǗ%U ꬝ 61hJZd1A*~AScuLX@ltRlO{O<&n}_߄qh-}ȭ*xy?yRȴ=[/ :ZWkI0h=R$5{r6&YXq1԰; J庿k~%Kmx4V.#wDKh0>d925.t3Q#uE_7Gw\IӐtf}4-NRI$$I<JJRI$S)(I2I$I&I$RI$ɓI I$I$RI$I(IJI$I$RI$ $RI%0 %I$tIJI$L2(RI$I$I$I$$I$I)I$JLE;yIJI$L$$I$IJI$$I:I$I$I$$I$tI$LI'N:JRI$I$I$I$$I$I)I$t'IJI$I$RI$I%)$NI$$I$I)I$I$HRI$$$$II$I$IJI$I)I$I$JRI$$RI$&NI$I$$I'L%)$I$IJI$:JRI$I$TI$$RI$NI$I$$I$tI$I%)$I:I$$I$I%I$I$JRI$t$$II$I:IIJI$I)I$I$%)$I$AJI$I$RI$I%)$I:I$$I$HI$I$JRI$I$I$f7VUli $TI$)$I$IJI$I$RI$L h\?ֱ%JVB $铤H)II$IJI$I$RI$I$dNd)I$II$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$*RI$I$I$"#Hyfn_ܒdCoП_?1$ CpI$~ihIPo!=VoV7)ޗ;>aU\GXAnC]¸ΡW)Q+3vDd?|JFިCȉMW*.c{vuV zzUM2Q&a d9?]ղڌtSML}WE -AKAڝR$T]M>KG~I*+vAzp* (QnDXҫܒdbuJlAO8 + }ë!V[Tc(#4U' >}; T % $C ON]y2>iQU‹ 4z8K6ha8ƈ8ڔ')S7)IQ8`mm 1)]ȟ)KI oMlhHdC?zS=BTᩴQܞTvDkjtp=DL\tL'-G*JS6( &BTn%-B|N!@>օ=&sTgɁ%Gt$|SLCJ}Kl"\\qQ% M1h%J`n!8qM1>iI?zdԸUصS &wKz[Ti4l*D*Q:|S*+|wRX{O\ C:< JOθkaMj3.q(bU)(;DxGFSDªKk+;|S씸Ui&\xU1mh4)mKV<-ЪD:+L#5Xiܝ`-z;D.6Tux.w.^ n  U0t+)1=Ӗ:IZ-"g vIHDJ1JbFSFgQ =ARUp#ҒXy 6TReMN3]JJZJT\;*ƳߔjptH1$#Ն{Nze) Z;!$6c3q'VF,A?ʲ1]`RM6 4D5o. F3O׊ֈ[f4 F1T-4ܶtA~I&Uwd6tZ "V[ThTPi|uT^7f{ 1fz xhYԯ8.d>Kw#4 J>?YB77iئnp'7CfW}%÷5Q bTAc HЈ[9!98WZX}\T^|:aF+3q]{c %v[>;!#{WƗ׺x[Ϲbd*A~oc_L w>^I:!b $g$TI$FHN4MIJI$7}Ï@uDn$$JN:B2O 5$$RcxJJ}gꂖ)@2I vSߺ6EKR@wJ0#:5wITJ3 A(?ɾ:RPsި 6'S} rOV iv8}.q ڽP>U¨lC/%D)h '$)")!JP" D RڒJ RhR H1JS]*'T%*IL\>*f@%&TRJtpTljNjfUAKXZ+mVv^c`)\N$ QJkgicەzd^W8N%JS̨b@PFs6HZ΂4rx*]軏kW4.k GP ؏ʻ[|`<${4i #0 ^̆9風7m>+bՈMT2Ϡ*:SuJ+``1e JIJJ)#P0Ȓ->)V.$ X|Z'+1ڰc{v:'൲kGNF8O䵹4#zZ8\G6ʪi׿. vw̑$6WVQ(1lɤ=Ϧ5%aݛEMdw?jcf2|Pn8Uݼ̥r!62-h?IhUjKiЉ?&CT[F7Z3|U6El{Sm7]tOfWT\E0A1l.fi -~*Q m΢=J[YD=@TmwջkcTx,d{8Wx˜qmtFI:΀n!u|.ۇ\V?|{<|WCSEmֈ!\AGwyм2ۮ{i.q2IZnl{ǟ,KA=DTCTDZ(^ruCHBtঘ:nBx&{:Bprp̿P;(1ʋFk9>~FkN9>Y⃩L@DyPs93Rn1:ȅ1UnpniEvV!̋.( aqV h{2kZ4G)>>j. ,AM6Xy 'p;nӸ[\vX Γ<+82Z,:~r9g[~;p3F@iDsdu B+ǧ [hY8`u*K q3z)Į3 wpN xF 8)/ 8E'+ TiP2iKTBƧRD)xN$&TŸ<TI&܂6bȔ4BJ Hi)RK)5ТeL1ljuJB; NBhLtH$PS) *S(M=KRC~4S H65<${r6=™)DHrD4Pe&H6QK0GdN'TtjN[vNFR$&5LJx8=߂%J[HnCPu8M'N> ӑ%" 9<dBTTQ[0 7irA"iR5g -v>JnF'[tJnSn씉A>F=),):@c Gi6am;8'tM@)R-"0 Q4MGp)ob Ke-%8Aj4469Rh-S I{%JD;MwoDPNuJk4C\~rg%gu;CX+n"Uޤ84i¤"O*)n6I.wd!cyFEb ?*u vFLJioZ,T_$)jѾvwKe@d7k*M+]9 &Ȓ q"}rNĩןs:ݢUic 'UܦtE, 2 v^Ncd@ov$m`f@33yNDKr&baJ\Go,j34y|Hjd(ڝZ/{s2 h+l<}-F`0 *'Ns:K %rZ-c:VU_1乻~\KON:e`h"5K.NFDOM,}nw:aWYl{'Z}c.lKPQKy{G&-զ}sΤ`SS~ϳÔS|AO $HoߑDnf9x'sZ\$\d^7~`ޙ2hqz.k '84{WH:A;$:#HI.o3v0I 7CKBrG'Yvd+ҽP5'YqG֌fiw UA;x`ŇT;sz_Q?J?צ\t"➢r{.tڧG/sIR4h"9e3wi RS?5IV$VݟYާu-&Op쫾Cc UcP4DHJWHvP&\7F\H*6\8{XM.xV7{<@Պt#vÈGi.P}Ls OtQm䕡re5P)Q5A\!$l[g>Pq'lGXɠq#J@X.\ۈw6y##qqO}\2mMh{Z{r;Ү]EM&x 祖&d1v:C@qrr^'SSOU P wf VX.YnuFvYYq$RwfdBvN.|O9 @*fFCR&E.!>KvGZ7 z`5OqsAId,[\wfwY5af z[˜4$U:>]s,&<5^Z 2_X2$p331k2+<8}mXݮsX>߈݌AD76_Y|?5:֘vzgPdQ%>*Y@rӢ^>h(m$R *A%)$N)$RRI$DI(&IJI$Mt)I$dI)$L:dI$I)$I$IJI$I$RI$ $RI%0g $II$I$"$I$I)I$I$JRI$I$I$I I"'I*I$I$RI$I%)$NI$$I$I)I$tI%)$I$IJI$N$I:I$I$I)I$tI%)$I$IJI$I$RI$$JRI$I$I'I$RI$I$I$I$$NdRI$$JRI$tRI$I$I$I%)$NI$$I'L%)$I$IJI$N:JRI$tRI$I$I$NI$2I)I$I'IJI$I$RI$&NI$2tI$I$$I$IJI$I$RI$&NI$I$$II$I$I%)$I:dRI$&NI$I$$I$tI2IIJI$L$I$I)$IV5eV4PvRI$$I,RI$I$I$I$$H؟3u\3umHDžTNથM$MdY2tL%)$$I"$I'I2 RI$p:JRRIJRI$I$I$I$$I$I)I$I$JRI$I$I$I$$IIK$tI$I$I%)$I Eo@G_Sbܿ%'gr?1$gBbIߥ[OẒI/>ʔ|]Rd)}Rh`Rqޗ,?S'P&FmD6Vr^bT PrGQU6x(:3!v!> dHЦm(|OL8hT `7o%A'Nҭ$𧸎P3I ׺*)Vz}F›rpxQ5BZ%Jޤ'P'T)"oKH8 Od:#;&Z]0>H!R*!2$*b'$K&܇ 18"hNBMJ5PyR`SQ)L NDqLT ?ƊIwLӪ&!(9DnrQ R 4LƩRYnED'<@$tC2JQ<)8O 7DP@#Gz!;$Rv1-(tt)VuPn;TcTxq)&♧1vИ;Q4<IwKo#m{)g7HI /O: @N 4Q A b]'"@P|S-*wrYNDbEPR@u@kܦߊ =F ۢTi\' #^MryRڦapn w%]ovu-ĒF#Y<^ h'[& rl  t=]ؕ4ESh;~k6.;WOSH=> drYCs0wH7pƫ! RA|u(Ukw+>(9Y4=,ãvk4DjW7ӞK.RС=aX5$h IQ.,bU='PXyr0{X xTY$14:]65׀׺7+ne %^Kmnѫ]թ'NH_]\~Jv9 o՛uw<蕟R>w>>hzPߌ= Ѣ=apKWԞu72Owp;)uYǬX<OUJV3@=_՝|;}Hqp7f?4e#5`or*gR5Sa/G8gR؟4|6}hHгE;o/A)W+>V4bKyH^>cP4CwN]Ӡ:G/lRX4,?@KoR=Fs#Q [6f\ ||TWDPę+w{OgչydrS,ꐍ)xi]D4Ӷ׳5s 7;xv'=(':t1D+z5*T ?G4V`?r'왟qYk & #7Z5CMeYp%;67}mxҏoG&P>'B |V{(.: !I9k42WIٍq?T k"cưn%4xkt2: n= W,4Zf86d8e p&;T,,i FGgA g&5!j3,8.+f6uDwSkOEڞU5m.E?fƟ%guZ`CV : z""E_S.a7;z1=8uR vEX')>e_Ռ'w0q~؀ 9h=yHGR$}[sIVLǯS yZN# sS<W\ hCI/xhVaĤXh~xD7;{|>RF<߫8K?(Rtocetltn]')[:Q$7(co6 ۛ' ~ P=~%!\k 0m3 Ut<2FJ,\ y!Z<:\#9W@"PSG5= WS\<uⴱ968Pp>=\I JُGdjK 얞t杤Àj:^.%̮9$r0F81OwKեCG0REjI$$I)I$bTI7D(I$$$IN)$L:I!I$dI&I$RI$I$I$IIL&rpIRI$I $I&)PI$I%)$I$IJI$NWzU&KIh%$h,;Ҏ:;!adB 05 T2TKA644KcwM}rAI>%H(Hr\ӚpleaAYVꝵȭ"x($I!tI$IJI$I)I$I$JRI$$IJI$I$RI$I:JRI$I$I$I$$II$I$I%)$I$IJI$I)I$I$I'I$RI$I$I$I$)$NI$$I'LIRI$$IJI$I$RI$NI$2I)I$tI%)$I:dRI$$JRI$$RI$I$I:I$IL%)$I$IJI$N:JRI$I$I'I$RI$I$I$I$P%)$NI$$IL%)$I$IJI$I$RI$NI$I $I'LJRI$I$I'I$RI$I$I%W;|եW;|ARI$I,RI$I$I$I$$HZ1r?ϳumH ]U $t&HR $)QLI$tI$I%)$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$I I$I$JI$I$I$I%)$$I$I$WvTl/]:;,Rv}!LH|W-{?K'F$_5$~ʴ|]RlSG/W'E?,_P" )D`M:yP%M8Bz'rJ`(m2j JqmҦHg'E"P*$<%0fRs"!-̎ԧ{h;_<9FLU|RۮQ%ƉRDx'URZ(<9g]RS)Т֩4M ;@꒗IJI!=S: f⠔O S)|RĤJE61$&Ԇ $5N[ܤ4)39:ME GCz!%GCh2=rxsQ^r 6RB l5tL(8m1Ȕ;/ۓBk@:CBJl:4RQx #Yl R Se̮DwP X6=V v ,=էc=a[=> e[5!.!^%v%eo447Yըw+1퀯giPToeG~k{ſMy%P uSp ) Ґv nrQ$|S>j1<򂙉rApY3 spy֓@ @kT'>4Cq$۸L=8`J]Y'#f4j#Vt$O `|Q>‹@抖:C0'';QȕGu[l)ntnfX}!6cx"VK N@h@[HkqUكٍRqN$huOS!Ā&cV` VE*u3}l'a` :xApSUgxtGq  դ-,'$SѨoe`Y7n(uoRgg~X:6+ ~T ^}&Nu++pqLX$I'TF)B2-6AYd^VecEBd}D ;&rSA:ua3+yr]= u5TL8i}$U-#!OAUCƓ3^&fxXQkc4 |4iv+CULΐP^9Nn"2OR;$?(V5<);XHsELq pGdͱI'N4w$ N5S ' ╩w%1Dk:!7U?Wpi(04Ckj$(ndIiBѴFJ=@]qx 5< Tiu406ucVe z˶:ա.1H=E-{ZX)q= q2jtVoVAí#ld`xU5  ĝO!;P]nqj ZxY<#YYĤ/_W뱠 NJ|;l$WmJ▸6t0 Wk"@?Lܨ}#c@&5]oKHvh=#FMݻz,6$'U:,3 NOU`xOp@4@u>?V*:%ieLϒWO@rFC|~Nz2coʳkT$ nڈy $og8N"<ʕu^I kC`HGNqnt7 ri,/cLn>h.3To|g6UChTN -.'x Ĭ?2gtˆvw+qH*ZL$)5q:#A5Tv䟽qF)~I;N?VK&|ܬl>7ڇ^ :2Q8j9Q-$s(:*KY\Inx *#䑯sKm<k(;Nxs\5Q]8F;~~0s_|+-hw@j22<qr]J[ZI*u6%2{o'Ǐ=۴F5Y>4Z v`ͯ?Hˏf0oR|'Uw(ОuBәj$6>n{5ܲr:tk4 ;^Dkʮ>!%ݵ (Ԅ jݿՃ)S`xP圓?=VN^U9g%^4'P@9VK l&#ʹUd $MnB@f?,.WH.> f̐}.~װ'r3CbJomLèq\׵ws6:?7  azgu7Yvdϣ< l[s+.ZXCvT=K)C5=Uĭ$hU+I 9݂m״7AEqPn/۷V@S>'@ d23.9> .lۢ)wd8i$^4vRƬUȾ)͞(EMa!@j H؃&/8!HV4TpuR:Wԕ/Q%5M:BcUEHLB擞 RqIMۄXc |y)<ż$.i.&8Wƻ$|!Z)<RENc$jp5#cj.i#Tg90 IQ.h ī-a mJ3DE<';BJkU;뢧v>lziʍđ~il -d=c|*X#ZcHUMJJ_T4jn?xZdnUby(;tL pV[!DW"Ǻ^ ;SLKGu|~(UKzJh}p4S_HWX6koR ~IMRSI5Nhn\mz'R7*S1!'tW#1'E̡nKt16Q}o1we ]RL)9>h T `J~ hSL"* TuI3[plh|<sD;0RR1vVZܞ r ܆o BPHe%)jL+iGp8RK;5n) ķn;5Sʲ!!dT:tײNƨ1=EHa_ T$$䇓SH=<2Y s[~]D}9!N^.52UjrdAV{N0v7QkkO];_aRpAadqSskcQ(1⚄(/6NF}sIզ~+vCOqR6Dfȿ*ಳC{ӓĮ<?zmf g} u ΁Hw oS<);@\mҜzۡiջD®qy@E6 Xv\5}P'ѧ:`5"#Ѫ]ٚR ,=WGa>+`w=8z-~o]  W M Ka9DceW??zJtknBtr\ }!7>}mxs#S.h:tZgR;!Ua<9# i@#HJPش*_i?-OUa>o`ùn'@5X?kП5>(;h<«i~;.pv'`d$z[揹oL(+=P\sh);9În:UaC|S9;AMUIo~ ?k4ސqRU_jgÒc&#Yn1'm5KVsthgTmΕf~p2<>ze``M:n[Th?D?Dn׀ h<Y8$>o+#u>mzMnP%2B [n!&?0 ]+֓y ʠ:+u"D e[Fmi f T]8 X֒2AT IYCs\؂8[-`%?fN0|BR !o YۄaʆUD.a$Sd6}*l$Hi"gJ$HI>g_g%)$CIKITIA%??ޒI$Hgz_gzJRI$'$$J )KrJ$J )/HIA:d)I$I$JRI$I$I$2tI$I%)$I:dRI$$IRI$I$I$2I)I$tI%)$I:dRI$$JRI$t$$II$I:I$I$I$$II$I:I$I$I%I$tI%)$I:d)I$I$JRI$I$I'N$I'I2tI$I$$Nd򒔒I$I$$I$I)I$I'IJI$I$RI$I$I:I$I$I $I$HI$t$I'I$RI$'IJI$*@|U[?H;)$TRI$)$I$IJI$I$RI%c|Bꚹ^>!uMH ]U 2tF%2t$I)I'LIEJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$I I$I$JI$I$I:dd$IF_PQWvT7/IJLC;>['F$OI;k7RI%~ʴ|]R}P*wKփFx|~UA!HDG`<dYUk|SD#' 3)*-L]8P xQ'N $Ӕx F <(EHK Sh'E24{)T '+ۿP IVn*7jxV**TE?%%3jnL*A%.R)R%.Jd1R%J\OxC:(=aTOtDS#N੶Ę -nQF;Ju_2d&"OT`|S$ZȔ`RkiʄD1!i)$qDȉH@Ld "$(Qh5R:%w[0t?*N f,7GfK 7C7׉5cì^N# t6s|S 討/+iuܔ.gPr֟]q5ߛs6≃돫qQnǀ0VHvʫu2賳ۊSv wGiTo< 8ޞzGph%FWNCkᡠx+M{C|O "Ṱq. wQչx4Ajki`x)5CL`4Hqy$Axp骅޳0D D$ 4E]q'T.THTmm>ID<ݸ5n?ѺdZF'AhD=|hA.qi:f{&-nTA'4+LWѸFGh]J5plpE-Ql lq ]Jca HDtmUeZ}ӈԭz4 -ޫjc-ce]/2?wY? {׉\NCsH${Ū6Ih iT>oagݺ)A#a,m='zfED[UIHe0iI粋^x'spc朝 wKlxIJYtc'pJNp~iA#H骐Ԧ撔ט:DDr0'_گqO#hiͲAqSHDp%O28?}qu;OȽB wb{v^CZgZ׸q$igy$òF?j"Uh#0vxЫ8h6t6#Sju,5ϹhtLxyT^3#Zᡝ -Νn?H> 55EcI{ɕE+ A(%Ӫ9$4I|TY{GYp{+۰ HFĉXGd6)yߨ:(tNfo +M[Lyֈ=xpD$ PGEKT\Ktz+-H*a $z N>uf9J4+u> Zc[S |5WlNxP6&uGk]A J>=|{HtMc?r $<ʮ}I O!bQXFh&Cm  ǒkmsȑT{:]Zct_*(-;ASi;BHV "nihDDഺ4tCe~)m%^TH&" @TfVڋg?mEC ɫS~:SoT/f}n5Q%#j-TP@&eV6Lf:β,o4TB%o jg;hMP#@^v҈'鵛82}Y$tuYd4]cH#^$?% u{߉ tv:^n㠎?ʵ\\O?=X l0}6SFu;a"JU ی)x <cGokOT~i*')_2Ǔ#jX\Z3V1}z%TKsD_p rnqo$&K 4Sha #Q9YYkxk5sAp%3o*uqԁv*uc@hܫl4^? HVZVN#cB/1 eΓǃoq;A1[f9'ױFK5PM_j5 $ CA1*`VyqkeV\Ѯsk\?5c-9U`0!<Ef&485;DYfC$;}1[sߔ6T}xiIX k#I<+" r|̿%ϗ 5.j qf| }o庒~ 5n-mb#|썐|ߪvC>` -cNpV"`%aWiiǺ]TR׍Kw>CWA,#B+@:S.ssHhē:!i̺Dߑ&8"{…57XXx\ohcI,qn p`3%/!&\YK$ru*UV/d*NSK:Tp-/L@LN)%|!HC.3HPh?PL"-DŠgt54x6ѷ JFDPwFX)ݨywI:IHXЁNȎ昅itL,!EJj1S3ΪF*Qwk3ޠ:ycȤ;S_{BzR4^{)NAIJɁDp# r [=ӗDRRX2 8#k7p9"vJ&IHtE2V\f?5=ХB!82*;>)<)n;v&LvI( Eӷ^x윝DM2KL|B5"Bg *Sd#%1#O”I(bcTJ\$蓴8ɧRSIIKOqʑh p)J~A*$pRt wDsd)D&&꒘x)JN}N(dpL> )gj4%KP .NL7$#S nD<ڟ$:D~M^e%,i)~uScu2 ‘<ˆx))~DJӎ!(=dr@n0|<撗!!@{-'X4ѽ _.GּpmlY×C:|QU]Fu4sL)Bcm9)1H;%3_Hh_ +׻p  N*> F1#QpHNy=wZLmfnQp!NBcSb'[HA1xۆL"JN2K7WZ$ h Ng=ldZdn*M':<4uiՌkI3=ʓ ~*FO%(h!cdQ  5n@65 @00dCI.i%w3h #B";NDu'5ML&`Q5sFؙJ{S.A@ƚI4*N0|Q?(ILkp5-$I,#>jZGn;BLN[#ĦiVa?'z|&|废2L &9Ly'N+ S NA'PzxU^DE- !!GpT GA3'DwH)UN[B}۹U=!=.~Tp.ywWc#"Tbw-l>G Ky_bd;]9OʺsGlÎϦlϯ62C^@?rlU `S֮,KO?pi oNV @ p |4DvGu& ,-.28W"uDfPɄŰS8ҜMy1='qod10)㷊4)ȓ] ;,$Ɲ):@ {+Y_qGQX4Y;Y.t]]soZ2RfqFYfq|ռa7H#iI+^`1LD*ح]Y QmzE OU/ޭ -2@%ە̒lik$<9Eu倀t=4$&skdγ"XƵIF8w?65uOcKA}C= «IQMĴ [xA-a V*#`{9ް!Ǻ.`VmO_IVl92sh@yӄgj#Z+ZAϊD躚 NYY[IB{tVY4tӿR5MR!dG ɞ~*ma.(nGaFRdfñ4ju@8W'2!vt>vUs$*;$‹A:ƪm:NzL2ZL#c =`ŽSpHʷO~L0ੴ@Q& B)?$T J} # RM9:'4Ɯ|R'#ϕ/ڔś~J$ |X$qv̥"c[+ؠXKDO:(5&wjR&5 &[:W5Ԙ]it~+ی%s}Do|{&?7ѮC{]khc2#A{A#BN`+s1AG#śubDXGu2$5jŹ@<)hYy5l;s+buۨgxk_[IP}f}~P68ݝfK}4ᵥiƱZ .o4t(䞎?[}e{x/#ɳ*[iWg e9k*!v:]-HDG~TdXBjhavWC%V 쭖U nB\Ztkt> ɞWOm%ctCs3lE{]nl$=b]V#Em;y&sd#8ƒ4eT9iu#̩ŮA{~ri0#hyzI j!]zrN{'%2dУas`*mӴz`W:{ƅ3G;)k!㮑%JCLF̐֋CO Dxr. qLxUȁyF3K$`Vb>(fup#l+=AѝCejumhdJτՏTNB_O%;MBA{4M~+# " RęVZ] ȎBsjӟf5JNmq!tß5UC|S5bSR4I$w#lBddӮ)ָz$@dU[Z FS;mTLd*`Cg$y"5 h<С}#kۨ3)2v3a/Vvmn7*N>ōv]֍tFi GBƃ{*9ͮॎp8|CڢÿH-餖yQ|uaHIײWIn=źX!V@ $7XY\0h@p'p:<^Oi)?i|mO[kj.:7P}LwZv|F/dIq{~3kID)`ò/kXVvDKB˩h:x(8kR^u1I($^?Rj,e:n]scNuV+cMOhcA.& I p QlitP'R c5j.wwj>cj{~t?K\ז#.{Vq]ڡza$5RT7Mt._R}$/J{LmX2?JߢHlN?5LV!no ꬹbQYXi> R}U"A> 18)1'swSm ӯd_@oWV2ĔNGv -C ƣ򩼴 '!8@j;-$ ^[TZ ƚ-*X}1=25쨁.-3"i nC 9@2[kZʍOkKިՇyoM?o$h-;vhV)``3ϊVޭ!ΜYܙkxs $əkgi$&O|YYO>U2G!yU9zR҇Ƌ7̙2<ڥz˭-W`Uu >2:-]%{Eoh Colinj?1u#N- v>6;Ipble#k [t-\ةlxЩdZ.:gڏh?jU;$Q d (\+?-u1gb5y0H>Rf {rx@ԍrV%(%:t4 d#PQw*0QȄ2y))(>*`w(L q~!"L8ǔjSBC] )BxS |Q|t52waF4ײN$$#O♬cT &kE8(AByd%)̈́C1:)9$@ELx)L(+ :$gXH5D~#bS'L4g|Ɠ$?