lExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:33:37  X&.(6.HH Adobe_CMAdobed            o" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?13l}g,9$2btw OKC3/5H.vsT1ZctFͮs5t81F|/ң9UL@8vӴ w=)c "ْgrgښӣݏ&#F?_L$e_\o%'R)~dUf#lmhq${6Xr/Go徦J+`n'A)P\v cO #0Up)}'Wc^J9Í?5Ejt>nM8cEaqvݷ0O>$ ,[[l"44ݵ7[>oQ~qnw3=uSϹ5 uu|u톪[}D::M >O?hIyw^fYu-cx{m@-;Zޟ.Aɍ_io{m@r9 .w6#ПZ m?_s1pn,swqeu[9쩖9{K%m=zU496n^$}nr,IfK[EkC\'c^)Cysaq=ѵ~?Sʮ8Y@p?H6~Qua'fM̘'}K1/M7V][kZ AՅѣcGoTԱpr{&wn9uK]%ciNlRF}4,a"f#{u+&C{(W_~;mimQgNrΰk\~M;e̶[Ms[>׾7=YX;exw н,hݛ˺F^l{4,)ToO|R|sSDΨϪ_`h]?b/7gSxno c}k%Xͤ쵴ڶ ڳz?[ܧ^#?X9# VGm54C@֏uK#sЩ}.ߥYungo~ص쾚Gp$Q!xq2 `$x&t][Z,ȼ}X>eĸi1y-UHC-]?Ndvycv76+,{XՊc]=do?isU~}znƪ^{K]y='Oſrw0]KXV[yuG?:>uNYwGِſ^FCXsGZږ~]Mln1]vUXܗ,4YmG{=^U]!Ȳ6~ڮT\H\[Y\2Z3]zvHm]lAc~{^l~-7" /7.PvNlz΋(Ռ?GHQѴNZXZ]_շVj̱"䴶5?Gkm_=d;+Uuao娾.-HԆo^ϫuiccXB1mT:Vۋgik\ $5w] dt{ - 0FXJS{ VOw7ɽB^V iDI १[bG1neNs!jz_׏fOKrVm/.{NK?{b$*65[Ϧh ߤyG(+NuokEjQKB)!HB.2$| b/}aݴcZ^&>֢3 nۣn֝g l|-<7G\Oe J'$ >nmz6 "J\rAGH;{>Q_JTE_7I@ |x?򱪡Ԗaptw@x7bdz~LT-1]szQqs < {X1ybO=/Q n@/p'G`?-tVlF7tyi܋լv#gsX@[J؎8Xl8/GE`;QSlxFZ]HB 5)TĀ$[Hah@ݮXۑU,5h3PY1ƶIh{`gu^;sG2Z}ޘu$t^6.v>Q-h˿9XX}+~]u}c ˋGs9fAu!r{\KCH]?YpoKq{НBd&;5)ɱ8+|<Ύ/CKaz8Ǹ\XYK 7uu!I>ZA?Ud;[K۹4ESD6 |+Źe./;˽ᄉRƪ X%cYGO{-UMU }*GnX-ï(c>2w3cZ (CPM%d5pvC;Ã4fpm?nnΛ{K\:աnK)lI:4 d;e_k/Ů٢kgono󟣳U6_kjhsˌGV?6'VXLx=ޟѯF!G7PwLhŹqy?立v~cdbR)k~ŀ>zlc[]1,}]mknB)neCmxIN#Al3"UC]OIߧ[ nh=Y/ Y<:׋ 7x GkhC#MBZ/A:ݿUy8sZJP`PH;$|1]{h$;}ﰿc;6-[2s򀡏}3Ml*mMqvSZCCsa.ekzA #DD4`:G&/k\\tyO}عm1SUcz6=$1E>W?\]ޛA{;wX\gTD[[wT QoW:[]|T'b:OgwVO~1[^1ektȫ=u_֮V=3d_g1i 7tޅrzkS^hfͭoszѺix X c\vG;*|CM;@eSw_CeSGp81svYWDJɑ&$!7@A۟as}te61=bn &|JYM7H&@ee7{VY3zW XdlK۷+k]`-{D4zw1ZΫX,ZfCŅ^cr\ =|Mcx;{ѫsZ-Ժ->|5-߹mXޜ6ޚxЫ+= 3)mȷ 15eG5 kkw*Tk6p@M?7C32s,;]5>c-N7C- ʈk >f63&K@kh%%Doi>%g\Uv;huN횮cN[JX,EruX8msUid /tYTI%>rnE:hTǖwV+gXX&ֹ]v?n.m#c:A^}z/QclYk=67 {jm^Gǹ' YD}B=~e.#eS7aKuvY]+6{[O?Es8?&Eh?Szua>事2Hx5=&4WoN{a6o=of_.6 k oQdaz6T\m#oF8`t*լn;1Pp#'m9M5ߥset|ddǿ~KYS;j1n< e6X_RW8Y=NqIhƬPLۛKիN;ߐ,Ԯ nvN Aq7hkv-;_Һs []ֆY" 5=6r1+9n5Qud5Asdn?Gǭ,.scd 2en,lvZ1݅cc_;?vPp.fmn~~wBJ6Wm?322?~ƵeUޡ#.t6Ƽ4Zi'Wv cO #0Up)}'Wc^J9Í?5Ejt>nM8cEaqvݷ0O>$ ,[[l"44ݵ7[>oQ~qnw3=uSϹ5 uu|u톪[}D::M >O?hIyw^fYu-cx{m@-;Zޟ.Aɍ_io{m@r9 .w6#ПZ m?_s1pn,swqeu[9쩖9{K%m=zU496n^$}nr,IfK[EkC\'c^)Cysaq=ѵ~?Sʮ8Y@p?H6~Qua'fM̘'}K1/M7V][kZ AՅѣcGoTԱpr{&wn9uK]%ciNlRF}4,a"f#{u+&C{(W_~;mimQgNrΰk\~M;e̶[Ms[>׾7=YX;exw н,hݛ˺F^l{4,)ToO|R|sSDΨϪ_`h]?b/7gSxno c}k%Xͤ쵴ڶ ڳz?[ܧ^#?X9# VGm54C@֏uK#sЩ}.ߥYungo~ص쾚Gp$Q!xq2 `$x&t][Z,ȼ}X>eĸi1y-UHC-]?Ndvycv76+,{XՊc]=do?isU~}znƪ^{K]y='Oſrw0]KXV[yuG?:>uNYwGِſ^FCXsGZږ~]Mln1]vUXܗ,4YmG{=^U]!Ȳ6~ڮT\H\[Y\2Z3]zvHm]lAc~{^l~-7" /7.PvNlz΋(Ռ?GHQѴNZXZ]_շVj̱"䴶5?Gkm_=d;+Uuao娾.-HԆo^ϫuiccXB1mT:Vۋgik\ $5w] dt{ - 0FXJS{ VOw7ɽB^V iDI १[bG1neNs!jz_׏fOKrVm/.{NK?{b$*65[Ϧh ߤyG(+NuokEjQKB)!HB.2$| b/}aݴcZ^&>֢3 nۣn֝g l|-<7G\Oe J'$ >nmz6 "J\rAGH;{>Q_JTE_7I@ |x?򱪡Ԗaptw@x7bdz~LT-1]szQqs < {X1ybO=/Q n@/p'G`?-tVlF7tyi܋լv#gsX@[J؎8Xl8/GE`;QSlxFZ]HB 5)TĀ$[Hah@ݮXۑU,5h3PY1ƶIh{`gu^;sG2Z}ޘu$t^6.v>Q-h˿9XX}+~]u}c ˋGs9fAu!r{\KCH]?YpoKq{НBd&;5)ɱ8+|<Ύ/CKaz8Ǹ\XYK 7uu!I>ZA?Ud;[K۹4ESD6 |+Źe./;˽ᄉRƪ X%cYGO{-UMU }*GnX-ï(c>2w3cZ (CPM%d5pvC;Ã4fpm?nnΛ{K\:աnK)lI:4 d;e_k/Ů٢kgono󟣳U6_kjhsˌGV?6'VXLx=ޟѯF!G7PwLhŹqy?立v~cdbR)k~ŀ>zlc[]1,}]mknB)neCmxIN#Al3"UC]OIߧ[ nh=Y/ Y<:׋ 7x GkhC#MBZ/A:ݿUy8sZJP`PH;$|1]{h$;}ﰿc;6-[2s򀡏}3Ml*mMqvSZCCsa.ekzA #DD4`:G&/k\\tyO}عm1SUcz6=$1E>W?\]ޛA{;wX\gTD[[wT QoW:[]|T'b:OgwVO~1[^1ektȫ=u_֮V=3d_g1i 7tޅrzkS^hfͭoszѺix X c\vG;*|CM;@eSw_CeSGp81svYWDJɑ&$!7@A۟as}te61=bn &|JYM7H&@ee7{VY3zW XdlK۷+k]`-{D4zw1ZΫX,ZfCŅ^cr\ =|Mcx;{ѫsZ-Ժ->|5-߹mXޜ6ޚxЫ+= 3)mȷ 15eG5 kkw*Tk6p@M?7C32s,;]5>c-N7C- ʈk >f63&K@kh%%Doi>%g\Uv;huN횮cN[JX,EruX8msUid /tYTI%>rnE:hTǖwV+gXX&ֹ]v?n.m#c:A^}z/QclYk=67 {jm^Gǹ' YD}B=~e.#eS7aKuvY]+6{[O?Es8?&Eh?Szua>事2Hx5=&4WoN{a6o=of_.6 k oQdaz6T\m#oF8`t*լn;1Pp#'m9M5ߥset|ddǿ~KYS;j1n< e6X_RW8Y=NqIhƬPLۛKիN;ߐ,Ԯ nvN Aq7hkv-;_Һs []ֆY" 5=6r1+9n5Qud5Asdn?Gǭ,.scd 2en,lvZ1݅cc_;?vPp.fmn~~wBJ6Wm?322?~ƵeUޡ#.t6Ƽ4Zi'W ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$Hcِ F125# YI$a %kVW&wLhYS}8'IatHJBDI@tI$I%)$I$IJI$I$RI$I$I$I%)$I$oķ <'H ~i~ :I$I5+I$I)I$I$JRI$I$I$-X6ZJq /AI&$IRI$I$I$I$$I$I)I$I$JRI$HbSl1ℝ(& O;jJtI$ԩ$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$Y_~쬯?xS?MI&U%;Ɩ5 8Obu :I$ RI$I$I$I$$I$I)I$I$JRI$I#Wu61'F#T攒I$MJ$I$JRI$I$I$U:0KE-$B<&ӷ,]uRII $I$(ya`0J$V*Td$H%I$I$JRI$I$I$I$$I$(ŴI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$YK>st1Լ]YS&ƾ@PY-2<"r|rʲdT8a`.1u@BCc̬qX[Ɏ,te%T\qQrhaIGI-Z]4V,vNvTxF&4 BrqdDb=qI(ςRBI/zob;&[9?qLOۣqppY<G$bebpܜx%Q8= +YE ª\ zd3Ge8rǃ/կA\ U3 0Cd|U`cc#ɒ"cS$qDF'S/ݏ̺IO -%7)?;޲^A n~Zx(ˆPɓrL2vGxdʒdIWdRI$I$I-ߟJ['%?99sO'%ʒI-Z]4V,vNvTxF&4 BrqdDb=qI(ςRBI/zo=;~31jO9ێ(V>/~6_7Deg@uOe OuQ%q_y'sfmC&c2,xxH?@LNI^X,.6 Gr/MB`o RI_@.Xc@.XĿbC1(TI${aI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K9v5LR*_ĬU.c49F=1ccu-hL%ިQxKO,w-$}BuXܮ<(?(G$Bgp%w/q[y*ϥ/3Gb%9Lxa/ޟq|' L<\+MIhgK=z,l3. ?0WqI0)IjQꪱv[Sn/N8Vc)b9|d/1RyF>$> I !$|7bYڎA 8ɰVOજS=|e㉏wI&R&Z;.y/LFK $v*~]@8;N,0D|кJ2JSo>M-NT" f4 _?M)X$'LNI$ћS˭~GSp3`,G?4]I%)%~o T:Sspe>i៻C4dxjPi&I(N $ʺI$tlԹK9Ç-?-NH~|ǔ819s(pw 4蓸LϤӱ{[?䘄~i۔A,I10rqӶL%b8;xε<-C,!8akr2w3 %KY3ow'n\?rv]~Ey.)%'VBJwk!Y.MUay'~qz?ٲqxddM%0𱽹K0?JΗM0ݸYZ4q$~l1g xQ!Z(<%>+)$L0s?[b9$_cJhy_Uq6c;V+K.,y#|?sM\DEJ'܇{S%`Z\@oL`v[ǰ]?-I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$YK>st1Լ]©?Yb?Yb?KqtÄb1?iU&;TcYpkr~l{)<+]y`г!n.[vJq#cye1.,@ mN<}Bnz_cp{ 8pS2p! 5/c:KU5''fe6X L)O3z"!\5rq3]vvSK'dGOר9h~S8|9YyuF0z{M/%c[ ..]YW峌YY2e#<2+Ǖ$JXvA~Kswyhuz2dJ]2o2ѩ h`//)9c.(9K G,L,_]1i$[Xk/&NcSO,Z?λPqu'SUY?οŋECv*rp?IqL@twȡҿ3"'ZΟDRSI$xI*)$l.I$%QƖbj@]A5 I4['%?itVwO_ɬy_U/byNSSohY:셞sNOj?YIuׄuuԿuKN+y__IEKc?:_Ŏ?sIA\1 (Ilak,u'YȱX>lbyRQ<-JπY/G⵾}+>dYx<V?J.RZK?r[K?rK_X論r9RI$Y$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-?FXkѯV*6)jTBuX= GJ?Yb0o?)Y$8I$8Z.tI厷8= Sl<2{G߸džS|1d[IKj7KӨԬ"VݎifƀAOusYq8^JQe #!vQI6gT쵺ݿWa;۰3N׷y&٣ l6ޟ_2qd^z"<9QL,"SmJHeZ..KVE5`~Ե7$瑗ymcʒd35d3_ǟ4{lZՐ:;So_"\yg}IDrI%dI+[>.Zʹq^='KgFFw?7i)D9_9aC)_gOq{JL8T/c<@cQfS z?IjbSGڲ>1eapq88/TMhS&ڌL;?XzdaX)|Dwr?Y-IGI$l$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$Yyy{$X2GxN_,%e,Lb7*Qw IL{]a qDZCNֱ1[?4G$XDa? KJ~(je9I:/4K bB͢Ēbu{G4pd{:CXyL993d>8\?,HSmKzl,n.ϭn"A#e2LǺ4޾k{w)9I%|YOTV]|nV^',sr DcKu[S _Ŏٙm5_h×͌'rBChqT ]_S~$F6<ǒe,.[!/R"%:ҿ3"'Z=ǰX%)]a HfN<+o RI%QtInu Qe[0v\Lq·xWO #F6~kO&N[#.YOj(#\^ Nj3Y;jŰUkx˳)۬3;1s8qrG/͓"Y>urSWc\,- 6{+Jn= hǕ>Cg)&oLqǀF2gť:Ej^~A%dYcq{̸TUNk?3K%p|fn=$[}^e]ԍI1>'B>'QFo,36 s1!,uJ>'ѡ_ź)&"R|[(KXY6Vݵ;^Ydjs1)`ɀp p{ɍ\3"`?U_ <&6nìx|+N귺q"GUBdg3cŏ~$')ʽ|?/I4'[K?rVoϲ[CȈAVM3G6A(l1' "A#$Н$ITfRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$վƳ`& JwU>Kϸַ3>Orz}ilp1jyM%++d_Ӄ2-uIEϻ+K@|rpqz/fŎBFs:'HNiizz- f+Vcv*dj?)/.( G$!,Ɉ˄ n<$Jmx l'tkŗֹZ&^}gt®3_/6O #?&*: !:X8]XӲͮZ+xZfeaX,#ަL9L<>߹Wd}cDNY1iRLDڥ}USDϭn"A#uqQc[` lGqK^_)9:u%Kjp_?!o:o RՎџe3Σbc=={*ɀGb *IWgW+ 2fg?0`of,я/|9&p'$$6T X͹[Kh mlA\hQ-F$~#$Ы$J2$R.)\lcX-d'?j|eXl||t{GgpxHH[])ʡ?Y=K#ph>G6]ޜ{@Rs>x:{a[IK?:'DJuoߗRd㏼mL@ lVMŒGs a2))6=Ӟe:q]k}4|!KvlvCvkO1ʒgC'^=\f;p_ 4JE/[_п22-(b5`;F?`./p,ԜHUBѱ2߈Q,МXKLbgtJ~"f`-lrȺs͎L"gۈFt<Ÿ1d'~3(z&xc :DJi'h-P:qctICX|U3ik"gǓe<ˎx=Y(V%|KKjxRvXq6g{# CKvʋ\Ry|,G O\3 8M)twsvV:,vCvkO1ʫhN\O3,rGی DžDjpHZWg՜,0z`3(f|8χt FI>Vrb%:a ,lr $_|Lq·xW!h>*|䜰c ǃ8?qdc N7hT)tK^gyF8^/ CyˏEwRM I$6e$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/qX,vү8v1@=jhbqq8Ma 瘝g+uZ@qlρIw?g&4}qU+_/o\a?T獟]4M/kJIrC/g!wbDw3?/M/i{X7U%3R\;1Kx%?Kg~_^?/ܗ7~I.WyY<D?W~M9?.T)~߽RK?\D?SvCpi.ha~_i{X7Wr_?ޭ% ?獟]Yɥ3i{X?Wr_?ޥ%+?畟]Yɥ3i{x?Gv_?ީ%+?獟]Yɦ~&?sK%3\;1N>%?Kh~_^?sP?ubTs4p?/M/i{X7M%߽2Kb$iɥc;\?ܗ7~.gv}_CW ɧ8~&?sr_$g!)?1\*K8~$$qU*ޙ%?я1KvY}]$%c;\W?ܗ7~.kvY}_cW %4?/I/kJIs_cRbds4?/I/i{X7E%3R\]%,?Kia~_^?sJe;,F>p.ia~__G.oTKzT5;,F>7$i?KwR./o\u%?Kh~_^?sNubTt>a~_GSKwRn/o\`?Ro]Cp.}Q=/M#C v4MZ'1\*Ko3&ߪo!Hpb;\W?ܗ7~.mZx(}bFXyWa&ia$?s\r_֋[նO1ȝ9p.RKia~_^?sBޛtX9}]I#c;\W?ܗ7~I.p}iy>!c\BK$$qU*ޅ%gz_޸m5q#яq).jx~__W.oTKwXޗ1%%\OO5q޸o50?/I/I{X7Wr_?ށ%gz_޸o5p?/I/I{X7Wr_?ށ%9_}+яq .ja~__S.oT)~߽KF>+яq .jbx~__S.T)~߽KF>޸o5qяq .ja~__S.TKwXޗ1!%$ILOKwR/oIaO!%LOKjbx~_^?sK q?ޛq?޸o51яp.ja~__O.TKwX?ޗ1%äI,?KwR/oIsޘfx>$I,?KwR/oR\19}Iw?G8~&?s\r_ФcM:}]4ɥ;\W?ܗ7~I.ljcW ɥ40?/MoJIs?CRbTu4p?/M/i{X7U%߽2Kb~% ?Kha~_^?sP}G};1\*K?4~M/kJIrC7;1\"K?5!7g&Ō.oTKz)<D?R\D?W?_?g&?s\r_դOg!wby %?徰aWT R8G g 0 #`u\;1]'O9t2  1$P/l$I$I)I$I$JRI$I.c>9u> \XIqq~J\$ 2RI!> It1я3/ݗ z?W6?fbyKf/1.oT)~ߦI)zsi.f/1fbyK؇Jgd}bW6?fbyKf/1.oT9~ߦI)zsi.f/1fbyK؇Jgd}bW6?fbyKf/1.oT9~ߦI)zsi.f/1eyK؇Jgd}b+Itя3^?7Wv_?Ӥ\K}/٘R!wR~$XͤO٘S~F>/ݗ /Tq%F>_c){;\/ݗ ?W8fyKn/1.oT)~ߥI)RėE;_яC?sqKe3*H^K+It_я;^?7Ov_?ҤBԗE;_яC?sqe3*H^K+It?я?^?7Wv_?ҤBC?_яC?sqe3*H^K+It?я??7Wv_?ҤBC?Q!wR~$/PΤR}fqU+_/RB }s.~/1}/bqU+_/BRW<gyKR!wR~$/PW<~}/byKهJgD$S}^?7Wv_?$}%}_`F>/ݗ!)o+ItaF>qяC?sqe3"H{[[aF>رя?sqe3"JooyKهJg4$%`Ǎ}/yKهJg4$%`Ǎ}/cyKهJg4$%`~ɍ}/cyKهJg4$%a$~ɍ}/cyKهJg4$[cF>RawR~% )$q\oC){;\/ݗI(JJIn}_fD>/ݗI(KU.7!fD>/ݗI(ꖫ%loC)}^?7Wv_?$ZDcyKهJg$j%yOcyKهJg&-V*KkD>򗡍}/fqU+_/뤛TX-KG^?7Wv_?I2K%cyKD>/ݗM BIlXSzXRawR~I(+%cyMyKهJg&d$=D>/ܗM BIkxRٍ}fqU+_/뤚ٍ}6oC){0;\\R]$Д,o#)mB>/ܗM BIkmB?)mB>/ܗM BIkmB>o#){0;\\R]$Д,o#1Џ^?7Wr_?I4% )%GRo#){0;\\R]$Д,G 1Џ?sqK%3tBPZŸc#◳/ܗM BIj~R^yKهJKg&e #v?RawR~I(Y-2qR?)B?){0;\\R]$Д,ۨB?){0;\\R]$Д,Ԗ8G6#◳/ܗM BIi88?sqK%3tBPZz#v7qKهJKg&f$qO8G/fqU+_/뤚GqH9{0;\\R]$Д,Ԗv?jGH8?sqK%3tBPRZ[DINy.oT)~߮hJbKL#⣕U'8IGÒ1C2*!z~&IVd]$I$IJI$I$RI$N$5ў}ML11dD RI .m%~F>_c)?7Gv_?$\K}/٘R!wR~$XͤO٘R}/bqU+_/A^\K}/٘R!wR~$XͤO٘R}/bqU+_/A^\K}/٘R!wR~$XͤO٘R}/bqU+_/AoXm%~F>_c){;\\RNSsi.f/1fbyK؇Jgd}bW6fbyKn/1.oT)~ߦI)zs.n/1fyK؇Igd}RW8fyKn/1.oT)~ߦI)RėG7oؿRawRx~$TJR]_c)~F>/ݗ!z/Pu%~F>_c){0;\/ݗ!z/Pu%F>_c){;\\rJR ]_c)~F>/ݗ!z/Py%F>_c){;\\rJR ]_c)gcyG؇JgTBW:gyK~71=.oT9~ߥIyKy\K}/R!wR~$--s.~71`F>/ݗ!o)ϤbyK~/1.oT9~ߤIyKy\K=?obyKهJgDϤyKRawR~$=-s.8R71.oT9~ߤIqKq\K8R/1.oT9~ߤICqKqX -cyM7jR?sqK%3tBP[>7!ޖ7!.oT9~߮h)AX-O^7!.oT9~߮hJ:KcD>򗧍}/fqU+_/뤚C?sKe3tBPZ1>?7Wr_?I4% !%mGRawR~I(Y)-mGRۏ}/fqU+_/뤚ۍRۍ}/fqU+_/뤚ۍ}-GRawR~I(Y)-XB?)F?qKهJKg&e$cQ}/fqU+_/뤚_8yKهJKg&dcc#◳/ܗM BIj~RgH^?7Wr_?I4% -%N8?)c㸥?sqK%3tBPZd}/fqU+_/뤚Ӝ#v?zG/fqU+_/뤚Ӝ#v?sawR~I(Y-qSg?G/fqU+_/뤚Ӝ#~7qKهJKg&fñqH#◳/ܗM BIinB?)oB#KهJKg&fcc.oT)~߮hJjKK~1~e88.oT)~߮hJbKNqЏQ[nۧY#pQ')F>{6ŧ讒hH*)$ȺI$ ]z( ??"]z/,i ?}PJ1ߕz1yR*"X3HPRjdO$ɓI$YSJI$ mRP$I$I&I<$הJR$$S$I&IKL$TB) aE S&NS"$I$I%d'&I%1NI$IJ$I$RI$I4$xH)&IK'NI$N$I%)$I IK&NS& $2t:IIK P#qॳ"@R202{IBS'-f4S0n@'V λu)c] n1o2mV3+ϸ7Ff lcsoq}{,zUT#AYŷ~Clǩ[:y*^cț'B5B6=Ҡ˞uN_iqgSSNGy:U=VԪ #T2S*.mј NgPAiHQJI1)NBALy$JtJxLBR)!R9-p2tI+$I$I I$VO $$1J2t!''N$P2I$JRI'I$$$Bt'IpT'tI$II:I$)$I$ ӧI$R$2I)d$I%,$$I)d҄I$I$I%)$I2tR&N$%jxLL2)T% I:dSJ'JS$:d$JZN$I%)$$2I)hJI:R:JT% $IIJI$I)&4R$ $)JI&S!4'N1LS'N詁Q*eDI:!L dDxNBQdNHD$I%,'I<ܢUjc4))$SE4$Oicy?(Ó揙.Bb$JI$I$I$I%)$IuWFEˮȬk'% [:I$PI$I$I$dNI&NI)I$II$I:d)I$d钔I:I&IK$tI"II$TI2I$I$I)I$2IRI$*RI$I$I$$RNII I$MI%)(Hd)$I:`)RI$2I $II铤J` )$RJI%$Б)!J$xNBiJRIKJxI$c}SrI$)%t$LSIKI$I)I$I))I$$$$I%I$$IJ\JH @I$T'LBd铄:XNPRI$L1$N<&!%)$Ja8NPB&N&I4RI$Д$RRJI$"RI%)$M D'I+RIDj *]$&QR)R$d)x $II$E%)$HR RI$I$I I&)&!%)$I/I-LA)EJI$Ί<%4IJI$12IJI$LSRRI$8tM<I'.aKB50)I$"I)$Q5Hq|&:$I:4A':jI$Q.?;(VwS_c˰TtrI$.]$I$IJI$I$RI$CufK?KJVUg$*$I$%)$LIRI$I$)$I2I"$I$I)I$pdR'I:I&IK'L$I$$I&N$II$铦I$*Rt$IRI$*RI$I$I$$RNI)!I$NCRHNRI$t$I$A I$)$)$$J\$I&ऒ)RI$!1)JRR'JDI!I$Q M )I%)&JNLI%)$I$IJI$L2JRI'Lt)I$D$I)I$Rb I(J$T'LS)t'N)e9AJI$ґѤ$O<&pI I$BhR jI2u<% )I$iI:I)I$h)BJRI$hNI*I$B\BV'LIHt$4QR)J]$LE.RI$$%)$NfJRI$tR%)$H$A)IJI$ R)I1 hIJI$KH%))I$IQ5K*RI$3b%9ׄt JRI$'Y JRI$Rp)LjI$ h'IK$I~ 'j%)$HwKU!t4I${(N tIJI$)'@JI$Oܢ pN)$O'F>G$I0`rNIpII!1IES$IԺoDGʧeedsRatÕA$UI/ ]z) ??"]z~7Li ?}P稏֮wRc?Z1NEQO)faXj`$H***I$)$$$)$L$I$RI$$I$)$ e$I+ I$*T$pS$,I$I,$$'k$6% "I%)JI$JRIJRI$Rd2J[R[$w%E:xM %J;JRNJZp8I$ĥ wR Q:"$\-OmxU4 DRlJChL4JuJ'H3Cai{$GAmN~iԦ{-uhtԪK c1\|htRk.~K&\|Bt50VEkjhaoq`2K6 M!S &O |4PJQ)FvjhP!HBIAV-ɥ2PBbmSjd9 xJII$I$IJN' $H)I$(Y2rJJKBP BRP*0)BPN U1$ T'M)"NI N$$TI$2I)I$O)$)dII$(\'LI$J"$$%1I:II2JY$'I$)dJRI$NdJIRINdR:P$$0'I:I$P$I$NRI$BPILRRɔ%)$JY$$I$I:tILJSJ' )S!DBA S8(JbTJrTINIBDJyM)$ XRLdT&$L0JNI$0䤒IJI)JPR 4?p[So'ar?V^S@? $PI$I$$I$I)I$Kb7.]uWFEcY?/?)W+IlI$&I%)$NA$I)I$RI$$% $4JRI$$RI$I JRI$E#*RIL2JRI$dR$$$)$dLRRI$%)$O)$S$$I$$I҄Rҝ(I$I,2I$HtI1I$RI$$JJRI$RtRI$1Na1EJN$I$I2I).I%P(!I% %(STPd'H' QI:H)tI2dRI$% )tL$$L!nRH"$I򒔒I$THM*ZQ)"(.I$?)I$I))I%TI1 M(.d$8HJ]$L &A I$>i&%4IRI'R)rv*R$J%DpN$ǔnR$E1"I$J)LJmJ4bПbA$Es$NI$I$)QJPA !D5I$$I&I$TJyI<$IEtĥ)DI$ʐ ? I$RNe8L5EM5HNc YQ w)Hv Y3e12P6z/vesТ'9mlXLmǰibyGmָhiY]Odb4zU l[:fEv\2hFmYTwbREղ+aa{ -.9$ %s36M,6nV02n 62}>Fa(du¬zzEiyNo'_eW"DmWݨX'ge⏸*[?E1GVNN <-Z\kvMxf@~̔"|MOSe4 nX ;>c\6C2 :M嬈wGk@.naV܌y5wO2WCZYU_Hy<[*i"wj<G $;Aiս kh)(7(F+AϑR}nyTKt'&R(,0Ij%:E5k T`QN:D2$J[L2j@b'%1Q\)L$AKtI4$)$rRRD$% )I%xL rSVd }*-kN0a?rϥHN?漢u+k|gHXJqr=f룇!:A $t&NT<$I$xN$I$(O $I$NI$Jc IP $I O I$I)bI(I$I $$I$I҄'I%,$I$)It$$$$O IK)&N I&NVJ$%1:I:dRД)N+SMBI$SJI$IK&R)S)Bb$Ҝ I$ %,TJ) )QpR'Ee:tB7("BII'1)$NSJBI$JY2rA%(&rA3I)NNI$%+0?acy?(×揙ątOUT.tOUT,TI@I$I$I$I$$I.ȹub1__dx^ߤ [R $e`I$A$)$I $I$RNI&)$REJI$)'%)$I$RI$L)$I$$I2I$$t$%)$$:Jb$J%ID'L$~Ld$IRI$E"%)$% 'II2II$I$:I"$I RI$N*Rp$ВtRI&)'JQJI2@$2%):hNLZ2I$H]$Ғd-ȥt' RI%m>A1:ς IJI$)a9IJI$:K;OyA.RnwY$tI$I%)$I$IJI$]ufK?KJ*ʬSIDʰI$I:dI$I)$I$$IHI$I')$)$JRI$I*RI$E$RI$$%)$H&H$$SSRI%1NI(('L<$)RH$%I%I$A"Lt$$dI%.I&NHI$d&AJI$S2I:I L2P)R% $)EJN $S'J):d4$H)t$ D.d)A %2t(I<RRM JSTuJԨI$Ҝ$tb*Y$NrI&"R:'LI2p!$$'N%.I$I$$INIRI$I$!I$d$FI4NtI+RI%N R$PIBI$!<$tFҤI4& OEJI$oT(0$IM:N)t'I %$ )I$mH&)RTI&$%)$L<& )I$P% I)I$IpI%䘧wPQRI$JsƜI&2LRRI%LjOK$I[)K⒔I$@m 6 )I$}(B2;JRI${%YHJRI$B RI$I&(𒝦4슔I$wKLc$I7Ħh >䔤I8꜉Ӳ`GӔIEH$)òJRI$6SbI)?ʢ5%.*ɗœxQI)VzI$/]$_ ]zv7LpWvU3)pS :T I1H$I$I$RI:I$ Y$I$IJN$L%.$L2jx R8)jdBZ)T҄LTKJdD(R$}>ȍ!׺dj*7sOL'p d K"k>iT@$~W`<Lc'Of[ke.T۟SӨSO̟(֝ ?*hwUK1oJӽ:֎]#.)BGI3r 㼶'q >(hq.Ô sک6;`msu+"CFc`Kñ[^lt&z0!\鬳#'"*]TovWG~=Yn=85Po[U>γwGsV2t@BSF>_-#,ZXGh[}LkId|(hm")BQ\Q6viF (6h {SH @[lSBI) D RBE2Idۓ ӦI$J)<N SI$R @$LNI$(I%.` I%j)I% V78puFӤ-l?R7?1q^rowx.uDտcoY- GvݛnY@ qN3R c{3 v%9)jS憁Pp3;?#'IFSe$I$\rIJI$I<$IKI$Y$t"N'I2I)d<% $JRI'NdSR 'I4Н$NI:dI$NdAK'I$I$RN)I1I$A)I2I"tO 'I1L- I$$S'*/N$ӔR!E$I%)2t$BP)IH&N%DN8ILJR)QN<&:I BRL(NH҅"S$(FԴ$(M :Hژ" HdĩBEI$Ja Te$I%)$$aྶL?bo'ar?VtOUT. {UPRI%[$I$JRI$I$I$O+"QoVq5Lr-QRI7u+I:E$RI$I$I$RI$I.R$I$S$H'I)I2tI$I$%)$L$ҒI$I$'Lbt)p2I% $I$SJJ]$:RdI$M))I$t'M )I'JRI$'I$IJI2tI$L&NE+Kko}s`!TΙfw0]aFzApgceB ?wG)6;f:ml$ӺsAmr_,ٗa!#ξ^u -m\]_1vAaƷ{e%Ӻ$  ~_ֲ~IY:I$II$7$iTI9)JdĥJPI:A>4$*RI%:dII:IB&NR )J)ZNL)IJI$S'LI#b}!-G#GmYGc*O? ]c_ 2JRJTm$:tM))I$tJiI:DH$$I("$i2!4J MRBtД%)JT$IBcrd(JI$p0"D)I$pa7uFIIAD')II M RI2t0I$N08JwF̤eNdIB$ 0$t*I-ý%Qi/o?^iwQ68dl>)HiTG \u{棒I%I$~S1Kt)$NԤJI$4NZTb4IJI$SD)I$b ◚iIJI$c̦a 8 )I$}'%%)$P'T5L'*RI$$u $I 1yRI%#p@I%2FE(R))I$: ?"r )I$`cR0N$I4wEȄK;)o/Y?1~*M:n5$U.I$I$$I$I)I$v}!]irLCʳ% %pY*LIdI<:I)I$A:dRI$I$I$I"$IJI$I$d)I$ILI$$)I$I2IJ]$L$JRI$IҒI$:iIJI$I$ҒISt%)$RtI:`d$I)I$(LNo!HyzUHЫʚ8}ŏ.0f_c+5cwv+*1..!ͻU`h-iV>K2X,a\qė$ZxWnZk#GlXE(Vs0g7[OFUp2ߣ`VӦI$tJNPJI$%)FdN4J]2t$)I$A%.dNbI2t5QJQ 'I9 D$uM)Rbt)I$r13Zз'@ṵS@2D kff lTV> ?%_(O}kmj n5:T\0ÁW\ hG\Uz=K?4=ykĴ*vt{XZl$hGeEc{X=r-0 2xuUҋsQLp$W`ӝA#faT׷WF?KqmGM:Χ`0[ʲknc!JR)EIRI$&%/JRI$7)L&I*I$ĥ\$INɂa$L5C"BdtBPR)I$\(򜦔JI$9:c%(RI% T[RQ)$ 2)d$E(LI'9QJQRI4-4Yv%;a ߓTHv]-cG0a 4Z}^ȸK>sP~z`ˀk̒$&r:69-;G}a6*ݠ_8ҫL.l4kZy줪 7YPk8gc7@ )7t.I$xM=GT)I$p)LIRI$"I*I$JNi9IJI$:'"D$$IT8XtlG;ni ɗf/Ms_(WX:qϤ˪`S<)7*aEGDl*AtRv|R;"c}1T:ن\\0 W_[OL~}/:W۬P64|V/Lrt-2sCo_ͧ2v:;OZ{@{ [4?gj˰myJňe%=P m2QNp)\THH'H&@Z 02I!KmD%)LSRRI2I$&LSB6d铠T I ILa(N$JH!d" E*Ne TW^[RCҼڟC \;Oԙ~ݜ0Y~b\۾S\-vxeY򛹠9opz.zxV-ci:?GP';𕥚eYqKoP"_xKzV!