"ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:34:07 k &.(6!HH Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?&F[o(&%Cm moQ}֟uUn4vv99* չ- :~l0l l-wa;H ps7%C[OQȰն װob87z vN0 }3vSkZ%)nJeZ%)I*j%C%Chp*??P6OLߢ> $9W՚1l5.@,{sփ f\M8,s/kWzCass_Ŏj`z}ƶƾw{=]x';쮗9!5+A0>>+pUOs,hfI5u4V}OOsnh`2_kZ蹻c= T{!k׿sZ 2=?,ո^]Z}uo>levTc9\׽EǷ6ۗ+ֺ6Э- ;2=?sk=|XQ.smlkuumf՟ZmIcXısv?飺:Ae4kk_AAV }s]n-s!z6~=WE_Wc_J{ˣW#{8v}&?vE,VtΨr1.űc][wבEyh{ g-2A,0G}A)ЃrINJSK'<& 6U:Eؽ61c{,*~!cK`]['p)1tH\2Kd@.;VM8Zƴ7uI=5HVi .:Ck3Nmfg,C %tun30ں!nKZ=xEދCml :5L"Z+hEΫF@wGmKc%hHE~ԧ~Ɲ5Xjs/~>Kt̳o؉f]NhaٳkZK\'w~\㺭d8qߩn?oӼ2ߦ7ݿ >V?6R|8L/" wc]T~ci`!i1o}5Y. e#auwquRֱX\Fm/5~ﺿGiptR,x}h{ :}_1cpZ%cuO4wǬ^='RZAi` h~¨css{kJ=K?Bw~ |BWE.s:ÃP9\1-7 X&\+;uw_?Z#iv>QhΤKb,`롞Zr+j £={Li05P=MbJ/E*` #SI$!IgM)6  q:p-~sZYz}#xnMm"$z3Cʬ5Ϣmno=QHN~zGe?\G!w?7T&ϳU{IsF^9ӵnYU2+,u5 q.`>鱿Jleg tZ*c}A sjuz[j~G'#d6WVVa`i~~߲n}W;?MI Y=_vt̷484Z O5Rk_J[e5Q`o`^Rw?CT8{d^ n{sN馺6//Qr,e[{KXD .st_VuLwJH#iESbeO4T=}p`5i Wn{}*[U~goV,鞓~CY@r]Yee'#>>PU,ւX5&VWjoJh{mmkk[kWmoFB(-DQS[P{,amX۷OD,ld ܟGoWJoU!QsumM7UuubW;i3]UL{qeOe[A ~o]]QY/Yܪ1CE-.u"Ƶ+i//vUMuW0H\^=)Ʈo&"y?;mn~i>k j_][Ử]oz{-Ґf2f{[kXqvzYk_vjC?mvv z:w}lUٶCkݸ2ݷ-:ѣa_eČs?ck=!퍮Ƴ~hc_S5 n,'8j1l0൪aB BdI)7ON']ፌonY 00\Z7sY{);2XͻCO}YҲ:]{b㗸;`mn35U~̯Gs[>zIA6Me }]h{.E.mgg//kp}έe{SvM{뢏1BUm-ΪON %xyoY۹?~_Q)[.ՑsɮUv!Iw%}J<2*k { _Slmgz.}>lM-Ij,mek 6{/V6ꡢuhwйk,3oٿeUz?g4Z=,Rcxk|~S=;=Tэj=Tfص~klSn6u7z?mAf+ kkݒ]cnކEY'*Ws cllsog]ݲeT~! j{[=;S~?zWks2Jی+spLm@2sPvǠQ@tѳk]fsz]{vzZsm kXe}+7wɮײ>c_[we~Gвkn eDg[>tٹen;Ú湻->G_]gGq⠔xeYbly:l|1+ xp_!G'Q e?GEID|;%>>uw׸ni_[Ϡi5b̫k͹lF=dV7}je?h?b{/aK߮U\7VʝS}F5vh;5fYMaԶ2q{[[Ϥ֚驎=Տu?LPk*Vo*oC?Pٽȹw16V>n%M6Cǚ ƶYհ͛k~TޛMebX-k]v܋=otԩ\ke/ߌƍ@oSYEj7׿566P(/u,o>lwqA'qVCwUVY}׺-.ȲH7 {f܍Yǫ5_+ UZ2kֻv;iN0ގvKYu~jV6ٮpncC{Q7UeWOgP]?Ffߴe}RR$S4[F֛l4CzّcoOeS_^-hehi{KM1ed۷[]p.Hvֹҵ*YgQߓF5vYcXKk}]=O:jpuu@dZX [iz/S/,{*~ۋcQKlٷҷe?+i'ZW6Tw:j 2S2Gm3G=Sikg5>lzo]mRO7V۞lqd5Cm/]OZ~FYOliވ7]gw.bۜ,n-%śy;1gYl<1 ufYll14mNcAIgftGPT@xvd_g+9w^ 3|& ❼?R=G3RD|_`7쎑[+6 C{}/ן1 =|i=wkӠ8pB:{{Se:,yIsJz HƕP,i(cX_Vvz>UNЪߧl ۷'i+poWV[_qݖ ,۩q%c=s-wg= ж?Lu/`=[\CZiZgWrMoW9:fE6,sֹNOs^Nh[S-:;ncF^w}NU>-bo,CCC]n=o߿Ѳ?}.&ZN5nw_USel_˪k/6>رf[l>SeV6`.uİC^ʙMoGrv{.m.-m+=o67սWu᠐[keuA_,ev9wƷqkˬzݿ_HV3Сy@ZHhNROU{-mkqfw#w560繖c=^9GGS/R{_T$_p =w7uHnF]M`hl87g~"f4UkC5kH!šsVUWme᭭E8 m>^K]fC6zzU~;ApiӎQγ̶z]B2^CXSL9p*wc~~5&Nꠗs7m{EnwџoѽjtV^;紆}|zNm_B=_, FNJc*>B_>_WٔfՕwShbuvǍV?|+&Qx0> @( V>!y}]e`\nsKT[Ge虍\ U~k7%y4b c͟@}CC{/MomL}XtD]Uf>=;}vls7_MޓM4Ek=}sGVOB4UXhc6:6{kѻ設f:^ֱkZ79Mz~ѾbzŻYE8ìfOtRO bOP-sX H!ۜ=35R*sE˪hUG+cCwdTKndz{DIݽovYZl6-4_[KhÖ4"I{߻_wv v̈́6 Z=mk(4 \,THmtś̯nA?/Ic-eԖ" {kպUދ.O^Lc\ߥw~_w:1oRIsZv۹g.'Tգcklu;{ӳo {vZw5{#m ܷR^*JM}4 kY/" ~Nl*9FL?~1Dm =w;w3Vk:kk.S4#HӎcXMb;kvZͭy*wZk}}~ c^z1nSa̵G6=6fk6Կ$4vwwC܏x ^^WK}T(964jCZ7<6v~ƣ׻= @ wG\7[4b6Z߽}SV_B~]OZX׻)ns};~SH߱u?p1GaG*P3^:.s@]X.MnO\Mǖ4zm`e9lhm1ncWԻcTKy9,6<+mVd>֚{]Cs_{?YKإ1zA=pkMXf9?~KHp w0_q W/M'kiCkZۙ__we_Yl kXOsjpw3ѳ6T= ۏS*h^+YBm&(hQۈ*S qێe1HJ S^3MA<1WVѥ%k'c`B(S!GUꏼ­tAKvՅS=Gn79T`ʫ}&Xpƻ,;۱fM8 eov]:P q!޳N;vl SsƝgҩڿux I'GZM kunݵmv_\*TZ6W6K?̳륣Ь{K̸NEwE4C7l@q%cܷ` 6 5|ZGZ5cif`{+t9 lh6k{"\o iLEAK O#(O{[BǼaIZ5D  Xo)noM#|Α4O+.Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMU kworkbase_foto-23 k nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong kslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong kurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM !$! Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?&F[o(&%Cm moQ}֟uUn4vv99* չ- :~l0l l-wa;H ps7%C[OQȰն װob87z vN0 }3vSkZ%)nJeZ%)I*j%C%Chp*??P6OLߢ> $9W՚1l5.@,{sփ f\M8,s/kWzCass_Ŏj`z}ƶƾw{=]x';쮗9!5+A0>>+pUOs,hfI5u4V}OOsnh`2_kZ蹻c= T{!k׿sZ 2=?,ո^]Z}uo>levTc9\׽EǷ6ۗ+ֺ6Э- ;2=?sk=|XQ.smlkuumf՟ZmIcXısv?飺:Ae4kk_AAV }s]n-s!z6~=WE_Wc_J{ˣW#{8v}&?vE,VtΨr1.űc][wבEyh{ g-2A,0G}A)ЃrINJSK'<& 6U:Eؽ61c{,*~!cK`]['p)1tH\2Kd@.;VM8Zƴ7uI=5HVi .:Ck3Nmfg,C %tun30ں!nKZ=xEދCml :5L"Z+hEΫF@wGmKc%hHE~ԧ~Ɲ5Xjs/~>Kt̳o؉f]NhaٳkZK\'w~\㺭d8qߩn?oӼ2ߦ7ݿ >V?6R|8L/" wc]T~ci`!i1o}5Y. e#auwquRֱX\Fm/5~ﺿGiptR,x}h{ :}_1cpZ%cuO4wǬ^='RZAi` h~¨css{kJ=K?Bw~ |BWE.s:ÃP9\1-7 X&\+;uw_?Z#iv>QhΤKb,`롞Zr+j £={Li05P=MbJ/E*` #SI$!IgM)6  q:p-~sZYz}#xnMm"$z3Cʬ5Ϣmno=QHN~zGe?\G!w?7T&ϳU{IsF^9ӵnYU2+,u5 q.`>鱿Jleg tZ*c}A sjuz[j~G'#d6WVVa`i~~߲n}W;?MI Y=_vt̷484Z O5Rk_J[e5Q`o`^Rw?CT8{d^ n{sN馺6//Qr,e[{KXD .st_VuLwJH#iESbeO4T=}p`5i Wn{}*[U~goV,鞓~CY@r]Yee'#>>PU,ւX5&VWjoJh{mmkk[kWmoFB(-DQS[P{,amX۷OD,ld ܟGoWJoU!QsumM7UuubW;i3]UL{qeOe[A ~o]]QY/Yܪ1CE-.u"Ƶ+i//vUMuW0H\^=)Ʈo&"y?;mn~i>k j_][Ử]oz{-Ґf2f{[kXqvzYk_vjC?mvv z:w}lUٶCkݸ2ݷ-:ѣa_eČs?ck=!퍮Ƴ~hc_S5 n,'8j1l0൪aB BdI)7ON']ፌonY 00\Z7sY{);2XͻCO}YҲ:]{b㗸;`mn35U~̯Gs[>zIA6Me }]h{.E.mgg//kp}έe{SvM{뢏1BUm-ΪON %xyoY۹?~_Q)[.ՑsɮUv!Iw%}J<2*k { _Slmgz.}>lM-Ij,mek 6{/V6ꡢuhwйk,3oٿeUz?g4Z=,Rcxk|~S=;=Tэj=Tfص~klSn6u7z?mAf+ kkݒ]cnކEY'*Ws cllsog]ݲeT~! j{[=;S~?zWks2Jی+spLm@2sPvǠQ@tѳk]fsz]{vzZsm kXe}+7wɮײ>c_[we~Gвkn eDg[>tٹen;Ú湻->G_]gGq⠔xeYbly:l|1+ xp_!G'Q e?GEID|;%>>uw׸ni_[Ϡi5b̫k͹lF=dV7}je?h?b{/aK߮U\7VʝS}F5vh;5fYMaԶ2q{[[Ϥ֚驎=Տu?LPk*Vo*oC?Pٽȹw16V>n%M6Cǚ ƶYհ͛k~TޛMebX-k]v܋=otԩ\ke/ߌƍ@oSYEj7׿566P(/u,o>lwqA'qVCwUVY}׺-.ȲH7 {f܍Yǫ5_+ UZ2kֻv;iN0ގvKYu~jV6ٮpncC{Q7UeWOgP]?Ffߴe}RR$S4[F֛l4CzّcoOeS_^-hehi{KM1ed۷[]p.Hvֹҵ*YgQߓF5vYcXKk}]=O:jpuu@dZX [iz/S/,{*~ۋcQKlٷҷe?+i'ZW6Tw:j 2S2Gm3G=Sikg5>lzo]mRO7V۞lqd5Cm/]OZ~FYOliވ7]gw.bۜ,n-%śy;1gYl<1 ufYll14mNcAIgftGPT@xvd_g+9w^ 3|& ❼?R=G3RD|_`7쎑[+6 C{}/ן1 =|i=wkӠ8pB:{{Se:,yIsJz HƕP,i(cX_Vvz>UNЪߧl ۷'i+poWV[_qݖ ,۩q%c=s-wg= ж?Lu/`=[\CZiZgWrMoW9:fE6,sֹNOs^Nh[S-:;ncF^w}NU>-bo,CCC]n=o߿Ѳ?}.&ZN5nw_USel_˪k/6>رf[l>SeV6`.uİC^ʙMoGrv{.m.-m+=o67սWu᠐[keuA_,ev9wƷqkˬzݿ_HV3Сy@ZHhNROU{-mkqfw#w560繖c=^9GGS/R{_T$_p =w7uHnF]M`hl87g~"f4UkC5kH!šsVUWme᭭E8 m>^K]fC6zzU~;ApiӎQγ̶z]B2^CXSL9p*wc~~5&Nꠗs7m{EnwџoѽjtV^;紆}|zNm_B=_, FNJc*>B_>_WٔfՕwShbuvǍV?|+&Qx0> @( V>!y}]e`\nsKT[Ge虍\ U~k7%y4b c͟@}CC{/MomL}XtD]Uf>=;}vls7_MޓM4Ek=}sGVOB4UXhc6:6{kѻ設f:^ֱkZ79Mz~ѾbzŻYE8ìfOtRO bOP-sX H!ۜ=35R*sE˪hUG+cCwdTKndz{DIݽovYZl6-4_[KhÖ4"I{߻_wv v̈́6 Z=mk(4 \,THmtś̯nA?/Ic-eԖ" {kպUދ.O^Lc\ߥw~_w:1oRIsZv۹g.'Tգcklu;{ӳo {vZw5{#m ܷR^*JM}4 kY/" ~Nl*9FL?~1Dm =w;w3Vk:kk.S4#HӎcXMb;kvZͭy*wZk}}~ c^z1nSa̵G6=6fk6Կ$4vwwC܏x ^^WK}T(964jCZ7<6v~ƣ׻= @ wG\7[4b6Z߽}SV_B~]OZX׻)ns};~SH߱u?p1GaG*P3^:.s@]X.MnO\Mǖ4zm`e9lhm1ncWԻcTKy9,6<+mVd>֚{]Cs_{?YKإ1zA=pkMXf9?~KHp w0_q W/M'kiCkZۙ__we_Yl kXOsjpw3ѳ6T= ۏS*h^+YBm&(hQۈ*S qێe1HJ S^3MA<1WVѥ%k'c`B(S!GUꏼ­tAKvՅS=Gn79T`ʫ}&Xpƻ,;۱fM8 eov]:P q!޳N;vl SsƝgҩڿux I'GZM kunݵmv_\*TZ6W6K?̳륣Ь{K̸NEwE4C7l@q%cܷ` 6 5|ZGZ5cif`{+t9 lh6k{"\o iLEAK O#(O{[BǼaIZ5D  Xo)noM#|Α4O8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$:-~lhT]$iaO6f%YN\f][㦟1JMK I:f5Cd':}"g%95'i?I+P-u?Z9<;d,~oJ+ v'JWR34-?J ęX?WTGtǶP v[wG6R}2~֋~!Kڭ\YUm4:#tfI}ìN3 7^Le\"*I< su 9 uch0=LΜ}27O*KZV |fZ#q[fVaOO 9DˬL,kytj;3w&c.4p/R[{tUS)k d$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$2JRI$I$I$I$$I$I)I$I$JRI$I'IJI$$I)I$I$JRI$I$I$I$$I$I)I$I$IRI$I$I'I$BI$$)RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KC:\և[ucgO3S?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$ RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$2I)I$tLI'I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$E*I$ҒH!9ŰjG.I!$ЦAJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$'IRI$'I+RI$'I+RI$'J)$Lxz>][Ya6 I$ӴOeI%i>cP$*I֩mm ktQkߠ?N7OhNZQi =yFkz#pX>'TRd(7'㪘h>$!d$sJ`'kSin$OTŮCk^;hB`)0IfÏp{+6WMڍ`Fup"jXWY]`Vj3@c/HqW.NlV|'[rUx\xc0fNCLG lzP.K>E-cuFD 7RR;Nx'F$VY[i9Te; '?158H^+I6z$9'ThckbTpjHqc;=V!Q'J6,7=~_Y"`&|ǵ@\c!>:$rݤl!YMM,{jn^\]#2Odx/]h)#*mcK{+`Hգ0nfx,o  0<RBcR(V"%56U$ĺI$z[gf h]wUq X1ųQvxtx"G=2+GkkJ:bUj0Nlg@~]Vm5F5k,YX{}OW~!8Dw6j4 M3T P˫T,.,{tΡrqWU>,Z%OƂ tGl(3 XR]"cZniPmwgR̉)PJ`V{5Gs?Y< G:D΁8Yvi½4L걀N@-IH>/PFb GNX~ Щ/d\bx1m-;e =@$=n#G@˕68wnP_aDfxw;C qvWMcT+߹*X:d9%߹>߹*U$,*BCZ5>I::z&IQgLxSak)8?V]X6ǜ|;/6w;&-Ivf1)wщBDS$ {8J>滖\Wt1&ڍu8>7G3vF9Pr<kJJKztBL@O +YN:-+zMfi*`/YN^c" H ƭIA_ޏ@s@'v.--ծ&B:"8#@ba qTp=wy-k|Ψ鸵6 ;aXTs*?uQvU:&u<䦂I&!\S'>4H<2I~Jqhbz ?GgM3[iGQǫcU$V95#}Cwf~&k$*[*kR|^ [P*V$'S7U̫N}~kGOB KD$K'L[@Dl9'c+OZ FT %]DJuP&uM굤[zO` x9ͭY U=ގ;A0O?[bR$VE?w,DGpokR9rV+۵sgmTH.Z92tSVoq'&\~鶴_!{Gh T+8:lZ]ʗe3^ +8 ZĒgM ǀ8 O j3҇3;&N/翀UYkkG<\[rQ{i!Ro(tψgF}Qk?jWҘ??{Վ[M]7~;ikuse*(nC;D4`.HPBjy Y$t_oݒZ`֣[ Gqg5źO/A,>GM&H2@ G]]wm~i(H'uЏnI *WV./ Nk 5Ow ⷖ%>#!/u c8F_NmruFQp,c-cA+봱@\^"vcfε8Kq~\O@[ĭ>[[HF˿.^V;2ݤ87̄.Xn̝fTp/}WI&Fzȩя$IKg fdP[UcJkq-{~Oੋ9Hf8#NچxNLM(8, I_²t%8Zꛋ#BLX/.)pБ2`Pxb6M]cD5LvdZьȞPTG 7oÂg^$(N.zWF:}{I$L3IvAʿ뷨+g,jS(;;JX:<3p=?_4?wX$ hVPev3U,vKv< Yc;K3cZ&?.}tf~Tl M ?Dw(F$I$X*9{o!"$J@t$_UuLfeQJ񭦠k7##2Hmpd$chm-fuTe:SP?eb]q릆wnQY$RvBN&9uu~ 0cQZyյYvH5h<6??ͱ5Xr!7p?XHoKN?ԉ6\tRn08QoLO٢HV4Z9Vz[rkth-{+4 qNwQ~;h,k6u;j@oՏsTϮjD ]MC""?=!m .:4?ɴ?y= BC?!]~iE?}?,dPz'xmPȇamݹiϿAD*V3=6IpF ,wUX̰  H@Xp$*$q74wh$r <a}"7#Rt#VIh i PI2JH:K;#cnY$];[L2:Z 䍓kst zF9}$YFwpa0lư{EkZxUe[Vf wQȀ, ԰s!92&QaXV?,5X5*3[ۡiD:Y8HjB<<k]>U\}=s0VZJv8OmMfHӍy_]!R]N\@:J"up2 $<&TAP?iJI$(Sm/w +BzGu`4U6djF-@ *L =N<[%:(}XB΁tLL ("7>Qp5j H14t]%;$Ix:EǦ뎍shDLt'L$;ͦB"t)[#M$+$ǣyXIu4L꣜ n͏ Wz`O 0[r*Vl†1?(%\_Yye_^PkXwSdx%"B#b,ݠO;Xƒ.6~?rF{nsűeou Z '{\bX:/'T^@ #y-xp7_,F:+YFi O:11 s'#ߤGTВ߈G:GcNXӹ?so=0cYȧ L?Lfj^f 0t{T[ggR^Sj>vzX{Vdߍeh-w:,eʰsI,YK7o4hM`? r?D!]t5*6`|jl*)+# CLy`vitH%@3BEODz豤@H T,uQ)hU]c=A lӪs jTISbf8z~mаc(uvՎHs;CRy4⼺ρu <#4 h y1(܌?y$dJ<(5o,ẳ-ŨC^t[ȴp2Ur\9wѢ}Di#~_*I0Odp$#Uu8Xlq"훎Ds:ROH0%T8@c2tA m `DѶ Gu&)Eq{@`sdڞXO l{[rtxS%GsL)(L}<+$=ţA* μ*xc.;hy>oI8̝|BO6Ef3DŽ%3LEӺO| kþHcP*.wޱBʩUZsH,4INǶz|[TEUqӴ/ryse0 NtOa]$Wz3iq}uGKռi5?ܨtK;5gUs N qA^vAИLmӟ*,s!;֩4oG;% @yU*3IC^gl@qk<y8 E+'/I1?7M Lot<YeurP!kybhDʒRGf p]$kFP7}+Gكl/sefR6\ӡ>?9U}x Z~!p`!-6/r,By305v' ?6N<>:o->pŦ*Fc[/.?F'1C i?FeC|]>GG]U?Nӹ!+=IVRGQ}(H ,pY2 Lfc]cw-- KZ*Ѥ26/@%1xNүd=H 6Mvekyb/LYuX1bw9G)ȋa"U;ѐNr'ky([\7 U,1uH29pw汪8t,{s%@ cj$ dh`J^$ '̩:I:=9֧ρPuϹی.Bm`>#+[5]܉ND(d81Unyw3YYnC^<00N4ͺQDF .eI baS~Fm?7V{^0R I26Tֆ Ik~Vv)ܒ@+x95\FH?i3#E$ɱ*X=FĚ#i0$KƞڏS{:.G~rd"̾N.2 F?ْJkm R~N6BWǹ_evTqj4!iw{zjّ`wn(c## ^Z $Kr ˀ++}{}ev<ӣUi%yQ鬡# c+K,Gy\+XɈ9$exS<+e*7s[TԢXco-LO0='9B($hll*N}+tB;+UӸHv>h=w12{'8:Wuj W04Z=Ddr d#3)tH@VVƾD;we[ڝd[wem<U Ј>M )$m*B(0srJGRN:t$I'I2tI$I%)$I$EJI$I$RI$I$I$I%)$I$IJI$N$I$I%)$N$RI$I%)$N$RI$I$TI$I%)$I$AJI$I$RI$I$I2t"$I$$I$IJI$I$RI$I$I$I)$I$A I$LHI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$ RI$dE I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I:I$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I&I:dI$I$)$I$IJI$[ucg?rZp57+5:f_?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$IRI$I$TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IRI$$%)$Lt)I$I$%)$Lt)I$I$JRI$I'IJI$$+u5IIJI$VN0Rv `RL UV$Q=GDJI$VR>V`qXh9RFI!*?')6[] Wȍ I$qpA*I$9skl;A &L d\=M]5$mO8NQN1V2+!"(Z;.7o5R]xk[R[>8QY%V$FwQ8˴h jyS.+?`:%@IIŤ6o Oixݴ{gSѬHF[v#X`&cܰnneN;I}C8F?0X(ʅF(<@yCcw{\ )k$l®ڝ> $LtȩI$IV;q}724OgM(#I$n;$/\.c ;'XtYSʷ(ۈC(JنXR2Z;CePXZL0<&k Z]N#OkޱB.5ǰZAV3[M}&7s-wE[uD2FYC5D V8઀#WsƒG M M(RD2o;uOIW vc.Ӆ4xxşUJu rL PkÆ@ϡ^6xFvV1eN9*\4xMcl-&;a> \QA'U#I$@:+]`u.=T-l.|6:Hp"LIsp%C@*n T]XHJ$17vVsyL$]"##/QH%k4YakK$w靠o{3IiB{,us$P~7MCCt 6"@at3'WRv%t_|v.<3||ܜz*ߵ*}Ns=ѩl!pP&_/.xbmč)L[Q1%?s@88Gv3{}5r`&DS;iN'Q?bAuWEb5OcRI&78#U6CQ%$d( L)HRI$-yT6"- hy I$iՏҪ`sQfJ<]L de\C4?;調A$gD4#^$/cʟI[a\Jec ,cBcZw4`_2 'Pxu|*#sRJH&"[BreTk_-cA L,`X9g=W~)2EH! Z'hjwW:% sv`ǁun<Bf6A-0u=6:\d%N0,H܅:s=$BNwzV SA`3YA$鐅.\k 'ZB}Hղd8&L_"fba$ j X>R&)Z%͈%2>)!;loHDDYtz˩4D 'ZoS־`\oHQŅ1 HsHv3Št1$Z]KqnjQ &78몝F@浧wr eZK*鏮Mr59~(Nƽ` /6<L!@ϞecA8~h)?PNDZgX >@굱pc_Qgrj 1$IM$D-,ChxPs*a"1oO% n)Mt;ʋ+'sA Y<"RI&*($t)P> 4JU$I&* ay %\\sK{uAȫ8("7|H K+Krjn12©8}!bSAʹhe>s֏vסtVZ`DZ}Ibc:8FHHj$xBlj$$wJ% U\5 c҉ܨYcv%ltvc\PDɽ6t ܂6/cT:KM*`BfB+xCITl ]U[I)Kjhw+SCЃ!ka]wRck,s 27^jALvp~a鿖e:!<  VM`iBԲ1KHwrtP$)c( dvM{7G !:Pu#I0hM3r'qοTͮwqըP G&9rE(bP츴Pw%Uf׆cUg6AkppLXꓧ҈9Lﰎw=Dp|Q`2[EdJj@bcȤKkyWrcH=OXi{0>L`hcʿ$4 c$n=*)wsU%Xc(Gb!ѣTJ18SSMnp:+TI# ^3 ":\+5t&e_ɕ0<e4cDh-xGba9Qsw"\(8-Pgi)ƴh!xNScHJ˽F.o:=7bzՀhZǔXٗ.Fqe[v!>5zՎ\Tx~n)(-<NDEē<_Gƒ>w¸c9 q~Nl¤:{rOy*ɔLj% i' .: )r\K&N@LA0[4UN"@-WL4*mhhl`_XwCR^+2ѽ˿nhxZdP}LKK%(\V%> ߒn2GoE&F=e`ԝOMeF S鸻2X{ģM浺vr չgʸJ/TuYS@ E$Ȑ}A=)$M=IhNF`4NICV,qh-Z$,:pKyGcZ$ʭ$x+ qohGtՋ$@p1ExBNSY'N1/WvSqG[4H\FQUn\~Q9#LY!~G)@G9jXM+ejIQ.2ί)?":a =&6:04*\QI$.`$I*JI$I$JI$I:IRI&O $)I$I$ RI$I% )I$I% BJRI$IBPI$PJRI$I$I$I"$I$I)I$I$ RI$I%I$E2r%)$I$IJI$I$RI$I$I&I$RI$I$I$I"$IN)$I$EJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$)I$t$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$tI*I$I$RI$I$I$I%)$I$$INJRI$:I$$I&NJRI$$$$I$I)I$I$JRI$I$I$I$$Id2JRI$I$I$I$$KC:\և[ucgO3S?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I $I$H)I$I$)RI$I$I$I$$I$I)I$I$JRI$ *EjS6QY~ev)F'P/ hfTA&mNC⒔Ia V Fׂ}.!9SDĶ+P! k1Y[YN#(Kn3 'y .)8Ƅv(.hMB6I%>>$E$V0N@ZE7>~] i*mɰX-$ ;ٟHm)UGJdJ[DBʱ&M>gUW4<]l%w!e%w6?ҎѩZL wb*H k";4=!ݮ;.dOp'o$lq?<{H&YOYR#&'f龜s,:uWcC p$hx (kՋ2{'D* L\v5 >#(s$Џ [IӷbK銎5Â86롃c\tCpvS,;:WEш2*H1pW:8c\ds(X}%5XɩدtIo4zk`ä 'j0ma; 0ӹDY.nA-|VbZkD[ߞuS_[X x*1Kx$Nnߚ|J(~P4dL*ݢ5j,ɱ} cE5kL_$N=te8 edI$@B/y)ncNn"N;VIIxdE0Qۺ%,qib{$%L+BddHa[ r2K4>:z+)${Z kv΅A %$x;'LiH9W:El6cSö 5D4$$TOUC}a*mpp)vRcwVnĿc^x$#a'~ˤSpeJC@>=a=Wuw( y'sѬ!AV|eA3 [98xS׾4`o O' TGP5{K ylh2D?t+A.ܱ@EecsA_yF\~+ +s!"aS{m便q)VO'VZ* i Z14RILR:^APntf6:i , )%fIcY=&j[G#t zmp0f?O֏OOooؑnо=iTZ01Y.c%ړ–>G 2*<SǴAh qY]->)t̖b-P*kK~O3;U51 q HKPɨݣU#S-+Ekcj:ĮcltZ8kqu!_eY}Yn8{X ߜV6E@[ILm!K9<ܿElvH-p~Ib kUocyAU 7LJ=Y-CsC H00@%-:~cQ@إ}ZCk5kN6 v7Rtmb@-}\2 lcB3d+h`SIQ;`h+zdzvl|~֖ջtIA~=45 ' gf ~iȐC8D:q,yL9䝵]b}޳7pxS&͕J+Gnn4 ,:.= mudk s( N6\$Ht'Rgksr_zIb; ŐgY~ewC+fK+k@9G#9G cׯ+I:fHJ5_2a?z,qlT {KAUݗQghV{˜g̫9y8U\U$h̙ 萢8SC75b}&8I r$Hpx:F%oq!VD:Hktz}!2vKc g,cuY(Ú8xxm~Iד\0!ąa32 'I9I$I$֒`jJJRI&*Knk;l (O(s]a CpǷx(d&?; `bEeɸ5 LmBʽ {8%{}c]>}5Ⱥݦ!,y=uT[kpRd燍KT6RkNdvScQ 5TR#^ OMպ|z) <4nqpdx QdH'U:mt-HG6SKeс2P*N0 sQsUdz ʳа2}R`vLhBDgs<(D쭶'F8(XIG.k;ednyh7, .M$w[k&mm?Y,e}(䎓XG: A BKךU yկYֹ.jب,b!%N nDkU$Q6$:tI%)$I$IJI$I$RI$t$: RI$I$I$I$$I$I)I$PI&I$RI$I$I$I$)$I)I2 RI$tIJI$$HI$I$ RI$d"$II$I$I)$I$AJI$LI)I$I$*RI$I$I$I$$I$I)I$I$JRI$I$I$IRI$&I%)$N$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I:IRI$I$I$I$$I$I)I$I'IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$N:JRI$S')RI$I$I$I%)$Zoŏ垴:=j隝?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I $I$H)I$I$)RI$I$I$I$$I$I)I$I$JRI$tb,\*)cG G@6$5ôȎhZXb;ٸ {O,u/,~occ.w~Y͡c8 qKh ݒP#?GĈ;M%(XZI aNU R.$/{ ֕ Klq%( $qr ߸熨98nOܨf]"!1ۑo(Zf8L.ݫ>!I3ZtY~m 8y .⺱Tk]ҝ23,\ѬD#BMpWJɴzk% J :Iʄ(z*}m`;1.|b--z23Y[ZAtucgdLrp<& 8y!9BܪG8?ʍludiyrG?B˥M}d=O!x>|zG;7ٴ›N(aC!;ӡTT}q P4*V&NKeCoAe]+o-:߂K#ΜN~hbnCjG#HzGI#bzL5.