%&di! HCSl tG "I> L%HT~)0JFF#ta3 @[waObJ\?e;[L 2%ll9g7t$ Ee'+#iDVRRgmݭvg@#(pF0lo>4ioHGVީ$ϗ +5SoMWs^#A7JRn6]ԙbGN@✸@%< %Ɠ24LRw lp:.ǂtQO<+XuF$'DS˺[`4OH 'I iDOo:idDI&) y0j>:[N[N<4S9"5G53tBTFA @{~1S\NIPuu?FգpSϦK GcRql)O# kμfI$z|w ֍]sNŪM2~ eݚ[;|&5E"{GJj j5;yh$C]]HZ56*c-`Dΰ'BC3G30 3?5CpB?)@#l DȓhV\yvn5"\Ip&dN~t&O8"T"I$%{I:y3ݭIh?7nA-?0 ִ@'~Lb@Od<=B:wӧ' 'R׸4$NZA6 PGAevW̉ZYnѩGZQOvHl ӘƹoP~xX ˿۸v2c.@'1E'[PCռ%VSٰZ\+s5&l95vJ[H45ZtsAD,ٰCAQt .L}#:Mڟ40 \Lwjc do?VNNklE60$RI$$)&P!DBJJdTS! 0JIBJP%)$L$$$IIBJRI$A$RI%Sk+K|V 'QNI'I2tI$I%)$I:dRI$&NI$2I)I$tI%)$I$I*I$N:JRI$I$I'I2tI$I%)$I:d)I$I$JRI$$IJI$N:JRI$I$I'I2tI$IJI$I)I$tI%)$I:d)I$I$JRI$tRI$I$I$I%)$I$IJI$I)I$I$I'I$RI$I$I$铤$I$H)I$I$JRI$I"$II$I2tIJI$*D|US;脐vRI$I,RI$I$I$I$$JOϊع^!5#1U*UJI$"ɓNI$$I$H)I$I$JRI$I$I$I$$I$I)I$t$I$2I!I$I$$&I:I)I$I$I$d)I$I$JRI$I$I$"aHyfn_ܒEIH|W-{?K'F$_5$~ʴ|OKց:KUʚ'E?,_@&LVtVHYahgb;Cu*U%e{!?FaAJIjZ F`GhPP:UtLhCiBCS l:4*aƨژ8i *øBv ]*`k n*mt$= 2luVni!<l@UBfV$TY<*0<r:4g7D*aE@3!Ih xLSEN5")MNS)ǚDwEL|N{eBmI0 I)`7j脥F%EjJ#ݩBԤmמaAQ9S StILIM:(0tMT)j_آ4'EhDcK.'!iOPm4}R wUm>&;x-];y(|cA:czu!;u.<U"ĞcNT^{,;kfI'Y*G`p.к*L tߡpJ$gVִD>?u9eoUƂ'\ՓL iӺ{>q0)Xqx'Cⱙ-*[(h tSӷMNz> ].:*i$mR tStlQp!#'u0{#mxB;IHtGs檇]HyE4>%+ŭ7Ձ$-޵kpl vo֓:#RZ98ͪpax3,{[\AeM9Ė .KD%ם[)\EaѣXf#Z7 .nהK=k'f$ƪĴ)PfAx駊MALYq$hkIˤy[lBp8V2fwOePMVv3hi )3E5on*i"lK Z% @u% k#A!4@֞uoAPS:R)t^CNIp>(AɎeWlynv$Rݠi~ x:i>%^\~i6O';&mueN&NpD֞@M΁y$*Og$s~)#B=ZxO nbC+> Ѕ5S>կsh.k5-:NJѱl*cՆneaK8X%xe25[Rˮ3]?E#SʧC`[FV>ȐyG{5Y"ȄW.3Ecς[&9V2[?D/<5*K<6GFI=m;Q%C$ *7XCƜ>` <'S٠uPySƈnpZ\]Ƿp&{RӿS:* Giq-w`\NV|row$QdLw-<꽬o.0WGX< =kG2tm"c|V>D@?MXY:*HA| A{M}CsY#Z{M>@p:Cmyഘ vM^BGOeҘ\WBW=ҫx#B5^k덵U^ViytGKim Uyx)jRyNILgD/JZ*a;9EϏ4;#ߩ!h{{Bne7f#SA;p \uHrA3Y;-:Jnא썻i37kO?=d | Pl.D´|!p5KSiJM\OQ+H#iU3mU%Ćy4LE M6;RꂧH5Y#, h0`y %lTHׄ6Nx M:p2}@(yƱʻxt8 =L}ӯ"6[Ml骫ꓫV27KD r>МAД0jL]#A It7X [ N4#sIh'0% NhhrmZ  Z%OZncf=]p'<hŭ(\:a;Sh fAA@Ĉ*:)z1"ccY~z( Oh:x:Pg3:J)uuR[`4Lxp|~zZbCOGڎc4m 8k³IݬwRu41-x<+ 4QkQh[xTfŧ{~A3ʭikkK#hh:=);|uXzl׹Sf@_ń ѩiZ`wM]AR]Cz;S0cFs4ވ-\r s\wU6c{CZIFK] h{,8ݳ]gVۿI<_{ ek\IzDEq-<(ABoRqoI0US8:ܴwMmh3 A?$V6A3,^v=Kt|[ɀ<4({7ohNѸPpB_q$UUW8 `: k\ %5|yOҝ,,7iOZlF%W[LjtZNdh|y^X*W {yhS[GSΪ;KDF Qn8AcdtE568nt^L U6Th.%TNgTЊvpgBd(ILL@v`!0*. 퐀Z%Zt I |c5DLu 7N ^RbNH!*Ds)Hx u (;HNƱIK ƒƟ6Jg2{FJO `*L%qSCyiJU4*Z9V aoV" ~jb_cIs{tpZΩf"O*DmDLI$$I&NJRI$D$)tE: R)I t(BbBdt&)&))tI2d$$I$H$$JR+KUV%'I2tI$IJI$I)I$I$JRI$t$$II$I$IJI$I%I$I$JRI$$IJI$N$I:I$I$2tI$I%)$Nd)I$I$JRI$$IJI$:JRI$I$TI'N$I:I$I$I$$II$I$I%)$NI$$I$I)I$I$JRI$$IJI$I$RI$$IJI$I$RI$I$I:I$I$I$$I$2JRI$tEJI$I$RI$ʦ[U3 줒ISI$XI$I%)$I$IJI$!5r7C>+jE|T?T'LE$I$ RI$I$I$I $I$tI2I'EJI$'I2 Y:I$$R'LI$I$I$$I*RI$I$I$I$$I$I)I$I$JRI$6ʂ"GqśrJNϤ>**LC_П_?1$ CpI$~ʴ|]R pʴ|]R<ZO}Uth:znʽcY ;;d'4IZkC-$[apM'7sTP ג`&tЅQڔ#Ur !j*uaM(U](b'yvG(Oh dû)Ĕ5u3T0)gu V/(Avj۬5gXh"F %)]sj9@$RZ ;Ɗ% $nwR2@P4I+F1HOp wI JG)BS:(H JΪ-%.;>Ң |螺 S<#цݵ{BҶ`˛P[{k*ݘڧFԵu-`U_m>H<N=IQSDON<Ρ|ӏ\9:.5_ЮWS*X y)8+cc=HЮ%fXxy`$Y<\2O5qV:4>+618%Rqd鴕Ӭ ^`m0BLtfqDEJ^ۙu,53&ΝAՇc ѩp+\G!?Ujx q \͆;)2)ɫ0nH3+33=ﺖΑ؏ܯa0=:5 h*#9A͝6V?_TgtZdoev('7XAMw*..t=F=fT O(N<$HDw{D@ poCΥU.s,;G`4PEt:иۨ+ՍԅU_h!zS$D⭶ Djv]ȝtgmTopuIykw("iT;uú8sEQ{gz64}LjQtkKԠk#aAʕ;hT1vZ s"YY~a*ۡ!I-\;yomRLw 9Y&As'%,;CJlj-%̠^TN/d@uPmlhyPcGbQvd:8V#=%!w3wF] Gn*^1L!{yvG1­klt%:T$vR =+Cd 8)Qx.HY 3~+s L-68 MK$먙J@ۧҵo;泭d,6b#W>.#]^(\%fJm!~(U MĀhO:vlB`D xO`k hâJe@.;[PLDkM}XlIܠZ~ۄLiI]$~h kD"ŞfJk]2f $x"Ph}).9.ctjkL*cIׁƸA\亻}:&Z89%E4tL>cVx\GԹAwo%Ѕs[E}`3y@?u֐ ie ,lx!4AI31ѻZ tجZ45{W9kw$ gPmc"'_,(!mHqqY[G-^b>KA'\N68B5|RI1}RP(5etvufy(ZwLa1{f<E%TlDem=A}&:*nZLsw@f [pENN;N`;%eߖݎVYsU@^J.Ss`FqԩX3fK>!GFi(uܩ8c_#PP?jR9ߥxL4r湺rRQhIDiikCMJ#{8 Xv^>hd纃[`Ј ge̞||TI.%D)t j!NF0BA I-tNdC܌ApJ6|R#i5Z@4yNnL]qĹaEu#O%=v l! [WJ$"\8T{-Gu*%B(M^TJIWin&:pT*5㐊ֹ`x!)=B` ӕ]#\ !BktГJNFh-:Z-̫BIyNȨI!$.pOhBdJDy*`KuI,cE5Svr0u@”JaΩ*蘘F,DDh $4B #Ex"vJQZ&|P{&k02CO PΎJd;Cy#LG! ǰ5x ox> $Qe!uF[txB.#{H@iA|ȗ$2`ְK4Obִ7ğV֏OVմL'$%,CZ@8:]E1fShbKvȴl`wdv`(ip~;(]I2!{m$Oi{k5<>^JV4@N@ 9MIG];N4uw Hr6ʁeK:">?A\Aݦ3/k "O*A/nDD?5@) !퓧iqi?<~*m.h7CAtnNfhLTp%S7؄IK#HB'b O$"}ư MeV?XO$[ivBeя (׍p@ŝJ{0XH>%XӅ_F4@JLX-ЦƺƁZy'l6t$(WnhcC$6WIՑKdZdFloauZCc~. OU[r0@s@ RSR8$;dl߿򕦀OA(B(#QI$RI$I$I$$$J%1RLRR$"I&Nt)t'LIBJRI$IRI%S}z~%PEdSTZt$$II2JRI$:d)I$I$JRI$I$I$2tI$IJI$I%I$I$JRI$$IJI$I$RI$$JRI$t$$II$I$铤$I$I)I$tI%)$I:d)I$I$TI'I$RI$$JRI$I$I$2tI$铤$I$I%I$I$JRI$I$I'I$RI$I%)$NI$$I$I)I$I$JRI$$AJI$I$RI$I$TI:dRI$&NI&U3 کIe$JI$$I$I)I$I$JRI$t,c|WP 1*V%U*I2,:dI$I$t)I$I$I$t)I$IL:II$t$I$$I$I!I$I$IRI$I$I$I$$I$I)I$I$JRII$RN6ʄ"GqśrK)3>Ē щ'~Mo?I$~ʴ|]R^?G/Z-k>aTF@'+@!Dfv0U{L=*5(p<$ tI%DL]ߕ&2@@M AMNUUzj&iP[-NW! Ѣ1CxNwp1ܢ &IPL%G F#p$(6&ѺpPܡ8Ω)vLjߢrjIK0%1&- 5IKO0rbtL4>I(Ҙi|R=D~(o0:R >`HKJܶӽTZ֒5!ǚ2^cq1?Vm =:ӐXj*05\8i}ljZ8.#vUXaI.lqye`FL.)g%e֨ 3ʱuUYGuM>,dQri|C %+ gax:72 +nljw7Outjynvi;IZ5QiAi1=\ BO$I[πC'h$uR >jݧER WUCnG)Dɦ;^Stypl䮰O>_S~к>iЬ,)HkZ Oröh=&/\$Ƿdr:hP谶<\3̨NJ 0x%#IBjOC]cHFOhMa;UM~Xc]LǨ !^ERO%+Q}؍n FYS"dV6B-'@*05 ڒe O%=5]pLӔVxU毚|{SE#D$UFEl$%%'X7Un48 !Xmp#|v]$ _U844#Fܠ|T:ւ$hO,wx#'XLh&.M {Ug?7c0Vjau0WPضP{FG\10YYt) |"1r6Il|~ԢN#Bfe\ưVU7DPsXH'_xh xj?^\DcDW,uㅫ$eu^&7mj-LJGR.M:f|S SP.jnIP|IIUK+A*lOunN> qDtFʍaڇm[ʷKAU]1Y6ef|w4O*E8D$H:}? na2}vVw:!ѻ Ϊ@25f4)UڑaC(t"6@itpJvNmtqA\t)kcM(ox!mV$Պ#_Iҍ%KސHM$ KF@! ʍYDl4h2Q6 ;-(^.׸83*Sc2S<<, {c8D$"tE"lqv6npŚwU~B;(`n]Gl#lT܈?ئ͎/ #54q@nqkx L ڛ&rLª\;i1IP!sh"  @a"$k)BۻG  2FR;q*{) !Ѩ̦${E;+{@#0d'n"|5N#8g8vD1 P N+S}3÷tBTdTu荭'Wp03ʟ]:O;R>)p:j$D'*mk {6#qP.nsDS+6֒Q==cIIsLxdW c F\;\xMVa;m `Tjk9WYI o2wd°^ڝl|Q/I{\<+f5fzSi85P/J>1/.UkaYR.>@L>ZtFo7ƍ8:ŝ]i孂{Jm6:ZOu*2L(}25h.%,W*G\t Vpsʮ2[h5sji'M-a{}ap=ϵY3uX"/}Mׇ WzWH;'GUtryWL=Tt1)k^ձ<7IsB6.9ZCț?TͧkOVkDױҭ9iEM kV %>iI|S4tDT\w4ƅEC? aI͒~p|u w $ rL5&[('%8ӑyP.B$7H? 'RkbQ l; B x U|S:J|sLD~*A8*k ?I[hI+gU2$iTuuL PS9Hyy\ /;{^Ch (d^Qnw*,`rtB'J`sLi )f6*pBJy'LT<@!L%- )IQ+gsZI qh5.= Gm!48B :%ȓq)$CD!5=\ItrqI9b~0 )MxiB fvD~^ :ydH#x R Ш'*2yFqС0B=@ָِ0VCFVKlOY.mpЏX!A^M!?55MvYPa$T,xqR=7a4'T}6v}'c۲tK]7L̪[^8RkKe$ݿI."H;/.8suY464b+nW!ɶaǸZ2\Y$@p VDG$T|IS|4&ikd9P8@QKw)8i%-nxm˕PoTΪ2 EQRMN›5(mDw*$2$' Sck`Ƽ aH8DԨs$́8 fnF2!iq5>ҡB_ܗD`XA~>`3LMc|T}.7^O^(kuq/;tB uwv21ݣ*N%)m6 \J Ϻ pQ->u*"Ns'$J6h) 8 - g?H'@Ɂ= -̙IMFZsǔ{hAP'q'Q2F$sxQ]XaO@i%ډ0:H;jp'>HzNj~h{'N@ŀ8iHKe4 !4K" ZvE8iY i1O,43TÙI30OUJt铦,I'I$RL$R'I$I'LJ]2I$2tTI$I)$I$IJI$I$RI$I$I$I%)2I$I$I$N%,I$I$$$I%,I'F_PQWvT<س7/IJLC⢤Ϥ>+ щ%{?N/? I~ʴ|]RYw/V^))/~UUVkDTh't*@V ݦYlƒR|(G%4(<d*jd< p쪇ƈNç'$EIfS8$:!J(:IBJ(3j"e&P•ǒ@Bg>(gDU%*~@=QhSJDRiRR3tAQ:@NDjRILҕuO2.ae4'-\Y+֘%XcW5TG2VsZ2@o1ʥEq :+،`?FC\A.xV,1[1ӷ#nӯ`F#Fii*:k=WTI T5n*a3W[Xk#Z"UwDpUJ).nWn; Zkvr3kXw-< xNN[HK Ɠ7!t^+ἙW(E ٬='jC;S8x#1r^;-z,PdtG2}F%|ESe7V4< DrA6SF~cnQ {' Q'iJձ}bsyY{Z Zt" R$kK7Hf5cq0[(>ADT,s_`4%v Hx4?ta::\@1Q2 ^k^>\#'xIVgLw4F,764 S]P+;dcT-ͩgq6MA\h$Ow5W "<\_ 憇DbVyQߣJLU|gQt:)[ su슓\.HDL(dC@E!JӪ,5!]"e/4ka bb4l_@uvtADx+ %k> v Iis&9H= ͵ө|HT!S}|T.&B%nq  AV U4y\tα൰);?-wCΫ-lJdi "×ը9MO~߽Ohs*.3'@ \]c4m$G!Bƪ֎8Td`ٍ>奈eܞ 4IUw\?I* $I#hy0F"40kHy6rRRt ɗ@ܕN O@'_$#Tw~&4 =;d3Ru0yI&ƼrTCۦ FRuZm<<ƚ>(ceV,catRppx{, Yl࢞˥9ոLYY]<4 S@}ͻ?9hUC.dñWmnI (CO =F0ԅ_ ;ʄ tl$V@g0_<VE SWQpy4f훌ie5E`s,\kX[+a=Phk@oEO}d󭶟OkV`*m]{o.2)) *.ӕ( DDB%M[Jo7v|R ))##-$zE@L+Hޢ_tSSͭU>-g36jD3[|RKӪQ4;`@ vwNL Go*645kPhFjnR*55CJCh Li_ȉ`mnDp;)5JH&7iz]EZs7ХMp~#ՌLSd5pH e"KHud䘹uRYunLV9Ok I57FH 8K+Z hn5}CChs}yGs`9{k`qʻٵYd7V:$[ )$)E\H- YvoqEIͤӺE$=ȴHAcԲMSaAȶ㷿\+>ξq k^Y_u,\mwk@ZX䱾Ke]|O7@`h~(E4wND%))Dy)x$je)Ro)2bR) J"PΨN(07Df ft=]1vE$.ѸHD<$4*q Ԕ4J䣻My㷊D+L9$fL4$-&yV&ڼ#J Xas*L$S30ZvML]-Ъ.g\H>#(mW:+M*$iOuhN*dH?KL))A E'C#  GDy'{B `I&J DkS( y>Z(>S鮺$"~TϸNGC" f٩R[$t''S{d *VG |Rh03f%vQt;zzk))Z!;BgDwFcnjAJl^{$FBNL`h _I")TD'q20(o2IpC@8i:ǂ PtIQ4E Z5Co0 ҘٺD̖w$2<%%?*{i=.pcQOYXNI%J xN܄#2# N ''@X{k")O5KBx:TFJ+;қq28B{A'AFRb #ZI0R5B'qӕ&hI0J+Z^\d):6HC=*:Tn$̍JQZȶN%@l1Wn}V @B}7{m#c=;'k ]?vudG܂ o,[`Gޫ.pA{5v6Ӻ"AiZԶiˉj{u]~P)gB{~|<v@0j+R1x5ǐ5]g=OV s(EТ\XQ)t:F F& ('$'" 9ʓR$L{hc b_&#)Q7n4*$(ʁ RC6?O0W~( FLvTLH$ 4.(A@GQ]T^D S$;4gQq:n%u_@XQjaq 5BEr[np--9 ^w$6VO' 0GgJf84>j3 h%S;XFBxB!hk|u1S5ꉴgx"K`f!#-W}rf&!F@OgvΜğHƱEI+lWHDKâu3>C<Đα  E'nAM-؊ q~?Ef8/*uI ̤i)ýPݴGܒQ5 # LM~/E 8ߒ5EquHX#Ne* CZ{u3jgP wӄl$H "Sq 9TKLX Ly‹bBWhaL,<>3Sru'FJw#IdӀgvS@~rwzr t%ZK'B`c6왠|4CeZϱL|P_/ưS#SLGB%"t)u׺qJF8E:iU{Ē`| ^4q'q'c DFKXt ؕ\6vl)zۜfu)TK$GtaM0 |6lW)ݱ Є.]*,'W#s.t?;tLPx&a5{Ak;ցVsbyt2fhGUQtq*Uhn@z#BFI2tIJI$I$RI$I$I2dJRt铦L2JRt&)I$$I)t*}SVzEY-jTI$BI$I$I:I$I'LJRI$$IJI$I$RI$$JRI$t$$II$I$I%)$NI$$I'L%)$I$IJI$N:JRI$I$I'I$RI$NI$I$$II$I:IRI$NI$I$$I$tI$I%)$NI$$I$I%I$I$JRI$tRI$I$I$$I$I$$I$I)I$II)$I$IJI$I$RI$I$TI$IJI$T7*yII$I$I$I$JRI$I$I+#K~us#K~t"XYJU>U$IF)$2tI:I)d&L$RI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$$2JRI$I'IKN2I'IJI$'I$I2tRI$WvTl/]:;,R>3gBbIēK&y$_~ʴ|]Ro/V^)ZO}UWr6 @;At6+N^Gd:&g:np U8W%$%f3NUbԦU'))8NY0%Jtk›5%##E (NA LQn'n%#eE*N1S:ʛCh< S! "G h)ƢS-ݩ)Q$Jb%H'vT;SI ]f `꜈ 5RkuI RN:(ſr(8IEp DO:)YFʹ?8U<`tQ{X8 [[-.ײ*BJ=dj<׮HJjkqNAz`yV<=9U2 h׹,d|91K]gU/OKz54GZ{,J!~lnĘ&<֖#00kBAs;Ī9sy * y}k?D7q=ZKI.;e]2?4 Ul{YJe\w=3iQcY#Mt t rPK!d]Cc5b]Tm) iMxʴo٠-ե%uetg. ,`W)NƻFL|ʱ~؂HPs4o6 Wz[[$L8e{Z LO3kg,ϴNg~Nw~˞YU0e5ãf!}쁅 f}+]YY'쭌^<;r7WB?zwk$9iۚ->ӲȬa^n+юէBT@&tuVw҅`v+GpA=Դ3d^ȭGT:n50I?%q!­yyUfۥG*9LjA C@?KG+u>\|<\x#̓ha @.ǵ~$(WpvW>I@& xԨs~ o&'Y_fl74a <ʺv1E5I_f "]s=^{Y}: *."t> 6{#!ּVkKLUCtIIhS`쳹j`Rڀ cڧ[$s63yRə*waIi&#.k(w %4+[ u\owV0Ο\ -ș,N[%d1jYn 0{[L ͐%ߢ H(S=ԓLYJտd5VzoY7P +6\~ CQdnYhw>Jvݾ .I;vߊJYdI`jS0e'2X~ 5C'^xIxfƲD 0|wt䀠 C-"Y>hbby=7o %+ l0;.-:J1"`!_nlHyefI?Zc"'E`@._D<IV#Q 4tߖ3*2LD` 4ϒIipWFDOdd#k\`.nAdc_@Ɓ߼,wMXfnֆtrH|2Y*mds(o6yqrI0ƪda1( 1 c &kHH-^&|7mqy1>-~iBwDm׺wSA|F9ti=_O]t*l3|%UR.sli;)%܁#-'vЃ\85aH'rdHײb 8Bn@:P$%&_<@J* pipSYh.Q"J%dƣ;ҖwnG*K;CeaU{ (O$ִ9Nn! x/~fpH8l-v1h 'h{'2@\jf: H%''T#<$ݵSt@ 3$#KL#F<sD8pa B8>'vZԑfى|OtZA;Ds$mkl{7kN=HE$CB5&a♍5DHhGtbBB4Pݰ }0APi%YeSGHǚ rS؍Gt]3')Rtω~%3D;Rtp7#Mw4Mz͈`^b!nJ55~TX 0t)v@yE#<µݠAv981;);p{J?^?G")~5q$xvCcy*Ct `H< ';I<.n~% ƴʢp bu|j5;gMÒ<<T74G.!}!5݄X ^׎?i'ݤ3^@i H:uLK0 d6#w*$1$,pE'eGqw'˯-`#Bz\ɀ>%H<ȱɟܣasGx\{ 7B#q'+7|8ZU:47MAji΍;so.$ÉC*t҅ߡag]]!tDr1q( "NO">+Ks=>+$tH%ͮ5;ژj%= θZǷOqGILpA +N+?:޴j LJD*J q›ZL~8N&5 p 䎩)Z;@4}g@uAB3D(ovRRfGȢ>^!V<4X:!<&y#Nx#S4y)ƦO3!8 TE vC|}$P@DtޔJ%(h:PkvQI[(<ƾJnTO@nd$Μ-=3nh%0:;up;K LTt$$j k! SXVhh?G_4F׵J ȕż:IKv㪛D cf$J`OQh$s*Ou!'"@NI$AӼ FH%1 yG` ,`MQ .w$ R{dA^58ơ,i% ;x( j9>Hlyvt 30jDNIhIH0"Gmm^_mO%tj -KZ\4*:>v jGjծVy94 y,XK'Iud\vܳ}[s]v U wl%:v͸6v#ZGi{Cd=[볳#V ѼI:t?++4m{B(e0`jp EΑm-lg1`6*KE<rܾ{}Ynm_3!Cn> kNNOKn: vpD$3%FhOe3 O @& 1t<#c$%?LINvpw`xRkfJE))B!;Ds'tlw ;ɪ͐FLAR=Α9@3 dN>$otMK@"%v];A9`Qf*n;"n=ns4iNӶ#? Pke tx?'h&@]Ke[fs;&-[ciG^A*nvmg~Mj 0OѻAA6k@)p*h:gV=>*;#'7) 0yA6[#TmY}Br#V4)O=Y<)V&j!