ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:34:48 k &.(6lHH Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?&F[o(&%Cm moPvE OodޣKyIb7NJ)e]&c=KR;C*sk|[[c["t%H :5Eպ9K?=8%-;-moKk|RT;*յ- Je-- Je-6Ѿ#HJTgCE?6ND|6 .NVFMnx9PXkʶVCK$Z&8l嶴_l*]R; ԇQֿxkL5?"Z n54~ES]@nDơGGzd;O~$l[mvӸIo-Vs:}xU3{mcsļC׻rug.O熷~ր{|*:fEyޭF]KWwU]SsORV+S}VHI[(R=e}s0/r}8,ݒ,th׎y '׬ez@kQq\Sp~*z͸gs@?Bw0Iˢ*kÄAGA5ޗqp9:%Kn+{ױz\EYIw8kU^ge9T܁c<XNr+{6}?kÝPH[_vǷ{2 Zޕ0PDi9c$L't?d6XX:X8>,:X1w~pcr.j}&8>Aqa;K(-(}Y!v~rʳo=#6!~ɺ]˶Il oRf{7i1T2,e>Q:Яͧn~\^C5];"C[$:X\ls @nդh}&ߒWމX8GoؖwDk.C~jeFCF;Sel|mwmޕh\lk1v6Y.$ 92N?J8#]ؘF7RyO"\ac##O[sٲlo2\ߢfͬ$6DalΞAE8L4xh'oQաEUZ=?G{FlTUWk]]>md8"JoXiw6=7 I-?Z]YY۽ A{sӁ[-q/.kGmi?a/]ebbX!kSd”al)*Ro/7O)Ehhh.{ju;]찮%xX#Euѷc̾O}~F-- *La}f@\,oT (zmuou`eoZ}@kWS 7:ݷJ"Wedo5D;k%M8o$7BLuSYflwnG%]54ÇSPR;9V $w;nk닚Ȃ swQi-wew]f,w-$}4{4{C{쑴Ih͟uhX,A`qݴwooٕ^OI40 umU.i`ZaψKMVAeMT8x}͓Rnt\^fʡ>:K fS4٠wudwQ[o%b jK xh1S֤*AG']GEID|9IyNXy<5mWSEWkyiX#`fqըf5,:В M``Yl%f4轮3sb6.YA2Fzh^qZOT,cGTd rZh[Sj%}dT!l|vw=*MNjmmq~b]H{FwʿR '_Y9a,g@#Q=FiomGmib?-{/{NTN}xxgKd*vcG%՟^UB\>s%#W1ﱾ9wV(,-'vHSG36 i \+7p}\_9u`ӳv\c93ߤ5 ᯑcH%vn-{'ةfi{q?Nu6-q^)yƷV#V6w툗ʶcɟ?vZCGUA[ń;kHӻޭ]$ O~t7ooj{2Z O>{ufYPâ%4[=h?AwZekkSV=7_Iى&Qx0>!ZD6 b>!q6WF{F؅[U c3À=Za~fNbV+{ĆmAF;(ېUKa;e*;\aְx-[w}E{ן?50Ķ:c[X$hK?uYm$: H-T.;7Rr$04H4ѷk{!h"U֣PK9`|\ GpwJw>%K<$kθ%?-nL<]#&ݮ-`emc_`0AEog>H29`W)ƪLk*x<f'B4i6Dm+E>(h!mD+MvSN`wx MA9iLphմΏ%Z )'=!GUꏼ­t?rh"Ip~do>.Q4Z."k@/3:_W2 >3uN,}L5ex:\ q&_烸\u.5O{3[)XQӬ4v[80^p?ѫ4}@{+t9 lh6Hj ()pM%u1/L&>?r`KhC~8)+F!59!+Ժo)noM#|Α4OPhotoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMU kworkbase_foto-24 k nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong kslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong kurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM $l Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?&F[o(&%Cm moPvE OodޣKyIb7NJ)e]&c=KR;C*sk|[[c["t%H :5Eպ9K?=8%-;-moKk|RT;*յ- Je-- Je-6Ѿ#HJTgCE?6ND|6 .NVFMnx9PXkʶVCK$Z&8l嶴_l*]R; ԇQֿxkL5?"Z n54~ES]@nDơGGzd;O~$l[mvӸIo-Vs:}xU3{mcsļC׻rug.O熷~ր{|*:fEyޭF]KWwU]SsORV+S}VHI[(R=e}s0/r}8,ݒ,th׎y '׬ez@kQq\Sp~*z͸gs@?Bw0Iˢ*kÄAGA5ޗqp9:%Kn+{ױz\EYIw8kU^ge9T܁c<XNr+{6}?kÝPH[_vǷ{2 Zޕ0PDi9c$L't?d6XX:X8>,:X1w~pcr.j}&8>Aqa;K(-(}Y!v~rʳo=#6!~ɺ]˶Il oRf{7i1T2,e>Q:Яͧn~\^C5];"C[$:X\ls @nդh}&ߒWމX8GoؖwDk.C~jeFCF;Sel|mwmޕh\lk1v6Y.$ 92N?J8#]ؘF7RyO"\ac##O[sٲlo2\ߢfͬ$6DalΞAE8L4xh'oQաEUZ=?G{FlTUWk]]>md8"JoXiw6=7 I-?Z]YY۽ A{sӁ[-q/.kGmi?a/]ebbX!kSd”al)*Ro/7O)Ehhh.{ju;]찮%xX#Euѷc̾O}~F-- *La}f@\,oT (zmuou`eoZ}@kWS 7:ݷJ"Wedo5D;k%M8o$7BLuSYflwnG%]54ÇSPR;9V $w;nk닚Ȃ swQi-wew]f,w-$}4{4{C{쑴Ih͟uhX,A`qݴwooٕ^OI40 umU.i`ZaψKMVAeMT8x}͓Rnt\^fʡ>:K fS4٠wudwQ[o%b jK xh1S֤*AG']GEID|9IyNXy<5mWSEWkyiX#`fqըf5,:В M``Yl%f4轮3sb6.YA2Fzh^qZOT,cGTd rZh[Sj%}dT!l|vw=*MNjmmq~b]H{FwʿR '_Y9a,g@#Q=FiomGmib?-{/{NTN}xxgKd*vcG%՟^UB\>s%#W1ﱾ9wV(,-'vHSG36 i \+7p}\_9u`ӳv\c93ߤ5 ᯑcH%vn-{'ةfi{q?Nu6-q^)yƷV#V6w툗ʶcɟ?vZCGUA[ń;kHӻޭ]$ O~t7ooj{2Z O>{ufYPâ%4[=h?AwZekkSV=7_Iى&Qx0>!ZD6 b>!q6WF{F؅[U c3À=Za~fNbV+{ĆmAF;(ېUKa;e*;\aְx-[w}E{ן?50Ķ:c[X$hK?uYm$: H-T.;7Rr$04H4ѷk{!h"U֣PK9`|\ GpwJw>%K<$kθ%?-nL<]#&ݮ-`emc_`0AEog>H29`W)ƪLk*x<f'B4i6Dm+E>(h!mD+MvSN`wx MA9iLphմΏ%Z )'=!GUꏼ­t?rh"Ip~do>.Q4Z."k@/3:_W2 >3uN,}L5ex:\ q&_烸\u.5O{3[)XQӬ4v[80^p?ѫ4}@{+t9 lh6Hj ()pM%u1/L&>?r`KhC~8)+F!59!+Ժo)noM#|Α4O8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$0Ωٶ]4DI$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$II$I$$I&I$RI$I$I$I%)$I$IJI$I$RI$N%)$I$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$[ucg?rZp57+5:f_?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$ RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I'I2tI$LI'I2tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$)$I$VcXi>xI I$Ī)Sv!A.I$I $I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$IN6$INV$INV$IO %iRI&LcA(ù4E ) +Yܴ|[+MQIGry=ju:؟ kXG.6Bm/i?Οk~+Owdx8ה6НRoL?E>XI;#SINj11*`|'E'I$(L $P 'I$'I$4'L (]2I0 mJY %IL]nzjj b+BL˔K d(5;"G6Ϭ-\&evoz!Wr> NI&I:HZI&I:PI$dTI&I:I)I$dI&N$BI$I$*I$I$)$I$JI$I*RI$I$JI$I$)$I$IJI$I$RI$I$I$I)$I$EJI$I$RI$EJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$IJI$$2JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KC:\և[ucgO3S?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$t I&I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$N$)I$d$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$IJHI$I"We@Wӣ[@RI)TQ¶bZ]_A|NSk@ǒ?,,%Lt~sfZJኸ4!3)rjtuPI:dq֒e^#঒Ѵ * (y{Cu(B$`}ts̸QI$ijh$I$)$I$JI$IJI$ٴy!d;}>jǿ*i+L1N  k|dI$I)I$I$JRI$IBtTI2t:JY$M N$I:IR$P$$)$H)50R;D h^% *PR/W!IhmB Az@yeB\aM$-%Ym +# M 9uуh T:ng71C`,⃜wEʾ~uCl5v6Tac;dtWDj.II $I$I)I$I$4$I$IRI$I$$I$H!I$I$JRI$I$I$I$$I$I)I$I$*RI$I$I$I$V$I$I)I$I$%)$LI%jRI$I$I$I$V$I$I)I$I$T$I$I)I$I$HRI$$%iRI$$%jRI$$%jRI$$%jRI$$%jRI$$%jRI$$RI$I$TI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$$TI&I:I)I$dI&I$BI$I$I$I%)$I$IJI$I$JI$JRI$I$I$:dI$I$)$I$IJI$[ucg?rZp57+5:f_?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$H)I$I$ RI$I$I$I"$I$I%I$I$%)$LtRI$$JRI$I'IJI$$$I2IIJI$$I)I$I$JRI$I$I$I$$II$I$I%)$I$$$ILJRI$$$$ILJRI$$$$ILJRI$2I$$I$I)I$I$JRI$IԙSA))I$J0,w0ߊ3:{G3N( I2JX]ً[8Dp'p-]$,ZGoN"EtҒHMĩ>h@$'H&ԒI$I<(I)$I$RI$I8 )I$P'$)$&H@BHhD`L# "ʃr0(J  QVY$MSe$I$RI$JRI$I$I$IRI$$JRI$I$I$I$$I$&;w技$kIV3N_j{ZG.̎s0"$IZI2I$$I' RI$Bt$)$Wjb8I^ۊU$]>n+ z$I'-RI$I'IJI$'I$T$(J$I<'I%)$I:dII:d)I$pIB$p& R$M䤖0rOZxU2PLi!S>PpG\Z|ߤ8PۏNc.kh5ܫuJU?8vSmS@47@!1A җ5*!M!IiAPv;,sK*٧㹺9HJ%,p(j'LI$RI$N)$I$E*I$I$)I$dI&NH)I$dI&N:JRI$I$I$I$$IO BJRI$d$$INJRI$$EJI$)$I$:H)I$dI&I:I)I$dI%)$I$IJI$I$RI$EJI$I)$I$IJI$I$BI$I$I$I%)$I$"$I$IRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$RI)$LI"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$tI*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$$$I$I!I$I$JRI$:=huY?+zˇQY5:?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$IRI$I$I$I"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'IJI$$kĶZVI$҂[gMw7FfM]'pqM)rM>Ϣ Zc$t$O w$"8I%Em8'II$Bt(I$iI$)I$d$I$IIJI$' <$$I$%)$L SdҒI(Y$bLIJ*9*$)Aѥ)$TS$I$I)I$I$ RI$I$I$I%JRI$I$I$I"$I$I)I$JOlUޛ|l]) $ *O^8:+I#4$@2t$RI$:I$$I$$I$I%)$Ws+ I{YU*IBt5LI$IRI$tI$tTL$$$I$RI$<$$)2I$JRI$' IK&NV{7'L[MW WV. Ts8A;*[LK|ģ%+*uf!E[ X=+tKؤB4pw П^ӹlxx$I$I$)$LtRI$$RI$҄𒔒I&:tjI$BxI(IJI$JTL %)$&tPI2ppR$@) .)4rR&&HU@q(WS0IV_h~Kh(:?WS5>E%6/ NΨ Y^~[m,F> *P9Q{`BT{ԬY+hLژ\@8+-(J@QXI$I? RI$I:JRI$$I2I)K0В$$)A*X-I;ÑEX#nL$s Uw^^cVJΙsig{GīDsyXr'[B13,P -h!Εa,p(OµyjoQk??jVT'N `6w O/z"9W04e+VW<1u-H,5i#W4y| %P)${e$I$$I$I)I$I% "$I$NI+U(Wzʢno >+)'I$I$'JIRI$I)$$%.$$$I$铤$dIJI$pI IpS'Q)Ռ'mNm{O@&**swR:QDZ|BԄXU.CQʧGVp0Rʉ*M@).BqS* fw2T'vQYбo2IAJI$'I$I$I%)$I$I*I$I$RI$I$I:I$I$I$$I$I)I$I$JRI$I$I$I$$I$I!I$dEJI$N$I$I%)$I$IJI$I$BI$'LTI'LI)I$I$AJI$I$RI$I$ I$dRI$I$TI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I2I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$2tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$I$I)I$b9LI$I$$I$I)I$γ,~W,gXYS.FfL?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I'LH)I$I$ RI$I$TI$I$$I$I)I$I$JRI$I$I$*u$ ?H(&IUI_9~ C% I%Ktx IYi-O~G)pqL-%J?t}?z\\atj-%J?w)}J\\atj-%Z?w)}J\\atjIj}JjE.qLɉDe?贕GܖQG$hj#zkp HqJRJ~MTO*IEmA+ SW-CY) |QPm=;l68TR)"lNI$I!I$I$RI$'I)$JIJI$~֩5l[}+E4| wXPBa2)j6-iH8h9*?{˼̣&85ǰT1koYiZLy$^"g{Zznnl( }3CyEJoA0xaޖ͚V y>PCt|Hi>Jn;=DqwSN\H Gt~2Tmh̸m{#mh*QhKn-I a I$V$5jq/kȖ%d{SCD@ۋxq;<`i h.&w`$Ӧ #9e+] Ck Qsv_τ 0OwK}2߽<ـ Y,Z7<7Q?KP> LwG&w5 3Nkq; Vk)BYqxS3vǀD+5E$OX$I:d)dI$NI&NNBLI"C0Э7}n2|@. עCR%U9H@**s43;hJΠGgJUވY$?7.)Ҵ*+k4B\bUp%\u[Z%IW2үɭŭ !f-7*7kB:=@.sŸ6^H%h]Iֻ*K)dd$LUخS SتeηۘuS NcX"TP A*L)Un\֒|̦@5UO5Ii61 q!Yl0mcURCe%QXpVwTw|R&Buײ!$͹ ÈCbeg&Gc⣔xY# SJt4+]#$M^$Nd)I$I$JRI$I$I'L)$I$IJI$I$RI$I$I$:I)I$dRI$I$I$I$)$I2t)$I:I$TI2I$I$I $I$HI$dI)$I$EJI$ %) $I&I$I$I)$I$IJI$I$RI$I$I$I%)$I$AJI$I$RI$LJRI$2I$$I$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$tI I$$I$I)I$I$JRI$tRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$JRI$S')RI$I$I$I%)$Zoŏ垴:=j隝?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I $I$H)I$I$)RI$I$I$I$$I$I)I$I$JRI${Cp~ xHpu Z]74tThqVpNU7Y PpE-=R8M)ЊdBJ ]$QJI*I$BIAJI$$$I2tEJI$I<% )I$hIJڒI$t$RI$$I2xJ$Jtjxpg$Z+~Y& CPc1{w(x凐Y;A2x'1RH$<$%)$M 'LI$$RI$ I)$'id+mVzwR{%߲kq")% BpJRI$% EJI$$J]$$I%)$I$I I2IH'%)$H'I(IJI$҄tdIJ V)v| s^?8*\wvMெGӞC\*TjSUXN`TEkrSB AK$JIUİCEp !-& ס \ RI&)RJqQfZy(Ys+FhW樕{ǵ 6ש<:k!-F4[JYup>΄xsEq4g-.Z x&;ڢ2]6ןiw;1%(0|H gˆGS/syGTA3 RsѶoQk{ǐOAKZtIJ!=oBf=l$nQ5379+Jixr[2G)?<(`G7:Lʋ RA$I-MS׏|['-4!ܺ4o+RrE԰z Zy F. Sn=ʊI&]$NI$$I$I)I$IBtI$I%)$I$IJI$I$RI$I$I$:I)I$dI)$I$I I$I$RI$I2JRI$I$I$I $I$I)I$dI%)$I$EJI$$$I2I$TI$I$$I$I)I$I$JRI$I$I$I $I$dI:IFI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$IIRI$I$I$I$$I$tI$I%)$I$IJI$I$RI$I$I$dI$I%)$I$IJI$I$RI$I$I$2tIDNS$$I$I!I$I$JRI$:=huY?+zˇQY5:?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I $I$H)I$I$)RI$I$I$I$$I$I)I$I$JRI$@I$&NhaMV Qƴ?Cu xJi TmhyTzJ٭Gbzħdުz)JhQ,JrR9T؛b(Bie%Sʯ(F-Q-J$(p I$ОI%)$I$LLjeq;F@\|Ni]\c_7tbPOpßڞDvZblQ~73C⇋tJ`7})$|6)W['FpAZ73?Hyu9."(Y3H< Z8~ |;};ЫϭtXcPmkQ$xЦ;O7f%]K JtxҁOfB{ GA (4UV $pr$$ BJ]$&:xO RIJ'T$$ȸ5XMn/]jN1<U'֑ԉ*Q`k̃Ǘ7Z"eo ӇC=zZKT6I);H& {;4%~F?&AO?XkI{Xs9;XQ?ωqf4"``$S9i`P5ɥB[,$y1QP:'˜NJs`.3AN&N֩$IYpVSR"bh gTuxc+`!%kN{/xSxsu:5LTC2|tR#Up\Wꬵtn@.pa?u@ F{}YXtژdUN?V .vO8 ;Ӈ٣ DMjDJNCmYav0XaV`<ռjwOa6ZQ_|zy%X!]gO}wjtOZI$I$!I$M Af 7;[Ijn;>g=m0G_Ave[c5,s eZKv7c;dQ ؗebI:I$INQ(I$IK.#Eo4٩<iDq#rW|nˮuU2󋥵qܪ̧`Pt/|+U[kq3Q-<aMs`wD@Dj=T<*meiTpch<p'X[XXg>WؼǻЖ氏A+=D?\G"u_R;B 9Jʛpn7g[Y:R Fj+WP:uC,~3%<Ws[:; mp>Z c;$&G*Lt[UXP)rQ*D !HĨS%E9UnUmW`%="vX+T~IV1qq k<[0N{s g(Lր=kx0e@ ߄~ȏsΓzn|myH8$|,A/u7c`sجi_cN"{uTI$m=i#pygn#Uʤu<#a1 w T CDI$I*I$I$%)$I:I $I$I)I$I$JRI$I$I$I$$I$I)I$dI)$I$I I$I$RI$'LI$I$$I$H)I$dEJI$I$RI$I$TI$I)$I2t)I$I$*RI$I$I$I$$I$t I&I$BI$$*RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IRI$I$$I$IJI$I$RI$I$I$$I$I$$I$I)I$II%)$I$IJI$I$RI$'I%)$LtRI$$JRI$I'IJI$I$RI%9LI$I$$I$I)I$γ,~W,gXYS.FfL?d,?d+xS0vo 7I*I$I)I$I$TI$I$$I'I%)$I(I)IJI$%)$L}>⒔I('yIA%?W}_! $Hi" B*RI$/ RI$$w[*RI$$wOwނI }})I$ H;K)$A[ +a> q+ǰ>=PE|G+*/ntǘQ!68:)ؚc SR Kjp9IK$SA)?4#pLB)5DTaB,LkFRR@䃐98i Z*%!() 'Wښ 1 $!II)(WSpku%iՎfA/cr| NPSy.{B5tj``$'Zn>xe|,I_αOJݺA7E19{`EyB?m^GϙJZcW=G?MS4| DoR };=[U0#G|4Nz` xv(8;٨: y!dPje?͠s`Ͱ$g~h#{ g{0{8t9+2O T[$2t$$PJM IJI%=D}v3:kF]Ԓ. *˶m- xM.ѢO_OoM@3J<¬lQukuqYjfA<[\|V[8hVF mr>yx˜,2_UjLTvu&&KcTf_2:`>q|܏Y>x@L(R6S-%$I$I$I'IJLI+;@Qt[[}04@?&LR2v-0O%_&5+c jvZR͈#ӹX{G0Ԟx}MkIg[Act89)5ΐA3tׇb=5oͿj@(l%l?Gco!9ki -l N>l*V> xeQdpq1x$&!yeĜ  kr[ VK9vrnrQ*&jst)ṯ9MrzlV,[!> Mom"z0MgѴˠALX*Om`y}oNrS]V`NBpcuJ% S')c $DF,-!NH&IE u@8<R-4A@s64>'o|:xI@Q-\5(l:GVv4'릇֓ʇӀ$)>k R,Jq\hKS9%_s - nQ`{G<[Qu$ݠV~|3$ID %ӡ|jy쒓Ğy(n'QCmtN˷!+UDi+V B\hkY=w9"T1zS|@쮃:ָ5t|;H&|I$en$:I$JRI$t$I$I%)$I$IJI$I$RI$I$I$I%)$LIB*RI$I$I$I$$I$I)I$IAJI$I$(RI$dJI$NHI$dI $I$HI$IAJI$I$RI$I$I$I%)$I$IJI$I$BI$'LI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'L$$I$I)I$I$JRI$I$I$I$$II$I$I%)$I:dRI$$JRI$I$I$I$$I$I)I$I$JRI$$JRI$:d)I$I$JRI$S')RI$I$I$I%)$Zoŏ垴:=j隝?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$TI$I $I$tI$"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$FGNYѪexvt[v< ) P3Q$*ۊt dˊqteP/ P7q^:U{AAMJ-.FlJPl$IrRR)Q:(T&)$FTp>$L$nB׺hcD'j!{4Ǟ B#;}A7R>(FsYr|?E}(??}X"zgq~_Qz)ø?->.Fk ,E-iZN?uݿ8iCob}67Lzz?L6EO=3*Ls џ+RKdz?O"9d/56i<1kn0LW <l0N)6.0!Fm6[ӊi.$e4{a[}O$үL\@`34Cڎ~ӺsY 7ōiiT6w5x?HwX6KǦQR+ cݯM Zu'ȩΡp>/ڞܚߣ].hu{ ZG$tՓ WIzYm8SU\ L_S1a+?V8ϋ %+ž2s&I:dI%u64XYKKn5S'ЯYqe6OueMH#1Us9rP8X6A!cs$̏mcIe uݱ^+[9tӲq ``Lk`q06ϵJ\Kh|R}^@s}UyجIVLYeFx vI)Lxy$#LhJc?C ENNQ:=Cih>O鱚4Ad yB# < .#GI'I $RI tRI$SZRPJ6 IʻVko`x)O~S\w8f[lBIR5ֻӠIQ"Ur[H{s)䪗:)de^N+`NIZL+>YQ$*AY~˛l_ԔUe;W^-P s|ŭ"bR(x[]S%$TT4+x^ B%XtY"mnP{zZY?v5n(;{BiJTeIPUBTDRvp1):j@!Aag #k ;Аll1H$DL tPgJPEST ')QJQ0(R?cü յ}=d Vlcm j`O$uk!gCȗ7~$C,58H&{Է({Qlsa=m֒Iq>" EA*mT]!. J ?u.uo@PXޞ?GheEv;GGoR<_\{97)DUAKҲ6!u [^;y$FUSр|_J,hs^ u&Ae~VǎkK<#gYcdY1\({p,:I)$I'L%)2tJys|B@kAHx~˚|tSϯӷs].I,=4P?<]XvSq1jd40|Վ7xTV8bw-f .MH?'k_W "[ÕkӾT݌> Xߺf$$5$I$t$IJRI&*t yM#rɬp>k~Tray+Ae-="w7i6?F؃r[do9s#PM@pKI-@՞ Y-Nj_| 赶O?v؟q<oKgs?oXڙΖcPXo5!ßswq(EXZog#. ocԀc<79'{b>ѽ+fz| {?K?ϧաN_YQpՐY>!=\Y?ٰnR-,&9$lAշV*iѧx] i{\u->?Fݰ;ہȠ {;ICOhBB&)pdƏGgnɪV~?oӵ '7kv>kv| KK0tnyh$H$*)M)1 hSJKFSWA=`8E4i "h 8#iX]IvsZwxODsKSFִH=)K7_jb,p@GƥǸQiGTX]EOH{|`E+ $w'{>|NCl6i}7y3wPkmNAV=|ZbGp%$6:.ؗ}/ - ?vT=S}K|v*Jϊz%qY6:~VU{۲I$ƲI$Â6B_R ʩy)[H6uh|S5G=Z5@9TswRp lZB}=9.8.*1V7k1H;<{99Y7CvѶwwSy#✅05-p-60O:I1m$L$xuOc >"cؖ8_ݤJd_\ƒ`*64Sc"a]y'wFDf44QJ;{SI$$$I$Sc[I@ZIBmz(urۙJ]ܧ3ӯJLS_e'Puͥ~ T-ޭGJݘVϠ8  \dRH$bPhhI$IAJI$'-߽"kR/eJI dw!QksDw]xL>c {(qE)*t$ 6{@*jCloPuUwt[C#K%IńmwIh@AlXd35RFCBhh@p>?=f3V. KgWuG'"򟣪[g ;*Ւ#bH[S\UfZ`wR?#+!c[na夅h88H*}}UJ Ӗ6ҔdyLRRŠp2,oSҝe=&Z>.4BQPj NX0T cCq%LBJPLQ:- 2]Lk:K tunuVG>y>?wAH=xy5$+l7{koP{w @LJ&p`Iwx~s~ t#Em7駮<e%@t5{ޡ`\w]M,l;$K&?:ӵ."I>֩7oGȏ!Gy9Щ>940bKcHp2MI Y.[7ji$;q50-n?jė>I,2PnAՠzJ8m%4MN0d!AHd19`?NB-[  !G/s*㿸vdjaLq:4oZ ۚ8xQ\;0(w-Dy31.pARayii)q_QRI$RI%&:n rѱ~ qF&KpWXT7Io扐* cZ H ?#&H7kxL4̇ImiA)7lq@#Ms4Gb98q$Dʞw@ӻs]o*C"(fIR 9TX=3'P5 g_BnxoIԈkӄQGtK(Q O'{\ǸA<Jc@d˛9N0LppЩ}>hiL܉eӛ6\U,fl2tEj$I҄$$ A:JTI2KZ*Lti*d㨐=S<7~UVOVim㸟R;]wɪogsL'7)ɇ8 uhinoZxұy'{^uc[3 [{@3" ǀp!ͮ);vscQKm'ͮv&$=w`~ wͧrIgis1 pc7we$~cn -nk]5N?x0;VicGMD4=n+, 1QZԱZ?vJ;3.yzoSqoW"Zkj{ϯuAֺM[wZ;x9Ԛv9ķ{˼C]}$Y}&56H#rY}'`d |7 ٨B0ٵ=Mgxq/_5iJu T@NbTQ*I%L;L0ݒB$j *-s4V8B'kM{'4#F=a."IJNoG꒒=W nZo;D>S|I>HZw)9)ˏ4{iJJ !M|0$Bxmmv5H8ld\ su&>xS:EHf-coS07I ih$*xq.jWYvEj Y6"EZ=ÝxVdl-T N6%S\C!Do(~ *XŰ|VzL Үcw5{'iHuG-a*)$f1iB׬ UTOY'_FVrA SU q=<S z?*J*%jkRަ)#QRV{;Yok7~ 9$xVOs)?/4UE$a$ZЩ7j y&݁2k||US ~ .#EIhwN= 4mr @x~ 7QW=< _ I!߽ {}+! &,ivI$t>;M%lEqcUdCONL N[wOzcUI* b,)$`=w0ioPbyI:)ijLqlz#HY:I),z/қ{JB׎ I*I$5<~ilw>dF?TI(>(> ~JoU)RI(AIOroP$J))zA-A)$PIOwM"$J))HMJRI$$%JRI$$%JRI$$$$II$)JI$$D)$LxI%)$Lt%)$LI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$2I)I$tI$$I$IJI$I$RI$I$I$I%)$NI$$I$I)I$I$JRI$$I I$I$JI$I$I$I%)$I$IJI$LI)I$I$JRI$$IJI$Jd2JRI$I$I$I$$KC:\և[ucgO3S?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I $I$HI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I)aPI%)12荢ڨ =4  0h$!0x?L'r&NSD`$MOvճm8cks*jW6,1ʅֶr;vA`{GةoҰ ]eH%DSq-ճA>J?jj^z,+c5PXC w-% uqD>ƟڮI&65iAZX$+60l$x{Pe 8pQ|MgyTZCH [ :GrGp'zRx&$l0ZCmdNo5Lm\!vhn9"ƗK~|'4bۏI k>#?i~&$E7 с5`#M@8 Iovc_氃VOik6< lpYx.OYy sw>pvx$JE'LC:dRIig_C]InѴJ~1cyU' 2HL;2dᡆ"cm YO!ƌ#n6yc G `j}6y:>3Aȧ1,lkG#U y]X5O 2}"#>30[׊?&;2[F,3M{}BZBf{A $ mp^Ȱ;*GE6 B/_}Q{OeignVh$IӖ)$K0wd, Ee^oywnɧkVXGSXnyEϼzlnEŠPͣBs̞JI$đ tI:dRI$JRdDsamc4ӫ{qsiG}9d=;ö[G6:fDa#F`pw{}F)..ͣc騾ô?kUE96Z`6IGw_]`_u_}Bs,($O7GoB5N\gCV O"'IqL/Iwjqa?#k`H}J%ceLm?F)YM&q@O;#fnoo"?J*e5'IFOj6QA5>Xi#G)Tp M)q~oJ >?#拔۫ptU퍡F {<5ՖOkv<4j_0;'!(LȘ(@SM&rׂjcXD蒃>a4@aQXK05*GMJ(nD*$@ a;e 3;tMd>(' -bֱķ{OPs4ZQt1EنbC0iH ukr#I  (3h2{?)IF|o'i'5zZQұ%OHņ?;Q>nRk?ę_VD˿꽉G{'RAPuv,~椥k׿Kk~zmήw <~'%3ˊMs[Ϣ᫔w{%r\Dp$5Gm\1Ո jk==ݻo=ցZXk3z-P\S:7 AhX\xnGi\X:>;RmdOWꌇxIigZN͙NaoV "[ii II=bI$}k=]n x&o%ϫҥG0W2yTMÇbk&ih4#=V6hcY;wS $jA=]c5cCH:R>6̷$KZx>陰"[}S>M ?Qܤl9e#ӹ4hdT6 X~O&iXޯJChݰ[z*Oa_SK\?^&6[Z?*w%Cl;77sT8ljs~OچI5OIJh=F!ñ 16,o1:Xvq{tPT7gf4-$,BQ܆^@BsZ~bc*J0+jbR)’R )QS*%;Ú?-@VM~d-! GMD?!.fy*k7;_`ՂQ=1Ǔm+po?Eck{?