#月Am% u}U4NO79Qv+8#VXȦĂ=lj)>|ߢŐz7"\<ȒDցK-JfDIkta给kCn̽k_骸I;$^foYc&&yDFCA\MN2K8PL|RźRg&KYP$c:h@oVNe_hfUXݼNǷA,qw`Y_xsؒ74W[܏Bx=$qgߣ>z%`촿@>)2ӹu/ ZZ"=ϟ,ޣ֝ J٪Fbe9!b{;i Te$N4$GC$l%gy2]A%O(Ա\>S>*0<"ʲH$-{Z;hT1ltΟm$(;tЮIR(;}d!i}^}MKDDhPĵVLF$H@fH'ݧ)ˋq2N D!ځ='XHHHlP$P;): Z]n->FIDIh6Ԩ}75̧߽A$#ƕMH+vF4DCݾ}ޗ>q#K9qD٩7of#T[XuwaaPVvGکt `{dTn5$~cܫJm: v=zGف:BAuA=➜OG܍ =FcIV3qYklۗ(~k=B節\kݴġ1qYvk JV4a;Y&H PfY~;{!SFI e@f&{M΀r *7Rb ͎R*jZe! EKiڄ2JQ RTu4$0{ݫB0 Th*Na>#ݎrGh4qw]yֽx I=\DTyHʍn g r8caW6lTzkٌӠ<αPmc,\JgM6wM =7n X*i)?ԶY֝te)4d<:=K J1lpewO1M^ւ{yӂ0?3o1ÿDX {a5{ HIߢ#,:>F O ejrZk@.UL<*l ɫ !/އm~HBmMyo*i+ ƀ70\D#r& pPv>(Rj< DN"$kA_Lw{3&JyB%6׷Tgh0ђAR>XmVMT;65dwc?6F#ACu:OUܼVzf(-?M!#W oY3~gbZ-~de_7FLr"_F@*mb,ZI+or{[sKٿcmy*k}ul(;z{amxB *-D.5Yxeb/pʺ꿲X&FR8E p2PծݎV)` 4YtP,y n+nÎ>@Ƃx51{ˍqB@~l@;C۬~o5m"kxO+GtD"9U['ú-6w :C#UoT\%4 KrVO.Nm\"ѫX/vwXʠ\1R } I* y:;, ZƏacp{ 8pQr3kx@ ȍzd5.> Pw:&mmo U܆+h$8u?{IwR-`G"+1l{w3YF!2ُ)/@?HfeMFQClk4*5ws§C,8eޚI-ݸAL$C1AKXS>vLLˑ$zmmx:(׽祑ssiyh@֜FC,֞Hn 'Uo@Dgq)|p s$x+mpABp*~!%,'I/Yʓ^NpI$tRI$M;H#dJ]͛Z?B(i(P&DX}%r :"9 t2rl~LIAAa$; Iݒ>!-WL~ joKTB@I:j% $2$%)$E+]ߎ5Re{-ѳ+ 3$Er)${ K Q/m;#VԒIJ})mgP:ma_"_iYcUzH'zn0D Oc\=-Q0Ӭ͗zf?$/jWLŷծCgp&C*"Xޣ2EK/ }!;ok4L`@sxʷHcX1n$ƿQigQ̹NƘnZ}gfݏO<=ĻȐxr#qz^QEAokd li?Z6ePDkc n<1M{q$cVKj(sO&B]Jcw6`[@sT+߯^Jέ.Jŭv0gdA` J>^xSh:hs[kʕ5H<")LD3q4RYPM$\m'!$-D l 'I%j7Slmg(MQ%c8x5B%{~ 4NBK]Ūj@ѠBmy*!%1V|aACZ G:K98`-Gy z's4>)y0'0 (kjɔ ɏDNN^K( /kv5tVCmNfXs*v$ gE&Na|Y}uczW,u6@p'ѹMN;ÝܩO)& UDHzg~|J`ꇦ:\Àd\:L1`shveh=*Xfm-Cp-ށCZyK>#tů<'OH5_$Lzc^Jv78y*l{^%].Ag!eN 5D!h&T(D uqlVK. ' BN]f'XĮv-ΰvVjuIg!_/ZcZ݇0h;qpA;([Tq$:LNRIۛDj($)ʄWa<.ҡT@po`Hnja!(C?2!~,$,`5NֿBeL{=úѯV""G}X,8Wr^n:g4H%>/yWcoЂ[iڞgQFA!ǘp~ŠrǨkMQvZW1Ia-ʎrZ˄#Z\#N=Ó'idTE7IGuBw%sZzC2rj{~G6;^ ?Ocu"Gt2@N$.ŒX%,QhH(j$~:Vl2?kc1;1"QطSf9DI$M^I$I$I$$RI$I$I$I%)$I$IJI$I$RI$I$I2I$I$I$$I$H)I$IdTI$I)$I$IJI$'L*RI$I$I$I"$I$RI)$Lt)I$I$*RI$I$I$I$$I$H)I$I$HRI$dEJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$$TI$I$$I$I)I$I$JRI$tIJI$I$RI$I$I$$I% $JRI$I$I&I:I)I$dI&I$RI$I:JRI$I$I(dI$I$)$I$IJI$[ucg?rZp57+5:f_?d,?d+xS0vo 7I*I$I)I$I$JRI$I$TI$yJRRI$)JRRI$$)IJI$$r[RI$')I$e?S}zCAJI$DGvTI $_QRI$$7}~ҥ)$BI}?~Q)$AIiwޚiwRI$$__W)I$ ]VYpVXWUn%CA#e/;V:%D, %9mԁNc8 Uٌ)-#NU ֐FtL{H ã!Z9}G[zX./񸑾 $>i`neCyZ2p2oтc7ob>7M&y%΍N I2?C}8Ð|_JLjnmloe B֝@Jv^;qul;ʒ9#"b7 2(DHfDhOyEc%@8Um$8.;2tU u 'MUWZyKdU"KK6maD:$cِKkIR6l0"5X'IE tzswll$ fޚⲼx;̹ĆQ }\ln T#$l|fX'B"7^I-I*o%#Jb JZy(H%k;؛ !A ]@22 4 z2(I$JI$gq\$->+h5RJ3@125;[IDLYs깏J6|SP %"b7)[ϬO=G{7}&?YНTBڈU&ꦱNȍ+ -0X,ĵkլUlIx?? [BcM4\#`$h?<wcm?!!7onOuB(Ydvj I)@I&Υ*k8 Y8&c`u+eLIa{F@ZG6Z<:8?k)Mг|hAFUF{鹆I]fsivݣgsh9񋪥d/!ò}KXΫD6Ss=i|9o* Dt$ SB+D:yeX.2pgGǼ9i-WrSG*e3`ѵr2hR/\rnP0t t:x} 9v7?V-+2{L/yUUnE8ޘe1ldgyG(&YU-GߩP¤8;轱Ϋ̲Enn6,0*5: s~jeN^@v u|ţn_$u?tIL53Htc kw7.Tfͺ '?X]ӲcZKthݧ ά>!3xB,HSߦ8o`uOEAW^|u_gƍns_/khO/# VC6$'{`ϪØ4=xfq&CS%600@O̗vi#u忘*(vE TY^UT,iqY>MCWrtNScd NZD H$)E:688Q? )[}RfqTl!O/;eU/#W0Û"COErģgM@ak*,; Lpdy-{kbv~F{!"7+xsΏӎCuڕxxPDb8 !{kx S:3voogq:X))8Ow}pA4!Z}(޲[)&%*لZUy v@Pr50u RgT]54>6s8*ZX 0!ޟEm=Oeo~S3< `,PH)fõ:E s٩.7f8tZ141qdz+sNW@^^zVTpѻaIޝߜַMTbfj#U$ $BrAz]۲ JY]=#c(2KN;"Jz͆> \H Xxa]U@=n Z*u;qpuԌ=tۢTX^w!;F |¦q2)`}-i! a`ާf}Ԕ[c\`Juf?lcfD#UȄ)qWG À~yq,fTLr >mB{&$费:{dWۻ۹ߚip{Op|c2e6@CEbl!Dƪ7k}1u0hn2]\X;GQOSY%(y,q?4|zMu:q}7nEa#cHSc5wrlꔒ3{&1ږ U5@e_=J 2r$"6yQXB xJ U- RH8㾃uPX rfV,"$+ <@ a*-xw @+hnk0]L]V:AC~q~1B Mt(Ӕ_^p'bd8DnK:r;U̸*oC%G. fٞ 1kDgo4x-J# `^)/ 7GA9O 6hYk. +J;{#`k&&A ۧ⣹C"xTrrccn1l2(,[ÈQp >|Fč1I L菰68ţ 7L9 Mb,`b Ϧn\Qa l;{㆏t "6\k^[&8)fXc@CsG?0i][i%0yN ySWI$1@a˟gKpny#Gՠ g(KөVU5V-lĭ'WcCwP;iO͋/Rw,է1a_6CwA(_ǂu&pF<4 RL+6}^-kLFcUFMeb:]Xl`/ S" ?cˎ$ cXd⎀B?5PIN^bTfi$}(NI+]>r|z[VܳhwowF]&mqt(ȟx}BR;^ٔ3+k>\lcǂ~GϳX7;m+7%!COshKeb1-$}Z6S|i&\;"cRfD!$P:tI I$I%o'Wq ""H$tiU$3_[EB0 ǴeçmQ-xctŃvOfW2/PˠMd/1q]Pv5-L)z1./~wT5s)ukgS:4'5[F,ocNc ׷*WI|c\Jƺ[?DF~u^dII}G销\~Dߞ_BʵAlӹAOkk{uc@L(myd=m<(Hh@(?fmHi fdv}&sL :0,bDKeSՂJpSE@_ZG1a췍1EG6{\\>[~.8*NAs5X=PJy$%FA[kƁ9UsNqhHP{_'AhE>\@s0À#VFOL/WսV tRt'w|Bg0 4_e9MzO̻v&ppio[~hW&"Q\ofӫJk?G-o ?SXrO)XzWfC dNKAOgk%~ "8CK.IL>9iea<&r&k}m@?4\d4Qz˱cQK* 7*rQ:h25:II1I$IJJI$|;1HmW $F&̂=ShC-ЧJ/ tR|DcMK*c\O`C 13 tL XEm9vπNKr>Ait?g׹}g*|1:WM XϤ@e}c&9 Tchpqs] _I0WN_S,YG;kGdrUFg" jVsKĵO.*Ufov98:Jf)Qclo-2yȱ֑PZlt#[b!HUge*.t^ӝFx+3iw\L7T.?dd$?IăEg*Gen6X 4;A ?֬pֱ)2ʠn,LNoe,?ջ ;p%p(}d7qP~]CvaCx>UUõ0m}mv lBGژڬ,~D?'_ƺQ?OݚyW{q {K(䱮#"[ ⧑g> v1s 8Lޚ?xĩ!)J"Fey' 2IU6H>\e ق7ϿG6ns?#䐝KiH'۸шzKy@yajGk4N)¯JU$%{0r*qռ9Q1{RΟ+ގ<~gSsgtuEƋ7|?yk6ƼKH AOзƧ?rmI$iJR-#SqJRI&%i )t$$ۂRR&I:I'I$ҒIHJRR$$*B&I")III$B&NIBPI$IJJRI$d $IJRI$$BI$I$I"9LI$I"$I$I)I$II&I$JI$I$TI$I%)$I$IJI$I$BI$'LI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'IJI$I$JI$I$I$I%)$I$IJI$I$%)$I$IJI$I$RI$I$I:I$I$I$$I$I)I$I$JRI$I$I$:dI$IJI$:JRI$S')RI$I$I$I%)$Zoŏ垴:=j隝?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'HI$dI5JI$I$JI$I%)$I$))I$I$JRI$I$I$I$$I$I)I$I$JRI$[8L A+Yp/RLDoRZehe}b j1LS+*ג an6^&`(NvuZT̒< *L`o _K$ƨ6}Zm$=b60B=\9?DW6lyABqv;,PFn@8PcuNǂTZJIբ@)iQ`4x$I$L IR!5k=VׁH:g䌻@14+ߺzkh~ D&ǡ \{+aWɵx@VK\;+s]k{|ʆq:9@PN "> Cs][f}*u܆>kk[PiZGцYC͆w\MM8w4:O Su>(5V8V֍}uiꬬ:OC?A H륃 lg)nmǟwފNS4)Agns4|cI$')$%k",ǭn[hRUd 3eH-=d3eH{wO%" qH&"ZN\- ,akTk nTI1tIBbPG #= JI)RER^AA[@_Hw lRI{h;nfdd hKw_M,eAOW];*U"]N"x@WpO/-,oIF !2ƸHV{MvZôVn'ez}mcvX;5ϹyKIK 2xpLGq`l}`Otjm6 #PCu pxȗpG 0lpm(]e\@)2 Z<QAҐ2x(XƱh& = KgtgZXC@ƏV!?UrK" ] 0rYh'Uc? cNP*s'ot:6-J>`_Xޥ{Ȱ~:A<<*H{Lp)D:?^.=#-"9Z;pJ[CZB+nKƩ9Z~+=K*jzmIpg: 7cx\GfLB<#pqS 5qTLm~a $W)$BePRH2?adcQ8:^;2en臸()D$^PFS\yD*UdX;*=50α~SoMhO`yu5kz&F&ǡTc1CUa2~Cckq~ >0a|ڹLg> ?A$IL 7E%s&QeV2^eQ2 '(H-X9 ITuf udt9XU[~cN\/ yVTR6!5%ihQU;\d-&[};&ޢ˛[ݺNe'W(i}d)Ym\pS=q<1f RѾ%?,;+n`x 65@ UݐJ0ufA;T+T6OM8Bu)$2eH=@Dnn< /)&(LNۆAR|w`wrGYvOb;D~uQ1γ Л{j ;ʷ^+SƐjA "AӅu8)^`oat]]ӽgV=X\XƗ0.۱jw/ց3[4&ȍPPUlit  X?rFAs>J bQ` G-{:'Ӵ},yD_4Ifƀב;h+ ±p_ XeH$bln(lVHN'9ā<KZHp-56J$`qlPJ\)"9I,LK2߲:!mZ̡k1Fδ٬}{DZɞk# Yex`pp~LƻX׏B_QᵺH?O\e?T={) j c$hWsj?)6VןL0yH{7G2![kCDQfSemwN!L i4 DVkgAš@"SQrPNIhRgh.<)FGtW3sGU_uu ӰZXU8/iYm <5*2ϖ ҅ Koa~kNLs2pe!Tx %Ar _vR 6տQ{XᓪbѺWktq{/Ὤwve`=@Z/\ݦD:OlFr#.l{i6mpG D꛳k yY{q4v O3cĂӤUq`.ݲuzV5쵿񉣊1džbRH.2@FHDA=27x Ɑ-0#[Y*-ToF˪m-gcʱq^:N(>?7iPy{%~m`i?9%ƪǷOSoU<f#v5>8Ϩ4bc+ָGМjiƝht:k4k#t{m}N-\|BzsÝ2 ,3BmlhFQ<g#":6o>LZ,Wv?,|V㙉q[2 qTBB>G>h~W$ @Kۗ?NISS8V ']#NC-9DHC&|2=IɎS琁<`Ql$K~O ϬiVK,限J=8ˌ'k_,PzLbPOq_s\1i7ǵ`?kPd1X%AReY)1!_ Ukel4TH8s9e[sttNŪ6 |Hcb,$jiyMEj~ 'oZhTRA, =9$T~`Q=jgѣŜJOc;䓷Fʲz ?Q=H&UJЀb9HS7;EIZ@hg2G=G37~ 9$H#?*";x@FI[9՟*M9i%_z$NJg/B*|JAIRI$iOܛHdXn1QJI$~OR_R_R)$PG"$J2TC% $J I(#4I2IKDI2II%)$LtRI$$$IRLI&I:PTI&I:I)I$dI$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I$$NI$$I$I)I$I$JRI$I$I$I$$II$I$I%)$I$IJI$I$)$I$I*I$I$RI$I$I$I%)$I2I$$I$I)I$tI%)$Q))I$I$HRI$I$I-?rZoŏ垵?TjoVjtN?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I $I$HI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'c9I%)$[F@{xpB[07v?/yp( '%cvmzLfp=ǀPIIu{C+U 5Y:bm-h֎%^۹ ΢VuNnd26%?FM" f>h}fexDP0&ָj JۋY5N?9P5ouN;=,VN2Xd%ǒdqUax~N*hkΥUq⬍k6z{ Խg1:($;/(I%Ӻ'*\J:s^-<NfASCjgQVFxe*(OR8Oc91A̍ UZ-p78J4 U655 8W7-zUw;,aߙu&kOTe"=fB1#;VN<'~kҲ)xS]'R ~mZOչ`/GpPjӭ&|ʱ:msQJ>R9pgn+pQM@K'ͳI JvѲf@>)"[m6ǹp BN[lI`ƷPNIhVhnd8ʳK4;0%L$XVw0a=:ù$f7s|HOó$qVUG>A$hI,{w4|AI/;I>'T@*@=#_YxP Bk#$N3A0xa NA3h·yǩ@%ZXZy9ȸc}}-ΖөLW+ڡ$JGN?z܏!$Vc 3blРM7sGRݐ'~6bv'00-Vz *iѾg-CZۃu>4M$HL/QR)mmb:+c9.^*5^ݰOk-8WX ng8hF *x"6Z"R$XǕfk J `vS^`]+9iW'EWn8&| |S#(O'UFcYckD_H2c[Eo 42^,=ԜцnȑXʝW>QH T6)Q6}WZ6:q"| @GdB҅a wK*^[˘ Sln>j^H7Tu[j;[X۸}'oMO5V q  {}54I!j8AĥZۈvHԫw`o PB=G-k{?}XՌDiޡҝW%qdj ڡG?FJwi c!,s`%Ois px1=W}iXͪ^Q?H;?MP4c,y']EuULxo/3pqa߂f?hfk}cO`ξI!+-|?j>T# xVOTE@B F-7mVXs!ˏcI)cj4б{wk4< >mHokt*N{Z#ĥy #S>1%%t8R7p.j}c!ˬV\vx(AIߩ6~: u4 mt RLHؖeڄ$hn$GSRI&&,;8EytC9W:/Jnps);/L ʓҎ&s*R86 7U!@AQH#'BTO sv1G UN IS$0i 4Iׅw,k;~@kUdI$.TH)]CuR)Yin`d˝-c|y컯&Jr7+m刈/ k&ϬWXEzԕa 1'пp5֒$;un1 wYXَPra+,kDO9:j/e_MO} i( Ct!Y}aCWz۲55AYY Ӆ$b *,UbznLǒ5I;!N jQZBɔ@j\=_)eq1YRi5N;H! ZЙE̱CLW>,b;HG$Յ/ahPVR]^NU[p]s࢝CP)ɗ6@Ϫw?a:bdKkʎ; uaioa\:?"k:)JAEn FC ]Cv`UHRAaF@[4dc4YUZF?R `:4H8+q?}0N㹎Ov8~߬.m[^ɲ Ьʆ0~^IJDmخ|?A'zʹS=<9;:ی9;͔ZjAQdՔV^nc[2_ujR]2X0=!5>!ڹ:][?At_QB,{0*m +wٌ7#%D.F{]B<_Q)&jX5l͝h}6v!K>Eʴc e*8t7?,bo*dP|e=#Z˞טWmG`%G)9Ʀ?ge]k[8y yzTf8mk@%܁'4n2b+UNF=5l6^lq#@4J`翂sZv:yЯ{k ,Wŧak;[MO`ꬉ$*LBbE7kMr[X h$+ Ȕ4D~A_Os_~4JA$D*ppV%Z%<t $HBI $Ir$ p0QiiV'IVLỔ$tqmuS0y6F%$|0≱LrpHQthT[c@Wb!cݙe^j!>QeS>5ok4*i`v5RJY"W\ 8<{֒cTʉ)cCm1iT+7_[wW[kmGjh?Sc!/vhbMpmq`)v3 th LաY^꾲4HPpyBnUdpD fkૄN-z*R)%f0uӢ=Yά[֟ 9EQOUGQ/JZ c&!Tޫ|d8Rf=o2XͪyFܐ8NBmV "'N  ^= *ho yٸ케cP{jnIӊ'_7?-ƌPm6`<>}y5Fyƹ;%bZONC]['w] C^cIr oI#C?enBcRٻosQdW݉ O Ρ` n:OgnrV?uK+7`^6;m Cpsp8di05wo?+al{;\&8FypnNaFqQ#s0\@Q ?Ue$<uXN2TfiIEE%+dtݰ=]]TDRYcatYX˛krf;Mdǀ&JkKPD#Dc&FL璡uF nMЦRc>L\ܳgHKQ`<| ` $M/ĸv\&JS$.F5hPһ. Et5dY8)ָ\y* СwVjN95tV6c7o3UI8.1"GRLՓn!{X`Tq/5'iS߶^_'}H \$\1 |U%n}YM 1)KDc#V\@spU+#~ xf #Y-&sh Ys8<~VѩC}m5iLԨgn"o4%4Pμnݣ}i)tv,9M#zK#ѯ,;56k"9fPfu l J\gS1uq?/>P&` d㽡ы$1 |?6Ogm2Rei;˄kTǷ vU]JNw H# H sTX< z" d!T3۸' !V6Iij$]lӺxEs G䱑 I@Wft0 Amrwzkwl+#˙MrpqnMGJ#Tm̨pMfmL ]?9pk[̠uLG踂`DyY;83qq;CF>MC#ғc ~b" '*-08UnsSuFGI= lgZh=W_e^0N:A{pCcj=X۷û(z;$xhl Y`{It wL0 D,9Z=VZʮmng*W5(\ ksp!T]$QIhR ԙ:dwYemZ"h yc T6wK)zY2CHֶYcw*6v q}.<*J/X͠{Bs(~8<*i-=-L7c\|:bte?a `]k@uӬn)f x%IơYhl*"+~~'Ď h>2~ %8 4qV[݃mIG]-,sI'XVw9>\|/$jbV9Y }Qa*vwZS\c)Zfn:I+6ྺ~܃?g'dv'd$I#{,z/JӪP$=E%'tjzIe AdAdW/iO}W_&6h(.BlȠn#;ܥzƣC(-|f9kLݧUSK*n~;Ǝi/"R)9e( YCZy<"7A4C*ē{8:>55* q*P5" O~IʒI:^Zx<cHN5M^)uF)3.3 t %$Zd|K=~i yWuﲯL"Pmw|Lln斦5DL[mY[^ U@ X$[YId'Υ5z1SU8 kpk줓[g̎sIA(kdۆS@e^O7Rt.`wSYkj~Aj/5XuY1neПjV*ls\[pn˧  X/="BqzLYjF& ϨK_,"tA>#Hf0Alent? v fp]s2VzRׂYkhI&8,nX3F\?T?+MhhCł^Grplk^6k7)b[IPN7MN"DN%1hv9M )2Xv|[v|wRIDA '&4w@K JdUd)d])LL *\\6aǂ>N][}]vB xtlY6I|"X1kqE ?/̭o?F'E GRL`蒆:͠I1VKȯ@Ώ}^6~_Uf5\L-]'ԝs)Qq Yp?2I SeYFcVif=/{ݡ{D{f;C[UR#&21T$piSKy"2qf\ncgITY]nXx1?FSϑOo^ʢbqo k0K].?F2nji c˔t/lh!U>DCvm>X0)=\G0bTHjL ‹-{wjnP2àv欥Vv%oL'}Vc՛'E *5}whJ? i-A튾OH57&2zsxld:;YW"c (Q17&]'bB^ȃjí$)א#yBZ Oi2Փ:*{ĄLYe8 DV@D ӻh4Qo:',Jv~ c]n:7',u_D~b-1bU732'f28GFc/S-r ȥf<>t'dnul).$H6ՂTI#d<ǾH442Nxf,LCy{woahAEc]MTߪxXd@IHPw 2LqGsٿri5 .2EgI1ӮW':wnmn=gog74-X~_S`kڑ\qqF鈓pˋJ"vv]85p(5 -eRT鬴Iժk#4Gd?ϻtBJv3^4'SclkK˿3($YVR)&5*8ektVI}V?lY;tB n&Zٶfh?җA}2{=>OXC밷{^b9MVe_%ks+RI %svZvԘ륯A}Qyb6cY#, h*GW(tv 0!!oi37cLLI'q dmbDR9*4J)$^N@TZ$I' 'I*I$1,-h|gQfF+-3!bLjPɅ ̱D8+94Ӑ@q<ZJW*jy>g-cekE:D5sdYASgE/;dI)?V_fks{v?55-ֆ½ek惡PVU赧V5o :oXr PmkdJ\ 'Q68>#EP$I9OX$H'N=4O{ehޠWz MD _*E5\aG\r\m;AMjcr"H:>yks FV e\?T#3~FьxDSh,Ze%kׁBv=\Ӵ\S9hQWnJCmvFa CO%elb,{\FUlZmq\ O~u!PQۋa_pP\Z+Ԫc[cu'On{v% Վ5yY59 CՏ[w SU>?ngc!Yaد!"%&LkʘQZvisX@-q +247Y:()B H&tJWTwx76 "hgCl йHHTmnȂ: ߚL|֖& Bu ZNf@hndB^k:%cu!!㶇[A8(UY{}-hM@GIxzl KntNw1nRѧȣkc*1ú,ugGkV#h8=%X4>j&G(·x*Us@);KgU,, }]fc#cIhN҇HljgSোDjNGׂ_QLٖx#CMX:S)1 v¾6HxSq&Ķk$NC]3؃r[A`cוSK+zOMv=/Cϱxt?k6MM~nh150YK_}^nbTX˄t;e0py*i#ez9 t>:c5kgSςT^B]B\&%bK67EF:g87PKlml'fI9OeI>E:c o=ߓ?YMg捳.|#jf8xat  EkP&6ʷaɓ6>-$f3T1e\]8HNP&i;^K:{ߒSF'l#4JzeIrZ~a̰XZ@U^]k'?Sn5dG TJ !RF:M!P"D*eZ9ً-Љ n#B:Rg#"ž1VEx{Lt﬌}'=OJ, ;N8ԩV#X=k#7eo')sb᢯־춰#OP[K\pLnj~pUu͆ܝk]N+:Nr5o!* <+`"&D#Ckq4Sa!\f002aRO H2J %(4 dGn⵲4OR.$!χtɐ"o_)̳ [\?subwC ֳRF2Bx` I6R=Gx*uni Tǵ;N'1lYS=SpZX6qlQkdܥNS Mqu!?Dvo]Ȃ ki5{mk4X=݊(W(!T˨Uk 伒$A{SՈFV ?Slw=66>[mk]m!5a]`P{OY#cAvug::xTƤGl'F~ٿVs]SZ75G?#e}a9ίh軥{-kL]QX"tJeF$C/V6ϥӬ=]>)>*#ZZ+>ϤmaHZq!ⷐ7k6>蝋?7Ƹxoo`3Z@CGЦN5$K]QXs[/UΪA/}`Gf?=cQsx{yo&YZ=mDG Ҕhk?@j ͟5l.~% AeYqmbO[Oٺ{ѴOoa^jh\Dn>jEGѻcG0K 71 "A~8?zkﰀN@h6vQhw'a>qe8r ~Ue9GkÂ6vۣd8BIT<gܥcA{tNC|8fB$n.F-KgwnU7JeEZthg!t[KEMXLH7ĝm %ǹA ǀ%Qye 9=Z7f@]#lZQW7Y' _cHpǯ @ `q?EX5ک9q*7fX :B=8cllHUkk wPמ;,Ɯ:SRtL[vLb8AI J!E cH44@:*RI:Sr]/+4JUQsDEX|MPr~H*;{ftx-&F෨7"5l#?b0yB/Yp( ovlG]~_E'Mora!˚I+aٗy5LJ8HW_vѽۻLmUz}XM\ݷ lҬ4疑#(3T3㌿K6͕H#rf1En;*6=P9%My@Ac .Y!^Z!A7(ǭJqJ)Mf'ۢRl3 @ScAD>83EsCF FJ)par=# d(k.57sIy[Z=ƚ&`'6 C9>i-e2 Drj"]x#OYYT#8*h[K!%B߳NӶ w۸Actq~^s_s=W[uW+#-0aG*}S3emrDiR,8̉adOHQNKt<Ոree )qLxBlJcy Zs"5h#nf^Wz5Iso5̜ɥ`KWѭG)oOR3n|Pkf;*/ml>%Vu];}j#*V:{[@Ϳ#VSZ؟5NZ97^Co^Q-1{ͨRxEA)TӨEa SܭhQ~w&  99 *al> ̠cL;'ڛqJw\}CyaWeZso8UxUpіP5G,Hᑗ '-! %#Q⁙NǂɄlbflwOb7MDO()F*~IBvwC)sugyUVIH?Kt OCm[\\(c06 yUx.͕j59UɍaCSLnS*vLr`I qʄ“|?R~;G}a.Hhc{N7tJ8tJXeE0%8hO:5X3*m2*-t"J]ȄVQK1֓JJR҄>(iq nf¿fmT m{I#akԚƩ$KJdxW2L|D述oR}Mqw\LY3,yV4-WܐXcxd?WxnG,n/簞[s|4K)iodV/g7*u<5uOǯQ?K!.n5ikibSs3[Oxn#ېc2S>L1>z=5o`5d7.`x Z݁\\e@qxRf;@DuSg:[o+DWYhT:wyBN{+&&#NXJPԥ)sL*b\ dkiOXA}WKu'?5[Xx`Z'tOQ-:o oJ"G؆(%|fBE#]v5od61=w?Pɶ.m=GMe?6L+=WV!Ƥ̟ٹsSG#_"Dc3𤋮{؟0]@R; {lwVil; +C1kNM\`DR$lG {ݵ|0:I$=tLH+uWs?D :hre6qɨrʈ\ 1 &*s BuK%OUbk;f 4{ { kK*YGۇw6xk)$(k(q2􉷴iE2k :X{XbYAi?Эޥ]n$*gK Cq FbU©c1bk~U{T?#Ֆہ GCV mH?(N@;#nd!LlȈ$EBY=`$<&i٧e 'N`:Qh!)P;'U B.<9\v3Py!P&yGVZò@>5~V.Wh| l8!mu?b .1*Ipc?n&y>э?JX(>G]5\9ء՗[ Y[65qYb[KAssX Д.Cb}&jo2B@51UUӬ6Α++e418pwVq@ 9l{" `I6f/tV䳙aVe^<$QR3E(OCz vi['Q_DGdptp ꫴB3&.Krv8cNJK77"bON(bcoF1q%i4TH>8qSƉdn侸?Fkd31KկQ{C3!ou\y3ŭW7Nd n+{ }OU JHUh>bk4VghcRUߘ7_sUWa7K]WrPkkT#-ss$J0325 ,!xJRMvHA *yГ*hL=S$`^RL%kMW%iꪓ%,RbxH#ko(-Ρ~ӵEo]Yv\;]{ Zy]Nv@T'Ї6FhٜS4zr{l:O[sAxPe fk"$LW}vɆ5meN1nuM;8SGZ {q"m߉+jkuGs i96e"yPI*EV8M$I<$*RI&Vfkp$Ar'Jo%$x?EEFYԚAdQRPcs?wAsK`|Ud<&إ G~&T_=$B}7kOd>mȊ7gR$U-uWdpaݸ!eٖA]ZŦɽ``!9n)'c" @.0fMhjxC7J};dmsZOf%=]JX^ˇ.Q{Vh%*cukOczO6T=c/kp'HLw;{XC)U- 3 8 [ Vjߑ;1l@\Xn3eύj27Qe&U6 [?Y`o?)5zdީ0Sk[h1>(^6Z LjGJ28m\5nzs &}۫'܊ _%)Pl8ALI nDdcJ'C@jmC Ws->FMBSO@DHSk9 4ͽ54"~(Nd+:v1ς1hwMZ᫉7nPꏽEiܫ̡s2ǟw]'^D(z}{϶ѐd`.?jح٩:"6M-Z,˶q[^̛ P]4ųgK]kRέIgc Qe~xd"PZ8T1}{KrFU|1gniqoD*%s$Jղs}!&"U4\:bu0Wĩ ĤJijI$nब5 mBx(5H[da7khպCEDiF_ˊzyd<N˚@<n9K;uZ{]Xt },+:72/D_M, h3r@}RRMc \f;ڤ%=U¾DtntΟ ϒ65fuFS듎AaNndTdaqN"d+ǒ@‡ U郱V\41gn0;6?A˃!@RLY*va Q$AWzg1Z/S#@H@ҁ[+qN [Yf׏lr4GXqpVMu.}sX}tHhle?BaA9<Huped<5?6,o67O >7h})C+z5##Ss^?ekP!F %*O3d=_ka9Ŭ_J8;$y@8v@t?vczZ >Rũ\!M2.8D:SuUnl]`.<~S 3@'~+Jj}B=8<$L&(ɰUXje[YMkH $H2 %꺋$P쀣p pB鲰 ZĈ,muh|!`̮1۫dOIF#B'!zppAUk.=@VV=x /yj0<Ѭ=3CMCH%Oqi~j=|?'0R-kuR:P{|aYC.Z|ZDH=GGd5%g5UeM,*ЋU‗$OG937@+9:"=HpA\Xtbh+]ͷ*hdYA[OĹǹM tU= 6rpmxoոЅ`뛐/lG"dXmtL';U\:}m7$#DZ! "77xk|cD[~y-K*n=ǁs16qc>?DP64kRQ!ro*%fhu,sE`*/Mes+ja`W:~CO> gUM^Clean;kCسGM3Z;yC>V`%1>h,kmqxVu\cB3ez8Ī+ҫdpתu H`I0PM[5yd _0DNt7$nO# "y%=OF1h ʵv)6;EnXP=Rq\p\JtBٻU4\v4QZ:H%Bq!3':kmNhQŻ2 {A$mG(F{Ռk*-[lhA_B^Xcx1"qKp5=~ _]5@IQY`klh,2*5\wW7sSiWHpc-%,XdSqneGCB3Lm!i5wf\\> 뽮iCm-n+:8P-!HO}E?i6Wd Vn&FӑA?u\mlv6*¡"oA+|c,?01,Y6O`en}ӧ#^A5ٴp]QGGROq k<l(\n&K r'hzA([rf]nxT8+Adpb_c#G8O)1m–F ;m'cp³kDgW2ɼFNf {,۸U|X$56VpoW:[c}1+#&Pl^= {?6K_aN[~܃ I1h=dOq7s+#`wQ3e2~!l7ћqew>љHˈHѯB,qh)*VB8 'ة+jV;-nxջ__d?%-EI~:q??HhHߤGwP +c?