`ӡTl P>NZC}'_}/,㹱aGp ]G $(w8bO~TgTk=潰k'%a`dk[eh pp7tߵ d}Zb8wh@$4hgpiVB$KΥZ= R -RI2tRI$I$I$I%)$LI2JRtRN'LI$I$ɓI$$I)I$>~%g=VKuڤ$&I$)$NI$$I$I)I$tI%)$Nd)I$I$JRI$tRI$I$I:I$I$I$$I'L%)$I$IJI$I)I$I$I'I$RI$$JRI$tRI$I$I:I$TI$2tI$I%)$NI$$I'L%)$I:dRI$$IRI$I$I$I$$I'L%)$I$IJI$N:JRI$I$I$I$$II$I$I)$I$EJI$N:JRI$:d)I$eO?~jT4vRI$$I,RI$I$I$I$$JGߟ]3W5"E|[JjߢURI$EI2I'IKN(I$RI$I$TI$I)$I$IJI$I$RI$I:JRI&LI$'LI$%.$$$I$'IJI$I$RI$I$I$I%)$I EoAF_Sbܿ%)3>W'F$OI;k7I%~ʴ|]R_g/V^kSCa>EaLFC`v69EO "ʭc@SJ*`v=IaHHwqMAD#ĐYjp<+N#AҒ4S I"ԡ))P@%(> L 3pʋl)8@*.2%xPܤm)D)BfLA@hYO)%rde { 0`1'$IR&)#RRI+EAhɪג gBIPm:,I;!eJWp=T1T1s>)-]- e PgPc'V:|4Y!ڴ0e Q<^[īO*U0{WiYPoW^س@wKf )Z*!ü굫!s=Q:jy* Zou qryA:&lA>GNz>~8n*ͭI aR=uLG(ZB ^MSsfƓk?kKkX懙^28[5>j@O=XD$pQCeZ浯O2(7o^}G?9kל2ṱ)KbVʽ@,l~/f]嵒u忰u~) $#P@=7YӰ)Jp.v\atfHvt*J ;oFkXϵ;`Pp,POJ]]As75~E:FMΙG5? *.>u5Tp@U{kkΈN`jn32L9ğn؀~k*짿#@o}Vy#@X9ڊ ^;S enpWȼi5UfWiĩ4z l'{$_:i&Q[xcGiq/~YsFYd Q<L 1N04G%05 0փ̪ua뮿/Z?C9@Q"?{L SpSiJp1)F%e3ǰ%$9D. 64 aW>BC³kCD2DZ6y5^BccӰ۔kI364=Æ%cDGx#sxN5Q >>(CDG(b `\;H^֟y[P{A'o.&JfuIV/%B]< r RkLE !1dsI3)=WAKshd= 48 0tP"{ $)5ʋ΢{"7I! q(pNΏM<%[)6"N OKrKvùpI՞|R|'nT~j`v'`(&'p?$s[*hp:UeĞ~Ȅ+- D "6I;\;@znA0$0>$1<87P5i2wTMEئ^KX[; 4vG{3-p{DmM/kO:3hY wRkHTܢ:S';$@;vi[9>.<Bt(7WvѩCE /s8{#Qq`dkku#Ƣ6eE{i">.p5,nƼ;{lx{Fࡎv:CKgR{PK\p9F/'_p{5 C8?wj˹'Xlf }ϗVKw'B<JSTJ&5IK;99*mq;_9wPvԚ7r[> m>)H A…Z|R7t;0 a}T;{=&A^=juO0bo`a%7m56@G> .Yţ}]Vm5.IQi"aݽŬ[NmRcL~('pM[)%N3ǐ)DtҒB\ƈD0);PE]Oi)#CAFJ M#NT 1:4@S82zl馚&n~QÎ5ʉ$ꥲKSRʶ"6) +l'lrv :pBOhETH׍ThO$yR `A'&H)yOY" ah LFϢԡe\`|a> 4AE P!0dm͂O3R߼ޑOGw~;a hAlVC" c 7fh?y( ޚe#vHM e{#BHxJm@3e ky U̍T Cq1(ʺÉLIMGl4Iq?ꓚwNJ |&M;RH Y;H:׉Og4J4 {N"y!lD&i1%j;,X8*.p?5j 'vΟ2"bwϒ#Q.0u+*Lϒ'\p:c#X7 l7PH3uAEi*TZIࠔFGi?/R8FpBIjk;ЁcZEluP/["tPݍ1~+9hOߊEd]J-RNI$$IL%)$I$IJI$:JRI$I$I'I$RI$I$I:I$I'I2tI$I$$I:dRI$$JRI$$RI$I$I:I$I'I2tI$NI$I$$II$I$IJI$I)I$tI%)$I$IJI$I)I$tI%)$I$I*I$I$RI$NI$I$$I'L%)$I$IJI$I$RI$$JRI$I$I$I"$ILJRI$t$$I*Y*9I$TI%I$I$RI$I$I^Gt\E>tH ~UO*տDI$MdY$NI$&I$I$I$I$,2tI$'I$$&N2I$I$$RI$'I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$WvT|/]:?0bܿ%)W(\OI/Пw!SoK~ʴ|]RPYTZ>.zӭM"|ꪵYU7R;D !9UwY[(C#LH N) .'NcwTz ż>C{K]zDS'kCi(3"̚?L!)s@%h Rsl慓akI""6?ն'\,sb5өcq n$pnXrҨemV][Hdw#E E=?ܪa7cw!\ICdgQT;ɕ'FZYZ#pXO6^PnEa D:A(k] wo3#P-vT aG˼:(5jCD!DXv_e% [tLd=t#,Du!Ou0 wD9;,ô\o:nxEuk,-iϒ}#%.3ewKA as[*V1-v->(:װW,koh#Ax 3w8 ctيlʫXtv`lsE.7vCLnB˦EQ/be7"i G9Һ1iꃫhK#Fʸ"#Ua3U.%k >0> &pq?U"R $&T[+g]Zl%Ng sF3@s ~Nk }ޘ=hˡy%Mq"g~s@3*)-΁i5k|?&wwEY%@IZǭt9^cHY4\DǾvB7M,׀%ӧs?cu 툈idWne[[7D~,U< $eq@%SkF@wDj=ޘ (?ρ<~оsHs6-PstqjZV63<;k8Zxn<]]Μ :͐':nAsyEI#O0A lD)%yNiCݭ6ڟO'@YIʓD; *8Y+ZJm Ӟau85泫 s;[*U]*n;[ܒ aj=q+{KBmonh䅙K+GsqН|[q =,cfN]s\'.iH;BvYuUd@:փ⚸8Ɲ[OVgQwꖸI%@9Z.;wY=}3HIװ]xP# *B2B!6eKv̄%IHNPj"׸L|RHB>32y@w)A"Jg65OXM U ]-TvA@jݛhЩ4)sFTm $4'JR}~*.l0|)yKL0 i1y>! 4(= <@6.&yVsAXUWw=ǒpv$:LPɺ~J AsNHHUk♵mRwJ^$EfxB$RUX,Ց'׷pdy*Xa۪I"T5d׺%d #6SKG-#րObtFV#UV_ u')P{ӬkLJAuט$+-UKL4Un'YY+j l: t#3̔ ќTޤDxy*:- pPiNSiӑfI H%)$HSkKCuRS-:TRNA{eW!Y䫵!' R^8H(tD Q[GOh:x)>(dF) q;FS5[u&2n$` /:|TA{> / O 'Qhf*j Oa{{l%I'NM`|"Lxg!ߊ mN2 ;)i%Uk_si׾)`IDhP5L4Uz#kN<r$3D"SjF04j> ,RoVt>t)9ɝ_!ʗ:t3&$v6ݴI+4'"hs2qDF꒒>h3*'Sܩ4'ce3o()S .rk|Mv?C )(FkO\cxZ/qU- j{!Zh8 wv)=SV |Q G yo)NT>kc^ vG#>y#J~#V}gIGi%FD|V*"t%,HPNTW;i ^v®pB k:{x4~(o4L+uAWn;GdS7i'N ٫ngi4V6xƳߔ 1pM*k[lwh{^Ѥ!=Em6 +]ghZR5aq}615hPlur]oJ 4rs75+QЍ'.卷kYw;]FAD't…`wXDGwAYD h -c}:L78鸡kC>Zo@S<(gI[ӗmΩ~Ed{L'v#zisiu3ؠP '*:AЯwwQavN)Q% Qr3%-Ot@#E(HʌCL'q3F@E٠I 2O*Ng^٤0UG>*`QI.wArJ #R$Ğԧt6)S!Z=d5*gpvtgTU# BX]$jk~熻O4*˝1ψq;LP`n2G! NkqC[[unm.dYC&:J7T(6[qƝʛZf4S46 ۪NIIԎ%"d\qDF4Gv`a;FiȠ4K'X!=7$hDxp>:{ퟤxԁT\IpuDIt()-R6ɎFkCIpD~y?h$rC;p?$5]$&L3;1=&&FR9Ф[4rZK7p#Lj)C`H ,vm:7HoND~([<$79 ^u-"O+C7kGroLxK7~{N57-6SS/QW4U˟;Y DQ#]Zt%gu2B| s#Dڔml=2V[ N;g+$3TnW1ڬt% Wp/vXqP: x۹*y 7Tde[6j!SθTͺy;hcX\7#!tZ00YK뾼-&{/s a 7czCC/dz.[U.1#Wrf92PP 䬵WDV7"I0N:I$$I$I)I$IIJI$LI)tI$$)I$2I$I&I$RN$I I$YG}Vr+%RQjt'I I$N$I:I$I$2I)I$tI%)$Nd)I$I$JRI$tIJI$I$)I$I$JRI$I$TI'I$RI$$JRI$I$I'I$RI$&NI$I$$II$I:I$I'L$$I$IJI$I)I$I$JRI$$IJI$:JRI$I$TI$I$$I'L%)$I$IJI$N:JRI$I$I$2I)I$t'IJI$I$RI$I$I$IJI$N:JRI$!$I*$KI$I$$I$I)I$>EtsGȮH0T7}$NbII$RI$I$$I$$I$tI2tJI$'LI$$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$F_PQWvT<س7/IIC;>S'F$OI;k7I%~ʴ|]RPYTZ>.zҨZ~UUެ* `nxVa!9a(G<+/l j$'PIZ&\X@=5Z58,u 򩓴KOJw0Uv\Ҫ˧oWhK7:DU~2@ %[μPR=NgVa,hUʽȘofܬt#K=KRU˝huA2ehՈ湾\QY ];4).69*vi{\[ $  bͣi<*}J *YWyY/qɳy$$K˅|Ι\wiypKv q2`^8h"JV\yZ4R4O.kmRX1*UCGˮHh$u4>$:Ë<}q:gk~$V_W}q2˹"Vh%!LA40܁ELKZ:E mLj~*g^ 3=Ky 5 ZC|G{9(EDF2LB3[ OE+SIRcEbtxWze>ƽ uI$nvf`iiI!G|*S;E}94:ϊ5S1N!{<8IJв:t{o?r[`k#hVZ4WAcgBWcDT7)WMsuPU{J;iR6ii:,AY6cnD(m*@DJc`ADk7ʃp(h#IL[y@:&p㏚HecԁRkAF'ce8l6A)$sM mI:"{Nh5Odzlsrَ .mb1=O ̈Ah|ʄW%R(X'o&;*upL9ǃϷw,`8&LH%sO$YӒ& h5u6w" DO- ˀ|* $·X 3yL\wtu$O4~$[W>uhcis0mӖ|WE@rQS S 4IE,d@J ;D/)IvnI S! ]L?$vyFEK& =miP@:@4 .u@,Bdv }NFHW#C-#ޗE$ȏI{vjwF!\&).\ 3s6@Mo7C*h ;S}s&`{(۸t%K p v@)Wg ʑɕ6)(0]!Vp)v'0xR^oqSoCIO NgGnT%BƗB+jNݎV+iv ijC' Uk||ǔণix""Oc ꝯ be 6b45O[{B|I`SuKqgMS&!}Ԍ"DN<ƲAi`!8ۻ]rpiEEl5 H;D{@0sv%cpND6IQ$AFPH%eZ/rUG52t |S3H~==$(LI hըLwۿ NqkK{<aE5aL4'Q)ms떷@Sz؀5(-lk`Yϒrh3-xJwD4Ob]ݠ3A[b:H:^7vz [?t&c!Dc3 J%NR颀<X"@SJQU8)Aڏ$cuj%MgE6PJxIsLFteFA2yiaE!\5Aqrd$jBP[gDQ%*aƩ`X'k!'>g[ӔnQe{*%[fpU mpa'.(l)iEjQNuN@Rq7+'n0jJ7s$Mgۡ }fkFݕ;uQӪ.hc4ya/~~6̦d_,o_Esδ}ӸA:bNC>jNC{|UZc >=zrGӔ ~4wM{'O 65Y%O*v[' uڊ'?D` M;$Ğ$. (6LIU -8$=Hۻq$P<CK{P~ޙ֝nЦ0oȒ=()3qW{NMlptR-ēg_eO2"?Sol<;L8oNVm}?)ԂP1+B9?U/aunt@'5;sXMlih#`3;Ͳkn-:yC.ƿ!&'J5HMNBpQSzbG#GTKHF4Q wS*2RIPH: ΠiG~{~U jP]JhNyQ|*-aL"D%@9F`tKb'tB̏vQmTMT GRq :$T[j.ByQZ#㮜'GPP* V A0Va.ԓ\s I ;'#N$(%{ͭx:X}#$CtӺFL`Do$'f >Aq:sUK ~V (|κ8Q?Ix%ӶZ\u*{CÆP7gI'?ꒃ߈ 4G{wP?;G##K˫h&Oʓˉx#|1>B3'B{zݦ}Ät65%T<P'XZ=k'(fF&q=q="#ai~ma#l-n|Zu">jmL7mA i(g^c䧨d{|7}RzdfgS hg t#qE|:G>&;GGjOz7W-0I?= fc:'x*l1H)v9 ^ۻi-NDS]#A 71iD%egަD)1lqmtsGbI?/ juTnLL¿Na'_]Wj㏒< HK]߼*q xwEc}[C>c~p#wޣ^NDGy7Y+2kisUls'^߼e vxBŗAwWq$=:Y 8)A% $I)I$I$JRI$dIJI$L2J]$IJN%dI$dB$IIJI$.[YG}Vr+I0Nt$$II$I$铤$I$I)I$t'IJI$N:JRI$I$I$2tI$NI$I$$I$I)I$t'IJI$N:JRI$I$I'I2tI$铤$I$I)I$tI%)$I:I$$I'LJRI$$IJI$I)I$I$JRI$$IJI$N:JRI$I$TI$I$$I'LJRI$$IJI$N:JRI$I$I$I$$I'I$I$I)$NdRI$NI$IRI$,G]T$I%U$IbI$I$I$I%)$Z=GJ΅]HADY:tW,$I$J'Lt$$I'LI$$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$'F_PQWvT7/ItC⢤Ϥ>!r?1$gBbIߥ[OᾒI/~ʴ|]RXYTZ>.zЫE4~O\??X9UxVUQs:iʬx+/ B ה@(Lw ! kP >XЃ#woq(AM{"0vRѮT Dg @(1LjjRQqIKxSܖrOAHZRQ'Ea@# (/Er Nu[))4piRwԡIJ@ RѬB,p 4q%@{@̨ Έ31n3.Tמ䠇31vBh Oen૸N7jtN yUhUaYBcu]o F\a]'3q;V«h5Ss^ /:B DAD*e upFCh.* a$q)]<-3@uMʹ֙1\dž,@ G /w'kZ͍Q"L Jt2tne<*lXX3߃Hk?J%ݖٴ6YL2;!hqR6;9_:c@$6۲c#z UfvKL#¯i[@lbyT-pӕת7R,o-:X~hkuwsPW{ssqZw51BҼAj~Z1~;-T8oJUcS0 hvk]hkdGB{iWeƁYmi$nt}G45L^AeZ-#IJ(h!4o̴d)6 !N<7G5VZJJJ.nmYnѡ[]^7i$G#)* /NvV>P8gt8Od8̄3z; 0*olt:Ct yu8zoD* /XujNUװz{<sH:ks*DIP1\>> I:53kLsd0&GWz.?i@rlL;+Q`Ѯ^Cvvt5Ьp8X6Guvo,s]Z^=IaOVh@عȦ:OB9tKQn5ׅmk~ WamY1XO݄ qE[o}di }ǔeNV*ǁ#U>DjUX"Jp5 USκ#H?IZ#ktk>y, Gw)k'T+bkE*hp- ZZڷ%Qr@1}.9;ɈNz B_͆5)Fi)co:*ۃs sr :.*UN2<jD⪿EVU V,n>+[yp\ukc@CHSTw 'v H HrdQ@|y@'M>RKk+x2#1&S JrPTVu6[5)N$k<:ƃ$J#O69ۜFh젖w(; &tR*;P!ڰ 1u2@)c>ƛ9I;tװm:饐#hAY֟Qe$9R9!͖5ė|]Uւ!PcCԫ-O smE kO+ UEm a}e'kBД)@ʊ~ɜ;iR$)wN"u%IALB*&`cD x1.0w:SN{7NH 9vU" @`-|H!Z|hR˴+US^Ds6u24"|Rs51)ĸEߝ(ܠ=1䤶p1`vK([n\y조 $rc\gOe[E\GuH?*u;/hVsG}klpJ'碛xo|k@K1-v4v#MI.tO#H ϒp m6qXt x-)c@: (¹ @^cX;TpYp_ԯչ@4ss)\"yw7* #Q.1;#[M[Hl#Y+vKg<#Z1 K 9;[Sol?f*G*tqZt4YhuB:Il'01I )t3 yRO01qCȇQcEjP*ISAvH#4k̦)MILu|TZ5>=6gt0e{5I G5N\pTVZ*`)SA"J!GQƢ5+ΰs:6Uz,V3א 0&>5\VGL9#]6㲶 4vA.bRpQ*l5Mƒdxa{cUUc@v׵$7$dT ӢIRgm@w. :a > a,kɗav۸y X;T~(<ƃC@oo&cnR'DyJDS?f#\I4f0W9LSH4wIKQ$(L(ScTS )<(Jr!A@I*RR+*iJSpePU:+ dr EJe6+wZBm+Oc[\g]cZ!-*{洔B:ѧwn^b֏?Xk/߂mLDՍTvy=LG<6O6mU<6n3IKk9;@?*hWX?,Zf?/WJv ДKG*lE:"6&4~ %h^nk(Z[ʣcw<jް~:70L lɩԻY\u 1>HFVc*ƏyXq3q2kqs 5eӴs(i*D!#pξhU6GFc1:Pk;$&vkR73$ Q)dt̒S7KZ&4-N4c^ 3oT#D)&TteZtI\\bTjezs8 %h7 `@{&e ;aP_(D$2-$ʞr~+ݡ8OE^ qq|T㉷|(1c%w^nզ 6- -l:KKqyw6<9֫V[D:䠧MWIuC~k jXivοU-{vg:]Ï-=| CgӎG$ Ge h ֍AcFxF9̰N4q>ڕc,:-f=6%SbXy%b4!E~nj$GcT@s/_1v0.8>j S[{7DOx5(źJ[/ko}SD)Oa ;\` `D $&<'rYC胴v:+5|4Pq!DҔ49i߿C_Mȟʑ:%$ Md#M@:wN2 j"4RTG~jP'iFҡ.`-4AhųD׺vcd%*a`NG!y v6[5fۅ!In$H焐Գ瑸 \[2^Nݳ߾J5Iӑ)`>xN4%ݣDz}_24Nj@0Q-z#.~2uRoNZglF N4ijatnYi$GplQp B8HMO> +vUgvƺߦk | 3}b~@L5h'5&i&:IH^D Ly5Lr$--x<"0>pG{q%55pn #HRfXf;G&Q]F?%LS<FIt?l{& mj\_O C5hcN?p'O4ARG#LO~ Z%-{\  F0:DԨ4O5xYdgq$y/3 Qݛuw-2\+'%eDA> c g4:DI<֛Z*{:U~+9uuI$I$2tI$I%)$NI$$I'LJRI$:tI:I$I$2I)I$tI%)$NI$$I$I)I$I$I'N$I:I$I$2tI$IJI$I)I$tI%)$I:d)I$I$TI'I$RI$$JRI$I$I'I$RI$JRI$I$TI$I$$I$tI$I%)$I:d)I$I$JRI$I$I'I$RI$I$I$I)$I:dRI$NI$g}!W> 줒IVI$XI$I%)$I$IJI$A|T?ϟꮈ WGf$IE)$I$$I:I!I$ITI$I$$I$I)I$I$JRI$I$I$I$$I$HI$I$ RII$$dI:J]2I$:dI$$I$oAF~GqśrJRQR\OI/Пw!SoK~ʴ|]Rzʏ/V^T54~Q5a>P4+tUQ[L'AVBvXou0(LqcPq L{ %]cT+|$P3 JЅV Qʯq46t/t5P%'1mNAI_B#11*I@7E!#vD' :Nq&QDw-E$TFlP`ꝨF0ɂIJqW$;H82>@ BHF8G7B@8>«`8U4%%-h؀eaN qk㓪MiNJ k+,h5?faO.*1R՝5"U_M} ;Od|!{-^Awݳ,*nu6Qp+9,v =o4"aV󵮃 nwC^`FT{iio~5{{Dv("K uakiahq򫻔guRi:^Eyڤ5)7))kGDAG~)ԨX[3Rʃ<*)_n0N@F\|mPt(\LigPR]t B B--buk/W QE \菍x~*aL2rN罾[7hO򸕊ns`$4[x1S F[$!p0VU5zƘ'GcE_55xY$DFdqv&Zc?6t31k6V5-?D];sˌ5N7S^婨N)1;C dK't30Ҥd9SNm@C(=c8AG฻^KJ}u] wR;QB$K)=“D;ivD4T]vR7 xS-\̅ ᴈ{-%@Iύ׺ICoR"! ;"BK"zD509 #(Oa4Rphx'kôi[wHXI9򧽣tQ AЧ9 hoзC tQ:AvJ}ǂ2#QSLD"vk#&"%]8 1G S iqׄvE+=eEI5TI@-F;rH]aj!@8D=k7IN))}t sC#CeH瓯BGS|ZSbjO*Q :LH~EB trSࣥ)tD& !80:AOiH- )T׺0 n-ܢ5T'cVkTA٢qIY t9$5 /sPSeƪv{%A 6h:%TG#USΪĴСF!5eX`.T݀BF΃rq[H{ of @8y!N@-"[ TB5`wSfԗԐXѼ={ø4'Yu.|?x0X5> {wnqdGzw p |zEh}]?R ο +0K[ۣj.U܇ݑO}mʻj!?\VuRE6c,gkuǰ,)dݜ٦WYX t\hHx%t;*d̤YLSF@ocl!nwհAN'h%2% Bbg.:haLN`${ Cqq!0.>7>4JS#hFc5UQ:]?-2l۸^IqEk!N:"IjcDvX5!J;$HiX;pt@eǁc|M2D(vdhmH JҒ hV}HHTcJD@~ _HAV1> %Ŀ^Q#iLd O⣤Lb*0xI)w1:'H!rl-Oy L h-xN.' Qq9Ssf5]쁡+0{!]Ah?l-o}}%#|4+?">}VN^* Wְ6Yv?D~Am7y9T27>ֲLjUeÏ =ە^Pu&)5w4|K}E߽.{:t pHia{)?hV#kO/^#& Zb{SOwC獧Fp?ËKKnƭ#T r2 ))wIԘO!>_ARsȭĝ?x@IR- E8N< Mȟ6c)-ZlRlѬ߉(ǻqQ"ߔth5Ωs4 )'`*BvC 8(˽][ u3)䙔 =Ӻ?zJUn{c@n5EL%-ӯx9$@8 Ku=R\w=ԏ%@1s)qpxLt]!4hF\c2Q ~h)kivH&\9{gC_EwҐtR.'Aߺ&zŕ1"4 <rL;[rF"EyG "dgEՎXm 1%`H$I[xD,lx$ @iPh$45~zƚd,~wV-n!D\3f5Σ0]cFi=ƋRn]&gi$XRZ~'}`e'a.֑@z!Bz(nV%#PT3 &I$I:d$$II$I2I$$&N%.I&I"$)$:dI2E:dIRE:og"TI$I$I%)$NI$$IL%)$I$IJI$N$II$IJI$I$RI$&NI$2tI$I$$I:d)I$I$I'I$RI$I%)$NI$$II$I:I$I$2tI$I$$NI$$II$I$I%)$Nd)I$I'IJI$I$JI$I$I$IJI$I)I$I'IJI$I$RI$I%)$NI$$I$I)I$I$JRI$tRI$I$I1Ts+wI*$KTI$I$$I$I)I$?ꮈ.{<ꮄ WEU*EV*I$ $dJ]2I&NI!I$I$$I$I)I$I$JRI$I$I$I$$dI$II"I$NI&I$)I$d$I$I$$I$I)I$H_vTl/]:;6!r?1$gBbIߥWOI$~ʴ|]Rn}R(gU4~Qܵa>E+ubVgB$ &U @~D>(zΪ@JJCays I!OW| r.p3_MOͨXCKZcDNWKX>؟