ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:36:09 Ϡ &.(6dHH Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?2w83NS8Y' $LA ks(hv#ϟpC1] ~;]:\HRVv^0?TMo-=06͂=<>\7GT;*,m692w:~R:~N1#et\E\GV'H,=3 %C̼XTZo|ԫ X{ګ\ÏGVQV@yԠ{=@Z7]d`r@:}P,vYYHoqF9yeɨ#$@>$8}T;*هfjMΓRs{L͵@ PS7?<@t>Uv{F^0?Jִ{q$q{ ҡ6Tt Gſ'8ִǑr ۯ*xhj *ֺHDZVoV}&-3 _b48rGZwn i5G{]1ziЊ5h ׅUFxE/p|g9bimDY? s{/ic~i&VsI&hAXgSƻk+43mUqn``q1;t oMdG;oG(~h;n?bos2do5b1gZ3?܃}4Z\y{\]v8J#Oj1Hq-?)_[ֹ't ? t\k.ɮ2 ZA<-&HVY"m?[Wȳ5anKb.hn(*QS~k'q Ff]TR6CU4ΒX~w EijV/'n֝gw']tBkVI.OR' #D{_ڣjS6##. +?}$v)ѽ1G4-icJ vK0Yu?މl"&w+ y'`n d®vgNH0nk>:'S3,},Ѐ\I'oٳ1Ejͧn4Q^[ׁq?eNsH:~jb`^vvpi&Iڴ ոG}O{_!>}WnGg뮲AkO蝟mrͮYՑ\ClޜwZ6s]2 [_hZf9k?AȒ F>5Z{YO?hGk8RDdlMKVjDmؤ?Π GL~N7<54xH-u~Ժu9ۖp/n=f]km}gӢ.S^C+qh-5߳{tˤu>S-[#9kI,TYnF_q덚+^Lf ^v&˟k0jk6lzn$7bJ{w=4 pYEIh`L 1O36Z5Kkl2+KRak>}GRn7- ÚY\kA1%6n˫ҹgB<Qlk,"06?t5 cuC 챆#Xm%8Y7'z8m:=K'1h:}lunyl=@Tw/mwعΩo>#V5oolILc }w/jεn:b--mκοbiئlNF+)eʁpe}u,YU!̾:Isֱ?9˹x9ߡ$xXXt^qm2c~\ƳӳguQ@3LN631jnCYwZ>q[YVU3$FkZnNgٝc c[p?cQv~K~@msa"ͷ8^􀰑1?Mo(\wd9xCJs[%>5Qbʺ9p uGѫIYW\_h4ˠv ?Ć.1kc[ˠt7.Ztqo}"Lj#]䬫v !$??wOm(8O4gh=3>[?|&Hoܕp8CvNlw'wvs7g -}]ZBێݬH1}Jʨvo\=[]N5IXKhkĶZkJ|6>d?q1;ϡkּ5I2$N~gG`&9l>\lE e\גϺvlI9Uue#fG1~Dupn_S49Xm[k/.鎻Vd6MgGc5]>rfk}`%un; x8z?9oin`/Pedױ͇4Gsw5[7ʹF=kkfѭoضzޙ.eXYckFnw=?+xUWmH }apL1VN;zTϳb}y@:C6;w\=568 ;~3ro965h1 sqq#Pw"#ZeQdzNHARF&mYk t:(c`tG\~ >H?Aیõz$Sp41ϻYdmpqЁW0J\>*n#pylu|H v&{^ZZg]v1.q'̸w?J>Ij?Ѫn-uN'tΠ?g_߳;C~E#tu$׹;eIҗ8R?1/x7!k[ɍci_ZB|U~h4v=iVb16[oEDwo# ܝ,sBxhAh&y;iGYb wp8aė_ꐗ U{l?*k^A=*쏭3v!=ɩ-p<>c2 ⹓>@&oc~#hGTPz2k2sj Y/[Vw0HVtgaJuPx"eZ8A ]Z7Gf~ >rV{`w>#Tؙuo>ǡmۆ^%gv_m-M> Ƴkb}l/oY1Z.Jupdlhw]3w9q{O u@%gGgk+>x8x c>oOmZ6߮)V{vN q58xJ!Wւ>-?!w:JupK@cvW]▐OWb ~ L$CMyxU?Iչ=Fnw 4uHr=/U}I*/|u}?2$_ }ׂ$dKu?2_$z?YAg^_WOٿ~uu%:}e?!uexI_kdO)~uexI_mo?>_iVq~cӟQhRKu Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMU workbase_foto-26 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM d Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?2w83NS8Y' $LA ks(hv#ϟpC1] ~;]:\HRVv^0?TMo-=06͂=<>\7GT;*,m692w:~R:~N1#et\E\GV'H,=3 %C̼XTZo|ԫ X{ګ\ÏGVQV@yԠ{=@Z7]d`r@:}P,vYYHoqF9yeɨ#$@>$8}T;*هfjMΓRs{L͵@ PS7?<@t>Uv{F^0?Jִ{q$q{ ҡ6Tt Gſ'8ִǑr ۯ*xhj *ֺHDZVoV}&-3 _b48rGZwn i5G{]1ziЊ5h ׅUFxE/p|g9bimDY? s{/ic~i&VsI&hAXgSƻk+43mUqn``q1;t oMdG;oG(~h;n?bos2do5b1gZ3?܃}4Z\y{\]v8J#Oj1Hq-?)_[ֹ't ? t\k.ɮ2 ZA<-&HVY"m?[Wȳ5anKb.hn(*QS~k'q Ff]TR6CU4ΒX~w EijV/'n֝gw']tBkVI.OR' #D{_ڣjS6##. +?}$v)ѽ1G4-icJ vK0Yu?މl"&w+ y'`n d®vgNH0nk>:'S3,},Ѐ\I'oٳ1Ejͧn4Q^[ׁq?eNsH:~jb`^vvpi&Iڴ ոG}O{_!>}WnGg뮲AkO蝟mrͮYՑ\ClޜwZ6s]2 [_hZf9k?AȒ F>5Z{YO?hGk8RDdlMKVjDmؤ?Π GL~N7<54xH-u~Ժu9ۖp/n=f]km}gӢ.S^C+qh-5߳{tˤu>S-[#9kI,TYnF_q덚+^Lf ^v&˟k0jk6lzn$7bJ{w=4 pYEIh`L 1O36Z5Kkl2+KRak>}GRn7- ÚY\kA1%6n˫ҹgB<Qlk,"06?t5 cuC 챆#Xm%8Y7'z8m:=K'1h:}lunyl=@Tw/mwعΩo>#V5oolILc }w/jεn:b--mκοbiئlNF+)eʁpe}u,YU!̾:Isֱ?9˹x9ߡ$xXXt^qm2c~\ƳӳguQ@3LN631jnCYwZ>q[YVU3$FkZnNgٝc c[p?cQv~K~@msa"ͷ8^􀰑1?Mo(\wd9xCJs[%>5Qbʺ9p uGѫIYW\_h4ˠv ?Ć.1kc[ˠt7.Ztqo}"Lj#]䬫v !$??wOm(8O4gh=3>[?|&Hoܕp8CvNlw'wvs7g -}]ZBێݬH1}Jʨvo\=[]N5IXKhkĶZkJ|6>d?q1;ϡkּ5I2$N~gG`&9l>\lE e\גϺvlI9Uue#fG1~Dupn_S49Xm[k/.鎻Vd6MgGc5]>rfk}`%un; x8z?9oin`/Pedױ͇4Gsw5[7ʹF=kkfѭoضzޙ.eXYckFnw=?+xUWmH }apL1VN;zTϳb}y@:C6;w\=568 ;~3ro965h1 sqq#Pw"#ZeQdzNHARF&mYk t:(c`tG\~ >H?Aیõz$Sp41ϻYdmpqЁW0J\>*n#pylu|H v&{^ZZg]v1.q'̸w?J>Ij?Ѫn-uN'tΠ?g_߳;C~E#tu$׹;eIҗ8R?1/x7!k[ɍci_ZB|U~h4v=iVb16[oEDwo# ܝ,sBxhAh&y;iGYb wp8aė_ꐗ U{l?*k^A=*쏭3v!=ɩ-p<>c2 ⹓>@&oc~#hGTPz2k2sj Y/[Vw0HVtgaJuPx"eZ8A ]Z7Gf~ >rV{`w>#Tؙuo>ǡmۆ^%gv_m-M> Ƴkb}l/oY1Z.Jupdlhw]3w9q{O u@%gGgk+>x8x c>oOmZ6߮)V{vN q58xJ!Wւ>-?!w:JupK@cvW]▐OWb ~ L$CMyxU?Iչ=Fnw 4uHr=/U}I*/|u}?2$_ }ׂ$dKu?2_$z?YAg^_WOٿ~uu%:}e?!uexI_kdO)~uexI_mo?>_iVq~cӟQhRKu8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$I{<W?箒mmXi-tc5D湜19/g<+=tva$Nc{'GFy /dmmX-.c7xBzt[g{<W?箒mmXi-1z(?Cl|y /]%mXi-O0@n?Lys{$mKjImѬClK&_ʼ=tmKjIl;Fqԋ5󐗳?Lysz&ږՌسS%շO$_e|I6Զ뱑S=LK&_ʼ=tmKjIlgZ$շK&_ȼ=tmKjIlWKm%?%/_Ib$Ԉ]Ԝ<^/x2U뤛j[V:KeE4ƺmy //]%mY)-ԙC[>cG/g=7?IGj[VK~ZݢPhc9Gd_e|$͉Rb$۝cOH^/x2UM- %0 ܒk#e|M6ϤiLr#:1|y /dmmX-$Ԥ/g=W?箒mmX-"+l?j;>佞_e|I6Զdϱy&Mr>/x2U뤛j[V:Kd3&Jàr/x2U뤛j[V:KaM0XϹ9NϹ/g<"M-%:`1y'{V٘/g=7?箒mmX-4,gܞ7Q[H%/^_Ia}$Wy /I6ԶDCw'gmh~O/x2U뤛jm %z0@y̿ys{$mKjImbCǨ?$_e|I6ԶT.[LDoy /]$RڱR[cȟMQ$G/g<*M-%@'<50?Lysz&ږՆHa [~佞_e|I6ԶDB45F[d^/x2U뤛j[V KS0|vXkHB^/{]IGjPۈ0X|Ԥg<*I(ObPCLf;o܇?Lysz&ږՂh۸1rvp藳?LJ;RڹH/5I8cdy%/?IF6>g(Z|y ?]٤ Itc"D4zKv7O$[e|~I(PԗH/Nz Խ_e|~I(PH25rsdZƟ_e|~I(o]!Bv7Oh6 ^/x2Ws{4a(\KfSK| %/~?IDW2aB~S > {*e쇳?L%OI]{[kLm䗵?L%a]+h4 B֟r^-x2Ws{4Is . 2\cho ]٤\y\K}i" {\_P s.1II赺y%r/~?I(AJ!sI.ֶ@,q K&_wf_z]/OGK&_wfޞ8tФm `{ ^-x2Os{$a7&2 #̊8K&_ofD̤VZ,0ְ9H0^-x2Os{43])gk%26_e|~i(Bp8kH-5cg?Lys{$vs-G({<W?IFϤ6?#c19^/{]$D i7R֒>KIz5 ?pBwF%r/?\̛9Wkc5^|#_C=) {\_@[a;f J]`vrZ$5o ]dx%R$ė^Cy`uLo }{\_qp<'\! -kHB^/{]Ӥ,3H4Z1X佮[3%Vo$9H 9.I%r=^/{7LDu\Kv;&ܙxh?$[e|Ӥ 0.=%dӍ[\uq(o-o ] ,NnUkZ\K>A0$5y%r/~?II%0dSlX/k<+߹="Hs$L.Y%K\@pqr^/x2WszDi %H/yƤUG66$4^-x2UfscO]xpho{JL~oe| Qu IvegN]B^-x2Ws{a%P$,q<p AC8>佮[e|s3#P'2B]jdDPA%r+߹=ܗ [(EǤMD%+=ܗe|~H;Dri.WK&_ʬ߹=2JN$0 {<_BH+Iu MD/k=_RB6 Ԩ>K 5n |!C`Mr^-x2Ws{a%P9x?X.=%غ6^3ۺA/k<+߹=P}@l5ƤfRyIu7o 7n$&=IcĤ3_ )*K ?LIT. %%7n#&~>^-x2Uff۠wveGphqk Ɗb@o ]۩*!Ű4nx.1%ٜjk]ho ]i*!nlE%7L3q?Dm/k<+߹=:J-vFѩ9%? > u-|o̿ISfYsE6+IvOlK@3Sc%r/~?IU<) .E%֖7D c K&_wNEs]wKo0I{\f_wL r19%>$CxK&_wlIq.RGܤ1Z>){\_턕sojgdcvq|!7ɂ?[e|~JGZ<ٞ)iw\JKL x CHK&_wo0Df4Op.;H?pQwOn %r/Vo$ԯ{|Q+pTs:(};}[e|4o68sH\JKvn}{\_:\4qi.쌘>? O/k<+߹=rIBBuڸk#H i䗵?L$})i 9#;}c }/k<+߹=r|!En\JK8G:5 {\_ԕA(}4\JKvMh䗵?LIPfc)Ij:ƑccAK&Jwn$7-]> L>+IvNc{EL@^-x2Ws{m%Yp8\zKulCGܚ5I[e|~HN\K a[gy ]$i]hwkc^b%%r/~?IOm\Kuu ksG r^/x2Wsztfbx\K5Kh<5r^/x2WszD޹DX"fO^/x2WszTKJ q.fWf+^th^-x2Ws{i%Vgh~Ny\jK8ퟢ#Deo`ܗ?LIVMƤAI4 '?LIVNۉq. &v0h%r/~?U[&8N܀@^)G!S [e|~Hӷt}IuV(m>佮_e|~H%.I%LVSD|o ]Ӥ9Nl-$A&>佮_e|~*tOȤkmr+0>佮[e|~ >݂P'j]yQ{'?LIw1My?$䐬8 %r/~?I8$]?Axch[e|~*ka>I}Aq.0BB1}{\_qxsna4rܛc1~ {\_Ui/TK< ~ # {\_턕3?4 sf\jKѠKlpc}/k<+߹=]::7XK`j05-C;0?LIR94.