|cUs1>~∌t1#)>TTE{+HtIǒDÔO4\ uR$RP_=ֆOAm8{['5*FUijV6AeX;Yix7?pI7xb1#)!fQs=襖744x5~+]d4Io93kCgi'镟{9J(0 04XC!6\xO,YgS xqGkU_9ڹ{TM| `Q&\BYmL)h^w:e{ז^l", re |P]?z/l2L:J&K1#JfS[o3iq4}@=rlz GvbS׈kA>YVn?e@*5_{Z7OAfd;%R}8vӱF&<Ek@|1:ffWKJ`u u&0I{ v} Atc+pYx|&k :00@FXT+4:Ϊ ӄxDQ<_֒=ęD)2hN-~v R;['7jxLTv-)JMw2Pn{k•ԻrҠǖ89O}Ͻ Sq'0I8AI 8E]tWIM: ƺ%"I1 f$S9h dRL^6r ITBpDitW_od{_WV dRTXAN[K(BpY.nuZ}_WEbچ`A3!ՋZiב0Q\WZJ'Hgx G~YlKqsXvuBKÎ]fݤ0gЂ4!tofǜ.h$5G;\?*ܸ n֩ f.uiruϼ1\IKru,@ك!wEuPP,Уu{(Ҭ[ApG}IܮLPؐ᪁km6>G sSsd?1*U#AzYev2χ,FpiΧiРZnke8PA,pYu]1-n?ws=>v 95k[]_v<4d@>Rulɰ 5oՐXANduo8i--u@$LaK ||i0,*iAPZN3l O_n> LwjktUVψU3.38c!}f]ȓBCm %)3Q844Wjۯ%=8w`Jtc UF8o/O •#M@'PhG :-&g5ѯ G(KIqzl{mCG BVly2K+5b<>1RD8HILD4->tx4~sm01҂9r1}M#`Ƹ8f&p"`|p+[ٯ:R0TDx,ogIOXy;#V"˜L$bw9IN+ $IԒI$I$$I$I)I$I$JRI$$IJI$I$JI$I$I$2JRI$I$I$IRI$$ RI$d$$II$I$IJI$$I)I$II&I$RI$'I%)$LI$$IBd$$II$I$I%)$I$IJI$I$RI$'I%)$Lt)I$I$IJI$L$I2I$I$:I)I$dI I$I$RI$I$I$I%)$I$IJI$I$RI$N%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I:dRI$I$$I:dRI$I%)$I$I I$I$JI$&I%)$NI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I&I$RI$I$I$I%)$Zoŏ垴:=j隝?d,?d+XS0vo 7I*I$I)I$I$)RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IBJRI$Hwe-?q|,>9ڤ)Oabɚc)2Rq<.va\{[ocG3]P*`li}7'AK0}?]"SBPzN  qw+Amo!b4hRZ;1Vdg?Q2( $[[cEx0lvC8-sK(Ӊ' <$ҫl!#rUq@(Am $ve !7mm4+X؏\La:_E.Qs/kX`k{}A a Ka !@Bt a ֒Gd{y p0ugqO,c`Iݰ~5 g[g*DOe~|0k|)s9ys ۝,sV9pS½ h &?yvSL)ۋuhSM >d HTes#"D?~j65C8>A0nF; 槏p]%w{mO`a1<-?NR,-2[_:EaRPkZ X RH3]"E2K1q2 {H.j8bCۦ6şwnjM4ӶycQ<1:HteNxk'[]lhis7NGosGcnY?lF~2\H(Ƥ䝕 ykS'pѱJdq~eLDx}LPe:m0<5(M/*['IHs[<\ee c[ %hG]KvvԪX>W x[44B52MYF"['J@pE5U 4囮u #DyYWmObzMR!vݣK80VfSf{ϻ H:~c ,UlL2W\T){ѣCkV5MƥAs8IsF[](We=Fu-AVө#r2%#)dž=/tߖU;#ܦ.=?вn ݫAU2ۘ gd]gXس%IJ9uOt;sŤ6 `Y.ztrݚ+C⚗) -'M g{84VjО*-IL(O:Ӵ&xxJ$Su5{VǠX+o$S8"vr ͎Q6iH눔[lT='[<}_sceludiBі7Ů#dVa!ѩIM>D]8=5CXkDY8U7XA! {j4YR$fkqLuLhLրtN𒔜&L6.5>][6Q;2<}ʖe0$69?O\v<ρTc)etr'[ƈ԰X-l·]u:ʜe`Oɖ }@@hDŽUZr㑕p/ )G)u7Y>VW{(f-uYG,WJXyr)N"CT㙁wHcGLk峫ciZF3~XeWD/dfȕLQj2,@8_Sa.i%xa')Vz rl*^Ƶ7~t~aI2$lXA`%IKS? Wn-7ƼD?AV0qUͩhrx&D Pe[1 uBm.c>m?!oKkg?ѳe9iwo7Ս'Ff"$@ٳLNW‚ZJa sJC ԮX|; Dc)}[38B%f 29DOMHELeK+tMґlN3jv$tTJ#cYKjP^nM;\ ; !+ʍa<_Phub9p{ w4գ^ u73oҎrmi: [ܡB=QĄcO2lh{\!ږ聎 fG<"ƑL[[ g,-;xI9 }M*D%GcDăRSR8o-0 [RAX鈞U۽T o58! `$[Y}*񋆎kf|O:k^áS{ڟwރe8%łK] [ǵS&&W!(+*ruu)gk퍊ļ'j_a`ʏK--8V僚}; 3Рpڞ䩣~ pWyyEVNH=s :JM԰{xh?`Dxw'80ILiiC}{y)XTZBMBGǞ>:&z~_4H )N'YQ@)qM--ycO*Xk;5opC N=|,Q uIjf-8 nT_LkM;=XE6KLޟ5FF:Hԛx\өXa&HH̲=! fӡ?4a@=\{ l bdh41vf<ө W ՎU̸h+ٍgm`[?ز%ht{q-7qUBZX]CO "̩X{cW<|X`<Yئlÿ{ؐˮ]s{9Ra ŽQoX/ys2/ݏ鮨~Z+#t[8pkm!,ZKI<$<X bYS[al?ICMk#PT>v}m'kI?5>WS}yAvG0C ?Irb"ӱ<{Gp҈]xVÛ!?zˬpPnΉsnr/a1>Iy5Hʋ>e: 1 IyTbdõDӷ MB` U/$qxE>$H,L !DUN)2Guqi <"z#k~Tk!fTR1)F)V [w# zpy0᳏$,-g:qB\ |dSnHpQNJ ٜx.ypعwIoGXIFMÇH$"$hmm[n+2I'$u{BcC G)q,K.$vP0nihP/%z(L3`D~\O)I '2Qz0/Lj/#hsD]S3}'4k+rtXwxXwNak]c.e4JWӞ9BI7x(ʪsK8*ˌ(uAT樓F]Mm~;}B6YXcNM`HEY| B̏^8OhUaL- p'E`5A]"wA&JM%@7wک*k[Џ߆?C,rգ+ }Y5^uvoӄ3(u 33Npu~otYs+l; Ci2ҫ Zm|S"$eEdJQ?(AA7(W7l~S҄&RS%*;Ujʩ̼*!>Hi}.?k$m59#2lL<˷Զ:44zhc`v講1mTa+s cYkw'^cʴIh:V MN Bg;1} pc*S@~!HTSVsM>=i1F"mc'~}W%;׹[~>,3R6W[֧S{Cd <<[08M.>g*0O.<*ha[8KO jkτLJq~}IgIR8?y(`a⬗&'ęLiOdGcDmNN?gp- ,{M'ap-,zk'D-:pS㎴>zGp o{]&:l۵x42L\NHwiITy”6N+J*tǒinD2}?$<%0t 4 R  <Jy[4PfJ'z!jUnΩpꍘlsILtY`nW~k1=|W ݺ=^#OS,{z '~VvT̖!] vPg7 LDn˰V +=F鸲- )}p)!b`/(H "$KcWmMXrv=t?cc{A2{S/gqL ) v6A]nkKv) jabXϰ1R9V {]Sy ,y0Oe2VRw;$' 8A3FNU׆7`&&,L _2PwDS!BkCp|SLkdұ3mY Pk 'm!ClDfz-#?k i;>-Y)Syv>I夸?3hX h,k ;.m恀4J?d"o+ xx5yW, [i?r,-<[8x~?E;9 ioxT<n7heYUtU.i{HB16 aiV^EYs"64L H%0~7.#Uf9LxɃ$HpjIF#~*JOɪe=KL)?uKY(G%I3VحUd%GpN"Ci)$2$dhBMiq$RT)IY2Uǐ&I?PsAi2V ,T#?GW!#&HkDjָA^$@Qų)*ӵ܅jVKƝg;RLDț"@RuQ RE<(fxENk ˥E$(/k7a2amT!-J&;q{fh$d'YvMvXNJxHD\μH݄YYVG`#-{Z@<ղ&$GH@;TQ,2S#v0:ebW? i5Zb}g "]`:ik}FJUxJa?9K3 Pw LTֱh7~NY߽y+qu?m0Fn4I[,vkۖ)6>ک<$P+,1[Q1+"K`7s.;^[5n\}mgn}; FǫT>QGYddGNTZ m%QpdzAR!Ey(9N!l𜵲Qw~['5Wel'ZgQ51)os]P]llpC/Zg9 %EZoOyh:˿D~%4mB8n?M+ԇ5ttzSKE~{xJ#*4H1X"vUt7c5#}V1@;Q͏ŨF8 '*wG:th j.C:}+<9ڲB8$!['1mh-%O sN#*-9֐KU0F-łv *Nī1c*g812ծ/_32>x~A sn|[`ZȯXRcS׈k]vF9l#L D8Z7}Z#03G"?xUوZ-cb;Hzf{ZOceu.Ь#Ӎ:1R[鵮cb &bUÓc(qq |knVoGW!ud=ܴ} ]X A0k!a7>CyH+u6F>!DHPh4H#U ȃk̒Wofsm1nvNqh$(K>*h,ҧWy~J`@&Oc6`r'ڜyf)hF^q D QgNOwܩzxX!&jhw(46{#(Spv@)8q\xr8*D Qnq j{Ob@1kN7~ n|e!Kr=]x##eAյ}M-pM8Q{~0SZ|AAMiC8GÑXi!*=槴=-?nLݲ5'c]@Os|_fQe9{_믎2|' 8\T Z|Z~\\Hx4NHfnTˈj\ xeZߩCZO(72G<ꤰ5w/YaF0 01lG,'2Ln0xAI$I$$I)tI:I$TI$R*RI$I$I$I$$I$H)I$I$*RI$I$I$I$$I&NJRI$$IJI$L$I2PI)I$I$JRI$I!I$I$JRI$$RI$I$I$I%)$I$IJI$I$RI$I$I$$RI$'H$I'I%)$LI$$I&N%)$I$IJI$L$I2I$I$I$$I$I)I$I$JRI$$$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$t$TI'I$RI$I$I$I%)$I$IJI$I$RI$$JRI$I$I$I$$KC:\և[ucgO3S?d,?d+XS0vo 7I*ˤI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I% ?Վ~j~oرbJ#(FruI Je!ѡbbPƮKFS@ |(w{bE T|W9ӬHN CjI$mO Z%R5ztc)I+p[}\`rUZ]Ka63..ʒI%S"d8Ko6^:p?4w>*u6eC,rdO<8*A;k.#!VlƟAe3@ITOHveq5=z, s$|zr+Oft AnNi~U]fCgƦ@Q]wZ"HOʦ7RƉ5.<S >]S5aF3\kqόZ^]@k̓q8j o?Wj]1 B C)ֿ6 `qx, ]P.asGba(;<H)=ÅL㜛[PR&(CuPMP:V0գP:9ŠZ].[*1$+$7ݚJ.C)U?diUuM,Tr~/:!•UkMv8k K~k&4=dsg:> VEtUM[ŷiB98_00eumqqDCJhGeN 3 HF_("Tm$o)S^< u PNѻ$Sp.O@B{LDn^NyL3H]u(g<; TeT> X)b^pAM-7BڽX!'չ« $Cv5HYHJ67sKxT_KU -0iy\{r>0lp=rc9=2l~C[U˳)?8Hn\ߣhM:Qɒ=hgSjm"i5LpA"ƺI9FfW굤BM66VCkwhp)&`qʈf19'o&.v} NnBI+/{*4#R3/nE<"6\>W Hx,4r\֞ZXݮ<%f (wi1*p<i j4).PBSm(}8qIRsCiKth9@V=毜躶mgVg{F#5pө#zjt'smˀ!׎[`{d+~p[WԟaŇ`~MqQd8uf>Ǣpu%euI7qn:_qnl1V?Vb{ZcO? ..#סjx{0G[1B#Oxu-k:ʭjTF>sZLI#P; ?b2ÍL&ʖF6=l]B9a!CIdyL&k_NgVYc9Hi$I:04 :I+]6\cl`I +/ f\e:>G|1x$h r-rtUR[}cοG 1r&ҦU1m{ߩ9V{v@#kL6.3mM x(65O!=ewN-FAzb熝MmA S:;kK'[[wTCuSyVsmf081RD'c~Ȃ.3#u,x/yÄy4N=G>|5FuX,fm>`4A]m!O{%&?03l ڣ6Y?E.}#Rn)}aŽ unwI/$oI` p fz#5+a!EsȦL Z[ fV8r1ߌNO  $,AQ?ź2Gy qQcĄhK^IS:ͬLqۊCPʀ$f+o2T Lո9_SuHYɥȂE9DZ PY880)NIJ66'+LxAٌL@:v1IhT,%2S`rRxWee,Q!hcOAyy049.?vFPoـ'CUni ngyFmxA%U5_J<FoEfx5K%k˛ ABOk@J{7@T}0䵮n)5obF۴fԧ jFr<_,gRa-&Remg^H_s"TҚO?#3dKyeӧuf81mI>o=ߧ҉ĸMzl1FQ{[K`z}UkAXh=%O7SVr!.>&"D MQ9UJl<= Z.dnV+nhƒpCFJdM!WRJRM%IO ,+܊IaJ*8/)JI#?Hzۨh`טHO'QLrRRJI$9b$ɦP hP kEE9*lcx8.ZT=ޥz}Tws^5vH* ɦzC.8% &IPx56Z- ]bt`Hjվ2Oڲ[G feA>l֏e^v Gbw9139|c&tI !%Z^Jqcp PsJ2RI$a?֯wV6ƈ=Ę@ȰKIIJA;Lf0CD#ٗUzjUL?g)[ZL+(I$!5PEqA@|VRIQI%U/vdZpNWBI*Poxʴ=xo i0=9SdGB$:m4XZeOCh')Jا(phJeFii`}Sw7Pr(Rqݓ  s;J6 Š@)(D2.e& <&!FwsD))dR}q‚ BY$h[ p@>V4 ` uIdHF{ugiy5*t Cx}B?8>)}s˅ 1)p#`lKrq RΑv nV3BKb$GjP4s1Ոu,8ǚ٫E:~U?ۇ@ck5;-wgcWfkTFև+?}FSck M/_LM 8 ƨtzpXCIj.zLx IjW0﫶ZYvcX"(%{KeZ,;7ջ3ssp{ 8pY;6A&6kS`clpp{S r-gZ<;RLKiJ@pO: ln&`Gӯ?!pmBNۿ7r~=m9Tkoɚ^.?T}kDw5&22"n# 4zM%\{$1ĉ=V]$KPW% ~Հa~t33%:@2OS/uh{hh3o塒|"/N,|fR5rӲѡQ}?5 &9:<?so};l4JLemŵTi|~Ȁu? &>5y;a06nh: ~H/& ]DX]0 '*Pn\C@JXH`JT sH:A.Vd=1d FO%"Nx#coNPYm{>.C;H;yDZR0P\ s@H67l(XQ3z鵻yebg kQ xezUU,p7F^W[b2&92Z1Yw [!2ױ6w8*HUhKOpJc+̬A0m.oV]4NVMQF{+Oњ#he)Zcd~a ORjts~"xoJ, o#)?O5ZoKp[䀎ܛ"8j+sj%|OЌT0x?GU![d4J }D|[_i1AhV`#[4f'S^pL)K"\c]O'wG=]NKbs?2Oƭ=QF8I%MWI_sU3w]Sm<>t!Q,r1$#A~NDǐ#Bc+a$TqR~̍X5au{HeZN5I)7ہ/r^Hu:-a:(2"ʉ9 <"@$i&|19ogl*$A][Mppd'UG+2,TZ`G)(iL$$I$2I)I$t$I$I$$I$I)I$I$HRI$$RI$I$I$IJI$$I)I$I$JRI$$BI$I$I2I$$I$I)I$I$JRI$I$I$I$$I'L%)$I2t)I$I$JRI$$RI$'LI$:I)I$dI%)$I2t)I$I$HRI$I$I$I$$I'L$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$)I$dIJI$I8I%)$I2tRI$')RI$I$I$I%)$NI$$I$I)I$I$JRI$I$I$I$$II$I$I$)$I$IJI$[ucg?rZp57+5:f_?d,?d+XS0vo 7I*ˤI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$[~E< ^'rAw9)pr%P(Jum;Z *mz4B#O)kPplt]$JRkR>_`}9XϬ#M@)V13I$#41 klSkjnۏζgǞe$"*׊I%mpkZ "dK*vu΢ D\okT RI$v8Ƀ->Dx srEk9O i8JQ#ԫC0ǻX^7?Eg1ّ&tdضK- {]3uAaJ<;;a/X>(hnw(;$JF0Xi%XFPLBNֆJ%5?!% =ΌO0':*/x` ` J:EP` #"t*Vol{x\ ƏrsENJ<7=5]Tp |To~wpC`hUֱY]n&DYحO6uw\``I@2 <:-uQpVq='iZW:k1pk_dnKyZхXs6(4I% Gy[1*1m $sQ :<{::}-?fśEt0'WOmwח#5-akski%݉G+F|;2lf{U˩'}UߌPyQMg۔8h0>ڡ(\e\)T);7ݱ@ ”(Q`r4*hqEs 3!ikLJN8..۸8AWr:.nNG9?ˌc"}_5\` d_5Q9<X1 {N~43Ulʶ3[MK)cIϯRVYUHgf;ۇtlyusui9/`a7&a8 6[sX?P$n-Z ;'uWk+nUlA|xĶ`.L41~RJ/EzGd#Ӌ̹ğq9%I䪵הHC0\L&T`rS+ 9Pm3ʌHSsłO\  eikq44ʕVݖM<+@x'2aaig 1m^#1Yݱ3)@٩nmyy'^T^P^||?}ȹyߤN˙i@TP_KG.Ud̓Y[ͦ]~,p+r12K0k$?T=.xDU'INRI$[M̰Ć:"fKm|Q3!գ]{)E)`4zK4 (LrycT͕S3ayv} B$(2Bv@ %I-0S{ҧI[P\*Fxr HPOL*!t#X$4pxfĭ.kΨ5/W%[:0"=Jֽ$5$P3 *VkөcfIKPe-+ٸkD%pe!?3{' NBK2#Qo||j2ab4+uG$yv矀?Ǐ\tiˊ'PGnT}xj;p󧊕/TkD!8/F~S!lduJX%ꔃK9Z-fDSvC|IcY?Fa5Lh?ݟu3:UUe)m1'̨ˇQPߝ #ĘZ5㲶kDߺڭ:sZV55.UXp{"eܲoXXF8:zz.0@7M!:Z%P4 ne[fvqZx,Vr3n;*-.}5!òp HV#i4g ꁰۄ:-yp:u@suIڂu]_U~ NC}c5T~2XdL8x%,\D'ê kҭsj<@NH]G<*ΖJ6TG:gSx0Ua`v@>k.繮ߊVa`|ϽK ukχz3(UWl4Tdȟh߽M{eLDN[c(MRj_'z0KgdIzWR6ԔO$'6SǶt5?bw{W~V?\nFRLإ/D vׁa]*~ c} '1o~Xh%Ǵ-Ke /XѴ@ɂi[Li˿o&@Ȟ. &U>.`A?2H߷VZpu7T߫'U/k4~jT.ݺ\|X}1ĥCuNK|#ז~#O7hp;mk7@hBu.q$ SrmpQLa-1+GU9l2&~>5(oƐZvtP1GuNd`%0"OlL>y4?s%3=d4 \] ]p#_&t~;Es ht >v:˰)ncx%4J r-;` ֥Χ*bӷ?Z;c.nVCOW|Nr ' mT{< (I%6GqJ'5F#X^\Uf\8 &(e ݶ?wvun-wcWRΪ'?6#79,w#k{ό~܌"G#:ܓOۄĚ:[s#h9>~?G-Ƽ-[\8qhk\uWEBKG0JbW3'7*d~)\1 JgOoW{U=[6>*Hѓ q3 (O%>)*O%W-}>+Z04zPT{)$@ǡ +q|4$| $>i1Do?ˆFy.bbc9zx8ԑ0 UO!hIAה‹y D@d%0N IÃS¡Yh0|;4|Q 8\UcG8E#, >QऒI 4R ^]ևV1oCh]Y$@qLEYGhJJ% 6\ ۨSDnX$v I%i%VSd°[` lTa()I% B۴舡ik^QgCxꁟg8g9>)YmdN_s2.w?Rȝ5PvVZ*Op!oݒ,y'9E F5\gאٲYd,G$Y5驖\ @m\ mb )7kXog0cⴉ?GV1#I&I\J;@@_jˌK@ Q]&Z)JdaT%_Lf xV+i g:$BxRI_$FZY?jY Y|fhPىBbIb5>GĻgդ@G@=N2Q j_I$J N3!Z= j<eќ>B=TI+mh`8X:[cϑ$:, I(c6ԭ7'_ VKC0D|2I%JL3@;^cZ >|f,2lGR9qPI$UO[`x(u}2c-?MV2/k*!͎2Kg8dO#rj6bGdz@=6fݭ^ْ^e2߳Z7J6ușf*qجWB [Td |Ux:'K0 b8LL=v'gQ8y &ghT x%\qI*.:5Oe˫gvF?,nů{R\EĻ7g@:$Upd(G6Ѷ<}Z);cDiNaf؀)29Cc&b'k8')M3F{=;4-"tU3ADS%,Q ѱ(y0Ε_L '@8B1NS7#mj1gq;IOXkLǚ% 4'vCS)$`E+&)+ŧ6@Vo^mnivJfCuWd%fZNQ(Ў]Xē<+]=xpEgrkp&8R)´c(4&WCԵ%1\G-ctޣe-swT}(:!8sʲõ)lSv )5] ը7$zu%[B(bg[rDc.;}H `}W5콻]Q(`C;򥸁 CxREbSJiN.->Sh8/?ڪF#(0$}+ \g"v8 QMgHYMRP K?uh湻ŸW`k%= R[@\||c8 |fg%Ey8Xi[5GU~M{&U\u9k$V_u$H qHxyyo ?6`Zb)֞v65ޥN X}CԼ`\n64.<{w i!aRd):"LfC2BJ /ӖHM>ZG%ˉUjs,m~HQ09ַj, fH 3kT"ۜj|Qݐ5 ?U@-vZI$p޳UjYKYwEHXctB}W'xÚ9گ,-WLYP/ъ2=I+N/{53vb4qrk0鍌qœPݒI-S +8ƺ,p9ky 4tZdb,kྩ&<`Ao!UYi'Es7--mh|Q7&CKY T]PX Sf9l9=E.p@ [b qMݬLɐ4b# dढ^aV=B;PO:"hl?l53|GR{,?],S-ɁUFKۦ?k|EgFn%:ovv`ƪ'%7L\ 0Ni{lo-2{$7z{8Nt~#>!ֳ۽@@E%ԪԸXX^.* Jn= lDge""k^+) cϔ]=$*'y͈vRI<&sXS5t&O+Wq6i[I>Сlv菗S`WψdS*lźA+yuWω?v#jU@1w/f1$F+5?Rd7Srk1V4:F>@'O#{Ud"ULOV1Gs*NV@@#w&)Q_D)(&J  UmSʶ;sFT>^XkyM)RS?H='*8) qw$´@#*HlRt'VRnKi{?r;kk5I>$@׶iJ녂ꤡ$im=Ϳꆣx64tmCK{h#o,ް:)-<_' ˪&Q]Ed'W:iISDZ~QmoPXYXBZ~a[؅CvJ0:*y ƪ%)$]p| uʥ%)T1bTr BKV&Z?kgWJ%${@3³klYVX ,s2K% 91*6y-$3i`5iR`nbE4%RT/k`D4±]{Urb'i9yp>ңԾfSqk%pS¸5\d4.RYyX2Y l`祇#2֞me>'as?};l5ۛyZue^a5\O;-s>p8]|YcQ'I$EI$'I%)$I2t)I$I$JRI$I$I$I $INJRI$$IJI$L$I2I$$I&NHRI$$RI$I$I2IIJI$$I)I$I'I%)$M I%)$I$IJI$I$RI$'LRRI$'H$I'LI$I$$II$I$$$I$I!I$I$JRI$I$I$t)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$IRI$$IJI$I$RI$I$I$I%)$LtRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$$JRI$I$I$I$$KC:\և[ucgO3S?d,?d+XS0vo 7I*ˤI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$g=ïI~EqfY:OBksPǯB3"՘puTMh5b%pD%}U]mC@INٍmZ¸M57^'@I.Rr@Ig6m3_V eoQ,=*I$BP>EIHĤIfo0 ,=bLŶ%pjI$AЍÚv>.^0] fGI]ֻd@QWqsHq> hp:r?r̬=ėI?k3!+!!+ \m 2CiCGO6V`\ʋGU2Xg#D%X0[$eJ}6Xe ^)K^DJDQV-6uI Z '&+yHka݄@R$gdD%ҒPoRMfVNhg_2]vXI2 21iSC 5腕Ҩ.$[JK[ntmw*}@|&p"?n^S=wmn>^ ZxG~MT)qPhJ|7v1 =2XO* cZK%"RKiQ W3Z N&R"@b_4qDWǥM:I&.l&I%oUQL̠ =2[:(1&N+?!212)TťB ;ݴMޫf"u{fn/0&oF}>e9"%NF<@h4y.Dž 3K`kKh䫙W ^`Xַ]|UM䒅J)YsA'=c 'Xx!6&7l;ʖ1247,2$SpoȘ[U{MUTIo16N+N"ƃjZ>Hױ4{QZwT)[0 Lȕ$d}!ܽOr+H_]86^[d硱,?,}hlp{C( m}f3S x M vK+BK+Z֟"L~ՙQDQj &Q= c%%@=x (Su<1['uvlП@04{Ukw+PkٖSCO(h6Ý7D:Z{J݃PNOt;#@}GyfsLA"QE(,g'0<PQ,;`<~mR@զ5ï2wKA<*(1]'R=\1,k| hmoGtTIuĒy%4dhSJiR11kD<'NĒ{g#5WHJJx#G??Poբ`]%(Є2ݰsU1Q$NZfB킥)JJv&p*3vCI0%)B$%C#TX"@!|#Բ)ט2hhS Г$cF /ڂ'DؙP~%O|4@ fvW~Z~-p*,2s?qRYYp- #"%^ ܉WPzx 槎ڏ\uИwZ9i\>g:~ mC_vrnxa1 ?\55?.@n~V3R?1*CxїF9鲽]$3n>Hog4jmcRÓ?LYWAw\ks]S λ ?HM_4hQ>XmzFO*LvCUUܜoGi9l?R؏m惨?]EbA4??)N<קsx!<1~f*VoAk簆q*f7Z懝=wl}?7 VA쑑`:5hٗ}6[BM kG}LGD[2].H~8gE{7?s&8߽ G9ǷpiQKhZzQuomI;[_O7?Yp-OoFxmq γ~ޏcu’<?*&8唉{?!~Fn(h@4>+q۱3;ϭ=%;\ciGeb %FDa`:wy&Tc@`GK,tK,5q(ZhD~ k):{ w!M%Sa۷U{!KCc5Dv yi ˓G. @yLe X~eWvVDhD4Go|uRIXDEM9ș5m:sb$L[kKQw]"ƶӸj|T.~ #gD nI^}'@[Q(fX~]1+􋗒IDƘ$J:uG~L~ ӕ %S)fΐ/d?RƇ@̴kyFwokIR"FGR$O /wγD kH$FHCcI2 !A8Y>᮪/~R#b/GO3Z1d H|(=3,kĂ WnNbG;CPnJ:ևXy>|=:}'h#Er]x}QQ8hoDEGܦT{ds%/vC 椒LFv]=L~GE\Y)Qb']"K' gl(XF>KrP86<Œ`8I!~+% Y5Vx`W Hi%U@NϙIEqݳ!r*hyi*HKv,3Q޽K"U^#&dVf>+0*qI'Qjn蓀w]%JV ';V&QGja_ܧ '+qp(͓}?E4q IRQ{i׿R)Q\ai{͏P:uU)QҘ64O ٴj! v*0#pR*2~3/n׏̷σIpR  lk10xg)JD>#J;H'IO:^ɽٽ JxǑw`)ž ZDaI<h,}k8ty~ڲ!Y.I 73+]:$:DO?L\nNۜu+uaWV'1LQ^r =SJ۔1+pݤ8We5 {i*طK ]"@`!)S)JTfR%R/4<Ѓ\=V^'^|GTCI3pT2tlBq2@9hD@Sn(FY 5-cf^$5hƒ#x)7C{H"1},O"xUa64A iYNaM=,9%)W؜٢ SqpNc{5ݤN@k-HUmpD^ 2!8ƾ)NwZtdyw~jҢtUKvOXnj:J;&"A)Qp-%O /nt3|Ŗ5/4SoC4Qu6G˔s:Q}Dm/yp_|[|C)&V)D?j}H-0t#踽D~l|stw}sWWM;_6_TQ_4{8LL:)cr_Wx?StI([ I2d$I$)A I$I$I$I I$I$RI$'I%)$LI$$IBd$$II$I$I I$$I)I$I$JRI$:I$$I$I)I$I$JRI$I$I$I$$I$I)I$d)I$dI%)$LI$$I&N%)$I$IJI$$2JRI$I$I$I$$I$2JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$TI'I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$$JRI$I$I$I$$KC:\և[ucgO3S?d,?d+XS0vo 7I*ˤI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$?;_eo,ů[#i<9o)p2D) >(oU޴&:*5Z{ќu[1<@xdCʒ!rthn-k$%]I$&&5<*YhAl3iM37\1#TI:ɪ} _9]kZӻ *Tâu@\ti5/QJI%+dΒ DxJB rNk-;OP; 褒IC۽iY$&h 6<,|aA$/宊L@" N캙2zCoh7k$_tIJ rI Igg[乃oiPV9}kv!fX8G H.!Y#.2g!/_G] g(Be.UΝ1.mH9Vi=VjtGk@TgG#Q'c66N<)44<3)'RRnSĩD-3-L4 +M6+؃pఱ2v ;+'9I/>C8qض15R9;#[m,ǁ 6uP8yl;׳iem?Uyca65ɨXōDpq?L'M1a+;*# 8;|ƙEō_gp欞}Y.aq53JDPe)YAE"An.$sbRV{e܍ bo`J$pTIS,> ;IR jcORv8HӅMNⱩ&#8Q-LYX Y[K΀)n:26Z n[ˏF-' ^PFl'1PCynyq 0ЮR=ZK=ky5Zjx ;s̸QIX75ec0r1[}\I@*Ln\$8Dz PHAQgadܺAGEV%X7AO./&d?~DWSC|\ʽ+Hiƛ|VUՙ e!W,'$(8cn&ڢep}`Bkʫ\SNqW>*!UhN5NXFJT}kd7 eR QJSʌJ Z9S^y4ITU6HN>5>bTr+lus;LJ^Zd!3^eIN_eK_/ZM0[;R-A;Z#}ɉG$8eۈH=8ߩh;5A]OM|`sJ:}T $L3љO'g^"sҚT ! &;`5S)V-kǽ%:)td1{H#Bg;h&EǰBihcb1!I B?,ADX>OmkӺeM%RYכ\v~rȉA62➛VB:-nLg}~ꔛ[@hh*HpI\go*c\d|Eܘ)$i@$xN'uxq!NeGUՖy#\IEТ&-?]2g_>%Uahq@w<Ē#[Š󪭓*F!c\,wȟTdj?:-|T|f}G(Հ{"$t9Y5\d49̖`I[橧*#kbcb]z$T ݢjf%KOi 3ƮwR#0Y%,f:ҒI%iE5|klu#c\Gn'RT٠c,TI( yC';bO:BqI$]KZ>.ؒwR mDcw,X`)![sglyn#axvHEo(qY5_RI:l6HXm8wLr'+1h Ms <p/򔦔gl%CZ8X&ly<!!gtd(hҚRBԌ Oe3&%6O ?kbgqFrEae)F|SnW8 E2exB ѐ@ݑ)(Q% E-.wܳ:y+9XX;;Bq/&4* 5G0q3)CpP;6w).yV`\]1ߎ}t*1 f3܏P30*izudSj pᰋV-u}keZRa_<Upˢ SG4'H9"N/Q#b(D0IUdO!S2U,mrp0cKV<6[ɟ},,읺s WKv{~ &G6ECq aUkۨ{Q?I~Im9l.޳rLz~Q ;cw QF Du>gA?Ռ1\Q%<|ԁ=XGI*57Lx>;s7j[zEri@53#`O)N¹mg)JD.O0N%|1rcb|Īd[s{QD7XkHh.=#S͖ `eA UѢIQ'} c7,8YqKM6l򅼼ShC9B@ƺn?TzhYx?m!Y^ٓyR }~ެt$ʾV!MTEd7#Ke-ҀF= %VN0!GjbRBocq^uuNKTvνԉMo >ݏ?E4+5:8; ȫ;@ "UvlmC4By xB+;}S2mR?5߃gsj;z A342Yr3Kcg1c܇uPoaiWkmd,SWz}Nyuպ-4jwwIg2 $ۆ$ $IIRI$I$I&I$𒔒I&I:I)I$dI%)$Lt)I$II&I$RI$'I$)$LI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$dRI$')RI$'LI$:I)I$dI%)$I2tRI$$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$LI$$I$I!I$I$JRI$:=huY?