תV 4h _D?eCQwȵđkX|V r-.4-hc5icc ^d}ZL. +kH &U:U#[Z A!foC6\4 ɨ!c``e;+okwLk*MlY6\fOMIa]Fh¬ùB4NUpk<Ģ9wo$ivPZA?G 3w撇yׅ`.ix)hß%\'4~ur-jѥ/7כU`i#g! 䭞XHl+:Z!KCNK>JJl{B1Гl/^nk#q|P+{Y|_$|'Qv?k0W5Ӗ55r~^Vkm.kZ5l>Wt9ܽ?x\ ,a\\N2;TtUjvYc\47@w]XFR 6npq$4I0 {|U +Xah6_?(Tn˼uVkǏ.j8_MYU{(x!yaKж)J˓!HQ`kZ#?H+1* SyB:!עlvU3B !C*\jptNF^]<(q!"{wMh:~))f3e>4 ck>sY?2O0XD@Ĵh.,~j(wgTSjk L ^I+elo7 ZGidjKm $v+/ XD ;hs;Hk<5alZ!k'Cvlt'u|BdHh׃+)7Ո Jdljqc.h P5'Q:&)d=AH81GN]S#%1LR>tOiLfӠ(P )jMtMzҀ6L'P*hLn9'R. >ӪBC}q'a܄>*-t٘:)jS4`;'iS $Fƅ'mo)&>iͶ hGbŸ{%H76H0R';q D5HQQ$HN2#^R6A $)--B'w8~$ SIsL 4TDjepƹ\L8tLn<& [uѡ0T7vE.ۄ002a:d1)JRO DjJ I'QTiU-*$gд GN=ҁyД"y<'Rh$L ̈삗ԙH9ÂrL)ISHq#4 mV2u> <sV7;Rsl J[<$ p&cSChZ4ԁ%Pkg]sd4( w[)甇sIZƖGwQ{\[ $'m];DC yѫ`\gKωCn pᾴW,omy NkC㙟nKkf8'H59jd-&8^Q7hdʻp~0u*ɫ%'HA3{w9̲A%?9"_U[2=zW[Zc9U]F|{oM+h<)hBoGFsw ]sC(V*VZ%gcФA<S7DLx&%-JDBJQ><)")H)Q e(T {S Q|7Tm2\O<،֎;JԔN>!@R(wX &d%ӑpiE'WjD.7 ș+i,>#IJ̳E[7HQk-ylޅrvhJncΰ @ \qVy ,-lp)K6g/<4I\'Wc5X>NIw/$ Ke8d״6< |yY_0ƶq&e K]ˈ@]׺/vontT:Fk;"QNRv(ǭ-5C Dn| Dnxڄؤ>) iʌBJQ=Y0d|twQ*28I,|Q*C[4ה[.`敖2:"ucBp[)D!3XdKE %C~'Nl-LeIs0VsOd'8ON4Qo*DH]7v O5<)@Ȩ!)7IV+65ʹUt>4^x>Kvj TrmailVU:M|f?MX9>cK9i:žL~ᣀs4 .C`OXs:/֏8V"F?LfJuW⟱0ʽKXOv4b,^{Yo!oDU=/+ۺE?ǟ殿_\f6F ´bձv2H"J9.']Tskk0 cA1Kt6f1KҎz8kk`}]d*unڪ68s"4R$˹MK67tEknٝъ< ց_J\r H5NDƝB6 Ѝ~uahc$#PXKN%ߛ /SL{*p"tqmd4,9|m|).srֈ ~dr~+3űsff1Y4:yV{K@J^cõ"Q2;FK@?ڳ#*I/n1ioܡt*m;yy&-.n%cFA=9̠߫xjIc>@XPz̉Fjm&NP$I:I$I$I$$II$I2b1IKII$RB$d$'L$$I$$RNOߊZ=SⳑctI$)$NI$$I'L%)$I:d)I$I$JRI$I'IJI$N:JRI$UO ;VrBqb}dY5Z.E4!)^\k cBY/7qI$Վ5=r϶],p8Arg׾%#V\kH?{7z#' k"\1x{I$tU{Uo2/sD&FṞ͜p8y{qI$RI%uI$I$I+'/&MNuMpm=T[]3E; ,kK3*thQ1K1H0RcxI:I$ΤIYKrl Ue֯)2@@mNO1 J@D&L^RRI$I$m$N6 jz)9g}N,kPfWԒI.e$QTI$I$$I$I)I$ jE"Y:KKttngg%(Y<9c.3x"X! 2tMfRI$I$I$I$$I$I)I$I$JRI$I$N:I$%)2I$I$$IJRI$I$I$I $I$HII$I.dI$RI$(_vT͋7r䔥_Ϥ>!r?1$gBbIߥ[OI$~ʔ|]RbOTu4~Q5a>J?z;Ua yI !< O;\&dI@J3 h hvd`JBx%^R9?(Fۈ6m"VZ&B )(FkA@Si Y$IVU]SalDN}2B "PvjDo #*DNTۢd6Jq{$.E\F4~qDi{"0I@ UjdOTtlx)$P'3@LAI 454_qVqy̡;I)=gÄqBnF+-0(#Π#E6@v#ԨP!$- #۠I4B@;Eg^IH&{Eu n(9v:ׂBtI(ǫ@"STR`HVs8ȃu%ۛ+O@S`%Nv"-W}{֎&]1Xt %NwYYv[-Af]AR[Ibё"V%CIX=3H W3ϡ{LU]Cw'ww8{*h&9G$HVɵF@ 5*W)x!H;P3IS?Q*C;_݌ ,+bYx̩yZtЄҼ5rCowx9d\5 V^方AVnWH33I#1*Cȹp>NJF;&M!`lw^z$ck9^{^_.r4I8LtQHD$d)JnRRDc%' O)RA%;tH#HH 0Ql$w)ݯeu%D?" L$kPyQʋD@HkX᷇ ReRhOnɅN& J3A ])k. Xd?y<(%&OX@Jȉ<g ͚JPjeۏtԛ]>9Ѭ84;+`sasCC_I{JDQ:'P㲈HqLxK%HJL 'P7I&[N$ئ%Kly )O%-P:Bv-htN4DѼKLK. \@2u؀Tc4Wł*BpQTܢJJm0%N{CRL4H2JY;l{JQo zR*1*dh )Lz'mv{%4$QYw 64zJe)o ^0t,<|~*CrmIM8YcuNQ}$!dQu/=2Z4b42!Kq VcP${H%!M ,1y+3cm%gYSD{;zM/+G!g6;)4\;=Tuv/^F,!`UognۛMc@!J)'% BbLc;n~H\'@)Vf"x tBƉC$-l EeqT rkBaOva |"4|ɏ-^晑)!Q*SE辜g`>S76hI,7rޝ` yyS̆ +2vR d7VSʸ![kn֏䢖Oq.y,v-!Y S,o*6zly:4++7;Kw3T{,  Bj^z:(d^u[azvI2X"}?Rt+O#fXH`Ϛjp;DOaS k'kJh2:Xz%bO. kʵuZ!$r''!ܬp(ּj E{|'TFq> No+/ +;Qe`DUbR!;nSa@4H;LǘOl| aʗ0%`'B=>xRR(! X%E5S#S!3%Vv?895XOx'FZ t@d]B@HtA+VvaF ox"vlk(!o~ OBzDjAcu<)%`8nѩЙ #NI-'1'0$R &h,eӿTc&/poϢ [i4D5P][wnĹ#J*]"a 3HFD_* %UsxhtS{A:m鈓cۖ.=úy6n?V0s^+~ %tgoh4d:χ|x%jF^DA,Ç쇑oٹGFM|GVW+=[ u|9Va<{ӧ .k}6k6մk7uq nD~5ʫg(#Rb(mV!0@Fb 'rdP$I$I%)$I2tRI$$%):d&N%)$L:dI$dI N:IRI$$IJN:>~+9iuAiYu%$I$$IL$$I$IJI$I)I$tI%)$I:dRI$$JRI$/G:-(Bqb~}^ꙬnV Hg9Hb)dqꜸ"Ip#~r`{IM5M:ׇekO{ B\r1Lp/p͛!bSIy_.e_Mgܯ$Kų2Hu:[CzI&c,իc*Uzqvy"y V/eϏϛیчb2$KOU9#}3?kBS!${~!4MŁZZ~neor3<\ 9ye˕1d=~׷5$H93#=p};v1{>oSC֞  0ҎLӞ^`LG^R I$MTa-h"Z~#tbe~O>"W}X;GlkW3gJiI?;s'6L'!RI$xFƘF\ug KeC~Y~ĸo{/ԒI'I$I%}BFip,C:܀e_-ȘˋS09|I$NuI.7;*_Yq~ I$?B39o뤺>3heۑ_gFŪvHoO^|kcŃ1̞ KʤI t;N?>+:;Ry:ՍjX@gP1$8D%dnG&){9YCɏ?&9$\CMsC7-/S\*kx}L\ԭk̆CZ<5DF8<\).c/8yly=~sJQ>yjI$7K=@c sV?~At}?ӮƦ];ek^r eY'Lm&Ĺl ͒@dÎLqBY% wQc@vz1ou-$OWWќ>#**$@Kq (2$LgRI$I$I$I"$$I$I&I$IKN$I%)$I$EJI$I$RI$(_vT<س7/IJU! *U! щ%{?N/?I$~ʔ|]RZ܅OT0?/,?TJVkGWb0gF2QJ!)%P9#V,dPw |RBnDdvD [ODžԬx.|Ynkutq9w4T]0YAA"aZƱ܄HcC x@1*MMu~g:;%G(.Lӥݮ:vVFhD`5B\\c̬nZ Eawd;ApahaN^ѵ7Hn5)J#s+r67 !\ua%|Π̬~D+'EsM&X v@mbstrJİd{z/Mc \Hs} ُev8=K~?A˹$^Y gld:)ۆh ZH~塼Y6XIYɯ4Q!ȕ]dZU@I;õ*kH HTq&@i<1sA8a$ޤK 5)7*[#EY4K-y XeN~EXDsU R{YVւ˸fM[vg>e)Q &կcm%6|?9=XVY@#WqcBʋQH1ī:i(c#7Fʀ(RHCYQ4()Pƥ&gT宒9;4 TNXCvk l*_:C& yU:cwLn+=UeݲKlR7 &I』Ӛ7J@ ܬpЪ\x,}~BKvS e ]^8#K 4"4\DWo ,[팒fdsd ̹a:\ mM.^iS jhq斵kZI]y;:Gݢ kveZC$4e&5S Q+jpe-u$ r ƒU)l) vS"4j'ۢ}š0'fetH$iO}1w^NuCI졆Is*Ӛ {$w dx%Rq D9ۤ@{L)ÈZymJ`^G2BsƉ:$Kn^ '$2]N9( H% A;-2 Lxw |)H:ƄmpS9*.vӮ$L n~{~(@o>jh-EEk0@ƁMӸ;(^;GW ʳ\DnʵvI.Sc3(n|Qʜ;u#b&N 73Q $mæyCIAΩ˷ho]?U#lR )o!0acsG;NK[@IJ <<ϒ@-)=bƃ |B ^ :jU![᪋(d&`Q;'1c>ׁ cE=2Ou'#Aq%?IЧkT̥U% D7aȍs8:&.-"5 \ SyHTJ:K5Qu]A'K^]l B˟:(nII>*.=2_@{eϙ-~)ikC|)IxLILw?PӔ6V hx=,[,>;u3*n(ʩ< L;Gs9Xñp~x(ͮ;@2#tNK`|g0ͯԬwj.} zVfM̟Z{d Oe*>V6wB8dE-%Ҍ"Xz nos};%ۖIV{.LI:?XӑK_t?Ժl&tv.6 0xZxs *`5:6g.u 0Wp0%LwuV\K -p>+WTIyyEWpJlnL6f=}osc[h[SɻQך6juUa #X-Ubꈑlq%POE:TzocXf~i=}t/ Ƌ݊k̪wiEtί-pdZ6!Ny:);d#ĩAG)4!E)~!0=ʶl8tQXHj7Y$ !GPS̘J >@մJ!#i2ݠu"t)HRyئ]: #A)lj>)q'F5t-)(l.[.%Ñ?q;tpV0d8x! wAcؚI<Ħ>A;[= :) &I;gp#; 'W@0?Pà$`! V v: TIA}ƹ-&`̤d8%3|QRʈhqL'vk+kIG*mtB'Ca1 Op!B\>>Jɐ؎;..t1&x kD%1B88q(TqAo¯]'Aw60'~vQ@Ei'PΓ3UB}H5Ltt.[Z3JaiCO%mk:XK˸5$-NZ5%%یh| `^,AtXԶ-:@O[ : 9ʆ;ZZ]4q0alFN,^YVdýѱN89e%L6@?܎N 2Ti6teB$$eHO#Qg[`%n*ߨO`ߥz.1_Rq g PlE ++PJdL $:I)I$I$JRI$$IJI$&N%.I&L J]$QI$BN2r%)$I$IKJT ť~~%f-%'I2tI$铤$I$I%I$tI%)$Nd)I$I$JRI$$IJI$(WVtßYN%j#k]k1.(WVŹ1[WzcDOL$Jw7`k+'*ܷo{J u %o1?jI$]K\ \O7H$\B.lusu.ulv%vs{OL?Cme?ʖٷoʹ\wg5(1G2KVN XG&,\^߽9|=?It]C3sbYq>pEbt{GL#=!STØ5?I2ܬ/bW8gAI$zq7'1e7/:)$]s\jc?cCLưwMqD9(hOΤIuX;j.\j>bccW1i]pg ?"BX%!#u$Iq}x f;)Fo{Tx!s?O/GjI$嶳GNFTt+k;m_#\s'E~~,rz)$I:d6ڒI%}FG~EO/rW9=F-0KI=zǠS_Md ŇOўQ+n f_8dI.iYoN})9p posx:BC ={t2}K{atFke>s8?ʤIbJ+\T}Tf/Ri%q՟}>3ߐJ-wnݟN'O9^^Q̤Iett3w`O%W,ϫ6ʽ6{\vhiޮyeGk lkԆM"_#ǃ/N5$KOw'R.wIWbowikƄ, 9#~pԒI.^9V~WEw?Pm̷"֖6!=pdc]\>w14]V Z2 ?RI$էB?[,v=ͷ[jΣ_L,!/"4.WFy&%GT>[&*Ǘ&hG?ԔI,ߩwK~wXԱg_]R_,CSx8RI$] ?Ȯ3+-v'mmlZ>j'`?,3aRI$3Srͻeѻԩ-0?}Vf/Qi%aqgeϹxrWI%SMOc?ꚵ~t}ivڪ}^fWcÜ ;2Hxe#>(GIi}}Ur?\j{?GUEGsq'2_kI%Ǯ\~e2[z-֖AH' }TI+[}+p50P;P#Y}, 9sOgfVcn,Y%ďin'3oR\#W119?z~OI$Y/x /Ck*G~}Xt Gk9A?ٽwuyzan>8q6I%}\鋐] /ɡ#5$HRx[-i#=A Hw76Ѧ1$[W7K8Up?.[WMʫK2 O#nTqL8Sg/0IsUg2}Ho[bjF*(I둲1?~\|ȤIj_ľWw]:EՑ{br1ưsK, y#sΤIvܟظ_]W4 BCwnt./huM{K g1`-rr8F y=*I$D+4_@s[?ŭ^Gկ.YŽ?Gժ_3s31f5,֑=\\;,cy4J&s~_F\I<3jI$Ooza}Oi,1Z _ TcXf] @Q戌7yhɬQ9.qGUJUR}:%UY45>e/鴶|D's,?~ v=|p?N&+9 /9 CdϚ+-;ifā(+aY[qc'"a_4cs`^ģ 881?3s F!=P#B~2+m{@#pbYS_kJ:d{/PGqLjoG/j7΀|zⰀIWo/A~Y+[/A~Y*Kg8$lA[Y[#h׍|՟BZջ۞al4޾_^B~8c+8@TqO+y?W)}ٰ"cN im48 FF O/<^}#Nts85ÏنLO癿FB4>xVr=;8PI%T:'d$I$L$I)2I$I$$I$I)t$I$I$I$$I$tI2I$I'E~?_Q<س7/IJU! )C'{?K'F$_5I~ʔ|]RVG/D XkO}UD&* #WG3 , D* 9X̪~YRjV.;Ls+VFTL٧n))@ ufF?@ V,1AIMA0UѪԡ+5(-3)!CwGqOSpSР#]e"G1F!X(A$O"IGt2t~DZFcvy:%hI䪼mY I81 [FGui P}c/aihZmsH:wLOOiIYup"OP: zM2&4iRı1#z6H>I-$L/"[0cUUͽdx3x32T߉Tou|AAkwYwòBߥ6^$D\]`ՠ~EtxʟF[bKIT_v{X v[}bXLDV=.-{E{*^5 >6O'QN)",XvH+ݹC-$nHw#h4haٸ(StP1ݺ>)c Fʳu`nq4Vj_TĈsƾ vQ)LU|U\β31Ay%=1SOtjM/>V%A*+UzZ:{JӢLGe ۢMnoe!aG]J,ꊘނƑcCFhC$HAMkw@1(>DԤ ՉN"onUuKD + riWu0k8G*Aq;)p\\}کϸ:pJ-0 ftQ X:43ZDٸ2x# 58jy;.[Ot7DzF ߲[H/{a>eVEԈAk 9Gwo'cA I8Q7i 'C5hS@h(M~ρХƑ6!NvDq7#u NsumtjKJ=MY5F 'evӷAᮞ JErjEŧi's9'TN65 pK粀dLu'mѬ0]fQ`N iF F'-Y6Ojsd e0nR{pm>a>R'XBt}=B9N㱀Jo$ǂpPƝ%݈F18EMͼ ü`(=t->2S:ro[6fߢᦿA544!VVsO8~Kc)%HL.kSX';2}2NԮVv{jqqo=끵 j'YUKÌF}3&sMƙW8 Q!DI?%ҲZ#: J,5I~VAPzn>#}67ܟlUZ-&`6TK on ku7O3'wGeWmufa˕NPy'ZrU¥ٲGelEEF1ƚrN|Zib dg#TTch#VaR* qCĨj7*p2;N~49R %,JG|F2))(4 5Ę⛂5ZuN*B5.#^$M1'MV_U\u:^ elpRo O2-nQVtkDFrRe \8c)p-=þ .Nt4y\FE&KIr8G==϶[*qu;NeoGzvcrhm YOkZF}; 4@{8:_`Vx+4-1ӠJcRW}kIcb UkdnѼ;og ܂+$N8Uŀ:ySwbfwW)Ѝ6F0~m#EhPXtTP A.'@nXW\鴶%sﰹN:XL`D M^b̢+;Hoj Jc82 ߔVLwN+“Z EǞ(GzD'p0k~A;5 "cx?<*isw@E G=i2u͢!1%pW{ I6ByMpԎ;%kukW2腩~#Et2 }u[_IS@Bd*=? ?$ Gdtz/RH8CƿC Yޓ+g'vu*LՁmuE hq GYq'_Z8`%wZI D*n[fit; ր_AsRcK'<=U* #cw4yZO-G ׻=P#NXq$Z7;L /5+}Q.HPV+*.q"6j02f#d'BQ$ُ FP^A6@|Q3Zi,5 A- .$pޙwpU]ƍ|^%$X84߭/<'0*5 JTþBUgS X"{ s)Yt_$:֓Si,>d$BK6DKuT+.hLJAFhM$ TzwƇ@9a Ԯvl:G?>|&.'H%$J agt:Iw?},wã@UṪ'TF@>&5C$LU0fE+4,7yw l84&D'd`S5n lhL?nHAz) 衾nLE BII$RI$I2JRI$1I$I2b1IKI')R$dI$):d')JRI$I$I$[YKJE[J-RI:d!I$I$JRI$$I*I$N:JRI$t$$II$I$铤$Hؙ.ĺAunkh^?]Pl:˼u I(4._"YaJI$˾)sdG͋2t 6ˏ<_8~I+`^̚c{ I2s-o$:j.W8x8KI$KGu쮐OAaեg$VLP N2RI$02#JY?r:C5 UOYT -ˋ8I[JΙxɤ41bP~}ɴ!qWI3P=oI'G̻ u,x@.DeeJI$O,ܪck-{KI_ 2tNRarQ1#!$K뙋X@N=CoϬ"]w:4> rRI$uwQsy``=is?~g_5&Iw,rR._ c8CdI${psIA$˺I%c}z̩Z}s̬ځKgwJ#MN3|_RI$tQԒI&Zx]z,K0k vH;޳RDHя&(e3q*?$I+ٽg#7[#e"L67@wLf23I$߅s2+@<*XzS+ z*se~~GI%.Բ:e#ŏqsWP\?9$4~KXFrJI$㾹'f78nh 2?GJO3ްI#-ͲÏq=}?$K]sEbڇ |jѷff9WMmwbw:?lP:5|739cI$KͻdّB |( q G c"*Vr8Uղ0-ӨM:@6mr,0aGې,=wnܠm2;&IX~uHI&ʔ|]RZLhOT`cK>aU-~(2;F~HƒDs#*2DF RR >]Ջt($I#):vN8B3EH JghbSA$][ L!-1 kʩhX^u(@#5RxnOh $'DU؏Y1*"7#{6JFQP'vSpIMg A5sAE0{ƒ$1cvϊ# Ģ!PP-3 żAUₛ X^tGgf#Od1+@EKPQCI :$ВQAƾ)8AERg i?<@8O2 ~oRHkCchUݮ8ϭJ4-VִֺƪM0`_,gё`V[{dv ]{IUjs7 CKUXsLz=7LCC5V'䅊AnoZ$p56Wmv:I#⒀A8{N  Gut}ǔqgjFǎFC?ȩ鵠˜܊pvx.{.ArmB&L#xql 8?S~EK*0B^28$JkNḑ~CKKK;%GRStPXwK-UZ L[9rd_K~ѡIk6 `w>kH!H@?EkklnT\>V=/] ?Y &O2R+YVWd+;.,aCmi${x!sxlPǷRl!ˡ~el8Ct5u&9ԄfcD4*=9ΰ=+\ Zdj7a9p[#Ag.V5E=5Y9MENS:FӹrWi4OJOUUXLʳGΒn'B j#-w"J u z§ npps'7m0¬~1ZHԪ[?1?\Ɔ4>mYnScᶸ jĉ*J}òEk9}x {A:\N[POzw]Jժ -*U TIύΪRh*& Fn% v舆yHILl'B76J0rE;܂άͦL{h f`!0dK<'q<{RqITx)#F;)'scAHy`'Rm )͚Bfg$:R*d4OJeY A @1S{;\uO{8k5Ps"w(w86!&Dy'RnhԢ4)bI8:T mj8"9Ru<9I X Bs`Q.)47òh< [_%5*\hyGPմ;r9͐>inD"(uB.d{A۵6ka)=ę@-?Drkq9k'FpZ<Ǔ:;)s& :7@T@ gTeyN08]v\cYjSCxa-:T[hh2Kdu A,֐8ScW=FFB%-ڶ[BA[$hHqU|*cX(\gSa{ȡe8z5Qqs Uu*P;7l?EkGj@3a{ Ԭr'5#XE`;R}L$ 0'E27IBU  tI@Q{T+a2|.0 <;ƨj;jM;v1)lܣma L<%O# , .l8˜:pHeDO(ty7ifQTڋKK(0\GX3-UޣvǸ:rv l TMuXǥG{ukTI Jno ղ{4{$|}O{%yOXAf[rZҘ{5LXnp ~DZgy"gC$<>| >ndT.?XX!I z9u^.͏X4;א ZM6H;DG\Z.lzm.fx = {&]-#%?ENTs]I4$ZCt>*!C}}̨<T[+Bhh,Zc7s6U,,Hn:w)dt:ڙYx͢@#XZ8I>H2AE׽xc;q"Vo̤;J Ϊ BIti*zi0|2 <‰NIM?ފ4CݡD۪xK)bdhl$“J aώ,j#,J#I:. &d4Z+I O @ 2l 鸕60QD~(Z;H'7haB|PԪL[_Ql  XkM^ڭo^PQ:+#k PVYWnߤ \˜ %8H\\hpjF :%[Ck]as4,ۤL7XIU; *)#gу)En. `[qjV$hlv<="B5u<5׺rH2 %̕&HIJ G*& RM8H&EΝH d 9IJ{{܉P{2CApJ-h^k4@2\I:tt Lho%!"FHI,\AC\4#pE*.nʥgb`I p{4S L"`yYed?%/M ! $%\k(ziJd㮩3'RJLZISt-yIډRC()JoC=bHS wmQ!I$lj:y$&AߔqL| 1=$ϏnUms~arM܍Dv|LU4FzW 渺u3&K&G`P'xpm.l7'(x~ K](]uCZ0~Juf:Og-NNѤL,W}b}4>N{#5wS:F}6#Ȼfi+7O:!|O5[7{M yGYvq.nrkmr>aE| h.Gi:\u7V?4eYѾg F [<< ;5価^rcO0" 򧴍Pl6cDT܃<%H;p&3;lµ`O # ڊ hĦ5㑶8Th:Z7jJ |URJWOymA9As^!fLd xW àTq)G+K[H2OP.ji:ɨK]Z|BҿufVWC'} c&4gDf]J[$úIskpfkBH C|ʛy-vTA "8FtX<օ4YD B!Xtp}j; $#qM>k[nyq"5Μ]@UPT 04tb DCA#X5Ot!*EeE_ RB[+UswtU)uP yCeRi<%Yh &p'9; CD&jg'"d#Ok[q4vLT<,t?*B 7N(O]Ʌ'Y:nq$ȟ@qSpa;LJU*n {׹59udEFNkjGruCu&׸8R.sh'O%S"KvNJfK|:y .wq /*۷Ts,4ΫEchr?