ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:35:32 k &.(6HH Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?&F[o(&%Cm moU}>Cqփ囗 [CXc uanѦNe\K&!wmSgW/sZ)sCRGC*=ek] moXu\Y5`l\w_2X]cQ%XZݻ WCW в,/^6ȓf<=x<J٧!E0#I8'INLe<& 6yvY^;6Fߢ>+,<8螮~1t[2As\\;mZ,eUc@uػc_kCVH;gPw{v7ḻHJF$Jw xqqnA96͢Yv?_s?@_[±M#3wlζ\nļHs^\ }Kw{?[qK6 !#ڐæj>{]+VXX\6p>nŬΓT~4/kw~w!c<0\A.cÖm[}M5 <ܡ+f"~x@}Z-S'v=7*ذk.6X6K"?x_+oP518F+TVX9|{\CǦ N="zYS>IhvcZٞn,hmѮ"k]ev'۵9%ֹ4Z`WxPG "C2H ~s?/&nOQ6s KAѹ.^bxvCKOoOuXŚ9< w%LBE*I$$)7Oe#/6 U4R}G8qo:oI uNl[U5ڹvX?w;=_:mu[,vsg>D#Cz_ٲjų/l~c `!Nߧf}% k` D 6L$NL~+Ω4mk];=;'7=ߧg9f6{Cjz=ޣOI{Mdq=ըRd> ǧ}vm~z Uh67-{wB摢fe~,s?]9ä<{ەU[a!i7i?OoTK.xtO u9`~LÖz F[@f"}K6Xzeb&_#?G;^Unq-w~cvN8Ѽמ ߢ 5]+l&w4s\˽NIo=K AHDk -l=a =:)侒ֽOqL(W}2>ǻwoݖSYu?GmOFw-?>جrd|VDǻԭ%qCg-qsrYXYS!kS`0jS$ HI|t?R߲e3cn-mI\V;?_|ngLֽy8mrpp7|6i;]WF6T?ܨ2`[n<anb(u;a'6a>Qcf[n5Kݾ->Ǐ!s]OicopBf0CoA}vK:${=uoC5"?*E}-V6[k}EJ]&1Ws)ֿEq~Dk H?GXs\dza?"`7uzݩ]Q՛Dćh9ߜj5{}fmqm۸sY1vvSeuu0A"v~Q}G-uqEw0 k5 f蕲%yߔE>_^t/ifGMUz0mc8'(ehLc8麿j{>Eć vLuQ7=t>I&A>^$rpXw]EVjomt>YY}'MD׫ŮG Z|^8kGB>nSUǂLJ|uՕ!G'Q e?GEID|;%Ᾰbz]QXp+g]Nn@'lWUv݃E<ѷ 0|Z"³Hov3{^=.a,ewC@ |DmTlk纲A>}8k=Kˬ H=onUozc˺ͭk\~[Ok>9gN-qs0m늸-CvA7QS_1HG~oR7AM1X[Z 5kB : r8[/xΑW#@K@uexR{ۓ_W ̹ =As].;o_IR3s[Yk_2S]~}zpNQ&DŐX!D)T(tjR_?<:tƊugfxZܷ讛SeXELw5r]f0C˜ˋsPuZ}tLwJz 5GZ[0$*N"8h<[i,( kXhs;;oZX4-'vDSG3Ro%}fWEfƁQM5?9?bAЏ#VQl5i{t=qZvpoUl4Y SK^jVKѴGҭ]\95P ]AN&5󸵾{0c}N{E oZ^w:agݿIl>Q27Z=͂DL6"hnc Ikv/].4:;톪2tb#/XkIm31{\tY0 ;yM/'sX43_PN֝`)=vio[B}-|. mEZ}rvL(0l<;hq%_QiиR fBIJvI}n&2sLoꪡ9;$)NC$cK:N"E=zuEG2{}/,H{ ;,]ަihe 9k?eۙ;s]B{ {Jvޥ[h-0e;9iꄵ#SB_>_љ^N;Uhc>_hŁ&Qx0> D6 Y|BˉfE 9Grh#)׏uuZvrv]Ndq6?T~ hCK?YcTeq % N,LMuhkϷO^ <~]bYX>[8&{/&ouöP0hu$OT gIhG?Eu'tOjx*KOڞ܊[KA$hkoN{"|[kݱFԘ C{ O)VQ&i >qܙeb \6i(si~ꍌ֖Z<ĵ6IVe亘,0|$"A[; 1Ah#N!Ϫjǖ֧L"Oԇ&.>>KnhMth$%kGٟ#8/ca}$z1Ƹ-4n}%4isgz=T!Ė~KؕUWPzJ 2), ~܊k]O}Xg5eI,.m3wg߱u??{-v1GQ Km#2'N`Cpc=!ja\s.덶3 $5-+{]C5Œdsy?=6-#Z7[c4k"4iObZ F@MJ܏P@`kKZ (5H;cYc4 W;U=ǖ{f.$8 }w$f}O6\E[ك?BxhjmsƗ?ANjW~ˏ~6U]^eƣ.a3Άl1Ovǩ~.NWkq+58 li6:FYF'RAib)Si1ǂ484]2_~Ve3O?!GUꏼkh"Iy?Y^UIε9q[{0@?qCEmFj2>kO\?T~o!gTɌ$@~PpLβ~IeM;kקdOա^å|MnȧG+Qz)inyWA@Wq\"kpj 4bAaOOqUӀ+0j ()pM%uSPRoS&~lwS=-wp故%h&8"7%ct?Rp3r5S">Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMU kworkbase_foto-25 k nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong kslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong kurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM $ Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?&F[o(&%Cm moU}>Cqփ囗 [CXc uanѦNe\K&!wmSgW/sZ)sCRGC*=ek] moXu\Y5`l\w_2X]cQ%XZݻ WCW в,/^6ȓf<=x<J٧!E0#I8'INLe<& 6yvY^;6Fߢ>+,<8螮~1t[2As\\;mZ,eUc@uػc_kCVH;gPw{v7ḻHJF$Jw xqqnA96͢Yv?_s?@_[±M#3wlζ\nļHs^\ }Kw{?[qK6 !#ڐæj>{]+VXX\6p>nŬΓT~4/kw~w!c<0\A.cÖm[}M5 <ܡ+f"~x@}Z-S'v=7*ذk.6X6K"?x_+oP518F+TVX9|{\CǦ N="zYS>IhvcZٞn,hmѮ"k]ev'۵9%ֹ4Z`WxPG "C2H ~s?/&nOQ6s KAѹ.^bxvCKOoOuXŚ9< w%LBE*I$$)7Oe#/6 U4R}G8qo:oI uNl[U5ڹvX?w;=_:mu[,vsg>D#Cz_ٲjų/l~c `!Nߧf}% k` D 6L$NL~+Ω4mk];=;'7=ߧg9f6{Cjz=ޣOI{Mdq=ըRd> ǧ}vm~z Uh67-{wB摢fe~,s?]9ä<{ەU[a!i7i?OoTK.xtO u9`~LÖz F[@f"}K6Xzeb&_#?G;^Unq-w~cvN8Ѽמ ߢ 5]+l&w4s\˽NIo=K AHDk -l=a =:)侒ֽOqL(W}2>ǻwoݖSYu?GmOFw-?>جrd|VDǻԭ%qCg-qsrYXYS!kS`0jS$ HI|t?R߲e3cn-mI\V;?_|ngLֽy8mrpp7|6i;]WF6T?ܨ2`[n<anb(u;a'6a>Qcf[n5Kݾ->Ǐ!s]OicopBf0CoA}vK:${=uoC5"?*E}-V6[k}EJ]&1Ws)ֿEq~Dk H?GXs\dza?"`7uzݩ]Q՛Dćh9ߜj5{}fmqm۸sY1vvSeuu0A"v~Q}G-uqEw0 k5 f蕲%yߔE>_^t/ifGMUz0mc8'(ehLc8麿j{>Eć vLuQ7=t>I&A>^$rpXw]EVjomt>YY}'MD׫ŮG Z|^8kGB>nSUǂLJ|uՕ!G'Q e?GEID|;%Ᾰbz]QXp+g]Nn@'lWUv݃E<ѷ 0|Z"³Hov3{^=.a,ewC@ |DmTlk纲A>}8k=Kˬ H=onUozc˺ͭk\~[Ok>9gN-qs0m늸-CvA7QS_1HG~oR7AM1X[Z 5kB : r8[/xΑW#@K@uexR{ۓ_W ̹ =As].;o_IR3s[Yk_2S]~}zpNQ&DŐX!D)T(tjR_?<:tƊugfxZܷ讛SeXELw5r]f0C˜ˋsPuZ}tLwJz 5GZ[0$*N"8h<[i,( kXhs;;oZX4-'vDSG3Ro%}fWEfƁQM5?9?bAЏ#VQl5i{t=qZvpoUl4Y SK^jVKѴGҭ]\95P ]AN&5󸵾{0c}N{E oZ^w:agݿIl>Q27Z=͂DL6"hnc Ikv/].4:;톪2tb#/XkIm31{\tY0 ;yM/'sX43_PN֝`)=vio[B}-|. mEZ}rvL(0l<;hq%_QiиR fBIJvI}n&2sLoꪡ9;$)NC$cK:N"E=zuEG2{}/,H{ ;,]ަihe 9k?eۙ;s]B{ {Jvޥ[h-0e;9iꄵ#SB_>_љ^N;Uhc>_hŁ&Qx0> D6 Y|BˉfE 9Grh#)׏uuZvrv]Ndq6?T~ hCK?YcTeq % N,LMuhkϷO^ <~]bYX>[8&{/&ouöP0hu$OT gIhG?Eu'tOjx*KOڞ܊[KA$hkoN{"|[kݱFԘ C{ O)VQ&i >qܙeb \6i(si~ꍌ֖Z<ĵ6IVe亘,0|$"A[; 1Ah#N!Ϫjǖ֧L"Oԇ&.>>KnhMth$%kGٟ#8/ca}$z1Ƹ-4n}%4isgz=T!Ė~KؕUWPzJ 2), ~܊k]O}Xg5eI,.m3wg߱u??{-v1GQ Km#2'N`Cpc=!ja\s.덶3 $5-+{]C5Œdsy?=6-#Z7[c4k"4iObZ F@MJ܏P@`kKZ (5H;cYc4 W;U=ǖ{f.$8 }w$f}O6\E[ك?BxhjmsƗ?ANjW~ˏ~6U]^eƣ.a3Άl1Ovǩ~.NWkq+58 li6:FYF'RAib)Si1ǂ484]2_~Ve3O?!GUꏼkh"Iy?Y^UIε9q[{0@?qCEmFj2>kO\?T~o!gTɌ$@~PpLβ~IeM;kקdOա^å|MnȧG+Qz)inyWA@Wq\"kpj 4bAaOOqUӀ+0j ()pM%uSPRoS&~lwS=-wp故%h&8"7%ct?Rp3r5S8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$tZI$I%jRI$I$I$I$V$I$IZI$I%jRI$I$I$I$V$I$IZI$I%jRI$I'JԤI2I%jRI$IJԤI2IJԤI2IJԤI2IJԤI2IJԤI2IJԤI2IJԤI2IJԤI2IJԤI2IJԤI2IJԤI2IJԤI2IJԤI2IJԤI2IFԤI2I$I$I$$I$I)I$I'I+RI$'I RI$$*RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$7g?+zˏQY5:?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I $I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I'IJI$'L%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I)$LtȩI$I$JRI$tRI$I$I$I)$LI"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$tRI$')I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$:YC<垵?TjoVjtN?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$ RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$tI%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$'I)$Lt)$LI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$$$Jdz-#oI SFR I$ʲuWF6<|N=?O\sYpZf(% .JѲr'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'LI$I $I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I'I2tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I)$I$IJI$I$RI$I$I$I%)$I2tRI$$*RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I'%)$L=XW]J(w 4y|a3 wRIRxTӅk>+Tvn!ĩ店3cx d;ms lϚ!sͭQiL̏ngKUVȆChLĮ}(>e;ykf#S Re+|=!92q&rL)~1A?3WBtI$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I:JRI$$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$I$H)I$dNI&I$RI$I$I$I%)$I$IJI$I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IhuA\և[y=j隝?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$H)I$I$ RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$t$$ILJRI$$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$NRLI+lplmm%$GU'B̼ЬԔcIE5 I$H)I$I$JRI$I$I$RJRI$I$I$I$$I$I)I$I$JRI$I$I&I:HڔI&I:IZI&I:IZI&I:PTI&IH4dIiD K`JI!'WMqkgѳ85squ0rʽ??,'I.79䍠GyX->\[dhIUzi-VhSBbB2bOk%(W]u bY.HW0,i?t\K@~ 'pS\6T4VѰ--nL!ېʠ8!7[`=}WmtJ |ʵDϟ2ɗ 4$0hHT!Cuk5qIQ|JvVc\b#ȭw](N}QbO(N;Ȓ;)K_2e#EN憟a.ƪdֺ`KT+O몶=[;@ML ZÃF.Pml$VyDn8p\ֵ̟M8Ș>o걉FDu̱|$ 8Ɖ!Wc78 {NFW&7HjSPfK=;D{r˃׆\?cxMV\?g*-0i .oܚ'^I{$ɶaTXx$dpB̽c\Wd `F1uXOU0.s~Uc6rYUN˟i5blȁ4KdzhQ-t4tP=L_lA В˵eaߢUy|#6q@@F |}Ӭ V1H-$h9(RN-I2IBФI2IJԤI2IE*I$$$I2IIJI$'I$ I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$H)I$I$*RI$$H)I$I$*RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&NJRI$$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$ZoP~W,orZq57+5:f_?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I TI$I)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I:JRI$:I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$TI$I$$I$I)I$I$JRI$I$I$I$$)I%gߒa?ZVK5/zX ZJwP5 %x,({dA oуFlxܬTK CÀ$Y)аC~C}η;O$ᡣEJuSz ! c4{nr'M5B\ؕZU< c$GQ}aKBr }Dp)>kM*Qj ɮ6牃izXf(z2+݅K憟kXDvˬ5D"gXYBjsjp p[2NVj  |:*D~ÀJ¡d25*I$bI$I$$I$I)I$I$)RI$I$I$I$$RI$IO ^O. R.q[/Sy43ꎛ_H8#U8iqWKxa:Vj`OvI1 dF;n@@GI?tۻN;AgIa\p3ZfY 2cE9UupZ欴*}<\$H=dpOSk7%CqqI)N|p\B1 [z\7ʅt.*0 p:KOrIRy5Rߥ!zBsDo6h q KE"# I$҃aV5T=>Մiub!X`;fLLd@I)$e&"RCv_2vYqT 7h|N0F^yqcq'lC$,lt)٫HUv*b煉?F5ǩ@~E,_/K(I˕jx'=-)tjwdISG{s?>A_+>I*gG!ƿ{'Ȳ1OÇuu bGu gmOnƋNm` 4 _1!Qkq = U1\G-*'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I TI$I)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$$INJRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$%)$NdJI$&I%)$NdRI$I%)$I$IJI$I$RI$O 5 RRLNQ25W.Mc]T!;".EI]%3VqVȘ ?ӗ0ZfS9ἘUL|` {Bˀ~Km=jxT7hn~1_oj˒XC?eS_ EP٬I@X5q !bS;]d0cP0.GZy &ZOɇ/?4Rmr3$ѹ'}Z $`{AYs,p2yP·6uU!ϓ0{R0Kx=igX(BsH&{h?󤙎ktq+~k5tA ƆΟ(GFx U6$bzzJ}TٸAhgEtw:m#Af7ehrV }_DY[x2â z#2׎%PԿ'[^8$%P.ڪhj|&@c;Ⱥ<=N>;+=\x#+V' ƪadJftM#ÂV+[!hHT̀4 QѨ"I,ALaZ5kTj%H47\J|7:T24sDʎ ku!I&GR|zK roGg)JlGs)w@VXǻՊOhV EtQp-X.?F[$vR&Jϫm"ָD"qce:|֝>%A@{MSy=小ЊLv2[A)p:`Kt x5s@ߜOUkpV*{`:M*h6?A$Snyag"ߤD5d1P(cւtGvK({+fZG:|z ;/SݳxM&?d{ wV[I}hK'qE8 Xt$"IpVJ3Z Ph3#-պF+lmU`%ELKw(߷tR[:\9G(i>*G2g'n#͢4'YP6}V I Ļ@8E}nw 8 hЁ(`̧ZҼ$U: Ct ]9ο(Yaq? WN@$vaCԵ.cFK }*Kwu0*,fo)o~W0 8];ԭjߒ,Ѩmqhhq42 8[-xvQUn0M%cփˇoQpn8L'"gUв3g{HknNC!8(BK㑀֊{ `2;AJtC]`7R$$[4G@NT*j'F e.2 l{XhR{GPp(=}AKn s?)ʠcvw;VPdH'iod!>+`bv?u t:~E IB H*Kf5:!_o,hO]2~v5K5fd/!=?$BĀomD4\eht9ֶߢLHR_rp1Yb4& q ]&$#>'QJEFr)cŻFZ Vc\%O}'p[Kot!9ñb^=D0nɨnʻMc`Nknүf,H<~ Yl~KLZ^G} mChhN HlGk׎f|ՏMUW\_U(yF6K$] ]FoSSm-;c{ϟ?S~0>mcKSϊpk92n9ƂGbO/:I"5).aӦNI$I$I$$I$HI$I$T$I$I)I$I$RI$I$I$I$$I$I)I$I$JRI$I$I$tZTI$I%jRI$I$I$Iе)$LtZI$I%jRI$I$I$I$*RI$I$)I$I$T$I$PI&I<$I$dI&I:I)I$dI&I:I)I$dI&I:dTI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$JRI$$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$$INJRI$$BJRI$$$IN%)$I$IJI$I$RI$I$I$$I$I$$II$I$I%)$I$IJI$[y=huA\֧\_ N?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I $I$H)I$I$JRI$I$TI$I$$I$tI2IIJI$$I)I$I$%)$LtRI$'I%)$LI$$I$I)I$I$JRI$IIJI$I$RI$I$I$LI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'IJI2R$b]b L5\@h)-j~?W?XU}O˔^$7uZ\_D.p~%`k WQ_JįV'̒ n n? H[*/OݻR<*v C/[cZ.+@{}'~jL#\Sx-um;&|xׄ+3vi', 7 cz>`ԱĀVTQHawlpp s22~A?% '8pwVFK n,$1lx)g%_]!?og`yYcC7>y w@Y~F;4k\g g׶ĩy^`#b\G}_X@;8*Cs'16y jǸ[U94=^T~/܎^aFIݠS#Qp?](j9%Ĭ~[wV(*|hb;ÅKl{]:/q \\ KhAs:LkwyxD\>߃&NPfLXk{*_jkiQK u}xGmU0 J}6n"dF W H@x\RHyxHd]F*a^e5ZzmۻNhk-$ِI0 ~և8x ёm vtP%{O 0F=y#_O2?4KR ,|26*W2 'UuqGG,7#UW׌hm`7Ic8ӶDɔ#kZA> mk]`m`xw)@XV nIGbHi. sς 4 CZuH(tp;yRllt_*b)ݡyI9@"cM-O WclՆ@3Kl?zwv5zpNmvyJܢr0B`qtH:tLL̎⍋eoǸ@k.͓0l2(7PcǾx&SZV-A!uT5*T%$Xc`iĦڌycGjMoEc_CEvr%1\1>K^@}"͌8F1˥TnՀkx 'XfIBc2].>(w[܎ Rp&..-YGsI'#5UÏ+hhw gk%'dM2G3HxeV4.y6UD@I湺(FDkl!BpE$( 'Ԩspdi74]u߇L89h4 _^2YPook^jhPCoe}!t$\͚2X{]B\ڵcr>Ђ;=W5 fJY}8KZt!```nAasL5TdIcB.K}0R$T=vSn X Oe*c,6l'IC5o#43'qCX˫s:e7^V7Ѻ5%9nþj! ?@2;$=ORI q=nx11@{$֝6q%I؍ kٺH'L@2\5 "&<|uNٍL<_GMx2t[*i 6Տ.c/տ )a}Nϋ}Ro{XQ:%_dDK" ?Hr fZ+u,wt,;%,2ǚ2>H׷&kDn+ԸrJ>K# o$>f<4VʋGS`\$[q>멵EOpq6#( ̿`DX*o"ֻ]dw]0,&xc8{lDI$^{29"21x#P=An[w!mXk>{` ?\Ϣa cZ/zQ*wҁ*i$PI$t!I$I$$LI$$I$$I2tA I$$$RI$'IJI$I$RI$I)I I$$RI$'IJI$$2JRI$I$I'I2tI)I$RI$'I%)$LtRI$$JRI$I$I$I"$I$I)I$I$JRI$I$I$I $I$I)I$I$JRI$I&EJI$I$I$I)$I$IJI$I$RI$I$I$I%)$I$IJI$H RI$$E I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$铤$I$I)I$I$JRI$I$I% $JRI$PI)I$P$JRI$% $I$I$$I$I)I$I$JRI$$I I$I$RI$I$IhuA\և[y=j隝?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I&I$I$JRI$I"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI&I$IK)I%&0'\gE2фj ]$(g&䨤^o{Zj 2ns5^z494+JmrOkpNKOv(c^F]-h;szŇ9LA."vxN΅D0N@ֹ``%Rr;+=8-W0+,R)  gAp-Ms>?$w\թsߣ4*Ve-$&Hb`Xl\ֿUT"\V0 'ef3%?q~Z0=gOn9%V(4r[kُ@d\C"aȈSdCA f89s?"nkyQbcL#<X,A'{ByH xqqV@ AX iϘ8qkc$$hޣUu"uYdfe3>40XP^y2=h{ex׃r>8F>lCյ.16껎$jBhv? 4l?x.nk @;&dJcHDjJg'`9~-\Qj8kKG`G_s6V8͖8|fg8o-.-A׆Ts'D`&0D_1O9lh\H?^hTXHIuno"70^ <.[!hHpo3(H-)Eh'G.#N^\֓cA/8UC^ h'6L@@C4BzeAr1\ԅVkȬʎS FdK{I) HaJGՑnq:}D`t(MZ8QqqIПYFmIi..Ԟ<%5״ä&RΤ8?[Ml AvHm2D,83mfUM|Fw(V\;+yT`tMN=jý=wꝀ8RU } 'F$ 6vUgQUs5{I(&$N6@6S"yQ<5{ƧCχ48়pcԥ@d;)FNXƒ@$q)ۦ'j4Muw)~j(3»Z+hor"{D'S7K`YQ_aytS Dc*Cwh?qGAAXwPkm2drm~-m--C:"fz,l%*-9T0VPL̯$Mg/n6қfLGh5;+XFʽxTIGeKG*/#L;Br_H(o/p,÷|L\`rqi.TFTuzK}7m䜘BU:H 'tGpe{YZ|k1|v*OH;+<{p/TMl#5{#}P\^mQl>x666אm`DUQ._;\bf"@'R:-es1i H= Piut?8~r ձp#,ګp}gy=QvPLi=J,98H?7&ϬF;ڮ7 i_WUECO}?y Ɠ$ZL&bvDeƓ^tClqd|)?GqwVbm7،s~Za}_hAj6#q䏤nwĮlq* VyeArFRLI2I$IL*RI$I$iJI$'I$I$I)$I$IJI$I$RI$I$I$IJI$I$I:dIJI$I$RI$I$I$I)$I$IJI$I$RI$I$I$I$)$L2HI$t'BI$$I$I)$I$IJI$I$RI$I$I$$TI'I2IRI$I"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I&I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$NI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I&I9LI$I$$I$I)I$7g?+zˏQY5:?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$TI$I&I$I$)RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$(IJI2IO]a1|IMo.cr!9o(Gz t'\'h0T- KEUuA&?Wp <9;j>c)GL^% ,i"dʻj١yZd?̝͏;YXm}#Ȓ}UfD@Una;DO#A-w*wVb"CY-]<MpR J6;ޥf:ܖŇ萳QOQ,;VشUR{ 7Ë< /rqq\w Y#i'DR+tgi2|.{z_ֱ5_3mGsTZ 83ŖVMAqqLtO ڴ8H^ֹ5D[dZ_sUJ7;%z6BI pHG>g#ly*0>K'}DO2Օ}þN2CD.UZ-.Z+=+#N<=2pDHo Y-żT֑1V򛾧w ݊: !aAn<W_K.KuN4[3(Fs%!ZutVW]Kqx5`SM0[m~tOGlj06g T3,}l.74>mZ44Qtmq'[mEx*0%bN;GޮaFL0<z*V:mkw\%:w>?gqͲnĂ$v.ocN}U퍩t:dK\\LJ˄[A'2`Q>udjOGI'qTۄXBYaߚSS1d\1$NՐ-s}4uڻJhg#!Qkx{y MƇc6kR𑦒lhҝ6-ZpVp7)~[hURYC"K2yk{vڠƵ w exqh#|E5+hcx DkZGVZ +m Rv ]B$NUf NZ̦P!$q '}/L2.$Qkp2@ؤOF<"C[;-G?ƚ˜`Oޠ7gC`nI)yl {{vL@B`;],yڄH9P'D$kc⤢JBuBi*n5 Ճ֍g_ͮOi-{֍?3p}ќ{}<_*IJU{rjs$xUC*V+h_z S#DUHTOwJ38{a>.n/A9L_Ӂq2MKãc_zG{.Pu6Xx@FNú='`Pp}o<9}b[JVwsmpCk)?gc`:YsX6. v)pcHӚ˶щeW8M9Q(i/n~Lq:W7{Bv}>(6T8lݦc H:O`eZI2B7MUtV7[׹GvEOhKdj1?a_"Th%p&Ă|c`0P߉*yрL.ln#(e9 q߫>_Mد"D|')oXܙ-*-qhxБ³=y0IlLƩMP=vYX' <ЪC.kHwr߱لN;(DqC!J_ђtszMw푨sbۊݏps{B&V[1*ATKvˏ @u8s.Sݱ-%ku*%Z4mmmGMRݬskO>I+h-p:8q Gm/sI.{5Y TAѴ؞۩U,-yZ[ܓKckPEcAQ1ȕ:X[0S決9I׼D$pP=m]Z~渚8| Z0m3;(6=V8<.hAE=~zkw#*2_A梔 _6; V1 X:C6Hi`k$Af yl }kt4l-y q"@qDq&Dl4 {ڲ+Lm0aVhfhH>:#cWچS%J 0G!%'R^ap …-k BxoP2*KCo'fIFZ26[#][8w[ :;CkhB*dRI$'I%)$I$IJI$I$JI$I$I$I)$Nd)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I&I:dTI$IJI$I$RI$I$I$I)$I$I*I$$I)I$I$AJI$I$RI$I$I$$$I$HI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$dI I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I:d%I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'IJI$I$RI$2r$)$I$IJI$I$RI%orZoP~W,WSju?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$2I $I$I)I$I$IRI$I$I$I$$I$I)I$I$JRI$PU+MW/uf2)9leEIQ VD% lt:۸:ɇ;ұk%cPÑ?r@h3IFTlsa ?P:OzeX|˸DoR/I< tnd48_I\oA i,q'A.RIJf4Y^֖4w\$ظݮ%>paӝy OMa?+5^y-=xC;'-iaHѻܸJ~߫(_zX?\Ma@}46$KC{hIwY}');blOrN>\La_Ϗ0,]q?HG.?p\POc@'%Yf= _/Nכ5cˊSasl#ɥu8kDx7 \* #܅8+l(38R$PuZ\M_U:$X(w+Z~ ԮIXilv:f8~_[x/pӔˌ6th5".wb15-ieK5/׃ZsWvU 8!wRԄMV#5mMΫHCDo{1p|Un&}qό[M{hilU Dd:y.{Sn{mUMa:4ǦJkD9Gv/i) ՛W72EkLn)a|UQYm j;Q.-[2Ь:64~ ʑ>)߫%z#x..!÷yՍJz{\rpF) YЩMO5stJ,]q ngw]YBQ<yO .PdJEh2>h(IОrl3{H>!Q4C18m2~ypIp:BH셂P<̭=G9D%70Go5{o D~ivP2x]؍ #:*}&#\5dE6ecHc%lx{FEkH]kq@}-oJ?u6~m]{imJӐcT&3pvPNfpd?1.8 NBS­~(C JkahVۙb%O,xu$ʳSMv:j'h]V~A;6wHFޘL4+VPړ'jhxVc]TH!(oT+5N>jCH>@VZ B<~ˬ#kO!ℶp.gX$Qw(0|qxO0jSłG#i wX_U9_d˟u?Y/vufhU|A*W)΍-iK8r N?f;4 ־KvSXah}*y>[X9lq'+C<†,r>+BA}8O^uK'C D-.4p669i7vKHO⸱0B_<'VDJͱ;ĖUijL*wkov=֐+_dșW+5uG1.Uso7ZIhoy 9r͏+,emEHvӠ3B K,JIڑ85.wR_gߠu'>gg?ox7P g\~՘J [0> yL6Ώ_J*.ɘ  -Ѐ<Ή~@!pY&R$>J5HlQm!kixIS V9a@P$]{Qo25i"K@ ލcu%HnK GHh{5L'OFN@ c(X w4mw?kQ g X״@$7Uh+\OJť qD7nR.*$ΪE$)&.'1A#N{$2z0{IJRmМ kl,GZH&4[TQHd 䴑Z˪ʙU!͏U.c͒"C8}\\5G{i:ꫳ CasyW[^!BǮlp#+5\ˇ#rkoQ[_<i}LY5"xDlGɌe/qGu!ϒohѬ%\k _ګhƉҿnm[+ruf뫦4GZ3mdi_{sQ7!^ 2a8idjy佳aZ-mnl(YNG:5ߠq+"Kߔ #.^8ikߡ|Cnꁒ f\^sa&/_[n63s.Q̽zl2|̱Egv.?{.赬Kl!uzʗZ[`i-#.}9Aׅ8r228s);gitV˯;B]8CYikd sSZӭ湟d+ {HG94ׂ'DVA3pdTd$2H }ARӶ;-8YP4I)b~AK3菂u̴)Bsv~ B{mxntxU-$j*ɻ {Cdouq(cZ|ک@iƵ Ɔv@kuVIs@B}%44ъ_kn.]63i0~ˋky8twS74ΟWf3Fv$B܊6kqr@uP1gŀ̺P6Iu۰W;UeX\F0cN?{Kk+#g ~adk`8i9ml9·m {N}"^D 0㬎g!4A<99lp [ :~(V:QI> }!mMc *b[$۶\xR;SVlvd~5t8O$4r,k s1iR#ߤG>J!Ip>;۴Obخ;?QS*L8 !