+zˇQY5:?d,?d+XS0vo 7tʫ2$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I"?ӵpBH$"">K-/?U^Z^MoR،,~̆tSB vc1F^ʷҬ^MsԝzobJ1'[*Qd2uA<\嫋Q:_ Y}f5(b4$K)*'<Jxo8x"TL7%rLw< >(hyi w2IY1S]$i\⍃?%c#DpP!mtl|JNCO %clTS3V7dR쭤cf3M6 kIَ5>4~]k8;C2r;"U|ƅ,BW74ml  n wqkXmu=n $l^np.ݬߔu\P`84CuV8@7Zxz6mDq mm@1cڞOؽ.9m =U :m5K1rGdYv08VGXˉP1 |s0 *YUaU3,PE[K,Gu2k5IUj86s(?FxL?|^ވ-ֽXO'umm?Qg\GX_>sѕGYk-h7/5#ʶa{&'+h{54J}IAfׂtQ |&q$[SS}ϏB9Qyy.J2ͤ q؏:<84?VNOkRZUAcl!(AEk$kFC?6 nQW}Z&Rmxubh36kQ/źֺFpf=AEhN:#2_:VѷI:yZ@Beƍf,zEvAs Cqgd%Zӆ{\W~޵K{C*Qv4qV7PI0*nDz'wȫⲉ 2#}ByΓcTZIXO0Us sU, |c<"\F碒I%y٬@Bz/ N  }t>P^\H))$SKUMEm(T9 p8EE'M))pyuo#h 40]IeS& @Ɉm)$ ﰒO%h1kFP}{-D_!F+O]?%R⇍]:Q*I$6_+ {\Z8v $5kL.VLPI# 2SV]mX թ]B Vo$HWywMF*;ݕeK.VrUWI%_0R5O)c)@?1_%;Ꮎ'R_oެ!Y׻q'04 *[$#oOg@CcB *1ďL~Y_Ye48\<! q8#^ppV" ̏3hhcCGBa^Lx-,gm9pfP]9=ԩ"5-{w$. ɋ%H'L¸ݮզTYeDXI #1Z\.nu,&%VLF%J{'ڔ' 8cS5${Y,\G?,?yH52 2ڙ`:yOhH(@γҥ|4N&x$S*7ٵb?x#b^2ϥ{ c]A1XLgÌ:JJdwǷ*%̟ ~ֽ6wgtX&pkSFXQ-K%^}I:/[XV[4 @Qٵތ<&fҎIWRR|}/Ydr FZ뤙%Ge*hoJzl/vWћ؇sIϥm[>JMIZ NCV:P줒ҁe߀ݓe54,y{5I Xר^R*2bm lC[IFʣO}6yЮ}IkBy~~KED)Bk?F@>k24YƗ@ %[8k[WD*9:uuH6`w[.\$vU,<̘M">Z$sD&Dwd"򗨨?- L`cS4zlkY{8ँlk&$ܣg6DA0 E R|NghvOx}#v=ɦ4P6JoR y^UCAqjU s 3/)Y"T nHRS?!nOJ} @>j?`A%-d 7%ܛԄbgauG'}>Y8Z?AʱV+*sTc;}؏ɱCV9R^J5AcT̼9LP.~mY[=ƪw5~1G,5m SXf{}RK鏫k}Ѫ},_'Y =odON5YӁՇuӈsv<~ܻ2;0Ɠ)6#s}\2@pAq=_5|?tEFf\%w(c5#vn_/KXcoBC%#kv+I^]*k<;w-RTH t5H8 OFQI:P$I&NHRI$ 4$$I$I)I$dIJI$I$RI$$JRI$$RI$I$I$I I$$I&)$JRI$I$I$I$$I$I%)$I$IJI$LS))I$IRRI$ɓIJI$I$RI$$RIJI$HJRI$$I I$I$RI$I$I$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I:I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$II$I$I$)$I$IJI$[ucg?rZp57+5:f_?d,d+XS0vo 7:eUtI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$ $I.]Nov]Dj*f1ɎR|4#(?ᬠ疽4;KY;56eOR6~rTR߶ǰYf47JR '84K "Jl'Ѝ]CTvF@ &!>oo~Xt]SSB$Gar) -tQ:f #n_K2Gx npo($)W-HQ}6xj&JHVM%BǹF#Se1v]C vU20i44Pv?R> l,y۵q翵b?bҘ`c+(#:n# \͙x1pnFд\Uj4zbF '9Q} tÎ1iC)^RFcqOUbaSɥEԦ' 'M:5!}i.?j?LH=aոk#W9-ʹD*TDOrU,Gx&xS9E{~ ~iC7J">zZ^iեܧ!>joQ]@1UˈN12d2IW-2ƇVQȴ>=Ϗ[eM|TtS#2r2Gd+P\A<'/HK{:[?&yۇY#Ar{n$@r/qydyc$']Tdl\'ݪ٬4ĕ>si:Xf-HkH-cn׹Q}l~D` pfY ˎwMZƆy);tK~> `joc:.rHC[~&S+nU_hGdlǒ9uY?Fae&7:I,X-?au`Q9 ߳:Gv{c}:y=_>U$J̦s3 !ՄiऒITȪl av4JZhuU15?8g1g?6?RlfI$mk$Bv:rӣ ̒SrLO#||DDKDYU׷iU[{;H/LƑ0H3xyI2uJF}ehD LȝʒI%S?$V=0} L'K7O5XNy4U9_FgpR҅^WXCWDGX%33L &dIRڞ5,::Lj A8vL1k>hwMe>v@<#D}I(6ϬkQ 맚>*JBIJSjaO1|Nl~b6 ^^L&zd}_6})q)$J+jmC@Q9\L\`&8^А#@)Q,^RM)JeqA*`B5WqrMge7QfO %O2)ꔥ4/BxHWD I4SHFA5wD lRc"%WI4ü@Oo\A' -٬߳6<^"Zjs5LuJQZMs3j R w#W$! džl?rd%`?Q,ٵ=Cc_C]na>Ѡ_&ͬo.?W .2 G]CF[BNhp Z4et$jOc/I^iu ШhiS'r'  .Ca{>J].u󏢃s\A<8vdfH: ){lcjiw$"(_[YStlniIJR%BcIcd&m&P])M)J6"$c-Xw*P{'lbR)nY }?OF |=B,ۧ'DxT3OS mX*l% Ű'3CdY`tHD'Bg U$&x4Uh29ciKj% JTMډ"Q ;*Y鷆'[k2F%m 4̍\c諉-,$?w2*Lw'eKQ ʉyXI<*9i"AV8aq\Ϳ?K3@ ba3\JTU~qx MFl$ !QK,l.|{m*rY:GV{aiЂ*}9\mXke14"(9wz5|eONjFfO1MdH)I#RuѩF>;⫊[?u8.s#䨎Z-vN@d(/ۈf~ime׏k+;ʷ `KAW+>pp&LaEٔ;b83Pzv!5$rB=Ƹj&e[8﵄} g@ srı;$xѳILp־Aky\۫ 'JAy!SJke L=[+usЪ3(h*h\V<\pDs? ..C&$tⓈǂK^ݧbvP~9k\sv ێ^WYa4 ׿z58G-@ I y:X 4MN moUVDE4-'fGxy {H $g1DW,Gy%5/8p~8#ǻ  ?~V즢IvΪmv|VZ~>Cs@4\l 8y?j~ 3(`3c*c #bbh{ h蹽JI<#bտ#MxPF#QeB ^2`*88={cD5]-b Pdl.RH)GtﴳuN-qJ8bld`lf*B'T~J5aITct_ |?yt.@t9o.Ol)rf΄ŋ@j"Khvuݏ('#@irT2]d>mp#NЌhlXK2@+I"l?ⶨ떹Oy >\L,%Q̿0[A®ѵI=[6\Kt?gݲĘUv(dҟ-ȁUeՈ{p'-vqʩ7;迿ӒڋLcr/y#X]zk &gOcT+EisyD9,& J:YHYi"חrx&N莳`C?x(ҏ_ 2!?05ps?r=72>][Z R~&퀑MDQl5:N(g!1̳Bu#UlsrPJ_1Y(Wo(Fg2Qp4h5]^684GKcTPIH IZbk8̙4Ah#IL#PN:3韂T%G&C.ky'%Dq~pN8nq}Q ~•,bxM՛X Ouz -#0;FO4+^m}IO䨺&l6k|~W_43C،{wI3:$3pր'S4BuO wWr5-RbES'%(hʭ} T#0vRI$}(ckN"U| t> w)TI!ۘ=A`խ0.H8$ NFW@-Z'q)}#d4y49Kiu!ytc lj)'~XyYmcA(øDVXe ~D\GޘOJMDǎO=ʝnWp*ais3@aI$|Zw\>W4*Tmf7;2V!6@ ,ɒD),R :Jva\KI;5fsD !8pOZY#I%Y Vi'kpYfA>jjq#"I۟K[IX Znq|T_m8 ^F"eJR<"坵Ouce-kRZaχQ-:)$@ƭ 9I&{- mmB\@|[^.#@ˬlM#!)Z4^۴1rvSVgZÖ"&A(D؟jtJ[OjpĔJ; > gA$IƼ:Ih`ߺI@\P/{Fa٠.pz|+0I&nc1ɺH7EH\ b"U܍>+`84p=2?D,̘3g縸t <_+[5H>gBK-iyf=;[i*NԬ{ wV[]N%E1d P4?MBfiGwv͍;pEb_{KwvSw7*($4"-;ʆvkGeTwQ:R>JM:0c/h r,pv΋bulLJqY;~SUwBޭKQqG%ZmZȫ=hB-lg=ςgX;vG5 {8՜3^+/fvC\KӅ9$#%_cg-tڬ;gvV:wh2kxp ߳ xCk@'@|`Xܸ#\&u&;H93ְNc CH,hԃUfCfNaTlq8~d'?7kd8{(RE^m [7,ypֆݎۚQ"VEWKXhv*!LL(}T5X 8xjV;ɅRY^րY׽ ![ޓpwF2GAx\Oka}%@< UYewKzӛH"?zϿիk8wF`>"$v_ ӍAUowY[cp5DOp,A!يkό*o˦.pӴ2MTГ !$|bv[!l.̗zf8 >m[ v@wV_g/%2IPǹhZPT@Qlgt=A4N˟pY䃨LC6qU3qMjEZO,Um%Tk50C%h4e3Ժm ?QǶCL7շ8 r/˙nUl`2@x#6ۄQ>$ 6;e |%]x# 霿ēV H?4?yXJ$X*y[[[ Z4Ϝ:.$V+ yGcU/7{Yy SA:'6# }q]T\Tj<ОOl$g5SyiTCx(d L)P~GSq8}_j'IJ5RkvNH#hkh$+ yw Q+U$K5=jբ^+iqѠ'u{['U+!=Tݗ>c('hMԌb5LO?Vn?EqL!2`8vբDȐ;-C0 PMlZHWa߿Yy Q1Dž %,`+Sf63K9e\ 6|M^J3Cy(7Z{G J3NUfg|3<^CD$LcpUqWZy=r$ⵍ~hڄ0%$I&^XI! R8w9>8R<8bI8 J\p6PeKnI"`J`T]\Ge >TˏRI$}vTGV׈pC7pujd25ʝ qcdN$~e$JEާV5hӂ^==Uh$pk/Hd%$IqE";T캺P&e 'GTBh]W]>?FK5rHiº)vRÈX'#I%s}6};Ph/2|Jf mDpnKQU$RUmGD,EJ5ʖ`2$U<اM(BOJ#j=+,Ӿ)K<F\?AV#XqHCWKXwx9JTiMuKr;:S`x);9K^SJRFn :tt5> }C31Eƭ'W"4<=?JS. `svUX2eĤAp~d?,G߸R̶< #md'UOi,ם$'F""fl(IF’cI'-4M+#V_vΟ 鵞ٗr@Vm֛\8Jǭ}DLUS)>Sے.KR:̵Ķd~C;…"#DHDVxAS4Y{^gj\\#h1@xkJL`ߥ |sNm(4.OTg-&68dYb5?^Ɛ ^}5,ZbR#:SF~G d`["罼}#kL!]HJ~*;۹Rѐ&큻x~ۦ%1Z.9Vbnؠl >^-bE-ӗO %oUW~o;2;y"[Q d;&Sn%Hأ S;e 9b7d7X$k̦(/]r[@uw)Fy2s#soly(~ȱkv{}^br;6!Y9S즈Gj9Uk֦-N?zl~ڎ.8-زK"U93ƉUsa~~_}!QM{Dy4C5۽G?973, FnH8U]fxH[!?Rd/KLVfMpu*õ%m#8LW -adGU=B;a?W.sH5\, ŊqɶM7D'^(wۆL6wީYegp5KbR z/[vCޝ eƠU6milBD@ 05}?RJIKyJƹ~r05~fR?~[PK 79&#fìQ}ÚSkb mAx&8$6؆,% y)d"7  &lFFyg(F<4cÎf2ɐB3?7ZnCkcv5pqnt7Q{r4O NDZHа84VݭI$E RL*,~p?z :9$^n1HpUBg@EF\u50wk1 eO`5~TD ,sȘO>!K ̺|IY18;M;"׋L|֣D$IU%ϟшm6?#/ yM (m{egTUU1q鑷|WD<%me-.qXXd]C˜|5e.%d/y֪ ~]skt9s`I'r3WX)nntr`~L([P|>c>᳤ b?}N@J}kA'(c[M״!H_]mhA;*hR RíQ{+!~h{[[$J2zi2sH_%;*lalXdORamcHCwP鏽4>oCq1[a*Y>mӤ+ݩ2KHͫ2u J GOf]6h=ac;̂=dD|w"]@!#Yc`O!=o _kA wٸvE/{Yof@o5VI!,IV0fOct|qPf4!hI:PWo Zzx8F'~ -3*]}!F| z5Y.q:5DE #fX7+c^!O?P=1ɓMY&|݌2P"4wWkVXd"Uyr >*$aqc|9rx# ~;dDԪq &O~w#nt_Kkxg9q.oMF˜O3#Jlc!3/ b`!Ѓo)tnJk KmnBvL -:꣐RɎX"c&V,5LL 5nhWkI'x8'Zf7;?]5!7hKtw%:(fdDA;d8bfM@dٰz,s|sNX?H+9(Vҙ *<$+>:&GkH!^kF[9Z{Y}ձ;@"H Z o<8wS,h[EշSikDrMf)]_pP`wZ/7_/z{IWm.'oRk ٿ۷O'9ezVf$H@" dt.RcU1)kwN ?+ʫAGUx-1Sحo2Q[nnxYXLIsqW0mg5Uh56 A+Y ?`h?}>W9bp x.n*me,xܮ>&5CO]msAhO)3"qɋScrc9qo͍osaHR^pKWag!AL)Sv;^p"9N:JU92*i'+H.?E;m.BkCU$@-VR ڮʶ13s{ 8+,| ϒ]/Og0M|˯ sQP3RuqeXGEz,d1;WL$E$II$I$I)$Lt)I$I$JRI$$RI$'I%)$LI$$I$I)I$I$JRI$I$I$I$$I$I)I$dI$)$Lt)I$E2t)I$It)I$I$JRI$$IJI$I$RI$$HRI$I$I'LdI$I$)$I$IJI$I$RI$I$I$I%)$I$I*I$I)I$I$JRI$I$I$I$$I$tI2t $II$RI$I$)$I2tJI$I$I$I%)$LRI$I$I%)$I$IJI$I$RI$$JRI$I$I$I$$KC:\և[ucgO3S?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I-? +`(ycÇ D{-xcÅIt3m6{A=Z3@v`i`n'⴪m >+R19%.1G) TTuAP<Y^~k[7 !-oc##RNjP}L ('yQyc!aN_c|XNf9%p|NSDq$rfn6-i)YƼ|HUcmpy.&x܈)* :h GŻM5M3h#2L8ˏ`ݙio\a;w;ģ4y/wj2#aӎJI$2dG%Jߛjw7f6'oI,{Z['H_N xEd$i'Uԙ$W!~x'@ E$K@Oպ(mxErlIcV٩ +}.cԆ8z.&TTࠈ1fr'V9N-h`㊀!W=%HG$f\|L0xt%_C]<;(vѧ]zcs 60qO?eAw))Y&L0I 6&o̢ IpwaɓI$dxTᴒNpu϶Iv XL/{!#T10DI$5O5~lG~?(W`"gsKGܞ"HX̢ oI%nU36 {Sy?lVC WL1v@MZ"TA#F4>ʨVa;`5N0[}WM)nYN '8Di u + 6XpD%=:{efRSJPyE7G0wrJpѸ5kmU#KI%CԷp:R+24YZ/sk0~ hHz0N3?$,m Wsq't|7q t ;)_s\&Q\!}g1̩L=ӒJiMkPSM02`+cN8-$ے;q0 KIYfSn[Sx#-C'(ҡ$ĦܩUjL! @DږVgJjZRܖH*B<|у<*0#3uݏ_Hϋ^Ľm 4$91RCtf2-{SO {S>څq&ġ&.*u̷H>S?xxC}fOr~!JR_caϱ@hu+n20~Qzv\y+IlrpRH۱ɳğ#.hy'o HgBHBFd6ESݺ#B 5ݫ8tٙ)B7x(eͨIrn˶G+J]ӯ+LjQd3:k_e 55lJ@V:Yߝnj!ɳOJ !ve! d#LcРr o4,v%*N@} < 6w~lm aPYzVZmnMLi#<-hz@2q±ts=bˎQ tnz9QB>iA:?أ:ゴPN ΋GTl6t_*;BPm̨KΪB-oޝ);)lM n?rZ '_Z'@<c!!a L-P ܂MʤG&>A<8@&F K ́dxvcv!$|5BvKXH1*C)È#_z4zO vP èxPLqd6t%9iv6O[> °5e=X#A;RC.&9qg%*%EIYoZ*!Wȩ!! I{@'.!G nQtUmkYˌr?S9q/׍+ dx*:oY|Gq<fF[ձwn#Aj8ǻzr|\-.YO(|HhY6胨#CÑHy<ftf=U 2A&T)X>:tfC+pC#LK48KÃv3ohF=kը;Oh(v?%-#A̢ *im>~9+k?MƆ|RO)dh+$juQuMsTn28 9;RksLjvj9f=GlC6?J?j~챖վk)800vZuNEX%ՆT}8#FPG?zмT`9/qxd1D1+cA{ig E8W͓SƇdnO)XĶ{{gUɰ-CD2q^yK> KV8EK#0]"6ӽ:'BX5ܥ.VV+Gq1x+k^Dw 2>Mɭ5UN'lb_@cs7ξ2ԚFxk{&H):ʆKmu.4w kOI&C8/#DP.̮@Q9Ce\eZu]~Iq 7 V1^'V9)nPژu$,`c&;à.vMk鷰?V1ǩG?[̺(-\ZEL7w 9SLRldŎ/=ưWx X9-@wY=-B{lNx g !cϸ G꫏~4.F%Y> j{ttZ;c:w]2 \G,PP o[ZBt2@"G{Qm64;A#E ݞ,9V~C}mƶ}(RS$}&oֵDӡSE#[ns0xOZfYC(pU(U*@AB沱*[K|4N nH-40BpT-Q4;2jq{=4{*T6R Ilpee͑kJV0ʬ;$EHbXHZ],*b %V9 s?2cK&ik#k5q]#=2iRI&4^˼Ytu;17HV2s[K"|=Gc=~S9fxԴ7UavuN9Ŵ= +[~EtT5iէX}y Ap{$y  te@$F0D*N{ڥu*@ ;!;tg91t&fF[MN{cDc[Euwd~8D"oy]m%] V׃ -k Z5 sbŜw{*u,̵]TGl_r 8kΣԤpi=`~Y߱rk %ed5mh$VlåQ_̆$NMo1:o;-Yv7o`{hO:O)r4_ҞXwJ?5]m>]=7P݈)G3{9p%5[-G ݧtƲ٭/YahfdqcxVuеkS, uM8Zǹ(]:+8ÏoZy(/]i+Si$6 5+>\8i1Nz#ӼhL\jrY D3cCS[ Plxkemxw1 k%I$m>B?lbhSčWQ 8aI%vmg'@v6ࡇX.x~CA?rCvjة$Tk 'D!;Ser˲d>'sΊeҩ^ZZ Jl{we@F|C崌|褒IEmi<i[e!g3!O`A:I>ih>j#C"J[qZO)$"n8d'VLp(G.#Ui#|cs߹}Ok8|#Rs%x UejJRL+{N %Y}&espnf'PcYi0( I$b%I ]kX2ǘ FbbOo"?dg:3>F $1G]āD]cM _}nϡ=KABڛk`ة%ZX#pRb,}ޣ$T3!ݸq+\L<SӜ@ d̒{ :T%I+8`x1*ǢU{{$0z-lL}1 1LJnEu}3[S 6@8"@"V$Xqljͯ)&ۇukE՝*`GhF-R<(]eScND8qVEd@FҼ*!& [Kl:- n%?+ԓTsY?cϋ5G xzY$xc8L"be@zplCtcj昽GjkiYd@| 9eLj͉)zr=Fĩ30 *I>'!26"J# H1yB6Di)akS}w},,q` @Z[?)d<@dǺm^X[y?X@cKr|UO$Y`CT鷠Y`4Bra@(g.!|fdc ?\7䶾d'SͰ'~Go'0 5>(arHTcO>1&|Q┫GIlkd?$Y4c5ďvuB',\^`9'.lx*L^<q9o;:2=hrgTdPDAĻN8킴> PW+BoP!ʌ 鰸sT2F3Q%|MRL('o$F78qYǂGSc~&"` bׁ n%ݿyXk7?fO*c))q]3!@$'My y@:xbL¥<L }7C1FrP#~Sh~d3%(s^:nwV- <8_K`UC#n=RH4cQ7{khG>(D% & }3-7]^(gˆS06Lξ)?#p(|S!*hm!|.V.F5?j\?XD$/IF:x!h$ [F<кS-kTk67#^G(sQ#t|\ J|&0vDݣĐMg]nf(}7 _ieշSz"$(vM<{&7qV3pn 7VĨ5ݫ#GʬHGcaꔕ1T$ cSt6S<(3!wÆL~1I *ζ"\Vau{-b'Ui=S>9>G/[6coQO5?!;S=۹W9zp9uE?wCqD*'u5qߕB\6TCT<|+.!ȧgS~??Gz2ZtÛQfQ6?<1Nޗ눶;c KĥqH0Id8H#ChԞ/Z[l~sS7+ֶ43_d<-~tkK-Gt'`J:U\+.8O9#V.3qZ^%ZlL{OsTS58m8{F>JvQkn&an sb?裀eeKn&F.h.5De,Ƈ,Gloɞ,ˮ Z >uAVDYyMp4[?ZƳS (.>E6$ݝ oTXm.#;:}">QT]L[pl$Jedhv=&AO#"A)D6MwQ?D0?W%vV}A7BB ?Z?2W= lh ԩ}JL~1V.e`a|GFDz*ִ)Βm61mp"#1EWVYlָ",^Va#IԮ@&q m:O"SR}ELwGb!XLysdN`v#VN J}pv\b`J-jy#T4zK[t KmߕS+y..=NCe q>QL0J:L>e+ vU`VoD|߃A#ƌ 鹿jKa;@Nc}LlxYeFX/=M'dok+^KG`'뉛Ԯ?AՃg?zM1wS6|srW6~kvT2Q'Sq]-owD6o&2Z?$ AVexp֎CQg{U  `r;0+rB5Str_rۙÇ(a-lk<s][\$j R_5] pp&32c&<\08 g/\GBFSJЖPM~ƾ wG̖\gK73 #jfA0^͎EdH5oI67B>ev}1k0klu; @m{GMskp}/x?raSG##"r(uNwmpy8{|$Lf6 ƫG|..,wUױIb\YDԿd;uܦ+M!Sa%XÞae2 WzZꕽ,P i+.Q QcqrHmOs8yZu=5݂/gB=|n27) 5_IȶFxZ8}ĩ߀a)t 4瀠iw_$3[e@.tk{Mq[W;A> ~÷fcemLpaUI~k"=caaۣx+>0m#αdt wou%m;TzOkuQ b܍e!Eg<xc;􏒦<@wTC 0N)Lr!bLцrHrG?8`3j`sT+qL/"}a}}/kzPhnMf)Ju]kEm'HR:B2ty~E^\a [l/AвcW$$rubÈFrӤ{B %MsCZ6rSUݶpwRɨe̳n$OSUF_- Џ2a1e Jޣ߹J:Gxq<G=>vJ\K=]" z7V mu?r7ևG?դnc\JFQEQLa-FMsu7ӝ< ?QŠ۞4 vtwȅ[ҲK@?sXꝾ k>Ey-~س>H}kc7tl:RKzKBS.~n dOb5 Od #]18\ Fַ}Egg#dS :^!Ȭ;:=h<-s02 y\| _+Yu}5*CAQ }SPKS*vStPfMn,xϨ`㿖f5U`スy^Xq;2\BE9fI$<$IEI$dI I$L$I2I $I$I)I$dIJI$I$RI$'LI$I$$I$I)I$I$JRI$dHRI$d$I)$RRI$ɓIJI$I$RI$'LRRI$I$I$H$II$I:E2rTI&I$BI$I$I$I%)$I$IJI$I$RI$IRI$I$I$I$$I$I)I$I$JRI$tRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$$2JRI$I$I$I$$II$I$I$)$I$IJI$[ucg?rZp57+5:f_?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$,?]C0k{. OkH#/e rLpǩD (H"!ucN{Ы1JwlSIg :$ gZ~e]g?y{˜=ғj26~XNJA#_ 'kʍ;(=O'mLgTj~ 2?I$:ϰO$wW?SV+dM26>JJ9~w x۝X.,o]{lPUI%Y$.<䖆.]VR4&F#GfI3<0_I%,k#Bp>!gU_# ˏ'B3ɋڐ%)J~or uJ=u3Ak@'8T뛬 V24@SA6v 15I#lL$VI$9pU_ZKIO  n% $KsVjm\kFۓW\ 3ת)I"U\K珀T`/unNqs'IG?G6G>OoJ) ʠƐZ8yB˹\V,~ `qGo, ?0^R)r>!JEb}UԨiЗ dta#^RLڅײ%='M9?pI;9)⎽ׁ@z~W)QVCis-@U{s%#B┎ޅcਇ52/)Sg&P2=G E ڒe29 ]eB76a[CccZCAPO (`%#! f yD`aay11KwF^=v_(:P8şWg=w(A %d+έ @pdv Kj.G;= V f{P6\\| nѧV}wIK#ӽH,7nqv~^h6‰q -)Tf4CD'k2 }w80 O|#K#;xCޟx1/x`C} :r4U76ΝHM@6] D=S,A}=5/pM#j.$BdN[1FcpD)$j9EclkdV=>`$]1>`%#e Q'tKv*祉!{ajBђQާ^<䫗F*-ìLJ $1tQ#l:8P6)jk|ckV2gt 4#uB4[SvdW@Fu%wSc:U҅֗{꣹;x3& ~nb#S(cI 4Fv@k\<_$4%1ac=B֖d)i#GI$džpnfr\|?*A A?ÄIfuyZ%r %q DI'" FS]} )h5#(@G_y vQ׼(I*A@'I2baHSUl4:x1ϊ#,7߄Z*&H gEH1,ߢ1F;=1iAaQ6`kLK)a1vY`n3!F>Jo农>2m`^ B/lv> ?NC! kM@TzVV1kgR$U9-_,_ޑd;_[Xk-lZ$ީm#e[&֘-kza986oIeԧ*(ů$nnd.+~V8c]XaQ͢0"}ceT;7?y珹PU&:,GuZׅ_ޟ cڍUuK+<2a~Te) UUrߦ?++Sl`7n\\G|͌LAIiZE1pV">>K=|?+#P?0.l,1:,b׽!ܦ嗹/OBq㯙of=eK6: 띵>_/OYs`]lt8`#KG0dyJ|Bμ'88A`a:%;`O [mhtny|V5kA]b4ԕGuHj>Z@+7r2HhqrwϓB1#&SR =6RDOZx8ýD}Y͡oj)t5 rD7_st}ph^gUF9tp~S<ʓ,LF" I.o?,C;xnJƉU NŸZ1aԗA[u Ju.7jphYٖ9 ho5.s̀6'X$n=w;o4Trz$ʴ*{D}l;nkO=Z.Plj[S)*kw)uGFk H]UklnZvh5WWsh gwS߰y`OѿEf?SKTIlhw54II?W75*Ra5WhQX`oNl4!Kzoq;$nʐ*Vw+hc 78Vʱ;G"U*WC<Z^t>v/%&۲ܳn o sgo4CC۴ =5帗8B{=Ek`!CD>#CRb G(7O/Mvw~fX[-6쥍S\ݏ yJVy&iNMԵ%*˪vT<gIs khRRV;6sl!76\IR v=Y,h>}m wN-]!2eS#˲OUslOL$k3z{c_cnwVTerДGc u6ǵ8U23pI X]czYϚounOg q6{>v1%"Ip7pdڭ1QhĮ8X#櫱a #G]bUS F~ϓa;e8^ypu .>@"4#~Vm({"4u)Pgg^c^CEs{Su^Ks\|6Px\VF)!cAY\t1keGcӟq;0GؖZ%@ 8 Yֻ?$#<#ǂpaq9J\ph{h`MX\`_C [Zn=ן,,g`Zkw?ku+ekp(dž'J^O|=#\d*$ Ddi V Z:=ѐC$IQv0a`pp&D'eMӋ+avf!f:4TQc@$pDo We4b}{RNJK3?zol& '8߾-2R{R܏V;SYsM}4O+$kVIUwpVBփ@d Iu'Q?h\?$4Ug.{:" +)f+{Tې9$w6#aLeOp}Phϴ`m?sLL[?[N*;*=pC?9@N]KlR!/Sk}Ҳn@7qw# MșFQaDBXN&'P;y+L^{.=J8X4"ϔ|^ [ܺBqc5Ma%ר~ kG]:8'*i{Gޣ49˥R/3f)ƆX[B$I~:y{* DB,ݺ{L갦ֻ}*OcCe;C9{zzO,e B>1 h?/a!#Ba%Q9 RfƲ<)CLp&1D@8V,ioeڛ[t"~ x0W zIDtB+?Q =umwq +].{Cu;mn?ڶ2ٕX>_V,h &,iփrbFo{T0%r48w]`} cT)9"FɷD_W݌s`Kj "4 }M6>&vQ&\~i Vo8YBPdɮtdBcO53dTI{wJ7P>Z?+?' ߳hck/`64MDɏ5,b+;5ۿ Qe=)Ψ{HZtBTH'y]ǽϖ8uk^?7z7t5'oʭݎw{UܬD_AR~{}\>arY+,N!+e?JImFDn Mccr<\\E i]KzV-c;( Fv,=GP[Gq6{OeQ;sxUo\ewQs<[ܪu,a;Ec`ﴟUpc+9:}61YuimZJީݵ`6O4s~[Bѩ{ =UD >pLů@bqܴlkCi=|vC>!XC|2WIV\n?(#5:EoUVF#S`3!= VK]c ez~L6/hjդpm#YCM`<?x~!Vv;LNtxOE16;i0#U'6DSGjkH]4kXկv8j9^qֺCUIxW>P-W=Co;};57c~!^\63BEܖx#*u:I$I$I&I:dI$I)$LI$$I&NJRI$$RI$'I%)$Lt)I$I$JRI$I$I$I%)$LI$$II$I2IRI$$JRI$dRI$I$I$I%)$Lt!I$I'I*I$$I!I$I$JRI$I$I$I$$I$I)I$I $$I$I)I$I$JRI$I$I$I$$I'L%)$I$IJI$I$RI$I$I(I$BI$I$I$I%)$I$IJI$L2JRI$2tBI$$IRI$$IJI$I$BI$I$IhuY?+zγ,~W,WSju?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$AuRu3?Z=#l.Lc1*E vEyu?Pke ,2)c'D M-hi擋+3L–S?I{@qvAWf{${Jkqp2`(;;2 N,$Y"u=xTo4 I$n@уúb|y dbdnL`*$NhxN SSZԒI$`)A)R1ЋLg(*Cy"'0DI)ˇ= ky#Is(}-ޘ'<10 s2衧ITu_fGܩWXI3Z\$*fȎ*Uv"LlJL2mAQ_ X5'ǔLĊ1)(ˊ|9eCLss(ud d6A> ZCy~a$X=D6Lp>)0~<"D)9y$8 7p8knY?p~f l ҍ*=nsЁjU^4Iկ L:VQe~O,oE[TeH5ZPjG> ]ʎkzcH Zֹ{|JAHE3q}*&Rnc[F3Q6R7EG(xG}5>?Dsh1X~qGb ̦kay%J+Zl!߁Vi-rM?!F׫>*>_%Y@ &N;0iW7_%b-{ fe!qUw:*ƚ1lY=C[@st$4@GU+QoR[SેU(eMC[\dT%j$lR~ !RBRT\v!#jR1Y IEn7&7ܤ.)G~4Ci&ձ'i#%C=sDe3E\Y(tRHrmgCO_n-m#Y_*溷kn%~[hJ2jqw,_bTtPTr9:FcVs>Ri@yqA*Sw#-~JO2' nA3YYDݽh1XԴ)hI&tTJI10:d*8pl AdlM,.h$U0nW1fw;t;Qtl[vrW`uwNVlsv~ R7d.QSA&װ#&|j5͕M}` U*./ dqbGعL٣!#s<逍 N瘓?YOսa2v[Yu1;"w: Ct49tTۙl9pg} F'޶ml#*E|ztkY+mpO?M\A䒆u9N۸zWD]_'2 .]X9Hzo$#upIv]$b`o$[3Z7Q[uft5S]Q״Nh@X=fQ/i\0唪[~FȔ͛Mk 'qUMw&U ,$C*;0z5 9x-2>ys"r hq\Sˬy{;7o"3#OO v&|ہ${h7]`.O-SK BΞIOt8QM#S5T?s̍<!0qٝ^9A` hRMxw)=Y#UKϋuАLoc1FRY1PAo"9JD#_ke@wd٠f >'*uK+w`n@%:ـ@u\O(\?/VOPsރ,ūV+(q;x2vD 8:ȹ۝+a5܆29runMP9bqC[XW %3Vk htwZ.=nx8A pflR *6Mۄ ͕]EXg}@v6<ġ;b7`.Rħug! moj0^5fEmꬶ`%ISSU͸d&u"HRsƯwA CE(uLkw.W>osXIA++t?Ԙ$=Ve"D,y+UW} #P xV~Xa,^=cix+ݧK7Pڏ6!