%dzkR"+e}7Zu9͆)eA{DhdCku|}L7IO+Z˵~!۽t!hh-w:h*nCH.W)dL}.KR`L͚ $!{kw:OAC ,O:5'YAz(uEj 8EbLɑB@0NI$I$:I)I$dI%)$LI$I%EE%.dN$):dI$I2I$I$[+5h_߉Yȱu5IEI$I!I$tI%)$NI$$I'LJRI$$IJI$I)I$I'IJI$N:JRI$I$I'I2tI$铤$I$I%I$I'IJI$N:JRI$I$I'I$RI$NI$2tI$IJI$I%I$tI%)$NI$$I$I)I$tI%)$I:d)I$I$IRI$I$I$2tI$I%)$I:I$$I$I)I$tI%)$I$AJI$I$)I$I$*RI$I$I$I$$I,>Ah$I $I,RI$I$I$I$$Kc->'Hl#g#I%RHL$R$I$JRII$IJI$I$RI$I$I$IJI$:JRI$d$$I$HI$I$JRI$I$I$I$$I$I)I$I$JRI$6] ʝo)=H|Be*Ē щ'~Mo?A$_~ʔ|]R۽ҟG/Pw(ZtO|꩓Vd5r,)4xRHSQS]TbSpY$*  t.q9nɵ 7(u-6}?n݌usu *vPSoVS="inAk<7RK: liX B4">SeEGp4Vq|4Uj%R )!gDF D$&H)E 3))𝺦0  7-hTD@*A6H%F Jg @)M_$V08IQ3 S07V.2{&;h%<ЁFhc[L&mux?TXun'ћl1BYBZ5> ­a$.PVࡕ4.FTec_}Fui Ѹ'5AWs\;Wzu^ăVڍKaljeu+$Z['wFXhvmL:İ9}\x^6`ΩJI蚵pBTDOΥ4OuIKB@-L!)Nݯb J$ Vr6ʓI.t|EaGt}\Id0-ԑ- ?:ےBhӗ4' ]y)O 9sgI nrl4K@ c⣻`4N!D eӁ'y8b@'DIS&aH2Ba$vLH:u7PgtLdkJsAI7আ~9 sU,"d;`'.Bx sw0A :HF#j8R~I#C?ONVDpw7:Xݰ &~ha$j;Woe_YgI<9L>)4 'L9 uN^(f-kRG3e:B[G$aCd)( -w Rλuҏ` RA<U:vOkun2 uZw5+ؿŨm} K$WTV><267KG[Yhv'SsSv9˄*usKWc{+DH]ۺs^dV}X2VwJAFP|SJTKrZ]TY-uHY &> XZqUm pS[4cIYU65 sM܁LP=f2_D +yQ׆B$4HuJJ O<24:p]80v)^]BS>Й4PT>)RS&몑p7MjL(<$<)HMY))1[F @StOZ@2k;Ji"TIIX^|[ݪDBHJ9 <9AHhDiTG1@%m*n{%7Ĺ0:䊙1y)4L4g])GoNQJPKN&dvDLBsrpwh%r=J;+kZIU^CέT3ѷZtZܶL!4Ƈp{2kϨekjc$-Zw[h?pdB[<) 5ʨsɰiߓ$YSsQc~sCjW\n~YkFkwU T>W:. n.jb.I.̨]Uί!R/X>A;`;*m  b >;A~:*ѱ gV4~H4G:Q1@ښ U@:V#D㧚k{+A#EZJ+4 7 %Uk>'Eh?%P$v,F.O?5CK8NVQk_ Z%,[D@_:k!K+;$Z8}{-'t }xzy|PKEvd?fnqP}!KFf5Z6 0EDaƖw;Qqt鯇I0v?X`s4nT Nx)Bv7%(c^UAyԹ 4O[!IYLlRO1\R<RRoy6Ϛg3@A Sڡ mT4<$JN3!)!.tBL$q O'6O 17Ʃq&OvDL|Ì(8~ Dwt'@S00^GW xBKDL5>I& ҕn+ &RȓL?*EМO%<'@I 3+x&@C.Qߢ)ippMA 4 !1. -2SF%9xӺ gY6R'ӈvJf֒ 7NVD)KzR]i`OO{N杮rƤNJؔIhDմ)!ΙV@ [1ON'RQ41DHIB,zAPpq~󕖷vI>:B-cO)xq3 5PNN)tgՆMcc4z^H=9D8LFFyx%La̟DhGjx+v:h.Y+Z+i3c=ʎ{e`it Ih"]:o=Ɗ86QǕavM4 ?vk%G XF iq.'wdC[TݡT7<˘H.:k;JeO YH M=Β5q}cA.c6Yf]p?42eVʭc ?hcLUw(6Rb(n7EbDj LE ItI$I$I%)$I2E$I2I$I$&)铦L2HRI$RLI$$I)t'T:og-.[Yu5IEI$I!I$t'IJI$N:IRI$I$I'I$RI$&NI$2tI$铤$I$I)I$I'IJI$N:JRI$I$TI$2tI$IJI$I)I$I'IJI$N:JRI$tRI$I:JRI$I$TI'I2tI:I$I$I)I$t'IJI$N:JRI$I$TI$I$$I'L%)$I$IJI$I)I$I$JRI$tAJI$I$RI$I:*RI$:I $I$HI$I$)2I&Yٟ|pI $I-RI$I$I$I$$Kg?䷂Kx Y!U*OUI:d/ZI$I$I$I$I$I$$I$tI2IIJI$L$I$I%)$I$EJI$I$%)$I$AJI$I$JRI$I$N$I$I&I$L26]  ʝǛo,__?П_?1$ Cp褒K~ʔ|]RAMKTRz_-x??XN+"Vu މS,JS!EElQY. 0μ#!! wGv/XE^m6H$tTtvW/qWkzr4 ڵX,0@5'Rn @ B* tNJ?+UKU˸U,lRpTڈ45XG$9MEj_V[:'jG\OIM[`\>{|P|4yʱ0yF5N 2[=N::zCQ49YaEM"Tlp<E`oOGr% J eKˉ7F;jH&Uy!8N\`C6F)L8 |0dG:S;#%mr2-'Ek!>RJh5VgJGN ]R@A8Dd|]Tr3C( GJtUϘEluPomtDAӔGt 5ÓouZ`v G@(=. BI2+5!PUʏd ʅ>=V&TNHI:իyԨ50!?s|R )=SI(4);% u I:$Ll?z+Y 6Rw*wSƀ#wpe;ޙI0X0uDk "eD蘝SlR|Ɗ='kwrs[+"* ;hW1{ w]kudit/:}kt̝[z3dI)!1  r@H>&H"`hPĎ 8O5)M0@:ܨ4“4C5RcM8mMʔwHtLBu){,B.StLcvS;He!;j4E(~[bdӵH4CIia(`l0s;6z,.~Iqٶ";jyM__JF*pHTq"g]'<{$~sHOR b^}3)CaMiΝ1òtQK6KFAC~EH|yHe. lg(dgTI AAi'~^Tka#└Wp6hTwY$[S'2O$.u <͛[Ɯc`:SxħkpF钓 +_d H)$LJ$w<}cK A:` 1 p#.nauӮdQp  8TaE" i1L$6$ !ZuQNƒ5*4T\5*/2h'TG Sv-|:2mǼ%Od w&{nA}i< kDXKw(9 w9Fi<(lHIZ#3Y>^* NO\4GߞTMD/ZCr}h$Iu'Y݈a-,:+-,tt ߚH`iiR궑Ǽq!w 6T)7}W>]*A@#I<,8iʖϮ- q"HW.q_\EiRCuP]Y +c##ă\~րQ+,,kû#9N@Rq-ju=]L#4sKgP O򓗾 8ɫX6Io1 {ӸAa'Df4VZFi\Ϫ79ImgU2=g#d4^$ _ =˚FRA~U1NG SG}|UD|S@F3 =8KNƅFȐWg%p5HkӔd"SL&.IK) RRH(6LiWAӋ]Lt Gj#NYcɒ ^kDϬ("uL). HAø=Gu}cTMGm ]1ӨT5l`'Bv5Nϥt._PVA[_%8X-8% $wQwӺ lHR)&e1*. r;0NO`Bg8iROSI{ >1ɳg⒙JO @ *Sfמ8 xxo;[(=R8V0۬s8%gDujzk?s*C;UeZk #8F+.dnr{si''="TS>8'Xh6 >$7b !8ν˷?H 7MI&h|K.5+;pMiW:䭊%\G /C!zA]]0b8VK"|S5I!>@4rw!G$`GbP(€')@kRB}:)[,>G > "=J\&iDv@~q+~hX J&4\6:3O-0$pW+=an`w+ d+a@ $j dkt96}_}lA$JnddfWS4y\P;l :C|V`^A L-v7OO'gn#.3 p[a*ihБy6*\bOPVk@p^f[:ri# j+kxQo vΨ2 axbgNPdY sN9kLwGb!4+-UlqƊbGU~{Or{5YU٢Y>I%Oq Eu~ @~j5Tt~U!x~Κ\~sml:MRL;sGC6h~. FS]|2mI,i7FGnyUi Xv )8-p;8}"\uNym[-w UdpU#-+;%hZBwq*enLWughTʊlڣQ6Ft7h>)!2y?W @eJ4 Oh(K )#MPE䓷y}cDǙR0 vPr*fa/N4o?Β9J>䎪0LP* fpXOi @hi[i RNQ5L&5;zm 3~h8t;E`>B[R`hB@yI2LjAA#!ֽA|>#-!MG egzGv B=7dޭH$@QOvXlh}{t d鴖7E >Ki1ے閗<}~0Cřki>zv?O?(aq {dΟ!^UHsNC'poiyYf13y-YS?dI'ni:A.Uo-{%-ZXTqHsZKzk6Ch"5 E$2(fI$I$$I$I)I$IIJI$$I)tI2dRd$$t'LI$$RN_ߊZ}W7cjRNd!I$I'IJI$N:JRI$I$TI'I$RI$&NI$2I)I$tI%)$NI$$I'L%)$I$IJI$I%I$I'IJI$I$RI$$JRI$tIJI$N:JRI$tRI$NI$I$$II$I$JRI$I'8$R"׈v:#NBIQ/+ ~q#yH%RT]Q[* HZn쓱5"<$HLp>xYieN.'>䔕%'))'R|RR$P8D,th;cw]R&Pfiiq%.‚S:"}%.m$Sw '6I4*)%:J]$I2tI$I)$I$IJLI$I)I$Ef8Vp:d)$KTI$I$$I$I)I$%%,OVVrx NI&Y$dI:*RI$:d)I$d$I$I$$I*RI&I$AKI$I)I$$I%.dI$RI$ $$I$)$I2pJRI$$$$IJRI$.]  ʝǛo)J>!EJ>!r_?1$gBbIߥWOI$~ʴ|]R)ʴ|]R+A*QK>aT:`pTt̩II U;'(;ƈOjVUnDL+#SVqH+Nր%eX(󦊻5%uB [yJLNSj\ JhTV;ϣ!hRU+eʵrrA-QBj2YA+)rӢ[V|.  YFO⒐ZV.e͟`s m%tNߺHBNƍ\|J@uE0iXGyΈ/>))HYh[bF#y Jge%&iJs)6kJB*%M()w DI,\;*ŒUi*uԕ^['׺f6] )H=J }=L4QFShQidGaHjv %!Uv&c| Djy$O'`jT|V{DTֽX@nZV^SfbTHTs0$1Ьq>WUwYW_X< Z#Oǧ h5hck >h*.Tu*8jʩiJ2g J HEH \vP*D(o\`F@Έ)) =Fx@#FMDvC)5EH@:G?J MRvQ+";*y .y>+B!gI{骅e^QWpv^Fna{GޢJ$yI ]"BAÑ*gUhG+0HWCsJHNHvlmzUvѢ p_HYΓ+EI4N*J'T2^9(djG*.R%$DAN;džhXm/9&yE?kgaqgx[ -kDpW8xP,-uc?l ePP͙;,(Re3tR::ytLALX8$8&{ANp:h:D5J9Ӣp( Sx L|@p8J^BSࢰ4jۯmFc7@>4rȕٿGQxv'|Z-2I'耓+p$!roSFX>^ќ;@xEkŃ$uao}]6͖g?ꞝ,T4H6=4@59A}mnc5h2?Un?Xa\g6֚x䡴Ɵj@YK=nv7@{^zѡ%IlꁍDHp:w;YZ}TG;g(rtEMߌ*T8+$R*!%&ct˄CbtQ*IS)>? SҜ $%DcT!ʿh;NPN jƣE7ƍC!AEWhU6jwq๪2]Yp2 ,-*}Pw@i!vGU ̃We9rx?$˸)5ӎRx(3TВ}29#vKlR J|c4C)76d OjJ/%#7plXs(p4ARk!ZTݠ8 JbFN @ӳa3rInؙD׸n/:Emr[;,Wxh=Ĭу&f;*Xҭ􏫟[c1m ;KxK Z@}\ {" Dp G ;Hȥ^xCaaKyNP.2 Klo ڔߤɼI0D%t[/=UFjQ_Pkܮ7eP [K Ӻᶙq2On0z:%a]&4Ȥ$H8tXHC F%;t;un tKCG1K/]\ms<|gن+:fIeq"D/?8/.mW}Nx=cyQ$ hZYqy Nw+); 5.pkAO+״8g;\}63c QcDQHNW֞01])u}Io36νjqC?FӴ}gʾ{U㫇8DxLЅnuG˚ 7Pl߉ih6KAgqQf汎*xPI'U[)!ഒ^qSvSe72U8Ȭ@Oȧˣw=ڮw gG ݶr>*A!($r\Iws+Rd,U.9#jn,O̩ & cV[`/VGuV0j$Ύ*D$ˆE's[}$ZÜ<*jl'kU؈[vHķxhc ߵFGƺO*BͫGZOlRً'FUa6]aUMu+y/.#_T TդFHj~ad# 60I="uvD4P`q ;ruϟhSЬS_ 2 2J*HwF)OF!*?ɈA 2>QI/șm=).t~*UgJmdk±D=>Hn‹S%Ed9y±HpNFɇpxy 'JBKAMv|S\$24~>R5'q#O%|Q20xLp7u&* qs\O Bqn$)ui24AE0I1Y-@@L骎 )*M8$5̀CLmt0$@UH*kzcpir]cxh&I:O9tD#W2da4+.ָ +sK/)={fN5*\K\8r7{Dh`LɏV>6ZIׅiuvl>o?}V9qjQl.p!Itm0 fb>ontf8Np Zx.f ipKQ.sOkv᡾|_kbP}+2lYU[i"uKM~$u;2.\|NRSctkCUG; +mckDw}M 4UoyOV;CMhy6:EF6;HXpyE57_?@ L29JoLvTa02{쟕tA(5R]x*Yold!W}. #IbM\TN̢ vH]" AUYxLy?*e'^|iw^tn[#ÿ)Z$!UC^ TNL$K`msߒ~)% r2W*Oq!# >2ciaithdW|$ )tU,7c`LI?'UiVmE/<2[u 3r[zp@.-L`wtUu R$yr.|#qpGhET8%p-B@L,omATKHBepI&RvU%PBX'ĸ$3IG ÁAf:V坔&;.2tn -RI$I$I$I$$Ksty p,_A c'RI$^$$"$II$I.RI$LI$I$I%)$$I I2I$J]$$tRI$'I)$LtRI$L%)$'I$LI$L$I$$6]ʝyn_ܒC'\OI/Пw!StI%~ʴ|]RkKU ZO}UD)(T%0hTK&NAUGeF<(xA! >hETHk [9rAYy#rj p3 l&X6*9Ă9W*f؝ ] +!VN);DvVJkÝe^3h+t:*h2UGa7Y(^l$MY W* KVXQR7 # UeeԄfӺ*@Sx(U=6^ZdH 奛2|cğ4'Ul Mܩű^-H1ƨ8~qeBhX Zūb2G>+ABvKNN8rNT4D -ЫU;ঢuDvʵeXfkx HԈ)mgƈn(n))`x#`PO4f ) pP:LjDJ'Z4T_#Ez+uv%XU 3jѺ8@ΪD3hxR tLQG ! IGT x>Jݺ2>k:gӽ8(/Jm'@X4OiDz.4jZ$L۵` 2Y< V$T?Jm86jz죏ӞL|H蘥<$x9LtIO r6vBIF`Eø4M$2چSQ ]Y7T )n1 Ja/HN 젤ٔ y#ܞۅzw||,}XɤÅYUL,r|Q^S}\mGpօ@$W'uIlq(dȁV@}Sp#&v?^[UTښ4j5UnC^K!juX\ 0 /UevI9q+M 껫:uV^]Y6<3vC I'5;׿*> 8'"AƠԟyE6%])d OZC~𯘏ou}XkP--?ki">N-<8j?@+jgLv @l>R IrH:]}GN[d .]ii&9< *%KGȩɏ4wRVq;UuV[Gq8cZ IHD49GhMUevHi*Swe 3Qwa"w{y&5KjcvI VԱN'r 0yT5: @qQ=H<ӖN F4FD!;q'WL^T %#q:6e Ns@RjcE A;N#3(dBrL9KU+RuL7"NN45JMSZAG |8d Hѵm9-#ZKA:v']~D=TڥJᢄtRFRDnN=&U)DOe"D ɸJJp rJ/t4~m-vOWuj7 vOa63]mIpx,kp6Xޣ6}" xPįkd\|5 ˶K/_TKjaUY-)%y.G'cd^+l8hkgs% '~U}fw_B;\KHI dmt-25a .k94q쉁,ytNH{P/56vP7;p㺴4Viµ"4G W+:,rn5ܲ(/2g#JnL»YEF몹^y5 %;StDlI):$$T%>):J`cR)N=IS 1qJ]DjeDt+nORe|!zNu,w: 1djPLM[ts33بڞ@%5Y$4R1 w9˝x'#hgtOk `~jm^,'H]31PI$%9 R.A+h @n (0trg⒑?;+"&QknW?J-E~=8{Ii ԃg'kp V9q&gi͏*{gB[\cAV. >QyZ.J̅)YzPt=qcx>+{ik;am y@xPM+tq:t*ɢyFaHVmO܆ rg臚xU tw(KyL uHAI-@Ӳ4ƚO/7 ]I+࣒`l4Vf#^HE珉NaA_$+ZNTju "6OxGÕ/$y($vl 6 bT] ڋSF{٪pIH_CWy5`ړ*2ÞKc,?p$o?d;w,jmw Hk"R I> aڎ'P |PrSa6jKwǓ[ VqFWwFzo( A$ILI$I$I$I%)$LI$$I'LI$**E2JRt&)$'L2I$I&I$RN_ߊZ}[7cjTN:HRI$I$I'I$RI$$IRI$tRI$NI$I$$IL%)$NI$$I'L%)$I:dRI$$IRI$t$$II$I:I$I$$RI$NJRI$qFD|iu$$Jf. lYYUiRRҝA!H)߅&μ&LJd)QkN\)J,9l})6NK0xRJRs'IE#XC-.w.G?J+k+  j}_%2#D;)LLu nʌ<#f41I[(h&{)3KSvR |!2'%,|m"@Pt # orO ~M_ A=MIJ[;G)I"_c]P8IҜ7IyײJY )D+-ʉͻ:Ԧ %/ @Qks1'i-<CZ]m8LJ%.u)lh Q59  JdJUBǾ$4F6]BJYյHN)WP:ď4V 3hwɞ;$"xP[棸%Tj^QY,; )xNwo3Sd#" ٹ\t*kt*a }voPm;;+x-g 8EI8rh$IAnsi> JΪ/?R~4{)n)1|n]dHsJ n9ڔ&^2GNk'B' ֟e>Ug}&gފaLm .Mt& RI n "; G0NpGɱDSןx/ |PV]sZ`O3 ENAL L{vIH)VpH&'PAIAGH*A ^|ʭT.V(ʸӔ[: Ī@V04D5mE#H- Ty@H3:!x f)ǎOb_ :5iP6{*R J)hkx=c "5Z?@ʣbUƈ}2Lw+*A[w|!HQCp'ᦪ5sTyЭ<§xfZK::c@,L&4TllrXBGJ ]EI[|Uj')  ^GU۩e$U!UǝN^>a$0-#N?E7BGڡ\S0U|C&h SI  =yHkœhӰ*JE:ςoZ؝}t d1H );^)9JqB ]X{AA *V~7!i1N*N:IDjtR5RQoUy ЫXQS!\NU+S;y%t݌ąCB̮e ۯ `^>5ڃDd{LB){M\OZ{A8Q2[kk҈{[@@kCC#UnU0H:4Fʰ[ l{0N:*svGp\wXZ<Qht^ !t`,>;rs:yo Bn?d`p-)6;S51 DHJbE%,L)bI qNS@nNBBJC e'734))mx$H(5 ?5L@'D@'@JSQ)&u}Uv][eI"[%eaghmf"c(C0|1+$Р?Q~U imM h;4'HQ$>>\:]42=A[ VLHG Bn Ѩ#~r # OIoy1VX@#8%,-L-̪X89qfd3`GײnRth1pSU;!7*%e&3~ 2쥈IIDF&/4_{ .Wu)5H0ޛh]In,rh;NUsiں5^Jͻ3>SJ|L{K1cR1`:Pf_Ɗk% hZ "/"ZuG2c-{h##}Ԇ8Hs]V{1*y5ȣ:t(A<*C-l7LA-[K2h]n "9vr6%Pk -:ʵh%H\nI- mt #(cq]8pnjUqzoPn@a+;^ |%d*Z3HtH?ZZz51i5wP{dvV7YէP[6̦-"<h)֜=VaEJSvR30>MMcH3:Un v*ֳyDқpʔK_Uf~OZ¡{qW1YAdž%D2cB' ~cc$;XZ7:`ƪJ13}jrt)=UT=+dNn}أ6Pӽ~zA6v\]m s"yZ#׍p4 + z#d]ُXc{<12U7\1Z5ugJsq+b62walg[]՝k+&Ueȡw-C0>*i-e p&~c-wU& hN\,l# xU:݌+^N' )9(U2,w+ԴC1Z}Y$L[TTRiOC2Gr^( Ni<'-E+g&}]ΉvL|+u4~RA;q S6:rvC6ci=I#`-yׂ#AZ%Ջ. \UݐWӤW{w8 8E W zVyYy)*A8 xE(Pp?42?AK8N@*=5@pHh t+tvK:N:(&TwkwFqִ=5 #LjP&!g;s쭴:xeMq>*"`H$|8Jҧ:FScCJ8ƺ5Q-Tt~(pQ Zl" V:wWE3c@_&<DR? T]i ukItW:G~@#Lp$MKd?%'K5  ԓ>Ӯ'pԓEKw{Mt 5k$+ϒqNwND:R{%f2|nffA07%Ijt2!8n"%M-rAa[En{Z p+/a,#;*mI1X[dn<%M5s\Cx?CF]ٞkc'/H0oxcIrw4MSYvΥEA)c]}Nl0L?90ldh~PX:%dI0A4ӄLƺ)80 p|A'P"b@ *aVEk4Ԩ$[Qe|t|umV]:.qq$9+}.Iu -!;Z}c]IgD3 'Fhx UwE8l~곕[$Gɫ~9]sAGUW "X@0|<7hUbY Io9껒Z E$EKI$I)I$I$JRI$$IJI$$I)tI2b1IJN:d$'L2I$$IN%):dU ŧ~~+19n(I$I$)$NI$$II$I$铤$I'L%)$I:d)I$I$JRI$$RI$$JRI$t$$IӦI%)$Nd%I$I$JRI$$IJI$'IJI$N =RI$8 %HWv2~(5I*I$3DsҎ{w$MUF٨ zYzO#bIpBHRi 4NEcH 'YH*OiP}꽭2I*tHpp:wHXBZ@uA%[7Vs[kko,ll:syfQ`!biyJ{P}e 4쾼 [YqU s A*x $[n:0#n@O$7A}4'xm`w#cGI v rSl^B Oh)z;xo~'cxI=q8U_gC${'϶y_kv #XG$mgRQsBkM5V~ Ԁ(nvځwMΗy ;PO<$h-k}R9*Taw)`=8zh%/L^m`OU1̨||}i01qJdl2A$D ƸnS 6 w vQ7tݸ :J2VU@RTv췸i:2SkKhSZb1RIXeѼ]k8ǂVVA͡15B`Jd ;j'hhokqET9M*/t4Pm8T~HYų hR@:KJbnC[ϊ(5PP5Qv=SsLח hN3ú.3Ml (uARCP<7Phyv ^m~zm\~ hyۅPiq 4xVR_ .lỲ ?;zckGtVbImЙ*4Uϝ(c(e$hc I 0! ̪I)V`|Oez(Uc )'<$F 5n]]=5j`S< gB}SLG_Pxw˽ΒDx-4!vApm\#DwU$ALXŮARYiwIhw/)*EQ*{\5LkmkϹBTh'WXD@VFU%VG 34lp" BJH"6LqUi:vѹAII;Z`I$$I#a?_PQpynܒCTC%{?K'F$_5$I~ʴ|OK։b*?/ZnE,~Qܵe0tb٪0=ƨ:L)< xڀ++.Zg@lkvScA^iYf@+AQ#R+UR'GVuN](1*Y!