*߼Cp)㘰% cqTōhM'i=剩K%C4L5I:Jtje0 ZXqY yY bcNymaÄt X 4tI%ZI$I*RI$I$JI$NIRTI$$T$I$H)I$I$JRI$IBPI$P$$I$$I$I$$I$HI$I$JRI$I$I$IRI$铦IJI$I$RI$H$RI$I$I2I$I$I$I$I)$Lt)I$I$*RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I&IJI$I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$NI%I$I$JRI$I$I$I$$I$tI2IIJI$'I$I$IJI$$$I$I%)$I$IJI$I$RI$I I&)!I$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I%I$I$JRI$I$I$I$$I$H$&N:63\C9rѦc5zfV1+2> Սvں,PPusᙑ`2}Φyk0@ mOo~7 G3}g kI q9TY|Y 4{h")* ե%BySd8 >HUR!I;]U͈F=.X6y*67 ;)Uˡ}B5~E%ژ׷pՁWgFOL1+YTk XǐdyLߊv[snU|IAb;'qfr,P&V6 aT:y>ǻeY <32O'O$4:&>^*6j|LYb0}'I׿zĂQrj 8"\ @x3li`rHZ0# Wn;uDm'P ַ  wl≈r*Ģ8Ԡ*;T_HAEEf#` 1C2/)%V51ϟek{4pkNƃB8ZIcUst\a-zTonihPmv IXu@˩{x8Oen5(`8.78-cXl]U{>p«ҫL=kQ i#E[L̠#UsIJꈞ6>L>E`'^Vqf(J dU*dϢFJ`ѩC{g@,kFFbbeFuVLs|wePBܫ\VMJ =ԣmAbdX[۲ y '>mĎ 1y+bz|,[f@[v+= @<~1׀t`]I ?&@9i*M |uid2Td̃y"t:S *!b`{Klck 9;qe,[ ~U~ULm28*Ȗ >1zt5r9B4%V XScQ>J9+)6V[_ "|W-1'Y{phh wHXpcloEC1?J7d2Kǒ21Аy?i _W7N>̙ wn{)Q\Ii ?謩NAWYmg@?4'p}gXNgG܈!෴Bc[)2ɮuNcl1lC@#å-lq+Hh)c"'k,6˜̍ 2Ǹ6GSȼR?Y"H1 A*i:GLֆ,X*vFUcyo>jލqh׆杒Fu<IO$@[K2`|Qjo5uȇD@V_\7"&#[rI$ԌLVqzeً'W;׏FuSL0;p Y D {EOG."xIC&#~xFlH?/-d#NJK}yvI1'#@~h%5#ŨlmsF"?664l; ӟӺU!AA$*z/T DĦ,|X0\GELGY܂5˼C}qЙQm!F#S7u2'?^Hp`FRÇŪ_U6WS͌(O#I,MZ۷Lޭoucb#yi4^NݦDiVG'_K6+amco?4L ]?ƫRx$̨X8EG9#v7FW3d2AR屌5;]$8uR.XfZ<58:XQ,e- .t>+-,&33tᔙ08q䜤G̋siM_|՞wyaۑnKSr%/~4:Qp&%RGwKu^ﯼs <2=Oư]5Xu#qʢ:uDv?Zu';G<\CUAs7R(KH pniU[u"F(X]jm~>1gX,hJkwF<"_W HQVư/F0HTs\/Lɳmu:$c囌Mb6uI \Z״q}6$* A U[?I<4 KۜcM 6 ݠdRIq;}[]j?"66=3=f?y k)pD}LٺǴ4DQOIh-'wLX74@I@; &Yf HH =~ov!E˥cjw<"c*;m)FӨ?Vjt?1|zE591?EB(c2?n^wR 5ݯ=S Þ.8\6ѽL]l;\T1jhq$(`P,!iU.s ulʬxPEMKJxqW;5Ef9Š>hes4q%ue ˤ̳&wb;IUsbΒXW[i%VcGue $ I$&NI$I$$I$I)I$v$Н)$I$IJI$I$RI$I$I(M IJI$$HI$I$JRI$I$I$IJRI$tAJI$$HI$A$A I$L$RI2I$I$I"$I$H)I$II%)$I$EJI$I$RI$I$I$I%)$I$IJI$I$RI$J$$ILJRI$2I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$tI$I$$I$IJI$I$RI$NI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$2tIDNS$$I$I)I$I$JRI$:YC<垵?TjoVjtN?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I%I$I$JRI$I$I$I$$I$I%)2tΕpgpAG'Y4E:S}Y~N7M"YЭ_'IBw(XeaX$h /[HS H{G(*-5 U=EZ㰐Ѡ", ]W7xȄI;mؙXcDJQd[D;qvG~ - 8w UՎYWiCdK{_"8Q}DE+lY ~MVs v1Yf2J(&Xӣ=߫>W;V?fa%SFen:b_7&N;KtXUfq8G.\ < UJ AVnHe{}><9VmYcNJḾ-Ucrm;2ӧAblH<׍nԅw)1q(n>hHk`APH{[IJ0~X{=vXKvq`eYS}t'ZW׾ATkhm-Zg(4%ѶO◱Biuo w k,u-8l HшA;~E1tg9Јd+:\Um. nMOi)tC珪_Փ%tm:AIH 8ǰDv71ടa#P J]| $Yx& e_HĴ̎Qiq NhAlbT-|쪝2%G #2gǃ6\@pr,n;ZA˓߅HmxTI)O&Kk7vfUx~(M"LBh>G^«G ge2s/`xeتPC ]nbxpSf=Q"FgpZKw)r$~ʞmp{U{vVqQ+c++&Mߤt qE^u{(7 nqk=0n<<̇i*;kA z-nC♗m+qGKAm.א~jEY۲vY:AXGh^ SymvÕSĴbP}k vnبWK:"{ZU1s<%Ɛ!E,m9\ѣ/YWݾhHT98Q1/lr1~5)Fƨ>^ evzIG1p'w4͝tVY@V/:"{h udH vD4w,j7P I/?LKuVY/:dq-<}b_>f9 +]! + XoZ " +~|[40%].a:+V .pc Oj۬ȸjD/W+hm ۧ>坍sE`k#]?Z4e ҝ ~+/+vÖnI:Jdcmב5Y^OGG|`SeyGM|0שn/rr>D4} 5~1cO`aV3w9H*wߠ B!Xfs:|u\~ǚA-1{nL쭆88+RP6}JA9`p:Ql)eF?U;1sELj]]BÁ f#K}xe$^_ 9De?YfS?-1HhiW*PUq-7RAsO4+7ͿL;02 >ť?4=?'掋G`Κѹכ'g[88eJlpK| ;g_GѺ!UF7sIП8F *9$v⊓ GtJUBŪC.pT9 +s|?0&CyݣͲ/'~IE 8xT\Y[@wWnlO:6lBL4!H5մ>Z'=Al4#Sv1{'#2>ݾ k{Vְm2A[:<+u܀4qv aۥGd8ȀAF-WsInu@"HHQmͯphվùCgf{fD|߽K!!sVqTˁnQZu,0c ݕ- afcJuq#EōuRayZnhg%`~tGr,Q 7N:>jk `6> Xj v{#]ߥo:zs3ק,%$Y:}f~*m`` h3!6 kb`S}MH$rqZ|BQ&ydu qp=hd9< !81tV08k+a~'8CgߧSS ɟ۪cki{4rU\n̗4OuK\13Kޥ{v޲O~)3ng{)n LC^K7) u.4R>jW]iLm䙀')e$MhkɍTiI(4 ?{;VL[:NmU`I쏍GȦϡ }b;蓵 FeFƇ7~AkwX#_'5\H<2t 'U 'WhD35IU̪ ͠p?E Z|yx\UC<GtZ4#klq@9h)7 CGTGt(gPC&iHG%JY4G M%' W3q}H'@ k>KK#)3V/5PMU?D)!y%e;ʹ\-OS!W.\yMfLyc1gptnPh7{;jwɈZnp4( aU[uez{:W} o"S_ũq~u5<.b?%w)0UGÛ"|d]C;)lqqְnǺs@.2<t8LG̉uzsKØ\Fcz"G!Ā`5SƲ݀Zis lZ &e4h]%z79 aGxQCU&XASfsH [4?L=itGP7li#1vk^;9DVCfxRl|4F,vĐSNx{} 7] j۪Bø F Oa"=)d@XGc?xhCȰجQ|4P?%\b8db=0'=7r|v2Ksj{+!XC˜MV,-aA4\Ok'J wP4ZΨYm \rftջXZ jQ #CTsŕ{5] Ϛ./Ӏt!q6\H~ +Yk\.yպH`V2$-|[oU U^]S&Y3|BoRnCI^X叹EN➶EۛeMCpͿoC~]% u 1aȕQ>.MAӢ|c^GVV"ccoaV7(+[]ʂ^HXd<̐<@~YA'@r:dJI$I$I$I%)$I:hO)I$I$JRI$I$I$I$$I$I)I$II&I$RI$I$I$I%)$I"dI$I)$I$AJI$I2tI2I$I$I"$I RI$$EJI$I$RI$I$I$I%)$I$IJI$I$RI$I2HRI$$%JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IRI$I$$I$IJI$I$RI$I:JRI$I$I$2I)I$I$JRI$I$I$t)I$I$JRI$I$I$I$$I$I)I$II%)$Q)!I$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I%I$I$JRI$I$I$I$$I$I)I$I $:KFU^~zni½@:r{mt%t<1?>/,3r9Վy#kt{M롾k swˀ #D{-=+h,:VgPh:'98 ǿ>X|Gsz<,5w{+s|}8"A?5as&=>?#Knd{Vpz^.Ge n 6<:'C ۩;?,p IO&Y$+ԺSf RrG%ټ7s! leZ Ks}>T,OSNj9A8Kxǎ5ף|05=Omjjgc #;HAHQ#n +/m+xIJO$0 B;s>k<'`yݯށ]amoQب=­8Dpci֓̄Bna-- 'S-~< Dm*/i>h;v;;pS\7=©O*;2-0>aO0}~_T=΢3.٬\ODC'qycn-wކ{pr!/;)!jÄ㻜s%WٞR$, mh`kvpJ}6ŊG)).6< ` G&}GZtp2Z%B2#+N`xuW;g<-S`vq0@;pG(m>}JFn V͒=POADȬZu("F=CNd2ӣ_q?qYhxC괗P恻IOe;+m46~qUjd skdy8!%6#E!Dq¦]*Q:| n9#o[v8T^ ln?3VM?J,P\TpiEY{4R|{Ej|%UkCx;gO5+ 'eMk0c1uNJ2VNa |lvi/P㔥 d:!uГ1Tk#TN5κs}VƖv?"R|ll#BôU3;k\LI|MOGnӸW3{7VFE_'I +./Xidӫ>?}C&.Z#ȐYS=]Ix!ַk0|O2U?U > L,X90.}QuPiekF}ec6X5?v@<&)"|7mmJͮd-3;X{BZ:shcc }/L}-r{cw%Άb*nȟOpc`Ђ{}?zg]%OLI+Z\3 >MdB@qYoEJֿkTjhG@ +E.0H.b۝l*=5ۘ{{:bꩲZ AU8 DU0ih<ʹSK{M9V{m-Z4o*+-~鏹jD <u-g_6LίF[9wuQk= hw漏oTCuiR{`s, ?R; [ۼ~)aa: O WUѠ t-#HR]4T2MN kW6k} 9*rIM)AkJf)$Dl=}V".;}\%i8p5?LgpA -4Dm yH\Gk CgUaE هO/@3kZ{!b 1cRn) ~Ӣ .-hk"KZ~zOc#:w0>O{^ &]*~\# Ϊ%ڍ5R*.ZA.>Cݣ\ݯs_k]{`׀ZnGQEjQ60#c@#3VqÜ!ǟ64 MCGDorMaШk\87yC=Cg&GZz Z<#,|Gv J#jn@8zz8ȶIk 8{{w-|dnR)Ov'O"[\ӣ˴p/nEM $"ְtY &S}v> 4%N|dqI͖2'ۦT8^kh> t>t?U!㭀¥?u>8ag7d5@+77xۧf_~u#,>k,$x 8a9_gϖ8!3[\Pҟ6)Xee˨Z `mZө\5 cNWAuR4C3Q\R5(K2K팬~Ӻz-#~mȰKɂh渜GC~ѼV^1d)p✉qoZQu v?H#puhwIyWTix\5v:I$402O!&cYW55C@KfQ@0<&u?uNN6Y iď?(2iLJ-uch 5G_7F0s}KY ̣5;ֹH{meX}F@>G/kI=p#J]C(d}J4'1Y Ydt6gЏw%C]H0eCa[fXZ6/f ~ uZX~j+TrX9uNi}RHDPR6m#IOv]Xl>-tL308̑{ h W!yS8Ϊox:z TJy⾴M, /:)I䩲[ric'O`}SS6=Pr@͍Bm^f$P(0*vY=;p'YƋ3UJvIՅ$-:, 8~+$9Ŧ9$F8>9NהS9FI4MwPsEH-28Zus@=ƈWcP_iY־Ǒ@VxS}58gMEq_YUېRZ=:gbʎM/ZAG.hd z*9Y > -ε(2V31$5LRL I$IJI$I$RI$ RI$I$I$I$$I$I)I$I$JRI$I$I&I$RI$I$I$H$I&N)$I$IJI$ $ RI$$EJI$I$RI$I$TI$I)$Lt)I$I$*RI$I$I$I$$I$E)$I$I I$$HI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$$JI$I$I$I%)$I$IJI$NI)I$I$JRI$I$I$$RI$I$I$I%)$LtRI$'I%)$LI$$I$$I$I%)$Q)!I$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/#>'LrI$I$I$$I$I%I$I$JRI$IJI$$RI$2t%)$L}>⒔I('#AJI$D|ܗ>䔤IA2'RI$$}VHҔI!$R_)RI!$?z[})I$ H۩wޔRI$߂_W)I$]g|Qq;<}\?+=?2+u{gcpe_AY=RCp@q3Z9 unBCIcluA{ i:h]5XdӡIARűUZ5Xa[PyͲ̙N:G?@:N+˲>P=qpwE sHk;텑5JH24(q|?*Y4zDG~gaq"f4͔7la>:)9~Xfr~$Ehſ #BG?}WOS{`#qNqh.Om~^>ջ 5خqNgCUxԕdkX_#|V͎mXqK= X }].|sߤUzsmԻk2?D _ 9lSUÝ+*_)c\-9UyR?Axc3,+AyHJK FJ&Ȥe@c :7c57#G$?Lxu`$'?zem]Pz6!Um2Qk pE!V n`G- %VB&d(W1=OsE~^=Ò5{oUZL`Cd(Vn+U U֬0e{Qcy[c2Ud&upBY0,xf8"6z!H!gp쇉co[9gt'-|G1†^#ckBc[%iչ՝/1?Q?C B7p"vSSHagd ]I0AP@0V Tǃ4+Ikuti0ui*eWhLOc2˯-տe5Ð:NCC-V*ps v&ofh}AZDxU˽7wyJ,$^l^p 88_ңgW? /.lɑxfpDy~O'Y;w*r9 f?.;S$ >wIf1QK#A^ro.:Ҽc'n~g1VL/d{tji޳\VgҤӸxst:u3!?m[F;;"5Am65i-+IΊJf͌FK,.Ы6+3llRse7?Z|UCCG j/hMBhZt:r]S=@BF sl.2I?$1?'yi=cνv=ӡ.S1[d~O'ՌyF]beں|;P'q.ӷmt!OK%X7h|wW#mW Ō֝U`j:aeޙhV,1Z3ƃQߕ[GnpBn˹s>+~ ڈkD5pD Tm]ƥρ˖k{VPT8Ʌ9~2YuIYȪ}VV+c-NVgM-+MIqB[ą,]]B$> ;p9}~ژaDlc]O3_J]lQpw-^?sI5Ƹ#?IZrFj&ZT̎ [E,~⋗"x']S[8uGa\=J ư;BZ2sp_/ =lq L$\nVheëdGW9l񞳟Hz!:KJ^60v6mO(oğUjm١ʱYWɍ5b8.1gXM\C=F<aw-s]D(Y􏸀 _Wgk ~ptVr3jg*pQ)/= 7"7y䌀i"3h ?I@lCdCD)O&csvU;}L ij*gCLO4\;QyG|BY" /hxĵZ`DI\^26vx?Bϩ ۹>Yߌ B:9Ͻ9¬ZeCLGC̆r lS@`?ɱ-\:C \g_G 8Ay[5 \Is{5Q5.ub/ڵ(̥t 1FD%R{^tCu^˿p0 }ڬ3XXٸ9L.i&$,:}nAVٓhեȭ |\z5\E%sq OB`#U89C=?IgddY?dǒֻ۹<Զ[q'ͽζj5\,y&ꖏS^KdŚ 줅`)nOhKFH8k`9v 7 [[s5Կ*ԃ螰IQƜ%:d t Bխ/2 pORĒ1ب D4*N[5'i_̭X+ᦺdӏ䭷WZ?|GyaXb#O>M2#\96ȳ,3{+s`S}U^ 4F2UsCF\4-wYƇ$wu3kǫe?#OtHABZ܊얈9 \69n

jƆ!*Z*g}堻c]t FH}#cF#DcӇTMPc㲶7ù8?o߿m4Q: Jd]G Yw+8.z.cx=ڨUZ۶AV鵬s#!u@YWD t%UkMN {Ox_M]}m|ndJ $Vŀ,Y5n~ud#xnwuWeiUM/D%20\gTdYSy5*2UŶޞNJJʜ1cL,-;qD2+ՄKUl{4DBf0$EYtz`Mi`|ѻ ǀ4_%7Vc@es>* 'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I $I$)RI$I$I$I$$I$I)I$I$JRI$I$I$I$&N쾬Ұ˫kkh_o%t ߲6~h8JyS/xESqz/g_~J ׎f-\=Z5%l '1NZ<(q_Y ku2@Ycz Kq;V2\XO]k" ?jPe#ǂVS{Q\9q|g_'0$zgwav#֚]#A+kΤAWHN xI|'g("<4(oZ"t+"]gkͯ}/oF5tsۧ!t3K?!R<_wR؎gNJ5yn|7,RHA$IHi8i4ہ@u@$sVqEh`R`DZ+I*VaXH>?+"&8<BXөx- ?|mw:&߳4;X1wǴʚyYd8>ׁ9ڝGrΆHhgU'Zh♤8x6T"9jYhCkd ( -L{k}x%A5P's P[a.Y\p(<2M7-!d {>uZΒGX]1YkC-*_;d/6y#EuF[.>H[W3wf^CZՙp?j{EhmzpGA@\?+HGC OaEEAUdcg~QimUϜy)lU.s/~9K&O}$8 iDIiYokøU!2i( (DIkZ 1Whx{~ o [zŭ,wVꋫ$k:67bk{wO+3tr7/ ݿw^t{!UH!uNzS*mڟwX+?lT?l ./T6V @h=Pϳht* XAow6H9XƋ]P 2}W=-R;^GOv|_`TW91O/Ʉ]ح m5e٫3 _Nf(ܒ^q@u=4v$!pq }e5.g]9 GtôO܁MNh5Zm8G B&h0j^$ ?$l PmѦʅGuȅk)ՁpQwP*U'&v$(04qck!+;_c%h"P6<t<;dP.n|=IVfM6c_ ݇AwUk( B]o;% ѵA1D9Mm^c:19B2xz82>$Huj/L#U: b y$?G{769,*#89$! knԨ9D?].cZFk){O@Q bU S6͑ Д吐-$DmcB~L L֑Dz}-51ؔÃk3\}w89̺|4eunBc3;==}Xf\v<4)9z. hUl2FRumk ^$;Bk ?IXykY.0;̏p50+C>(&|{'AĜf^wXo'BFWHZT{I (T6 L ~^]~̯ͤEu˼I,GV܆g*+-qվKZ rHJq2sgq684q^mLEo>۳_\gU,FDsѲ|BcKA#Є#"0~X$vB9Z[{ư2xTE»i^f̀i*7#X"2{r^!q-lkms44pq[h{*1;j op 牁ЍNsi(q p6?骬Ȕ= ?904unp|eAkT kFGGDZ{@R 2_Y~P7\Q赭,v8YAO?b;UWA"~9Uen.籨ٕMϱ@~j6>Md G/% 7tOOkV?YT8rpbfi$&IjKȟ䃹k85zN1,>[zu{H~@ۼ{|ocJw]^};~dh61":l_PPOZ 8!3l>exU`Vso#wBUB@k#ClckC6o:OSڡS>ԞLTARHo 'KACC.SSJDNѸ0HJZ`@M)$VLf`qQSF*٧aᮒ>*o;%$o|~evۈ!~<0_EW pB^K~k@ps62G*688@ⴺ& Yo kh{Op]8p 2EgV+thϊ}e!E!X^e9<31S(m6)Ïd*ݹJU#֟;iVHꈉ{x#JvYRk EۧH BϴN ~ Xc`5].:g,?ۋfH`^ݐd@]-~j?FakRI T* \74}X,xIhtQYKz5[[mDi2mB5ǟ%W|s~fNV]WXqq i+86:~;,~*k; @Xqh /M~~I$R;RI$&JBJRI$$I'I4ITI:I&IJI$:HRI$`I$I$I$I I$I$RI$I$I2tAJI$$2RI$I$I$:dI$I$I$IJI$L$I2I$TI$I$$I$I)I$I$JRI$I$I&I:dTI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I:I$TI$I$$I$I)I$I$JRI$I'IJI$I$RI$I$I$I%)$NI$$I$I)I$I$JRI$I$I$I$$I&N%)$I:dRI$&NI(dI$I%)$I$IJI$[y=huA\֧\_ N?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$%)$LI&I$I$TI$I$$I$E%)$I$IJI$I$RI$I$I$I%)$I$IJI$,~tAW CS.gG_28f d4Xc35b#QwVN܆;ZohwNcI5]V:!vӳC,?;ZShtDmyЍ w &It:&pM,kGskǹYAƖ<Նk:s+!Α:i pT/'P>Ek+W>qvDu{ڪ1o.oMn|1(k lWk2<}|_)0Xr6ҿy` a~DેAYoy]ݴ{%[6:Er=<'1+WnUrF\>$,F'@aym셠gw,ERt[!U9FJ*kHcqqqd!.({SeMFuaVu4ZD Sţۣ*ly:-Hh BϐdHFq9Zk;|HIC,qʩmt쭷<ќ#;#[}uh><|wF=S#R?/K-2Rڳ *7y*d5]nmOl7 @H`qZb%Z99d~hlV_+/'X~OWG^ Ԭ->KNb%U /05%9Ձ[`^tH+ OyKt)<hj쥲֎SXvm;m5DǨ$ƈvjsQZAQ=Nuػ'c[]5k m-$9U YXqhusc An[ oU\"Ugg{ Vּd'Jzc-t!0Ţk⅔=WΈQpSVj6*EupBfKa];9amS!=侘 !D>jMlٙ<>Ң5f|{kaw8dp#TCGE|rF thuޣ4'_~:}@V- 17?'V,SG#2y*-V9UhIOMo(3c0ˣ.mVV,޹LZ;hVt P;K-i]jZ͔Vap="bg|R LO&ӡZ]'u'K7 \}&CI- ވ^F[+ͩюL\7w-\> 7sBkD~  &m9`d(;~q*tkAD.<@ڕh> r8Qk\Jf9xR`9Cu,6BUiړ-kkN}«3آD!D$SugWeỾ ENF8%NJR/(Oؓ4l:I#Y[U*g tV%{3@_8]\:I$)hS64w űM'k}RG2Ve C1b5*I$?Yx" ԫZQ?r- *9.D8Fȩ7%Hq,cRQp:sDUU"][yr]]?p3n``:uf~p0|lXhe)! ?Ia6"'+a?4?(Y.s=G: .jU(nS hb uJK[kt>噓[V$ţ~hlZ 8=enC .>eicaXn|]+ `Á׹AʪnDLb+apx,@6Kf́hTSK1v v$_wQ lw)g3k#Prl:ܨYN)0x%RcP&G?ư7]A*v䣌!zD]>3ġz(TI=s<5WESɰt ׈`8RC[ꂤ/WsB!0-^ MIM/G@d<#N: Pciiibl3!ax,> x"U+17jtJ̫Ѵ(1gY+lfѼa9YYDCL?KSR~4VK<.,66Suޥ{]@ T1αD7x'm[p{)4I|DO~Kf ڋbRiW;gtlH>P[P8 Af77AU>E6Ga(2svX[Yanb8=%C6zE Fcu."PA/k#VNasNBe0&T~5 ;(QmoNCn+IBReQI@*.x6) ^牗r-fApx"n[em4T^16IF;<̫jVQ }r`/oq{snZat< ),#@|J3ݺ"yD*_A;{l;EԵĵAvnQ͆4i?{4" 1~cЈer1AR'l;%5@O:As\I+g ʠ17R4KIV+`'J~OC@#u8Nd8sׂg(9]=D@e]s]!+cu T8sw[6&9GZLh|;&Zϭ~im ?+d}??t(# !,fG3P1:[B<>x]*:aaTLE7qദ5=F6owU ]`8!cw#oX2Ef"}3sOr)M5Z;mv^OV~n?٭;~OT*7 #e-o:Lnp g>xg.><. C w1]#=%WoxUKt*;ky_ɕ[e[*7I `j WAc=ځv0xi0ʾޝU%rdQ4 nidEkSYkk,^G0)FbH{%Ơe95k=]=] |£ $;k}q<~kTGD RSI[kT[ƪ !E"cU$t =F}NTSjI+N4L%AI <E8y}58HY:I'^;%?Jm)TI&5v);}#v>JJI$?Y)WxJRI$ɽBI(=A6 I(>IHIJI$RROI2IKDI2II%)$L}%)$LI $IRBI$'$$LtRI$$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$IRI$$IJI$I$RI$I$I$I%)$I$IJI$I)I$I$JRI$I$I'I HRI$I$TI$I$$I$I)I$I$JRI$dRI$I$I:I$RRI%9LI$I$$I$I)I$7g?+zˏQY5:?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JI$I$RI$I$RI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$5~i1 ”c-=Ԓ]evxX]_ÏZtN*lk]<}$wYn\l8{~ RW⩷$NY6[+4u|Ƈ} Z 3j?Oz7M/$Π[;4?=?uNUVO"Io{}Va0f;u{N}s[;)9qchT6a@s˭=%I#g]Um̳txw,YB5Kog>3\3ѳ}2[!M]չp =5h Th5yduO7gIzYcvL$#AZ*nY;&JU\m`Fz44|nf _lpHjO"9PI)WS;Z ;%)&A˯ CJϙCV )uf8BDHĒm#,'VV;:sZ8euF*-Vca!'Rd0 t;hkDL+qCȨ?%2 T%N? qG?2{"zkaWx'+e%;^^J63mAxS18+R>/V 8[P괐Ppv9j4Exi*řSxUyLR&[ϴl !у5kW";,+VDxHV88HQWVi\O6]sS=|>h8~(: 1( !-lAF+'NGJxcIq0wA$&{wp}V.1S7/s*[UjA $v0B'7 Z3LWYTjdqQ]@?40Ń N(~_%{ 8QQѩVΧN0q1[藰=% ;4&#[d,@)3Āϊ|z?#<>>mVy?-UIc`>Z|W/DK~out_]OĬ g߷Vk?,3\ah@;6$jfm_YYz7zUkM'hJ~r<~?b$zvTDwm\l7ubO;VVzN1{JI87N&5W9si2[B"V4wu Cxg53$qKY#]U_.8oPxdIi=?Tjv'u+q e̒ШY^i| 43FxDB8A -;yOꬿ٦c`p##eB| HK~RBY_J[Mwk#H4F8ˏk~Hu^0{QCqVˋU@;csd8H52GxDjska3/x֧ {'>5ZruOdSk.=H#G ZƄI |8^V9wK9Q `? [å#:6#0#\:[k@.u}ےs9ugNMkqE'5Ǐt?? S[F'iju*7ZshD&gȸnԔGA7M @I,lv`ɉq*bSnH4T~hT7{͎!C~jlP0VHn\kv;Pw?A|c24]`3lD7q>hL@" l ; }MxB >*݇eq_)&LX]Ɗc58Z8Iֻ.!eP+qaɏ<#/fh/]KxSAmmǬ*UX,nn]Y--y #rϢh*!3F5af#pˬP|ee0 (Q cMBc`B5N =#?5[oHG3(YPaf?(SjuVf4⌏HtEmu䝮Ct: kAR5_tDZ΃Vl`~YHqkPt6 Mf ;&䢆9 WES1hghJ}7!{@-~=~j&31V-7qE Sl%KpN[fE;9RDA,|P MN}4\6w+QyDu C 0Q`+:Lc׆r]^婓[hr)e$_zLD~- }':AM<}Ap6K:Wrom -Uƶ85g>K6oiT[G+D0Pݐ'BAqFђȝ>ФXDnBTq:x-65v#ķe:12ac7"\6@3_k_g[Ӹ1: ..a#~9'( uP'p UCO)R Ӛnq"4}%SPX*8nU3L=>%=fgixm& yrLU CNVT=Jù;G׀Z;Kum6n#Vu++2)VKA>ͩS} Z7nys^C> e^zrR*SeEw"8zD45H%=Z T0oׇ,6$Ku~#Nֵ{JWk*>5I˷ bvHwp4 5k:Zb}e13 ph.wxBͬulO{KvQF#38tVE7iN4o$Z>+x9}̖v ^FM#(&c ']?x'$EVLi$pp׃U:{l7JXe؟mې7Zl>稠% :KڠK[5^dq>J]#IԷO4vܬPэ7i_r]2B7^tT^jvl4_Gd+;S>*c!dc!;> ߹#gT16 A|$ݓߎZ~j-=4_䫝5X`|w4뷏7*~pq>ӣ|3CLc1UUmUz[<ķ27|°#m8dt^} ߹Ulof+kU8w^`'VS>V~u7eX!7~5K<Ϋ䰋1wa-Mo.ecB)nv0DZԱgBK~rBjQe;ɲv=D)UVpSV֓h3k_υ6.<,* +"h=n؝Eo oDzZKOJΆЉXQ@ U"2y;.AbОT"dP;2lk`J#`&4fXU^ݠA)sB|Ku(X wCJk`Lێpi_XZp(ٚ܆mx#V*p9Odba$I=*:c.ù=7pZA+Z"uu\?[*.~=ث 2:eܞ EgRI:hQ%*I$'I$I$OI$dxIJI$RI$IFRM )I$d<$I&JI&:I)I$hJI&:I!I$d%)$Lt%)$Lt)I$d )I$dAJI$L$TI2I$$I$I)I$I$JRI$$RI$N%)$I$IJI$I$RI$I$I$I%)$I$$$I$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I%I$tRI$I$I$I%)$I$IJI$I$RI$NI$I$$I$I)I$I'IJI$I)JPBI$I$RI$I%)$I2t)I$I$JRI$I$I'I2tIDNS$$I$I)I$I$JRI$:YC<垵?TjoVjtN?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$$I'LJRI$2I&I$I$JRI$I"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.kͮKӍ=uQ .1KP:aln7DV[Шm{[u@lr|adpa#P~ &9ɵn"AT:"gU,w>K Gz|ɘǐvmس9ϔST:iS.Cm~iӭtD1 -7rU\Nhx`px#Q?Z[.+px*PIqL+rKAإ 4~~m+mlJz^5]q4vJx!hDT5$r^NY~B;%Ac, :#_ZDžҬtx[G|n&<'=aɳƨكhkzHhzz{n?3tK|4=ꝿE+5&t΢I?&1qGhIûD+AlșV& >gT,N0^SNZ9Rp&/+] m{4#}Mtk=Fkh4z,  /ͮ ^/#C1=5?NͰf9h-wgbzrNP3q&gb*qnCGOZ[櫭m~><9Qdm'ޭ_wbȌM-ҵO:{]7o,,]ՠŬ>qIoEӬLu oi??_+! MNݐQ" -W? ?4~eM,ά8hyVMnKO8?Kk8: XR YҩwіҬgpU8X3zc^LI)$#%%^]nn+A1۲ʲb5l[Lm"~|Ut7!úSfOO\< ?z\ :w+5ټtp.Yw:涰xvՏ e&͡2^bS5Y\`ΧYgXS@cb3@caKGv[~ CIh-nfqo'6)qhޣC\4Zup& n:VXk:?4dѶ<ɪ6kbc7W~<-?sG=\sV"F9KE.횀.{MUD4Ql4QlUYah1L6HyD#Xy- PdH lieϻwcG㬪=͘c52Og d@GkYPvdg8bppy'2& ^ɋᵰ@:;-۶}e 07<[}bǎy%VCK 8D,?Gm?Xz[slOJIunǹͤW?ɽTu4 Z3˿id .O\Z"IU;8昀u.# ]iewe;.#7`ų!\쮩 #p4ǨU-G<GZkH:+C$>gEG7HhŬ)xjkѣ̐z;6  H#?!ź5pӕ*Vƣc!o/1QYU.LA kzN]12@[ huNQU{Dv2C%ڱ^1 fuLcꚫw?%.+G:ZoQΧc@:9Gi]"2iꮋK]:9ƹL:8S\Z^[?(Bt{ t#qGh@ۏC$YP'R#%ÓPp)91H~ѿY8Qum.lI0Jas ג^xOﶴSa4:}-v`5>M?X1j5U{0]VZDA[lJi%sX=[eOax@;!5k1dMk Slc:Vcčx]#E?sc1IM4^sD p'8c@K[AcM[1ĒJ;(]ZKahW1%h#_YWe\p~IW3FU1OXbeBZϼ{#FG0q$Q&uB-AW=Nt:Æc$>:X^{(3,ͧr\Xw7Buvn wngP g48A(04x5#J>M,@I?ř]ZR=c3A3 cN^~QuCIb?%/A- 菧Mk` 6CiƉþ:|@|@c*;Z|MooJ}8O mA%$nOcjpDkUɉﮨ ȁz|O @t:JV>icG7*QYAV:Wk%$+p{CBe^C2۸EĸӉ<ړM`?uZ5U5+B~-]ߚP3hs.ڜ}:)ecj#S-c X_{D:7kΛT12(.yio:/Ӄn'Ti/*Y;^ƴΆTuxaRv3^P<~rlCxeqHv;q W*tZ Y?>A"7GhE[]NWr`  x-wD6e5n@xbgOP}: KRݤ#VTT Z۩׳sO,lm{Ù-~cX y:?ɒ&b#,q<Ic;?a .hu*YŲ6(Uuk'K)ҷnr3"3*&X:Gs5n` SÕᄑ?'2NZ ]A$| 9|b'*ߺB2]V]Fr_Wiol2CgxmM9ѐlh# Y=Qd*u;"1⥜M{ucń?#8r?