\QG̳Cb'Q-;P6}V-kL,ֿҤnw`Yg|ܨzUOɿ udDܴYŻ;[ܫ]/1> h~8?y߸؂b^>$-rc@& //SHĪńJ %au|#oϠ?5O3[ AN,icăQ)iц@>ǜ0 'ӱYÆa}r Aݔ5\ ?Vp)4PbOYyPscq*)@ iEQ (pҮb>jȴAn)"@mx*ðhOH;^ǹl:Ue">. Ş #F{z%]g6/Rv-ޛQ\uֻjy?ha:“>=8Lx2x,,T??ʅ@[2 ?zͣӰõZDO ;(=jxUM6kΪ{&6TJޯVIAw_I)9a =!`Zn%0-=P%>gag|1I`HسGmZ58t+t"e^b :Mn`q {Ҵp5Z 6^ys8[Bk{7E:5Qh}O± >IqGI_CxswUU)kU]I2-snhΦ^\}>cd[ en`iOWN{2^!fb Iژa72{C:-Qim:j۩nZ؏*Me?q?Q} nDce}\xPCzhAeˆWc?+9G3䱣JcgsLj t9GQIj}c'{n~97d+auI9 x K$NݔYiR[ӜkF{c7~^ aYD製#QS+OhpZ; ,]Ot }vӨ)%dl@: n?5f˚ih~akEs8j?E>bscMM( X9&SZwwZ9 'oew+x9طzn0Gp87{~"hyumq%VFz&]"H,kl+1G‰U,N?WLٔr4Etb4**#?5>bu+s ww,rx-l#9|7`ɛxd@>? ߄Xgp K+#7QGRoe&ѐ@{=d|?O{t??1\mu?ES`"9S)`refNѧn֡[ Ŷ߻^ۏ wvk H->I~g"Rd,UZ,x /R-w#:-\|znx-${.eͳlorۗ^4p*I*]էb罎y$=Bhj^EUkaB{Yؖ-V\e쵊A:<Ԣl B1;kxx ?+m..ڐbAԉ kq;S7oG?F ?5KlQGڡ.ڪW#-3#e\qub{!u^WRhז\{xs.o%^~~`>&[w(n 1y^#u6sJ:JKh!qVZfNã ?>gToKhptY$II$I2IIJI$&NJRI$$IJI$I$RI$'LI$I$$INJRI$$IJI$I$RI$'LRBI$'LI$S'LI&I$RI$I$I2I$I$I$$I&N%)$I:dRI$铔!I$I$JRI$I$I$I$$I$I)I$pI$$I$I)I$I$JRI$I$I$pHRI$:I$$I$I)I$I$JRI$I$I$I$$I$H"I$I"$I$I)I$I$JRI$d$$IN$J)')RI$I$I$I%)$Zoŏ垴:=j隝?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$p:_F_ڱtEp}?"Ǥk?8Sis9}1?? &g@5eC2@J-<)_-m@BI$7gRƲ ' ʐƬ Du@G\g1%I$fBL=U_,#.SDE4II$Ot[b!0X$J.S @Y3+VF|iMZ?I 0TwS^I$ORBڔTm7cThZȾE\ N<vh#3Q Km#ﺥD9 c]pv;jml؄YQ 22b'8ˇ68C o$=X*LiK-خx̨'O!OL+ʜi8R8H &1O3z5+=^70bnL: 1TI'yAv\ӄƶxw<}vOk LM6 p<SׅeJ%ĨE =Y-m$vMd[3rVNy!=vzH«.#ݹ,`DŽ F̃}3Hy-;YpA$pP2hmcc`4O T~.uT[Z73VJ.+vAjNs'-qoT1}uːW NӸD $2 ±P"O!gEoOʴ rv#COE7/;ݯ$K4t'y`%Ŭ:]ȴmysӏ,uF_;kPm7VZ֓YS\NQI+V*=^Ə kP|p8k9GJUGRX*зS]Ņ=ƎBkU`}G.4xc:s }[K*l|6 ;DH?FT2)= h=Ouԍ TNI e ]&2=Ι*nGmW@:s}VɎoN$~`.?4a}8GQӺ>ims*^aB9n?9Lq?X2ݠk'&s/vW'ԭ.3p=m-9q筋c6; XX&}Oj45sF;!81&225uX?AKɪZ< J5=?9g8d472F|LeUY $n:@P-gS+g$F(_T2FHic4e3qoƸyƈs4{0; Ν?HظfK߂%gS 9nP7!tiMK/ot*xZskUgjn1rNxhkǗ8%?bdjdDB xmpu`}#'l7~O3y=iE1Ϳ¹F#@rԟ}7Zߙ!Acj(m;P~b8<@)z~*/I6[DDjn}t o՛|!W:i^촱3SL|5̡&Qٽk]Wb!jVZڔ&i@pMJŦ$&#O0@֑HUkÎp;)qb9Xs/9 EfD1A޾EvU35\Kѱn8C.at%@ORr,lEkXe%Nv G˵w 䖩_V?wM+16s sܪmjt 'fY-qO_Z}wT}[c! I'ga~s":v}|v ZM:X%)BG.QBM0էk &?3C`3Vvq$%?-0tQ0um>ƿs?.Qef6ƖKObrJ>mo"sxImDQR<-9XC68MnUJq~{ V֚iZw;j/L>iLa{צBRM{ a%X{hl*S4OQV0q%AODܚ@纉$*ٳd d8[T%H6T'PJ)$@$D# 3@ E԰_h*[fչUWH>zy+g)=#_cg?G ==WP]s}FI-=sEa|}zz;-HeĺcoYf/kx jv9,׫c`\'ͼ#GCU][Ax.[.H8d7թs)ϤZ=2,$>vgvWj &xe5RǻVޙ~EV}.i6,1]!BNp/[WWnշGOF{{Cy4gpP)"]dٱ%7P:d|SSthAJKd8+u83ǵ-,zm'p֘h wk>rX1WE(A@W:HG'õ${`YZ{&rZ>>T>S:߂== tx1Mc!ض"OTDVst&~]dbYG4?o`is^5Djʆ<}{i1{cGUK=ϒ| ?*zGeK2O-jƂaO;0O`?V]d+' xxGo9qqI;l` V Af*aQw-5hAVX  B蘃5Eef:wC$ʥ׺UU@sG)j}7=7q4򘡛Æu-=JA csGq(8cq0Jb2’a_Iau)AN0cxA}j*mwdXI$Sځ1#`P]ܠG:= TsK4"xǍ><{rPeM u_mn4U*umE%5=Aǚlv#P":͌) ky3┱rc.{Ug\ѩR.!2mc}@D4zgVK|r.v#Olik~6C=hjא }g>92gYۚZ;$tNje.Dze.p7| qϨN=4='T1p6tԓUYk+.:|GlcEYC~>Ylnk3L6.ac1f(zW!;kuS F* ZTJ!ޫ5*:v5^~Uٖ8@(xrIQFCk@uXY9}S3m.wN9;Nϓ~>$t6I׊RmSkXur|1KyN{hCBu1癗v5g Yv'Vt~"o^M4 uwгWqz'~9aάh;ԉj9kxR+SZvd-իVnȮS?XK:!Ue.f ~↍ bʼncſZ-ՈO?y=oNrmm `;hYUB^揉\˾j31Ιn% qiv#Bw?&3:c(8 Wͩ*o>'m,is!/WzgL˛e>V2/׸> [iqN%)֔c-c<|NSA$vAsjkﻕy"[GD6D Ꙙ\p[3l PK:$Ln5V :y,}Adfgj?L`cW凑ӮxxOADpMd8vI]T\ xUqM&f[P*2h#A:k{#Hx7]W9 =t1ei T\R?/p~~AugsMk;,odhuOz`X[< lcC=I F>+n,E<!d Vڽv*8؍{N;li?ZOuUs Wq)pD8+5eSnsOt҆w׫[Ԭg=Uj;|f&J,l^mmw?ZÏRZul ?7I~c39X>ҏ\*AFm͖;x-< |?56Qi@UɯSZQwWO%\lΑ3<%e5\6)b"d.81JR$qQ|>t2y#+bcitxƟV]jD5%Ԁ #g}:y"}6 tOgDA j+!'t?fo2|5JCZ5$7_lQsi WWl{v㺇j$+y_ܾcGѶ<QƊu\~I<<9OU=~x\z.y]!0xЖic1?7mt{[V}՘#N!y1in˥79Ts@\Y&bq=\Y}/;AM_?Ũ$@RI$I$I&I:dI$I%)$Lt)I$I$JRI$dRI$I$I2IIJI$$I)I$ItRI$ɓI&L$I2dRI$I$I$$$I$I)I$I$IJI$$I!I$r?d%I$I$HRI$I$I$I$$I$I)I$I $$I$I)I$I$JRI$I$I$I$$II$I$I%)$I$AI$I$)RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$:HRI$NS$$I$I)I$I$JRI$:=huY?+zˇQY5:?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I+/5}7?OMeF͌ѣ8cWS5 O{}O 9p G knvWGtX .=*$.~M@BH/$7SO͢O.JNph P[cMX@Ovuuo-` RI p@XU[36@)$Uyy27aǂ>fWi=!6i y |BĂCf2zRI%` =*vV vSsHhqh I%)5IDg$'OL fu۪M*$znO3sCK륐@~?zkG 23q$tq.2e4dׄK.kA@}a>jQqpDGĨ ш?L繖0tuJ#U"Z7DE"c:b1_4&dpj5*@8 zUp5Oq kJ2psB @ر3km9 0YKyi(VcV@W͍poh\BğPfq_ͮK ?%jKa*N즎NCswD ܝeca &~%S/uY$ `OiFrhl0;9'#3 ;"<lhZ;K)^g=5YbC'ZOrIQ<7_%oUFl{Tb@VcEVCd lLrA5OU(JS4wJ^L2 :I$H]$ґfgT!pr űU&*F2 En4iIHƠwx)akuZ!Ԙ0əS$-%]| + 4=ǁRhE ȑGrmzH u.gH3⏛k-)HZ|Ņ&hTce{Jk:5zk!"OQ?NЏ'!ٲUn@v78k[ܬzή2op.sL7_?bj S=쭥 4rVR~Y\@D5RFF|BX9c) g^&xZx̣saڲZ2\יe&GSx"Q?V3^~iU~^`|zbZԇ@׍~`(_& ~sA'=QCCB+w[Hk۹I܁x whqmdRڛ%;"1}݈ocL8n~ao)Ybh:X+)& k/ϳH~,p=ωlq?Wx;,Ln3#^EMրNlZ W[V~Y]p iNCe'2W&H3my=gruՇ8y% ơQgM1#&@uN/ahmO0$ʎdԟkFI<]Wu\:z{YX#] Z"6IdT6W!QXPĆQLCEp[{NB\_/ }úE~Rr,-A16IGhhvWJ{i[-3eKGoRvNM~!:MX1.:4:9?z3@h?ũS=XÕ|"?G+N=#iAXoH&com[9WS,o1tg ~O~s1s[ߤp?ۉj 9D Wqk؞[O,sf~s.skln|Q)'EdsZ>Z'$Ww?7J2C"II fA =y__hgi#}Q]s;. {Ơ3+osu׸*$q/ <2[wxG*$KAtDmi8)m&W%R$A09QAߣ`Geu15E~uMkxp#|~}]wM ɞ4}&X[ Z6v=ծ4UQ`W+7q.#K9gr01F=IlWq# %*m>AZW%ϰ>*\͖<_ٖm@S5܈?zȬy~jYps. nUT75Nk *WIe}DƾJ$j\Cڞ |k.iVs}yD a=[c4@T(7/1B fcRB!epVeCPvήԫnmNJf\խ)l'7 OﻞYд<=q5lX!`ӗ&޹Z,h#ib:rFN;#2ظ-H>|*aWM ӘT`*O{aeeGFr-u?rGl'drþsTh'5︭h~kGHZ6sEuUWgs]!+۹s5ɴ6G*)ڐ,%q]SG&7{w _-< YK\NrXs\2ǩkOi',qEfL8pT"IcxpB5Z* @ _,h T}ΑV@>ǒs5;8j~_RǚK~Z @@8vT+CyVYv8l܍L;֏k_6t| U:)!GhdC~hlUO =3xVPչob5?.5X+h'vU3e pz-WྱR8V,/NXX v ]\[/~c rEsiXJq.Í0m2{*m6 ="A#\j1[H]\-H@0k 5D|?uM=;WC+:53tYo~8'si{'QZvywO]A(85_hգ{'w`ZP᮱?2"eLa4?,c4[G,\twɦ_ncoZck4 O% E957X@k'aS3,1łBv˴hW i:|%KYu!q$$[PJNf=Kh_v¯{cHh;dU>}ULnkX1>?j<vw8\_3?-2IvkU)E3$'UF$7f849sH>#B6K 6ƸLp!mMcKZ L.Ջ$"1GBqIt5iGܤ\|H v>1'q%Hy lũxwVB(8)~$` }DY]d>$=BC|pZdn: Jgڴ<ePc k֗Y_\u$sC\ֿI}$pŏ$y~~I.nrH WCwj[#ؗcV;cQQv݄h}5lQ`'US7U%p8?$pE+lec_%xc hz- 'ƳKGT}t=[.hOQka>ck)5f'ͱIT_Gܢ۩? r2?-O-j*ˬ89^Ew9x?豿'leDJGsVK CpdvZh?[cEԡga -vwb7^5Z*1z^Hz6l~0rX8qǤ3"B85&#*-lw>@.L?#լ5B/ѭ;ETKaS{IWjk!RtQ:j;ݗiCg $Sܷ6Knv:;p[Q^ɒ1\x) &&T>C3K(Q쐵:Wn-S%*ה% zDJVmXa)dd2HwwW#6\vx*\Xο+lء<2a;Z\aAku+Y~E$"6̋.q%?rjղg)k7h+1rԙGNX=vOw:1uujH\ sw K }$\* ߘ:Xasc̮q>R݈\&>[0y'˻ olr01L4"C@B.Hj͇t^7 ζQTI.ԙSt%68P]3TI2.c9 ??IWlD\[v-޻>?5-!f=ڜM ~ɤ>+J+. %<|nU\~ `HS}SCk].cԾN *i68c!>IuNWI<+-<ȩej::?65KeCOr'ش}.|?5V8Q6BX=wo5B+oxQZ L2>x齃GyG_oQŒD&5nLT2+~5D7e!ysT<& ك\Z}oh>5)21V=8H'^ i3i: 2˂ׁ6n,iОO9Lq$'zPQqFeZ21g3bC9᧘wL5HX-ly򡓐1G'Qɍ'^ڨ]y;0&i. #s95{Odx-,2d4*7\6pp kko-:ʆ $[H4JK. ol vwP$xZ&"HY}șJ#7! x(:x|yIcx.l 9ѥ!v&_?5?{;6?셂֊΅O'#@oJֿvK{AO]LkQ)nSzHi?H_%*>Mh0'^gGD5#=l5;bșG "CGMs|#z$.` &[=fsYYW4wYhuN#W9KMghTtNo`c\ 6GDCjϫHC=f_-wUnq; =ժUYH-J*ipI -:=g_/wX\ȝ;%ӳE[s)Ŏi8:H8O6S&?DEԌŇIT hȫiN$I$EJI$$$I2I$I$:dI$I%)$I2tRI$'LI&I:dI$I%)$I2t!I$dIJI$&NJRI$$IJI$L2JRI$I$I$I$$II$I8LrI*I$$I!I$I$JRI$I$I$I$$II$I$I)I$I$JRI$I$I$I$$II$I$I%)$I$AI$I$)RI$I$I$I$$I$I)I$I$JRI$I$I$I$$INJRI$t)I$I$HRI$I$I-?rZoŏ垵?TjoVjtN?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IV*R{&ӇPk%;x^;C@;oTOMo8}p&%"aD*xUV+Z9wa[[u+#d$ N91q_ytvIFvk)ojẁΣi~AK9_skkZ y+|#I l*{V4FtsT!r9j v,|_/ 2pJI$c,|aA|mGn,2%R*= <ԒI$%@'४}zkZI)P}Aέ5#a2ѐF6MKI1@ukgo:oMv:s~KOޜu:䢔6d J%JySNVX!цJ(wu.8F#ӯYgէαCqNZSl+"~:R.snk۠ ':[ #Rep[uV7duݶ+¢tIT s iR U1mG;\:+T&g1ŋd4Uw .)^ R 1J E"DHu]OބnBkvFKD;}% ДBf6Mj'(xU %cu V$050 I#qXDnwrT\Xn8Зk;@7Xe^b jQנL٩<'F:LH%~fRUs뗵jtN=[a߲|$ŧ! 2OnLOސt[4Rsf4;&:(O&\E&V!ˏd ۗ"͇.Q cPq͆E{$HH>"~i6Z-v1NF›ZxeX?L}^|܆iˎ7J$&wu6J[:9w$vΦTCuL1JW!99yLOti2$x:CgAQUl2 ƍ<uNQ p9{9=,oľx챻f282ב$.xik:akjNc fHi IpC 05$Xy=V۝c;)|>!K&XCؔ>1ڂ̺6)UMF5Sz':-Z0+p?Z9dCFcc>!sH %D=Ot}b=1awraXsOg;Ӻ$WWK..4¿3C o6]<䳺u-gc;SʾHDdFxJF!v?nwP+֝8%G:^tOZc2\I2#>C y T4GlN7vRT&'ՔHUn˫GD?R$OM5'ӟidxщ7\lܭmhX 0>(m0i><)%{,Hl [z%Mo'"aZ;ytyGdgJZ7% G``ee beEcZ&Fr\㫝22g+V>-VV=؇vVhhH9a=|EZ{ #lqH=Ih,}313T5Zt5*cҹw|W6u1Pɬ7˸ZsDZs!}9V1qж9D84X4hiR:|%_P5PLJ⾙fX|T$Te9Bɔ~YktHoq437b; #2CLJ72d>*51hR<*R22ی@ޢ7[ԁ?beĞI0&%Wi#ǘ$2GÛe bqK<+zS‹MlkZwF +L D"HCS 7iw^K0+07q8,!10t0Gskm}/I[N!=}7=T<,C nkj@m suܫZ4qQ~U}3*c=g2 Cu7k*UuKI{qP'HˬN)㹵lşy Ć i?Ӣז#B{+®D#@x?ڣ4ʆ.uyBX}pOea :c诖.q7[RهI~?ߏA%wJ-}pjAp`Ru 7ߥwTz̩Gە&nA/s;k#cRܛq /s}k 248o <~ 1X 'Hym`5;4?N M~Ne]2W@|-۸hL;Q,|c~B'$VQᔾ&N1)+Nc Qiݿ_[պF }:sqNUӶ Ev6 60ޥ;\#[$qw`F\=Ϗ84\ﹿ5\@Bګ5QiTk찾5 ˛gZ~84捧g!:\W)h=iY{ 5yPcZLj oZgS ʓKĵ-C;fU>`q-]ڹ0gf567Nރ5t9 c{U;ޫYS06IT7mgǕפ] NCemOphM=Ze$juYtיͧV#?+twi8ߐj×b6ZM>#Pj]-dĎ\z #Ϊx"gO)ac4b0H㫕YeXOe}a&Z?5# ;q_(d tFg?.GY>Ẳ8oy>Et` lvyP_靭f sB4),'+,1$Ɓv;ib`*p 6}Y"jtwEUYqqzmÄG5qvC'W*+3z\ڲ:OteUۣJEW'+.(˄ǰ!qTdþTӇG7$-emο]cg?-ѷEc>?E΅?8HRh*E'uX]!"ƆpnLA L&co66_B'Tm0,ƽԼ3-S1`OS^7P!NJ&o²7suiTK4V( ~|::N#Ihneט m};ݨ}unc&=3KՏE#nn5T+d ՘|{n溁:)x#*}?4fT4p2ˈK_:1k@F4Azme-*;S S-CyUs:8z8t)se30H\<>`c b$x8Y,!'[TC<+'D;qj~wa}h]vUc/ű_'U.k7ч<)5iБV[?$OLG~d|gAf빯:4?䭞uC5580%&ְȰw%3wxVSyt!F踐

I|T P!4xYy4;ʯ~=tĖ>$7HF:F@h5#Wqfg?]NGMkI-P̢NL؏vP~@3CXk?!]E3VčR\wwS`ٻ|O>`x9xU.Ʊ>Kο{__vh dƘcpQSck;.oDfE}"S-A*F-Ԉ!#V1CNȝͳ\Pμ:IW쫝kj W԰~ +VyޫDjVg¿EA+H-b`t} ߊږg๋mlğ.b\f8~ipxhMwߕ<^cIT/Gq:/w`_rn's?許fCM>=j>u]Sjl%~kC֙@ct؛CSsbk9 p֮xixGZM>*NJ;6ZXة)(Ac$-:K+RέX$5k6VhL視bbb~f$:tmW% Z_VO&a'6DT3zqƻPeWٰ?EWO 0b4"H("A4101ʹAkn{2#%D\>eFEGWSVea{r0xaMsQ+E5wg[vxF~|x()q 2_49˄F^1 yIiCOd8v SMdV}~+֒f;;R7锇/;Ka& % Ʊd~{?rn{8w>:sY#OWrV;vdT6V#:.&G q gdF~wYTӯKXltqtV;wT>^ 8/5n[jvM2[K?7S+X̊ǝ`uw4lx7rjCL:^rZXv>?CqhRhZ-!c/M7Z$zvz6c1js,iv<:r-i*Ir߸x|Ŵrz.F1j x;[/p1hs]wBjZ].n-mTo 9͢tȥd7xҵ#wmrk=Y>WC#yrWCyB˶w̵Pų>{Hiם}wv ԠՍğHQHzNz3)7<HU5a>cR;@?W2N"F)…Xج@ʘ%׋]!X.< %M'b[\4|)챥i 9c87`q:(c_]B{`Gg\s#uf+} ޒO}x"E xe*2'≸IWC$:H.RI$$IJI$I$RI$'> I($I2IBI)I$II&I$RI$$$I&NHRI$2t%)$Lt)I$dI%)$I2t%)$LI$$I$I)I$dIJI$S'))I$dI$)$I$IJI$I$RI$I$I$铤$I$I)I$I$JRI$I$I$I$$I'L%)$I$IJI$I$ARI$I$TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$2t)I$I$HRI$I$I-?rZoŏ垵?TjoVjtN?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$p.IGF9[O9<(`L|Ռ`R"1jj'Z죻mzPup>KN$@ D\LY /ITI^k{Y[4M ia'摮>T %I$UhA*MԚUmvx( uvq }`Ր~`IZ{SO(72u>Z$ KD#CUL,2yԪm(Fb[/3/.7_%DApGk1Nk ˄LwM,zGɋ 9|DҪ]kK:t"@s<}#.2õocjik-T2:mtV( llxo9TE;g6Kr-G>ab08Umaq33QCunaAA%A4']fw mškáh"=Pe#v6% 9] ŵX}OMdug0O 3`A;(B#=U ~sHpqgsߔnɝVv^ORQpd 7_quxz: ,wi dYX|vZA'wAUĀT[20Wx)͹Xu=HIm uA =ye*Rn֙Fe{ S#\X($t_KgOkN65+}!WV^CdG YFX-PpOu}۽Hqse*Si2uѲj7 QN1#oKTԄhݣ; >sOJpn3~l@AWlh5s~t 8Us"<Jpkɡ?hr3p݈v20`HNY@X1_UOAZ׋Ƕ7GNô*1B]p`>>-[1&vuh7-nü~-KLّ׷n1H]}/*?UhٷY;UKfܢ0KthFg= q(P$h Ѱ:LG%^#g5?ڌ?\@~st?W'f eSōT4s^dy~jJnJ 8߆,i[}|ŖHI8ot'*r9m^F^t;N>XHdrF׳U-VDBW#gU \5kϠ?ѶW;pM} ?41XtxҴ;iIo雩j舅 !gpV;ahά>ѧ?35Wې[)@Np˂`~F"n!役 _goq~(2X]WWpl_9ToqCkysq"j-5hIfzk5+Gh` }"u򱅔k7?k4Yy?,pD[$ >WtGcX¨n׈$ifauX t :y=yGqu.kOƿ"m@-=bz!~vy3[m*HZk^܏g[h6ɜ%Et lׇ_PӼUT]7+A<5 *V pm he?C?""+sn5 X>W bq旨>Ikĺ{c&߹,h A>%YGfv]vi5647}^:}eb7ZR?em{@D5>Uz'W5浢CͲɰǮSv0@xb3eBSiʬL΢)!2K}ڪ$2~jneJUIp 1ʆC-hK)ŭmHM~`E`-sȦQz)c(@O?Op5 >n;HH |MYkx,LF;|]@ ;H"xR ~hKa1Śrˏ^VV+lʭP$-c FED\cp,<ϗ]v5Yδ9V=+]O:VV}!gLwLc =>GD]>ԞOio ps>շX~(jL+JIDmcxgI}4A?$ullw.PEߙSbA TS}ُ)qяؑ6coȄ 7KvAf^^|;+~f< >8e%/H 2>q(c:xoE[nC?M=iɗYGAjQP;!)`zquP1˯I_857̐]#G}nP@WAfepuipeb+{XK%?փ=9nH{}#c+tm gjdߐbZ Ku:%;߼~Gޱ-__s+.oncyұxbwjs^'2qxӔ!<´%Extp%f,PK/cnA:$1" Z('(qFZ}?x:0Ǻ.s )pImKl)Bg NT.a;A+e7Z{6'y#CՄCDỌxnǬ-2]R_:d6xkn$P*#?]Œ+a:xY,0D" <)ⓛ*6Jb )rpC8,k1p\CPy غ5&SC4lrkUc>;};_VLJYlwV ~ڶR֒Z %7$ͲbLJt׸8~#GdrCbh{'T&8~*ˈd'M~H' \;rӠoRiy5]MƟzN VЬ}bI, *OĕFC LI\1[].NkOfPgMX@\NEn#",OtHG :~[ᬨ ^ʄ j7?9+Amb]Yhom/?Jd/)09;*|og⻩XT@#(X~Fl~1j{Nq#Ë sMWNNNph̩hM6xGӫg몠F+~pqLƻy|xSmzUV^68 =om $ M79C"xa) #@ˆAYk ݬC{ um(خ+"Dwt[OSr~x1Z?Xi nL?p䆱?<9i@SUc󨂃n#%511lm`VwZqa эDਾ 8%%l[C X[تjt.U_o-=QJff< (2ȿMUe92Y1cTqm,7o4j%Y?vպ%m6 (0hK d5/n`;G7Kl/wYRo?isMcaQgRȗk]LX!f݌~PJ_46~R dRI#1!L FqCIa(O5d%&3SdZ]4<ʜ.۩a_ru:* u.>XfHDjW)%>m+cuT"xr1 w)r5QW1n4'V,4eao欂J6 x5o踗q4f-gio^S6оA[ipk!=yWQn!G<v.>F tYҌT,{Au2n5wmfsu{n<|LOWqh (@u~upQԠ((Whpzu²iӤn^1({k§ fcj-V߽Ob\roUG-3?wKHeR2$SD CГN[xϧr)vӜ#Ce]K,2cw@?ݺ5Fǯ!ѹBOuS ww>ilheg<<9(L~_'$I$duqۂhZ5+ccdA-FZY ƋIjuiLMۑIţ$$ɩRI$I$I$:I)I$dAJI$L2JRI$I$I$:dI$$)I$I$JRI$2dI2dRI$'LI$I$$II$I$I%)$I$IJI$'<&O%)$LI$$I$I)I$I$JRI$I$I$2tI$I%)$I$IJI$I$RI$I$I$铤$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$2I$RI$I$TI$I$$I&N%)$I2I$$I$I!I$I$JRI$:=huY?+zˇQY5:?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$s_Odh"Rv I$ŸJOx$~OXqmc~b:}_njh.R͘d(BHM2zm z1@AͶXCLUcGvrI$VCq3&h}U'ic7)K,7H(5mI:|IF-mi}  =8 XJD'~kBIL>h# &J58UUƿb%>ÒGrSJmʶ]%%g2?Z/% lsN>TM6dž>%*ƪ.ptV*gx=s=kU~)qwCfg:xBu@"nOf|ʨ|@ps aQS˜(3rf%)F|_mL4*3!,|da ySކO%wV[TQctʘ BJM#rl5w1_a==BF+q+h_~j tLa2FS:G2[?ީ&Vm9a2Oo͖t$%un4 1j2˜%G_KuGT[\ :<17OɭKǏMy55JFR"_RkzR&|6kuR hTҙa $½5I_齼R,6e>滴k-{ Kh2%RXd7 U)._Z'X-Xa{DP m.)}ڶ|a i7̌gI)ps?iHOdŭ/Q/Oaiq\G⾆Cj,!/A=>sn8?//ٜ_kGy94zd#^sp78ZI mRZ%դa\ih#Z6Tm̤ei0{j>+kt5;{iHJ3R"xMbusin; bMيvpPisiS˯;^ HB\jwy'7&pdG)Na>Ih&1::cZA6څHUx4nA9!ctϊɎI&\~IAQsi2`17Է=x,еs. $UH)݇U'\,Ϭ5LqdOrGxh]0CLr0vka<+IT3ߺQF[n-sY␉Q!7ig/wߢ`Ŵ:;CAw:*k6 ''0[s)af*ud$n$8q}X{b9[?%։>A\&QƸ@tUs>eY.yc,{~M #%cgɪ#= yg9$x+ζ^fmrU:O!~Q˖?TʾZ)7j6]Oo,4WY8 #)e6Z=W~UodIʵu2'AπihC81glqcOk0}ě`t<][lo k"{堟KA<>Jw`b݄ 2I{E&eOL#MGiXRS)!ŎgNc88K.8H=7?q [c ?Y`k?;\ Ak;~bvF>E2@%R̆Gy 8K'/ `NIK-?h^LrDDYfP6u3ƾs\}U̬ ywY}1l%Y't}EI^ zElȝ=!5ӵ ޘq*CY#O.8Ю.D1̅ȖɰGwE)]v BX!9tjN[mC|M|HPDZvetVg3q:H^0++U17k!6@$be/q Ҝ5?7)7uZZmo/?gCݦ xމE^vz%spV:cw惒N-h(=^r1]7P|;# l$|1q5QYO~>*xA,_Ef7ikD 9ɛE0> rݍ`-* E ВjؑU;]Ai`[TӬڢm(5Z-clo)SYrХW3VyN$pWV!J {..='Rnognߠ:M;NXQps u6x $,~t_7G~T\  NQh[-p-${HwQ^CwVHyɭ?>0f?,l~h{UewSݭNh Ts 8ARc4wցXKGX%QkzgxsG\ڀ ptq+s:TQ.|dy?N690?]ӄ]Kts>j YNBڞ*j8 Zc |4AqfCA`O{(eMVvB@6"LXĵ:!NH:5 ;h$I$j@UY+XwTeH>mq8q#KھIc2_7G]Am~1@xukcsڟ5iVrTøRS#2d8$N8[DF8K܄G gq `֓=Мvׂ)@Χ Z~ۉ\VNQtNÏ:/>bE*uBQ媽͌+ms`:tp.8ccrc05ӡ](/obJ]WSpRژO)n 6Zb\o[aFSj phF7znB$zŀ9>jA;Z^aQ#@ p1d!S,BXӗ>He.}<(f9!phh" ?q5OL<;| X;BN`o륒zxX X$$L]ZzcLG*9?jeǔGʎz U6ZZ }] 'V>JgYeWaUr.Zxl~ sTQ"?Mf5n|sAnTuX"adO#7=PC\{c\}.s鱨8 <^FA<'3i-=11`!G@cX{~+/'[[˽7ˉӁ[%l7+̅~n cq1cI3/kn  'vCs L(>qھҺ!@ٰ#Zv<s) bxxpfyUg S£j1^GgVr5nc0Y]e̵;>tgxe!ҮH'[CO+}>cLZ={@+?Vo#<&rqb.G.p@$8ptQ 捠0!N@L_du|oVs#rB:Ŭ!F*eVi >}ZROHp 5BD}ng栦s1߁ZDiEW?9\!K'9O?+<nyBdqs#,n G p1}, 0a1ñ e߀?P`Z ~2sQ7qקDZ<]{~`gxZmi!80'EМ6N+n1&6I>aU#e#Ck3 bx%6\3nBa pQZ5Xu3;O3r\%8>tXm@<V` ]ihBxG\yC6S~F<o'&$)\Lt%$O[Ur^u.dMmro6?Z]Q$DK9Kh[2Ԯ]L 7Ťn[d6Ō9E+1}X6e\ t|Zx`qWZh9́sLJ\e'^:eCgWkƯ!J,NOeńc69y&IR 7hWmYq=+X/Wrsۍ>øT}g x`?zm\oƒGGenӵI*b]a=!K[ד.V۫I\GߒͼT|HdŎB_,lGMZxk %U-p-r5>}Iiobƫ EM' \֏"S2ʐt#΃\$j VxsI _hyJE\ߤˠ tfmWA 0Ò=dkU'gV\t.?z*$ 5Yy?WvK-W(oh>QZ2 kC+ {Dh a˫?>RAX#PKEmL msT>ɏt@Tl ˀS Eɜ8ba 0TFAܧt#%c,kDkWァ~\sW3 ?WOջpʓ*;\%q^P6Q U/UmWAʭO'oc͕LC%@9~1q?ɱ.dc Qփٳx=%Z'Zב3=uRs\ui­ԫҮl*(a8͗$cc OdƼ#iEQ 4@c\қ^7iFZB~TWYk;ґ>98g75o@χa'h!jIUi{+'ò-]%r#hGXpTGNm,qmMewvԙO@#^t&_,?<#Нw[nc]H`Z`Ӹ?hNe*Uh5i:/Kt$@%^[=JG< Ƹ{A/JVIp'ĕ_.`DenvE?<7Ѡ[1њp݉Y.?Ub"$C0 Z&' P YM˧Vvs,5[ L8?[ſr,̯x8>?ɱM |kLfɩvGq䏑HI;B>Oo oN}gG#eh0<\#HWAy>82>jVZਸ਼-uE]:;V*Xmg?aS_/JP>|ߤ[PA?˔]k8!ù-KYn?z,.k?IsV?Qwp`Ʌr77ΰ{_.@ ^6Oz|Ze8O_NeVwW-.;W=?