^?rHf?7╅RDo䔽cANa) VIC7;zS}~QJ߹O(00!;J¨I>^PG8/)C^P!2?ُ%aT$?W%K)`"ȐLJG/t9];mcײ2GYq42E-9@uQk_&5x. ?Վ ]h>חaٸ:a"@OU{,>r K%BG6fncuw2 wPs$ ":yt QCi!s?[kL|um_A 1%GQ C q#=Dr/mekcH\R~7u cWMX4wH! RHMxVCHX.&^`B微a Nw *_Ԭ;Kɭ\}AkqSl&p<#V ug=7Y:m1r2+dYMWàH䕥*W'\oK>v~]k6Wc@='be?Զ^y:ḄxhRl[oєn-U|ήG9ȝ,ZmcbY\h9%rRK-h$mc W`u pBwl2ݝ?ileߧ .c=;&8lխ>!`tU!0|apMnSfؙb?#.S:脜nI 2hCYGqvc7xnjGḓT9졊NK{j~|`$y~z6OK⪩cLcDoռ[0~Nr Ԅh"D$̮[ 8 O6uݤ|Npx ?,SKOr6خ_?;u[Ϲw99tZ04kGt,OS\$jӨpQngQB;\LsZGikUj~_`'iK ֒I|f5' ?fV_jKZw5L(~p\+$d'Jd Zw cYѬɬu<7avnP6<ف T* Caw Wt|L.+ꕹ4nIPBF).i:~(W~}m.fUkZ#A/<#;|'`9<ܛnx`tL.#v=b}n]k-Gܟu=kZv[3,vB29 1P|˲F۞\<400Lbt -s.p=N~8Ÿr>k'5^{Y.,g 1.S;eyg$ v1kedh7u .*Yah p{).57{I?Wq544?b"t˯ ;^Fgs,]թu;^bƀ~ԋx$\[|mXKZ"X#|I$J}NI2uɄhA*I$ D%)$QOd)I$cQ"Tc%)$Je1?z~JRI$p4LJx%)$N!&.IJI$8JD$I)1A;H2I(`|S%)$RL.)I$d"S:BlI""%)$LtO&$Oᢈ:IJI$SPwG\~E> '<IMg$JI$I$I$I%)$NϤ>+tO#(JԺII)O~I) 4Jk RI{wJ]JhH~~):ow◻JBEOܖx+ ]$%$%,?rVL[߂m;)$KUs k "wV[sj7= wc4MnZ]Whnn?s?ΜQ#E,Xci 0G{(,pA5W,ɪ `$~cWN&Um c{jV-,74H:tECǚgY `u|;2C]V2>(]']hZ؍uuSfT7BV6ZvyEJCˢH,|ȢtڙmkۯIs=@/'Cե`A0AZ6afaI9 i>y96ODs*Pv0kk*8& (gO:[RaC#ޛ1GUVg_YC `ƐU۷wtd{v%e1Z0c~jw'YkyM\FRW -ŭk@@9ٱΫ 췦X L_gI %p .Rvɏ6^s@{ZcB;ƪՓU+{\|(Z>&cI:su㢋.LM~+Ը 3~SY~e3p2lsGyܹInQa@k|Agj}#!. ),l>mc[[/"es黭zv q}OwAELEIe_[wzm'h~#ONX-J wRlI qSƯdZ\OPmŢ귬 )J?`׺KՅi>wIqS),cF:H2׸6y '亪4( QVn.qM;箧' y>8kzZǷhkAuٗ+ -ŏTO-; Gn2t8`'}NY]-׷~ooۺeW9N`~+EV߹;{JU,5;*+6a9~>y꧓Ԯno ?Gk'E:}xvl2Ob0isFHlFlӝXsTS0'O8Uoq'eWƸ(?*֋HEeM os}wY'*zۋx-4Nֿ!vv'1,ciU1XFXوaUu>v]<}z_cTסʷKȰI-3!_FTMpDOU\۵VzMm}Y q 節*Ƿhƹ $.>FrcߚMñu|}pq<4s5_cv<p)61e]|S#NWI4QO>:IRI$%0I#jNI&$R%)$IFSIJI$(p$J.2tO $$I=nJRI$Ft8Ή))I$L|Oe AߔIG| '4 ;H )$R `wIJI$ x=RI$Ɂ)rI( <3JRI$0zT~)ʧeedsRatÕA$UI/ ]zv7LpWvULi ?}Pkoc*#&~TII$fVl I1)* BP"R )N_J3@L8Q(TI:I$IBI$RI%)$Q!2LSY I'Es$*$PR1M)$ФI)I $FNRBR.E8 >TJbP$mR4 4PSlGz287}e٥1ʵ |UA"$XZ]B~ET4C y#Tp ۲fK$jj(Z[F xOSN--+C&kELk\C£X# w* TǺ akZ';GJ=FZ$ ! v)ήꅣpITegoV#жrVF>Q<# <ޣn;Cl-K>c\$GYqy-~SsYYsurλ8cEdPԀX8=[ڬb|;2ܫM}<5!IdR=g mk08{+mmn$ 쥆ljCMdu.Xm,s,o *7}N q 1rG5;D ͣ7(Unh2G=Vv~+iY{j>7 xBɒuԻεcW2|BO W8zϲjWQ4JK*6+~b|yd o{+ X(l&7)dV2[St w;h:vcg{*#e'%-V,:vSO ;.s>%\A>%jfg7C>2 qRyv+ "iQȷ@/ؘhAiCꚳ2g*~7PDOkP2'XhGjKAEbI$$iN rIQs\aMa$XIN'n|Њ<$XY9Uuo!&$LFSnSAS '3IGr}ɓ'L $I I$$$ J IPt:۹%Q6ǰ&9 JȲ gS䅙k{&]N^Nu.s)z@{3uBq;IP󳺍lС]Qmz'Tcs:ׇm ǒ|}i~q?p Kr ($LluXI`)I"$$0NS$ tJI"NE2I$$I$IK'$I$:PI$J $I)PruN:P$$O-M)$)'ڔBtJRR4)BP$ҒJc )BhNiI%,JBt$N$$IJLSyLS%HY8)&N%)JIҔIJLN)$*2&N)Nd)I:bIȩI RE<ELtFSB% tR2TQ!:R:JbQ*J%<)L2I0R$&HPLJa6JL)RB):~M?/O8vQ/3E Ъ\!]EWBI$)o$I$I)I$I$JRI$1?]F'QYO?1J@t yEI$LI$I2JRI$$$$IiNS$$II$I2I$I'I2I)I$t$I$2tLH$tI$tI2IRI2dR%2I2ߴyOU>FJ L%p [n@V_0 jJ%DJoT %UúPBmҾ3*iR^;WREH~KN^*)$!)$y)I%-:I$I$$I.m-l r>PŀC'A̚s[,vO?zs-hx~ͤZ j<)cktDAvMMR\=B$5gH3'[E[z6Ęj+:pi5݂*I(v={Xd2uL*raHBE h8P}IK;(fE~ J!I ME,*uDvwBv9+]<;'X\Z<2>39{+5q ,{{aTc;;=7)Er>Z+ Va=EEimr#a]AWACUd QdT$JRI$I'JS$I)I$I$JRI$I$I$I$$I$I)I$Kgٲ}'}tmc'kH#B8MDbz61JÚɭ$CAЭ|~C"{m=:v'Rc2^s #Or3顴RɐdA+AC泙L2+AٗnD/ށGMZNTihp<.]`] 쯫cpUgB%#B>DQd8}M#s3iqsG-rgKQ:g[KAZH}n>JReyXx.X=od_m;1!*D iVzoO)dph?XEv;iiz)Hk}]^Ѩ Cź=OtSgR ⣗F0>\lˆ G[,cv%gu2xߤLxsSd.ҝ6@s9=7ni4Rݩk@%Ipс"$p.s=@iGAx$hCF폊k"I+/GaY iוMǵUVzR\@㘟r(˚)PDRQtTnM~`"IYպ6Eچ:'O #sZ kבu5wEG,c$жOt[ЩuLe<*Z==/+xx\oGe^ B,1&'?ۧN'_DMtXF=5CC`*}'ͮϥ#U+s`@+V]V[[wJ<{.& vJ֛=Fys8+"@:Mo\j`O*윯Sfy[Q% E\֜xKkDpP9#RM nW=`<:=UNt}Bdc}' 1GFʲͅu'kNE}n%+BW|Źw nm-::=lT:U4첔Z6Q8Ψ6gUbDZT,$mN8 2_ J.$̶XK;-.zqU.FKokkf?wjmcs[I$- NNu0LWcrWim׀ְLX;}8r<V#bDnI_PsW=v:/_g7euf3ߏP>.O{JŌMO~}_v)]1k2oj8G{ YK{JbyLk &5IKFI+RX~)UqD*vׂ IemGo/h~(xph-՚"C|B+~!MD'&:&TI'*:S̨$I$xI8%)$Q|Ҏw⒔I%?%)$L5oMqLPRI$0;DNL&ʊI'Ԕy)$KjyL:}ɀI&"u TIJI$ '<IMfJI$I$I$I%)$NϤ>+w+g;fK?KJVUgI$eY$I$IJI$'IJI$Jt$I:I&IJI$I$RI$&I%)$HI)I$I'IJI:dIJI$$I)d$$t)&I$`K@nӷrur;%ܕMܦ+Wh?EN]rQBʑvw*BIg/^CI%0YHTrtw$ҒI)`}2I$BI$I$ $Kl lw$ekv8 kDW<PS>rqN<ߊ-{I P[s,%2G(p5vVTUPk->*i$!XƸhY{Aka<?V)H B_돦S`>ۚ jkS?:V2JOc%8rE;(Wklh{sN#4I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$[=+0[)T/2ӭd10`]r XK ˪\ֻOo_U^Sx`r\7jFKp{L UF[Fv2Y{Mv imud[}pѩ-[_'X(ypeqęR-x9)0׵"(O0\$Rҕ/IVmb`kKNCGyuW< nSNJx5 jk5P7OndVmiԅ0..۴{"td|lqqm׻P 9>^ctO4@W>ꡜ1sa:%}'y$@wvOVfC(_+c멦$'f1"Jk @:IrW[eNxKu|ڙY  <.`S}^hX7ǺwZIByrv>)*WdCݼ A,ڽ#[HsxU:up@1$R ĉRYC˟WHnq%'t=u])ln}tӳMy[ =#Nzv84WMl.n ҝ.Z tUcW{u묒,-K|cE<"{=H:t#[ٽ9<5lSü:!?oL*_f;_1]\lk 幢`i%3hޟѝ!OZk]Odu .v<x*t1gUUXn][Z@[+}ַ!*a`kKlnw[_OtP4fHH$tcb\0zu斀I:p/VR>?y>GO L2;' Ӽ\9Z9BIkÉi yWGc]%ķO77n+0=YS}Bdj%H<>D%qjU5v *&]]Aj"AV)Ʈ*J~.-Hutڹx5<df]x# UfVڪA>J+iya]V̂kLʡ;FӐ4Z'&XyY'GO ڰĥ;E$TН$-$~)$-$yIDwt0tVCc}D-9 Q>8Ur'T$:KܒTI$$9($I ڔx撔I(4J!! )I$Dw GTI'xD HTI('1)"$Id $I'dyI%)$MM$O)IJI$s sjI%LwL Zry )I$@BP?L4?S>///O&SIV^I$ ]z^1??"L]zV?L->x\Po6]ߕwDžgHҐ*)¬C55vQ &򘤙%S `BP:II+% 'Nd%1R `&Q*N )$H!I$JbR8jtJrEDbR D&-I$ILeJTR)BI%E$<"4I0gsQȩPT(@%d INjkyt}'$M89>D}ɉS&0`߲,_e`*Ex#̯ftng4syX/}t\vDZ]&Pi~j\nuT8 ?&ޚShJw$;Z?RM%[>0 Q `;-f (֎as2^Tvv]n>^KkJ}JCo-Ӣl9b\,%+uvM}78Xz.ku=/daWe oerN8Z=+vQ.ѣ_,yw_c`>؅|F|?VN2ƀ\-g:YFX}Rn >#ҹ싞:*-v?a3XnpTi:w;U(2?9eV/ouPv5+-q'Bkueii;ռ +v ;>蠝CVMy !pԷF*!kKX=Lwܲb0 5,pWW@tbr#R#.9. UO0^=v>}Z9;#|WDEouTz}dׇ%J>NC}ݭ q;\߫47&($k[Ve |{3O۴d?ѡಜ63T:ʀ5f4I ѭMiRg},;'qR&h7^A&RK3>ȷk|#;, s\>_}W[P?OO%fc?V9?$#@&ꎳ,4@Lѩ9Т@Y<{LZY)@8u?h>(VWeYX73l=UbÓ̞Kӹq|é~+e:OܵfֵX`3:ѵ-YVii&nFfFCMDZll0dF-Jt|Wf}~U_T6ZQNhhOĬ<5[kqFQɏ$(C{J 2!g}[׺ sc=tP-p?$՝&>(kQn.G gDaZc9X~Kx ńjGh)C mr߯oiBG^Xa>!IԷ&=<](5є2Ŗ9u9+Wtէ!dDL(Med (|'L'$̹Dn=gl"Tw&+#"/TXeP5W\36aluՓؓ X-5i"Eτlvk#%.ʥ65OX][F|O*y '4?B rs47:&ɚ#K=M8Ƿ\?1g}[ߑa:UE"wo2??;<{RCw6-iI8nր{Jdx۲~"cI$Td$SBp%Z"eI$ȥpI$IJNI2E%1KI$JXN'IKBe$:Ijc RښT (RI S mDRJKH,DE%$Ȃ%D2I#j`Ob[RN$T2jhNN O)&I%,BM 2I$:IH%hL$LPPc0j~I$KФS$$ZR BtЦSBtd%- L X NRJbSyLJX 8* &-Q-D T)NC\F2L)۩&8M r)6I"LIL LྶL?и/F4|.CpX$-ԒI$I%)$I$IJI$]F/Qrb7+8&9| Ho($e`I'I2I)I$tI%)$MI$I$I$I)I$RI$NJRI$$RI$tRI$'H$II$铤IR'LYkC~*Z< J8Sd%klNe{GdH!Gs)%4E*dA$YZBjJPPLЊJuM*0)mO )J; ԔD1rJ^;Dڍ) zUsoU(]O# ׸ξKx\.꺅l ܪsD{lNfk4ah#KnChcZ$%?MMcd48N7$X]m{SYi#MF位P?*J*Zʆ&$e2Vv%VKv\@5/}F\vE]*>K;%zy?i7cd{~RM8ޥbO?K I$W9ؠ:  ,Ҕ J#³`܄Lzj=:D~s[]`p*Nc]1Zb 0VedL'($}?EcXq 2&$CLJJS~2m/5u/Ak ,yc\Oш7zIau{*!8}![5Zۚ,<BxN)-jER l%HQڒ) v(IIPܟrJ[ b!%2I4S$$tI2I$I.Pcz685 wn[P" y.NrGw0lDʣ>ܸ~, sh60O{? ticdJܽE\{n*#f<E&}6֙Mk*ۜ=uMDkL:[2CDJ9D8.5v"%WSX4I*Xַn QKŗk{"2tukh{}J1.+yB{?6'14*O+`w)cۯU}\ %v|Y>c ½m$HEuFc=;sKZX6`n`ǚduĠq'7PY65BLͻV˘ gu;F:UVdE|06H*YTzFt7s-\xg = NVO@1ੵc6ާtbfuTd5!mdt w@ƶPȓ$YCDRbGFVNmc{W\ht(UwQs'JU[cCCA&+GۘHDo JWWʛtPϳ~&U_!?ܨqlGtsr%hBƶMoi/۔:g .:Q.uq KW}vV6@*WMY!wSfzoFeT5Ihwz|-mzO2K#q?I$rI$I$$I$I)I$u^{gYrv:u&N+XUgV!A܄9Oʊ(dI%"`&"ScJRI$'T覢Z#PI&?4j@थ$I5QIH pI':&k(!%)$H焝Ήg"4%)$PڧS9*Q%)$P=4Qۮ$$ICH̨O:$$Iݧ4i|tHRI%0)A4kx$$ID3,|O YvߊwNI$e뤒I$I)I$I$JRI$H|WXW&Ϥ>+w*?\3,(?/*XUdQ21I$$I:I&IJI$I$RI$I$I)I$RI$NJRI$$RI$$IJI$$$I$I)tI$Nb`$Y_k ta|$uR Mjnx|%AT(B3Ri #9Z@9JT!4)[QRIB–(IJI$l H5Ħ%AB:iL6 lOV+Qh3tX3ې8gg[/(be7+׶̘?E-a6O۫շ؈>a$?I"!h W^Kqv'U(~ExnL^v7@S'CuL/iDmn-N`ʻIiVY{MaavR@Ǯn&[2H)_kᾋ 6tǸ:I*Kk,'ޒ ID#61!Vcv58}!\f#,5rTUvQZ{~w@'= @-|45D[x?Jv4?X=beכs6>sZ0X)5+R$ PʎԔByBIEZI4š *]$ҝ2IBPI$IBJRI$I$I. 6FwUm·0$XNwdBA@hwql3qGI BG·V@ic27DfϾ]qVM/R5NV#˴]kVۈv k1֒$딲 LiH]g^6뷂\H[7z(~"0nCkK v;>~ZApM^e,*nO@Ku1io'STzk/Ne->zH?Uh XdZ^^B!Xv N2ZRwj :N+cu^V->R *}_!G֭p(d;4p8B#ޛ$r湎l66{\`*x"̆ OA&Uh*tu+ IWj BzelvL$&:8$_ҩvKHmy*AVlihHDOY6 +hujXsSPDALjͶgM&"Ou.E-i=];pB4Wæn{O!S&SS ;Wk .Ff]Pǐ<r:fƍOGHvI` OHIxeL)UIJ].I$q)+UtQ 2tef6Ҭ!I4,fC}66t0:\.&Zq "Skת*`{tdcɀxS7^%oCo3g>Y fхV,IT\ht1a%mgtașY.;|'Eg'[t"Q:K3IBṈwOuh6GBvcU$U2lx0c HS6_Ӭ5Ö&26 QOT݀@ 't` h50Z[2V50SNXtgZ Ү{2h*.f .}M̫o-!]n4A'_5Z5ƫRΏZCDPShl:w90uL[]gl0ձHcX>hzkr]S6[X<WzFy!7%]̭ϩg0*<1nml{Aid\iփZHdz;"VJݾa6U>MTc@ U mQ-s#3_ r?y $V=~lZI$I%)$I$IJI$I$JRI$;AU0<|UX`Sn)(M"#*!I%3dѬ)RI$_#e5RI$D!9P>"IJI$)*.I'!1qNH" xIJI$:v8I(7Nx2<)JRI$9)AL媙IDSjRI$Lq&cܤL%)$P<$51M" JRI$J~?RMԵV||,Y7Ԙr0g$JI% ]zULpWvU8ͳ+p?pbl>oQe4WgkKjI)L%1ږ$ĥ)$!2LtE8ILR%ʒuSJ B'M)-) `)5aKqPIS5 VT]R- \!AҘ8M8_d3;I9RR!*AqR_tPRR,i)&r@uJ=J6ƨ;&@PkF`BdղڣN) 4x MoYv#]hEDn nVڱW>jYI$jOΚƩnG0XӨ!@ )j52J,ͅ%KSmЃ[g,;nA~!'.]qHմDJ:=eo Mh#ՙAs5D5eQC-oWhxq#}/.5 4K!K'nf>kPu'4λft4veN[lZ{Uḫ!G}9k,zx[[_cxqUќz 4Qj> U4)Mi4Zsj'V8YXe.QĽ*YgS698NV!t9G3G ^,sG= [ecbٟN0OP=pЎ9I!ݶg*Cݎ4fTګ6ߠ!P2 VoAe -䓮Ce.kz׷  @ϬvgUͳ߿ e]X i偢L(~Ug`ibNTOR_ l jPεD a^ы$3Kg:YcTl]OUޡQfpR[/}dfퟹ_Hp]^f>!]ݴsZ-Ƈ5mTP52[⺽! RC|3wnh &h%U-&ֺQؚWOBw腿OuJ~iue)t?i'(vgOXY[XW x:ՠG0?WaW#g<*DjǕ-#TĮB)Nw=觷q$%,")+>S5C@kuB66u~4; 0eAp&ȿц:7=Oݭ.~n)TƲIJZ8VE#B>V"ߏ-!6)\F"1b>fUTs2%t.ɹ@3TYohth{>(v۴ Оʾպ2,m{ʸp#(% }A<"2iH;>5 *2rǡ>%ۺ5g$ޕ(A!Il#Tnro8ad,'mo84%< pL urm,Q S R DkRJGګ>ZaC3\,9!۫L8wE,wMeiʍ~ &Ucj?QyiecPƈ BEl F3=ϼPcD&ate֬X]K@t쵷L!cT+^+Yg|cdriPGxEǽc2;>m1j=ּ{NIB6/R ƍ;j-PQ"Av4|RA1 tu $I.T'I2A"dJI$&HW)H@$)RI:yLI)hNI$I RuH^L0I$T\'I:ISI<)LJZyI2tIJ$I$%(O $I$0 P&)  0[)&N'mH(D,Q)p la(ShjM)H')b PR@!0 idJJhJ$Ҕ)')$)b(I$2tb2tA JP%$Jt1N'I2H 0D:d)E<&M $Zdu'Jj*Z&!:He%S B}ژ&*PRI 6%6$.gϗ].o*|Gy?(ŗ揙!w]_ ]FWBI$*nI$I)I$I$JRI$1]F/QYO?,o(I($I$I%I$t$I$IRI$'LI$I$$I$IJI$L'IJI$$I)I$I$%)$I$RLt$I8bqGrB`p4 ap@w?h0{ INԦo*r%! E49 %L$Bj' 8Kj[B%hJRS@)&M(/rO*@Bt"@-Oo'uKb9mN{GkG2HujOɿLϬF8',ղ[n`k?}v*֗P k^l6kF4Uװ`cˉߦ?PyE6jx9Dij]ӦoP- {זh:fT)?-2ݣx=u$VS~lu^b|܁]۲Né3I<*x, $qqeBSw֎R;Pd:rݒZ\ݺ*Rs4OaQCI Uew#PR)D7'_-h'q(NOQ;h?Zk + ;:r绣gelv$Ee8q[Zmf}U]R?4̖-m" zn0Vm=tHnC6onQFYswV! &I= [!2hPs4DH%J_r\HJR@`J-l"0㤨mMbS)NH9Kӑ[%G箷ug) \kۺsUeVD?W)m@ͭ4ËL|5btΖ}k VPnvx1u`mlk䧫SH1>*xPZ\UVjwrz~I- 3lkĄ3NJ&׶`%cݬ]_N;m{$J'Tٮ,ݱ¹Һxs,'Es=DcYgi\G\FE@SԺWTkI=Yݱyi`|m:GȼH">lu7h-;l]ʇTsی_1#\>֕Z8EۍҺUWXv&TzuW20eg8zQ:VdY|՟U'V_7\.n@Bi;+jfL/SZcHS_a۬V〈1 -xob8X]dc]6";귽VN|% k yrQD:( FwM6D1 tu~[d:F4QgK ϲp;\]EeKhPf;G,}U8Eۓz5T*"~=[sZ{,5xOXϴ?F5ln :AȾu0CL:sv4I'kGH-cw 0:L2A Mpm]*Ξдmm'Zc70 @G&R: ]F:i>2مѹպu]I \`->nmnl<"'*IS{۩"]vۏ H {'ҁ 8}jk,@c[K p6Q&އsjbDLWձowjtgG{U,l{ iò$>nVtܚ9 N۫ 5}mĸg2a[Xr4ꚁװ] sѶ5 Q1z+s[1]7b<Zv=\lG{ˏ$b.Y1!>#d(P6%-jT'jh*ǧ)BJM)J < Bdw0(JLqO3_3}Vy35?"]xpRfyOEy`$`|UͶk)kq$:9DI9?PxEJI$" I%)$QwR:&R$ID%. p9QIJI$)'yI%)$Pt'*[gcIJI$ &Q6*@$$I&T1Ʃ)I$EÂ{@5I)EiܒI)' ajpI) BPG\~DYS_b˰TtZI$/]$I$IJI$I$RI$Cr6}!]cVaĿgA)Ww*®S$J&F)$II*I$I$I$NI&I$RI$I8IJI$I$RI$% RI$$JRI$2II$N$I*qjuDJk~*/IwuJgĩI3v(œJJ(ɜErJ P*@)P؛iEږ) <}[uIRZ JTiJFcTVPTPTH)bRktG3Wk1A'a^s䱇Hvf+٘d7}GaTp@HI$⽍-$;PC)LTvʅϱhcdQ eOA lOdiּ# Uzr~v)]X!M&LwN] q$%EƗ-2I IRP[CBgX8x%$k͇P'eO{K@0J\v`p8ٸM%+;[$ I*{m3p5@;}Gc Z&yL>n !!݈ݖV! Zuft·3:P#5?]1 |[1.OgK[?qf{?oW3ь.-}OTˠp˩oUK7?HZGP`Pgb.vˁˍbN5pj -0*IR)JD&Q-t"B4N Q-FH3:]8G*2 Ji0rN04#ŽԭLQ}_-N .i"oZnm@-> <~[7tiI#W5ןG>XǪ+ubI#1V%Է>b=+Viap;8:#߃^Q;):`Jap; MᯯDťGS@h<lųX}왱.Uw|Qss!}/<@p<;@Buf5":x#d`T59>]mugEjs ~a Ʀ>VG;*{\A0 j跽'Tnf擬kUUo /{e<'U1*y-.s 'c(ﺮWS]."eV/$7qncY{ zt|l6W{< 7b} 4uQoZ=/EB|uکX[$ nD; |Tuo0VF_M0nwe[n=n簁Uk^hq"+<^#lcEy15"u@vuYϨG U喲0N+=XB<Ƌ["='OyQ^@nMv=DY&UC nVZ. ʸz^hkt ^Ln+{OL0GE-g̲{L~c. =6xi pLjf+XSI*AU%P7lEuc2Oh?9Tv>G+]Q0!kꟺyBJ۷wZ;Ӷg¥;v^<~2"rZ :cv˚ZwGhB>[+bFP_ƖQ yk.->.Zh~ EsmyWRi~(5յ#@m%O[*Qfd~пu- :hkvU.{k'HKڱ=`8.Q{]ntGaы(1-K:A)Cޛz1b&IR o ԶkW⊙yCUSuF5 C`ILQ1| 읏a|O9)O|N (rҐ!p'_\@&I0NmtNyӄEJI$:(NRI%u8) S&RI$H @R#MuL4$I<'qD$$Jg EihGIA>~( ))I$@~jDO)jIJI$ D2HI'At)D{Le%)$StLR0$$J`L(1SA3O+TL>,jL9NrI%Yz$ ]zf?LWvUXlc1CG6]ߕwʦBe4Yh:&:t~ * j8sQFTo ;Qnh"HҸ R1vo'֓]0Q(Caߤw3$+#]JC *c?1?dԩFyQ5-,.{tlwZ-~; /6S IZ~Utt*ۛW,L,CjX!m]mObV$ 61X}y6ZAThՀr0r57" *Z];nïUȣckԢN*cl\Oe zeq.iڴp} aLlK2iu-q7ڿԉmSpX3-O^?KY -2 d"&y;F-fM lFk)fOk)V?l[J$TCt  rZ9WLa#**=^>j_ծg}-ǀ[9zu:#sUPQ[ݤl4x4G)]w`U2?ߪͬfjT,J*f!Mkߥ:Ң],sk$TU#D70neލn P+clXQO>Numk$AWYY-mϩW0m4ffPۋGs8XvO?oM-~zˠXi~奉vٛB,tmNK[%kcj`vUn!T^70y(3fG~TGCDy*cߍo, ) ^ς+CYJ} T$S~0GG ןe,k:m[{lc`',;^σM6QP6Sc\*B4Ij- d rӠlL=7 ď:؄IODz`tlÏ>*XF Df5$@EL?kt</Ne5Г :(:iQ"Ef5G`MQ=U}%z9KvnGf4jf)k}>.$NJ✺D̍` %KeZaqmЭxtu*L.e$j{+Z l!8O"ͭܜ|ەxi!>#R/+|ϴ'O@=G?SU;?1P}:6x& :O ֶ 2[BU.k}m]tWsO΍)?^GAHxܛ:GtG0Zr_X׼"X4}Ի OˍX\G՞e2 p2;#UV!wmGEAEhQ^D`V[Wp 6)osdPb6emvX 7X+,#ve5w5q GdSn]tJfmuQЫBecQm) }80AіâBķϒI$̫/,+1A;ءpT.=?;@')鎞-wo#o$^gOAo3#?+4b I$i~j\46{ UF:-\BáL_ձ Tձk#yʇD1QuAUGwLc DoɳhZtB+uԲCmeYws;wCI$[I2[QR/) ФfT@F M I$J$H J М'ScRL@c MDڢBd$)<&:yJSJI)hJJdRBP:IR iNiJRSIJ"&I%1RRB I&NCLZHJPC 1 d&Q!%$KORڙ$H1$$&ڥ Q (RI%#SmEJRNS'$&G5B!:u!FT$I*LBtIS$&NBIӅ AZI$(0LBQO)QI*M,S)Х)JJK$)JTS$(D!D#""'\Wz/OX?F,4|.Cpw_ $Q)I$I$$I$I)I$Kb7.]tWFEgY? Ho($I$I$I$I$$I'LJRI$2I$$I$I)I$I$JRI$R$$I$I)I$I$JRyLd&IKE:-,wѴj~(HTkgs"_BNN)bgj $JfI%9O 0RR0 >CM 'JC-ҔUJI,-RLL.T'IJѨF[xqϹ6GCU3%ISr`׷u)ck4)X707  eDV=ܸOugkE*pD芅ۚ8b)I MrsqK@hP)$:i~e*L00s}mxmVa]n,׿ѓB dǀXYnLJvJc,Z5\70OM,1D@ͫL(jtM.}.Â{,s^.<U1k\{1j2xIWffCw-'?E-r7Tڶw~r:+gM9 BIc!A%k# /clic-"=je-֎)C;U69c!g@M% 9y.q$2>/ڞY6ZUsm $pAeq*{2\^ 4] U_n9Kȍ?LD<4SnCYZu`#ck+:<rzN 08լ|?,0ݯ VZߞ.nbxQw}c@f[jt8t$_Sb9tmq$4NS^} G +NomVs]#zf);Mv)$/R(ֻ J궀6Ƌ7tkTݮoz.1&sOܳ>YMlc <3Ŵk[uJXh%`8$'!,0\c;FZ[H.vP2(qX"ߵ18Msh&U'd>`ÂUfdfKHq~WW\(umV j% $wKmZqsvνuԎTurzF>U6KbUC۵,N{c0r:SγEkl X=w_Mޕ.̕eX 49]/<]2G#2c&VF[&HêKF0st8O߅57Cu;lu7$mzl'Ճ ƤU]X\@29zR, ].V; `2w;.H;Y]w Oů/u4)gKKtG㺖6?Hc5'>RqŴoӺeWR,PxDկi?.cj11phXc_yho$f3 NpiiEg;q!ǻ{%yu7dFҪmf`LBOkXHx.!UWaX<b>vcWA _Юwm 7OLuIRyY:nj0'"qJ֩NH]}[Ri+.`<c]qnؓt>~e G9]'ĐHwR0:O3/[R=3}^gQ>f55)T A~uD:;ޛA uKSK$UѰeXGmcB43c4C8zGOͶb?~JF~Fub9Cu;,4wO+rs]kjNO oOb"q`j5PmCnGeIvnemn<e|}]~ [Y-uukc@aZvA\\Wع{%?R5ctmlry>^ݶzN%O=opDɤ:6 vOR?"m/q>Z^75gV3zV tr%rBтL ke US [ =ۇܲκ x*Wu8@+@} u[^;CI tvMޕFx&HqMR@қZ^A"@%spW:n' \HnV=>W.C:f;*fghX}c:-Z#D\ kXlvag@}ěswVxun^Ο CXH(ZL- 9 j[TLSe'ބҜ\)z.Lr{UfBm1[]-#G:~^wȡFӪ-ƽZe34k 7HUm׈s_ PYIe ~䔤I!RT ))I$&KrI(r]$$I:@L4NIfxI&D2"A%iJRI$hR#13JRI$wR><>I)I$ntM$5HSIJRI$>d` !ERI$̓|8|O yvߊwNI$eˤI$I)I$I$JRI$H|WXW&Ϥ>+w*?\3,(?/*XUdID$I$IJI$I$BI$I%)$N$RI$I$I$I%)$O)JIRI$I$I$IJO)L$R$IY@䝢L(oqwMRWOgB S .5K9;TO*AAI d$"ɄhJH! I((JA"Q$E$)ʊI)rTSRcd3'wUh_sCu+ QxVx5=,_wzxis/KKU$DRS]Bbe.9QPM8qh!8Ɂ':I).KGu\ .$ϱL)($ Z6ϷJ\"0%o%إy?;5+ h.HùDRHA,84{nsAUFk¯~%Y:o'Bjp׍So.y:7s !ưT/ l&9N$1X\&urf;k+Y.x4@+wN7v-F)BhILjTVlEfZBSʅ48:N%3f #׋]FUrm9R-UH5b2kK?OT߉ a"?moE_nUVڟk8;r9j]@$݇E hadjHڶ:u)E Tݑ 0Y=F:F, 7R+v]F$пcYG7#Φ֒;WĸN^ NU\ٽ c1>K UZ]ѠBcX\uT2@Nw%JΟKtOwLP*u0uT0$2VG[׏Hm$2jn,\\D Lvmvmy!-JsgJ&Hm]M755$L+61ۣT{C]^>d 505e5Y͵"R>K\&< sK5E`\<8bGoMXP P[~CZy@nƧc;w-sLҤGJ\9Si^U<Ys|x*@pLI@ nR#]RH$J JE)Ld$$I92'JRI$F-H|$IHL^`})I$NLf s;▱dID3q$f#!?>)I$n(-DI0& wOL⒔I&wO'CO?|& 4 RI$ r C'.RRI$ڀNGGOSbɼ?Ô+=$UI/ ]zF9?"|]zEms1Cs[{?ʻciNfF(2HN%[AI:pRPT7?CJhlLcʵpAu c̩8  ;b'r#P?jcsDF)AD~p~9cPhV 9 *?)7*w,vL #T)~w\߹iLScAf9YTdVˇ4"Ԝ=%{ 9o(Tlr{0r]@, K?0Xc=~aetUoGYeo0|?c=gckB~7kGRXkxh`A$n DKWTW[WpjVcZE:ꇒK9wyEYSccfes XB,|]8TOXҰ:B`EG,1:ŧ?|ٓ,qWm@X?)qpehmoϊL (EЪ~ߤ55rHyF#[f-:íS?RnKUvR\^G`%ƱGW\>IW8p?I %z{\X*]C>WliչT7$9,G2윫;oz1Z4> +'_VkO%i.ť }rDV74X=Sdo۠J]y%GOӻ?^Ͻ`O<yqJCZ^;j8%I;q];F;֮~~#[oaq)zU51G~*C4 @9]uem 9/4d 7X}) EvEw}b=9 `e`ΓOM`좔]z.e77kte.êާI0+ Y5kgD HA 9M ܋}y+yNWYMHK xJjMbt,PG(†)w'D 4`9X .;]oG9 n|9F'ͧ:uՎIO#L_tws,U^mc[M`Z8}xDuA1'"T.y(3 :@=|JtnyvQ , KDGZ"{ĭk1p]1nCy"AOCEdH\T?M@]v7znn] qO.8Q8Ե˾C5Vۺ.^(sw]9-P&=D #C ?yJOٍ%3껬0t/O\Ħs⨻m$!>ΊkƁSk{kz~hKOޭZpHoefIA~Ktt!i%xk&K[kܭ㑽π"bg7R P;!tT.:TXv*^eh;)t`|xIX曱c5%\ý0PLΡ$l/;6C9@C:cHCa;X!WG.t-{Z{TH}HWB܌>zU'n|4D*#ZfLr)8@:;RP?W= >m0&Ly.;'eP:Dγ ۞AOv:~JY+!SU﫩RRgE?%gA |֛6Un} JgNF:82a{KXI [2NZ^cEerun.1 ǿ.l4F(ܷ:L]t0L:e.VPYZ>iǝvt(N'Eb|W;!Z#=?;U~=7Ob.Ǵ]mϠƠ\[[LNW~`ᇹz֛.eX+i!ĝ6AYkH#U ~ͱ1ު`sKX4%@t@0ok[ctSˑnrf8xit@}aŃ-}.cI: Q .9e2Csh{*p; 1Q\vm.%b܌W;DDBw]O܃׃MMt NfL״50u.ȉas_XwӶ#}V?ٯޤ8juZkeCeհ3-ݽvG'H'WĨJr(n *n VQAI*%1U .!##ڵ"4)wJ" +I$L vy$$I{p$I.;&R'8I&ҍSpI'>A$Jo$I)tG< '3M9IJI$$R$I0HSI('L4ܮIH|WZU1/fYPr_ UʰID$I$IJI$O)IJI$I$I$I%)$I$IJI$$I$I%)$I$IJI$I$RI$)$$vƓOwNgu1RJp|JtTTcv E IQ!Hiҙ<#`I'I$I,I$b(WL$lF}?PqƦYiHYr}BÞ9lf{_mkɼcTƗ@4~>)54pD$ x 2].%ĒO>K $ģ3ϩׇb(Mqii5&c` QZ2"[ke4j}.,r >[6! }6Zw8J $`#>)`!:x10``Ԫ-3v:43T͍ N$j^=Xd~n ^@xFH I:@&&;!JLT J} $I 6=s6-!