+\ޑ_+tl3iJXu78k Gaƍ'mąr|8ȜFxß7([72wy.jeoloP-kXU;t_S5Nc7P1_d,DqPn@ ծ?3܅ʷdtp8 2xhDx( hԪ2t+|FTy`htԈMʗ),⟅%2Aɠ2 v |Qze_'LrI$I$I$$I$I)I$I$JRI$I$I$IRI$$ RI$I$I$I"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Kk_ŃiXTjx{yi4mAeO.o|<T;t@(#+{uegh20 M㟠NMc1 %m=mvepAa Gȱ?Ym9S*U@<6?'ʜly C咲@\^%Ʃxؤ;w5Vk v%GFkO* ՙB)L8eqH?2dtjn }rsAo}IGc@׺M!N *_1OQ_w/)ȍ ~*`ӄB~e"e9kozc=zxV`wnުs-2⏏ki@ 928J3[:ԻoFW#Bݵ䕘̴8kn3H!e4: 5 >=vlF;5 > }uC RTplCg~^0LBGv#s\,K!x*2n<]ߥlkVn0cVpN:AO[Td#lxWgiܪL;r|| yը_ubm:Y鱬ublu .Q"D%T# џ/V38C__TZ]G8⹭oC ;Ut,+hc+-㐧`^[@V{wNtxsG41"QػaܼpxP5a4ե;2C\% ֹv.x pUvz|95Wg!Wub7m!=t.ӧ=.au6}#@]:?4ϡz0jMG;iɽ.;gOjO/Uyֹ9FG?4સZhw j,JeO wu^B"|UC~ZkĭOr=ur3).$ov-g!sٛakO _1t6"X V.ih)~xZ\/G {QAL\=Fm?% F}ܶ8L Ni?k{M;cƇ䫷dc8hAoeu<`ׇ0U|ʷ|Spસ8ս唰@8+&.ϊIl"~֋Ksj.HߧZOFƛ0y 2>Ez-+ c#!vaoIUB6{8YIËx09ŧ@԰E(1ƇDcGKpKS'3UbyQƒS$ lQ;핑)I)&9P,q71%T}ca "@Q=d+ki{`L G+%!V='"XH|~oVa8|p*\غi[cGu }jl|#_8 [" ZYߕ.{1N?w^}c΍ qæ>?+Y 'b HWQ#tqNHy's_v{tY0$xNQG@|ko" .'X .$ ࡘƇhN4C̴07B }]c?x 4b= Z>ϵ ,kEiIhF` ,?aa1$_4]#=J8/I?(b46̄\J|< Xμ11LSuLaiqP_ 9ͬpЩae&F]?'(5&%Qfn:iU:]c+Nn菠-g4ZVUʬ#r #eCfh. :[ 9g ?ksYs8+l]5[5AC:sH\Dk"5vưK^\jf;hc׍[0V;o=z=Oow0UZQ?)&2W> /ƲL[s7;+[@1YaǵK7kUgm@Ɯ*‡.#Ycl-5c/ k<%,>}ZFuAn_ t );>`2^,/Ň^Oq~~=Q[Nh$j vW#kpmNoI;wy*=G 55Yoc\b\^ G死(0W"0Z(ɲ"~l_~P?s1!y?}f {QHkndΟ~Ǯ%頺$i!`19̳@B'Nī22mHcaZKϊ襚2PU_֦ 2I扔$ΪCOt7md baML?4z1n,h> Mk2q:E3!zCʤ m+ٽ*QԎbe}GC]T=͓ʬ>#A#,]?[cD u6(=O^I6\=LILv\顏F9xaDYiQi zqM8j63.}n#MK_ߊ*nX;#*r}/cC[M؁9s|v%^:ʦs68H<^ג}Q#{JFI yk[P]Plx1$ 4Cv< F4{|{h:Oe:Xg ZZޜiZHh*0 <%]h4"cOrJt-Vli687-TrZIEz2ݬ8Oe(dF\1Lx @km. k=+͊!\r@ȓmʞ\H)M` Q7;❢,aBI5NA1G GTݒNeh76߹TqⵯN5L2pG/W@^ Pvs/߼[^#Ĭ Yy鰹PkK ISf0-^W?Ժ[9f`#Î5#-9uuN +u8vflbWRnmZoI0{K 2kީԊImR 7?tF{ pV'_yYM:Ye@C[cCD{XdʳKgVg ]#I2@DtvTRŲӏ,¥lv;=ZKG{kkV87}0EY!χ~ ;q牄<:&/."*n^E_s>UhVq2=2YfGP6<EZX{Q%  Cx+%8j 4:"Bl+qkN#LtU{jQt_ @nlI(̬?Nh;uwdf47Ucg-v5u]V7^Gi}[k\6BOWᘔmS=;5JG De nhF[ ʻ>`tUrq]5 KC Vmf1 UX*.crZ ~%9§Vw0 p%-oVPMzV5 rScvX"G*sX5 |Sk#e"tPV&d 98e:rGINR)~5B*ƾFcNP%aD´hD(Pt'`Bi5['* !$!x)ILC\ ^$syT{ .%Sx7>BB:#UmUADLv+$'QI$2tI$I%)$I$IJI$I$%)$I$I I$I$RI$I$I$LI$t)I$I$JRI$d$$IN%)$I$IJI$$2HRI$d$$II$I2IIJI$$I)I$dIJI$I$%)$I$$I$I%)$M 'I%)$LxLI$I$$I$I)I$IIJI$$2JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$p$$I$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$铤$I:I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$t$$IL$II$I$I%)$I)I$I$I%)$I$IJI$I$RI$NI(dI$I%)$I$IJI$[y=huA\֧\_ N?ꅜzPseJ/#>'LrI$I$I$$I$I)I$I$JRI$I$I$I$JRI$I$I$I$$I$HI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$:KoBD`.^w\D8uNrqּJv8Գ{_.5' }ifK#]| VQ4MOKuO+5X`piG V4sK{2 6n"Ofg 's)7uH-vJ;w;z(5ĹOV)nV(/"\ }? ݇̓WRNhBH =^˺e!=9_yMeMc̓rX%A GPu4X}@Y[eʌ#cّ*SNj!JH$܁{$|ܨYh7wVF)wO S(PC (HHX61lj%5}6r"GtҤw)Ȟ[`8> N=Ĉ̈K nePC-;dثB ^nUkۚ7%4QHXW j-tΨvxS C3/Y-fbd^<Wx1:HHw5<LJvS!Bt#Muл4{UYky?}AhrC=HVj,D ] #0ToTto{~j">*S#!4腗WS!t!s#s+cxTs lJ}KUj/omԟ UeOӏAvi[۠Z1#GJ` KMvZVdjWVZ",Uoev4A$TiZ{lajQ͠^E2kX;Nj5;HpiZWivMK^hc=&Ǚ =EV0/M6s- ]Nzo qP2o5Yt:)u icJn<Ts@&_o+}7sIqj^_hw)=a55.'8lX.W1q}]\aft[H8]Ve>;eնiT8g}][r3GU,bTwdߊm.Su_5:4!X5Ղ!UH||=oOV6Ds5u;[2q yV; @=Sdzi±>MqkY -lףOWbH~E`ߓx>sDXM"?8,'ׁn]@WO8m\NAuni_*Վ^YJm*HǏ7 ,w AP`,>/Z-QHȃ ?#VMZ" VdS$Nf(ItrVU{XZwWJ^{:ɵ.2BzV{?G ł*#;ri6Z;_hihx<R |Y{)i cSc̗4o5v!.&6'<YM#G]4]+c|Kvh} X{\G9̺ATYf{VlTAvmpm~Q+cNn$ -qnKAݪ0H}sHiMoo'byRv5K>E}oAm~wAiV˞+ u*k#qVkYv<$,,Zu([UΡ#S\5:k-MenpG Zk*m1RUPZDJ~XaӇ; s - )ܩY)Y>Ӑ沱[Fx rulCmiiח98H575ۺ~(}?fG82$}CB)6c>#CQ)&JAJJgT1?Ql`xƚ 1 ?_CD( v<7^Y51Ÿ*F(YS ń @*r杮c9p#3h wʉ O6+fst-o^:G%3֍ |sIUӭp(n"&p{ZUHCpƖVu#E%ffksGU>{u#uNi>JW290k5p>ck`/Ѐ%(sdrU OmzyW˫o0?)K(b70c*5ƺZ];K!Ɩr; h O&uF ̇Gek}:M EZcYE C)H xvՎQ:4Q`5G\Zy[NUakn!FU6޴CK/9N;T52 V6Z9]eH,\gW <+>sqUŮ!p,2><ℚXL@>v+5Ky3= `kSY$Qzc.k[}}.UnٽŦ#.׆9Il0G w ]({]Is+ ?*v⾷ 奏k1c`'Ajtj"@ SKDGbR[&J fMhu+,k,Wz^U; x%,ZVI#Do8h^yB> ^!ۇer]UL6'uw;.ǀ$q'K Iw;!ʶF%Y$pF6%{`mDuB@`rDD+&4QrH\hWH&1)JJ]$NXޅ> 2h5{,GPk0Bd. ~fcu`!'NSJjWI$I$RI$I$I$I%)$I$IJI$I$RI$I(E I$I$JI$I$I$IJI$$2JRI$I$I&I:dI$IJI$I$RI$'M !I$dIJI$L$I2I$I$:I)I$dI%)$I$IJI$I$RI$I$I$Н$I2IIJI$$I)I$I$JRI$dBJRI$$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$N$$NI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I)LJRI$RLJRI$$$$II$I$I%)$I I)I$b9LI$I$$I$I)I$7g?+zˏQY5:?ꅜzPseJ/#>'LrI$*$I$V$I'L RI$I$I$I$$I$I)I$I$)RI$2I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$ ^oULH/=] 5G\>/Tk2 /˚L=U[opV,ilL7wLG϶7x{}kZ <u?މM>B,O>i ʧ]gui+Op±5G4j7ս?L^x-6>$}5zfgW>b;[[ &|UH[h o6>O=Z`|]᢯Hp# 9Ζtu5=ƖB0 rRŸ}&UXXd*2ңW8ˉVr9Y4nVsvhf `>jiY@=Sex-Vc&*8xuXdp/8Ҁ{v]fc߃f8H?U5z=\xfmq.w&Q |;EmYtxA*5lkXy85js ;VQG揤yW#pO_/@Z?h06jq}fGuH Liӓ*VCVIa?kSۚVz7pJaX0$,Ieݏ-O6<KXk DXchH7Gr?ՎYysX8эDfftH*VwI=B׆?*Tz3 p?=TTCsgE;/rÍ5B20\MR o|QoV]W?Uƛd4?쮉Ńx=#_D##[DrHiݡ3>_:KYOk!̂[̞rrp-<c֍6 X;@x HշKCZGҗ39k c4ҵO!& Ory,yU+H敎c /}W"D,8r!u4]\]KO5GqݤI"PfaiNL3ѹEeZcHc=9i8] aWZwq>A{nj7+k>+9:&x~۟N.lhg^<)&T6E{[!m DAINH"twON(VN4V$,{=J~rؤJDGl=e:CZ|mTw#l3ʅADNЬvG#3S'*bLA>h$=,p|Ll4tjg"]qV!E'uZJt%W'%!,S}0{j;OC8h +<4APr08ItͦuG=ipsיo;UWTͥ$v16K銸 }/U|H :4U_ g>~OZ5y0ZvQsu'tZxF aZQ /5OYYs0?UG>25{IptПʳKx?}Y}8}\,tCfu]gs'lgKNN2x?Mۼ ZH؝WݧT\QU}ĸXf" Lt ;E{^d8~E"PUG),]5D>wn>_>m~ D9qȱs'Z?}Lۋz{394Fpe> 5&h;b;.6ӸCUc9ZS($>O?I 4XCox; 2`,[NC=Y=REaUGOr^)@8|7(TI5/}L{Xu,AwSmǧ5g?4Cp(Ȗxpz[Z&0_qiV~am ]=OSţ!.HVLfѾ"VMT%,oTh4;B6]֭vU,T>-$G)?j_s$xF&wGq}̋~wxQksxߞۅ]xVjuk m,gF89ͿOV}亃 x8 I1=c_Fd#rV@sz~  ?Sf=~1 5*q ORm iʱޚo.Gx{%pTS5q5QV y(-۽?kD򑝁cZƐ{u:^HAUFuZ,6l2j&;}&?Gr-PʮbNH=y D(oEG[d{`ي=A?Qp~P@uG}論aIv+[ םedQktw_Np`/Lbf9D~ pv^vi坛:5[@ZJ FOv "eYt/s q7\~s@L#'[Kj.!Vdsj;߸x؂FhT[۴mJU40!([~Dz:9$_!R뮒\N֎}N9~|e(XAhZ7?)#UVmo7y.Tk\K4'al70Ӏ{icScsvAz bvv4h@;ɹtC$Ɋs&N[/ tTV@%!q3v]<ԁҐ3 ;k,f5}6[c˙l}K"ANJ+164/Q"*;v-*WDhWVe ^t Zm ~_"JomlR#C4)bd d8h{)QdbE/k:NC$5՘s'CÔ74ixw~UVF!Ȉ?,{v@t(xt!s+N֐@_ڊ\Ҹ,~y!hCK(!hK%ԗf@ݟX/{Ük.y|n';=uOǠ:Xtx?:c_i^ߛe/=%TipGrsrq݁{ީ{']~;u7^eJt|2ݾ}͵$οj!A{q6wT{?P4SH-&9}-.|CX{&Iu$bMTV@p[Ü@+g%hk N?y1s=9=7>)FDN@MU6`K[y]{kftϵ<][V7'vC[Oւ-+H*okI>(-xq5S0K~89GwApq^/;qAM ~=HB ǻ@Lgeeq1+/)|mVG~@LDpQfRc!&u[*Ea]ʯcEU8ج-./U;zsEfݸ^>Q D"dq>2e/TY1H-eY}n5Y3s 5*C*@t(Yx]CQ`:X5Hέ!O>>|MQxr#fN WPۄOܕo 9hQCmm2ۇү~FX+0\kN{CmxN3`"4(mдe8Yo oKm1iy 3~xwgdK *GY;H}r{5ƺ"oWvp Zֳ(nqѨcG p0Kk`-#>]YmG#éH,OM$V՛t*cqw,[cwyP o ia᎚iuM^as֐&2c[ &_ʯc 0ݣ95vN L(nBqA pr:Ps Z) r)IQVwVhク'LrI$2I$I$$I$I)I$I$JRI$I$I$tȥI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$f,?ŐqZAr{y#?ݒJU:{'uV\Zx"kv/ *6=mo{}{6%D1r^kp׺xN; /iFڡNxymhCR5Ͳ[ T&ͣD[fp:F:݊mj7k佣|Yߺ`v7+ZbriKj'M|cUj gpLEEF]+S_{_,ܩ zFc5b\k>$izscCs=AY!9R);=12Db ? WM (sLLy:Ԯ$9cJ%nLѣS(Đߺ8θNJ0+ehO,"u>QuWáY2}1}GǿWG%cSc@&LE35GKA1UOOͥQn!1u'91qQ'8#x+=ielT60?ACuԢm0 Oa?)>D S1 @./`"%_/Aӡ~?r;k*vXlqq]D' ̇1;^YbjVXg࣐}.~Ş3fcO\u'3(ځ4{6[:Wz|EÏ7?V'bHqs!]K4 >s&IRĿk3F$q\ Po汎>xLGeRq ULi+.≆U~sV% ձ=G$(k/.ټ c!]F~D,hsOKaWRu`6ZX}U({7H5yZtzcYs7 oH_(; E8Ֆm1:xцq&2VKӦ`?l൪k@3'_HkoZP2v<8U}Ƕ9+HCG<0IW|~Illu̢pwG5hԦQ#CCЩk=V4m9Vp{#,|,chʬ0X:K9\9E*4!]hL(4hI疒=#&HR;m#ݶ ;bCJlt̐z8T5F'HWܫ ' c_|['?/-,{vPMcv?rVwZ>cfD%(hX_~t}&{a*;?[~_Z Ǵe(-<\^D?G[9Y9p*~RNT⹛4W8vM #F5>N!amunȩ Tn\{8[<2{&"I'sOlϺ۹H, yps%h0Awq_ Xͤ39c_w6hs D8+Bkx3??95ˇZl}VhCle@w6±|[ZьEi>VMOcr/L=]ŲXHkwTĥY ]>#8A sJRNB`5yW+H>䟤E\ʩe Te-6+i|K̸7[3tPKrH^WP*k3l@c:沆ߓW$G-1[ww; 5(6X1ec:i$o!5I|LVYI۩2;+25)XOv٘>Hme*vn=gva'W~-,mϱ3o1g7C[- p$qCds#h 2(qoO{cqʣ?Ump!As|l-4*MNS{$;k)̀k3<kջ"Cy ui`E6|#)gGpNqh#Ǻ~% qO(D#$4z, ts ]\<ʋr]I{hS-sS_/q yՠGmUa%Gz!xD~c-ٟe]He",t{~I5<@GXާZ «{/qnr.kKk[vŹ;Ѵ8$G#6= iVKlq`GfȮd|6;DƋOclh.sQw܇,qDx;6!wa1Cs\*Yg~j=,sAxgE<<ٻwTgot@9CڌMU&(8͙ti)۔5"s&+a[MDGpjlIZ䶺mC՟~X1R(?Y-%n+*u8=x+UjmV[y0N곰8ń8r5R៻HWQ?ᆒ סXcKUm\y ʽ ~su+S`> q2w DpֻDWM-sjюHlj wV#;z99nn7LJ0ϨslC,z_؝8hA3hU}}D z#k'(qHu;}4CfY[ڧӯn%ߛ_vcfp5q+xWzcH{6HnZϧ`mv6em.#sdגvx@C]M5sk .D?6czMa0 mMOzҳ2_]?')n'AQ{C F{25`ˊN՚cte6vV%$ V4=PZ'tZ~5udy$ޞx1(1x-:9{uI|ĘK'6ƐRf|7+93suiK2_J59OL N)czU~QUTy * 5YpS un59u,%ۚ[@t?h]veA!A0c 5݅0:8i`7u@ ,@h?9SÚ' tZj~uÓqog qFu@05 $~lec0uug][s*xѵoWG X5R7ko 89b8'kU EgO>>*w'P1ࢆ6_CaGbLΩ%:S@!/$= vZb>[̉"4N}8QiзȄw /j>in ÿyIoQ $Gc>jFH?MHX#mhfͧlH=o&ehX#Nki2yNKL*ZQv*\#5T`.LF'E&}Bx@Z 13Z ӧPZ4#1o#4h`y)I0v]"bV0+k"'LrI$2I$I$$I$I)I$I$)RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$9s& }_DX?'f[KgplX6.eo#'UpC MdxJR=<Ulb,Hqx,wj7]YMqo㍕:9Lj{zO)?} ,* ;\2}~?u]'1G'qثwdf?fr9K> xrC'\XUQm5tn-&-ަG~_5sn-V.;8x>xE*yR@2OʾFئNE`?scJQwp`uƍc\qo7_NH~.+W 1> #)V!BǫlNmvSVMͮ|j18AB?c2 |X_oR` qp4RϤcXTFA[R0W.4<1`| 8τRk:'0tYr\>TgdƓO[VZrYTTpˤoi{;L%L|{ӺOJVАvoTr8%RxuWV<%tFP֎O)b&2=1?d@< ZC{pX:iXkC]RQRSҶ]a;YfM[@tNYofW?J~J~^GĐyƱ܊kxpH]?@t?W$'S*YVz~ct0ujZDZøw`?pFS¬If{?CRB~p_jdH(:ǧƖ?pFC68Eg:C!i/p-:W Ϣ(AU.pNo>eXȳc^ԕ<>o3cBn+M{wC%[vVv8` jO1"^( 0dS1 l<QWcjU6d3Dpl uS-*{h;"^0E^N *>#me) ~ >6]>+gTԧeGV  0]?ME{(;ɗ/,|Qq h,;\2[&AkƱ~htmw>@'%6"嘭pNk?^Z{U*{Oc#`8~z̸WMs4VrO[Z >ji%xv1ƍ[ę C)niUk۸xh~EXXwG.MO^?VP$܍u6լ "֏s59>%Nm=5u R} pp ykk`#0H37߱G.]Z=Ƿw+&W1̻I{N1`ids18ik wNlʭ-0rUU׹O}LnHkf~jmBƑ&4nwuӰQ/ƾf>0&FSmcof ȘVkəSw_Q 1NT\ӸjBֿ%Y4"'_Uve7]|x1uQo$mbMEI]q[U^I7B_k1>#nX'c䶜wRkӡ!ShAX8̡!;b}=sZ8 ԛ.n*v, E\;}n;*O.s9C>o'U("lWSf :&kF+nE{OUM_ Mu&=|Mck'C~D SWkC&43r>31 e骹VHH@knPqCXJ> TXkg Xr>$f&WeoeMV0r]*م599&Q^1dWT6%M`6}@l:q2pKG 5} h c!?Pe϶umh-g/J{I:*> n\Z^[@6!: rO(eŌ;AEhxZ׳>:JVNd+R4U2uLsydG?cW7j7Sia`5?,=ڝ}j#[c,dwaGʴ9KI@m}nk[p1Vzp`cY'2kܙk7@J(;D*. ״8>6H|>fy C4 %ݴYo/]ŁM?x( -G[#,ߕE?o7toAx*0.S:ISt2Iz^@7)D;߬"PuWPzbbPrw 6(ceP942gk_ڹ77ʅTͯl:5^Li|b !XM*L#2Q(Aggo$nv<KA%Adc}k`a#? [mO GcYCeG[ocT5$PNRL>%*m;0u@x[7ж7<}%3$;pkŻ7`ຼH-¯^<ָjG> {1LJ![G:2斂e93d=2 "ĝ%ܢPiv7+ *xr tNK>BpFCczf)@beQ@ӺA|SQs mcZ}ߜv X #IGLOokTXv-Ve/n@_ю_f/e;?Gߢl.n!Ցmo<c֕6-h wYy =%OcMSVjuzc浚m}v]FsZ7(kc;"7]K4HIVrsO @~7cs1}V6 "gN֍jj55=F P̵C 4Vu@/Uwx#Ճf.µӞ Z` A *~trxf8a32ln'4=S* tYz|ӡPcOIM87%DM52^s5RYg$@R&aÛ1 tEV],tݻ-~`cG[(k,v@LPMƲ߭:T saV\kC^%^8Nh旪_A_7sv'4N檹 &>If[ם6b I*vuvŨƓSTK2{ZXvCZhARc#1U]LIF7, ʨc5nՐ̖ƒ:GƱι4X,g0_K3*>?/juqs.Gqpێ\$͟Q=/++ OcHM`I$!!0_) ,k &|0jy(= RTIjc{l1E!&D):!;C%V P-.jxH%!itX '9{= 6(O mĘOT@s=)gVr˙Rl N&<;fuR7hۇD2S8O~xv**t:A숒I$I$I$$I$I)I$I$I'I$RI$I$I$EJI$I(I%)$I$A I$I$ȩI$tI)$I2tRI$$JRI$d$$II$I$I I$$I)I$dIJI$I$RI$I(IJI$$I)I$I$JRI$I$I$I$$I$I)I$dI&I$RI$'I%)$LI$$I$I)I$dIJI$I$BI$I$I$I%)$I$IJI$I$RI$N%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I:dRI$铦I*I$O)IJI$IIJI$I$BI$I$I:II*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$II$I$I%)$I$IJI$[y=huA\֧\_ N?ꅜzPcseJ/#>'LrI$2I$I$$I$HI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$t A}tg&9U)$ā%v@V6Hh2xO[iRLNh%X \@3'$sX$L;WPv׃ <ѵ;f.DRxq~gP`}$ f c@PHN;jʤӴaF)V}!"4IU:"1zKܖd]rЯǚP7'Ó~GOo5OoHDmp|Vfuaul0\]XX{[2]ߚ5Dr Y-&r orxG(۝Uz>j8T%C`#||%Tmi<;b͠KD+ 3X-]SC+r l/z6HTl2\aݻթTUldSout=1(7 uqЭFXD=h1qqp3YQnӯOT̫ѰP^~o!3r.s=~ ^+U_" ad6HFǥ;Y1*A7sZcA?5T[#菂ŮNhV=LjVcQD[kW}[NHjCӎO6u0@>?\K=K!-lrKmb?d_*;\n&k}+Z¶LAiWT:yQ%ĩ)GK7qڔᮩ FOpɇFe9K(8UX~׻(:<̞.o` =ZX푯)|c=9 A\ ŲnQX81 Oe'8 h C!۝?"} 8?]U2Zhh=7 #C dHώдUgu'~(7itAG!W5NOYRGSkp0 N*yJ8?XRm;-3 }'ߏY >jv6F6My)tDck3o$rX1]#,;k O"?U1mY1[vG i^n~g@MA K#B EQMe::vΠЉP~#C~yEïuxnd"Ttc!7d.FRYF U5,cTa$f#`.ld+s2kH%wŽ7T.2/~x esvI$T%m~$)_\17F>mu}z M tt)cv ~Z6k { ^KH`~Ib6/9{Uܬqpzq8LɍZƜsqoftoZ `s>[3u5w-LLQ25j2=7uC,kus n]qTghku~f0M(tßko!7UʭnA> cJeĕVM+sG'o*źhCfw5{"u>TbC?˥>!]έceRꭂxl`]7jg>MƉh{>L ݐl:HFkF͑{(.9[Cୀ4A3j|'9$VX׍2*^DVݸ&d {ѵsu(Gj@{ki+y OޫB L4@d2*ո)Q1<–QΊnc X>#pj+]fȖ ~&7Z5*oZ#"! 5d#Y0ڮ;M~y.mZ*Wc{TmäAkN#uۋ\KNj 㺝{$C'҆;D'c`tk}ԱôAEIcR{G ᖉ;J?+ԌZfM~CoMZlzI,w4^QmM}"USv֥c n,<±v jRtw\[۫mծ=@x} {!%*E{IUYs @,e͑“!÷`h3Cmx]eXnՑǹpu\͡"'P"X /U/Gq`x Za,l5nۛH#]IEݰFoa]v00P], ${'#st8'8Oz3ԸĤ!xuv!D^d0\{vVje4;wVpsew,""87.xX׈_q⬲0*K'-юv:~I.2u(- U>ʥ^ 31yI5 ~Cm<[k9-7׆׻5\XZuU|X@ ˔~1-:l짼wHy$ON?F;~Df@R9=8YNt L_&Q@"x<,sh`k i(0H ʅ%(X5:} 5V5F0lcD{]f\oi技.ag9VIXOijb p5 *{`MO]c۾$,,΢YoY卟cǔd}sH)ft ,*b>yzLyweJ_K۬ fH=?3 2='$B/_kw[#)eahm.vGOV>fwA {L܏ƜMKgߍfՇ]2%Y4PX,a1'K>*8ˆuu_Odח6sTW ^Ϧ#R;x+#;'0c?hqk}]oکht?ASĝI7t, 9vȵt-p{'Rx쪞<³KovO~  rBl;~N]»;9*]n 5k-.)gR2ZZ4#@}#sy!nzZ> yo_Ճk4ӫOCC~*lbWyc}[.|S!<etYmɮN8xfA&-|@FI H]Yh"iLt1KIӄᅺp1-(efvvFT Oo!bwC! I$vILYT -8IBbBtu$1v|Ue)Py*lDz{-M }kCMR'wA@%m \`ʱ Ii-4B +8'_$ n>JmwI&%I$I$I$I$$I$I)I$tI%)$I$I$$TI$I%)$I$AJI$I$BI$I$I$I%)$I2t)I$I$JRI$$IJI$I$RI$$I I$I$RI$$JRI$I$I$I$$II(IJI$$tI2I$I2I҄I2I$I$:I)I$dI%)$I2tRI$$JRI$d$$II$I$I%)$I$IJI$I$RI$I$I:dIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I8IJI$IRI$$$$IBIRRI$$IRI$I$I$I$$I$I)I$I$JRI$I$I&I$BI$I$I$I%)$ZoP~W,orZq57+5:f_?ꅜzPcseJ/#>'LrI$2I$I"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$@JJRI$A9܈Viԉ(Rb$Əcy*}-V. FǪ̉S(m/A6b^ 'Rwv {k;R1T!; r]M.,8Jm&Iԫ㵔5'qYK%G`s9S4@PcGS2uLAV݆[W!V rQ11 ]"+XfNdX[y ,8I ZZ5.'DD ̨5l= JMc"Aoa [wٌ։hƤoĚ"b,kpvUwo'q|epXO=ݱ>tWLQۉ LǬsms]S\A=ڽ/j{v\=Z_s`2/_ >iGъ\2Mho}W-abL[\*xd<:|)8nSu xsHUwYL,8NX+ޟ̫R6e , >;[m6`В9AevܴlN)kO[G;np8?7tKv~*vǵǚy=OC3+ 'X]5fZnu 0f|qe$s} r74GAV|%d`U;&TIn?fmBkU깨z; \w~ggKMuL.Ac7'O)zdmpw 1n% t?O߷jFx+ɥ==el^Jz49S2cՋ&͍Ѭ0|Q29* q iJ=;d1O .'W C~?(,%";=Ѻ;AAAkgԉ~D׳` ց[YT+i/ڮX8E_IT#°ک `$jU@5ZqL-g3Π쌗V K%Ŷ&}?>kǂsŀ:U)>j2?ܗG69cq1礼Ryh8ݫSP ; edϹא vIX{ 蝠+~1劉_(zv?U5=L;ƺ #%<'Bev{P;)APДN&{8<Restw^N @V59=Nѹ[UGxC/\`wOVQhs<%O!YYԈ-q?_QooR=_[^}>OH$# &օQَ62YRmux?pZU׾KַRI/9셓W[$fSw陴|xF*SÇW$`+Z+;G?|wc}W>$W(l٤DhU-;ଧN. 1 *#un] [ W?F4k,:cN>s& y#iqN_#n6#bH,זobx]mKfA.\cs #a^`uq pݹUVY3ҋ^'$wmCU/4jmakH?Eh9'p i7gz/X{c#D)r{E 'E1]wƻn|3)13>dR5oCT Vn5,Hz|p7aDοd<8e7+ٹxf0;}6}o类1F kf=pt*Xa; Z>S.Pg?&&7K~Bmv3V ;\> yeO͚~j_'!MZGFJQ ܡ-y"G Tb<\udzlwOEwX=@@:;Ʒy+Xpl$jWlJly]ɮzds"&`:W%7@vYY{k] Gr?5JehtNJ뮫68I= I?D&Ԭ [.t iAo|Ju;+Mï-VLݠQ}H[K9 ٬oLep4e%7] սUA {}U9-95kWQ>L΀(31͈y=>U"\'ly7?FT(M6p! A㲍9PH uNTGk%E%R{vX$sSAnyTHi-@YYx#blq~+@/@^X4eFhtfa5c& 5+? zZY]??+eT-c -*ɛƣfu;C0LY; Uau?/ʽ[tRm>:iO*^]瞧nq {'UF"HGC1O}. UPc@*L;DזU(~(e(/LM2c\ \4`b\}ZHnG贊75nԏ.aCO׮)%DA q`?2]d{(|GtB~AEg$\OlzӃp`~IDtDFlYTI:1s :M^ 3Z!iGv]`B rY)вhyI<([gǞOsK|~.-̦Q[\9L\5QԬYx V,*WDiT瓫`{7 ns8 |{4Πhq$H߸ԁZ]Q-ۤXc<1bHs:wJk8}+[r4xhh`k{&~@s K@ .+ xЏ*48~wd3rCI&$˳xvFcm-:L}?wjTre?J%ZƠcI9ۺz[T3G~\nev9o{U͐Z__ر \:6@5Vkŕr-6c*L@bMMe$h鱠ѼqV]Tn-މ$?+~c4K-?o3CxDKo1.8}i@ٵe{lL:OVMvY\9@+#> wbѢs BAjP{ o!'LrI$.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$H9?r ZI&2B;hD)iRI${#TZ@6Bd₤;D%YfهaS{rM>gSe<{q8̵y\܃ #d*9uAjb7ŔOIi&GhWkV'{ѧp8"`HB(Nb#'Z:P̶ktǺ )ʫ6jMZWq|#qXW:+ʯeǞ..s7xk=Sn)u szyw籊Zt5*\vv9n4?oՊs΄Lww_z{ŃGɐA',oy '`?Su…/5o<k;B)1!iEv}/g`088GMgYj&N خA]jH|P167]H0 [m8P剥*M^niY7hlxw555=11Gc#zcRuHGud$4 V1̰5!|c(5 7wr э,oUԎ9)}ԙ #ͱJ~6Omx't{j/${F$.{EtBl5Y  iPuYrGO5SFMSKd{D4O貍[cq{gZVIѣW$׶G!Ѭ*Ư[QAvݕ7O !k.d;s,pFp?Np$y+4mv?حgl*66[Ω)?e i%ۧqFd@|?u{L\~C驹[2۸BQ{EMQ>k 0]Zoګ sOAol6K!ebG+ض8uco ЬfO4ӸOn~HֶZ,~?ƣɑ鹿IB%o D@>?VPj|=ՙƽqZŴq7BUEŀgoj877!j}kGF9 -\/G*Lt9HWoZQ> 2ZNfu^4^r~Iݎ>5s"lqOV"tlZqݸI]$SL0`? ?-@`5{w8>x[ PisuE\ K4*|7Ǻg7^GLyCRZݎgjtײqf7S_*ZM7NEe-4};եUAOM~'9YvC]cm21Ak :h2qpP\P9 \ޏOau٫^ʟax { NF]vSx`QCՀ>(mcLmhpi&*vꝱ Q>Y)0 !m'i_%}1cpXw6bCDj4=Z{L \1D+x[vj=օY; s*-i#?U[&,ps]vE`.,V2DNp0N:NjNi0ڦxAa kP˱noq.{v3lDlI%EvKlq"d^R$CwLBCJieEDzf#MKu'Ck/qX|Q[L2TIQ?qYO4[F[<%4Y 0\ˬYk3 /hUp?52̒ aG$nTd°1Z*UA " n=&[{Uُ7l`+AHoPXݮ^*%ѹ a Aߣ);x!6٭os5"S6Ȁ-c2B SwFiJ$.}$s׸@<ip:x^wod)PGLJAu# N9 =?Wk֭UVB?T|<}.zQ7Ҳmlncms>Rs)4Ya? t{\6gLE1> 1.ƓWX(idkUG6S Q]Pck-&^P?M7lo{]̐@UߎpPNz9@꣬*׵pO/lOihxQH5c02a'^ד_@i:;ޡӱď%K.I{3|c6EO#>}G?{ς۹᠏1MgpqF`p xy, w([-lۉ+^kp=Y@vf}kÇ[RuqI>j "I/G\;j}&LNct융'Q@X̤EtQCu6>=m;GM9O L].I=Զ?Ĺ @Ec6 Q  aJME HhXd wŠ6I(ӲhLr%I$TIcQHÁi y%IQv'? lr8!N=D]#:Jҿ$-1Agf<C; [9+.,|y~Wzd/d\\F:}{e﯑#!-VwE :u9Yw0;$1qIW we)N6GTޣc$Y|PD(cILI$I"$I$I)I$I$ RI$I'EJI$$2RI$I$I$I$$II$I$LI'LI)I$I$IJI$$I!I$I$JRI$dRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$IJI$L$I2I$I&I:dI$I%)$Lt)I$I$HRI$I$I$I$$I'LIRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'H$TI$I$$I$I)I$I$JRI$I$I&I$BI$I$I$I%)$ZoP~W,orZq57+5:f_?