&EN*a~r!1RkSsL2IZ:C]%8![lnpd(B! THD!D<A{<7 K6 k2+XD6r $cD<*t{VN Kc}?gq-;UIQ-Uw-Y˳RGT&s+8YWLik2{=_5ssY]7Ck ,7dZe,;)hOG_\]KVNLYhԴ;#t$NC$I2E$BI$IJI$I$RI$'LI$:dI$I%)$Lt)I$dIJI$QRLI&I$RI$ɓI&I"JRI$dRI$I$I$I%)$L&N9IJI$$I I$I$RI$I$I$I%)$I$IJI$I%I$I$JRI$I$I$I$$I'L%)$I$IJI$I$RI$I$I$I"$I$I)I$I$JRI$I$I$I$$I$I)I$IIJI$$I)I$I$HRI$I$I-?rZoŏ垵?TjoVjtN?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$6% i"$ge$ba:4hкƲQ~|}D=f/%GWۍ'/03OQ0uelMe$(5i6j|lt9FkI&JU>(N$Y xRhݪxI;i0 b?)L熉:B7u.*n{-Pd[Kid̦C6ܸDҢJAʁCkmk[j_[Z|l\a{ÿ5ֆt Cs'9Dy1|]l1D/c>#62Z4S[ 7<R'Jݧ`uAlܲ_iU\ >5uE@ (D~Lh2% uo{Z=Fmmanqⵃ+!'* c'k~thJ<_4f@rEkf7uWc˼Pǻ]`GDyYL{w4"7Z(s $T#< `jbRcq=N;*3a9}WѠF94;ﳹ.uB/;hRʬh{,̼1!GgyXn=]vkI:3iwk3ss̳[`ُ泬,quN;;]Kd?i@y<ܬ-k\LPݗ[bcE~mtCc{#]P3Vf6 4V:uuXV8G$5l/%cq~ [?נ0M9D6JlNU;z-.en-Z95i㊝O1v \K.c6`ZYdy|T2(ˇQ⽷y7d[=K-UYiHn[jvmG̫0V=TcnIGg}[4\%N?I@K-kf13trbq(G]qoI;e% Rns639Om`ӹWIgcSCV0'@>JvDŽVw8wjkmBN\vzU|txԶ ~*xlOsT24>_MX7C4#n?}{d?Wr_*g1MI$|&YYV=f?*rKH>@\qd{zed "A^N^T',FH@َMq%Z|n5:2|PҘ:{ςh]8{5 v@DD;OQ Yg" 0vJNC|`|v AݟՓիX-nZ jk~YP>ke^ݿ*WG.1= p?o-'ĩsձy2z;n:sk Щ׾ ik'=3)H"HVqB$FS'0VKZyjK[*Nkj_ (e=ǔONyR+> AC/(|Ff;l#(OFNpܦ>0B2>GGN qÕdfrM>>+t~꼼xD-\zknʆТZ?LIOskE3~S2y<-EA |4|qkԳÂvz?T<M-`>HJ\$m>V4F*(G!Lt'/Bd'xKzeȂcK\w`7:m6z􉯙乫>ښ챵䬛:Sn@wXǚGpe]bÓGQ6X6V8TwhxLy»lĬ5[K /4SCp[j(ࠉev /@@+3 ԈddsBpL~.<;Qs%PX% ѷ!c#ɄĢ%-T):Gp֗h%HbX߹Ukx>pd<'jX 2y$Q /*7os= g n{uA'-ޙ6ǴmǞIü@?(QNɷ_U)\A^5-w}ׇpx0VPF!?Eo<߼Z\@<Pn.-G34)5gsvd"[gFy&ُYy'hgЖ~?j X#s޼r#͊`$?4! Uv使JrhY;671z}W DJF31!MA)mb 5[±{J[ʋq)P,8APCrՊ(:C7$D~g۴rTV#ELoUڹ=LS+>ѱ>n!TEh"˿.i;1 5ʄ1P7>86^Xge21YYP=s 5iMVݭTh_Vӫe5rkr1c>T!Z5"#>M6◭eN ⴿ{a`{v?X6F q߲ϘNKƟ ȧS.h7Jպl3S~_I! 'qT{8f->*[TP#24pϚ2ߑZX}k&mX裷mta{%R\d~q 6ڙf3]}?{ \:HMЂ:9"pH w#rSkR=_lji,L1@C.A]#Xs#Ox"PQ7v-ʑЎ/ᢈY)go^#mMT߶W/6gmn3~ciw~UH3?b 5/%o' U69ѩ6uB87(~ ·1fe^,bsAq'+%499N E/>OHHDxa;1Iڰ/ȥߥcE9Ax?ꖫ>=PHVuy#M<䈳0b"ev!F̆Wwaƥ uP7d4-W4T h_C|U 3-8ǤR[2 gT$>K ea;|[;V&[2G0kmv Z|#aZLa+s hGe#q>6N>>h60˽~ִX.:@$pR:LU# LA ե;C\]V;[P4MջjIs|fPݕ7k|шs:xm+>EOp*-k^8?8}a/-f>ՙ^ 7~C64[G }y=F]GzDw+m6:R_K=G1L3{$ܬ^ԧuL5Q#IkgaYc}=Pt?8٫}|RϺ0dx^WzV#/ͯ_ZeBhVy&@Wѣ9D5s=KC@Mn#jnW{7rcP.khf\`7o041(qVy̫uͰdc ԭޛw̭k+~{N}vNɓ "G:X^b:(7 c0Uk2<x 4!YCZR{j5^v㢣cHƗ.x ȅƊCs\=$L 'D0qJܻ1=䝮2@}26v ^\|_%_9G$i)Rܗ5pI:Q}L{ N"1MŎG9uJe g/6`@29 v!tpY.6:kCIorVwZ-f?Bh-'"ҝNTrc_\2~nyسQF3#PTcLLا GȭY@!D9USV9 Hz~(Kt>ZLwV\C(631?zn~yU;]'ɣ>H"R"oKbB1GF?gɠeno _ tPGE f9(,=QvG*vt0~^.0yR#D$'\Ǟ"pF[\ȿiq>ö;FJl+'y}D>J/Kٕ[S0ARljKA*YQڲ0BSu^97eV_; Qc#R0:F<,y]_J'wܟ~b䬬rZ3 ы$ kߦ-7zsla箕4=C %Ha )‹T( ]:iNTHS*$$ӄ:AMBQPsUM3N tF!@.I!H%)$QIHRI$2M )I$dI%)$I$IJI$$2JRI$$RI$'I%)$L:I)I$dI I$&N%)$LI$$II$I$IJI$$I)I$I$JRI$nI$S'<&IJI$I$BI$I$I$I%)$I$IJI$:IRI$I$I$I$$I$I)I$I$JRI$$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$LI)I$dI%)$I$I I$I$RI%gXYC:\֧\?_ N?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$JuV\\`IJI$Xd*qWHf mw}K*AHF`  K/E湿rTF甔V VN).[vj-ϩ]JxY'oD`ME^9 rہxYKQDTO;!p2Ѯ" (w w' UcRGK?.aWp's3gDƹan>~ 19vHz G$% %fWI-q ȫZq>JlAй&rL@U,I$ܢm[MTR; װ||NHюP B^bӮԱ룊n@gSʭcu>'.Fƴn\}ʗ1G=A~5X8(R'1y?ʖNn] +tRޫ=7x4V33u?j+ KA"{&ve9$t&}zJݽ9x,PEMr~en5`#[At}.^]&?巋ܗɀ4>(]C+4ǷςU>'1qћd?Go0jh}0 ^Uo <|?s8 V?N=\}rq !YFjjBkM%խq<n{qtp.F!#GsWESrkwܜ[ikL؂nu, 9&R*ݥ\5U#@E878سK[TZǽo##rg)W$k"t1ZI?5Ա+־Vzl'o1j-` q;I>r@QGmib-`w?bb9nRm{\Ms}jx;5olsX+t[I"Xagߋu7шǞ?zd#xzb8oiܢ7o=;k{㶊#&ƈ~({\ ?"P=dg~;3O'Inr\u2%s{߇(ݔ}'Ul`x衘!Q} 4rJd^w;RSB'Y]>FFYvt_{8-"d}eښ^|xoUOxլgcP6S,H}_5qm9,S? E[>jeQcEy~\&ݏZPL"Sc9C4Pajk{ l& z.9`;B` /1vUBL&b (@jV- Dž"\R$<Ku>8{F .-D J$P=\@SoQG-7P'rtE? ]gEïw:+ ns煝#"GRDp9U~Ѓ8O%8m7ť>8#])y8#ť"5K^HJ )$W><o{>#5>̬W ?dƼf#mMߢSSm0<ռW wZW-sǻ9[Ojܸqǀd[%q5Ùwb6YYݵ@jJss=o6q'ĩ6з$y {u ȕn-%rg<2#](K"_; CϚRV(c|'+*Ϭc 'F B(wrm)3ЮJO_{I'ez!7Z/Pv88| zy%&'[!;XY`iK)j4d7ZPwBA$!qID;խų'a1刹W~9yβlkÈ3]Bp+)]pnu-xѯ)ʝ"?0C ׋VvT7=g6n<,k~TZCÜ cY)@1%ȉZ:Y=`DNKeAO2Un@!G 7s[#`25vAX:LtGeZ}C5XXerٍKꓵt/=үe}[i!ʳ03v )!#~YDp ~*.Jr~ *: } -ws#QKwY8--qܭdaQ /xuvЫJ8?d[^WAf1n ڜ(ϾOi {&xKMֱayֻGVޯuWCA+iu#*..5½ Ƅ) u<Ú9:Ij=6gXНl_ccVec\XV#ϔ= m.<(E$H?ڧ@ _&\D.Zho|[ = CZm2pa˒R&Pu/`0}{Zy䭒!2zpϥayWX<%1{lD *tl3_WXYPc@+/ ]k^9y`Il&K-aUZA 6! (;,"~OhKj&0#@n 1m>z[[̚I=I6Vq~1{AoyM<Լs0&@x c5 #uZ}/3[9GJxi%v߸dגefA¡;5Uf\~I2>GUtG#~Z$,;v䕃U7ճF!n6F֏Vۺ.)v'phZ8&Èǖ'I6\yޫ ֏ W>.;qmMɀRU"loBy{yM*$ m*%$ %,RNH5ty(LNFPh8PyQlvlYwuY Zx@G"!?5Rz/VC#~{pBW3ۑg,ۏY5 ]1~[cѰL+yo{Y.09Qn%N̪oZeoh@:kX9g[to`2݇\0GmI#Cc0$u%1>j`HU9Q,U f;+g?ڄ"h)cC}YdzV?"sƽ^HYzڵR!@8E[ǁ\#":gWW79V2[SjX!7&hUƻ ,,!%9(4 FO;ͥUu%y3M} .1U=A+hRWIx"@C|5 %daɷgG1U~ó m$!2$j291IfœPj<#ȁy;q,3䀇F5TJ"Iݘ w8~) &+5r5v+Bh(Tj`#ZR5S@hu>ޟWDl",@qʝL #^U 0R`/sl_$G"lxZ^Nzuߊ~eѫLmU&$3Gsy *IQ?*]9uNH(ÌdaҟXx23HO)RSD(ӄҝ@*d( 8CsPr\2 QN  ؄榐IANB!jjI$2-)$Q:I!I$&RLI&I$RI$I$I2I$I&)'LI&I:dI2I$$I%I$$$IN%)$I$IJI$$I)I$I$JRI$I$I%2QIJI$I$BI$I$I$I%)$I$IJI$NI%I$I$JRI$I$I$I$$I$I)I$I'IJI$I$RI$I$I$I%)$I$A I$I(I$I$IJI$I$RI$I2JRI$IBI)I$dI%)$I$I I$I$RI%gXYC:\֧\?_ Nd,d+XS1Kvo 7tʫ*$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$HR+K`RI&:r̗n]D-,^FM4Nҫf}#|no9.o}IJgPe~ vw`Fgd1xNFF()LR%D 'Z?fmo`rL >3ihkBԂc33ED9Bm'oJXѫA˞Dvו:.IN3AZ1u蘀~eC(%B]ae7CD #EG6SkZDJ(q uĪά;AKMqۓasu\㞮dXUIu;X5}F!N<kGPDյm2Ӳ3Z%e9v;8~Է;Ө;KRa'֞|qP6k%^ G+2Ө-j?ZX=! tZa6,`/Cy,}Fl%BQ#$H}QOӛgԫⓑIkXG,jXXbpzk4d֑jXOh> aR7}+A^ I0q=^cP -#[-xgYG> P9dt6lq*,9f/$UJAdSgnP-4J Naeuy$&Bdggh;8 lsn3$]vQ= qu= 6qjys(;*f|ko2ar؈b%z/?'O!yRn0ߩ=̽y-wq ?he-.ۆ U:NQ;G殄:5L8 Kd àa\Za܏jv[ 8:Vڣ^A-׏5ۤ(o*OPVRv=A\Gzά]=t{MNV'b)MvmXe ȳkO6Ut,C|dc6Oe FU1#.a^%}[Y[ggNwT|InT99!&|\ ״[0IkkP}~:(D&2T&-BmX O$[3%@T%hRmOuV΃aӄ#(drdp39 #q%HjQ)ya-"ZGpPYhUC?}]3܆xhebR'앶Gtb# "ϋ8L{F\w<8ˌ:1y|B JtV&OZ{c@{eTN\H[>wM НXf0" vT\{*Уe4EM[jsk3]k R ;DzߐŦ!(Xrы3C6pIar~Lئ}<TV* =uuw};gWp:|MP=6K>`+zkٹi0a 8p?`ѣY@xS#]Ci` [W2Z ]rcC3>աzc˛[LՌ6,+ppR͌/ p'ÇͶrk& s]*YVsN5E ݷ +c7C8OE67}';fS-`# z+ >pVĨme6[cqӳ{Pn]l]m}@-OOk_-asD'~Z ;2ӣNꍿ+O쇹&\V?N3S><*9 +Ŗ3V<(/рO M 짦'Jÿ_<{Hz{Iƍ+.v0:TjPNehk;CGh.:XWhܖgMSQzVc<4(Q<_?Q. t`?gZLˎƍ*OP{m-wIVMtT>GZ;84l]['r7}\8!F]u䚶o09V.7G* 'RN;G|]uOժˇU{o Soo+ t@nQh$rx>Xo&́CE52h칮qfys #O$/z{za؅gRN *l/&2Ǖj5G FuC?GX؏Y5ۣG?b32l'i5jEy]OїpTMGw1LZ-lk;Nft:m~G﮲q& :O}+9f!?/ G~k-nXui6t@^aBROOy`{ْvz=6u+c.j>6 -llzq[z|@ׇ-"}^v)67}HC Š5)ת_$]?{cv Ԏ*pip+WGCAW\;Iɰ?zn}uRQj8嬤3)JXzaRn_@vj8#x$cфлK@?WhժqZųr{yI^c.(-lϚ-MBw .-hէLK"peNJ,s!nZedxL;TQ(VTG.Rhy}wQetKזmGc>YV̢ݗVI5mj-o,8W_,5Nx*.uj;niwE`_vX9W; Ce}bkIJ_XzamIIUXk趲^L:|qG`U{U{Zywzd~kzUt8趫Whs}Oh3(#ܗ2. UlTƿJLqO g4y{nmUQZwci v۶ݐ~jx}XHs͒2G2Ş3DOtj9|ILIiD:?~ '1χ۶~i ;gf;6S;yB\65)"c947ݢW7|v \in5]a7&GOL5ɮQT}=x:`NI?De;E\Y_Wrli5R %V39Ym1DŽ62ln*v+qr~w(ٕ{d黻Gk[ǟC96 K[clwRk,h[*>UofOFm߇~Џ+9YXC?g笙'Vp~Fu{xC܆qWh ݔZb&7"V=>#PȠx*;{fȢGpslwNn;hv!`6}!QoX{,o5;-`֗NoNI(oT6~Ы2yTQyj8Y/#ͣGԎǿZ 5X\6L6du ʋ[ƭ>qgiI=tx<:L95 ?a%d?<RzNjA;$pog <P.@I֌DL9gskDlzޑ~}+&?*IǏ.K GIUw~}w}I'8!fbK>6W'x*;q0G8ADn?՝G-V+\-<A:|cDy .]U~{nGSFR ~cc<~Y5`gem&H1kwA)Ѽp{5ϒߢp E9`85&bg!.L֤O-k:ʭs} KlĦNR"ա8MyQ)')BJ]$P*$) AD$ jJp VԔਧ 棹nl!HdE: $"BiB$I $I$IE$IE$RI$'I%)$LI2 RI$2tRI$ɓI&LSI I$&NJRI$2tRI$$JRI$$RI$I$I$I%)$NS1%)$LI$$I$I)I$I$JRI$I'I*I$'LRRI$I$I$I%)$I$IJI$I$RI$NI$I$$I$I)I$I$JRI$I$RI$I$I$I%)$I$IJI$$ I$:dI$$IRI$I$I$I$$KC:\և[ucgO3Sd,d+XS1Kvo 7:J*$dI%)$I$IJI$I$RI$I$I$I%)$I$ָ1\LRI2z(~Cu 1ܸpFgN=rt;G1_"}݂ c7Sc?HS X$&.VJ΁\w&%)C}+7iꥵhE R B0vd=ˀ 'ߪ }n \5:Y4?487DgsqZD%uMwJM9Cs0g Q% ;U]Ŏb8Z~㘐``xyO;rh 0}u6;\nؓRe"b9&]N[LہrU#zsc]P~.OZF:ү( @y9}7kZZdƫ2G&}N#GQ`k%2O*Tw[9'|p8[6XIUlk\y"S;4LDU^.s{,<Ͽ:sP4n ʦ*uȪ9yb_">J|!+g?Ĉ~D:}H'FT=F46j3h;PfER7 js{qiq9Tֱt4QFR2Ṿ'fQIXƴF!HaV5IV鷀O7{S<5={ QO絿Y\9L,%_R=?3kcVx9:xDZPէzo2hhG\{j`"G=\ǂ<~U^cCHߢ0C{ƾam/lD:(TR\K`:jb =E@'R@yU7|FXsOTf6VsT1gQe4H](ƎZ=6{&-HR>=.$ɁZX]# 4Kl:Â29 'DG8_*4B B,K;S G/E1j}iauΎ>s4s/cۄv@H(\6{mdn'c Wh^g94F1GQ)<5A +ݝ[%Y{ThǬ[{jY5rM(}J>[k%HpKE%MOȤ%A^JzoT_E? ӛ}{ti/ .OŎ6\ i#b gw!BvwYDolyկ!W(`0^cx; h yeU ws{}փyJ^A]3H?r8=V'K;1rkgQU|(`o_gn G 5̭iX}"^1u 'QSt?VB$ݔ4OѬ$T6I&48›ϙj3k}cjgu?ضjīMwNƴia8VnRZͥ}RUv%˄d;m rW62hn}Pxi&5 9UFv.?E9lnk?)N%dYȰ,f_~C0Z;y|"iækcZ|@cUP]&mLg- њ\y$BzmM `OKtS8ꪷN(NO>Qh:V6F4>VmXˣ=AkfAj1 e2jdڡH(N綱|,;zHq]w hBį]cNʇ^ŌǯxU4r d}SS+oUy( Kd<]7_< 9{jmFToFwwfj@6eƌak[ܜ#z+CD;hi$@DkK|rKlxb;qsMdu.e$;T%]~R(5 U%ڞvxQvU-!~eN-c}Wjs_LQ!Javm̩6Ɵ OsB2#yn}6pHڔpHJ$NF^cx69<ˆ-VvNْevJܾn5 bFv=Xvpv֘ozk@Q"?{aszDdeI1DH'@c0I)"-ygM8GoM OiQt,<T`&-'KL& WlcO?GX,%MTցSQ2D X#Fy_8HJ!89::f;:]Dj-ĭέƴh$7颜f:.<~cl< |(2Xe.,׺sX.Wqsk&>oCHuIi#&LL>ܶ2=|ߧ[CAU}w ]߅_;yD]kqdvVuemae'⢱g +H̖A;> WWpfmfts$O1if2#;㻷d*Gs"kk'qXŬU_O$HwOӿ(\'sd$R;==ʂg1Lp:&5{RV+u ڲ-ٖTێCoSuͫ@_WqtNz݊sēcV5"Q ӔIț\K?Bu?MTkRs~_N5a `۬^zmѪ4@Gpp2\KvhNT$L5S6 澱`}'(jKN'6?r&?b*#*;]ҹMH}*]kkE3C>w/C՜r/}U̒th㌆XޒStPh>;lO5Ptrh>%;#P'c['˳\K_f\Mƻѹ~:?C+h)duF< %fC5 2T% 1 ǐSRxVJ* cְCy{X(rW5H rDJ&?(؎LjAJ\>!r4|TWc߹Ɵ*Ww-$#12|5 'nwR;^*w`c/1\;VS:D egK{tQM)de^e/'Ҙ'Ffĭ8!j̢O),*\챦DA+w]gYѬ) \2T`Ka@! OwAKTkKl sqۻwފK^?iZṬ Dh;#,g N\(uqa ţX0}&H6v5 XwHRI c(%Jeܜ?3Fdݎq;tϷ;QHƉ⛏s[Ӌ ׃WQ g0Փ^Os`<}%L7_sسz]@x=rYrxL;ǒ3g~%n "c<3cV!׏f}˙6m#3?z9 vwq).cjJރ uDs?!*٨k=Uר=˥ |8֣r4pX@@dDĥ/~DQծ&,zi:v΁KO>#Ó)c0Xd~L?+[!A8U:dž5܉鲖8[a H[_ߏ"ՐnC]="d6~ge>]o/ϙ($1!``pKaEaݏ?a,~Nq×?45kN㷀k$?tZߘHAVCϒdO[mg5_8d5hC.qPw)rAl' x.3Б#͖>PkC@h-TIkÚ8=nṄ9-?0G),bΚa%D$D8:>] Pծ*?5?q Nu cV¸Hj[Akv&"Qu&?4PFdu.jwڱt?p}c.p7{keFXR ~zU'e͌|䞫@I *seɌFHP=x6a?ʃ8j3z-؎p2i;Q˺]ܷfs,w+Y_l.h Vf ͖iWK>x(zO/+pqʭLۻ`jj4< 2t?(.#l' Ja5&kId5&)&fΞikY_4"$S0W 2C&P}>CyyJMvA-g rpq}*YaK"Lr˗9)a u&"|8hQ2ɯ:xw?l"4aOd}5%*\{õXH!x _N5>^S-?@aۓ{'qhRNj[nݜptlVֆp0ߤ kciUKIUH4Wv]O~SiP|Zxcc֏LKG`Db,dףF?Ƭީk¬y.֜{rv6.Slk<9} W"UdY?6eHD_zSE2 j(ض? ꅘzQ[0!1G޶2z4w!_!49}ϑZ$(!^b9 MȤc%Ų\ݮN7+V9^;*mk%\>@v~ɮOi}jQ(c2ayxXMV87ni?9s-`c;VYgHsаp?{7~z9b.ߤ 2#sOwLć<ǵQpuB$dH#Y+dDk|8qgQy`yL9b2 8Ê_ya'x#~iƽGht<qױ P{L'h(hrG ##/?Ys25v쐐KN晰BFmY,a4Zy }A==W!i2{Nx7,\`ٽE,-&f\~KC6[}7mAO+KS.q;KDx,`E>2j熉qqhO> %bgxgprt>hF$1CaX6%qv5xG}gŘ yFbGb <|a?OT?rkH #IFK&ZX^snˏd x{,q?r]UMs,kġ[2?VI#QgĎ@Rm,C]XsNj,\AtRFircViȨT2Z|NZYdyHe'VB9dVW®Z%,R9>?A,"<;;?Vp92zeJ1c%no`~*"W8zۑ@NGeTF?7mPZ|u c-EZ31 =0F(wƱE,Ö5ͳƻ?}?鹍̯tCK.. GEVkUP#˕Z:;vS"?poACqUy*`c_i*(iqt 7O H=V*ϱ.loZ#*Gmq'(cw˫o7$x:~d! 9ŀ4uP 'u\GӈYy2̫Ik'GW-?oeQ@[ A&|gxE2C|C]?fF:>P^K]l ڶjunIFOj2w LJ;:PKv:'KGq #T -ǐd2xHY.>R\oXhORֻ.WgcO&t+ox:~h'䟽/EpRߒ詥9l1d`hr<ħl\q"xs>6_!yż27^/%E\;3剜 Fe\XGCI#̍zԘ#Ro#_?oOwgG(p6W--_1AxCxgcf?Ln sA@JZϣ?՛VmwS2?qlӔnspHڄ02.%~,k'OPK#13n|^'oechh 8L`loYשf D %FgUT?8%4\_R$eg{]*x@kO2XeLSDv˿O2ܱ:o s8-wt{,lGrBPLy=[ǟ{Tb ,Sa2od}_ǤAjҮZx!I4t%1jcQ4dI p}Cմc[ϛHI)̏,5"!CiUb״n<\`(Ӧ-ߖջugOX~ [Vh,֞`|=p߹T>)՞]U].-2وw3ߐac{UMFCY~JX^a1u>k&aӴ"`Bɴiλ.kL\ģe!6sU\"5LD+3o*_s!LT$uL!*0.ub7F ;=Uzpz Qr:&k U^`"W+Y_sn^th.Di=GuZ/hi/ G?1k UC m[Yz`UGXqeտXg%s]R0 0ᑌGzdaeWU'U uguV58B5!u.vUlf8GEwYPhh^GWSu d|Y`}dZ&5h>JJ3ZlFR8RTue`>%!>%Yf.5NǹiWb;G b8O6rr񜸇]Œ^?Yqn*) 8XVqYk8h%E )Qdelea"Iԥ By ò䣦E(H&s給5/b`Bɐ W8)52qr2OH挔3c,Vϴ$2<ӑE SxsXs]fW|ud"q .IQkv5B7K? XfUm%p oIʞ=!{o',ٿlc63'_ъ"<~* .юOޝX;Dȋ< AL.'1I:N \VMY,1O)O`<І^m!~御mb9 ])>J7g=vo?I痘Ռs8Z-2ϲ3P~ӯȡW's}zt7wEtSժq2:F!1x)%^x ujvXLG*aϤ-~itNrPs5%Y>0U[4 CոEWdpPa[a pUU3fs+axv1 ?zq3PT]Ŏ|`kJI"`zOn}[S+7E#zzM&w$-^`C_QH#81Oja!]eHEոDGVW.EΏw=m\&qd Z|uhe7 +F8Y[]v5hÁ"KH9D#^eV< 華Krim N|7@q+5܎57LLȊHcGaH8a4ljEeVHXoլ{5d%zrO|6dž3ZǔgՐ yВ8Io015nU UY&m12DnJ>'s}GFYf:*||y^L81GhgV܉ zWA㺼Nco]K";TACw3vS63G-8^Cǵ7G[ '.8e W#'EyԞWζ ,YWp?ʗKcpm5K;o ofDnÇ?b~c٣`V-"n۳PUJv8~R4B UPihjy-{ ~nexx'zX&u?EfqZgr֒a>I : BEtU g{Zuu ,?έ_OdSX=cZndu?Eŏ y#`Y'7;3W%XA(N)}Jsa3G_M#Xl|ZPbzVD i1!C"4n?n$C]8 V$lrKzœ&y3hǀ^Mb|P:j4ʽK_Pƴ,i?oExvZ&(#KOܬ&sY ۣOo" ckh+VKdINK.:+xvgۻK@g7-Ո L^"@"VzoRr1&&KwiRh#iU`r2xJ"2:i1=|Q򃀮&H$U5?? Gf\[ *Ucsra%g9{1{GB5NhȶôCb5G[U|TvrwpG0S=];xJq߉cۅ- d\tL\ʝXZ4rS91gP׎?4 %uߑW*)un~#LWe=>!\(?|'OܛlX!ݕWµxァJopV_YNì}7ͰX8ǃqy&4z2x u}Nűv`:.WcLnJ8:lwq??9?3Rrp"5*ik>*|!@cA!YY~U3B>bzT#:T-G * 6yx& *O*t`J 3*gRRR";S"fYU3zmY#M|]l|`Wʶ']Ip:GMvkÜ?D9>+̫ 0wURZ+` hWSȷxx4!~08aL6R$'%nkF'egu{L 4=K!agʘ6s&| YE9"s)YKY)% =O?[G}S1lZ=2?!q}hؿV꬇Z!hC0+&),9DG'9B$TlxcKmeQGIϢG(%#ssFsx)K:|QkE :^6Ϡ68OӪlX5試S27U Gi<{ߥG<=LYDe;7 r9{~i<ب|s>Q.ogAۍ=ۭ˴UMw$ [.Pp< d4- k_8쐖ar \٠]IvKy͍G50d"2FMɚ3K`9Y?oi Gk68*".ϩ{C"PMqmr(xسXiƊ^rTJ:^(߹zmlD'hhRb@NM%,x5GI䒣 xOe #Wq~[\6懏jo:P X4c4 Ydqo!ױkq3*37cŜЄVHDŽkr͚Sz98G&VYָk} h|9C[8\c9Тіg!WXz-v|*CEl4+rg$LOf q=3+v4ЦsǸ*S  ?zҺ}FÇva}3k NȂl A=çPҙ񔓵ʜBAffWwHp?rQH@YX7(q!h9Lj%_YE,S2ۂ2(,'F(2-S)HɧU^YsvXk;ه6.`9p5tBhRC)vaˆ9F7$#f\*)0Ʒ-jZ4ں,;=zޙE=kiVkkXݭ<1qHwٟOG};H) Oѝ< TG^ѳwL@P $8c|6r.+:Kul ш{,uw}-~eW-Nh;캘j@ plr K8Yp8K"x*54>`x-vNXkA=Y}^,X76(%OVHKo1yO겞_ѱE_#'v1DϑBsKtv)*b,lf4o !;l[DTr*1RMy:@`2KK?b17A)E{̓  12{[=&Gm>U?UՕv}Gk-'O:mN(LOP&C82K;tjZ:#q#IL>c0~ 8YA!- [^K6&,3A$<k|WjG'@A-2 .g;:ׯ7?m-C@q]cNg)0\gb,xUI'\dX_Yd:?zey-rF5Z]FԬN ؓ:6FP xHoo竐0$xOVLg&S(1?$̀/<HuKvH{q > 4jTU%yUU\DGsqet4yd}Sܘ@uDڠsa1&r2G҆ Iā_78d1kvvh#orY4~74'FfC n.?=@e:ٵ`בgޥ׳eGC}?a6#w`ԫnӱGs\֝ pJ,<]QthVNǵݯ93GJԿsZLtq]56 !@ e%L{ٛ(oM/k7.R'I$IFʤLDY 4k2l88H uU[w`|yHln}!Cp%[Ä,qqkyQgmx;\;_ެLÄKshiLexrcr q`ϏK7PH:؊0ZA:?cCwNA+Yc1WVƆOE*͕9tSEP]ˏ3ݟG[w2#n4ո!PjU\>)9A׊^~A?r\ 7H2|OZ:Ol5Yqsokj8f - d"1,n[Z6H%4JHnOZ׸[pXw)Xk~UXmphNs!r'!ٶ~@o:1DVtIKKϵVcf<1Ո ;q\uq?7?T_!#`.jk9al}HpL?0n&ݯ]ί[875^Z{..̀=6I*78 >OJ2> AG! d 'n؅@\ZaTE, ;gƽ bߋ]!1'o8:h{,@ޱڱNiayR7R.@q"ʫn|Q)x-Ьr\c]^eG0#6Y`LDpX 0ɟ$A5#Ą;ns|6gwa֭aX?E0( {k B3(,`ar,̮_Qpse_01CBLO5"(݂1'`46Nd*DmotD)QؑhYX>籶aw5ޢͲkƉ6Nux,9"  Qkh_@xk!Q Nv?;u[LOIq<4h(9{Χ9%a]%7kGW>eC$  _D??cՁ]3ZY ±㏦"U{t+mgIR%45p}W 0/_S̵l w=r!s`*i&lV;\Zd)XW8|};f]&[[C"SG}Myr&ǥVp ^hO},GS3iMtmn^#2?,Q3Іdo9R$uTq xVt Rv H%md/s` kG2@,lyu9`ampMRZ?wBwՊQ8*Hcɏ,zwM~nfWP *?D4mB۝l3Fn'}'Lj*o-w}]ǯc(O98c8OLv-`k(6h!cֆ'\뾲:1yOWk1U3kk:RW~Qv [Ķ{Ul\2|AЏn&Qj| U) 5gGJh7Ժ5a?mf$5SAAo367G8Bt-ZyދW$1bB'dΌ\H>G&od;>gC;q+:yJm7RfI׭c2Z {׹$oŰ :FStIX礷dao&}nA&8nc=45;rj"H,>KN\\s4k7ד05ntE`o3Wų =ըD% Epɮ\|X S2S૸3@$@[pƓBuAxA zb+8i'׏"nnib0e!?}uA9T3MuS7nD+U⽾iiV  Yc0\i8C.?}!vrszmƛ'Csx:䷱n钔]k%N:E2t():I$ܠ' Q)')R$dҐ9IKb3N$75 F*j d yQNP!@(diNB(8&I$I$IDR)$)$L9LI$S'H$J)'LI&I:bI&LS)!I$dIJI$&NJRI$$IJI$L2JRI$I$I$H$$I$%)$I$IJI$L2HRI$tI*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I:dRI$$JRI$I$I$I$$I&I$I:dBI$I$I$I%)$LI$$I$I!I$I$JRI$:=huY?+zˇQY5:d,d+XS1Kvo 7I*I&N%)$I$$$II$I$՞[^w1:3ܬ1&r*I%{-߫}%U͵h$)T/$>cݪٌ#!祒YKXL\tC%='Mm_LJoAęAM6?jq,uQE"vTѼ!3sûs@!TpB|B<(1w1@zD,a; *;rkKIK6ø iEƥvap*teڻ m5Zl' 9~N^\<njdG}|?y&H+3Y^Q#M oeC5wBj*K.+ʴ}"=V{\\X$5.?% $\8 DpagdO [X5<hu .Xbe6+pZ]%{wu,f ^U]zZ̓<1 I.SKe| b1 "~ʹڒVfE%6`U6N96urs>uMl c'$X!'[4''55=1 2%D4VϢ`ג=OF>*!)_ViH@j3(\U~ۏ 6w+ova㮚BjvߤXG_[uaviPXgj~;68Q1cͥX45WJ[-wq ҍC}z㺹aqct,ܖh s{&0 >EW2&$CLpjݭ&9UF~Vl$}C2Vwc!P0aRkœf9OXYf7ugQ<՚q2"k?Zl{oOgӆ1N"^j'&Xn`nEѵ ńF]zw? Σzqϣx8CYC&ɡˎ2CX,gx(eU5i<"`t$DYX?-.-r6+z0-m?SC,#)cp~( ghA5p`c}9P-yx4H> B0Gު ..0#j/v>׏50g>3],cx &fGY0r`MˏR1\CY|ܔˇ}Yc^ħ5:$?\|9QK?yhԷI4Qf؃kQɒRp,}9.Jٱff$X!a#|#TڍSiCn; *NM +tv#Ӎpé> ܒ.O2ų'GɵpE[kc =lJiH D0PΉ))& I<| Jl퀶;;GTF@>OSA,N) Zr6?J{ؙBt3FrKc>XoytGa &\b As@ֲрںkknDf]]ǵ2)1K$SX]졃V-2?Hёhv\ltA?_z6p14wLZJiX8;A GvɽjuDj֐8$+ZsjlEgSKn>vJ6>DKHPS9h{ ձrr֟~NӖ5Ƒ7,[vuVO#u2t 2NKIzeKH~Cdc\ʲZ59 cA TO3huG3ƧU"SmW3 T_XR׶h[kXo`ӻD{&_f@GNS'^u6NF +\:L}/b=Yj;rg(2OѷŧDA qFQ' k<$g|_yk_9}q?