{ޟnüNKpgڟR[ƇWZxgvjEkli{Al%'mkYwKXFdӒOG_̍of,k$IL}@cC@Lbk#qd+O~[4١bŮoyO)pd<5%Z6' =۴G'kvzj>?H,7i ̓}/ \I7HF7GS kRޓg!TF&zl~M5ot$OQfۉuWwђ> ؅k0CIyv-xa|z᢫dG}OK3g$JT7I2tI%)$Wa Z=[?G \=eww3M4- r ;If3uNB%2Cco t IF$OI:7{PH_lZosI4pjGƇ㾰gog-'0hXݎ-)܆YkZqey~k\>74ջ{AQN4rS+: w N&4E iq)*]F@fQX5EN /=ʂQ9Y |Mbi'I$V$$NJ]$$p$JLA$TIJu >-[!Qnjle=x?!˪5j;-rj%j; /s ~uzg w4ĺ.4|>(%3jh=C}N?E~kol?T0waA5 C.tI_Ekw[& 8OÑۢ4{kt͘iV3(2ْ6[_fL_5~$\,:j:׷d7[p4䪹!YӹI 'tS&kSI$)DI2d'%)$I'IrI2A8;H> &swzlc!*gŠr#7qa߳s)o dnRĎ95Ao(`}Td9ď Y8${,E<IOOj#ݾ,56(h̓$R;dTsV-,7量!Pn4!jLqU J)zD$<'L$2<&)+`05 H4򒔳\=C<ZK?(ޠ#'AnIxtF[A+0L?SǴ Bj<Z 9Mo4xw9JNn<!-:$~rry" h1-N,iGF$ eDeHl %Eh%3{cB#` 9. uΓXȩUL#&yd0q#EmlT $}@ʩĞYx $wRFqq:pE 4jb`0$9+uN,xEmu.2X4@Ee ppuOu IRI+I:I$$I$$I2IIJI$$$I2II I$$2JRI$I$I$'LI&:I)I$dI&I:dI$IJI$$2HRI$N%)$JBtRI$'LI$:I)I$dI%)$I$IJI$I$RI$'I%)$LI$$I$I)I$I$JRI$I$I&NI)I$dIJI$I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I:dJI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I:JRI$I$TI$I$$I$I)I$I$JRI$I$I'I2tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$铄IDNS$$I$I!I$I$JRI$:=huY?+zˇQY5:?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$t$I$I $I$HI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ph'cH# ѵTᢒeRfZ!G8\P,hs=ʛyy-]8K*Fƺ@;L0;KXI{J>=93q >=Rմ~?ԛ2& `Gpv۩Q0ei Iw*5KU ]ʯWkA>gi"u 'c~O X̳ӨOGײUdxNclJSJxNJ])LPxJJ)M)JIƚNRctkHșxto40TZ|_EB4q}='{Tl7\൨FXH'S\Yo?Mpv&aڬK)A<;6Xhp֬Ii'}@GnoI}; |}ZX7Tb[`KZ ?>B}v:vPx<RML&wl#TR 輐>7ωH[~3+ pvoc4 v?wDk<'OOH2wUg='ce#h-o$Ʋh-qp5jMH?';g qGAOv|ɈjHvF\~!-"~_z[cZu;p׸1xc 6qUsvVpx\u SHMT-թYlB>L[5ҝ䒘:]B +B|8I+*oBS9Q aA訮( 7"II t·], )k=/-iZ#7YƚA >1Wr<:\HV_ScaQ&x{f8@`lR3km XA$9?E"t|K6d{CFqlh.?稾@Z[ =?s@-l5vFc;G^ 渗x9.LI'IoX> ?IyKS+.;ZIQ'V v4]'Ο!ld{30Х>~pmr*]`;p?tCHKwMZ~-ho+S OO 6;@<MQ q]"u~׎;cq62\\@a?}CESD ğߟت)RZaJS$enq_gՎ7d(?Ɣ+Yxx2P}'yH❝4['cf04ӭ -Uwf#?xu zNd@%TyVÃvhf+n("&UpM)X\Z4Lݛ7Iq$*Ux3UDPf\>h*Qo 16*ETҌ s< 'I$LE$:I LRI$铠$$IJI$O27THc|tś|Bp!w3'?kB~`?6k2k;Oh} |\~mR:{~ ߣq'w?)0fo^G^Ʋ9B[O6}1o|?NͰ)<Ė g*HYCDHsɝl4?HA(lq x ͧcX};ZwVpNDD!2yN pVT]ugdUNiJYPi{&{Qhȱw2Nnǖuqsa:`D餙:I'I*I$I$RI$I$I$I%)$I$I I$I$RI$I$I$LI$t)I$I$JRI$d$$IN%)$I$IJI$$$I2d$$II$I4$$I2I$I&I:dI$I%)$I$IJI$I$RI$ВtRI$'LI$I$$I$I)I$I$JRI$$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$TI&I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$ILJRI$$IJI$I$RI$I$I$I%)$I$IJI$I$RI$RI%9LI$I$$I$I)I$γ,~W,gXYS.FfL?d,?d+xS0vo 7I*I$I)I$I$JRI$I$I$Iе)$LI$$I$H)I$I$JRI$t"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRd.̶G HX+' wc;ڷ*l}Xth }je+iPNP Eۻ&*F401 ٬;5k%ͱM<ƨzfn5AY4D,49qwLv:÷;MO#0 >I4<D@*@1<@|,JAdpTI'Xú_D=\PuU~WVdGdb܏_A/H!V},?y[g$~ KYc45 Iby0w%3N.,w*F*_L(N{LJhIH%.IxN J)J'<'I+DJM|ߚd#ZV7xr/4wFVd?R潕:ֆk7ʥװsv;a5l%,gͿ0ʋ;#Y&'oޓj~Qzpg)>6I"ǯRDx/,QǏavxng3$?ͮGbJ CM`ZYO2c\|='Q<};E=wiQh+{S-w{ئD<;?Qdָ"#U 7NR!׏F~uAݧ w}Ώ>|zD ntS"|`41[@?F[0p>+MW| kCm'Uwl:|GJRsZD㹻@?wWp]P<[MX7D 2l%H@O2 +ku*`$N *I)Dʄ<(8!975$m(AEp P:*I!k.xі~jRm 6r4jd.:ďD8HѸP{˫ =el?hqy 7<X^_Q?|˭?5%eH> %*^hyˇ .74ކ -2#xj h3L]$؊7{ꆟ&kn-{{R HP6{mv!Shr&U߮Rpu9$B˄#[-α6#]!uw}&-{HȠ,f]jð}xvAc>@k[ $JF$:t Jɓ'L$LI)S0%$jI% mmB^`'v|֥KmZcUF y )H#VCa[C71{{xʺvU?9AꏎH< }$&NJlil55+a_`ĺAF<;.Hl%"^cЌ R|V,`D{}t?hvc͇cYD:&lz8sC+?TPxۡ5 Qk|=G76UyhRs9̓M+,Ͳ4kV `jC&{66L]GirXQ^Qw=npMv= Rp sS"o->&>O4+ꅣZV$][{mk o~5&6];{?e_Ss\);Qp&81:v?<8zz6| HŐsEE`TnYR5DVh j!hdx{/V` lתQwR+'̂ѐZ n*?U^S3giH\htDvZA âRiIQv$NB! `(Qg5>#VA#D|BoHi@KwF})C3svݮ󽩷{ˇc#Sʓ$BL1[@hӏ)C ߴNiIKm-NF)Ct3!0 Ռsv{#젴cK4R߲N(:x(p{1:rZQBFd5K SxMHq#$=B#;(۴A ILI0I ;A\DOMI٫$OJD\H'B l;|zƻs VDv+e%:乧PY!܅2nZlgUM%ĻEit&M^I$$$$II$I$$RI$I$I$I%)$I$I I$I$JI$I$I$IJI$$2JRI$I$I&I:I)I$dIJI$L$I2I$$I&N%)$I2tRI$$JRI$$$$IN%)$I$IJI$I$RI$I$I$IJI$$$I2I$I$I$$INJRI$$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$I*I$I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I:I%I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I'I2I)I$t$I'I$RI$I$I$I$$Id2JRI$I$I$I$$KC:\և[ucgO3S?d,?d+xS0vo 7I*ʺI$I$I$I2H!I$I$JRI$I$I$I$$I$HI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$@].km!smtwXyi ֖LhD73'ڔ[JM)% <)$ BtR$hI:dI;LVˡ:5*ա."ЮC%\œ<co]f\6^D-,ѹ.Iu4~}|p4vԡ{A;gX]!{|o_A6-0B{ק->? xXh=/ B66 Ye{N|CKKT:Ώ>ɭ4Vt-\#_oe0ڻ6gފk7+IeO$q ҄=bLP햴NiAkf7}NRp#+m OE{40[S\DvAR-,+}zCs`} MUƘI+]G,a6\7(Gs- HZVSHMvk58KL{%$M睥LpG6=no90;*`!Lng恹 +ژt;QT-{C,hs,$ڏԀc C% W[s0UХ ,TI'L%,$𒔒I$<$LRHhek<;Gž咵0߾=(ЮCËU;Xv>-]I>!;kˇPC?Ia՟V)|Z]g˫k;__% ymw1gD̴|;T яuG贷뻹hw=9`v$.%i<ݚ6$Aag 5Mss'6RiSHkl 7s}'W2"-Q@;pbwcZ)6 #x)OoI,`w3Fң\ni<<{馱8VvQx"@PMRk5-w(5$TwH>i)Ui 'g1#O @gAK`hUvcQgwisA%uEo/HvW ;F5UFGq~`դA_ĺD і=Ǩ1\k~M&#GK:<φHO^ȟ1w3X2{Z9{KK=aN> T=Fi;ǗA':~^gԜ ѤFz@,&| TpOy([: .ԶAϖv(90<,vm"kі$-p w"D'Zs ܱ oӆ7y/-I7P<TyxsjMQ?ڒ:mNL?I|C ?ޞ`ikcl&E̡ >bp^8]GD_ḻJݿfԘ8{~J!yWkKʕi_gWc$Y#s[{;/.55gwi`\F.wEMϩQ?6Ƙs.1_곹E:ϔ>/=>jI ԙ$'I:JRdL'JRd2tI%)$We*=6>)O̧X_?WU_,nj_*I'Ocm$DBH)t%)IXãtR4,'@ܤgd-'hnOnie#kTr h]/S/2?0 U r/nq.ԙ)Nưho> RS$S8JIK)$Nei;MDh@"?ӉG)#껊K_Yݍ3Vҋp!Erj#]6(/-kL4݇lѵ1Xs}V aѶ5ٳoXZM^V0xk"OI{xewω]Xu~. lzZ\Nm-w5ӹ`x7XGxM9<;s| "mOpl`knZypK+IcFs¦r`* fjf6tƀЉW ) À?v$Q%OHBDl{ ;2":@GE,?fcK  c;fa:?G.Ɖf 'H ߙI CX]N)7t< ) 6kdE@ hfd" RDɡ5jgQ%X,ntSI$IJI$I$RI$$IRI$I$I$I$$I$I)I$I$HRI$I$I$I$$I&NJRI$$$$II$I$IJI$$I)I$I$JRI$$BI$'LI$:I)I$dIJI$I$RI$'I%)$LI$$I$I)I$I$JRI$I$I$:I)I$dIJI$I$RI$I$I2I$$I$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I'IJI$$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$IL$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$N$I:I$I&))I$I$HRI$I$I-?rZoŏ垵?TjoVjtN?d,?d+XS0vo 7I*I$I)I$I$JRI$I$I$I$$I$HI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$-~**U<24PuROb%tɉNpQVX'0M IKIT)J$JiIJNI-Թ 5^N9!2{/ǽwPT3۶8w.`wV6lwχN`icv9rf@w(ֹCq= ϼr#wQ{O Oo!t)ͧ{k4K|~'2K ʎ26GonO@k_ؤpC3CKkIJ Ց]$縍 +RoѤmǁOC4׏[?ޓ+ %՝?Q!; w;VZDyޠ[Q$XIw?2g2\picԢUW5'̻B@juP@73R6O&WoI/@>dOh0?K!q%-amp._H6y˽U(,h.;Ck#M6R ٦{ZK|b̯Ӵ9J;qk,}ۏjgUƆ hTߏ(O ԋS)L'I$2IJЬq[lgY⁔DCB"s o|ա"Ƈ vߦufK4Gy{t H̐?hh>?(R2= B. ǻ|cI79G* TTCv:\TvHEϼu3H1#pppllCFqӻG%2E5> "@ߢ{M$d#H`׳ZpJDw g᫏3ʻ/wvӔ҄tRI)yM)):PJ]4I'I%)$$tNy*hnh6B]Pm_UپyjZ$Vϻbka1ߚXT ;P6PG}v;hՀWoKK Zt*JōYөA[(̊A6U*[NݧV}Np,k ]pb:->?lPkRum?нD7i[o̓M@EI-1G椦^px[I! ם?K2jPcÛ!ѿ|:|aץVG'hA1zvGԓўц+n@;=I(V߃/ p~?&hgJg?}$K$[==R.%>l?)p ϸOM0!w[VwRBgQ>4m]2֥mx ᕑgp+X=>  \ZTe"%Dhtv]ͅ{ZdP&LEfBΪ]fc*]U BQU7 K?72i`B(`*^9*FJ; BsvNSP+G^AT J88vM>Y|U s~!_Q}bƖ }U =G&6#ۭ+:}@EG{1@ه u~GM=uK2;}A魯=]MI#] /lQemqwB~I2mEc'mt5ݤ?1J&{Ƴ,! VZ5F䔜gFͬNOZq.[>%iыYr|'6J-x :nhJܝaωplcc1W==07;OZtcU-|?[;n6He x>MoM;yL#ȨսG4 g sc>v4Uu-%@Z\XtӻS.H }Q5%2,ǖbt6]Ss~kEeadmvBA<'9I%)L)tҙ$$IJI$I$%I&I;Iׅ.(> Ђ A X#gms+Ee;S1$HdNZ} p˕66\ԏ7 R$tgUIy+0|.=wrU4$2I$tRLtIL$ RLRRJtМ#Xv|l86mi&Hi}Ə%_jkSUoxM2ϓi͠ǃ^?rkHzVƾ'8-es߃,w>V@.\jԷ5{!h?<8_HG麭n-0.Αxޢ,öZn6%pLv'eQcWɀ<m؄lCXWo${õlh!fe4Co7uQݦR A" N`)n5 m&!(ILI4@J}WOnYՒ5tP)iF%O.x}nZ<0sKGiԹ!:4iܨi'$;QIJN5OiI1JT7$\TJJ]<&:nSBt%)$M O;nz*C=(atMTuGUaBṎ!ikwkYp1<eߦ,GS ߔQ-=Y?"| ]q-2^ekxI?e 0}6|]ni.,#xxx,ؠ>I͛\6I}IsLyodn|77NS{-4GcROsyHgW{| CkX_$xn=@Wdją}V輷#3wE+8$G'p&nKC D<}0?<?vЈַ-Itx%)5 R>2^T$I{ND Cl#{l=A P؂͋Pc-@zUV~(ƯŠ65C "JxJ&'ם4*mݫLMv(99l|Wê`p_t@7@w.(T} YTk,'S«+ٷ_%bj󸣷ЮNN' wU7ĩ"HuGIE` Cw ZB{7T׀ֿ:ravC¸O2+~L#9Hh~!V4Yz{ṡI&5UY7=>I!݈KGy`$g+xzw^~tiLk-ҩN6b)I$BJ]2d4'$4ҚNJe)JyM M;H!4%)yQp=Ӧ%jfkY{oR {GJS/ =?Kt9,߼r," OM\ <)585Ǥ{`RٮߓZ,i-,|Co#P,ΡϯFTY,I(tG4!is~sR :xc6{<*:Nݭͧc 88""/g}j{zg6Ao}a^lh&aO~_r$BЩ}ď,u4[Bug; -u/@wߣXó%̖@1Sss<¸V;>EA3 IAF7aj(-Tcɮ 0| pr=ō: s@TϽrcqX7n -lg2Hh͖y l'lCv|2%de.,g逸A$)$$$$JR $&JRI )I$G+=\鎇ɌԳ:kTz%S"4H#dehP ZEhuHY詓HTd]D{UU̱Xw $,-#SGdxugN+ʥ $nLtRI2dIKI% IJJRLpwI$L Juo5ݦwh3H'kj!n]$OSWwpg ׏~,z!w9_:7(1߻觤$0Әg4v.j,t-Ǧvh?6 1#g]:u3Pe-$(ɫVY?^ALZz< 5G\A\ea*˹,`u vi@[d0FX"!LlwDC*Pi$A"<tѤwS@;$th'Op>@>kXn&==\?&4:܂%${ tS $:KX6LxeH۩ixnѠ~T\24S |†&?2 %3(f\LL&n0tf7akZx qvJ'{(;CX>E@:Ω!"}6O{Cu~dT'Do4i| gw*0`xSFȢtOI!fuƽSH$jPu.wOSl@151 P>KTGHiA3'C5AZm_  RWĴt#Ea$I$I$IJI$I$RI$I$I:I$I$I$$I$HI$I'LI$I $I$dTI:I$I$:I)I$dI%)$I2tRI$$JRI$d$$II$I$IJI$$I)I$I$$$II$I$I%)$I$IJI$I$RI$'I%)$Lt)I$I$JRI$d$$II$I$IJI$$2JRI$I$I$I$$I$I)I$I$JRI$I$I$t%I$I$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$TI'LS$$I'LJRI$S$JRI$I$I$2I%I$t$I'I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$L2JRI$I$I$I$$KC:\և[ucgO3S?d,?d+XS0vo 7I*I$I)I$I$)RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$fu9@%&%R '@ý) i4J;N!ifI*-S.j"(h-1-kI?˵%>:%׺aOp<:IVU#]~VXw|BpA\ 3J"?)NE JMRS$(JA$$$ɓ )t%+Vi#Cik$V7᫇B[ ~>֟- ˭K/wx5SxssѿةK7nG!o6\ {?*52?'hhվ/EqGojRuA:sCI&c}ֹɛn4wbR?NcS[iihM67iLc?zmw)\qؓGʶ䓍-pbZ~ 6 N ؒB߉  x2s|w'z%+Ӻ]w|D>tph>x[#]E坿p|Gc=і&}n>-H &Ŀؑ/#PcŢ?9J[:*%_.O[w @1+M2wqw c;xXmn-;0Y4ž1MB]G+6 jLllFI?,]z߽UrH䣉jQ˰gve~#$dd }k⯍4 y$I+Tdҙ(NJ])M)$0S'$S9$hsrgU&%Qcn9 N/w#ў'$ȡo+2]6V4= d\% R;$)M)$tR$Д'I%/2E$II/;Z5)( RIl7s 1*Xn拶A=V!O2daU1k}A.8etb2qՌi }i%fz4,Ż4">Hd{ E%oBsq#UJ^VA"úkhcG.*OTgfȢ:@|v[Aw=^\?G ^ScU7`XᴿO-16<-?A]->%d{G8ypY@ӷL[D-s9߄ұF*q>ӏM+sOȆ}~"ԭOK=OFhmh>\?6qܠó?/4iPH-qaoKak|vMELy4@ F~t sR`s\5yIT"nRP:Pխ! 9#YHSXGT]6|CC?unf]i?I +蝮=wu%uexTa #egIWmz do%C7On碄HܧSZGs_q@?#c7ٗv&ѦthB!=x\u 9tIL^cTp0oC)5D ⣴p$r $(JZIsȂt8] 侓`;Z"~HÅΥ'8 ';IbB"'CZָs4N8(yXi#S>k{ n-w ]o>s?[ xU5`Ӻ!fhYŻq5 I$lI$I%)$I$IJI$I$RI$$JRI$I$TI$I"$I$I)I$I$ RI$I$I$I$$I$I)I$IIJI$I$RI$$JRI$I$I&I:dI$I%)$I2t)I$I$JRI$I$I&I<% )I$dNI&I<$I&I:PI&I$RI$'I%)$LI$$I&NJRI$$IJI$L$I2I$I$I$$I$I)I$I$JRI$I$I'LI%I$I$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'IJI$IRI$' )I$Pt)I$I$IRI$I$I$I$$I$I)I$I$JRI$I$I$:dI$I$)$I$IJI$[ucg?rZp57+5:f_?d,?d+XS0vo 7I*I$I%I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$I$WM\6%]۸kp+LRJ;bLڱlP4Wy8Wׂ O(jփ&Bx LdTd;x{'Д@5 Ýq.GQ)<`. VOxyyDMkD5 H;A&H`wI $w?J^a4 HqhĤ8D{vy ~_ <Ц4IhOelw3ςS`|N.{LO \!D~):i S4B dqJm(Z(pOWަ@Vk*j%j~p\;d尐 d*A)4Qs0]iXsk18Z#Ƿ?=G-q?wԏ9DxjiCkgE_[ ״9$]g #X;&,;Og:vѠ}0tu? I \vTmP_AY{ Zy`-"_OA}*{EIcm>'JHd}tO}+={љ([MDy?C&c;|rT ]^))msO~1N?.?R.?Kލcgk/V!ğ5ncK7l<:Ĕ<`VޥakdžjNG&]} K-s|j5dV ŇVMݻ-GډĞ5Eko+cJV=mݎzM ҄H¼JJT$I<$JI4'I:I^SJiM:ӟ-s m=GHVULCeSI$i$I$JRI$"&} " ,D?&T=D'r6dhG ƚEW&4DžM̳'H;G c+YHԧyrQ A7!iL,Crz{CP>@mdtoh~+pP,$BJV"Gt铤I]$ҔpIJI1)$Ɨo)Kq۹H Mpn1'&9Y9d [CSUUXF4G\ˈ$Vj$k}\XDYL9ϋA u*`1T]6S!kOJ;hv|}ǹy5qcu/zMg?DMִK75nOu*w:?z@6?Ex1YnIQmEqr$G\kia7x5$ yR\hǘaw bpnbBs~}ڙcg>M.ωש|ZRIimD-EA<ۣ\f?uψh[dE uwqтj}BPzJb[Z]_O+X+O!,w󛏓+-ɵH}.VUQq&VqKPfHj?Mo0]3!ꥏZiZ kٵeW2q`**j@my; L}x 'ҚQZ&I2iJRS(Rk\{1rƕZ6+$iiXe0lVw.7RohAc (@>SoH;H>-J% 8UI&82Q?݊vTs|?ĶKZ5)VsKO-LL=`8|[o1ijVY`npe; a;!#wOP$>#K4nG敟i?Y&Aa6I/?x~!ilYE,!峣Rq?EA- D/hБ*>#Ip)2H c?z~XbD#k #-0XӾRn"gqˆ*{]0FO>#l :LjT{@"TfftH^'qV&x )c#iT`)A$*-tfZ`(=15nFv2I5B {s~?JO$4̎ɝ 4BS8LPk%hذ^4@I1!@ hjfNtN3N .o? p 8F8,<NZ` 5k= l$LLtuqKݾOL #8dXWbHG @NAQ0 N 0 v( `|R4k+"M`$yLH>0q)."$p]$HCk6٨xD41ςF'1;th: )5٦O&#-?Pw(kef׍8Fϫ;6f"F<<7eZ6Y +l<*>HI * AII$I$$:tI$$I$$TI$I%)$I$IJI$I$RI$I$TI$I)$I$IJI$L$I2I$I$:I)I$dI%)$I$IJI$$I$)$I2tRI$'LI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$dIJI$L$I2I$I$:dI$I%)$I2tRI$$HRI$I$I$I$$I$I)I$t$TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$IL$$I$ )I$I$JRI$I$I$I$$I$I)I$IIJI$I$BI$I$IhuY?+zγ,~W,WSju?d,?d+XS0vo 7I*ˤI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$DxD A4Q't,^Fk0>=YĘh쟇0K&`~F̭rfRT܈<*>ʓcpGb0L^֐`F˻7ƩLװKStK6mS>jE,GGtTw)=D)t 'FS&D99@q1@ &Gf52\.䴂x?D0tT<$2NG)4ԧk3h"u8̙6$AЗh?5Na.fߢV#ps얄qSr~<ۙfָD-TCdB~PH9 Hp&: uwVk1- *֧y%C Pwa)LTtOW..:"2:x p}1Y.*hhelRUsEgutvGXCm˵op۝K9p?_'vcKWN#PmۀGKvw :k` a=>?ʚ7_ƯF'q.5&tq^ŭ\iv3`0LAH$Sv7Xu hR9hŕͨn 5%M-?H6OcZ!]QsMgc/ԕHu{n/o[%&W!kZu6S?L6sXD4{~`MǦw=}a%R=;g/~jgMgK؊}[͍"0֑|7;%hFB ZKA.v<V>h^s\$jzەi@pcQN'"RSJbS'$RS$O $2II<$I4)lx>j0הP~X~-1Mf{\֒HjK]`U-4;H'=9 ׹+H Pg`MJd ר=4*F:^?Ԋ-6~-+Z;rKYc>a hf> 4cZ] h4,K(Z#Ioj?Q]x3ʁhXpߊuCFq]_IpDgRhƹ; x B\XC!;u[W6,?zeE9>U!ZUg ӮeSYAV@!D 0*J-SI[~!kEo ]M|7Je5[T}V I$d' $$NNR$R)$Х %b$Ĥ\Xe `aEk8H)+#eWu]A+X`NXU6cيKսڬc6rI(;_UTN)XUtmah[e%[3,kS^Z|CyS!ח.sPԽ!aՎŬk\pсp/Ww,'ͬZLhĵ)iв?3TǷGw/D!<lХmq5?J{i{|}hy?P+{[f>Kcl~d& c[ozq P"u[P}e?{hk.TINŧ*E;Pp{C8O)J–wILa(Rm~ W:e_Sߟ[揽6TE*26Tz{#E|O|Tm0ǟyɎcVkk-K(4}"|JkF+Mכۭx!D{?bN%T֓oLWZnc ̪?Jc@)<)-s c]#wR-xZ L6xj%TC|)% aL|"I p'S3 0oҗyF4t GiDQ}eqtR)ߜ~)'yѴp2NGHJ}HߠQHٻF x2N$JQR294 ~>9&~i@:ϗdtRRHJKtyl@U!POT=L~i)``ʉ2G1旴$|" LD>Ѥ}OR>i' &rby4[}$0L''09!TFGQR L`Ǎ)?K l8 =)dbO!Y?)$@?mIKi2 |Jx}$'[\~?HO 8LO H@ Ӽ$Z;E-TkNO({BvI}rJs"'Lygk_j5) ;6{'aݛ&p)â}?Qs'ܑ T{_+w3(}B;I1N@З|ш"enOJwڏO#N9lWSGf1kƜ$i3| th0}t0 ]:&ԉL'tw &y7<+$HNKN(T$$Hv7tw6-uHd@x#[b' 4dI0GI &LIwj4Q<"a<"rnn=%\ҥ,`'OCÂgE-LfFC CDh]>ÉBgiF)pHo4Bvo~S;L5YkD[~T8x::!<{#Dr#i>Lg)b+'Bu1J}FGw$:|NtGmˣQR'> &]i>)\hp&kOA2x?H-wOW& #KqFRq-VJ4<~*E,,~(j`%|P_dZf٭-?b/SeP(8Z^~Hъm] y<Z4r|PX!MH2$ǒmW@+SIQܘ$N)aKjs rN,L{6XyX] p7VCʬ>4-2֗I=?1sF7cfl?v4'֘5 3H!sZ#iק8i =,Oa[XV$ѫsFݭb?JtOw&v>s;[":i{}֦{wX@qML,69J9Gcq=;s xВ"]l?ֱMqw?J Gv ck'ӽ?p!,RL'>IJ?HĻo$5X1?M\R%ͯ=87?b@ɭϱ;ᥜy5nO[XZ>$]p1yE%1k󺓨=l?ƻ"֘sn]9 2I q6CXy5p(/d{raѺM3 IR-oS% $RM)(O BJ^RҚS$$I(R"I+M)<yoBf $Gu ޤ=;gM¥YQpKOL$$ SJJc|5sc&_=hO-ԽekADI$ה2INJdd$$II$RI$(v| vH4T8y"$DZ3ty<g:kPCf*,.<ӫ*YXVUXšEjW3 \77G l<[⭪^ t7uhxZxP1kO7cDpԨBCV䇇 L'%k]#ȟ ZLy48HݵE.%^9^;0O>JĝeN?]FX4p۸=D<8?RɇqgJ\GɊ!?sQZXWzi@??R8*G,3zh覡ZDjC}z1>դK |]BfOr3Yk}i=]?s,&]ofXZqwBF~ ҉?I,{A.#6G7kC?= =Vƽ+L4j-i'RXy7oZ,q)'&Y |ӗ:km "u0]BQV grk2$>H礚's ]&ұHpCT|uti+=-xgFwKR}VaZ?h>RL "~I?&8iws?545y",{՚:}\Q5Ic{OM>⨺)$iѥlc>Tlk?Ei22{"~~Hp$:-dv Yq&_kcNk:~)R &*ES@4 -"05RAH0p:Oܗ`%?ܒDr9M7u9Ӷ[ɔ襹Ѧ)&:Pc^`&)h4)<6beI)+E)@n ײbe㢁FZFL7 S *]*3"{(4Nχ)>;Sl9/%,\#U*AAˌמgSkC8 ,t+}"k5A.TjΠH' sHsѴZuV5rV>F!~I 8Ik\!{,wՀL~g@&wiȦv'9Q-QR%Rk#{G]y_շ8i?OOV"st>JnRQcuXf)}|?fcX?um:IIߘQ{_]?`2@xdi<~BQ0{GEA~-C-f,nO@d|Iɢ"OBc]ÿQ?" ͜@?)z6-p7&VF8ADA?&}_7ca<>_F8$(2ϥ?Ƥ,3D,k0{@qHc? ،99G,?G%1:kr+rD@jbIh3zAh)3'a?Ȣ9݀?EZחD~sÿ4X֍&<QWu{}GR gI^~$oSns xRu @$M봍\?:&=C,6ZOҫ]è$24<V2ۀ-«U5 yh";C#cxK~+,^c3XWXߏ.L&c ASX+njQ;l yV*tZt!2 "SLI)I$I$I'I2I)I$I$JRI$I$I$I$$IN$)$I$AJI$L$I2I$I$I$$IN$)$I$IJI$BI$$I$I)I$I$JRI$I$I$I$$II$I2I$$I$I)I$ddI$$$I$I)I$dI%)$I2t)I$I$HRI$I$I$I$$I'L$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$%I$dI I$I:PI$8JJI$'LI$I$$I$I)I$tI$$I$IJI$I$RI$I$I$I%)$I2t)I$I$HRI$I$I-?rZoŏ垵?TjoVjtN?d,?d+XS0vo 7I*ˤI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$Ne $:ʘh*L{tY _!CD9?(on>jN|H&G`1Hı!tR]0RqݤP5$v?NL??O[$q$䒔'MI|FԆe cy6:d=D5: $j>wJxNZTBǗoI,2C05آRsCBrԡd׈O>t$9 !2dU{kŪbݎU!6;WfI}S+UM#ڮJIBxI9I)LpA%.$R 钔I*I$)I )Q,xN?V+8yv( 6 OC}&ud~oifcØEǹ5B]Yijg;iG@R3Hgמt}'"aW}G8TsL1tbXZ@$WYEujրLr|JoX (lM=JjLiR'QFSƒ\Ilj@ĆFX|8J%8%"-jSaI%tJNx(*[gD> hRi |҂sRsGHX'!StOOP6HJ5;~`8op:ƓM&0&!EnO)?'RQVL$ S&fِe8p.২QhqvO2:{[eFR;cArn~u-?O\5kI+2Ȣ9}'xQnv|2cMx:4}21ŀ&AgntII%5ӝS{\ᩃV۾%"ֹ(u=$ ;$wSO#CCA) Ƕ'̧lG Vr =l2oUD߀%%.I)qM]n?tJx? S̤jx{TZݡn$RրөS$þ@ΔhtsIufY8{I^{|&ezim350xKIՃ-ֳ9eպE;^B@F~G M2_$ݺ_Jm1oI9!#)9H( 9i0&ˤI'5PDaR,l ϦKOMA@ȉ@〠<<hi#?hC'Z ԩ6з?/V*&'IiEL1ڐAgWO ji'R>@$g<\@3 25@ɩF~/AK 5||)30~J Mb ` }M嬟 \ &.1e=MOeHsd5BG&Rk:9ꨗX`'N]:IJ-ar#6xMh0鴏E ݮ`S:H }Y􊙲`43Ap 4ȽP}3>.Pu3i;_В0GBil)smoĠc'8 P!8pByoy:rJJZ3=Kʉ qlOJGl|1.&U L~HF$Cs-: ͟z6^h9EJ[,~eϼi;F?gfW_5[mpQTf}2@v#ΏӵySX-#Q4H1kם}GFUwq*gRB ZC;Uq͂\$M-HXv.vVI$KI$I$RI$HI$I"$I$I%I$I$HRI$I$I&I$RI$'LI$I$$I&NHRI$$$I$I%)$LtRI$$JRI$I$I$I$$II$I$I%)$I2t)I$I$JRI$$RI$'LI$:dI$I%)$Lt)I$I$HRI$I$I$2I%I$I$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$tI2tI*I$JRLI$S$I'LI)I$I$$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$'LI$I$$I$I)I$γ,~W,gXYS.FfL?d,?d+XS0vo 7I*ˤI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$KT Z?"153)1ba ܝ<9)$yGZ'iw  >_IHƧ>ih=Oq@ÇNCKFi q&]#QJW'o)4'BG 2tMyN5KICjMH=0d:ZvLOptuI4N:IsJQw=H4HLD!mwS,Io#H O$<8yRd O3dEXyk < >KgH\Z2RRuv'YL}[L4IAqQq*/pb"-i< $K"4NM<|A{`4)nh۬ `@$|Rtw$NCC DGA$k'ga0NM{'0ktPKD4FLr·(;v]Jr &<=󤪷VT|ZUG8J_>+=8fTd?