ꅜzPcseJ/#>'Lrt*ˤI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$Iit.ByS/֩ԘAɻd\tC+7Z py%kn[ zU;,W[IAIWPms.?9߂?gos@hׄg՞t*3dCfQ1Go7.ZH{'joaF5*YcOm?;5 vTTαHQ"[S4tv5{BlvCNuC)nZ%= 2T]; .=Tɏ%o<\#+KTxoH A6x܋n=-ȯaBE'kpwJ*,sΚ$G\[W{P"+V w*X.I g*qŔO ڼI/SXLk'+0s%fYz1P  s+$PsNzȝuRJ 6fQY 0Јb#U:F y-Qނ⎻vTmv }ReF*iОϊ|_KkchxQs?wcہUrNMf5AP2ZyjӜ+tt#em r~ Gft L2AZǘ0cY+6mp.vaVW1;]$?˟Dsmkk4UxJ^}%ky{+IOukqΡ9oZWŏ&~*8;4M:lcFk-NnYF|%.65=&@?1*/"$T_U|+5SmQܕr3qsA'V1N*q|f',}6Gŀ=w@ɦ>JLt FWAĬ5׏QIXwoH3H&;ޡ5N >~YvPꝧ:TUv0 ƺVeE:‸B̔.pʹ~nU:[n_v+v< D^v5 dq$3 :əTkiDļyOQ1n7 w)mVLlcQ:-W[1V% >f9x?->gKk5p#W1\਼ >>f״:k.1;gƵ9&s 􎞐JD `臑$ *YxP7Gr-wV:7#ob&0eqU2цS(a@$Y6ZrZctq4%_s8^ 9|lh]@z" -| }Zk 3b XUo .ǘ ywP=,,:7tP1*kˇ _ Ğ4Rvy|40egT*?O}G)k wѥcb4e5}9X``]f_kqkY$` Ove0R!ۙ$nƁ!% yW~串@8±N#Z"8TnAawDߚV󂈴eLwdǧ$5 7{%6S#O؝L󒥏@$O-~-[OVPnԨI ~!]kXR 9$ke5q~dTnnèi??{hay%TvAnK%Us㸔!XU-PoE7ְh ƽi]ciX9*(>(Ah-*Hs]aY+*pfQտڭ]eAi_bHPXD:8pmG5Lۄ*ޮLjq!:j?1cޗݡ=-@4;Of+'~rv8@w V!2춝A?Eߜr˟30lJUu8Ʊ uISs04.x,x{y2o AӸ+/niF&gHfv!HZ>Fz Nai WM I2j h2It({$$v8Ѕc$2˕hSI $BʅvDD۵k3506=9ze\'tekݧe7&e,-!/R*iLGO]S5lQ*&i#EmKzMvD׋eX,]68Ƀ%s[ 4 B4 *P"C| -[Mv hPl =l#DHĪ@s~*UPަ R0x"ii,qQO@k0u0xOCN#;O3]3;R $`2)xL V+x渻B8Cn;Z;Rb;!INiIRJ2I"NJl{ZsfxPI,$0#HqԴqƁ'LrI$.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$[+ƒA?U\zq)cjԬUUs FR ck7Cp٫yXͯA漾=ڗk?TPMxqXP SSi`l6;^ԧjIJt2}Ǖa9/2F[pS]0{PaΆPI``3I%l5FG!b쵲,y{\Ή1NS"aA}-u9 D4ӆp%2e2I$(hzBr hdҥ#FRM.~ Kf@JIÚ Om˺alƩBi >-ƛ[`Wug WtVY\e X!pRMƑخrYZ" зv6+Pax}xxXsp OsX~Dޙo[CXH-*ug u!^İeHդa("47\ F@~gNѦvy[Z`caSʈ z*MwH&{ю剔H̭VOVtdJ|4&7NG<,|ެ2?c8DqE MGeqe)%$(wYL7AAYV#lV=680ז$՟KV!DYʨ73+T xYwV9m4i®_ZKzֈ쁸X8ӯsB%/i_Skp-ⱇ^};4wo5 c=5 ?/XSV{cH>$rf `+=|WVXKN_]GN%P|)xÞ#ј|(yØ~)G|_lio?AlA*@ǒɠeNF[g~e\)ݑ\z[;<9C)|?831>j8⌵;h'V"_.D``QɰWY'A$Z$9[3#t76>VRPmLx "G,yk (șAalpJm'CV 8yJ.vrum>uҩ׃kF yp!qXD4NdŹ K6ciaӬm'pCXx#kR9l}J6~e۶?NLY$;wwol{KZ?Jl'kyn`eG/Q þ AtR<a}eӸw{qsN5{*npN:O@s8 v+ꁃ1|R2! ɥ`Ǭ';ulqa' A {$flHyXdDnS$DpxiSRƾesk{F׍S2H=U kʈ*na-u5FD 'W#t,Y-h<?) 0χg_Wi:]^P/lP#תBKx~ٻ\09:l~gl-%S?8X >%Sd'ne`CCznY|{DkSt!c4k@hhO*Ъ0ybxxS]#G x=rɯԬ%IVL'BKRjT[X#UޗdXYg 4&AL|Xc cMuӇ֑>cjOC,a>c[0L CwXsIUiKsGak'.*{>Z}> ]zsEa$ZkZ;i'[\څ$&y[r{ '_SfM}sI g`{4'O5ht5p5Uq!ib ⧔agɹXV,xM*ڪo-)qo/}I?Z#P!Ä=WPyT_KJr Ey .3/[(ı%ɳ: w0{]>>Srk!l6V`{;&~h@XLHS1rY!dR-e{Vc#R2 Dc®r :y+k[Qp-cqI tGC>(7f(ō՛wNun>hvuX\qSDZR{|c^{5C}Ktd^+:=D[2R;:~U:z<FĮoq{,ڨ4['e%W&QKWGܳÛgPW%QΪ^+0~c5L՟ڱd>+duVLKOVح:T;kyWGcK䌔O*qgckis }Jґ2[rc_aLOus.`mݐFSZ Juu^1gf74rBpY U2eʾK*}5AI5h!.U晄=}bN(h{'P@v:Ic G!_5产Ϊ 2Z6DP}l{CY ]ך^CAg~gUeL0r*5kq*Z†tE^KĀRcNO`J,wx~%$h6aJ/+ט5׼98ԏhOUfEu/#ʊyab'fݻN$isYЃqoj[|ɝICen5&\֍|+qv5OeU ~ؑ물l%?cNkcWA {j6n{+Hdτc}9-&H_}vVv8H쳟]56ΟH ݍ[&OȴB>' +}?(Ys[ukN>\=-CD|~BSl.qJDDyryp36dcB@E<89JxI5|ÌD7r)k2<c##d 'I0k#/Yhv$)dD+&}Ԟ(> LjK !~lry|{vRa ̏y!.i3B]E_Ojc"KC K^A_Pn0Hooq'B?G0O,~h i=I֒!\o;Rǃ<8Fu0?x;1~3x=t:Ȯ{KUpk,p'tA#}X㼖vEe{^>yA #; ֵ9.čr[ߺ@=dԂ(nIUuOq ܤ$I$UA$JtɇBn1TZ&Dkx S4'RP[rHh#Yr!;hs۵ӻ袥)5Ḧ-P)5cn,;x@  'p83)wQ2'TZeenL}y Oiu@.k_v<&"D(Yc;dad'q$t*(m5kt "ÚA5 @2I$I$]NJ@^R `:'03 ej|:wi:y-Ĺ9榔&Rgw֒bIzrA<?UicH&c'ZKz~6SKAXR{G2Home̠M4xK32ZZBG%ISMxuy-{d{{ R}IV:[2v:@6۵'A Rq4l2d\G?H;O ͆'LrI$.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ZlxSkCؗ7RtSlK[ ·>&ں͍DV}Ƽ6Jxv>Z%0:iAXcGBKSIC]C'P@-6QUKq jSt@.wa5hAV})p`CSvIEH+nLj"\$Fo|*d@Ak ĐeK-?$&՝ 6dAu@֗vonjjkoOo rT1on1t )2wP^LX;xqdXxK pWild`vs`hIp쓱f^d4X8yB^[}y婠EK S> Pk\ABw3‹ukLOy]yLI9Sဗ zHE}J&rv'{9Nk+%BQtWTT8Z(w[em> ?4E3<}%m>q'iD+\Y`ԥ%Wo)i[@z.Y>̴&5ʰ!Yk &@iIL|I͔jOk:guXY D[V GF= pcN{oQ:_Q̡IEs=aK'V41t:½ul˫8L%|S ZXH:c7.hF]ǒjkppWˎ /TXĵ>8DWkF:"i糇}~ g^;$\t#V9*KKA۸G*W?G2§?s!ܙ%*D=ai!K1'?GIXn-732W56w~Y,x#UE=EXv IhukOe7RLß<&#ć(]m̢U- Jc1qʰة,,ЬޝI{?*gRݵ|Tﰚ u`pg*ys6EpVupp0:<\qR~Ywg̵0XA~c-"V] k?m\:çfSC宣"_]ZxN6b6UA->u3KH"#QXC F(YdJ紿pSVE4bc<Rk ;=g:}Zll_Z.ɌGՋo2݀zkLquhoHߖEHt\Sas< ;FM%[Сĵƽ?Bxj#G'xɪq-`<'T,%NP0!:#P#gX?hO]͙sO=1D'Ka}*q(Tzԭn5 6ncۗ uIۉI5qBs̢L/~br$bqE`=,=>;~sn9#~Y&S $6z\75hwL'.Y=:^žsKÁǠr{qۣ[jj3.;#VJءv-qCoGڧ.s[1F'8wjVEGy p<y^,T"<[p1  D^}.2f";B3U2N:dkܱ۟HrBU^7B/teW -k^diVwٯIRi.۝ƺzpn~f呕a٧lFVX@i۩ٵgX^:2L n(m̙+Nsjuft+[mZC~VDVxQH#U)dէSO{ R5I܍Z%&a$w鱛}:5qA< >oE,<Z=\Y"d 'maku 80YJ,;Ukuotp"NA:PkI.g"漉bg>Dhm/d:H` n +#: caAmmGEd1}GkzcU>ckcBp?5mUv% uo2z{)hcX{PgT֙S?:oO1Ӊ4:"sQԏ|OG~E7h460T1ےrIN,|.qkvh&)e4,$G Pa\_~(I'Aͮ̌{+?Ø3> n1_Qe#ӯWDUR[cMӼktض{ UCC+ېW#gNΫEO2\P\z'}Ⱦ5 95n=/2TTÇ.Tucvh{%]MmfI ,./i]6uU 'vtQ tI0YF_X7ô*󪇋T-=8[BX@+r84'ڊ^[`y!)4wMp,qϷde'} fMBcA$FޖNI oM2 ߢa*Bx]< ?Gu, #]<oK$~D>CVU WA^BhW#|ܧ Al|\i\L{u&F?j%:D}#*tZhxUHҴ&sx$dY6KqCAosFE ΨPf,|;cbX㐫)CtJ31 G5*hcvl&GzS cD_2va>ڤ5N1 z?G3Gq?4VoIuG6GdFSu}dNS8=uS5b9U)zEkLOac f-Pa[jACE:+*!>"㲔uohDza jI'N[|R))I&S6jI)5O)D86#QhN JC#ID:h7q=ۇ!3u\A2I# 3">i÷HJva opɁĨ$j]ACJSrSBtRhhN%"hl ;c֖1BT-h$JT\H #I:%0`6h&,x% a&`2fxS:E>I c$vV+2Osʅ6n''LL{|eLd9)1Vv)뤙%&<=ÂqNpKL xZj1:L|b< xsƭ 2Ouq.,nݻ^zS jmxeDa44@vO=@?n 埍p=mӲy=_z,~L:T޶ZxSi\*s~qY6dXw!hK b}1s[쬫>[/icn#w馄&eQlߵIwC7F籎x 7PZꇫ?q GuJXMD1_ vlU&C8(T}-aH@2L4l[v4 ~:)sH(66M5U6HKZx J&KK֙h?K^я\k JNp`> 0dFjk͌f f} k`x:CV-FN8nITIk71)I({&V* HG]Z[ēYgml1\^$7UdFHAhy. w8 LDmMOޣMsu<Y0O'Y[^RÕ$+G}A< pQ16W`xM2IAJI$JI%)$I2t)I$I$JRI$E$RI$I$I$IJI$$I)I$II&I:dI$$$I$I)I$I$JRI$$$$II$I$I&NI)I$I$JRI$I$I&I:dI$IJI$&N%)$I$IJI$$I)I$IIJI$I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$$IRI$I$I$I$$I$I)I$dI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I&I$BI$I$I$I%)$ZoP~W,orZq57+5:f_?ꅜzPcseJ/#>'LrI$.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ıΡtRk#l)&WqSէB Aiҳ\ƽqՆ~![?іPxןFYA}dNBmT:(Qm{x:#>]q]Vg`@R6Y[mݵPE-RseWsI9 LԚ5NI't qh1JH(n&L( )Z+w»aZ;ν=Tb8}[}Kp Ok(nx':&ȡkoS$({|L'S %Gj^=FDJsⓎOLpxpTQXwJRke)?)v w7R:d'ZӠDHjO j`)[XfNJz(ue:gZbg3S’C{w?L}"eokg'0{vAR|Dqu1]+ 9D}"&!J@""!ht;sZ6G;*(dc".._"b$}.>v\{ 5}c0'~G?p=53?Fd9!@,xlNj/bIߋ7?ohU#P.ʥӀuw?ʋU]Ukm;w.OBP]{e)'rѡS7<[灣O+2ΦZ`@[7dsFm-Xs cΣ?롉Ts0nTyaCrWxpZ8h|.4?iӏޝ\Ѹ{O_=?jͺi5XZ ;9W/dp*v*zAZ|ixA)kx\gm5:)m~!x&hϊS*}O?> OCmfjƮ>K@rˋ#!/pܳ6i>Jlq}rccd3ehVY?&FIáycwI_aھ̠ż">kdS9tw繏-Lp4F@Ue-mpV%5OEk'@HRɨdW-:sOitV(x "W;d3N^2\,#%e6ZFOK*ryӽ]'RNYUs6 ii &fYvA>KKDk!t_;k(aOI9AǎQ?WHЃi.ѪRwB1.#f~klw>gVͩ}@{SdP✈dÈ΍AxDsSwSxl\Qc]{1e{ۙ Xֻ5O7(d܎Hg=#SĦ Pt@. QjdυjY$i?P-hxex ᣀc'ȱPs9uL4=5ْDr8Z5AR9{%w_hRF212>L\4Jg(~@wU~ёW~']nS>wPȶ֝;̐WI).)6;p S3Q HuCFoSATD:N"w8i CGtúsX4@"QEl 'ri Pi0%:Igq k2Rʭo5pfS\stZR[!*I~(Vֺl$"C9 *BcTY.3<#MJ**AbB)(wIW/<nl{*^*vAI"ʖ$p0"{ge,@Zu'hm%#Xn! SV 6" I%J9+i:zp 斒I8j;"f4*b#|h R)d$Eߝ(e4-kiNd-yBuk?9V9[\Z6Tb3o`*HM)pf$*̤ͭﵣ_ n%@ӟ\^ΦgTS:}BD=Q8*1U *-8pZ#d$^;70y` `Hmۧ&/{:1LTH93M6ыw0q( `Bu{]5~*dV fkw~:*aquCTPK|â%=B9Pk{w?f׆̓@ v ?V8OefRKVnAzjp;Z.a_onj 9UöG\Ke6Fu uL9au2;$ HI$P*RI$L2RI$$IRI$I$$I$I)I$II&I$RI$'I%)$LI$$I$I)I$dI$)$I$IJI$I$RI$I%)$I$IJI$I$RI$I$I$IJI$$2JRI$$IJI$$I)I$dIJI$I$RI$'LI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I'I$JI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$$HRI$I$I$I$$KC<垴:YS.?FfL?ꅜzPcseJ/#>'LrI$.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$s|DJ<#vRb1ZEF Ha9Vv5&P4,\5f ૖G(ʈ$2y&Y2)I$.I#b=YG)y93!$@߉L.,!KA5ک^]}>>Kk H0"rE#~;ak i*58=ny{*iiɶ@.`pU+) RRkCSx%6{[ =>)2tɋAL:i6I$ޟuup%ƩЗ - GMlqRys+r{ ߔ9p ]8IB^7^'S`mŮ*,t? 4\ؿGS,c$#,,aLJ1:kaի ߨks?bt;ǎuQi-<6V.{맵'9T|4lZ! qj|;@匡(q1.Kݴΐ{+]|k7<eh[8:|&Cyk?w|ٮJskkhV;UD4#4BF++F{Ol![˟PU[BAB&w \GحqʳvypJ8yU@0Tֱ@Ռ;n^KObPCfjx_X9Z۽ gPG lc4Eaϋ܏EBʟ_*=t2rLgXPX1}-#~F/`˞>9#ŵ`ehQqkl?E~i@h%N8>ibaUfK]+wd˴nb4~;5&ō~]ͨh㿇m 5hDNFYk4+J׀1"C$&hO +p6a :xac4"Dф xu66}‚^3kkCē8rS\߳kysRV%ۏT7HuYA8n1 amB;J45G*6cQZmo)tׇ5x%SM.5a:(vhDH>D9Ӡ?kYcb!?ڽ"8d"YۘNOcޕc@|u Zmsw#EІR'9:erh?vN.[@R^U,8,2 Ige#nEL.> -Yy7~[.qOtɭ. ~Tl`gw~EvtCtp!qӸB ߟ:8z8wpsd}w#oJ'yZ ۑA:v%;>l34@hj;yWs1iqf*R2KHenPYb YQǗ[aLpg׆=]X*QsCPv</ǃ<t u ?[q?D`~IvX>uIFZٺJՒUč ~cԤyne"-DD;;Y"OuH i˞Y`5$|=D$]7O`#B/I<ʩc7;t1[z4^ >k?.Z|30?0|&{;oe:[]E}o#_##j_mB3+*Ü츷hĶg[!< NJ]x7Boˢ5D<" pc0 Jo`qsĬ:89sq~$4 G/ΪGQy<3Um&Ħk-8KUo*mκ(dK*kA,wX^ZS cUd~T7{ !Y E Q9;CFG .yUfUff90t&Set^?6T-hE:CD<>ZƹSaڈ p[' A$q @ #HϺrRPȑ:IPp:H>t,qm-]?;rqF]mn #X>_Ss)uQ3oio`Ԧ+~:`kD454ARv8/ݶ95`gU- x*ǭ~kLRX`Ќui2 \H!^;wBU:n4N $,i0%qhԀO\9Udl7X'S,&GbF*J6BKtG4qhʢZ= Ȳ?K8EU'xӺk֝]aͭ1%*HR4&8 {d5Kmfu A.˜v|ɜրY&8Kdߢt.;di ;|G9HI6*DFU2fpmX烼3f0P;*O[C@ '*f+|n"tp춧ƼJ;!QM*Jo F1\ |&)&܆Bd]QLQېQ+4HaܧBR̠T0`}RtYk dvT,յ"1J^6`hUl76Òp2y ʱPGi4t'IΪ%tF2A'HHAnix&u] *0[q9e8I\4hvZ"H;LQiL#35cU<^xn>F`,4w$Rc.jU-GD}6o M*6fwH='piVp!k⡌]HtF6dbK@q~ETg]Oæ@F;15Nx50nZ߉)YKq.4#{N:-2-hTq_ʘ7 kl6Lü=f5YIpq{w(WY$fTkrDؒbi";*uХ%OnDZ@.p td$tv wWqas ݋i',Ȫ5E;|һ~p^ Mn]in~2Ji!`9YuSYGvj( ;"<k[H$cE(hnybm:5N.a[B ȌieO0ҰQ6<ﱅbQYl9!W:s=r%@}5<^c?ŭ~uեiO<52W5h>DO r` RB5h۲˺َ)mp-"Z;|2@"t[pׇc/w46=6FȧG~3v( ).J 'LrI*ˤI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$KIJI$OElsCOu wVmbJ_9 {u*H44 72Ʊ ”/0)09A:"ba0i#th)"bo4)J06E$vNӤc" 9Fiؠ@_c_îUS9(J!J !2iQ)s!͕ K} R޲ Ixi E])03Hjd$yLI%7dRI$:dRI$J_;nck-CeR(x~ U<(X(YpF絯:mہ0i}6'oIդ0q;IS>K%r3:Z\v"UTO-J7*­ПO/*[ j“B]કkZʞUm|=ƑGoZllZq:35c9~f|'N߼ؔDil\4?D<}!YŶ@t69&H{{kx]i>桎IO?=lp3t3G<8~VBj*Ԇ㵺K?Sn>~Q5iav|%Zgt?;bu<?qy ;|8Zyx#o_U,} :-}/`C4<KWWKKOpy[UW=Fqt, /3#@)zir1&ri-?Iqed=k7gu &? NSaz-0H{xe3DjQ9c2-<VYMy[? ,Xsӂ?ն9y$΂E 14l쓏N-YmνM8kC<U-Uvt'|}D\tjKDDv DX;s5 X[İ;B p%Mq2rR7!J|ժ<qBi='pgZZC#~p]Ȳ:DX"a#eMh|8ܡ/~o r۾< mykcMkzVU9ҿ: cmq 6pK$;k`e5Bo1XqȔqKX )*k}!܆xUX#_5i'&P+@iDX Me#ˏʈkJ^IPNy0Q$gT N@kSi*OKz$ݺGd$ۚySNPrI$Em7C(IHJQ!I$K7D/ܑRLjRM#D^b'AN4%-ﱦ\%tTMBb9j4is)^HIhPwq<$3Oe& d8T`q9;d'xΛ4ײ+u{IWK2]MAfc*+I i'HIdL/  7nYd80Dhw ;vh͈Y4IIضU[Z W:ENNj{ Zy 0 k!<~U{ƪN)hYcq @"08.$C 4"ׄXknqxlt4?^uOphM@@0u" nKh#GGP.`-R> xՀ?[wMh>R}YQMVk㢲}#?y_.;\Om%D9xPIGi!$d !pHYZVI$S7n|pic]SRQ{w#^ԺW[x2UWH>+Q>iXrС0<!AXxlG3@g[ ;A<;"#B>jaR6ԾO3Ž 3] '02t4Ⓩ['Rl{X$a 9UCyݒRۊv4jFBK]{Xeų|Yt[rCI#:|IU#406COre$(q?%N8 lt鈞o #Hq re?/Oy2\.?JܦVI닛 3H 8OН'|H5qmxEmդ'*yl5m t < n R=yUKC ObUxUpi@J>°^^`uʩu\4kV^Ur5_ѳ[BY|Uvi "r.HPhhn(n 7VXaU'sq|*^wdm# qeķ]~XJ{g4' ^RR[k+n(~LD:Kdн&>'F4 m` 9R{31ӯ kdj|r&I:_k2>iɭ6VtU)6hVKb qKDU=SS[05Mm#sx|W rK:W"8HtݶKmDp tqOG/tGxI:%{Q*uۇ<8p~LVA_8|Gn3zK uy|:^BeY YTdpUm%6yK$cvajl}'cN=A'ipאv̈`On[_ q OV+ZNȟ+mHJ8Jȡz l@{.n:cǏ{kPʌM؝`p =!WxVWzVc4ch2L{A-#UY++?7]peQwT-poX4ȕL[~+ $|Wc-XᢒbrIRI$$$$IN%)$I$IJI$$2JRI$I$I&I$RI$'LI$I$$I&NJRI$$$$IHI$I$$I$I)I$I$JRI$I$I$I$$I'H$I'LI$I$$II$I$I%)$LI$$I$I)I$I$%)$LI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I'I$JI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I2I$I$I$$I$I)I$7g?+zˏQY5:?ꅜzPcseJ/#>'LyL2̺I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ꕠ)ka0C,ޕsZ*<+DX~J-0 ID{Ipphf%1A67P(? c%^@F=FGT4+K[^d´I IL(eIв7[[Pnk!6KbULt0l4=1c,liu#c8&e1c~O"S[Cuw$xX×;[V;\.L'IEmpI.XLb|Aߺ RI$H³C-pׄ:DCSI[#]W;Cp@^8'WFC@cHtU1 4bnA`^GGA ԚpGUXpl s,cBaiDRļ=!O YO("?@׸~F߸M'˞Zt OKPz9Ɛ>vWhh@_+@aXn66Y-upT!w%h;̨i;W{"'D}%o`.%~Dk{!K$F=DžkQ""4o3 쐅h=WƪOn"A+ϬuR4j?x+;71V2@>6Q2Nm$?rh션=+vYC+ֳ}hHy|iī |{[<ڲ,ly8O7; #d=86{mMiBtϰicXZjW7_̏/Gx lGW?Y襻_ai4%_6b|FVklg4 j%ψ'Op'w6YǸd-wpF??owAMK`8m3s ]~[_`(^^^`O;ɽEI5ùau-!qOzF~4g%!K4 Bec ?{uL0{6۟[Ћݬh<vs5Lk-ߺ;bn!li[}ۉN,'9w7p4 .О uv;g!s 9?ŧ1< .\cc,|@Y?^05?KN,Jxȣ>Z7isZ'voں^MYXKsZq9ŕ̟r;a#~  7Nhyt!#(9jJ̥~f\rfװ43>_n9]P ~iCik[0%ڟ+ `qkQEƺvtWeO7`>YɓCೡkbL4W?ccq;Z y~,O+eXpHbSi%$Φzi'L@16[-{ KIOEVN2ksL5G[?FiY<6ܧ7 qj#ʫWmq5Uy%ƾhQu}*I:r)P$$HiDA )I$B9 -2B#h0H R$L(S7eMOb~I~jN}4np~W( G*/GGۋPeA38N \ѣa9Ct^F4| 'aW{\ꉓ1${xp_]RX@Іd6B}/$D|>ւu>I{Nz*yLǭ ,umK\8wP!A'8ʍvSG~I1@093g7.Ʊ7R ]׼NTuû' qO^`\ BX5I%7<HK>?&JShÝ* 6#'mxSw&RS">i&:ម'lvQh%-ٷo~/eGH|(p%J;L8OM$Д')I$' $H6N04pRF)IMCuH&#9kᨃ0f;)mD(ȣE6`'4TMhw=Ȏ?MF8=F;Csk}MKD;<7w I DS}as-$X vZU0mqdummsZk5 h$-tZi{Iw ] -c&AP{{n5dK?Ul nY3ڬa3I.)@ K_q)ӵD2 43sz^EL٠33KzmJ rOduNwKI㻍=sjll#&wO>@zr5KuipJݭ4%E]u`*mm*?g~ ڸ&s\z@F5FFhicvuUՍY۷ͪ/ߓ 6AU׻Y?D=o3N,B=+4XƓߟPj3ĈJDS$ !/e{StХn;3ǒۗhi( 5ʳ-0 !5LQdI)[jp1ICXRxh2Gܝ~Y/kZƉMLmmS6N& `7?Bw(k90'NGkqaԃ"cC,kdPy<=ÿC\8 ?K̫liL̟QWrrt=Z( j5ê|_YֱOxM}{B_Grmsn%6P̒X8qzͷ1@E=֎N+\-ii:@ߤ8D/wCV@'Tx@ǾZ no ́Vնߟ{+#V̨Ѣ" yU[J+-FLZހuqzЬ ip&ؕ)J 5dm(=0d'QGjLf#I҆,~ݣ`sqp*i{=1.kǙZ=]\bDnN,l3kցSk>i j76*fI?M ƨdTY½eVz`6ib60vӣ;MPf:|BwhcX^Zt- *LZ ocl[z w'+; ,UZ}*zVQ1VI4I/ :wy~<1:mْ,?EUʪo" dtC'j}v;B IvUq2I:$m<;M:!n<5H[hT+7NᷞX+ |7O(AT=yK(P%;Ьׅkd0+Df]˶6|R{SxhR)BG-һ<?5Dov߬X83]([DC>TcNVEuTLFf0UHs!6ρ|T-;c666ffkG ;.>? G~6ɟp#D`QkĔqӱ02pJtcF=8/cd]3o.Ѵ"i ss=&cU[}lZ9q]gts )8GEn~U^4wTe ?jā@ cAcc 缸x> knN> F'.JiqqꡆF}ĭPꪣi擄F#\[, a)U4:'P,|4}ξ\$$Iw}8wmIPgR{{RUf{Gd6דkB UO6!}A Ź.c&i#A:Yg3 נJ̰#}6!Xē<(䇺uxa. dwo!2{ \w'6ַTU`g $>jƴ'rEơI3>;fTk# 9i4y *.6<+:ޛ[D3Kp?%zYƤb:^i{ yhqe .Y̞nۡn p6@\hVú,KeCHB>u^CkCYOPYÂ~DCZU]aor(J K=(Tp=…AG" ([J:'U7kr|Zx+!ʚAI:+ x >(ͤ`*2u% ߻THNR$I$A I$$$I2I$I&I$RI$'I%)$L:I)I$dI%)$I$IJI$I$RI$'I%)$LtBI$BtRI$Н$JI$'LI$I$$II"I&I$RI$$JRI$dRI$I$I$$$I$I!I$I'I*I$$I)I$I$HRI$I$I$I$$I$I)I$I$JRI$I$I$2tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$$I!I$I$JRI$I$I-?+z7gO3S?ꅜzPcseJ/#>'LzdVeI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$|7E11^[`9 x>\ߢ,L6\Pkۏ3piԍ~ /L͠GxjUG$ΘӕjRi*Xأ(&O qk%'_ڮK@RR) {DD:<ͭctT[]Nu{(5Y$TK~$Ǻiu"C{45$s(LTb@R;MPg+.9P<)nxFF]ՁEmYScfeIvtsUO݅g@̺z\yH};_|V)afM"K.24k>(_^C;T/ݥAOt[ce.zQa.hsI9A)}q5/Pv4MVPB;lއSqBOuVy`GlvX'3jmWJ6xI4ٖ쭺*&G)fџ$j@Uck4azڜq[=CYt8eNLъ beCftO ye1ߜ^_Na;)eA`XM=`56Oyua 1+i5]t@"Li!wJ _aO-Q>(7k}*ݦ(bH&yB8b>XD׫JW?ϤugO[g6]p2m]Z.Kj%;y,kp|^^>*8v椉浱yh}F?Qy(us\~#>Xz 3k/ @P1c}.PKHnK( 8(slewuO~hb:nxos0GF#giRgX..Vhup~?+. K N(qkÎl:IKT/?WĪ+k%$<-W |V|Wokudهedf39ۉ *#.Ltx-LX 5p\ VA ?*h@[u5þB@_.|ͦ;:HW$ȑE56k-=?! h;z0ջaDuٶtYEL@EmnN4<5WK輷i<5AWi{qq\E5yUʲI"=Ik8ېvvF%o{Ӡqj@ӅVyd_V@+PYu Q67)NS+?2`A艝c D!kqSi+aFTs%Ob 9Cly#I$!w* C; 褒LL(SV.u!K%s `]"҅$E왁ĸ{]\-L Ο5QZ9/nk rcwD7]2D \1}9sa ۖ㨉Ԓe !,<_}#&*UЯ@>_P6ѮA emoP mnX>* Jk}s}~rY4 4;N$O$" 9}P S-0 4 Ԕ$'-ҔIM>`=駏){8NDw.S?2DAHn}f;I앩@@ j}/- 9_w;N0huIJ׺$D1'N'D|\Fhq1J:kѦ#]5 Ut_^ԈL:):כ%;wmgDZ`h Gx'LOu&1;}>}swkvӯK`.-y? KӹR /T\TBtP4N5Qg}B!4$$Н$R$%M ^;)bzbYeu\փm+D@Fb;ʑtP5Q=tnH1ppW6־ \tYR֗hO ͯ$9kI?{~aR>CF$QU{cG.f9c @t(aȫƪ=eeWisB4 K!6LJFq.L3܀P\-qr2m9?腢偛׹TP;:&<3e>a M:-i&@ž3'h3> e{\}YMӸ <&79ĝ>)hܡIBx $w 41sv?9F }$L̐FsIgȹ"C]CK$HlnqYLxF@:>ckIvH(Z 8i"AvajF%H52@Fw[0`L4Pڻ6 >\)nuVex. FJEFt'O -qirhu֬H0$|BGeȝhauECCXmH)5-x"X EjR&ꑿD;aR--՟rnK6+ٿ\ cFDZ!gBM1GSȰ9TI2#~of[qL3Uc {pow(hL&;µK@vO%)V0ZF*d[Sc:uCڐCK7#q1Dܟc F:].G UBۥΙ jn;diMmɀkkK$vͰ.n@q)=+ӡFIM:8]I5ctQ(Pp/Ox#nۺr^N܂"5CU2i61~חk=6<3OP 'BZ$i{t'@ Eg#bc6\eekl=+bkqmw8܆L.jO0phӹ;22B|&q;/[k[cix&<C7Z:$h/Unp$4J9tq +JGFF˃5qTc0c 7KCgR&S~ȯ >*:1qu- IrNvMS{quqHUĂJ{̚'ȡWʘ$LU&:[q*c i($ XGشgWIX/XʹO|4UQs]ke*5!):&Ea@opDNRG,ݖkNsOu |?N2Ie# QYMY o#X$YhWk,w[Hqn4T3s(ҡ`sƎ!øCׂKƽ;A]]Ad:T3><$=1SS̱%ZR a5> 5 y4Ci 0d"ünuL\ݼ f{'wc_T]to<-ԭ8#PZ)s ǪWXtD7ֲFgݰA'-!Ԃjf&$Q.3qiᖘ]=OBsp[Lϊ|~u"r+I$v LfB<'2_iRZNE#Qʰ: $W+l5PW <*̧l`]|UQA`rbUrСOR T2r_4($B05M&Q nwn$W%/FG6&N;N`\DCx)U@@xZ&Lpp"Y[BY%ǒ+#vOonK jApU1uVcx [>nEW{k‡#Sٓs}3©mU2_)<<@ˁFݍy110?[jzvY65VA>32qbk*P;CT2Z=Dž> $Uh6 qx&ęiq_TVMmys L4iKۯu/ om$C+g37U~*a"fV#;(2r 'Hu,mm} pZ~2!yNQ}qmĵk#lwNmr\}es&q Z{P8d>eWvHkrY?c"wZ>IE3\ c*!v8HRT` I]ī(6V ;˪$Do}6#ťI>*`LY⼆cdiS-wW},w$,D\ UqrŢ|Ve$$TI$I$I$:dI$ $I$I)I$dIJI$L2JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&N$)$I$IJI$$I)I$bE$I2I$I$:I)I$dI%)$I2tRI$$HRI$I$TI'L2JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$$I!I$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/a>'LrI$2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$#7't:b&'Uvэԑ B& NjNE9gct ϊ|K6$J7On9}GU;^ L²$cHqF<]_,<,gd:<~rS644i6]h1whnEh{ath>( ;i!*jY5 Lx}ɉLʔ+F)fd^|p +B<?