>4TU^ Ξ ̀PJ+x܉H NJJC`~ 8nrD73 㴘PYL+Vkăb~0U rZoTkTم`4UqV4Zx-!e;hf .GPdpt٬X  QF.NpGRP|}UUR,ZW :fH+fr:lϷǺZTx)b Ba kdJȤ{ӡ>CRFOJsLҢ㤨 *8Ť+XėGh&U:Gh*̪1U~J|~>k}DOk9T@kZ),p$˻&>N=ޕj|[`w+فd۾t.}C%_S B=L:\F 6Nm{^wk+5m2uZ܆WJD4:jjVvs+a-& dJ KM_,EZycvX%eds2DUS_xZ )nk:l.L.mj`+ S1HB("`uALTH6 L\7:Tǚj0k8cR)4LIOK\nT3<5ީ}!u=[5RgC[/ywzl`s>+پte{36rZ IkH$x88gnBCn5Dʜ!'I$`@iFǐP*l;N"Q=AESx@1iN])Q.O]{VEkt]U1$(.)ΕoދW[[SK`exzc2ƒiWXݢ ~ǒxۮplq2IƩI䩱Lĩ?_)u$͇NCeque܄E B͠4je?D3a~ ,ap2xhpIԤ+;u1*V;?(PqN5`xݮj~kKLN\{ Ss*uLGaO)$#jYLéGP Ӂs'#T(x)v%;Nkl;A,h_F$g!Oi;&)L\{x(9B>GtQ e)Pܔ­q&Ҽ<2 :kv=ԸՓKn{;vC]f7h\F,7}'w<.}zz7 - r[xAV;rߴkd=eZS~+`\][A]]}zA5i-zfGNp%h7 0DpkYxW)ӟ$+ϺZΎЬduu,cˎ,l6 'm2HtpFƊa-;ISŌ:!Vsɱĝ;'[:S_m ރ#[h%7Nffie+FS'aq?62&J:뢵gn3CfK5uDȝ Ez*z ϫkdL*}? ư@!䮊FFh8ZU:BcQ%> u/+.!烯}'K*504Cq˄G 6۷(ȎUl?鲑FG4Z@^}Oy[xŌhR˩~DQ29Mڧuc7qn^=0VoٟpvShsrZ؍vcdu(3#.Ѻ:`瀮`.UCh !wx2axh]ĸ>hf!ܻEU6^}|֍ o IճBttXVyy s@.{}syXNgyd`#[XI?P.h XB=eG WHk}BmUzxw 1rEmڒLԋ\ú i `u+yh7=+>'RACvO-,q;xwWvN3lsW\^2V5pUTeBp۠R.vtH5J+% P`{Xg $Au?*5mq<("5w{QC&F(|y*"9:t<*֙e纩c0 Q'ǸL$iR:ȍ(BIDj{+>(z%-& IlqW"-D)['Y:[وn=揄Ծ~es;v1ki:ʯ[ 6q?%ch*zE:A&D;w<2^k@LԵǸV aĹH=+x Z;̈IYm=9&3E/\GVa) 3]p$a +EteHv8GƪSŸDx~*YZS2q%+9񧒮y Oɑ"P D̥`jFJ(QL xTBI"?Եڞhn'QsDx ?$3#G}:Ϊg*`몉'')`#nOMkE?;@8'TZ2{"|04IXHB3?%9ڂh11A<hGrgPsK"QIK`4 ~(ս[5WFBqn0xw_GM!$l|Jd-eVc]A??FrvSzeOMѮ)Ck ␽h.ߘֽCNAs G8<ûBHHhBs4'd?9qaӄ/:4l L0FRs1O[ԙ<?BZw{AuH$yQȹƄ*s N@瑷M%nKstMk̟NYIPU#qq Îm@m0q)I̟:r..qӟ i1> ^7BkݻY)v9 -kPOr0,|k?dV7q040۽s\LoPbD$\k̀6=°*5w(,cwtWhF:|S sɃvKxTI'4 ;~i*N`hTi*mh؀P E$IKI$I)I$I$JRI$dIJI$&N%.I$:JRtL2JRt$I!I$dI%):dU ŧ~~+19n(I$I$)$NI$$II$I$IJI$LIRI$:dRI$$JRI$tRI$&NI$I$$II$I:I$I$IJI$I$I8GcK038?$&)#O%f6P[eXt RRR&Z|PBLq.P$rvRJD'Nc<)Fmd J-@\E}Un5L x)]_SH;EEL(cdMv}~_Gǩ.~f5DQMAI>L;򈣳ݻ8ʹeXH$I!TktK\IL'H6(6^jʃIK)jps#}|ZGD]p-ᰒVx8' B}k}]❌$5z4UbW!3',|7 ӯKa))f $)I LtWWQ}{=PR`tUPK\4wf@4Eq;cPH$.q;)"Jh I2 WCC{*$*iI JZl8z 2HB܇{˝"$1M:uaY~v (54)9=C$&RZ\dvD)6R.t>Гܔte0\KvS*F mv DwO#;CO*%HI ֈLBu`""ce maĸǒJZ; tK 7@B $Ok{;KILZ ANH@4;*':"6wOdCk+l/JRRbe 좰 i)k-cfx%9c[{Bv< LZIc'%PISCtxM>2{)Nh2?#OO*^ qcѢ$nztBmmg%Yp$c/ [LO=t |U}5[D:.qgIw c}:.RRc1G>5ʋk#o%Xql4Un5q=( Z+;+c&kkUqu %F8e$k[+3,ApC` kX4QI;׎\{+ΝALBjsL5ON/s {BsYʔ` >ϊwYS" I?[~A![L))r}Mq5Q鋝3 !U3mQK"|ԝ x+8wڏJdy6400UCE.} $B-4.EcI] rH?rͲ1m?hID7Ma$KKܱf`gC\ }BY{772Uޕ 9>i&-n%btUKlv"-Uk6ʰfkc1mktG% vc:]qa%ޚ^w`'יBOq!Ox)U:4N   )L䢇<xPcLD'Rr}LoNxwhIL]񻑪N*E Ncm;AVfg(RkX>$5zIP#خa?_UzX~ǚk)W&{K S.G'F$OI;j:I$~ʴ|OK֑9fQhw7_%,~A5a>PUFBU<vƒyI0D,()gO4%2M H@Vjw*HT!"(5Zx%iF;ѥ'*-+2HOd7IY9uNƙ "ǵEleRKwY-eZaĈ-|{:|yL\O>+Q|V?O#Dzh1tXBILD))ʿO =D)bb`WjFj5V ^uZ !JhI=҆~K 3ku(3%2i#d#Rh3*[uFlUFpP-<tɚ!N0vTaNqPݕ]߂-*Qec䉇SXKYvң\7rѴw3 ֹ܅kFk5ǒ cPvqm2)|crrUPUܫ@owUI9$ ` * bT֝P> ^Q?F &FrYMa}ly0q ys[]g;1{a:^U1/R;]\*=+3[y~*Q;]Y:V=*I$>՚( PB.RPyj.:wQcVAɷs}O5HA΁'wr]:n]`'P?{j]"y&4iKy?]v'ВnS$ʁ 'J[{KKNFm'^JCM AI0yO:h 5h#L<$ p& 1Ll&aFu/\:ƾh-p [%Gq'iТIjl|`45H~d'@{qlW6e0@3˃cOaD0af;53IJ :eb꫆Z6 *n07vLõN vSNwiA+Ɔ<@C}[vtO.l"\tMc@`:x $#a$ˡ^¤~p)SMMc\cEc[1<ʎU[+L5CE$D)lUѵ@6NxYe9/{v'wsA%F)Tֵa:tmÈPrrs@=Rq,!D 5DKu;(=%IJnPW GU6C~JgBѰN*mTf7$;hѰQqg+A 4H$NB*`HJR)$<JY$*Vpf%:יf9>/DUfDk^rmw_ݎ엢AP?rӾxm^61^ӰmZr>v/ضPS@!vHL%g5ϧi?i-| }!< `f <Ŭu.4bW[lE-BCYTxU/t=FLG 2MN$Aޤo?HG!Qim.DhG ("$%NW.eXBr1>(.IM[Q'S'"^Iɂ nUD(USqJR)JTk)N?$ &%%1'MSʋ Q)RD|T)'$IKj9L=M)lgTi n0H5U-ڹ" k4tWV7L'i4drkaL|V^V@h͠./BWIyCPx +Kn1!9%3-&=s?we6=QHdSFѧg 7tyc{@tm;LMUkzE;{}WCP찴G:-=̻#HZ_[+и;?.|_οWpK,t`VHk3OBs &bWtx}_fIvָ+m],Ω0ekwχXqJz$-BNJqC](sA.a]sɐԢ1~R;nq[[KZ:ʆx2X5uw q529Y~kdq$-K7k OǙ<:8FwJ|c{' UA)K㴆g?y;khIi,D!G o i5AiւvYQeİ T{*MӞUˏЪ.%lnӈk'tCLV<C]x{վrvnGr.'{)mk ]z񍗐gUgZn;A *-~[FIߺZ5 \8pc[fٵxGB)ճ1fmk#SsџpVH>yш4@'R놈<)!PF# {o sN x S_B-zlx-ҝp`ÿ~Yq+-/q*YYUvb" >!Ws(`hzoK Vݽ=Ke8 ߺq|8AKAąNۦ[mN!*W:5<5[D"0TGRrZ#IiEVa%Uz PiDg FBs^LSjQ)wPC<H-j?k+f4.UCͼ?Rݭqvފ}t.%* ݫYWz;@V; vK NEQevo%7k͠ f[Kd^K[K;0{9i+KOEDy{%>V,6?Hx/c6 yvM%6r[ooȗ #?^P]!hrŖZtZI(TE*L;3պO(np(yIJpKUS`XL rS‰)Z] D*onE NaJ*M Ha:(zΡX  ӓ*6+J~%&3x:!iukg]UcbL{iLuQ[|{۸ƟB@-{ԧ~SzPxQcCpyTXQ'B3 _6Q3%I1UC1ē@ `i:3 Br`=I+:Ϛ`%;*n&h5L>^ gRp28IH}m| 8ӵHO(xzOtFґL\\f8U/\LWP,a{G`NQAꘓ5Cx)g!n4 Kd9>?RILϑAhFp6\$G}Jۜv(Y j c6 )K#1q)i~@ ӹ?M8cq'X}HtG>Z\CԙWGdm2yLƖ<=L$7[rꔞ}Fb5Na htp2 35$Zf/ IZ"%)N1@$sDB]kIV0D&šIYq㪓džԔtRwi‹~IQBJRIm%1X>RR&H]DM6 wNgR鈔! nw(Ẃu 5"4JIBm 4Qx^ @њ(4VwI)"g q%Lnt05Qi-YVpi%э$$ C~6z}V%@h(e;%FaSIVvL3QU׳S<0e1;[* 4IlBF3$$kSbmsޛ~Il߳^1M]ʢN%jT_;P}$ef 8ipI 9'RVC#sds⧴8|J"M(Oe|(b{VVjc⊔hl(Z9)1EX\p;(s&~t1!ȶD$ DCFIjV;Dh ARIQCgyL"{f.ׄbH2G\pMu AJ&焚%-*և -{2a"xQBR, |6E-?9E ly] )Q BI!|{(-KuR6cTv;|xD8kCb@ S )*M\7C < $[% wT}1IM2%IMglx!D)63Gu"%Э<,'YJb`<C35%y!7 RyR5N#Yt?o[OU'G QJW5.q:^%EM(,`mẅ]Yk8W=Vysp"P.0LC2V6sݦ?h#̬{$ zjh{fG*Pu-[rSCP֒`h~I3O;|w%G4A$IH#\LBƆ44pjRs浑0K^V8H&4Vw7Hi1ȩfI>5A!v'U 5\ق`e7#R'yqw`х1ahzUSo< E5ܙ%]fSXU}؀t.MnNM@C*T.&īII&3q| 8Q9MvE$L]9ǰWIVkMy'HA& Yy&TC(2]lx)st 6C9U<@@ZX|83s(:w A<+k2N R05A<V0@EvpR&2ҠGJ[S\@Nk"R"5Lra[V)!/pT,|rP|jʘALE?d'$ΪQZ M) R!O2}kA(֩oR@j<7/Ig]ON щ%{?Kk3I$~ʴ|OKXTZ>'yp>jh~T<,8 6C% ՇkĨzr͆LJC6[l x§(Ҧ\ZRL7v ꒗H9*OܭLw@YU7ke[֔/lr.d¯u!an@L\kU'ZI*YC-^AZ]fX X׻Z畉kQ=?Ms[u 3kh $'hr4C f9[(hK$79QrЩݕt+Lrr5WzjƨCi0Xt Ep;!wN  zFC " ɞ;#4wj$<f૷NQZQwO q$s:&R$Jc\ e5`"$ʓiة;  qV1*Б·&Q(l{ʳ .1P*dy(PgMӱdÌ=??7k%;qAj5Qwi#po`:}.!TZ@E6w0HO>熟xmd?^2Ʈexqp?i.;wVk69*4VxʧVu,aqxa;}%ElJ wc- ,wLSYBBɫR%?v KR Qp_/Ug>w#iiJiyWxjdR # MwxK(@X4'>KbeXY^4O`:[a|SeVuI?V;걽M\BA<%&%!]k*QNաYoQJvb]mgySdz q(qۂms, ?rUE+66`2AG+q0珊-$3E`<J2;cәFMD Ma~t_--ݺ4\xC;cu'Ue/7M)pk;i(5.sXXp2iUb a (/D\q5' ɒO%8OH =RT)9Dk}p HbD dB@vN{Gt U90*o\f{ˌcshQrm sX] S{r/i ^45:\ euuЙ4; egKl{wVU4$O 5 Z6ϒ-uRȲtAwN]O[`B$h|TXh8iDc NRɥ$ƒ+ڙEMkmc]ġ\5\^N]T+!h`AЮ5@V 4WzETCwшpn^IsW;NI$&!1$N>*L!Ni*K^ɶ(tM$ǔ:RiöJ.HH#I:GLR;e%?ׄAO[eAi {?3$FXtQkh V HX9DBI&<;@8 Eݒ>)G*CM;H9(9-CZ8*PΒT?hhhh?K063=a5$G5t@yB<ڒ\uB>dSʤ0x Ò]LUm`k7`ƦVD6yt$m&59  Bt$O3vNfߣ=PnħsA188I98K*11dQUL5q^W1Ǩk%ƈΰVA-KEz6ͨj~Y4CCa} cбc. 0CR.jZM%:<1FIs41񽥮v*K48U[9h&I:bh*A )5VO.;mvw U۷i( 9ovV[]K9<T;rGtz, r!2[Z_-ɧ@Nn:O q?4,sY{U׎{dF 8z)hxQ -G)m[*tH F,x8FtPTw'7P;En;/c΢?fǴLl4jZݨ*UC$km3ZNYDyBE*Ϩ #Rŵ<][Ʋ`t@Y $4tq<Ct?;)R*>Ӡ =,nhbR,/n&=9@/1z bmVdĠ_vN#Ǖq/@$J{Aj G) ϢAԔkhY^8#p|4q*0}M5'NNtO~I'!f:{VfC\45';T$kNӄhD r'%t[Y#$̬Oe}nZ vt)^ c@?tE!í  iiaO mYl&-:5'D,$ P{d_@1Sj -G;*CG{?:jىAŞn@ww)D@ 'QBp5{l<4Z?N>;FofVk @Kktm%"aYMAԬ~2 8Zl l)#9N [WasѶ7rba׌䭴IPqLғM Jx <4BS %HɔAJ.Uo2h Fs!\*W«w?9{Ȧc5  )=Ò;b4D(0;$el!SVPRH#$#B$rPYtөP xZtEqʭh TƦaow PӦ%[k7IiP+cv`iBtI i;o쫕XXtno%6lsXIk8['8-8QR7~i ·O%oBk\#D0[.~;Fu kw&]6-3PϮM+tX<s21p0 Yv6h+x<)$iZ'I[4 B s䜴2ToU |55 2%%ͺH: njy+,;F䡩(LK`*pl&4:j\\dϊ;| )U6 Lw>JtCk,%~Ed<keH"P$m'QS tK9OoFc]q>*$(RAI)ْgM 9'$Ȉ<3* 35==16|TOf#zK*!ѸWXAH=е DyB=?RCp'Ny°ӴμtųZ_t)HND {" jdH0Gp!I"|CGxwrx2 Pӷ,HӞ;`F)1EI8"gUAԂЦ]#Qf{x$hF LAa8|Cu,>b!5Dz,ٍ5 %9*NԂ"4׷ArSAI2$w2Ft. `D؟z}ưI=j j'H"'{ۣ/7_}I1Bۃ hN)ʞyqsp5Ϳ%3nҡk;%F?˴y)፭uYm,;kq;sm?DvQOvXީ[A-oa\0ݒƂDp ,?Yk@=_+q::x>?Ya-L8G?Z^6exk]mVꁖZ[~ ʿ)dߴuamu 81U(&ǰ1#lT[L¸@w( %jCj QI$R$I$JRI$I$I&I$RI$Ɋt)tI2dR$dI%):d&I$I1I$RNuo߉YO}JE[J-RNI$$IL%)$I:d)I$I'I*I$IJa *=14~)*I$^vO-6SXѻGn聧I<,QԦ= ?uqN1?V' 'RdkOe~oixLDvI\+RR1,O;;#(^R,aN0Z ܧIҔɖp;Z! *JR)J=} eR!;F_$A)t'WJS9y|RR&I@CD^UO@NRI$f4XDž"\L+*mc|J^R@ #%7(cNǹ:Jtxf4I Jf6q׍cǰ{# ì 7Uߛc3<IqRBRMp9ԩpeg4GbJ+'nh󔒞BqN<[ II$<ћKyUX:vI!I'M j۽n(ec>Vӧ +eJb5kLhqay IRIpw*iG);njLS͆vXgCuUv-^#sJQCk[a۬ӰD81=#xh:F,fop}[ yI L:1ou)/mWLE+#iHJ=Zw$%3ܥy{pSX% wnԓ Ys )c=ѡ aԴyRmd+_fC:vL:4vWSʓZN I h>xE9))A:iL\c{f;~DIReEjukkH$%,4 Ļ@[op=C*g]ͩMV$QRPO‰!u$p̈́mXR'}Oƶ0PRPAH\`q7CtFGP-?M#IܤCpqp |Q1|vve>* jl$;dBJ\Gd`"FJKĻC܄@hP6miG )Q r4LypKa&♎<#ǎPJp*.f=ИNԸ>R焆D܍nF~ 2<5>_If1IEf>⬴@ [y1-|+ ЩS>*˚, rt=cA*G$@0vkOyx$ ef2XjF0ɘR32ԝX7%U_Pn&A?l@'}m8I; nḐ3T{<$,׺/j /yhfkJ̦0::IWX%^q:RJXOv^RvUד]@'VZOzmtLF[&l #H]` \xL㺴D7 rj6dO@9]()fC??Յr80> ;"ƪNtMQH68ELZ|TIK| Hƈ)]R"D(%q'x3Dg^R3NR{Jxk.M">,i PnPm'%  843LGQDMsT29C7ONRk&Lk3;OnRt;xDx=Dy(0JƇjmKqS7*Z oKh'L|:Q 8AH RoP 6@4 *[tHQh6:ThquAV:yj5~577/I*M020B щ%{?L/?$K~ʴ|OKzo;H,O_Խnӧ Qޗ ,?fjQZnͥȀ ȤS48ikd#Urk VɭUcNUV0gnfð>(Q(|+P!Q BwY=W 9)xmmhA,p`k ƨm@dƪj='@tj%a*@%Y[Qcv!i@64sNd[Ԩ7e_ysti*P{-] sLk3Ǵ =kx v8ۦIcssƱ>ݤ;@.B-Zu#TtVNM'@S.pqiQ蚡̡8PptVȨ ^c04ô5A9.26VDc;;`kNA:yr] ˯@癀~WS=ž(G]y~p<qʴsc_`([OYTk}2[lZu;( ?c@Igm'@ݺ]%TX r`,0w4H-v/RWsKJv_5}3[:r[RIeB<87Sf) Aq,.E3ޙә=Elpšw :@~(qj}}$Yxߣo=(fF 7 MvǒvM 6]hvVm-pxWLj2,|r~#I :O2Y7ti+U6N m1p“ }oWapbBcT #V@um|S0A%DU{X*KNiuQ][Lg7kO'VZO\sLIT=$ ٱhl5Nv>ep˪v%66ac'MRRv>DT<!lIw*63QS+hۣ+-ɂ"s[khЉ46AUҫוNisa|HnƶP~e_/W!Qch\inZm ?Zt)4S}nUdt3?UF>n(߳tl;H́E4OI(l̪}rֺIoӠ㒫E-|" 8q.~E7MzǸwG%Ψ LJJ #NJCA}>ZHaRf9{UP =].x&cϴt$`4{I"\d@ԩ47wqpt:O>zxp4 w2 (5[{\ njiylb/0 }!wv5j4!aLt0@Dh<{-}NE~:#6>׷TMNFy%j`P&4n P᫟™VU[8"d+אLBƩ4j{ MdiVJZ#X]ϥ <)w`xI oҏXk]61.k1} 6UNN6ʂd?PBOؐyZxj/'&lV;Ap Y5t,6  Zeo;oͥqU=I5eז5]۬P_DЯݎ7pyjU!m^G+S)`{#jn`U(n͖x<"YCbvKi h/<%3L;(lW@ 5I(*c; $Oܝ2d:Q@έc\FK0^֝  #w9Is+u@><,uޝs'oA VwWqxKu'TSA"J$ip@ ' 3 *1<0n{)m>*nG4Vi _ :YStѓ`/xx׹ᱡ+mfu 9NAl4w5ݠ|Qz,t AS +cBd]{O>+jߑ}j +[iRA+Ke`nS9^=}VG#PML*N<86 q?  oTeN̎u\Tε)Y{ 3/DxOMǖk;CʲH A*ZB%ʠt,ׂ6g3cg {AC G=>?Itt2F어Ȟr/fap㸷6!/hagXNN2L5N-4;H$M= H렸ح\&!0Z?+q_"u@iq8'U+;DwuT 6l6uamՏq lrBGbPh6Q[/-$q#"gt_M)V2,kaY+9,k~Q*-&dre‹H( 蠂@hd)=Ta;i2GIu!ād@ )ED|jULCzl5}a$x(Hԧ=~@|ޡM>|pE: ^} +cK+` gU﫝_[" *Mk=H:HX'Y>{LqO!NTe>4*X`0D]?Scw`umaX!s[jkm ,L VjR@VluΉ))rg5 >؍;F›ΨJկw\H|mIhegv/hI_D@:”J ϒJ`s`Opwp~0;'sH? mh> g1JO`$lˆ:-51 >8trHSEnxEx(\!ȈTK(|LtpdZ@>r6" FMhs䔄I PvGʃOp4?AÔ#S{APvG0擬NДt13 2a`׷P#&s& p"%həN5ԧDԩVPS 0 kQt<"NeF֐F#}t<KNJe?սOsTX>F5{0(mGrOD5g)j@:% {Qb}q!t)iLJa>H@2F$I4ZRt䒙 Or*uHO0 4Ht쒗:$OdB4N[u0&4zJ\S*3MY{=̽ʤw(%ZZ%i䚺uLƒdm'rՓ7]: lhqJ ω*o3s;$J/i.q]m[HhHIJLd-mi np* E{ %uv'R0 <1SjڝqIKH1.0'EmՎ <k63WeWklyHRqq%Osߒ7I6yNK)f}GRR<ӿ^9d(ݢ;Tei(=YLwWfIJJ LSwv M1O]Œ:Xܤ hT\uUŅUa|Pl5NT)$ @I^O CkxI*I$DF^*=H q%m{p_c(%5quIM %|Lpih\$ ٲ\aU{B@Ϻs;RyVÑSհߒZMU;Q$7RlUV1.Cq'>Q}wo :F/3Hʝ5U8 hǒJdTKj^/F=:('hAk^eVXgSJc4hHV I*NcfVx!b:H@Ñp|M %Xi÷VAyx#bT .~*bRC#hXo 6 7D) CI(Jk5NGӪb*uՒZ lkt2AӟqihX9 R8;)ESvVmqߤ3f>E G Ϊ-`CDҊ.6ڃBRxvZ7pyI+Ch dJ׎S.#3kG)7mO a+dR?`xLA{u0W-kk* v \y0U)RA{N=88 -aq<"S䰴[z@mB 2ͮ U~e7f)gVctd+Mv` JG 8Y..o`bQo4ݩ }=ަ|zEv7aryTUyq=-{ǸR.W]Yb_hhk@-}VkLXPcF$t|i^H(}@t=_ȈfC5>-T^mXzVqjI:+A!}!UkO x>ɩk*|U#hi-=6jU *H[8D-?+.8$Tښ;gQ˷05hUQ)q%ʛ^L~qP6> Y] Q60uuSfC' $nRmV7OSz`hi:;@UctTևlh;QO`Zu=烨+25Nl0˓ձP tSu+iWT[k\g9T y$)cZ<fĒ щ&L? I%~ʔ|]Rfl5[G/VeKeKe0Tu?Jm-0uĮ\u<pmmi %awƒK[ɒQM!Yk%ڞHU0p;ֽ )'\JHxd q I"1Q}<2+UMiIR(%R; I&4V,cy*EvTjI!)?Tӯ g&j~TnO$쒈dcG E ۠@lvlGFolxxR΃pU2)Um$8`yR8I==xq{|RP ^t"[<*$ZMc}pLYGdL{}"yBL熡n+2׋+a4kUjvh[YHJIyH eE(@T+>*MWOˎ5ULkAB KVJ@SnmUr5<qq1ے{YV> OqY`4AeT$TڅZsܩYpcbˏd7t0Ao׸Di FۿvQ`-P1_! 