ť T_-MuXxYcxhx8H GUݹZCd;k}2f4mpsZhAS7[ {u.q{k!1 Q(A)BT$}O =m >;r%3NIrQ2[CZPďp|AU̹28M{^<6T0~j;HW̱jBp;Htd@kp,tO[+c۟%v1Nިʞk 'nm1!Pô\㴐I pjv6.=FVk[C :Q ZA1R [AkY^I&4R>uF9LaR0ڲ:uI.o-piĩ_Za $i:-^{3$@_V,Td;+23sR[925a_L״đ%R,#^˩/a`H79BgOpp$ !n$@hu62ޏn!4V-9HӄOaA AA~m,;KJ}Ցkt֑N%گe@EcZZAoh\_pvN'F DajϐA[fgY9TjY64=;O qOjvOZVAAxq"D`<9oe +y]ft*X^xnK% 5⃙r@s0yZ,HĤE+tp[Wp-$et!j8\_ ?t*W`s욘vWq+-3>hUfoX\Isq76{UJOO%v"؏%Ah5cW >31:+DŽU3-oxv?du n $i~TS 9̡SY>skr}DD¾,xV:vG,sni<5];6oo~t$ fUUpW7vcs'g(,s[.$G7s\<QݑBȯL^P*{\ TzA:;GDap!W1NHs0~AP˨HVgKI={?視 @'"JiA)a$'j I$RɓCN$xIՇ:gApTCHu+p#WB;~hSHRcWw5IvVcT;w3y:sײp{`Rn AJ*dI( ~ %I$EڦRI$D RI$܃)8L`a%)$HzyIڦIJI$L8RIL[G )I$/JRI$8'ktI uM3/%)$P:|9Px'NГO0RRI$Bx(u4RZ5?U>///O&SIV^I$ ]z=ͷ/8_WF߀S?Ww~U#g~TT{( JVekjQ^ HY_ yR KU@\ge1% ˜4C vDR3݃r4$5$$FE璴: vz EJS};}.,`<=8TZc3ٶ" *a7g@Ί|Bُ-Zbbo٘)W/d IYWGL]Ld|Gbs-]gOLB H#{gZ_-7kRXzosv(8 wI~zF}9 />Xz#>K7b&fF8:<Ҝt-G^}ܑܼTޤyV^M1&WT01H$,Yl$/'!$< Ͽm)|]GstwZ3epΆhӹ_IwRvHc$qwX67B5}MeuuB4=նL41V:vTrQ,2=-<*2r}ENvZf=ORD~ʫ5Vڷoh{k}ݨ GM'nM;4: AbݑkE!Z= 6Y{ ds5>n;N>)[WpS}e)m&w ~KtvUhyƹX[{(=7$ESEu`]dn ʽ=/"e8Սڮ?*A82(6\o>JEޛ|:m6͖ *:ByhRE_bU'z#=c .u=22\͕B{Zם?ugfze͟H1_p$sDf[,ӹ JmRu:ambG'_ fmD@ݯNe5.m9~"?5Ѩ7Nf@k4|zZkė-7l@h\${Oص "HZuT/F"be]a0WvS\XVjh-DX8N*o$ Ys޸W[p}7"ˉe6~o4oAoo`dp<}6T\#Wd<k=Y䀛칄p)WxCLu.IW$)g`gyФqrwH8zu#(Ar>G/EGy!nriuWz t6hu4LHP&4pC~[- rZxC֎4J{\q~*MB$vqtVVݯ6d< NTG=Rĵ{Z h "f (HY$A2I%(I BI+d<$dR@ [M)JD& nM)$I)INIIJI$A%)$)&I$ I$TiNSI%.H&Nd%dI:d%(%RdBJN NB)t: )IJLS!<$S1)HS(,P܈)OR2d$JbtL%1)QLr$2E$'EKʊI$ Rd$IK(%  A%,NH!gj $JQ %"NWiky?(揙]GWB]FWBI$InI$I)I$I$JRI$1]F/QYO?,o(I($I$I)I$I$JRI$t$$I$I)I$I$JRI$I$I$I$$I$d$$$RI:Im2M)"㢸0vRPmwbӬ2NyJc6LpBA$8@JGbI$;5) @杜^ }R O%5 NC0t21NL<$RL R$ M)2d铒I.5^WkMα0V@9 ݙP?ܻEC:9Wz>v u"ppqsuﮓf~}K@e!EAx&*`ZS)ma$r,u]LSb_b|R4SX7q<'8ֺA-8A!$7ckJ)2wX@$gu`]P0F}XH"H#nqI0A^K V<!%xZ\a{ 7>aúknu6<˜d[,5fhɂt)h{+65JiLR"˫atGZ)r4Qf;K[⥗:NkoclgpO4$jT-&[jyܴ~HLdr9 :Xl H}apnNmaوR#Q:(.$P@GggdT2),GN J3 e×O墳Z]&&?5T@g s ]+'JV+m{[1$ V2q>@"d*М0-p^%b &yF(y4:m04RtbRUcp{p}y.>hDzEbHQ$5U{Zw󿬒>>Cj>쬪%\K]=7{\a)HWU Dm$nwCiB@ gK1-emE isJt'(݋m-xA@pW_<e8iqX>G-ʭbFobՙXnail#NUndT7{]щbu*r/kZHxZekcsgQ*I$6|z(:B=$Gڈn@G+83)yZN5 ?Wk>Tl1a t3?r+ck u+._/KI{@(&ӊ8I湐PۖV[ns hW֎NӻĵMfc|oZq`oJ -O!O+`Tqgi>RgimГ BIwi+۱NcU<8]w\ʂᯒ>E95;lu\qh{,CHv~%j UOJx2A?4A3 Z]3Y eұókt?.|a\.c^ ~yĠ*Yy4-ӝuOlȔn@qE:暬um'BGU@ V3.{vjoI{lcx+*^L !4dNz;L|A=yoknu# c7w-8iHr dN|o8Sgm9Wm6; ::P3lWUk{vGJ>!X3m^_r['UҎc_aX* 6;E,{SeZ]c& _N>LZ ];m112=z7GA_{L4_nmo&`LL 3f5)f`ӋncO#VGLt}%U?X0cPYgL"ٸhDpI4۷c|5Wki0 +?xaK <tyJҽލNs493tVMl'б\AF3!c1WkZ u=6bft0:@< \ʏ';u {}JQCϤg}w)Ϊ:n`Lv){228_2skfFCX&/M~x7PwNmO<,v3]kAAYS Zi IQx&Թ#rV\[U9dF>^0[y'v5$VwC{r>AsOvq6PqM,}{Ė'c8">e6tۦ fĂxV1ˍe߸~Wzcp~?/X/ % B6 al47@?VF3ib&{^]Oͣ`N$X)#A QUQS$I%I&H)(4)8T,.lk(w !%2 wۚt$ *}w6@)md)4y jȫyonGom6{ U;p$*'nTH hh )I$$:HI*I$~)F{H IJI$ڦJ&xM )I$׺vLZ#HIJI$ $5AIJI$;o  )I$rN9IJI$vx“jGh$$I~ZAn!I&꧔?TwQkdTbȦdǗa7t黬IV\I$I$I$I$$IurlCrC2RU]ܦI$LRI$I$I$I%)$N$RI$I$I$I%)$I$IJI$I$RI$I2JRtNdR)$;DQ&8IK(ӕ(L$rd4x LAdަATa52 ( g)ژAG(E ?D%rOL<SI BRLP.d$BJ]$&I$9+JIf닆G6Z<6ftAGߘe0W;1TǫcFZǻOX)@8t~:*x|bƁ:I J=cv"2eDx!y[8A#9{[xyC)XZ8`JđKw:P?tb6$$fxtyM)JS(YxdLj')⽌:ṝKke.k]>$qt vd1W0I?Bi ;' };)C[A-쮧P#c?PtGh1kKIJD$S m\\|J RyxEk5~k?ꔩ\ 8Lu%296 L-ĭYԴƈNiD AƯ `&8F9Av]MPO!'ʳQdJ$:ȣYу:S{{$i&F7m:Ɔi2I)iEGIip-Q (iۋMpb54> &8A#eUۄ~o"cc,CKoWRD̂[P:P8ۤB_I xe<"qcU5oUev#bfӚe.a;ggZK\#B š6>/hw;unD:oh[ iM {xp-WGyv>ܝW3wٙ-wRoWW?V8^掠?,Nw+w7݆1}7\4?b]ni-'r6GcYƑpTW֜N; c'z/tm=ޛۨױCŕ:fL, X]YY]Ik;쭞dD6׵L)U׬Uwjqqsg0mLOSʵ{s[`VUY#jݡѩe;DStL>K?7&ƾp<*yN~b%TϽnYQfmaKenВ8+KW~&4iWr{]܅p\>U26 өP[UֈK}4o.HcC\ @*NdRH9ZmVѽP n =<$JkVitlFd>Ѹ5וst}845#P4NNBVu+ nAL>S>U fzYh:#Jh"֍ⴺ.%yZ7b ߫M-Xwy 'q@!昵%)$Qq\p%)$Pϕ)S|!3I0D-08NA)$I)IM?_6///O&SԒIV^I$ ]z s]z^;Dȧ#?W` κ~kUH96ԔacJ%q8PZe9( *$F{TCuLSr4L !LH$1*HiN袘TQa8b}AI%R KTW6BtLI`%<)$tJRRД'LSJIJJZJrSJ*POjjIiI-4)BPQN$ܟzC%J DSB[aU4=fE:6l>#@$7: ,lV]Ƨ:5px<)3C#9Uii`xSͭ/#(}n}Zϱ;[Yp-ƾ{ִj!Zs'Hi BoM~f -{u*@v[pZajK,")ħk3 G=W Yvn9՟Wzm= D&45h◭r1){}:[Y~\=Ulu{{~T='<'UBaB:{B:T4w5ֵ>XUvbbk?ȓQ.$& NْJd蜁aZ}w ?H$'Bl\mIڦRH $+DT@JU!6BS)L*6ҊIAZ"ڞSʄ\) (S9L)JH`Z%)QS6kR4WC-$ҖFk$%Qi)Jr)U%b[Q7*)Z8)mS!8lo)o*A(V=J' C8j[R(H蕄Z?bDڜ1>=!؟b>9)J$'EX)nP%4Q)mD (MzBM M܌+*E68SJdZ*%Xc!I(LJ!Q-Í PN5$T%:d9QI!t'LSҒ+JNd)I4iI:J^R&N$r@NA"aIEI&RI$$RHI$J%$I$)m0I1O)"(*I:J[rDNRNПjD&I*%):I$SH$SE(L0( IR'LR X R2Rr2*E4Bt2pRИ%N))d!$I%,I1NI1)I$(HI$%,TJp& C'Q%:d bJIJL!8)Rr).gϗ]Lky?(Ó揙:?:+X$-ԒI$I%)$I$IJI$]F/Qrb7+8%-QI%#I$I%)$I$IJI$I$RI$I$I$NI&I$RI$I$I$$ӦNI$TI&N$I:dI%:uUdJ%]6If#&yVUILP #V`JA-+'^ KjfRP~RއQ0AF II)nP.MB8M RJpP8rԡOj[RRIJPޭtVn̫ ˬ}nmgk|;rrwi3.gsgXlۃo-js+{Ms׬4oDf2`I*I;p/SH$1)r-0U^C%6S^^ltQe{^l~D*YW}`4 )L{]nsH% RSsם$|^mxmkq Xe5o)5FX6fLTsCa:)asvmVS uR*qd괥)C&MNK"un,$hFU) wێ@$yp{ {N;}544HIU,׀Es{H8@Ln=~z܈)6˜==dvU)L묱haПVZAP"NrF3imP?5A JdH* < .-xٝLjI %/`x6Y:C!{>B(TaJ!%:Il=.%΀ F*aɒU% cCi9ZJI%#-LԹybP/5 Il h-¡ \ ]ct)傢X5 WƯ!ysI#hR:rDړ_e.kEM!{<UJe0x e8(ѻGF◊Ԥ@a"wGIEn*UFkwlJ"N9@ dOdc$H ߪ2Y;0$eTcgQ ?!#Bϊ`5w ƚ=wT)uNPd߀k%oE^05HB+-s8$*CpȖ9;\Fے!K V8X4k]>#PӲW%۞nŸkAeuZX;~DO%nu4ntau\V7ߢMcuPk/쾓rCx6>[ז4[7?.1qÜa'RV\--vL+#[yDhV \ʯXQuKݜOGC+ǬShp-E_uLU3cﰷtG1%K׉.}}PϚƸj Fq$ZzfKZ8rT[ M5[sZLDjˠżIzcyu4yKm!uo` )W@VR#8A:䱻Zo`}h`yG>Pkī}ـ]m4+O8T若JQ!횯.ܼ.C)mvH-*VfvکgG%u-%>s#bQ1x .uÃpIh?@7-[wVLTn'$&#qM,;|7GalIiNSuP1P{#}QM <©3'lʏG{FS7Dkϊ@> Kt[:^v-론"VNk;q+KޙޕZ8EۋӺTV*AlPN4$¡ԞK{)tdGvVOYdotH&d;8c?FOO"?'nLj]^z+dAmHryiȰgHX#ۍhWvO<8`WiH u:YjHAkr_+"VSv\ok:Ss@Эvszr+<dGcGqp:x.i g9f~*Q!6(fH/{~0aeZ]eNn:Jkh@"-[>R%hcuWc] F $ ĕΉIub#3h~;I<_6<1L¥(@lBOt:7YgV [[wN-o~3{Ilj:ݿ(l4\3.o0f V9l;" Ѯ޾6{k.m;s4ԏ?Cec0$J KWi JrPP!Xʉ(rMmUrcQ:7RS|=9r2'2L15#P%@jR) -JϢJ@K]sA&kúo5TZq?94( ZOz)cY688 !Kd BtL[B $%I$b!(*E4x$IhI4gH<$$J1 ""9RxA*I$Ie&駁Hxꧬ$I 0O)%)$L@TmL5EJI$`6)=< RI$S( jRI$MOe<&_Cp_c˰TtZI$]$I$IJI$I$RI$Cr6}!]cVaĿgA)Ww*®S$J&F)$I$JRI$I$I$2I)I$I$JRI$I'IJI$$I)I$I$JRI$dR$I%I$dIJI$N' !PI"!Py T6J`eDgAHNR! BIP \qc\;Gd)턋QS2{|BڦxIL-nCЋ JI) r}{RMmII%)Cޖ0@`=%`'*-)qjaph' ,e~bϭ xxO՞nc$5YOT0*167V)91eOc7M >Pl2:{N(ޝ>xn. 8o!8@I xJI!d[wy $$acW2=0H:sT3{EDKIHA[)1pU|\QI(hJX P9k "UYR\[P^74(v^ZCv))n 1ŏ8riחBuOǺ*IReӼA?Cj%4B)es6y/;ZH@ވ=GmʸDo{ZL@1 s5Y>5nR@O<X͌pp6S-D$;E=2ς#ZGBH)yjSwz.8LpSL$pcU8Li)È c S2Op4}H Jf5̥cys3Bh88q w 8+nLDii:d-t_e\FA0 .B"G:I)έ&C;$j pAjdxL`> )p!:^kBC?23 NjgSpo5&7vV;w~goiSE {BS ƺ#jN"+ -O˷q?"{$ eVG"}j^6SfםKvU~ImZ>( PsAufZ=2M^St^=ʛ ?1z6hZU[ϮՑ+zvHi&Uqp,z} cjw=>KJ3 ςȗ]vd]PlC>U]7e7Sc?Qkǯ>MN1Ra$g6@1 f&)M|OtH#UjQaLPu[flŲK|!eg^~K@gnmt73aJWVYHL@M[+vO4ϒݯbT-4b!SƨaI2!:BQpUcvJW:uKGCDJǷ +]ҕ:6iC=>`6|ZX%Qa*¡CK}A17Ǒa OSȜvJ|y[} V>U䴱VU2G.(&ZlM/eiB)xnPch~#eR r0}TUN UG[eұi!ÿ,sUk8{i-[kkv<^n 8m ¥ԃpڪU^$i#U2QVar.d܎Ӫɷ\CF*U )lOľ (`swOJkkvʏ5CAϴaX5[RA,V p Utu,NmX.OT~Fk] 'D:*F;Sy"I$!8!$$LRI4HQ  PNRI$SǴ)BpRI%p'p$Q:Rn4) IJI$hAR0pBI%#R T_2TI&1FK:&hₔI$5RvRI&:wM?_CIP6?Xo90:aI$U뤒K ]zN?MͰWvUXͳ)?WlMdCc]ߕwgHa$%^٭2$b @~RI%Z jt'JkTv‘F yN5L!ht6(H y!8H JE1HO):J2E IJVETPR+UR8)I(H$8 BxI2ZRRɓ SARRHH+d)'h==S&;(㻻"mzCv\ ̷4Vlp^ qw泺uιۏ{8 duK'"h& Пȥ]dxM6Zݹ4wj)'QVY]/ jsREu]n+ vѶ-'fa]ҞiϵP%͇4Úd5ԳwOfcsf)f;#+@ЇmY>Wqs*dH DiZvh*<Λә x#S@9:?Z@T "{roeLErK%>D7%5H6&'ئr[F}^O%> J)E騚ՏM-{ܡ)%545cbL"nM*؜1X[w%)˭bxQ\'ؤ((0$)!R7H0bT7%)$5(R V6&ڞRR9u ORRЖ&؍>0R*-5S#lᐝI-K.{R2T(R)JeV%Qs(8!k0fdRPO)ֹޚXbpTSĂZMjИ)N &JP%VSmr'.LJRSUhSHe:D) nS &!$)h:$TS%()1QR*(AI0Nd\:t$I:dI$I$I)II$:dLTS NS I&I$IKE0NI$)$I$I:PI$L$RiO)t)LS "1H"E JĄMLS% MHI'jSJJ)^RВI'I*%EH!@ " &D,!$$"M)'I%($RLI$%"RŠtĨ"$IR$H)(IJ*H$IJM 'JR &)!H$RI NP!LQ\'/⻵}l*#݇aGYw#%_ v#%_ $PI$I$$I$I)I$Kb7.]tWFEgY?_<R[*I$d`I$I$$I$I)I$I$JRI$tRI$I$I$I%)$I2t)I$I$JRt&I:P$)LJI)Q % !t)L+B;?"lU@VA}ؠI^PlFvY$)՜~i!!UXu`+{^w0=&鯖xnVc{q.q/UgW?Yo bwEL9%wWcy+*d:@Bo?Yޞo%7oT?5p)~ܧrTYS4ltOsofC2x*X,iˌ`hnߣY\z|,yƍ6NJ-Y{KIs% }$kK@:HudWqpadɹm.Fg0k) /)?E /l옐t1EGJJ- 2FK񝹑$ hd:XDx}t5ZAITvEg`t?I$-ЂtYc"t>H)A/$\{kf> ݶ$?U$IaHOf=}f6w06v$ɄxƩ.ټz w J_E3}yĘ{&RǧװV%mf VZʣ{wWWLU6]>K0n1& !TU2w#dj 0p<a"m VC`aNBa"'NBSw{gBvKd</R'Wz}"eEY,̦Tmx$Nm|yI ),ݕhgZH0 'UCp{:Cg&g\=B$:vSo(T C$oAGn=pi H52ccr&g>Ɔ>'arC3ipXJPJc&FݮkÄU@TD,feTlc `(XA̯L vBZm4XZdJE%@'l|g丶$ɄhJUǶkgh /}R<ԙs5s$aֳ3lALfQ*>cguNa'XFWwݻݸU;ku]`rS{~򓸈CvDo2X |=aC53"ƴ80xDNMF0yCfVX\ uL)#z:ʰ9O$Á:*u *qqp굴^򜋴s_aknY!*,`[5q=\NUlafw?Z LnhuxVַM;]ِ]Ut dtz3K:)cd{4K@7}KmuUxV !. $j̋>-ƃ u>y̭ōi}}|9y,NSͭqiv8LÎWu2{+{}qf\[PR$m;H+chã1j__kaP8ezUV]gWWB.'Z/ɻڴϫke;BԺ@ŭiJB6WqADT_-Tģ֒I:)%,G GJ7ikp|n^0kq ~v+E^S>XD1 }fYv54y} qiv8)qWѤmtD[;Reqp%Z߫kKpB/Zny@V܋=$h0LMu9?! ȜcҨjt-͎۬:Iv˺@ aVh~}w:ַt^.ȴi"A+]}vO|NOK{I3ߦ%]2*7G#X#_݁4i,뺣@I]KhzVIUQs:EDÈ$ Gp9^ADFq:x-jm8;u$X7dž7Rh T/VE7{]4.-R6ֿoT29^1Tl [[U~Clr;,46<V}Y*}kd6SS4W6:\\O!XD48Dk}O3qE}+[mkYPƾĘ0OQ9F̫Hߖ\S\׹i_t='.C͒j`R d &5]& U  $|햾]cu\+PRvec˚bO%X.}@iWEWSK9,Gu 8v<kŗU[ 85:mp?m䝧sLν ݼt9䩳#!'M{m^{Z~RnۍY-h]hhcńLw!stcz56KhQܖ:f(zJ4 N&QSOTxxo%&vC+cH ma{0T[sLHn0 `njircFnMv =w?q [H{DLHnNe]" $]A' )$C⦒䘺QXnk/$Ct~>AtRxNJI)>^6 G&L€5)& @%Y"Zn쎒ĸIԓ[]f>*ȕ ݲ} LjfR=*IZzVl`&%E"xS vZ}gТ$Ρ62ǰ՚8-hD$Y4&u]_JPp(#-$Ў?`&P9 ˸XO $دc!YBOH*ۉk,$4vkpl@/l $`1ir8AL T3&9+{RO?OOk\tv TQة$cCA1'g HBU52F :VhqupdAjg6]T<&CX { ʝVY[k W\?Mw4 kkee"tn(YSniRSm&}6 ;'͸Ϥ C(k%L(1v׵DU&EnR&-pӾ8 Br8YOI(c[2@,k+2wuY9 %ԷW{QE0GUq]x-$I%Ba(X ̰mϦ?8ݏog_v#Z氓Wuf k$(tGRRInߛkݻq-LKK ){0X5'TJz^5L27,'R1mi@DŽ#Uc0oYL5̕c[u%- 9mpe\ LOq`kkjHydS]evD'X0:ZK{OvƗx UDP-{`9AVZ▾*l6= }Mf kGaV-fKu<uAI>Zu7pӤ]rX3 E Xc&ZhtG~ik|ǫ_[ ͒?VCҟG<{_Yi.yG+ZX:W u?K6,RW-oNRߴ|wQp| &S)UHmKR'd"h%9riGd1H2 S Ί$v  Q SVsR!M Iґ(!$&J%!LFSRLGeR<'4'NI%0I$)LIJ”*)B=mSH'SIa<)CM BtҔmOJJRĤڟjpIFR%0RI2tڧ Bd$$0N 4 mJXR*m)˔@NԡaInL\4 (JiJQl%G:.5"ݭ'^DϳOBtAB $jmkJ]"IX0S5;ZH )]ٌmAis[\Š5JJ"'N1{ӹ 1g48ABï J$ge 醉 Nг\ZCYVeԲ7DhE.[b]⦗tJgN̆:}FtHWU#O朴Azle.LU]LHe6mkC*yI$3+{Gٞ8wPR:_cv89#MÔq6p=I]EG6--?riIIq`.kicwh$JB6\,2!ATcsX\`)Bt,|ke,vd| Z:)ۺ{}5!K!kJ" ^Xs64mx$KSjskʬI$T<$@81tj:$JfK\lZڬ"(S0wDɥ<>D 8G!FYswXuqX$jKc*tPv Z;"!ttTպlx-w tNYT-a37@Lq?? 蓷d&`qbR)9nhR!yٍ5?|*d}+4O$TGCƷ} 'N|>vt k6"Qmb^@MQ9NuU꛱]Sc\btU$]|4&NJChu @b@8\g~68q˃khZ,_aQMAv?raɳ K?3}\<#ZfRVdDF>2tKܦ50~ O myĽ=f!tݸ!7Zs5湐KYcJm> zrL6!ݏ\HP/Zldrsw~_.`1ֿEfk>VMI$i[ޥxk^ E\Z{ݔ_MTMR] &8WcƈRX D u K+p׃29e<;+_VN8*dqkM.XƓB&{;ַ~(X}i$:&Iv:-aRX D :?) M9 < j qCfI>ø2X֟qU`7'W|WM[shs+p;jY%@T~=r|O  AطÇs^@(Uz`OξVf,4m qLTufG9vo`|߫q>I,/-M]s쭤3鱧Qw[](7Iuڛ~)]h2M֟3Ǎ {Ŏ.dq<LMֱȒ{Y;, qY1B꺟N9m>*MVcZo1R׆&D~/j<\I-Q9s}>sԕ[`h%^Hb~nS4ʞ>5/䟹hZXqGh0۟׹mn|I.R6Q oL^Z4'iF/L^^%4F:]Q%["hEe*ȭH1[(BKZȴ~ U{w bP V\RBz.*U"ȭJxԸ+Psw4[ˑݶUj]&Q;l7o!-nיAtI!#$'JRI$ SI$ߊxL%)$L|Grm )I&NL%yJRI$`;j!<$$J-KxI I$ɓ$J$D$Н?iIK'L<%I2IA%G/!RJl)/Y?1~+]JI$/]$I$IJI$I$RI$Cr6}!]cVaĿgA)Ww*®S$J&V)$I$JRI$I$I$tBI$I$I$$I$I$$I&NJRIL'I%.d(O $RLd<'I2J0% )yJSJiQK0|B"0~ (T%<8ݻ@&&&B SQzW.Jq "tE^@$ u)M^aoKn[vl^҅t([ckwK>M $uRZ)m['6m_){m.} *hT#cA!'$L} fsZG'Qu4%3ʳ$Aē'rhS׼D0I$ !S\e꒑xH Fu,mv8<8=U.SA*,k+XV6_$6wJ p;_GZ֝ lZutR7aZwL3E M`cC[)!ݐu1!I[ac\l~q(ؖڀ$ bT$5e$r8(#-wSck is@`2R(e&a͏ʠ @ɀ` yN{uD $<(P㵤|4RQ{STc I[Smnlj )`cpk'&[]4r7>oøR q E"E,<> m4߼<`#w~:N:tHߥx(= 8Ԏc)9.<G>~I L\`#eN3DЭ;66n5-_& LR'=`}S\KIVcB`&'i:+,4jvR[^IoUltS4`О79D0~HzwH`>?]`z$JowZ!$E,poƯ,ֵَoqkG,~ӛǝw<7.7ZYU *aYH ~KhxGeU]3$`p5iH1󤏒`A1U1]t9tYNq&O+Sά:%Th.c1F.Cx=6}' PkÝpT$4&O)nZT; %wZc|@(T5.'ܻF4CxZ٘δ1  h>:ZHc J=Bf푯*wV2\#@ o#ܳMOޑ.U|WZw)ktM:Fn%nxUkgdIѮg*[-Bxxs\uհs> KulԚ]r,/9 J|&2~p؍8Z٘κ ;*`ٸhFq:+O$4%}]^g KdH_㆐\H_,cnin#ܳhHp̠esdL҉:%Tbp9Wh"Ob@sXC}v$OރV@2+a8T$4<O(ny=fsEF7s4wc~.Ձ k7ȐӬ Q:8~!#()VkqEOZ!AJ70Z#q=.TMմÜ{A0zcɧ^$'Eṋž0Uԛ V58h~(xOc[pP$P=fA,7}նԪ]rI*}m+t|zCZrX w{WPGrvT(3I\|Q[w(zCsZѤsW6@⧝S\veU&@\ǽqA2~I~my/+i,~cblEԆ1W&ԎlLlU͉DBxR*G6(9[KSQ"G Ԝd-?7TƱ*AxX2vРTq7*Ø;$ 9-mB ,#BJ.9%LjYr9*l'LZ:ba%):d钄H )I$CN`I\%2)쒗I$ Jh+.ۣDq *X$-ĒI$I%)$I$IJI$]>/Qs b7+8%J@t yEI$LI$I$I$I$I$$I'I$I$I%)$I$I*LI'I$I2t'I$E$I IK$ (N ^SJIM8j JriPs7oLnA@>( Ȇ;w(`KdH%# !lA;L|Qecd 5Z[aYpU-ic{;T47y $P kpLa3}M*U&@s'A4/U05$šKX?H%}X`ŏ6FUs_Z,3Y#EۿW'ou["Í&CnUN䆻0TT%x*'MQqu !A/qqC]7#,mXA DړzԜqXgw~89N9>I% +sql:L ?ѩ%(Ń'E[ܛ Eaiw+:$ڔ"iyq#I%_.,kjLvPʜכ\A Gr*?P"C̅b ;(=HtKg#YK/q7*qc >I;ɐn5m򈅓VzNA($pu :g}νr&qq_N.u1ii *bg>.T%O}nٙr/Z[>j (H-gGw!lq .S dlc^{J8Nɑ\E[  #{>KS@ ecSh)Q:ڕ]KڵXS_T=bvWSր5u% Uv::jG! ,{h~-,[ $hӨ=BĀ 2Sr3q&NNGIi? v pV[ %SoA.q y}^#jH;'YU'Mݛ:63؂RGql h ր|uUe۠{X0h&@c7d|-ZfO01cC Ӿ[T ~~p7HOt|A54ArZwo#ק*Y`0t! t&IqRBǩCV8UI=ɞo2<+ovpUFh>:MHP ղ PI0 pqiMcuO B }-qOHZ\'T1UmvRaY:KGWm%utvbk=q FSqu:Ԩ[m s&'!Xuݽ# 0.N@*XosK@h;ʮއseCu (QԄ6uV8m*ݘxQQhGu0h5Krbeb !R3X)܇-!?%rEa$bv |b ?P3TtZ=H9ao!Zhh:G}* 5XT>E,vʦ+@:,Q~ǝA<* T@VS!fԩM#̅J85츀;E{;%KKReOq1$kB`~\)t$a!l$'LND%*RI$*35'ktgIhvH JRI&QJ5HDhe%.$ڡ#\" T36'<tÔtIU^$I$IJI$I$RI$Cr6}!]cVaĿgA)Ww*®S$J&V)$I$JRI$tI I$I$RI$JRI$I$I$I$&I$JRI&I$IKI' &)&I:@)BJRIdО 4М5JIKLNc Gq3;;> eRqՔ g? ~gZ-;#EK׹gi#g ,g?}-N[lAkTzN d(l]Δ*)v2H.cT7\^CZ$] 5g` 4l@)q9 r&[WD.Ƕ<$K8[X''A9t (%\0ٖclX!?PevtDL&SVilA)5q h%ǀDNӤDߔBt260MѺgwxPslnw$&C*^l`t!)L CZZ=84T*6<0@. kjc6C(sx+m t!y)'II1M$N_gX'SIPukg;D~Ye:恱:&tiCf<3,"rXhp/ua3:X hUyQvѾ7w)%0  Շr=2Ho6on6wDIJ4 =^EAPe{ƙs9 DHZ\|RI,E9,25MvZK[0 &'w}8gn.:&stHuASc7/n- Fv4 ?R{ [,:"$RU;FWv`m.dtb;&IMa㜀Nu 7ptj;Pm,k̀{DL4̆ +ncjs2I/sX9q|Բ1yϤ dDNm-%l JF~*S3D"GzDUq{$p 5B( TNS`ٰ m.g9_iUx`$]̴bSp=ܼt^GЍfgWukLj*VdC9"`ictgulў~VR?uAɚem$z>|eQt3`e;Mmhp'sȀUyL{D'tD~Ex 2H'5A'g?&c49>ر Xw7A %^~EM/f[y.Rgs.Pu"Q[28:jh'V *;PwT^t:e&'Eޣ[v2Nf솚@NJ+>sdf^jUzs,ƪۙ^cPU$-EInQu{{WJ9hiDy,]J8 <+']= ݦ*qƓTS3@Gtxz&yYW6X^꾳mq$Ĩ7;?TV]0]c1Af-X@I3z{ xVn,cCH#5n}v (u"1$DinZ0<TY5R fEx T\Nۑ'PR锵sCF8K1zE`7@PJxmq I1]7C=N ʬ>;,%Ϣ, =K3ëɭ@&t Ca~\oQ6!("BR#5a Nh,Fܘrbڤ"mN;(X xȢN$ZA5iNTB-NB10m29ZJA .=@Uא[jˬ9չi naoE %Hu\Uka*{jO0Q,x%JtN ׄDE9DIJN$ӪDJ') )tLN2R&I.~);x'yJ]2I(rxI3PR&I2keѣ3 ENj+;?&I#mX@@:u*JB.eqOQd/fǒt%HpEeY}̍'^7SgQ]9{꫇8 u9腋V#=*D6IY vR`#!aDqU aZ+Q}n=F- 6G $+f H; |HG!ȱՊI y$vC868FC"f$VLJ `D̼dZc@U/:&"I! `.7tgj G$@k`B+s&>NΟW&CkkDԈ הT~``4O# _5&NSC͎p}8?U*[k[fk0dԢȷc>2DX$AHPE#"TI$r*E;u*NC16;G&FײF%`e26 c&Uq&k# ޥ{AH'l-k]ӏkiK Ȯ4M-siYA$:q JK쮧:xx F}͎.#ML>-uƶma䢡}U֗p YqcK8#¯-77qgBշT61ipo0&?h$lT΁YA}v+6>BԄFm9a#kmВy'=2Vv *RқKt kZl͝@1*aWΫˉ% H/HIORthu ]SUfc ǹƠC;ʮ-s AIWeK<& <]/HQ=صpDzNԎ@dz0)kW,}!l,[+EF_JZG6vIꙌgk?z􎇏FRF~Z]u։Zܯ8lqh+uXT:-n2Z`HdJ'CĽ(~nb2[qo^w1Vz  [+ x!e;]I#u%hJO$4.Rw#)ϧQ o1\eܥ[Z7q:fV;+}w\o`.iɺU-kA缭^k݉$|98aB>֟Ďm蹕2Ek7Z̥zMpsNгB@?zYehv+:^mcK۲I&gUte sxt\EDz70:6}My p=֐cڹ3!d@=?B2Z{Nτu"<+ &# YWùĎ;,ch+=04׻cغ+}[rc\Z7PYkv J.u .h^1c#R-nOLT [ݵin T:Z܋7E衎ܚ.>43u,nR7m$q5kpo-h4Gj;o ;gactNuDDVrjs @~.R +$FU9q{mLBK7(uGLx#JCx.ܞhe k#U_u X;ɅxgaYa'iU9C]+tYVqVn~ d(p]E]spoӺmsDj[gXF㷉0z/M롺DwZlʪmcO*Y/{f'XX5 t9r: F*LAطV7=k {WCfݧtm'P.cw5$洺NOk켆'Zѻd}cs0&SNid٪ :;ik^Uz{sR neb/;xGbρ K׫!eoi$\9# }99 3}˯MQq~LAs%9hu .=W,Z$=>YUhpuC>r9bVW\8t?՝9Ӵޅp~2jtn@w=\jCdcR륍kc`cZL%6{1ߑqdYeˡa@nԨ4Ճ5 J֞\L[2RsefIFk25>P m nNbDN󺧷*u" #G"F"k]U`Ia{4殭OiaZ}#bd"`?Rͷ @?5(!Ai֠וQ]Unm7+Czq]atVLVGYg ,+W^CJAiv:Ky{As f0mHHKlI$ 5R.$$Io( *RI&CU1*;#ʗ%.Rm R{RyIJI$@;)p!(R'Lڧ h'ڒI1I3[ܧڜJRd2 O SIJJ%'DHDJJRt(wPO.,MyA&RCtIU^$I$IJI$I$RI$Cr6}!]cVaĿgA)Ww*®S$J&V)$I$$)$I$IJI$NI)I$I$%)$Nd)I$I$IY$NI$&N(NNRI2hR$%*SdO ')RR)@)BAHTK%@l$֩$Nr)2$$xAJ%"JCS {F~U644moBaPRR+3K<(X=eĂcEbʮGbu 5?]ϔ>\~% 6ֽ#D3FI$I$[_Wp-ߚKZ?a[lcX=$ΊGd gG˵׺4=:Z0:ïs쭿UOS3: ${Z-̲ @U3z=y vA3 qdr̆>V&Z  $x%kY]Lѵs@> kI%F[sv*Ip4rHz%ǰ U1~b8GIAk.%6vq{=UQy즒J`&G\\;2 =x< Z 9A0TV%‘{KeROyQXכCh∠,aq`p;NJ*}hI(D5ևavЬK?Hus &$4I0rQl{ Xp?I !$JHj$p@> )c(qD%U4Y4TKh󎨡7w@BƉ݃kvD : !G|mgD'//1Zէ0^th?)`$j:Xo#do`zwmO]\vVG\}>+[7->Kh="ae~;Xt4йz@Dc /> {9wKKdnIrXq\"|%C*@cFp )pyti BG2Zk-ӳ)kv Ek]5#P6ƞ SOWm.sWWs pNoUph8&^ZZ ^2VJU[2۟k[@.<U!UkaAxafKm<; J}M$ʲ ?v5Lq^7 iskmvX@iQFulWw[g4VuLo. 4_B/¾-iP:gHs~TNV5cDNqNo?V&e} qf⺮7~{9i&gޝF%]mwOhZm\Η8YׂA-u,f7px>ASOoO쵭k[[ d3hEw[lk}H/cZ -Wۉ;-,|ps_Up97,l qsDH~GEwQEgs\=0Ս:j|jjNrCsB0kQT˓oA6(ZKj j}ϨzHXĶmLZao-*?k$ACۛA8%u\?94ANkɬ\G<2w:m'{-[)tDJU.