#e[EM^ xe\DCghTo\O!H9ݶL\$U:ȭqK0{|ZC^Mrq`![}x7MXAnv(qu*km|ʅd4@hWWjkϥUs6sky]5+W:s=9ЏjLrXǟ(%hG@\v{G' هi*B@eð,.d\pd;*uh2Ǜ}ǔp8]y+?;-M;I{8TP8NF]#7c@:hwEﮫIj;S++=>/%̡%t{ TKGRMz$9qo櫌hx4E1LwR4P&D2ͯN?J W*bx5RN\^;d(xKk)ӤWɳ-͢*ؙ.ųhcǢA FP`VS \xXpfS<31,X|ĦF^lq( ˠJȬ}ݶIIZҝTw†YM2x(t DdT5ӟ!xg$%1'ZYI a*l*.*uOju*$RI3v4))V9XvR' LcNPcDf2(Ծ\өUB i@$>!Y&xSXlЅޯqnӪuG@Ͱz&`O<І=qHw./Hԫ52h ' Jjfo:Q*f$3fas` D:yVX8i@8}NS$rD/c~䦉"E\"UbHDf]o>ŏǹm2VpಽpU{"k 9*kOj aڥ#wQ7T4OܬdB|` XֱI<|=_kVu[w|[&9z=X!1ĤV]G+IyvDDHu*42oiQO)Gu ,;k5#;r6n1H-Gcˋic>!S_̍87*647S(yB C5AגMǗK[1ǂ.4Fl왕?FR\!;Pe>>*;RڤJe6Ц&7󈖎QRkkvVByQqgISs^,oܣovSC a3f4RGQJDWOkvMYя$ٗfSnpvx?ZDjKU6JYjcWq<B8a^QvuHV\d *k`DZ &ⴒتq焝p`Ԁ1*v7ccPfP{@ \gJNV+)c!ִZdb VmX16\G`vO* HVQ*UI-b?Iǭ\$"KC͠΁dp=5:ㄸlXzHQ`dL}i g(OĴss,- %Ĉ(܋0y[+,ixkYBbG@d}16-Bb`g.\\>{J$_K<OOs ?$NyL18K}%  AgvʓI1>h㠁Rs`4OF#[e2~> ӭɞI(Uٹp{aya?:4YaQf5G'/|k.UeV xUZS{(c@ ۱S?gH 5ӡi*l $L_hNGGOTZyvnƻR;~cSa}$1Yt@4:Orppy&-u:jO zA$k|T 6=uP5&cO4"k'! Bd ŧu^ g&?c$ Tq5$[<-'k32~::\6IE)2_ F;?`GR=Gk{oG}.v>!/bHԩ#Eե  (g @+{@h3O:|ht1L֦BI" J h%V (p"T# OA:„ɟ%(R'qz,tuq'hOޞ9i'cki}$ n<8h$L4*Ú`;(y a4\`wQ[5:nB> 3T$46XyodBi!;dTIҋ鷈@Hp?$FW>=-5CEp5vd8 :P-M0;opCX I-zshUe:Y@Ac%=kiL\غڜ8 SPU6b݇E6@:Du!N)L &,> a0tvT6^@s8x)ʲK\d('ۺBslkl&#DZ!)HL5]TŌ3ILNCNA1]\E-2\d*7 N-#H?H h򮲢fy-j NU*/۴|$p'Zs.tXsXyX r^!q"CYHPo{$-:N6XSSvMVw*V2D8h\bRAx:j4i;t7+E8cuzO2Ĕ:.hv'ȠWuYOH2f fXv;qxQJ8Kжlƻ ?ۍGah"8%*,w^\7Lw 4<'c䜑QIIuyv~ 2$GxMp}AB0BiԠa{v׺f?ǫ}J5JfI(ZCC~UthxS}r=(L 4%u٣CC(L\>}]=yN{c(jɭLhAY=siCN-Z o 9 TꁍZGlR{ nP˔wO2l|j7ӡUl<$I.I&I$RI$I$I2I$$I$I)I$dIJI$L$I2I$I$I$$I$I)I$I$JRI$I$I$I$$II$I2I$$I$$II$I$I%)$LI$$I$I)I$dI$)$I$IJI$N$$I$I I$I$RI$I$I$I%)$I$IJI$I$RI$$IRI$I$I$I$$I$I)I$I$%)$I$$$II$I$I)$I2tJI$I$I$I%)$LI$$I$I)I$I$JRI$I$I&I$BI$I$I$I%)$ZoP~W,orZq57+5:f_?ꅜzPseJ/a>'LrI$2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$a?k*NQIk1ۦ{&k){tIu6LGt"[;9D%e!&a|O}PI{ZLb-jN OSg?uHugP$ϊ%5ߢsD[ wm:'xxRq kT\<)jD%ht1\osZVd,ll+2f{ W[v}+!Q %ͥ́><*tepZLۺzÉYʪf+u' }>q ªÍ H|T3z;~Q F\Za|_Sm>ʶ^u 84ͷ.:Om[JE $$U iKK SI$ yLE1:* N%p 03Uz_I&ǿ>"Ph{Zܦ˪,x^ED%Y!KA9 U8=Hqn+56aC| 2c`fZ'̧9Lmcf F]<J#- *8ّ`{{'wNv)p?pT=6'MHJj\4 IKb#L*cȱ -IRlՋ\4_>ƼkHLUeLh_Phhݻ@t6a\ֺ lt) JvȟhLXw@$wRJ_ 6|Qox&T/Dؤ@h1L?u _Q`xRaO(Ptd)~Ԭ{#cH b,)3Ŀ;]1Ă~ xC'vZd+ͳ{Qntm2O=6ݴ &ll^;+L&O8s D˺ 8Q)IGg|Gy dA I"VͬKtE;)])<Ѝ[i %H6'T8sţx:O/Ӊ[10\JE*zݲDԥ ?TaZMR7&܁ YsH Ǧw nHQsJ N]}!-Cx4Jm6ݸOuW|7Ah7:\m&c#H`M5Iˡ I'Z\Ua8-0s"uJٱqYIniCES!/T$ gW:+p`pQ:N-ece.a{!3p%j+`]Hf'|&܃]<!M5 X H#ToC$:5pu7h'K yZ35UP@ mg JאdZwB>5n֍6V֙ C/S%A*'D^Z7i=Hw Zͬ4yh:Odm tAжbZ?& %E'hĘ" 'NÅ^NjN(:;ORGNU]V^$BlHJl1\ ĔŤ&*ax.|scIla 0Hܥf;p1.!{K)۸I78Z@ :JՖOCv04Pmݵ@(lԵŅ$ϸX^@h<<`\ƀO4M )CDG.%ĸVl2. %He}G|{vqV%]ѧo"hs1ZFU@i &mf \49CȨj5Kֆha7u_7$NP1~;ŵ&\i2,'$e}D#.JODu Ș;U[[w+9US̓^;Gbo^Z=<(?)W ]=AJRRȵيN S'$aS`tj<l]Y^[V&xA:\ rΉ+2vNG:ܧTˢ8btϥK֏q>}:mʝO+/o3GMmdē%^t4r9O%ZZ׸KftRo40hfL-cwƤ,X7" h;]-qC@{/VڎL:]VḂ庺a;{jSc;W IYY%5apa~:xVG'J!ݜc^۵Ps1-nsn$B^Fiʠޟ\k$Utzf4GlEp`70aD Ot֖iH1?HgQ矹Tt¤+"C@!nkd8U.?)[Q? %Pc0eLjEX:go"9Ӱ(%Uiy⥿s\Bq |[0uֻ@Z)bߋhi!t2K\}4mQ⼚jڸdt4&鐆O M;J11 hǧK)l'V5D颲Z.  X-S. R F0F)wcM I)ˈ.m>KNp lc?$Ij hyD 7U6&ϵYyFTXv$S*R6tWV։S%ĪuCTʲA:haĘ*c9H;TEq==I:oc~X-:iMT&5M"`Iw;8—TPo1Ђ$rQ6a,oT17pr|NPJv䡓Ja6 !BC[Y ƄH(tLA(Zs ۲l !㲘lSǵ,h-=8*X}ѐj>^΃*6b2p{MΝzo>V24b?w{TuGX;Ul9rqc'i,?T5s-9P?^Ge{Ko,f{5c؀yH-'8 JD yl?{zf&+z8lJLhn$8qid+*xBup`%&u?{{DPre:6]hVIcƒGVTkK=٣I:?Tt}1ÇqeLK@h\9En>a"5 } Zyi?)INփH:| hDY?$cݶ4[cݪ>3ṿ(A6|SϜ*LDVh{^v$*tӺݿq-k+K̫aNՇ7^|J$)6 f~)v8 vX]Ȱ)S!k HDwX~<-6ClF/64Mpjٖ,l+vh$f%{uv~Ve8p"z 7sN| Mf)0;?UEc.`&FoFc_ݽH%2nR*] ƟKA>5EGS (FJpJr;Dj8@͏- b֙l|Zּg;h'9~f~ܱ\N?elGb}'OC{7֫tiǂ8iX)u$kGCyDf+\~u\Pu#fuh#t{ T:eog*y c/#oHqF1Ŏc1ha#¶ove/6VwkWrj$j*e>E`ݼ򓺆8^zeavT~En2f*rGOcVN^HMpW9/fmγ ?GMmLt>ȣn W2aݜt'k 0<֗-1Ǘ'O| i'+OCP|?G̪;{0fChpƟ?"a83eڐtHfMۧbx*CI<o:'u[>Dc@w ~*|;W\6֐|G9xXkyo#]*05t&)h4ڜ#bul8t CKyABw=GpaVƴS`s3 Xp212wQ̸ez; 8Vl <+Y*pEW U9Nuv1Ęp:|K8r=RucߊNJs[Kt mmX`wHZ5 f%䳺O`-V7p@|#PT}[E۴'LrI$2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KNzj;_s?k:AiITXߦJƙh|R:>-7Il5&H |  O*M!r;e1k:NDqw}x5@ZA tl59Y:/n7ah,g!"':NF"ל4m9ĶxM]"-$wM}׍E+xvxh9h|R5<N ʅeFALTZw U%II:I&.I$u ! TnPҒI%'XNu){"Ѵr1i &*"@\">P S"4 T'MR||ӱ@1ǂQ$9K  0]e>JtK_@ǘ@Qֿ|L$0e$0f=fPH47~A>$Rh)SXKk%E'yΥ'iX%8 Qa9Gyk[@UPk\L NJ.L HOВtoU(yIkQqk5:AWp:'@7z*UL4/YQGT֠EX?7oQ.[).5O23Rczw6ʊ"^Ϥ"<žˈߦY4>26P^S !2Kn:6bgHnF#od lʲ1˽?ܪ%x hLqqdCXQDQtZm4S;V['S̐]@G6,aZ SE/1–UBFIUTY,pt`$vնTӨnq*M{4)YCH]iJunc[G##Sj0]j\׽lwIkm}kRX B<Ԙ7⭺:'慦47*p% PᨢnM 1rv6RIw&܅E&b>>3p h9=Om؀{+QRɧ} ddNKsv$&kt<e۴fVvǸ;υ=ۀ/݊yZvsaXF^Ux0P fe@WH+]:$@4YuUr45 5+*ɒ`iB 79k#jj <=iwKH_f#W3ʝ[{̀v2IMR:ѮJmDϸɓ*RJp5pRmy}ta=s<T?/fOO+#IE=y,:0ze7IO0o=}XIr|}dUbWL@*[]@s.wy53_$BsneF}d;nTA-s(PE*deVĄj6 :)@߄~ ]ʖ[ߥ()n`k{lpD%c.5">::FIxH)t {7 ?oI衰#S"cps * cO܉薁hOޫ rM;-gien-#IΔmm4/S>:AMa;Nī`@>FZH*2UxKdC4IaXlaP=8w<Q^|Ы#2} ]BFȋ&6ݾZ Ugb[a5jGyU3K,>s;pƁI2 g Nk"9,qr&,#OQ1c\ݒIU 4LI˜gU=;1uT3l`-_klض IwH*"[؟Zs-VaR×{FڪUc[v=ƾ7׻S.{쫝B@ mh[ŨxT`uyVq@"eB6e\?vnu_[^;j{*U5Yg1쥦st4Qs[t+w`5gq)3w GS #-p5<q͌o>fdِ~US@0K;~{E, h>mp T(u% ;TsۅK@4ngCl651?i.!LDNg8d<$"JDn:)no!aE=#@(nʭf<6;aq'lN\eKhk6S !(t*km? .'^P&2CZf6A&Umni5qXӺQ|S@7NfeC5o]!jJnq:(:HA$ARRq:)U^UGtkk2 e=ON=[d#czLKKsESqs[확ad~p^P+tNɍu*F$o~5;<l;`LlƂݨےsP--izrS\55& 5= u(ag;).+tVm%YTzhж<ۢAT2 t"Bu0;I8"sa y=RI=7(Y[l^)P`h`ԅX2Tɔj.}}+Æ+m\MAWͷ 1+1yK!ѧtjS`W:mUmk/;;A*ܫ/vѠ:@Z47K8""=4MM)Ak p«$$ib"R <ti18'Aq4 u%8G2|5Z!uU F&C3#-'pu d3({[d8ؑ_p:n [+!͆;N!r1O^ZljNxF2uar'vQp)R(^]"9 ̦̑tOfѡW$=4}! iy~A㣶U{f8a5vO! /1Pe[D3{:y!iRx%ˎ8\L$H=Ιy=~qap"F4piO B <H j綰I&:yK{AO9Iה53nuC/ձռAnHO)_?J4q擲ӴI~JV#ťVw w OsyXZʆgclhtd<Oa¯ś-dLhi ž>) X߁nJ632L^ [Ɵ+sq, Fy+Mmi/Tre/M{B,,X`!Y>~qӺ!aǎe-1c?a˓'xJ_ޅp 'kAN6kG8)]k]7s {!my_$4xHB=׷չkPkh$I 4T7}l|9"x1ǖeÓؿF??cչ{OO%w6ʛiR2qַ]>'ENg@GѡP4oXn[!sel]eޡI>)G_ qpKV+,-]W8Ga-~3ZT١謹nCv![nb$c8 G cRM\jEGcY:08AtnF3MppG'{QG1~b^ 0pڴ=rgswP|V%01$RcDwu6h(ܞer1~1o{%ܢc=[,'Tjn@Ch/gu.+;3<;O<[inTY@*b^3HJ܈f߸[/ gm,A2uRk:HKu]P w l|VLrjc۰N]D) -qB5ײPi:y(;fsfبzk˞w!:ƺT́* D\ݵXy c\㵼_VQ~ m² :ۄ7{xPRN1MI2xI$TI&I:dI$҄I2I$I$I$$IN%)$I$IJI$$2JRI$I$I$I$$I$I)I$II I$L$I2E$JRI$2tRI$$JRI$dRI$I$I$I%)$LI$$I')I2I$I$I$$I$I)I$I$JRI$I$I$2tI$I%)$I$IJI$I$RI$I$I$铤$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I&I:dI$I%)$I$IJI$$I!I$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/a>'LrI$2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$HNxk -AZ~wŇU$v:b3cL4"bi>Οl~nƑU׻Rf8O1 8䖙DUJvv'=4zn qЩTM΂TqkkU~[Ci924L}& lpLnlV Z AY% iA\BZN AN״$4HbgTI"IJ#6@Or$ra4\򘱭lrDs7^!R7tǃ0@tMk}gs~ 68lcI~.hv]<('h)?*LG{A&MSFП潇gPe%XN@:=3 -֒@&4A`wmJn=RQD0{y)"ZINSAM^rKUH5< [irLB/,7kΝvxXnPBwPwxVR쭗NI$a{m:ZA0vAJ6X+iq)(HU3Ivw*8W[&N]f L<\Llh|@&^}W/Mi}6'ST:mM]N:&;'I0Z8`fW={Ɖq<믽k}VlWkv9rNUģDDZpv(3e`{CZ?tvOP6\Q6fmD8o~9[  G}-.2Ou,ƫ:x˯McdגR-=@.̣ThlR:OX B"RQ$G Lg ;=!3IL|*̳!ܪf;i)lu OdPE]hquM$܇sM%bT Lhgڦ: ;q;/$2\֏54lDQm}!f0φF+)8ځ*l,1; u(DVnC^ΘC1"G#5!@%4Ɛ᷁)Й?(<8weA$R(>ݸ!T&?͂%fGTSYP^fk[`?H;wx@cXL^I28!I9 uMJ4:|5t\<-<,klm̃NC]Y6n~o+l_Tƀ $A̵a>.܆ilg-TQsZG!edh ߡFj(2P 88MRRgPFH:%yP5gM!ibGryLG)/t4JS)1:+ < UUʷhXB6H~b]Ve:AZ־8_ds#}=F"#To ݬaJa<NJ_*)6Z ϊ3{K d`D~i\ m}StaqD&ΰ<;cc"JѦZ|5Fn8{8?'dutj^W`#imo/&$Ⳮ~KQ퇉#E4;@W-KN6uK /'G]@[q޲;Y2Ǹ<l3 u;! )e>^)n+7 eQ2Z%ÄP`hP)Œsʎe^{ =:<g֒8&Q`$QY@Ճ NtQ7mH~gT V* sx|O $)<7]b'@*o{y$Ng0Ih'F DƮM c5 >4ݫwО \<ä&z0e;Ԅi Dcw8MP$@%D)BA—mhđTOnPBFNQMv5CT>Ml: x55NPAЪn+kqoW D EI<6Wl'Qr L?Ahc~lVYv9U.C?EC) "@ SM搬(U:ߡKxSs{ %.g6)JN`p,|O7mjlr0:=aitl!^74([*A ִ̎0ú=٬\[ęҚSJҤ4OJ;"κ*|\\82x1RA #C#neZ?_֞_jvh_>M^ O}'r8 moRU촐D=Q}#>uaoT?uߕG#QTe5rP1c ZD(ιA=NAvTlNۻf;~Rӳ)y1aNRh>Qv :B/ dE[~EA_7-A NptGlsU2l JY{z{TЦ 2)BP$[1JYxT{L_ǰ;+H<,XCЭƇ Y#wy^{(w]9-5ß5dضlTd4{I'XgRXZ)%KB]`eUjB¬XN`&S4NDGPGP*m`)Xݦ9Pq3'DƊgN!0edONߢ*<5pQQQ]=ut`RIX;/l..LyL\I;5COcteHpW sctN p{8',xaY07rM w cu)7\өSR55o0vc4 h\VG'TS} W?p5v#ad mVm7w]"{U$ LI$I$$IN)$I$IJI$$I)I$II&I:dI$IJI$$I)I$I$JRI$I$I$:I)I$dI$)$Lt)I$dI%)$LI$$I$I)I$dI%)$I$IJI$$2JRI$tRI$$HRI$I$I$I$$I$I)I$I$JRI$tI*I$I$RI$I$I$I%)$I$IJI$N:JRI$I$I$I$$I$I)I$I$RI$I$TI$I$$I$I)I$II&N:HRI$$I*I$$I!I$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/a>'LrI$2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I#Ph0TR'ImߋKZ~^ 55+xHpF `kv:-'Xx0GA;Çmѝslqx' tòj4R{E 4 IRRO|u<NQ +JOtjRf^B鉄銛-u6Ѥw?JKdФmk?%ba(# MAEzeH1M>iq#Y*O.i, :NJi!>TD-0yQh-Mtה$psK8IJ$O9 .e.4z(m$CbJ_F`th~[q^0s_5*.Sst|[M?Ǻ͎S&-OZ?i۹“MsRk}-0 6G '̥U^B`Bf Xs1mᬉF io~m&ȁRM:áqES ALtR0TN!,cw}=gSVvhO*N{Y\+C- [H&N8SI엵_n}.)ob$Ph$s%ҨBOU $J]TLCG}]F[P,.&7u+H 'h604:)O=nh+*ٸp\ڝK`k&d F\[u$:g]#R.Pn- {۲wp#,kkeFX!5K{4״U"N,4lĢf8S׆8'ecXΙ=;Ͳ!DCqi#9z.:4=x)KdujZvӴGo`Џ0U4S.xLda7eSЌv3(]T N,BO [>hLi"H=#-ɷ Oj[RRmз% QvJt(SnݤPJ '=վy۔xp0H^E>hOtྷ Gw9D$d͟ Ldeqd 춵uSkNON+`~iZ[OtTQln ObfIx f7b{delĀ|nO1gjcmܸ1c_V!?TZ4i:zuwW#8gM5cqXwنː]dA ɡ}6U2nqsv5H7v;`q ZB(B Ug9 o{X\I?*~ /v!08P -pD ^6DIUѸ̞e<n˪mcG$JXGAmqia_O$IVx|'Y]o?蝹-h%)exwB:A kHp@OuV+sc5 c̕bX3d,2v׽'q&V=O!gXQqD-I:Nk= 4~ YXD9 RrAi@-L|4?ᄎ۸G:,7p)kcpEA=Ø&|tEcyxb4V<6UN,hYoYիD3;"Kj˴%Ec>h@ZbkmoT/m0 3帄bG\Lc#'ެF碨dG tr4T[QVƀG YUqc DMiüN+1=ڧ:;sK/#}:*NQ#b>փ;m!gc<@qLe"/'f]<a2A ͬ9j/O5J؃٦C-h}qvMՄOr / 1Ba|t J:tyDu&S[~ӵq)֌ά=$ٽ@csuq*U`X6ySoH-۲Pk]n:"biRR]a/tÄrb0?y܏u|oQ&۷n>t?U2/7%5Vzm qC@ -?/tv[%&{[4?h:ZAJoy.-{YkC[)=Okg'8e;jnChUnt'vYԤvonW2WAH088{x+Q2xIaKc.sDj049ߍXl~\nT1hl|np! ̀رsDjx?rb$J5NY̟ЂG !?{ǩSdr: RB,@sC!yvR`k `0!䙼oas}iVVAfCA1:J'T((1JECX5l43='{!ΟI>5 Hu;Bi`gYEKVYR`n)uEh.R}$v=>ݧh: Oॳ]${(ȕS7>0ݣ@~,7 G#z-5zCDT7k*#lyd5ꁫFOd*hn+[{ـ--2Z2x:Rh,M5zfڗi1p*-C&xCֲ>:9c}^RLYNN *D`X9SRʇ Tv.Tݓ@& D;%}G4QևS_:?r4ϊ5'xZC#o 9 >^$KU Hk\X9쇕Qs_<s #vѡ/U g*8G]K飜};>3}WVehkxViqeoGb#3D kD !6=aS䫊)pUg3Fq~huJ7Xu Z uwkgU}a[^ХexC\$V'q=YLFU8fIЏj:~Eh^ZֆU-G;B -3ۍ6evDJėneò WzV!VdHU(m#Q MO ??'೟ic8hV5DrENvj6ς$j!>PGP5JwT5=lühG!AAV~c\ew^y-2H< f ,{!VolB/lYidncU ^X÷Jo/ FS2`T,X(GC l\2~$KB׫q9%]¡ukˈv?WC#{lv.|iO2 L0ÂS>p̰:GUAy*$(1#Ed+Lh:~T4{VK"[s,dD}cKɉF%K .!0B/M5pUwӿ⥑nT BZZ ۑakֿBױ~x [>*wW^<¯mAJEuwR.ʫGHWK=ĞGEF)tU{pôZAFq˦ HRл]DjhۢvN!X1ߺCE8&95¯s[ۉG<[^}L@͵||<, 8] j>=NmZ>( M1?/em\itsefn-$+ &ƍ]3mzFXs#Do&ZQQO7 g++i)Ni*k yRpC>*x6T[hCôxr =uv,ע3,~EK32uWuD?V@{dc_N=>),WeE#ULn=[6-{k?!(^y?rsYIߏJT.շ>_s,lC  $ƻ@܇ ڝZ5[rih9Vߌ Fs3PϏ6"QDt'LrI$2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I#U<SZLw'`S=Ⱦ^Toxe1"5ReE8gHFP-u-'A.=_UvcڞlhTbd6o_AE  a$ \E/ I$Y5II_kDb Ί-\Uxzcm@T#nCy>+557G⏏ Bz -A0c5f=稂 t?7HcvФ j&q19 '#P9aG%D>M8骋h ; )tsAcTh&TKyUMmiRǩ ǹB)kǹDsˬӵ#7w˯"]} KDCufZΕyM`S86uvqTǻn&u?BʎBӲU3ۘ5Yhn|\'Pk/n-%q"G 6:5ù4$${N%Ӳ&D$`K:'ֵ1ۇB7>\v8H2>&9R{2#a,/$A?vuZW} u47]~L۳ov#%k$; rJ` ,h3& "4xwMOdf{o3PV5`%Icg$oGeZN88X5-mA%ݔC͎hFkì nNlk!c4hwKv"6'hwb.,MyfL?76giVx{l9Vu Y49Dcy?,qiԃ+ -ݛ@Uzwm[7ۺLm)%Z4[ōlT:Ć1Vjݨ:.$hw}/\Cv$LU^ɤR浭l$h .Xt~J h l&R ˇ{L1/X -W3mX$A-Co8qn|*  4K9*Z'i>cLGNHNGѕ@kne[A]:~Sz 69fYY)o̘+C:rvZǺyy~FVh6ەG]6.dgFZLm# \е-%Î$b4䤏#orZrI꟟CD5A=VkϜ@X>;XN;v#I#e19(#+ *C≷g.[ ()'^Ŭh3Z*A85 # U14@ۀo;{ @vSݩsĬNq# 7mUDaw=,$=}AǬ22NVq1Y`? IL@Q",`&#k#M3cZLtLӬ\~3 5鳺AOԦ q߽+{AD:Exmvy<s9u-FI@x>ym+LA0Vcix>K%@H+-1ޝ*Դsh>,PKG:ZV;*Mwos3 z(_{8EqzG<UTkqn,P[H Xַc!& T$"o(ݒRG XG.;Gd2qG9*Z*bfJ-KDFp#iТH nC5ۻbViē tWqv?V2ZY.{#I1onHT5 LAF;xRލu*OT}_’\ Jӥ_2熹|֏jƅĔޕ՝+"CgRGEuo/ BXOPߍs}lynƤ MQl c W-;@v8ˈ T=JwPsD}u gXrOM֥Mb G#&ܣ,fYw׊ݕ|<ú@'\dD|?nh.q(ucOe0u.r?uۚXäYY|YUVreN%Wm'CyAӔڟrMq'SFwIih9"F+kk7mx'7%ĕ40DC ŭ ݦOaGZv1?Sy'\ ir@܉iiR67#i&h{e7@<QZsX82 !B<]퟉J ; pR Rӻ^4JkEtg;]  ZH?JBivbm$x+TVYs# )۔"G('7~4 9x@pIei4V)pv5]oL.xf?O{cU7YaXhOw/LNտe~klCtZލ:;wZ&c`NĭBO xZָJ֧Ŝw?s\y G8$i3<1V\Lͦ%G#U;L4.jȵՎ MvM1+v;wV͢7T=7ۺey};"qpc'W \wH1柪[I0e:'j];iA֏DoBXoYI o3&STnjW)K4dlf29D(jqkl%Y$ۋKvr.pc\GN=&KlV;izn *׭`z^\gtJ񕡇x9\qÒs8e?b:7? %X@~C8șS@b{L\-y xl|8A1t$DԶcW[S p m/chDmmoƠ*-!ckwrcbeXYrM̑[[@IcvA0ۡ4>c&=-VK{3ncxEeD׫&\`#*p !x8.f"? m}0}kwY.TkomywX)nw?(8?CLvJSsGC'(0|4N t姐XscOEɶí"ʭtpqV%;Dq; -lj7BGb [uih@;6;BZ' 3;h*GBlqU7v?eQ1O@*#c\;O+\$ ۟SDXP'e:8ˇ*^[|@S+!XpTr?Ly5bkngjkuunlsRcѡU-q2R8(N%{E'NsIDk[kVeEỉ9VpxFb;5-\M"]#ںjkkY~ EL;D΀\7ѯ(u7}R|Dj| nkLz'-k&{1קD)FocK.L-EEAMCt;)B[kX=Z!+ u&%0~ EL*_y&?4aGl&8d,(baA OVPuiUY" m౟K\`P[]ܞՕ6G 3'ff|?1zߺ[UƖw<+h๬{@&=VpDDy̭ zǡ!8g\.{g򿔶]]L;I.=dKs%g,ɲC~Oj/s"[?uehk  640mn.LIt]o}h! vUSeu-4#D$%I$I$HRI$dRI$I$I2I$$I&NJRI$$RI$I$I2IIJI$$I)I$ItRI$ɓI&L"I&L2JRI$I$I$:dI$I%)$I$IJI$$I)I$rKJRI$I$I$I$$I$I)I$I$JRI$tI*I$I$RI$I$I$I%)$I$IJI$I)I$I$JRI$I$ I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I&NI&)ȩI$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/a>'LrI$2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$n'r6#[P S0D)I3Bw?@h;*O~}= :B XW] E:CTB&Nqe*7q:gL}M;a1L+O'5<7+fyଘB3IȒ)`*ub: KcrVa=X^C'"k5*HG0ȫe lx G.=Fݵ+-!Ɗ]6^i;AⶻlsӐ'qT +\r7\6io>^ wnէEșLRY/p-ֶ\ )})Qg4Ā _IK2߂NsrNmIw0㩁 6#O,-h Lv1oHK+4~2I&Ax(ȒtIslq o0O2" &Yhpk>Zւu썗cmq-䒅V$DpD\u$+ml$4Pǽ8 c X;CޜhEC9ۻ'NF4!JWp#d ۳CO!70 Tkm`A%$&Gw-$q$J0,JjKp4e6ifeP3w>/Ȱw4A;`xb[;wQo:~*8ީrr bd 9QeHpUS"gS|8U=jޏGd8R+kIGjl.phS$R-V :'H5ZUYSZop!ʯke Tu9%Mm$R`ڜ^>[s4W{_kt V#b$hPKx Ś!P%4?RH㲌%m9I9V c XLk2LZ(Et:.&5 j`0J)N h'DVX>h7myOtOeoĒH*aO 8oAÜ㻸)HQ %\8 ?ikZa =(snK]g 02 ʀ7ʋKe k[RO|O^fb[SI#EH6GIay+j*kl;!g`R2̐GߧA{cW[:BmƩ eIW=ƾ%wH ]a ;$nVhZvŇvrxAwR-8GUZ]PǤQ#YåF8+msdH;HQSCXVJ㓯vZg_iOф'R7nI7SS62|ִncdML/ V/ 8Tim^,Xi%싑kh9mw+_J Imuo2An; k䓹u ~%3%dGiwoխ3}=-rMVLT)n DTwS ;0Jf;m"D dHil<>;{Zb }-xݯ)L՝nuf7Kw#:5@LJ\)|Է~#[)6MxJ2_ 58 rNҐ˩|ے }`gE ~QyJ=tHH#D@%SIzg0CvYyϲh- kQfm05 ~⮧WHGh>X"i=]cypS;(t9AגZ{(j?Hɷ +QGUS#] [ֽNddrT)ev@ !ׄCfldl.1|=5D*n&z%I_ ư1{hh;O鴈`vI"2uO]O$c"^%AaD%:v p=hM@t;OLy3(v= w\iy?j4bG(bZp!(ѮԖmw%Y8]Ye᪬TIq!|DDYdA yw |;RYuFɩԢJP;Z$47a(zLeTyb~!K&:p¬f5oCUc^'QN'yx #:n"?.p`fPڪf{6ÅYY`SZX*պC.;|eA EoFnk@>(8\4Tw0|J wDpTH=L$9CwRu2H(DM"5;ޅI)Թ k+?ʵckwR u|!'T'>TٹGmT\DVُ0bcIGv# {O )" ]J궳wUpLR4fC!2lݧtğF@Ba㪐tR讨ց 9n{D7ս"e]k<^6 *NOuX08'&ɲ@;IPAWHlK|1Jh~@s*DwLvmw(ɱU۟iPȝ;$[8p.F}& iL2 # #EWïoZp.РnA*4ˁԞ(C&?4>?x$|B x|ৡx1Wd| V5w+5 -Jkjyo YCl%K{Y y0 BD-UrS71 ŨGb . //4ҪCUo>S[5Vu!;ג/*-V >^:;,mJEVI0vLHs-gv+]* ֥?*lxpuiRuqr_{NDZlo#B2)ַ~EƸ?%;*-I?B<\i;ջ\ۘB%>Ijr?iS<³]~~d{ zOLAۆ&B&\0xQ߸ 2)DݷKj} ܆m<|T1-t*W錀"5Q %ޓ{\/8T왥@^3"a΅O)>-.o& ŜJulJtsin0[XFV1H?Fuדq|$\*dk]g"Z};Y[9#pe;֏p)P.Ee#U:\I{=Kgaqoa m;T}PFBLH)N*NB(pp.g觔`Ũg\w> f>:p(ZFO4>#Uu]Kb׳D`aqƂq}_X.b Xu&z.U]Gޡ=:CJm.*q]'Hanǵxaˣy * H<K{t[6C+'CϹǸVOJud?Zu!2p;{'lH4]AHɒN$)$I$IJI$L$I2I$I$:dI$I%)$I2tRI$'LI&I:dI$I%)$LI$$I)$I&I$RI$$JRI$dRI$I$I$I%)$LI$$Id"I&I$BI$I$I$I%)$I$IJI$:IRI$I$I$I$$I$I)I$I$JRI$$IJI$I$RI$I$TI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$L$IE$2HRI$I$I$I$$KC<垴:YS.?FfL?ꅜzPseJ/a>'LrI$2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI${*-^i<}ԠRbAYvڱ? ޣ@s.ԩ1'NyOii6 ||Q"8N$Jxnt;'ו]ۮ04ȩd ֵ͸8Bl nI$*%A8q{,^;s!"@>I`bVXr/>`(wP+ 4x":ok,np$vPɰX(KΤhF[D!ki[}0K਼Pc>(sN+[l_Q.-6Xq#Xn#t7yO$1" y(4˃u <k$Nԗc&FE(:/#q5l@2O2<6Ӳuig<1u2?ꕌz>OdƂCFOJ68pڟ5CdOueay2B! 9;Oͩ&I'wr󿴕cA0^k &11[F;FkK5GLc #G >Թh }h>Y;Ek *Vܒ  s4'5Rm<8lUꦼyLĦ)qPݣMU5rzu8=F82e46(ܞ1<БrZZuih5 \vHPL5a='o !U)nΞ %smqZrZT ćVXXH"&3e-Ǘ wZ%PY 1`>ZBZ(WH0Ə)V[L4GoL≸g\LJ~_?qq9.d@?jvc\L9K^U+7 FR{[;@#UcMnj"S՞,rl4l~kDNS .B'[G}7;l:ho ɮly;iu: a䌸8O/ilw3ֵ>ce3dN;f$+;, 0T,s#g'DevE:᪐gLjRJ +gpGxUXc *#E`c%;cPJ8ĩ.ިIׯiP?&DB0㷀yP8W#m;B8ff>Y b-2VqXZ7̱Q+ )m1$jf|Ou5z֑̒e+ m. [hԢ4~2>([gL P Va'FpTCãNH-1*>]~5]BXd$u&q]C}o%ZAOzEGG8h{J8wcC(; ʀp@[%i :V\\AhB%Ow/t COzɈ&eGU0HեK\"{HHU{74_Z6Tl@Fg%&%-%Exq= DqLp;.TPj!} Sc^2Is-_N_CLT`ID庎Vۭ 7dx.kvاL Rq|jpLtRt6{1٤n{\'$鬖T4Q[Kgnqp=`?TFtCt0W6i IA; xvgaŧ#m:Yx]+gXA;hFƪ[ +ݻ $Tcc\IaѪ8 $jm{P鉟-\jM{F>+0`FSGy0u[ Pɪb淞>)e6#5E@ >idV= UEjwe-*x3t)q;ԩ^zh2xQt 4({7R<4V0 FL-l6Nݚ ܮL1,|<<92)c?iu+^ T誶 ?"긍4胫[p<|Q_ 2dуAG@ɚ?l?ׇqL@NyZ̴QYQAKZO[88xVp<6ոm.g-!