ǰ #:rD2E<(IJLBD:hO)I%)ks{NM&\w;W;}cB||6K)-ΪdaU~HѵZk{-e # AM(g@ pKm}%×B Uq%^LUmQq@N;+]ڇ e|g$V>aS\@sKxpq@H[4V*;* -m?*wAVkK A(0\jo.w'{KĀA jӳ4- ,QX(ܼډFƘn*;5?29X~M9v@/hҰƘK7kTm>-I[ÃݩLaJ{!!TRD_1R!·ԥr2l_I$:+T$$xI*I$ĦJLhG6tjX$r9}-S }.5U= v(%n@j ~*>Bb׻HHq94 `#(ZI.c= c%1[t8}uejVNeMɛga.l}%;+܇{H{@`LqWCO\kM_?[Ay[)CH<~В%nc8I YW=wA EmNF(4p#N? E'}1I,uɌnQ{ 4?b{6 ^-=J#mlI~x- MknQܤNHH*LI Ewba/渞\@梇i7o%Xf)*$FhG*k}Fj|3> ~pZ`Ϋ#clln~["dOeE2ItМ$HRtI$"$us:B.H-.?Up5w%NY?WfUH{k˫s?WwR|f m#ࡑ3~kbwV{p=q6qxֻ&Dn~}Qaؕ\9-cτ=X"cj k-{pvjQa9ǃ{SOkz?+ YԔ͡gVG6T[~LI~ΩVTvږcwU=agB=ZYSèl~ۏĭIX6<>[ JP)JBzNjx!D@QI RD߂ⓂIb}!&J`So _+=8fǖX*ڭԛ4Q~x𜲙M RJRI$ $'NR"$D aJ!I'o4I&#ty- aSc Hp:9x"&Ryhrn}E"sL蚉Hvz{bI(eGA3eLB@" ?za1p$@RC @Nu] v뮊[L >*MfѹIL@$SSɀԵõ#0R> -)ܤ\K{nГEKh5P|Rqn6tS?DϚɑ䒉db%3 k 24#䙮*@ISkH ^=ܞ-Eu095I#X(Up? ;P~eMBi$3Kt!ETXCixR}ȯcgP1uxFlpki? s?{^Ƙڣw)9`J b}3Af?}U`쯒#ԅMH&~?S۴ `Y|E3 G=3ZdieoӸ(&HILppJD|SsIOE*&۳B<ɄՅthAޅDyIJs=O$[6j?yHZ&/'Kd%K1pW2珇M%2 &JfZNi#ǟؖ 5:4:'╏¿)^@pKIKu? `7&Kǐ(֙''=(5>,opkH<[~zJYS_Xe`]nKis l~$$L{\mRi{k~Wm=\U!Z|w(  zZ>>2.w2?6<}0m`I>LHOmCh? {0|r[&YR`qr+A5Z{>0ԔDN\=CPĹſTX>.QT:kgzob8le5Û?%l T,kFc,x3]0|ȴu ~a#MR_Ҩ q*K-|xj=&:Rk"IHϦւfR0"wrZ8hj\>@ ,Hx|:j63|\\iFCSI$Ob}P/g%nvP\<\J/c'9"?x'}cN.og0ǃIEk~ bwMSv5 1Of@xkN7'ed vչײַwR([ <\}/ĩwzJwQkOX&F> %'YiwX^m? 13R#PkHѮcDfIADޘn?E^LSW5x8MHӨJEj<ɉ.W&Izcg%#m;nym|}mI8!5-S@s>r&{d=r#wJ!9 ~<[?EB?9y 9H=*U#-#W磔K<9NFA?B b)i>-Ȭ^mtGV7-4Cσ# hoswF kTĖ:WineNuo YHXwSLpw U:I$I$I$I$$$I$I)I$I$HRI$I$I&I:I)I$dI%)$I2tRI$'LI$:I)I$dI I$I$RI$'I%)$LI$$I$tI4'I$I$I%)$I$IJI$L2JRI$dJRI$dRI$I$I2I$I$:dI$I$)$I$IJI$I$RI$N$$I$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$ $TI$I$$I$I)I$I$JRI$$BJRI$I$I&)I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$'LI$I$$I$I)I$γ,~W,gXYS.FfL?d,?d+XS0vo 7I*ˤI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$cĝDܰEpuNa>!"28"5SdvNd5x ЉS1, hyHRi=>){si"xrc>0CID Hqcwp@ܒNC\e)hΩ-:Mq.J l8|;"Hy8|WpA5hJm]S8'%c AJ{Iԥ@[u'ĦٷMKu1H2~{\b9-Rv c@Nu.:\L'T_u2>4atN}S.f>Hfƍpם8RwMƝ0]jX枒؁iAq7Q:VYGF"~JU eOt"u!LĢNҦ4A, SpJI%dBJ腒͖y1\;o׎7iyUkIn*k,nR;]YSI 7 2LJI%8 @$\S(8t'AJ%1)MdI)yM)N YNj5*H "{T2:XqN2Z K=z嚬iVbGNO_q[lt+`Fh.#d6ckO["2@8"?s<EcPycH֟a1 gbN|q K-w6燘 F氟mO][[A&>~+[O<^.'5ߛ3ƟktbL 4W6Ͱrn4{GYJT<ʳRM |?IsIw1ُ$SGEe6X]NԪ(;OY.Ok)NѻP` =w?tp y5sK#Xo膠uR'dc?mVn#8>4 fʲҹʈw#]Vd@lJm&N6csUōkjFӦ]mBt&%=bН<'&Ғthv|֝na=zȬlZCZמ 9n/Ϛ occ5Z~ >unUƃ3j|wnc;o*N`IßXA?R`=[yM">>Kvthunޛ)Ɖg. ^cc!;-J 'u?RoD4:/5>+ M6,l?V}%&1"~*"I-Lֆ;l9e7eowsyQfg(ђ"MGcmciYExzWcTU$A*E%uTow3[>Z'=Jv?y(%@W>HX@ iRHX42D4 *-vZ#UœI̟?rj;׶8J Oցi:1Bַio[[VC6I*5bA%yBSSH.8 q,g&/#RoM$汼IN])!bI G L]wH^mtO <ڔodM3^IHSZvܟo"\:bD΃XN[ۺf]'?DTײ@5ZT3ՐFK}/*-2RUwZ˶u_ T;Z4&>SΞO̩>͞4HsRxyj%:'hHKMIv9IKwV C?/ޥtmaC 4)YXK5!cll09($DpA.: ppGQ/?0r}$\64|]R,{?~%2{A'@Szv~:I?{O)75 ?2gL߷Lᨓ,m|=vD8 e`Ì9cRkQQK@_JS=>^2|ԊNiޚv;v|rOke'jl Ҋ k~_Ԕ[%JhOZfW:'VR9HLB?ik$r3KΨ6[HU#>9'|lLƹk{ lӱA}P?+IM-i_4"f@ g+CƤM!Z"~(o%A|R 5>#[M>2GR#<ɭBmn7?U }A2Gl>gI&#;Ě)vܜW. Q6T9&0OEqobIS^3թXKZxp$x%Xp' :9肻I ^^ZsVznp-`Buϼ7w"Z?X l1k|gikl"\8?XeeOO8XAbXAC?Ⅿ$?HIc6'y?TSZ]S~CZ]M%4:?J?@uH>LI"l<<\5(Τ7z$2P ,s!\ 6E8.o):ߥOPI﹥IJGp5&]iG/դ7MmH6}&?y>e'ėis7솢m~7Ri 3 !?hӊ ݯ em,GpeH{'oAIޡ縹Ipz3$ ϐl(:)as`k,w/{cLnv(܀}'8o\G Q&|^\+wJ5tn~E[19L>ꗧcc#`oR6!1 2CK{|Bg:n<\^[&ap֨z#M%%0gJqY:84M۩`>Ȏ~|?ki )`hq%O`V&:j ${l.}G?({`:. MQn#9 uI,o$ |9;!=j7ԢY(l0)Twv?H1F07/ATC,i$y89{Vek$|O'[Sxқr2 [v}B}no)zMvc̕`zl'ЙͶ?JIλHRkǸUuPOK Pmu!5cj '2P;zgci*[.}'uQS}OPQN̗?Acnğ@8> o,aOu%%WrLA8ϩ]_S/Y`TE>{Zs}HbZ5[9҆k#i; }R ܺό)4swpiP~?R5 a"Cy=$!n[sZ-y4\7780ì$Cm`ƒ| jُr8}MڒSYaarQnkN q( nw5DksG^V%,i6.tgeL!ꮝ> 7Ow$+0btdcOTpuGic,hixs%a=˟s ?Zԟ]Z=#:#B:F/W{m?޹~!vlC nK} "wGߥ[ٵdufU4IFIN$I$:dI:dI*I$I:dI$I%)$LtRI$$JRI$&N%)$I$IJI$L$I2I$I$I$$I$I)I$d$I$I$$I$I)I$I$JRI$d$$IRI$$JRI$$IJI$$I)I$I$JRI$$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$IRI$$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$L2JRI$I$I$I$$KC:\և[ucgO3S?d,?d+XS0vo 7I*ˤI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$HLHYIeBtwCDQx;H'GGx{~& "yR`F|D&`i3||5I9}IT~u>~4 "O<:$$r<AAT憍4[.Nx L]ì" }>)I!V`)hRsMNS}{$֒vfšg- GdvGJ Xܧ$n$Khm0yɜ  ,d;A~Lh7n5wD9q3$Hx@hN4DG|H>} PO'1-5t ;%~|qRiH3hfgOA sd-JZH.sy'$ւLN\Bxd FD"\`G aMi'P?qAl4Z0 H$3)Y:@`I"0o~L؃rw"cDvKᵜiRHP3ؔ@-isRSoB3Z*ZARh#A \DIS ʜ_ L4N JFJQ e4)ܖ%h`Lٓ!g39nog-"zZ<`H&8NZ&JyT\`S$tI$I$J$t$%I'24JS$IuD v$lv*Ժa]ѐNϥئs-N6%c67E"t+:Zy e+k5iPNc::)(QknhsQ!IsZ6+S Jwh@oKS]#1{Ijkiyun;hZ}E)>z,Vݺq?^3'Rm @şyL9߸򖿼XL & D6ot(8k|KjjXwZ@I$kw~HՅ]Swܖ "[ĺSi[Lk{jSH4/ϱg"uՅDK>R򑽭F|Њfl !|bg-!NWP?cG'׾̼Cs.O鿹t!?$'_)οZs?V*s {|X= 4G;Y[GuGJw (t?)˜0?ڢ_Gm䔫*ϼ8hh#yL'-c]wk֢v?l2מ?mQGϘGiݳZG U$Z6%3Sr^p5<ԛTOfIiNve* #QZLpHjxw-X=-/ bo Ɓ?HOoVe&LS=9k"L:(CM(\@7Va,'BkM>:(-huDODАt-HA1Vx-Y!3QQ%܂uW\X! Zd^ E 1:s^۸G\ܽ4[-k)93?a lt`oA<8.VOܟ[o=Odo ۩$k*.p2]Sãb1+d"QI`'&x2%Ĕ'cR~T[)f  ο0p=C1Mq04 JS0Q:L5 5:RlR 'ٰkv4n$5 :۷NS@f5I?sp:y$KP&i-#$]U$d^GNyOr>AH[~A#-@}+j.cqP|Q%ZILGiZ߿!VbG&wp&I`04>OA8{OEVN>Ky&`w?_4!(Ā_=Oc}ďՉ&<adsxG{KO)GIh?(u0LZq ?MpG;K5͡$vG/8%SP.Dؑ?50s68ߊ7AwCsmnwEAu̗lbHe[Bc@C{vGH44nI;QNç|o_;Fp?gl,Pv%,k?Wk*K'?䷦zlNCt )b QZs Nku>-Za"?HbֹdG'c,p~-DZ?N7VIZѡ 8qQvG?lNi؜?Ll>'m~)N.ab&<6 ϻޘ ZA[Q4k3D=ѥڴwmC%)Mq,ՇO[=?HH.CiouV#Q\NE\k*; F= keqNĔru4nzm*kX?騺AM?1;.yL_Fˣ?]I ;7]2ԔFāԚ CO+7i'Ōڐx3(H9O jbCuLW #O[enqk?ޒWp h|*Hy1ݣM%N!`v?yE5-GBi"N5&kMdL bw_AF\tKYH)vsN7xV]sG"C}?ݫEn@ء$ɮ]ݽsS?rdMg0X98i3jc~V̺[ +ЇXKp<%ڜ,opqyLwQZ ^~>OI[1i{4]\-rGhwm?{gvF5`#Ōv DuFXO7j?j뼇x=BO m`RWwZӤn?lv'RuXm6O-Gv3Fܞ9tcѩ'k% o7T&kvhK^##Ú7ySG[nd!BIf͆}?m6$]F8/#[ZF/A3bl>$?^jQmu<{\G&?1A}:v;}=cyY*i?L;,Bߺ|}%+}:Ϲ =B Q…yƺ˿[I/i< +oWFYޗvfZScV HMe}#` &Y[.?| ~HOdROއ L?ړ^ٍ)zg-`o|H`kI4AvllsY,p{n)ߺMM?թn;C {OkH$'Đ-`g?cE 5(3nYX#e`ؘwxjv韉sӸXHR?\Bf%? -M+>JTxmA1dž156wkӚ9`ӂi9?bcãO 5韉.I4ɖOgX?Rw8ǰ5>Rܛ l"'u֏?Ō`՟n?"zҶ\է8=kM(=kQ>j[c> a U Ic !6r?խ=0CK";%Pm[ƅ?iwAZ\ 6!C=x|) ??I0&$X *{C[Y?[GZ6v[YʹL W(`>dgb Q!P7%3po/?EYZR!tcbEE"{59YVTč7 "> 3>Zߓm djo9;v[$F6=?^ж;mpën;YgI6@^_^qScA~LI-48'nM`[SǝY{@ӸU[[{VwԚD;[t6ߜYݿئc$x9Zy$p|@!5lRJbm|'$e[?Rю榎PEǘW58G?f[ԛ'L\gm?ڜ;~n~rJA.?Fb<%?#UX:cCm=%Q_?k+tdM@h?5]CvZ|w>|hݟ`Uݶhɦ 70+vpߡbcG%hb<뺃G\BuwtR6~$ %[1M-#￾`$:dI$$$$I$I!I$dH$$I'I$I2d$$IN%)$J'LI$I$$I&NJRI$$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$$$IN%)$I2t)I$IIJI$I$RI$'I%)$LI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'I*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$$JRI$I$I$I$$KC:\և[ucgO3S?d,?d+XS0vo 7rUf]$I$IJI$N$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I"cewi+ %.#oJz,m4Naݷ^|Yk$9u0GN`L4I(rP>h2jjgD{Ӷn) 91'栗$;1$4n|C8@4>hq׏_LAvC)p|AS2 ]`tp;BXԏo2G "JxQ09QM9AБ3yxxl_rѤ%{~jf"> \~nID)?΁9xS֍%AA C۶Ԛ8I>T0Anu>I! A Z>S:^fhD~hP hyߢH~w8n:v\4Qn0E,<5{nZ]SHp;#PyRs$mݏonHh>ӱt[&g~@{ $n2GGw xXdvP->̋7bF$$P: y'M I<  jI)M[N,ur4E,v#H!ux4*L``DpA))Qk{9QNRMtҝH5IJQ%9 .H+Xh*Ukb)|MXSV_Iګj6s Op͖g9*&]1R-|G4)9U{\J*A:dZĦN'I)JRS>ԈJRJВPI4'I4))hJ(N0d&)[w*P_eR#iMn ]bƋMMt,/喻#-p268r`ZiqnH$Fc3Z?꜃<%ex1b>*M;@Vf|*CSJcĚ!HѶ5Mn{h>@D&Ǎw&vgI[\RkIRl"9G1%±SIw=tv7mCCOh@:mapQR(%yUFcag/cQܧGr\ڇLlsI-KGB K!cq}nf' bDVO~.yDaF>LIՋ'i,*+k {/p._δ=@Vm?IiSL2K[ޘF I4RT.ۜ뜬 lms|X>C_gV?W$9k 4J=V;.>nTfS|fă6(n貹3OVz?A Y26+5D9# :z[ZwmpUPWrv?BDH|Cs?r sx{7O#35d-aC[Z"WNVAr^|Tw#QIT-}ck1h?߽iy59BXhA>7:t0pl=19={krQ6RTG]a>mO}ɎOܒ3cD%K<\~I~?_N)8ƝTI>0יNcI?<}BfNK|RBTIIvJƜCa$GiyO3<'9M#EKpB\:|!"x0䎃_&fN֘Qq?[Z  V?RUHh'*2iYIy0gpkDʒ-h8I-nU<):fOPX~F q[$P'w(tƧOB${i{~T?FF>R$Îē]~_*sZELFOɧn0aP7ؕnxSͣihjjqUMG])w䒰m0Q65׍?|@o)-nnOQ5*i.> I1qWV?.?yXCRRkKRh|&0?oNN㶥KAؙ#c7m-!>D]SǾOW%n`D0A{5?Bƻc~f+=Eqxhw)5Hl3jozmͱڹw U{? V+3?+ޓ!jiQ3(t>1ފ:ṤO}mCΪtsA:@MIツ ,Xiu0FRk^׼ԍ,.ަ5mA 4pkOl(NfsOͽ{Zf\?jeiuk~dOXV@??RIzOX{X.~(6?w6i0<j{A {u(5/?ڧ^@'ܧmpmsEh!U갟oR{_f5xAwTC+n-?oޣk8xGZ[nk|ޙ@c's]y"Vưo;Ot'E[[IW#΄= cƷ9.~mh`2Ɵ&4FSAޥbm=V??rUolEE.p. 친o-`ɡ017'YM-7ſ٨!FKCOE8ehwa9}AXK-N_εYpMAީ9ĐTtsA693j7B ڐ {bO[>'yFc.{l$% 'Į]Qte֢[83?'$~{AX/`O[Z?Y|#KVm> dӱ$nx ?yT.vmqN׸~;5Mv"<\* и|r;c*sߴmS6`Mm x0Ɵ%U{_`3L|ѥ k|fPZRnTcKAs9.R,$[&q#[<)wip1XPm :5i%)&SƆ0iih-oZlPYcOTߒ ss,aM&+hՉ.lf]sSw:j[POǨ laq/3Byl7Qv1;z-L c#^v_f^ykO‚h#MJz=@֏i+fLky䰟!J̻СQȾT?gx5^{!\\渘sA6koMαZώTM:vbM9ͨhmld{|>M\ٞDXXPmu iTă7Wa\`I;6e5;f?ɮ">q{Ǚm-ɡY{cǛ0E3ƱO]j\Gkn,|ᔞ|˝R]o`y4v$?B 0Ҹ Qqck/$ ;x 5Ϫi8(L#ђ??=NKo'|Oh-Հ+V O!~J$xW_~ebh?5{. 7tV^tmy1|\ccY\ %H&@d}$d:GV9nmb1p .ψ\;;j`kIUG\=ozb݋t9RPnV\7dZ#na( ND9Ь=-L4|lΚ`񶭿N̫wcı>odkUS6v]x0gq'(I<T4b)I<ͤ5e!ϛ7偠y#+pA1҉.rQTg%7}vku:;3zA&;,UqFX91;QR,B{sgZ܊ּ>LAՎXڬUQi YM"ʇaqI[c۶n<a c275|Mr?E&ې8 mˀxP[.KKUQ"6b?芼sq"<SkJ-!gMȹDpy)QW +I!kmo(?OQ,h+S#i3ϽE\s}ְQ4AU{zC"ɵ \ө KK,ul9hX?"%kƒjխ>-;xM{[%64 mpKjE}51sάx=9 㽾;m-sgfYZY1%WV9@N,Cky4v;`~zJv\FǸXqw@ Q${<+>9ZLH{G/k~@F>ZfZw ^6#o3˘x5ߥaPP_ճʔC=/}0xi#cA&u|HTd JJ}ro$~c[ާc?f28wc!sOEu>H;<;LzOC,Z o|?94HK;;H>q0FSu^9oeX٥J)ȳX{c<Ĥuf ڰ zT&c24xI%.I&NI)I$bt)I$I$JRI$$RI$'I%)$LI$$IN%)$I$IJI$L$I2II I$$I)I$I$JRI$I$I$I$$I$I)I$IIJI$L1IJI$L2JRI$I$I&I$RI$I$I2I$I$I$$I$I%I$I$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$tI$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$L2JRI$I$I$I$$KC:\և[ucgO3Sꅜzk/f9T:f'L.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$A$RI%ݎZcUAՒY={k>xq<  (o:DHCd }'QH$hp=^4$GyR 'h'9k>>:uxNDZ;;j[A2|ᫀw|NOImn s撙p&Ӏc"& )} `p` 3vu ?H3GCNwI ƑduH:@i#@S ǔ6 84D:|& 4I+Qi"Jq)ӑ) rևI3vI.y"3؁o;)b9 &X07pCw7Χbwp wIJ:8;$uH%!8<iNdz#}e '~v&3cpݽ׉ $,0DIJ'%'Cu"wvR"\ HTil:cIlkpRٵ#B$%3 ;~IQ;SA$p NtLD|$Gx(qĈ @LTRȔspM"BLQCFD]6:'e>ClqG`Ri܍[Tkd" $1"+(DJg1U !*{9LP=@>ugsGWJ=+oȫ*R9c>$e)IL(J%JQSJ4)%)40)% RI)hJIҔÙIihJ\{$k`U+nեU?lT<*"2c P\ϤJ+${ޓD̻³Mnv: nCx:=wĨEZ]#Fjv-+[Z֗re\};Zg*{ QFS"lj~|gG#GO) 'io-` U=A']$Sޒ\} =7VvCe.Eim&}hY4qC9FZ'RJaGIi(i FNr91Z=G\TH3vIL m _@v)ה=ys?rmKFI%aRgTv$I歹t:I A:(T4Q݀seD SA { :)0"Ht)TwKxPf&Pn^IgZtj$NZJj4C<OCg$2OGALTj1Ŧ1RRsG&XR{Չ=͖@({^4?OKujs?>?%2k:x\2gx#kj?bC|Rf~UJ6H5; Z*f'#ߞ]#4@O7PF =):%ޘ` wlIxI25#J(Ou|b`ֽۆm @;Ӷ>g>' 2H:F/?~x IL: !!cJ8>nom %&] su ?/->MJ|?ZOomwNְ?g覩fbv8N3G|L7{FU7HSTZF%?GwEGpgkLG[?$iSoku!.?(ni?GSݭҊR@sS8r|Zs56M$k'M?poJkktψ%,ׂ*BÿJDŽ@Y]-.R{q u#@ai`<64k>0m~ Jgc-$G&n\k'P{#^Tnp0(>8}rp S^ѱ>&+s)cRts|*erqcgCdᱩG!:¥D˛ma&b S[;q\× Hؙ2Y?S\voRgYӶ;CuCíH[Mn >5"3G?S=? Il! ?1H괟oHl1^=<C'!T0r\OA, hPuV<@/)}.E 1^JLk9cHaPa-@|ZweH`͚o!O w X>1XL\`xg,l|RH }5y>@lj;}/n<87Xܽ!Ο5pvǑxM -PP#C -lӵVա+ |"8ǯ47?Gk4g=Z%I%RWXZb6Ĵ7=}9yXQ~XE ]oM/G}b۾.j<4[~rJls#s:Oz ŬV)\ߤ== ~P_- vIH,ν{bcdu>fWGޙV|?'V\BOfе!$Ap#G9ʓ6vLOaw;Iok[F$=x9±EA;OAwRo$|Hjp'䔞i;pp` \%HUWᤞMcKgEF8m AHRu܂a37 jTGAǼ=&F[Z$ȃHt}ELոGlf}n|~{9u$A5ڰDiԉ##NCp5$i ԅnēRI.iC#o'>?0x̿95:C҂x'F?SX}2[I$wE%,\Z_M:9>poR@;>c?):] çǛ[?CmjrH?ԔX6p6O'5m|BM I.cR5V ܤDj?AOiwZ9P[*[ $m `v,R5"{9kD.#upkܝvsĆԡ,1\ 9|JD8qUG-a\֨2WxOӋ5ѯ%?: ƀӛ.']?zͿ*%ѯ<^T:kt{)9t?EHTX.A`ȁG}I( R?Ek+;Dh~djg`_ZG.`$ <?$gh¡7<6VFq&Au5W\Ks+ ĩ6wШXrG<#v;kS:4yZ#8um O(;-Yܩz"O! pp!qBVt[yF&9/;>ʆّ?& @)%AfPKY_]5v t%ēS]HcQC}n>X8JOK`NZ0vL|{H?P-|Jowm4؆zs1( q$a;U5y& @"ZֵJ^65cwNWpxr<ń$YC#ӱ0aqZ) ˈOS{~!6Hօp~Y k>S!!p/]Bv~:lM*GD7^??{*ϩ)Ϊ<8@IICUA!<.4Nk?c H(m<+&,>?z .-t<# i?E6 VUjny#>JحR!ݜ9 u:~{t9W]ăK3Q ,8?w< ƿ_6?:3`w?-vkj$G`?Oq"ƸAZw)][Ij<׍K|彇̦K~w #X![,mNJZ]W; <"ZN猑GoC I":TI$H$I&I:dI$I%)$LI$$I&N%)$I$IJI$$I)I$I$JRI$I$I$I$$INHRI$$$$IIRI$dBI$'LI$I%)$LI$$II$I2I$$I$I)I$IIJI$I$BI$NJI$$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'L$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$'LI$I$$I$I)I$γ,~W,gXYS.FfLd,d+XS0vo 7$VeI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%cJBNgo.tV5?*\gN;Py?A"ts;fv ږr1Ă>_IHơ=) N] ` @#2t}$iM%RA|R{x׏<߲")A,G$ݮ028R[K#%KWDx#%-"u9) ^:&0N@;>thׄk<>jO$i0v3}N-AT@HdjN9GD,8He:i #ĂuLGB 1EOn [Dv|$ XCN hr>KX8HБSNߡ`q.H1lEpdjt!7Nb@ <Ӄ>xOyE0h%FosI)BXle$,G~ )1ˀ HPy4ERE,I %% mS/%$N2(wXRZjJeS`(Qr10\XR)=dx+ǖٱh,M^a~-VJ>9+kBM^noUk0 [i❥(cل{ g1 nKt$hg4GS'I )nv5*[0W `yMy-ǰ%93$I(qq~H 4s%M.LvRBeGcZt;ji'JbLI xS po$&u)` [tRujNrf:L%!:𒘟XS4nqIw% ZLJbutNASF@S I*u:Ƥ$u:Ɏ3|9IhNʐ.5PLvQ$p4*$;nv `OykݩNIR N}MBPZ1$A3?= =lho3 *$4Ck)=xa'NxԈ "H7T,&8 ͂?'jIJ o\SXwv[. OOȸQ/F=C48@k!'icXO}j@ꍨo;SqԱN7;蹃 $+ HaQ/DQUQV~5ex {HO$S " 8nh$l[u΄ޤN8>?U\ySwѨ-o݂֓p'Pns%H= xb,|ızNm8O捊iFkZ>mSթ=K w 2@Oc=Cb:KW>}.Rm?nC.̗)#v?jE~oJw0pЄI^ݾn| ^CM]aٍ9Gk֢[[gLn:4,}MXF5z~E`hpϏ Aycus4?K/֒n#NLZ>wOR#j Ր~[$='D&;XYvk{2\->. E' %86~f3tĵ-@\'.p?)'%ev3]Tvȝw`Cs\ts:0(3cyQ\~̒-#M%YҰ|{NwѥEa>u>4NOH:~s)y47-x 30l1>(xT?AܓY~ëLqw"46d%z "mi JuB#!u$yIT{|_|b(gM7bf {{usO>&oF?ixw>߉Ȧ0N|OE;#ɨO;c =|=%-ɩǵ}q稴{9)<s'XoJn)Po(݋6:1XIn [9| C ;S<2mS'H[[~~ٍkY?hu%a&RžϦ5vkJr,?KtyCS?g9ㆁI={. e^JEQz-5w/tVD H~Zj4$v_LH0m\_IsB.sgGj d{H d49@Ctl?7lkN4],BYSG!qDPd1@(O-$ޅAܦIQ.)wv|hBeE+yUv F3sO]p8F%IpsY[cgCT+_bpgO%u.}E޵[4bP޻ZAY3BVv 6Vo `sU"T68HiqH+W` Tip@Ԡ74;VU-is01(nrx) g+E% c+-)7JZ7Uh IѢ<*vK(oIVնk?RqZy{!oG'ZFa#d0hV *M¶F%) Tl]>_I >_Y)u|핻_ :q!|4bPZOh"jumۙ4*v>#@#Kxvq/yN|n{7TG:8yMZ/c- ٫t>Ih!zZ MCj`xmSc>#&P▞ee@{Umw~S :vcgi i<7iq*-GnM{u!ʯG!_s PQ qzamk}a308yC8a 楱\?s$mBVV>7S}B.VcmhU;Ɨh9*յC7)b+oH@Z+l Y[؟>sMdc5Q\ w|z$Rc`@i`cET=~oo騴 h++c9unH5Jc4;klkJ -bCltEFFHIĸw?ANGzoVO.8:RpOp{? X{=Yл-4<7#2 es?6`'#o,J\dj;<Eu~yMSD??fFLdbl6+0%+wZ*KcJ0\ZAusVUs@v:9g5nB[gN0s;a ٌ gO%S|k<%iAr$I$HRI$$RI$'LI$I$$IN%)$I2t)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$:dI$I%)$LI$$II$I2I$$I&N%)$I$IJI$L$I2I$I$I$$I$IJI$I$BI$I$I$I%)$I$IJI$I$RI$I$I:I$TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IIJI$I$BI$I$IhuY?+zγ,~W,WSju?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$IҮi1Z lH"H{u[1ad;QPh"xZL?KK38#$2jψS0iT?:Jp &@w ߔwi<=tSħxsuiIJtƦ4.PH&!A OѺ)h$~#X`S6k'Qݢj4QOiԔn!Е{ˈ<$Ii-3rB 59Qv9߀NZ~FƵI97 C6$|S %[c$LjsL9<̤[j~QJ]p]%isL ;]I0}b4oޙs<(õ*OoxӀ/J$avMmRU.IO MmhwJP͍?`XlHokOv-Nښ~hV\G[~rkyZk> M8{z^l?#^7yRa.I4MegFsB4OUCM|N䗔1@w?Q 3h%bDMQ&wzCs#^Wq#h A {O8DA$TKA1%5n%>.( >eu@v dn˔RZ$;5@:􄟛V)79x@gR-?۝z#7Ҵ?*A}SI0 Xy'97ٹ̊IK ?/B`D$d5 c|(x14PR/,7OjQ&4:aUn֜>?Pp5䓵Gɩ|@=)aA- ҵ0u:_IETu08K*hǼh`N hգOE1;$#oIIMG?LƸuP*4G\XX'k{\Q[ΣJmp}-$?J'>44UG/Qh~k7ӱOӰmZqra..pkDN80$OZ0s2<(n%vvw.(:[=8 rt!V=_EZ]H;TKGܪ<\)sT}KKaj VsÉm bg,kĹcu{[C,wxRږtMmOފ)(&ܴjq:!O~UambvQEYa}Lİ Os>5Siw'Unf?TC;S;rrhi)E"9?~7XK@>?KK}#v-C#)%!n!Ο Ll @Wic:;)WxpT5u4Kg╮),~GX 4*wg2 UK,Ы%H_c)e7cpP _utt4$̜hZ#TzkVm?IʺNdžC ctچ2[J)7i8rA` [:{韤I[P%=SnMgkG.E 76]~ChzH!Krrk6<42SnP.M)!bb b`SܚTe4JE>Eڜ5OrGgMyT%[!s!EeFNJڳz[k9 nɦOb?`L;>?Ӭf÷N"`" lR~Tt  ~E)_M:Ohv8OKL8w>vq;[܉T?v^t#O=PGq2?"IEl[&۠ j?'`je5<=A<FFHłϊtCpS *21:5l4hc>1Mէ).RHMdk{O>kqiOF68Z[ [UP747?LZŬ°,< EoRmh`DTq}ZOejB}2V`}k0~FF4޺&Ə3^yưŚ7s[ n U·q*HT (i`jT- 4NXQsZEcFcc6 Fq0G9-ap79CsZDEiuі 1(c`ug5j6F]>A=iЏ;LEL|i]ۡ2){MpØ~>n+ҌVm5=<9Vs}$G3&>K娉a |ޤ@BAt?;ܻ 98wWY ӨW^zFijH-_7<6$4jtJcO=؅,s R8M'ڸ$YF?R?X6!!auzqnOB &N ]$LI$$I$H!I$dIJI$L$I2I$I$:I)I$dI%)$I$IJI$I$RI$I$I$I%)$I$IJI$$I!I$dIJI$L2JRI$dRI$I$I2I$I$I$$IN%)$I$I I$O2IRI$I$I$I$$I$I)I$I$JRI$I$I$IRI$I$I$I%)$I$IJI$I$RI$I:JRI$I&I I$I%I$I$HRI$d $IBI$I$IRI$I$I$I%)$I$IJI$I$RI$'LI$I$$I$I)I$γ,~W,gXYS.FfL?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I+}2];O0)Tԣ`%9줙uh<|ݼ xiW`xcORlG+ sG'LOH4zp N~6 wE4ǹ?Kuo#3-&)F L\uNL{ >Z~E YL7Ij@s{yOma1Y  {dIx$KtNx$F͠&F)A!htdIdcBF|R P<)|ߒJSDeKY3Q cY)5 2cYQA,y~z@H5qg!:Rh-xؒr۸'BCw4LHvNJmd;879OEk%0t TϴO@v!yDH<Gݬ;hZ㡝5K=ϏT1N*'BgDU %BA SșYwkOO 4˲-`^ iƉw `DjѮ"Ok*dRN Lq*-o}Jpw:5'XIKϒNwnSBfgNև?H0~ Ε{هzwmi?`C"I2wB#l%2$4H5Kݡ.kXI ? Ƨk`Bf91 ;f ?K\Вw==Z'![,2$8xL]>1?%c>?-p?< T5n<Q%2{zddm=wa$|L4Ƥ^k-M }#ȁF`SV7E#FcC).fF߆v$t}3;ϟ\^e;Hw3/b#\׎Ԋ-sl_sO򈭿WILgCx5&?klw1Xɡٮi0@3 [w^α#=?bJJ5i4a92#>(l n7 Ԥ HK0?`>dӝg q_XE+ q Ivh`"bԋþ™p<|gZL4Y Ak$؉ȍo6hb\Ok-h`./y+Acu5@C$ hl(-:0IyHVO>Ԕ{Zvd)ԮIvѶ+js`M鸏VNsySn?@BkCڒzpk3aRXC~K6*t9HMv-h`9&Z|pяc{'tG-h`9@ǷMhzwa>lwj>]kC5 G.M]ۏ=H?