\rKu-4}ɽ&O/k<+߹=-='R]wrO1> {\_@JvW">h ]$&!q.F-g@K&_wl$D?s\ZK8mwh0ONm^-x2Ws{q%Le|raYَtAf8p'h䗵?LYs{.ia w+Iv> F m~ {\_픕oXȈ=\Ku,(V4O/k<+߹=2Jn'BȤ1Y*o ]Ӥ(흅Sy~ :o ]۩*,{GtvWٍ[AK2Ws{y%QhJo\ZK/x~ {\f_wn$r;\RKq$kF[e|~JNB?R]zu. pk`[e|~M%cJs]a+IvëG%r/~?TljN2|g? `ׯy%r/~?緒TNc`;9 J]Ā> }/k<+߹=E)}ˈIv } }^-x2Ws{ڦ9]ƾA7* }{\_<jy]@>dI^-x2Ws{u%E'Pwf`B]?Dm(n[e|~J$vܜ8sԗj&]Ɵ>佮[e|~J37xRnI>.1%L$"čO^-x2Ws{m%_"I6hhF@*xK&_wn$f=`R]*H~M~/k<+߹=r$2Ĥ;1Q4go ]*5R$3>|ì[e|~J$Ɗ-Ɛnpkܘ0j[d~Jq N3 1R]XKK2Ws{y%ME D.1%7 GܑĬ K2Ws{m%LBC)⸴c2`&uL~I{\_ĕoXħ`(aiv&53r^-x2Ws{a%\ddv4nEG]K&_wN܂Jg\tƤJ+|?~I{\_+21 !ėj6$1+I{\_'e͂9O\RKnftpMFi K&_wn;1 'Qqi.RQf>dcFQ ㌸}D&dH 7@`!kO+xғvᾪ%i"8K.o:$SeBd$vX &uM,,$LN}lU6v ƃD:II%3IRca dx$I$XG$< sntK";%I2A3C\4wSc5&+c_J]$D)V=224 |T*RI$Q'ǚBoҞBVĀD5A*I$-,d'X)$ҝ;mMְ&1Î*ࠐI1ǵ(eF Gx GvIJI$wy2xP}]$"29ǺP-`|RRIE,6x)<.SEփ #$ & zLUķOB}g&IL34vKh-GdHUCZ$RRI$KX4Q}LHBᱢJY$(\cb]2^yJZNxkxL)cObͪ`TJI$X>=6 28S"V<IJI$s*uR8cw{M)$$1[=ͩڟ&IKOt f9ژLen; O-)Buو<"46s<9A&4Ji?Qaxi uLQ@kw?^HV*puI*L1R$x(ZɄh`D@2|PRҜp#tvB% n$_ ȩ'L$dKD)5;_a4D& `;O)XGRdЦ2I7xHOBhcqetI Q %*ByC3SnThv"Jo{pN+d@x3NI -O %ʳVd|a pyOdV A`( I,\5񦉻;K-!IZHH.$iS@*~us"}`/ )IJZ HN h;uJc[P$Zu sKhit'<c GTCx$Ait;wpl:$IJp@5=ڎl idnh k[92uBh;.T@yIh z7S" O8kgcaO pyT|Sm )GXg# 608i0Tiuvm'T4BfD;)^'Q棋kmf*-ò*w*NC >i*ױFBa:hDvRG.vElh*͠ #I(=P3ؒQML O$f NJ/#oN}(RR'_5&\u'DitL"d0|Tkc}1-}2"\K.2UtN8Dhe ysc˹Ӵ4^ȑ A)ڤCa{Z#jqM%$LqHPu"WWj>z! G}}S 4hT=5" FHm5tDm͏pF̈Q ݩ1( (k~(*.q]cq\p7I \GU.ܔuIVu} '?--h,\oZ?ڝmv$2%%6, k 25uFI Uֻߠ-Nh9O- S f$]d !"w;q[kwl}J~){b2R ۬kqlpALiHl)nlhvg MvL RgT:)iqIkǚgRƈݢJH2*/ot%rRmq'l) K[q0\"%Hk}|T7aZx Q+x&,'PRqkC0|TH]v c'dϪ|N$Bn #jC͐.L0R#]@LYGܤƻ$mT P6],i9RJHpARc~^&'@?9S#9Nq1ʘfRR~J ̒4 6.:(9C kN GtJ @kJII <No!a5!&2tGޞUeN@DcX$R]V=I|!5h|5/6Aqwkh I:9= w(i&@jsLKpS_ԉu@kGT\6>D$TAh _&~~ o?Hd׋ ikKA* `ƍԄG8P>T<|e+DI{wI fQ:(P{&fxM3I5S \$&‹Z<|n%sP;Z#hR$9Ĺr[ TlѼƲk'8q:1:'n"'5V;(FHǚ` DhZ md4K[R.TG-28En8y%%0n Nׁ:ţN'(p`xCX683ʟi&;i8a1iۡmI+CwBF4H:J9OmR3kO3 |k\&{:nRG %l-Ä50'yq;'o*.:)6!ɬc`$!S~mӬokL!o3B#T74{u4}ÁJgG5 NS4jLctIILZ!c;d#Or%y47{쒙<8Q?sI0%M?lAh`OI%)ԲISǴPS 2 2J 槥bZRRA Gt"!Hۢp #.;Gvc]D醙=v*/ƆB`'a;ʈ;G I,D7iJQ&[ɝuD0] L4ILZh}B$7Th8׀+&O/2504U qL=j]tmi >1G}\D4-;Z Pv5i|L܆>h0<4cS݌lGMBRt15S$3PHhNؔ )ѻIΐ&H)瀒i=Z&"T+.;@`@kf;)ˌ)q>!0qќd 1;#!!njHD@"cA>=@>('⋷{a%@V"4n(xh)%v{O?UT/ѺyX9iӺovYK:3sΟE3}ec VMF}LvjLRpv`כdmmʲo ߥ2{mNlJBD6Isd;jnDy%c hiӺCs%* :)ᚸISAlT0j&`pݾiOMR﹃Sʉ~xLHM$9R i:'0 l<%0}.\hgB KCyP0JfG |Rmk*`HPyRkGҞ{%c[ݠ]CIK@`C1lyj7.(AD}wa@guE۴.II n:yדI;{(-Ce_o443@c@?R$HI Emrt47AiBk Ofv"Oqk旁SV%>IL"46 c#dȿc}A|{O3jRmoi!+= ROV%/^4RR}n\g̘QkD4:IHk+Jk]T䰸n$4OxIp;HR. FxIK=#p*.!Q.-np@ 1@Re,&x!EhhJL`sRS"^dh{ǟiVX#E#5AG"!?D{xILZIӕ7]<]Iy;vmtG)9|LpAkg㬍 fJJS#O(&6k g4L,tN7c0APc?X1)aMnׅZ>.ebH8n>bIFL'&V~*6}Z%vLtQlL(\2CS5$荤,!"ШY8.|ʫXKdi2z?N-hva$u,5бP?a??|xI;UL-Tm<hof"I)]4-?0Z>թdRJI2km0&R=ÉV;:&6 LJ& ! ˚pOXz2Qkֈ*l69%$4NSHfu``P%0ĢVwD(~u0S TƳZ&@<^kt7S2 JRI%ZgpZDʱX7XG*4C{)"I ӊԄ Ω@1kLp~OR.sd=Fpa2WI2RDŠ5R֐>IotI 7&a8KBr\I:bcJQI:Jd8Fe`[O!X`dI]JɉNgL@7IX A NsT[<ʉɶTs'TF4iH(Z'$*%tJHռZDd4)|y#0%$B%~Ei*DŴw]}!UQ VwNPHxn~8[4,~\Nk$'kyFx> Ba m]W9nU B}Өcw Z4RVp~#^ᡂôIԢQs-Ti=jG ))=N#-T̍#oeA"{%[p|S!ǒA)9 4C{csRk.LBt5ۀ-Ԥ8; CQG>J&iL-66J8OH1v撕Dhi甴*2(:.s :#Ss[۲m :BJdփOJ~ Ԝd')4#R$0Z߽$QpIަ@ POܞ{BhPvK.D{٘RRp#fJCXn(*dj GCcttmI y*G; 1$g8jR;5BWcZAS7NB<[Bg>N[_P,<I*æBMik)pCnq4ptࣱkDI ȝ]Xv[rI*OP.kD QY[肓5x<"Zv:Bs#w{5`B*`rLs wH{e-a}y%MIT㔋˴Tf㲃uT ]Çex ^Aʘg8i19$%`9F6zDRG?F?DPEp40Uu ؝ tEqlʁtD VIlk bFB7tƅʁxv4SR] a X]:RQi Um@u΀HKͼ 3e@ f?@$vQ!{0d7j()%CNǝ S{hߌvV)ħ&85ljU} &{˄T$;;J>j K=m-CJxL Q ;Ĥm.?-Cyt5(l6%;9QN}:Q cSC 7 #PQ6A pA:\f>)!D ) 8LP5W25 Z}OݩBId-=!5C\c#@fG܁^{˜hxa3 [hKf\XLQcx{  -O ÀwS}E4f\5J԰kBrb4=`l7Ta0  xhSm4I)dIJo~]ȓ ;q@VYkaCtwHLh)UKͥ%ycfѩJ7'V>#k+IQc]f\H%,L&kۤ{ $7B6ClOwp$86jAIn>fƼjXkv"IQ|BD9HuMscE`$q xpDi"`GuK~)#Qih撘Pcw)VJm$elΊep@XF$mk+%En0'W4AhAo'YRpw%Nֶ)-s\LOpk8Ck(YL$K?G0T+kE ({Drז x$ŭ`o`'{蝕]0-T dP%u >élLVC6VA;8Avy`0LD;6x oj4UϴHyo>*:thςI$vQt{O/.NJZT==䝏.:S2˹ 994:y xR~#TűΈ{H2~O[A)qQ8G%,́Fny jV"AVo 4PŪ68$ l .I88[$Q eEAoPK T!xHdG m!ѷ[H~M9y{DOiAI-M-|3R>~VfS5twNFff` )+U7#IvDwAvhO!"xL`I&gAun2dYc)^ 1G2Ym !MXyv“2uTFJ5!T-Q@050(yh42fHՀνR uB ' 6li@pЄrxW4VT{n74qtw2" HS.QaND[`BfuTq ;"&D5h4F{Cv.MipD|RR6:(w T p yd$e H'gm5$$ ES$] N^ xs Ϸ蜳C84jtGL;).nA|*Xd%AӢNQyenЃ hxާ !%2kƾ=\cQyNݜG2Y}}Q: a4ILl8N \xOX t{QLhY{}--kD| y%l'癘Ixq&'nWwh<'q$ִ[wh4ohO ?5({-'=4id!~J^` f3:&5FDA{<;#"A2Ci{IIKZ(nf&yJ G"iςA,q*osXa<$3``8Jhst9lOmQZ}mMp&at 5I+G$'7ݩ*uZ uZwu#;ms5n%!W {"8òU5:AE B850kb[v 8)69IH6ټϙ17L^`Ay l-k\HU]铴9:%JCD ;[X727'4Bg9B池"I$:Kg @IMcUsR6%'(:ENCk{(Z U{Pe* ?qI )n`[9QkpwhԔ*;X I1($dQ t Nk];{(kH)#RݧN1Ml]1ΰj8 5r$7>u p;--f))f;tRq=^bF_䕀:#=L:4S5%%.lQاi㪇@Q w<'̴jBt \C))YX;Dν-ݬ45 {e k5*LsKH]3L >t /kxEz (7Bհ馨SZLJzE :# ӂQ) ~DۚqI kZuN@LiJSy5dƁ3lɟw"N<:7S`"ARR;фG-k; @ o=Ɗ! eGehd$z`puR-TQTS0<% ;߲\\KI#~4ohQ“ ;3=h u) Z>.Nsk?z];"w)a׷*gM.Vd~!{;9=$蝤 :'N<6n0JI;SL'tJL?H) uq In*'@{ٻneBNH NJVFp͂#撖p'@JtiՎD-<$fdkR5E n"Jga6$I$oN[ KNAH#,%A@a{JS)FB?ԇga^(Xى3RRҝ7t "'*B{ltmU IK$ΦڝN˟}#؅:;)VGC@*Gq<)fJJP%)Kਜ਼XCuDy ō:LRf@ "$)Ax$tLeaa ^kJ'LEFxޜUH: 3ԆF*I2u=x6vk` N0csJ7AyP#p'9w).huITTCIPc] +vITIWm;ItADq!&$<&,p}C$+۬jU9ԐdRDT&/ 3 u A:`e:q'D' kv[LnI$3<'/hǰHDI+:Nq.|{yudiIsu">()dJTǧ$065<7R@k ?DOJY::Tp1Y4(߂wRkK'*8]HvwIJN:Md ͲceqERmNqw))dq'Z@xMx$ I&sG~8) +IJg8RA=ʢqNSF[ͫۡ<ʩ.NPE&~*6 Ȅ'Na{d$&N5QR0*塵I©t5&%*fSF芁GW 'E#P <Z=)f~䔝4N EM#46fu@D9JKHN:Hf;;QK읻@ARJK׻iP;ݠ66 HTj 4@SNe00!hv^\I- ӥq05Jn~<#$,t&Jˠ&<H!JRtQpin>3 $mNL1a*"G(Vðrfy )fT0tRT_a`R0I#6ֵL7^_Yp@;$D2 $\dȢݸw4$J時fTYݨRI$ `y-h*NL`GJQ;pC#PG܍f1iD(H<I02I(o#5&tƽJ'LuۨNv'$" ANI$` L~JBJ]$(zi'sx #^D5ü꒕ BI(fcPh:"4kue+RLk~$%_XAS^I*"R!1)* .qloɪ RTt vV[PDg8UNS9WK%Ts$Kc`JIx;r4v =[8u@5j h{yd#iQ 얁*ϝwC54W2KY#q'4UCjQ 3 ;]a kVg*I@tGb3)@II܄U乭 Pdcڝ J`CGmJk(p2[&M8#Wcةΰ{A vROn)E@XߣMQt8m:P0@!%2,qײg ›$hHR$;jS |K$hNko&| O @A =6Bb4HY@B q'E{ȭ>eS5Nl >A,{=='4#0{wjҬc &@@2{)d>o1%/o mi qU@PŹquqpF InǺHe@ cXI|uRqۡwVDvR,A:$@@s4D%Z9RKfACʴ4Ï։dx߆ˬ5% %V~G5n*~vcP&]:áGH5*eIhR#hNY{ +I$ ʓ\Ѥ3u@aImLs8A {|J3n$xa$DsPAiy6 ;)PtQs~51""׊+:ΪH) |Xl ܆WM$B*b Kv|Q&RO)n; $@)=$dqה;@LF=:q*,dkr$G{s0;J*dΜIAk5PU8Ӫ W:O -$wdIkA'3AlwN@CvF)Bvfd4P R!