>J/Ȭ7kk*+6XNӤ. *^9b9w/C\Kg)3v5w>)[?)3l"Lj:Mơ -LL{[KKC o`U;x(5'!f!G3GeWz}7s[;-#k(u F(58~pLw9纒x٬_P~+u \5J >%i^ :gT&A<Gr`rÊ^W#(Zq1߽ߺ"is%%nt!slx&wxY>i ,wJAAJ1%[U?s]{kcTw50fqiceO &IJ>ОuzJ_7$/NeiQ۪Mx(:ևv<#f8y) +ؔҗ !1n"*[xUEg|S<(Ju j>@Ų4Sl-qПl)n'[xL$dm4* ƾ*#ՇآHVi/#BnP,ns W^8Oꪅp0?6[?D±Pmmw>>x oob}/# {G'>3B'-tK q}ꓜqO G?Z slI˸>;"ĺSQx[? -c-`lzӳ$xYWctFUA5hmucAS]^Ƽ075B+ Y%eTIRE o8\ȘFGzs+b[ĹpWu&*s2}}eBQzteT g;vWa\$rNo/"{GP:'R^cf$43I=?VO8Y:8P?,c`ݒ{Ὴ0+@y»CMNcw X qv;^o҃ERȘ*4c`5{Xzh಑ {y}*>?7$Y ˙S9(ξ恴iVf9q"a\pz}Ւclƫ,p!nHB:py[Ơ$>H[+ۘip@P0OkQabg~Oj!$1X9z}+>o!z#,dclin*'haI.%8KbLBQ⦗FSE~jR 5aXB $ 9J|7W?ט&S2tFźA1?XO} գav`}$dJ[\"b6gl7ikOeD1ꙭii$8 `:Bwˆ |v7"{BPS'h߹O}#gBav֝ʙ"A\oUM9*u%2|·]M۳x"vVYv7;&Ae#)d2;3@u3VRȬe i84Sf.]gi/x67OkG,x(GGox>jsYOAhq;(WZHa;r교D<ƺ")Ƣ\Fǒ|ɭV Rݎˇkبk;,糼Q=dt4ΫQ;ہsžIË5[u ;F]kCT#bùQq8e!S]NE($qEv;h%v%N׵@8p{vCئ•If7V>)5cRT,U5T4ywuhk(]{N!ÐcLQDŽg6G^ ^@էD$ Mx58> "~# o4=I#1݁w-ϳ\\ȴ˱'~ jeO޹[wMu*ZV?[ޫeO/)aܞ}}xֺi3Z G!y5߫=[mwn0BYik"k %˸ʕWw;!|㽝}#v9r=pvwC ;jn];❭ ȣ|ѣ?z ɤN,dIa$k=m4Rȗ4CC% F6S?+ %!tf+2 㩒9V갖}, +n׉˟v;&Ⱥ)r]AgKVגAi; nwX}Va$+a M%g7 *ʲT+'LrI$2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I,b,I!GL' f򝺁!'Ir `eU7}\@' Mmhj5 'उ)m菚J?Ӥz>LIsUe ǔn\PY~]TG2 L&E(:S]<ث* Bn{"?oF ˟>%W1+}cd Y3մKUlHO Z۸,kdN~E,mMT2)kۻ@GQ7$`4A"cM%\~&>CoPXyDݢGu0K 29GfJo= 8qEA,x.c84u ޭ4XXB̈́j*`;pZ+sw"ߥ0xd._⣊Ǝyx4;.{,Źu->oPy>/!Ut> 튭ph^+i.<gگQP6cee6OkЧi,GV1(T;,YЎex[Y}e*vsu!s^!4=e`#U8²֗&b:. 2/$WҤf2q6,meC]|-'Atƨu>ZP!To½Ult)[$k)X<y#jN ) @kt–I\|J-Ml 7͙39 %p@W/+h8CP$lSc>D1B6$s]KֳloQv5x.kqK]O0Tj C1ɂחf;q]1t66c^{\[x 45?${L1h焆C@|ld*ή@TX׾w3*Nw8X2:&RT,R8sDpn@Z5';rxA; k-s\F`yV:kŢetK5t6*3[pfhspNIS '.N_)HKrrλGqkvQl "_GрX,x`[jn댏r/XuT54%NsjRIq,|UC t!E, g(G|\?f͎r9. Su!jLʙ zM>`17hc sH9$cZv^^Kj oڦz)$48 3>i/|۸T[#ۇWY,|H+uwG*^ǂ%ܫʲ 0G TYVbb?tuڬ@p;?e5<[[#YVav捧t<8a h5X{q^3](Υ`$! 5 ~ 18huo=4\BQQ{Z߉PdI_/,x_"͂-TBį:\띹^R*- ͏:ƟW8㶑-bt DD&H.N"|uK/ir[e\cޑAk"lrz`Hj+{;AO<)=CĎU\@W3@yB,g'.Luϸx?x_:eaH+^Ξ4u*M. -p״kObF@=b`W;t~o?r^qZꏦb^Xt]x5 qYx[MzRU1Yfא|6BY_ĖiZ<`q_ 2w1Y?m7VqZ`}^!~z2KHXx򟠏F=5YV>(2Jo ߣV}!X lόY { [P'Pcst+<"~O͟t9b=?yUUb}cH-5kg{\3&S/y%pK]R99WX~omf:q$5>/ Os6~tX k~9/؆岿صp3AvvwĜ6CO 769I="tH{m˙m{L1k#XMj& @,iH\N<ꉑV?ǯe4SYgO~NUpk"43eY]v8{@"?Zvz Ć£ja'~8;$-;kdUgCO1e c_٠1D60A%;uTnC#Ycg+X$e 3oH~̦~ss+ю졏#2Yg9Fy!Y>O򍁒px5hPqh& 3Quŷs-enրgRO?l{,u̼O O]S7;{!Y25nE"NFZbFOPx8U7zxP5:$m:%1ۡSjp%> ѸUpy9Q 7hV9D,s4hPQa qʢ5hRQHY]Kɏ/g~a!4 R m!"]tO1Чp<ͰL׻q쫼;8Z-ai,jq$V&W?VO9H͈9??pɇrʱq;.9" 7ulOFⳗc>|W#c ZyAX7._'zBEA4-PW_Nx}UƇP(d(5S(vl$*)-]K"H+Bӥ͏1!Deer:F.LOd}UtM"uTgSہwpj981<J9q=+#֑5U{!z"ұrO.}ө.jBQ&9S3aUn*'gW[g'LrI$2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$>6?dԤL61-44Gh`p&ԑ1I'$%$)$B\CBX*lQ">hqs|NI$`=C3ʕl9*oBh߹ IGN$jH><{CFR ,I)D3qyEaTZ㩎@FkӶORVftOxQ!ϸ%MGsO^^͠ O jo++48DH(AF.k>?cYXuHΊpsu xŸSmM HIDuuLQ[wq柒Br&:H :}ϸNʝhyp<dž}/Q UPZuA4e{^DAWi֕hqM "<Lgβd9Tبa~IĶx(Բm#D@&N͖J|OBEktr{~9>J uLa[mk~HKR&Wʎ&8%T}wW7 A*$ƪ/±1ܕtD I,>JL|"7ê)tMn{_}gV! ՞'Rmk[c@g3 DS:[6DFς8l^/2.řgf[\xYZKKLUGT7wCƱڋ8?\I1?V#Q_vNQf1ȟMvrܶ\5?fԪXfJCv=;U-HdJ1dbxj_錿z+q"'xw9^ǸY]" nɰ\^[4Z,it8Bc %1BacǑnO3g< Qm.\Kqz6䍻"լegH~\&y)SC7Y79/#Y**e-'\ـT'jͭԮa8h?u ʼ+as٨:~;1LEph6 RKbGHq]6 +:m.,y~+>j;%0Z_s:BwQLp;&.'B"ʺ=CAX?j­s7uB2X\0nsO)z!LZ@BucruiX o>Zef׶~&׸s@Q^is(KI㺛L dTF/],j^jZ9ԢV8Lnf$4 s ?4iB~COYvT{]*\r+H8c2bUMA+*Sx$OfK~;$ӡL4BvO MYM[liJVqǪ p#…-(nK0Q4kCؔχhFes  RL:[rUhcv!n*XϘQ*NBVqS+ nN~ :wˤV[cѼ}FD|:R<&"?s:%8e9#Z-j>EX'> ɐX P>2 C4KI a8gȧ9:?"sC^! [~#y1A->j_L|UזL4 pH%Îh8BSPK]2jHgZ+ :j:l{Mz7rpʀu.vߓ}Gzs^//qV-"s[>c^>.HA;;0*ǭ^H </T'Jv`:O&>Y9F.Xy-Nֹ\Ñq$9FU}ӧIh,hi›XCT?SWc_%FƇ\cdO3Zv8P {psZ]qq/M܌ O#b8Z6..V0{FZCs%0sxReO )X6D(J\1S7(vt<ƈ9cHmƐ00mNf5BIRJdIFH@1[mk;Xt@?& rEomH"KW5v*ی"X }"6c&%nd׳c?1a'Pp~b3O2>KGOvpo؋Um͏gV/mfJȿc{d~Esn@I1:!_c솴sCY@sݼ8IFR;(j軨ۣ*HapAcmd4AhZѽFą:0{ WU}-0VX5aqԝaA<9q,|X<\B19=zb|glV#"6̆~6F^ C_IZgϒvN 5Lqvk1Vdh!F꽎obyQHӨ'sp{7j fɝ#2Jڅ̓R>)Ο! f]ByFq+%.>px6 ?T}Pc>Kze5< = i[90L>C"SK|$c!(E'[B9"\ 6~{pc ާn54o)Q,uhoNmvuf;@x;X.c$GȦ;Ճ2|GL'7Rd{O}#\𝶵,H>PH /mm} (4E y CHG?GKAc·(,pR졑3֤֣"v3v3kk\a?]]۫ZrHucJ"uϟ&p ;]s2 o]BG`~je7i7ʭչUwZ>Guܯt<<Akdo6ϧn:]u?wT3^YMaRl :5.WP߫UﶖX4?'{=7F{/ +_}@#U_|{=+"9ި2& /v,)%wPml.LFOU c}3u*YD#\уMU@6b#CE0wMuNui_~MtՍ0rCuǛ6{wWNv3,~9/CIШ,Oyk,EWk ɰpu W9{|\M/ӢB.s&c:qrEbGp#B#/:Yi|v3#5TTm %l9W@L!.۹ڛ[v̑( o1*8Ȉ?33F4v+m*{Gls m.3r@N2 u9MN&{])%J eA{!j3*̂S8ɐ#VZ|Q:)m-nj+hhTȵͰؖ2ŶxvNHXO{o]B.ZQbz1<=?FL2ůxh'B?6a7B9SUmUX yJK[B?FTk)nBߢ썮M'yj[j<pխ_T4=9 BipxM͎õB<m/Tr-cz{P]aNM;B_EFL̊C='i߲,#I 9$Rw 1p-cFۆԶv%C4{ҽqݵ|G21OZm?zlkt;!Vem<54R`.01pdNqC1GM7@U³$9ŃUKsCVhyX,?Qο{ٞAqst.)n@{OTcpHHqmme6 4x)sZeʜ #A1!xpp8LKMC(J֊rZ<*CZ,DJ%[x&\ vJ;qmqaH!Vc ]}j-ohpU:}Vx6n";L,x*{] P״ '" >P@v0Z|hdջs&;sĴ(vOՠXQc1٫Ol]GQkqEalT6נN ,ii[-47Եd'"??r ~" yò+|T$daR·u{]o~侮C03'#͖u$<9-eu<ݼ3@{e<if=kiKLhu:Bw*QjmхQᯄ'*m+T6^nPUOwV.Ô ,5frT2^,7P9Pr"AcaQէ!}"H N(/)ZӸt HPYn&GP\;+/il*]6\4d\,ct˼lmpGbV&DFە:UV/`p͎-+Ut:v@X+#{ vkVYh~+TD1Ñʭ>Z&74lm'"}Wxp[~ _Som=sG4KNhLsࡱB ʉ)Q @)B dTS/bB%)@ UFa-> µG[ͣAapQ܄ J?)!i xGoE¸Cf@**Kb ?h#BWּ[=oǏ9%xsa !ķ`~U'V5l1Ĉ?+IuWӺ T͍ >b$L˚9Eyo8c67Wp9$VNO;Ge3E2tu̒I$$HRI$$IJI$I$RI$'LI$:dI$I%)$Lt)I$dIJI$I I$$RI%)$L:I)I$dI%)$I2t)I$I$JRI$I$I&N'$INS$$I$I!I$I$JRI$I$I$I$$II$I$I%)$I$IJI$I$RI$NI$I$$I$I)I$I$HRI$I$TI$I$$I$I)I$I$HRI$I$TI$I$$I$dI2I$I$I$$I$I)I$7g?+zˏQY5:?ꅜzPseJ/a>'LrI$2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$JUIJI$cu@gnPk{#&8O^k XNS N)KCb!4"PI0t% @+A?RI!fhEKnxvkGK I+/W44;/T]ou,nA̦:G T j8YXB~;bU,p-n3HfdYTd?hl>q1矒`"t\C"|=UV\>e\nJGB 5'v'}1r):,\8W{wBl:@~$BѢcI2m-w<(H@p8c%E#4]"e˟}wT'_?+v{U#+q[pz.#JyhN3QT9 Uj:~8x 6X45 ]vZMM0ms[ua%?XУY@S>q᜵(GN]}ll|LVYqdAmn( s- 6ȧ!(˼Z3mɳS X!d25:YXfP[l/ak~N-|nqJvH2{x*VxǁQmޫJFT<]-'Nú\Á)҃8Lq]C})hxJj\عA?[%nח-]N,D<*L$ 6 w?0 xMoZ$nv#jYd s=hHh> 3H:x\HP}XIjϊMk-)u M=iWѺ{ZlooܬWmQ虨@ (vk0NW5`Mt:BepE/%kEo#_Zh$:HS Σs?t hh;(Pb׌^A FNktVI$Opu-y.gnweB{NpCML8wNXg(64] 1 < !JA☁՝ţ!A Ɯ t gFMz7{V)4::(mn6jK~kleU3 @@$%XsO1K@w+ tJpg,1Ife{kk9l~>ݪ-9#Ums^"y0H i.=#"=K8u-ۆ$ 6`O%ǴmoPwxO2ޚoIhּd$KgF*E͕썓P(5'VQ*zm;z4sJBhV!NƶѵB-U*3`Pf ˁ(*QV>hvh|Bqj}M;na W*[4n>@>*CP~zu3FX"krߤh>iTmcYmƑVic Pz[K[Q+nS}P1Ŗ9YOTXl4{kLl*yTA#BGhd0TkQm}lwT74ScA$q9!}b* PGK-ATЫ :6⚰䨗H&<"5a(q0%쥆tEm[\H-a zFs0^C @tt"u ˿HߦGEYm]3n$c?J! -. ;Bٔ$Ul}d,gn7GQŰ5#Sc 'j|=퇕6sv8>)(ִxjmAP>D)“d?H` 6;1Sc )T MW>o0XR!6 $H)"KD˹ #b4D괎BOteY=Hj̜x=BGVXp JLRx"7fVXfFqVؔ07caS YpA1vNYQ!lSid9{ۛ} S0-isK@F)m5Si3Hd/nUP;G:HF$2$JLcq O0oypNt{&N> )9"=8^lyS[yT3+/d A:\1(ÇD/N7wAȯfYm QM -**pBh[\II"4 Dޙ-FĚ:~,pl@=-(3kec5 pj-9GTprqPHE $5i69a⧝ŭZCZ.`w4K2wlYEFleW'TGV8HKzZbHNyK)5|nBjlV'w=j9Uլ`}F7MRIuNY]XyAkI?I>Yߺ|Z*.-Gkj{`dvL! ?Qf}݄~Oݪͱ;eZ-VxgD/jKV: twWQйU hoVf;2YB *98N#?4~hk#[yNh_>M!kf%2\0~ɳߓ&6\v·[aiݕ|Z65[`}M\tI~AC]47]u3Y[N1[efOu#Ҫ{t@Nnn-+zb~ b=p`J9p&@5k I0G+onA,|5hI)z%Ĭ7bKwի$ek$ ^*&1檴MܭDˉ8]pV_]0j-WfڴjW; - 5÷R"[v)߲}@@q+?D,-IաnG2GjYD;+RuxBKvvMq)@\6cӪf36,҈KMq g.T; ʹENx',-Eƶ)ҝVΉc8T2ki:7]'TDz슝IrHhcBdߏƇ!N 2u?|$ui< <WK[{l! 85J COSu]qaЅN:{7ˆ J]-hC*x/h->h0{LF!,w K6 #X?ᩧ׷q?A k,6p#*J*%~^Oe,p8h9pRtKD(Qԩ6@M2>A4i*hyQ> b KlJ&AYCDh^ķ;'8<[VHppʜ-CMؒx :U%> >c%80n~|ޅ0칌DŽV`j\7N@8O:~jn$ZZ`*N}ohnAv ϐ1OԈwts^=Bʹ2@1QX mtt>eĞQgԪ;/o"<?k trCY~1e P-5Ÿ> j5B]ˆl)dN;\ Tn)Gdao; @IvKmwee.&Bk+%- ʡQEyH4h8UlմuGv#o'-|ˋ:%#X␌=S6ݮv4 d5iec!3= hG;CnA97q i ody{d6ܭ⌣%Ҧu/'hdI<(QKhn/q@6sn8cZOƩƊC$x$%d{( ltNY:y(:7M\_/$5gn ZH}BD6JnvL;EH ~A̦-<NN,@p<#>?2{[*yi#BuX}>!C_\ߤ?۰(QkcxpIN LOuuDÉ!&f܇~vUώY'f0/ьBScktAUZ'EznhUΪ[ElXu"Slue7?1ZK*k~ߒj2 ,;GpX]B@m#Zi;d8*=~CEd1_eNZ]I%Rc[:%=/+~pOfՇی8>j=ùkaδ]7PNqԭGaĽrpq~hF6HxR%Ǘ;#-0}mptw\ƸBL^N0wۤm&@{;spiy>s\n򂥓VSBv$,pHBv C29,:Տ49C(‰RQP6' !IF)(N)Q*$)K$)+AMC TPN /j BQ: j(I$2)$$J)$$INRI$$JRI$I$I&I:dI2IAJI$&N%)$I2tRI$ɊtRI$ɓ!I$dIJI$$I)I$II&I$RI$I$I$I"I$S')RI$I$I$I%)$I$IJI$I$RI$NTI$I$$I$I)I$I$JRI$I$I'I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$'LI$$BI$I$I$I%)$ZoP~W,orZq57+5:f_?ꅜzPseJ/a>'LrI$2I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'kKI;^vU3nTT<\y*nnFI*Z/`YGhPZV%GobIqTЊu$(] cc4ʽTSxROj{q[=|#̩k_ΰC\㮝g?Ժ= WNmz <#RP_.| c"Iۮ/m, ;zIWmVd9~ځ ^3 01f4fƻ5t+Uᰴ69c9O#t D\{* a.*i.F2ւpq? hv.Ns% 5%5Hփ=՝mιޥΝV&/ErZӎ!̫cxvDeD-cŎ?g,V_& IXeߔe'hLΣ^( U]HL\j}x@WXޱeg$&Nx>$D2n!I2"AO_r7i>j~ТSӘ *6[N)wR{BGOZuTڛ[3=ǀmϺyLԧ2W}:ӹ>)Ѫx85Ѵʋ(XUlqyMut/Lx?IB$pQߚuq{-ۖk/f>X -'?5wEvFʕmah|Uqxt'ulmdhT)!䢳&C@uD&H54@ޫ_i=rX P^AL)q$iC S\JeS$8!E!+Tu94"@x"Aa5 = 1+|PkcAF@@$ѡǼi@4KI:~ ZGa'5Ш@j:4ISi NBGxRGcjO(ϼr9PCpicXT^1v襹%!d=(S7ʛX;T6(E&"ɥDF'o8p{hˋ,vwfSLΨEe+vH,3(iTgh ,V íֲ$OH-p "kZֻd#oԧ{~۔xITy`QfO'Gn/Aa $ lv~(,N*)f*$D(7k~jgVT@##W7@xUdZlè>h鎼SC|%J}1B0xj<|uMe[|wz$)d+ꢞ S+6k8Ens҂Zݢ %f}'c՝ Z56,ik*c8gEhWXCwʽmma{F¥M{Oĝ$Y6ZX-GHh %EZaf}ς%EFKԃEܨFV=DÃԋ(&}AY`5 {m {]<~C4f#P}E|xPVs'lɀGܶIe'!FK&4Ֆlۨ2B8U0~jiJo|QV0HQN֟70 %X(eS!$p.ǭILE8d[˧S i=0][< {Il:Nt afو23۩*H/ 2֒$ iW.k G5%A,kD]tA7P ՘ +n߁@SV2I&>}a\ǻtV ?| =,jXMK~2x5ୱ";aW`,!a@ؐIhu%N(s<o֚Yß QSWt y!C mVG1o5RgfAbl= q):$hך$n2:pJаhxCs_--qU+%{X#ӊdݎM[_@'csp 1{m${R@p5NK;( =?}=?7{o HMpc,qh>i>.2I,P{Z|+xIXyBTvXt-up&ΣB)^.i[yO,kۄch}z :eng].\*v4c_ uj)m@F4h4|O\$B;FI7V$Rv<&sCNO Xko!E wjଖ{=F`i7S.+l)X\QvDHzI?Eڡk׼pS0~nKlЪ>,@Eۻ@L?5D2iQ$^0VxP{K4jUnsD~ onâK_ kH.8%S{R=ias| n xnʬh6:S{A je=]Ș})6yCK{d()tT:BP]3覧[#gТ^?H~!2W c/L&5*c%I7"ߑTq&~ O 0x:t)}XbXq>|?=Vϒ]&և3j5;S5:HЄ*nG]ʫYfҝ.Y`}7\띹cAem!߽Qsa\̴«Gԣ9==<3NdPXgC Pv>hMiێ|Y;Ӱ~*_rb<>쥿NB5HWZɝ;ۙt*%ǁCD7} 6*4T2`}Grc{P3+"Bs ?J2KY }np#VG[!RCZN]8l|V2"  sjkqi=ԫkR_UJ"b9. 0xr pXá &FRbO! "Z +."ժ_=ΤD¶2GK ?vNh N紪5^FвZlsLC#hub {aeX+0&4Og lk1eoMrë|1CV7}؄]ݤ~k_-~+h%?`` oB3_beQcFQ go-sl<|!V}A:ukFӨ*0A/T1 u=ˢˋZ[iPGc.XC+W}>>uU2Jip[TF9z?'<2]g$q^]AMf\np~ޗd5;"(Ie޴' $D.2u8)Bb)L!)PS$d BsQsPS (T{a@Y{\Y'Q HQ(%RI$JERI%I:E$)$QL%)$LI$$I$I)I$dIJI$$2 RI$$RI$'LI&I$!I$IIJI$L2JRI$I$I&I$RI$I$I$I%)$OEH($I$I!I$I$JRI$I$I$I$$I'L$$I$IJI$I$RI$I$I$I%)$I:d)I$I$JRI$I$I$I$$I$I!I$I$IRI$I$I$I$$I$dI$IJI$$I!I$I$JRI$I$I-?+z7gO3S?ꅜzPseJ/a>'LzdFUI$I$I$I%)$I$IJI$I$RI$I$I$I%)$H$@N%)$NIS ?Jc+wGe$cKIRI$FHn=O5=jLO>Hhh6'r3qIw]2m>ͮi :e:% T2世87S&Xm>f|JPgUjhx ,5^1E5Ѧ l8 M "?+V8$yv8=@ߜG;~Tk;g)<4IZ=mQnIb2e= rs-3\-L=`IOMCpHEOZu(=q_ &j+&wQkIhȼCt'+$P_U dc}/^cZE .ڦp=Le9J>Z%#)Ilah$ C}VAq]D&I:IN"p|P3Lʟ^m;YᩝUVĎ'Ӳ!wtRCL#V$,s7$\PU>uAր` [̸:&pI5gq?FCU/d5kro{ī[3*&G"!kW`C 8ea1gӯ_EM{t+PVдk%]}]i>"SۙF6FZ|\#T;잎,աW,i|ng;~W  E 6 ]Cd2ϽoVjJ}gVMcI 枮Yfp-y\XD>1Iۓ[(.egvӡeAPf8Y3uw'̪9 eJ%f'*ԧt֙ _p!%8~A3o9ܡV` )9BxcU C\ZY\Oj=$*5X- W7ciP7TP>h@pz~_sƿsVSnzGAĪ5ΝXݰ;fT\;ޝ'Q'[3ǿ EkIv摴<ԙ[*LjQ-$45Rq XKeO3ZO 46q Bzf3[Q<䴰 w*e"gsS`AJD2F 2$ٯs=CANlx-io)`phd0>PjgS\> >Kd+-<3W a*F=h#pE.ۧT}'ik ˤku)O߁SsD(CRT{vFC< Nt{1T}F mgp )Mas5>GPSH:q w x `HZӤIH}Qէ%@jp{ L&,5Jf띤'2S en2]A9.x|X?1)TY.-:+8(;9@4< [od0߻e Y\0_5ѫ~.oq(8{[`':Vpi}S.x1ȅ"9Ld+HU6\CqUe #^j2,8: $֟恽|Sޠi;?5iθ6?;ò!> HfH1 ;> %/D-iۼ*6\Cfdr2'ī4c:"n5.`xg/PGj"DG wks`U Q9OhgK&ܦ揃Uf5E?W]a;9^ iѵ*%aJϚ(_d3؏O*ePZZ'w<$;K~mCqדwC:Cuz;Aw%)(K? 1{add=[CO*4ٍ;tx^[ݭ]Bd04Nt#H: ]p. 3Ȁ!u@]bX yK*xc`Y(VTkpq>Qȃ`=]!Gf#5ۄ169K:I3 [l#Z3`wtt_Ra% kD']f&v'ɉ2yynOz"܆cK<5'V(gVuJDQ:BCެXĴx$DHBr 6L=1 5oemk;V) ?Aj ѩm"j\r?cÉ׹3SDBTjNY 6p5R}c⬶g^H4BȁΊ@wcH G*"@s`mPbNuIUAxq qי+{\Zd~w^w;1C>3m||4T٘9Wdi#̵5CnCLj6xCE )eN} 7zmZ`:Oօ-ii%[{N]aLdvYjyDG)o@*>L"~4;4P:MU $lt:Bohe|sW`U,s~]?HrQ$A@֬K-5TVǂ[^;OܕgQ]+zOßc%7P4(8̠ORZ 6PDHWx*xm'GhP6pݹJ+&zUmc#ĨZY U/oZ vh{8,iqs0\;V1=Ue>>O*MاkoZ~}4|[ Kaez ~U*4X+ u^r}Jߊ"<՜{3@y\NBGguNsvG$*+ QzA+ǀ;*97ZctC( (zn(kfOtECWX Shu`HX' a M-{^xE'HV|Gѯ@.dz5effYUm}MF !W6W{`7U/kH’뛐q2ptreiDS\  JbcI{ XVXD3j!Ek$8*vq c/[~oCKZVBCA' ~2?98O.œg~^Y|0t5^ &9TAuSNJ)q +r$Ӎnv e溙d9 d% ~|dJj"W/Dև];W XK_!g0.o~5Y^e^1BCׂ񧚓?7_&L;EN9opu:6A5wԯ1DtUhU3S#(uyxӕYFGR:KOU^n>k0Ƣ%h5DmWUL{\ 0ѤM`&~It-{>^;sFH-oHz]}*hL9Knb*s'6Q|A<%gYm6Y%hN4CZ+7#6Imέ1VWV ) eH5.қӷMP 斎w(hn@ 8xȇ*e춱@5zX(ijˀwAV Z|sKA YCX >`=ku,Rf-q1"2ug G* Mt4TC *ϡX3TWa!+!1-GFV,Rk63kJLVՍSczΗ聬x*:q@R?ɟ͝?mWIP0A/#Ͽ|i#F{ln#3C $ YMk8HV!َfv1u+e"TYyΚ 8ج?P1otܶnzzkTamh#O&W̃?M߻Zm2 yznPxB4ZH6ihEfA2rE^ZAJ]lxrn0 Wim{/[> Uf,?pj_VNccS0c]Q3H[kahk*uuwA&ݝTַ ƒ EcxPcMSµK,fjRdꭜgQ4TGQú3*Fe0LF[ãn#kqAȠgdq B h䒤.ҍwzk`vS:ZOj|ưaێU*CkJ+ .NP{8> NA{ T8=vO;Zk 띢D"fu4*Av@cw'U')WױpuD +5l=*GGz~VNd" K]g6zxizN@ uV7{r COckwCif㹲P\@Ů; tv G DB9/ǖ*#]:&1%1R1ӯĵW:{)A!m*u>!<#`|d ?Gڬla#lE`c*ncR Z8#"G|f$,lƃ-7v9# 8Xl<Qf!#[njT%Ef$ 6_R OB`l{ Z9Uw :n N7Zw.eۡ5CmHV'H/ggc{vY>p!A HX7M~:0s]-tؘ aԚjBmyO ۾0Cok:s.fǗn#{+ixu!&2iCsDR'vp0"͜C10mWt{aƐlges?gH{j;U};*>| W 6F?جcQWP&͗IaشzBTGvVYa :C1r5Mwc#@{w4kSȡcL)Q@.áXNC!D>j:[qf >> 6K:=2w:NAkŋѭmW0pIr <В &NTHS)J\)pŠjE: ڬ(9))QNW5CsP2NHD!D…I%%)$L:I!I$IIJI$RNRIJI$&NJRI$2tRI$ɓI&L$I2dBI$$JRI$2t)I$I$JRI$dRI$I$I$I%)$N)RRI$$HRI$I$I$I$$I$tI2tRI$I$I$I%)$I$IJI$I$RI$NI$I$$I$I)I$I$JRI$I$)I$I$IRI$I$I$I$$INJRI$d@RI$$EJI$I$RI$I$IhuA\և[y=j隝?ꅜzPseJ/a>'LzdBʺI$$IJI$I$RI$I$I$I%)$I$IJI$I$ )I$ '1\DU5us+Z5-*hCC{ZJ5)O)vHr=ʵEBvG1*/ ;dRB7)Uo%7h|L+iQ2xP/P6 ͈YHRĩYT1 ]I hndpĦe+ti @-T1F;ZMLaaUCI~+hwV\[< _`+pwgjX".RA,|Im~^^ 睭+흎4LK=;hV;lq3*ub:⭹D OI L6$h,OYPi(I%3 jL(NxKђ8O @^95{ ->)LP&L'`+%LjkZ iۿߒK6v~dG Б'[uiktJ1< t'XRmUYBt**scZD̹,o6l5K)9CIsI4]SZcu\j$Gein$5:JaAI 5DkwS߄s2D+EGTsyԵW<Ә$"G`]G=yoau*C 41[D  D1HP a!j=e{29LF?[Q%&#U&d`sw?jHUY)iI1@ v J!>8aHGKyEVٯ#@ya d!SSsΩwIGe3pY"@I_Ȭ}"֙;XJivls^@s$4)D4?L#1)hn8v*Ov֒4^Q #WoQ`rKCȬRQxAhVq5qPłR4a苐 tߕU˻Ѭs0jIU:9FA AYK'74 Yvf\ZC?3<&9!OR3 hwꈤZ&dQ'yw3:ʹdH#mv׍8;􇚷A3PzIjqeh 7 v[: l?[Tm'UMպ%*DP-"6VkkI3Cy|PĄ7aYV6HhIr١ہ*̈́$Zy-k)M9 ;&Lc^o_h$A^4O Psny_ȳwr4eߤk]x?IL˶~RatmG^%1]--FpeVi%\[hT_S Tp;dc[eСS^ kڅS Pxĩ̬5܄+\+`Q)Tbcn~OvU1-k<t<(Xp3xrn*d2@,)KFE>-sYNc!}bR 6N'8p ]B\{3T-cx0W{X\ Ri-o8>77V;Uѳim;C\u8,yc.g$1FgL"q /v=42^Li_䢺 w>Vznad?U83~GF2 BJD2) q!hK';_cgP:pLJ!!+m2|uQpꚷ 緒z*uD  r-PNҡkb@EL4rI {Z,T_U1fx? ,kw4r;1ࡐM۷5$.TnaafvW[mܨeGpq):*vx*v RMfX*72;$ֲxB. 6ƾ{"Ckw ,``Jcc(w{ux95X8"Ug=2^eN<&^$x%#w`$߇$o'I(鼕Lo!䥎u,@XCϧL!Ð^/\ =S< IBoQ+`,h$1 d1lmp;3//·葺Pה =f]DSH!ZpY&V}=>rc=!sl(K^d2ˢD-_sA> T 7 L<k]kW^ƻa>⦦8q?z^$~*-E oP?HʊKmBt>h5}`"TͷD?+MʹUs 9Wr0dcI?s&CO-?K%Mt%LLe~637:OI -I:C73Vʣ .:檡\)7cqBL=·I胒kAԡJF$Ty|{N^ NV@}cA-`Gv%`hg^ִ#[ w:OE"Dy@YMuٿ=rƙǁBBz61:)ԁ-+fCK4O[%vNK2p&:4CEcQ'Jʫ1ku G1kCw~sTqn;66aNö?~ӼrSx%`zxQV-{6qFjeshlkH>j=?]B]a*\GM5XhoOa7Yc^:uY _Eϭ_ū)GV4YdJq IԬlz pwA"LJQO8xOzgǚK@ X,78s ;ZKݎk{H.sI4ARvG6:Q>'#au:612k ;s vqFA +uf϶Ti*vB3gs` JL!qzXWkK*gI1)=U\R?Wef7?Ӑ9o 'RN;B|{W%I% `Xc}Cc '@2SKINp~h N恸BU5*ǩ0u+->g`c:l0Hʆ3f\TM3ZnPsq]FE9re4#r UkBX!5ёΌK-y 8L*9.,eenkaVl][eDtY;&`P^SpqGKY2>ֿS7LwDe5hu5 òcvtu F0t1mh7}=Zj懆wSUm/X&]TBps4wdCnlۯ 7F5 s\m[\.ƒ2oA#UŪȷQf|U9ݫ̎6Qh ݕܛj0jCIϻ*h"4Vx<*8ν&.C^}(?\0c7 [*6S(tH* וVzNq ynD6:!^Pl "nSm`t:i8-sje9VqUۍ[]){ !lJon}{MCg]vMfd)9ЦmvG)8`y!%1cB$'sLE ՚;i:X fZIwJ\ͼpp<T.T_Qh|Od_jr揣jc qs|Zaqk κ`Dzi kc\=ǰ&G]X<}(RpJt}V*? >RcBq`gm{gߒf >hrn,yH&dr!g?* 5*wu7-#iso FەgE֟s"@E^$]3Z~8 KyMV,wpɛ۟\3w'<.tīe?]N mk*-lwCeExȭ5kxQͬWy1C 'ya 0Z էYsli {][\^JCl4?I:$׳{Ä.u-0y }r<ڱݝo;8uX$woXkԇn8+uANx;2[/X*铦+1IJI򘤥 $9Q%%.I1M)pnc2 RCD.j栅ԁPN BjiS4'B!EPIA2 RI%bI&L$$II$I2I$$IN)$LI$$II$I2d$)$Lt)I$dI%)$I2tRI$$JRI$I$I$ɓRI%I I$I$RI$I$I$I*I$NI)I$I$JRI$I$I$I$$I$I)I$I$JRI$$$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$JHRI$I$TI&I$BI$I$I$I%)$ZoP~W,orZq57+5:f_?ꅜzPseJ/a>'LzI&UWI$I$RI$I$I$I%)$I$IJI$I$JRI$ -Juo?KT:~3k?ìuh<"-%JI$# Sq@%B6Y-m۝C @uTx)G{\ZaѡW  vy.'k~&B!a}dx~)X=Gl  JU ژԨo |S$ ;(\a蓮'@iku(vYTr獬VN]] S LTsSSurY)>Zn`4w>o*k?mD)*-IVӠ`Jg<0+%h(S1 WQy+lXꑶ8b0S,a5[uZh e沆rsf}3t'{P'4jM-:$s' Æ_c׽zDc]t [q \cP@d?ԵT 5])q@HLJA3Ǔ'- _=l . MknCU@a9Kn0Zu(a9n>BԺ y+՗zpxM =~VT`{7H#~I!5otA!Iʉ9 AZK輇X7fv!Pp{e4P2\ө3'm{2`j}<  - Q<>?,ICkgO"T4yydV{=+Ոhnĸop|SU/>.Nw>NAE.=dpS1% ~J-+2Se~."G<מnBOippeY?*e-*:eI48BqgD0W5Ȝ(=E_v[()4xRx;x )AײT1wOZla|-SX*h`(IK$H8T br5FJ%]pK^>'kH'MwBH|wx~l6 A8ݛn }J-H/ԸYK ]ߝR.a4|?5k[ ۬=k?