*}K,-{:* )tI0y%JRdSTH)I&)$lE6BJT)&C NrJRP!0d{P:ukmUuked?)9&Yi$$_ ]w #|]v#গb?eZ=xYq&d68Kr ĪVJ qQN\n+GdfQru )Q*IxLBR AD)eeHN8E(\B#R J!:JDT\TJ*Hj@B$MJyQ%iI<\Vؔ"Hd$2IRД)BJI$)% I<)ILvڞO)$IKmO 'O)I%1ڜ[S;[ ןiڤZZjK ث5V*)1Q4#p* NG7y~ -h4t)B˨gfcsōT$n a(N$PC-'Q)IIK,tSq@#Xӧti5M`4v LHy(ܛ14;l,]2d2T !)nPJE3.M2))JI$I Q/Qޑ)$'ED"\I$D&A['$U,"$铢dI$tJJ@)ED$N2HŠL8L [9L$IK8("T\p?[]\U?O>gn@]HWBI$in$I$I)I$I$JRI$]F'QYO?,o(tLI$I$I$NI$$)I$I$JRII$I+I$I$I:tR$RNI)I$Id%)4'LSR%HLSJ(n*MRMxI,T!KTr$ĨSt*M)pHJ~aPD\¸:4F;VUnwc⬤t 3'󜪮+j7~uoE' tE*¤֫ y+a5{ܯSs=&bCXè+e$q-6$՗d51_I6*\iU`=8IWvU~XdGcKZLh`dQ Uw8 c5TvYɷcdGo{>kDHMx~z,0AI%S*[[xm`V"7d|w㲷X]a5ϸ7׀TBeR HZ`(7)$u6ƃ[qtkcqm @ͫ%ef]Yy<[|ÇnTƲv$ɁRH &X .v;I̅d(NOf2PR;y8j'os.S '&ZͶ<oHHRLahn@Px.>&8Qs ZAoR]`]dd )``)v^֝ߜGUA Գ,8vI$~~N߽ %$@§ 8PݡO .*ϩ"%n.hqI&Τ.Edl2@|Qkmc.@ZwbGt@$xU]k/xLtkjSPYPkci[-?hB?;)ޘM;ߤ*hH◦s ه^)q/l6?gfm  kykWÏGY584A׀wMNj&;*YpbXjcdZ˩~+tmHC ͫKI4zK#3Ev]~,L ͭž0_TVh:[x'=*XPf7 &JΣZyL5B$&ƞu*.k{x\RWVGL=Bci= V .v0VWoy4b: SXˆV՟W6nU> x-+:;wonlZv#k<_Q.s&'Glo oJfzo-۽ZUEm<v UWSiꮂ@a>_F<{<>WJ$'b@g4TLX3,` m{a 뺡m-hk@Q[N,.m119\o^ oRt;kK1M ^QWѢ6<%ltS\$LNV}]]G ]EۦYU\Li?B*zKtԨ3l= Z5YTO 8.$|Ur6v xD*K^˝UD51ƪDv9̺ AR8_)WGGa\t|1@;eM\ V:@ 8:؀RZn̦7uWI-[[s:AhUZ \6L \8GI269H𕽇h<}^{+.kÈBrZ+-ۦ]?1mB*!tzKkݳQq(B֬zq_weK{$JYRh|X^۩ '/k'Alt|g]h x<9͓0!N(赊ivA4B,ipke9t5ˏ13YSsw1V)4"b֒@RLYXֵŭppB;84Gc $%:IxjTX痸8{GLPRRּ1D9&N \ZAi8*5Zۛm-Aih;!%?sTݎ׵` \KII2Hhg'JeWҝ}?BJ#;͛BwTF3"JPp<E\~K4@ݡJBI)r'i%:@)ĎN;Duw|l%*9&5zuz'!7,E^f=˜p!$'WD2ZۃC{;m[lQI?)B@@f;콕5WqJQ;08E˚s&uѱs`Jp2)krecZ+r}pKwi5[micĴJI}uIjb Rc>x<5M'jښǹhkwXIL.Z.qlC5[lc˞Z*qp#Lc[cGZ <0+̻_S(qWZd]Q:U]d_Fm| <UHs5$?;Z58uѧc`zniwXN\蘆zK5_XZoo'{G44v2o}JѾ]uYkvd47Pvb uVF_lznqciW1vƚD^@T2r#C57cΠ cQ y%OG?uG] cPޣs+];11ƬkMx#Zvx/4eٵ4> ,8gK7S0[yZSu&="Α [/,rQ0>, y=YrZAnQgE ;IVKe쎣f`୷VLj<{f P*s˺$x0F'SV{%lIo i<~ ^`Vp U32J3aAJju\;":jUźnߔmQ#_RQA<W95A 3v`׷LRÚ^{Ob긟` "F_Y!Xw[nh;eq2w'D'tΎ xBC[ӯ˱I%tUMԋl'ǷT= l?ꔰnocA ',얖ɬ+IsԬ=8wF*l$fY Yu lݠ-`z L5`$p& BIO)(I:H> ;$'e1#PSI8$S'Gvg= ERwFho$F(撔2t24$iI2JR{)t&d$B>* tI7p{yHRR$NuRIKI%[BxBI0I4%.M II1%):dI?7 )I$hU:ukjM|,y7ԝeJI$ ]w,l]w #ॗaྨxY+LmGR)9NfDi'LR NSQ!J8Q]҈Bu}L[,zO5̇ R!3ij%iSK)>HyX?Ee/Y!JF5&4?$2&7~(Ƒ %RGnc~i ot@zn?rh4%90'*#)ڊK\`40Y$*u[&ʶN< m%W+h:H@[VVB5LrXHY/'SO[ʐV2!2~cƨ.<va8@[;ΈʴP ׺pB϶@ eE:9gVZl`Y$IRiN$I%.& $IKR'JS%R%2I'I LLd$J*)dI$I$I$%)Jd)&{Ϥa%):D'c SvTɴEO O%  +:kncYɄD[cG D6?B~~(+uei*9MhNpg!n0c7 J |QiiNbVI:dI$I$IJ)N:IIKBP:I$JZNI$JR2I$'9Nd)I"IN'4$4$ E.)B@%jTQcn9+IV;%i A'EsMzZ.4+ɹXtMP$b` S*s7UUE^IG@HJJLq/if کb\Bl­ _,:$5$(Z^fZWn.c=p,kx2+DQn}-Jz> Oeulٽu!%U O N TE%4FtUz/1gBPh/{$.*Cbp_%[~ "}M[*u1Uka=CQ+0M<^4l)Bbq'SbLS$RH- d$I)L]):I$2dI$%)$$p۔P%(N RT"I%)$ H$1St(0?aky?(Ó揙v%_ ^ꅊI(I$I$RI$I$I%b1_.O+"Y/?)Q-$Q20I$I:I)I$I$JRII$$$NJRI$$$$dI:JRI$I'IJL2IJI$$d% %)");TPjAKTD -R$.BqSqC:*AD)JIXjTΊ0 t 䒘jΉ:Th% NȄw7|Tqݓkjo. }Ek+JK_&T]A?rк1Vn~6.jO@[Eګd~Wlk# !"GQ7?^|{mùIr6E&mnC^]S PjĮlg(B=*`Z 'as;2,ɀƙ2?4:ݵ7ӹdՄ;j0<56$V%|뛑smi8EܒEM. IEO'e][r]恷t@WU!6$ӳWF⡊\TphK(\7l.XIgAH)I\m-c_ܐ VnKr^ a̧'L#$ f m' B]n v#PmQ뼝ƹb*yG?;"rTFVW9ǵ~9kuȷ1be~lɥl/O޵tT[=B5eb#%v+y!,w={k~HW0 }_(hGt̯]YH]L"6 @3Y}s݉cktPk h[o!sUS(fi. G+Gt 0SH-J yih09>JD\wi wEm%(J3AX}_Z}e"Ouxm$Y1>*kv<4AU'l?wGetec. q,ԭ@t ipL"5 feSYPs ;Z].ss$Q}/ǙRx(ʍ7MWmc.lDg2Z5En6k88Wl qnu-zv١&aZ -5cI k+BDᑀ@ط} >@궝1@|*^qOడWՊGAt\VU߽ՠl&vԇ=}_2kfU&I: X#n Yg٫ ?vAv5fU4{Z| E|hGz28LM6ôBf={ׅzm!tK汮kTq5ޣK4YǶ@N/Pcd`LkH6-y{h -AW "8C[wFD?6;ch#][?0`鮫{]3Cf $2nkG-NkkF -f9Ai3ck:Oޑn=`Felk]ANf;x~rkc;HK/xTJz9]cmh5xR酟ig]EkXKoyZ}G[sP$1zmN9kKt9iѻ߭>ErWA~ձj9=>f< h݄U!)Q6?ӟwmt@NGeLD`%M"#8gin3IFզ~ !Ycś F6|E'R <e' $HO'KHIcLNF4mgϏRKK0<]Ƈ$JdT=xf${Y[{|niB:B2:e"$r@Ѓ1n7 f[6xI?A + sչf6wS BPfIHaJ0AD(deYCԁ6F7.7(>'fӝx)$r=go=SyNp?ދvznv++ Z[pDNϥ %yTaŞcS l 'q$RCvCY>pb}nƾ;?ݱBsCA3"mlo>(L(n2䤤@[*9xhk[%#'M{6kp@$4*E<4\ {P>7yGgNhOoTƻooرw7C6YcZ!8G}PKP?myWAS GT,q2~?:Fβk=GOi^T \hA?wb:s]1 "_ u5K4óp.Xp̄o0a`yKul/Q閰q,Vc]`=40aϡJZ٘P°<hNq:+6m %u7WlUAͬp#Wo;}w Jɨ.@ud +ӁF[nC+7WU> 륮qlp&\Fʻfp> i_9 ꇅg?O :Ϥ~%:t*t HXN \QR*) HbL8LĨ"T!H܆QTp I(܆Q\ʐ*RG %)ALa<$I&yI K^sհKHTp>;)>>!lഗJ¥^ԮIY:ͮKSUF֎Cz_c7YY-<Z4:"|QS/L3ʻX݆9Wv8Ǥ4w$e3ց\μi'2|$I $dHJI])L{'M*>@T;GHT?rŰEIW~s LsQ=hRVH/ JU,eX5+GpVzev\UyhNL(-'VGV-XԙK &e 0l*#]:fk.}bыKtZהmwQR i>E&8Rp]@\4&'51,BpJf9 nAY@=z4Vq3[p}B~*5cWP⊛97oB-h9IȂQ-0Gp._ϔ:&0*yņ[KcDPV&Lh%Xq*꫔vY:dLTJI$JY$N$LtBR$,EFS% I,)M)(P$PR$%铤JRI$I$H'LD'I%)8)&N"AС@Y -9V0IVKrY}SaNvOJ~gRb>r+Ř[ X2ӻQA$OiHس,i}.2]e0}ov>/X8vHlN(J*&T۫͡BnQMyI u E~ƻIiyKv* >aYɭET-T]`n}[ :Uui.USj0{NI$1I)JRI$T$R I$$I:d%J'E% NiNN$&NR1 $ILRO %:I$Ta:bྶLޕ}l*vQ/3Eg.ӣDqNꅊI(I$I$RI$I$I%b1_.O+"X~x ~:I$(X$I$I!I&I$I%.dN:IRdI$𒔒IJI$%)$&I:I)t$II1)JdpRL@)B@)BJQ*2L5;Z)Eɜ2SH9D;URDM%3%E4t T rtQ'iH)TBtefTNvU:f Ҏ;\|C6Gm&?к5sC eHݢY:fq:&~vS'|~mfHE$X斴qcac[^]I {K m2dZlcv4 }o3ܬwI3\j i7jc $nIDWͦzeV1MGƶˍ-  %694iVHAyHj=vSg6zC˜Dx* x$ZFBbcTy1*'Ug UȅO#MeLjݏ^@kC2%L$n# ~Z7 ZH 1 tLS+dm*Tdj縋*Us.̷`3>IYQS+ &ISGNݱӭ 6D;2;=Ft*Z#{A&aABLmcP'M+,c9-.cNJl{t.$*.m &u] qS~7GA[яs+{u_rQ vGemsHk'e"c7_P;x* X.!wW5|Q9IunƐ[Y:4sIg,?GYT Y0kl$U}8{6=n*WRkK]SIu[O[kOY=6:Ç aE hcD[MVʋpe"׺9.w$~iVnBL,iqh#pNcD^ŏДdnkC! "'^ecxr _$!XQ}Kh&5RHoe$vGs(>}[0I`Je8 nO$9f{YYL \5hCzn՛U?BfPkͩsd3/qqV2̈́еpbm^˨Y|Pm Dim֙ {GfUUSX X}\{%Ǖg9`vZTkn`J$3q?6jۛODƒ!s?Tc97JҺ ,2c*FH$ p0,VGcѶHQ obsIўXu*ҵ`(w.TwmHMӪ,u8|{!*UnFcytH;9CF7 4VmCex,wZF:Ềq>?bWQ&`5;VߓF( fa[č$j#Bu[H/MKC"r\^$8V3鄲 }gZ .W:vm6MbQI>C,:}T2^ݥΡMm#w$9.nϗuS?]]ή8V~@58Vkf8JT$P&4GNNKm\\'>>ƚ hp^!>/X <AʻXֵG" j0+`t W%ݼ!ң?!qLBx̸ NE彵d] :N3Y`>gwF9 !dC_h='-ĥϭ;_+:\{WC۴̦H ?VM~WزʉG.Wa$=u[i kȵ>gK BG#v殆 *Li1(=C7š۹$Ż=6kr2+=LJzLD|a>Jvp7XSkqkv˘F5DoGiJ@wR[ֿQνto¦,l|^-HQw\"7 GխpԀU>{ uibJ>]}^2Ali({r#]5/gkW3/h.DEbF`{:M;af`˛&H<6tlsdoK7M2s@u~-OH1;+\NvWͣqVUFtmh$hBէ6)}׆&}!]kVaĿgA)V*ʬS$%"$I$JRII$I+I$t<$&N$ )I$RI$R&I$ )t$I< Jd2'I2IO 4)M)TIL֧ SR 9dL I*.LJ@ '4șLTJTN%1:Q( ALOO~!yQ05?5ϷkI. .Sifs*/PacɟϷ&ĀH~܆cUa \nM&dWM5Yg_εræ#~Jcs\G4,k6L F,`'ROHXw7 5)BJOooI"=mVRRR" Dl. %]!ߣ|RRt5{Ek Ԣ6~9ݺw?isl8 y0$$eMn`!~ I%&-ptw S\C-P?GIFm/w -6l0}@pB )Sx<"^;hu0᧿?@k#jsx(V[q$9#t]Z:PfkLo_ $S&I @9(bm5ALSƖ;I+ McCZ%ǀR1FCRc>LFBY,|fcL:"֖*X&\ݤ?{\/2̷AI2c^+$n<4 j@Tcu\BitM[Ɯ)J&%?+o͐=̕{CB%BLR9H;LKLUDJ}ms`hPCÞZARkC6>oOM,X L[a楌)6noɈCItL 'Q/h;dI)uIKDH' {Z]h0Lpce Ф7q* nNݣHD u*VϤY;MAOv:e, 2!I)P^x*;p-k\Uf8q7G66Lڸql'>nd0aӞD:+ُs[hGuV %c^uʭհ8n` vQ=O*`ʫzx>v%h*ҩK!ӫnU:˰{Y.fcsLj wr^Ap$D$/np$TknO&ѰB>hJmjִpbIfU~z{Ϭq wWʜSgLL"~sƁYv]-0^%!sF8j[!p+eV{:nK/r+70t?RnQh(SS0\rv:jS /׎_wR̊ @gUxq:(ѲoCsW]y,{A$!ИSdP<]!1 >2VU]u5<7|PhÿD:SF-ITٗh32WVh5AN:}`̔uV]oayZtwn4,:I4 ڙr #:YsA 'ݱtrQ*#Ij3&%{'!\472>~9IE/]vDE:C1GjFMxH'$ B2h<*ZX`s8zl5U{^ moǪxjCǮ8Hu :KZ pZki Ƅ(?de$qA⍴HTsp~`Bꯝ!Z0X[+v6@[]W@.'" {(5m]En5bU^ѩUQٷ)T,vX:- M^Uw-\nԧ˹yl;"iwcwPﱘL JHWKĮZJh^& *udbMMtE^ɹc;B˶=ĒyD9 xLh#T;]aMaO~Tnuf3VֻAĄv )N2r,WX3$$}^c==7 _/c,2 O^s};fDҾE$4~qu^akohq ?zT6@<vPwp2W6, Us  SHjQ<0u\'RB{q$uk >#q͓?Rg1YnVU tKrzNcR75!QgI[$I$JRI$I$I'۪\H蠨꘧LI9+'I24N!)LTI"vN5g)7N{d1NF 'IJJRIB>t4I%b AI.da;tJBxI2E?N|ӷTi*I$ALOR2I&L`*RI&N'K*RI$:P$$d'#DÄIU*hC }R2_ Ԥ6,IUddI/ ]v#ผ]v:_s :Ϥ~%h}HTJ)UTHRJrBdT2R B\B8 AD) ZJD"N' .P( I)HܠTʃ A2pQStLSRL)R) 2t DR#VUs_7|J  Fg6]&&8)֦]\68cUϟ+؎i#`F i)nG,wyBW:H:TBbBj{$  0r@$!V FcJ8Ę-%3W IhArB#5H#Tם$x*-9IIm#q#1)V3٨w\W7׶p! >5j) ,'q#eʩԬ I))%|֗P %moIPW{6;䯢Nii U>jӝvπhcznQTث(3B |g۽NCL54Z)HeϚi)) P֋X=-gm0AT,s;{A3}$,f.Z` G(Lku_Gvܙ3&uSuETjжP/ C,RPsTۢz/?LuBI|7ڵm ,tS} IRMg1ooE kHM,h2b 4X\@0H9cNN!!0`G)F#Qpc] RY&A׈ FR*{w=p&'Pe`zwoٯT r˲֘== V*lHs#@Sٿ]{T7),>u!8=+Y#3%"w?ՖckmxGeYC&wZq1e<HcVf n?H'$P|1FV/,Ԏ\4T-HR\a/-3O%] :}Ť@5$*A6~i%5Ȅ\k n棉2XAHhUJ GN\ )&_hVqk ÇIMrJs<>aSm8~*+*c_<;X6e%6/,՚_um"uUnxy!$\罀:.F`|pOQ :Wqs<BJV+?^ZdH]kqℐ)$DI$UAS;}d x$?`Wrq(#L!XncO+"uUろ[\2|Qݶ!)0Á@eol(KHZi$ΔO)$I%dI$I$)E@42I$tI$IK:I$JRII$IKI$I:J]$8 ‚,M4'dh( a*鱮DJjje?5m1n4P`Z!ԁR[R?lBZpnOPg45uӫ+p}C\k AͿ铄ʄSY XF߬K}T/*$MgY j'K륮4_!tW{0H .N|MkgZD䐺c3*kC8˱Zz!lõn<<ej^FraY@J[՛t4˃N%K2 >oKuG~6[kdC5LHIBmg mBQA>nk䝕gr";qcELoU*ZIE6m:+ʽAp?GVS [nIE@v򢒔&!+M$d铢(tIJJRLI$I'I0N:bRL2TʁNI$)I p:q  JTY]$)$CTI93g˃3U?d?O>gT.$ףCbJRI$I$I$I%)$IuWFEˮȬk'?)W+ I$Q2I2tI:HY$I$I*LI'I: Rd2I'%)$Ҕ'RҒhJ2iLxO )tJiM <'%.JiLJr@) A.*RhR)$.*TR S pLD$/4%O=Hj8%.&uHQ$) 7isc ?M"xQy7;\SA#W8s_E-2BlNM|dD47r=U24&n=ͱp7P7kn֘cY 1(N9Jv`2dN J9 ř~;qHnc]Ɨ r*==2&Or @0]BcX5,I}+?)Xv|)&uU6Gآ5g^viL"SUOFtw\'恉o{ fHT k0'Q1َX{% ~=y kC D%C3'.YQCVvLBŶ:L_>5vx9 s̸t{AY<@x> O`QVvMAǩOtbuGMn;6?KR|LkE65tLƀx f^N!ΊxL P1aLOBj$hTiubLƥM䵤n u of4ci; o ϒEo7C;쵡͙`5`4Ρ?HjU\$!=%M9^MmcPٓU/sDb7:izk_pSbJ"aV-.XcF%΢*58wTQ.ݲ쫓.'ĩj #bXxծ:> -i# VTzώ 04\+!Q2:M rb )a>*x`\/$3+}KE^7^V?MqnUD~]ONǥ`X]O a`^:pt:AƲx~\_svotf%ĉ$u̧Gj O$Gh[v'PTz: ;>ku:ں5~3Z9n|/is23T_dd4&_f ܫjuc4ȿ1 n SevI%˗z(5hӱ:A]Cz;ۿ{@–F5Vk-D.@$WbHBǨQ\<{~~~(]o#T?΃ZSk9'%\ 'M87GWKK#uwBGG6 dDB-̦Qs{JFg9i_pA HUYӬc">jV-iT.mt6Tw}tWasH0(N.ܾ gN龓UDWVuk,kAvʷנ5g,k.UCX@KTN Nn퟈W:oVf-~-YnW/ne}q }5<# xcc܍*u9ۅ{;HV[ΩoޣI'u\LHsicatnccȫ9 uΧY1d8KiҢUmaNfEcZfe!#G.U6C2u{^;L6N,ܛEsW:.]xָbDO;:>QA MG˳c[g"ӯ6ikZA$.GGwDan g vQnEx◵s5szlRڬtQH$w_۞,n7H 4D ~$GA]խuնƩLsoxث]MfHiOֺV*d§7/"hW$Os#T}Ô΁pEۼ4Y2O*JKX:+uӤߕNklk- fUv8 kK  2JA6t8kVvTT5Bu^QdAGu|vt T/Ͱ_A8tTݎCSw jU(REѲd4"UMZl8nQxW5so7tY/!HۋfW >M$0vS@i|lY}A@P}tc4{ A5ЯI ]^Vu~% #:&(K{N6ܑdhņ[ %/a:msn`{x!ekt eE$铐$I$IJI$Us8%i0hQDB'R1I0DHS') SDT QJSIJr%*RH$).$kJ^RLD{)N$.( .#q!tI1nN-FiJSpNB}R钔DNJ"$S%)HA*S$IE%.$RJSI$I)LRI$U*W7eM&1aJ#4I$I%)$I$IJI$O+gU1/fYPr_ Uʲ?$Q2I$2tI$I$VI$tI'%)$Ҕ BxI%))M)&H%yJSҙ$'dM)NpEKS\0H ✔7)4'$XrRhB@$1"RS$1ILF{&H? Х%.]5)P$BpQjsw~襯k碭]ҧw'_[+Ѐ_>cZPîkgs F4@&ƦQj8AiQCk#QU^K$J&̛[P0 TK }JXk" fR"RSqlm""`xwa>f;qum;T?YqҞŭ,w*00pDt|R:?}ξk]aa/Ԃ;ch깖1!ШWS+'r~- {-/=GL9C, vʬ4@:klA D{w5d*n%ڟ4fc9; #"W2ẳ#б kHC*wf;ZݮeC#䍕n[#A^;#`$`y )7Nͯǒy1R(ŵ; 7m0L"'S:!CqkI2gTT-#B!KpAF~c#E :=*&."O%3aqiwtOrk\ r@YI$m[W1銵~BYhE4 Ob$` iqP{C\Zph Lsń{I%^nul4N)+/8ɔBF3qeo i?Q{ki{PpQPt*,5IMjumlh;"]C!T&4A*oּIAʡ=U}Bg$Kqˋ"54Q z}ƏvxO>V+$Ni)R*v:$>n<)pH:I)TVM"u9H8)$ĀaD8etS[KxίCA|jA\5Hg Ct]<ګ}O~ltNV; <5;6q,޼,iHUl[`{<"cp;A,1,%ouEGGr38kma%u[i:KIA}L+T+c_Dp?KCʥ[^ʱ=%gg=濣(W|٤;rUA;`jsA lgNȠzxב-㹠CQ/Ȯ<<+U10C=]Sh&l|wyG}Tfp;}oxЎD^A)IlcQ04~Sf%(uOs6Hz;:Dӱ$ :~KE6OEu >I>kCdWsr P;GcH l$۔1nk@'⌢I$I$I$I$IItPT:`<O XR))"S$R#T9HyJI(ꔩ(jLtQTN BE8Q⟺II&Qx8RQ))M)% *RIJiQǺpiR%/)JR8 R2I(tK)$'))RI$IRI$*_T:Ы_6?_ Ԧ6,IUddI/ ]vm|"ќ_s 煞~)Ԓ8UW['LHpPe"SB F[TܢR aD) P*D('EpX8)() Te B )€REHBuTD)IȄ:I'AK$2' E!tefwhvCzLB .;6.{{ We}{# $2z"úQ.h@(ʶ^Qrbby>_QY/_qubuGb1eNIN#CkeQnD7*"fT$&϶!%)8+މ8e0O1#S5 $X'AVs Hafyq)&0l蒗N5Ӻ`+*u{O~+p:c)f;yY;q޴6Q2t+m 7 #UCY ;w$*g]fm -;OVˡ &*>X@{ѩc䦒JN̦dv=uWCc悔;f#]\մ-gpzkm 6&|֓\ԒSE C-8׈U L,ihSv> )W0' ah7WPѳ&R2 rHI] ls3-*]qY5\-oCFـ)lrP8]QcA ,C⤇}^`rg:zW;:6zfO }ʡ+=9 $T[\!SqRI#'sCF#ŕU, Y>)%T! Q&grc̸XSlsti!'ZTHHxM3F$byǂc\atTY07Gs8:JڅþM۔5ZZ\$k "S$$ӦI$I%.$I$JI:I'EK$bI$IBI$JRt(I$A* @&)H4$Ԅ)<ܔ%R ![:[-=R" j|1sΩ齻cx1a{ֿD̶.,K)B&]Kv# .(!n0u۴3~E@$;V5z%5YTj]YYr[=kj[tI% i8LS73g o*݇aGFWkPkUPRI%[$I$JRI$I$I$?+"SoVq5K^ߤI(X$I$tLt$RLRNP$Ҝ'LtLIIJH&I0O Bp)$(J)JdĤ RQ%"TIJ% %D*$)Ӧ SH)ILa"e"#THHH$ J`ӷTԔOb# Hh$r#\&:3ʔc2 7POmU)  AbFu|gAe`tQͱUਗou^qmn50:S~Uր5,<1VuLK-ٶ H-YǮ-k\ILnO!" ْ 9ڸ:)sJllr7I!q~;n%k1.A@cWnSEmS&Ukr+unl VSHJ@' 0VF0&L*?2̦Yim56 e$4S{׈Z+>Uj}z$ Bv$IS!B@O> RBb4V+-D?UAU:S<; Fů)[3N$]3!&W1 $:LBMhhhg.f1k??}#'S\N栴10ȪǺ0h?J!گ{a 1M.8hZ{c@s(XInk5qe[=8nM{cxPQIqk@|]dhP7vhq&dXf¸DA y'l1:Tlݴq O*%`p'i#CmTxմo&97f9i@!5T[,)u oTײMO~>i3YcI +c0IHqЍ[ʰ%$Hz:( ?SXӸ;ks0] 8hBtICc/ |Ke,LbDj4@2|LN7ltv5\HƯAJt|uAcs@1l ˰Ưus]<c4c jAUq=0G}~:ٍh G>Uh Oeey|r@ϔrq4XnXf5"K հB7MvܦO7Z=OٓgLyٵ9 t \pӧKq4B D35ic7'3@@HVc`x!u]#B[]V@ݦ;/0O<>hXX%U{G]lK4}atdtǶ@u*o]miUުWy|W/&%f?;`#n6l^@~wX='!Lpk/pi !DgQIoD{CT*8c0v19<+(;!ϥࣗ_IkI$6x .v5}R8ni2@ -G;<_(_Lzm귗=w'"ҟV'eYҭX@#_O}cU'a_oOc Y}GUƪ`$LGg5H|Vcfn{ TԲ^ݎ^[PN`h]cCd͂O_9xR陿+-V ƭϭ@!cSH2O2T?jeէR>)쫡S=:jqTmɱcS+;#euKMN~r;f/z~oWKC$^kD07Ɩ<'͏𭌫rq6lssvE`?Dΰ[ڛKoBʿ sk&YM U-Ӳoe% v>CK/-UYS0r LnJ&ͻuՂ@:Z]IC@ H vSx} p'-)GWk<ˀWv,$4 uoqcďLǎXGI -{T^@/stܠ ksBu}c c ;[idU na4*-uɌ!@֏WE"|J=yiq#F΍Ȃau?Q6ni}_mxtF3̟8CΪ[ =$KۻJ>7J>Rf;P^ٝO"cUKzЂ=Exr٘ SOY~ȝ"ʎK}B#ONEqSRr6+6)vc^SWEG߈fdY\K_hKT8xU9Ct :U~k~0@ .T/vZ 31⳺3SC&?;-4xR©TƴBnSfytWk365geUE \[ݝs*UIi$4D TB=Yյ0Bl?S.) t]&ea퍟92{}t |Vw=$DJs[\H©?@L <>{kl!$lǸLP)WYcqG v /O븸'U?cUKZF 6^0Py7s#_\W0@DEpL[Kkcl1ݪlW1ԲوX LV*nj;ڄB MJ(*)$ dI$%⊇=7AJUwE*V8R=biJR)$tNIRI& &O BJ]$&!2 IKJ):)(%.d$dr T$d2JRI'RJ$ !dI)5-GܞJ'%2b$)$&I<&))tI9L$I$$:AVѿ[FS/Y?1~*:1EI $UI$I$RI$I$I;>EH|W\U1/fYPr_ UVUgS$J&V)$I'IJI$'I8IJLJt $RiHt'IJLI$$$d$.SJE1JIJTJdĤ JrTIH % %D4JIBI)KE$QJc O'"SIr4IL&%ײIJRL0QkX$xO2q쭥{Lsdz[W5Rc;'4Ás ڬ/߸ʬҦ A*zWviCq^`-:Cϧj낁 MIA)48(PWyz ջ.gmk3PoLʬo ]"(m&$ADڲF>뺅qHR'ʾۚ5,s]KIUspts}d@x_?E} 'q9km_jA&/ƛ 6 VZ?*U}^@v6Xc<~w*/e9Szx0Fx"@X4Җ[ie/pgÌD=[k_Qd;uL.hGeY,yFLGġ+{:M~!CKmy3O􊹲yPƇ8m'M$l,cDZaԶ}[R/S[:Y6 1uh)HYKL7n–M 9V8$`PcdⓩcG43~-. 3&u-0"|ω(N ǀ3-u0zZ Ja aI/|#H WEQ,!Ѓ 70PȠ88iXI%/~;ݲ\LX6?+}a.`1"3)Ԁ \gP?  )5rbe[ƿF}B֖;"U{s*f#ޠoYNpIv:NrYL KCiCoCܗ@h=?xRrc|d#VE?gfg-DtKO&V=Vb/ܪ=RvCt+F*'ޥs졲:NMdVh5{3@5ZF#]c̠tw܊Z 5(}^ӵrS{h'IV3vX!;@@gQõtLtu,ickkT޷dQip:~6ϊTǭ\Ʒ l[+?v #O!m!rrp>R5j|S)gsiPoc^p|D4UyŵUA=ʗ]n&D Y=lBF}197==z#[̑J~{LZ}V{hMQnK~Ju5^a[knƸ!=ݶIC&62ŝ>Rא ?F&,&u{MΥ^Vv+Řc?5fc׉$`Vʱ qZmtB$Z.;Kppq$ZYa˄赇wE?_cV^yٴHh ]?ߵĐB6y)lfXu>{Cpy&gXB(m"5Ѡ f[&C?R/-mBǸ=$2>\oOx2~(lo Ƙ%Wc 8 Y50? >pzkHpgA'uh.-qC3c!5n=ߙ@t6O%vUMm uSqq gO } R{7b,6:yAꎅ*YXgt^Ӿ6ƿca̵xWK{c#) nYO~;Rȫ:$6;74+ݕl|G:Ζ=]:D2ƟVgQc3ƿi+&]xV]MeF.iKt=Z{>\Zd67̗^p uaA9fg1KN$vXO`|^đ?S c ROjYԎ=e6#CoPq~9q䣞y2e_& eu h> BeI@wM @JzWM)$%JRIpMxJRI2$TM )tI(L($LCi*aMzIKdR)I$r]$)$N!9BxI+$I2tĢ$dwJ:I$IBpIИ E)$ҝ8YsUYsUɗXo9AM%$UY$K ]v|"ќ4_#{?0E%Uu1)Ҕ$Ĩ&R!IBR*8RPR RbTJQRN:Jc A0R Z ȮB)"NK#)M P)SP"8N5LaD"⒐H tQsJA9MyUݱXJi'%@ VMf(&8X1 - ZBv<|WI,?df}$XL hT2mzH?~)''{Z#^QH\'ޫ:p'֒Ix=v7v'%3cw8 ۅ p{o0S4*}AJekv%18pԫSϩ{X$~ PEo .1'+/VHɭ$*QH˱FDǚ䘙ԙFfFIToaHFV3+úz5fQ(?0CeC&<*tphuC kR{ SZ]La2IqAB# ˳ly:RILZ@2xVۖͧT(R5 r>&FVA=cJgcc6F #U~E]VPmSjR=O t$0BF Hj۳krʣJ:N<\ j̝#I\>{1vuE[KkUbuޑBƒHAA{X]%]և7@d{xVe5hI4ܪhg蕵:;{xّQs*m{\-Q*gPOC#u U"'S{w4Rf%_S6k]LDI%=FhVt-&g M9ꍶz`4ʶ^I;v4WvZmh"<;*$$3Pr_Y'lϏeZH<} aBaI%.S=G1**t&=pե7n &݋gO:Al1BJYuNO> gEvŭמʃX`$I)dIQ~5ܴBE@qM uG))EMmFKMrf[΃+d8ZXzf5ۄ>(o׃lń<Ϋ7"I۲pۦW9 E$%9-SI&V>žM&iiO)jB$Ңm Aь%Q6B}%)Po{+D{ڋ!-zH^xeء HŭQ 5EIjcpKۑL$Q%4e!hNen ONRM5-M1=-T pÚ;I2^RGU)Kh여mQ쥷'SM4BI + c$)jmI)௞VeqWZeE$&A a7t)$HbIJI$JRIpSUTvf81rJZ@%i')* (2%3:XM!(-*'DW<|c{@H9XU7eK i7Yŭ\YQDF[43q}q 8i1X9VbYz;osL@^k4kDJ EM"c›Y,@Lgly/avЭ>,cu&g|LBf41)$tFWrT Ϊ2I$)ВK3Wz/>_ZOJ0 *\X]I_BI$in$I$I)I$I$JRI$p]NQYO?,?<RoV{~*I$e`I'I$)IJRN)2xN')ddJRdI$$$iI<$pJbR%1H %(ҘM JO*%H$N I Jd1H$S%) 5JJ[mД柔 OɔĈ ')L` |a2J^t%;ZUשwk >u9&+t\*AʼX+οd0Ǐ,?7 Kq]+uy"T9Gɰ݋KjsȝJWQ]#:Nqv_& PFx'þmxLZlcvYR jxw }'yѧȱ^P5"sUW{]p\qah zc=6nf;E h?CR(%msw:i X0ma2cuLQE9}ߚuꦫs]vA`mCbU^,;6=AVF96i X$lo]2s罹oNcM.ww>CkIhTK (!8RՂ }(c~m- K̷ y.kT O;Ĩ/d<כ6= եq)mƆH 1\HDދ"6-Z .v/.qy"S9qq0\߽t|FV0[:c n]y 2uRS0&oC[kPcwhX4զH1M9Xv4Lo}d*'d(I|+k.#ׅuEn>*BaSQ?'uS_[I>aj2lOϪ׻9hLևfuvjV @2Pur#~>K u7 q3?2~$y7 .S`E)X#2C\;jxqZk;ctgrnpⰏPMy+Sucv?zx߹жÈ.qۏ&CNxwbTƟ![Gn܎?0~*G6_Pw jiix4.'~ۮr ?b"G_7*t! Jox߹߲w]n>9#KÅ[}97؎]_7ve2齮qow3Z\vc @BGt :l̽uF5S;Dw8wkU!X=! :BkgY[?<3 @ev7O܂#%`>_) /ϚkuEV<$cT&I$BGT$J0RR"a$dI8M !t'MhRKTI( IJI$ 5NB$d0JRJH A%R )dM DwNI$N))I NLIhr2ta u l?'<e&(*I$/HI$I$$I$I)I$v}!]q\>C2RJ?$XI$p$% S:` d2II%)2I$$R)&%$Bp)JTJP'<$JbR%4)Q*D$kHbS'Q)'IJLtNn/JY;&.H'"0t2{$tųI?))IJ:ra)ND >&{kq%(IkG$ʝ)sPVXz^bjd@Y-Q-WԃAb5 UZ *LX٭@֬) IMRd֢X f 7A&ڎ;LvY= PMc{?*[ePe nסI=')8v-tiY,Uhm]' lrW>V=VA$#gUGFWtdtzSjV{[l/<(1K#"9r PK-5_[vk`aWeA|\A-UVX|{#V$~(RXKh ꏊ^%rZ?Fٓ=EI$*(w LO J>VSKKDi~K+76`O=Ӧ. < ?" mOƷp!TVc 9ikeRPo1VB&,uM>"Sgk챛x:*)#6`Fkt*SXHS-k)'c lkZ;;u{C\!}?VCZԟQ@R Jjԗ]mc~,?vfX+o\7))mx %#*[mn,n5sJk$S{xۊTDImcR}jc9C C |Sջa §V; RRS v:HgU(Ẅ,R Fm +v)IVѷ!>v?od joO+S N[Tc[6g_xIK,2Gr$Sd45t9D ]+&~j}Vk;xBwOP1Z[,{kV}X1_ X5yC?X.