ݡ%2480 6ֆhpP67V7H`?Ak#gkRuUq)0['ITB0V@nE$`.?ͥ&hwY? kcYw5;GZKnw%RKZs&=N;r ha-?vilqM7!xϿ`HP/)*ʨ?5'ej ?iYx <6@V ~u `[.c.MۄoĊpieA`k*ua?+ώ܆?w)?!9 |77^RKbw( kD;q3ޫq.͌N+a?Ft5$OJvhX#?}O;sĻ%%ve|Z6[m| ﴨ4=/)\Q![ﵩ$y7btc[Ο5'3F\lh2s]HB2|,~efmRDN7~M{"ƻiЊR'c\z:?yӳ`%p+$͹ck6{"Qh:mw%0kZ~>%0\e\/xzx`ПcY¶zby5zbO-kIs,\QO0.OO1%hh&J8m"DK??PiCy~&e~'qE%~ijI sR?xLr#c֊U˷[[g"~kXu <ӧHgw-́ ԔȐis䑫,`g;cik(znﱮ'?Ti H$'D썩&pwsE>~mic^z-vXYٽ*pusظ5O& oq ]I$+iks\?R6= zf%5I_S^Is}?V Ƅh'1 5^H B*]{w{"uvi3s6/z0G& !G O橌g]nEo%F_z7)`l tG'1WG}ًyh=HbAݯL1}> &LD)M`Ik7uVnTe2Bh6?H?Z oMs>PWJ C?"q@kcbL?Z:)RB(Bq-28FsԄpA[mk5sZp+0̪,cMg7hXcX(Ǒ2V,[,5խgXFnKrzmOQ6' RPܛrJDT@-o+j]l{;^ &C -ѡ__]+ڵ3q}Zr58 XmO*;*'o93O6oi |?S50CoE5֛~O0xYTd5 :I?~oAl򚉱AHp{K@x#R;֐lg>ՆE#SZm!6]{]pSFoñm@vKLD_'ls\gsN}{On8VU)j(eOVRaZ$)R)9c mRSJiIH8j )M*2 E)",$65 /֨sVCS;@t?]%~w%{<-<~#mF;1K L7oX?oV#f㺛w3>*>H;G?I樇}Z-p10d|1}ocjb~ە}+=;wHWyԏjԦ>ADߞ͓?ՈnӇ/q5/lGg]?JNwƎ[40x?DǑE@tÇCI " L[4v!]h~dZ.~E hs v!FIjXXK-Su"6 P"?/* rcOdHh,hsx)5L,ƕ6> $5ls0^NPx#Xp.h׺$+x )X5D[tImv8yׁ;Ya;i3'%o{Di|Ubۏ$NnCK3yVZkx,SGLFKF@Op$>?a f{(Ϲ$i\Z ]?n.fj`R{T]X,/{LHh2z27Ϸ*aΚOqN\~ r\C<~jmȖ;4=K o3cplz\?8Ks?A/I1i?Һ'лG<-S?$Cp? R[=w6ta>i,d"B;g:+W!-L2KI$N$)$I2tRI$$JRI$I$I&I:dI$I%)$L2I)I$I$JRI$I$I$I$$I$I)I$dI$)$I2t)I$IIJI$L2JRI$I$I&)'LI$I$$I&N%)$I$I I$I%I$dI$)$I$IJI$I$RI$I$I$I%)$I:d$$I$IJI$I$RI$I$I$I%)$I:dRI$$JRI$I$I$I$$I$I)I$I$JRI$I$I$:dI:dRI$I$I$I%)$I2t)I$I$HRI$I$I-?rZoŏ垵?TjoVjtN?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I%)2tM#@+D͗ Y]akkA$& DAF#P`iQ,oP7FdYKvḂc8zw8};ۮAAwwaNZ$LOv HU'UlLKum⥼j'fLi -:cP5I F-uFyTZQ"[u)z~5.[E,9Á:O:Gk@Vd Nţk5|P2XIy`tva):Lq=ʐi'M$}YEFI$ @ (Bc@۸&X҉!v6Jg@9.8_&H!14BLMhj`4_ɨnljuOY' ,d )KLIly#1)9E]~_(i<]O4. BKR5aO$XfAhLݼʏ~>0I2Qq5 m;"4R6 hȀE II |uɤL?P;Ѯ)O$zc R me~2Ӷ~B?SlM`en~_*3KK<?6Oz )os4(2/'ѮRhhu)TM ? j͡JR!<k?\߽&!6W薽%-cgoGrfXv.Ѩom_mEs7lό%0K;I֢ & =R}5ƹ#Us-k] %gXѿ??Peg4?L;pqwoϬ1ϘDhu]6(YO'\c߻$2cm "3=KX?hyw*ӎo;T9!EndܣURKX͓/cZ|\a1)DV.,~:V&_A=D@wjGwt筪/ a"9u1Ы3Zk/?e}f?[FH>5Mnz(uMֲK"9ϱ9nvbVEnn?KV?oAV-x"ָ=1TnzˇAUSG&Z]ZKLenYRx6鏵K K61=/o2T!d;61lm,!Nآ)Щu-24&L KZ|y,~x0$K[䰻ݣ<\m($G5 ރmt%Ϝ( ,p/pچ4*fk|abJ4SYհ 'ad}?H9i u٭F;#֦\coYſZ bs=Dwѩ5Q >%ڧ[]XgZ 6},Ɵ8#o{ǃX+2구&m۪Kֻs[m5㗰\|Bf-.#E!5}Y>,ɕѪTpk*YD>J4-m31nwk'<(li:O/E i1?Q?4Iwb \Z?L#9 `jsƴ;Ou-F6XOF<}bbڇ7s[ֿDUUS]h-7tmM6OU%˜Gkkצ?X}Nո|$cI|bWZxiKg w1d,:H}mCV Sh'g{͕96ܕU&lұ',q#psvp> .I47_'$3KÝk,tc_;Law9բc$y9uGG -N/EIrȋZC|\?B`G?kM9`eݴu_76_Qi=i 8=C[[]OW*UZ+2kĸ;ZK5]qGؗ6?u~/MÚ.E`M bgX Ǚ P cOxRH\_sqhcwZ7yt7bzK7y1rb3mB,.#ͨO;yKM?FL9HЃ-b-]3Z6w{XY?k$w}ۯ؆ڪNb4>8)"O:MX`y6?ژDb;h>dIKc ̫o j ,{7='Oa gZʛ{ӗVt3i Xn"&(< ԤLq䱬F7ldyyؚJfƻsi؋NkR%?~%Hզ-77G҉% *b s>ֶoBkqKCO{T6 \Z̯V@qmkZV 2]P#?T2>y45EaߘO'芺-Zw6Q?ʰYwMuV{6lb%]5ՙ5Շ^LKac~7' xKFLYƐʿ"\LEqˬ Z lwsSQ*Ǧ1+'#̆ԡ7P@?W`H5.9e<lb?psjWiկJ2 Ѡ=9PlgAXQccre'dZ\~H2\䫫8LY (ƨkUƑqRN̤̋u'w:x)hZ[m=?zO2=6DBOpZAi*QLktyO;sh% ;c/cp- 2%Z%a]I \֓'--h%*5kgIHS p_cHϤp#y3&>ZwxvFc^5bF0T3mO;aj$p ivWeMh=Pe$h]2C`{ Pie~XؽZ@]۟Q"TA{Y&/)"=4V \lZIhc,//I -1X Sܩ}ʞȡi(gXxomi X;JriIKG'鷡R)j;+RډYĶfQ&XXA"&&[T:77[;T,X^;P%DSpPB cD<.h׻qڎpqCZM郎),$bډ{A=G\CI6ƚ7Ee}M4;[E I&Ls}Ƴɣ"M7xHOb~BqI 9$pov@'ɣj.ۤ5^詇Y + u4>MP;G0 5CD%&絾M)0ef`ls~F)oqR>MPH5@'?7%IطyI-X)]ԛJ06FFM9Jy(C2GɪU919@Z!59*Ʃ`S~R.k,k>65dH *Yo#d9*A(0GiE 6ڧ mRukaT%ݏM.v /"Bݻgi P6#XNꏻsó;Km=I;H(tOLL2y !g{\a$@^AAo`ER=Iv?6:\ F\CgGa-MCQvE_.&c_fWkkW=ռYb;Vɢ#=yD?j*w`˲hQ7wfN@nKr{ږMmSĨL\ᨛSJbLJJTT SܣFSJHa8b M:+mY1lWݴ)G-loZ#P#Y\jڅIdz{]jkt~cm2Nӣߡn't?HQηR#s7;B=?!%@p)nZ|3ѬIL hpqѯER1XY?s_&b=adEy~߈qyI(&[H>ߟ#J&I!,:F?iA AR$scVo1[zfo3T?\i?]btnsY ?Ъ!DVscO#Dcٞ2^`Q3ݪbkOk8!9LQZ1 VHCs{nj4,6#i  szr+-!r1v۹tkwף̒Ӣݓ֛F2xME4(ˮZO֨6m@r7 WAcN#8D$KCx&t5\DVcZ֏ёr綩@U}(s yMv_z2NDTE6~7VP\k?zsH\O);>Y?e>B$HV(퓠TF`r?bciuP lw̱3Hd9Z~r]Xv{F4xAgTmv|qCi4$'$~ ngZ}Fw: WN'PpF6Cv~m-_UqY;&WZlZcC~ŋT=%"Mx9u߿mn.^c -:2 pkgu/O6 ˤ2kaI0N:ITI&I:dI$IJI$$H)I$I$JRI$$IJI$I$RI$'LI$I$$I$I)I$I$JRI$dHRI$dRI$JRI$dRI$I$I$$$I$I)I$II&I$BI$NRJI$$HRI$I$I$I$$I$I)I$I$JRI$pI%I$I$JRI$I$I$I$$I$I)I$I $$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I&I$RI$I$I$I%)$I2t)I$I$HRI$I$I-?rZoŏ垵?TjoVjtN?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I${GgiR ]$\;.[{DDŽ \gAՋA9"Qci0_JGu%}pQ>hm`j# @GrT[ē=y)GI;ă%AĸIЈF#OL^w8e%^5{ GFDTO^r4S;Q>1 CkZ_$v?|)cG8*F?4$E۩)8P )-'JVTѡ?L0j>j'A-~v߀B|TC~ n Г4C}=D`$K[%Hw|OpZ[.p%;ZOɧF=,' H'>@ۜϥ'?&q t?–@zqiQ6[0|5i)t0hcXj[Ä<!ҵKq [Sq4?C]T,kSHG{~e1?s|oF&ck|tOH9R>J1[yd ZrpKKXvw~shҏB_' ZcyixYZ0קm}?+ A?@sX9k]l?K?Wӑd?S>5h'4bwn+8ɲ`>&+Ӏ]xqΩ_I2$In=G&ip?/d~~Pl?'e:Kbspk =Ë|&{o|b_XgŭrJ[h[EܜqKKܙiX!؊]vAL88Úo?Xݷ SGcTvcAyI4H$y=QkM8%'r C+PK{V~Tdh]c~B0~Z|H)?I2En"6Yei Zl?چlЭW֟aȢ5 ډ}H`Mlwil.oWթ46:prI'kukz٭M/{k s!xk wyI[&ci&+oQm?3\I>[lrS UI Սtw?Vs<SşBgK]gn?$'vUz's^<]c=k[`y/?7U8mh{?uߤX)Nk@1~cMІܒX6`6U gkQε{,s?bmlեM%܊gqQ S.'FV˝||S.Z (_#(XƓMXrO|bMC[G\&5ndDɬǺ7n ¾?:,{Ƕ-uZ=y6gaD{Qgɿ"<U6UQ.p' H5??܃FTKL,F\X]y?;Bh|qOcPNgZ["͆Ckō/wOa~nmc@Ιk 5FZ) N Fn-~ߞ< A;}׏a;~?"Fz4{JLڠӹ4qq6k[?{wULk;ƶoޥ`۶mj2't I&œivN F|yN#qHF?hAL`g Ѱ2u;8oL݃T[T e_ NHD ;iVO?K~$F+cZmw">%s+Rwc|(6'Z >֐<Г|'8NOw$ŏkIQE%7h'銜>&' '9hH|IyKio!<DyHjJSAI n/gɵ70:9(\5p%"8-NK `"kؖHjJ,tp?4M~ar+Nd$WQBݭ6KN?\#.J{GĆӫX̧ؐg5D-'輷mjKlŭu~ V9/G{F4rbgD$sTEXakވ*yᩰц|CMûN;K9v߀"s,.kcEQICŌ mSa00Sm ma-XI>#Ih$wO*/Ped{Xg6E4ODp֏iiqؖI ަm8]裧2 .جnIO1O[햑6<䡸븏DKH-¼itn{)ݿ{SVZowRǀKc_k?~~.%R5~*$:r[;[wn?jt O+$IM)f3s%T5]CO6_=ڝ>͏{=XJƖeZ Hy1ʃiD–֍`r)JJG#qvޟ0b}{P-*ЊTΨ8ARش]ثvߚ[6>G2:%cN%i\mEUo\FrSJiObM MJKrJGH55>)M*;)jp@ )Kr)RQKb.ԡOrR)JT{ڋ mWqNLs 6oW.h .7GR,xN4B͎[z"%7yI8$!0p)025kXP-kD{ 㽎D5OҞoIT{({OLK$|ITg鏌0(韾#0FT8ihS"98x@~z';$-q:40 lr1y|yM]o!><RM.O%&`aFVNi3yiFll-V5 7B ư]XxQҚS'e Ojp"SL(M)"d'"oL&_ ,ct_kYӨ>PnkÖ[H-L =3!6yBpK%9c+5ta%iO>ms~T0=H53 8"ZL B6\A;I?GRU6AmqZw;KhD?u;v P44(B-!   HtYY]X9P!M9bXMj}܅-)j}Rډ1r\N ˔w(iI BxS܍w`*(a ѶP3qjr5 %f;~?ޠe푣a,8E&y`<~wcf_Aͯim|?.KmY1Zex{-P[;?X|?YAi N {ZÂ"Ы @" ضs%\>*CǾZեG!F( /:AkפZ=$F.'.C?e*fGkYƪ.HHc[U݄2}J2=@2}h[8,sC1]_MRGʳ#)Gʬ [stw$hTYVM`_W T֝Jjk{Bu n6-t lr?IH׏4h8;`c%gw,|KN"7aoa={>KZ0ÿ%\5{ HM3A>7I}QHvŢA;R dPw{SN!_?~婺]#q̳7 >N=K~uޘk ֧Gc܊{ H8A;Y; bzWPnKnѨ]|.7 `&AiGnEa ς 'LPeLd$I!I$dAJI$L$I2I$$I$I)I$dIJI$L$I2IIJI$$I)I$I$JRI$d$$II$I2I$I&I$RI$'LI$I1IJI$I$RI$I$I2I$$I'L%)$LI$$I$I)I$I$JRI$I$I$I$$I' $TI$I$$I$I)I$I$JRI$I$I$ RI$I$I$I%)$I$IJI$I$BI$I$I$I%)$I$IJI$L$I2tBI$$IRI$dRI$I$I$I%)$Zoŏ垴:=j隝?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$KWݫAg{IEhbc"g }O='LnsQDëNDP]B%8;t]"OwO5P]>!2b@y>?$m;<w|BHRkI8ӦO -O FnpRg${(}IKkdHLtKhh&΃D724šx~%2$85#SӴ];N~}Q$J[_IN$O3Ñ iY=³<ʋF&, 0{# ohHxG4HC{lԦ?<~O><\7xj)stx1EF̓87vL#S?}=>PΧ\' _p+͐{w{OD:$x;.L*kÝ҉f|i1N.FhrHgo74|N\ ?y!nE \=.nNQ&S1I:*eERRHeiSTH5lx4ըɠզK}DR^C&KʓjEm6?|ٺ0t%L8/t.mAkk-SZF.hbe\?C1LW>7Emk$ p)(j leHKc>(=q?xЭE&~ XNVޑԐ)i ՛+RccVIoLg`_P?(>}'O*,"gKG3)?JaoHVNٺllYƩ6 vkCeCAɹō1mU~ZĝX>'oJfX}.V7:% sIv .?XGLv .?"kb fON=ڹG`GnР ohƗҰ;GvC.lIJ$̊چ;^ʑT\ Mq;J{o1?L/T5[{iw位 1h?7"F䔝-hg'Xu#wsF9>scc~9ZTNTe>)89L~MCqjӯ(Y)vCC{@k_h`Yc ؍_ډ!1uu!{̸y F'f?ߏ$?ޢ=*_q6uo%6Ckg>gr."dǐ LX:GϛV msǐXYA0Zs?T蛯??=IޓIJBXdG91-?K3ALZrYؖ%MsKCc,t[ Zmh4v4(^t4Bq- ?I8 ӵhyxcvP3ۿ&pe4ѭM+v>;2)m|i;d{JfsgPO>?Tpv7+Soox>'9=n-<(ITui!ї$?J6۟Q w.Z-m,nIE͘~<էY#ڠ\y)*#c^ҹ3,ՆTI۵q6Ԣ̈'%>|' #Vns/j`'Qw$Tmbk2v=~iq?*R1rl*dƎ%h NlGi?x$7d}M^dQp,n\<Q1>oVWNS.GfD뵣?7S6?0l*/oj,w#KKMyd;_N:2 tdz(\pwv) h>VLK:-:lۛYh64O(ѱţE NJ]/"h4MT?2~??5C_ɠ-*[&<~E<˿ﵫF⣽M~~Ci><'ڍ]:?jǣ@~%1rb7U~i6$'I[nw%B”$MBS&ڞIL˓nQN`kJQO# >bDlWduF|VqNNX2&7R@LwЦ1?y)xJ]S{3DSpWAV*ez&vײ0#3²-y՝ԮFƼ,"QY{6>+Ov'"}KTa3`0;.q9s@pojk]Ǫnvxu\J.9C% =&;:}imu9ēUY\a ?rWk}ՠ"1{O#cifgwnJ:ݖSntV,hp˯s5qnª^zGp[l9%l $p;u[R˕^N[c~ed3RPnOM!nN:bXO1rm;Kl)iQ"ږR)Kr(Ķ"BxRҢJRmR N]d4[\̕{{&LuӺ XYV mv`ݫ'vokTM*Y BE::aAvzՇwmR۔e)ESDږ)M))IL68M<*20=mRҚSJ c(Sڟj״|b۱1atNv(egh{`nvg㋪ r5 8'=;E4NZ&c<ޕ!uy1q$O-mx$p~e$[m?a sG oLaJ6@S|J"db\mZ3LC[5{_\|Ʉ5ݭ%# Z&k~"ݞEַ%$֗ 1dÝZH "N ! R߀Iu#1c̃wQ-eKi&`s7X9>)׵pP:jˈIp 8nfǚ΀)G!YYoCr%ڞku=RnNƺ IL!<)McXUzx(LMOT YL&Բsik1,CcZىYu{4<ߥz\<90!8C5k[ QC4>Zr@n;ILy|XA?{TvkG60dy7$&D/m)Dvozo}/pg``Lybv@#>Zf\GV8;OJcm??p[C~%8nh>?􋿵҆|?:! Qj;O!?2vjwi&'1"CKI'<op>ȽF'CN}&~_x#G%[:EV DaAiN|B>jwmG[+,{mhӿjHੂ *`)) #1UVAp-{zkX?H~!m8 T͇p**sn_U`C zu,Nf?3WQ!@V%Fzt"*9XiSwĕ q gjRZ d )\@' -L #}Z5N}wb}؝HAS7Ӹ7Ų&@> X~$RL>Co73>#QS-"GbKu ޢ?JA!{7GdYRe7rF$FqPfè$ MXin o߇k#]$k*a1/GՂk!+ x 53G{1i;l@1CkIՓ)L} ./RC)# Q?ɃO ӱ$y]l'AzFڴ50-o ^ oަ+/,6À̹"sKD6̹C6ō*[դjxn~eeL?~'r'3,N 丩:,.lyru{mP5oI-&S $LZuv4)/pkQRiHvE Ϭ7;Nm3[Uo5_I?86I;iwrO_gQiA4n#Ļq5!ηV7ݣ}ߞdf f; k?Cpa8NE}\>1RS%iYO?(v9B?luj/xV$]rD<Ԣe&O渏 !%Qn:tno_mc|w'׾Zϓ`ۏJk5hT["<%6˄\i'fy<m3Nč,yilsMs8-<Y)-GM%ϐ$^:'8֛{,;e?u?zM{vݧ-v) N18xH:0Ա* c$14 Z6֗ըhL4_wmND|-1R.0 U.%/ ;C`%N˅gkZQxԽž!SoSA#ڔq񄛵?RRù87SZPߣ ꒰YX8HjN.v9nᣜ$>0!%$*6FOC^1 yB];pX@?{3-Z>(L5UjǸJ[xo^Tk{|wZ+{41T';Ioy%ێܒ{_k4X,:63caghf~:$Z5$3D|K29aq>& @>-V5Lwsjt%"y1H.Qo$a;Ȑ-HXh[77z-Mtjq̎y"Ie@@ E(e|-M]Ӧ? m=NE$Gs 7%8pǖh YŎ&s\54| qL@`-T5qr})G mI nw<@btz`K~4sio.!AĹc򄟧y8ߑcFu{?zN=cۿ[E6@O*$1ܙ)o@t>m)꟠Qz˽?oOS[x?k>^$]%Đq#瘙a;]}SKg|[L?oMUIeS}fKYoY{?ճj":E4=7O2`v?ɰ/Bv7QwI|٠7QG~jwHwa?/NYH|-gkPLD-:=򺿡bDǴhFO\8vT=Fg9M*;JJG-SS۔7&ܒQDܚP%%Z0Q6'ا-{oIj[%18b֦Zy!"I`߱OV\4~ =+.K8Xgƍ:)39߂8ޥ{-Umx;ʗܔެ%6SzqDgG"}' ?0:ѩTZZ5!("&~)&$ORQA˶|J QkpIn Z>*{Lp4FO!!M0^]= mwx8\~DX͟) ikFn)ØL6GB31Gĩ:wtyXO)@7;HJ,5P?T^Zt||ԘGuHT7-V=K ]0ٱ/PK&|BڲlcZx7;+vQܝ@ǼHzlW 6{t1}52w Q 8DXeTe)O"otuc(O)JdBД'I9)JR-<+fY_y VXx,I-29M1Q^&v:U8=a൓9jeR_VI2V_6;~UQ;vM $K-j;Eh{JJ2BJIBRS &%,<% )L%- BtЪf ]6UTWJWΣլ+phYSLj5C Is4j fmyRk *1 &"%4k25n'+hkp6?sM&OA@ $?M4'uیHVkGOjM_V"bFsLpo38h~?A]0㡟ozG_\~E oœs,;D?³ -Hwݭ2h$j52cc0>=?nU% GҘ\jc7@ Uh'g8$γKvsu-mIcs=)m/z&4GB?RjӠvl^j&~K*}[HxY;QL,<6Ɍ_č?ڬte~E\-)5ދYL8 J{B&HA60TPR2$# PUpUVE";[,0yDž˱iШˁPc؄7b=6\,lɮn)RߕRU'I"`9g2=8pR};HN NiQ厠)ʃu O]]Gd-puP4wx?K|Sv;+eDa{wɥP#X}+}O߭18i*wEs&\{=*\s'Z#_VIR$ymȷQ4w<;bwhůѺ [?3?k!w)owpBKpɤ@M!`Bkf2'X;q#j I$WI$I$BI$'LI$I$$IN%)$I$IJI$$I)I$I$JRI$:I$$II$I$IJI$&N$)$I2t%)$I2t)I$I$JRI$dRI$I$I$I%)$LI$$Id%I$I$HRI$I$I$I$$I$I)I$II$$I$IJI$I$RI$I$I$IJI$I)I$I$JRI$I$ I$I$RI$I%)$I(I$I$I%)$I$IJI$I$RI$I$I$'I I$dI$I%)$I$IJI$[ucg?rZp57+5:f_?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$ILN[9*xo~֍;ьv7F| ,|ԢsD144 8/:Ok]L5ƿ?ʏ:7SO vDyxςGR>Z@1L N ~)#'=Б2w]I' xԏ BcDۺZɦt4|[D <~oJkia:{$GF"F79)IɎ5!H0ԞOcIOh)CZr\Z}5_<$=ᱻO?[uvhяQ  {/`? i-1 akuRD)Rk)v~2\5k0(h?騺{?KE"KpƩKK ] oKq?s>ƠL"KCcA 7_ysv{~O0:`QMg弩fZ]2sJS4Gm0Р.`8ay!\O)仳ct?;GoFsKX^#5 k v)6~ACX}w\il?"<%P]Nq\w$n{#S C{þ+j np\Ajfovw̽H;RM3nCY>}w,XB͞6 aaQ%4n:<&3cw'n݃qQyqw}.&£n@h&X\cD1#T+ %4j#eH; %Nj|IJ5n=20FE״KQ?ioG·Ȓyl|RB 9Rvܐ{-R8 `-x"x%?=I:D`#I)̏ڒYݷZv[Ů?ܡ:|@k@i?q'?Ivg"k|G!+en7:?V k%!Ri͌ bD(Э $^L8ꌨs RxIO`<tЭ1\|S8gmf:4liD?8| ܀nlLvA<> QOW,{O% iw,w?+IJ $B0X |JNBwqʬm{*:KG\#LI>-ho'-TϢЉBG!~(JD9aڀ; WG!r4`q{v|"&:MP+]I#*.iă\NsBO rƧ}Zb#_hi~ ac{OE0b_G'|JhuX>>{tۻR\%xi?}pt"?-S@^oMeGĻ=n#tM.Tv)*Z$|NԅA~rAz^(p֟{ITN77Rsn#ߞ1:cxkjF#d@DTk*8-pHcˈ>LOl{ɑX 9IĠ`x_u۹GNLSnJ䅉^H.OUE=-]=L@D6Q"Mh;6ʨૌP2}ZA+ cKK-?|֥W[ugKCX}BZfmHweo ˜kAc`NPI)-CX$O!II2$vT 9hl?fiJT y 6-Bhҷ,iOB~͐;;XX#iP3sÄh &/SfǑءJpTF"V `'ܭ*%T`m-t],س.+NõDzk/s=ʮ]&JdOZm{DtI2I)hO NIR'JX078U%[p;Sgnꤝ ;1 sy `ŮQniv'r ?Mk5\ wc?h>8oInh3$@԰u@>@8iӤ>f~rHFZ O]LZ^?IZ'>?uN=IsmQ25#Rf;?uT'`X ١pMq&,o=Z0hY,o3upEwjq;hĐX~jN;p?ߦn!F.` p0ƫ>}Դ_Lklv݅8gNOH|)4{n}Ax?ےB |9j?jv:缆) \vnҦZ%X{/J<,8*DńaBg+(riN@;]O۱]y&0:I5ߜ,i=ҨJiP.۔u6D$zm*mKj6Ķ"J[ޒQ}4w&܇6h E؟b&ې%" Kb6UiDX>k8YKM?-,}Q1sz7^PS-WV<֜KgnM `ܤbu'ڈ"GtQ7% rRlOjP69De/$Զ(>M) O/>gVKw]Sf4ɎK ӍifJQT, EPu CskN>(5i{ZE6UiyDe4f}z R L,yyRC@O-MqRuuyQD`-7R)a>`|L8~KmCTIcJЂA R~a4X~ y~i3))O5 "O A I&Khh'( mH rJhP^tp'Õ?Lv;D!;_#slT GCm$H@l`:0}{8;B/KS4lA$"5*U>%dž4T0Cͯ(ݔFaU~M$eN#]?i'|Jp⢒r[hHBt{Êޡ",:hJ@i+DzBjtAUM [m:@?Lt?w-Bџ>D&𑶡F1Kj}$ GwvG.mֵdt0A07Hà3mX7IKu#Q+AE<iX5pZo_ &g4?%pwgGnocI:wI?(>Ҧ' tj; dbQ*Ůa!h^ӡ*rDdT;%n{^%Vi"V߆Z TE ߠv5ySB }1x:gIV15<8vUB#J4ig1S:pB:}4 H#ۨUhVFƬF‹`Èu{L4OٲE٧>wV={%s+wRikĴI@ũkX .>D3@{_KX>z&$b"5Lu%ArYסQ:Ea#䍄|!&OJhq˺FJAOޜ>;HS.A)GQ/)@vqFFښ;M5&WcOLE& r_!w,3ÇF?۩U:ryO[N:(A>Y.gt;֫ZQtDn>AT_XZ[,?IR?$EKbK!ie˯.]Hkf{t uIvc0s]<:,(Iju'zwqeHX{Lmn׍B'LI$I$RI$'I%)$LI $I$$I$I)I$dI&I:dI$$$I$I)I$dI$)$LI%)$L:I)I$dI%)$I2t)I$I$JRI$I$I&I$BI$P;R)%I$dI$)$I$IJI$I$RI$I$I:II$I%)$I$IJI$I$RI$I$I:I$I$I$$I$H $HI$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$'I%)$L:dI$I$)$I$IJI$[ucg?rZp57+5:f_?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$:wI~_~UO{hh'O-&NCll%P @(F'<䜖:w9&ԦNkуk昸'Nɀw~hӣNHb J91:ymKlQ8$~OZneA)5dk3$λ?I"b5ѧ~H1D=ǎTOQigIՍf k}{{oɘt2uk}W$ɟpß&#{& imn#؝]m)kL[q?Blqnc P 'Z j]ZŬj䐰<36=_YYp6&{`RsX`ngo'eUvh?+k@%+ Iw{WRvwT]\=mئ saҩ v6r=@\+'GԽ u//v !톞!^~ nrJ\Zްche. g5g݋5+jEtw_ iv w,%]%vmԒ#&OBmCd0)^qsOm*oCD5Ӯ֗{Tn״躔і|H?v dӵk/|j;&U]f3eZxMoBU[ 6>w?ҤAUIwІUMLF5;?-AJ|"k >]mK&cXҗ6&0&pۥ(P?s"W[]ihkG֒@͕onl&ۓ{rSﴪK mcʿJ[&i ۷(anĺ?0AH  ]Vwĸ2E%iLfor,/vjr?H9.{kKvڋXkMr;8y@\[d7 i #P&>kXc4!\yg^?_OJh4)=Bcc ;9ѥwOm'g-R&tOJOiG P3?&YopYZI`[E| Yr1p-dmV:j $V/I\c3r`Ylբ< ZcRU}⪳Km?aȢ1O#({zMѠCP<|rDk-i$^?F+.:$:F1E+R ͯq$X汕8ON#Ll}w'ndnZOwTA&+-ka=~u{4X.F!ҦXF3'qo%ܺhr$S6v4F#N{=x ay=}?9kWu1=)X@;Z}W4߂ϊNctQkK}7"4q24jkC5kG3N߿ch-{O+y-:vg`:*Lkf kT{gI(R,u))J'O BJfJiQ&JpK"SJb|tM B#h{ðR[M_M*4 .?J§f$dh2=aiUo(a}{|x~DvVt0JHnu6zwn ]H?}Vݯ[9/A5q Ǒ?==Q/#ntp?H_\S4kӫ^P{v9iV1nyu8|7OOi)#IHONXKkX&o0 4eOxځAk+Lpy.$ Ĩ0b#.$+ Hs#fi,.2#DWck nJMn {!,2KP$uONY٦.g-0VmQ~kR1Q!ԟ%ON>hKc++E!JSJrm-QjBMɋM*N+RKz7-Yzhq.`:*~adj*6gzj}4_Q斞b?6Tr#2C'MJ0ǔpNLiuMkX5,Vи;?Ag!?v}fwM0pt.Am~rg?a?ƭ;O]OpNgMy[?+#ď#FOj!ިڢ ğnI(=z)z~՞|j"uR5n3[7\7돗xη}4=}ws(xm'Ʒm/LߤzVTÞ6u~>Ѻd3'mf<S_LMLOgCSaw >kf;bJ'?Oׇ brѺ?;fC?oVo[tsYn&{)Zߤw"wL#~$&Y'wg .jn􉯳L9*F\&衢NSgO(of7{ ,&Dm =A 58:o{,y3ή%* gX+?5Wj&䋐%9eږHJ%Rl6ڥ L6ҊT<)[ JRUP_Y*Tkxp!bB\&Bq` U0+]Fn9T^o(c6+좏W۾0hq[F3:qs(yaӫAMDcC[Y#%YOs.'շSLm 34 2RuAhl+kQJh!TN[hM-I$Ak(ϱG)J"6, M<ă% 69 g8e&G$?I̩cz4||bHp-Xadnnkƍ1(?@ONXĝò=ǃ[x2I:. H9,$7Ұf)]I#'`='7jFK@>$Iâ+&< Q-ia2jgC.hwKt$O B-&?Π>LSk4/H5KXO1Tw4KI#F`wsk&EɣwB 9N,vzt >nL]asǙ )!ď FdOޟО9'`H6jݭ>@}hC̱\~ hZ7I@d7LI؜;Z yi%39̆)=7':pEkѓI |ٱ~!t% ɨỂ'I2IjI:I$$NtdR$t$I'NǖG!2I)INhɤXBWe{eU[ېe bך0I`ʵh$I=*I$$R'L7%iK.oܟ3mT2 ],HK9-S`?}#h$6d'I$R$Id%)"E9I7)J鑱]Cj;~6avŔbdz.}hSd:!~V+r[{E<{?xZn7GnfZx?B&~Byu'<~#1L݄ -yvhpu#@t>RUݮа*m{]p*=W0?*[dG ~c`[-UZ)8qtU{D)ׂFΡc2ߤ5V9Q*}Vy!VY+kZw܆Y\!v\!b]Xc-[Yuwsrd婒XZ=G95Z[u=c~EW.fyxJYo<Wc euJ{ޝ?i>ҍOU-hZesxUs;`cG~9݌}VxhɬMgeWttr?Gpp?1sm!6<E\6 . %w`0T ذ:ܖϚ:II$$I)I$I$ RI$% A> IJI$&NJRI$$IJI$L$I2I$I&I:dI$IJI$&N$IN%)$Lt%)$I2tRI$$JRI$I$I$9LI' JRI$$I I$I$RI$I$I$I%)$I8L$$I$I)I$I$JRI$I$I$I$$ItI$I%)$I$AI$E$E*I$I$RI$I$I$I%)$I$A I$I$JI$I$I$I%)$LS')RI$I$I$I%)$Zoŏ垴:=j隝?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$@N:}{G@A<"ʓGJ%eQ<4ո$$<ԣw~ Mvi؞Mawنq qʋ1˒H?' Hw  ?Yݯ1H&.|{ @s˝~}[kI:h~]oЫ&ԝ=-RXN?Ii*.XX\N_h%ybqty vLZ֐\Kcg9BIf"өi% 'HKn[&gnI(jɨ}ثێߦqj!f-jxmا$j=Lωoؠ]d7o;?lL't{sOsob){~f|=ρ%٭O-'g9=M3s餦?6 rG/ ݥkdZ mB ;Z'QRͣDL?~p^kZuv'RV)QYѴ7ć9_f VΦ\Gb}&Ҡ|gݿ5D;B#+ǘho+T0?꓉@? }ҪZ+3!J6e=; DR}`hnBD$nU2߯&777 ?l}Zd$yH `>hNJ9Cx($p.$9l@:yU.tO0zQ|yB\F$ d+x͖ARykCmso|m/@'IT3{`+qcǝVq+o"D|Sv\ީOm-k(cg v/AЪ%H q~*)RvVkX>'m6o4}3tTR[02v?J;z@?`V7 )J4s+o)} ChO+&U+4:m!a14\4vU:,G7hA>j%ğWv慎<{Bh:0Lpȇm`j#iq`n̑h#a/?:#{։HoPO)w%sSm C 8OEmVarcL;NKʑs;&?E@ˏoR )G60u [Q4@4ƆI\{? @yܖďJE8ΘkӀV!~E$5|"ꟉRwO!JWYD]LiV'2e~SP>,ui4w@Mӛ\%Yg~y ,؍O]c+9ӋE5!75$zw&  R*]xNlj*ܒP>Z߱ \t}. rU F&B #׺Ur`nw ܊"à=МN3 pPAA<l䓘5u4$i :j~8R6(=SE R!=%v>X G%Z hG(9djf5x%tD0v9s`5[Qu |8*-A?Jx=V\}pvM:Whu=7KէeFG# +d>ٷmEqB( 3T<vP_`(5W9n> GbmQ6nKr}1[\R*SF6Q Rܒ)lDz[)EVj[T(Sܖ JRUږ8JlY²] r}k& oXB晎(_X9Jhu*AQaoˤg{La$kCG솒?ȨTAc4?ے`aC}Ɨ~x?}$@?8?J ?ɱM38.!_$H?Z:QL77*hx'Xwa[ӱw)ִdRT5 n朦_<;$aeAQg[uYLƈgn,JFoE'>?