(;^d%,GqYŏun3,t:F=W`700Z*[gu)s?s_B[7ٟ5Ҋev+Kۄ?W"8P|>F4k$mT\}j?4q51%=w0 5})A@sy <]cXf %tVg+g՜Aw0IiƼlw9 $He17;q$n7AZ!ZU>B#k`U-)08)ZHvh{+pe `][Nݴrf\Ѣ^gƴH=]v&ZcQ0A$Gả}7xg8k3ë!]t)SL6QHk%E ;,qqBM>:+2sOcI' jױ- #^@0$p>Tv0GD{A>0YLppW]iH^tԧr_ -e7Pb \A4$uDmB3ƺ5ǵDL1S qwDXs'nZ188r_'?T^"\?K:5~QCѐDJUާ>REŲ{#{l+=E廚I3W>p՘rW?Zi;{iՃ K ^~h963ΟNưT-$m*0ǵIfi{Cݭf*)yreڇ2~ow=տx5F_\1k\., LNc3$jU,*z`Ơwv[nų$vT\w|UNY G1c,רpO|[zjco;\ߚ5l8$y?my'-pU!E:B7!dseUE^7pwb`h;#cS =^H quEUh| ,q [Dv$4R`iq#?P,a>&JK[M鱶A$)2Z đ6_؂jQ>@&!U$ =^O V {>~a:F1%܄_Ұ׻GQ-Ƃ|Y77>?&c5Pi Ce1;4MR{30knl68ry}]mA7Xc#^ A`dž.0`j}4-mNFS5OLvi!f .w.vh6*d]HT&k0 '7+(sNtwqأ6Hs:IG_6ZGp`8:?"Dz?r:}E#2`ƈbnu!yZ'4joi4lǚ~NDmk`+y8D5h ?BV68;'[17sszĴK屦5 kL٪[NԝUNOyxʞ5vY]k͆PQUm̻JNkвnDS0wl^Um '>6?ʺ|JǑ*DĎC;wcۜNl<; :PckTqκ'N n ۏ=Fy K?ڍ͑fP8%pU=2gQ>>zJLxl=% L%1(!2Sg1Uoju>~sU:+v)[2`Ͷ/-5x`8*I'TK9Qĭ%SC\\C;.to4 Md=`Jz2  Hk UkF;A$KA .+W@9NCXwOPm>\Ti罍kIaW{OQe~`npIOHDM7=dnh.`W7k{ZomaxUOp_h/,wJ2"\KAy&9#FƷ %]sP6F {o&Gtl ܤ)k\8(I׵lQ_|UmXL9 X2eIxHk$R0%XltKJآd,ps>cj13muOj'W b`~wPրyU|G-.?Rt;s^Ѯ~=nKtf;Hx)fb䞈ɸ}vP˝ƺ!TU'hpJ ȸ}FC hxlpp_2++[M1$s2f4ZkqDQM8}q #Bu~ܪ)i-QP LƆB{\ucVc9lJ{<8KQ qÎS6[x=܋[{kȫzOMˢ޵A+V ly)m0b{wr1P[o^On "\XUK-o>Bcݾ <+M/Uph6PǗe}_ "ͳe챛_ʾ ֫Rk0xUn؞W&u@ѼUZ:NGnXx[XiWt"4TsciV鰝w5j7_Ght%yAB 'A, cPUj0 5T;s¼;䳱Ov3^=J(U}0̧Ƽ2#h<8}|сqc8܅q5I푹Lm~bX*40Ub"RIi d:Wtg4\ڽ7Glz@D*ϲKg棃:$@:`:|ԚI粤b`tnh<4iG9@cO<ρ@ͺmC \-4p0dn!ezvd?u="`%B?H~*Ŕ%r<;Шr\';[($5z{#+MxHUfqd+Ak;/ʦ5HJ|Ju6cbw*b KQMguFGhl~=gK,w Gh丹m!R6r %!ʙ`Qp{ k+5$/!ԃ̫L O)q)eW a0~!Rn Ag``th`}} chODK ^ǫäB*>a HumP׺UKp\`A,~͝nqY7:0huz?V*@'8gc5`V`@=lY1<Qp^A_O'n?:4{!SDỴx'}]#W^_aaZ7w9C}!daR X6.9վtLSY쁋ypG\aB]긾TYyqr1=or]\_I2Ii]$HLN8LLRJNQRLPBH&#IQ-RLPR$C-BsQʃD)uW-P!C!02I2t"J! $ $J QI2hRLI&L$I2d$$II$I2d $I'LI&LS$$I'LI&NdI$I%)$Lt)I$I$JRI$~ɓI2d$$II:HRI$$IJI$$I:I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I'IJI$I$RI$I$I$I%)$I$IJI$I2I)I$I$JRI$I$I&I$BI$I$I$I%)$ZoP~W,orZq57+5:f_?ꅜzPseJ/a>'LzI$2I&I$RI$I$I$I%)$I$IJI$Vpq]`h ayTh~1ȀRg%:<#qڬcP)y@ѼkoRƺ5y)yȄ#SY׽7R v5m| ׿;Cq+p|Hl<$E΂11D4G*GRnPܛ"MࣉH\m D^I?7TPI*+'ֺO5 r$M1͵ĶnQ V,;aչ;ik`cDǂ2s_=Upz[qWy0y>) qx@ӫ>nPˑ_̲p3< h>*PD8K_O;T@1k5;=WAKgp 6%Nv^ )'vx"'D8Py5Hc{Gr:l@x֌ >G,iceJ+Z{xBⲣɉW(}F4u?FhtVJQq-)xL bU8F)lvJ$ji"#) Hk: j[ISL29A`gW2>*Bcߥ)YHx Qun=MLXN)e-wf}ꫳӻtP}.pq.kOmy柔N% 9cOV\\#!+@挓"9*X́:}gGtZmp@g@|JPqcᇳ0"1CtY~̮@=(O*^`5 sy%չnN5aPzPލMLxїkը<)E?9#!9y76LdqĘYk֗?,A:mQýKAs;NXA> CǾıOhs,6۠79.[ )zq1q&Ol‡IO85\̔b\*;9PL.>*fRF x L8y^"KOGeQ+uF_]ֈ|qu Lyo1ʥ]*5%ܦR0#oW6R6 HШSnpvdpk[;r;)-$G: ,Sc?ƼN9XϳVGeSlݿuV6N{exr$JIkn$0L/o1!{S׈tjm#q*а 5w du;aY #@*pg#gpuCmݥ[eMlFqx< q $Oa وCs\>Fo{Ѱ&GR8HQc8d?Wr.t/_%2$\taB% K KcӠmF}SX2Cvfo:$(B!-PW]!Zʝ_#Ek^2|efa?e>k|XϗHJPG0,Y?~_W.o'YA9RNGWE 2uv:65<-A~bEǐ%WCK⵹lD5q3|`{}d ôڬųYÈ85ѷQn&Nxd}2 >WmZptT(hn??U+嗦_V3ѹfZu$)syZwŐ_\{Icnph.v#gcf A_4v_cR,d74cS,&Ɩ Lsÿ>Z r89gdna$:4~hZߩϭO!b]mlLGnXXu΋sᦡ+4GBت?g5q s;Qcd60C:l;77lGU{õ};!'C6G?#q{Zd"8^l>YkM`Y 3OՂ@Thu`: TcDKg `80( ׃Uƺ6[ixpI Drd )om⚊L.9wsEe (ᙍVk-r{\F+ E#vTꭔGe$Wc}\(aq ߲q dvZǶ=JԸ-iЙ:VPKZ T3DwQ}q*"28xUqj,CMItn)͂4% *J&I-lT!N `6G9i>3X6\ߚc i乏᧊3t+>5&Zƺms\x@k A>:anxFQ xH1c dH(1+$XG~ԁU`GOD'˰bwiJ%Վbc(eI,{|HJRfc,0a+خָ{Li ^d<: >:,ָUXjO5fIw-uY7,ya lAV,*M#AXtNnv7{?uQ$hT|93@nYO-F>2,]#o `xդ9v,yhq +OX| =:*s"9ԎאZ>,CDF-E78(mCiKpŏ3k xI:jJ7Ч+kYm:8խԟU.cŒ.XM lk;]C,?w)aHkƝXlxU[ .E[.y٣s⬦CVt"TQ&EJ ̡J}+I7U4DS][N߽Zi> v.= vEɯ"mF>==@1> 68-|Fao$Kc.E0iGRʖ rYʇRI%&45d- h> 7Rͤ*dy6bX=Fd#R5UJqvZQ9D*X*zm2}Ҫ8I OX4̨2;( kĵ< c*zV@3>-J vD[b̺Qy >=!, 'VE|V QlڦM8uVď>mx}5jK7}-ӛw,;Ő[5ƊD-ȚAGQ̳d:-v`k:[\ZVxح۰:Ř.:Y7\28[e6@YijJ>Ĉ1(-~So`EW`K-G+VB.@Ȭ8|ǂ3-0nۅ` ?HՑ{]qK_В%EwBen\rFZ 9;_ b$UJߎhU75]Ůe7v7!̅ZM.pyvdDDFsd@ H;NV'XKNc.LBYÄcd-V1d; GӒe`AAÎNA_>> 6oiz}fV9kJQTvM:8%,00k8wXnݰpH$=<FsUnJ[Uv'!&OXICm~HC|xKzW tAV|_Xhu<:RC+sZ4>M :B5Gag =vM`#kM: $U0 uK)gdp>渷Ql 59#Vd\&D,CQwXG "p6% G5[&QUuC݌gmU]jlD!g`_W#cۛ%)N;#VoQ_*#mIXh\aQUlZ=/!Eٿ!+rm6mԑ¯lXp+R)q aPhc*]A!m*Y8e f%5Y?hdNc-!Bo:VڥrKJQ'EX>}L,k.-I_ZCpx>Y55kX\.#bNJuhOrJZ\a]h5nX'XT,Xlg?i|Kq֞TI.s^]jd(w:l@1nNe5f꾋SoceǚMC(>2؝ ZBGHO혃+X:HOsK@,TC@f0(A!31*o\紼AiVSրH:O0KOim=in _Wō|F@ƴ8k@R3$^9fTZ.aA0LZ١ըg_Q)]?(jezstpU li%#h[1^%-6+]#Y$D=**GoX.WP[rFU-wPS%)k*t铤S'M))I'I1O)AJN$RNS$II2dJ]$) O)CsPbJyQNP!P! $SBjI(&O $$J%2LI&L2JRI$L$IE$RI$'LI&L2HRI$"I)I$dIJI$$I)I$IIJI$I$RI$I#I)RI$I$I$$$I'L%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$IJI$I)I$I$JRI$I$I$$RI$铦AI$I$)RI$I$I&I$BI$I$I$I%)$ZoP~W,orZq57+5:f_?ꅜzPseJ/a>'LzI$2I$:dI:d$$II$I$镌:w"I$XdIzRSLvP83dUޒ&?xt%Sۺ0 {D~3 V؞Ux+,i:Tsnk-Ս}Gl'StG{yD^և=u#k_]S̳9@ӶCM՘i!ơ7.-2 d;ືwj[Tۑif1LC)kdX}La8"Jn` Ct.ȮE%!\xj8HC2E2F?5# '`u&rV'Pv bp5_?Y  tudکmy'2JJ q-3+wH`xjNFu(9+1qDInФ rZ6mQrKt(& ]NJodѪ,8h:#t#?;sfLm*%lDs9I 6Lǂa6iqѱ}`Vkf99l{ #"ZQ8iJg?p (!FCLa |G6L~SLf[AV]kk8H7pAu8Qn d 34_u[eމ@jhk-vP[/a~oZ H$<"xPuaŤr4)ۘ,En+![L@~E$-k4`ښwEǹ?xJAx'~hi > ;0Gty=I[HLZC ai:-V?MLOm@㲉>!'E&]LHTmy;Gdf@a#OꥱF[6BIjP'k1%L9Uqa;[ִ0 w~ VVc۝P~Ub_p {C-,"p9R]b˙hrƏ7/A?ykÇ<)A o&DjsѮVɷ~ݑ(8- w h1xiM!%92D%J.88?AcE݃Q66OѦqA6 ΪjV~/A<g ~?ւ?衻՚C!HZW͠9N ǒb<9} Jĺ  *-l`JzGiAT[Dŕ8ְjn g j9+k#`~+k\ؖۜBv?+fÚαXۆq,ov*nƸ$j#,V tp '[sf d8z:)JGN $S*U6]{p[gV:{3al7]""Vƹ nb da/Tv3fCT~׷kȟC\ =}P uW1vBҰ66tbCc:?gF=/lp b%MZSDFb:)%p?Qa|?gD 紼.DkAnpZ?u>>g_)`w)q+8 }m@nP}{{,6Z }Z}"qޅ+ v"4O5vD{CVw@;Pa dvG 8#Rn]<g+ 5&tXmk aM1?[NvYG9-q0ѮA[4Veniu۬(4kխЎ(o=©@6 "> W39 6;Xޖ!KޭZGЁU6vVmq7Bjdz_0Lݬk@,vB:Udm- w%;ꮟ{̷$2p!+YMա*3ݶË?ֽ݄je0Tjv,y,#ڦܰڭp[$ !ИK%']!cs!F~p; K YYaD5Q^HE-7 H*9.$z=rC{7 s7_!F[cFx&gq2XO#|?)miBt6 pC!2_O_50liqC vH'g;~U56Fm qil!*Yeՠ} ;ct!a?Iq!9z 5[~G[JfVGt]Bn3Py>*{q$,sRKO[x~i~r> {}WL?H~zj{ K@=-2Tl\aDTԖ9O56Q=™h"b}rD?Sħ-5;\4< @b8?O YjnuLf9mL:߸rx"kǑQu@XXHi"4)tYXx ~q ,ce=p _R!c= 9uw è5Uqm/t`],0[h7nL&1JvRGC;Y[Nׄph3mko@ q<hyS?<)DlmH -hn۫еSUmA3ǵcX`#BK R8Obe:_eqդ4B0v^g S3D@n;kƉhnBP Ck*pP (wD`m8:0x^w5B 11ܿfPauz4o֚QP[_Vq`4&@PUAjP9 375 [O!Dmϱvu-=2m^փI6f8!F:mL%En yA-a.%>1R(7Tms@2n;*6^~ C27nמ}L<VȜq 8@DVY} T:m~=95=B\?2ãF1:SN x[杳:0xjis]]ﳇûar?SN?4?|9e{moRwUk^HNqV ~ɞPk(C^q5^td[_$zήo,mCL5?{vEen@*ߪk,pۻhvh4p 4QKFJ\\xK3Gv-TG:ӺxUw5FjtULrhۖ{.,UKHCo!HQOٰs:{T4'Bٱſr <LA-p׏z۷R*l(kkI.xӄc^! +s \[Pu}AYY ,50%ʁ BDGIkmD(5S<ӓ,n['EIԼ!c9^Cgc]24Hڎ|smV@c*wȞ sADuM$ \X6Xpc#{`!3G-ᷴ9Qʱe-xʍ8'RdF5"a0)nn%;C >wsNkNhftTZɄKvDI,:RK7@. zAw";"47p]ͽbH2am#mptԏ6F,NJ><^Ku}jVqH-粭cۊ6Ԁ?ڧR@ VC8{7"!NɝyQG kZI腠yԯǼUn< fL}="8*@:ewFKmn& SVUpa*n&yhMDQ[oOoMdU>Cc_Ya7wZo,ս5*5?"edW;,, *F'έ`_嫘lf{&RЂCVƞ*+w94FfeH's%nML2'U{nט Ɂ$YΜD+ h81~|as92O y'c`D`lR M>IDpaHAΪ$ ГRs0(Jy5)Oӧ1}\GV\3qrz&W1ݵrmA!jr=2/:\aWKZcMTi0ƪ5;kV/ŪX$*}`;K?բ[.fVI rl J?k]"nEXd%<\ia]]"Wj+5 $$ΉI+]cH# !Ó)FgQ3Ɵz#,,2 =nm} 8s) hF2Q5 7kC! >RlzlAVa  fBڋ|QN5ol<(LEd7s'1"4Z*-ezioa\H KK+km0A X| #&?H5DzemQ269pj@(m2 wplmAV?+hkvRG$YcQ5>,츶G૽T%䋏qh@=` |GՈGPrGZI&6o:co>>ƭ[uאGVt] =ojw[spzXZVj:4PŌ;צKs=+4vZWngi*9xe:X5 ܖp>ไA`AaQkCRLIE$I$HTI4& I%r%):dR!:bI&2t72hPpI yQN\\L*ddd(B!I$dJRI$BhR)HRI$r%)$Lt)I$dAJI$&N$IRI$'LI&I:dI$I%)$LI$$I$I)I$w&R좒I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$$ $II$PI2I$TI$I$$I$I)I$I$JRI$I$I&I$BI$I$I$I%)$ZoP~W,orZq57+5:f_?ꅜzPseJ/a>'LzI$2I$I$$I&N%)$I$$JU[ CCSM%YCÀ’1}Ve1)1( K{]HcMTik#zNOM/ 5Tw vI2ֶ"# ';WckDOJϭ88 `cFX8e:#kAԔ=E|()sA|V^ᴇj#].%tOqϨ3+ds[#׉]NqhJz02t4 Z|T`Sp(F\[leUQmimcduKrXH %[c !󐫺Grrq爵qWhH▚0]_iB"VZ@p:+OfIPcÆkݩ%f{9Cil%G"}4K,5%Yq d>iiK|f8LJC+.xo33۵sd:f`"OtFЦ_Ylm/q:*@׺@CUnhsK2XvaUDm W\efcFqS |⎅N;@,>=/@L>?Yt׵ot*ث9:?%6eKQ|1ݾK(R;^ jxGAՐK;z?{|uB`]Z[!gQծTkp[*H@mn]<8eelQch8 0Z \OsF4fɏd{PݸF8>~Y.ױasU0OYcY?l] ^YLTHoIDyd u kL;cbޤ}~4-??0hZDlkm9 w@)٦[^ qZq?GjC ?'ˉG5V-"`L),#v*U>ǗLQO1vlɾ_ e'#n> cni-I5~(]\ƏSam{r qc g&O 5i|gŇM6~E3>2&2_"b}4Ô 5"(dUlwZRwr Z+/g~cq턧{}ܨ4Զ6$ǭƗzN׼J S>lf1Y;H#`YU!OjGd@#}T^fmHV=<$:Kg4VM<$AP%9YJKhc| ,=E39kR[Ϡx1O<z0d&b'I̙JS꽶jիU̴K+RkL >k(j}rLyH9 x-PvG<ԓ.GptYkW3ЇP fb\ Y$ q08p@)luDzK(!K$짙\mEUuNdYj,EC^#Ƀ-L}'9 jpdUn UurP8vUP2D/JcnnUq| ̟TjY GU`󀀯 ZtGlO; CZ P!0kNA G#K${ZMi:+YexJc~TWSnRy4o y:{GPQDFTǧ8wߣfkr̦@(1Fn#Y7T5@A\C+pP F_靶ѻf[5;Nc4p5Aotpd%8i"=o seg?4ȧino҅ז4x!2Myiwmb #w!:% zY?c7g.q$%i5cCFvT[s).s5q?櫘3Sk#Ni@NKA1 3!%KF{jdC6?uA nНQ>KHPs )8$i2։D,%?44&?Hht׮o㱓?U{F!^ ')b8zhI)YO3-  )mZ #-;%1_%7j]0 Txt3816ygm*OVt'G6XψK baqUşьPXyk?}%{ |cUa17GyG#>` "8dxgEC_%6FOdZ]iOn?Z\X-˰4C74;qG!o%x>2k&R4iT7X0u>+6<˥}̰ =,mi= \5kO~T# CZG[s QPӯKaoT wVG6c$Xٵ𕫝{AR!?@xŒG!GxH“XA.yɪk;“ZYn.`s ,CZ89/ˤHqc9IU)a='S!,F>08D0Ёߚ^7QbHU}9b1nj1MPT-ct E.2Sp _^'o?)ο68z/>>_D6%)nm[< *nmk*M+v@mMFV̇ZGf }~j #SIOJX;ĔvP#<+aM^Asuv\$Uv1AUR1jUZuj9|!PNu!Fq`5wߢuDTR k㙩*yqNJ}NA@jW^N䳝sɒu(U=֋c}y,c>[Lc]#lTO 9֨wsڴPH*vFӨ(5.we4 >*WOF :ȃ+VP%!OV0p鿋vMljTjvQբN|*Ʈp>+BW"UsJv'_4J0h06[gLV*@h;u:vV/ Z,?7ՐG* i:铻8 ?3 wu#2?eeMew3XOZ\+^t"Nl;OSOUSv*nhK LC&j=pTߴMcv;u[%ӑU(A(aFvEIy=]ǰ5yZߢʂq65s6iy'%<$p|L#uUhتq\[kcE@Q0RO}R]23%psw7]4Na ubt8I╜lI 6S3s6?Zؕ6a2뱷7k*{vۈZw1J ݝF24܁enۙ«[]]Ƹ8WjlmQŴZGhZټEsj-U`c>Pí'+sHI K {w{D-NcE+ec5vN)c^la|p;))@f{6x#B.iv1FӯtpCDw\oFNtP,=nb>Nn®]X=WH úOfsNԍEwkty#u@ 'w4"uAwxQtPuN54lG1$ozI{ ^CnOqW}IFAN$ 'c9XJ-/ ~ou"JQV+/4}"ݫ_|qZuJsMսI;h#T=g#nckx%1c,"T mM buVs|ơ;^l(Ω[^Zt),V[[CQ#U`M%ݱTfSɭ!pZfƌԱwcUa3c9!B=BSCc;RZ襓*?< [D#4A6]|Xk[ 춇3U('eM(9ПXzMv9JOckkvR cxr9qk$⯕̆5 6 Orc. lOa/X}\]xdr}5ѿ%V -ȭxy,fXdy% y{iq9V/uĞ 8:;owu荢|&Zl,Z$|9Rm.<JֻԸ"[<j鹜T_hmA-'7{NJηiaTOLcKʑ&&& bcS|04HBrpBUI-V?<͎Xφ}Cxc`n[ٯ-l,*vipZC;T\WmwsMsxTa(DLj.;:e .(3v3IL0f=yBxxIznCǎ ԼB DNr_1BldVnkwWyqr,Pk=j5NF]@T/vW'Ź!6^ݣM} ՍDxZPݧ&7tncu8##1"UVXKnisO}_`k;^~*Ԭ hpl :Z(8ǐ gsu%ݹFLzL DǂkjV :|ےݖ p-kJ"!SlpȫG#@.7Mx~>i0ig~BsQ{v : ?zNlj'Buw$GSLJ x[v:v(Sx%Gh Bkdq3HZֽ7(w>'Nm?%:,Bea,F(pB}i] HO/"U5@#τqY6eaWu"s}+^ >S]KSG'wZjX xVʺl{ȐQR Ba(/ν쥫cґvk l0òw{5P NF-: [@$;/O pAE F]~_OțzC~ @͝H}eyT@/:Tj`xeXCUsZꚻ[hD><cgcv82|l˞=ݤn*MVcyBZF;NIF\#ƊC,~ >x-: dl|1#xFe6莬بf67ntl u uKVzF5=ZxBz۫xF`ip8),Uȁ>əV_`3 Xǵ'PIC\@JA66PBHKeˤ'a. D);k* fDUIJ2RGpdAKcS_a4> ߰I͖2y:hʭ)Z[DyQnῄ]-c)6XǑY=dNE,w Y|YF7&R-fge-ʏn`yR4D;G$lǩνx-kk. ~C1{&r9*:G-)YTQ u)+c5 5@=޵b%\1ݸY[膫+THS*hfdbnI?HwVgN('AT.L,G%kM&I 9,K s-"AhWcExDBg㠏$ӪO!^lh ΐT\RkxS>=BI2q2$fJmcڕ[#> qNq7LYh0#O@%ÅF^nq3łS݃11(k-lP2cUJ 8 'ogTQSߤ(c6K$h\$wG:FДr9j~3 Sf~|Ǹupa$i¨sQ-yg*4d OUh0Z wVQx"|6YQ'zs12彈Gu\6(tk魛aǕM٭Fy/>"G6ͰAJ -&Cz#RcJ&}ߜZH*>)dž"7:bIdԏ1_I-@5Ub4T۠u%:{@}Q?zxsl;?v2Kt9#ϒ醗Lk=A1ӹ q3NhѺ_G5X h$$ӖbRwy~j%o1<9LWٍaLrDkAi8BHmehp'-!;9D~Q.Ljׇp,0;>,$³Ӂqp;l+4$KG*b1d4khbClRgClxr#\`%v9!})Nm^H:G9:v4 aBId/?8_gc;G*5;8n~P,a@Or\ iĨ$q \PY`4BGLЈtռ| -2\[È |vs `(=\yB{\x OnA-iʕUmN`k41#$OA&uY\T칼g+o7y;0 5!6̑" J-;*o)Gn3)S q'8sϮ}ò hetXrrƝ(aTD,54=_uģS{:)]y#A(Nc`$ 4"S߮wbfש;Ħr˩JUTu> aHdAJ5n 8c<׺NvhpᎦ9Za){6oUT]>(+77&IB 'g ZI&UolI-:CKN8 XU븛 9,I95*mX+JahPci2kng#X/{ y(I_wD)U9Xu:{a!\i:fKm1:Qj| enӨ'˝Q #!8gnw/A%x_qeL;`s;=U]VSYsVkKWNNQ{G`UɝHr 9e82?kێٸ;v)[kk`G3}Bd 8)ݿ@+S'`ާγ*n0o'M.N uDxts@7B8SCd }wxwCXI>>dʡ1jah `eW%ϰp>>#@Bdni1ݨ?{Bn`Gy]9gRBe8+h K{$I굕yl~B~?VY=T瑢USD. >/MԦ{kUfVL[uqG"tn7cbNZpa uBzZ*+y9M*U{f!&Tǂw<ѬhkIkeS/#XznCÔ8՗ʼNQ$òoCOtw1a12 ]˘O}kilVVTOxF&H̑fagfp{m6X>1}h:tYN٫5 8V*n1hI~)ʘ $p5*ޮ\<4& qǸ ɟEռuCUs!Y)G1XdƘy#Օ@X6+@Xk+igm5nVkhuK >CWL88kx+ǹA %h0t 0_&veʫ*ww]s!\b, WLJʮT!QLGH| {|t\Y;B%Wզc J" %-1B8ô'?V24OmN =;lgOx ;Rsj#vAAi3,#-ŝB0δ4@U*փ]pY>#!ݶK IHB{-Gu\B<;ުgRnxm4Y2xQ  N,ܓ{.kƹOtǔFO]%gc_Q:;.,l-W3C6 *A:'c2gJ҅~3mq(B,isAqtWN͍sCӁ6wn6&:jUY ?lt+jUdAѱWʆ8JEjMa;p3:wV4NtGGG4CMP)eiQi,va^! UFOɮ,cI9wP{H!wM.+~ȕ0p(8l_`2V#TT~?֔GQR> k)$CcZlBsv ]7I^OBQ1g0cWf+[Z vZ<[cOJcL;P{A2;v[V JOVm)pkd%Gqϭ[! H TT櫎f~ V薸(rF9`b[ )FQ8cU5T?"R}OT?8H@ޯ`PH'G5x'I)JS)Bd()I$LI)tI2IRI$dI2dR$C(A!t铡P!LB$ɈRI$BJED$Ib$)$QL$I'LRRI$ɓI(1I I$&N%)$LI$$II$I$IJI$$I)I$v!wRRI%I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$$I!I$I$JRI$I$I-?+z7gO3S 5iuB͗+ gpf3xY$̺I$I$I$dJj64$$J CZMI ֆ5SХ~ :&y{Yi(}2n\~3nuzai/8Y'@9ƪ#} i3U2t}"u^^14Gjr3}_ԏt.^owwsǵw1ոq FG7vz۳=Qf]i8L{w7P4MBZrʞ#j#P9'@rf!r Unt~AN0%#?zvw̱loPZx WK`:|w731`%M˟[u{S3/|*c;4zvol pĬYP-uQ{v ~vCih|nS1^VXraՈ]-нSi2ǧuz}ڏx'>P.[LnHUZ Z5X%po 1;P~V'4MkKuLOp:y~*/lÂͺX;Dk`;f4PkG BsHd)IR5xVWc_ig%(4@>(M5CtXZxP\o!Xl'Qt?GjM8P`Ӻ )qK=xoU^1Fh`>ӡSwo4|/hU8:P~sHv\#ӛ)b%K~,ghmLjS6;:v)W JӸ/kmsWW=5Q`J蹵zvD՗t?!NFLy(Z:pL--ֳ߻jfZR;[57}#%Y ɬSzյ;M;&#[NyM3\IʶבK[ܨVj>)5(4\ #sL|Qdб}Alg q%Vdp׺c(-@qs8(cc)= ;kJ|CyG6=%BkOռ8n YL7 s@U7RM)ef:[X7%Y׿*ex|y5NwIw-6Wh*?O9?@vHvx%Q=M*]a͏n i"xIp4c:cY cT:u< kZ!w8x~Tv6S$8I&)VJhj}"LCր+)cskd)s78Kup|)e4׎Pc}[]Pw&ed7Ặ`18d__ح.y}{'\hGRB݋[8wTh| =M^قZ 7zW`w= 'E6GSd.쬯}q[[ m@Oe %\MuSN&8HtE,^C >[߲X`E,. ħU1Me0G'h!HQ{XF\K'(cD^hئJ ik -a|r\fEb}tK}LVe_z[@UTV `ϗ#J6qˎ?\$F;%X8 {VWT[&Tj`r 8RLGHyB(& ڞց-4ʪB<< lkwX| dwښ^^-)2 )s,'J]fm ~kn,g4Y%Ys\C>e\Q m 26*YՎGEj RY{p_{Z[>{nLo @R;Ld*#jsA$!Cս rI)nk;wQ>NI {5hSNlwo^^6G:ς+ٴù 4?xGs{l45ZEASI1\l&<5Gv;Z;yr\0jOP\p8L}BAC x *A]T4'Q) ].>=QipՎʽoH Nc諁ٕKv·c  %? ~~((<4þ(MGD10jL'^W~n?uT: *v[N= $a-W{LHTPx)#v,1)琘t)$*Bd$(iB3yiWi@{kJǵDUӀ TNf\~X-:$tVl:==DmhG*p<4+XUYC<l5KO'H2xgnS06ۯcw,kFOoQZEDwXڭLf6{sŤPY@{w{>{(7Q qo8b)|]UAՉ~U1/@5b6֏=9cUg_pir>hI{ .Qu +?kH:, >ପc0N x[AYCEAHab%~hPɱ΃:Efw!6c`rވ%`$Y{'qהv^=7hP&\yLۅ.g"t)+iG*,haiuGDz|7zPhs˜'Edl?Vsm*CUw`I`T1{yH[@l)3G*U\^NA਌{lS.|2rlHAP*Mya t0zSjrAv)(ws'C9̭.z5┧JcUcJfcJ'CPusȨ&=V-S×->E ys4st>bi/ ҌgжN-NLTóu#N|wtewFFC ZllKDecє҇42dP?r+CQQ[9Ma|V;j5GME\lo&՜Z䔱Gqv'Kk:rNdI"]V'D7u.Toֶ-%lYN0G`6Q!CiC?ʞZt}0qҟ4nh-걃٪ΰ{x,;Eoox^#h68G)X׍UÂ\Vlt[l#i*}'d v"K +KA̫^H 0;~|Xm]hc_w`8Nq<=JM "QAu / 1wS*Xd=?aS 1׹WdN=zvptM{t&7r+i8ldw)B *rJʽ+O[n<"d#l QS5?pBt2{ y+6wح$ TH.!sܪ|\0?WY8t/4j- ucscЭ֚qXv9Cu 4:"Vb!;m.|Ui}`nf΢JkҌ;# 4̴5ŦG*mN4|ֿ*r7heIٹS` sqpJб<A3 S fȍwDTָjׄh۴{z%!H,H;&lw^Ms4VنXZhBVXtW-e9Í\#OXCƾHUTm NUik2P{ť3kN3(0 Ka>=$xLfc/zSstB|]k1#5cL]/sG"4F%Ԑcڬ<k#%k3USS<(Tc6@>\Ha6yJkG"Túw׶G{v)d|lKx _|$( DHQخO$|<c}OAJ;-*$( @ӪXcDu&Ʊw ojy)|:TA2\9O4,楕P ûX Si8VkmgGN3~w HՋhq!ԙV/cx4[-Ԙ#龿w-UV8>jB1igQ!T#Zx<-Yá,oRYVh]`D|uswSg_~/< c/$xH῕M@;->#S 蹞~CՖM)* E:I%)I$$I$J$$IL2tJIJI$)(p:Q*EDT铨Bd)$PQ*iRI$S)I1L$)$QI:hIJI$bI&L$IE2bI&L2JRI$$RI$I$I$IJI$)P 椥$J)$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I&I$BI$I$I$I%)$ZoP~W,orZq57+5:f_ 5iuB͗+ gpf3xY$̺I$I$I$:f+<OeKU1-RB7i*PŢ@%"fC*a(z;0h@ٳh^-./ч豙jx\l|g Ǘȏ}5_}bvN1_b4%qV`_aqM[> U^ˉ3G!V^/L)7A/thӀG1V?Lŷ s"Vq_S4J<> 3_P}nqx&hV7cupkeZ[m-8F#,[\|IE%K?ꕂC[}YYT/r溇ӫ7[Ts8q^"|V-/sg5䵥rRjwLE@׏W᥾9 mV `d斓a&mTm V XGY>Mc7;G%,{ZHREHƌkx#Qh j .c ՚Am.ouK8GVY[gīrH* a!,>ZȬ($kI^ MQ=.<ƺO~y䮤yTCc䤫͋jZD#fǁIwYGc+ ^V}/) ">d7st5ђ$"; Ջ]DD#I Fպ?K -,Re/l:H)pq~[* :VYB#of?'cה[ ǚ̻qѸ)X,!୽d `ǧ3[ N 0|S<8* <ܹCC}>NrnEk鴶BI RC6ӧ^Rf<HNm q-;I{Ozw Γ+FۍA0P ;CrK3 ՈHEZޡMF '!5DFl~۴##;{3iGvP.Hl  :?_=F01l !R4[=` !Dx _z6֒l;Go憸 i۱4;Cw=TW%$\O7urS}6Q3)B^t8'Vu j D#z&9ByB kᲹ1JXն\`'}w536tOg#Ujtmvp"tEh%6׊x w~ЅwGMe-@ Xpd4A8kkF3O[Kg uֳg Rm,alkCԥ'/wEࡹT2zx1(K?Yr<^#L`|A:Qh ]:C_ zq(f~wpb$xO6ީԝZvni+?lc^ĕ:=қ*ktj\HT6mo=DIƀBf&dBeF?]ikJfnS CZ=TJ3鞭-Y! W]/'L [k}WQ%79yͶ vQFG]Ks`?Z1U}S+o?_Z U[Z}e]]rl{GMէEf b*kd-hXūā:wTV5Sd{:6bHU5!~P0eq+v #U Sa؞Kݾ=*uVli"{M'd[6ڡFY̵hRuAbuPo puv!גe6۔`7B=yaPx6C  3T { O2Pi TَyraG$>CK;繠r`9Rk5F|lwr!ϑQX,X4G nUhu\•h@{Oo#R}t(/k|?4~V]…TĆa.v<:AHo gxv%-i5p\Y-naLɄB \|x4Қir )cmu װV2rL%JVopŸ^lj#)ƻW)>:|T>#3𿪼Dյ}zL1M򕷰;^VϹkЕ 3G yQ8NGܠAfMqP3{wDe A[${c#dAOP&sXG_SUsGk Y#@?F{?!Xkyk 4?DOf4* ]ŹW G-{B qE{w=՘!vmaG[?Qʭ.2'ȡeźNKaM'2,&{{L dCauz=iefUGBlv,pG(vFogu!&UI$*}A2Y*8Oy:B~&5u à G , ԎRKLQvK6ҡviIB ,/o\"<<q`8LTk8V7yS:I&iR~*C6wI*c}A@w4jhS^m#C)˧WsX ΡPm=]ʰ1*cʷ.^ ̒:\%a՚ϰ0ZqEsmVYe8ѵ|kp.sv!w➌k})l.d:S*=H4R7sIDʵA#ӻQDSm.@Оa471ke [@3<:D|EEsq5G,ۄU찀 vU\1ߖL$1|&?1?K{wRd|H74jh}NSONڍXۙ"}ʵKc 70ne6ye2@xlNj*La<׵8#A:y#Ka&{襓v5moҨa?(vLw-1 >qG"ou8qq)[FIRsyI.y 4厢-1f`5Zk,4. Iiʱq 9~p(}0F?cubDqPz7vhPl`}G7Gw dVJ$~8k5a `Y9d9wVA9U:ƿSGj.<6?H7oEAj[.a1 \O B{&Һ?,[en#G bYN[^|U+[EU궭5xKC:Viq!;SEMMf45h~aU+n<mwech"8?R}'̓K4d~~ P!nlyV%RcAZ߂vkr1*[pbvɍ}Wי;3Ť~H *8sh^&hX Ż $ I4sg  2 6),\>pG$%?