陟W}o۞큦HwXX6q?,mT 4'8~`x-IEkVt*|_R}l7C%"6{TCys}0=f#_ Gi$kTca# M6]hcFOܗ6PI exu7WI?isC4h8 catD28IJf}1.y8TnȲ1O']c gtrvm]''쭻|[ S܂Xy>(AFEtIFnn.1?QcGNXñIPƴ3M]mI0K,Qaq)U Cc`74 :O&OEMo?I1\]Xd4Ts%@:ݫ)\m-`qS ağLwGLy~j{)nku$e;l?[`-=G 2YZ ?MU5%G,샺cO\\!F5twV Pݤ]R{\u>(7dT֖vQ}TwdRiXiyzëNh?yZUH!#ak:#,dm{p>jnc_k'hp-*FѢ< m{N╖ ipo4L>:\n}G*aCoxk)vSzLgŐwfzw;󔋥DBse0@ģӫicͮr6-V:B]fgoeǍ5#A!`i t׷_wpoc[f׭da|w`ZTxLr>~L"STGIʃfTU Ef*[Kd,qi mGug[ʿ2u+.OOC@Q1`13wX¶ۡT~$NJhioȄ~XHOHh>)@)6:bd ePFPS0D)( eV/Ё63A!JSl`}{HpDB/UQQ I.܍)7 :%Ovc$_ĩZ*(t8Æ*&V= GX-#GqI遙*$"70n=?y% m~-+$h+<"SiMHh;wR]|VcP"͓~DBHgsuJĐ8Lk5)$1ĎBMd1?Z2C;#V}O#wrO[fIijJR4_-*k:y9He$p<cKyKdfL@iS#>jX 1( 1ܕ !̸=t{~B^<4ru&ԇHD4 SXƝAl=C{y2[>L\C9N~E Pj"Tt&{vgL%I UvRJ 0t mL7ǐMnvct:(0K %/';җF5Sm:8mQSC{0^L"9ݑ[K~ @W+bu}Ʃy'ÝX ^ng I~߲pdI'B 6[oQ1ߖlta5n#YR ${'%*2I7 8DBiIKITR[="l͚W(UgDz}w 1Oq[\1.n@v[, ksUP q}KYtʬᤖ?]$>kys`0?Mk U?PapZֻ ~p画Kg⮽{-5~r%{_+gr4X}5Dd8\N* { tݝ6S:eY: C_vD˭5F׷BxXYI-܋cv4E5B&J'tCڻWnW_~*'D'(Lp&<*:2!:bl椡ϒR:f%#pQI<)% dI7)JR(B( f =H(R))`߽LG *nJTIHe5yQst*aiQw ~%2kǚH/1ɔֲZdr!uOy-iF>:Bü@'JѪ9U;kֻ͆|h74uO h6Gcۍvܩ0IqBכ5DMN!۩&"~AsW* =B j|푫Xڢ }ΪotwdjKQs, hPS!?uoU@S28cKJ G)Aȕ'RFÀNj|TSy$dgkcg -( /![" Q1$FZ!ﱿJCB T-nw8@oao,k;"7S,j4F=-u..ά1a3kNarYi{Ńseu6{pTоE@}vQ#BW4Y :C+Li^u$jLb<-5#⦝cNQ}%˥EΉ pPɕIDe`)4pQG=ҧgC@ Q*047HQG?Qg:"ZVQlPxN %tZܠ1ʨBc<uUlCuDiUdeD`kq:Gn'oE*- xDkQq$D::"$@! %5D "R "8y*CM!$v.(DŽ7CkL{!!35ˈ?HD1R@ :ǚ#uiedU2B]NYH#W/T=_o]!سZ#p?׊~ʱ`!eW+2u6ߖvA*l]W07DUj I o3+faOj͐h|BB(!{+CFβ }BL䮱ޟyC8RژBt>P:PMӯ*LwtK#VBM3R#XN+PqC$Be  Eh0#iؕm.S3O068FBvQ,`a Jl0C'_ %m UyL&"uj>{8 dqd& b8a DEO<'TH|Ri Qx գU{[e{&B=;UhS,ncEOI >NI>A0NHăɝSss2>J oc=~FkuP Dg-"$hBbHty' AD'NJN߂s{@I99?'m3$Ӥ$|Roj`8$FRd^bHqR>Ѓ:#{pgJss@3 Mr4E{{TuaRR+ {YÌzAGIhp{j<|t))b9L#9B $W@eĝ _&f5YٵuB@uU:6P5$,tzl.$4kV t<^.pni׹Otꅄ`ºh N ӷ1GrXڃDYg>SIpBEr\uu kA:8EVQ BVH>V<ˋZx 8Fz`hB!Ws3 .GzBf6I%.I$I$$I$I)I$dI%)$L2JRt&)I I'LRR$II%)$I$$JV-oĬX庚$&NI$'A3$-I$ | l0mo>>JF'N^P:K{R]2|A<ǐ %R\h\%T+pGd@iM6;qDsDBJ҄P?rlv|UIvKQcUa0g<+6 o+m;}䇀Rk 7Uz..w _vD A}g8 oiCcPZ{Jt45 B<)OcÀ,a=H t6=uE9"rQe] ۞w4pƱF($&2XA^ "T=#6PyDCh%VrtD5 }fݠPGUj͍"y(vC6tJSvwo4B͐\[H!]fGΨ5ZRU'f6H }i˿dH'[U <dU⮺VnoylIrjͤ1Jl A%ef@ UC ruR"%D帴vk&yVX$Z!@T`|}[|i.O衡NZ&iD)"mgK}:'x|RJtЬShc5%P.go y`I e1thR g'#o^;A H6L8Nc] ҋݙI:QYoY9?β?j11n_ܒ$S щ%{?Ga!S]$_~ʴ|OKXGKd(Ѥ%/z_ 1|ꊷZ"]c$LJnsI'5縹ǀWPK$5T~z(;4YѸ: 'ֶc}G Kݻl 4\@ gH5hOp:uqIUЈR8>C_:-ƂvPLh({d>q6dGb{j@pIٴ{#R#lV+nAUfCHz/x.i|H-s^{Wd x)xhY +2]< l3NJliM{%V 0yITޝLG*VDe6Γk "X۟pYR/ˡ颫cX+%~oNqS]A *B5('tO2V5jt~S۴hHXz,$AFӼ^tZcepl8RS=6Tsm: Z\.4xߖ= 7BO.Mo`k~fc&yD2 8@BNnIgE 64+-{ \AX0uVn+7cM.{4h[UK@,=%Jމhm$DVw ip=I\[ nZ Daq`5 Q;Z$@n5iph[#`IO+?-nx)Z^XƉqTKAsIXYZ0iiO'󿨳G,N=ֆeXጨ5;Dx zK^Pk 3z}LBJzX0=M0 =PNǝ5$-Zg^xnUont(s߱lk|8*M&IKA*rZy)ŀN S[=@;Sm\ 4@oeQ3,AXYqߑoOU1k ΉY#FLz= liP0G dl5סhSWI=ӾѭY {7S*a4_D 3z5]|BVc@{NП2Ң'qV&G>Q.a:=}^=7]V*Y&B Ƕ9ԝg]wpcBVߺ<4FcZhO^a[ :uȷW[>W8h$ISht"۵ȃD+\I!H̨vF|%y\IԺPϨR^^x a w'ӝN c(ݺ3.%>Cِnhz[ `jNV-c/ְmݤO2+4A 0$pSgHmTot}Mu5JlvJ ~7v(_\$lDmf cE>:tJѸo[㩔 T1vڶAh |όFݯEk+k_3e0L  5jK @=#QH볞` 1#6c5S]s9Nh6pL㽕o};}K׍˘`1c  uFZ%S{&k WꇗHu\~E68HL5=*k{I}yk[3$ܮG> ;s t>f-7@oWu ]*^(x;"L&seFPj2L;@pD8nRG?_1[vh{ I h5yӜZ[FWY  Sn>l%+ׁe.5>>u~\K4:v${WE&pv8\=`ۤ|Rﶰ ߏ5p$bupݨZ,|A±zN=s8AkDpvWk;M6GDDw OC46A;"KA=#;B!pY멗XAfn&XwNl*͖F9v?sC";]~$̔Ÿ[& i*M6=ۜgW3NYiڭclլ:_\g0v'-Щ#;B.7H;ܑS-ӯp@Ī,zM]]m5sϱS]ss[H 4 aCzzm4l4XA0Q.dB@Me`o8[3lm~>C᥾?\0wGu#n . v S& pti"|o\L$+Ś+9Ƴ-Ju5VU6!rWH*)xuMz 㾉}r˛KAqbZq:qcìkkHݪ/-<ߢ]iq'W;_Bٱ?ե+%H|KCEY ?\Y՘ڶmsm$ĬMN.ovӧeG*R7J{J?W]mvV ʜZ[O*J,#|4e [~d c+)2(ה$ʃ_I8ǐK^jH4Y' N|{P2 g'/'R:WqSB%D+x~c=u_8f.vVe[tCݢmZ^lv!JBvcՀ"JsӒx4%.ԥ 4(?*ƑyP*^S ABB-H@)t:iM'\L ldJ;*օ[#Xè:BԣU!0m nK @X.TX U8?S0qen:j-T,;A=Il?Zdtdm/2{vU[cFP'UmtlV` LS1V+l4@%[Ima}gʧC9dj$U4-6\߫YK:wKɅW^~5ƶ}DiWN'@u3Tct[QF`*hݡ0GdGh?ѠI'Gi%=unu4OX5Ʋ|S7ho5$ Sq׺ Y{)?FlGu69v@kAQ,mld?Ca|~ qàRe[G(Q^IOSO&$Uk U F%]#]maV}giD)A'S\7Ng|-q@`& *?ML*!STSvUrO(:L%)LJ`a>4)%xI+$ɧbc6ʃCݺOtisÞBi$mq\jc2 ;F~~j FջՏ-b`&p`}s_zr?{r.ŵe*pWJ/$q384Umayos;'"!(@hBIUPItjh%A$h0LV~!A gURj<諳QC))p΁昕4)RQ))2܅(heH$SSCD 蔦"$ 9;qA!'4B`yEh$ rSwIKwQ|BtАH$,JySxN‰00GCPNNgǏ gCsf )vi<v;ҶmޙptZx5@0V}') //`}qkVL8 ]\4ZcM}MrÜtC`#D[ j)pcwyS78& I>MeѢ Mߩtvko윾vbKą@Q+5 IU{`NڶX"x+>ua '"dxR 09*59n<(n' -EMemIςɗ4Zl. xoRWo"Alvr7וI:}Rvc3?H'B ǐ[ulsYﯹL%?*.0`)8>ѫ'p=Ӯzc\L5VM{ȆM0|J-$} Pp`HmúdKZd)1AWlp]~t\NM6=,kuRjďEG o*Tc㪐0d  ,D%d~UfnUQ"di䦅S&k%Z8 I{*/)yL~ Bjp#DPRKJk{B3|CiDiA-{\<%^ʥ+¯ky !K5Y[IU,9Gsaߔ;$O?2J@w(LP#^9GPȀ5B" qʐQL SpIEU&) -$rRP|\̉P-*\?$X0n ^tkbT$-spO> Ŏs膐'F+$<0/kcuI%Zs2Sik0 ElsZ@?hc-$߾[,WWXhcI=֖!NjAlW/&W'z$x[fcb7R3UGb Vwk< %ķϟ[:+X B1nGDE4'=tR  $H4څf]c`i1:(8ʇtG(%P%s3\9:|"2 $$I #N*C !iTR Yݠ vNeGou>(G*n)64%8o$r4h$bÈQq*GMBIZH'C%L.׻|J! -CBdQ  #"5C Ƽwg'U]2`ɏX"<3m׎T9Qp`)fI~*Fwh=āP]ƺu6!Ds45jxψP=Jf'?}͍Ď7G0HܑRt✷?"BFLƲ\ ZLD8Z{'T:a9ih JV,5LHS 69M\HH `x$7AOtt8EDhgU6Z&{hC^#D$:~lh`xUpğZp'䊘i5ܓt0'I@` ~*PnּN ]`*yHj6{J'En;qcDZeĽ#Y, +W Ƹ?;Pq-q'RuR^_V{6#׎qHWu"^ƽ4I)DvH)Nty?ؚ68 :KS> Qoӓ I3 x$PF`򣷿~sD@v{ZaK쒕Km=R V-mCsV}? ˾wV 2QZJg`Btgѯf;qH$PdRI%#`nT[d!6“Y%)$D߸题Â~HmS?I$4'I@?KSe%i;> *JJP@[LSɨ1dp $%ڷW*.HFi%f$$1kidX[%UH/:67tJOhoR`^h $Ry ΛV;Zs߽ǹI%bMX|g!3 Ȟ9Rmnq8oKvӔQ\dG* 6IK$ѯM.ԍvCu-hJm#Tb .d+74jecD7@%Uq'_U!j;u=~IAN)>I)II&4mKtIo )I$R@T45?-)%JEo$a4=Oi^2| ѠT)qȔ ϒ!wI$}OyYaUutKi`ڒ؆]QN5ܘlRckR\ܤB+vBϴ=$2cL>TqmkC!$P̀*n0"{(i"O) Ӷ# >i)E#xJD菹:UZL;$LjP8DLuc#MRO)i:%W!8CʶFD]rhozDVZKL:HI-IUmAd<?kH׈UѱeQqcݕg[PHaQzH.B@!j;67FB^gN|5lE $BT$Un''֗&⣸Hn_jN71gopDFT6O ֘q{[1l+ $p {u<^jQ%?z_ 0??XfV +Yݦ!XkweEy…8COdUkk'_݆p /ǒr \6@F;vEvoi0Բl,4oohnu$C:~M֖KGuk'|HS;!Դz&]4T=I1/@۪n֏ѻC=!CS gPt+8{"F2UAYt\ge+vFW2;oopvM>H0.;+6FN-_c*XǺA ʁFӠ .5=kŤ]G*+gxSX9L;k!ǝѢψ )+bR R jg\ uL*U3FW5HeS2h| Jp#za OXX}vz TydʱK˥ή;cYw=IIݦJ$6J2&yI.;<8 e'T`h~XW=9h-~(5ΈI18w 1SE2 tITBOvN8`A(,'l9Spw~Tun3F~ѨRlPqd,굱:p>K:H*6|?TXTI"$*^b]ExL(x(<2AKh1:y01 GRlhe45Seq;](b?ɡjg@"Tgq@<)FQ(mڜ}}҂@2-N@Otچ:!jJB6H#wZ۵qjFN=xSH4r0 ɘCySyZ`hvm]2t'Dv5wu&t䥬y8L#N2 05(BMR-ОDbHXBJ4HiI-'hI T6`tSCOđJc☩5drt% `Rݷ4 ;1̢Pix$GqQQS[j (F*_Hy۬J}cDe !%1lh PqO8@BI%Q$)7TĤAo!7i))dD}/o!;kSRNi#@BQ"{T0!"tۏn%z,@cOC#{c@3;jf1I{]?Uͻ% R%I{Ak҆xH'VDpKUaVZ%81pQ"Ϊ'xd/%+riN@iӅ^ûN4Fq'++$"R 1 @R@NAkCb"gF ʊVPdx!A S IT"t*eY L9{$I S}LIRI$W VDBI;e,S% SABmPä uJ$҉V|%=5EL]#TCq Vc98T٦y]k P2̭Gt 5tmp[8'^hGuϬ{axds[pvVr@:=aP5$݇0" IΣՓcЇ@ >Ӌr2p-`i@LOez^s<)}~7x)auw@> eEdf>jn:"֎b>nt\ j7}ikvsxJMC%J4 טBSYqʴ6N Q$iSkc KG&<$|Ko$bӕK##w*NnJy.2RO ie.:D6O4*.HCD(IKJ^i$LLB>P y p0'O VCt]@h.q LG9D>n@( .bs5'Pִ8{\}mui=P8ccG<?VXֆ7@1 =<MqMI=&jc_qৎZ@l0y) Djj$Dm$(ߕ'ӈ2g;-|j Tı|e.8@nlH-É_lA6qjE\9(~H 1?M8W#[M;f4'?KF7896A:B0MvKHױ;^HkVuFx2#Q5q׺߭:tƞm]<rfeqKmF>P*2&B@*)D*alr҆g#QiZӶ οZ[ՙXa2csBm3FۤhRq!_ȲT@E)%`a<)40 8O(J E πI(G|A?%Fxp ЏkD !Q(RŚȞU>!!XݒS 2#FpTMQ aM$r o:! nj:I jIh Ν|ߤNVc?q:* ۭ8@U[[\ZL7a ~pHt9ܴwʎ֖y;պ59Tlpxi%4mؕ3^ZJ+H @{ lfF7qbh5 Ha)d`76 :-Wie\'@Dd]gk(#ZZ| Cw~ }eZsPIEǺKXQOoՈQcT*hIk1NcTP'U"%6-T0={!1eKp:~U8HR8M(9qԑ3\ nx> [K|5)(JB(%qZO[31 A ) R?H:O5Oq)7>A|'54 OHAwAL?"q,$LP{P>Hi!DbH5J ς*X-puӲ+. 5M鵎O,À<(uld#YOLn V 69}e..&!"4AѾ* \wp>UgrRFi I 2ҭl7BO=ȩ#QBJ QL2HdI$I$$I$I)I$d$'L$:dN2t)I$d)!t'L:dI$$'I%G}JZ}[ZX:`Xģ{k{xRL8 {D%d&$"u":Di|Oq<)E(I%-$O);wiVM |ʏ'@G)h;q @a%.(HL'NS3| ?{)F@JAKϺgI0<4ԜXnUnaBP@HP@Tt8(ezk7XOW d:vScmb5'OEMI'@ue]>*sAĨΉ!I8O`Sn>I)I$reJihhI)4# <G&$$JNiN#**i229{xR|RRd};kvsUD?iDLP(*E[fd|'{%t8( 02JHRI$1HBjL'_-RJI%eAA-:]cs`(ДT<$TH-28B)׊Jѧ!HH1@_bLFH&C?9(L+&GZi=L;"#ZaICEl/'*+.q'$O0 <Ʌ575py&+9c;qK7rJ:Ԓ!G)ZzmCU5YwLPƍ{FN) O1C% T\$F\aiݛ,kZ"jg*7e?)k'p \}X`U;, ߏrmy{%A)7vQi:B%7ߙeUQxa$ WD7:GcghJ3&?#FJft }UKkL nPuLփNk!KQmȃ a$4<5I8 ("wQpiR$PF'}/w%H#PsK^(e5h ;Y*9-!]ǀ!Ѵ ْn襒%(LZ*1FN[ O2q!ԥE,^207@w\<3sG/|ԩP%)Q!ꃹEL\;duZ^ DA{O뙖R VM;t.i!sͰS`="`ٽrTwp %\D@HXc7x.*[ϘXP:HB&{i!njӪsm1<%:cV,fsWIqk㳗c 4twl{@j-Z2\dW Y\9L+-ЈL!hqiY`oqv<.H磌鼹 ްtq,n+{r$H/1[5G",ȑׁ Ic=v;BwW78pm>GÈBΜl Gr4IGƲ Dph3$8D|E٨ 2L81H;1eVr 9*՘F\ @O'F5&uJ$D E[X$je6KtjLn :&T{ j<04V=~`Xl" Ah5l|T6v_n#dWh$v*++OI~ v(IUD5QxUO#84CIS4\>h?uՐx> AvlT{Z4ˋ4@]Uki03C,)PlH:yn'/P:$Xҙwd)5PthYRc֑H AuKJ* hSvj}4󢹏d@*-2;΀}ɟ[AB*M"ݤtVkfdP0LvRm(tZdP- C6&TߤA'>OkGdv2O!ҍչjf<|$VH5H>@u)5敠3BНpQ=FJ$laEuR`J]DoQ9(]X6 DqQ@JG :XR.tQ: JQ O) ٦ҙ(Sϊ[H+S %1IT'T ITI#/ltEfb)5Q3R`@5~>HT i >1.D B{@>jo``E+$&} 5~&REU+<M{CwyH=y,QEֺB};JV^j>@ AEݩ'FIjbt5`N9S塣`x)NӢէ;Ѫ 'o$)ag';\@k9 e Hlkd Tϩ}iVzo V6\O ikϸ Qiq'N=ב>T8]\ޠ w3~7t̖hHj7}#PyՏp%ݥv_Xp\ZÇgi!UaA)=te.ay_79A|fL;Iպ)n5>[ n&wE1pL4NR@5aLꜸTSAxhGnTk*"P NKuD4)$Rn؂uRY~`JI2hjQjpݵMhѭ=i&)M)d9j"J&{'Gԑ}i"BJ_ɦRP #C{cA)R(N@:N .HӟQ~):&N:.u(9+6z|Via`(Z9*9p]~psq}jU\F[p/Lk[ Һr*V\`ci|..*u?P}N~&Q!xײ4CdFټͯfEg]9-QsD8 $8e=qS"{v~4)6;)-\ ʛ햆6xBH){':bQK"O\<&JJ`T%0TS nh:R$lAnVftݎ\4=煟1Fk[SqL={Zt&|'79t W\A%1߽G_`?\Ƈ9w ^/n-s\޻; 8[pvEl<Y>k]k8ZV8Y>\$=b˙m'{ L}7Zﭢf vOE%(h`2|9)G[tH9O<JG||`>(MJ#p(i 1$xwpGt6*d=µ2#jv.ɂA>6=2JlJ;4G\bʩ|~DdԞihߒ^~*k[­swxȎs wAI yU`&Op_U'zL.#NKi$ϴ?D|CgOqU[h%s5+=~C $yV{ PSEN&Q{mFg.v /ߥd^,vOP?DZ4-:! =@ ;jxO!)^+~!_hgwK*`m@9|OնIkdkcP-}!mF!=#G+[v7zf+0k<wQꞍsAr u-iT7Op5X^خ~WB05յy`{|yvS2}^̹^_?۸ȥt8!i30\C $bUjv;M"'T+~5+B"U$H)W*T*gEV5En pk)1uJfBQx:F.jZ` 5~jH);R4S'`Bh3u I%Ro |w09UP Ð4I B+g}ʭg(vRnbxCԐܤݯD)0N %Т`'pM ˜Pj %̔GruII%(T-}m(khL*d-ndoMMGK_{bhwP]IT5=̫TȩF VKl,~:fZѩT,SCuSlJ̵Ucv7vYq$?Xv[^H4Zhi;huV.1u=fqOu_r:꘩=Š4kФoڞ;LND$), Ç"E|G QsN(K5FE)́=l"Jn)R>)S NJx7ݢS"`QL9&{|Q:Ga0AO[eЦt(_LgLiF`9$pJ;Df%"|J NםQ{5 HEXtSG'iԢiOZtb&!BoѲ9)gC$A!KOgj&tAģn{:%StPt6uI h;)"ͮiݩA.4S"19 n@3 %$ѡR{wK{dw 0E`&Q)GEi1%!?N_$mHӯ:N+.v%@ٶI 4qH8> E7s5=j$lK yq`Y vH#*jZuu!٧A>LwΓP^;~)ƁMU4S`ID,F{^to(Y Cg8< A|9hdC2sSG&-+i4< ~?]N s&Z`ZY @T 8j -KZ6^Tedl[e`i'OMWVI[9Z`i"#"V ϚUߧU"!!߂: ?H}/79Xz E$ELI$'I%)$LI$$IN%):d'LRRI$ɓIKI'I%.I&L2HRI$I&IJN:~~(Uh_߲ԫXܩ[ZJ-N 甌{vRJ'IiR5=/I@T )LnShP˹>ԷHyvK"0% .xr$RH7]S'^D{)>(Weu1PNtLl)XEQ5xk;G$ZH4rNO h 9ϸGo6'Gv#q$۬:uOӃ1oyV]eu{)iPZ!W? D VcݼZ{ڔP$еEq(PPRI$"ƐC}U|UCRs էIV>nA]5uV+wILI"0*.qDH.X@'BI$DFq /& P(h8[ΘOJX!۩M`Νuj㱭Z(hQkAT4SQ5>(]S/*2!O.BEInwOO :jypNV<-ksNG?Ճq&O2RAaH@>Q1[eZav?Wh qXn1k}DP  c7I(/7`r;):<]PkyvSwGh8U8= *`O; bbe2JQk^I˕fXԞX؎y:{Bbӟ4;_۲5g55GH ym '󿬩;6X)#Cd59u]?dX0dHYC=Woa%."PV14#mmѦDb<6R^RQ+S2Na&Q=88=Iq{e 3'[y4ILHqb. YXUhǚ ;<~FqPo FNZi3%@"[!d&+Qpsǩp!C.Q@; Ez[{%VT0\7+s %ἪdCGt0Ix(Tnc@$}(&sIB PlJuHjNIH;_0<7LJ:Duj Ww*{N;$%;[&(Wmjp OrsF'7 y$E8*OI/П_$>ʔ|]RX'*QwK赵~A1btO|꩎8H^FYm"xV>tif=%ɯx.'EU"gI[9zm $Ͳ}u쬶t:TLu#V$4(;4m; TcK! _e `p̷;D\Z $]]$.C=ϸԍk}<)촛Px c*=9u2`[׿٧ⱬ!^UQ:k'^7h#ZTgUo킲 ]U瘎*d-(nCwQsJT'Bb;'HSN*÷U{S#e$QZl*_U]SԺy*!YQxFrL kTh#U{1Ш4Fwl'`TRg^oM+xjOU sIHq> #\$0k*Mo%8w*lS4!^=2Gc䘘 'P%)``kL԰d%U=!- =­I2a1ʈ~E>$FMmTW[AQROS'%W3T2ZRJ R Q)& !HNd aX'q:)[)hκwBqUFc[ch7tr&@oĥ!otɴ>co8qm8Nak40't%6~DO$Jh9iDrMbJ'Dy(>&#Ii=TcLLvPP:}' ;0@= 3~ݔ׺1!