$T{ڎ 6Op:pZvy x-jG~R' f Fy%I'eΘ0J-5r c@HĸdωǒDnրdvLi4Q R~d>jHJd!3wOnɷnxNːhѢ<\{0|e9B*fk]:%o'#|{'E64ž5RfE$|y&sL~)BuRmTðoLG )}hwFZ' l\ʉkSg^S(:Jd@S3:Ӓ 4`6'S…uX*ocL$=LIԩa &$:m# hfJwLpH8!$'Pújx:‘i(o柽HC?;E0D4hMGj{w?D!l&Uvwӽ D$jO(z#RH !̀zlBh%Oa<322?:Ϥ%%[.nMoI,2Re 6bJ. t5_sgND- 1$ġ2I}p:%e))/ KvA { Rƶ8qKy ;RH="VMq gEnB(47I<}Hi)h*lcQ =2H:zKdpxp}ͦӡZ%yÃ$h-dt!ΘTZӪQlOÄx˶?zI 5` gQ4w=l&|J#t4Jd-p2<Si"VhԝgⱿGPĀem 9g&#B$LwТh`s kACk!R mntD:JfO@QPek♡Q ԢK$( $ 'vZR4҆,srJb& ^Mo nvx(^e1k̸px )Ah3ϊ,1e yӚ>p.(9v4Q$ZtE5esʛ/FwI y^#]8IH쥏c;* @H-WGt(4iRavhG!%,'ڤ\y#HPwKsgNTI%6VII7n&'Cq$kj!;8>ͤ5IIO>Z&9Iϐ Iin'ȝb8R e+׀9G%;#M9AtRc{ ͳ􉒠\r&!8E0tk9B8ma9iJ^4IL \dhTt Zjmi742ny* DvLI$8dŮ%By$ Ox;C`tRs)444uBxs*~Rn}$᫸SiGy@\"Mh%Ov7Ԃ<:!]XsfO(|OIlALg϶]ZtDh3GdY$%;(i"tIֹww$!]~mT NO19Nֆ{HIK2i#Rku<$IwRMU0zcqAiBu|P+X:IMVh:wE!ԅlYH푠>) [);/yӄʷE :#R5\t(69ih:Ʃ̄Ւh$x1.#O$[0"#SQ@p:Bp⒙BaT" nL(h\#P@%߽%26gBRaB H"Z;u$;)9%)|RS/Z4<u u' g8A%y"8=u&VtTMrBq͂+G`ӻ^$'/BtRqD7ԷPߧgH$!h;y(Uiq/r`Q 'V43A8mO$6Ө JdQ2tzsQ|ZbPy#MT))x)V DHw:Dh:YL&u;L# .QRa`&"8S%A^>(v FD'9LƓ-79%2hl '؉UmQT|B NJmj+SJf]ǚ.#X`vJ4ac9GtQײJj2x(")FN|BdS$pHmBR%lRҊ %w Rd%ָ9臱'wvI<H$|sZOnC'U2]@oJE>'U#a!BFgdJ'Ĩ;/m@X q-QˢI kZvQy SYH0&JvTGd̀8kB-6 h$@ gN%IL0̔RB5쥿P/PuaMuTF3Jc?4OG[XgHeY_򥹜z獡[ U&jȳiK{'O^Ci$!ΐ8TmZ@3r%pm50|@ v4(,?IY$pvV cq ΪMS%'M)7SkuUvxE5 $RIQ-VuA'{>ǚ ZJ Qu褗(>A}=k8}̫fՍD^F#w?I:5 ƛ?5ať<͢8ǒ)ۼoa; sNɦ<>+kud%vIDBuIH"9qypЃʬˋLCȦo&j{HDCTh`#@QȞfs5$I3mm7۵(iA-odk%)C@2xku$Fݤ;BJI$aBv4<%A 4ZITJXd9S67v՜̱s*,USAuSh4 uB/;*nGE g$ RnJ! ![8dΞnHf9P~kd%XZ{'Ja0D\6tef^QnRU@I(JSF U~;+=@ *¥!P+"9p 7b9 G-l ȰmHĘ3] !sH2#mKKX_X%!ŁD OhI_ s`LPnqфhsY%XZT"mJ̊;vAsu5j$K|QE 0<"$TIZD 4EvHlm0 JX'!4',TSp.2|N.ȃ&t" 4 Pj%ؖT<(h;*!-A*Ŗ*GoJ![cݹdH?ӱ䠜xI!C䒭\ Bud &Tk$ 9EakAx%,\n;'EXO#D@ vO \6{LF@))dtyRI%X4Az\6RUN\.}#&.^ʳm$Eh{nN3m$'6>BJlD$687L0A:6RU$E%HkL@QH-Z$265l5==#O$x$5%)hL?ved򒔒I'1 o` $JI$5 NvYi8J]2R1tNx#TƢICf,l%*JR%G):8|OJVБ $c!Z}J nsFeD YHqUz Ĵ W Uz dFʿeV@vS13d7[feUx'M܆lUii%>|pnK$| Њ,ݬi$Dib'@lCٷI)uH88Dq1dBѢF J]폽82 HQ"D5:R*.l Qoӄ`aēӕ&X&-CK O@nq&n%)O!Ǖ sl2~j;{cZzݎ44%^#MP=+۶|PS_[=5w8tV}Zݺ<<k i`&%SCOpq4|T?IA͹-;)vT Bt  S0ȝeG q&l y4 [C"%D6xDa;ILTw`-ѩ`BuB=\f,+Rz ZdƪR5;t`'qC#v鏌*pd쒒^"`cAn*沒e  mɚhp(Ϭ8N:[ړgtwN;y6F k ;HU[ 1#mat<b~*Em 2iss;euV¡W8*NBtGEn=gen"KJVoUӠ/ɥxL|qKvOȨ2 K@%+Sg; =vzeHI:ǂ*y$8 V"㨐;&u"F`9n% h׹Nt%恿(&4J+VvP ԡN-Aʜ Wlh# ׋miR7 ę!.m`[i-E԰h8Pcf;I6 uAǹ쒑;Ri#{*]?vYP<!n}8lp9Tٔ^m -H%IuT_E@ )} 5"@ Bji\;j5KSlK{Xܤe8CvK*!DY`[' Pi,pk6K“%0cJl]apaR/ߠ9QkjkCd)uױҤ Ӻ |67CJfn3Y=Ɛ'Oncy$ >$&u%@xO7*S}qh v֓ɉC{A(%g61]JJd8 L;tJ=R[f8'~VFH 쨋Ntv ˪ &%evP؃mOM7C\;(.E0hAMNT]X DHÐf 'ꄐuJۍ [c̼H$Q}&Lj#NRSgXL[kbtDy Qc5w익ƣ撒zuNy!#T]fCh'F" V RJR ,;PvG %4> h<wDG)''NB>ݒ NX~(|$D'{C ֶ JH59 ITX<;Bǹ fS@j;;)OʒA!48T[sOHrӿSTΪ[6L%JL+#O%P@ }({b9E)hJJfwmT`'NPAc\@U:}N›ZxcH?%6p K:(jUpK\ I [$`9Ԩנ!ډq.jv:>yO[FlgYEJG&ùY PĶF$)KHj<lro*dwmmnIFSHA:ꛒ?;P J/~+ ƍ3 +Ѱ[ƳA9R6!%9.%Z>dvH,* 8q0`_:j !Z;J jk{"WCC-1%X{Ɗ-/pOsTP?ئqkq-ipG #飚a쫵wX%#VOhgS*ya m+f;yh~ vRk>Rl2V>hJq1ih)pu6T^uC9Rv JFr+>@== ):S]L.itFbvP-!S)m1  XCy?*! kDʖ *|X6Ƞ)v|#lkD(ǒJdlk63P5Dy!:Xc4-<%87~y)#{G^*PbBj} |6Tl=A i&áUNJ{]MQSi  jxjjC6e] ]CHD2өKꊙBUlwKt>1< FnAl4mZ'{HxQs>J .n[1'3Xׂ )(vxR tDi#Sm#8A-p!IyIJ 88B;8Nxjj/ϞfOϹE8 #DՇʰ\@ 3i*no N3!We  Äh;=GM閂RÎT~0 =!k\g䘾vBklptjTLj~*u8h%,. Ab'ۀ05Ccw‰gq!S3A5%.l2Kc! x\Lx T,kjb{x" “KD®~n#NQxc]S\x1qú#qO}LϚsX#r8Td!&6}-kfaN24{`sRg9I-G'#G\c[[@N$r0y #TcD t=n(;l{A -puFpͻeߧ ŏktЪ9j4+znk85Zɴ0ryIJ3:wVtD§ :$5#C--RRm`(X@:F2Nc(u3@!Oh#p2cX!1SD 0IӰSq?ڝc$חv2;^:wt'{(8$Ș%7+;]I; mĤ6;u/3Q%9`.sz۴ 0xN#Tq5II5%1;ЩFӢvN#Usre3H4IKΝԶ`A4Nm$'5 0ĦI9%1B9$ᦚ&v2Sj%3_DA1)>v&`m<{!jZ~!wC;!rg;Q$ $:5:=:&xa;^A'CӝG)\ D2B} %25Q^G3:x'Ѡ@0⧺F%))Z:v e=o)jyB4PęG=P~Cg&-a!h4T IO9;yPq1.R$'H6;as%B \<}hѤ(R 05GΩ%o]<t+h`JxӅ08-wP{x ujp8ةv8@RuHL]'<|SYo|t%8`1ʋI#T8{(UTuNԄmwN]ȅ?FDƝl虗Σw1% kvVcfF?|~\zzwT9]rC̟ޏs3Ίf>*Ոg腒zdo7G TNmltSeI1a;i >3xA IF{Onk$^J :{)$;.{[\mLwDžExKy*ɔWK$ L 9U ƅ5Oqp'%[#>W-*\Od_<{d-8wIARLU\ lDIlw\@ 0)$N{9g}P:&\-a#|OiE$$I%P2ʚ] (tHSk`9IV$Jd:#HT2n{S3Rd+[>Zy5i%hIOhq$l y%)$A.{U($'"uOc$$JǪ: qʍޓ?5 K@2'V I7 ݦ;^IdEH]GRII$SC)cI|THov\:JI5^o//;`%Ap$;pc|ܦ*-⹃]}9M!$[TV,zeRO;j vHTaqmgB{LE$ʶ}g;w@Pmi%;Kv˒RI$kN9&Jw>HIMWDdž%#CRsQRIBli x](t`p-%)2tɆUAo|6c8A]5JȃU$"HtI 逃[F|SRBt4Ȱi:)dcV$܋dʟ`L|$`乚=FÁ$kPcD4ؤ&#!ֱ*tc]SX lp<J{sCBtyw?ԛ+*[aO ߳H@cFRU8hi@EceE P׏$Vۿ$('I1)seN {kh&kJRP%lXf`ITph!'momPs^xw\]DJ:rhaTaio~R;ȧ_~TIx2Pjho.s>)Tj[Iys>I(IJڋws(-ii8myhi%Km*sf^O?)Ud<3ciʞKk $ripYa! %ĥ_'YR ׬ח =Vsw!Z!%Tj̋^ph(y!NֹHJCpvr `LSS?E`T÷n<՗CcwET2D!WKLo7N~hHq! σ!$R2t c"6愈2t1)%iNACmwр>ݺYÀȄI2x@n qtq -{$|iJD$A Emq5QM"=QN]Nf:Aiu#{kԴQBˋvHAc+h1Ei0D=DQC]|SiIphHEۤj[hM%yت*;! IKQvUY'5 lqao]՟kXOvZ Rsa$*LHܒ \ZuLzj,k->h8@\mnnC!)n<2<*}e's))@ƃPX`$ K#{Z[<)1-7#_Zn||Xߚ;Z K JwӨnN.h| IIMJ]`{]Tm/yqa^}7NIs=tEfאvm(F Z} >xe.q=Ң5)]q!}Vh`xcenyU6 Cn=Ԃ5֨ nxP߰iIuEI-Ȥ:lɩϒ!Z>JC 4F B1"?icvΈMHhDzd7@QleN -2|MgLm;q&:`(>!sfK\`F- pΡKQnV!h"mKko;BéƩ~;~r30G6r,dչg@yIƳPBFԅXd&"JEV@mea :U47n'Of5uusUiW:!NFiV%47 Kf|FՏkDB.:x O) 5)S}lEtA))gf2Cv.Bɼ1R|w]eA!I3\zm8ʽ^0TfHn94}M?ё冀+ ܚݴ_ ]ǵq,CF|e}]a0Ѷ;J@3x)GmOc<[%aX~+^i6x6i%9i#RYky$!{*Sn.>oJvkhV QZȇ1!1dpV[GJTh~ M4 .;!7n!]aahITnObViRdK|YMwEqĉ#ip&;NfT#/T52S<\ qn0oѲeA9h6(?sD1N4(ilKJ䝃j*AM>^$N&nO8L΁{gġV}Oo̊kPRfI#B<Gv&PpC}‹ӷDMZtP7UA)!>ѻoUYbnGn6Dϭ &QXA%2+-OsUݏth} o>RKUk@ ^ƍǒk-t6K~E3Q'~5ƺl'q٭JZBupx+%.˝F]Ɖ>5q;tI )`'%^K]!:+C;̥@qE05 O DsB9{9o!E:R"D:Ü\1Nb8yGc4{Z*ǫXvH>[nkIhRnCtGd,q;=򡺫[k L(I<":LFA5|3,ւfuIնB*G]!o5:~7uOoN =k==:>h5fY')gHEcoh`T_0>JlhmsE tRdhm:> 9-s@P^<@R\G,Ӧ9;g@{׈CH8wh%2nx$> zR-A=Hg<ƽE *w ƾN54@eւk6< v>jXi)tN#CTF3f5F}y?wi*UAL߳k⒑Kx# nQD~܈| 9PPNwvz'R׏JNif K"7[)ٔ 4PZPY[?4 %,9q Ϊe0 {nOeaTE->P 2h GJ@ꅐi Fq7j6$c$^AMeH$- hL`"e;)S@'xH8=Л{1 밴tK7S@nȎ(Ip ԙ)RR">@ `p p6"(cGt&bo|T]E/lj'3Io׺F~%/kXc{OcIm:0C{qwӶ6uv'Ĩ"SEp*%³4A&'@,tq;HHM@Ԩ2OBݍS<&k)i4 p&çt&2BwrkC]W5u' {NI"HD7 aSyvHF(Q4kΊtjO1p:6But$q$ciIY ݣyVqt5Q*SU,Q0iv![v\hܗ7R$!%5e^3Or杤3}a48|cY$ J0OgpRR#xCn!t $‹ǿvH$=W5j~f1lJFB Gbq'B?osB3r]@=_O4؄ؒbeIe3[ƛ uJ`fSE$Q -]ʐlLjnytI׼pܦkJ`)`n0.1jBѤTm*}B =GԘºCĎܤ[ez:K_C O&isL ?JcHYeC{;k[ &:ZKI*Vf!%#5DVXmBnh1SuƆ¦ǹ ^P)xޓ(7sASˁ3WSOJj.Pu%%+F6yV\鑪 w>XL"7 '$k`0nUGIL&JEByOɑ T1; *bA񢏯=f\"5 1J[i9it#BHn9H@0uND{)m`n$I NgJP2ux$">͠{`4Ino-)bv˿-[3ZH( "JYS1-`!mu*.g_).'E ۇ쒙4( !5 ;'lvO'$<n NJE%-"]Ioheh5 nM i S_$@O* sbyCuR" =~E';LT Q^j B;&SV\?7ˈ 1QI '|`kIw(7~utc*❍o))h9(mN?