ք,*$ˢoՊEV%z8$BV/?$V{ v% ]JeHSu/)ZRv1ѷSn;D6> L^ 9ן(nN'敪* I=Ovc~c~FunɩB.Y$-OΟe>_2Iul͡<1}nr) <{^S9 jv.o.GqN^GS k?t\A%LXr]nۗ.3n?Y\J -D`?gYR})})q*SdkAv?eGܗ).xuw.'W(˜ fZ~VhkaS̱o.Ѹ7P'v=n]R/|{'v`'B>*b=q5~w #}?÷ۙP~-_>[EV=3m5˚WwthB­niǬ  /b2 kSy4E}a1¬+{#-@kf5 6c;{t胫]E.sѩLsnF%O*M-Q*F}wAq (rRI$I$0ЂjX#NR:4>0 <$t= I)I7 )'%)$P9LWI0I$I$.d4)&I j䔤)"JpNB$Hjd$$R vQU I:d)' )I$I1M1EJH(D $d'LRNSBV ;}Sc2_ MG5ؠ_ %$UI$ ]v|"ռ_q9 ꇅ~%h{ $I$S ".Q%H$ $2S€S .bTJQrp))*H& `JS(nR J!H"oB((E8 rtTTIN @(0\ w*@&ڤuXA>>,| 8 > K{IV \閟]*nRqcÇ {X6W N!VTE:B}@P FkohxUTJdZNB(f TA-J`{*Pop Gea']lYٱ5a~hN1L`rj|Ԯ%$~IY;V! :۲JcHx|z}VK\Xdhr-?4PdJt@8Q{4$qLq&Otnʧ?ؗw=KG0+X`вj@yWMqk-4[kX 'I`y.ԦL>UDBt Xյǘ%. +7{=7f0\0;Yl8W^6H)Sk,vUvL&I$]G()I+TQiW]Xn^8+du A2G )Vv7i׏`SFPCݮG'I%$L_I$ +Apedl`uZ8I+8 8wKJwT`򴰞-fOU( jZVu :pMvo;11޴qmn< o!O*cH!r(];1 "?N@Z=5@Π0Aa$vws !LU.v 7wp0@hܨd)%l>p$Kf JsqO E I J xiࡢQAm#E(x %&F;>#@Zh/aӂ51n 'Jwv$,-E%)HA;IYAJ{q΁'A $Cw-9Uh"K:i v6ѹB "݉iy VES'՘v00*ZZu3a- 䀊JL̷44mOd46NӷC*YLrlݍo܊dnĢAQPVN LZ"XANz@Eȧaӄ$ߋh,w!^2eDRR5;ܢc㲽0eqz]ϩҌ KNSo1b  bjLXTQ8x()pZB(2G)ń!,}JuRSlVRL=FqPLS9qʉFɼ,10SJxZ:P'prov|D+ha [%h!WՉF_㪷0qT&eĢteO!UQv.DV'T'E,a")JS% )b:v4Y,cm&^ smbw З c1_c*pĉ[ e9=v$ՊUΡ?iʀ,:v ֻs\lS-s|ki 7%ڙ5O!9c"_;kcO)_X8?D] \N4$,d<ȅSeѶַ3*z5.&ˤCh{##6xZ5W]"!XI2%*Dz cHͯdu]@KEU빌6.G+;:˲۞'NڇMlj0 v]uU=~ǖr7@uj+;CSLM[$f GF}? 뱛em$wQ{0[SS\Z8lU~6E:IZ&JSi*Lj1)O %O a1)aޮ o*vQ/3E]HWBv#%_ $Q)I$I$$I$I)I$Kb7.Yu8WFEgY? JIXUHВtDRI$I%)2IJP$pR8N$LdI%.RI %(ĤI:JRd)铄QRLS %2I,J0Pܜ$HQ*$0%+Ss|Te0 (#HQ$OR L< =)̝JpGޜ'LIL$rjPSoJX?'P+3 ;OQL\bгjj[oML=H= :VER JpmTAիZ) P0u*p@YRUSLԠjWK jrrפBsVՐ6WkÒKE@WZ ZVO-lڲL0:5Ȭz'/˸^$CFc֨Z}տIeJ]&%\3dh]kC2<KRXqU,'`iE@rqi&;(Ӑ}ոڿʱG-G44@G7эr!{s~'Ry*@M/dpת]E{49Fǯ%D$">:8nk\4/x tIK`(P7ZY6}ޫ35?.i#=[$PeG$h5\oU[m,-n̻1Em4oHk/`TwYIYko7C t-*?V;V*S ίi ːSӕSg\~:+tjo7]o,=䒢&}Au[~@ڵ`uHJ?5d$FGfo<|JwXq ?𪤕Ư ʷWGƬ}~*JnI lǩE$A $I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$II%)(I%6[Ss6X|@IS|[^EO,ot*J_`.֧M}6p6#(NhKZ[F[)Dj˷*iX:mmSa)P⤢(T7@S)H]:dFRO `)1IKd ORB铦M p4II $dNIEJI$pAKI 'ThL4*ITJ`^A[ Wüd&\VTXI$"I$I$I$I$$Iur,CC2RUUH &V2IJe$%)2I(RLM)Jt)E2DL$)tҒd' 'IKuJS$IRI$:`$Q) !L$*E@ Ҕ$,J!1LxHx%.5>I LRn3v2H*S3 OoZ}lJ^sX @ Mi.y ?N`#:ZXEfJ N,m$SwiSAUAY`{}A,B3^К"B3mb7&E@ eq*544T kvoR8vk csƒ4o?Q AQV'Sm,f2="H<3#-RsD\՝g%HّeMġjy5&L1%Z22V!QgRǫ<|wuQq.m$8L~q +,~]bKwG qUd$YZX~ ?V*o.?rI^?]ٗ;AI SF_OYn%-,oRN^rILI)`'I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%!dr#zp᪮7JX{ni*J~ p-VS i_#/{xYGIBbUeH*JA@ RSBN2t*'D$ aTr(5( (2 RQRPrS$HeڡNAHS$&H$NNJH'a26J҅[R=´LjX0}`$4&!C{wRTvP ;ot#+bp;qC@Hܤ⥚8Uj7:g@{"}oy1V!dZ)f{4 .֓VfVH5*4@|R³ԬtcY@ge6mu$dk(IˉcL*Dpp( $0{&{Y>'VNx5rńItYA~~&PlJ8kPYC(BY@L,w`ЅМ1PF陕xЫXpŵtYe\-h.u˚nΑlONˋrOv.7Z=ͺbl^zYx÷F+xFpC9Ʋ!9j&9UVNhQD5=6FՐgotd:ItM}&m&PS6k=;ٽ\Olx=<<UШׂ'AΊ@K7N*_92eH"<\at%]I ARn6+ ŬƜEN$˰g  V@Yx]ZY8O>tVEa3+?>,ꆮqRCId6qPAQLVXv5V$rD-R/`#Ba>Mc&dDx8*9| UkU{ Dp{``l`U.48!!a[F`Ge|Sv~5I|,fX>n&IÂBҜ(9=0S$ILI$I$IEյUn-պq$DV+iZ8A{_YI,N6ṺNѕ"BuZvYV<$II'I2tB$PAj'QI1NL BLQ:I:4 % I'L\M tҙ$]kBp q ~E@h~j}Y9[k _[.e!߂ XM-u2g|+}jX~+7uN?"G?,m&=6g_w(fۚcA } ؁+Kt3kw=uIH.{m{kIEK!-@S]S6Y@5 'LA+B :ྶL?\U?_>gtT.(tT,TIDI$I$I$I$$I. ȹUa1__d%*}%eV#u*4$'Lb IKI1)BI)E2RH'H'IJM)I$$Jd҈O )E2S)JP&HQ)ʌSJ~RRHRE RIL *NQ)$;$ &LJQ)NH^a<(T$'2%-$0i)O1m3pd9V]^T&S&.vn< $I)$I$IJI$pRИ$H6HLB(rr*`.jBz#^Ҋ+ ^*r#\\֫R{B+Mz+\5ȭzJrSe`R1z 83"ʮuƽdPd=~Y.!³՝w') 㠟Gkq<C[kI1vIIYukpKj61K9U?& Z׸okN(LY4?QX|&/|L絡OՆ>w4kIu7Xja~䜺Mʿvcc~ܩuܱ#˭#<5k bO YOx~!tm>+X ZlwZ뺅92}U-ՄϣMIJ9X2g`5cl!giU3\5k|F~=(4r3q}$]%41(ϫ`n޴q:n>#vT?e$I$+I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$J%$RI% !f'wA ꤠ'6-f82F ? I2I$R BJQNJS$E;BHRI&)8O"JI7):A%.I&+VaĿgA)TmTI8Q2I2IBxI: TI2hN'%.2D % %,RJS:A:J^SJdI<% )IM)R2IJA8H %EDJd%,(Q*AI0NSLtS I4SB$Js<%L▥?))i%;aǚa':rth))M0ENC1Cϒ lEcב!_Z*b6jlh;iH:$,i}A;ɴMӧ ICu{;;D|j]hZ07gQ'8*6:IG#7<Χez}4/ z=Wh_@o0K:%FkIL=Ssw- ;lJvI<_!'m@ߺѸzxe\C#̵޷tk{8hы>hׂdoI[^tLmUXYj}YƼ7iuEnMƖ]h9:G6~e&Rο,w}N I\O?2X^@U;r+Kpsm1u\`s>x91kmb05t}V-.{ 5wѪf`{ɣs5Ϥ#-G&ڟV[L/s}bWDͰu9O_%KEC;r}I>*)"BSv,seYI$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$JLR9 Z<*-vn+H`ƣ1s'R)ƉXbt&RJ&NLuN5 BHY:IJbShR %I$~%.$L$I&QNO )dJSTI%’R$P$2L8IKBINw]5kFTL>)9_eBI$3I$ ]w  _WpϢ>K?8kp/?}PGVgY"Z iRJI]vQvM tҔ!J)5E8EseHS A@)RQ `$.BpFz NH&U;-.:Z=Mc2%"TRM'8 $v[DJ'LAOI8 m`IKPͅ܇~c6>:+]JE*Х3 n6 EX}iIJxNR&CPtYU3+t8s[|cNΗK`;O5Vo 6佯q- 'S)^u:NҦ4&@Y6lyh[ Y6@rYT78D3YB|G_"0> M2_RIhNI*" U͸4JR> die.N׊u3GkȃBli4:Oba%sw3^1mbּV]RC %[M ԞMŧXeGOGj Pr Z{tW#q#S{ U[!"FV_f$A>&UX?xIK$=Y+ 8Ў4-gQ§Nȩ l3rNQB=Jx& xOZBl1l? %:PNh$*n- NkG"H7q±@>agGRt#كQx||Mb ]m={WAZo̱8:譃:gM'vZh)A!/5s*pSLMDF⎣c7IJ&u:Lo Pӱ\}_9 5-uaL41],h{x<(5O֌InCG$4һk}.:U1I2rBbԀ!)I$$I$I%S.) ѵ.v\^%m0T2Rd\'GnJM)(8y#"1I8L"A$)R%*0$.Jb"' t 劉RQNA"IL RP$I$T$JrL'O) $)Jx:I\ e2PQk(H(/]Vl` rcXE<OA$xd?m ehHk'-*Vy)ܢK:ĢD(4DRI0)CLuO8NB`SJc L@TO9z`#Bp~64X@k Oi&ӳ4ek?5ԑ!9mdEPu w gS~O`<͟NDr{K:!&=RLf爉Tl%Kn=b\>*Xrַd l^ҳnh{̖dZ!ӎ@v0W^͟lwۮ d昡+C?*C\N'ЗA]z,w[1tw v4p~ Y}9D@$Qu_?$jրcEtcaVm\d$<%Bzs=0a#R-Vnl|`r>-XS`"Hd;W.zHRx<rv\OA'I!(*E@pWaޅ}m~ZOJ0訷v%_ +*X$MԒI$I%)$I$IJI$]VQrb7+8%JUJʭG ,d2tJRҒED'H'IKiLJI IK)"<$IJL1NI%)2R'JR)&)’'%btR<$JA<$$iNTD08B*$A)IKJB9H${'N$)l#^ɸLI=p|ĦN#1thGDŰT4IL)D[IJ;'S|(˒JίB9=(Ȃ gU\~**{Rؘy> J%ɷ('=mJ)P.MBMmIL)Cޖ8Jv&ڕ)$({އ SڟjJI)PܖH$rS('M0j#XRR(O*NpA{“Q^}"c[{U1yAz0>J_a zEaGI';EgI})+P:;*c;"rI:-/>ho6ӳpЈpժoPO7Y!jy}\-hV+ K\}hkv0u뾕A$дpv#y خpi4[w"Y}79JI'!tWWmk~4I$IJI$I$RI$I:JRI$$E*I$I:dI$I)$I$I I$I$RI$I$I$I%)$I$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$I*I$I$RI)I$IJI)I$I)$I$IJI$I$RI$I$I$I%)$I$IJI$Ah~N*aHQM;urt?tI1 BFR)%)NВU)&NJPSdH)%)(I$I&I#IDI$INI$)I%SFVNAMyA&YN:I$$I$I$RI$I$I;>qCfK?ܗ•K>VK>N8PLN JZS$SJ` $L$'!%.)LJNL2I% %,R)I1R Q H%LL)TpR1LJ<& HQ%IڨwI.IJM<$ RINihM0IL}K?ژ$Ss> )?Dp#6UN@ԵwTQ( qa!X55coE4;&҆"KbTI(R B.Ķ#JdR B6. @)NI4"4&kQQBDJ)4"(9OVJJX#=Mo<v5S9Վ$=N8o⍩ \Ǹ }ywചQV9~h̻l s\VI(ƭEo%'BwWo $8[,-%HtlvWB^EtA?X.XՔV W^>Q3mDxZ-+>p"rlV^یj<:gWU+w'm${eē$SV4RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$(IJI$I(I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$zf'i iQ%I)I'XEtV0 4Pu:C)S{CUlmt(N݀B?GbRο#2HCg 7$ZV>p#Uh5V~9+R(j[ՒBzl˔6LͯвGbAP-HZ=[}úΠ!<N>m1;i.goUϤ!]OQ-k ApQw2;5VeF@p~ cqTis +I*lae6eZ#R׺TU.!Ð eT^+5*pap*ҡh$/%ÅU_c:BtVKs\ILuRUr`Ơj ;㙙G @JN:"" *%CG[70adf3kx|Uܬ@3T%kc?s`Z<&!UźVHrȃ8*mmUNU|#CJf P z8Rf>k eV kÄI i0{k 9YaiHC86"IRK TILpLJB\wBD~ S:6Lr5aD|"!*pZuP#? $h~ݤKThkЫ'>6JRn>懷P+VW5X؎{7vH,nSFmwˤ Z{Sĵ !D\H ,= wb\_O1Pe M ! yBk%2t J)EIl̟}cݽcu,}FYʧt  ?#ѲvfW4J&BxI%-%I$Sȅ&tJS'I$)NBI'JJМLJbRI$.J@S d%yLRLJIBIRdҒ`ReSM(3 ^v!^"!XKUwGS;&L${w.ya!\U<#[WeE82*MyRxI:A< & Nt$1NS RkA.[+.sAѭE;;up٫aĄan].&U1 QW'}%ҐheIp(LiA,'V6<bxRo 'CH5-0onӮޮvCh}vpod0k.?uezWYsk,ll` kF-t]3P2'ԟm6[p Qz>tl]c4R/)DLW}m4Zt$\VnNAz6%tT ~zk骽w2zԍ} Hˈ5"I'IK)}m~wp_[Vp7Ҍ9~h*+*\Q]GWBI$Jn$I$I)I$I$JRI$FE.=oV15K_W## &TeFS)&NJN)iJRҚI$bRHI(IJI2I'H'IJLo$Bt%)"RH8H'A*LLL%,TJrS' `SB*$SLJpyJvNIJp1ײy @% )g SȍSxr9/crIL q@pDrڈѪuSn%1߹߂[ ;b}IRޡ)JԶBa(%E4rPڈk۫o.(h܂K`.Ef=>'e7ZIBKN`Ļ3kk>9gp>CdSYsOD J`,ʏ@I%5+{:HȱIQI"n5m+hI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$N$I:II $$&I%,$I$$I$RI$I$I$I%)$I$IJI$I$J'I$IK$$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJ QRrHڕ)$*ܡ mD<%Je)Jr[(SII%)PA(RВ)JdP%2I4))&I+LdAKI$I!I$I$JRI$I$TI$I$$I$I!I$NT#YnT'^;H!\pE39S)=Zu{B͡A%.JhJJRI$ӦIKdLBP%*Sd&w I )td\GD%yI0I$)<&NJp To6'<e:XI$ȑ$I$IJI$I$RI$CdzB% ?KJHjH8 B%":`$(D$R)Jd$J]4 $HI RbRM28I< $S' $S'LQ)LTNNTe$:JRbSTBb)%.)τ䀔_$1J|9Qx &6#L$_K $Ge&8y`O$'r7NpK~΄n!,qZ8JVɷ(JR-p䤦[nQᤦږ7dqx+ _r[D V Pcu\RTP#L{)ts{{q솒>$WxqS$VI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$:I$I)dI$NI$I)I$I$JRI$I$I$I$$I$I)I$I$:I$JY:I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI&*0"mKbJ])QMS)JTe)CRڌj4RSJR B&Ũ)tJR )hEKJ))BhAJI$RNJRt&I$R$I$JRI$I$I$I$$I$I)I$I$JRI$ˤCEDlwxNS3 2JI:)Ʉ1 !10 BE%/)J2!$𒔒I% )iI%I:P2IT BHlJR-ɔM ljIdJDsVRkQZVة]r%x,ܗ,MNZV{T9>k|! . m=מ^y$62$<?O|{Y0OmTӤ;jN9I T铀O8Vöø ĸ+l~}/8J>?a ~򰂐׵ ]p!$/0 .RRN9DLj,`oqm_XYùZ&TMFmi>+ ڞI?ث$kUܳ.  1USiܱk9 KGs9 4<ÝBzW/;6$JѾYruaBlÇ&K,8QJpi.^}WWVuF}~{agu ÐeW Mh";y\#ih:"'Y* WډH A@h<<&XQ1Q% 5 J;8AQ 4v( C%"c YD8rL"L4>{bVjv3- dc6@RKk[7?ӖA<^A:B! .p`.<?V5ݔ9)ed$Xs,vȭ6<8H$[qk!cҾ08j|sX`PSh$RL{̞O)`*}Az~VHUDMNCpookJ:kA> )оyYlFkx;~)$7<$' )k=FR(5vZŹE?$ḟ~l|HC2ri-:kgY_ұBPҩ?*uΊ79.)$BÖ#jccϦ~Z>"t[@R+XB` z4ry QgTZ;肎 4+z5\ۿ5Q'ghP絿HUh珖wϏZgզa>p:64+ 2epD%3SWf׺}Vq?X\E׷3uqy]Gn><`@}MB%eȔd! Z$< PaMRPSwP9^sչj -Z?))=6L{#е?G.dwH&RQ2LJEFS$*$RR $LLS$x$%0)M ")H&H8N)1)$tGNQJ:HQ%1HO d$鎩t Q*[IQp<Ӧ'hgi$wO))POiȐRHMS5O&'<3|RS:S𝕺NJD8Rt pD,s-44" Sh7{*42 hMYcSx](FN[_hZ H1!ˊI@җ|J#qg r"Iɔ$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I)$Jd}%tJm)H5KjHd&܄%$I@=JBdBjJ]$Ĩ(BdBJRCSQN F RLJbCu؊j4{܄^bj. ĩrrX]b6cbm!%*QbEƴU=T_jbcZbԔN6S@!4#ryARCЦZR T!2()FNJdiN$JI$'LI2tNILIK$$J]$I$BI$748Dw4z —)N߂)49k !:dBGDKI$<$H $I% %)$LdR$IRJXB?h)/Y?1~*S I*I$I$I$I%)$NϤ>+qC6C2Ro*i(PQiH&IJ%1I"A8AK&JS8 DEKĥ)J5NRR)J`BI)@%1L L' RQ)b' LJu'NbOD RN)Sje$L)%Iúb HI)I)IJAH7tB@*f6))@@:j+`sr P{[V`*oJǗq>JLau5?}2w|U44@{~sE6c#kH'N^ܦI$ $I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$RI2dO%.iJTR@-JSJiAIMՐ )II D IJI4$ 6I(yL&J+jiKJb=+%Je)Jەp0Œ+SmhJb2ֈ+F$%E귦Vizi)>XXUv&,V4ƤTܖ_N,Uv&,V j%)>9V-M%RSJyBRA"Q<B)tIE$$$I'I%)$LI$L$铤N2IIK$$J]$I$IJI$$@`@POp Nn߂AxTS2t.JQ))I$II$$JRRI$$IK$Вt)tI:`$I%~_%׾_/{k"-|,IUdfI/ ]v#ฌ]v#य़aྨxYGO 9HTp:JS$&)D% @'/ J*EAFMExQ(n0';B+ZҀ)==G!@v 26ZVif4 ݏJͽܙ)LĢS& ST%§^)7ĢHQO BjJH bQ. V3[ a%v)YlI=m*9. J5C"NܬhHK<8e֒6U2u+Xss4!WgԳ c>4SZ:lֺ`aZA坻(t7o:v u[ÑG51LRCP]c NӢsu}'<ʮm斂gVVgPqs* @8HTZ9+D|TM-y#,7K !#iR=C6pʪJIF!%.M*t8o­l%t'ڟ.5p5 @W졖1(?(ʉbsdf\a\ \׎QGOpޢYWbĖ>_>V8#UxO- Xyl|.Y,'9@˶KCf;$pny?5B{~Jm`,6:$̺ן3 :H?%xZ~̌JcEWM 1Lrnu7:r.yky'No7ި`#3|OZ~Kw"*X1kYe`|JL{5ٸ̫̦vN%mB:VC_EM<=ei ܒ绫f}֩3?+n0YhI :ⶈRwZ}uU'QƮЇ^=Zs?+T[lypwu@^̛lN%d~ʳ%6w-;1D;`2OO_'!SoD?>kqUǧ߉Kܙw֟At~k  xen([߂;z~;x`YzU~+k'ua)@wQw/?-k f5 Vh5v.V߮V2Uw}nw oUdZAf}U=8!Vqv-Ә˚.ޛ[mgpd^3𝷖mzL,wRÈuyfN5WY-(obl+$Jncdv*nXVr $)VPmHBU 2{x({ R5,(obI!7dBŻXE^;h_NZ{B[Vfu8:qˢ\]])׎s6WGs@Uӥ )*$%E(NIRLRLuL$R&O)$HJ!:)N U3FI$)tҝE4'I1Ep^R1Ri:I$(I8I$Ԩ psT--'yF?Pe*ΰPkEp~ }4dx~ѷD?'R :㌵!0ki4$ 2$}}'gTgw#FUڨf>=%sIS1քuP'f d?m%D!iޣϳASnކḁFhx fM$Ю~!geٳ*k~*,,l\| V izi)JbP] !ՀĶ$N.U TZb& Ԕu}E/M?O 7L%Ɵ HnKU]hO+cb\O⨆#cِ4.4Nߛ+mvc}KWTتf:0!rX2Ae_a>_Vhǡ\n\Ę7+Lo=+;cyft 7F%dh6}_Org~eO?M`Jq]{LN0N]c@Iէ,/muyUVuL IBSLO)FdH&R*A8QOJbSwRM]Ӥɒ%2iJdNI^Br|)JX$Jfs2A<$$SJI(LbI8L2JS$C!HH$Jd8O D%*$&%?)m0# Dgݑl$x?rcqvUyBp&^mk7o/<5a?ױ޳@OrnZ>' ${w|;ܕ\m7ouI3f5~cls)w3}!PC:]>?e';]DHj;GѥZ?hؿ[+ȰT){b[mpcOjzO :KNi,i*YZ|$܁p,>4!+U=#>`M`Z'3kS6gHsbନ8Φuta9-unL\PRg9'sO#hr+o RKo) tV\Xj \{!ՔkP5ZHzjP"6EՔ71_5k˜r-EmʉaQ-VJB<@\ЊXZ)"yPO(p)PJI)C!ERBt$J]$NTIK$2bB$JjJRIʂI"R&NI,2RIJL[+!VL Tڐ&E{dH(pPLI%) !I$)<$2I&N$$IIL2tI:HY$H,νjj׾_)|+2o9Qd$Ji$ ]v#ฌ]w #य़aྨxYGVgNa UTLT8$p]LIQ%HT @"ĕTT N0I1y@L4"wIGAhrkk^x(QuTM` {۩o1B%Q n2gTzS`H5I-{6 P;Լ+tH5I>%Tk DmrB+KY*dBOrqN"%5v^P\(vXٺPWr1\DACvJa![=נC0Y%h1ZjíAYQ,J1E|a@Nx3wu_@ZgF;FZ4mR1 |oٷxxtqǻJJ~bR F iͻ%6{=YVMDG!a~Oܳ꡵ ٷy%6{=ݛ]q3 V`'Ho*9;omI..(W{DזiG_?r4nx ?y~ɳ{܏wu=d0X~c Bg5/x.8GsQ~C3x%Gz s>K2]aNKZ _ VaG䃗8~aޱC!m5qQ=?/~/r*kz]M:Tf߽c:dV¯?'cWReнUR?ҳItkU8O o'߂{%.6Nޫ{*%TsSFJHq5RoެmOm)VC5+\5!GopVE7ˉ$--f4j\OV"d[S$TX &~N^)I%1mLohI$I)I$:II I$$I%dI$I$I$$I$I)I$I$JRdO)IKct8pQ[s4k@(t[ VRVSJ;:ݭMY!AMаVT/s>]m>cOaSϿͬn-YӤn6c~$o{YL }^ +]VRY\" TN'O!5bS~Jb3KjqJ>Z ?z2mVFgk:-FcAU >#S ?;0hC> _T2ߜLCeR韹Lu\u <7X2z.鏑*CZ[%X \|JmUhk6;,6u4㬸jLʈswy.C^%;\xk1sE$p{-M=jj{r/'<[}OkO2 )=;AJÊݹBYGyķs="\\{=P3jZ3Ob4gbw2މL>4?cDKA9X #S@ ꗼ)>f!p(JRQܘ ))N: H&I$%.] )ܘH$A:`I$)RiM)B@$Bp)JI&I$HRMdpILv4JHs~(ߥ)@}V4&Xҕ3M%tf 2UaaQ* ' oqʆ)))JApmr*ZH$$)Q%HBIp"tĦ <ANߤ8NO !+Qބ^m CU/0ϫls@ hѩ)B@%9zm_cAOT<6͝\}M"K;X >JO4[Py$5C<*怰ޡnMt 84x\Pȷ!ήhZPbn;%q` -!i_Ѫ5Ni쌖2Wr* 晣zv_*J/qkIh`x;*_A .Ek[cˀ`x$+ʚ\ ԫYش _$"RYKJ)>a~Af@dcz ud\SmW:wOnaps Div5ۚ #2 >3nxasY=F-`5#zQ)@@CfMvX}AA,ʲʚV`ui MЄrQVۜUja eX*"@ևΏwɮȯkA^q$ȑ掴 ة{gbXVZ\@L4fZ7"{ *x)ջ ƴ|;ޅe[$B K}i{G wmїv,{2rr uCl" >QP|Q.7k M4pJbe$0lyD*kݫI?+Rk`x)Aenm~i욚P ))UˮvR+ .f{r\?PC f٪ k zd u9IHC<mA~=2OFO iL Ʃˆ*}H7V@>"}Qst#y"U>@nSsH{6y`9P6GyEHq)O#nRտMs]9w#>ݑ.(R$4iCɱ@"FCث0'TG<QT߁U~;x9K.yITҫ}SO迷[FCU/{;AUfjf)~,oU!4@Y7aYPOBXpk uGɠB6z> vk=l\&Wի]g# HV !U'1l_\CgY[v| (mͱr?[sex{ɳhe<d*n VTĐkFU TKU28(-r* jj J@ Pe7AKt%)$I)5BFLB)E*I2@$BALL%cUՌCF;HV2wddОBJE0I2P$b2p I)I$Id%)$))$I&N'IJLSNѫ_Ūѫ_6?_ MG5 BI$3I$ ]w #|]w #ॗaྨxYqxY}#*IBd%iI4pL QPr(n)›BZЊ.(Nr܂'hS3B / ^ cw8X$rR+r)Q{)fXM6?!ֲ,þ qVjwU#e-`wGrO)UO⩿/ͰPqִ#Qb=G'kZJ{-GkGGG]k8/Od1yŖ~ bרD}4|uhҖ0ó'?(S̐IQXp?$7сTByNrH#UK Os' G6~ 3d]S5X tI$$ҒJAcdJ%r{OuJ})J%6!HRpܒ_*!NPLB[OaL (ZU'v}+?aT=֏RIhyB΀5(q:I)ׂ>T/EnѼ,dyVo:R z"ﯛ5>dWtw|6GEƎsĄ8ž%/ 4hksI- ϑU*#jJcC[<:*G=1hr8ѳS(S%Iڀ`Ƣ5M:I\$wxhNRS ݶ5Ce lK:J3OoDz?ILd:l28;宇}Z><ņi/7:-3VFˇinSP jfpΥ9QL'I$S$I$J]2I$w+W}n~[忛F 4|.ϤEq?+X$j[$I$JRI$I$I$.=v75oV15Kf}?f}?H$ek P BxEKiLJIBxH$L& )<@JINI"! R  LJ)(%,NIIK&OP$җde(KN)J*bBJE)HALǂGA)Av;G) t*2\%(9h-~A .*$J()Z`H$$ H&*)d'L:dI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I'&$\QT" Gz$B!j[RRYH0j}A)&-Qv' II&܁&6N+N+I .@6SF"E\ܠn@ R F R IMbUf ¹/G@IUUmt(FcYArS23=xXچl{[}Wa`` F~Ku ġ[[AIU\6e*#p^qV{7UL9 @kYgӱh`nлu+%W1)Qd=/'󏵟5UP~QGYI>wFlR c^70peCSNgJ^*.R8[ >A4QuV`phi$ 6480xFwi,ZG#T]ZI p<7AQ̯읤6T4q*].[D:q=XvDjaIqORsAq (Xf7}&@F6KSAq &WLmOi)Xw<ePo̫e $/vΰZA 8]n4ҋOO Ul❻=}2CIc\<08$%]A#4@Lx\`jN!YZK^#Scd)sDh/ao>)V_t2ZtVY&IA1=3e8{q긵44Og]{Asx>۩z}VnkI`[e5a ;G]1!’gm;ct'T^- H죏[`m";(oxWA xqxPʱ_[=6͙ < qdm ߑ[,mN0 cRic쉒AqL ?X;[ke0O%lwx1cdz?ۭecݽYSGݟD+b_q̳2>Zk6TI% *$2ppR1I1)K$0L4wMXAJL{'ۢIJbE RB*\$IQ:yHH$ )pa"92$JJXN<&RɡNBpFa QSpSyI)NѸ Z 6;`i:Urrp#c>W6@xW1qN>`ޭ8}D䡒L)$J)J PNpJd2 RI$$IKI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$"1)I$J`´u)yM*%ɷM-)*B R[\)%Je)nC/L\H1RJI)!MWԃJBrbbcjb^+RɷTMkSh^lUͪZ`jWӬp 6(g$ο;֟ iQ R Z @{<i`PSlP6,3mMPƉ.wW?Rn?ٍh#me#34NJ66\Ʋ2FC}@I$ѺZEGkhp>>8Ve]Xiq 'Mb3cp¯Oi]amb@!Uߚpim1d,s&vZXu68n{ }$َrٶ^Z=L;F&57nƗxRSCbaKatYEa\[&78%X{|HF1kl~7_?&W#XF4z.:6~ۏF`OO*1,&PCfs:e0N҅5E|ޗrĶ='󾂹VK: a<{`J&_Y#XJv82by"(7'Qsp-'tݓ;ՏOX;U[|߳mH2;8>_IRUH+X]7AvݨN>Kzc}թ)JM h߷R̢Yf0b[7*Y/o&')G7ֱ퍿ެnJ=F wwH AWoŲm=rrFk=Lw3V7ՐQCsU1 BH@XȎjMRDARI8)IJI$eH vD)M*D!D"V75*C9NAV1x#D#b ) ⦡p(S I2IJI$ 'J$I)I$I$JRI$'J%%)$ $$ѫ_Ũ__5ked?<k"EI*$K ]v _Ws_4 C̳ZgiN& UJTIQ%2 D%ȔI΄&@ВyAsIL"4$1ʻΪorcԚ JbJcH`!aKNI*}Ѣ%f $Jr4Q`3jIG[EȬ:e\PD] y%֭%I]]3 ccanaJ6RE.?ƅjΡk% /w%(O[krMFZ+m) z[Rڒ;)O7QqO>(aY^ߴk*^KvbW?k 9z}zex!4. 5Qӆ5. {|co⧌`8B<|ch|oS[~K{iO}f'hN$Gudw]>bscZ~q"n] 絛>jG[+\.2S8 "ON6FGU%O' M%v cX!FƷ}hU_sޕx7YZQ>hb}RãaRѫ*h&cS[~`\I*+Lt+>\AN)>Mav(8T{kt:cW)SP3 zD%[6Ϭ9&.i负OGȷcQ!Ƨ2ƏӁ8.qC,Gշmt|?DǤj75`*&ҚdJ;aYێd߮C-ߣ|B3zs3^34 [б {O•!gΥP^zn<<fYl~cН~'p-)T0ǘ*^qcsog$(}s $B\eOjϭn#*hR5"ѩ #R2J\eOO,k$򱝈;MmB3;ni<*tz5>殶!()9BSo3F~Y-zmYt\IZ qF9*?hCR )ίގ-/ޱ(o ()ޔHtO(}RZPOh7]/ޫ{[]ymօe yq,*Pr8ʞ#n3ಲ>?~%RgO`#CoAi|]`QSJEM[~KmtCuka+hgR8hBʒ3;'l7^1 loH4 @ ILG'LIpIM  (yhJԳAnDm78|A8C@>!B0jHlTf^7ڄd΀8BIfYChμaj 9K[e}Q@YhVzJoÔeOw-`x2P$JTa$$BV)JA$t)ɁM N%7< nRġW˼5DW˳ҩtRIŲ'M$jՆ ORģ3UW>ja$J}Jp$`TO0+'}`Ȑ'E]3fpJvH~ٕa?*Wr^eNo%<=՘DŽxwÇT' 6uqc׎ݕ"lB";Yw"Qgd<-u[75²]Q" OoB+po->o\uDWw5E-G8^vh37]wAu~!Uܽ3X}CqX 覠,I92IB*RIR^}i+ϾM??_>gv}'% +*X$j[$I$JRI$I$I$.=v35oV15Kf}?f) BQ*&T0SS'pPSJRN5 I? L$)`SpSy%)J*;a$QU"I SLH'HJ"RL)1IKD%E)I(IJ rSDДQ"S!"e~J n$qGٰhS#PPTT JLР*)H% ItɊrJ ]8LHI)IKII$I$I$I$I$$I$I)I$I$JRI$txE*I1M*))BhI Q$%t%DA%2R2IGr[RSږԩLPܖQ?MS9M! P!H2Q}56֕"bMoVB0>đi͈nUsj1>TQ܂lQPKSaZbJl\܄eV+Ge.yOWEɴNz d#Q-rR) pϻghqy@ܳC-O֏)(#~όu]]j`??ECQ l?]Rawl'EGGǤm$r*)q(\1wͪGS֟uX?+$m}Zyݽɩh0gk~s[yl5i3k i# bmF *u}v}DuS3\i  lu,v%C0 ..msMQDsusXI+ib.VlΊ,_XÈy1OQ uw߲ ׏6L1 WK1~w+b?lt OuH19> 8U:EfZ6\i@*S_fݵmlemgsPzn-]a?VYu cer(9v6VE<Yj1e3{hX24a>sܕ'oHU ch JM8"Gm``Uid,mM@JZ F]TNtr)nQIgO+ٍt;YHG2>e64^uFiNeUx[[ o#g-iZ EJD=8VqT5 ƭZ J)Γe!xd['_JemeFB_Q{)nm5CVAOh-܏sS ^Bmǥs~Vk+g ?