棚ō>PTmiP_K =̅\Lٹ(T{"dęS@`c\(#ʒd"9Is?Y),E*vs*5;C>I|V, @ߣVq]--@Rc 3D:f杯iOf3v?SE{=_7QO]'z\}2cąc]_L6󣆎{\Ys-nykb`<=p ?$pma *Ty|+%L~jˈ?T7q{)OM^(.ӛ!^0N9d'#;d^fn͜6IYmV?w2a~xNy.Y098ǙU4C֞*dw߱gLZkwaƐԄ̹p%ys|y76}$+hQ@+]eIƎZ}o/7??7*3 +g!&*bpq owVmw\;0[n~+wܹX,.v~ev"yc.9XD *#T \;lGD u$[Q~p[9W}G}YæR9#!IXD EЎ;G*@Y Du7?W1,X At{HF\"xЋhc9c L,.IE:u蠴 öXvWeq~a3.[/\N.F `iȮĎD&9$R<\?\L@q֡F{,29 ƉJGiMɭv J;?u8>~IӱfEmp, 1ÖM-w4i qK!sL%2a3NTn1*CfuLVܶh82`v~b}p[4SNYgr5` sڑ8K߇DM_J 67^k-d Smn:,p?ծdaӖݖ4۱ aŵ-op[tg\wSn~Tͻf~(lyt*je< {s/-$v'1Xvyi3H|]Y=+^ZƖF?PQ0F0ř$:_Gp o`-kvYQOƑ)W^dG*Ow|^[l92! 6~*Jmd,o?W~E ˇ:FzSKaU,<^}0Eu>Ӄ„"? 6PL$;2+7W=:c<{ ZmC;˿.HsBSݕ]E.K{3v6? [E(_؁htv s棙Ɍ{:LԭvxL^. UUn~+P+8l*2\NѨ9G6~܍V} xHi/A<7I +[vJU\xȨz%I:,~k:em\VnoWw`܇Zf}d? Xs$ĸZ{w-t2Lx'G+,^eÀIےֲtk-?gOq Xsk`idA`_ċ*`| c[ >#IJwO?-AY9dC;ga.s'ݳ4lCSC?R/52'1M`4  T3M[k]?#@4U~wLmm u.#l=2G-{ڳpQ5۸yW,K6޾J%=yXeB^1oF8rF5SC3Z6PUe9h,#ߊGy6,{iI&NӠ25KRMky7_{3oY䀄jK1X ebpcMoisy(jv}ӧR`|S7˭Cq>Og;C{y;gj1-xoBQٍ0#h$@Yf&bkpjX$hxB~*?]k-BK&2:Ma>`{>O՟8ޘxjO$dd~E$b|b1߸Q:WY: K_feX#@! io?\9sJr߆?4Lp@J U"tEfWaĵGީt~k{M^3uhQF#|f.W[TKrX"<J}f/c#z^sn&{ %-~P͓I%-4 i2wVZϪ,/OVVA sO.n613Ç;?jWݧ}]G%=N<(>$KO\dy b-&#BֹH]7 [D9ŇZ xxdqEZM'߸wM#ޟ>\oud9XZ{NGahÛ<;[nksdC*5`̚k [:* sChJsE,qi۠ $ʋdndOwϰj9?gLGQqB\9q2 =Es ';UHټ:u}t!e4ug{-kCpzl?m=:׊U[""$xo02a%Ʌ8@L}QqUo1nobѩ͹Z|vPzM\x&z07-)d~M? =Ntr%H7L%nݒ5g3Q. 9V$v$j?wj5?J0ZoUva`򑄲 #!H1eՈOȣ4P?DG*lH䡇oؚ0:1ߚUzIe4h+899l5cCO`F; .-N1VJ@LJJJ_~&=·x!2ưkI>$9WqT"*v#_gEm@}F?B`LVhF㸒{dX x(^N%du\Y^8 o?5cQl6s}F\:WՀ✮AZDz#9|ς{5pS>CUU:I]~ a4Jsxt{4rTf2z1w9R p-vQ6`UL7V EPq~GCyt]fKo殹0)WUϪ!#OCoO`T%yΘ)h;_"ه,YZCsx:YKMᣀ->aEDY QFITQNnU7p~b:V~1H5qdC%䴴<W/ӖwXwgYPB`&'MW:x!sHAɯEnU'OIT4y Lv2m{c3m5ɬ1m +OGrֻfj[ .+KZH!P_e۠Lqh7[d̓68 e_'HvapI,#]'3ۏ.T:81A݌|9>N~iW3 8,[Uhnp5Y~*\,/RίkQV.15ig;u_D?NёZAƬw#(a:cBI#Sp8D|tÇu!lն=N|W9f'?/[{j18BP5~'6uWy H5H5[Ϥrd]`zY{E>Ab8:qˌ5_ +Nn,Q6[oFu {^8mw=g҂ +Xu#gteA_Zteyo)(5ƣN>9Rs]D<CŃ<qr)KyT6-UvM[p$ɔQPRI$2II4&J]$QI9L2t) I&铡e(8$yQNKTEpP!0IB! $ $J)dI4&RM !I$I$$IdI2I$I&L))I$d$$IN%)$LI$$I$I)I$dI%)$I$IJI$2E%)$I$IJI$I$RI$I%)$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$ RI$$BI$$IRI$I$I$I$$I$I)I$I$JRI$$IJI$I$BI$I$IhuY?+zγ,~W,WSjud,d+XS1Kvo 7Ue]$LI$$I&N%)$I$LC٫aw},>ӽ CLGj,yDQ1:d'Z,K\rvwY54O>jc >\jKTcNPp.y>NOXv xD~bW{29 8/ES;*B48Vz^?xo(k2n$ypd?ߗ~BX뉳?fu&7Xxg:ׂ\Avs.<3Z4;tHB_kT@&uSzcD/JڎOuN-l8d;6~&_F{Z] \?6=8GDe9V3I["qIo1^J F-5`m2s~4Q@lT?⭐i A4>J8,k9:_:uαo.<},77Yq;OAnPv1`uKo0`vF[oڲ5 |L BvPax p,V6K20!H}]54(rÂUӣ6xkgi9nҾW=F}\}LG8Yw\F_hY lg'mEn׃ʸv$ ,IEW:x,WhY:ˢe^iM5C=T8 {ԡpcv(O]wV^#ત΅'c8䝖Nj3;ی;1]R9%SL^2)sؙ~{UNEV5>w$+%qq7 Gl~* hmi> x́#$+zE#`U2Zkeٓec}-΅;}kDܒ0i%U%./c; 4BI$Jַ;rqo{?$2Hٿ\L90Oя9Hq<'y$4 "S}g}`Cl(]KoieZTP 6HDǩ pKN xּ]-е,ua>҅qmѵ-HuI t[MFǚv;v]6z8 ]4< fQ!׉ P4QSnmxU2F[֩u|e9PYX9kW1b#g?\e\#Hm5**k*ZR$.!Cw?5,N?S ]}w~[[C ^rG]BMC' I~Y>XuU MP.=`jK5u {G +4CsIO(RC Y 8Ŭ#^c'~X5G•V/B4zwF ?]OUhمkFkO_b>{,{\4޹ܪC51>X&0G%J"Y`qd?C C79zARar漲#4&tk0ZlxZzܞD\\}C P]mmY6\WŌA>z|c"}^IHJ tnA5DJ)}fZQ%!M1t/~b.2yQ(YxUf7mc.w7[U}sTyecɆ95:Kc-V+X Uaet ] [wWx|gwEiو?,fYԭ=?) G ^wĒF$"C@k=]^'2\=Su3^=6grrp;(],kHf(NQDIp `iAiNyv[ճFR\Ka^}a?GJ?j$1V}VKӅ~ޟy?zRvK\;mqe5Ǽ7t;pk O]nښ' |ŀcrN*D!u2˪~^ҹvd>܋OsVE%=?sY$ 81GgG>mh{O,"c%bYCW11bGv#({TgޞAV=u|l t{e\\MT}ͱv'j}FWM ˿ܜ vl(K$ ^s?-P.H-\[a UǂV5K?RګTujdJzJ*.gt9>Kjp&K+fʁu;4A[p['[K\,[0<^[[u3&] k%j<,ۆ4wg(;\y#2mq%ڴMn ?@N35OIswrZ64gvXkxpP8dfT[qM4ŧ|TBe`yn!܀Vh7⽣ ra ?uMFǂA*_KkNI=:FGdԒֹ{ҺvHP(bs11vꙣhHă ]>F8N> mSk@Yҗ$uc":#xsxB I,O5uUqm\?qv4Zt!rKYKWїafEc#T0i|<6ۡdžA/ϲ^L=r$VdS}aCH!~U)$H_y1L?I*U7̷L4)}k56y|?࿨FfVkW-ӭttw5t FwefMĎU#;~JcZkK*j1ưˆڋ %H3erxd;&m̭c݁!IL{ȭ)l4| k7wvKυ$l ~qfa@<ܩ=Nrj\_}/%Dsh'ʭ*SxfnU dd |Jh1I>S)>Xa6Gޣ>(R<<xk~ThuE 6Oy?]y8A|eVd0)<-gF8N^$CKcuN1|hG%⊟g߬f<0?H8Y-,6GD=4vi(NѸQN#AZbcr_M1:7d ㍭<7k8< c1q swNT,17boi(TA#CrƇ9%aOĞZl}g%Lb&ZA 1+l2|T]CM8\eh5sK%7<)>,?v&Km\?V~-\*ϸOĕ,iߐ|5K¾bl?643~@ Yx:1(ħ'`$N9T8&o,As~+.hH5_#n*,>Ojs8P~:lO ɨN= ggOUR5~oqp:Yi6N5N0ᾝ;wBx_6,kcd~U:eeKqmo.23NϦ_TEԄHGfHDJL cnPaDu'{z8,N>濪 => ':Cl0^#Q(pod=)ϊ1puc9JNj ݮ&Ze|N||*{>K7?ݍaVߜ5}c#f׍Gr?n/hsOZ1Uzrߥ5}'`XAy߁ o ;Hbshh F\kqp6ˈ/:Ok~-%?.}C=J.`{Zߊ*տ|%K`ձʿH5 PPq,GR{,711%IJ!;6<44QstxZ ]OL h_2N0## g hpu5v9o7ŭiHTF=y?zrë{/ҋX:~)q QbhkR. B%a,hnkZ5qϋO_n@~ZN ̀\핂~8.~G?LlIu.>?)k?z,Q(zeͭf(,$#u2}7p![Q: Wqm̀x![ϸWuNhA߈(w Zcfu㴣,QLrT6OEzkWAZtpBݰ'_XGe5vީˏ;gqݖ˦ F߭)%)+, I RILIRI$ɓAJN:E2tȩI$I)$!D$%,$ZBR'D(BM! J(2BRI$t)I$d:hI I$$I)I$d $II$I1L1I I$&NIJI$&N%)$I$IJI$L2JRI$I$I) B<RRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$LI$$I$I!I$I$JRI$:=huY?+zˇQY5:d,d+XS1Kvo 72J*$I$JRI$dIJI$Z#חJk% Wa`%K0Z00~RiBdXosjƈӅS}8z~ ~iӇ 7> M@<+] $<倈=IakGeo9h ð'}m$Dlx2䙄b/BtCBb͌iqJί&@$WpwPIuib>J&K-am W1-,,˘ь^LJ8Jr.S w)kϛMNYxBcs{ied"[>J>F>` 8v* vsmX2&"=ˣ ρE$' "Iosηטa|kdbs[}gwwNqn-~cIU\=_J;g#>K;'"̵h?H󻱝'ZU&*AmFMP˪6'G*~u: @ xzEL8ܝ `|HFƷ?FwO8$ G+q+rt':cQ8dAs;W++s-S@M]Epȗ_6?V/tJ<>|:8hSkC?l][, ӁMuI֑-2xUdeog-kGۑYaTpn{=Fѣ@C&uSt ̗J@pv&X n` i~?MFl k1Oʣֳ=Awso6;":ô )Q" 1朰qHR<c5ǨݻwJzk[VuU?k_ [UC`\$SZLna?/f"\8Z>)n06~qܥ㌉LqF_cH t6}6m#EC2muJ.iI^:6h*@6 y)aZՕu$}Z;Vۙw3(Zww!Wca8Lls?C  dM<a#]L:<\+N>Ew2>Z{D}Nq˂Xw<Ut.n( Aoʕ7 Ä޿ahϟu\}a ш ̗L)kq NYyE\|oo߬ΉI,?v!t=3W=[~Bx'{c!YDj*a U  ̊+ I< S(=AX8;K (5ùsCyn1ܗ*뙍?OO|O㉠?f^ܤ V8~O]Yi wJ~[9%C(ޮӲgxkrF^={F6VouN][G5#_]VIO>VFOn ;i$JHQ}%J's մ?M崒xTg>9qC8X ;!&L@w)$ROۀrxOZ-0|Sƽ%:H$~ɫI9 FjMQS`%.LRTTR| J"$  T[4U7*=5#]5oQų-p+A?>|2e{`='VΡx.Į>N[+Q?YyKCK U`'SS}u q4̞[?=RdS4PeB@@Xk>& y|NjJLdvuSWpmax έ}$inK؆ y.??CVw~?*|f&Q']/J⦃ty!~;l%]3j AOi˙ &r7Z1ת2~)G*lY}g% #@}`bƧĬΥVN5;V9*"܉$W QV3^e:b4UQf {ݫ+ɿQWr#/Oi'U$\ȑ yL5);(8ʨQ0j%86 T宑 }J^[C'xgVE n8ng/߈MIx]eNmөOtvv9U0rHp{t93C?3m-͎1_M]nHnnْV<V}[fo{.ߣY#6WvUje ]#MM* Rv)͒ĪwZᄎ.?Vq,56SzV^:a#ǎr$ b֒u1*Ă c ﵺ87 k[=*83~Lǩ$K&FV,OHO:syT# INVQ)?ˏ `xifSrYaQMʖZg[@#R!kknh{sOp,r|2F)_V7OA4 |nlUi,o9̈́p#!?]0{ J8s>cH&68*n4=ZuKRNZH%C8k~dvCuI)mJepIT6UR4@cPڊD]ƺHߤ @ʬZ|c|1d\\uS"'@|Pnõ"y tEJ)I(DF[SK0),SJp;fC o Ϳ.; o_!-œUB'wPtmvw" z" d1ӴRs;sUΏ9!Qwym cnUmP1938BۙL%q@qj䉢e4)0)뵖h4?r!iW_NcwT*1ksp?tWQ8wEUˋQwosB=Mk0e}HTf@ŊpҔħU)«ۘw2{eBl 5J4{}$%=698m4I VÁR8U! 󎈬ix LXx .RrM 3 Yq_Y3w<wtC'^q. 7+_pl"|QO:t% T6>Xe?UzWL>ȍ# ]%(!q@NA%W9 w\~Btl[$52+2 BE~γ];W3Rj=n~]B$ߪDc/uKdr4(ZvS~)ٝ EI̓w.?הM:k:.e\O q lxOb uCވ-ʩVIAvG5& kZ|VK{Y&g@C 0k9kC!#؄n"~Uf ^?o]6[3*GP,q}3 2k8*0>f?iuSJm4\XߣIo%)(hgGfXnu*Rp~cGM d,"j×+#%սl'h?7<`Mf[=*ęוnb_ǂ;K+4k[ne,^߽NYl3 }fS#=ֺ~lf8~i1F~,$,DZLA Ciwx*w=8P똿h$}&{sj.q]u5V[4=>xrpƥfn;pcYU8~TC h~C$}"U8/6} %tCZ49> 9%mPδG9u' 3 %-sTIꔒ)!ߋUmn.Y>?qmD,maM˂ 1Xe-@C[n? ٻ:r6ÿR˳{dosgEc]#WOo';;`}}Ws>Jh3HKc(GPu;D֍3o c`ɨſVT.ӵW>emDթf>3E<0={ślӊ;1Cԍ'PQ9 JƗ;@;^X١hVqR3*}Mh#v(F0ԏ̹9@GoX@?|ǀGZ+Td0ySӚf ֟װkIV ˭ɪozda{^Hnx&y PG犨-zEvo5OO'(k\<\C%#+~6#<5{I}L8QS;vQ>(  k!f^kv񴴝 }xw7dzk_qgeh{ J3MUwކֽ:~1![,/NŴJOv2T2MVy?LS>YwaϏ&Mw:i6V*p>1؅bN Xܚ VwIg$3ݎVl-OlP2D9 ]SI)zxOT}6Gw ?mHsO+ G!la`ID?\5_['@=u!u(/PCnF9Be:1c+{>CSX,ak{kVO_̲2&I2eǎ ʫ*{twEen2ASgK'쮟\kF?*ey6W&gG}K^}u]NCӳY]OUf)d~Kw|=&n#Ov ;!g~KJ}yYb,g giGiYK/kpsR~gh?G7RO#]~C򘝸{e9rh"9W+ 5v:ȣՔ7T*A~ L0%L\x&<~,D}nvUC$9CV{q] VZ9>;G7ec]gND~L(N?c0 ~fM[?-\iw~U4zG<2ksNR{}4խ,~Mvk&#aՖ=cinɘT3b \&#?"-a[e{\vEA{DS1#>~Fct8-̪Hd.d1?`ܟW^GN;Yy0!aA[ˌ)] ZݫOb-(Hq L O PɮxpYKiO(I N'LII.I&JR)"$I$I&L2J]$Q*)$tʃ!  TuQ*ibI!QIJI$IRI%IHRI$2t%)$LI)$QI:bI&)I I$$I)I$dI%)$I$IJI$$I)I$v!w򒔒I(I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$$IJI$I$BI$I$IhuY?+zγ,~W,WSjud,d+XS0vo 7I*ˤI$I)I$I&VfΧ@$ܠI$g wH':ѣtduF2F ( , A)w1|Zq􋅗 ˗GOЋDiOe|;i.\dh䫘xX鴝hxsc1/vy^Dy}8F}N%v?qU ޫtڱNw{)ãE)JgGPqdž#)rl2GaG-Ssu\o8AQp㭃]CmH\C?rO; 'opNGGg }MLzԒu%Y-x]'B95jWݵq G-\6ÚL\H,%m,kmY]Y&65ǴY"`9i.oR||UD"khK]L)S^kk '?S,uڇPxM-e6O[bɩ䏢Dűnc3imBGoP2#l3ef#Y.w6q0$oFM5r˾EÄ(3iA*}F hˈ͘1GXA&@|=QmZa[%ew;ȫAA:)Ra t0"4JbAw((GtQBfu{j`V&/U2Md~FMn8Br*v- {{DĆ0% Cgcw =A-~\-68X" ?tWm<ipRp_ߜ]mm b#ǔpz&C9M!HPwc50 Z)jmmG?.3Q%т^e Q<'⑌q,:&Ts:%fS얆L?7kT:6Mn}Јbۃ=Fgw sO,>{ֶղa% p#➗Fþ(.!Jwǟ7WHFI?K t+5 !UnN @>=Rb5Kx>)8i/:*͹jM:!V ˾+=B7;<hƯWR71e}c&p9m:BiVjV#;uxF?~* hC{w@k6[`]7gY ;dz+w Ŧl=SNӟfNytP!B[X@kǂR.lk:lb7$![΍?7UxA:t4FJdDzN vAG'oҚKN %׏1]5V7ta`s#4[,`iǹZ] c\iqX%3F<\'du oXCnlB@4 @)n.@>j rHDo"ɒ8g/>)5IԨElsJSw ߘH|5vB|z^{Tdyy%#EǣDcOe<#L#\̼O})05Y=lq1)W peGi' ki jCFq\NVT.'dj;Bsu\^M?mgDΩ}Փn($r[2-[aj?PO! T`U_p~rRBtz6xR e7к ne4Bqqht\\)|o;O֣ˀq~&b@3wjWalB_um043 [A 9nK5kY:Xr;"8,8dbCX۵|wLB#p:tY;}ގCvY֪P05&XN3dWZ%?ȑP%6Xa}%}1O}Opt,^H49IX6cRr3 <4rURܯ9c^{}_ ?9^c߼<ZhL_ t۰G=U 2u׭ιtEnDs?z?u[ FKߩo,\~}iSEbHFfjG .yv@{4h=,-c\5S/γc =\~oI3KQu!uմ$~E;~PgO?G`zї1Z6OZK8j~*Ӿ;p*<;$jZ.V!Ö%~a}9 M0g7-oY*Wo<*5G|djxo;L}Ȱ*nB IP> LJDr>Ur+cL?70Y!ƯH~?K(y L6Ѯt!TQ1۲z_Pnu{Hyk$nɺ~s[FC8s" 3m5桄D2|91Fg^iQ㲴P|<=O#EG>'Yx]OI ϯtC >8&;lW^k2J'$THn]gܡdՕue8hˠδՎ!q~j֍ ?5tݧʵF89U^ =ʼw:& >_.# ?ʹ7ZgNAeN7_5:(.d=ڪyG^4ys][3p)"UYb"'!QnG69P,$V>?wQ\[Nͷci?]QnC5'B{%sAͪ~^1~_EU{My*E/Z|o?c@5_B;032c=?: 1HuЬO$`56u R8GYf05>IϹ܅VƄ|&kt gYXZ !ߊܚoTc:8Gm.DłKO M~B̿z>puYqѪwLv?P4wz?bc nxhn?@]Sl0񪃱#G%om͟ o,x0 (+w 9;O WX=,Ó܍zܦ+57wp _x28 7*,/vY}o4TC~?h$Ք#d[>5IGUѱw`v/[f=ZncO*?2N67+Y}S?H}1wqKD_g8(Xǵ䨐xPgZcV2qAqe̼4aoSfNf珌)ǗuҎx2^ OuMd?W\c}ck܁警99x#^p H6!9I2f)_dsL0pnM^rOֱ]v}&Qg6~!&fB1eLI"PtQxi9\VѶvR˻6<\\^?*?n}1g?3S:pٶm;$sgoQ3}%^,aТ\F4]ZʺG.> WN /p-0S+y nUY{TZ^ khu#1(À}/ Ogݓ%W)r  HO*&e)%Z,-b{5st䟢T+yFoz~fGV6_!ss\t$Lbq+Npg*\0@'ĩzY>g]ws|vV~UF+!kA=¯ )_eueJq=N{kipP2ɮUz(xmzX|G}TǗ Y'G' \G6,s ӚJp;lH&9CvZo{ ڀ\pO#Xs D#t">HUOf,N<1T~ >;L_[ Yv֒$p;ԳK\SAi{TmƦ48y10q/1@ Uk|9DIy%1C9q3]5Vl2lf{cw+cv{cBEm˰xG2àTzE=vױjяPV4g:nrzӍ]kmeq=ʏ!4e\!Xliy(q," ^ӧu ZN5YLn敗w@}fp,:-]By*g(l[g׿!,2SC h ΍+P%~8Zh'n\$  9pW* MDg i?_2ꎠPDzL~Y07p&4VG|Pp#725Geq e;-N}Ibݶp>!fZI*p>OsG$H>Cl$pBG U1(p n[+K9r[XeMvwT[O\Oi"?V DCB8SL2D!~n`ORkaI#ÏI;Dn@q.pe`(u:{g?ac?﫣 ˁFYrF22䈜O%UnMq ƏkOEJX?5 ՙ1ȴܜl:uk~nl= ˣoOb& !"6ط~B8Q]H2D>vv۝7|RRh Z*|B/KO#  Sa9L͕Jd!{qqGtATک-5oM ;l91uwH*J.3u[l=WXvTUd|J:gMn/w*|1-V4s?zt;bz*-n ~MB> su{JǑ?.D`AYY%S~]Ѓ)iNkgиY?7BDnqm]Ɵg!qc;8be5ce}^p%yWBv7sc,t~_̐tq=Mݥ ,51P{g6Wz2gl*3~i2YEY]*`h11a0~+YdwS:M_&5++uL9`K.f1"FXV+aD@q,yosVF~5'3 [%zO\~V(nVBrzZx2RUh=e-!]u6%uQy|s݊~b3&;맫,j/-KC'56bEOOu(0gd,dmf-HէIV?kَw8Itm~wU%oc6EQ^^f?BoJs6'1S]$({-l: O[V?K77*.FF7P"viv#0sY[Nۦ{ά7 Z{*<lyfX4p?E҈Y%ɯ$Xjvӂ _R9ĹH++wߝr<51H *1~kF.y.ahH-3q0Y<)W$I%))I$II%)$I"&IJI$)$ Rt((I1*H$.2uT@A:d%D$J*0PBI%H$I)&I I$RNRI$ɓ()I$dIJI$Je$!I$b:dI2I$I$I$$I&NJRI$MRRI%I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$$I)I$I$HRI$I$I-?rZoŏ垵?TjoVjtNd,d+XS0vo 7I*ˤI$I)I$K ?5\~C(7\9ޖ9O5PC?ԆNЅekC4hd&Ym$Vh~3Go4T` <ܧ#Ǥ/lOO!+7e6c8GAT9-|vG^ #԰I:ժV6ƧtOc DmSKU/ju}ȊENm`_j!is'pʿ}F\{=#!Vuq~rӡUxizi..>-}bWA`n%_ëSCg}n5QHoۛW!:GR>h'rL5zmri^ kcC%2I'1)$Ij]t|`ַhbN GbJv3+*KԲ1FCFf!@UY x.31d8O|ݧS!1Mu?\‹˵fռ*Ֆ<]TLx\өuz;DFI܄Zie G!1`eBdHјD}RQe-O \deEH5\Qine }'}曯ӵ fMVWT\2n$fOȪV{lvnD|Ӿ.[iN9HTq̀C+j约Kr ?^ղ˛kC\$,? #%Z{'ԠyaUq r<:Ԇ\?ʶ4#PUޚ?DO\Y*y ڱ\ T%A+3pFKPŋY'.ol[uΨJhg]N/U1Ihөϖr%gtFk~?ʟNߜ>D0ӂ*8 A`D!jdlJ-lOJ8cll?gU7Ь2 ;nn#Cz'Ն·FCСsQ%c-:)Tq.(w_8G$xf8`uQO-$w9ޯSF[fǁVu0rcV?5hKV/L㬙W qv{7WECspi:-niBȧsEN.iR}wΓߎ]ĺy:(y?^_Ov Zo4X)N4uaW(]av8p*vw!nuy2$jK?*c;L#"гMzr]IVFSLm!  6XHr:8 ZG<`RaOO 1s=~ؔ_Af}7i# wBmIU4vlbs|AzJ=,`[AJkHG#kCr>U wi~: }Yl!s KCCQ?Ϩ?pZyv ʬ[YB1_ЬtˡܨLS Ol`oM,0TkQ捒@obkcod:C:h[]ˢ}uYl{I^Gi *.S3݆e I yN?#_]kLiTJ2qX9]/M7S6s4q AE)TLbpo3'$r >Y Snca;Q l_>bTYYtqlmSv<gNp@kۋV\s!\<\K'Eu?)$ԧj: T[SQp'QU)N8(HNc0#W<b.L59)1h?Ksx#WvwD_aWN8$%!V$6-p>8Ktk!#&Xdbji{qlˋ Se{ߦ.wFZYwi݊eq4OnvcέЭW\ӣ-W5:Oo xc0'GۏGkD'mG1F#A˜9W7$/ Lŏ:d嫐E=7CB,Qou?eK#*̒֎?H됒p,1ӮI $"J?j^6UT%H3PQfdˌdY$W3|H>?RU)CVe! Vt|l.="?W7{4*vU'da!e#?~8 mcp֓v+B7C K@vTg;ܦ{xmũmtu: ;G3- $z]qu$7Cfn،2 >: 91$>R6!Gf]20KQ)_0|LtY?OFN["g}`>׿C02L8xYEXă~hN)?-Fjn|Dƿ&l\uدcw5oUN>N7Ys9koY\ݖXuE硈ӊd%_.$BZAW>RbԚֻn#.vFE֟-8ze-@36Q G/>ܪ1 {ƜZH)9]>)CeF hX[]T{ lsv)2DcqzG/\==+d:( /di%7s@}հNJ> q2zVQ;kO Mik|\@O#°`2E1Z+졕ϚQ3]WFM3~, y1{zޅa@*ʾ 4pQ p8Rԡ}(ihN(bWݗ48ߪZA-)$g8ltY

e*#LSlrxlpecsw jmN@KR9UBѨp˚̷3-oiʁd]"Zͅy&[]gmd8V%}?G]eHH 1Wƴ wBK5k6-\vdWv/<)~~Si?p\yݏ/=*;;jֿ0۷U݇[鴆ĥoTcDǼT^Y&ep#`a#Ð .c@ j̓õ Էdmd 7R-Ɖ+'SY_;U_ۙYq[@ct) #4UIb8q%?1J\O +ufa7ADj[_ܴcӧӈGG2>ߧ+Xt7O V=1HǤ}|Ֆcq+Nuu'SKXx./я,{[Ul/+`.7Ou2eWq'nV9Qh;ʃbxxlٲJ FS'.q& 5XD~\c*5W#WDh8$W09Uu<g꒸g =L8~YE-Nu5w:dyC{ۂ9 tS7OlcYY2Go%mVN9t]?t?%&\f H~f,dď֘gPi J5oh#UIG]=ͮi?}Zͧ"EN6u^gJvz͖s%)R, x'i$n&:&T:Nnu{.Xpn {t]YKWIEko!^)07^Qr[i6k`ԝ˱Ǭ[X5N6)˭ oMW2FZ f#BG#\1`cK<ehk#+o)kwtIZZ|=WfXx1q\qɳ䌧,a`ɰ=#kG'iH7h$i&4Ff3 Zc#mc9?sԁ1AM!'JHRW[PR#Oң|T1iրֳ{KIE3;8m?[=Bof5:]42h4?x%8=շaT,U[)uF "Oy?6!Ͷ8yFТIh?!` %JL,YW{c>1ِc:9~ rHBSa &m >Ϥg3M >I#EPaa-pn;Zme ]e֖(deym S9$#"(L\>HmkKZTD=†GBa-AعfߤӴ1t}?yK/,y#ӓ!CO;3R~OHYXށa+2ޓGv<6|XS3.+-l* *B~e0I*Kthx}~ 4VAQ[&tLc& smedVlhy =#wFsÜ77]:{X^]k"}[Lnpúpwql\8Xt.]嗛\ v8ɯ4grx+E>F0Cxˋv;R5_WhF5nΓەGa=u@wd3HVɑ?ѺΠ  ߧL8qVӎ x} #k:ˎ׏qV[\z4o-`;gYE=5/lj@n N{Vi?Qk?ͯL%Aܠgnw1b _g~Ȭ$jHx/ aۘk0Od٘] 2plEBxsƫ]GοaڃR!$j#]k齤4 WG]k 7 wG ˫/3sW-U_ ?Jezͧ"Qq۟=kx >kS`ekuG O:<+\V%:@Pu4Nuէ+H-RI$$EJI$I2tI2e$ВI(HROQI J(Q()t)ŠbI$S@I$ %HЂI(I$$I'LI&LS))I$hLT RI$1RLRBI$ɓIJI$&NJRI$$IJI$I$RI$la%)$QI9ЦIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$$JRI$I$I$I$$KC:\և[ucgO3Sd,d+XS0vo 7I*ˤI'L>w)z6O <ڷ:;j5 ȡU:,NYnKwrn1ۚP4Yφ&'(q!ʩIhиYKNҧY#:x";в״02+ϐ=N8<8HEkk%qjp>+W[N3Y噎og73Z!oġعܴdѩ!|w!xpc4nww>G[m%ü5S0\粭ݠ٫8fm-5[:mپ x'_YɐcvtIWkfu%PŹ•uob6O.RK!ӫ^m+#9se}Ws#FGׇ5HdZ]hp'\R#/p"+s?޷0zȹL]a<~ #7俘@a^Lj%SG 8oh]iKnSy-,}*iJZdVRSos94~+_WtF$\[|Y M]Q-+"ON~"gH-{[JXϟ}B;+cבK+qoAجv.Ne7#şͻtA9DZmpd(#/-p{y0TKΚ(umaUxIm`18Idp2'PY]S'TE^j5 Jfcw,C쬪ŠZCXRSG12KoJ,Ӳ+߱oo(NT:۶b[s#!טUs{ 8Ap> L $~  1ܣ1ú?p]7Ny 3ha</Ie{H=A!/L^#Fi].Snauz wP33AɐcRiR(RwjfWٱu+ ddH~o:'ğZ=·I>M1Y&+/1#YKX΁ |>\.hj b,OGW^%]E2-<ýhc]⎱x#i)G5 5 A\< O?5n3].r'ecR.10)qiz1c~Gʚ#xE=#.bœ$>x6  ռ+XRii.قTG}~t,DĐ]HH:dSGeS]JS.3c}*&G'-5.kc+db CA8ja͊XtIC檵Zk32ƿ:+ycu}ߦ=߼?]GCu?3>b37+?cVppd7cu[^3j{Dy,=:̼s?wikCuc(BIX5rƐ ʰƽӹw$F;LV;tV ZFcWJa 1CbɺϤ@U-ۧTC~tCgq.nxls3{}>6ɃpcēnxiZ =Zv Vv]%fXt<`A]B́"=rp ٙ,'ĕo"ݢ;OHu  GZƦV Вp Uv c #rߜByȅ"xQO`!WJA&ؾ֔I2xR{v†Nmx-0hnYc$k/0v,|𳙛Y(hQU!D5)D !R}eiLZ QHhG)D32D#e3ǒrwYC{Od@E UPcԡm O%X $^9Dsx>R)e1i/ÔY^~CΎD/MNi|G{4됹f?հZ1-x2ZY_V]S}_ipVFHHi.N&L[vP6T n%Éb{GVIר3i ZC1c6Iԕ$ɏ{Qf"`a;Xoy;-꫒Ӻ?=Wϱ W,kô;Bu5' ְ oS"@cP?,M7Wg[TL5ZPn}L9d8e>]ofIeEj?vEKDI:/=kꆍGkhhGBsۡʱΫk"X*}yjcS8>'cviDszz7}0uv!]tS;P Y=#v@ i.MV83"frirG_k>T)94:(X-'eI;zPh$(ze':O9 #,x3K, aO 6@O9Cy+,@ DgF@]cA| e )}"/ R=y,\jƀI;T݀4p')Ӥlkt$U3,q uem%ѡ'0]v9OC sGm h5w% OLAU|F8",ws/U1g7JŻ[@'cᑼ_-Xƞ ~Juc_hCc$aXnEgV~GXʼ|4 yZVbfR>f4Y 1AY|Q 6ꎁrIJ^Ep,q10Lիҫ>;8U\8](Ǽ ]VjrYƧA0e͋_v]TϢܚa/kn;ߒ=Y>SGI13sB |ҙUDOvXB2-k D:cwaLUbߊ̐孵T꘧/a/X2$}G]֗r%YD SMDž޵nۏ_bDH[U4>xrZmg?'z; m&9CS \{s ZH!\{6Q1 [`+ig[L@jpюcoD?-qodRj>]񴳿+?{|]_V-sgUp>[QiVrLژx%fh>jv {>6_5ԑ:v\vmNvA]8[XŪ/1QMgl|isSVz6-XmP;;گ]s- QeCswp<>A,&d07n %Ҍd:[T?S$oKl?ß꧴gJgIf:y$HhD$CLF*G91费DR?(67ΤEJq.=3,acG3h/t|IxkN|Vi{?k!48أbe)|LCw.=*\q0Il~sjW}'oD \[ZD0 96;1Z 6L4@8cAINIci$T>);*Bӱ!et|hY_Yn;w(UڽFXt.fb{z}D30Ij {K'$<90I֥^>)ژ[\ 4QB׷#"u?}k1`vn-A=YGV.icߌUsqO5yN4 )l#B.U7bZͅ9K1eՋJc☘㕢+e 륕S\];w_5_Sm=>Xf5Gts˵)SG7߂N (5sLL(9pfL8)o&b%? ;hW笾F݃YRkw?*bZp쇗NP3LS!/nCW1Q9bxc\eӴtp5 %$1>0}ǒȻ۫ty}]MMn,骯fρв+>P[6@z2Ga1K}Qt[-dRO>n=V<9!?yG!7,`p_菗a/pҗ:r fxwMSu;۾4#sؿd3;[zó!vpx+÷?xV1_@ɏ7\XˣE~_@%'6V~aWw<*"x#{Z?UYlv-?ʍ ݣ|VGQɳ1FhSa?z)^G@г[Ǔ–&%% $>kzuL-0AEN Q!~4?+?#͖1H-0WaCr]\v71`u^v9^%n+8: 1lڧ : 殂+7Z-=zˮB5E2I$HJRI$dRI$SI 'LDRQI'LJghSIDI%:bI%ВI(25 I$ e'I1L$IE1NS$$IJRI$1NAJI$S)&I I$$$IN%)$I$IJI$NӨLJRI$U;|TRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I2I$I$I$$I$I)I$γ,~W,gXYS.FfLd,d+XS0vo 7tVeI$CgtkK$f H&:JAF$d6R..2u)Di'shƪ hI$I!I$I$%)$I:I$$I$$I$I$$I)$$IB}+X&I!zjL>CDQG!M)BiJisѯ8OxZ<_Jkevcw5gW8VC%;A~uzo"^ f~Mȥ`9-p(c5-k3wmtm//^L̉lފ}{?W kFOJs _L C}3{MV::}i䵾= y!Xk/aнTz)% Df1Zwjcd