-:p{G%PRưoQ^BfZT9 sNx"9Q4RST((mtI|Ӷ%Dѷu'TTp>@hH|4SnʉJ`Ħw$꒑=LR\؝AyIJI$AO1 `!cX,;FI2+g 2&T'Ea`RI$밓YA@8dB3n">h)I$AVQ I'÷R|$hySRef BI$oڼn<1/{$ߥȞJI2pB!ms`x$eGU< d0WL5v)5۞Tt" 㔐IEa4Rnx*uxbIJI2uBb%N7N4I'54: AQ $2Iׄ:G&9hQ[7a(N9Y kIw %I$M,c@㧒2$)$I0 GPc&u.(/02aAR NI@{OGe2S$A;3I2Jup@)#sH%.I(1<ʝ*"@$:Ot mK)G$$IG29)SsnI@;S8%h?FS&)w~ %ħIK'I%=JAPI[)$SDNfL\tR DJU[:I$O" >%f$'Hd]v{TI!-SdAT|I L$@& =&Sho4I~M$ )ϦeECIK(LdMF.3a%.I(o0I2R.;))!I$pw O?xF‰t|%)$R{ZxIƉ$$J qo!H% AJI$HL Oɐt )I&N'md䤕&I:G; M hیGv:L$JFA 02-t拄˫ݪIYʯSwoc"_ Ŵ!ߑv#Bw*O*6/ ڛ @X=/iv[N*%W|u2ޠ+,h cMTw:53]5mpu %Rp;Ƈ*2JL.:QkaL yl%)'SI " ײl-pɫsD͸ʓ[<& ho`LF|R᠁c6KDܔaL;#vh|n':)}3hBJD(dyA2wrꅍ,v:shPnwjlI%,*SO'X4ۢ`0S ]v"mMti>1IL}-ΗSy(̒zq8 NpsI˅!5a4DoS'UNw0I "O[OĐC JU&gTޛ=G3J1;j{BL7q%!ʓ*.r%9 Eɋtd?p:wDikm! k)K` ]?1d~`'i )gpAh9C,:jkK['`A=1XILQvpYkL{G܊,gEW96wI))wdq̈ԩɖchdr!&Ʀ.~FC;"5V*9w][&otN$H{%ێq\郬A%!%26fd|Q! wO@iv^L)s:]{y R#KA[+.t!Y 2|a;C(fpNaox)1+"%Gs2O>gdO7{"u!&1jkN-h)^>) I䠷G,/D5<{B:*Ht$CsH f4IH?YswqPŎKēQS2tޜ@4"<4X;&ƉpDCI>is iW9H4$NXF >*vx!?‹ Ms 6\ D_y'p“%#;l1P gA $)m)$] NY74HPv4@6ΧJvIMo׵Β[8dlnS>(<_4>q%f4D60Ac_gXD&0|Ra$L)%Fa:M^Йn77$LpIl K":x(7vy8;= 5xL8SsKt&G:"!1k]NDEpnp.v[+ͭN˦>)RqqT,/ `x#ntu|. h?`A v;yA(^Id/{CI- ꚯ ]4(n@A1 L‹w=BV٩i&s6yNZN@R0jP 2J! P"y({%}%>i0;xgHO] {mc|)Np L'k{U[N)L8ǂppN7vO]ʓ(B7I0HZ@L_ ]Iρ'e۹>j(T1✴nf=ʓ`۽H1 :a@<"\~)RF2i"B` ĉI 'W8ޠV .tGΝR#RXݝ! <|QCJP5DYhJ~Lx&l>)圸yۀ&voޢ5J6$"hМռݻ)1͍t)O)bxy8s bjk?A8I4Sk˴8S;lG p_L9uILwʈ,#p3e74t*,fk hxBpvD[46Vu %b8 uCkd 6Z4);C}fVHCui)!vSmU kGtf&;c?v3IqDx2"I,uELy8@!V[%E;!s^TA* 5A Shd4@Na‹} %HΣX7F3pR w3K<$kq0;Cw _g' Jִf!ZRʇ[%I u18Fԕdؗ!r"e1!0 IHC D cE#_BDLD4LC& tKR?V Ĕ IS-D-!v#7 L;2% BDS9hAI 1`F 0Dt{( ]fH<"ZYyJeeG 8#`d~ۨK1-aI $rp:Mp: 0 u{HԦG'4iXĤ̑S&àH #@8Sl5 o*XTxw()IQ87{*Վ&L65UuCS6n))md t(mTƠudÆ%xyBhTPuù"Ljq Е'VD|Bic))f@ 06̓Pn!̏KF%+oA.!MkߤYT7qD G(h @h%͒ \~(?$g8JOtvpTݎZd)%}@otE ܨ&F(Iᲁ1I@द.Nf0ut#zn4xN,p>`۴N$!1`:a 8 vՀtU#Tն4C%8!"[vˆI`q:jS y%.ꃇ h#D]9P-: S{̔ۛZn)Ef4{}9xN]/j7WwC/'!JBjtI:y$Oi jx ̈́ RH#hCݰKt"JBNS%N7j$d𑼝@(0]:@Ч:SqQEP Cu)mq:> )N荨Ѥ L$P5w<&'H%%1u C54)´4 &"I x 5Ee{Q4=dXgBMیʃN؞RJW0TPh"`‘-H=gɜ'D #H @dIB=`Kx0# `'샺t0qs@\ g0R 6RB;^$..ㄶTKH:|Ӑe4AT88A`By|SJWYI8'Jc?4OGI.b~Jڭ@VWεZd_ϛ)1KfLG1I·^)صI%dd uU!ݔMQ]jI$5ݑl:ѩv#۱䏤RH&N`xՐ|xfح r{&7]G'*5˿F}D>IF%F$a$Skξ Ra0De%H̲Z 2ӯui:XtI+$2$n'TD)$; I%2ZL'6X4sCXo:AJI$6j؁-k0Oe*PlᇑdIEG wN"s@N$$I{Z@fani쫊E>$JMą* vߊrJRd'2{Jߩ{fu}d EJI$.vP=xPRI$]۹(HGq򄔤IMםxSkA2THIJI$hs#9%IRd'wnsI w36dB*RdIi:6BGQ )tIN$H"#D *ɘ<$$JNEtwq&L$$I:C[Q7KXxB$?Ba%)2tx$$G4 d3KRPRI$ ply>)$$L<5hݤvhwjHF)I$}K`;2ezJ(&Oe$ZY?ܕ#S[kX֐~M?SNPtr3QqS ĥ:x$If;wL[;hM5I وĻiU"U ()1N=k(XKC tK PN'L~ہ& 'RI(#@ mN>EJI$kѼ]NJOʓy(%dfDjT]$' 4*&YN:vp$!ESpn"$I! Y&5"AG'T'JGrvNJRI$*C`FJ2%'xIJI$=!7'ô$ISꝵAJI$I;LN= %)$ScT4=`y$Z{&NY- "wZ5W0&{Kn٭wVԛ{ߑuTʹ̪V: m>巊8X)C@ vQɓ!r=sIBH )T@2[KB? @sLL7^eDvyI-Gi(a΍5?Z$JD)#|S9ǰ4 l UӴ3(. pNg?IGВ@Ek=c ЩvxԀ C-٫T!Ao ;T@:ItjS1Jm@lȞ@:!H6D>gBii8xySVֹ[[qlPZ1N)w2qua: b !Op#pFwNHvBU{^h UcJ`=a`#NB+S?](Դ8XH㲍pqwd54Ajf4IH$h=':#QZ f3Do:aK]lTϽmIHs`η"ج~qQ@5̀<;t FxuaNu#sFOdT%E=$ i#@dL' nQ5tTs~:x"9 -8(uRc\&F(7 ʓYI:ƴ{O"'%#ukR$BC\NE䥶D fGpp'&.Bxi5c3A;]JGyotL 90e6c+}A6[#T†IBξ NR>6"7ǧӯИ3{!AV}] hPwqJ+cB:d|6<(I {:(:Ü#JJf'nZ?zNYQ 㴄lHYT$nt:x(0mG)`(!Bs;ڙ-*@)lSnPvhQ)bTZn<̓Q2d:OOx>()Q7oQ5{#DL- u83xB#'4j`0PM9V+$s(Nt35m$dU{mu"]QﱾȒOo-k?. 6f`p7(Sz[ ]ۺcǺ4U uE쁧ĎG 2'U&yP;['ϕxAht(IDwOPCI+skeH3BvYk` " { liG^H2<ג`\iUIӢT$N*$͏V$';&V_Dhw[w8BJAXu$Lx|xLdQ}&7v4QHBv2@oOl w) %"`q!!hkcTXo:DZtNGntKyw;wsÜvq)#p )m{y%MxkHhzo{D9L(D{Bg[h&RcIrrx {S IloRuXF-$hgjk L.^3Ia~(^: P{YcZ9˻RBrDռf< %)ݴQԦN&>jLpiPc|RВTuE \4 NcAׄGP:06ࢦPn1fcR%XKpCy@AS :*S4{LA&̣_$tm@$*U!F㪘di05 9= rT >%x K0:dR -eȇ!Mi=vOcZ@P\\ kh8>8IHCZH @ I >-A %6xs jRsm>)c֑[gN|ٙm q"mq,tx*,q5ѻS$$ExHD.1=Bx'x ˵=ԈԬtwf=@EI &PRe~ƒ'9 )ERS5֏w{ (x)1otT]"N) $BT7p~B_$Bq[5/Nw;t5;^@%9A$miR昴vLJk9c 5,$iSdn"%%$9%kjv)9 .$ÙQqo ]Ow;E LvDj|P!40襫d<t"KuSDJLB8hIvJƖHLl2jD %'KRtL'h$4?S3e>pjL48~øs++hK_"8IKV1kħ %΍PgTŪosl՞Ԕ5֓zKU uAMS]V eR<{5!Mq##k:%eu>*A'Ro` "Q ;%3hS0ݿ@(&aKBA 2[߲%t9O=,mЩH*2`>G:xC[3‹l6gza *mpqi o'GIGk\y(v#ȂtPeŽ߯:Ge+q2xI X)m&s紤<ӾT致Ģ98!%(3QNTj OacyL5h,H2c9i:FTIktЙ]4AKi&7hNCG'Tp0c\`THw<&F$H2x'g<4iwV}?o:#6yLyHvTGjlhJ]ENTdmMa(#Qp7{))y@KH'2 8 HЦ|x%)HID kuM;DJJ`L#Oe6-ǀ?$wJ"XԴJQ\=:dkF$umΰﰼ4Da" [7 5QkN)\j>%HLZf5N'N{VGhf{$GBp"nTw5wQcB6ꑂ5S:{Hی$&Tm!"ÀDbu-qx9 )MiB8k) \ѢL;cYZ=H.4dj{$J+:SR`:PnӤLSZ%(;t]T@15aH UhAEcN9@>i![fC{O!Kv('8H'Tjw()M]o"LRПaOdMٝ< : h ZDhE9<*-F᠕0G'TI'=Rc3 "G=ӪPEDTX꒑#[ZuNT< ڤI8RS T1 Od1:m<">`GA'!%/w!Ѭi)Ixt80P{L-1kRӪJHpF|;'"$Fm: pSgtu:B[`Dq1L:?% k=3OqFKxIyDO%ǒ^R<tžZ-R`ƈv#Q$A47siTgRR!G(%0/ۣG7SM~JDND&w08 B% AfjR {) ;90@N_{L*UѩNʏ"FvLc;YJf%$2/ J+@@vEtQ;N!$EMipzh~I5@hTK`ARcOrꋹ*,hkt %8v ,fRDk^t$;$Oaչ]Jv㪟fgE `:& IG눈2mTٮE-۠-6ᮉ mLTJHS*'v$kDBy1obS25QtL'<i &k\" f4)>ݻM+]gV<$M\?_[#J?dS6 iVōaY_Հ/ ,գ}dVy&#?}U3SjDFmġcN<][UF$w{DpJRs` :k#TDDVI&uvw'VZA?1 $Ha4z-iA{A$VNHRI$ǒ:4Aq9E(G<$I5'Q(;NL$Hc sTw&{q!)$PFI\Iۯzqw)I$@>La3'瑯S%;$(& I2{ %u2U4s[xNw0)<ŀ1D*;Z:HLKH{Owt6X}!~E YIV3tR;~3^9 M^@I*I$E$mnsY;m$ 2t`<<l<ƣlxe&bMN'e < uB|O89>i#u:I=#sxH3i:k!:I%ֆN>WٹRBI% ~r4J{7:T\yRI%:Y!O] !I&Nݎ$r i𔔤IHX d',(aژ%)$E0kD0A!Z{ YO$$5) KI8)yJT`OdI6@,$9E$:Hz : RI%&u00@:ɴ!;Zy<$$I <$i):.:$H04托Dt7uAJI$DɞEۮîniUcK .'O$\{ILXdk= ʃ$;ATI$Ѻ`jnc jpwT6iP :wI !SˋC M ~ D91iI ⒔$k[a:(,~ o5"VݤWI$ 3-p'X@5O@Ĥ$baAkG&NHnS n"CI^ ӄHXUe7}.l M2]]jT\A3A#RI%-@'Z5)4!e)$S$wS-!jBwFTI(UY i?@x#?-֍~(()D$B `ܓ薸Xkc4Td DbBv9Uf㮤$I%6<'SӬ|,3,Po$GnP`=v0d裼7A*RI'RsX#@HN !d$n$Fʜx$$Ir i Fmu))I$vXn^ƅD2< $J 4{Dw5CD|KIiZI#T!)"$JDw00=K\.:vRa kx$I4pDh!I$(DJYvCsߢa:IZN,5  5%-)I"Ǐ?58)FӤh< HRI$$`$INwID4RiTKd)4O )I$HL5Er$I($G*d>G}RI$I$#u-甒IV{@ʨsU*v·e3%buH8ߑ[*S[G~E䑸v U̓*t¦#[ۢik%mV*kxZ6'T#D۠KFe[vP{!h$tPIcr[&sYmڝN)1 $; Ar*\vܑБ -0Ѷ?9H=m;G !N#SŒ4KdJ<Њn{5CuVI=S&(60$@S Eeqo‹iqK{+ԘĴy 8N6 v<<Mh*5ςJTx:|T *@'vn.xmӒ PY`&O(Xn{)ȎgC]ڕ2ԪakӧtGQ^ͭ HRA'N;~ o>%FI4n8SHyI+dTs='MT\ 6icwwUnǂ16@gdsY?4=(k+wDuHX$Mv[v|R!ݕmD2$tkawU׃,Ŗ{~B`Ģm!Ӫj+,n7hQ'yo(v[[-0*X$IL*Lk?