ȫjO9m?nRG?LѦ;Y/ \ o>miixugBDvI5-O,6'sA>v=Z#\,5<*'@}&E9U Y)LهQ=k@yZzT.os~u6  JS$Xބ$)L)$)hI:IҔҒJY$'$I:KWݽOi 8wzVح,=]>I3\awWҜƤI:I)IJI:d&RI:t$I:H.8Hb-n &?Kd<pj.i5|lp|eX&>%lqy7Rϸ;MO-jT^fEH1!M=?4}'Iȁ܇D8usKӮ>>A$h-&Ay?/U@}Иf42wТf8T淆]!o[;BɉL#v)鹣''w(GN()Z79?5}0##rfÏ50e`FwpIn T$Eχ)KtkI1{J-;>WEM H6xbw(mwRP:e .&LW~.3wK=iq5;ai*J"PNWajuެdQHX9DL2HtI81_"9 OI96]2@%$AP?fԻ¾ [U$wjyi젝) X;IB'I:t$I$'I1I$I L25D:k,YZjxrӸDXAJ5DE5LXs:B:8Hn{ږE"5oɱZeྣA;mcipE55Zא]FN#O~olItt'HsF=ԉ]cu3!mc_Qoag'OW\>XFҭ.:lҸTTmM}LZk`!aXyެ2<]I2J]$I$IJI$Н$I2I $I&N%)$I$IJI$$2JRI$d$$II$I2d$$Id2JRI$dRI$I$I2IRI$I$I$I%)$L?dI2I$I$I$$I$I)I$I$JRI$p:IRI$I$I$I$$I$I)I$I$JRI$N:JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$ $I$HI$I$JRI$dRI$$JRI$I$I$I$$KC:\և[ucgO3S?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$s.ұ@Td;m }WK9.?J䮈3Xh8RMiKv9@ ۧSN0|HN֖.}LhNߑ#-ӗ"~~i;'U4?PL7'|?;WKRA^gQ b\8mkEL2TM~?蔚~_9oAd8gG"3{pHutTi33rs:n5G;k@dfW4>"\Wm8aq/>J;R7熏?"gpi<~M%S Cw-<ZP:3T\gfN?5ߡyJ\H{>[/;o%w9pOjhvso)ELwIj i$s}֙ ß?%@$XOnb+`ӱ>m%RKgi}ۯA1Y" ;?pw'q{PŎ@w?FZbߔRw0D8{|I?JL=oFzIڽ!5X|=+J cu>;nowFc^wi5&g2}|RsGM>'R\܃{~@#Ώ>j,tA n3EcqK|b`K~mcF}ȧvL[2YƆͅDS{ZqZ#iyfMMi:@?7{c5W~k; 8mnzTR"J+,xh߽=T?j48N;[lWjwrƵy"י+SP+2@PǺ *uۣqv*p Vi=[vSGG[X}(?2R!Q':c$o{DND:T?9Ѓw%/MX8Ev#JV?g |gVΨ˧%TVK:.تwhH'O &Ĕ &JyDn?M0*48I\4>em\ ?1u * A3Rn d *fSnD XOT4Nv"ӽR Oj75L0t滉C9$Uw'V7V1GoN`6ڎo>*>B[Pa4vSXږOQ1z B4)%FSnIH!-Dڟj֟^YM dx*ma:㤈diſ^m:Y[*#E M*ɷ)&-a[Q%)Cܖh(EؖIM*J[JxDږ2R M%Z0ԡj}rSJI)'-Bҡ|Ɖ ru">&P:}WJbBC̤S~Y)h]ZK^捇C[S'H5TC D}>%&f_L_prưxD{/l;#n5F7;]3 ˤ Cˬhks˷j!'}jf3+ɱ%*z/n_ɪys IXOϬN^G]Lѷx?)mlmCɇwM&gߤ؞w>?1~R)qw: CN~T& ?&~>>c?Rm?EOo?znñwnLЗWpchs<џT9ct-0IO)ڳoӼl6佾(?1+6;#A7aiM?p7h8Ɏ\2Vfya&M GMf; :m;XIiVA8rl&f8)\ 7it%(RI$RҒJY$'2@O )dR[kiFoN2 $z)$'d\  UV ޭchU!C>iv uCF\cCecXcr/y6Z#N]LE)ZNZt fQR):i\Y6ͮ{$I$5$I$I)I$I$JRI$2I$$I15<; $H5Z҈ܲ0q>%CV"+aOޡic=\j+$y࡝Qcx*g׏syh~w1G{ x}mulѤ47'%HXes杵F~y$a/N]&֟ѳJQv.ߘGI g9ppNX}>%Mϰ&FIT[c#gmc0 ~l25t[ȓD5-$-Ujc]J-? K~%E<Ѷ5e >2x@_ I8*ᜳ_7E"IURͧҴU]kgSջde66wX=ƈ/JII$I$$I$I)I$I'IJL2e:5F"˘yD:b(=Gg ?[!N*&{?!Pٍez A;p  @pV)ʪ r}ZK;k߶ͧ[bi!v+gd}n46P! z#T 2ږ,CT䋱rR-&,GO RڍJiBޑ%ZڌkN+EܘآmFhv qZ\ŻӰEgh\2)Y xC7ԤUWya 87 0TNŨ$&=nPܖj[TrEЇ)${Rډ<"$-)Q6-R䔋b[a(GvZVt8NbÿԦ;2bR,ii=U0Yۻ)E]?8@i1-o.qk[XcIz#ԫqAHa=%]5;~Dԁ:7_VsɅ{DJ50{ki΁%[XcT5OQljLΊK9?v!Rk: Sj_GXaX-=nA*ٻ]⇌kŚZppx/oNs6 )R-lI$Ҕ$PsŌuO 'o6%ޕwn >U>K'z6*&crlZ{Ąk}j9;s &`$PqsFEXE5uOXh> <$|?/P=Osa$8k>)[hxwOl* |e3j~ iA1 09I2_» ȉ 5i]pt4*fõMJTFX." Z ;>*S@6E}pynJSJRI:I)L%,t4%,IR$IO)%,!:Kf@=?LǓ\#lUmMgYI1(+('۹/iǴ|CLa^_xrY {O]Svp'7gzkxN Hgz,*Amɚ+Noc'_lҕ]2uwlmB;N {|gj(q:[3-o1%H4ouz&CŻ u2?GgS5a,< aTp7&Ė~aG:20uho$sAfi5y1ny=G^ o?oOҌ$h{9sS]  0Oo)̳o%[\S΅c_=$Q.HM11֏~GsjI?;R{`9>Y(d 77l?I[\~,w' 5;TZ;j> %l`aŮ  'T"h=GKc`'YV=oK﹠>'FVk<'ܻ+#s~M_[9!oySnc)~O씳W~ {%@(};9PU Ֆƌh Ip{Mra8^Uݙc;TF"w([[{J(c[NtI*I%LY6ث]6xrTwШULK\{dxZ=ú*TzeYd ԒI:dIJI$N$I:dIJI$I)I$>ޕiZ!cgH<9mxQ1=QAOY¡X[vZ/"M\cήrp֏|n%1?I2])so8lk$38,4 Dh4SN D<%W`~DڇXd"?5pG4>%G[ I$nItI$I$I%)2tN:JRdI$RI$qir]@,ˡƳ߄\g^{C̡d,w+PNhvPIX̧ѰP EowX=Ɵr2d$I2I9 kEՋTUޟ`x4ldK=Ti;*]BۛەI%+k5QNYMԔjXRI8LHRI$$:JRI&L$J))L$,I-.oQpY;v5ݻkFÃIDt>i% r>0|EՖ}Xy?Qa14äwH{^g~Tl)6;N;$nݝ5&IS68rz-<DMo^ a忑XYw`x#(ͼ;K@j5jhvPZyvV\wQ1]UaaZm{>).ƅ6ofBemCI>k2(Z{&(6@w>(iQkyP3XW6E?QiX{YFtn]x- X;s[8Q!DW3 ˆRQQ2N%BbK$2HNjڬ榡*@TsTeAsSHC4!: j(I$2)JRI$ $$I)&I2I$$I$I)I$dIJI$$2 RI$dRI$'LI$:I)I$ddI2I$$IN$I&NJRI$$IJI$I$RI$'I%)$HNS$$I$I!I$I$JRI$I$I$I$$I'L$$I$IJI$I$RI$I$I$I%)$NI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&I$I2I$$I$I!I$I$JRI$:=huY?+zˇQY5:?d,?d+XS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$JUT\$ )I$𥏎\ a2M  nJx |9O 6v>\HdR])΍DkR4gObT]ejo5"c̨9:'6Ez<k墛YG'  ;qBu׺GjN v#` |q;v`n??Ip ͛=j}GX&aϏS9}։<#\I@O?lI'S?ڧ5LĝbxbIYn'h?8OYh9Wx?U;[`wUmQOfO`t5uXTC:IcLJ#L5QǩY#v??׳Ta9.s=? N|#iq@^ z&q`Drƾ"$p~?:O1hNe>A>Xϸ}vd!R>Ms?wYbO=dIyGv+Ů Dϊr{/vƜ*Y]K%VM=J漁t Zt sh@%6PȰ\:?&S %==q@# QɰPǞjJUG256VG6B= Bp$~:&U̪3)%C} >Ju,2BڑDV+V\+.N%ҕ-13q0Nl%ݩ9Zice*nTG`d s৕)d<,ƴqӆ5[YIAΫw4OwC@XRb]f@/q1A F5o[M8a#aiEk 'Cgi-V}5ScKsc_M]YJ 1}(.bwOn'j$wv=κ@x}^? 1!+yh$Zv$ԫ,cj4 aIWU_[:r?s?z\yv5rf6^E>@2 :2-4AG~ѧ)M#*V40>,պ4>kmkُ4 G!cٓ(=uGWadS}aa[TnQI=hJztjmi" SJJG-ie" RpvhkFĿӴ&X+ʤի,-T }Z{NuU+M^ n)8dPhT:cZ\z )vj[Q!(EoCےS mSzF)M))"o)%4S I)Vu,Jviv(bDѵVϫ}s+I$A[@t\<cZ Ta( s4M7< ) 9~ǫhdTBZJLjs#S5ݡq)3)IKMy>gD$7V[TQ SOIZ&?R1'C~)%"q! `㪗cmLѠV[p~s= _dkKRj~&[8G;{}%,LAjk~:VCx@@f\'Z-=9.Щlw6A)JO-CSZHU% _08wSNZˆ  t[)$U[CNjU0 k6VP1`gRh 2@#A7ٲH}OAt:#h#WcySfp@0lC*.!hIocbA=}X5~ jds\[$P[ qԬo:`eӑAJ+c21 hp4(nhP5̪-!?:t*7cLG'pXRb _͍UJ|ѕ Q>AiY)Y姱CR[IBӤ$I:II I$:J$I$:J$Jtkxp$=p}50.\woLuQ1 ,lgXiU^'ſH=7i,w]?)7cL|XV3LJb z(;?HX(plɦi а~j-&A:>OooOi;G#G3]?ԬyۛH콟礪H@ @6;Ѽjũ5n?? ,`j<:Y>~j "@0u?Zv@;Ɍ1ZgA>Ͱ?'QbHHk6+hOYؤ7<xgM6S}I:ex,w: y=v`- =mKi87QMM֐k; + o{wRvDvX7Xo0#yz6n'=3z~Ciwi@#q?bK< |7f$y=~aj.`vT7ǣF:sLo?6myggj@ G oo+%+XEJ$I%)$I$IJI$RI:I$I;]9 aeSV2ӮaQ_:𝤳Bh8`ajyI;訐A2)8vx6-Cpj$'Um^tVRN:(Y$I$RI$I$I:I$I+5@w`wn5 Tu5Ղt 譠SG~V4V s,N*dđvD!^]0+8kٴhB1:OE{|T=?Q-|$>K[uI*M sg,tA@Rbx겅̻Cz嗴 2r!h4k!hm1.<~IUV'Gn}NЂ߂GE{`iIk gE'3pH0jZPN:|uSx.0HPickƾf TUCD6Ulk#l>qMe-DdQ凲xAd#. q:lvtZddn~Z$II$I$$I'L)2I$I$$I)18rSnΑQ.uJ3TD)OX+Zfï< *nlQMLFWựW`3k{;Plnm oa ɉht70@FƳӰ;Ъ%1NWP'HJL2uBdN di 0K$'CsPr\ਧU{a aBsSHAdD$(BI$RRڙ)$Q:I!I$e"I$I$$I$I)I$dIJI$$2 RI$$RI$'LI&LI$9LI$:dI$I%)$LI$$I$I)I$I$JRI$dAE%)$I$I I$I$RI$I$I$I%)$I:d%I$I$JRI$I$I$I$$I$I)I$t'IJI$I$RI$I$I$I%)$I$I I$I$JI$I$I$I%)$I$$$I$I)I$IIJI$I$BI$I$IhuY?+zγ,~W,WSjud,d+XS1Kvo 7:eUtI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$N%)$'Z։'^FIvg7M8ճG;- A'wD­m1:Z=Pڙu-'_E :'|NanIJO Ov j /qvMEϹD/w-/Ј& wI^wiQoAFE7 i ϶<r! tE {);*wlS`7@8?v:{Z:nbV64@@?5.{[.v!&q.kV[sǫ͑±_9 A*HhỄkQ'kKo9egWQ u ĕO z& XvQ.? yP'$.o&ˉHisQj p}f?4Kt+VGr%`c@oI:~ӽhg_5øH QsZ#V֊ռV/<['$=ĩez.Y6"ͦr?k֊aazUMrrMl+VdªCF+xʰTRܔL%$QLqƏ4dvqt/PAQ(I;;PKX>#Gte7*6ZK3XF56d Qo<\K@?Khi|FaMg_?香Swnhߛ}/|w?O?}4ٮYR#3H?ٸᶏ7rf2ǟqF/IPճTvm1~c6x[ j=dTZ.ߤ==qo0p wVǪ?gp=F~{۷Q;IsCljd9Go!)<7馵C8>GrU]-*b icz]?A8d R%gGڽ,zv1FVԙl(GIy ;W!ƤAj?Ԭ%O rcC.<5T$I\I$RLIRS$$)nM)IKBP%SE {+* g:{-Ut DIɱVN#jF³}qhiLJ$)JiI2IY$'d)d$I&I I$N$Ijtΰ¡ohJ8;n/E0Dۚx N\;^xtsm\ -c..*!݃JJEvƤL}[CB$#+?oBA](-IwtB_Jb\]xlgB>Q%}S#s܂C4>AM ĘJP}N^|ԽH\nwP,'B|Sv; b2*-5PճQ[DqG\Yg;W29<+8xͩVc04j'RME(U|ZN>6 IԨ`ӴoEgHR8JWdM^dqe5j&I$ԒI$I$$I$I)I$trC1[&F6HYsנ0]gqRdewq%1n[5q^eyLkBVQ$x28~q%Ht´ި{k:8G?LWi#HB~VZ)-ef0#?%,2 CƩ$x3/M9 7ҊnpsU KOnG#0ϕ[n?ߦ#[l~I (,^Zr7hkv}(6Z܏cSC^g;Kwѹ<cmG#k?0ݵ]K|Y<t#N$7 ,?jCn8Qͽ5b =nnПc] <Լ /i8?1+\9QWP=jQ 0|Th~p2tٱ=jC !\YT'Vd&OX铥I%)$qdDZΝaP2ptg}*JŦ?]}܀IUM L*ȳBpl{Z8RwP?k)zGJ}T[?.-ûL=*d$I)II:IN$I%)$Nd%)$Zb?==YzvA(S[ې P/TDA߫d_U+$r5Rû֬;Р$t4$dIJI$I$RI$$JRI$1V*β&GU@wH$lה pX$hUp%Ί%WZa7 bB9w`Xӹr_rm ChRWmwOQ|B"]iQ ơ:hfUI$卄I:ddI$I%)$I$AJI$yÑ`ȤZBZ2denIii7.5;YJZ>k=$\M6섞5c":)QRIM%=/HFG`,qUY0\Mò7sM 0PC,cٱ-=>[pr2˩p5'{ Zy )]D1ҔLLIӦO))II$$$$JI$Bt eZYj?T1n4+i8~U1`K\Wh]pa~?n1h/ebj?Hi9EwL>NCJ1Lթ1$mxj?)!V({Us+ÿ*+A,<Sz3co~tVVk^(<}V_RaS9 F!M3Rݮ׃BD kmP!F!1*JbNwn"P @úqN|R Tonǐ6}ʰNec?{%])&H%d铨R)%.2J%D2Ԃt22NAVSUP!Csa C$ A!DBiB$e(LI&):I!I$% ))I$I$$I&NJRI$2tRI$ɓIJI$L2JRI$d2HRI$$IJI$&NJRI$$IJI$L2JRI$I$I$I$$Ibr򒔒I&I$BI$I$I$I%)$I$$$INTI$I$$I$I)I$I$JRI$I$I$2tI$I%)$I$IJI$I$RI$I$JI$I$JI$I$I$I%)$I0NJRI$d@RI$dJI$I$I$I%)$Zoŏ垴:=j隝d,d+XS1Kvo 7:PI&I$RI$I$I$I%)$I$IJI$I$RI$IIkA$ )I$iq %t'3udž:gGmv Pgɼ'o<LTX__!ЋxraY#$CA [E" .GY֍X-O%NaTbD =GoZ3Ux'H$k ?boaۆhqtu}.L"k'dy[?6䒑w//նU}xWk[Lw" wwtd6{Ak~cH3qm?8=?M$u-o!\KrH&|ܳH֘۵N?:t!]wSEi?NL1hoؒWsvLS`'{MR1.:?B3A"F}I?jDFK;=?D m>{c!ٰIۧs[Xe?P -;|>ɠvAN♬'F'efFۍ @`i`>N)1@ӟ8V; ,1SQyV#\YH,`JmL2`N>.'Ls )P:BMR5%4鮿,zO}9AZyuNm h~ č%AɞLEO3sVn o?H u| gv| 3Cy &i%d6!o񤄋 #Tu;vTu0L)tQO?A`M ޅYcGR3lQ:@6XEzuʡC8EP;_Z@h|IP@F+=*ZM[v$&NI$$$L`<],i@S]3sw0l8|ߗOi5av-w?rl.DRi3}Klh#͎rgbK`9iXMQ -єoAćO[ܷi4͟i,b y]a?e)G`3H&(@8Qͦݧ96밖)e%1˚?Ϧ-v+YT^AD88Rkk7 #۽OrcZP} `>" _˿c2XRm81žS}7w3Y 0Yg 7?~{N7wIoQ',?oiUJv1Hf8YpɱKpHx;y9 ;AW}ki#CuN27\o`Hseej@t@?W!}0Q)][p5AF}%dX[*PoUQM% JR(RIO)&JRR'I:II+$2PR$.I#bX:[hpȢq 9D QdW0%Oͯ{h4]=V*JOii LbuRLn$$JS'Fxx}8 @$nC+5SL~Yn$8%IT]\l%6fJZ|P`[->a -0D,T~!6cd]r'EZZ5UK=mDa̬ϋY:5)*[_v+yqx51e,I*[sL {SvHWOjr'5$-5OH{⥩2C<У>l&)c#&mv0Й|34|4,<}^a$?1N{<-aHhL9ݪxvo^F#gZI$ctI$I$I$NEJI$U p|ΒF4VrduՒ~">LI"QT*(-sʺI$ƤI:I$I$I$$I$tL`暜`NW8M\͏4k2~Zb7Fj.OY}BSMgKȨSanZMnJCÝc#9+dؓRHx?>F8 a3R{~itx?i?QpB??jE1gMlx.O|j*SHnI6ͧ~imhp?m.O[xm9Pp@Vcn)d=>膠la"Q0==qb?L Z}P4=E !QfDUǏ(rS螫amf@Gm Z1 m*A:\#=FnEBq]O[L?6w s%E$ZdN podVt$I!~I$I:JRI$%Ge>CnVzlK:wɏ[% 1-5 +-kyjXyE9IF;&I$R&NI$I'I2tI$tIRI$h_8}&ޛp5;&Ok?IJdw *%LI"_Q =am$:-8w$I)I$I'IJI$I$)I$I'IJI$I$RI$}<$FAr=!%}U~*vT*-qiWfH c44m= v-2TƳ{E$lWPuv()h[ 2=4$II$$$RSdiyV+( $k0N 0+r{R4GˣMkۡ@Gsw<BIԦF&sA\8_H.K[<I 4N v959_ѩY+gcdH5C?"`7F#S㵑zmI1M7+/ݫtc?ҿ ;X auw B,5 y[j։|Ecu:&Z $tѼL\=?w![?juA|?H6>a$<ԇn+l F)>{SoI5&2G&/Pkd>?>$bc= ~!%Uۺ^"U㰸s_7|Ge~k٣Bv ֟YƠRNCgPϳ uBkȀt-]#ZL68;@9:tm> rܓXknT aCx56`5-_S s]R ~hqg,Ңs?k?b` ,?ׯZk]x^GM)gYM{軐p,.gcJ N4vY\}-ԦƐpX~-Qy ~,S3QVhk(m]3֥ s<SX{VIJPHƤI2t$$II$I$'EJI$-o,l[=+&X<2JQg+y!UݜnV) ,7²p,+I;Z^`+즼FWT0bUmu.wto$Ѐ,*~I^JכUݠx]$ȝSQI$$I'SVe iJ*i+ʯ$lk6bZ5aX{?Gf?imfH}N2k-:;\Uq٣ѴL9k cv[pNAGFÖ3=D #]&*̲ `hNEb/)m`@\踸O PA#ğڅu w(5<-iױzMR ρ )v4鵮ItkN;FGivg̙Qa7O 5_nՌs'&Ok?$d=0}79/Зjs[ ߤv]E8 ɆySsǐء@i'yE:lA9n5ܥ pQkX\|Ȣhf@mMEkhO0a4xa"A>Jw&ɭlcK{&V^;UUJ _!F;Ul\w I$(RI$I$I$I$$I$I)I$KKXTVj6ޕX]RRǶeUB՚X{(+R"PJ&ŪCΧ;*}>igp$I'-RI$_L|TS $>)&pBQWV_+5pN>я#_T;YMB;vY<2ӯ.6%Ath3La70c~4h%.J>Ƥi;u-;OP-ţpE@. c.q9ڶtg&h$ 8l?9M!UA˪<'MoSwi-b={OUN1AR>%Tqu(BKB]貨 ,8n !=ES{ojXݿLyg_W hu*5Y6(iXEGK?$2tL2I&I%)$I$R$tI$,I$SnI$hI%{086U~K<y`6=2d֥<TAWGx;:d5'LI$J]$I)NJRI$8I:JY$I;ZA$&sCiI_h< Ox!R-<=='KG ƛ]C!^Tsksnoc[8*)'OcdI&I:dI:dIJI$I)I$I$JRI&N:Ht$I$I+xaҷV6Vf*j?V+P$$8e-LBOV|\P~eb }カ$@W 7Dlbe<+pJklvд L#Z ާ P7;X۸5|dׂ mqQ{̞S$kR>UXUmCkth`’I$rŒI$I$I$I%)$DSegV \؎]diRdǾ.ZWw-WU qm㺣)Jwy NXI3rt$&I$$JRI$RN8IK$I':I LS+OVo {gYz6ۺӴm;Q _B }+E;0u۵{֎e{lv ybN:1'{_#kKZxDt$m5YƉ=ɿWv[YYlSklD?AjL0PR9L\B) $)zl+J!Yn4G%.s d;u7D3Zwss'z13H~:w84d X`#,OV9t9ĆuoՀ4.RVW[- ۿ܋`I/:nEBOPmS]@ ѳ'Y$?I5[:`C~*.%J guι`)WwГ4?FX$瓠ʐ$ 4nw-ӫ<d7Aw'KjQ+;"4Μ-_j+i9?M~*v0n:ބ׷N_ʄ$7LO\O`҉urNOfQ[>)TB[?z\~suD6?bJ\kw;޶uʀnfR!fWl~R'"Kz|Wk.'B)dvF pR\׿uV5};w (`kT\x !i.#AwS8;w"$V7XF$ir5LGn}$YK)&]),ubC-p_>jW#yJ4ICrRbl$(RLBS)$NbJ$$$NTe%.<$a[Ji,+գKws~^B^m:c~`rp {}1?Mx*)2JUI:d$$I$I)I$II%)$I:dRI%}| l}l<?JS_+~;@=rotʻvڷD^6⳺8*N2IL0Hٶ{=Ϊf:d$$I&I<$$IO BJRI&I$I+%r7~%h H-s ";iiABLq ,cr6XkʯX-YHƄ@3k-qt&/oNkPk ݡ/=Զm06tX. gɭTBaG[ki4b3x= wqh Scwr7|L ZkZ.?  mk~~&Jsa55B@2R4??*'] 0$Q.?ݣA?2O05S IrHX;GL+6 %?D}9VRcX";kY鼴FCn~ݎ+KOEn{|nI)$I$I)I$I$JRI$I$I$I$$KQcytaŇzV꣎#?TD.sV+ETC .%`IHƙ$I$IJI$1?9ôP̫Ұ܄!^ZvC ;W3+_KR|9AI$ҤII$I$I%)$I:I$&I$$J]$W]µ^C;{kyceoZKu~{TRWtPiu*=FO-/ZO`p XNSiVs7=1avw5UGwMGmrMr`wr MMW{K1,J ;5E="Hm'Ʃ|l=A67֬p<,g=ZvZZ@;Zf$Q'cν:?Ji1{64˿ѢsAw-_媙mpx>A-<G[ۑUΟvl?I*D?ҊLxǴ<}?yg' R.uTJpdJEM `C(P!68u+~7 {kU0OY=U]Tnl+D{cv8Y z'ók Jɒ/d2tdRItܠ'LI9LI)I1I$I&QLBQ))tCsPbZ'QNB B$SB) . RI$<$I(I$)$L:dI$IJI$RN)$Lt)I$d:dI2I$$II"I&I$RI$'LRRI$I$I$2CI$S$$I$I)I$IIJI$NI)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'LJRI$$IJI$I$RI$I$I$$I'LI$I$$I$I)I$IIJI$I$BI$I$IhuY?+zγ,~W,WSjud,d+XS1Kvo 7I*I&N%)$I$$$II$I$&Z}׳x7Rе&7ٴmVEjP7xQ|P_b=p=JX2{]׻Q'_lDyٝyvK!ΰ4`Oܝ I_9vîF_?i ]fO{~I!gnvѩ{Hu ΚrB BKr9vѱ#l3b#+GԽ61%ǒ4cmIo̯JZߒ]s^Bsen8 8΁1'-5;SƚlWSBx)RS2y4^Q-LSħTRP :. AčJa&2Qϴy -$| :-~@h1Ylq3-&9w278@ $ewN?D7YwALִ+UgO>)8i{׎R^g䙎v_t"P-$xM;A}ӫvI!E+>zo-UdsEVq=e%+gkI \ɞQIg1*oz|;YhQ#DwѓCEW uP̫}zr5 |(7>ibg3kIs{gm-+A&Fww wЪqcȭ_h?< ":cl׏- G5,/eL>f3C6?vc}jL^!eJCUP {TOiu+?F'mkw5jk\ "K"y ߿@ gfW{OSCNpAoip`OG,o<|>tbϥI= ݉gA XݧiK]Tjhs[HE/y|b S%~p}թY#,/RRgk&8;.I>G|Qn8[<YIK-NNƇX6;GOKf\&_\AhIi9CޝT7j׬D2+s|ДUQQ$:_ȉ'I$)$I2tRI$NO- L\*@S3P 9$IWvc4r-wl*zvy}1lze\ $s֍3bqM{=F,p]ﳗBAfV*Hs|ДsuRPt"$IӦI%)2t$IO)(IK$$O}1e+}6ݖA&X] /Jve{-U\jߝ?Oަ[O+d1AԴN7>1&o2N3<_!EB^hI ?JyLzT%?'I ɓ'T:h= IK~?|} i_CD@(G P{{|1vI)Ww6* EmÎ6C~ABla#VheZ0*Cf& y~U;LPb:9ؓx+TZ?Lr{32Bd{Xߺ8H?E?(jsTXp9!st"H(]?9'>`5*,?xs w>$݇ަαaɞ&ue[p omԒu?4hSڱR%. !sy.Y:4Z?g:G^$pBtw^ ~ W::Y'w~?U* TcY)uJUōm]k\ i,-*e4v]qTV";d8{\Ud4CsH*>Hp! ѧS@?ȝAf:dIn ) e3ٹN XlYp?z&B%D t GK6[GLTTJB&N$BI$I$I$0A$TSjrDS6ݤ6SjOJhaRϢB3D|9> S5>Oȳ^A.%TTkjNkIZNߞTߠ@63w½+&~l}\GX??jvIa]Zhxȷ Ň(hsgK=884袠iړH1@!L\8c]I܍?u'k{M/hwIW}$g5?,LYَ塰 %zf{i5;qo<YIKp e;" RIP?)@,?D{ITm-cͿI3k[0VIbRI$:I$$I$I)I$d% )I$$qivM $8H رsil6]f;x'BOD4YCՃQU`mxx^c)֏~T\)5GL+5>1<h`:}$4sjO?)0|ڒ6?v; խDV~ =ڴ#`Uy9ܓw;S p RkOE&8(ڙ2@H ڢKA}h>$*l\Fҁ(1}"A?vТbeGrPH.ڧE֟w~:Dv9phѹ*}h% 3+7.J܄*+5>&>AR-k=ZûET:mM5}$II$I$RI$I$I$I)$IJ4:JW0M%*h,婎FV1aYF2JL^/h }Ux=Z ΩI8R1$IJ8I-P4mHw0M%oWÕEqav_kKK-VLk'I9I$:dJ$I$JRI$I$I$I$&Nh,<?Qk=F?j.f]ɤ˃y>GRr]%oٯHo9r?Rԯwlv7iN\vZ5i}#7,obW kZa?nQ7zo:8lP;cm)ɬ۩cxz58N,bvo:W5)a-AQl9FkqXJb:{ο_x%oſ*.pINnak>d=RPadj4+9m7r~DZ-<`zvmHDOg s+);LͧcਤIkI$I!I$I$IRI$I$I$I$$JM8h]Y5v;+Fۛ3iy懌?z [*6 ;=-<༰]:* ${u$I$IJI$N$I:I$I$I$$J ޕx:%OaWZ~>yL:JGޠͧլ#P ޭz4(_zI$$I$I)I$I$JRI$I$I$I$&N$I)$I8L%)$ZӭAL}k=Gl@C8ﱵ!Pg2πZ $t%$dI$dI$IJI$I$RI$RkwƖ ,Ym<hqѭQI%뤒I&H$$$I&)&AJN$d*]$LrI҅B!A ӦNB(I$BQ"BI%IBI$ɓhIJI$$I)I$I:dI2I$$IdHRI$N%)$I2t)I$I$JRI$dRI$I$IHp))I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$:dI$I$)$I$IJI$[ucg?rZp57+5:f_d,d+XS1Kvo 72J*$I$JRI$dIJI$e/ ԁJ։'@1F-Mt{DZ̒%d;5G'MxT-~$'J+, DqҊmDOk=㿑ώg^n:ڌ]1&d>?j$s3IsH'G3DKSskoˈc޵LZH`tD\^G*Pq~hE H:` H45lj)׺v5YG^#zkFt젣' Q9I,DaN%9 Q@j Hť1)7;@=0mQ3) úON^d]JI[N{*mZ̸De-mhI mQ RIj(/D/aT(nH$&tE;[cFni?E^u m>D 0 S胨h'hħ> v:?(A'$zBSsĎm {yfR*4X0~pH:4n5;P*y Z?JBrI I&NI$I2I)I$I$JRI$6ٴ 7Rȭ;až>kd{Ynh= YKO e>G7w":ӿpnѶ$~d-9 EoW5MJeX~ lZ?YR?Q,tp,/?ϩI5[,K8g:d8'6e_&+{ㆸ<Q".oN;O]Fƀ6?roZP^.iaRLq"wh,;RZ?%̓-?I m'y [DKǶ';w3'HOPxmDPo{fIvC|ØV_}T-c5<#̬љo'֍%.+i2b'߲T{-&%č4B5kTR"7h!Rn'b.$3rZ߆ʁ\eYc*ccͦ"6jx;sP^E6{)1Gh>zp3;([oF5Z>'qNHw6`\nH:y$pB$z ~Skht?!N}nf" w jA5guMVvCMM~z-@dJ˾ht9nz"8H Tc?%A$$6I$I$I&I$%tI$I$,I$:I%I$v;-Sԩ[XkOߡ:_ {쳚 a_sq m,ޫG7Ch4oڢ\a6~{SI55&E }3kzw {~}@;y;Tjpkڝhlg[X?wzG?M;jIaOv(Q9~x{T,BwYjkMwG|M谑Z ˄ϭUUj-93J s[o-1wEkZLa U $-(1,=~,QcVY qJT:i%2I$JRI$I$I$I$I$I%)$I_pR~J.5ݻX_ QnTcm5u&V߹ -$BesSTŢCp:nl<[NI"dI$I$$NI$$I$M9ԒJ.s[.Pf Vb2 yH)6To`xoͭg nQ߹ hZk ƅg#a  4UTSI$r$I$I)I$I$JRI$t"I$I%)$NrI|R) HMg?{{jcBWգQLʿ/Z-G |$s$I$JRI$I$I'I$RI$^$U{~w&,)TV'EmgOeX|@R?ٶ%Bw3>)'I$ZI$I)tLI$IRVw7B$첍ZBJf6FT %]r7"YHr~S0~ ɬ Hpk+7kT[ 'I9cu2sIԫyc ',c-<+ꔫ/5;«efɑ=j]s{Ou+u2`ア2t6I$I'IK#Ӗ{N(ލwQU [M1t:LV]={1H @Q0Ä)V8vDfPph'~ugpB,mZAPcKt+pN*vh tB]^wBXXyȅlm/d?4V1,}+)J&E^dFt,{=F~M)$I&JS))I$II%):I&I"JRI$LH)I$1L2JRI$P!PrH]:dnP!RN ()I$$TRBI$1I2HRI$HIJI$$$IdIE$BI$2t)I$dI%)$LI$$I$I)I$dI%)$NR<IE$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$'LI$I$$I$I)I$γ,~W,gXYS.FfLd,d+XS0vo 7I*ˤI$I)I$I&Vppe`r礥&Nu Oauj\''N=n=~GWG&m@14NhCjL$ٿ43(Ӕ̽{)U`q>.#߷?;M<}&} ׿?d+c}PߞOH0%ڟ6)(n!0ɒ0Ǹ9ѫo1Ch(r] q3Nt;(A=&<3xu]S M)$O 'Ref=uth6F}:;om-p%瀚Bzx綑{ZSwab{๼s>D|ջ vIFjʝaXӜ_Zچ ί12[Jps°Y_x5 ZWP};Smic+v3ڃVR%A表5(ՉChEDҔҊR7U(O @aޫ;*Rfe_k=vկ PZ,)>3v#`~ay5b}/o5Nu?"S j w &G'_NA$5HcD:4N4 ZvH>>*%&$q:)d<P1J? hT=4OܙO=ԘH.lk?4jWZ-"!8Pm-C]ȏ9 E1k]{ SM&Lr懏3HfwV1+%5U3wO %D @sT lPa7i`iᤴUͩS_͎Y{I;w|Zy6?ԋ9 8YI'c۽?hLvr%8ig"}2,o8ԑZׇwj ;O^ qL'5c~pF)eR@}${m:?v"V!Yu.]'P~vK0^=C˽A:< $K=.:U%$I$$I'I$I$SD3 $DQsL!?.Y::pf>ۋ^HxMWgE:J IKvCŤZַ֥pU}- |=7|M x+9G3mVz^,kw2zQyJ?ou}Rg*IFzI8"SI$$I$H)I$I$JRI$VE}nXY b "C,@*t;x+-M6O>]FH#^B!\95 qJ6tr7W!Nb+k=j݀jiTW߉^@ANY)Dɷ)*m}ۆ*%BI$I$I$JRI$t"$II$I%߽+5J{pSf,/*Ric_BʯԬC[e*(شLpgSFx%K[-5BI%(RI$_"I*l0*%<&E2cJkMv6*ku&5#ĘGTy/_ЭuVk?g?&#OPqc<}+*WR_\aRt &KVchQn Gg I$z$INI&I$BI$I$I$I%)$Z5[YYҲ0Af zKEnE*m^~cU 3+RI\oO n>j;37Ǣ3 %M=@R1nQ9HʊTzDl?`~`$>jX!:+m@TI.^M?