\3,(?/,ZK2 yNRJ )1tN 0AKLJR'M))I)Me$;&H:"SD$#D [$ऐN!2ryI.JyKBtҒO=%IJIBJWd:iM S QR %o"qU-q:RA*,fٿNѠUژ!<89LЦIQNS tT(!I'LRI2IRI'I$IJI$I$RI$I$I$I%)$I$IJI$I8jJRIQIKjhIK$'T.RTS,H1*R&A$MmFKRJ ;+/E*R(Bmjk%Rڒ$7XVih1zr 15Kj(b}!rmFޢM#AZJObCuHVC0I :]@h#O7餦ɵDک]] kK:u/{pp8V+ZmXAwAC&\PcA0 ,&jsve|Wskp:{k$ˋ=jx-*[UZܦJIwM_YkCveXYC'/}hV1#[o :Ty?Gn=!yaG8h:GyKHϾh/wkgQ8( *c㢟X~?J>o)6X𕦙;f5,Cݐs7=͍>So&',zM&QeFUfP#oo-Ls-nf6|`#./ƶ22{~G}m{$'84L)+eVjq HZZa(IQ6-k@$5G>0h+``>JI)lʑiqINq{ˉ&<2cXKyi3W}s.Ua.WBnXγ)mUy m)59A,Vee:"V[C*gM^qPs IkO~b ;I?5$6d^B"XUUkh;u%1Dv=`!ࡣٙe6F]>:ﰆĩ!c%8?AHֻecsaD`H5?PSu7F@RILZhBDʕ:ˎBP_DA8D{FII= =?[iy y#}@T@LRTiud8q AXaesΩ)p$N_I`->A,p{L9AE~S#!]U-piwQR[qnk A=42!HvEx:m(xpiu+nF3D44@S:k m%AMϡ;]:ߔI$Ld(ueWs87Y[48ˈBR־}RkX5dYP*686x򅑍^Kv$R ó"EM.#S@@&gn!U9gp$} d#U8I?Qci9*Ü`cA暛{v 1S=T㶠^l7٩eUdU=U'Hl<v+L+ OcAbݩn>f15 ~;{}Ap;_%~gT†6k|-ӵ}.#nU9̵Ç,KRD<;wCP5Ґ  ╪ծhvu.g+jڧY[nE{pnC~psh$5܎>j\~gOz/Hg0Ƣ}q}O>m` OD_]`pvWt/oY- v;zJe8RCAvY)$HvH$=N@SH)J iW6ʃVIOB !٢fQ{R ?T[ZHSd j D ZF0)Jd:PJSJR$RiM)$E2iO)2JRE)H'q )I$eWUeuWl&__ MG5ZAFI*٤K ]wU _WyPSKUb?d\}xXן{%8 :pV@eE.CsL)YBsP"4&hSR\=r܁cР-|Is tRXCy:`hjRP;Jv-];`_(y@WR-R)l1A'$e ,*)ʫ 0rJtyDžM^2[Y=+u3UQZ:)$H LJ?}*lqhCTU>I]AL3 ZE ht[&{lVߤ9Uu( 7<胻ӑ> _dV'OLVu@GrmɶT+_<W!seY ڌֱ4(JZeK浛7U^o=lo/H0'ad7^hG>ta.aOG(xO""ODXz7d7핎2IJcĂnV;CSJ,ӂ^X$J߬gS9vW=J Y(釗V.$[؉.rZI<s}dh^57sN0_5UWv8/Ta]G)2͍ (y^ԕ CJI 7Zjsv&Oi+;X;g4G|QOtqc xƒ/{["UcgivAq U$jkޗp>KfVDGdkdve،G:*_WpSv.CkOuu>asy*_%]GW5ZH z7L|gxit+WpNx*TƉq\Slz H>h{>*;zz~a8SI>HLJ~Lw*i}N˥=z]azYG>.ޛ*=7.7T?+هS4G\Af>z$8}t`ϑCWuv K'p080Qٜ0|׫; 7Xd.0'Iq XO`6!;*e1G/L˨W8˱~n]wMm\]k9J ΋is{RO|ݹG<#:5"{ocv;$8y6,g(˻c}vvDXiZYg⇵%qmq|jw|ϊ+k伏OlV~(5n]i>Joˁ$I&{#Bg smd|]ZF$Xsĥ^@%j8V rܻ'9MaTu[4|베|%MWXyh#c6u3W w%\Aɽ.HN< $w^4T=jm59״nUL)7cmoއ -ǽ%zkXYWtI3wb-*!H ~(ޣ}QScmA0Yw"֗*˚~|ŸO!7V2TgVTv)HlYf{ci$B(E,N@5Kp n*^1jJt=Vd"2 J{SmIMKbm)2Hh m )"I 'I%.A$$JRI$I$I&{ =~JtbMyg ySBV8HU20_ heCtYs_L,;VqٯITI/$mײI$(IKBPJA8H$BHFpgNJ5KT˦̀ JKITMaqtj%TX*cUΪn8G @Ϛ1$$*Rj) ge7ZDTDIV~uUgFrNyq&e_%d הѺXtBu7@4yN╆]9IJ{~/I$^_.lh45aeg MnWohCC7 $#v:;& tp (0o[}/96,?A+k_QYzN{=+>TY#b١.6Z7Av/7X}kVU ҄,T&"B\=4?%[W9ovQ/3EӤDq+X$j[$I$JRI$I$I$ȸtUXO?,?<R_T3?d)AD̀B) H)Ʃ- A$A Dt%IXKR))tJY"rTd$,Ҙ I)%G) I&O))crdJ{$IB]RwLnAtO›{20TPܒ$2T)+Q*`RK0(&%DS NtI$I$I%)$I$IJI$I<)lEJI1)A%" )J!JBdR$Ħܢ`6.T [\LZD%/)Bޜ= F jT7:[~BkKIHڨzoI0\ӊUf10?I2Yq'_7 yx_NYr_Wm?MoL9!O -_D+{ o lWw 3 5bgy?5fIQkԑM 7u׽뜫ˌVRRo]GRsj{pVP˛@;y㉵h(4uJ_l1::#n<Ne=FLZ4tj8fT=/4NUIFXQK.YpFC^jAvQy:qg- |fck'hqVzOfwH,61ߡzSJeVqE >ߟEu")٫{)in\Kާ,kekwgOݖ*dywւ0$EN,.vMvJ7*2m{#ySy]$.0m?D<~F5wu7L8zEj"$J/8?y1-"t1KGWS@awG^yHT:Em.tp\cCIZۧcI kw4GZb1̮ b֒vJ`Kthl ;DȎ~Hq0( 2a E/R=sQ=Q-0t#*wYg>WM8Yoa;7:[5;)!hs"a(>c0!Y~S\6Cv-sHaCI-cA;A090V#=K:Uh{ 7ǢXkw4w )яfCT$Ĩ=0Gpt~RYk}0h(ccyb*=uAGn"Udk0stGRVc3U,qY;ŭdܠfUIGКَʚ\pfSkMLe)}n5 BVZW轷eVLH~ kX%bᵺAQr9QXg_ <ݍW[(vAN4 nC~ꊕ*X=H0?HnuY02<dmE8uV-ShJD^[9)1ߌկ}8:OZITbm$9p:^zGPa׎ֺn4| rX+oT.v"I+Xw;"Z9KOddƥG;2[cB sШ$a:[#5~`3fͨo3V*W~WٽP!e`ۊ"⫤]e>ڛ;>:rUk4FR% m50u*xqmq+k5P`}6R~8U:zqNν}$OߺǷefDOWIYU"D¥f.[)Ѯۧ{7jIWίV"`(%@ #zbQm.{ߏ!.Qq_N9@t{VoBkͥCn- \Tۙ;\;I<č{T90$IV54AN^]EܷM8Id[*/i^g?j?FWptu_J> ^Qwֿv8 ~>T .s[b^LF«5@`;i\ƾ  b]U61Ϯ=*6buf;kMų((SShcjgh߅3ycfAOgGT6fYYOpU`S+l6ܸQHyk.ղ'șgΖcK&f9 O*ɦihR O%|}ŮkpTvK<'D_ZDL l `<<=N4hRRNz }! 6]1[y ȹ@t{cD+MV:HQ˯>mgG]~8o뭵` 0Y?I-~5m G}b`,],. 9><jc{>Ӻka]M7uny'H=Z;]gۡO!%g; ofUel1i*YfăKnA xK"'U{m7!SVVYyiF!g;B"=怜nJO"&rbQI:I)t'QN$'L$$J0P<)ֿh+Ш l;O y6ߊ-(HIU^$I$IJI$I$RI$Cf}}!]>VaĿgA)fZK2,rN4LƪfS '%&+lA:%rЧ%ZN Gڤ5ӢE!ON> O Ʃ!fx&{'TI-H`(LJRy1S)9IJH'Dnv{T%7-C{R䖥+ LBrD!D)(e@SyBqA,p)&%E:d铤I$$I$I)I$I$JRI$IeKIJI4* ) )tJt Rd3T VR%*%pXMiRJt-!5ͭ;kVk3%@ Yj)W=%!R*zܨ|%{N)IV6*>Qu)RUZ)sւOIMܡ*C)4kX9s)-"KvXբI !aTM ϭ ;[no*cOb5PX?:k41H1hs)aKKI Z &Ճ_Uxemqj*S- !k4#{,V43zur\NϿh _+c@ְ:T0{`;_ƲcӃUZ1hnq;ߧ.h cgĉ*-i9BR&uڼ\fuG!9osd1c@ohVK65N0nw|4@T\].?۶wk(HSWNrO޴.XAhs>`G*{IuIZ͞_{n\S&Y5w=ՙa  smF?uB+/;jiqf\P%Y:xX3@`VUV\t8vb6ȓPjtk~`>^w<*fSېUۑf'i S\0 6?f߿UGwrr ;u1W~n$žAɥ:|S[\6D$|OYv%C.kplkzv[IPm`~rJ>{1xISI^O$8 o2j>οoVJQ~%^m3xijZ=bFة5IXfUZ"DDkaBʫi>3ֺڛc8I+;h:g]@LD_[jkLؠRTrpc]ӿ}.ƀ -.m5c=RncI$A*J64BAUzMՇT;10kx8IA^ )VǵP$| qɰ"@Uc5h:!tk(kVYna&w"u,Hp M%0h8BbͲLw/>v%@Đet x$}?2v9 'Q|Eŭ\Za}j*f;^ϟ%2mɨ#rDgՐƆ65(u,Z Fgo*ȯk g,{)<'qŠ'%o cYA>;%7j5|5V8RӲn콰DILlmti|xu\zkc:#ϴ۽\ITW_MAYđue }GM7Yyl;d>EF{c2I1*k^F%xŸQcl"@<" d۹@! %2PISu6ָ"~Htde,h"I[^e4:4f<5O~.31EMgs_APIFioz{e%^n_m׈o*߱|N |pK Ȁvrl\ DAQ8!I=VRY,fIݿ䕲N2֖&UT3nqߛFE:#i$ WwI[0fՖ#2T67ok Z "|0)g]5ԃ!|Մ§ב  u"k(g6F9yjvk(1A=AgBJ\+`YY Og%%ߥRZHynȎQ %5IAL~3@$A?Bh終\`)RFL2u!L:;Q^C!0AY6-]$B3Z))a>FkeCe6ۛU. )J;;(efڀQZ(Y]v =ǰ*O۝iG F$4aWkEK(մ'.+ǹ!b:.+ SczF$Wg!!eU1NikZy_H7>u]'v~عNii ZIG:j%gRW| W^$*w2V5Çi{iIkz6iY(:4w&NJ@EtВpIK$BtR&N$$$:dН$$a $HJR +WYd`L><jFjxX$"I$ ]w} _W{WpS G|J<,GXpUYCTS DjB#B)YMA{"4(0orDzʐRe0 H(ނmdTMdR`  d:bJ FLL6I:#6|&Nog nvk`8Z[KBD]S 3FM7R㏴ .k].<.,[/w Fzƀy/ t\JGݯȁQ3 ٠|D r)L˺I..N*~ASɒ}d;c*t?!o;XVp&>\GZH{cw6 RhyMqTw'q1k4 bĹgf}hkd~+_$֐2=Mc~t9V7%\2'*g7pm%QF%[[KeOr=+*u;] BI(׃UgpfYutav 4|ѝc荏CG8dI>2@P.,(NRR 2f BTȶڵi]{m.v4,3 98hn`y$諮$UVSWMޑ%NsCS"D cb7{I'11ILlv`-כt Gd '@? =oQwA D!%&UOZltw*>An注{pvZ@ȔT)f+v@CF$f $NrAILQj=9>U/o|qĢ_g,0yGnfѷh-*g_"I*loa%)fQEV|B~`iYP\5C*?6+ɘ(ρDfK٠Q}~ATu~Sc@m[J]6Vd{*Ϭa9l$sU>ϥ⮹KT1S]4IALtv~&Yǂr," Of=v0 X} @YqTŷ={LI:is?ULX՝Ֆ7U7 cq*G/-א2Nc_%iLA6t}1hPwH鶈y7" : _YhZJ#zKytn9[h!\Elqsq߄?7Mv95Sm9 ô+ZPcW0z[#j"5}BƶENx NwIV3[m{>#wR쨷3̊o zA\KrsCڊxVHOgfdSoF9oMwkAr[$.ѝO)73Fql^W)Ot.Kngaf5v!yVua<9p<e52 ϊxV6HzN Vj])C M\v$SqI"AМ9vR~c 7]q?-O~柂vLk5MecܫPzkm&Q"m  aq'4׷Y*^ՙW#-nk{~IsLiwb711)ӫeJBŻA?0nU\a[{(8))ٮlզ>(s3%U Bji@RSг wDa3>}(!YgRgҫBxDuD(m!: Yvx!E%-mIIC$!l%($ZjJLwRxKiILJ@ԨZ{N$$85nTSaQ3 c& ף ȴ;P'#vcmpԩFPJۭTBƴ;@ۅ{ǒ`ю5G)] \3sW+[xh@èɾ#@HS&HjXr>:N: _U䦝Rm 2|arZ?ǩ!rH!x +?V[9 Ofnmgꤘ'Ua0Sm֤I<{[RkS,у➖RI$ֹujc'yRV䬄p*1g( )qd &!8%JRbQLҞ$I2d!0I9LR%.RR .5HJ$BZ%:Tͣ^JE%0Еo:p 4 )+QZPAD )0*mQ! $)AD)(Bj f t0TRRڜ5%2IFSnPIb^Ti!Kz' D R E 1(fbj#Z1MII bdp0E weYC6¥\FIBIKx*NɔRX EݲRxCuʙ'>fc9UEWƁ6'?Gg;Ȩ3u][h=w"Eu7O_M?L?QsbFѷcKSetڨ`Pmy1OCXZx л'IXN9?I?4Vk5wO.ؕﱬnqVX Od?Tnz S߉c7XZ,w=?c}`r2:5ո $5c?!W8Fpm&ud:Y[fM_du^vEtUV6j"t['U nĀG 4^EN۵Y(>kլq`6@(6 q;AwnM]6f~=t۳{1 oA;d}Pȧ![q{ uOߚs{M|5Y\˦[]u9p1ƿ]%[; ^KA UznE;ݕ4ZgRp_ R6&KlDLKcŬ_b!5;6GiCt=x~I>3ȸa [F ±ܷ4`Fz9-i t/j\ :,8=cR>;} \F`*{LS[^«16@25 -u!RLq (1lquF'CPXqԔ0Rki<z}ocbL-U3|ٿ?4eQ$DGF~eV)s}Lᗴڪi OeaՖݗ6@y*]Wuw 6v=Q >R1;0x(yahv%QBYCukD6XAM VW$nHJzAm{K#}$S+mu/yio3 ~o Hnݠ#P۾Nf{>W*Xꅎ/,,q}}_U.94G17>nwG8a48:;ªLTi0WXj*[`S"D,ΓЛ}p";zCd}_ejkeǒs.i"%DV:ZffUÁm3p`ag~ިƱ,IQ@+wmPen'E<8 a]{{ \!5eM o0bjH2OxE dcS4Á=>owP2}GD^̊[ QSe0U1:xNk.iZP m:5SXM;e /T!ɀܺ]KU郩T*.Zw>%fn"Ot UYl9$ T5#Pv%"8BYchq&:~3iXNJS+/u^_k;?w~̢Su l`eEy}ykŅPkȮ5?5v%G3?b&CQث2blz$*5D/+Ve@'VXBIocjG">8J c'A`=e9wp]mrw ߤ>JM u`tl-1ì2xx|$KEZ8jz] AB;O-n3#Ցfuރfu_N=i=r蘵 &v}Sjj[=X{Y]OV Y=k?}3 GiYXY{trEkK4~,bQ>-:WzEYXw^~tT->S9>hLgZ9:J!3ep]77&ht *ԉ,q'??[i.Ֆ xCjc<5E]wVqӺUY.wTTHLXarr:swe%r +* U{Xu}¡kv8Zl|RQl:N`1VGP(m$I%)$I$d)I'Ld$Ld$L2J[o7e]-(H,IU^$I$IJI$I$RI$C⻊h\;>ݜb?K?ܗ–^F9j,HO*T)Ȓ h:$N%Dj@Jㄥ%,SbmSPRJBpJ$J\ũ.D&Npe$ɒot)td$%(uO GCC?D$ )Z%dLm۪ #̔2T ^N nD  $MmE@2B fNBdBtҒJA[R&҆/V)J;܄j(LV)yJTw5bMZT̔79"79CӔ75^[ԛlz 8VڥZ8a%7w(!U*.UvҦڕZ>> :h?E%6MA֪CpD:_aAٻ^^=:qqj-d&;xaT]oU/]rٗ}&Tۉ=&3FXh /H!3Y o@73N8WO@]JyL0ls9WW?R`{6E^3 'sGc[;hiϸd8OJ_ OR~2x9`7]k[[m=[jp,p SE-/I @'D tqK.cKb:PxU6;{F~\\Of?EeЃ}BZ7V_A x SȹfƎ4 JL"=>ӰLʋiXsybeĒy'Sehh,/y:#?|4vR7<4*xmۼ+U4񮦜sP B\v*[̳wkشh idpƏ&2KDTݮi\K.wF!N~%=vP(A5%T8Ho1RVzP^c<s*pWg^]OY.~gGDySs[yqb(X-n؂XHZXp9l꒓eb?_u Bnyx`<;Pr3xc^㲱‹c.NRR|l 2+/apMZ1E.!trRqI.c2` ks-<2g%).!`|🉷q 1%DUz3ֺ mè+h$ẖiN!XaAͶ]@ARsIgx9>s2[,@uW3'ԨKUpזG+;=4 V?FvFȿƸ xeb&JTfG!Ynpv+gl0I\ABpݐfA} 5 D" /ԓεB}-:H$g̃>4QfZx~Ȫ:־9Ja!kDɧkh<KZ ʲh2 ş,=,̆5t@.簏C?9TaIT5h䌦OtvSwDm]2own;j7@Run >-cY`ղsc]:}-/o?\Ծl#sl*zwÔ)D[?«4%ꩽY[{5;5¶@q:C_sOb+^# ;vY=G"rjXYgT-Gvrk [Aiv:D'$5-opא*U;XXd}djY\M)7xxו0Ul+2$($W)$IJI$% 'I$I)dI$IK$I$$Y?X8_Ŭ~qWl&_CKbɼ?5< #I$UI% ]w}pWvUR=4_T<, cV`d;0 % H7&0H`ЦB .F!3j( `e4Jiऎ2w@;΍Ӡ2VzwԌvKZye=::o&gZ \vVu;ӦcF!)!axZ?Cd8C:GlI(q hJ!}φ*hT5'$u -//aWW.Oojai<(d1ؙ=6ClBY! EOMm@p~;*0Ϛ^P:qh KEcT ,'wS_$}n5U&m"&{OdwU )vq&S^%=B5 D^]:h݊k5 k2.^dUJ:si$WG絖glu)Q),Bzm.U699 p*cJe]~|m9^[D9O"Įh%ꯇkY,̇‹s**`Ul+ pphv5QX;ݪ[H8Pa ZwWhtwmQI)=Ų[/{'NE(dyL h\ZxWHIKIQV,R LU,PFcfvWwVQ%%61Ō3Ac˞a=ϤV*$UUqk⊙)@@){KP*l5GVUQ!݊ AʰB_ve2( whjMN]()6ID%6 6:H2Z4pQREՉ!*1b{a)wO!hŁNX Msve,6^{KABJ[!;V䀗e7jFLWs-*gUf8Wܒ7VpQ 辷S~dQm{=@Ce%1k뵱dJm ZƇ{ %"e1twQcKOt#gCu[!6?U/*UYj+a$,{F)l@+VPˆJuJGy"Ur f$BD9v\GШ}Py !nu/ԙ)GZWGUƻN.im톟M8W zdcXVS>u^59 X5]_U(pGDX[d awɤ#W8^y\PSB4,̟qVPFq."ӨOTH& 陕G,oIcJ/۱ÐeXF̛)}[z'QsKOp~ϫR<#cJC&Â3%ޢ mcY׍][E`0t>jP=,()\c}d{k%`Ԑ24*E&WMh/vAOHx!LWgB1v$a ))I Y:"ߍ:V  Pڠ$Gа7pG>]ۄ.%  BMҚ۞ƹ0HVTYG;D SܤTݠp;T`)$,䩕)'N5H1. [{!8\Z?NB!PX;uOjKf,,u[VW~ϐt\~k\M|_ej]FB bSZu#dMEwL1[IRM)JSTUbڽj#ibK@*-v_Uj䭺Tp蒵 bN6hY$+-f5O]Q^ۭ  M _b߂eXxn!P9a.:%)*ĝSuQ)/>4?%[VvQ/3E+*\W *X$j[$I$JRI$I$I$'5qbq#U_d%,,-p4Nt $' )@&H0)SथSJxS)}BM)LBxH$yJe#) :J] uM)& LnJ%(\H_-X4)&!%#8STTQ!N\ (O(E$4D@PQB AIO(aɋ658jJoA/Q/B у$NmQ6 "1Z(bb*lT W6P}4p)&7*fjHV5%6zU]jB R WeE7Woy? 9>bDӮP6,{bΥhN|XASҲ-@=΋vU "~R\͑S@2ժY.LQZ7K,mf|q'l b0!:1* >5hWK)|Vmx}Be?FTsE۝~M2v#2rnYw4h8hru\gP^u.:7RelC"pٲp=߽EbYh[L&7~G?~/Ƣ[{$4cYD(P]Kn<7i@f h]ˤPjʹm Ȟ|0OecվqZװQr*gp%7i!֏^eXl/vLIQ4"A)FX}::"bQqpθ5]$8N쭻 68&ǹ׽DrzN1PmyP$;qXSZޜڬ-x`HܗfTE"}ftOS++`H@ڕ1hn(>m1؇X. x*$K2+M;N=_35./M -8xL@mdZb $a`;,8|UgС`^"=FLs gt^:f<̇%d u_Dm8Rev4g;n4ƟB]۷׭tWY냥ٿp$H@Dji=}9z;?Y+?qݶ PN(IL\rYoJX`6oϲ4eIvA" $u<0մmsN~6ݳfCNժAjCZ@6W^/ˉ0IwTrzyǩ{|uSITnm≲G܁zMa^^N5_kcxp1DzNUXG4g*X'0n۴|yUZ{:kv;NH"fyJ=uN* -$\&W 4UZlۈ4ޞqXחNtMɭ8g6rIg:]m~R@StRI,?`4Olӷtgoӆ\߳Pi,uS;{%%ew6;{_娻`5;wN-d8$|È X X;is2COR>qѻXI7ǕyuTn>Ey5ꌱڂF)TvR&$> ׿f)Ը~ԇP6VYS,u`vp$V&tP:)0~O%]ּ0Z8 @(e%_3>^KCԪVLS{vܮfU_p!)?*r*88Yv>6~h[lxw?}`Yo3"4uQM0+la;~cC9򟢡U}z;^[A]QH\]ܞ@P$hx>0~1Ϫ#M{7ے1Aly#h9!K⺢8nP=h١ ݶ8+ǐrCMI2,!k;>:v_^c=7A 5.H[SPFv-2^|k7`:C\8?Q1w/Hżs{8NDWzlˬ-!abE{cQ[In#/Jni1ni@D5PC)t/ , s-ͷDVLNQ\p3N5.0:CiVFh AlL8CxXuUY$8HࢵʟRnVAPgY= wG<{SpEp:,I:dP$:I'LRRI$(JS$$$RL(I:dI%CFWAMyA.R-hIU^$I$IJI$I$RI$C⻊Āv}!]mbK?ܗ–fAiERO S…DʞM)μ%h蒖n)S5J;%O0!BJJZSQ2$"!8 )cĦHҔ'DJRRr#w &O:LRh(%]\0D'I%. %D)&H$wOƍ@ԥ0TNxh $"BIj`TPM@ ))(*M2 #^B LCiRQv I)O*rbI1H1%3ܖ2R1L1%%6&6 qR#)"j@ث JbbJlTMA֪¤AR8b%6nV6!ײH1^ڿ<R=4$N V.OY >wLϟiffY av{ߢg6I(y>h%rjZGd2]Nmm/yRI*6ubiOFUMe[an6Vݕ"U]cb57u."|SnҙmCL_z׌q'HKVSkHJIBsCN{PDI)) LKǵnCh?Lp<1-sfw ݲF %"~s`l%𥗅MEU ngMInA4FܯN\]'#o sMK+U1EEf"w:7zIMsZmMkLJvC2kS:5'sDaeaXE[>\ N gb W5̉UU6Qe.G3*V+ vڋMչ⩘8BŭT`=|'dh$/Khk$ Nk9}<הr3}7-Jkr o`wI[,}GثJesk$4N GmS;G(ZCt1 GGDyd]dFJU[:U̓Ly)`2>e[E["aFw4x$2juD,^@s$L"c\qm[ȫ>vI:*g˄mĐDid2Xg\I[ff=n:u?H98P[vF{S; ]P3*j0Z)c1aRSMN Ls)>ߣQ˲-s߹C rJ%2Gڧ_HT_314475Үd+ @ zP>%^I3#VگF etO!RIXOL@<UN{ (t×V!J.1l&LxZ >1-5i'&KS!c V-t TT,[Oo]m y 5 )JݕI#i:V>)%0<Cɡ !JL P!i }@i$kV]՛p>cgq_~-DȂ 䏴XD\gNtlbb7GNɃFr+N)U5+1o߄鬴8Ňݿ?1/tr)Xuv5{SHऐv?r?'j@B!EzpI~z=t: cGt3vlBdUϠ>폹gUuf[-kGͪ^8[溼< Moa$pG!qFYWAҳxWeyA왔6NK]-kud:;dt{ I~j5ANacWPe{[ 0]sxO} ,?"82[D1M$J"ͳ.!6 ZᣁJ:[mpp "7~&V~ ZgQB#L#t7g(OO\ny46Z;NZv G Cʴ҃Ziihc ڍ5]$"I$$))I$$I I(I2I'JI$I%|Z'ked?<jGjxX$"I$ ]z?AEo^Oo),s'<.s$?)VV2.(N*n(Xa wԣ׆4/+!qQ^Mf;?00P<eT{ˎ])JbdJuCA.*hn'yNIBI&mМ$$RI$O %)$%8b[())1;,fG5 SbK.:SْPT m4' AЮǣO I$9rۖL~_Q1Q?qg??z+Y*acҶϙ++;&IkOf 0ܰ nq>l|9nߨ}>o?|.˩_I\eVI!tJ{gUg3/%Wq><⒘%i= r'rII6LnENeUm-a$HY]pNNZ#S`0;?gԺJ| {>1r $E'@MF1WhVI$Jv Rh몕,vҢg t\NXaOvRSk]3A{'$ĘCuOjW;FRRK;&Wd v㷅#]ӝkÜ6d1,ir+Mk[UHSuNh<** \+>jۼDk䒕cGIFn5H piײ9qlDA3 pR $ R{̔wI +鴻PYhhuIJ.qO gfF9 VEy6:oS5NR͛;*63c6DI&&|oAKahWX [cNVY¸ݺ4ZTln!M%4HѓXo*ABcJgii2**'QHY98mn>TRua yc/ps]Wjf@SI%&n`Peb $V[q'Y(n%iIJDld5bW{ {ml>t2IMZ7@=¶C|aUYSk*I$>YRIU6N{w3<1|%LW5p$T~HvV;NW6ď{f|=>`Vp: YooB{ʊI!dd E@ʠݣ"UIh6XۙBtQۚI8wah#]S0pXfl!J܊l~ Bm2H)I@H{t:mb&L!CJg]f ( cZ+2aJ̉OwN;Ԯ%^  3I)LaZ݄ S'LD𒔝2vBL{^%B´Yަg}=iw" J]-0+svO{a*l0 {ѽI){Ɵi!$I(%xV[stJRC*pPۆEḖxZTd69*UG@IJ5'RMgE:\N k!:I)@yw&S$R 'B?ߜieG- 2 =K^K] }`;._cKP_X3Dq+̱_6{I+T}l,{ÄI,>BΞ"mtRS ր9?r5 FWg- GTmeeVA?/\J-&5$Ϭ!%[u߷:m6:0T6>@䒩W\`rXB_7ۭeKm W~nP}Q1[E<ϻ$ gܴv^3@s-7t,|¥0+p+~YF<ҋ2eڻ>g;~Ew]uhX$bI$I$I$I$$I.˥F\jPZ?#U_d%,>KEf瘳䭦?% 2|RG/m~Ke%*nSnFAМHB@$&QRa6'@()nSwS@\& Dd('M:b$RL$()I @S'0:vE*:|S&ztiPG@撗U.rcUJ=$-*@nDrAI[;PҠTE!4$S9Kr (NnL^)LR )Bu'! RyQ6(nrj}]{Ѐy#\DIf^T /ʯ85Yn1mg@qS+Y4am.++XC OxJ [0s7`ܣutlplbJ G4n/X -}`q<\gd+nVL0F`KL _hmKwv*‹D:zxkKvk2 $]=?T&B\IIZ4n RwQ(>Q=Et5en&Ln!x@ɿeu*I\Qqw G`+Ykn-"Ge_5n.2L@W*.,n~1SCB&7Ukm|{}0xE[ϣ&>RU2V6km5#OmUz]/75^I*F2[[ eu #];**6Xʛ50"> Gg3:[KI w(i[Ɍuk' LAa#6Yij ""aG+ l {hğA/T,wSgTU@zWۦcwfEK[e88 =]ghʷIg<]VDzk&*h̨r=ksꝎ"y̭;kA.=Qq`;Je4 4bӍ>NT0مP5Uaen!ÐR]J&^K8@A@ez:71ĉW5_jX.;rDУf ;E&v qP$Z.u dW89!5XR>5 DY `Vka.$i#vIֽ5$(ps f]5* qa*gQ~` x4Ξ*Ĥ/,o8t ɫph: EU:NgP`cn 8A<7vxNUC$V^-k0ZljY5={̟|451s$Ѷn[:ǓU\;kd`BS7n?WWM;\F`guq]@%o4j#ijSpm'.(l\1^, )yuWZVݭ'F-~X>9.juVv\r'\#BZCkRl;k$f,")7 nFv;dzWaO'ijSs2B{`(Maꞵc* \3,(?/,VNI#)BSP0#at=nuRO>)AJZ<j"BruNʆ2>)P !H9:02tI$5 ĥ\%)rSBxS5NqdRLħLP<)ݫܒ 2 NrEyQF7Oޡ $"RBISiB mBvNEr !35Fj AB*;QKR)J) bb)rb Q*!`H):7,l{s-&NnW?oqO%[{xT2s}"+vB;dO꘸%j]]Q6ZyvR۞*˜u3re);; n9QmƇ4=gnegh< 4ē5!8m#b]^2%E$<ΧC i9.tB#r+sap쒑l+ecn#`@|cݬ'۟Pv=`!m˰d Y-s'U/m{="?9%%c!mvRUc7_F@ĶjaSFkKAK { ~gܡ0$kxBjeufB4`js\D}T}.`|<8'}E u{hx1kFݱPJJPͿe,:Jّcn P'Y/NK^[h iVr},c,j58QƼ @2ne^2-64m1ĘH#9q*6z[t1ۼ'y1AVkkCB7P cXtLiG5^;q6' d.y< -F6FD ]Jz2`9৏fI"dQsYs۴}U54oڒ=C o k8Lj:|QĶŮo[#-1g?pײEM~:iQII̗mIΐE`n0ӲݙW Ɯe2:JZֶ ̑sqp"uC(Sֱdϻ-[fUO.+u+=1uaN4YX͆ﮨ1EB[SK`{8AJDMNCYFU>l˱챡D>;v?rۙUOÏ*ٳ:s01qq1`8V)¶uPc+cC1L,dݤ$$ܤ}? v9Š '<=ܧkx I*63,c@w~f''O';pƛ?zF%ecfcTy6juD6'AALOu _OfI";u2a ԵQ ʭݗW3pyUZ[ II[w477? (<%K`OZ,!tk+AF7}*M̊]sZNmlRc4$L$X J5d;mbO[ V陯c[c 9$c;h$Od~7q;$}W{ XPkCx%z5Djܺap#%s=r;YP=܄/BCKߠ Ssoh{8()v5KcHP+g>i_K߱y};1cv}$ۻdSk?3{]& _K~NىB̧ D{ca937-e4ILŻ$9ԉ XZ]ۘK\ FͳdAdI$&cvSP~g҃KȺ^= I!/eI6#txOXx}i0w؟gW`FCD$+cO@uRimųґ1:}n 7<܇c=:ʝ7&}tfK:ĺ'S"b)q%_v}&8#Ҳl??g遙=• kmcP;* h_­ p~uиΟ( N܋ʃ $䓎Z;{Tq'-U 6@ |5߱">.;ZXMͱ2և;}c$Ą+ |N CX\PI,moF`i?s-m^lA"~df74{?cOu]d.eX~1@ۙ?),j1~z:eYoÂ`NF+:obYmYp՗:A.CbsʤH={t=J{Omn{1k~=3B S%[5<@gC9lԝrk{Dj;jGhR>)))~DЙ8NQR)N8I $I$I$$IY?X8_Ů>_l_&__ MGHz~I$UI% ]zAEo^mcK4r_\>x\Y+*O 깂^}-媖61^5`;J R,VW~EH=8( !› NL dI]@䭜}#|V<<~ =Qr$Ou^拄; :3gma;VOzQYKqӚ1)VېUGO.]aH𒖮Wt'I %vZuZ'j'EMm#s*1q<(2=ō2G(@ű{N)JNhqlzuqH`c{pWAM0D$+1 Ud1(l쌅noILceܩI!"7(4 _>2Uԩ,<ۃsiJ rk-&=X>]O $7d;Xzz=ǒo{vu7}a~K.?Fa,/"+oG?eR>/r*"RLYm̮iXD+$!qVXIj}Q57)q$)Q', +h<IRߠ~ qzUH:5_z9= ޘK8x'iw?$?ŋ ~![x'x C^?^Ro'ug~)ToЯMa_9"~oCUO)tS~pMm?T_(?_ƫ(q?bndv)~ňϤǧħGޗ+ٗ/c3')Rϴ{+|_ mdy}_f7;%t_Jm?*X~e{^}n>gVPW7l-??%k^7)~8߼?[:"['kdઑ}σߊ+J;^̿xjZ~1CO_'܁\#cx>h(?zoyqW/,G5 j'g#}ly}?%2ǣcUK~W?e_0sI_{~uܟݿ/tcXOЍr_#?{jW'Rz=ԻQo5??q'1絀rcR{y;Xz]H}`lp_ꨎjqּk FEDt}?~ w*qemR=ZPwTcf@C,h'uLo}$8(<ק3OBwFv)M"},p9z*XAp>0^rp՟:w~ 7KVG՟!Kϟ>x'vGw#;W7t ɷt?rzmgK{:Є\(p?4BI$Y$d;/mD= dդwx]Pg~%"lc-76YBMەzWĝUr8G}=*nbR'udGm{8%+jvPIfF.0\= SU:&>]LA5uEk[ZW)&mAvZ/^ң>-F쑝nX>9oqÿw<4A^+}WwgӦ>*}OE ?5M^d:R[\ďZ"?yg_Sb{a[!͏}wpVس&LܹkO)ds%eNCON;%om Mat.[R,\C' LbޟUP=n z۵k JWj:n'7ۜu;{G1ݏ|%#`CgNϪl?I?/B-|PUndI8s6]Nh#&J37GJj0Ѳ|ye5w=*-hmq`l,%ұ4l1{y$nnVXhpWsy][yHe_O;J8*:}>v^0emWaeq(j,쮿M`|M['rZ]/q?\H}ln;1HKJFa7y?U1j5yPց+ 'stˣ%TI@I$I$RI$I$I%t~_[cY? K;8POY|ɄӬ:ꘝaD $GtMs%8M&yNPRbpqdJXGNp)ILe"S&0.RMΩpIB\'%):an5Q(J))ChN% )$']TANЎ~JGaHYʦLӈTm9=`T E,#BQJR%DD - `&I$$t&/Nb%2N ר6-n,&bKGa1rHN*d&V@w縷\y!dSe+iqZ=]uZV8AT?NS+,ndՎ&VVgQʹYu:j,c^tBxa;D} QS$npퟝ-̚{js{gQe~Z 8UxmYhᓺD]6sݔG mJIe__PwPi(m_" q‚MOMuVaCfVqa}imm֎N%SA-#^QxbC{ .)2N5& fe\+yUA 踹>Ú.'t-I1R5U ]xVDZ?[}68DVId\g D?wcZgM ݷJQ"T>"Ԯtq.@b fUCm'P9hy>&=jQv&;`9AglbG6].11F¡6^KIN[3=Zq W=a%պ7חOmN$; 2cֱt?