(27.F hS tNGx<6:&c ݹFl)Rv$q*Nn#0P³Ud@E<7kDjPq3ZT].vF $j#O4S !r `A!E:=okZ]>HEN~5os)Z~jA\:>(ٝ%he:N8NARefIUF=䒕>I9#I!r}@M;B` 1JPLh}Ð /h:o➶Kth;IoVm:;OADNB=r=]YsKV [xkO1*;K0IFse}Z65Vc%$/JsX} g!픫%j~  OuѫC]`T S=\4  8QNׇy(KOO HFo1g%/ `Ko 5e.!"|{SI,qm9$Ǟ"SY 4J#"SYhws; t!FtPsgBJGcǎM;)Rk5Oq욽֒! swwA(ym`O *N94{IG*-!||SH'x=Ԉۢ$a]RJaoiձD…-v )p< iFh#RCzg!ghq#tSs>jR,pIKHiHTC'ۤ{vT6V⒔LE<)x]QR'~x h&MPOq$^a!/YX--= ) vopod?p"[$B7AQpR0 L\co Q[ݣRB Lݴw$a0Q,y":L $Cd >(EIIt>h{~IÜ8AJja!Kh  ׅ+`졠ŤJQ0Dh j 4Ndr>(nߊIeLFe-ӤkF 4M8Ԩ8Gb*U vReAL|F{stS`x28)F7CP%1qi'87sKNDx-Јwg ;ÐASne0o3\EKH.!-GZAjR5J!'Q )G:`;ßFa6@Q  Fc%/L:j1$hx%xJg-0QyIJR,!?M5sTpNTO 6 QtcTdndRRG4T`S].&!CSƁIGJep%KAg7MQXihLxHHE(H$(T}1*W3oѤ2@A:%0#TuA t&{ b MA@7I))':':5:)N Lߺ\4O:@0<<"zSuL9GnT1$5ΎM7Brcdm!Ap:\ z> IHj +ԨYH$[Q[I08*k r= )։Qxl›RK|QIRxIK M?r - btSMQ ZTƦRR&JpG&y'qRnH/'^> x5IKDKXcp%#JΊV3HtG;q (&RSK`lh1r& @841M%)7 @:T v'$ǟd n"4g4=wd#y#$(Ky2gH<`uSl옗*U"ݨPaLY$3CLx"YX&N ~t[<ȏ#@Ngm5S{ppTa-sloL^S9QB {`NFNlo (>))}a[ʉ>IJɎC\6jꜝ$e@|yLJd{{5En|%f>J> L$0ADž":QlO0Cx q q%!FnLu)> R;^d|ԃ@>0LZÄJ$< pm<NTҹ5ufc̴M\?_[#J?dScrU[2"Ha,O+xғvᾪ5Pڻd՝?6ϴ$6WI$PdvD*5T@&8I4>!I$h0<A`Z$Im3D\v I!o8WɄPD$IZ\C t$R Iy uԦQJRI$;~w)UegpJRb@N@r6:c] cP+sݵ.Euo@t0\K7sxRSu.f7@lOLǦβژ2<J&Nk̨YGYmC! $:l[Ze|P sZ (<;HSɍZ60}č (NԔI:ba ĸ{Z!@+Nh$j"U.)=.J^,mBk}<zDDUK54!5ls8U†D½m!:Jh{E3I0)vy9#^9P8IJI2uYy )֎=c||;4t`\ Biyʛ\A>I I$L 0udɆLpOF!) 6dJI=ۜD&}@${'$k^4#/A6s/1=B$llL2ch20)% Bۺb`JbQl4I2uSłG%-IH>4RI$N"Ʊ `&N ѳM{CN{ >))dN&VcT JRiN#@P?]JbIJJRJ nh! v[Jp()RI);9 RΉ'Qʍfnx%6X>䠃;\Od=5Mh4f4%1#T(TL!9a0攽G4:!35!*5JZcG%;%82NSYX|:v3Pe3'RxMVv3yȝQSKT6N㴖GXILNy)7P 4*v TT)u[ hXBOy:AO J0@'XA{hf/`;I#NHTIBvPAGƩcypA{}ÀPd-p#!.ha0:4N*uCwl. rPAJԸyH]adC <Ȑ{3Rpbv1n;B; &%B:5ńLEDj7} )-mcTVTs!qygg˹McH2RS++m !9xr!|TcI$mt*uiuIKiTc_ha0i00p0#I)ZJO@%@<5=;@CI> %.A<HR :OkO݋MC=g9mX>))q ^L4VXe1Z (kU5ezqktu:DB6Z!5`e;av(94Lj>#];ιASC[S&uSenGsiB@R}cx${AѦ@*lY)[\S A=5?m^$wAK:@'NSUk$iRZc@ hE=x j^H)AH'a36CxR48B5pF4l<i =1 WvTd s|zketMѻC#hPH.&÷?K300)al$9CkRu%G v^F)h<& O0y Uzopl0xOU,;C{gO# Z _HVh@&Wa.'%ҬǷ*k6sĞڤe36uECF^!}SSRĸPS&8iT\ kZh(q CHhq+>Gd'}ͭ@םSKf!4AI*=?[֎ =I;BacA*e[5s% I%D2R-qre98(q<&sww%Ô-&1N;(S"J{h!sI'HN뻴D*#vQCHS3[-|RmZA2ߢ=p]5qC+.dPImpN򙕼LE6=v5Ijiȩ6˶y*gА99D BPy'-~ICh7V}8P!^ƎjujvAʓ@ {qTرƇH7pHc$TK`qOD9S$s~In-SvuL*,wǂ;LIK"aEw'7H(%AFs\=|l$H L ps\>"1q#MxPpi"OdKX s),%A> P  tN=CH.vTĴ}'o aDDkUsXc@U%[^Ȯ;p&|J6[[#@(5`q>JU]XHN'kwV U_s(H1vO(AphiT\@':k4$xvgiw#I )Cc\#{$׷C%ĸ"T#8ŁS`&IIL )<<Z=B$6C!7K4AIwIF7C| cLJ}ΤgIL$8I;gZ\#ۜBlCkh.oŰ|H= IIwXxkwD0  a[05ST[3Mh1ƥ'9ξ [ZH#`1 Q0kI[QH"!N?N5C ^E"]M=Of-1o$%(k&w<'_f8%M,i *.nD V/ۆIJKF!fƧ=˷9߂|Jd|nێ sXIlhZ8 drT@c;HD K~hn`C! Q0%Qe^>(%L;O* yqDIRmL:;$K[yGtZ 90<Ruu蝒$74#?Sݯ,׼ $` 9h۲v3D(ey슘|T@!BF Re 0;W(7B L0 Z (KG n<Qּ Ul@XBIXIJƹ%3L JEq3N G!tٟ!j{Chu eG†؉[khi@TCs{ILCfb|qa q# |%e;7N )Ü6FD)qqtT> T(TNtJ;IRGGIPlIuH蚿ΉbN IFy> RZdjQBgDBQ<8N$T\I08AKOJB)ᴈN=ijD$)!<ڃIU IEM^) a֗r4Drͮ Ӳm< RHsJH^Sq-RSFJs$ѦG%" IKk)1DQq.LDR[tjI&xOHS`''^ HϊUH\i&}M%K ;$ уAL,{F֑  )k{vC"LR5qR .2Қd&{'sgWDBrHQc\ݯg\8“}8J@Bbtpg=I%cГ6|ЏR3=G.ȭ 'mka!ʛp %N2yR L.<1*L LxJ k;C dJGm6r $a6-*ݵݮwᢙsTA9tcy$2">)qS 6Hו#`8CH$$DO60 [{N"JMs4Rm^HZdy;$uQ6zp9Qxi@pBYd&8$lD̂j{J(;Dk@CDmEʴgR 8D IMmLyC.H=~AOSl<"R{#L"?Q#n)N>i2SsDͮJ%7`3O dCx)/ԢeDv)vѪ;> cCa'' HfBwOXC))p]%c6:؅=O<('^" bu))r(iH <8$])CIhHMOu2N I]P&[I-%8 a$ܥõ2>)CuOy):$`I a 5QqjK9-=G%%tuOtj[a$;> tD&;opADݵi=O4)͂"R47Ң* (;D;ĢۉxIZ)eDmqʔ Dy5$D<3`$e:]01)>t?6S]"isdi!@5LCZISfD>68J)ϘI,k*U10ӂuo\:gJg/-2z?8%ZUVWY< ji\~Vy&#?}U3SjQ79& La.p6WI$XRcd)uУ)I$:)jѧ絀n쁑cpݠ Rd钴6|TJN%'I$w@SA9nRRI$aDNFJJRI$)*@I(1juQpI'Б:3IӄI-a)$Dsjt 3 c V5l}' 9'iW7 Z6Wcλ e iJS<$*5sXMc^ʍ!GeMsϐw6*x Z4 (95 kX\>L8"Ys)n5CV-vw+!cF@`%Iub<S:k\\@O%LI(P {׈!c4'pfw))R2 $IPCi*N9~8> &I$1#mSm3-^!q$'MJ-p $m[Oi19G =nRK-3xSp3 b-=Z\$RE`Zp Obq+{E/׉%/S# {DOa60%|?92;O% u"AϒIm$%85v4L;@3져s>)!D$L(=i:R:C3XD)t)$N%$>)$)$R%! @JJRI$maxn5·^;{“H)쒒#NSqʉp>]` *hК;EID̩;˔&Ԕ3tCa9$[irD@=buLDR>hm &BpP-l(g%A!4 3ۄ<@LD>2eFֵSkۂ7uMINRswΐpOK 0XyIJEQ\qv:9V0ൺ<\e cqIJ֘ 8o$&It)Vw)=FR;%:h:Uì1kLx&Siot'PsJCq!4 Q܄,ևr&X<"|xLZw-6XjRk?$3SwrNt\ 'mGv{oȤN7dm  cN*ӝB`sHC:8 %Z&ĕ7;tR7 *A?.7@ia$,S'p0[t״ ۔)U Κ)G`S:' =p &O=cꝠ9P Q-Ba_S-D™q@`BoKlh:纃qԝ]`at %ۦuKc)055O%3kq::LE>5Qi!x'WX6P*N;w&Fw )HgKw { h I$*5)= Bq2~g"n@|`DY>AOh -i$F`%Y' N5;F=.iTTj4NE fZwe()g:"{s}T=p,iRq8R iG-j ٽ&!F`Fy?Fo=ҘKYÉ~͑XJKqi"tЅGD 緂 why"ku 'j8̈p {Z`Νӽ8L@ %61KײfXTĒvIkH úTb򒘳{js\wFK|y ͖5%ABc5n)Vqԏ m eeD{-v <& bI"|ߩRh;[>a$UI"9(4 .#q=g;,f {ަk,vxKivD<(`ms!(+yay8tY<*-K8Nc@C&ySYCHw7T :ϼzz kHHŰ PekZ4*h"A:!YSN0,0{ʛ_~Jk׳?iWQkCyHTǝ|щzB,> >$hJ@OHrl ?M5:#Hw#^v9 !DƒZuP.0(-QU.hSς~Oml8C\#"ݎ45($8! 14tD0}'MWb#BR,qSn"Ri-'#fM$#c`hJb5꒔DIΝ @Ax)i=D{JCEK{HH@:^4?K(E`X@i )\NB$ ĞR.V6xIK{$FG rt g{H)~FQ A;* plvIL EK^sC;'{}tBt#H*LD[NrN{Su2SDy'kc;$G% @HAKt4N JGMS$SK% hunw]#kje$n+74$BILC=BP " $9EKA8<si`^?%."nM2dwTMnN%}.XʉT-Z6 ٙO&E;q'.x)_JHI">)&1$ ޚ2B%pWILrkSsdsBk{wSm3Jgơ3CMT,*ogUnStKyI*{@ 'ڛpSO!%} M$1Ą2a14N"G ;mĎ%hhӺJe@AHU;ϐ (:A$v&kRD% G $,LJsI<AP cSɞ%nR<;5"hyl!&LRpvIHpJa:ʖ瀥[c̩z5eѢwC3Ί%Qpv]/Rs>i)|v8#H5EǟkD5H)v$J^˚LwL< JIIX i>ݤBJJď$ mRa Q:rV> n1H]HCc`kwSڋ@lI✿$$ %NL2?BP8T0&SnR. ).ֈ B}0dL3 )8jLa3hn ZRh$hBNM&/IAKŤҝA&SOnB\d&?nthGFt48juו6hT4vWa˲JcqDS^sDJ}tP IHt!60 8Sphj+HD" "k  Ea#FLH*`rIb y"NxC&wLr7%ARa?ʐ Gst'Ce"uRSO)y"H7IOkfei U> AIL7: BA6M!;L3u8w`p)`IPx>EHHYLT+pO$xudAM_y>!)"L蜰p;'[Q2k:q&O)9 c?tiSBHH^HɅФyC{#R@*DRRF:x?8QjJ j-D .qJҕHHUWl*m$hq)ƪE-)&w9D]4Fn9J]IR%"wXRsC|KdGq<+]oW%rJ1rQs'A&WDiVR͒sJLGfL՛4ji }eQI$A{$oȖd"$I5SmӡT\t-ߺ RI$ip> װ鯂bI I8R4@yO)%I$ņAR rm,)$nRM$HuR9Kư!7I)!I$醍A/L::[%%)$Rc (=]i/ 5'wܒI$ڄcnցPFFG(I"&YdY2$&ȷ.!8Gލpl-7mV0ŢBT2,O'R!ce{S y0Mo5LJEӹI6@II:I()8oϚxd 1G(I$<NJgb9o,@^#$hIGӝ@io8ry3@ 3kI*L'I44'Q-{7S@3IJI$!>ЅeAJ׷ROz-RI2ӴnWy-v9,Uv⊊&N It V\Ir[अ$I)!Rs=3-v65aE4 )I$!x_pPl}=> ZHI" l;!e/RG {uo(!I$N(ւ4e`,4'P`tNI ypJRI$c]X€ptVK\ ƨooH $$:%-L?!;aF GI']@QRI%-ѢIqsOPOu<\> )I@{>AH )I$l4)u~XҢIL !%)Gi3I?F4ah!ia LGJY:I"{il5BTXAO $yQ`ihTu))PI(9'p$;H.> <%+P;HT,O;'DP$e`|9 RRI$z;fJs@JRI&S$n&$9hևk)G2IRIPhh7:fB)8yI I$e"5CǛ5;IY$5NuQiÍ=FHdI#Ý$'I @VN?@~Rc㔛ϻTtN h\NTm; $ǒ@3=6=Y!I$ LkDh F5ka-.v5gdsH쒗a΃}R?dWUdfVD1⒖q%^C;?