\RnZIT'N[w6RpI^pRn-=Uaò6FKhxk"-o-V`pcKOuOr8TRI$6I$dRI$IJLI$HI$tRI$c⠥W FQDΩTB>Jl>P/Z}+Jϵ]L$ԒI$I$$I$I)I$I$JRI$Z$KxH*Uz{ Uhp FʯӰ,z6uA -@2wk<II9b$S$I$$I'L%)$I$IJI$V0nBbDѵ*M+)Zi~׳CC~; :)b6N~l@(/~" [>j e,?AۃڝqVl:$1ipַ|!0;5j$qs{Y|si~O1I5k~?ׇxtE6ŌTZje u_em.ix@݂LQP-;s4懁f;+~H!?kp9Buno"+o:9yh~lڙ5?h$roV&>Juf ʛzf6<ՖZQRL3*)Wc2ӪpbBѵB$$U\ˈbykUUb0YhmS 5c_vZS65؃#QYkiվ ~;X}JOہӂ5ykBumG*Td^NIJI%))$I2Z$I$J$$IL2tJIJI$(9HRB'P*%H():dELI$SLPBI%H$Ie$$)$L:hIJI$M)I$dIJI$Je$$)$LS'LI&I:dI$I%)$I2tRI$nTjJRI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IIJI$I$BI$I$IhuY?+zγ,~W,WSjud,d+XS0vo 7I*ˤI$I)I$K Ǥ\$'Yd74ԏ.V맷gWڟՇ,SɹvǀD_t@˻?r{up?r1cH7)Rw.n̚LN6:"4cCZuf.CiݴߠN;j*R Ȫ~ T $|P*2m);.%J`2%<^ݶ!RuqYz:|;J/FOf}fƑY6?}.tdNXϤ@ī4t7fc|yyZuc6+hkzH?nY4˲+K5w'~ԫ (̦I$ĭ I%u`?t*HJRN3rɗUsmh{x*eszGѴtG PoU9mChE͑ ZuH%2rjf$ĤAL"p< j&\}D􊷃dA)=`˕ޢ-oT1ɽ~ \xnӚ!qWL,]:d- wVusF= JOB!c|%FTm`ǽ UJ5 #eUZ"5Zt4$,{=J-QS&NRTQI<"cU@YIa*;kQc=B8jEsC69VvAïkwJPRI$PIBHRI$ $IX4<NH6HcTōp-폘15N?pxPhƷ[[#q\Z(8kw&SGowGVJ̟Tۋ[{j 磍_$9˥A樤uq{&=o?%m%iBã`|cqBN G]L67)'%(Xh2tńM)$&swt+Eeú1Xu}Ln̙5"_vmUJ^򮤝$ԙ$I$RI$JI$RI$q-kwBI"RDΧV7pT֍wjM~A^fl?*5 I$I$I$RI$I$I$I)$I:dRI%&E-rYVo ~ANXw:IV@@<+BI?5Ȁ2wj3>Ji-4szmÐ2*-MDK5+ÖcI'I$I$RI$I$I$I%)$I$$IZli- w;h>imogl8|[RmtP[:9jvI:?r"Dпcipؓm-o$zo"&ٵbO\7]ZYbMޅ~;O?$Ynߍgm9g so=;qY<E=ߣ,{ &y6mw,]C܏a"K[Zj\8q7ÏyY_祼VmQk|ic?`'ϠkPl@@҃FZt09Q#;I\PI$[$tH$IIIRU$ccG$(WkG.>M3x#tS; J IJ}#)*эx`rL\-"~J[]ZSm;Ls@KW6Jb8Ivko$%Uu8ohPMljuQMGT ')IHI$I$I:I$I$I$$I'L%)$I_wSw=\kMV&X]Gê ۇ_BȬZ҆斒!2jQ:&ŪC68 uSZKMndII$I$I$$I$I)I$I`Nڂ"!,c`G-Yڻ2d?s¾?g3ÖI${$I$JRI$I$I$ JRI$I$I+>ɚÕkZ{(ń8r ۛL_eQ[oMOuG槺|I=:I$I)dI$$I$I$$I$tL`h5ZtVmR9L:=Qj =Vݩ{wglmu|:¬6Of_hZOQ{pp{vgX:1ѹKLG!36P50yUI548'?1&6g|SVC[DVsE-&@AL;.2'cY&`8*okt$!;MRlN vQ]·4:g',?G7]>@` n26F!;qVZhNP6]v9U˾.3% nOUp \e ƵLUmLnhՐ˾(Q`kE$Z̪t[UȖҡe~KUZÿ9@j(芛MzZY_;YdAZͦU 3b0dH:v8V)TI&I$*RI$dI2dBJRt()IKLbS$I)C!EO ]:dJLB ]$Q*$)ЂI(H!I$e$)I$LS$$I1NIJI$S)I2b$J)$JRI$$IJI$$I)I$I$JRI$MT%)$PI9LI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&N%)$I$I I$I$RI%gXYC:\֧\?_ Nd,d+XS0vo 7I*ˤI't Dɸ?Yz IfKqIԞc ,fq .gܬPIJٴW}0#j_ga}Cv݇lo zNf8K O撤Aa9=w^Ǭo>*Y->:d,Cą *pHqtxOJ'ܫuLlvc+e8T$S .=SӉkl{jƮ 2>=PݾgU~Uu$$ % SFl;]em` I$S'LV$I$I$I$$I$2JRI$v%ӌ̅-r;'ꂲlVVە)„iRs@HHQpNS'%D!M@6:lejm;*o`{l2ik-43|?kc֫Vm:g3ѹ {*mf&pq;p;4) :_zNJƂѫO' yw?moo"Zv4}Q;ݠ$f4ռ"0=sAkQ n<M}9C`wv O QߒdW}=UBO>1l-Gp5qCq ?; E ’;UO:jīrS)VI2tЙ9L$2DV{ݗZ?W*ګe*II9jI$]=U *=U3k|Jf8 Tv條$XLI2P$I2I$I$IRI$'I)$EijӴ;䵲Yx,?ňX~,# >y n3?UeLkA4YEF}{[؋I#Ga#'w3s[kK69a.EuFXx꟡K_`Bl~?_@DѺ8ڕD4}"[ÀQ#R?oљşV cM姱Z{Cn?%SW؇uXZt4xO;Og`X{M$R!I$I$$I$tI$(NJRI$$$LӬlvvyzVېG!^cndu{>#U,[=Jû{G{?%A$Ncn$I$HI$t$I$I$$I$H)I$ X{Y<;]NppxuXv U?{pz-U{5ZI$I$JRI$I$I$I$$I$tTI$I$)$IJ]QTRI ҊSIh=4,"O[gst!_;3_PM]:xx5'=ɷI8U:D\TXdNFmMoI$'I)$Lj!g;Z$N n9}%Ǩe$4s'WP };$ Q:6$4p|3y--q60,&6@} Gqjƻ6gPڴ`Ztf?tA^ 8xq AV^ R<" +iW~+^it0u˵Gx 98Bv8l8CQBd>-տ%Tlkg^WѵE[ 7W갰 ?KI#'y'B>@:0p;9cI:?qvѭ@_tG~OE;΍&qfm@p@ǩ05q_ZVsKO6otoZ@,d2$I1NXIb)2H/h}~@2m?ӡ^5P3}F9SgD[QҩI[I$e{Ycl5 W?M*U{# Gec>=UtAB Zd #:I!I$II$I$$II%)$NEl;};AtBB>jYRAʯԬAvG'َ_+X}ǭ^˚ZϠ!kZz1f4inM|X#'9S?A žTֿ_>);O?v$_v$Gj}Kn&>OԊFlnMV[Kpwͫu.h)݅w꟠Z]f4~O|pۭk Ƴmv;~= Ǝ{*JVqiTaLn|StRI$I$I$I%)$I$IJI$ZuGV}-6ZKK'W6ǕuWͯ}d #Z@֑F !bV$I$)$I$IJI$I$RI$I$I%qc󚳕ޙd<=W:- UWWک$_aor+FHxz$I)I$I$*RI$I$I$I$$II$I$'IJI$NǖЄ$(I%:prȍe:.48+yt )e>7h5 ]+ ZZUl[]K>JK4hAŠgd=}?F꫕ϤQ2.6{:I+CN&I(,xސ\U'I2tPI$$BI:tLVNI#b[XۂDXFԃ_Yo~oUÇj Ybt]kcij}qݺ+*r:I'1$I$IJI$N<$I$I$I$$Ko@&~]LuBzmبDl[&|1dk~tNKJc{ 4;h?4}X4UONI iXgOꬤ*dI$I)I$I'IJI$'I$I$I%)$I$I I$L2IRI$4~pYY<}+HB`А?TDղ'JUz[ٸr<+}ZLj$ObNI$2I)I$t$I$$RI$I$'ZiƟbVug$v{UȏzUz[ٸrB6U>)(i$[Z$I)$I$pU)$S$K_FoOL^!#tS9(N3JW'qLsX+hKxܷ&"xsq@f-+T:Z!ݕ7f ! : LєbtհT3/m=3SKvSU< hg4]Snogad|g5Cƫ 'I$r$IIR'I$NTII$$)$I$I*L2cM.𩽅-7[vH(Ǚpxma;4"  14g\w 2"IG#C8!;( b_' G#ޣx%lm~T7p*I3Dt*j%v*dJI$$JRI$I&AJI:I)dI1 .R*%$.I(&R*%%.d*N:LTM!I$bI$ j%$)$QL%)$Q**j%$)$LS')RI$ɓRI%I2HRI$t)I$dIJI$$I)I$I$JRI$Z #uaPIJI$$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IIJI$I$BI$I$IhuY?+zγ,~W,WSjud,d+XS0vo 7A$UWI$$2)RI$I$I$I$$I$I)I$I$JRI$I$I$IJRI$ a4"I$#51j .$eֈ*EcaL5<%tҘҮt{K<8W^++ZA!EpwɯԬ LI"I'H&%2js S۩ UsRe~7V- }*.;HSj,sk]ޙgHGMZm;N]'Y:7oM`ù:iG]LK@Vz]0#S?v"5; Wt3@dKыr?J!羇Ba 0$hT BKwLj#Lu|o&ǰЈ+5g YUd0{-`uC>8:DaŜE!n<CG -OUΟf4*QR*)lL"%)$V\b2> ˠuRgvw{1АQ/\ /1r!v~Tli0 {<|R{gjwzkeo ?3b:G?V&NVv59L>ɇvā px3?ٳ3H0YaNiiR]OMᶏ}AQ[ōI ֽwXVZس6lGl7 ۫?l紱SW-lwTG%YI:Wf6?KYVVvd~+E2tOXI$I%)$I$IJI$I$RI$&I%)1t- BZg֥G <0&Mj_&Y㲸J8 RI$ԒI$I$$I$HI$I$ RI$o,ppTRIJQ{wI%hzѠ< WybǕ}$铧RI$I$I$I$$I$dI:d$$I$I)I$I&NI$j|r*NImw)Jek*©iV\Ⰺ.Ys<ˊ\'W?:tTg&m )+j1!g`TG#ܓK;p_+*!$hph3‘fSu%wuYM2?z쯃?B(u /[_?%90PĮ@rq<S;?nh Mɫ#K[w`7Vw7[Kuğٯ7w)7ίq%EQbVp'miC~eLATƛ0Fa(hu &$I$$I)I$ӬpxU-5V;wVsx<|)C .Yc+uX,hpc OuSZK* ${u$I:I$$I$t$I$,tI$R$Jպ|Jm5<8vM 66 0QsKIi(B"QlZ$8M2cpTu /M:+$HRI$I$I$I$$IӦJPJ$'Vp- ~}*F",RbhʧQL[HD[ZPWr)mU$"l&B,{ oծu'BSM)ՒN'2I)P2)t% dH$Q4XנyneUM!x'ͭv5v eBTO , vA:yhۜHR Y{5*X `_;]^Y&i!;)^wKiNNAkw 4۵W='r%%)$L:I)I$dI%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$$$I$I!I$I$JRI$:=huY?+zˇQY5:d,d+XS0vo 7A2tFUI$BI"$I$I)I$I$$II:JRI$$I)I$IMI%)$II0ShI*I$5N I$XZf1HФ`rTS$(ZT?Ԩ;Ь+d,*Vm-u H}JʲE; v`hy(ю5W5E<B^kJݾ w UʁG+ܒJ1l u=Xqt/EMΩƹGSHH-{;@R=8?L[Pۛ"21Oy-$x-{['O;!&,OF0\#H1 oh>c -'Aw8߰Zk9?Ԟ5qJlF#Sֲ&GGcߠ|?ʁ2}$(nԈ`0T4lw>j{7#&imK|9Ke?MFp_CsL65"y,B`R NN'L2v8ALI)I- W:sxr\g7LI6=/yܷ,i$҄I$f@tP˯ӵӴ;+Em0/5X̯ugjRT7=\m.:* 'I=cq$&I:dIt)I$I$$I$:H6zvȫ{cK=X`aRЂC1[7G=[NKPVPo*rqqo:ͳpH=ivǿ.GտpMt7O`gNꄚђ_4niB&0ldS V|jO/ni%QϘBo ;u +v#\Ikv1` r, EWZxV=حVٿ?8軕>^7Iy"xB\>oZlvxd -ѕ#?s6ʢIR!I'I$RI$I$I$I%)$I$EJI$ };G6u^#=jhL:J `Gf3}g,;=J4(Q !u0I$6I$I$I$I$$I$I)I$I$I+}:ݖ*#!- Ph6`G\bYV EpG}+QY$I$I$$I$JRI$I$I'I2I!I$tI%)$I$IJI$&Q(O*^x ->Z&e]#=ObvTqǯq8V3,Y)a%oj2]a"rD@ Jߣ_9,!SSeaJB(7\f{8x-*ҋk8Jgh *3g#FթqwQ:{^%Sou~ ޝI$6I$I$I$vTyñMKxH*TRWTl`{KOD~Oi#jl څ #R}JYYX.4k=ZO tL^QN^+ g&cH̭!U𴛍_:m`7 7!r/1/ɅI?3<# oα-ٓvѻj^1fg%WwR`"T[XlnWE%ۚ5n¦dr1"Js{}0Ȥ.!qo:m^|5u4K*-$?#_50" sk/h =& [vRy- ) -3- $H}$vQSn(ڈ-=Nf{&l VUJk IC$:ųk.ӻ~ giYQm0Lz8+%i +9uXӂYbl:vu_X$ %I$I铦I:bI&*%I2J]$M .R)!I$LTJI]$IEI1A N:d2iRI$ɡHAJI$JSQ)!I$LS$$J%1 E1I I$JdIE2dIE2dI2dHRI$$RI$')RI$Ђp!۫CRI$$I%)$I$IJI$% IJI$$2JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$dIJI$N$I:dIJI$I$BI$I$IhuY?+zγ,~W,WSjud,d+XS0vo 7A$UWI$I$ȥI$tLI'L$I0I:I)I$I$JRI$I'I)I$pHRI$[U5'I6@@S *)I0')2IpH&IA:K^ezR ά ѻ սJ{rߚ_Xo*Hc.`.GTJ 9(Sj*a@cɚø@*-%E UzDE弫!Iii+ mQ>,SsFC)g#&Nm -qsړك&<ս F#==QDrSj3&*;L|O5#-;-Ij΋}1H!M'GI>؀a?}?Dx[uhߤo.< ~DW}#%MBPw3ȗp nh#)xwhgUu K4=] Y>'FYn[TDic|)ttLoI$$I$I%)$I$IJI$I$%)$Ih`ZR~K=XӴxd,/j^jTcm5u-?zL&Vs>UYlZ(PdOt +7.8Y1at G,z6W3++>#U\0YϫӴUY8(pdJJby I$HRI$I$I$I$$I$HRI$$IJI$I$%)$+C ugɕqZ ld4rϩkkW@ C~I':I'$L2J]$I$RI$I$I:@N+]:<7T i4D<$gZXͣ[[^j£eۜQ3/OaOWN_>P9vln u Cŧdw($II$I$$I$2JRI$-xBN Cr"JE g_= ad^'QrMcuLۣ!coM{F;yẈnHpݑa4TVNw>EmN8M[=9lR;.׿Ӑ;J $9'tAL3HШaөDHP73|O4QH +hQJKe"m4>i2 SE;8Q{wdCIZ;qhgrf5Qt9=` i)L> ~2g{wX+s@S˜y$w@t'Gyf>6gI ey-h4}Y)9s~!3A'qmmhRȭ{F&~&YALk)I.0ʦ 6\nhaJǃ ni.=< Ee2cjv8<:SV%AQ-o8> LG)<R0$M./$x%LβC^xsGH$Ln׈;Rp7)mB7Q&I+-3:Iv45IP[hcNu*N5Ƈz]h`J/TcSWS=:=7^8L$X,1 QkI^){VeiU =[$uc:Nn1gwYNP&솰p3FrS" [#f|=&I)y$tE I$$HI$tI)$I$IJI$:JRd$I)tI$%JIJL tC }hCtaƷp_"SO2:'_I9ך<-O-ZI'I$I$RI%~C< DĻѰ;ӱ0ze]$/TAkh#OY]:湩()$AI$RI$I$I$I%)$I$IJI$M IJI$$2JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$dI%)$N$RI$I$I$I%)$I$IJI$I$RI$I$IhuY?+zγ,~W,WSjud,d+XS0vo 7A$UWI$L$I$EJI$I$RI$I$I$I%)$IMFJI%6 8%I$33B+SV)r TB)Y2tʈR%,t”dJ(,~!%[Smic!ec[CigScrB#hTHE *`5$pTC!D"!o ̒%|$a~|VdKp,x䙤#ZV蝆Vy{vw9y&3Rc7VϐH͞}1iQo4BL (M"{$<ǟ57{iM}#|R`2yy) `6Ϗ,VG#ՐЀ;p<};2Nu :07.,slL7O~Oƭ }JGW!4)=kd1NTRR$%r=l_6NU\ .*YOg6,i)=-=SI3\ӤS<8v*)$sHRI]l`Ih?՞5paZT|I'RI$I$I$I$$I$I)I$ILJRb$AN۵m}9,w"n3SP,#0|93e[a2k~p7R.}g#Ԯ ?X_QxΚ^\k!gɢwq5GFX?gzcY؋> `<t/=?=f9{C;,a˔ #QΡsTGMBFEO qa; o1 =9I!MReUPu^l?Nٞ6> {++; ,rI$OXI$I%)$I$IJI$I$RI$jI%)#IhfZrֆT6dc&Mj_ίWU,齶qp$s$I$RI)Li{6D!`$DIDBˬpeWI]Lnx ٫RCl2JsIL~gU xEhG{YPk#UDʃѩAJq+oeoT_K^~f-, MuoԬCKrkRZVZ8+AQ̬R 5UAgaZ33Lok@={,lt暒F=50Dil%牒 i2tvϏ!9qhsϐQl{'EG)[[,SsE;yJ%Iy:sZhwNS2{H5Q=kh бzdǸ@?++9p49Ham-ck)A#Ex[j55=x+3h;um"WHADXñGG-l7VzpnmfD!" ^%C oO/s@:G(QtWo*YwF5dif?mfF<lȲ֐4 Eu7Zm5VD6WbU ouICHcZ"2! ,¯UC+"=Y=ƻ$*^* TYYb*Jm^}je hP?cWXŽe#_ez&P0=N= (`-{JI2u+}$I$IJI$I$dI$IJI$I$RI$$JRdI$IJI$I$RI$qir6TpxMdǭhpx* ]I㲾 :))[YŧNcټV ;$I$$I-*ڱjV0ol6bƛLfu墫gScJu8:b֑F꒭#Ee$II$I$R$I$JRI$I$I$IRI%~ o 6%ލ1iu hú=3XT*֘hSX%~#Vvo;oeB\P2iF+?Io(7 ZUkeE*=ԇ42㨯OZ )BpL5ձ*qoX6hui1A=ke s[[ҫ]Vax0Ämin:nŃs|B׵QNNZ1I1Nd$!(O)<!)O KY+k|v*Y uLd&=X`d| [<96Q9 oovV!JrYGcBEI#B"dI4)bR$b:dI$7 bI&*)$L1LRRI$'LI$d)$LS'I)$LI5BI$&NBdI1Q*J0I&L$J%2dI1LtN%)$LI2HRI$2tRI$ȸN<(PRI$5\(I)I$I$JRI$I$$I$I%I$I$JRI$d$$II$I$I%)$I$IJI$I$RI$I$I$H$I$E%)$LI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$:=huY?+zˇQY5:d,d+XS0vo 7A$UWI$I$RI$I$I$I)$I$$I$NJRI$ DkT@EhE*I$658.RI$@rH)($R)' )IR 2t%V;!$Rw.aapž Ŭ5;b H0HQqZM.M*(=RE #\LTʉE RCL}ywщYl6]uUY->Ml ]'pdβ{V84@7MAz9rka~q5*^Ox)xe|7D<7_hL `Q,9Go5I!A$~@o~??4T_8A[_hUϏV7Ǐ[j?Hq?<9b|ڝzVAO欔pJNAF{$ӦIENTSQ[u ٸpUUv5ۡTc}kkyieTYogj'DhFhIB˛Xc>K?KžhS^){Jn8&rb(5-~Y+/~@-c}>φ3kGGp-Y56-5 W^-V;fOigs)IJI$I$I$I"$I$tI2I$I#HUP`@-6"A Ӳ,o4V 0`vVf5#7_cֽ#;;cy(G54:۩VEIRM -r:7\ z?: &ℒ" -3-ĔVNI@S) (N"4>LUUkiw!^T3ZiLI)kg87R)}Ds6'EbK"i ba@u.e̯dj6"g}.wjZo!|ߤ)4GnB4LO1?Yگ;OQc+ gc KZ{PRI%#dLI$LI$I)I$I'LI'I$RI$YiMT++<)xLfgrUk1*:>m^WAkHI%_V#BI2tPI$I'A+$II$I:I$I+xMNʢvBX<%PuҮ{Ci60Rf&Jյrಓq2@l=* ɥ@iZ'L=II$IJI$`lPB ,QPVSYk8lX`;0h߻ Yik]"Whn RI TI&JRR"OL V)|N{㆝>U>V*9+ߤB -Y鼷em~PѻMx:udQgZ0;$$i$2dI$(I$1NRBI$ɓIJNII!EI$b:b$$2jI&LSJI2b1A I$$J)bI(R!E$)$L&IJI$RN)$LI2JRI$tBI$ZAI%)$FA@VmR$I2II I$$I)I$I$JRI$I$I$I$$I&NJRI$$IJI$I$RI$I$I$I%)$L$)I$t$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$:=huY?+zˇQY5:d,d+XS0vo 7A$UWI$'L$I)JRA I$'I$RI$I%)$O ژ)TI)4"(4""$HPjSB'L 0)O(d)'%)$R e<'L*#jRdhove-@wxhɢɤ_Yaiȱ:5BE:* ʐLB6;9m BU~^ZU O^~۟h.G?8<&}쥻y=-hlރQ-y--`?:O=Xd?:EN:hV ͱV) qƾ)G8"MBFOX<49^~ oBwMsAΞ ub puUJϫ`{5tOkV&H[ +[<%jE2rNXI$$$$J Q2 ꋍgc]v1u壃nį( ieJ"P++-A$6O#D,lX#~feZWWuI 8)'AR"HiY٩MW}W{m'8O*ߦkPWsF> mjH倍Q {9]T20N$&OXI3LӤI$$I$I)I$II$)$LI$$I-V[+\vodŅKE,Jk{A+\+LtrCw;{]ͬ5K. -o8KgmoMZEƏ- lo[ c+p{w+=ؚnT~^4˘^>=)FwYUc[aw ?Mg+`k՟ KD" ^~OmNsX}.Rq$?8 : S;sLikvf;!:kٱG̯;f) sY?P7?4 $nS)T餙p:I) Ff ᰅT{G% Uӫg(ǯ?0=tL?0ro 0QYcJr xh8+#rHC~C ƾߤL"3\T,wҀޟS>T~mls%*J2QjE jN+?Xԫk繹jtF4 Aog,&R0: $I$IRI$2I$$I$tI$$$IQ"Y!at H*]AB}bk=7E]uCŃ*HصHpVRTuiq$II$&IJL$$HY$I$IJI$F1k~(*U?c"BU!XCUW'm }!vA(zAXT{j=I$I$I$JRI$I$I$I$$I'L%)$Zg9=\Íg*O-MI-}S5C-V(Ԭ9 $4$I$JRI$I'IJI$$I)I$I$JRI$o`wnV!Vbr1}&&HQ H==Hrj+#+iഖ~я{\B`  ITKq,aVԳ^ptU#z}Aw.02~CUvVϬ\t;jk~wo++Qm pþ7{fH'+AI$ڪK[mXk⣴gMHkj.lw%58ֹvժ%oOm~"Op6Y)fn?B?qYpxOZ]L݇b iՉ0^wO6(^c?ܲEɨ5(7Htx$HI$I$I'I$)I$t'IJI$I$RI%Uj`6e>8<& 2/KUȞ墫gQ# VO#B)$LtI I$I$II$ )dI:tBI%sG]YE,pp+\ߚny揌Z=F-o-VhZMcw$NcoN:I$I'$HI:=NM"P ^_dS--0t!42=@H& x{C(Ah51yfLBБNJNB`,T\ ,"-mVTǸ hYN ;Ѱ{Q-,k}'A%guONE{{W?2Z982dwABrm\W-dI$1NI$Ɋt!I$e))tI1QStvQI*I$&)R$II)$LI2jI(1I I$$J)I(*IHRI$S'I%)$Q)')RI$ɓI&L$I2d$$JCu T RI$$RI$'I%)$Lt)I$I$JRI$I$I$I$$II$I$I%)$I$IJI$I$RI$'LI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-?rZoŏ垵?TjoVjtNd,d+XS0vo 7A$UWI$I$)I$p&NI$I"$I'L$$ISj`JI%&(4"5$D a@)T:d@ *A)2ta:)IY$锥:p:e)O)EJL%% TR ,:J` 'ogsYHXbB Xn+a|Ω'`lpƇ1@ZO^p @yJ%x6;&}/FA9*6u_ xGep\Yn'O(WGva51=Oi+5ֹܙQN=JA4̱ aH}})ZNLn/V;4 NI8+05i$Gd=ܔ2gOKƉ$\$JRI$dIJI$Z2Yl[=;4$,/@R u&(MA]ÅMLpȆU?{BӬ%\NR+TI$:I)I$I$JRI$I$I$I$$KKF/UgxpUӰGBC$- r㐬Qg$$$I$IJI$I$RI$I$I$I%)$Z4~Yݫ=Zi!UZ[۲dtVI/Z6 ?yVϯ}r9z2tҤINJRI$:dRI$I:JRI$I$I)VQfߕEhc_՞BdՒ64=߰ثH/mI"#B{}$)$I$$I$I)I$I$JRI$I'IJI$+6ݶl<9SRk@ڕNVo[Q{wtL+ {vBW-cnoDL&}誆5X+$:r$I$I)I$I$JRI$I$I$OЖw 4jWSpUjl-Me } Idm-G0 YJw$IHƕ$I H)I$tI%,I$I$$I$I)I$I$%)$Lw`=:G]F3i##0pضv$D=A#(@ckb]73OK:-Sͨ?bO>6R'HyXY}{c?=2X\7|-gX[ ]Ikuu'sY?5mL:%coi̻gu^5V?V}e6epuC-շ~2ҵ~ao]vgզןwşD;>$jVX7?u3֨Z9es>ಮjّ}eJQZKֹ<6}-Zl08wPI$lN$I%)$I$IJI$I$RI$NI$}  ,tduAohBQ-U#mii) qFO)$"$I% 'AJI$ɒN$$$II[:iwMI,pp E] p*=BعyFOk n-=U .o~U4l&q+SgIQyݸWHY$I$IJI$$Jb"R[dL!. 0yō-<T9N_VA(:'O#O+gmFDP*j$"5,{6X 7yj# Hy1ʫԨ#䥎V5WW@PNԡI$B$RQPJTS$.DǼ姐]Eڄ%kƚ?'y4 8pSaz 2SC9K*%2%Zy H(W`+8ƾ@UIk{ʬ:G{_dpW d)I&I$P]$WK+?f@<s+p $G}Y=+Y`WfuUY=۪-`$I$I$I)I$I$JRI$I$I$I$$Kcgٙk?JY}~qYI#fˤuWŭ@\?FóԨyhܒ2u+` I$I%)$I:dR'I$I%)$I$I I$I$RI$I$I$I%)$Znc{gҬUK-)А=@.{AVkX9[CI$ؙI$PI$I$$I$I)I$IH IJLRS7xsW;mh>ьZyjd"LmfN~]}9fL=I$L$I2tSOܒ$cy!A:Οk0(©i^1"e]Ս;F0 M]#F4VzDn[H \0'鸔:$8]JmƅS~]k NM<$˨H&~>v:iުб]O,PVm7R,oisA_\pҏ-NT|[-  ;-ͻDBcߓKkXc?Q3A`'?Z}&U?3 ng#YTn5{oN ,ջbU{C'ӿ뉨vlPf>_[\bFh{?ԦZ5go?]uk ZBH~X!GyXڕi gſn}n\Gk[QW޳y$J[Snn 1Ȍc\I29oMT37q?I֋'SP9۩|GloB{ۢX)X[O!ELe2j,hp$I%)$I$IJI$I$RI$$JRI$@I$Wi<}& ]+ {vLg_BR~yg滅uw7oj6-޵aII$I)dI$RI$I%)$N0N$iwVn-=1BcE/zeʷUև=4USCpJI$I$A%,I'N:JXN%&<òt,ii&Gpsxv."Sa?gXL(#E"7kikK_4(.l"SFDSZO+>w!-)#<-՚D-V>dl:;j_GK6<ЧIPhuVΫ}d%bA o!5Z5*xa5q^ 7M@$K10|UVE?+ϭ5᧓l}jmYv IiQ d&AdLTDID)dI$"4$$I'II$ɓA I$I$*RI$2t!I$d)$$J%2bI(NRIJI$HM IHRI$RNS$$II$I2d $II$I1V۹UtJR`Dr&NS$I$I'LI$I$$IN$)$I$IJI$$I%I$I$JRI$$RI$I$I$I%)$I2r%)$I$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Zoŏ垴:=j隝d,d+XS0vo 7A$UWI$I$RI$I$I:P:JRI$RI$R@)RIL PN JRI$wN )RI$99L9M$Fi9TIFL T$B(*R )Y4'INS)IK&RL uT%,:J#T~ f`Gފ x"gC1/c8^5;S n LQ%NgqA:bmx:%c@w1(11|SKžE&N`wRQ%<$S&I *d((PL)D JJRb$AI(V?X\>ʘamwv!F4yQINWI*]ߤB^}R>@UQ4FlV\IVP[$T'LQZI2I$'L vWˇq |WWݩҋ,5=ˆ,+ߡktmԒI$I%)$I$AJI$I$RI$I$TI=;Z5,ůQN,b>aG=.=A ,ai,=֊̰z;U\&R0i%I:I$I$I$$I$I)I$I% R'L<)6;QYk6$]%9(N˭!4+ǯ:Sxǚ:JJɽ4B 'FcXF=fP7T8v ܺ3BDI<8iGtVp*ǴtC^97T5댢cY9Ѫ]2iaj1k6#">͐.Y&N`o$I $$I$=S|P&H&IY"Xxo%6E)\'@ٜaUl0bfWB}1ͭ1HWzm:{BWW?iНMB\r]ڟqL\I]molOTRK}wcG郲jԍJڱ2U&Zimۄ%D÷ i~!͂dw׈"UW)e5ơt;0`.ϒ9(<Ŷzp+IQfc;o歱Zd)PI?f2I݋ikx i$I$I$oh=() ELMR]~dw%V^ohm򳐁vAF EeP>坝¾I$I$I$JRI$I$I$I$$I$I)I$_:SMŧRǷxwԫ L_d>xYo;갷*:ôZ$t6I$I$I&NI)I$I$JRI$I$I$?b=\1&3 JYl*-WI$I$I$RI$I$T$I$I2I$I)I$I$JRt$IRI%Eۃ-TAKDI[ )$p%/\/};\꿴a}P$,@[VuC$~(MkvA ˋZ*S:/2'D;T[-<;y RbQZt[S f l;~RIӬi=sVy DJt']$NI$N$I%):dN$I$$I&I:PI$t˶<;iӸrKxMRof")VwTHDw8ԃ}'aQ7coh9+kh,rcrl>V3KMɱA~'uOFklD8~sgWDs4h Rýl?IGgV9mSv6OGbPsתPcZɭ ?o(R=9iU&`??E\Nݾ^ucts?7lS>8m| 8՟{ߦ8O!:uY8~jsKI3[3֤?I'LAW8qe<;ڵ#$R1I$I$$I$$I$I%)$I$IJI$UEW:}[rdeD% ?Y.h*]FhTI"SJu:hI maz"I$$.I$$I2tU$I$IJI$WplK<*jU@B7!T-X+XE\`xm J<&[ōԕa8WSHRI$:`%,:dI$I;Xjo\°k?!;Zx+TXMn-CT[U4% %vN'ďLWkjc+ov1Z#h5p4:yax!%k E<[CJ;K͐5LX9] \<| Ocoa ?#OBe{ KOdF􎀳#Ѻ;?br55^=Â(_BBʫ֮-,,MKYBqY]Z!E"I$I$2t$$I&N):d$2 ]$Lt)I$IAJI$&N$I$%)$QL2JRI$$RI$2r$)$L:PI&L$I2dRI$Axj+/[TʒI2P$$2JRI$$$$I'I%)$LI$$II$I$I%)$I2tRI$$JRI$I$I$:dI$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IhuY?+zγ,~W,WSjud,d+XS0vo 7A$UWI$I$RI$I$I$IJI$L)RI$H)I$) RI%)RPNIRI$9 O))I$0ryBȥI$0t)*A%I$8):FԲP$fH mLa$#6)T$ W!3:h?QZ2m թqt:(K`~*OuGu'FdhU$BImI$IJI$WU]_.-wޛ1b@ԁR,W+k-RͫӹpuU֟UF|t%a9HóԨ?[~*dCVlvDL@tsYϭjڴ[fr$T8&i4αAo^GtV]L ;=8i(\EV1׉uo$ Y[<\&aL{+:k[܊zWDIs 8}%N^(F\a 79'Bޮ681iӂ>)KWX*",V؞cw($rG*Ü7oc,G8Ԣ_ke'A<{G4LVtpg[>)dšd˜i{@vxy' KD%Y<)1e{>@&dW%,B}YIɺl.ys6|Nx lRKgpS 4A}N&9CN$^G>e_X6QQUuyRI$؛$I$JRI$I$I$I$$I$I)I$u_8ſ՜vٴm}1h-Hp.Z*Q}{-2BHuzV۲ #UQH8߄dI$PI$I%)$I$RI$I$I$qiS$&p tkm- TOPsv dtd. u'_Y4ۇ_kI$5I$Ej+W u,׶.*?kUFPa"SchAvM=G5}g% Հv7BoFu*d=UFFsEԫCV}6ƖR~-"X:w3riK[#rv?0fUoPAUyc[N:GTRV njDr;-Lwo&Uimrd$$INI&NI)I$I$JRI$I&IJI$ń8ro UP,[6#g< { Ai[ k,t*9 qS- :4^w4J"CƷV> Ō$#gR cig_jlk]ZSuv?pڠ.b 5sV7Ѓ)&?"{\A#Roi#[QrE$I$tR'LI$2E$2I)I$tN$$I%t'I$$%ݩ#=wo]V9 Z;2;QHT$C0s8sC<4vDԶk EH!:9ڴ5B iVdy RRu 7ͮi?PyT\}3͇$SYcY\Mmп使AgIzGmgK$y<9MJֆGwOб&dimᚴ-;$s |;>ão/᣹om 7,ğQPPPpac>\l;7Z4x0 +0>s|ӭ-Uw;EDZ+?