[`-R~b3dK [Y zLĪNʳ* $`ct!,PÓN(9{ĸ0Ze ߠ&݊vP\<n4;,7?mx=d F'6 b6?I#86U1Dq[CGAi`pvfSZ~bd 2>hI߫ iҟ1o-.,8}T]DgkC S8y4j&גno5X\Hs.XYHq29-W.u;Lk#"Dc$6naeX;tl V)}?%{ݠw$eMasHq,Ls:s  LLf\1 5XNBRyU\5omn?ZZ@ث,ayE, IiFGOe128A%1HKp Kѯ0nIBK}+=ПkPOb8^ F1ކN8ƴhu*=ꚫ݈7#sE'e⼑}jyRhp=@AqDzKdcc] g'ށs>|UFwǏ쬺ͭ<'UNƇ5<š5Br - r!2gǏrckDXY쥰-#o xeQm5Պ!Ux $[ O rlv[]A!ݕ,\L r*dG70e%Yp'VLJrl02A&ZbBmS:-m'7KhuN3W:u]HTڌQ.Xú̺I\7G[ĆFCnTHȯP 氼!9 ;AI.jcr{Zv-=eChlFLLnlf4\Jx "l{~Uv8~)>?ɽ-<J@(ycÂUx.8RLJd%вi&C~լI$kI&I$RI$L)$L<% )I$GEE%('L1PSLI! $ $).I(1@I$Q!HЂI(IJI$S)&I I$Bb"I(e")$QLTIE$IJI$&NJRI$$IJI$I$RI$m_?IA$)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$$I I$I$RI$I$IhuA\և[y=j隝 5iuB͗+ gpf3xY$̺I$I-^Ѭ8RSY%"kU&Ngu ǻWҺekCt.¬jqs0GKMiUX2.{t2y|./C/kG4r\c,P :0K 4h$`vVjQ1CŽ^"fPYU1%&UyHTFE?N%E-,?* $}uİ4v tykW#EvҤhގ+{CgC6E㐴V[Ӫ.T2 6VCr ϸ5GghThְх[5x}dӕc!YZ!ͼ o0B6,iߊ;eFS""$|tr̡i7&^ZPkfֆ)xsLAj 4=;_lCU-ILm1 $B=vl>H4t#懃]܏!VtF|% rT׿@$&-mm;uPuˋiT2:dOd43 J꩒㪪_`J$M65j9([2_d6FwVFaܓcAsHpbiTRZ-͓P:BrHa0eΉOG {tt\x7kxT^$,* L"+V9% 5w< Ch{+d#זAQ#3'(Bi~OHk۲`?*K?Hh$;)ct<5[%Fuѣ܃cǨ;`Y6VٍSjZ`;VN2FȨ [\}/Ro# c'yI!9&O;7:`h◒7T@Ve?{hC iR4Fj<\N=CǸ\zPdSB*'Xa]h FC+od[XC]Dm` dxc zאOx/msɒml/ndJ$#ktĄ$8a(\4>(t ֗Vd)`ݣH;t>B+ YY"4)3z c2(Lt⌗?z+!ꁫRk\*C X?ӍyiFǰJķ BHH_Bȝ!r{O@-OKLt*da#vPi_9x"L@|?xAd GPf#08 Xy кN]FuӴ5›pTܦ@aX̥ѡ:*hi/ވEe.tn?7Wo?> b솑iAVߘ^=SbXOpu0ϥH,Вe^~K}M_=Ѓ%681i޾82a?TmsF,թpmvlJn8:-<͍̓ߣKh㼉?Sr|qǎDΏqΥkm-5}GEK6ow.z.ǻW*=+c3ps^ChnI I~wrObf7VZ馝"r|(;:8;[e`!pZvTv^^L4@m#L)e0~Y-x1lpkha 8nʵ ƃGj%p?Z.rf<ۦfV)q*PA6Ztf8ǂ|8GO<*z8#Dj3Y J}\[ࣆ\RgeVyZGd3LhR:|}P[*Q̥5a< ;1%jmӺ–{tlِ*L%2eEoXls#1B h`IM<Ԙ[oBבʑ$(ϵݐ4Eb'N hy5:X}=i9~ȫ~hP.wMk2 )=F 'x`]ZB6ߪ9j6ZgK sJ\:6S\ [Si.YS׀d:]QPTr` mqtBU^DW#f2m5@#E5BwGrtFu C^Ք;1ۜ5R!-WuԬ~PIװADfC Pm@9̭KUŵjY5S[P_&9VNY[{DzǷcbuݯ$|kkC۠C sK:8fm<>XwtJ2EqabVγ F([ &e"ZvE6]3"VPKςˈ;_EmfUَecn&2wd"3u5c 1k l-gFtNZunEsC#GqJVP۽݊^Zd"G^eOM㸅 kSB}JĞk]P{v$숅7ʣQ(x:L4>J,S . }A.jsǚD<<B'ԓ<|[(W3Z#܍1liۿ4WZsf۸zo+T_25Tcld} X4;IefI Iά묏"cI\ۭZ v\o"X7bP r8(qk@$ Q,|G 3eG@0>(m*g&lHoiv6Sa@t*sf{z^KcA/%sm /Ak?$^ِo^C݊2@)Op?Ze#k? >!$*inBV-(gpUPߢQch @_]XG]ʰ˚u ,3c!@h GxS$!o%|Jsί˺X8XDAQ}̉PFe(P?/ 2LOH+<Bv'm쨀&']dbdFʱ>%!恇%G"0ҟyfEvY[V *$wܯPt n·og'WPPꏮh Bv+@ g:Ē}.!Vʮ!ߚS.sFMK]&{mtw XO;6Ī8PA ??W88Guj졾Ǻ13mq0f"\^\V2Ivk~)c9ţV‹ߵ9XC@U}o>\+vB5*r}=,JR"K,%UR&7Ǻ 0ے0?$a\69S1T̎4ù8vRBbE7i7W\-LMQpPn<'PQYe>UXd >Qk=VhJb\=|BΛkĈӻ<>y~N3y}vFˉ\r{gl7#D|X\$'58vQƲ'p:?5Sµv#Pr̍ZX!x,f})%. 9-PqwT}oʄY{;p -R0:sh&af-?KǞy{x#kR rRjJ=F iK>?0d7pDJ12<05[i0_Y P22=h1‹4tRR=0| 6WOi6R&dUkwӍp7s zF%ŽC]_UkTT^[B >d)՚xV*Q1ZX~NczJc}R;jaO1-X+ߒ½f?}6=]]EY >h^ } ې,k`A??@[G$,^ҍsu Mx'Fwiz\D;X;~((0 F?TMlNyN s_sU쥒\DBǏ #;ۨ}T8Jnָ͡T pw@ʾ#T!'b{UL4.TYLu'YZvd y,M.8?C&ïpx4|{j&Aݽn٦<~պJ};12_8*M jy7DAScCDЖ1"|V ]D"1'p l6;sC#EŹSUFg':ZWH[8puScF@h~ 7GE~/L|ջY?{ nEbj ZX h_k^bcY9I"f]I$I$$I&N%)$I)I$L*EDI$3'*%$.I(*%HI$S'LSi+:LTJHRI$4ɨRI$S)I&L$IDNS$$I%I&L$IE2bBI$2t)I$IIJI$I$RI$ IJI$AQSPIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$$HRI$I$I$I$$KC<垴:YS.?FfL 5iuB͗+ gpf3xY'L.I$cLfzuX*ЙIn-Wh'QV2ָbI2u)HȝIU"f5L- I$AK'I$I2JRI$tIJI$I$RI$RI$I%)$IH5;(bI$HBeކ}n< b-.5<=ʒvTҕG0dI#E}E1Lau-8 5Э! `ze!*p/hQr-n[u9.k5T.{ۼ(ۧG%>?uY-`%Hy*ػN7~JZLBv\"9Ms`oc4WSZ41'sL` d}<_9L6U {5P~Yx{<6J6+fJkZpj$(ӭ V!DJF?N2~I n ;:ԏvn;{PvjwdQW8v@Rs̴ U2\T : &kX!Ym5ha5S^rv&A q,7QKF݁]eN_ZOALʀyhJ%x55Sb?u0J"'C5QsU ZL|ЋkJCA #~g&Li ޭ,&Dx<|צ/avP?zv9xPʣxӴOaG*WD ;%"v5T6ƈRaÂ"NVe4fCNn}:8eQ2?8j%TB::zi>cuo?r0O*6znB[6@wbP,x')*0>䋈x {>BIS|*!sxͭ;G!R(vSX;)E4l%feթO%w 0L(DA W "gSeWV4&TF1U8ͩ[2!?MѾ@p΋+/(\yc n̪㮥N;ն$Ɯ(ِn9B(R DNJ[j>z(c@_rpc晤>Q td35U  7$0~q;ۓ7VeZumw GeE[qy/EǨ<8i,?H E`p.UW<`;ѱO |ޞ5A+ Ȱ-U>6cHp@6EA|B|K^yUQS*ZF.ۡ<`j/?w<-؛_p.& †3ara!< kdZ0HPw`UM-7U ,r#Dq)')"|S@ Hvۄ;Uqle}SUPX%=ȴ6>!WoLcXI {K*QTs6'I(9.(i%8R5(0H'D8u]I'AT3]s=>\A[P-ۤBt̓.=g7i?+]kG~5V 44vNow#'Jp=9xiq4qWqC[USlj8cYٌ, lhu ht @.V&Գ}gVΓ<=ίsGTnme\&@G%Ĺ*fǴFgy>TۚATw;\$y6P &F;]MzmFV]KK`k:,٬z%QQ˖ ANyP{X4*Y=yZΠk@?qAy>.|L!L,5܁ŲL)U5[#Z949#Q}XxwZ0ތŅƊ9CUdzSyߤߊq ԣK۸L"l{W6m{2S?XTm542nt+B$)ӯeZ?a}ļYXYZȬUjtLٔ΍ 5xq?p`rDzcEvGhx@(չHK=*mlr}tOR;<}[4qKQ&MgVFeda}gw&X !$+ռH?;PLB%9M Ju?џY4$d0s=uu w)ug(X}Ol:l?ʹCϗ-#Kiwlx n`poy[y-nĎO%;<Րi!~*͹%`e'HM5X&x[wT=%z UFU-vbtB$jVs Cdsgh2љ}4²ޭ`4Aw _k,0%jÎI9K 0(zGyUl;Bn}X7 #ө~K3i~#|}&=2`ŗGyc{!qϚcC|ҭہy cR5ULftcbur0Ck~o7K$O>1(ZՖޢN M-UY$|:m}O7 0;tryxKU[XXbl".xBͭ08ڋ‹H6NJga'ȆķlybGqd6`/5RkwA M<ϒ""tNZ m'uh\ ݴmSPeuTus@`)XCy,qu<(9kMheW U?{ yN@ڙm9t5cAb۱JsS:h j eI N? ۧ!ĔrU!k֘a,T: cT,sI{!/;J;]I$FFT?Semǒ1  bq[veQ躀݅"@J>{"vG??cX_܀ZUf$rGql ⫹OiS⑔lAOn?{L;,L.#i+챶0X:N܉vHZCI2 :x$ =z7sQv,0'<! G.LǗ]Wߐ;x.kS[tڪ80K^ IO ][H Х]9Wkx;DouJ|BMEzBCNaKRF񕡑@xZ5YYy=^vBTkE6b M-O.<}e{4tD!T+)A]_mP\t#Ts°`|#QM 2nyocv8@V}w1.%[!@wIopՐX>+sm؞ m-p|Uc(zDgszv9gW:[ ) v:Rt"1;DZd\ܚg,lphh0q5< T}%cK{PnӲ#HVȖ'*S6kxUO nU!nխc}Y몔ƩCcŸud`NUZ5 8i9je%{NJQGu.>S5,iՖ t,v1=gi8kG 1{S#O-M2jmEo$>TON4+USXV*i 7Ss9Wx hK!1a~a! }:L\_:V2I@U1ڤpg@Lrf m8yGo'n^.?G٩~ x}N0ŋ~xr?Uerq˜;U5F9=T w>Ѩ125jv- ~,Ci+ xOksrw|Uz5ñ$' =B2 ǂrIA(ck 8q_aO/ Y=4xt[ #RNY4#>4K{)-,pM']% Ղ#\A8tmQ{L++,hqUZ:) NB9ոju; ݮ)7%lkmg!Z"N7Eq u=D :&(&N}T@ v=5'`=|Vjl*A@)ȬT%CYsZ>P)d%nOO h{rk>kGYݼHǏQz'__s?4P[u0N MRu#sB9 ݴ6ᢚyT#la{ J-m4pwL* V RT{k]f<]찐$)Pв(5e6Ix W j#ӽt8ߕZB.2ُH`gDf4@H%Lj.octFRQiJqˡd0{ۛ(Z<(TC09sh~+ un6k3}ahpŔgFd"U;uw;|iO6|4{#zY n 9\EZaAb9h Zf=˽hn8pt% >L^ {K랢1=̓*NCQE6f@Yi)sGNtϧl d F277j\ǖn1˝Ca74yUNFVus$|zo"\~Gc#jE/<#]qV[2;zN5t Q;)">(zv"BxΰMXH2G܁@?;V.?9c&5zranִ{۹暚׼~b'hsq@ߚtuZh[ʏ&L|3WOY#e蒳:vp=>t5Wկ:]V/Q6k 8AjEױD1vU9 Yc}<~1jefG+_K4wv+h3UY>ajxs]~)m`QH# Ƹ7OLx/Td^ƼDŽY&QoK*lEW̭ B{;*Y.g#{H|Vu7=w+[ w!F*o/;OJ8W  /}[mhs5i`f44iVm{ϴv js= O3Z;?%\@d>edjq+8_A[HT3ވַ+X;`ȦDւ~ 3+u/㲷MƓ-Lùܤyk a-)}, 0rEDhkμޡqC9-F=x6,gُqm%isZꅗN3F1b"{޴2KYv<\ 6yD#̳#dRRca 1敕6଍VxiUXۆD懄ԟ%O n׈M<.nJ\a=cY)z]z~G.Cİ:6K8fׇm(M/~OmeSɧE'vk 6˝#ِjvk28e;c#)tSeGOLFLq$U-oCq#=GOXj fYKNm5LÎXR7`qrs6C+ A'@LrS@汼 > k̳O!Iq˜vXx|Q.} aB?VÄ#TrA4<D=D\'xD!lF>HZvSⱔ5FLs#c<:[ݔh{K BRD_**؈|U5m}*οV 48n(; *ߢ/Gq6V?$ DFb_7 ksHK$ !XٻܰSPl1?B /.f+U2Zʬe0RTY;Vިwਇdvm9Ujg0mgޗ vuM,;ucXUQӧqૡX\$"*Yg)MSc(޴Sus rCpE LdYoO!Q0B[ #*_Q%G3s#JV6"C{K6N^*nӊN)BLw9{5K/"7&4U1},+[*AaD;> "%R o"kؓx!V!=QcwL7C^uU +_noݔXn~x^1\,:q(n>c{wH}Տ8~zo,O<1}@"YRBY\AUVHSABmsgf<'"Mn@n9_4JGwj\ v tF(>`Er=K+(sl*vc8h${ }]d c$@{o/iecPgmAwtRxx-"qSp-t4*za~wpEY:J1q1Oԗ9[Uq$>) I#35`42{w+$u#\~^]*o>^^QRqK޴nD;:a|N*cE oWgwx֒[̀GZCw6Ӄ–*tDPiyU֝BqkggS4I|g&NJvF;: &w#U,'ׅ}NNHJA;M4,$NX}d=Ƨ[~]/B6VP \*m{äH5׈ݭ# X 8ǝcj;T3sx2]6e0_I8xQ(LHqDA`EnܐaXֶXF[{x1nUZc$l`@B?B{KD'n}v?^8  6H" V5QHjLx]#c^nwsӜ74B6V"hYPh ƶHn+.2gz/ Y 7=K_{@U~NJìhpEV [VD'EK;ӨpT}]|i1hs۩|V^sZ6BQQZ,E i>lB zuP@>[\G}h#AW1mkB `t V t-hJd^5 c]OVgCQlNKɂn!Y14>!KYs4w=VG$M)'X^a|xgHi  F| c6@Cw}̈́ S ĝO=~j%5츂%BeaQ{[P☴VwTY-=\Ʊ QԌ}Mbsc`|K]>JCp{έVHs*CCLS. C U"mwh~D%TZ 5Ԁ]ĠgmS*8uPљܚPRNi| 9UcT'efW%6 ŔújN!Y9Żxa[.ӪL}B|i2dS Vm\7pЏ!9\pݑ.B\ZwB-x<COdQu~ΜX88kȭHP0-pUµԓoo?6ckX:a}ʣSw<aã5vĘI^pwpUFK1õ|=:(Բ Q!3/$h)P[?Kii쭂[*k|!Ѥ9Kt KyTHk_Ia7b V\7{.TZL0U\|cjNo1Iy&ps%DvCi'51*KKh][H\$r+fNp!&bPGS\dHBÚ ʩKCjl8# @%iXkjZ45{AQxbiy̜\}$kh1 լ[3 cqsuiԏf郋Jb:yJGE/xEy)juUkG;-lFX3ke2ų{K݋eWjcI?I>JU~|Q{ZG4L\cp5 GU||gx DW? 'I<4Nƣ얒+5 W %f;,F[KlEcp|}Ge ZScW{LWaI7V]Gt⵶V#RyRs,f'Q(S[KJ&7k6 cbpTN5$J }w4s Xv#qՄy>|ըDsjK ;>H Ƨsu} l `|h{X6,OuVrZ-`ݼkvYT4G(4Z[8d.>k~Kw,ag3s]"V:N =|x:| F?7R:Z([("2+c,jcj=*uJ!՞ A:FUL,>7#rz҆HM_P8Zu@>.?;2jŭ,wZcVS"zm"xEyGM jഷNS6N S!ߕ Þ?}zbHnms{oFIOSɨ@Nrpt+ˠY۷usCEbupZ-*\/w)ᝰo_j/!ԾIdWZ)qXzynYj%ֱEz._-\Ξ vr ip<D\Vɨ#./Ɔ7B[@?zr7CȀmу>H={Ӂ-FTݍM]>sAa`Û ke&3 F9~SUhu?Z=N[`YM|{)h3>v2П#ecC+0v|r0[c\۾Rjq'H,<dž81F?]' *Hڃ5$ZnhT,ym "LZͺ,~ӠG\y{vrrX.\<~%"(~Voͧ{5t•m<ʰ]x:8ᡧusaZ u`mwq %Z\DVH-|_!?cf ߹pḿ.CtWN &09KI ]oStsc_H9El2BM!<4ZK'o|5VNx唡uz lR $,hxuC-<4/ IkT2>44K=:Ĩ6I \V!~jÐ܊^cQ>ZUV<&lHmv d)ktRu[>({C d! ~MIwj#>Q"4B2^]VY"t1>;QWri)ΪsVCG}$M`!J#I;$q* Dn.%zx#.I9@~/\;7 W,ʯq.*=A'EE` (Ӊ!4x~olƻkxsٟNi؝2&S>15 Y6m sHu .qhFw=8( \&ƀfT:m:O'cGZY{5R6Hh]bYPFVc5PK-iQcS`,CFRmUYcE_"ϚvP]SgJ9c]W;8%5 AcUOLw*^wKw!o=5FVӰ#R44RJ#siI (--ԁHe;WuhtC^$EuAU+:ukEU5i(N2حmioi<-j\૳Iwlxb Yo7j܇Nq6qu$+ m|As}:hcb 8$ zVCO*.Lzt1f8@aU8n3I>Vr[Vclzx?DLqDzmHy>+k@PyTdwz%N АA좏#9FxNY8O3\r**i"Ƹ7at ʶrA?$ }cf$r?]46K\ *%+@,H ,{{ޓr( sٯdw3O;+۰eRcִ>HAW)hB$&ƷP )pa=AMc&|S]b=63 1';KA1p5 >fFI 5>:v lB u5FKL`KLh+BXƇlW֓{i;<[uGR_[xPqcO(ʯ$Q?cssmyMէ<UO6]lR"cAૹfE,M-a[#s*bs|Bv)z;;JǛS!~zGCjE}ms@t ar/u΁|QhhD]f4EVSmv֏ז} %dQ4+ T Df3EJ&u}sv+)>I^n[=?$6HE lxa9;Zf?PuAwlH) kù72z[`Ô_C,E7}%nWHw׸nq®EݾY4*c-Fjkx"VM@dTl#h{AuUyÆU^7*|}*9\4>#M^ ƣ}1<č|U@LY.I4tW=N56:%)5k27:xQ;78qΏTpO,B,,!$MYzO( ǵe6<*\d.x⟫-i'sLbΣ!J8Ii&nsD*pJ6qp0Аw,E5Ef̙a=0Pjő?t0 V;t?cDzoe61Hv{1m5H'ƭLb1ǸxO̧17hV.uKNp7@Q@su5(ku:vHBվ'$nr QH8$,{qn^T[y(d]O !o=mݳUF=y>pC1–$7>V6!!]v[ l`3B]Mi6=% da;pݐc-]^!NQԲ 'eM" o( <> UKiZ4RH89)^˝i(',sDNQSu.h̢xbFiw,QƼoYӯtrH'RR0D_g#VFNpQaScP>\?4F>q+ 9HhSAR}rwwa0;s1Tl]V 5C>J|I• k+ UG Dw"Y`i\qJR9G@<')"ᷲvOdYՍc0C{smѢ![qP}C[BF02FvL:[;ͮ;puF\fIP(ͥ $G9v&CΨ 䚙_eZrRnU^Z=7fsuimv:C `Gܪg 9hŢ7| hhdDI3@47YqꉬGݽ*\'opid@h0d+k x>oB `9H#B9çJ9EݹǓDwՃ#cn(m.GpMV.?Di-Ҡm.hבLI);]bNuԔ.cvHdݐϣ6n򚗴Z Z;$6YK ] ,1nc]' NQ*CCeE/.'wcJcp]QZѬaW!9V#,\P5hdI& k$D%X{_Vmu$x$} UXs:M$LJdž̀dBpt[.*Cx"Jfo,VvWT:nDT9s<8(>t*lq4_j\-}JȪ#v??kO@PX[G Y}Pw%8D7@.)ǫ:l=h)6PzmFaV}kDu;\-h u2rb@KusvRp.ct2=|_Š`gTC*P4\٦KrV|#3^ПʍzxsZs15T>=:Hs>?v!d0#Q 2-iv,E vTfIʖ3@iy1*6-*ٴ|S{H)Tֹ;$ydvDٶ zLdgxNHӀeʯ^kwyS9N,hɐuCnk(95"d;xX8Mf(M6(otƪ! vZCLUXbsPAJ#*Lmೱ!.wMu\y@)AT1{}d5p= rl-Gj@.9GWB}w&Q-Ȁِ;nC*;\uVŬF׵>=1D{x +ߚ צCӯ5L[[ Is<L= @BYh8?b>)[)CҦG"V,nZ! Olx+ƹf{TNsU[C[\`QC#u[^AЎwsLz&5UsSzĠhPxn`wORtr5 ~S$qढ़븋!ǐ E} T_f@ KS_ǂ2ˎ"FWm.thAgǰLz607OY,s|uW1j\4 *;=C={cXŻH}x)\7<o8~_7Q׀q4cnʉ6\`3<lVGҔ#aeQcv4ƃ̤cNoUWԮDr L)z/BMsEEǴV1AY6Z?pVT נ~DlL#ڍ-ݷ-ZRn?;p(8eYi#ُc ;*/og@&DRdwVDƃ|6<>a[wh?(WmϭLI8Th4l1[tbtodJ}5$~`8%HUȑ.ۧpA4ԙ*4d='Q h[Bm{{&IV-~PkL::>(i%Wl`?*56 ;YQkyWlfqY.|ܗ]d=ߔɐ@Ԉz"rOq 0aDj:3 C8%> 88;L.l@!:VZ= J'6`=q dLbM{vLZl4{\6sYֆѯEGEo׻(#L0,ۇǁg%1|]; WWRxJh'kkZ;cZCxZMZY]F2P<g*oq HLJ(⇴}ɰbQ#"bִA3 I?vgH(nwwq K, rٯ)VhIV1߄˓,'YpFQE  zz@7ݧU'{Bk@'!I1!Mm wH@1&շ4NTlQkYPK`rG?!’GWz3>y=,()W$h6lyFy٫9 N{cS1ംTy(v嵜jBc%2i$ieb'x d_إQ4?u.eZr̗X?t!{hVYjX-ZDh5a.k$B?J#ϣGg׼0j;{XȦluw*WI 5% ATo7kp\2%9#LV7蕊ƹ8p x~򻍖gΠk)Y5NFuV5k盧C*Liä_FϑOstUl;ȫCݪԂ|®0l~PprhFWq?Drk F{,g1"aXf(t3wZ6(@UݣZBD:)Ki!׀Հt8I+ kvL%Pw4/Ғ{i.l,wjv5 dDxkCÄzm%ƶƆTn-cy +u.8@h{+^=r60-ޣ 4Et))kGJ#f *; ®Xב5-i-˜AW]G))@: #k[ ꚪ}N烽&P3^JliR ;/cTYmJ؈Aς&g=[*#(pظ)AB`ˆL u8^]hcC‹ZPA%{ݯt[ 'Y.Ux\J! qxBq+@wN!d= 75]Vv^;hUf3qc(k Βu54dAoiw S}9#iuzI9P8 wQDbO/M^P!g0!ZZ9\S Y'VT%9Q5*{<䖸6]w׳IF}\L'57z@S}^kC@hL%P2)[N:Tnᯒm#iժ-BǂKkp$yJ8InTZ][N袎X xpǵ#d3k^ d-$F82Nؕo7T~+1FkK|W5f<92:Uva?Lƒ5?KRV_>!Uf({; *otvc{ZOeuU!;a`8F;8pPzcùU,{L4Cѳg\N%e{ rCS ^g8z/1IsӍLkSI.3YׂcUv\)Xw;V21<ݕs}poђ'vwSc]t8 Ip[KR>+)<8+?'ix(mϽ]IG1$LOVW?^ ϳK?DQsٗ7lob t ;%K n:v*`ƒB^ c9G_u7u]׫t)UzVu4G<)8טk kln-xdž8c,_p6VD3s!32d ƁFͯ *7Ju}.NUa9e, &{|/mfU5)GcI'+`GrNXB@זaW< ɗ$ZFq"zݡ$°*؁(f Amvb BoD8Ww!X.cvV$wt78ՠ ;q_ [}<<ڏc\5L5ӹc8Q11 l0*<1węiV\*8/=)a@zjYPxN 0BԽۡ~ͤKQcLi?r# /~Y8D|\GvEvK$UzꙨ9Jm=?4;@,4VP'܃ʟ5<*prWYocG~T yAs\hUE;TF0 Og1OݴLN$&Jvvv_d7״yk.w JUʼnfIJN n"\7?kwF$5#1Mm}8SiZ`'vB =ޤ潵ZOu&X8e7f$r~ݒNܧy2_TNFC1̓Gs8e Z FTyάmQ<(T9!J ԝHÂ@~w?a s#XYYe.[UaaXѦGǺ'!-m'Ԙ `埕h [ÍRgTUw`UI͇HEH@v'A5 @dòtg#F'і`cE_w%VOmXLd+Ӹ Ep5;QC/&$_G󋆎hJX$Dup#}>$h^k0L,p.սǂ+]fذ7w3i|R-+YS,v</N!;CNˣ/1 Ȧ@:fY۲YTڴpj\utE緯°>):: PlJ/[2;ۚȠDRԺ.v׈y&Sق2T*FHh'9s٣*lx qSoo7B> ;RPq g!KHBN? ?#VxU5)Orbs.X6!ncCA^eyֽ c~Upm5ZLiV8:=dcwG"EA՚*7PIi-Q Gj/i " zuqʅ 9< 9H,2Q <@riuNFTwPf|ˉFV I5Tu*L{2eU~2g$΀ʳA%y<^YU%S}LN H#T7 Bu6H#!>%0Z(ht<(o:9DCw3HpfǦc]TKGb7Z "kNSpJQh{&@"#5#\F:>~i]R(<ma5 vw&-IX7C #K`3ǟ(Ĥ-[W*qU~-[XkLifuqodT2{5߄!ƕ 򒌶`r0n-R,CɘL[:yՄ곪.ix^Ɔnk1UywG3<2 W'zԕFƂ1+Z=@Y~ys,R]Vƾs ҕ\CΧMSà #1Ny*>ٗkK)'ˇb{Y EfC%mG)N.0ZvTʷ`~X9OfXrOы~ ɔXs{x@ eSkд _A#iVCÆ)Bc`< v9ؤӡLЈ#Nr? XCT-D…]@C'Y9Eyxf ]S`A:փOh\ zp82 bHf4?f}yDs~PQ AS}. UWas_U?F79\NrԁHsΎH22Jseb9G?W^kj2C. E%S ;NSGY[kV߽Ǻx+skh@┌Uu|\9HPɬWa`<e ۘx*6HL* tRVhGyii;` L;OwUcRD"G0h$#F%zojT; +=7?Q!ZctKt\cUS<Fk[cgEsFEn8.bN,w-0v Zx,%Vw?JB羲:+`;`,S\dV |R.ׁ԰P?8)Z$ƽUMᎍbѯ-M^1:-tZ͒#U|I2_UkpB."aΝGoCpڞ\@ʟ1s/e|Ԋ뤋 ۲n`@)M}Ꮽ3SScXB\ݺ[͎sr#䙖:n3>IfD<ȜDq|kHF$XͫYSAqނp'Pf)3,?+!IUC$>)<`hL a R׶D7sti2cIsZȔdTkiUi _dNjU`{ΎpJDZw+k T^?wEw$ )XQƉY|A`T n|Qy,:InODDXp`xNtCIОGp `8V[X5n=cFAq#&<XЎ1{ οvxD6C7,jp$iF#IfhPr*-kZퟒʞXB{(et(C'c6G@cc}gF3.u#lh|U'{x)V4*!݅3Nޙc?/u6İS?jwS_U ASwFT.$"S|@Z~?MT|TihШW!Lp"D'C"\B&@?/I I֗wr$9N1 M]OFŖ6*ۃ70HLnu>KT:R l;ZK7UÊK6ǂSw0L&`JF׷]!z,yh 5ҎUikvHHbTr1w8=ªZjkm609>ƊU<Ht(mOB>F3itjuYfW[sDB3*.ײ[NjO[ڴ*ʲǀ% >vaWUr4G(ؗ08{s$$j۰h@" 5"kU;Dm*mwwhDhe>mut;,|lgre]pK?C'ٽN=tl㙅&9t筌ƟT[0Xbƺ"K@CaAڋSp#wÒ08pM24RIUZq7p@0uvcEJ8w4sCXtwQfCi d\j^L8krSX8@"-'@ [{A.q:"[osx;z{Y~*1[?/a^ ]H|pj) xY}%/0.pTa/'2=fs4J,tqU\urֳ#vJ͹ÍA z=f厗vשβ(β%0V+t̃㴪YA}\pARC ZrS-0uי5k!)͇NMƶ?k4a:%Iz}t#P$2Q =\_R*}gVvW0_A:*fuGcÚ؉A#@}ގѦ@HkJˢ|ŭt;8ELjM^Ɵlk>F@VOC.a@㜽_UѰ=0(V֐LS 4#TZ/}cOVA[,SfLnLnN~㌿FL91֘䡘gp"R)s%#PB602}6FOhD,dΑ?/j2Y, );#@@GV$t'k]RL&ayP{7Sh-OQq\{CI4z@44o꩓GUsς8~g+\eCKxTieAR!uFWoPnKqL۩t;:)C>%O#Q ~Igѻ#CZѨ~KM!ߨieF9dYy"J0]U{Iom;%Eg{<E'B#CTqV28] N:{'pTw:Mu y5FȨ65=}Qឳ(6Q|^!HvƒxH5kb^q:@Q5O D%®8J 1%5RvAӨC;#D(c`E],:xkAq#UwΥKDw1#棧I!T'Q'q)Gdo)m"d;'ۡCvHC&8Gn.v1 xʹec|vcTzcOUYʫLnMG NMnQ)؝O pv|PVi# qYC.2T۵0)B@ Mm0:Ly!KvXubƖ 8ɆʭkKZ\Z(~憞ʹ3G"S UUpv[`#:uH qw3۲Ecchu)G iV51u<_*=-s5 D p5eu}:X@<^@L'.p>&kh0;'Nͧ01 5Lrw) F MO!4g;#l&dH/95gV5(zv84pU-Z, ocK)xAwqzEͣ{>>'Q HmsDduSccFn&4i b}VԳ1Rs:JCA w?`LӆӯZ].^tMH>)}w4 PRT}Hg/wO;+?P{i>*65Nt%"~ns%蕚\HFĠ ean)LW1Г䝃)뙻8LwR{)1w}/>М%葩RR3QG~S4n xh{ ~D,2<"45E"LuХ>kE'k&~0= ({X CUdUn#.cC lǥI=nHӐyWfD xYoˈcvvcN8(C?ON3v`$C xC-q{~+Zn(:gV2Cv]'s{}nk 䉐_g |YvYhuij9e8"%O>wuWއ >Yz3sI#HYve{}i6.! ;Ih֊==ØJCqF9n 89pt1Lg# V\wjnҝiNX+yh%Wu}O}E"Z2dž_, O+йl(Pl+30yM V2 ETHH|#IR?h}꺙"&%I$2d1@I$b:I)IIE7 ED$J%2tR&NS')RNdJI$МMRI$2dID5BI$Й"IJI$(%I&L$J) $J%$RI$ɔ$$Ie$)I$d\sLI%q (PRI$I:JRI$$BI$I$I$I%)$I2tRI$'LI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$dI$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%orZoP~W,WSju 5iuB͗+ gpf3xY$ʺI$I$I$I$$I$HI$I$JRI$tIJI$(jf6RIMX`CkQZ$HD a9KTT’RE+$2I&NH'LN{ QB(9Xʭ;#]#\Ys~VRj48i6]g01N2?kO^O[l~aƹ!{ۖv20Cs)cÙYEh l,p> eƠcK/p&> ȵ 25DP;3!*uNo!3,L!Qb{%Ř丐dwE Ge+im#+҉g,{5kdHΖYԎ阢%; WZ`w=vp=ۭcF=E`=A` شLs؅ G( _Lyii)rcdq Մ|?mqhpU9JoH}L%@̑B5#P^$qԔpcŒb-hi  Ś_r|)9hs~m;Ò8(@?'6DS*QK(RX1S(!1Sk||`ICh?5srE6>oow*evOoKdd !#l++3./  V1†~8U#OɰGu7dR^T#Y Jh4f=z9d2hvQ14pmTrqotH``)mdiVM!?Q_\$]N3XX  Ai,SevqJw}*@Yv9mD(ې0aVDiQ뾏57 V85E~L˞XQɞXQ|A|μ[-Ө0 Ʈkf\f^%@hcӲցap0AcF6K {KXmZ!hc Dtp!eSwGܠR(<<+h0L.=nu%GUqkտ\ugNSTcG~QM Kvv5lxGV̊2GIH#_{+[Ôqiu;'Ej&ߒj:˜5K&۴| ~Ucܚ*x :`cgPfCKU, c Ǝj I87xժgsa&i!eHKBx>!6Zt mt)(o [Ƈ%2'}~cP:0;<$xJI.09NIݸs1\ߢyM~&6w 0nw !Rnj~y䪯Ԫ2sLʐ" EU%T:? [+ eow,B}{I/Iٸkm+G\}1eB[0 ©s9 sZ][%dGl[~&p]Y l5)#V.4a=V&!BD gP ^Pd!۠8c"7KfH#e&I̩Tf,'Pa;/SWם꼴~[cT =qeIϬO!Vb|ӳF>_1cfu uct%1ˇ1l p\nS"湧² okc{L۸n;0:XZDf[en X}(%;[ =ăXռwKaC%6Ke}$qk^! wRMsnS#mkh@˿gK+ w`kB2*k:\G2+{C_©մ]&8hRP = =`1R8{s]nm YzmN̶li6;*apAPB{h$}Š1"a(F8ΰ_J2El-#U6[_U@ r~ I}wh [c:vV7$N$DĭBJ d$a%}%i{AӬ7{{--:n}5thdUXiqG ~ .:U.U~yS(1͂O#:.hnV  =}{(ntTPK9oUa'DF3U![z^Cj0ݴ1yL)48 8PSRvn۾DyV9͖ Ա ϴ{/C<@P\)|xr{pfEv[hs kzWUn <5mV;κ @n+itpbx¥m*{gM#D[ (lx!. +!}n8s2bFv2\G/+. +#&28c%FI;Iѧ'Ow|Fx4h=ȾiA(i Bƕ@Yc ^[t1kY>uNU';sN(vw6uޣRf{cS5ϴm>kѦ#Pͭ%Xa.vG% :lPwRZD%i8AЃV?$FC7ԋ$GNt " w<˶pƦ%iNCl[I#V #Puz@&V{xMWT6 4TwwH<ۆ+y z-s4J vI(2-ThT4@2LQ/HUmv \O:#5MK1Re0&1LjUTq4~<ۚd;T4@V[[mC*la!?9"U ~![h)T`enI}3'GIm}=.18d&ly xOP HӔ䋏g޳ Grùv Mst<+{lb> 'A{vX7Z/k~]fq0:CIvJ[LLhf#'p/L̯}ƁY]U0 Vz8H? ◨'+,ȪM`@RoPy:U#J/d R}F"Kq3]Igs[Sa!GJk*P8ŭi_x~ʓ\׺.PK-cլ