Ӹ !AqiwIIf"yR#T(DItX4RcˆNJJ`QgRSUӶNF$jwN@A(vLyӲfcmAռSeӴ.wd{H%DD@ ;\ ĵ55]v O3i )00TQk㷷2kMfP%$1 `擮nh% ` GA T3p32h#Siq얎 O}=G#DN['1g:IxR-A=gbTw鮡HĸS$v 1RۯQ)ݎS\|SHoF))g=Ҭ$;y cѯ}QRvjwTC- =B0fSLk'B$=WݨI e Gn1:vB j-q~Ri$hyR;Kp ݱLtk\O~TG:Q6VPgH)0A:$T$ |Ȅ^/kdpu<ST);|~ Gn@2jt-kZJUΤ#P:Gnɬ}DCx 263l!MII۾=`*Du# dXNF<蚲 ݨ Z>*L K|C;S <5&'$:DI3!9(մ] Q񯚐n#%35CA%Ky#T:wV*HBֱaA k_#Zs I*u9Y>Ѧ0O ~- {@$puv{sLH(S67|6Ak3B.j-O & 5)۫I8ޓ9 L(D@HԫT{dYL״tD4kN$iC\o3o"( ZI#)CJpPwδS퉔ȓKe"6g]{cIq8Au{RmDܒY6d/<54ҳiD70$ij$Na9QsrݼsS 33ѱI( q#PT.〢 H1IQm(Y(|a'}d$`(kN\&=ᴸakHe`T5968$j rS8UXMMxDҞӺfXhZ] Y#i)LlrE%Dik)!ZH@ (ݦ>J!$3,= \{!g&5i?!8JSw $&הraQiJ;%>S LhO))[$Ic0kb:wE\]P xE~cB#!~lsbAPh%J R'{5p *y0ITHC-,3(b!'U@ wD{&H`%,&!<2xPc6[SRkOr2t)6aIJV2N7YtPHBg |x !~@$B}Bz7S'Aw8% p4)sA;%\Ѹh[:%jJ=o4vuS?)ťQV\Ih6M$aʻHkD|z夓\tJ׳E j]|nL,߬P,q %(*GB O!|f@i&~9O󊉖 Y-HLK@S\ * yU! q0u(sNO@h5 MO%%3hlHI:O [@%wzD̂oucB\d꒒4)W{ચU3ogS  JJlPjv)Qi]dBvtȄ@G\#m:ʬ +Z@i:70܍X2 NT hHLNր5KpwҙIIcS(cp$(#$g^""8Pdx(i $T慹OAp$T~55F9Dmh'Vd5 tNnHSĒ8V2'4앩;L]4Cn-yJq!;^ӣא6Mƀ [$8$c׼9q. $CkH$c#TF)+"xL%*1`* 9A)uS6=ݼTUYNJ~P `qj t3:{[&hQvC(ڗ>Se"8B $DH!_rAIO ))tgNxp<:Zlo 9N@{ӗ\L4DH:d vIHlj!LO%(I;<`Wi `h4 R4MuJGp Sw(rBg4(~pQ,n`.L vc>h%%puII ;)F*Ax'GN<Sv N:󧂃jJo5^)N.].F>!>(mA< k NoAH<肒3>iHL5ɞ>vI΃<(d]"{Jvh CLH:&ONTJ$3p-$\#M#hpxWxi PnӨ<$Zc/J |R&)xp*t"8HqB䂔I(5o3=#sL%*]F)$QZ!Wafmy;l.ݧ(!I$)yq0QwOL ?OTI!quҦ4'I I$z-={6Dǐ A1jQJS^Q M0t RI$ȓ }~ ;H'TI! 8Q"5S6{g)$ AJ7{TxQ-PR$L58y(j~@3⒔I!5HOBôB*RI$a.-ݤ;ѯdWΎK}K&ݬ~(>leDiaa.i iw$I&N؉<[T&$JMv{!;6y)y ]j)!tyI9dʋt!`⒔N-aY./\}I#l / 9ҙݨ$0[hD%`5ѤAӺ:m 3G*7qNћڇR}EIZuˠm ɍ%Gl,էi ]HM.ПH_jNhpj Hې5{ei$t&#HRcRR:e#mm JQB:+ sNwQ#h2ot*h )2%3%=q2AL@I dY)Ms;mRR n $H)4>*aq@NhsP$RRѠG)!0`aӺ:)1 7~A%A7A{ JXT}I;;ă)ƓD9[a-py4))s))cBTp˓m (O)8 CYwJX FeH5ZtN8SAeau*/lYDT\FʇG pS=‹kqp!5LKpR.k픲ݺV=j"R#MR"N3ܢ^KxK[H:C4IL\D ~SC2!/ c{3xR}DzNdL.sd=O*-q=A$ot5(D<RRgړ}ҜGg3rCgYXs`&L%0:8)YQ<̄py r;#2A粉s\u;{DnЈ@4<%eA'kxnِ p@}?akƩ)v5"67{KNw<;50TZ)+x$V @ t8 :<[54x2Q\4i5Y %, diZ}Ο+i L ô KVw*! %>t|T]k]fuN5l.6ʛ+{3䚦Ykw-HݹCRBw:>Ʒi[uu81JvCI&J}HGZ]r8O>i)0@F-<*$)tRh$<(ׅȘ-uQq> GFLD1(t !0s$hE*=vm=Ӗr&1),xL!Ȗǰo(UbHQ"a8nq軄GR784+lt0!-q- 5>ݠkfT^> I)NtV82 Ɯ&DţtpT"k'6##sthsK@;&_MdrQ%#] %VlwyIL~l}qA!nv$y!\'fF>6v'@6ÚA!?Q'!cIE 3Q}.!-v a0#EVPmԁB!Tt1f,i[Y<x&Od {RS3}i)=ێ63T\ty!gЩC.{\lp%vmsM]1/+$8\ Rwl꙲\~Fϣ vO[\kp&i.pY2F z 98f{Ru`{SCvS~ξE'%*זa ,s%&>a\D T/sn)? IJŭ'BcNw8 G ᡲ!`oI4w=E0GyI\dsS[>8-ȹL\_FIɤA1$@~a w2Q{@p$Np;]5,pL,kY =Q-k 8hAF{vb$m JXk&|Qi5@uk@c*2cpJn;NkJSdI  { ۮ-hJQ+wN@;APR{^vƾHv5׵0un-;L>4L #qUe۴QXdkӸog8$Ts#H&JpSmoiIչm:Zl7<2ݵHe k A`I-q;T.ДShq/@IK-5丐ڶ@H'Ce@cHG7I!nJԀfP (ħ} i}ɜ3#R理Tn/i䝧5NڶpoJ-dG`\6Pw$vq'G<@q&mT_X('e'72hq8Y|{Iw XuL p5574RB-wMiAEH8ngp&|I rz@))Y<ƒǨ47k0'j8#Uq&I\!A:' rJx3] ˚h2ٞ%: ;Hi1c:>Iàn0djṠtYhG0<(=8Ei85BĒǂa۲JLok 7']`vEI: w>J4qx;YôƪHVoF !ktJc B@E,d( 6nn&w|G)ݠjh&{y)hG $(I:pqQײCX>) 8 UVwI:)m,yq9ݓרʍ&{@8xSwA!>Ms4II‹8L' I>LH\"K9"1'KϸJ}#_ ד \sI o k"@La'۪^v$D )Eq Ӭ=aD4ĩ0W\IL$hsvEi;β#le/3IĎT-3 /N 7;@`wL+S&HC ai`NrNL8X>j{IШN'q@ti*v8@$|wj%FOd'FD;XBtHix!Yq }ntktkuqQX6 cTTXv|T'Y&~ŭ{FZ5|ˣH9A2+kHf#C#^FJS\51Vznp.Ԏ'>$6}r;7BLƇO%2Ѿ6N;bu <㯂,{u?$J!yCk SS:$owBʚ,tSk>h` ⒖@9 СTfӡ3S&%(mkd!26Umx(^NSG4l$ m '` &'> V醐yByg /ְI.0=wXX~g'fǽ1v1—CeO/!p$0vFf@lL%閈%<5QL$j0:)C@Wy m(+"JXr&htkΞeYN0G1H2I4EMg8O*,{ƞ=ߢN҉$P: n::pv(&dkO~sJ_WC fHfz˚g; t[Jk~RsM";J`*sD|вHVcQݴ̎ hTkt9~ D䂚t֍ "[ D- XZcBFjx6#Su&S@უ̟-#8̍%Cq'8gpD&8RFT4)coT@Tf&i 54Ys IIS=ĔHS2hR;)V8h_$ijtOx3@лTPĸyfȳ_B4pN\ITM SG!%)S$%3 tHpJ)axL puKOt y :#'KtFN $a~F)1Iv6'@1yRS%`)m9@CI-g<:(j'T #R$۩)m.ԄF~D-$ N] v$y -;#̆ LlגMBa9AVs9&%('X>*[ @H3 ChJcK/vD4Bw}TMOtR9LLq#= ~) kH6I 㢘x8ӸW2)1$SO} p\@EpD} ):RN!&g!`O)Z| :ǒVa&Ԧk𔋴>iôRJd6Ѩ 'X[NxH<;Bmrv[A0RMe%'>=Ѫ[擩)-d8Eӄ]1).yAL=3wm9hgeL<4q¥֏+]Zҹw?8KdiG̟ޏO H/se-O+xғvᾪ5eHL)L uLZxU+Hnt(yvD7@|j%t$$I>(5"Qa 6%$Nz`AdIgP"5<$IIJb=I)I$gN5 vI%k1<%I$p$$4Ӻo.<IL6Jo%7I6:'H 0|Sp;I(~Oit=͍{}/SPUw8=JهǸ7 HT‹Z;xx424 AzOprI"<9Ryv[H)$S/tRj$J(ltǒK4p%2tw?xsiUU:6 H<3$Rb%qq?D:Ge"%ca`*a$HmhJV\,4p Ʋ`)@.s] "{ 8H>(@;\Q&;RBI$ %{6ܞʣQ9hB'L0yR`h]H LI$;Rc cIJI$;qPLΠ$I1ਸ4'y#AyIJI$hdjO)NtE>%)$O[_'YM잪ۼp qJRI$F{m*fmd0I)'ZmN:pѣOޭZvnvvH9X9Ahμ JEgIۤ0]eiZّAhRBcU' " $Pjߴ g{LL٨Ylk$򒙻 dq ¸JL~tW*- Me3Il4ELcRwW4✀Hp:udpRqēϒ8pum]dVי ۯ}`IsiDeM$8cIna44>@N,$GOd;N6 瀎j'1''gςP Z!АBkZ'M{䙌G)zd"T,$&m 7x{&;~:$l4$lL[D`AICv, 8DB5!GI .:kJkUc)ySXhPtUs(d*Z]c^ֵ&y*VCC6ٻ$s~qk_V-qqlJ#iѨSAO(œ-H(SamВXmk nUSq.C2%?q 4AEs'(h!'Vʅ$QNA(hא vPP@h  LDɎi`&5( ltS#`"g3*Rڋ9ݸRwo%,~v@ci$FuGcdJݳ:)WN &$x$׽xDA U{tZ  83[D3QC A4nj ^4(^-y+μYkI9B v{0Th+x#ӢqBo%=ϊIFLmOFB<C{GZBEHFt@sI;"uY-AJXC2Tq. PRZ" gD֐x?X$ޖ'r0GtPmJJN!4V@@];8Oka JMiѸJU:& L #Z~IK`rT p[Q ɉ<&=SsuCB{'nk 9ToS2^94(9=Х0t08NALv9|6@Pd- )@uSt郁r4LƁE ڥBJ`ᨍlNM0@ ]YJ%ǍS(Lh9( 7;hL$&gU#;`p)%ҥIEJf>inK l(#AI4'^dA., hIH;$ԔēFN&sAIK h \tL5Iykrc[|S!$ ʉ`vG3(ls`ʑ;!/H3N雧X0[rjptnQsX0rAi!E7Mx&{88S?rt `3H_io=ͤ;heP#Q:rT@$ %}8Qf{+txmt|8Il)ĉ]'vw;-@D&):b"S dNNHPNc 3)%VH5)6yH<`~fN'hk\O T>ܤdK5ILcYGs^N} A Ivgp 3lN2" #hਖ8 QkNE cPqߤ{J][3+W9pҏ?'iUv򥹞ֿV >oaHjI$n7A{q0/u]cI3y~%)$I~ 1?ֳsg|h"))I&NᬄT~)!I$ S#E2hH%RI%Y4H])u>)@%)$Qgƴήh(<<#M E*Q:G`ݹ !ϹthRN]-  I:(*Do) JRI$閕#0 StSjRRI%J xr_PI&"BE?#l2TI!pjh64EokIJI$KLj@E6v9*P*$$eQq N`e'5F$I$fb: \;0D"26 4wxN̻xk!%h&-618pxMﱱ> O8{Z|IL&bik=H:8Nk_p )Io{;>):L!%)$D5m:w`[3ܤ$J$mh[IMZD N݀wH`$$JtGa$YMK7fI)CKy!;.p ǂ%# $3Ξ NK3KC͟% Ah'mRRS)<6`0>:)$WkiX0X'Bu'qtVaiU=kƐOF5i- Wi=S(C}O|5I'R4E].3ӫ8 ; N404? W" JL\L8Gh#Ta܆zN DC`:kKKOE[S,o(r1'qJ$3Z큺#S@:#˽!MDՒX1<9φwIQ,=R @_'A!D8ƨ\5Sqi"4# ^F RS }1Π(bk&<ʀ[AH 6NhTXTtOdcxl"B JkݡU^㫻$"QAEe$hQ74p6p(%v0l[r{^jD"-F̲ʽKzp& 쬰DgQ>@ՎG 6 ₖsxroeTbNA'RĂ ځe$H1@5 S̀ӨDc]i'cANng%Ga3)!#EKeG~ E$Jaswk!V8Q6n))7 |]7O$4{d'K왔{-{Kˏt]-xw"6@dFz$<n!6#7ܨL ];@8(Uf1SksA (XcZAI.cHQky F"5۹Pe8IM ctĶ.m#0=ԚAqn*MP%㵤2Ge s)Yk[ )\6yOFN$~rzִT=!UZ )v:y u&|QX= |RRSkQ|o "ow$y& 1{)r5 RJF;ʃV.:4,܆LoZsYA h¯I$PR*7q=^p.yЏ*;Zyi-DwONC6z(D@1 KAIKCQqh2W*lv!Hu@ ݢQӺ ꖴ:+p$ d"SzaT.sHP4R@ Q堸pzz$JYJ$6uShܤD èiDel=úIGiܔϠΒOMmngsIF.a7hf!$.gpq3<q:)uWAkէOSnBI`2hШ=AӺ+Cɐe5hJ] p%cCu:x$aEB: .h:Rc(|w08O[ Iԫ 05⒙mQ{`@0 Rk AsSśb93`PIh?cwkSF<@ oTI;lFuX)_,{' 1?z[/J'oM`@CI?I%)AøNfSA&;'w䧴jCe pst+h.O?r{Z^Dpu4qA )wd4Gu-! U}9Rs\%_[&II2p<({Ct&1URsG2:&GtN$n3f3H׺^ʓ%E٤JqIK w m;)dt%9l8z$RoP b`1$ϒg G#<(E-Ԁ%r @QRۀu"GcmN[{Z4NxԄtAxJZR{eBJ%tyQs>i)`]–AGdscUʑpysاmq۞N@2MxQ ,q"9h% 7fTn>5>%ETwh ݳ̝p$#Y!2~([8vC l&҂Zt k(b`wc&5ILC8!eD?TӘH>>2R2vi)g@KlZ#Xyq aIti)q.