_NkS:d$$I$I)I$I$JRI$A $$JIGd &p{I_hpr+>fU6:hz/'Rx<+QZY(i'NX$H'LHRI$I$I$I$$I'L%)1N]p%Q,qi%[nsx<|$}QG0ܫX5XX{}>SH$9I'I4NI$I$Ŏr$JXcKO:EjO*VL~Jxooyixּ| gfձ8+A .Q"SE۽y dL[6?ȬTbetI%LRRNI)I$dI$$LS'LPI$$)$I2t)I$II I$&)IE$&IJI$&NJRI$N$)$L9LI$:dI$ $I#;m>: 'k8r (ꋜ͗xꫫYc_RH)M2Vt4$JRI$$BI$d$$I'H$I'I%)$LI$$I$I)I$dI%)$I$IJI$L2JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$:=huY?+zˇQY5:d,d+XS0vo 7A$UWI$I$RI$H$I$I$$IL%)$I$$IJyLIRI$@O(I$tRRI%)N %I$0 t)I")5aMrJRI$ (a@iRd")2 *Y4)&V(خ)5dvNQ)푻\ ΅_<4SqgIE8I:I)IE0Asv<- ș8Jnvce-2oh#Z{`{-$ SIJBtJrJY I)TPR X|J5Y Kdvh:p2)&Eka$I$IJI$RcGuomuTcm.=\{PdS)dܦH TUAtg'+CD @I2I$I$I$I$|lP|[D^ d :Jf3\Z*ӮjwBւB`5dxC<\z6s\TrjXH um=/ "h}l2JG뤏kBp%X!浭pkaÄ?[Ց w\}ź^Έέas7bU u{^fN4cFt0a=~~+^4C70DYd'hCKƠJfA{GYKX!0 ԱI\&;Gc9$w-J[Fn3kpK{c< ui9ӸIp >I^@09|çV(h{aER ?3viĩkcG)Y;!'f׫[$$] b};620"{S5q gv6YB[_ˋa&EuiIyBg3dm2 E+95qRAF g{l4"(iiP55"BJK$5&G ;ֶDT)VOQV[a`Ko nsX4)*,~Yh(]PJie6}5MJ<%\$pSv:|$baHf"MnI$f;+W3, mc`!"'2tŹ K](qc!H}h* 43 ̡K}tуCBw#D|L'I&GHUK9Ttc?wylUvCRoQNNCe'$LeSčGl?5;'  #ťI|Ld}>~bߡ[0DželCgR&r50&Ys@g5}&~D6Fe-1 Kb>*vI+:?%Qv֙cc~X JEa6ikHMV˭ӹ}Fo-x#Bm>v:ߴR-9YD]1GMp4(; I: Z)$tL2I$JRI$p8IJI$N:IY$L$I$I%)$IitjwL{MOMuRE?Ejd-+S`xi;&5Yik]?EioB{=ѿl0N&21ri^=F=1=.xC{б˘{nb6?I_&9?r@{ޚƆ9}zv n:iV$qy]2H~6?{\3ĝqi0h}GTj64OX6M{T\.P|:6%Wbhڍ· Ƨog5v}6'd>*QӲGUZ74=e'@Gx~!]:R´q1ne| $I=bI$I$I$NVN$I%)$I$A+'I$qaw1p* |5Y< BPx-CZEUI:Z{(',:7Pku4NHRI$$IJI$NI)I$I$JRb2uw :|S淇aU*ՋZ{ia-»ʎ|u^oi@tq>]U$J%1NI$$ RI$$IlI$ɓAJI$JL$I&NHRI$RN$IIJI$&N%)$I2tRI%Ф$)$QI$RI$'I%)$L:dI_&5V,X6`8~TE4qdş2tRI$$JRI$dBI$'LI$:dI$$$I$I)I$IIJI$I$RI$I$I2I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$:=huY?+zˇQY5:d,d+XS0vo 7I*I$I)I$I$JRI$I$I$2tI$I%)$NI"$I&H"$JII8%)%)$R8क$J@ Je%)$SH0TEJI$%eLIIS֥)Z\~T߶ͧIabװC"%!ʘM*aȭF((} i  e݁@y'6Z?4UQDsPȄTBk4"O 'R(QH9%1!)RKjD#R?EgQ3U]qD*mD&V6L2I(IJI$+vUHV oBi/ĩU߻*qTN9ci$I2tBI$IJN$I$I=n3r5ଥWK{2} 63gsH=n% {grCU󼋉`LH{Iq6-G4#mƆP)g- 4{uZ'M~ITMAD0M%+Ϩ hJƽm.?GAIKX I 7]aZ%Pa2u!FkG: mn&00X?"~|(swRRqas@~Nl 8TR}M[}I.>젶͍Ԙt%$.mZ@h3.ay'K]3:q ٷk`Az qh g]#撖Ұ]ȕ&Hq#@BM,X9J"ܓ}}oOR'BMp sǵ Aý|DtAÔIpiձ(1NL乭T[L(Ƶ $p;2s!Eg>E1Xfh]hM2 t?c^NVو*"]wc݄73bF ߜGe:@n? [n}9-{ \9 {YmP]c{*w?$'dViѦM'?[ZF`DtJ^=dF*mcuOwkS}G%B:`鍂U[.41num=XMev[ԜtEIĻМ19IԭݦU5~\$dfQwUHW1MC5J=`` Mo}GR\; &uqhfzUA(L$t=I$dRI$I$I$I%)$I$IJI$I$RI$I$I$J,PI ѵ!_ԫÂb)96;We6ӬZ*}$I9I$JLyce$hu$c[x5YGwTy,!WK==Ŏu'A{l;d'$Lt)I$I'LI'I2tI$I%)$F÷Ұ^V7mg;t cꉏoPCWYot.nZW-,I=I$I$RI$I$I$I%)$I p:dnךUń8r".MT5n`xg4`Ոǩ6ɐp39rK604x,I2t*I$I$RI$HIJI$I$RI$NI+6Ի]Y姲jlUΣVQ/p[kyZJŌ-=\ woTw^s3Lʋk haD'po|FK?_MJUAù?rgZ,#ID .$E0ƻ]S8j &3?>#n6}y.${we߆)v֙d4\6wKaH5Moҗ|tS#q) |5L~'{'!%##@#Xq$H͈Ni&l;8.gjM$ʑm</ORpCF?c.A5E:5^[mwPԩ՟w TˡͰpt)V';ܠ4GJt\?alTy, vϚRݢ4x(FB]8N9Sb؈fn.i<:8Us #M1o^ʕO-(044^X{[sxFg@xs)o >hoP9:ue;${Ttv~93[JfQ4J m)npG}6'?Pe~o?Ao`h rz/-K:F8:bh',}Be}gxc( GJ zB `t˩;](֚@RI$CI$I$$I'I$I$A$JI$I8I LIqcd$Rg=%w56%{ƺwS{ n-<$h`Ef̂ Pc}Qp̪SL]8"]| 3Nߧ¹kLMn&[Ɩ;G;B{L;"]nΰ.A!0v${Kwɇ5A͆OH!=u%IuUA,JҀ'faob5\4$IP$=C-::Rf:Dw%榙U^q2%.گSIkiғ4XaT7ƹSX!h*Q]R:ٕe/QU@Y1d a vteg]U^Q~M E@S%ܫoͥ"I&2 +' 'BI8Dj~yVbT.')&W1q7R$pm>5qPufS()fnWB:BG~g~PA+}ux"cbl;ԕkyyr$طY 8NIJRI$>.5@6 Jr5:-oGVT9GdzlYgg?rk-*<{͐h Oqi,; {=J :d RI$I$I$IJI$I$RI$I:JRI$$$$II$I$I+6ͯ,<8*zv\, C>Y,Xc`{KOuOiuGtmI$锚)I$ ԘGvx:%Wiט. #u aGc]O9gP+ I(]:͖9II%# I$I$$I$I)I$I$JRI$I$I$=ƳT,R .TXZZc Ou,+ |^GPJ&¦8dB*:]ث$HRII"$$NLINJRI$$IJI$LsQϱ-=&%ݸ(Fo93iy^wQcŃ!UGt.nZI$I$I$I$I$$IN%)$N:I)I$KO;wh2b&9TK3=7@3*+>#Uq׿5A#s#HvTqً/\]$a.Eu5 kQMnTn?稖sD!P|chNX%_I s<"9FI{oh0qw?:Jw1M16␩p;s~c|@;Z+}R72l$I9v.ѿEG`nr0QN7!˻?E?'Dm~c\7Bsh̓_TvpMLq?ENţ`9H8-{ܒ7p|ZDC{Q 8<|FԀV9OF')4%K@} dH!ltj6`nwixu|ju>gZ0V T=U L0J62Kj}!hDج?IZ8mD@N$y5Ԏ9 Y;Gmg{X`<)4YR)e]W[^E >#p!Tsv'He1?(KwwYiE?H ;Ki<BOo%;L|Eޣi0; .AB,iІȥ?"(ƁXx<ڛ|JK(x5չ{w#E@j@wI/ ;DUms53RmM%d/2nU wVk,;OP:M"?J~?K)8Wߏ]6U-pN:PY[=sʿNC.~J $r7 'HIZ')i2V1- vppX!c[K$r> eU{'s||HD} ph|Mъ/B`cTȧI,+?ڤ5&ʑƖ@'n,OpqS`wZ Ag;ϹW! UE9]<(mc<4(TY[YWi:JRI$'4 )I$yLRIgͶGgLJZCc(E)J4J ppӂjQ!Hx$B *`P\BhV;{<5 lWODXkqiP R[iVe2՘j>H?`pÒ-ЖVũl؈TJ$H'؞!1H"2;&?0\ ߢ>PQ! %8*AA|A%$ȡIt]Y2Yd)W>́!XU ZA*ɔ ZI3Hp'LI$$I&NJRI$$$$INJRI$*{mlTX Yv ug{}X(ł@ @H6:aۻik\9DI !5XCfS?V{ªh2IUlɲϤP'r1_@-{ôR6x6^;+!]9̯Jfm tx@QLa9JJ2I\d:IDI$I%)$I2t)I$IG7# fI+ R0}O?FT4)d!SM͟<̝g?./bc}W#⭤I'$I$IJI$I$RI$I$I^q}nr=?SfjZcZ}OuJ#镶#O1,kiQT{peV@琨2ݖ2CR吒u!S*V uRJTMo%A%a6 ! d*n (HtI$I%)$I$RI$NIJI$'I$I$I%)$Ihcc-g=>N<;D <1URϿh*oG#UZ!$|ʍV꣍A{#bg IV{ |,.'^>6+:qܭ-imb^y}+> T&ljֻܼ)dNKhyYY Lz2Ti~N{y$M/!Yf~rm }YԿC潡K?͹",Pc*,j&cK+Bus-7 ]~۫Բ+Xt o1KOdSe9SRDضINJM}{|I$V$I$IJI$I$RL$I)2I$I 'L?h5G RG#T*Ъ${a$I$RI$I$I$I%)$N$RI$o5f6ݯ,<96cKˈvwlhFTI*J߹ m4I VRI$BI$I$TI$I%)$L$RI$I$Ilc] rHNW[Ň+. 46$., ȫҺA;"ȽJ9 P[.Ʀg~~rIZ,NA 'O?Gd[GIq1I\Ѵ n}_:&&# 0% >Cr`tRyys|F?HEkv(=vzc[[un|ueZ~jv ?FIkczM`n!n|}IK`&*Qz{ A8910I`>yS#\ߓC4A `?ɍycvZ18>e?vÃOF{^ |Tå=M`gpg)bF..;GN8kcz^udkZ mdID֨O#BImI$' )I$I$&NI$JY$NI$$INJRI$? $I%YU GgXnmUmv?]NA Q9E?q;hFIچ{G6~psTq#y/P&G=W oRd5:;T6G{Zqm@;O]ӓǍwwg G`0:=Tzr711!3ojy!{ujl,kjo]R觧l'o@ZNplCx{'GclU } ŗW5y5TR=֤ $؁uU˾gir֢UZ{l 7K\XSRI%*M2tAI1I$$I$I$I$I%)$IN OR XZ{[ùPç~Q/G5Dw@ KӬ-Ki:FxUqml\5Q0ѠM|ҏ~(5e.#h)5K'i*O#  << [{zm'iR wܟwʍ6ǍZ>L ^F2?T=VyYE飣?F^?S4>ŎC~+0YhxVS}5CgS-??̒ͩ%}Y9a?1Kh'&( jvi?0Q,v;簩zc)ژl>;RcDAtH? 3ҏBm;BpѱOM߂%H@#PYzԷϊc}V{jߊUnoǂEǹomhkvPD%ٹFa2Vv3O V1ݏ Vx*)KLROSR$IJL"*`qhTΣ,[}7N\p-*"(b_k}>@[B'M%ifVvsu 9jTAҝG\:y"9GQO$M#iLhLemMp;]<] k>ixUg"L%pxfΈ{r[Fm铫"xdՋb ۹!c<ƅmTq P׸DEmpwZC]VS7 AVr6{bI ĒIE2HRt&O $$I') TQHLI$$I)$Lt)I$dI I$&)IJI$Jd1IJI$$1IJI$&RM !I$dIRI$ɓIJI$=n[Z?^7UaVsORHjHlI&NJRI$2tRI$ɓI&L"I(2HRI$2tRI$$JRI$dRI$I$I$IJI$$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-?rZoŏ垵?TjoVjtNd,եd+XS0vo 7I*I$I)I$I$JRI$I$I$I$$I'I$I$I%)$NI$$I$IJI$)RI$SNI$I$$I $I'OI*I$yQ:JRI$5R@iRI$0,^V~-\5S@kQE`>)߂2*RNZ L cP7`+l?M;jb"|՟*­GD6孰FSdJR&ܔ*t;m>j T!ոy)DH!>@44|B|uAHlhKwnW3PR)ʊ+WN'I=n,ppS$iiͶ8v怬JXYo i#YI2tȭ]$I$IJI$I$RI$I$IJƻXuV7觬o7w7͇][NgmP力Y^YV'o k5*+C1k{ԑY .V ;%Z $HI$$铤$I$I)I$I'LTd'L%)2tȔZjxpZ XK,Bc.3ty ZV(#%*D>A%r%"@n'c3fms\\-MqRsdh]?L)uܒQ実0bȄ6h}M3xyH4~s@s)~ ԑjuZe/Y~e@&;8(gJY߀M,=pߙILe%FmlR?yߊb?"[ƿ ggj0i~(N\ 桴ҜZG7*;O9$rO?IU>i :!!`IJPn2*]~DxpqekղGUU lZ $&kO}Qݺ+)$HI$I$JRI$I$I$[w4wQW:mrP&^Ɨ,\[[K~k="UHDPLe 7;!_$DI$I$I$RI$I$I$I%)$I$IJI$Fķҵ0Pa."LMR]^E4d[f> BβYs+Zٻe#i2Cyr˼t?+A/ u%P;kl[EVtnWc¬QN>:= p5 q#ZZYop`a KC.\;C͎-=UΥ\?xSNjBj߽úlUI$V:I$I)I$I$ RII$:J]$&I:dTII$IJI$ЭKk.qogiٮZW8CWQơfQk@'ŲNF]-?C`$ړ646Gǻ>&],o]Բa{9a4;i5k w;^E@]C?m~sMooQkwnȋG{obv`'k|oԳw qcuLwZ kwc=չ'4GWSl'oF1I0j|9UpQZǻ[Sn9aM&DIcOdtdd*=gj,U}j?NNU$I$AJI:I$I)I$I$JRI$I$I$g`rHR RE~ QWzP`ʒG5g![Im-*w3Z)$IjI$H$%)2t$HI$I$JRI$A$RI$\[}+A7Qk OXLhcrk-ӭ͇k8d%9$NatRI$I'IJI$$PI$I$$I$NI&Eƴ`wd$:6,Z~TۻP' Kxp@([S-N7NqhgD%ԲnT3v|II <mmiwyn$֗kI*dc R0%H FЧ껆oqI{q )'a g.܇跗| V=7Nݜ߂q^%H'ĔUiYq#L~{O*.t 9#>7OLTxAC`>|PBA#ĝ >$2GA0򐯸n.2 joA^N\5E~k#C5q/w?L~ˠcC Q|U+[ft;XolÆ4ܿs;{LUÄT6H#/۾=PCDޘN\ȆHJ]2݂2{}C ݮsm\!8~\f> sEնhudC]Vu,qi =='K4Oh,̶mK`[8)I L2tI$(NS$2tI$I%)$I$IJI$I:I%I&I2o58r d(hZx*I-v"ZKa>l?EG["}.P +(L~AuX"ֺk6GlM?Uhr {;Z73ͅ5iQ[}9c~9=SS%GE쒧nv8m>V7&ND]b5a?c_V@PA{~$wESY6p$lq?X0F9T3j*gK -v8?ޣQ%0yL 4?gmI1T6^Aum}:NBiZ}2lT<`j\8w#ծLJ8pVs]->ˆX?lEHTcu$L(Sm/'e$>3VY!QEIқ3IU=ˏȳ6>*^mΰ+=j#s7I1_[oI6D)׽ܔ9%*u\FN ь%Yn=l@+1ɕ*iʸ`^U6{_IlY& Pk<"ѧLh(׈m7?KO1 -hS ̑N^ЉI>A0:AY'QEmC9o@pS >%EWL|:i!E$DS4)@!~CN۝C&Npޘ“wȏ&ۭJ> tIR Rx' 椛NSm#Cw `-&!A#Lk )kG$~(F< 2R~J#%Vy !2=' iv#yNHv>8 N I)%^BD4:h):-ſIRkQh P]mƿ>aAGSڹ-dFQɕ4Z9ie**dI)$I2tRI$ɊtRI$ɓIJI$$SI I$&NS$$I'LI$I$$II$I$I%)$LI$$I$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$:=huY?+zˇQY5:d,եd+XS0vo 7I*I$I)I$I$JRI$I$I$$RI$I$I$I$I$H)I$II)$NI$I(N `JI$I)IJI$@JJRI$$:IRI$N)IJI$4'IJI$uWp-R Rn&+q .%!sQ}pl& "55t E;Od,V;䇑> T+EٲIg %YS{JQx{@v].@}}|ե_#wWgՀTe$NP)BdJ^SN%ovU3xp7i# g+*kNL&)' )I I$V2e"*cԡ?tu)V9vGʭok<S')"7t&NRIKIN%)$I$IJI$KRI%$uI%jhZDhS#!&/haWثoe I$5I$I$I$I%)$Ih39r${e~IԀ ~*;5^q` {I=I$I$$I$I)I$I$%)$I$IJI$I$RI$:*RdWPn'TķҵZ{__>5 2xM,{ltznu$JߚqWaȓYys'\]V5PcN7sFt+SK'LCleIX#&t8Çʸ1Cg-<4O}Z{$2KP% I#..pZ?hwPNe#4I:IIK$$N%)2t' I$I:I$JY$$z]~+9Jƻ6b]Eej,WYohi,?K͏Q{[Bֶ?=Qs<\ͧQa$xIyqx%Ix,gQteMO0G;H4Ź =2~Hu{ls+RYXL ځ[֋sG{?Q6}VJ7մ(_IZ?jfsې[[{E~rXЗ > =25m2?hak??̹LX=ܐkw;T*#dr| ŞboR{,ikgahI:d$I$II$$I$I)I$I$JRI$tva9uzV۲òmm&m/2T+F9j.%a TpXY'IHI$I$RI$I$I$I%)$I$AJI$W:m^Xxr,pp)t *}J\Q{CZ{eUX[XۂB&rGL1mg;{?%$:r$IJRd$RI$I$I$$Iv6O$`,pGe,YqQLTyp#=M^VBE VHkݴ ?RiF'cmRkC0N4hN}sfbk !_%;]Kx?E$AA>eM&pߚJZ@ IOĩMɽ:I%79]䙖[`7F6Jgx ':"j@)|hI Z}CiK>ГN' ?Kh*GtjgaA{H>Cqʙc~%%RkND?p?u5L>Qlo |fJ05|yl> Q EtxFЃ;Z|x}@<<}4T5 5vC%27BS/`huTt'TDK;#8ߤAڳl}/5u4kM ,aQzZ[Õv+![?i5Z j ~X{ƣ t5;f*OùY':I=L$I$I$2tI$I$I$pI+'M)JI$ RII$I+%:,5<8-[O֦՚D\=Q1EBCt}?=[ed:EsܤFCy(=-Mgii [N跥HiG跠P> ={~_uGAh?%ht(Vm|7GWbhՇV?6mOzTš失Ty6n|]/v(H|CǸG{?ExKiWqk\\Z,o=Ξ>l9Zp~cN+6T-ݑU`>p0$A68g|:uF[pjMĺ #wFpw"~Uzʻl'D#}7%~}m%[nVkĩ(+"cd?=ѺY$B ۫"3]*JNFTRI9kT}IN%)$NI$$I$:I)IJd15<;ZZXoW܄Ɏ≏(iV[,+M i ukI8Ap'Rɟ ;3Y'Dw%6wO ~条ޒA{(sfC@ʛ?xwbKSP-`${T\ΟC| .$6䛷Q-aNߚt?UR~(4;g|R-GTR?T ' , Y1 i%G30I*i{ 3TK2IvôO&C4KqP$?rs=V-g> 7~!GAy)ny&=z=L& 0Y[LacOeIi?rId 6?ThoqdX'p+^H $,ƺ8zucѮϠC}g#RXIJɺ#"גx#?)1RGhYX{K]Z^tL48;{x=<}ɌR j<83pSA@L?!$(8R焸C{&"5w9 dGp엊J;I3Fót [C(ĕVHZX`YOw {lf%tVsyLjEkŃsx#D Z lY:y!S+f'CBD/G_c9^.lpЪ1RQ)/LI("$I(2 RI$2t.I&I$BI$')RI$'LI&I$RI$aI1IJI$S')RI$I"RI$'LI$S'H$KZ=nYXㅵч}?5< hfaȯ*'LI$I$$I$dI2I $I'LI&L$)$LS')JRI$$IJI$$2JRI$I$I&I:dI$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$[ucg?rZp57+5:f_d,եd+XS0vo 7I*ˤI$I)I$I$RI$I$I$IJI$I/dRI$$I$PJRI$$:JRI$$RI$I%)$N6JI$I$I$I$$NI$$I)$IH)H$&)[(2~-R|'nk-Km v"&&j$}&Ç"7=ӽ-=(^,<5 Bջ{C)*&k<$:dP铤:dI$NI&I:dIYzw>NP+@zКt=Gl|F*Уn{=3M ),kĴ)O $$:I$JRI$I$d$I)I$IH"&I:KZwY6?s_~B ˈK,__׶Anh(V9?@DeX#%gZ󻙎 P6LT%t2QX^6}U,6 3ѭlq:-k }NpxDwgB<9jGB)$WVvm5AS s[{Ơ]FLLHNd$J]2I'I0I%)$$&I$I$IJRI$:I$JT$eK|pGo 7pgp-gΠvVHIgp5ƨ$}SQ\3ȔL?̢uZwz7i͹BH7`{.И %?A=?{ým?h0gRqi,ճG"=޻Z㡵{~ӱ^ݎ?mLCO?ckC^x3[zrLW鶓ͧ%Wfl(84w='i$X߇f'ku'VCiihc wUzv8:%_>qGZ;+:4wF+8UL%*I$$IJI$I$R&I$I%.I$I$$djQYvVء!a~3GG A2V;+]BnVQŢCtO}{O-VI$ZI$I%)$I$I$I%)$H)BJRI$p\.Ի ZKO!J{pQz[pݥYz4ZwB̫լ.nZI2I$I)I$I$J]$$I$LI$JRI$BMÇd gJ$ >Eh(_X!jٹHE=IN]`|uBtdjjմ`oSy'oB,y"< #( iR'Xo'O'?κ?gr!4Tߒ h>~8F?3tAܟwo{g|Gg @߻sS! UH#"OMKN8$+Tnwc sHYyR dm G$?^%&}Cl)!TI9"O5%3F4Ğ$\Sr_? lhǟj΄ lWeHzuޥpNEif"?5I$I9b$I$RI2I$$SI$I%I)6;@c $DQun0gPkUoNkDuQ;j#Ѳ1Ts0k杵dd}'m XYVs'W1h RwPcs+'TkX@*XLSGl]cpU@I,nO}zMG¢斘dw쌙kX;9}&臌Z1*{Gp1nXѾqh'Vdx).ݻPxPkഞڗ&u~I{(4ݩrM mQc^$:xB^4>v'ZNn TsRU0"{(pFH[ ?S/Z _b> d4HJ@$s.#ѷqʉf^Oɍ| K|~g6BIdڜy6z'.MoHZ6)4gFHIK99nEx8iA){2kGIL^4HGC熓 3\8 iMa<S<98x8kԎkT]sf E1sG"]RrB`{K CiI8j"B\&ص o!Ox'FųPVA-HYaa sVswSO tuQÂf=v!*2A܎> ]B\1ℋ]g)Ulَ?FKyD!yv;mwFðO*g3qL;q$ZϤ~ *{Z%M:Fͭ2ӨL☟Q"8)6NA)H7]S“%${~3HK ;P`*:Zj2k7B֝x߽r m{m-wNj2ߢU| +-+mp|>(iŸ]ʳC; cMqc6,xxo Eȷ7kC(3:(ۀ>JJ%EHL4&R)RI$ɡ:DFRt(:I!tI2E$*RI$2rRI$t)I$I)I$hL JRI$2r%)$I$IJI$L2HRI$~YVnE~gџ23 ^c@'G7B [4;*EOӟRL2(lINJRI$2tRI$ɊbI(IJI$dI2dRI$'LI$:I)I$dI%)$I2tRI$'LI$I$$I$I)I$I$JRI$I$I$I$$KC:\և[ucgO3Sd,եd+XS0vo 7I*I$I)I$tI$I$$)$NI$$II$TI:I$I$I"$I'L$$I'LJRI$:dRI$$IRI$$IJI$I$RI$$IRI$tRI$ID' )I$3 Ƴ֡< VHq!I *oi v:. 0BvҦ eh~͇*V1t%cw]T?{j`۲pB)&2yJLQ &IJN:h6uPƤ4zp8Q<Ntd}䩅E4S˼UyRe -nǖ2tmS;)TT$yM0d钄I$cx⫑ 7!|OW6Zov@ξ)'I9bI$'LI2tI$I$I%)$Ihb~ =[鶆[lŏ&LgZ,6hJH*$l+\4A4V((+8F5KYBVYo$C^}"[#0Vv3W&#uT7;WQ_ʆ*\T!2" ̟$m}}ǂ %)II$J}Dt ʄ;)e8^k/.43WUV2GkaM XBZKg>K'NعcxV\OTonU(W31C?I^? (-S/.>\ Y,'vf_TezV5ݸ(׳Vʣ[|Ӂ1 954&?G{U;Q[ |eiԝ[%Vͩl@QCCE($%=?%\ZcBu[\+[5tR.BzEV/jxMYmI!a aplxK};LT:z[TޤEblZ(*l> grJRII$I)d$RI)P$I$JY:I$I$$I"$O58v+^ ̷OzZDdj<QExD&6aoYJmp;&zEMO\}Uc0Ih w67a'8Gr)R od3ZY[th sx*ZgoB2j=}?*~6&Z'Wbwv΋ε%,- x"ۊV7f569-3[bf5?swgw)|Fc$_dm{GDfviˎ6VCh=}Pv_jLI !r ( @?'^Obg=m y.n!򋶴*[,pH;Bp4 <<۹d}m:RuAs'#H'O;klS5kS]TZA84xV> HZ"?!Re&1խԞG $G BTƩ8%`Ņ44Hw) 7A_@k27Tȅhxwc\ 0Q6lBxUs]RصiԤ+SV潦C ;v5?gM|eUX[Nyж?GoSmP_^H6V,XGĻ֬;Q PJ ]S<,Ef%N$EjH/̩$ RZ8MWg2eQͰG@30mN~XJp$fuLuB?q\J#kcqѭU>U1$oFGrC\YfRrmN Fd;ӫ]ߥchS~Ch@,GVwU ot SFx(Ckjv!u $b$J*qHI$(RI$oR*Bh-?IB $5?ʤ]Yo~6UśoPL蒑caIAKN $JT$NJ]$$:I)I$d$I$p ;.;)$Ā$BvUM %`aZ{&vJU=B߂qIrHӧH d6d>9Eķx=e@:AxVbx:KMW|1Em>dwqn B+#*t rkOԜ ˇ% ;58s֥kD t|S"c{?5)+F8#SrcW>05;ͤ#OQ ݁s|?=$lx;_qC}|dš,+F[HLV$ޔ%1űN]ť9{rzBl|g`Ox>!%2!lqKORs:m)i y7H J @5 6Jq_p4i wYyb2cd}uÇ=L7dx+  %;]!V`!%I%)%.d&)d WI$&N)tI2d(RI$L2 RI$dHRI$$IJI$Q!I2JRI$HIJI$$2JRI$d$$JUy`P6Zydس<9!NSʝv9E/[g4 dDR)^8#Ѝ?DrUfbL? 7]켠ed"<)hYYW;[G 0e9Lٴtl*!$4KY[w(L*Gj}`ZaYU=zG״)?$F-<>֤ LF?"m^К#9{m 8$#vTqM ?4|\:I8AII$jjf٦0)Cr{vh`Kx\KA2F2]}pE/q9VV,>`tj] aD!|a$8zUv0Blk;5 r zzMߑYu<QuE:85&`vah{$| lqoqq9NЫ+Ab9"dW[ VIksb{gPZIU{i&NƑ$I$IK'I$I$tI$IJI$I$R'LI$I$};vk &&*U:^S_ |V@-[ȋ[oWez햲bu^X;(c\|2c]D9u9W {?˯ZojQg,g;J薼k:n UmC[[?MOzM|\ݧMOanl@gMkZMgH ,hUȕ7r&觨X"~^ hrZ[ō?p4SPJvIep]<8WVU$c@.VI'LI$I$JRI$I% )I$I'I%)$& I%.I)MòԘh+F1;2ZYa1\Q*Myiu.UYВDF؝"`dJtBI$&NI$JY$I$j}Dh@'e$,7׏0}yx T,;LWm۴{4QQmh"LEfOuN?3~9XvX y<, 9zm0S8OWvu;kWSJGeM:w0Br͛6- I$<$$SJdI&I:PI&[nL,u{[ƳL2cIDJǹOaQE+B5|=^{H04qQv?hw-gFs\$nj?%8wa Lu:%11?b:m!cX Z4i'xTm)MD6{gK0i?7S'R]?-nKtj=$r>^Z{i-%S {|Ld/<PA/c%S/ S?N#3G$hA#F74]S46dJ:}LR|Ѿޣ|~M ҳ]c%E8ĝ1!c6P=۷Zm kt|k:"!iVpOEfLO$dNZh''NW[}k>A4]&s]tK}[~A#%ȼx섀N-*;VNCwỌb6{$I',RI$2I$JI$I$I$a[<WOH6[>VB±OdUփY˚`lWeMn\[VVk?T--I9bI$JRt$I$$I$^`rTJ6X+nL֗ xau&N]iN/e$T.;il3]V?~[P+'*ẕf|uxVTQR6JqssX X4>Z>4LQUvG t B2LII%&r,ksɏO$> Rmd[Rpˀ5&4섅_}ۇ )hSRtA{OܙԻH,Maoɥ8`)KhC:i3q|)EcDyJe?`>?84}LB4$= SpELlhvm}rQ4oԁ? V; %!_?J.O3YQ这aOs)Gx=ܝĖ'`H}GqpQnq>D Ĵqe/GT $;>$m?;*mfM #%"t'moQÐ`ncHӘR%:Ns6E\ήbߕM>&,]48pTKAIҔ$qidR!ڏ4NHCKVj>&F"Z$asugp#U "=|GAR9I-ksE#3D HJKJ FL$DK*X#h%V|8tHG2["e ˞'m67]\8>!:ih!~'X2[-?Re!~XWL;,`hr1<+w*",85^h#TaI%I$) TMhNH]$L:E4I$d:dI2IIJI$&NJRI$Be%I$:PI&I$RI$i0ӑ%,?EZ}iEWQwb <II$$EJI$&N%)$I1N$IN%)$LS')RI$ɓ!I$ddI$I%)$LI$$I$I)I$II&I$BI$I$I$I%)$I$IJI$I$RI%gXYC:\֧\?_ Nֿd,եֿd+xS1Kvo 7I*I$HRI'I2I)I$I$I$tRI$'HI$I$JRI$I'IJI$$OI$I$JRI$)I I'I4'IJI$I$%I$I$JRI$tRI$I$I% I)aM&)[=1s| IY)btalXxLrǴ;H,(H$ 9.NRr XB;JKP켈wSm9Vxw }:uRLa:1YMuW =Q}fmvFAųd¼Ƌ9%KB[cw5E2b }W,6E~h N |amOVfPYV%g[]I$2I$NH\'QNY(zvx;/};+i(Yu9 I[PZE& 䈙$$)$I2tȩI$I'LI2I$I)tLt!Â>c}6C;z4Ǭx"ni*㖡b8yyWc܅CaYi'R$I$JJRI'LI)I$'$NI$dI:omYҮt=ά1dǽ~yOTgklt0O—;C<ܥ`h$|[q l͡]Br56K64@?[:x5[Ü\|BGK8vB*\~;`P/ 'RmG;q=q5;}Nli6CJ147"n%KidW=Fĝm"B0ˈi;vYN6հAsG +e*i5q*av<mm.hqLw q'DQ.hf-iqS5V4̔Жy 8m>BokݮGVY-$׆wuYNs>+:aly.*MΚ>yVs Ϸ/:+q[-=)q} ~\Ń U͆ nMJZU An;ywh=A,sL=oQ% ‗X\ޠF<ܚIo xxWQBچo.Y(L1ǖ[$@uAh'ͤ.o1$i ^âG maWTv;͟J"{0R{N( _HY"^K-!;\8W}4c[Ê?zUѝTKCle.h,?ojXcgC,+ UQuw7(u:E4Bsl޳?AiYP7k>Kܬ䓤Z褒d'I%.dI$RI$I%):dI$R&NtUi)1<&U*1ZLD*u^ꫭg!avARbըxMi$I',Y$]nD*hu&5k4ʴDWңenq\~f!Ʈ_dYNjKڢyL+%%"̍+Ѿ%`9> 5މK$h7}wj.'NlѰ?hm79ѷ~ߠZE'D(pǗ%agď/j`5kLkl{Bv>' )E/>R@?]N*mC!rJGko_&φ hoЁIɜ|jr^usOB8iw0w'-h]4وWFmBi#MlK4mɷ8~>",x^oVC>Nm>3BfQ!?0]u'Yp_Punp Yia)k[2D;Cfߌ ;Ot]V9 Bǭ2էFKol$I9bTI$I%)$JTBPBA iXpڈnBop $(Ff Iĭ-1 %Xuk.?Ԇ@A&9AI# ^ (ͯ%'ZNH1A $Ɓ.$ 7 nQi󗩿p$ X xpkOF|EMD0' IwŮǨtw'wJcY1ܝB"4ZLߜK>NÇjM<`m6;`A8+&0˻ Nլ4stURNki$LIJ)$$B%\\MR}–|,}{P#fZ+h5H&g$xG vI`ϤT1-}#@s쯤I'1)$I:d%II$RI$I.$I$)IVz}<+Bj2)7aW̃ZJT\;jF"D 'TPI$$I$I%)$I<$JRI$KF5~ETQhBp`&KSL}{]#s&N9W qy.<OYm hh)$I'I$,I&I:I)I$I$JRI$I$I+YGxtlY`Ԫma. 9 6_C0 o5x'5.-x gNAM)Rk25$9Ξl)Zt\7F>7R"Ȁc)R`I$ iJ$sLn$9?CA?)<~4#g[`'5<@)*b uě?QE&DUDj>@$EGܜz~e)ޒViovr>G3&6`$~iӋ=LbLnlR ^iH}ɋ@ԩS$$fq?$ԏ?I?CN9GkߏR.sӖpOJJI6]mc ?OoBgmI!H1E;Y 5,;O!h1d:(>lc"<-<=Â,>+=2 N¦IԈtI$'I%*RLI$4I=Vm J5|;G|Ao]VCWgOp|T]F@Yl~lٿm>]E2A õju?87ɩokM-J,LV@@(8^<\T\xI#˪"T{}R߻R\$m O揋Aw%SݺqOj]c)5hGBE͙;}]XvF&?