ީ$:N*F~֨ʿ0[`p&館aWmtV̇n7|J025&UScw9$M&":ojme57lxL0`jEb`8>#= =mlDRޢ0؇7?\tlۭv3ZEN{x -wN$.NEn# vo[k{p3FŨ48$Lx$.5/*F}L|&mVzoN1sA G)c262w}ޮ($Y]']{to h5i-@&:zmX I1j*y$n?O[),5wH:OL(k=]{jwJLf[^H0XڎזY>S&ch.w~zC.x8N\F †mS״KA%gۏf@ڃKh4otW]μWNv=@ufGErEjW:u}L7etOmk9B )R~&;~BRuReU [0V]Eq;ʮdm&{}V^֗$ce^oP{cZDg}$2}K>:'HE ;$'taa$Pʜ~-۷#=%Wvf8D:  5YRǁ5vE%o`}tnu bcyhC]DuLGGǹ56~Sc8B8hU}a;A)N-A*T,54Q..2L4LS ]jDNwaMOR5Xt"q9"U~w4Gc=:_|~VJnuXHlJZʆxYS鵒$R dюu0l<&ͧhQskt\?^;GR*~)lhF'K-{vK[[{zNSC㹮%}Gv 2|5XOVMzDʠ6Qzm0UKNA je p9 ÍgӮ?7ԭG әE9/ŲGǽ>DEʭDڰqNŇԱgv3uap|]z:|bݫxFIL h<T,bxN@:GN@O:fϊ}RR!E;- 4S4? 3 N(NJZSMM JR0JR.I(H'IJOLF$L}$RC2TC|`xH ң><*m|SӷI$;I}B`Q**nBqI V64(JHf@ФХ e$&/FڑRJg*n5bN3pciIbDxBuoR_s3ssWlws~}t;uuoޝ*s:WN%lo)9XGn ޝ0u;WPq{G$}kH2/kٌ;g[1߳vĩK%fL#vƝoouɒdsf az{@utЫwWrOuhZ/Gɡ cŎ8C[KǀPZ5[˝)4S=ny %$emf6ˏ߸A{E}0UUN/caǺWrLVSȍn]41ӄִDWR c8đ+I@7DOxUs3汭\ݳ^։Gҏo"$ vikm Β6Yb1&HO) ks&7&g؉i <I gTJ-mHiSx jhl 8xefɝeS0t*w[|zJ&n_߿nrkz$e {SݑV8΂RRozΰϒ `ИgTidz SKSe^h !,[MՇA=S9)?,%Chմ.!cN' O#׹$k:+u^kF)tsqc\\:FISIBV9ĈOۈ$J"HI^ DJƼfVYw>>V19h02f$V!%E9c1q>?3jJ.v_!VN|F@oV0kp{OcIWɤYcIM|nf3 uO?"{ lR"F-tX wcR+yDU:r?*.Fe hܛwWWUwMsO SJWi1Z2ǟH -n/ٽ=b'M*IMOsqUF?y6)ĨTn3:qqq?yKVծ:Qq2>hnfe =Fh kj8IA>h 'SۺuE1,dG}?3+f7[G1 Ɵ&\oQh8#hwoG&8DkC@h6c1>cٍ>y78u%${_nj'k|>^ݬ-S┍wc!U˱ Uj2e%+˟/"ѓf9.<#[,\fGmnhlQccD 3۽lĂ$vavۍ?)9/yu%Gp|pHs\ vgg 57ћS,ZqD$$&5N.ۤ5TIX>$U%s9یȉݞV7cĄ7c&4)Mϥw{jb4Q{8"I1*'THG# :v\ZENyoz%&lFHx=<hO 4˞xm}Gu(OX zLIAU3S*PǀZ0_MZx LRN%3I0)ce }}0&rTvTZ<նM[b\"gOvK_kLnfRxޡ_]ij׎u?g(v>B"BϿ-H RI@ Ep *mcd1d btz b$B RIt )!I% $0I$I$IJN$d}`)||,Y7ԬSUubI%UzDI ]z+?o^K"Y֊ȝ?">x^u&֏O 3Dd{T^u)1)*-?@m;LgrRI$R $:P7 $ %.B zgTC8 IIoyCs\ SkS+Uvs<LA4V VzA5U?H]̩`,~gѾ*WR~CGCjwXf,H/_]Ӿgp '9QF)T] ]nna;R,0ʬe+(o`fNQV ڔK+  ]X41tA㷄εD[^})s+ 8x jWSVPVȭ,gD;$8̣P D8ZJR rPݗC~0_SǶ̋EFZmW kBqVulKbʙUe%o, UWc׸)-loӵ/C#tu%%n7Co cm[>+9TΗǂ sk?$b#%V[Ѫ7SScZ<1`X%;h )Jsu7T}Sڿ%yVwPg67Yq>◣kBTN?ޓyV˘ᭀ$zuVx<<bNحUGO?$:;4e@$/x _qDoIs%p~jgryu?"zVPX |_C zIWLbR8`}d'_u'XjoG[h*CyPv]ԽzuOHgOv1(">$!;'؏VYۈ147[o'I?2kl99چ@%9+c8 ;JH q:pOHS~\t̳/4f;>P8Ժ>if\~ ZGw@wQ,?!N#3K 5)9~,25;E^Ÿ5]J?\S~ͤ|YU@zqSTm٭ H}So{"?t; >8vz枳>32~PqGg05i?5 : b>û{{¿䗵#W̹ܸyq^:>:n#O%zc}o:.zۉ^׊'=lWnjnRm;.hetޢݿ=^y\GĊ{`xrha "G,f u8M}V4QK4goMv_;]Axc Aw<@b\~Kw^ik~J' >ߪds(nO{PW.z&cHt[N͊ 8^??%~?7ko.?%ߩuJku\9w7[pSY毻U_[Oֶ?xVO}}p}8tBRod3jJ2KJ5:~|w!w`u;0QLF~}s3jJ2Dg `!q>)~^_SN>Cu;0Pw֛эC@wh~L1쪒ͤoёQ?Y|oVwފϫ==Y'qKeT_$>r9| \Z xgT]$n;O7:x8UK5)70Nq7߷s w>~_[wJ_wJ>:wU-?&4+uz[c%Z!y ƵSο/hF%?3qL~[\qU˳AWsAѠh%7tʿѿ-ǁ~?I3oJ3FVOqU˳7p Wu?$>kx/障uZO߯?Poa)pcg#o21MgO֬a>⻐B[?7Qs>}n m;?y\RD3^[t5?C9?"7_D.ŹKAg9Va9%B&LASkA8EKA{ƩkIh p;MJba S)b)d<& % ;}'<`}Oe R.3D&yI N-: %RL|PR:5LSO))<%f(ZwUp`U RJ)@Ќ0 @"59t(LjpEK/3܂ SkI)K0+{tQ[ɖ8ŝ.b \`,%Ǟnm8OfT3خ.oy]ش-sZ:ϢJ[길͎SveO2Q=6p Ok3&CW&`(hʷtPlwg{լZKkySWPWP"i?+V[onH"6;>ƶ^DţmA9.;hqޫѫ>4F" ׆?r5cc7_YC &Rlpݫ1_AO>Gsψa?^{ќӡm`54?Jƺj٢ZN,[q!lˇ a#q/2I$:VNp;ژlrINT=ְQI@Ufos}+ tSc[c zcZ 'OUk\|YX~wu]# Ul{kӓ II[GHݴ?IK-V)k 粘Föwﱛ{dMOnNZq51.?Ad.~I`6\ǰc~ *V#P?~juJӡ*]E,cOzmy, ZI&#O?cXj!~%-ڽP/;kc=YO@C4H\&:4UZ5z5s14QK`k$*]W?6YF[.#pHG稚n[]~3ߐlq pb2t WMNĴ8DTp¯ҪcO$R!6WD ŧn[@O$bul۝E$4LǴ? Ea­YH\ $}/bn=b" AR Ve[| ]JOL} Gdg2߰Ɵqh1I0?9:n5P@$qB]?&w9ַqjN%6\ zru [0O*6Wڛw&|u5OۊEG y6zΈ1{C}>kGwU^V8$ njZ59cK =jS ڀJ#QI[6z^=u{{<48l>!F6&+ƒJhqc : 512u'^;:zR +ikjGYhp/y+S&LDUr5 P%Gi.--RO2Ω`ؤ"?77Q12R8 pȟda/=qgW[j`c~DRkզG1}Ty"}@7HlW꿑W2\dث65hSy5_DJӱmJ1+Ʊ:WQ[8Do#KxGuۯ`ee.cI>j{d yjMweoC;5MemZALԮTw0$ĺk.sĒOr,!jl.HۋyGݺ'5=3q9χۺtD}R߉n<O[ݲce?.7nSdJ6և7V'BbPXH:8'RuH㮤aptTjxFǴWA *UlZN[Z}Wy~t ĞSc׋/a2X'G$@'^Qk6-H tʾv}8I'*xufV.OG77[3\^%bD1^w vFK,x|)8$@r~ɻN=WAPg੎2~ٷï2Nnz{yX\Џz^g_꫄ΰVf4|QI+7 <Ƭ_(G});eb\kRRefz9DAiR$'4 ,+i7&\O򜏸Z$r'eVx~^,1= @`p2|pbH  *9=oc;ܯ9y=*68::>q   ӿ@.k@q{B=YYm>ZI=Tm0O NHQ[p?yZ\ǀ8A*O;q:]qݠԇ k~ Xn,"gT[inTz!\'tkSZי|h+;dn'_UNұha0Zv~P}1ctEó+wdnji?.Y5Ǹk#]; XRր4@B]Út|und82N{%:L$#XP5UG62?zhOalOO`a8c3&Ij OW^ Új)e m5cD4ߏuZ߂\l[2[P $X!Ðf3` B9/yu%H4OF~AĭĿP {\+%GTd.Ŏ]]#U&׾MW$tڛƏ&=7sHsOPf;ixt>gL@7HO_WVDI~) Lv*xz6Ȑ7Pf[Ø FwH~ XKҟZi,~rrb1*i&oQn]Mfx]§"9`[>_N};,xv?ш<Ӕ-B?I,zvY[c?ʛmi4*>c .@n-u>gr:yj|>f k۸"2Lkr]n%荃̛}7kߚbc]o@h>wv摳0[eo& O<AD6ӊe 6:<=OP8C12(lfئ61Fl7G}GzSsl+hTޔwecj<2cGzdğz %b|uZ<{?[mJn~w,[O%m[`n^øJv,97;qٌ7]:|6 ٷBaqk:+sjh+'7_ZUAܫloel@zK}f(NbRS) !:*] I2ID'II2@NBvH&)"S)IBd<$&N$WI)LdR$Ru ѿ7,?jB5 $UWI$I$RI$I$I;>ݟD.!H|Wq_ ?\3,(?/,̏ Yy9L JH…t%)DhTˤ(^QR(SLI {)oȓI$ Q1ND)S3)!h q) [BIbLsI>yJ%1'Tɼ.RM_|}T{ʈ }TXPDԩĕ򃐜7$FjQZR<)$"Ҡ&kQj jJ]A{=.z`Zs$)vU #|'^i9E쥆Hk$`RN[(i}뺅[Ojc9[WV6zDE NcI> \jf-s곭_۱Xb6bXa{Ogq讖7m~sUq>?s)@9>hsLNJ znnxPv;[M[G絿Lµv`#~dy{RNKhlp2ADtPݐ\Cx7*kgzfZumMq?h68'vZˣ?J}0=d2yE}7ű%0}8`ECw}'GgMh拜$kE:m[Q^ا[Z;'_Rl-*FsAsrII<~^m!4qWS Vn$6'" qJ-vvLp?Ԫ6?8?Eccw04 {JJMcL-N_E/cˣ>6-﹥ntFYZ=D~~zn3(pmoݦh4||ЯȯawDkpP Ĩ^Z͎R\lk2@ŧB ^E+qna>-'*SL'^eT4^x9ka~ݰcVV] ,3fۤOZƸ0n< J'E3~W\x$=/iD8Uf/ٚ$Oow*`'᪫s[%5+k B!"GPS Scጻv։1Aƙ qH#  i*cӱjϽi լL" #DAVQƲ2#h[384<**:<[_1ԕZa58;]{VюpBIѪ |@ Cc ,:PcPRĝ\OĹ9ii | Ƿ}Di;!@:q}60="*z{ME^HȲ88!s}ϒ :m"e[PK ){c)QI!v8=Q!,e4 R[Aaȩ6nxlL^%Ivs=fEc5WA<'urوQ0m``WSyL6 D-ς..3鳰OdGKD4 O `cU\eV,d{"JGX;F+JzIwΟ[ӂ<2Z(;'UzwJJN޹vɇJ>20\ ơ3 %]f[q8& be7.Q5 ⒙<dc.H䉉d &Jlwb<ɀAِ8^ *G0d mI 2l"Iw{yQJEokrw P} g4C_ DM H1eZc5l(GU^ˌ)5[r \'<[I[$.p O{s:{88Y\%Ӭ +x$Ę쭱o>i)Ju>/0T:ml64 OxU^͎,ͻp#]uzPat3s\:EuDCngI566!M%0mO 3S5@2lun pnKmvOիɷh {+u- ]Q7Yūs$D)SgKy`s2`ܪō&5IWCTpN\L7f8'_*9XŰ&P:}.#Uu"+#7y䤭=Ffwm 'o}.e0%ZFI"]|>;RS.^;iĝrsZ׸Ve|kjo.=@ވ;r]i״Qs H|ՄL_ͫK" |GὬy 'no4IV}`4L@_UI}Wa%nkELٗW5ig6=! մ!DPch Ailh| M\*2С|[>"niCܓ4JoSfD"S]p6i9zQ[i{Hh5L":M y K>my0!8p@# ) ju\afjY쭗LmpgU:A 0v=3ݱǀ*W>VnR֐@Our2F+}Z=7C?1y]5s'O$r `WvL'ӫ\9)Mq> O`M^7qOMU<\%]na!c`UcF:ih2IUm/ŀ23mcYlf5:lO췇⫧@6wHm{t(lnhAGdN ,uQd &I ,?{5i{̮#mpxS, jkۣcwU+xIL8B\]`pg27b5L6" SǨcki8M6,.[FȻ}5G[zw0'wR#vDc9A?gzF%ErgśkZk6|[;֤u}w=ۻZ=/8ZkM~07|w%C$rV.7ٻU{m$Z?un~q TΥ[:=JT 1JLZXSPO*!#IȔTHp4oI'I)*].QrdNSt% $iI2d$WI)I$:dI%+#kG+MSbɼ?bOX$"I$ ]z)o^Q"Wf'es?Yw]pYm**I$ SI$IJI)Q% @))N(ovaW<' !0voUf#L Fe`7s 3Wh+#QoE>2A4{ff! FVHn{h[U> ~Y0Y`\﫞.{0/w.o>'30.pF° ݵ~soBO-Z ֶV?S=1WUc5ѹRkEĪHmc?[MX\|V=䌖q%$d?f]6\~NmeV:~ӓ-eN~ zfC2>$+X<O4}Ik |Y®Ygqjj¬:=WdůK-Z&\Ff uL9TҶ=w4<]*[Z|vvsۙPfiLLz}48?T%l37t􌟻gX@%=(ȷVUVk@(;[&sh?P_;t}a)=NK3oCw2>$#7[>$Qǖh$HiǸ%B߮8aSߙS>rd\!V':zs\+c@*_U#h+MOXVzF8OĢ7?6kgjNgWwY<CyBjY(%;rZ>J7eUN=zFtq9MUon=d#{O;[c%uQȡ~p!6GmOZ:{xy?ňϪά|EXs`1W.>މ*:w5赾d~^~C&Uk}[ETreO#̄Kh1(ӬWG5Ļ$Ο68qȱ8yL_QH`|\k57Re8v Â'W).=T>bϩ_ec"Ks'OYpq>HgN7fY<ͷc: ~[$9wNumnVyXzY#\?)3ܡy_/kP?Y3vK)<* }ɣ4ǥJ^P?S[CwXw6"PRy)zMOhWW.{'{IJaj}<WZPJR %]JRJ<䦒V;*RK{uM$vW U)$<<I_|dt~/y"$+K$Hqg[l i%jI% x*i%j2KTPnTӥU*i%U BI(zg7戒\E\T% $|J"d(I%L*i%U $xIZڤ$_?)La:I(E!()JM P{&,oZ'U<% /eVH/xuL?/?7W`Ϋv9yQr2]z \&諾=18֟+>aI\Kw՞åSWΥ'滏V9?}uOwEvWe"eq )3>6'c# ؗߧ[>- qǬS'BȑRZwoQ,&>gѵEs}r-L!Z{x=h0lhTp/oxJMIZбVߪi*Tʿ|uV[(r?%&}lw%IV+'՛o?$齄yK꫗f?ACi?$&)𵏑V[#uu_]ks\n/l.=Ud4[15XpVꦷM[{WAszo], `^!͟+?׭6DRx11OZM~E-3& ?;n۽qNm+q}ozItx*QYUnk..}k]eyv\%fc^K'gѫ6QKTHAN\U; UߢDhȔ$BnJl/e!2Ct4FcU,0Ps.4<ZKgT[ 7kRj(u` yXؿlkLV7A 7U0t< #SX|Ն =m*9JK_'(d9ѿ%: tfƆѱE}dr{Mc uyySlYsyo)avGRɊݸxeC o@e[9ݧ]4H%,QlphQA-*.k]MwndP0rp$ϳy ?53<>hWc3?[,u >[CY&VFC9BOz;Ԟ۷Pm>{ϴ{GW;c/6x٥ ?4,%ȳ~=Ovn<%yTsG3\?^ӏ/a/)k2z/:_.BaIo$I$I)I$I$JRI$z_j?#WȬbk'?)g9Z ;;ϒ'Z BwR)M 3L蒔 FSyp۪JCA $$P:%IMSr&O2 b Q*P)'K}!t.w$N'*\EJMSC|IO 'G TTE8)NN'=AQSa()0k))!oTɔ;ELTB)kw6 O Mi<$\+, xI\}i>I}hܷ݊Xh%X5Zykzcj72TSzN!ec;3!`VKg7Geb F6@܀ZKݿFֹ==mνQf dVdI6"b=ِw\sTXiPzN9g{[hy;%48>ȭ갼N& TocwZ:*5Kp j e{l 11+ yWSV;oOCrju/$5 hbXG _HٮemX0FoJ5pyKE/EȞ'ȯsǑ!܇={*`3?1qk#Z9q[̱cӮ^{ߡ\"H`I-$7֍?<Y3+mv8:4YM .U9OivPk\[_M:+.}+L7*DI gkqˏc6 ?qW;Z5_+6Hˏ zh%C>oMw(۹S:1ɟIrxo@pC@3RC E0-RƲ55`A2\ƀ]'ʷJ飧Q8q>'Piu_1it8Dg\4s,D +t(k`N9ӳ"LT1ߍKkK'YQ{w41麫W ЮɵU+,.cCh٩5Ť; 4N;O\=|sq'{#P&n%3s [Ur\hfc8Ym?uKbGO+IS?[[Z4{P8/Ӎ>z`xK>M@@U(1ۿ'?cWo,5ߚ糧"Fqx8ɷw T[@;Eg>GL-sٿOުt|u͗3D̯ 䔏 FIZp,˒|UcN]1̬rllWec^Gzϳ;S2Cavhy F[sc5k1qTLho~[V77R4154U8Z`86MlvvߣB=W#3%xul%rt4iDZ}E4 (CӋK\&9K51pnC#zw49gu~{ l&5Hicd>0uxzuGs +/6M;Xc]UW1vxeȥ۶}"Sp:vqtv-$R:I=wۏM*P3hhog^:qkvsFaixԥVi+?Ļk[SF̷SQ|Ԁ #"ZͶotعufWӺ9 }'S %=>lAY}ed=`l3Rz}g{\O9%QA5԰襮G;/,ĕnfM~H=דe-;0t\2 (Y6*}ō'h HJ[e9ǶxB}oƑ 쀧K=G&%,VCsC9u#~ծMy43 Y8c&'tz!iY*v/-a1TU:h4] zrT6vOv~k`L !`zUXn- ӝQ}81<T:ptGac;q>1҅5_h<~b~}ޯۃwF12v=*i6nHɹ4@?@Nͥѝ~ Rg#^`Οih^Yw}_k]:ÑO w7qkA!Dд}i۷Ŝ+~mیh:3KN<i `?NI>QqcM>SM pK_sl"@",۽kʪv&> K't{3exh ̍~h8=H'W`w=]q8F@60sI2#\ڱF({HtA3D&cQ-SVdՊbO"cW2lk[ {P<hrHFmTMj&}N/+y#@"L{/p{hw{GO~ݸoXcS F;:=N@w{k3C-vc`'YWhqlJܤs-YmmZ"yݿr:v)R'k7qP _lnv6exwG *K-/ieK[V8v;{F絿Vs 6x?/M""V7zҀ tYa2Dh'H6 LiUz7LNͱ`}5NO7v}6 V=#Dcf1s$eTHՈ1#{TF>ZǀO_R)*jܪ6HulH\ȍ(˧u&bV=Πz + yRHY}ӞX kY}(igG>YDS`u{f52gVmmͧiڂfL0c̴uu&WHq=gm"A- $jWVE4=޷'v+a=8lX۝=svIš,*Els !#?.csY:2OdJ*Xɀ74n$xtn[i#{?Z(6fSUO(Q%6f=xӿҟB wOzh65;oe  &5UoSK c K#Kr ^w7"<IuX>ֱTֺeBm[_#,꨹\0JB=1Z ?{A*)-ARʊD:% )5L H)S( !A<(L!)Jd$LBJRPSdRHBѿYs?e]Fc}$UWI$I$RI$I$I;>⿢Ϥ>+bK?ܗ–^Gj,^RBu 2)N0re2c'H꒔%/`wD) $u9"TNM0RDi=)I8L5OQv90J@$ʔwbj8 q*3:N4OI)j2| Ly&R:NC N% Nե2N#%dHCh4w;BhI #JO*)T%%.C{!=rarLjc%l6}? igTu01~[CO̲ݴm,?_xͮo쪙XNh𖡃xЦGT#Lc#Asq-޶05lvq4o~LyjD8zNpi\?>Mh$u;~kD!\l"kf~?M< q0Ǘd=pOb{ dH?J3hF[X.y3<QҢw$?4yeGձ')QeMcJIN=rET{LٍE?*C};3ʓ}̵'\ƸVH<. ܡ{go7)fcIcgqRc ! T}mi[%,{ѱrzmKr1*Ja U؃2cL{{\Gb81I JJ gb[񴍀w!%ZxRVw0Gpa_ٴmmhL, \*Je.өs=kqЃTHkmΰT,;2-a9IV2>Nn!]E[`f׍Sa_CLs cX憎&{kT:w[YH$WS\%+2V#PUޑeXCHN/U{_k 4RʆtgQ.HHT:[p_;tD۟qa%W6|`9W3+:̫RcsXˎ|+=żJJ-(^4e䆃9KϷwP-š›HQq``yu`%Uࠦn?Pi{C6D$¶ )ԼUnMyh2~LZzFwo9g$0"yWNwѻ uKK=! Lcָ˃@%.US@%x9tLcR z#ۮkI2K17nv ^mUgCąi%n{Ci2:T[š*kݵh 9Q$,j[#!Uĺh*JHdY'MuePIug(SMt7eckBvZ><7[I|S;m}aVRH$%K+dN1g5bR,v ʝ2TL8;t@jVlK]*Q8,2dk˛Ƈ7]lZ;)4D0X})]۫% =K{q.%ǒdMxԂܣ]!d \\]Dp6VL[Ӿ! _R95z[bbL{bkN[X*Jn'ښifE4]uebH27D?$omqSCAǤQ[k"JAÚ~۬Z4"}dh/a7(݋MGUӅWI1WWCK=BӰƱUm2+ylwS6;@$=JT_ck@*k!.Vk)bcNgYIK[CX$X{kE:ϊ|̟D> UM./(ƇlTZxΉ)kraw>}w? q "zSLviAH0$8C}ξZǁjA}_>Aɋ%Icu>:UQ7ZcC-yl?4.U51;U $?Y)x*FV<|PKyLB7{8~M9[Cάw<-mG蹒? ZVzv7B>3 Ji8kH~h݌{-?͟7SGթCi@$v0M"t$5?$!zʸ0[?of@A@;ĝjg:5(`ѶdבGs4C=>_Sa'&7h! e$t? ,K|w8W_E|g{O?qҪ_@]@0x\ʻw~TTN& N )yP{8AsRh&6Tvb@Cȼ0IU_$ٗVSkTss}fS;;~hO*ӪG<,C^FF4.t 8}#*)h#z"$$oMYg/oAg]7f5d[5Q1Ox|t_׼YyǷ*bo4 ?9ڪbٿ{=hSf׻~M^@^-{CjjA[u:.oV$Twt0|\ADRFϲοa樞Fxt93zL~WHr11s Xpjv 5yWiKy? u6׺Qjy 6ܞşZ1~ Z^`=\hdVx?띇>&V>3*}/ [G+zi4yB;>W; 9X|lrr'iAsO>3/Z{xhx4|;ڏM\uHPqMJ\|ʱW<#sߎM/CݗB{#հ+Yqk`.ZmSFg:-yw({?t3j?2Vmm]_U@U> CJ![rRdOR{^߬O62gp 8JF=E<,&Y(eJd=S$vW t!y{'BVKTC/L*i#e\d:JN*I$,= BI&:VSC$M$JO m'I0ޅnu{>iRIKFZaq#'U1;^ x!ֱin8G]a%Ja'$)lj{k.$y&ŏs\g. mJIiSDhs"#VK9n80%1#?J\h$O%6_=-$QШu/Xih: q[5F2c^|~kIqGNy?I*?'oy˭W0c.<.neKeQ}g. _a"غ9) =?n>GHkt,y6C/!:OڥJyA rS4rG޸}i*~1T4)8ܻ\Z۠lF8]CxQU?߼/:{J!?[!q}w{g=u^r+}}zv)wĹ1r_Fs~У9t^ԱZ펵Dzn0VgWy ` A4 rq2ȑSoIxgQ{kKG'G*oޅG_wZ_qOܗo};\]E[rsi"9\=%4>)elCލGދ7rޯ ˴Zϩ8N˃5o,t7y}G׶= Z;/57s<ޠ]WklMuK]_h޽ۄ".kdp.dD4(v2 %lW.wkt*_NW'y=]{2?wDaʸG6iT~߲3G'.Qs,>kwl`# V{Zxju}7nQh.&Z[ |N]&~uNnk4+͡Ϳ Ej5JXj߱9 5B>_M@=躟OX қvL׼}Ɏ5.u r'xO煸h8da:ƚӨY'ԩp<IvhǰrcS-p՗^kޭd9ccG$}.+QcbѸv(32 TB?qQl[XFA z!˰f@oǸ]+d>k}.P8jM!uuNƉf8+lq.C3eΥspy d.vt[XAN??ʥ/a觬#w_ nw_ $A-ԒI$I%)$I$IJI$]Kȸ?Iavv-VFBrS|,i()OSR>5)vI<$Q)2D4L9Oi e4.ҙ?!$b$š?MLLJHc;$$)"|TB\'IL#Q ɕi:#TP#DI>g59Ӫt .+8He1rgS+/Ѻ^!:v^ +M?}[f;CZ8MR DDu)sUO ks[=S 8stY'Xv\ !Yih:OU=i'k&dWX#m)H{F/$LXaV vڙY#N7]$=7];}?{5j9:C.`^}F7 sZV{o {,v{rqcDLߢݳWs!!󚹯JƿAu^Ѯ욃 6Iw?׳sluy~q-Q9 V\}ڟ۟b -~w_!WD MmwҞg]FCmp~ѩo9bU2*uksOՂ!Ѩ>_o ?x:Yo.c,<0Cd= Hˁl>B;&c}=qɱݥ+؏g?j6jMNMY[?=ߝ[F Ihtd"L^}44#Y]HsnҬhWCʌIC#ЫrJIvm͆=h@KB+%%Y.!S$.U]pj|JoU%7J84cca䪝j[ki%"#O(mqVUR:Z7N8%֍x%iB 8֓U ms9?pP:XSTT˺cJK:i(D fu+h{Ln]9(EjHW%.$N⸈.oҒVKe>Z8BˮI#a}0'Pݕs1>o(l+uHh!r > BVmAG0)x0BVe8:ǚv6ևN=S84A2+Ʈ4ml΀+JJ1$T#Q}nŮV:c\dxU}{dEvuu͠ o6-js/`) LK.JaB:ܳ0p;(.Πֵ--2T,; *k]?H-LeӈqjVpI8;ΜϲbG^-A[I<T [ Ρ .O輇8ƻ[|JdVu.:tMenx \;ۏh@O}@ @Uֱ ͳ1i2Cw?ZVy(Zz}9tI&47&@1S_kw?dcny N,z `J0D"8oIbIC̉;FYe,33ܮ^zk%UQD?kKvG&yHܮ@PR|ۜ~5:綶;n"M2 Z[,~/ñ&u Ĝ 4 d1S 9)Z=+=1GާQm1:/0$>%Za% &ˇ7t8zNG>^S4\&8 oȒwMƾ}X" +?t̜[mGH~DBTtEfU^ySkR B '*f[1>juZYPBzh,kwm-2 O?IXn-M4Di_RJh!*n cK!Ð߱۸8:h\Qѵ*}cBz9 lXOmB9Vn]%Um\`d*G9ڀO/˧\ ʝԲhsO Q#E!Fv]4|+A yM]$8pB[simNIX1055 > JUv@38֚j(I:\ω*wcDz-"UA쿲ݷtw?qiWWUxfg_ HӺS?77m*$J', =8O\7(aݷ @ Ϊ˘Z GbSExSCZ;RrmO7 0$ջsd8wJ_sxIYO I3gq`7[rv%7XזH 8O1WpcmIU5ӰM^Ey#D\^5f\R" ips!GzZKO Miq =u0K++uN-x-pTgYgPs֖;A jIf&Jm }#E6c\HuǨ{':pi,_uVtiqwa\54< :!hNIz{K=Jen-0a=w>Mn-'Qk\$RY=i-'ߧ\rLHNj{c׿5)h,,et.sGժ]w0Ru=q-oETQoOXZ\I8{~~>=׆Ϣ.k! *Sc ُ,hI X4]ŧ(ae [pqb?* c)`k@k> u|gx~bߚ]=?T&k&HCR.uIs$]m괶xV߶}an~ WWU0]goneLOYv~dDzEm.#R7(aȝڇzz^ii:+c/f8|CJYKEu45ҿh96cwnxa3"AAk[6Z@8x:ݣ{(yJNsI$R=P"V`,+tS{߹xO0PE $+E՚xL2 A''&JFMx6Ouo倳ptɘc2SgxsrU|,]j} nqWpzoZin*XkCcb%W2: h!빿NoF?YT6D4>W ?F(wuxE5d-:v?ͨg}R6rki\` *,x۶kuIkIhݵLULkh2 !οNLszď3: 'n'uG[niŌ9@';mu֠׊ƈ`ӭaT7eI{%{AKN^Cqt};HPP}#Aq$oz&M{0@akvj6oVKV >qEZƲUShln%WY;֗Xh2c`>Qnŕҩ,X?Ym5k -gtig=.g$kuWoԪND-!gbHh4bSwN5H┨Ήo4D'H$I%(I4$$JSBE"L: I$I:hI*I2tSJRtYw?Yw?e]l~(>I*ӤI$I)I$I$JRI$H|WsH3>GC2R1aZ#$~"pfF BhHФI:ΪG8HA ź%2IFQR9 Q)!% )L()y(~.$LYI 7Ĩ%(it 'FAH` yL9N e$$4mlw>W<'MI$JmɉA1 [??mx(c@f>W}>MFHNoedjUUAhѣ@sFUZ[Zu$c6,aC0#F?Iњ\2f\Z}Mny.q?jӭ` h9Va5>JfmZ8$=YLts`W3EI[ޔkϼ@gZ!YKYitdUEՉwRj$Q.kIܡM^v2PUz}^y> g84$ۚ04<ΟElUUUjQ8CG.!㱪wMvZ8?qtw!7-9F}QojK/dsLb#+dmVzKOS 7}fk!NE,P<^Y[ PSO-.`D{d^oy!ێt+p ;^ 0gU^Sh+q]7D ?9h"عoii"M=-gs*,$=vA̧=Wm9$|.>vīV*`cxh|RZ1.ȟI&@nicc6wIaTXrNj@vYXdi ~<Ū9ܔ5*WJ8 {n߸آYu o'EOmS2N~hѭˮ<([t}Ŷ#²Hy@ ߊngaOUIhF䏁2ˁvݱT L1*KnSw}#q:LL]D߳Bz`?F}M8c_4?@)!ed}dJJ_; VFKZ^.BfdTQ1gn(7GFY,' < &OYna%o6 l+Af1F??ʯW{i>h *=QN 1 w`[};κ+u+8jh'H7=mi1OrX*h͑DCEȘ쇅r\[ $^iҹ2Ock Qs#CuEW #&3ڴTٞ=Ȥf ]Y@sp~a|AH^V$:uxRA%y2aX"9A>RUuGqşYHRom'\ ? 7ޝf϶MeތݿG9EljԮpF^{~n?qG7avLj#UM$,aFD,Ӌt Vz$)S('w=Ѱ0~ۺ]o<kya2AUzcrEnI$&]q!~ads~*7Q8[>ݛ[zϳU@"?xb{3M"SKM&8Lwc%l '-vIw;G`Ʃ՜Ov 3[F*-@?$62Qo[l%!Xh&BN1,+@vѵ@Ȥc&vv܆l/i. 1Z-]CԿHĕpt7iQq}t1ꤐL Nؑ< d}dOhM|WݟM`qi#c\|okpdUO70ZAȟ-$;w[#M~(fy555iEE2>OX.&?qZƱTݯ#P (cki{%-qȱͻ]oU+mvsA}":68WXxI2Y[pDccCJҙq ILxwFvX{enŎuG蹠$1?flZuhʮWQ[L) YPFy4B+,:o#mF;y":9a:6`xnic.X{gũm-n3mo~;9&kMO#&x6_I(S-}ckc+kDX?ֳE. `?qw/ NCN%Նmb|b9#_% Aycխ'*H--LOQvmb(Ёfא3?VsX@Օ-A蠵4jc|;w@*eVv9U U1B5 &OBJ^$ $):$Cd$:JRI&Q)'I%.BE$/I$RI8I+b\$$I`$$-|Sb2Xo9YEc$J$ ]z o^Q"Zo+"v_8kp8p=@oW|x^uj@ O T[l T \8 Z/(r'3 Rn RZ'xFvDrķ2ܷag}PJ߸~7gcD¶=ųe1MalP#sՉ3)$fcWQ61iM_/ldI gK5дA0~Z5sIʺ9?C p3ljaVX3ѯDU[G$"wMjϬ/сJf]{d7)SL~ =ʼ$aǒJIYWRPJ>SJ b@ԘJʄ@Jh?I ? .n*'l,0"}7Jp2nV,ŀ\78Su(a(˲o@p3hpD Z ,loin@.QYfKկLO4~{Sgu{GSS BBIt Xk`#U*g{GĮZu|ܡ|5-qH0+8VQYk~ոAem>kn~;,i`.Z&hY]<@|R'TPx=x_ḚKk1@[=Wٳ|UTѶx]K`T2~bq#?ўy7SQz/}_rw[^]WO,X"k".-jLq$TےZ!0V>DL#bvS -`{s߳'[8xu'P6LdIqQ폀>6O%~vm}UlcƲ;~i0|%XцI{' +FwEnq-cx\˟~Y{vf2mtǁ[b̓ih*^̱H0IJ& :hWK5RKC!`ƎUVK@actn~8ڟ.skCw]'L(P:#d8@O$M̬:EV=҉S\ .w]o'cFekS(hedyC]2ӨԒyR}>Gl 'hkMݼՙXkwdl^zVe\@ ];Qmi:rKn;=t`JѺ=QH0uRcKɽǏQ,60osw6l=Z$Izoݱj,-wT[8h{VY=h=mq~k $52:ͦ6IO,A#B}.kD`C-&]­l!͟T`l8Vxo1Pn<{ZxlgPpkW:e.Z},>N%]5V9C0>?" SkqEOqfW4ynV]Jn>h[*Pyq'0HdROVgL{ )#C[Yf;FG$?7"Ȓ8*(_=]!7h7+R艼3QޣV2\2@:v).ݶ4MXx~oh~KӸodcs1O,?Q? *C-#J]`zmC-;- ;TH?KnɖF[v5TqkSk0ʓkyiE^ Ԡd64w&O`o#4|;NY`Pu"`mGШ{cE)ń 쮪h;)y'=`2r`GGwP? 8yy{f{_~K-pf;yB|W޳yk] G2VauVa.Tzm ~H nD幏{,зTUVkM#O4nO +QO`aY[ u_C^cPSn5ţ y}S ޠݰ{t#=իC} 9N%Fy'úG΍(J `ঁ#1QNE]?&2DOoc&*p#1X^֗J5͵Ke Uc__h[j;^9:qߊ^@+\ۉgV)g #@}`G=O}#zw8׫fFl7Nh&8VQ[V~D-{*XbGRuX}>OV}O$œIk@r{2Tm]8$0,vNUD4 = '/uCCUi7oBUls:!&%lBt:Lmu;KxjA ˭ĻF28Z=͆\/GzsI{44XA岪YAmytȺC+#SEo5:'';v9~t^X{)!ډ2rDKqJ=Ax N{K^;vH Ա,|_U5z!\0~RBc* ?꾒+Uܢ>N' =Ã&Otsţ[X8Tj}Ӳsq4}SԼ><}"h&ef+qډx?5={Z6PQqeᰝK :&UBxpj/m)GI"=I4 GRo^#RAUnu"9=CW}Kq~ԩ x~k$$0n]Z8~!G#VZ-4̒ZfRbUsͬx>\5v)c2惡B25p?,uu2=1x9gcٷk\Ө<'D~8E VTZ~AsGdS$9XLF*}/dVJ׸u[Mꗷ?̺͗O嵃̪IܑZL%ѳ$V{.3 W=J 8esQF؅jZb7X\V_R}CERGx#\j-V7}Z{1 `iL.ҾWT~itvtRko>$.I#'!&Ȯ e wg􌺴}d|?(_aVi+W:F*JhykC XAEN k/]uZ9G-PFSJi]t^%a_K#7ڳ':sOUV.NV~M'\]F!]oXZ~o$2z<UWt OsVK1kşqRQH9wJ'\wm{$?