}asFࡿǔFφ5}Gyk?4lN$DMDzx{̅ (QKaED38*M ~n*ΰXOQ/m Op R:AY>wP%֒4*a*kI$pRRSݼp׶$ D?{lmcc;])i :FhA ݯu;}T,xJL_vP0kf4QX\IPcYKhsL0A ѰRq=n!%Ne1qVB õ5Cw 0pU0$&s@9(m#S ʇ~Q{_E.|ԡ$k #U# ‰:8xo#}KE.bx)pxLHL̆'o]R`$ 'NKJDyqS)$A%)$S &wJt3I IL;BHHm ОANG$$IUc. JuOŰ1'^QW^  '*5ʫ"d$Ak@()tM) h*B=IRI$S-hSTy1RRMlVTGh52nOdJI)k][I'sT*i~y&RݾJnZBIXLHIDF$+gAXPp>?$N UaA(VZ ;M:UCAjeMk `$$S*6TC 탩` J ;V ḮSwƃh{$\>htIHN u7$!)$@L$q-tij/u3c&|`9IL L7f%Gd`vvPuNnD$jS:!ڥp q!PIJU5%$.d@ƜE >)0JJRIJHh0'E@h9P;ޒ0NwLOtFSf5AWjJY:iIAٕ7:ЇA !kH$.:J"NahQqxv}-FTNiFz#@`)d:dvJg B4*1c̃ "4NLjF-<or5<"JiN1|v3ˬTHwT*S3i?"ᢥwPEdizeTx$wLp#[< hlkء؍B4:ʦZ{on*vjo<@Wd8uiW39A+/4(n1)Tè@d:I"%Wa)Ӭ K(.h>֝xII] qI&<N…c!11R"tK( %n2.=]ml0*B8Lw) IKi-X6JͰ Xs2%I5 )x.ݨq-‡I"`$ K )sݔC۴A#O*I#[HIL6T8!8qZ4g p;!k;]RnHeb:h Tղ0N V'Pa g;,x6 $iݠMķS4"1sH(v5'\jB<{(']'cX<(beh[=:F(194)lxS<0D{*JF4sKJN5 It3*|L6w79%%.Rs)Ip]a @;+6p R3}DyP . GcX}Q€8ȸg Z'Vj))iPˆO-I2$4.#wDn III#Mh` mi;)6X0 s( RRBLj :J@E(3䯼%L8q ڧv[d5@OI7ܝQ(HG L0*: h\t:ӓ)6]@Pl'h$S5H{!N4js~+cZ[˻<kZsw0@&#t/}4q aB ?:OYP!M=ff5\vJ4;_36:&pIZݣAT!K$) G ]v%LY0 dW=OJ#O1ംI}|gIJ`|O|DN؎Кx x*o"6mC{^ PLyo gq; 9P!U>-> -pw?I&V jn5MĽ(L4 Z4Q-.5hS^l) vm:5NX Asv9 %m %&XiE+ a{Cn{sL6Itv@~>.pܤ_ps 'JlVc;feAԡ2I IN2ƀa{&n#CIմ0vy$'r`:D=Ѥ n|&P +iAmy\)%#6<%VFG<ISNLlp5G0􏊁"(&'|ap->H;ߣ㿂b "9܈"L i4ʃsޒ4"}d rJekJ[\?]%qp\6䔯H6@ɨiiu8n$$$kkKC!=L2RRAX6z '%θaVsZ7Q, `'AlkAD?IRw;4:p>$'iD'sMFbS丙IKN$A-Bs lbXl9II` >3c >$q6#UqlJC Sk+!We.4E7ǙH[h2Oe'Ӯ1HQt6e$+o~!0%Ij=矂Ĵ}0=I:J+PAF6vB}c_wCH;gm|C6 ' !S쫵t`D <)}!JR4CpL\K wL=P\74<'t Z5{wMIL <Hʁ|JH44H$) i%9))m$S>) `Q÷ <S"O!624*& qELxaLȥp U7nIDq Ή kF9h$V<;E'Ps[SeE ZLNpկ.!Jot*i 5BG*,7Wk M ; |JIdnc q ..tNH 'p-:kۄ3ILX. 7)zvzpAsqbփߧ aO)@e;\% v^S7NG~A/ѽ̑ Y 33 T5q49-jR{Sè*t#JV}D <ȂP  ScNRΑS\Hy…m-!3[A%1sw dj_E0xP/ *YFz pʎƓ1ʛX Nj2CrԥJF òZ]il&۷Aa#(vo`vI{FY0P΁OaS9&Dxq#@8^e A > S 5 ѹi!gqϏ+][ ?tA\?_[#N?d[եO@ /c:!Շixғvᾪ5Qk/&#t֙#Y%U$L%~N;$I2X)hH)I$Ns*$)6))I$` C]9I&16(!EdJRt(4TS_@ IR4xS/$}I3)\M宙+% gU]xQkMh[4v)eL֙=RMKjX>xi%?S= =1v)kM JMi?HR8s^4! 4nɎTpiO`xOm&>#ATJKt0<ӜtZ뇷$9&;N2QUS9PceĴˇp,4rZHG椥K_TٻARk\]5dH [ߤ9H5$>H/gi#JJ*& E 4zƗ@R!@;kRB\%3p? w}%'cO&Q)ݴIJenax*RkFրH3vyxFc%.ID4N˺P$p{'d ^e41A)I}:eI+I=Ξ2mop~*n]d}$}Tl}IO<+?@ļUmЀU*(%zsPlb\:#-k,Mm^%Uq 9Vl<*OqJ_ v I0F/B3:^ʦd()Z5lwJ=cH%EXS`HxQoS6"=vGĢ:AQ!Ϛf JuI2S2u$7@^~fEftĤop4(; yAYG c^40A5Oc^`}6n%-S}B505.L8B[ej;ٻRYS ~\<&sC5$&ecӨIK-pㄜcBi2Oh*A0(lIK4 IԤcQ&5"E`{A.>#43kI=IJ%ŭ;L Pk Jr&o Qh;t'D1uD%:IIr'P;U Fk[ry3kVYY5|T?| .sp5@uZZ<uVkiNѰrXn@t4O(1pƤNk='pW~몓&@! i&yDhـR=il-Qq:v $ggFDO"I0DO#%0t)/=L]jh JJ-OI΁:( z-&twЄ_IZ4J\n=Vp65ɹ5c\ |jw[Cv Qy%HT`qXXז1YS|KL'6FXs\ZߔRmms`!UQU3" @IKӔ-%p1w>b4A !"W4"'Mk[\;+ >i6\%+R㩍?mkĴݩ%NkA!E&^^ԕ\òw#So0@|RR& `cGp$=gd7YㄽgU'H!Yxb_qICXd. z-> s|mkkx qid,n#BJUoswOu{$_$a Iq^cPuMO Gs'As$l DQgM'T$5Awòv ;6FCyI qq7u{g{>ႾFQXkhOO:JV R:\L|PHBujM׺{Xtk cG*s (YKCHwk0 q[i)!Bmh3(_>JaBk=$\ 51ۈ7h{$-pChqP k{x!pW5 *N-l#>5dDjiJU=8LƹgNyTԭL(RkKIcLhwZ%j7[-e ˷\ۡQoU5 t÷{G8)mO*ms@DjT5oZILI0 5R4%$lࣸ:Ȍ8Vv#S>sGoTs %- _IMw5q +Mpt6 bYy<*8cV}>|TE#IK sKR¾vE;<2m0@RAR$򕍑icԔl\"~ssc"C=FF5pv(2a̧|K][gwiSkv :H@%q.p4*^ vV]d8L89ȗJ[m:rHS5=5c<+wf-4佤דX5/ISWw:y*]Ah]1lgYx-o1=ΐvU&8=IUOL#B;P7w;!h$k$ 2TFImK+iHR'6ku7e. Nk C5YdOqNncCh67xMf3]] 7 .%X{A0C#^Q\`LJyc#LmhT\!DRS(s~ ddy){gwtV% $|02kaOR#g;C5f{uN ĥ!R6BZ4:F)PZ{8 CR{&s]0t .n4FԵl<5Bp, *Lv CgSϒ}w .ה<A'M;Єc }#?s''C HII&5@e(nV͏AēP}Hj-EָDhnl"T-Eikϔ`i0[AIKΩpy(;:CO)>w(;cORC׶I̢zLRW|[n|T=F럤 J`dSǀa׺萀τx"V!;@k\u60 :x%3@:h]4Ppiqyw%1۸ HvHh$ ~d CivJ$iS0A5`~)U :S yL'撒~w%X옉#XH)c5pvNHGnCO)))s{$>Sˉ 9n=Sjy䩷S(@ %R8Ek)H;O"uK`'JbIIKjgxAh Ü5CJqasFARRKhx(x7Rl:A0BZsQT|PSH8N5p@DST&9LƸqLI$vL:83Oa'TG~DŮvD4TC\5x.=R0!$2ӣN6i)VxU$u4rL78 :#Ny00;'  h׺fl̕g0$rRywT^y(}ƷH1JbA9Nocr+3>(3{& x1)%1*?ia*!: 6u jq4u4D-ԄmĴ P$;yv%;vhO\0%%!μ|hc{C:y &΄)KB1Se55֤ B[Xd(9 'AA > X]iZuOOe3Xƪ j$#^w+Ka"bOji:4MTKyP-EeLp}΂S6tEl;MtUa%'dl{6'Fz?Qc\uvPs4&5qC;גaڕ"'ot׈JcɒR#P5[˴I ͵Pȝ|P5|TrA:l[1VA5tRU[+;}5陔CX] 6T-%AMEۆ<5O-nІ:p ) ,~I(.){dM8 L<sw$uPbwyFhcܡc_:򧽱*'a(rc5LcXL w#5 Mv[Mn'N<Ԟ(eSe4*{iDhGHRpiR%u n$'TšE-@5M44pH"4 .h'C'vxFS6xZl{O˺fc*b4q3'MC6nx0k04StQswH< S#4$N] NXHBI"Dk`#Rg%0ݷ3l&4)jNy 74:f `,X)ˋiqn;d{'cRu{;R mKX񳼄ͺ7GD8-}-ֶ<}F ^\H3ɷtӮn~*n pD(i0@A":je!;HSeM `T#_o)5t#+RฉyB$0kLw&{Z3' ^IIJXuMEp`E^ӕKy:18 81r5Su;G2Ȅ+[{(wU4 8)-/ԁoP nG❮P=DkL~Rc'OLSh<;4 VsI89Ð1F꣯?8{Tm.IJG%DY"wIKN O;fB^7H )t'QٻMI1#BI(Ц =)t !I$Gp;eq!Ko$Jl%I$'0gT ~ I0)tB604č^80 d2|tRvdj`7I(Ǹ5F>$&7O4\a i4I$ İ@H@;DVJ*Rt i)ÎQۤI$ld|Sl!|SK]ЁJI*L1Ll0NpQa .dc%('L9ptAk9[.-`a;it;JY:gu7 x\%A|RRNUmDLlk@i0e8%m#QC  tE(ԙ:HyG{!H@̠]XѿIH0PY${Z@'S’3퟉5i#BrH>㸞;$Y"%"3NKB>%&X )"ԒI#!Ӵ'ur!`D@ײI&Nq &vKݩ% DxVI$~$)8[.x)I$%/hE,vKPR)!HV+~j&3Dt;vI!IYN .:AQ> @rH";$O rh!ins4b&4I LN)6̈́h/8;&JJA'A[H>:'k2GrTCx{$RE@\kFcO+ "T}ԞAIJ"RE2fS<(5|C _~Z'ۢJ]. ;P*k ǫa cڟ$Pm 9N옙&~7b:'òUUZOl芔-ǂjG'syPƸ<)68pi5*D4%%đLA0 {Rf X^It)TӶ<*e: "Xs%@0QRD$ nJtSQ5"8o))EZ'Q&BC<*1{۝S$DFښ  Q#EKTZT1^:.V8oHTMO :D:Ѹ~Ů >I)IrRG(p3 {̈j5-D"S;L !E:($tQ5[$>)DH p36X 6&n@S;"2]0=JLʫhHE`c4xZaatAl+gX:©G^Ɗ%6+ wZ`ruY88\'U6D(3ӸI-:)|BT&4+9Ny;X y2[Yq?q橲ʞ =Cm/ !I#YpsHF:!& 靳Q&Z5 ) ce+y߬x#`- :bBCDŽCj IWxvQ, $}Y%]%JrFwG:G:պ4Qi)S]d7$Qh2d>䶾N N%9F&Nts_{d'-DƗ>hG#xy Q[F% dlw(kCI@T%154wpj80m!3k)2Rdjq HL+z!S* -y*e{Lz4:pDvG}a3l`tOAwE )D 0CP}iM۳*gRutJ÷8i*SWa*ôޫ%\n(lUeSqT}f7CUnp{c<)vR#X$1ˢiljr)UkZ$hS8&4ƺ-| q^ZKІu@M`k@TM2*_i.a-5]v)R}hLt #ĻZkôT :$8Kkk|a,YRw4`cX7RSYa;s$ 0̀;" Poa-Õ'>I!S: %2A?4kK@SL2}IAv<h(5"ВRΧISyV_n6=e[$JpݑڴRVZL1)thB>hXs('bRg^LvH{RR;өxQdn.8Sf Lv35Qq'PHt̀#Av:&{)UO`LQ! 0='{  LIBm~ MCnuJ@>iƿMwyir٤DAL?|߸k(] )` WX5< GxvVK6V~YQ" \-t&U>H-UoisD5#墦(ډ.*A><5h'JlO)̏<,RUm>#kxN4IL;Gހ]6^A,mC,DJŢ G)Se3YP eLnp D!َ֟qHNl\dx&4;n-ׇjkEi%jVU[#.wThF \guPtSm#GgT?scNQjbNBf% Ë"w dkpoPafq;:qz \II%e08P^؝{&n[0 75Ik]Aq'RmP9~ӬJkz[[c 4"ǐ@k~ n}'dݑK5S]1-.}:YC/hݠ k#e024;3۵aw! k}BIHjf*A2uVMZxj`̛ TdX]mE=6P FN/Ĩ|!dbWU{{ҽ`Q;+d:vDѧQ}f9EK5<)Ju ,I OĆh pZ$.!