dKsC{! 9Z[j6']-d{?VvZ&M aՑ"9<@C(-O&׳ ni쉅p-==gQr5#鍌Zvs8@w=>;9*Z۝8B3|F#̆}GxJ]jTc=ΝԜ`o`pnKuu.NaXs\rJ'R(Vp좍Pk&<9ݔA*VTj\}'"7ҭL?KcVѢ3Q0t)gݖw[m4hdqtPo ,''sWU^lĩǝ.ZʍYtۄ| KcwjAtR*vW SE-ڸ՝r(Xij~e.0KVImnDcohr TC64[ֲn` X V'd EN-|S(ې+/yqd}f|R>K11r+VМfxe aOk\aMcKo{eoQRC'k_n94~f ?o hGīւ?+[ ܿcϹPZ8yo+"i9Y_9o8ql}`m}hscjց'Fv0_.xD8HDg d;I㾪mLu᠕Xu8޺nl6 .bɯ"pIdޘ]W4Uk0Xb;wF65HTi[Wplu~xWH~Nn8cI80.9zk6샐;Sّ٨ IUn)$I>ׇj=McDB#斁lG @qII$t4`) ZCLbZ[i 2b<91?LxyÏ{_3Oupb9lcG otiN{6OkƃpevCAZ3 de!_挰)Y}ȑkސ}`<|O\t kuim@<}%飔&Y]Cg o.?S^4 +a/o})\qޯ봳-OSGn;UV\x#·g>da{]7+'7k )jo5 9#VL(#C,"8xAd`!4}D6:ĨEۑq0m!Bims=|m`\I; i?7/&mvhmnܪWxGfK^! _?tU}gN\xY_V[@ǰ&?8Ϧ__O5gp|G0l[u(6d8@V%zN s"?ȴcUAST6t~1@`E."L'i}7u))tSɈTff4.{Gz?V 2"\XϒMb %sgcōCp'cI>K*qZ VֆA˴NDγYc(X\}`e#{YI: 4HԎ5&5'b]QF+<衔0WXEˈxM뢧qcws~*uV|y#=#-g8QVª@)"V J3JP9u;=;e7Es,ʕ9e i?Ї/džZVNjs}1Yzl$7w }X &ke/v$pf̏O+d3&k8!q^شdKxJ,K7 Ր1g8|9nK><DJ!)@x1cNBsm=ŽvթiZ=[w;5wߘYQkK`ܩBY ti4Á*n;nOmgtA+\O'yGފ1gtI.nF)WZnHCl<=Q ђ<9luI[8mJ 5qeu*,mvNFG1Gq.Is[5czlYC5zp=,&Y!!Ce=lD0 võvop 2eX^v5?XYQq- )w |rF&͔O2 n%⹺w6x|a3ݑ.jc.ea¿F[jj|b녥 Ջ7jY/cmi\U4GMHAHTVYngAqOW_\L9Y~]$:!̑c'Z.5G`e~dBEG^ {xZyL6XCG5jJ^J5;Gwb'POud<Gg832iPkO[?[ՌN:R0ȌC g2ḥ-cT]M@Ƴ(~'YX#vGP;uULm޷*: :F7&oO*>ob01~0ȉzc8i:|b]Sclq{<B[Ź=?FZÇGd\YÇVoWT6PFxd*]<#٭-k;74ȴ;tڶ%V96ebۛlgK C#=5_ ZxY"7oL#:μvDJULngI;>Dڨcl~-Nh`9 oycco2Y=^ *gPrQ>|G}Ome6Ōէ03@pT ^'YiFEaޏri. 5u Fca%fftZ2 {&x* C=\QhqO\H ?yJ@9?Tk60>ͤՍ}~#nY!7̲9[ \Ӣ`q 6;0'EbĆ>K]2'Uˁ[qӣ*d:7A I%eK z=Y$ptwQn|mEWc=Z۸~nS>mj1a<@𚓖~Zs4:Mh,k$LxrMk3Va)B&u9cNy5"r$HX0t_(L؆w%nMuhL( `8(Op$13vLO)N1;X]/Mñ( ~8 ]?񆞫>Nd,FLI.kfd 4sD q±O?~b@Ğĭ&_KXU#&$D[3~ ^;?+9UV? \bb&^21e72Z \ǤWx?)Մt-A v[F%kP;ƴ'ȫϠ;k* g ~.*?d>kCUò=h-ieXY`dWgd{LQ_W$g=3#G~s|TXz6Q*⅃B*p y ũ*lɑD;Oq&/gCF C J>_Z6@~o}47F?""}H]-3}d9!T%͑Lbcv<>ez8pZX\Q:69!c ;B] :8sV~ o< mZg#fdbt>/qXgVwAe|Bߥw}%zl.ҳD 酻7$jf^A:̀b|fLDp$:zT4 [UDfr9>:(lψ^ۣ mNTy4?7ހsX,;Ԭgۺܜ-GUUQ-tx]B16tV~xk`½pmU'Qw@Zf>0m #UwǗ}ߣ')"v!2 ,4L?չ^@tk2ày79X[!!/X Deox?6F.s8rU@|[nOm4ƣRX-<>a2͂\@ W ֑ %캠zសoi:; Ukp:?EZ~`̌A5!Ϸ$LEccGI;K!O@. }]^OwI_k1EsG&OyLI _Ʊ ո9JIrLBlQLQc\^m.u5 ?12۳kΑJ,p**qk=YmC?6kc|Zyc:\̗b9R-#x#4~oˎD|y.;nӃliЏp57d4k5i0ݮ-QWp$A=5ьTHXkFӸT?|V$2rI&I$RI$I$IМIJ $LZ"BH]$)2t%I1@I$HЂI$S"I$ $)IE2t)I$bTʉI I$dI1L2 RI$*E2HRI$t)I$dIJI$$I)I$I$JRI$Z #udx($$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I2I$I$I$$I$I)I$γ,~W,gXYS.FfLd,d+XS0vo 7A$UWI$$HI$I$JRI$I$I$I$$I$I)I$I$JRI$I'%)$J%H5;Z֤RI$Gmz$#.$e֦*EcSTbSJ~X/Û^N֝kd9?k9be0vy8b/fu齶Av}GsIG"1KX}U0\ alac{ :??hFިϒB ->#4NmVeKC[ji,{(NM&wrGfs1U=)DGV#m |#{Ơ“+.p经c?D`?SOܛ~  QY($ |QrΒnw.18W'Ǿ{oaso$ʫ 2GS]^{lյ`ne8!\$ʿ{`9up~fرjK`k[3Z.|B2XZ':yj=Z$<8{d/.̭ΊFOURlFr:UOhZv5j>Věpa uƩֿ2eQ޽,k6[{fu$HtYv>z '_A:dQmcVWEV-]G̙O*tRC$b8N:5rb=\[zVZ=IJ e7# FЭa+2쇴5)!0{PG~[HnwOpi@3H @huQC_rg 1z}i1<(aTE`>lYڦy;k`@Ukq!kFfu-lp|Aֶ-ߖnN3XyI0 n w%a3P=^c618qd#ɁI1kZ5~(xKy*X}uP[5D (4?ك?Mo#~2rc\}($*a-9#D2 L>0̠ǷsuՊq[[~$K 8YY-x!ͮIncӪ@b71?`78qQ/q䟽ICwDk~$mcHTr69wܡ.5,t3ͯzOfԘ 'YyDpɉ̩|T-&DQ#Zw}dmkGPG_p _DnPhUmSqEr$MorJ3DxGgrIZuܷmcq2[X+X >+aDS/G.s$.gbt@Fqܠ8n!oc@bL4)C29$"Xp/rVrNXHM,F)Gx\$xئR0["qIԍ7i[Zo[cKBQG$dD{{[<7ƥ@3v hc3뢤'$lF):I)728 U͹tSǗZ &3DIs@~Oj.-; tۓ']Xe5DJѪq?/ځc@0ӄ ^KZ9ÿh>ְ8ʈnv`>BmOe:$-s4;wr9 Aos,|_mvkFWҩ:׺Ą`txe1OZgpAZUD#[H$/X|UT5Ǫwgt2, ;'?dևƺ_oKeH\gIy(v69h[ E?KV5 c nN`0?q$7x5N7@H^;AZ;&:6%ԓ"Qf6vKX<Jn o #p˪{;LhX%3[Ίr< L(Yc?$2?[$Ӻs*OXDq.'i2@X45'3zCy~ع>g}\?{ӓ… 8(V5) !3VAȻt k eXzlexe/)6YuT:QÝ0'w v-n {ՊmF U6ɦuU06ÌfΩ d2_!FQlּ7P@U[Dpʧۙ`h|upQvclikaf}_}DI9B6[$:|&+J0CTA 2AxT_V~>MGBo!pw7VsOg4YOnt԰=+{T"IJc;>z3ςU&KXnդs ៎x{`~3n3v5akMsq$|yHt,f'cCcG:DUXtB}j[ݿ!@hģ~q,ffׅYĪS߃lBYH 9ܒTeJ ^\Ʃ;:\_T5Ug'ĩ߳Z|'RwLGZe-Iĩ4ȓ챲QcTU[JPLȁmc;{K ȹ:I$/I% )}+RD4Qyҁk.L^CIn3U'r~nWre#"/ZM@D ~C$rp1>B:l;'qN |GvNT~@2uQN=MB6 ԁ]⧏0FAېw#pzCN4\}>+D ul"x K7:=I?vѫ-pkxPk}w'wPn-f~eYXk|~ r62e=f`%vl!Zf+;OܷuG+gLGfG|R_ ֭<3a:p|P߆[ bM̽!DUjC-u*߰wLZZ`S5Uz~p5sqW*x>U3>+<#;'պ!\>Yogd57kZ("Bg f$Tm브$o qDV uNJ ưou zW_:\2+xw/.0ba43,I_ʉڈ_]m5 &L9ƴ~l >#emTZuL|REA'M٦DE@ FTAGszmO;-Z6woض-m[U-ĿG0u90}MmN|-տrp;)>~!dٍxy?ȟ5k;Ƥ:i}Lp&Gˠ5 zⱿV.EKCۼr9Uw#U=ڵFUDƩ @ W٥~K͊Cې8#iY"|iC2kK]\v]껇(- O^?M;4-%A,;*FaQkK5ћ Q6Hn?qWBc)ۧGtaѣN0I_,V-?,~y"a}1 tUHNÕ~Yx97 Ǡ[\7tmו_;HV~>? dαlqJh$'p柋H?5>,?5c|3oFF\lAlM.dF<eJ쵰K4CnAkH#󀖠dGQ <z7]y%?QhȲ\!Gt?lo̽04`64.` 5orkMwhyiݨT35wj |u'7XZ۱WCuáجQ*}Z G\]mms{U˱ylXtp/o_X+]. Mv7^AlIXGC.)?4[6Ax,[ېƓ%P[iMI%gtl[݁mo&,ٷT3~CT z\&$i;#2,gy g.UfYk7 a]\.]mn;w>o['7nˊB=Ah#+wH&)VHKZZft[wgV=VoiG pl<5a]Oȫ#=* JGbZq?xr-T 癙X9\co?Aٿ>N ?bn?{U|7DiU$R,ьb( Lɏ &dO)UD$n'?N=..pdn1xth2M(>ǑKT04*u%I< &dF<|?K#1N9eS38 `_'3w;kBUVHM*;\Agb~Xݶo|ON> 'cnj0>#s(V#O$:m̱~#NBi$*Ʀ'WjA⶗ :Y>?tLI>(Co19Lgx8UsKCl}Bc!:'3|T*Xk>'UjJ#'LDdefS7dXIBMXhIÒ !wWzdfO;ݬt-DDT~˜6(x ǨXQ.o>JMkk#mTZG֭ϯcZ~k@ "̐@7} Z 6QSMKA+C5;~ K=$䒥~hTH07GZCA*cX ˇ+2˾'Sq?1?EsRE~nҏ=+WhYkCAiP9ȅs#խԸG3jq]/r\ LvHpgk~~J+S ?Wq_IpC9]}dmF,;;3X5ޖP-pV+(ҋFBxNГC\x'XB~%Zj?[h#÷q˫ʯ)FG?m[-<~6GUˏ;6ei hTmloYG+~'R~efDSJ:vCA2^Dgu5VH ΍1d5@ig Y@< s *],'_Oj˫fFⰺ[jh¨CZ$oQ1[Dqi~01 GlLwo#YA0a^}gE5${tO_}L՚ÌN'af72k{< %3pg&/T5>Vi0? Y8N <ο*8}['s\5e7uFAwjG̫Jl ˛GSY"xH nŪj ?tU;+uf 2W}D7OcD鎩ޮ?\U\ նZ~*y8O?3F%i?֊%LG&¬g:]G⡝۹4n=@\uQQĸF>otm=\cǾƆHCZ$賖=5Mm H;qJ[\\l?Z{N2ӓc0_@fWcCjd7A2mz#2V=aoT٦}4*Q5AѱHD;Pm,.vh -ma s"*;[zDF&`kN]I hXG" 6#~T϶[H' l\ *4cp)Hq(X}Z1<#f!lgWO Xgzb ?Blh{dUBtKUi`γ~0iNՃy2[[u ?]=-f--F8c܆A#9]鍃G8kW+m-qV{=g롍-n-W ZZ|;ޭn\wTt%<C?|@ڱ ~(.0rZ7riGFtk޹}pM!.ms% w_KmL'K'9 0c1,Q_s톑a쏛V]>b9XT dm>#M+[?H1-?'=cˈ6Td'ioMtKD~+]| JmUQ5XkVmm;G*Ӆ[_mX=aMˆ~Ø{q⇦jI>u2<P{J t-=KrX!ڇ4GmV2zn7ToY;[5YN'd8~miba&si1ȦeCeʅ7Xիair-?U_`lx ]Gt@y2[D(;+UR[T:^d*VK1+6J;X?Y;kgbIM]20&=fhEr5%fuvihQ`R'&C"<4N܀Ө&\O+Dv\T͟TZ _'A'1 XƖ8Hp@y+4m5q'Ctj;)&Y=/>an=TRQ2=&#Hks+~&KOQ09_Q?7>IPIme\ 5 ~+ ! Y·OS!|A X=faR.k*vh>a?ۄ-fxO1T{y NogQ.1J k.g \^ߪ;nad5Ҳ3^ZC|Yvw]{+5Xڭ6Fw Ԧs\~G{ r){~k9yaOXg5RqIml0 VOdO@>O<%^/ 8ߤ?A 9LzdKwqDu9/cTaDŽ2i(Nph8:Q٨ G>(2 |2CT<&y-08RiοΆﭥGMUO ǭpo0n??AX$ JVA] =)Z_3HH Gj1!pIBZviGCX&xBUԚZ ^&GE& ?G[#a$YkZ;Q=8K ǃ.VSu4sIեguެϳRw9H`׌́G<[ :~%]$Nu20ދY;LzppUǂ$ګhqm'x`']G"d2>(3,TǘbKf49d3U(?GoIB'Wo IR .q+KuŞtO<<, --o(1g?%,߬a-Vqʷ3.f8ߙ_vwC151h?jq:DіYY(-^)v1S.RkvI'Vln|U\k /yk5o"?}M4z6烻W3n2!!3!#{zY{.?7wLs+]M[Ol[u2[ śLqXh>m@fpYyU;Up3qq݌u?HUC:iͬ97?Us kx>8~hr.S1ޣdKqn*^ o]}$Ww3Ұ5! ;Kk{a,8hj|B|ܶS|<@Cn8:T$+G*Uw gGh'Uch_sJ?a;)B7]&QT C^}A-p[[vT5bَ\r~V;$c#&SDi Pco31IԘWNE=sy5[amNZͯ=+{cƴTt3أ&7cqHhd{Z};\ i]vp.pp`VmW2588|u5+įc9w&?`qQJP؏_23j4zsHHq&,#V^~"rqֻ:<2,ɯ>֝]?[G*IV`;6Xhm{+77f=C?H)i\˨c1h@LxҋL t("%24_[cK\A@<ҕu r[<з{qFK:߫6 8Ra&DFLy" ISEMW*2ѬYo4Iпƨc?)+r68Kv˘~_Qa+9W=Aq}%Vva:4Gbx8hʫM Y[}hVA2LS< d!#j~ Eg{[[Iw)2[B盈?>7=;n0~R0(D&~5*ѳIh$#3l‹ِ q^cp7K9>*\cm),iHD>> gےo3iuH~& ~UՓ֩{Ȭ>U)T3B[!'=s#D3;L!OcQCsWq-[͡6ƓGu pQ~*Y-x X?qL߶Z|T$ xAs>?^æȹK6> թ[2-։xL~_; C `9ʩ2|->@qU|c(cj [wIƟu)Zed% ??UqK&  tJm?Jmp",O5^WjS*~8WA??pg#mjL¯.[\yWƙZgP&*l˛< C1tnq".lDy,\Α}Gv5e̯Y?X(yle.k|"xs~̫-|HhL܁Vo*=tFC/nϦqMVT=~ g5iUtko}UXV~$F#_|F&#7lt tVkQ0 :#P GXE-Yse~9>\wkHtnW95o(XkŃk "DiK绱?r6p T;,hb~iwNv\2! K،'Q~^(&g,gmcX .KDx5.9kB]8ٌ {GMfof8p*d%use C-?tf)1Ƽ l;utà(#s=vMk.WwZu8k$@ rұ԰OUhjhl ]gwhYx܏un<ō@2ǎT}$k!n9ڸ%L=hJݐ[ [Seݫ Is 8ALw8<CbjzJG5DZަGcȃΫF?9a) Q`#ElpW#gDZ| G}_,4pA];7sϿ:5ְ+3,uc0uzaɮOb+C=7`Koy8e7e =s"_VxI^E-ra8>ز Me6X*۰wxrf 0#Xu٩o3&ǭ.iv3wX!fkw04IŸSL2̫:;/lXv5O@ƃĬ{ L[y-̨Xg#nl{>vѿCV2`>ǜz *r 6[ }{Ւ^x~ ]xtSB~?X6a?VCvY82ᙐOհdw v:3ϥh\4!hw{8O.hzO}GװA"+uW3aX C 7YW7R)\!FXyL%ٞaߠ'o7c0D ?8Dnp%;n=s! 9FhsH?;\ eLdce/Kx)d1"}cIDf8GAmhݸ]Z ;T]vDUF>2W)\=P<y Z%Df>+_m74 Xm&cmb}0_oL`}y nc]IKlա@e>9tZfx>:hs҉%ѨnENuq68?^`B^!뎻MƲg?GMt:Y l hCEatﳐ yzz73=z{)Y9~~Ͻ5M#X7?K\bG̯Mޛ<%S~Cʤ1wW&5炒9Uј?v9csa(.j}@)y"$EI$$ QAJN:IIJI$TRRN(uI H$LTJI]$LI2RtS')*RI$1RLSTIE1RQ)!I$L%)$Q!1RLRBI%H$J)IE2dI2dRI$'LI&I:dI;t !4[hrJRI$I$$I$I)I$dI&I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$'LHRI$tJI$$HRI$I$I$I$$KC:\և[ucgO3Sd,d+XS0vo 7A$UWI$I $NIRI$$JRI$$JJRI$d$$I$q䒔I'h( i\I"Vv5E82tMS0 a<%bS' a0 IL8ɷ'EJM<&]I-~v).N-ECh=i4Ys2Ð#]^U?mV`GxfecVh5Ãos5NJwɐeŊ8-LM10=lYݎ7n~]Sga3.[G!?^ Vg 8MQC!h5}F}!f5jvʫ.*}_}aK`ً!o"Gt':/Hpƿ2u @ oIsl fW2\wbj1]~R)88) M:*ӧv}4hx=;W;ǩ1<N]^ i\L2?һ~Mr@ǏӊgӉ.'BַUfm >Hlf-W!a,\ގW?Q y/v수?,J8HPIic+gQ!SlFH%2Vh.O}GtVv5O%"n<ʫ2%3շa%|O(@kweˌ%-BrR}M114E.% n (paW;w ݑjujy7?l]>3*ph|Uܳ?>9[~86;;c~W{9%_×@s|ydft+hy~?">V558$ijd`>TxԄ_7K<T#5y-pB4O ^ֹ-H"BѲ}Z=7ꫡ;(X,T1-HOD4 ͮ@^6hUneFGՐA[]Mc~%:n\$ka,2# :~ ķ 喈=S7W%g>OtX=wsI~ooΓ ٥4a1vmWmgNUe`_zO?Wz; wQ4a.!6@:>uu&yF&U΍ 3eS&΁Z7V[ +}h$V}w{4Īx8sGU!\ݝHhEȬ$67s*v=;b uV{HJwqcfu.bL5\ݧ~jHałœ?y.ALH^gV x&C݂Xz->Цv*=/=%}W_rgT*O`WC{Rm~4+P>>N?7]g@U_-wiʧKdA*׺ OQteGo!I"ag[bj{?U|~kHKxp:ŽUnao2:)=b1G=dOc}@  KD8C˰KUdbhZ$R&qs/;OUYQWZuVːeo?Zq"#g^K[tUĩ΍ϰLy8T0x7_چ}/ot>FM~=&_WH'g[nUsf,- 㪯}%vLY,Ԏao-MvvߔX@,cZjIG} ϭ]OM ΫxG?.QRV7>>~k4D}b3=&hp-<*Vk1+n,ѡCrkE"*@֡"-E&id.O23X&Rt@"X_2!Y2[6fQ_{G uLSōԣ.]kÇb6C| He14xNk߫ww{cVSL ʪϠEBYl}+Ĝ7*q@A G&BKvGSI% ` S]β:P36 +77UK+rw, 44x@%K3F h?Y:-X~@05$y+>۵ڎ:kukGOU&s Y0E,BsV_¬z!d{ h$5Pxv9T%thxuk!?p[1AJ<(5-VWSFρ*AAp?!8yEC; T="Edccnjvǽ:L҈a1Q ﬋]%CGYѥ=\DϏsC|W _`V?6/?E'ȹ\vsDW kkgC'U&㵿J]mT ۽*?#c6Ch6:E+o+ S`ܞT9r"M<9EtK@ԟOeˑ0'V׋cGޯZ]HS< At x4Z4x\;/-UΙ[2?$V8UXq\.^;\ҝ8sᏄ3&h9ۅyZ7k>k"p\߸K's'M l (2og[>9UdZZ4ߺ«)^{8} ʯ~!\74衑VKMvś-FAc&ivV[p Naqޭ6{6P}&<kWx3Co?SOb ;I,9?\83Kqj;OsL)ψ+]=pžu$ԭKCcmXLKwvH{/l k3ʾ@8?,2l'C&ߚmDjmvw [d摑Y+~*~rYHU,۽ėklZ_GaYkY9COޒԫs:J Hťx̳.}}ǪdcWIѺ@odOd05Ef/s$2F1g?c["v SO##;GW|74ߠ`9v?JZ;9D`׵%S#wӑY`=ƽUY× -,_7}g!K.b>Iph9{b UƂGX>:p$v\"$T;l-:QSdun+neb㌇`=lL<);!@gH@Dp$/|lcӸxG̓A'Nm ;S78;.ƿ'.G6@q]yhDHHLUkgu~E-{| >I-]'*lyjf g"g.DxZ4⪢X+v&b|GV2֜wѿU1:kMU +ke]Mn o`Ьf#LKH6GʫX psq:Ui~uUep bN?αƿ,/y m'n59A^Q3ŵ (&X}GV-s~>5NQ|*;5VxHq!( ٔkc0~J)w0=&pRgQMg+Y_[ wC/Zc.?oUmͺ%p{A NPtV=ݚ&W?K^mp.Ԉ;3@6洂=h׭dV\:eb@1FAvT: F߬րN"ې調i\:nVKhFJwY]FąLdcݺr+sjJ~I@ѿ &DW`Y,ַNǀ3C~lC,ki~erM*}ź.TUa<~6%?9t-\eDrqeS ^!_ąBXN?EIi:Y bZ&Wcם~z:*jIVcߌpӸV{LԦolZZ<(>\l wc/m .ϣ-,Gvr0%7@NgB9Wo]._j≯X!ۼ)n!g:w"V<+_rcr{-=ơriL_F}>Y"\}2ۃ??zТuq ,òD'?[UƇ$.W*ÓP;5޴hvuo;<̳ euG[B;'PiЭTX8\#h5:B]rk07~qU|qN嵖p5"3"A㏂| ѹjjnk;hZہ-!rkwN{s~L\+1f p;gWEAvѾ?C4d,߂m:{v85 Ck 6w[;'mcd8+Kuu ,|n sO%myuni<.j ̊?=ҊL~Fk-w'eq[RmCn}-5;^AW}n[|Pk.KCgEJgtt>-*sObYve'?8Ѯ#'C-/LdEz9sAY(vƭ*a7RqQctugPZ-Cw-d>̬7`<]QL(p+.{[.Of {Nw誌vp+˯*}:efZ|>>CVĨrb0:j%>,c_L9Vkv*3B{ݮ,I߰08H\\O oN@?uv]jQZtBIQi;O[VbpLGoNCf̈́9?5Q@u Lm?+;YO-8c~hY"4 EcOfYۨ>[(5x;J."cz!k!kFE&j=aڬcw ̐?PXZ1˄;Qdc>J(~&ӢݪkÄG:pO,q ʉZ-'E I$E%):ddRI$JIJNITJHRI$1NSI$2r%ZND&MRI$ɓP*RI$ID2a%)$LTQ!%)$QLS!I$dHIJI$S)&AJI$dI2e$)I$dIJI$#}*H椥$H)$JRI$I$I$I$$I$I)I$II&I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$'LJRI$2t)I$I$HRI$I$I$I$$I$I)I$I$JRI$:=huY?+zˇQY5:d,d+XS0vo 7A$UWI$I$RI$'I$I$IJI$H$JRI$IBI)I$Jm !M$$SkQ&0'$H O Y1NS B)XI$Q HdNE8IKIcngivm/E}Um(W.g:<=_CoտA\0u/~3 .?5l-.[L $kDB յ>,hs{ fwMLCtEx)ȂH>DX=춣,kْegE++ņr#(V0Ф(]iKa$K8*eRr1{ ) YqDǺmͯw" lyi\d@7T3lSCuTPX 6jM3&O*>!gtz~E3f[z=[,T30;)eGSK08|EMo苎Jz>m%ާtۏÏe;خ^;mjK2kKHQqYIue0p:Mb FvBK[567Q7RAd]Ou١aEwՋEYoƋTD)y1$JGk+q2@tTmDV \^Ku8 ; #)?wF`"Iv0>hmL0^Qߓ<5qr)*YYOԬw/V9Tdȋ.BQ]a Oğimms*_6ec9@`Zo=GQۉ[]w>OlC!ql|FY3sBuX&4?z=,a7u( /r0aB-T_ a${!VP$~+B%fgWꗉG~(Y9 Ǭ΄՜c!:"א6PaI.;GuCbm̻A?{zBf5;=KGo!2=_xDcfkD&ߊ]b"09u{v3Pw+uZ|Uz\oPI}kI=3Rvm ;vGE<AC$xۍAJf>k[M"c X/^uPy<j8:2׳ӧVdS6~벺f>Qs0 ~>RTymcC? 1ߚc㪦a?l:O4юN3#w*Uk쥥5$D-0:^ *GmHO6|Y2C(XKGT' ܏4Vwq(W2Ϭװk K-͛?F| J)az_Ycc_kem؍#C jlL`-+3=e.s@'XKt&kHcGRLKSLRxa"d*oߓC0j烹ۋG:*tn?(il4ձ;0ok- jԛjNp*;>_Mj~`Z?6^!6&,8xOh}'}ӁON3T=KTtjm):hm"JTlQ@WI-&LĻд1~n+9=>6*ϻ\C$:^8@uX>># ٌeXZ Oȫ h_!ŗVZ'&mꖟ]=*F}PQhInKr`5;b%C|<~l ꎚaBh{_;O=xpCwIo5EfV40x?IBʭDnUG&vEG-l^I ǃ_L$voZz׼;Q2zCqMb[ {[j5 h's-0iQm65XeLXuksZB_WۮLwtڋ Wkpm@n<?Z?,E8l|Џ%@ xaTy._@p]>:H%Xx7#=۵2K`T!}k- $hv!|3Z܋g!#sls+߰T]kS YI YvPƪm<^q >*,0LB:/0fZV֘N>(n9izkG`UYq,%GXɦw#^-}|x17<.~eَ AtOkwYd-u)3oд1ڞ %rly^DQYbceֱƳ4'z%v jW |8ݸyRxǖ9n0_ܫ U>WXnxhw%tQĪ,]MԚ |ؤZ%a3XD%1L .2A_v5hDD^۽TSlR %R^βymp~Z9su]Bj}~%Ka!H q/(S[9Bhx;s/2cĒcUA7ܗy'ۇh=kt{t&'Um㱠  }%kXZ!3s4r=l oh''ov2pOt. ='iN*.5 J=_?[e3e\ۚ-<ZچX:|̆kʕouf[LZZ`Ikr9:Y1?Lr#O|׎Z\@rf)kG 9@&8B$YM8r} Li !_2r2E>kB&> $&8O#c&cHAyeOp8*9V~Əݝ?xV ZUafoDELs5ZWx~ [-8څJ jwaJ׹WdMN!Cgq}ͮ6VOHBEY~uݵt͵f<١>#\C=jWRѤd6I*Y0zҏCW8[p~MvIUzG8n#m??ǟ-3rGKx'WK$K .Z%Y[j,b{s<gF~sUwt<2]X0no\qf4)c8oX\7tC:W6?H;rR;.qOE :MNn4Q歠g}T9#O0!{Z P=AJn\=r,^9w_mgPEw|>4 RqoD'4$=V,hvpL?M^›j;KL_#m"@0?6ݍ$z=m4BkkYRKh?Iwd>3[DtfHM.<[N ?![mĤXe9di GU@E6c B D B>\xj.KfexkT`'-~Pś!tcHECpZ4~mXKhy)c eȈu-V`s9MHu+moEZA937 ![a$qvq˘.?J?fg->i8)=?Wy8-ikp.X}#]\h mW!׋Frf^d< K6tUEK#o>U[tIWf ;{VZ3+~>@7w!:2h#~I36 cnf6=Ef-Y^F3`h<'[`AEt"lmm'@|DVV\ pqō0u= krZ\c>( w/Y酎M<~pSs<|_Y}t3nO*8oN4Q$l\RKNѓvAݿsF-8K+p׼Z4x2}$P|'(,yK(8zv|FGLG~s|ԋZ.YVfwF!ޮ.ACgzN,p}4?Mp~'~*-5U(tp+hXY=w&͎-iZ&,@7(De35qBquBw TlLF?:ak gOUOQFuHyKllÍs-}Sx 7=xNa7?ko٬SCZww>N?m胋fj Ve99~l7p;X>_ѝc\~hy[#> },eQuVcOmNC1ȴA:~z/ѡ?nV9|X/3\ki BhZ=w8Gn(HN ( )-m2E<&EjI$ɓ(.I&)IKIp<$$J%1N%.d')RN"2 RI$)d)$LS)&AJI$I0BHRI$j $$IJI I$&RLRRI%I4 $IBI$ɔ2JRI$2tRI$ȸ! $IAB.Cv$$I$tI2I$$I$I%I$I$JRI$d$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-?rZoŏ垵?TjoVjtNd,d+XS0vo 7A$UWI$I$RI$I$I$I)$I$IJI$N8 )I$M0j)RI$ƣ4'I$rLL$R)' )IR 0)J$q;s9i~r HT,jAnUN8B:h]^-gp|-_{$ +SoK^}տ(} twVn11=[Y=xćG{]E:D-ߤI71ǹukwYwvvtl黇m84s%hJ}ܒ9M8 3#MXϧ&&xy+5~K"6H}n550qKvK3+:J6zq׃Ckc$XVXvhF2')R2%#)ccŧհ>O֫kvuK7fIu?rc\%u9k:!ßH#D&loM KH77OQbጷuFv }GV/Lp` Ug#zB 9OWeDC_G (y 4C]X&[}řk4e'e\?k"p=?rs){O~giZ`}ɹ zX>'hpGſv`-H"OڅXGcG! VdUn5!K=P oXK];rXS)~[prkh-?#,f KdEq8GmqL ʖMǨ hU:NcC<$oU~dGOVm.g?F]V覂;+ <6K|ҷ>U:I}QU <\|L)ɖ\0$}Kw5 +8]=M~$ѫ)E;9J*~ow5z7l~ɫ2 ?73NM;o LM GF٠b}cc / u:{Ke~L|p1qO)ZUrl;o_H}R8 tui([ÿut? ks:zf7t0~RϊMsmn4wknMmū IpKrIY#"|pj= [xre7ÒKw?3téOY Rd 9+T_W^mWv#-rzs> y~T湯h gSƗgGKze@:\$GD DۗPm=Dj<@{ Oۛ#cficZ|>`t}*oQ~ X<֭>X`zp8gobBs9x`jw Bv[< mոQe[.GhAc?uUr9SԘXO7sVEk*MI^rO |L#ӎ^%f;.X}ke^vw!XݧC>Ҥ㕂%0 1 FeXDzWo-&BS{}fc~S?K;:Ui9ՏL//^99øpyQQ9 6})2>P; P FkafiI㺉Uëv O%]J'{ðEy[z)2d։a9c؏7<