{sIlc<U 8VM5]{OvH7+s-`#z9؄ &~sdhqR3XsTIN.Y"t+"ZecwS %I CI ⫺Ɯ#cۼA)^$q)I)J)&4:P R,\`jSЁOQN|V/VfkMӏ+:8.*s䦁V3%ae\kI.?̀,ak-L@iԟ\ߛy%_b; O jĔzlG33R:\VwPe,hpO]R7J#}]-!FKD(%WBGtu*GgiEo0G ϩYQ3l3[Z:88*i^sqU/-_J1dkt_uT.OUT,4II$I$I$I%)$Iv]/-q_kV15K𔳳>KEf9V YHH܉J%$%*KtI!NSN!dRʝۀ׀^*imo;'Wdv ][ԵۏS=,l-7?6Kgko+s{;aw,AȎ;tthVI&tǧ(XH~} { R{;_6uF|?A_oI.w s,.k;RY L 7~Omx3ԶQW#{CMD!Am˯"e 6_O>[{kg'!\\)Ʊhskgd0bd}Zn*YSM)$5$Ψ Ӊ #w&08DꦲGI]s{i+9}W C/鹭-!@cD+C&eUP!κq|U¶{Gt\1XFEy>L֑H )KbzB֛9 U̯ FwYT~ .! p uk#eg^a el[Ψ1Q5 Hv--zXªKYyg 4Q%Z v?[d=Rw{QelC 5J2)|jʽًSNT$ԝS+]6}D\q؂N(- Y]h?V:I-fہ!Ã~E]8R˵\!肫3>6m׷`D '9K(Dx+mk=Rgql$JwR6(&uRӨ7AܕԛԩCvv揓^]f`v \x*Y7U&96z`:̈́Β 7:Çt]IEXS39c4z@k{/T˱Ts|U(gXiEZ8tbrHݬտd`]e^(9um/eNai wn?g57sLxhad[pw jm%AN55Xkݴ65ꃕGuS;{,;#!l~ֲpp,P$GiĜ(ScW|dJA+O'̓a9ߜպ :-6xw{NE1 %qTIoꪚ}E،sfLI[Uۯ ثTۘ\ OUk[^_Hhj7Kq̃/![K;YUի[Af3n憆xϲ/s7~stzD9,s$HTt=wk;i-ā81:ZGռUuja C\c&Tֺ,P,oce9$}?%б2qk{rNZN?}ZHمYTu+,P8r@JUȣ!4*I'S>PCgrX7`vݎHKH;=»31ͷGfD On a. '?IY T^ i 00| X9xXr$4.D)&M&kOo0SEn7m\G[j( r̋K D|yaƿ:&V1Ģ,fuQ3-X=[p-[ᨂivxE@!z]Ooٽv]P iҩIcTnǮfT,9yt6sbtD̈&Ws3Y-']2"4 G#!՛l>ߟjP8خɤ [ڕ$u F[fا1mFQ:k5) Gܥ-QgR#3Rp8 ;C⣕-utUu'MNC/ ?)YC=8H"1mS/cݏV[R쮺},l?f?8j DZJ^=T&Ω;OuJE]Z1?s?F"n9zht1cήEɆn EW˚uK5K㴳Ex OQ{hJ<ۻ="{yݹe~%jK>ߑ{WTpu]Ǯl!nweş=&ыF=F4{K_ZzD m+<* G%U}ϒcy G4R-c `$hH jf>ӡΏ^5 =$bƎ@A`RySh .pFy܋>HUΑ{1GڟzDAq+=qrjw @%/~HGVy A1et/cxo4ow'zSj%ߛVENu>VmU;7XcV_ZI =ǂk~|}op wǦ.u( vʇu_koWŤ`oc#A%ck=-yqslDx}.aҐ$kbST©Bu+4^)craYoV(oW˲ ]%Nۏ^ú*g1"PKoh6dCt O}weY2'i 1}ewʭ)qy;RR|v5qRǸW5:r+A `9YHt+7?"lyBHhNƍǁ))Rl-.^HID{xnu&U8hhYg&֒+kkv-6= 2X:Pƫ}&*8UYUAwGAM5S"܈\]qֲ닪U[I#R^n[}?WiZȕzΦg?vyCI<{zdDOm,^$'7Z9o-I?*4v~#rj}Y>ή{Tߐrk~c6ޜytU|q,-uUW+BR=HI2S_(C'5w'ZYJErc*\so8 k&KIAWIVR +ۗfKI p?E%l9 ȷu|$t SӋ^;ߦ&v Zm`DS~c μէEFG: U󵀓5LaX #z=Hjς9ƥ$LF5DÁTlqq*Yw}ZcOA@;G: HTL$L;"ؗ6\|o5X'1*սMc} \yo?~Exid3ԬO2M5G|\f*nw))%4Y{TJ_Cvx2oTrg'pyȰ  EluCw GT=22d m%y,_doq1eOwzG#o']A,??Y}mGG{X RXa-QqiiG!cӓ>A+`vWÒ\]+H-cG#:P^[q:#fg27_U fӌ@ODkȂf {Yc䒓QvH.y5ކ7VsO|>fp`;]{U\$OĤ A:VpTb<$'AIJs.$(aݎn֞<WgQ!Y6屵L~q+%. nC#.`k; n 3悼7`$4'OTǷ%jl?\mn.dAǶև44Rc%MMI%!-unZGp~{,/;I>'T=e2OoQ -ҭUȮ Ďj:eX=vlh5WVC?7(6װ0N)YGU۾YY Fecwv*XŬTHrEeM|`kCf%O)2Aɽ6^'M2'oCI߼BgL̏8mW#{$ʛpu^Y5u?h WP4!6'4x%+,mM/y}-E @Q8`Lc sLrUZdy'|[ s؉0ƴ<ԡaa3 IOtt-pei p^IN/)h~H vu?ӱ;`p*OL&kDHE\:ꊒӉu6T5lu[a ±nƨ\FIqg-UkC{jis .}'NtKkm5K\ a`80]>5w([@w bv:5>535ix4z? 1Fm86A= oM1{iݩ+ vvӧaߑ&c _!Zbրu?VZp; N()9A!O?5Ya2|I2LdܒiUϣ!ŕ\mS tX}[dHS}̨;M>(>)ȹZ,1׿=cH-{7=7Z{r멢CpAn;kğMqCϐw`nnV,Ů#Cg[k=`}ޒNkdy&\$ OCz6>C+v=V+OiJCL|=DI$uk51XI\dz}a'{hw٬.23w:8;;rʽ^5*C;HVJ`*x9039LJgN $&i52M J\H&M*DJdIOI$$d$I$II&I,j*EVVh+$UI$ ]zA_HpGQ?/D??}P𼿪r~̿5NSڐ pN1vAՔoRoS-lWUQr-׃YX0y[uⓣg?׏+BA2~@~,]+f3}.ܳeIN ;E+M`h U|N3"fȝٛ!~ovUz`>4o}5Ľ%:u*H-W1gO wEiƷ>%Wc7>ƀߋlnyy:UJHnN5qk}Q2n0>z-1!I]*HqsBޭk|>0ǼduaK==A '}cGX'TJUϞ?eVr`7ͥW+w _cցξ%`cGorYseA1$yOhT? y5kdګ,wϊ?'u+@]m\oUmJhI+4KvVdIYɸ;{GXԽ޻s?*/o]V̀Iy[߇D8$V96f_/$htb%ӳV{ݰ8XW݋t-RaQ*4h='Z깺%bZl>sc}֘ e\O ؅PVKvPd8e1/tnSZQG=cѩgבhmԈ0Z?għu@!z l7 uw(GC:j"1'<|׶{p1 3YE9tx"u{k'_7 _Lʱcv 1ܬgg\ NC5dv(f=msݸ%_kXt_O+#GSzW~u|XOޛr$Tw?^'[G'dS200  [-w'Ql-N--s-a½² tWUIc d߄ls./VXXVc`cro9c3C[jݦ wV^ $WPqǒٸsG'౺/74x1RգpX,&xԕU<+w[=8!uUW QQnʂ%wSl|J]7>;u1+9WE<>=.h=i/ uwq|##~u ~s+@Z*&IуQկ<@, M; Pih|fz0@W0:f=/% ljCu?ϙV0~d~?~ϼ鼨W`"4N_!'-yg\\HǹT}F7F*1^vnV [I=+vj u٣Gic k7?z} !H?7a~gu4<98?ʥw@x-ތ@ǰN8ǂCe\׾IvĬ+{ĨheY]h Oq ٌNU 5jDx Z4Z}$< WOfX: qQKr:>|Kq+ytcT(m> .^ ĤoyB I!Jp29B+Мc /6 n`sQ闼^x(`'C⟴oa !6GK`0 (b5!.$m:;=HiЃ«;N~塒 sd {,$x¾R7#:@t *^ wT:;--GFXmkCV~ ƻgr/ڝ5L:H2 b[yv02KC"KC0=B׍FeRc-.u|xVǝh?Sլ KгV8{LQ䨸nk:u pDW;Y-}/-Bq*v}zzB<G-p4U+vׄ Wɂ`֧Ti}2 L^kW-><[p1ua"5Uaczo}mOxe *JcIjqX;6S%ׇ:[_A?wԪ< DXP4R([v<08W#`ihtǔ,4Zwר?P{!tnf7?q}B͍wtk>pyU7CT'_2\'ea$V#qvY4mwV~co FTQldSk"2Ah1i$ec@wf}{^i[C2~炩J O]'5&35<^WDnȯCItdxSsKA@K@ES";yj?w8ݠ֏R¦Ƌ _g~ x 2[Ů$p[:1nO&Uw?Xwc={ՇxUwi0x+oPM~M }HSz,5:Ӽ~p_Z~dmq0Y` 4 |SNpw-_󖗢(D=39qDj,b2EuU~Οj_J`42yU݊4*Lf=Uvfůa:@ځF^K70QK@ѷ3TnF;ŕPlӴ\H-"=ǽ`EӲ\}%f%zNȱs\BǺ;+gznqxׂYs8qPKPmn%o-s^V`z(euIo(^F;L~wfu,kJkDQ`=BO"yfC(oŸm ^Ą?9resExHDK.]N;S,#)7cJ3wK,kx*02qϩS L]̆]Ns}>7ة>-Rj][[(ロ`y )Ԑ(-Le0X}U5}+Lt[jLc(x{dr ۚAHp/oU.vVQ[^CןE ! o :HZĜ2eP>A0r¢WWs%W7VJviV/7s|YU@TaaPg6/CЩ^qY֯FЩX$MI$I%)$I$IJI$]J_G\j_j?"X~x?IZ+;:=O% YZӤ$%E1H(Q$)ck@}]g|ZLcth c41z}/[X5I]B;4CEƶAq*UCX5 mKqs&U>kgWᖖ8[{[_m-?5p(yh kgU,9Q]Mu8plu5Y]W5˃E>>]EU粘q s? 5aӥLh;hm3F+TtDUj-+f^rfGc_7q*GOQGљjco?ZNwd9yjɏUf'6MOWI yl4Y9ub4:mE EHɷ}7m'5 HK̗mIJʥҺM}5Ӻ}'q!UYR1=Ů;$)( mgg-8j<|lMkā)̾lDi4WgauNGM-kv;7ܴ,ΏknЁJ<^1Qߗs̠\;Yha|U=Â%H feׇYف_\đhJ m"c%s%Wo決;zfNLvФPfh6J9I"r@#ASw876>jK[ؾfdB=>Wi &6-Xu X5Aȥ%3O5~+痼ˊ&5‹[a)uv6 hqxqƿ,]9siZp 1[u7:k $FSs ?-p<ʨD=̺tF;vĞuK>ӎ*@T~dÐK#i"?{zfUm,p1#_*_sYaT&d*:QLVU4I`mt%,oC#7bwN~N"X KOeюNjL忺oK5`5TVֵ2@us| I~ܫqe㴸CR<v7^sI YmyU.km1q(?Uc\\ O`4$ISX=S~ģS\:nOE:@hLwUDH2lƣ-% 8"S\ml|C2+u6 c}Ҫ)%ոc`k{c*5=H Nu L"A_qS*d$c7.Zhtx]j'R=Hׂ"ckesic8[-v;~ 1괵1-դڇ^~I$Ld""=_ej-΀ TLcr,{$5<\gӮ8SʸKqcKhݵe}^7u'X˃}Z sZuV.t"`r DďQ/UjƪG'u<CMdH *yG Ω,_]bke|\'huO@qv훠mw@#B>(QJL(8>؀KQL5 =a^ָ rVKqjuN:PQ0Fzm%4?E.S"])a"D,u܃ D{ P&`O.sY`q.A'ȉ#?@wNb ΟYsok٘1]g5/< ߞl8ѷܯWcn`{uk0TDUX`2.?.[v0Ȁuc n,v0~S ޿~7Q`5֑{h`3jpp7?OtbD (?Meq  n+7ધ] DAW ̆7s4;w? Q=RI. O+ufZ!4 q(mn0%Oy% ڝSoVwoR pjh4rX+:#Gme$pǷhX{C !Âu$|y*GLU:T:_-TXIfߛ_8_Ï%W?W2`Dƈ6M"cA2cwC˺>&#Z$&eѸxY?WzE2 DFv-l<۫Έ!!~Ttձ&Wzxu0AT(v;S{}zG < FC1ukD8yUn2a`re*Eά 9R\]c``}`'}\ fŧ]@8 $;~Ǻ1"%"FQ VGMoT8 3fd pB%z;Ԩ<6w{)gu0l<8$#B;GȄ#"DqG(Y،ʷc Ӻ'L) 6`ITtl2D< hU81?>s+}q5@ T>v;q5V# . I1%Yb4=LiDb5KAok@>1ԩϺbHƈ]'݊n$ÈAgGc̽ޜ{y4QoM]he?NgP^@2=Dsj̪x•W]@5BUo)ʰV hI&v5v%~=X]gk[<%p$r5=v8x+#d2ɬǻ_1s0Z}6k99[᧲ߴ#V2 ..kZ$ۏF֬+JɍσF vs?}_5KX׻ˏyܩ`@: r˿QoW5%R_bz-UZk@=ֵ^HKR쒛6SL1LR:`4k)JT L) ]$I$)I/)KD% JR JP$RI$!9"RRI$;GZ+;GS_cɰTI%YztI$I%)$I$IJI$k!pC⻚V#ĿgA)d9k,LKpP&t)vLL:&)O !$ $&219J4I h.*SA8J\ʌT:x' $ %1q^RI͍LSpO~F &#?)G`W"`iT#6Ĩ G@JH,P1Sa?%@]:cWx\x-&Y'S7k}'G:5F>_Sh5?FnuY V9ms4' G}"@04-UўP6^ q>nv~9U1kKխ#~vPL7ku<G )s-|GFk!ӸgYqNV?ezz̵Y\N;5v(d[ZXStj s8Ӻ:|v v>~=k ݫ׶wzE漟?Z\Jńw~55m8_m"\ֽ Wz2ڿH'Aqu:km_5h[ o?|C*d:?g%&5⤩ߑk$>FC1۾Ule=E%:ؔvU\l{2^+K>NBVs߉[Pgq?EͽN舃ixC ZI%삐Kyؘ:(ac v99q<, 5nʭCeO5}x슒A3 OɯβIl Ddm>߶:) Jncp`ǹy~K{,68A=߁~;:c]{[lm<lޠ ֎3YA̮is*0EKRf$q*I-h썉euZ%WLHU{aݤ^Ӭ0,mRtly-mc2DI*Oo:OЭh@X6%58 iAZ ՙa-j-Pns%uk26UٱgI9YCW#Lʫyc_ꪖ=:I%@#Y]W܎zh=^f5d[q<䔃6ݎq-V:Uy64d4A#UIUUb<2$`|LVMד#,mM$/O)A?UmU~f5^@B{JUOX *7jhH G˿$ՠhb5բLJ$[k+qA*Vţ3?=s kP&q),~FC\YVj-E<3୤Z]76|w6Ϧ 'O?C萮ns$ -򤜙(v-cwU~m=)Gd\BKMJ5I^ 1"Ua ]. ht Ʊ3R0Igp> č%l79ng_U2=BvYZ648%Im tkBk:ud[H"1%]n(h{Ԏ*2Q lf3cL$3&W1sȄ O*^S_4k-sHcwmU3:V DyWmw@3sYK)6'Dl $&* B?OƯ.Nv&PΡ`;Iw.n;lgJK1@Op[fRͫ)L&AGY-AvNk2bGz{!cY֊dL+40[Z$ J-c$@ 3.g8ۤ U{ln&BvsA|>aIgzff{~Hλ,Zd -$vV-/OD~؈?: 8{=).sG* T,Ïu|۱6 L_9c\G)+}s(X$*s7KH n'71ŭ;@w ,fcVR7:GNv~^EDLF⪦qԺ}ʜw.'_ѩ߅u:c*)*=[2F4ӦAtL#ΦcS.H޳ j{q>h%?I;V+u04(;vgslkmLGE +5ֽsA#ĹGOM%x2/tcڪ\s֓PLju̮ qxwC=ѕ <;5.nUE Dn7FAhfQ}F]V%e3i$l}'URUz=YDĪCdc66'|-B JEVnUxY@1;\mqgo?/s\O$!cVkeÒcϭt˲n?I^ mmֺk/!)cX gaӆ I] O ez2:#UgUϿƶ~-Ѳ[`7[ΔLeζKv+ԾΞRPe>0$Dk_cg״~{/_р8#Q@?i< gFAۦ~L[@&"6ZTdc]t;ʏPcT*$ ..#^rJPkgS}G'5 $Uʬ׍?$)[Uuh';ֽyhio&ERms;\Gj- ,mm/yIPfK}JΓ߲ KKhf >'*s+`R}5r8#(pw~ MN?6#MO 9ہi+7F yc [_Ι7ٽAU5Hp:ʁ]SAp#M0 A1,uV-=ɗ>Z@p?zh,px]ʴ2wtYg#롳k د=@^͕z]p}Z8*hViu`]P!wKGYcghd|A1 Iʨ]#=>;|Z YF_% 9 ))2`䆩tR:d逄'I%.JILJb%<$N dxM·TI/4JIJIJP$RI$NJJRI$l,_|S2Xo94}YYdIV^$_ ]{'OlFEx?+*Ũ;/V?TN .>(1.sLU֐#UTi ˸my,54@ M1bGܢ({~!אI?\ D5+;q +.{re@c0eSZ7@HPm h$k\`4>{·`ck 2<&KR-gX$@d243%Z˽3Ra@e%ė9`֍l7SUh+ئ_i-'tZѤ+sXvtF;` ⷽ/=?$A;Lh`Ɵ6Ik"L_ AZ OeG[vM[h.Ia\:]L66sX:U-F7ph֯޴-zm~ gz-i$g"5_kUL\ {+%G[Oű7U[`jإe95.轆ӦV*_%1f`GOh4(N)ȑ'}vcwb9!JKQX V='T=<}vk^_c&MK|Q0jsx?5k ?$ kO )} f.OM'ltsO.e_k?Kk7Abd.ocL1^~Pw wjZu 8 x*9?''s~/gޘvR- h>A7ڠ4U_WolU }OnҨZ ^ǺpJ:-lD#TtsW%7sL.P1Sxʩ7V52Q_>#@Ya\|J?(8V=^ V$-N-_!rwv̖WsD/kN=N?5/٠o=U&"rdF֏a&p%$0n0i?4c~)ɻg)#y,r^i>u,4ׅՖ{-[OcЬCv[e{BX|Vg#2$cyeuoM~H[Y1`P32ok[\[x>t6_c ;[UwCK鲖Q1d+io{q۬έD£uW5̖wF̴=.~o,Ki0aԑk6c]Gfn5v\& :w*ͲtpT~ MMԯ?ޥ_/:w:t~)zV,.m`uVU?>͞\RT0BcGUpć:~Jo ߓH3RVGȭ5iBcKLqĪ$ yY9Nd"֒x>e.:N#FS]áڪrplcN4P/,HGy"_cC}Y2vS_ %sARiis\G2>%se[ KLqfns`G#E>mUݴu7xʩyG/R S^{bFYjwGT@,+Eźmk$,-VfEok\!t$)mCOp%?rv)&}GGz(7ZϼSGަoXX캬<5IVegWk-kƚSW]kF1yվax¨,oOK ZeY5XSh;CZ;/;l =8QiQt7c6sw+!<[D+8fXx-*pr*% /lSc\o:Oc͜OkTZLOugahc:9텮ąg|dj >^Ar?&[y#ctȣ5в/U ڕepx* 7&S7lZ>_%VN0teԉBt\5k~hk'QleObuCE};;XՉԺcislfj=JfEELF'BmnsHUMDxJ*ڼk+NMk:FZTKco(yIj r{¿FXbfw1$]k~TtH_42J V$#'Ny 7x[Us_}~5 Ϩܩ )H-/VĈC50vP鹯n ;1XNg]~%ݡ:Zʰ A<7Kj7㱧h9Ap$~!?{m?zb˙햒ӯq/8MC"Ʋp0Gtpdz5 t\rE,tjz:=Ez %"ջPB0˰S ť.52* ;lUJ{+T `2ܟBE413]I?4&wN J,Qhg^@4NKN6>g 8j"K(ׇmvϽit/_04XintBvcr?.:~A`?Cd ̼j87[?W,{swعWR5ec\dt?5{}4n.iF8OŨ;:}t[> kKK;Vn`uwK5p?uhPn 5dDR,4NCx=ou*@mdӏCa ߮ӏVp(œxy,hp-3z7B3I@^r/on#I(I$I$RI$I$I%to\jOZ?#U_d%,6|,+@ ,x$ J@)?iI H9Q0%))$nH>ДIJRIKh I8I ޙH r 5O>)Ɖ&N5Q& JcO%1;T朏JPgRj, @Ȑ<V @d|Wp1`on몭MYK`xO4eU,"#W3dzM3qɰ2Inݾ| *;3kcZOi"c,fHk9Yγw` &\oXǪI/$@OF]" |ȓ?I$d8tD]e^ gS2b4 n,A{UN遾;c%U6k$G7ѩʕ`;'(ؘVewCt׹U5ѾcsMoS"%P$\cse} [ {aU4N'`iXf\$HeYY[/kx{CNOrebU[{ع3ԡ͘ӱQOu5\ Ii?M}q%+i}`VWH7faEmWS+Ɔ0"VWRVO`rJ>&t:M@2yYN{Lq&a[oɬZԩ`&}qwm_E[鬺v7 dk:uϣjn絤6|wK.h`F?[sOcX>ƫ}+ sGIHk?/5;'FF>HضHlEhBUǧU!QIV>Ndج=+3;!Z{w-.|L{DDd%r?Ho~Ȃ[陴cgҒxVsFL,߾>׫aIcuoSsS6!󛵯B593;4EJOH1iw+;=x&LZʬ`CNI&IDŨMu%kI6^jSsxH)eٖ#AX,{Q7 wJ9}41#Vk~:K+y>@@qhW1b q[\A3sRiݴ7=Ae l5mBp1M5vcLMcѭ+ȫ֙9αğs~ڰCl\,p$Ay @5ca;}}[}W>&7_u7VѰC5;k^jrG~D_m~ϦǻonU\+;:@N /ZyXjVT0)ae $*X8qX4-Z/~;ŌCK+.̧n4BE:#q'PQkZ$rS7z4?}gt`e ,ikCۇ }>`B^qxw\$hx*=J+F5oU^E>ZA$xl Գ"]s5 ;:+843OV^qYn,G[8b"$%뿓Uf=v:ÚtVnc1NvA˼dZZ6>N8R L`=ŠÑ:sVnKic\]"ww{%fR#o먒Vedz@i@),,t pkt:9t# H[݌LUWğ2ۉa{ _;llhGUT`ϫtGQW>@7I a,>+>d@A~Krn64@5'_Un* <5f_+?m{C gpٳ?-h#_ Zᤉ>s Vq)KI0Gݹg!KqF@J`8!Vvf:]zF 9wm p>/Ui痻W%*m5=L+Eljh?Բ*Ȱ> MѺU<{k8N1~Ynyö\Z>#"B2r8i'R kCAUR*9Oϲ= 8n]V@qc#QŸT]cm{{>#%Al_D|T1Mt:򭩆:G: }on%Sb9wOߔEpC@1ƊF~{ V:ouwcV-r~ KY~>L4 춝*ntƥD4I Wy6mye15!Kc*4O!,ne⣻h׀AwO:%e`ס;3;^49 ?Dz\6pۻF3Ps[WVP}c1Ic ygC:{84kK!ڄF6AF2_f5&YWnko?AɾC0~#ceiQS+mxdOԬehr`/N+0g Pe̟-̗9ͷ(=G8GLmX V}FgʸcUS@ [Ԉ?tl~I$UI$I$I$I%)$NϤ>+Bwu}GC2RrYGJ@В$ZN7)DÎ𜨈)BFIN)$D%:JW)S (ND)L:o4i)*N)@&OILCNvM \: IEKk 5#a3&$⵳?@~ZVZ?7~r A.h>H<7Ц .q&+o\Ix4he[v]H X[.=5]鮢qh\="N# 9x5pGJ֫p ']bhrbQSU1S X{[OgTb"AU$pgփ g4ɨ\} 726`ȑANaʝNk=,\K2 mc aS8bKC=-eq0c^u$}GcAmc,Hk@$OxUsINQT:R!%LCqUJ'E{ߵ1X0@R䱦>_IB*wTYb4?K kG.]Vwc*tsu@-BC h-AD#TV)Űi 4BRq*9I'ò .ªFEK#!,9I^m^fP.iM{\ Yuюu"'^?p-ȲӾvk24W1rLk2Jjuq+ "#G'쉉ӄ4lC*wTMm"A娒R1#NtV0zmW֞I m,(x+n uԾ9_' F"_Вdr,uGb`xG"sc `iY=FW'qVU+zU \pSR7RWbmz#Q-lj*eڑ]]fC42%uͥ3 h9kmls>EBfcJ^ mU~Bp< k~`Uy/puH @*WPf;$|ۑ[kkx GI^Hv4vW1zsl ?]X +<8=۱[Y|DQsQT7c.n -Ck{ĕ*}28';kkx L- O*Ԕ 1*$&TEMs4F*Fe@ 1MֱƱˇ_/5"Ij4=BF-yc*~ڙ٬hRl<fn!C{u&F.is"Pu*S*?Q=6< Uk-nVTÏIL 6`jdqIi vZ[v4Knͺ tyjG ^[qZ $#﮷=wLq؄5Hba-Ŭ!I?PMk9o$f;J#sJڛִ}57p.0RTGe 438Ĺ?OcSU2֖8U5wy쫒G ézJ܊kIQWjޙeT#A%cI5+ͺʅ.2χO!EϤ<H̓d1l"{BX f ]KniT[e%2vMLOk='APRRYޥO)*Bi=WU9fV{ W05Wj[W;Y[Xhwj϶&'Q,,hp"S7<<}yx&"IcI &:I iqq '6spY0 XxfdəG )6c{Ot\ ܝnWڬBt*3+c<YWu:<[o9#Gt'Etm kkĂ8EmKLsٙcul=?Q:tV9L9Un_I'ܒKQilkAQ H+ pp{]i{Ϡ ֆ烯Sc5Z'۴'0Rk]hĮTv#ȝ4Ӛh-;&ѥY=G8G-d<9s$O z{[X1_gֆvͮRlp}73UNOJ}:Z._EŭiiD5s\ @%6G_XͷcD坛oCNaCpߓ[tzCqKֺgMgB.IJS}{?*A^6q?H6JQ^r>*4RR76R n09k骺_ɡ+8??'d>?GYpP; ,9LJnc csL?5( }эظ]բP3m A_"ɖm*_.;?+,?z/pq'kkyOH Xu)pK-J;&"Hԑ#YlK[mz[1*)f:'YђDLJִ4cXֆ`P!q}֖:Jұ@>O ͭH Y[I'(9V|JϨK #=4߽luzlt%dž6.LklVOC`v![70~pMm-S;%1y0øC!n E 0;ӑXM_{m#8 >9|8E.zOpݑuk@?Q"=0;$XOȡ@C.+·{֟ J=gt}]M V7nC#J`y<,>]u>(xnLxkX'S(!lhy䖟ZL6q GK~<#OwG .|7g"tޜ g:53o\םكCZfǸX?`H' m{c!Isu\VrMݛFMA &kߟ?+ hwYٖ ><(wfF82x䕻1kJvoP.1^ലn15H×q3"h\cⴿPI{@ )7k?T‰;? $ǹ>D/33);NFZvwEmr>? v.qVv-8NFhTK0=*J&3G67?>D=k6UwTwOMcicYUX֗ZT# pmvQ-R$47_aOֿ 8a3q4Zah?t0ӟAض}p ?W$}3ۚ2~#}ȍ"CclM{pW4q{u5k~<ۡglQYr?s o-a dIY@f;O[p:5c^ل[IAZoA7 d351[znSmiGeD)fyy9@'nbJq[i" 98-*$UW87ч??G_xD`ty}ޣC  dV]&4[EGadlcc,l(a#@eOӷvTl1C'(w9m!'[33@&fI-qM*P w3NJƵ4R,2號] ?zw[׈ӁZYK^+Goj͢A:XS5t]Lnhz}k܏pgSf}6WoJݡPzXk#:?Plk trG=wsSYBı5d^7!kHY|H'>)ccPϪ\߳:Pc?k?x~*n|>8W?_/W;*UqLz],Χ}4׺g5u׽+;fG~!#^\y-Ra%f~x]_8?Slkzq>iz]?_W^Qa~Ӯ5z ˲L`cH:k:ZAiK)QV AMP`GgmkgSf&V1=kJf6Omxar]0=74.T\6`2ǥywޟ>jBkfo{UsZgpWص8hecZ=&AVzT꟣+Y6Z_ZGuVƚEjƊ}S`CcNdtEvڭ7_KIč&HYY9UbVJ^nr[]"#w,H;8sC} g"29P,Íkc^j,">R ;zvS?md&>Wzo]78edwSmvx\>Au,o`X7tKjqi"B|%zu:Xi"Geb_䰯CnjZh{x(*DA+[5s7P$VW_Xqa4)W@_,;n##TDtK#*xQ}?0V99(`ɋ؜7Cdn}R!|$] XSjݵ>AHjҋAASk?gğ)7 6ӡl+dB6xS"<Բp6*x4#,u,.0U>] 1G2Cf4A< dQKۛ0 ,讧k@wWqKYCO0Hүt05j{zA4= 5vpƳmB5uїvè*ASWU[woyLRmlyEsn'4X8$yiT:5w4][NǔL Y9&z(o?1{i*pkȫ{ k |r+Z~JwR:Lj*ண [ME!;>>M{" cdߜs/ToU]'S鎴zp5Y [_&")<*Xٍc|AW$/X_Ҭcڻʬ6 i^kPq=W>}ac8&+. QϠ yX[۲j/F 3:c]Vh;4Olu@zK. kZҵ~d4oOEwUݿ$=&eƵ̄fa<; !.$XOc)> 1>\H|p׺Lq?ӏM/a"ÓC-wOb%z?AOndm#]]COI$k$I$JRI$I$I$NŮϤE5XO?,?<R?|ΏRK`e@:A9TM)HX̤nTS@$I%"RIA S>I&:H``)K!A \|N)Ly&Vpe11*C(5ڶTG%#Ps)}!%KGDYFʱJ7jhOn;ApR0L JRHH> ;M9ISD'EHu&j#;.d:}4#x:oխJIWE_ `uzEWHq$zHvSFan,cHQ<F{튭gH885~-UdzN 0H"|gvMqq?(5!ߍn8o ,~F!:?k'cXڭt=@uZYÛc?$-h"}\bTi]˴ɪsKl]n8`pO+AE?u~<5tx+}5"HM 3-FasHc|;W!emfZ 06y<,ޡ! ?!m9H'QvM:f/|K<g- /`籕cl;G?K\Kd_r& @JGzp2).}KM'Ywh  Ve-c0tsFEԱl5x*J'@Y(BrI'U{UCui&v 0Yc`ꂩd-֒I@+9g΋]%;O}W#C S>(ޟ[NS{tH<+#9\Χ 0?խF_7 &d!MOM5(ͻ^'U2̗=hع.=(*s&["m{u'Z!͘[H,R1;կWV0W֖8{A1 jT. 5B2zI-LvPnsH zsUzuX\վN6dVu OV*u\[`k5W+3 |C$]%(#2xC7kl;qqy"[mUU_ԭȬV~t-9+#TT@CO $euL|Gt8բAB'HqG(Wzf#2SƓ̡c]āP->Oۗo>[u7(bR {v}'9s62W *)MS)׫G\\scjiᢳ:pk\H&5Y]Ciw3,lIa}aȦ6洉tH@DZ"51%ѱu8l-hGCRkݽ2L@ݭV/5֏z ``&ˇ;G' "t"[D X> "ui?wIc\KAt\}{kkSw79gt~~`43VG}'c$"Wulu.VM>s$m *BNLle:Szl̘1:c Em0I?>ǡظe8RO kC?O ӍP6W8Qaa~F[jNvrϣ4zxtWah{ "*6$=JEĕN;wn?U~5G؞~M0VFY}{6Jiй]O]K:KÜcsaL*RmdXFtZ,pPT1:uMU pcN*]*ܬm ?y_Cn-.ƓgΧk ,p5V6muJ+ǁUˌIV3:s,. zavV6F7mHR\oK{Xk/.h DjkvGK(Mat mL^i{b5}_ɿ"t8m'Z&^u%6t܆ߢgOFUK*H$ESS[`,?81wK+3>+:`~Ųw A v]j|j.αtkBSG]nEnCA=;VV%ᤴx=UMiq. n[uiaiA;n^8%\uX%emz8F4 E9vz` %>npa3"g/ist]rIXZjv9 v>e>Q nꘘS`%- z=V-p×$\Oܴ:eۍ[5;]MVEWgr ;&I,>59 JulXʯ򍋎rl4ɓ䬒@$ =zGPͻ-;D֏GLacݡWiID;B `x-^9upjv˷Li*G ,7PKe>. fղLJ4=8>ܗ R_/*WE]c`h X%5ڨ9`$}ʗF۱ZtOqWs2F-/$Cu;X-n梁DCR`zBlUWU}Ue:)6V +99؍ݻq!Sv_/GqFd?~Х':[Y ;vh Djkv15us ]h8n}b!$o*W2+yHmq[VHʥ O!t k[J26 s^h{E A?*wj{vL(5NΩ3s+.Hpћ՞GYvg{6Ԕ8N(p0lk${j_YxvDG8MUN3ߎ?HFJXL{a{ vc7P2 A$A Sx$X_ᯚ]v^ r$m V9ǰg}^乀 #9yV'֚@=ΧKF@ݹ1g\f@4WfKDFIeed >AYs < HTzUoL9h5F#_I:6zf5nx|ɰ49Z Vp[CZmos>i#b ܜۜ\-Z]+75g_+Fq#EHj /hw.z[M@5ѧqTs1N-$\8 ?oO%3$xYYk8n~oέ(JCIk WZ=P ~)R.?ʄmw:6c ]}9$_Skk$:Z]6s뮫ھ5[72bHrl6<'dUG[v}-?z[Dn pܐ갻b N-+$ʏ$fU1%=vOie`3Wn!tw7SzW2(`&oT%kUpY7ӱȕyt w%s@`y8TO۪i$)!L(IL Br RA4~ɓE.d2tJN)O BI$I7 rHjWH$%%h-(Y{?e]6?u]XIU\$I$IJI$I$RI$C⻺~\#>1/fYPr_ X_λFO% *TP4N&%:bV8 #D$$&JRI8LPB"Sܒ@E$R'H$RK\<S~tJ~ L9> Q5)%b3oiYնQhk0FqFeDŽK*O Ko&GL;m>&#X(Ye$byEZlD< PqN,N̫ lA2{aQ.Vsr[o9(}5Ǒez&#Më|Ib,hpDjcǨ[@2NT0pߛn DAS)$t$GBvM"ǀ 'aF0 hL\l#@!.~3qo50 K=Gq9^.k[MGiV9pH<_UEՉw*vdUQkIJ"Ii28K-2ϣX](BӍuZN99 6t3:~nFٽCK[@$*R'k :5ǹsֵmkR5'@%̮V0=cy*Ni+8u>S\ctԱhWMO6V}Y}Am|wKb8z%].h?M~SKÃ[04GvzN |VoJ+6^^O\\`4Mj-QP},Mɒ@f[H S(eY~4qF?yi$(ny{2 JiqѬχ8صesʛ/C  f"L.wos#&̗o5Tj{_WszfƶIVm. n ϲ\g][',htx{yOU%o1ܕ]Xo$ _e&kqla6=޽m"{"!sq6;p?A ݴ:ɧе<}Ehj?܋2#N|O:h~VK'3 ULFͼ3KD})RMxcnY.?߳ޮLd"cSV+pYV$0s~Kw a*Zm"'-cR-Xב!>Mk< }SՏ3=^Ӭsa>;I[>"?ꑎe^`ckiIӳ#@ͫ=RA<%mlHU:Mkm-謱Ǭ4hJJMvQ>9$)Z85?9Ͼ<4Fp4 /##6:c{W2Ѻ#&f=u)uqĭ,|Sqn>BQcb{'e {淀ODT:[M$ż!#2d´ U]X񑴀;?Z|n@'U20y~oy?7z BɻЭ;{*;5%x RWlPބl?4FƧ׵wܬ,ZVO{}5[^Yn:W];FrXsl}O%2X>I?u,7fU —O8eI .-t ݻc}(1I>-NKwsUֈ'7{ϣ&槧a{wSYEc 8lF&^Ƴ?Ii%7` aaZZgՎzlH唗*63ct UacUmޓ}I)&+kwiޯOsőHLsqt?r:k\"߶##f7}/=?󄑳cu憵sCL)K8b)z?Rs\319[KX3?5_zgXjIVO#<9} ǧ{}\1)*NqDFܬ };KMxtHhg+>gm%o[A|Aܯgu_T*Iđ/M >t{mRIS]<浻\3P2W}яkLԭt.kb7?⹈q>Ǿ~8@Ʃ;{Na@='z3˟lUPkI:O$o8m.36!㢱z՞j/oZ'hvK3 Qv" 18ֶ7mjG5{>\jcpX9L}[HiiY?iϩ5<$g}Ƹ4 ѸۻF'D?9juqͳͱ?K7}T>5JTvA~OIi}O@ B "zMOo՜En!V8n.psG [}?>cw#$,mc3n.hy{n@ㄖQNx{^3Gj8P<_{+Sm,s 2 cg$C>ԫ!3Z0|!w'ә1&LɉI7DK\c{8n?[酂F1?SaqD(%ؖDkE%wm[dTfV+ sL&#O{\J\|Xo9_ѺMI K- fz$ktb ~Ul}BXnM [L4P9ݩk,䰗pVRV0g. հ