ױhRsIq : ߩSp9@jeH{Mq wi1Ψ5HDT\gN̝{6 aS:wE ή%Fu-A02e<ȕ5]#}]R6LOdǿ 9pΉpQ- b'E % LjRya$Ge6WL̨CnGd|c0+ 6Rc<e6t5CHS";oi24>wTL~\#x<$oceȥm;|s0erjܓ\a5' sw kLEf@>rt*Y['RSTa`ad ׺#`!$r\KύD(2^6= Uw: N]c@e 6)sk!IXc]Xs p O PY1D=Tl ~-Ij;xB'6LkOlHNQ[iDv+H'>oOuSq-z/ջn#]c{#&b0DV%[{M2 ]I[D;tj,J@$ dG3]NH.$'P$.d-0e9LFh5Re` :IJ@DcDv )Rb왮D )D'$9D(@` .d2@&0pR%cD 5"Ug< `!tԁ)qOw!&u$I(S ˋlXg) O(H LMK^y ς,s\Bdz/Cmakϊ?UoѽG%z*~#2+uOծ&i S| +gIʭ(j 2=t\?x\`r?U\7ǺTSH$`A8):;$G9 EꥤIUr F)Vpqk@B gP{KЧ`k$ u)R4ߵtM& #OֿTõ@-7VϨmz 1+ŞK۷Wsk?fcv*y?V1o2Zߌ.vS?xR^\)| hh0zWKvC+%EPVŢb8]Kun|0zO4i5COq`%^Hkh0WqL4k=ѷh˅DI>EF;`5ͻ8:<5,A.S |N۞ Lk2RR|>ޘ)a[^ΑCHhS+XϢ .IDs˚m1(S}&ʧOu A"!zhji堓Z#ETU{y@eq8*hV"y9S;"&D)rQƜ-:*h`p8AbW<)IRQrra!M)()%̨F\L, Er<S&S<Q 5&|p!9vj>j@ȟ$RN<4S&pNʋCD 1 %HS B3(*w~+Έ,ba%$G]T7HeXT{bU,H<#X7 B߬I?56Yv!71ӡאC`5K"#N\M_ؕr91]* =N1Zat Ѿlh8cmǶ:(w$Kvw'IQ=EiןO;F'TΓ#y @$48(4RihHrςgR*cjڝq.Iԁ m:Foq?"#$@D!ƄǗWyI`+N;~(6qƥN##AMrcC "Q f8V`w~E 8>r'NI;TA|ʘP)Ly94-<UDi=ӽ>( ɸdV eVGtW7Y2<%sx,qi]P]kE[H4 |8xWfdL)f)7^Lu^0IqY [7)IEwa Vm:AET.m4jyVX *ݸiΊCzހͨ E$ELI$I2JRI$I$$I&)$$IJ]$LLI$&NI$I2JRI$gp3 IJNA $y6T$ X )o$2s$f `@yK+53_x*]ǵC $j ``\[F`-$d鎩5t߷vPʑl *lLjRISCx% i,m: {, ~ӸK]`tSȳquX@1#5#HIJ'IYa2IjL䅍A#.0>ۺ `@eӠFH0P^#=Z$7;H3'̴4E tPh1=bDqyqG'c Iwjǒ*dho\)8ƪ;5T0+QP]~9`x ``8ho(z PDJI*Mc%xf%4LN@lVpmk opU^C*GV40Yc'j3r5Sy[[ʍkܥF=֖6< [=,OuӰh5W[Xe{. <8Lx)t@-ԕo]KO#bKt!#u9L(aypG=5m US¹p 2BK݂ HufKz8ӶyYГOj. kQjyZ9*+y"8NylhwԠT_aSw= uJw)ISf:$pUl0'D LL$L((twTi: 8nq //0>@8NNv)zY X'IE>5$6]*CͶ}{&L,nmD(W2*u(L NƇS# mnkeWЏ4!MDARR:)ĝI"RRI2PIWEg5kJ_MyXMOn_ܒ\@NLjVWOI/ПoCp$_>ʔ|]R "*TJ>.z. M$}8b,?S/0K:پ sC NU]c6 fç*4i݌,Udq?7*zTൡHZsldmeVC~^v5 ۉx]Yh!rsee.Aᤜ\:x%z7I# 3y,uF+~dFc7p;<+Xsxho#e:m`j4 lیjFe^+NR"fNMY`iwYF˽_Zai`o rֆr, 3,Xֈh'dIduJeweA{{~-#EVNO \xW q ? ;qVUNBͺ5P {-*ʀr3[]LdA{#V+ cEj;U@uE`hN>cIdlnUHNʘ`:rhykH%%Ai3+@? ?+ Pu;Ǫ9`hG 3Ak֍tQ>) 4wW( A:JEFIkK`m ĎT8&Ԥ:hZ4οzR&fHCH8DCSm[DCQϨ8wN\!^ɴYn5l##MTOi`LW ӯ;6ꇂ;-3 ɎIQw&T]b % ~o$J{ƊuΥ{~hfKN NZbJxDe* "BϕՍcLtFt0DW_ƭ)Rd+m<; 9j8^xp8F {w9""eVxp<@ۺi $ׇsVu)iLqRxkNSR NatCpKyw'ׄۏF̼@,Ѓ'qݯDj\ZNL]p<9ĝݑ cd);\ D0Ua*p#u&dG(x!A $Jv>ާ]C[[V]\>i0<;LvNBlvS9I#l@G(b 1)lR?)9+yO1Dƨ AG"u<+S@y' 횅\I<ְTb TiuN0.a\hpf;6zq $[x x׺Nacn.Q>Hki` ^ΌL'Ũ9i z#֒788PO*-!;HD)NɛD6I?Vm!wUk%HO7t^Np:mia tD\d`몰6xVFX'4^iep\-*Xn4؀58WtG;r:@<#Pt+`U:Z줙:P$!i%&eP!ECE-/qUsAR  io MI7&)I$Lt+׺BᯊS$wD%I$C['kOHEJHEhAȄJe) tI[DD bL! !(S*/vB.S`jK>-n| N4v$:'U[Ɖ!I% [2). C O)oAJN$z6פUݳVMU . \B+_溧0.o`%p נd9QLikÕz]Y ^9乌> ܭ!y/ӕ;VƊMl/%'GR :(M%.A S)M?$dRL[V`ٸp^F@= ]Aݤ_|~ j}v'&؅o,{CkِH9i}7C'IN^ޠ쪙 Ai W#%`נiGo[* ԢU,-X׵Nd|;wQ*M.3i q^t;F*mRI[FHVJ%Im0%Ik"{&ƩJ]{E&tx%D2)O)6{m|)5x$!/I)'8NF*%Dt蒔|t|Q+gt@v% 4MIHw>H3KhB'U({\QRV 8S-tNĴ4r l!3Ч:L &?n^6Νhg(@H(NnT0{\T%LlQZ%>jYS&9C::cnp(+Bv2:G%q Tl{(o)XL&&yI,Ʃܤ[)#Uky@{[R`$6#5~(T'ʓ~-(lp8JO~!,ʙjr4%8 CR<))nT])wP{; 'w*M RJ' 0\ 5NZਹ%,\RLD/6~)Jt x LʑQ!I"%$(Nh$r$5EPݢHlSY3CIE 7k VPwÚh*(!Y`Jh(&Ot`'U] UiZ!>U@Wl׹ćiT\#%8MNV2S;'T7 MNS(Gi6H$H Ơ$;pѰ6N;b56 GP2CfOh5t]5s/t1\Ol8~rzeax >C*u-#b!kZL'PsHDn;XrZeQi/]Rb4EK'N&`!W\Rx0$(V74Kr[mhO+nQDI Yqց[6ej;2h:i$D=AyI 8-!IT}tC38D?BaYTl2@WLvJ.?EPqJכ"\N4N/$o>IpFj~* %%,T+qNT*ݵuVpk @Vp$@tIA*U9Rp7C^CL0Qu$Uր{'I)JM 4Dr$I$Fa>uqwUb= HnqjP_QGRW漢[X{Mv)ǼOUAVwu& ZeXI"䒘4HDGv}Nx47^Uח'Ed׮#VH`kZȽI&z@/R2Z$ELE#N& |[QjG 5.Ȳ]SetwSfXhIL %;+ E;xd7 c_%\\Zӡ1ݠ/0$ sh=VĤZB\`'^7-kt}({UڛIԒU{AɞOtV*%TKq[niӲ4](2 s\5Ip:ˀ:Bl4R<)U[vªv]%V/ꡓli$6`j<7oi)SHǔB0Q{PKfxpOHwQX4GF % *?5)q{:Hku:XJ&$J;T 2t ߔnR 'Dq#a #ܬ҂VI%LX|Vi)(dš R]%X񧂳\#f*7m (Y1% ,UZi%:" ,YDQaSN>{)i.*$%@X $FYNOʔ|]R,; A#OԽOCc'z_ Xe0b%:bUjH{,sVI cP`<{-+QD6CBǵ"t0{5}NA.C B]\pqd]ܟiĶm:æָ4|gIoo̭ 0L9J\7sZU#vk[u* K^'M߲c[Flv)[r_V@NN#FVwiMF{>@V^0>dT<¹X$V1w8;Xp6 X;lxWqNjud$  /iu:ÛX%²cWE7Wu+ssUֿpRntQ${&D#mtTְl;v82\;Qia=1F u:AM;6M)Nҍꆹi:mRs`{>jl tHDv{Ϊ.yDPhAR/D׺'U7RwXkWa!GoSC ]'qGv$iFH+qp9Whk= Al=Ph#TAD''I dTT葮 ťH :G rDI^([Uf3yǚ GdRzqY%"/U<]cȭa ӕF5N'M;%ꦨꇰiQ0$!ʛcF$ ە#AR?CI߲w'3ʔCd|crJ]3IP S ΁)4bT "xCf3$`)wL˴(5D|#h:kԈKE6onӑ F9Qu0Iqj'p['Kf&tsH- {'T.wbJDGT5f<4R,vJ@VkZO(aD3?k8q1Klx#&BJKj \փJN;;({])v<(N&aylRGp4N?SWSD˾o{A璆Ir6 a:&5* $_`l96S- Kȏ8RF|YY@OtB֒N |T$_AZ!jBCt)5P>:5>J3WϾNCA$!L4̢O}| {b`q{c^Xk^I;؆nC v:y&ÎÆӡP O~R!v)V`-h.-y%J _?O;?( ]:~i*@ N'JM͟É P |X\@k  mѭ>*: lA}r [,?H Nܪ"Ĉʂ w}Oh ~9yH Kfa;Wjµp]AdRc0`N*J^G\N:G?2t[kq i*=4Dr=5*N8'IA8W*k(b i#DBQ)Al8m)2wZ] %I$TUqGFaQJ@TV+ c[l@+k[ÇbEW;[8x<*4un8/C AT:C=ZLvxUd%sY;] UKяͺ`;)FStEQ(B:% }aI"iKlQ*iv ý<3T0\D'|kN!p$*D 1Z [yv Bd+`YUg_vKf4ɿh-i,>t;{kkp\k60W+ưH3 c6aDpl_3: [cKIHSCe/X/. x]ۈ$7y5m3󿔽pkx|;ŵ ~]DY=1&KcQk?kB%xr+]N?V{*8qSf?0)s#grv@$yMAr۶쯸hu7K<GQ$B[>JF Y9@SptE-;40pOO"&2St_BIK8G4EN))ɕJ*]Q "S|RJ3H4昔/$;$'-'H!*nx lvʛ I{@Qݤ)&`Yi; R%xlhu"q?c_53E | v7浳;ݥp)ĨऒA#Bc;#I1(\Ϗ!IHjH!A#4?/'3$ͻ~ Nfu+ xh'AvXlputؕ`5Z]ai:E{k裡V^oi5hsZa1ٵ@JeFiAOR?Bt|5Ws.gUE3)t>UɍAt* M!$Lk[o M pw99IRI$I$I$I$:dI$$$I'LI$&)$I$$RI NIHI!VTL$7EqpQA\icD{)8 p`GdNNKnZ% sOBIRI'D' M#\+` qהU`~I)d>6Uޓ骸!+\ sH#_HhR& .D#r%=A>Ui/YAu!=}YR5">jV(st?KW\@u:;Ǒ)6O) ۻyDcC[>JL}|8;P68))x9E8$k95#k0&m>!%.S)'(0rD;),YV6;H%`8]Rg'KJw;XRI^TH2hj}R)3Buu=Պ4 <'WPyI1$ʰ} > Ԇ<BJm|wt!Mtģw3HT)03A9I۴+wٙN3=:Yc%S.}uǒJّT3='kG )3%7эQs@ T,A‰yƆ\&>>+1Ĵô( !|_D6JI $S$i4H9TDxIGmT.ȡR:o12$ʟn縍Åߊx"h-u!t>`vr w[OkyJJ`\c V䧰 Nֆ+s3~Pe͵FOrN ̣PC.w4J2*{[|Sn׍j4wX۾&> 2Ӫaq1O]lA0;"[7YRvyЭ܄\i) 0DfQG(/g@-*osoo-byN0/:L{EF"1 !tI1inIc 蠭3Ή8IA۾gX5I?THKZʔ|]Rl }"?R^׸qpŏ?XXLM2i'iZ-cX2XK-+/c(+sH=vNluCVZGrblyJ܊G -quLc\q@[U14'XHn~V-w@ȓQs=Tl]=Ч2|-c,i"B0Eu<\02V]v–{58VA+}'{ໟ;@ڰ̿hp< O0m&`GuN{vQ6CeM6cVym!.G'۪o; pw0m\y;dd暗g멆0Fʛȩƶl{O/lޭuLavNV Zc4TߡohW/`kInS-'R 0XkX69յ.Ƌ\Ɲ,   ڴV f q˛%-{\Q4;yCE*"K5 M74BpG+ilDl{ۭS1Ur@o!574+?-p2-NRmtHp.2XiO@BS T Ue~vʘ4Ci`T^%&΃?DANbyGz F_}:ԃ։P,`<4){ kl Gޤ n){JbfISh%#c@H)k\A?%A9H϶g0  [5 \ D'E*|'AVp$AT'th$i:'jMqݧZkʭmDᧂ}'- 2L:5SFe-[uh p.'P p"akyTƉILQu;â- TgCAQsd AM,iQum"Cp #Q\!ǂkA(Bk ix$y;xZ[7h4! R$k^w# f&f,0"IyѤ`zgg]2=JbNȃ@]4AC#Rv?|8t:)'iߊN '$\U|m?( nH '4CaqFl$FIX׷= O`ǁ^A&$̘)0"B QِG'4IHA$4!@Ѫm uI JqR3ZD9%Iw"Rx`I'@m"B5=mH~ 7︓(y=\'-pg2!CI>?LI۩?fCCsb΍0X,Jig˔oֹ5O,ms`{bZDh{-WqeL80}4Ds$إ $LBo&Lo5I%< knhtS7X읶DG)cEc?kA O"jZl.: 1jeG^h|fѨec?`Qa l<"HHEL~GZSb$Go)|53뵺3$"qcqF aKn'(I S8S(d;*uelIl%Gu:5ʈ4)u*shh4 9Հ@.)oNpDDʜ|k]V,Np^< `ׂeW`kWG{$ <@ ;F>j ~(icĆ{*fNZ_4: KCj ?iE䩀I.M8$vH|!LcӺ%95Xi}jl}m~lnB1yvLH_v:pfţt(E0iqn3?k+sMdju.%yB"'Nz+-tIH5}(.Z$mq5{ fJ"k۲L 8#vn,/gVlloh_|׮cuuܩ.R^]-B-urL𻞁uXM3\ft<+5xNL$$U{@&mqD>ԃ4FO)N hG ;7!wk{*lLhEK1=B/!O&PJ$TD#S D&hMD @ ZA ƪm L"A!tI#]&;)V$ۺ{ RI$=„O:$$O]@D²$1DFRn)+,5 J;)%e` Yf8W,D#))b?*F{&DyQ))ZSxSh>iDLOdi”ƽh)m<] ޒ򩵛>uMhPiB<%$.ƗGT:!R'SQD|=('F$ &ToJGtVk=jsVt:r& InJ dW0${#VUFAɎ$ k={ԹSOv%2Kljj+x@'{D(#=ަ\dk()gDNy+4h#U]H<U $ǒ =QLJꤌϊ#i-~* 㩄~5$ > _vN8(nt7AO*#Q c@#_yUms۸CXw99 ZRI$$I$IJI$L2JRI$b2JRt&LSIKI'LRR$IIJN:d-;ZJHRI' 'OT Z̴QZDQOfgO$>iZ]~j{vL$:?փ$ >Zf=3M:w>hCRJП]SXAnkM #[Ưp7B2/`-( DJ$tpuPF֙bf2!:0Te H:2*5mw .a㾊%d0D8O fq!!g .>24;kc| ww5*!S>jF3 =[4 Ua&8]SishW11!do0H%YYvK 2>娅QAH`NlRI$UN+F zAy4xpOis h!$=0|O |T$ǺN`&>ۋ4iJ>R'I$̤]ƩL7BiI$A`h;juup6 |xIT]QsA'NhV}v48oPg%Jo\xIIàINWe/tp[_Hipe0dr%3NIOtt쒔:dj9P[#, 2Ԕi *;I5PsvF!ޜDQIJ:*;"4EspYy$e$O} #ksA H]$Cip&ݷS'%)$Ƀ@U/htvPC0$H9E>  T krBh6?s(p8L= J# nO8I:bt^@Csr|Umlo~)%J;l)9D&~ʍU\Gʔ|]Rylw*_TJ>.zXN<?/,O}U1N+2cCghssc( ZإHF[{wm ~H(%Ai,\$eZy%Za#Pqoa O _K\DVSa!cwJ`!f+}c}a㲞q4ՏrI#0QyiGAԎH:mx8i/mawrL:.Nkm槂3r^8YIATƛ%lۜ 9UmD}:XXo]e1jcַha-U3(0ӳ̅^Mf܃ʅ~-MqfDbka| mۨudU+ J]jc]h #oА=d;!4ʶ1a{* ?5Dw\d{os [dX6AIgnU{L}ꙖU IM5Zr)._ [94hk-d\7GbQ it8"~ME9{NT˙]7cO*cti;A)6_ABRZ\m);f{UY̴)j p A@%jl楎Zb [[u$,%*Mp>nYƪ;%Q$M:)NMsLݽ*`0 !!($PLhtλkQgpIBRK"jO& i"O8)H(*KpiЙD+ZJ'0ZU t<:*I%-G@F6IRq 42 K)$Gh4IC$I5PPx{@&La\v#GD!=DX!Xkw3¯@g;l_4F%Ϊ!<5ʓ,Th!bT% `$N$ւU-:i-Z'źe9N4+‰LZbuA/y'TجwU`asFy]ww8\gPQj~{i(-۴yJ\@qJ+#v=BucH˜yB O[FkO%4rXh~&lLt]kZ=|Pii)y;UQ̠EH-Ί$JjFI ƩiЩoA1;}YL`=Jȍ=1 %# 13NR2qaڟ$| SkI1)n--yO]}:lp>!I{ =aA51IGQP"hƎG*É D sz)m a:Z C|Q+&؟?:=Ύt O4= Jbt/@VdQˍ -^ʹpaגMD0#8*d8KiȢnmF{'5ˌAUmͶI( pTBRg2mmL4X haf5Ɗ3"p:IBddINnihQoNv{ T<.d#*69 T|aIӰQx C6`*->A6LHjl`-fD Aaѳ>)XTd HV=TX!(i]HlT2$<6sO dUpDi9s2@p!t KC7< @ L zg|+uw1DUik`Mv)QMs{~kVcW׿MݼŲdxNRw9G4HU Jvoq8 |jgAl#˘ QcC}n$ƉK wў2 4 ,"洶x(1{kD͡Dww 8i=M C_#!pC'Qk!ΏQuqq6 .?'o@վK_:O0I\VV[hN֯cg8˚2tq IM>ߊ^Pu55rB[(t>Aj9:q $&c B tEhY1ELAD %HGtt!]nȁJY(H&NbdrTtvQC:~H+e>b82}YnπY_.IB2 S n1kޓIJAJ$u014ʓZJRI$ 3Yǟu6@;ۨJI$݇#Zٶ2RRI2aDJ mDhI+NJSou(I@G4s(?Y>tDiR)bTEò׊'JĀNҷݷ^WziVˢ^ָ4 ^5s nsI u֟C7Ӣ<8=iAnj6ƅ$Q*O)N ~ ieXB0HCBv|ߒhu)o%Ӫ̦g)jA4=%"5YuW>p.%R{@4 *Lt/;\D88bg\,y:J߷m i&k,mOHƝ;9s )/x]ֺ`]#U4m5t};Tg4Pq?]UkbNW2GzA0 ]1= ˭ȵC׶15} {,gȉ!iΦ O%dvnè=WZ=0|T*8aS *Y-nI⩵!?NP('DAWjoU@B );|B#O#:*L @9O8pX$+t{w o ԻlfUց$/{X}&\Oo*k3!Oee^]y!]4W-a(Ž!&OJ%Yז\Y;Mhx#<Ѿ5{[:Ê#wOEpP-Pݤ GT2e >䈐`g8iJnI)O#dKSrxD*PCT`|T90TIQ)m+ZNQF%*)Ή8I,Hw'Aj #)OhKba%$vKAp#TWImIDjJ_ʰFS¦t=iAO4'2t*h[,}V+#hlTs#VD8nP[ςB;k#|!CvXlϧ4`k 񮪭KN -:.l;MO櫬*:wU꾈A@z(LPV$HI$I$I$:I)I$d:dI2b2J]$L9LI$$b$@w8DTy}P Py@"J<&k.7;qfS}WhJ\>u4h$DLwLlO$՗8*zuIJ$TG1ʵ}o.ipRP ɀnq=$9CBW%uA?A.fD=-aIpӔ~9 ЁVn0&>*xK I eA]Jr?hC'Q>S|x?Tl%x~ʤ9P?H.:4=Xi| s < PथR)H =wBkPOpNQ ׅ {i R h4JTL&3t\߷vR(Eku )b6 %{uGP&LЊԁ:`V"Р4fUmh8q$HN$$npz+s+GC={ 8I*Lt_c3oؘ\IQ.ChH̤õQOʋFAhk*6be`otJALL$T,+SD U9G+.f=J"PHLwiULJ5 _[CN!Rù)%*71Q[O]"cI NPƵxVc'CkH:r=UO}8*yQB-"8B@Aj;YF+#JϞI:t $@OlAL$5F(CaodR& RH[ʝL%hRtWpyVrÍ wQ^[T骘YDTDʨ0Qc\IR܅d+7$y3䉵1#I%>Ie&ꂔI' RrIRI$Dr6xN"%I#HRI$ƨ4fOGܜH)l69"jB%; ԔBtHRh=RJ*RI&*Â*V$)㴔gjI$r ( RI%&Z$Oc?ꚳƊIgSQ7r䔙:JOI/П?’I%>ʔ|]R,Sϒ/?R^FhN? '>aT:b(qЍk{[a&Nik z|1B-Ƶc_'Ug$em9nUЂƺ7 ; ss:Z5Ǻ~'IK-ud"UY=zmjLGV&O V?0yB5c'rޘ.-k%_5n 865-P2gÅw i(Cw0Tnl IU|ZxW3t"tBSe6 !o r=׃cUmPc'%X%@jY̫/&U\i쨻P>)tSBvh+oVF6F5Ns@ׅF :> 1TͰPc@)G!|$`xwTz5F\$G%]1)h }a=I0zkbd˻s}X 8AXs;)>@ BiHrlAbIq(k?zE':x'i3_H"V5 `! oY$:i-% L3$@ۢ%Scvĕ3RyDЄvX&dv"#U^xE)@+t@l5*H5O[✸7M4Cadsh-p G%F9ǚD*䃪)sXh8栒OF5iQրG>hۋy;Ua@L"G{w*=q 3AL~H{H?r|lm3xu`?r" diCHxߐSz 3C<߱we3;q<Opۺf=gqP6=#PxQZDx%lW~ aFh/yEikF|jW&Ѵu=vHP3R뺒[ "  p6n⏱C ! Z5/yOبFVk.&]jZ>"C׺hhDLgjTKÄQ-@{(C `I{9D/wSkDnݻD}M%X T{`5a0U {q?r  ӶdӺ0=I*;Q3G )ȖW2ױF/k\N.q:"P'H(u~e줁{uj}uO+m!ÙV1;quOTXIov'r4NṳKӲ\%F HQ.4*ǀ#L$cK=Gz|+6Zb`ct=YBaQ&Bt5JdU"8-q;<(:ÉL[&ISzmkM $_kvRzh:(MX4#O:tT\O5'8P:wRSq*X'{4)<☝ڔcMR V-.jgNV4J{A–8M#S T\&cy SIAۧH0y)~ja"C-)@lQ2Acg:7AEbŕ3xh>L DA r uc\4#`6CkB/7&`%ai⥺D$e{DzkZ ]:膃\Z6.+* F͊SD`x‹-BgiJ4gtH?nD!0{Cfw> lv[WلVrK4+R\ ;նR![yR EE-lKI)J  ='nk}0gRRI4N ]`&{*I$>JjBtD{ЫtJasl:Ჹ_^:r)9ulh^^4ƉHJ Mh)׊7P+|>uP ; Ro{ݓ]C'YVƃCʦ.#R;.E,i)c]'ag#1tڹ:6vg9.^d^'Ǎ\I$,MX3^v /G=ןgX Gz :g4tDz1g]n\@gرcqYIX k#X[[A%I-f<kd!f GKc>qtĬw\*xhbdGQȍRCu#pTmko,qAxPE~RSlC ɴE"[.pFgʤ:+ulQ&Aڢjlo2dj IQq2RS64FD@>)'<(ɺ6kQ`p>ڜ%%(D)N)’M#%,DhxgBaL()JHSϒL|SSQ)SJdFJD D#@( .II]JAFqOKh$3S!x