-̏{B [F4?y?u5 ;}0fiO/#<̔LF֡tR;G*Pn?F 7N A%FHE ՝G!ft JЪc^d o&H5m+J]'uu~:ks VOp9Y ؅S\ )2\MM$,1DiSkm pBl+BW78!QFf*E|[}JQUԞ^Lt:I$$N$Nd$I$I$RI$I)$Hl=J[p:V G♓kyDJ+I/ͭ",o?Tl4=r{,.gc~iXCv,?wAtT< ojzߝ5ߡE@C馹~xo該]+>nKkw:?7@x.c>V1Ӵr4}EzBO79fKLr75A,{4wOS,[< ky#i~j]BZ\2Q]koaC7õ?NzVC]{k,;+,0XͫӴUu 6-qiDoX=ƅ$I)$$I$I$I$II$IJN$I$d閇Nx{]QTlaŧ5R8rn)Bq,,sno!^†M^eMZk[]g?KO$0 `0kR6< $`FH T6 HոuM~ }S\67@%09A2w:y#s@<RGw &m-d&qǚfY.3"㙁 G~&Uq`IVi%eGĬj58PZ]Jh,1GҦMftˡƾݖNIIJI$JRIJHؖVv;ksCV2ա"򣘢 P1=QAOYo~B͢4m-U8אP5>ZGR8~qQ)56qEQ'_ܜ'?CA'T:|Rı*{H~Р'Csͭ#F`rjhqԟD>%jY[;HFyN Aj$c}RiuL>OC!i?%-^Gd=9Q I;G;oiHͿ>⣓_IFyNOf4SeѪG&3F'Yq&ưQx 8lx3ClX"SX[!)";) ]Vߺ2IBJHIZO'SQj+jkeTCʹgYrӫyrHyZ<myamT2~թ pԘ%]:I $I:d)I$I$JRI$I$I$IITI9)?i w;9&"DHuSgdJR-0? ;*onyƪ~5 ya/Sl#JkAn a=C<):'=0GQ^H7?^L̕ sd&8ϔk$}@>?0c<<$.d@?( GJqe˾!s?R Nˏ%%#s,' k"ZaEm{Gĩ8 ߑ~ IT=AT5㍣akc;@Dܗ<(@t%!cl})kq96q:| R~)TSr~'O9~ -v>DR'%NDs}GjcqI>8Hѩ [O),=IR7VZKّ>EG`?$Z9o(<c_QŇT;r9Ht FNd8V,RQ)Q)JKIE$RN$I I$&RL$I'I%)$L:dI$IJI$S$%)$QI:dI$v;S$RB\7+([GM@V:*r@IJ2ʰR[݆Byog@p rkY,4ݤa#c>,?AcÇb*&E_7FZAV%BF0ٶu(b֑F4!;p-=0vl<®I":I$I$tLI%,$I2HI$EųӱBI FkY(sO9 96;WeGy,w\Y$VIƤI2I$$IL%)$I$IJI$I$RL^vCg iV=wֻlpR/5X=NhrZ!̫- 3QR06qO}R>?>v)0$-s}->>iˉCuHm$O*N1y!OD&hG܊py4(4@4IO NZ\ v  AQ=O$>gPAQ/@3A~Nw̦?IQ ;nIJG0v1DXS56$撖ТgB>IEb~)͇HT0'?3@c0x9e3 ntI(qa& 8Z״9x)cmfMc%KGx=2 kaòZI>)؝Wۚ ׹>I,,0^אĕj1-YLxuV$GՒ^Z-p堨F[KDYķըR1LI$I)I$$I%,I$I$$tI$I$I$I$ok]ۂ $E6,Z{ƈ-j>cqfXߏc۲ܢ}%t4*{^dX꟦ϳ0j .i5;E`s\tdZ~؞߈q3m'1tS5sRY>O Rӏ`5l6Xܖ?48]{Nf꟦#a3E(x+ivG'nk cX>|qVnoC9-sf08>܏CXKOdjٳ#wk+Ec=e?jc#I$Xt$I$$I$I%)$I$$dNI&Z#hwxrlƗٓ֏)fղ\.NZ5kXɀ8 .?sܙ#g=-}&, /(y O?$6 Ӻh խLlrF;~%?rgMv{9萬z >D|uMe!Sdh р~TžgD(J<_f/Di~LHQtO?Nu'FRSZx%&CN.mit䍩̃S8#K{&- ~͝^H F( kg.,Hz==GD(d gEJcO )}(*FOӓ@&uD~h'^2y2'Q d%N6T8ǒ*fHp$8T :&,ky kxzcpoqKW,a%AK&m3'֏'}{GuWvMǝR6vq?2Y h? 02)dL"o Lh{ d̬{-Z*F8r1Uݜ(_X!ƻ`cnUvm'V% BR-IHLlhSkO,']%}cPv?i})ۏs!F"tn*}J_3jx-.VtTwϓT  56"g 8 Ya#ۣ] h65۷ 1Ś$Z !?ss4(.q<7N ?)9Qc\5źꄃ@0'I&G##$Sԃ:)_ol~p?k6~On|̧u~  h8Hl\7Fߎ$5x#Y/hP;&7j|4 g@ÕcDI$TYW.o 0tI<)WT䍛Dwqv7\,'<1Sj^~ChI 4X'2v۞t?/M;uE ZeMŧ0=/Ev<kN,h Aj֪cCI<'fRL Z{I/qq],pPLI\cCGe@\h2tLI$)$$I:dI$I$I$I%)$I8L%)$L$RI%{:wSk>bS6>h,5=W`ÂEՖLRI$%)$I$&I$qi^BPWp,jw6]2@ߤnZ{7}QQU$Y](Sg絺wb^\ J ?6 ̱1)u5%A?GD,xb7?cwrB{nΞƙq%&;/J}#*{* Q;qDl>՟["Ϣ!Zm,oM[7ߢ8hUI.3׿98'$ QI2'VȢRI[kV^ Hi!jOxL}PU+9ka8A\ϳZ`5 {v)GiD`Is?I Ak|Zxr]~I "JZw9a⓽2eA>#1JOJdCp䟽0 @LCGv)rh#S-')aDOT4(%/΅\'BsDy2Xti6SM }>Q~*[O|BAKs1?4-i < g ȅ |1X>eLXh Px &=,0U BΫ~P6x(O{xY-V=Âl-~UI $R4I $:eTQ!.B*@ 7oG~UQ宲jr޵)'LQB$dI$$I&I:dI2dRI$Ɋt$)$L:dI2I$I$:dI$I%)$I$IJI$$I)I$I$HRI$I$I$I$$I$I)I$γ,~W,gXYS.FfLֿd,եֿd+xS1Kvo 7I*I$I)I$I$JRI$I$I$I$$IL$I$I)I$I$*RI$I'IJI$I$RI$NI$2tI$I$$I:I$$I$I)I$t'I*I$I$RI$:d%)$R p?=?>)JY\@ojTEcI銙N'  yQhIL$ҞTvxLmPB?;oioB~j)I2+[A:V2=1"fRwYL|oeB[;BI2bQZ ɔКyN!Yp1û®b{V8h.Cz>A'欅[3۶_Be2!D卩N TQN$I4$IK:ILt'I,$XȸVzwkd:/2u-;+vxT@O}[{Q$Obm$I(AK:I$JRI$IIJI$$$Tt$YHq555ʏ 2cYVük,\<ТCOFcS|IK֝75MF1$5CyR"u x<Kҏpi>nC2S@I#oj`ObQ3߷F#d뫏N'ޜ>.qڐǒXߤ@?$Y?In1A! poIK? 楺>GDKWh]S4nL_R+ }эRσv=5nN4y(쩚TCwjZO(4y(9}IH(opo >lo6R})zDEѵ`1Y0"I̸eR_ah ZtrL7O,pcà?'K5ިoc w욽zC99T~AR-Ξ抜cQ0*>T.^V4y) GX-1UQ4W8JZUPbVV,{=W,e8QDBI$I$I.$I$RI$I I'L$I2tIJI2I$I)tI_7mygXquͻ]/V~9 Hqczw0<| llo:֕H![|P[:鸞&pk5cc~5.K#v'Z [yi3}L_S{ݶ4?zLY4]d{ߑmEvˆf<bw۵Zž 8|G' pӼUM6=ZZv;ԩfÕ 9:H[LÊj\ÆՎn*$T&?#~ijI9LZꤒI$I)I$I$JRI$$$$II$I%&?ceHR OI2f 3(w3gp<@Bdཥ{B7RBA8Pku>O$ nh$>7's]͑S1q(?FK Qk? 8s?8RRck@i#D8p@9k[ߢp]K~T4[?t{a7_晸$/q<$&?c-Z6Nr)W57n|tO5s'@$a-ODcOܜ ~n1A-O/y)>Ƿژ5I1pqO#Ys|ԃZӫhNEm2Hde_D(0!HS=ѝqQoGEAL0h9e̙wRIL Hq5E[IEk9)4v8hK ld3L@x|)7ROLgH/TI1~E3ZdaKny+_P7w6>Dml J-n< 68Y= QZ VCOF$IU3S>' ZUrl1ޚ%E`'2ܠ췎];j0Ivqh\gUGQV}O?HJC=.c=K} +@u4EnU.30Hpw J26>kU:>CEJ5 0{kxG>w ODpUvQ NK>ƭ74;^ޟU\s`{>? ^mNvw(ᬶ#O ֜G}aa?#5dԭù :)FӐ?8$F~ >@Bܸ)1l"\<>C!72."|̟Qc~!COQ6D9%N-tC$8}=~'!S=hAX53X᠀ -(FR|V\gx}}mÄ=cB}+EnA(,hO;.{%0C{|zSV3UtLȢmxyVHVSHY2t$$dJI$I$I%)$I$IJI$N$I:I$I+5G .5X_G]Y٭5͹Ve{[ϧk" DJGtM{ nI$+T$V)$mbƖ KNM8JscF0,a%N8Qt=e#BCMhii%Vj{oonU,hpu$b$سpb8I$I$PI$I%)$I$JRI&LIBJ]$I\x*v,.6CQyɜZx+MۜxHϘ`cxtqK#hГPMcĂT˶p> %КKG+h> j+/R C &_im%e#t'O.S=?& WviB47P>R0Z~(v&"IVsgQ:~O̓JvxlnCkp- :JG׳7Q?""iӒॲڑ5-%-kn!v9찳O0rDY6ݧ 䔡vq A:;p`:RkOpOr!RORɏpw&>HGS::'ͮ̓}聻X{'Qd"~䈵 =4}҄};!5ѡ:ynsȇ'ď斒dW7ʨaB8pRTznDS+IB2t:I$I$"˜P FdSFJ-ժJIWmhʊD_*MiEpr_2ZG˺'yױF Pj>ƣ]\Zy hռzsYH<)*xl;mE4)&(%tIE$2Rt$$$Id(AJI$&)$$I&N%)$I$IJI$rbI&) )I$o<U՗c|PS]JaÇs{{oXա>e~/`?4[L2*tI$TI2d2 RI$dJRI$2t)I$d:bI&L2JRI$dRI$'LI$I$$I$I)I$dI%)$I$I I$I$RI$I$I$I%)$Zoŏ垴:=j隝ֿd,եֿd+xS1Kvo 7I*I$I)I$I$JRI$I$I$I$$I'L$I$I)I$I$*RI$t $II$TI$铤$I$I)I$tI$$NI$$I$I)I$I'IJI$I$JI$JRI$YvX)4" sw0v vL0I:d铄ddNJJ^S U28<8twkGs 洖nAA:!HtMN p5;|YZ{+k\gm8p}K]ct!X;gadtiXLcmI8N'Bu*齮* !Qe!HLlB VFg~ SQaپ< :};_Yd+II+WN8LI$$I&NJ]$$I)t$B rt- ngeǭǺ ;7h\VzI6dNIC#tI$II$EK$I$&I$AJI:d1CI#AkdV[䈒ܱ\oB s%FnhԯN-/ m@'xQ<Q7D?v^asc@ 8 L\%ji-˔3WLZōa0\1#mxh GuU&NsMJS8w?{mcEPloM m+hO4[";kT۴jEV^KQɶQZI\]?*M<ݢbK>~'_Z2L}=-Ynݧ/cS8&?w^ҼIcנh'ܤk,[T}V4sR[N1eMD  ZwN^֏?nvTK-y#h%՞$,5?`m#@e`Jo|Bk.]Dܫx7Y#U->:߲M0V/,yIRcl${R,SM[Ls\=F4S/uf@5XÚ%vy(XI+\;rPo[n5 &XV4gV: A$I$2IIK$I%.$I$RNI$:I$I)dI%~яf+2ݶl=&4_zYy!~kMSpYF7'7Y ~a>ѱcx EX삟8G}8p5x5ok^kYA5oc~#oJ6귫=ð!ؤ]I?A+=PV=*7{^[7F#R|p]?oB NKˆ@1Mn_- a4K&pнJ->vsT/UP,E>'[, t(`wmkw!^I2tTI$I%)$I$w vDQ65HfuLWKta2^>I\j܇mW{dnD[ Js~0zY6'4TS(~*Oˊ^@&ᵭԐf}mE9 r;1g 55:K:w̭z_ Ø2@i$N W-_ݡ9 }ӷe#ǹfƩӠ3Q*.hHw;kCƤH#nmHDir"'j[{#kS~czAp?Hѧwԅ{>ĽrA)A0vSv?Miq $k w|Fg?2 .31Mt?oԝ7A)8ο5$2>TCꍡ3 ma&%?;h,\@߿l IKd=D5HɟjQ#ţ`~#Yw$ PG$j$q Q#^Z|X$ۏQs?$?vKq}9F6$G-O(=aIGdA1*}g4 aF`Z#?cq:A?٥X珊mYuN$$ vvVGxđhIL6wvɊ;O/xiTM?T+awTLpQ༏H^&hfziڀӓ2*i-rrܒgh‡gO/>98rcFzaS,ߝ Z8Q?[d|%r^v@04? SHLa\ ScO w8yn#`z#w8)A~E/A~-g2~╅5!m` >iQ9tXB ;y$|Bp[ط'wp>` )!ƍONpxB еkyہ4Yii Z -BΨHx(Ѱ=|mVq,wLkw#RJS%)I$RI$e:D$)B*!:t.)$JtAJQ()mJZ̽{@KpZ5GU~g軅N_͵8)R>\k} =Hpݺ<xǰQXcԝ*Gn>J{wV׎}ӌ:PZ|68)4{~Yc{Q{iњ2k)$e2`RLyI BI&RTS(J?IS*#bY</fǖѡX S'VDhj>Jt?c]䆒t9bD2p2t)tI$I%):dL$IXWNӵ b@u[UTOqp FϫӴUu-a9IChJTVI$RNXI$EKN$I%)$$$ RdJ)%)2tht9EeR,  Kko?U~eeQeUs%_ъP8qqRmTsZH&7DCNȸc6=C^OP߽8r`x 䒐ߤDSO|ommPo/U-.D cF% tܜVls R 0Cw;|$͚y;Ql|IL]C n1EIDTdx4ܠ?2~v'A#}^<?P뵇+BHI)m/s<N EM?rxV NT,gƾ`1xh.s;8Jd6ꁊ +s\@$SޕlHx`.aHhC[` }n{M.R. l~  }9`Ϝ)׆WQLYo ^H<6OJ } o C:NuMHIkwZDUs/oh*mC?7U, }JA4UI$6I$I$$I$JRI$$PI$2I)I$I $$Ivx$(I-^6\GSQ`8_IݴR@ n#K ͸︕4}D- GU\qXg*'h}2&b˛c~?zbƴ1[hx !Qk ݡэJ}-MRPS{黵{u37Xlp LjU"I2\=ʸ@@s+a)<~%qE0,E $D@AޚtW_&NHRI$d$$I+2qaJu<ؠEL% U*TX,6X-G8vࣵr-qnvn?ƥ`ݿFSnDĝ3bHhюQen"R?9KGІʓ$|Rhy2GPCkƢp #p@ܠX2iQA92v]FES )mgw|J]5Mn/O?h7YѴ$gCPٸ̝Ȅ'wETL5|LIޡ% JKHj` >~2|rfz`}CcT}=L4ys(`6k1%,]qIp+*VZxp.dV5Ţ*1 vi"Kĝ;Io:xL-IN`x^LןtrnDѩ$c$?ܝ`D# `} )g'?6aG[zM-hT H.i>dyp G!@n?&Oޞl֟%SXcɱȎ sKNbOmG8|qOQ4vn9Y㫝 S#15浿1htJVэĨ?кZRL:I$$I$I)I$I$JRI$I$I$I$$I$I!IpI#c:"Dl Fd tpࣤ{mo(8!ἬuGsyZteL#&#&Iqlc5$#\K{ƭjmk0;F)5p'̟5^#E3 awIW`:;1V1Fx7NUw8N+~*",w J[twT䊒I$I$I$$E:I'I%)'L%,I$I$N$I%)$I$RI$<"ьNx2q LD&΁I'R9v 5[Kwm$xV;R +V״5(iK ), }=GnL6Q7נ2JϪ1vӲ<[6RmzmbcM, 6ZdH&ӧ?}%7qcxl?ԩo/MȾ1.-?r{Iq]^#[7`?<5L@!Kh0Hѿo;hxpbUث71A:6'=M-a\(Tjwxjh4X _ik;he pZ(~[?Qr2* AYni09o/wۏYK <ߕlオ-WQG ,УavHѿotۥrՍ^X  8LII2IN%.$N$T)$I%)$JdBI)tJdޟlQ*Ju6B&&guJ @h]XXԕs5Z*Q&V "Ǫ4=B8hGXk.!_)&N9jI$$I2tRI$I$I%  QI)DөN#oQh%A{w:|QhiPZ8oS]Z^ J o?7`d2vnd\~}Hh}C~$rg&$PG$C0ߏ*`=n?IX O`OkT3miND3#B~ߤZ[_}rK Z> ~^(o!s o;GF)OH>4ѣ;KO $DYnsG4$ ˏ˃GuQoB0>"܁]S dBLeR2Up=ap8E ?;T,4UzZtPAUk8ZVw8L c83' [==xVx Z}`֒2b9)ցO*Q}mV9c`C_i}NLHǭǺ\uhm&>Je埔[{ f% ȃ II03tL$$I$I)I$I$JRI$I$IjIxDf- HvRI!*rP!Μl "|~ҕ%EIJnFG'hP`Wyti ;AgYcnY}{N]u0}>}DDv5Zi-?rүV]U[j,pOV:@A~M,.Vké)'$uLI8I:dI$I$IKII$$I%.II$RI$I$Ij`ԫaԅ0DRӲ;ۋDE ‗KjxSu*P}D8d$~Z{P3]Ss5!0.n-6A`{߉;^zHh:>^'RU1'T;+?2RP\|?I39LV<]&`#u))Mxvƨ:Nܤ<ߢ$ߓs12HI m4LKϓ7kwOF~GuxJsitx}yQ%16?%,FnH8NϢ 'چƿ?Ը^; R;|yDp;RbJ0ƍ T;@*;ܗ&vJR' )w–;yig&1Wn0ʑ;W7Q~S<>gTH;[^ճF6JDnQ|P d@QIEvB7p\| LE.d '\{@˷1CF<Y_?땨9k>Qkֹ~?EJl=rvK;~->Ǣvn`09(-hp4φ 棽nmDF|?u5nub5Q,pUrkߘc$Z] nnPa/>hԪ#美-bk埚wI7!ol* i;W,{b,cߣz-bY  Xߢ n׍і7]|?9kobvpf͎I2*q 76;%/t`ǨMm?Pm=AɱENnkK/c ?uGڨSXh5շȢe0_\]$!.1zk6k#QZ}:R5S̽`k, fZI:e*ē$<'R)LI$I2I$NI&I$RI$O $$Jō4ʫXOK7u`ŭm//?=48wFVxOZ`:*i$zA$I2I$$I$$I(I$RI$J&JSN)rSJAH&NJ1H)$t$ZSJiU7&uZ4ZۛWPӮ _UTNI4)I$L$ILyLLS$E p;S)I I}SB*X' $]|H T j R܆wȢJbUc}jucZtP{߻ڶ$SIJI$RN RI$9LI&*%H))I$eRBI$ɓIJI$L1IJI$L2JRI$I$I$II2I$I$I$$I$I)I$I$JRI$I$I-?rZoŏ垵?TjoVjtNֿd,եֿd+xS1Kvo 7I*I$I)I$I' $$IN%)$NI $I$H!I$I$JRI$I$JI$I$TI:I$I$IRI$I:JRI$I$TI$2tI$铤$IJRI$I$I$I$$IӨpI).,wIgʟ Oe*o^G[UD8uH( V$j*j$$S" ruSĦR!2vkZvGY*,H%xd<{w4÷= X}Ekt7;cO:Yufw_zzfq ^=W?4ʂۼ=DŗƈǨfwvobK?Y$SR'S1pS'Vp,<8BBzݱ,&&g39ifSX-=NnA1fÄ$ HQ1wNkyia$"$t'L2I$I$I$d)V*RnШ_{iEŅKkQ쯬C9g$INd$I$d&)'I%)$'I$LI$t"YZ `GP6_Y!lֵ OwN &41(zw9ǜ9ÚTh6P{w;O$#bb)Ig3>HHJG1gG3tROTGtTBpC~=RS7j%w ,q&Dx4kr`Iբ?e1H R; Ꜽg&RK7h?*&]Q 6<Խ6G4I٣[?#|uACMXz~cCG5cL9H %dy(a4RU0{WB"dWkugg G69^Cȯլ5Z{w MTeUpt=JI$ՒI$JRI$I$I&I:I)I$dI%)$I$IJI$I$RI$NJRI$0drÅd-dYL2C[(D -5\X)[+7U`0 mu:O?>o\сkAn?۴(4R"{8JHL/Pl%/3Fy\~ vjIb׿ƶ,~'8Oޙ?IKV'=VcĤ1S3}N[4uH; m#:))F lfʉ]&8!P[i? ď 8b9Gއ0\H5cx'*0ɒ "(?%(`)@AGvGĥ~-ƟT7~&-%Rc̕8d4S-1?kbIIo3yN[5IK4~){;)A0?H˾Т%D=qRiA#ڒ cZ|L1ܝ5Dt$G'%d@>~≴Z2|VCiZշ=%RlpڥR=a(Ve8+zcnjI)6I$I$I$H$$I$I)I$I&NI$I$$I$I)I$I$JRI$pKLS$8ANiCWaon4Xjxr+- 08e&k㇌\|cD<-a__*6M梳A%#)$铤&I$$%)$I$I$$I%)$'I$RI$|&oOmU繻kIW9V9`x*3}?nj1gT׆~m^|}6:ۇNq5kc:kL wz?X_x|g=5n:n;i5wW"ھKoE}\G&+?Uv6}?mg$0c,,pVmQJA(Y-.s|VI'JbgsAO R1ILaH&)JTR& )DgͶ-`,slt+DSV_IFr0.䙝 v!u`V' mxx'_k?*N5 Vi BCBq#1:%Mw,\G>{灾HH(IHyQI0O BiLxO $)JZSb~L*($*BEW*s-0~j22t.I&I$R$dLI$jbu?( %HPU1mMnH;I? |ѩ$''_ GҀK30iwGDL@%GBKOӹ~lX85x#BX^QǴ<Hט*c>My'V %7>3:hb<4wF(0zUp;/E\RNSi~,4Dz>!ێ6Uϊ:ܤHjvIw Z pӄI$XI$t)I$I'LI-7VzӬW鼵2:%D.q_+9h]NX,YƷլ9 $OcHI$I$$I$I)I$I$JRI$I)K0В@'e$. ($O]U3+o7__1iʢrJq8];|vuy.C@vUmaS{JĪ#hNpSSneޠܕP=:*B k9a hzv+3>+X5Hq<j=MPrksUhЍNuv:5~n  kARxy Ѥvc*V6v=(#Bi6S;SO!Q t 'b\É;;s(o?)\8a`$=%(H%Г`$JO 5By Wܜ{:R-.>'E{t Q3'Ԕ=CwyG84x Tct{ Hxhwq#ğN;F|{w4k> [\?vP[OLO}Nͭ0_hI6 ;hPh>ӷɣ n)`h40 I5F|ݢU:?'J]yvIHn-k_Fƚulƃ4̔[%P& Ojw9jID$W-y(@k?bA xձ;M%߀Lݧh7'6v |I$e\)!yJD?vL+A14i{݀i,Z|KuHm tƢ(KMGF\'^]|}G MCdw:\cV:HzO- INHx֋k$I)$I$IJI$LtI$IJI$I$RI$I$I$NIJdNI&ZX/kweo`'BB$ ,mZh97ŧes*@شHpK]Ƈ .#y$N$I$I)II$N$'I$I$$:bNҴY.u`-VZw*}塵0CWKSm cm#ZwhLH#l;Q#%dL} ď'iɖMy=V\obMd"X'iL͘_Q57*5rToj#xsta%.}/T 9hm N x+MRNź7𞸷7|qhлѹqf$j VAj2ZZG6*]FC**G/<_h7$w%>5t ;#@~u$<|0e- JHNI&I$RI%I1Q*IJRI$S'LRRI$2r$)$L:dI$IJI$$I)I$I$IJI$$I!I$I$JRI$I$I$I$$I$I)I$γ,~W,gXYS.FfLֿd,եֿd+xS1Kvo 7I*I$I)I$I$JRI$t*RI$I$I$I"$I$$I$I$$I$H)I$t'EJI$N:JRI$I'IJI$I$JI$NI$I$$II$I$I%)$I$I*I$N:JRI$)ALgX1{[" I0N)')JIdYD'II| I$)EֳGLtp#=Bn>.1|(LTqІSN>;۲9?bmI'O*[a?AbMڐ|cDl3(g_0bdy:GCGf׎ZO%9e*LNhNHRpS$"LE`wYL# YGq H%nolK=J{ƨʮ{5U$Ncm$RI7h5*UѫcLOM2tu&&5& p,9O v 8;Bʇ>.?jԟgZl}[% W&O]4@#zFdž(N.%F)]tgϦ;-ܱu G/N րs5ɇ9Do>L)nv9`ID |?I\RWk=068<)W$;GZ?4iTMWhGϲ{B/d7 rtmj wDd$|sY2uo=3BЭC5.~+2kn _Lu5E٣Aㅏc`4w.I!4,NYࢤZE:+2$I!RdI$RCMVlS^𕎴zeP2CPcD,OmƲv-*56;;_hK?5IjL|JM`\ eW_4LJ-?hԚﰁ<*$VN?-A?RyQ.wD?pG- CZ8E̴|}O;q~ *\q8=HOBҶ~P! M}7v%69I Fݺ7k><II@qjE1*"ڸ?LJhoN'>x >)sMƸ?NFh' vv= $x1CϬ5E$%vy7DgkaV'F$C.l&X#;X|?#pO~^(9jIя % Pߔ]cY?;%Τ>?v1I@łD'84/3oSR\jp#q=1%|?5&#ww9<`>%8icR7;x\ xԃ rGkuw-?ܒkOOorcXH:hB[*]\~ XL:N+=?'p$K=Z91 5D&%?pmjQ=| [:斘)CfyR2jvZ+qIlG2I% EI$I)I$I$JRI$I$I$I"$I'I$JIBIIJI2tВtR$&NI%)$ZUA,<n<; ,Qr#p+Pu*N)tJtI=I$u:uH([{)CSenkK.P~qM'` 5jo$@%M5[ qQn SL` {%FIKѓM2zUQ[8hS8 ؛1wb %I9RW#?0:?8@QuLw )rpmߴTk{yyϵWD חU8JRիp忑Jޟ[%]dc-Xij=P}գ@wvY\ѩo"l0d ѣc|G}ĖG`so:m{o q\ݏMm MCbx@὿ڞsuugs|SnlX5lhL K0SRe_micoMGa2$M͉Kxщrpa qOQ 9))v=7%Oi~g1%ƵǓw۔t xRwc45ogP}(:撫M/a,wnm<ttKN%hj:8~2Xݩo;t{\<-xS?8xIV:[uuD=ƲXC?IYH@9`*S}ymFGSO>!=yeTQLO'kmp b}' 8˫z3Y5R|[ vG-5M÷SA;&y,xEP:dO1 hONͽ5;6%h*8˞QH$V2H&O*0%42IJICݦB*YKe޻贪K!\[>k9iXب<ջ{CT)9)-7ĥ#A1I<'Ywu:8\{'ٷl*HI7UAwy5z#vCrP8h? ?Խ1^nѲ4'p(NZ7;ħ1}$I.jLl.Cth(v~Hphѫ}sFHۊ:%j#Z4y4j)_m@ QjDQ-ڟT Z'kyȦp2iq(6uc>moSrvyq?R.i0;)#9I1w4ljPhO7ڝ"!m><=Jk'ieU 5%<hRkcAǀnhѢOQwPk\8Kns{3+^<VX]'SMIjwa7uC!N^Zy UM*~R]ҎEM|[k8pV]Wh8ЍPI$$I$ $ecN<t3Dѵlŕ -k@n =G(Ongc;-8f{nf7W@LeI( [` aYkJ"0Ow.~ԃCGO[N v#СĆ!6I@'(松M&q^ߛ96kW`dC#X]m;O7F9 |]NX>@Z8Edx4m987R*N'7M49))w53cCOR@\6ՠ|J@9E͝ /&0WÃ>9'mOI %>CyI] */{atZ\Ȑ߇J6q[l:4"MJ;G7ā,ѮrJα\<P,Z}6MXC9-*}Bn;U[EVÖa=~?Mu[-[Y$v@Z)Jr0"SJdU7t ,钔L.bT(aTYEm*izLפl)gګ44vUp) z䫉'L{I$$JRI$I$I'LI%d&I$$d$t6ٴUU&;ivBB&&TUop庫j/nG.]^v@WVGQB&銒+Z4GY=ޝ%:I"I%)NJRI$ ʠ{*klvR?hV8 @-{ʠ\d $4@RI$t!I$t$NI'LJY$%)BtI&Z}>Na['l4uY=Năk*9.o$6 ?k=(̀}-<?rhقQ$4llKZNcQ s/U|`HHh$w$bg4/?vj\8ϓG5)yNlX9PFnRsLM ,:8&k,tUEi<=pKNnLx5ML4%. x!5`z;wZ6Lsx&s.3ԞYGшCpsdx)׹UX\iӐHClHcƀ(?u|7Hu0m$CzT@Q,&=GۈK|Q.,n\Z k?׼l863$IL:V<ݿޘX>@f|t La?HVFm;II{@>^䉝E%.lA% <<ӿwy#4:?7HnV53дCkZ45ɱ=uoA,HAI4K*Í%>wngڋn y6Kp</f=,_ô>O$=ZB*E:bdI$I1tIIJI$]]?T ûk[vOLqU)r[;[Tުkf -?gsɊBHr$Q**d($I'LPBI%LRRI$%HI1Q*E2HRI$:dI$I%)$LI$$I$RI%)$LI$$I$I)I$I$JRI$I$I$I$$KC:\և[ucgO3Sֿd,եֿd+xS1Kvo 7I*I$I)I$I$%)$L$RI$I$I$I)$I$EJI$I$RI$I$I:I$I$2tI$I%)$NI$$I' $I$I)I$tI%)$I$IJI$I$JI$NI$NI) ;QU-;=\vGܤ!SI"=ji?YdAzpn Ppe2bYk^9l>ZiH1O)= J1)BdD'Q!&x)Bd-L98pWV&;]ݦ vL|{,$+*_s;JS`?ٺkOYX%IĞL>)._.ɇ1 <o(NorY : ߺ 䛦|:y1;&Sz4OKɼiIy3Rԍ[&nѪ/yyԓ8N7Oo&,I / $3m R'&=荣ʉ玲w]5!úoezԢR1vOޔGt<'v=.|<х<9 1=Y "dWZDQ]$<{=JüLt4 BpM)JYg7[>*=>͖C T'Iy."].gRoclZuOqO _m.;oN>k~i8/jg6?tO7Rχ?mwD4WٚmMypcSn?Eo99a:?0?NT$G2N7GL?ڇ.z mqܢ d4hsQT=xOSr Rִy{ZR\9ppoGq8=fgP tlqiVZCh{u۸pR]٢x‚A΃2˰i}VmynII$Z)6HQu v ֢ eBw-7uW~ƗxK3quTJdOco4m$I&RLt$I$$JRI$tA+JI$dRI$$JPI$3!P" cNtK:NhDwd:ʹpyZ ȐgTcXh2se$I$IJI$UX垴^=|`G-LCQ gZ%f|Y% 'I%)$II$I%)$I$[I!I%*.`t}7JAp,U[xԡ<)KddMAN<1T,'Tcft|5v|̏P0d^KdDs c5L5!G886Ӷ a@Ŷ3X٠۹?:%r~ِ}.{@">)9" ?|(<HOstH911'8?)`7$h0hG_Rih )wQ2;4|u)\| )ww$CZC{@x o%>k*B_q7ߏ*>w2$nws ss8R֏">)z@gR¾<$-]s70',`q$/hj>0 \TI*meM0|H96))A4U#S9(>ݫ}Ʌ@w8+78x$ƶ~c8liJ]†􏞪MJ۴xgss}H>;4'|\c~ I !{R-?EG՝'ɂq]25& QpA,lFk$\2}%^[;AwN6j 7+7&J%ԫ`4+9>4WuAΕt8'I$I$I:H)II$$RI$I%)$I$IJI$N$II$R&NINRUx('I+B XY)-X{CJ&ŵ3cT[zW3ZXQBQqBakx:Ç.=RN`t`cCGe$JI$$:IZI(I<$JY)I2I'I%)$JJ Ō59RDMɲ@TޥY-$,j~;?AR ڛ 6?Cl 6;>/FDŽGM̬}/ai rua wjȯpoQr='u?wOr]`|}&xN+86aB:+4 Q%=yX?b,hάvʋ$A(.kPqCλ}js9]2 k)ug-> D`[Lo<>PsMzvp4v&~H- fG,2<}B=>!&PxJK!!cmj-OmgN20%'CFgI5T5b`.5`'"\՜|ums@cĴjk^7UG\☱PvY~B,,igHwU0^)JUi!`xB _Gh5<*+Cm,v9Vmj|A *Ev]UYv>j5$$J%2tRI$D($J*%ID$IdHRI$S)%)$LI$$II$I$I%)$LI$$I$I!I$I$JRI$I$I$I$$KC:\և[ucgO3Sֿd,եֿd+xS1Kvo 7I*I$I)I$I'IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I:I$I$2I)I$tI%)$NI$$I'L%)$I$IJI$I)I$I$JRI$I%I$I$JRI$:dRI%)Zxjf˶pVP[(A+(9-|82X!&+ 1LBz̄8*H$&!L%%Xj+]9m-5ӻ%?ZAS*i]>1KV'$߈/鉬 =Yau;mT݇sD?M?y Z@|h`竔Kڧ͖|À#|?$B9c:|Y3;{&ʯӰ Ao̠eԨ$-*k[7).xwrZ:<\KJ`bWw`GR.u{4䐃9]Sh3ǂv:)5j3mcO$hJNsY΁E9W3uȧsX_%o&CXwRsSAT#~n)51w'S4jhԍ$} X<Rǝ+G) ]T]qU"6ʉn} :G$Iw?rbIf|})4nLIcOˈhDv]F?r:N%;m+%cCp- G>=SboĸxgwN&NbH`[ꍮ:4ka9 摶dx7Oi;xn$8oM0t#}"\| IWKǗ{~:?L[@`Ԧ?*B4rΟc^ڋf?"R$PۗOo iku 4gTnמ|1gX [ܐ%S.%2 #`{2\~t4+ъ818j$W;D]O5Ă op+.0m\` SA!S-`'i'Kai25? H{'[.;r[ehrZF6Κm<*-1Rۏ z Gv.np򖉱.D<x[UqMI~vqO#j5dqQ.Ԭ1m.h(i woCm.>kB3a0;4I=B@gr(fCѤ7 -Q)DI?S}h)8vQ?G_AՇC|NophI6Gܥ>;ڣL9>OmJ̱wH.#0X7l"d;D nH(d ^m2NQRՄ1 Mf痞6zbKUuLY%@ cNO(rZhD$I'I$2I!dNd)I$JY$I:I &H)$2JRI$I%))I$@ƪT]CmA_1G$:"D,O^ omJIZ{&OctL8wNI$dw?SY)BB.*Tzz6*, __5m!0n!KTYVr[H5H('4QI.+qE^i\GW䨹ἕNr-6(LñaM/ʱЉ'\ҿ6w#cj31+gdP8W=Z+"T]!UJM~I=VSu%@I$NCSI$'I$.$xrշP;,ugTBd&?E-Y[K#6Mۀ1j#DP>I)OyHh;CO$<bqN[^$0jINߙ05? lj~y蘇<R>ǝ^t|hgɡ6|N䔷?}l00k$ȃ}S/$䍿40}x S#w2&Ĥ96a&;& Z;ϸ0yhs/hH >I-sXt}"wyМV;0y߂ DjD{4V5)+FĵCN?/Sky&@Azk9$yhw.= eE4Wi<%=003|̡4h*w+87[g1h;!NOV鴳%h0ݤl|C*#)G蹕)&2q1lv-NlW{, OSQUXJc5|gh HoVc3-;nxD% @'V۔ DGjp(IL&.QҚ(I%2%4Ң)BPY%*2S[8 DQO)+y ZG;qHObE2y´R#惚E'>*Nu+x)ɒ$)QI2IIKR$$IK $I%.RI"IJRRLRH$RIKJA7)P%. uTW(Btc6S4Q%C! طz੷l#u }ZrUL s=]Gm*l$pr }>Mu sHTǭh-:?4قTA[M)\%.5HVN8wΠ4NJ+҆XG!B#vfgT|[c] B"P[P