¸vˎE3 88Seoh dX @QyhqhSN5"T$RuN^0O`uDsfǂJ[3`QT@2JD7t RæS'S$7D{,r< 4iԠ9BJlF^ 8xEkসףZFpT 0%$*Kp)j5Qp1 ](=S꒗N$4!5niq|T@ "JJU6 DuII;ࡓ 9h'`r S@N}K F邤Z<&kOJ[B`'2`&t"']Dtձ &J Qyg>8 I杅XIJM:y&xHL|rxrxϝ p%A?RƣPpQ q'6 IHYm>SiГ<p" _)8 IS}2(c5$*a,ԔPYUYS䜕+Yi"JD*撘oARf!()0'J:/L!Z*!JUm&XIRRXiOKuWs$|J~osD6%*E^$ ׂ -AWh'SQkc] 5V懰:4ohѰ߉IIHySH?H8;%HGA$p%1w'!H:U?iLoPI"G?$G#ϲIBKd(>n d{L|{ Am$8IUtxN=2Z}" Q^ tXHn"K N~ s׎)eZOӴJ:ok\ Qtb=$JjYEntr:$7 By:eAHԨ]%!0`"=2;4H< @/k`U'Tp:DHA2{de3Vy'HO;*yt' ZVO@m 9L Ȃ <&C#@1TQA2Tl° 6oB .%Jk9S> ܗnOpZ:n䧼PeR)0ga#CcLa^}CI$2Tnִ8`)5CP) ݠ@L1v\K@J[G\@b&Q6B4MN%U 'Tjp38ΰ\j4P2HSq6FMyQkehFH')LaK~*zҢ}ܩ|&AGyNR26HhΥVӧiXw=੗8;,hHQRrcD0Ƈˆ & HD40>12>)A:4j6LGL4 .pJ YD7BS T1n7k$u $QFm!=Aq{:(~L<û&"S7t0Ӵ@@@)k:N5ON$(LtM$>3x4HocŽ, s"%Ky0B{~1y%sSRk#rJcI(>y> j@IG%%vst{tt i)3!IOtQkAALlpvW[qjiA"h!Kֈ κǂ%;BJEqsIC4s񧷓ġTV S t DK<ʨ]2t#WLӯ(S⒔: F#bq9c ;V`0 R{%)?$'yiGeLJwS.Kih-.I4Xg^๰0A3O H]4'LT8D( RBkN sɃ?O] {@RR]M)K`b5n:;&!,`&:v|]i5;ߤߣĦacΩ)MM2 jDUKĺgD0{!,Ф7 Wi ʀclp'lG.a&?wD U%7WX\:"jHP9Eý3JJbٍyI9L qjXK6T ߬4 Jd Lxndx=:I 7_n )lLk 詊&mnk [yykf$kLJݱAH kL: wL"R)i֤4$87 ӠL=F]s!&wx*cYDN nrui›CçS,sZUռwJb᯶"P״ЗHA=HLF?74(큷TZ@*mP:N% 'ƒR䔕iɕ6oc  Q]f8<L撑6#5Sn$ȓʉ`V$Ag ;4Oo<(*Gki(8R{߲zwORG< :h7si'k l) 8\v0 w ).@7ö'S~wQdQ,hx/Jb|ԝ:H yc=極 ݧs/ uhRSÃ"DaRea4] %@oa3G1%1嵐Jpi!Dfi=M9L N BB@a3H=LLr" Rtӄ 55 {N8HI 7l9Ld\yDI=@)m:g^7d<h Mqq H7PZi)!"$N99ТӄI:JEK ڥD)h3j Mat* Q`uC9:r#ݯiE`$)D&!3j<%#q@pѪfn+h=ts׸IK#T[TŮ"xMhܛ{LAlNA'kL$ƧTw(l %?#[T{D5.Nd%=O ii$O` V0y @iqinOțkI|PB*p岓'qڠΩtIR~RrEg OqPReL89xJ[vN0tS:4P- Xq4NAf$N)s')e-:jۙIKБ 3NBOlQ$'E/5d8O< T+(t }7iJb5;!ƪEHx):{i<%$$'*-Z{"Z ?5C 4>i).QJ  !#:7 4Jˉ$tL ( dnKq%%%Eݵ<%Ʃ~";)6Ge䔶Nցt΅& {*vCf5AVZ滙l uДB'T ]`psxU\) 2Qvrz${$ 7m vi'5fc%$Bb!0x:vOĘ(HR|9Lwi2[0BthG+^vm*;|R :BpZ%ҒQ8r`w;h8*'q; aݩD'5EC`YILM!jtEapG{&4Qi $x )tTN41 vަѴi($L )M{XE4)@"U>~ pq)֑wa^) 8Aə$A%&'gd! I?pRyLȍuLH [Gd48lj..{| gNi?4T`gt$FL&e@OBp{ZKHTJ)ɲ8"լ@&%AvB!k )UL"5ڀI ;ۮ[y8(NS1k*Gcj#i[BNx㟊6}j 9AHq':y) 4 @{ $p!>H)RIL&*'_6A S2z{{7 H?CK;41lQ ĝxpi )tΎ4Hllju"~I18G }-RS5{kØ=# -3wF1rT<&{* >:(8IRkȐ<Ӽ@:&#o`u!;, #MuNN 'rmh{$P=)ςNT9P.sF[5 ƶu q0s>\9 #6>J"y }U<>$dIKxQ !%15"4-v6xʗ!ʙ.5Rc47^0Oe:'C `@Pzlqsvs@0akIU]S; TӡSA7@Y|Ҥ:y)5"QZZ @ :q<$T{5PKHN$}t[ܡi]QSYդlB(h<&Id@cdWbHAH}8[W5V;oHY]icqi\:،gT=]sC̟ޏvWUd򥻜?l  >oj+::dJpnRkԏ I&XFI%3rC4; [k$$L HQcִOn'BNH00yk)W14gTT'ND@ 2u02{!m Y$A"wvLqQE`\+uZ8 FRJH]<,ُ4n5 ~ 'ppC4I%0yAStIJH61*e6ZPunA(kƂ!$ vJ<&-dն@&ps;RRI4#7`2AlqHkig>yBk:JFD|է1Lqp%W 2u(IIL$R:Tc O`3o^%%(OtM:I̭xou>?kTCZL"%:E)XKu>\(24k=Ti y*W຃FhlX :HN=.ȮCmfӺuRkFARkA.xdp-5IV}rXTs};+ۨlh< 0ݨQ㴿i²WRȘQY;ϒg;lA㴢:!0ftAEnxMkk H; f;$?Oh9ydq))UWk\qS2ݵԑwMVC0}glLtBP$$4N0Jn[;ZpIk;GJ.IJjc^I*] 9BjH:ɮc_$4˾9P g )n:r47Px" P%e- !DBn IL:D'ۺc"$vNw8d`j!X.B ⒕瀜tf<yF" ߕ7V\[ )3fIqp, o*&Ѯ@ÀOtƲ0t`CCpxpUvH9`u6VAR+XG☴2Q, ;(=KF\%8` 6q &&.<L܄#Pl8d5gB׏wQH!1(;n)T8Ԅ?3] Je dY=k]25 $hF:;!SH2 #@$ʜ!NF 2F&H= &LD['kk8:{ ; p";0Yc%MΘp_L n [Dii%>wT ɓFH"DB3Kt'`ܢִ$sB 7$ha'<F5 vC%E=CHsM $))AAG |{Aqςs!9,'Q%I۴R?'T9PШ5MQ*oNcb(V'qNOwl|ϒTd9T@2BcT. mB I#Cmw 3#w5> *RR ` ?FvSoX}=n.q Dkg`kANAkc{0u 4R,T62!VӔ}:vRQ=^B۔L8P "aњDia!eH[dv1q 25IRPHef!q(R .iӀ5'$w'撔n gJiH>V_2ZHgm:RƐhuA= &F;I`JbȐ `H]J_p> N7nlh l\5OehlII k!Cx:%8}>&L|C+^ J1S4pZ2B#]IO%ƨ))Ouݣ̤l';Ĩ!GV'KpPS&h׺M;w2 IF!&Rt Ȁ IK*-(H8Zo쉷n蒔BtBH64옴.vR0yEK9 .Ңc8v];:@!%*A&o<"f [Il {Pܤn)ݪgNJ)4LZF4jw;v,|D~rMyN6$DQ%,AIRIJ3470>%%)QkAHwQh;Cw HߪaQ᪉ @ ' 삗sFf1RtKzi.;$Nqc AxELtm4moN(Oc^5V8?$u2'Ig KX904NA!1$ D%7p|tRJ#`o'E ,q#kHiaC(r'ƁikL IL+!D*M@Ȍq b~0S{=E+TD8Y$gݪE4N|wQu)!& ) čˇu0Sn$DH LqljD5̕G ƣݢH^v(BI<:`jY3♭2)7% #T)p>i-Vn# HA!FbD7-DJd -% r@3:"V-{$v)w%{$tL{6^#UHI) MsΚ( %LGe $|Nr7:@1 [ jih z5晠dQUô$qF8H:(#^ߩ+(@GaRq-ӱJ@0d'XлI < FZbMBN&79Lם;@N4t3tNRu0qN#S4 (>e;uDT]䒙G<$ځGtI&xk !;]'h4EKj "!3蝺cdΉ=95pgRg'V'EQ锒l)&O%.BDf`x)50gBHZ[Ol$ڞN$@A*{"uU$ q:vA(KHC3GZH{D@J`?H1 BJb}$( {&.kKi2 &;H #S`H[>АAI*uU_ gNR$r.i{}V74<3+/T_!?y:['IMF{@ zr&d7liQ*N׍Oe+$H .>#Hb94Ŗ 4{ Ó d%Ӡ3;wĿIo ΀4 Hgy=@"Gti$D'TAR ʍ8Gp 1{^))R)0PPYN+sH$E']B3 0 S'|RC'T4c'q `@h`k:nuY4a*n;i:6H4 Noxd(IƒXt z(uCuu8a4E`#HC(A5R|by k()}x"$hB6{Gu 0yuCy 4IHAIq;)8B5ŢAQBf5T:wT9uh;6+_[#H9ql!h*xB$wW򥿖 Ɖ#+a+xғvᾪB sx縴(lqQ4x$g|2H:̩88I 'LJzٺ`-L, &VuU)?)a|J! Jk ڠ>(%`'D'ub 470b@kcIIKJyM TVIHRfx!IP1:EM'GO>J#ĠtT2  #۠湠8))I&O)y0™q&LJ\uI$69R-!S}IJL2l:);Wk .2RseRB&I1GpQJ]$H%'kة؝!%,2H~ !I~iց%)$$- ς54׺}nԤNku㲃Ƈ7$sO^C@RJtІKO`#TGNE %.d0! VID{6<蒔d,aT -$pOI( p6L$LGIJI$YkT$wL4jdI iÁCF3Ɯ$d-dXIժnsԋN;$I%G ocǂZ<>))]Ӥ>C<CRA.-Ib'Gi&{A%݊=I=D;Qr&8Ru蕰02!%)$)a<]ۜ5V8}vRR:#E(U k>($ΗDHkD%.I!΀C üakLI I$tQ(qv"+ {I$p({F>jf+u&INJV<[쓃dƀɋJJRI$ ʈ#o:I$c@?$l|_!́h^`IA|d^:"rRI$CVCu>) ǴIM"\ B-k?zÞ >I%I$_(Ya0yףGr6F&NWiIhۀ#iq PkwdI JSX^\LR Z߸Kc}Hw;tI-y|{N˟O>)%I$Zb;D v*3DnitJ,,tp| m!%St %>MY K1-2*4x rB`t8}Wp 'ޡ>גZ8BvA@ݺL${I$h/Gy B y2%%):dAh|̞[_;F(N6!%.^rAZ"&q0g'gY3@S5l8$0)XCCxNNwPЄTa :I"8;)NK^L< hׄz_/ 8m*S4{>P%%ǴO8+<|X,ikU:' Ft꫉*H Stʫm-h@7c`? ,#֥QUG#vU[P9ZL2vU)`mU  =F,SB #YfVZB/2`}mȰ_|B&֗:&cX<*fmʈ$R~*3UA)'s@am@%B ETYt% M]7nOn4Ϭ0nJ*f N8tXCu,rHR-.#i:1: 5CaükK ԣ: hRAN'O~? 쪶L 6KӅ]4A()6K+J+yVI@89bEK0xSCՓH1TJ~ \=rĂF)4;fn*c0Y:&hh qU78y)JX}0>ȐLj[K\;ݏ'ʧ38G(d ;(mϔXc;&H2>i)qʌJ(VO0>2{9 %'t = 0J\$๠JC|!A5UM~ Mn"'˛Q4s?ڊh / )\ۏ~Qpj>&h#}e D[ΤF)cٹ |'UA) Qe?Dc@j۱ hl =I$ )%qI7Buv'<4EHOX{ |S yMmAc$:kg uNAcoiGmLi۶ww(vZxCDZhOdqv pILD',yV2 Q#Ec*״j*ѻ!J2s&5I>ѯ.1e#F[ Fdo3Mx)XQVX#㲩"QNe<;sUgy&AJ? |Ym/qNV" M Ckw))hpth<ˀ' ݚ]&Z787³~ L 9eE=BJl9Z]'U1M (7!O(Rf;+;>JչL5U(OyHԯ,qLW(IR#J֋_=:5;p% eh`TW7iܬ!Pm3I[0&]) $k$AΩ)vXD' 7a`ەSk]E*AFWVџ6%R&LZ̠dz&8~h+P&;+@]D=t>jq l%[Ns&"]ǒʃt8n `;I#i E,t';ߺbH7ͯ~Pͼ FGk\۪JC^3sx{t)ځhk {)}6ACi9%0ciKcLCz{GDed 9lvR:pi57iȞ)` Y#(map#W#lw O $|ͥEl ȍݰ#_/L;(22J!{Feq5>jTx{ H k[d{~*ep`yx">aG=D F A'aPk]*ɯT&w܈H2aǴ𒙂GD@(?YH ʑQ,(ER&A"gD"ֹۤ1H>wV0%!Xkc^Q\gUx.c2jiǐRkN5-e_@YQRAcNĨ`|QI vz`J 73J$S-@S$ʍD9D  /3ItL8KjVm{)\r58i'TH.N,g✴tv*b擡teoqHvNK)1kamsKwh53XN5tJG@n'8䣵ܻtw< Oe'tIJdȢN;C jh0\ZL[w%-c n#!(=6yMꁫ+I 'NNA яV_gSIls$DG)5(Nݾ%3k%X =2 LP>.N M!SdH$U:Elq6=B$x:Jq‹I lh: RxR`x2di0ID!3qϊpARD~*Dr%9|$` hq:'$1dJa1*NfAwxDl#LA# TO)5@;wCe%)PD7BDSH<dv$juV`>HfpCu0jgnsaQ☲~'P4 %t1SOuH4ijY<}ȠO%CG| ;sJ")jGe0Lt9I1&wIAJsd&f'IJ-!3ZH1:'.ho'Y$DJ\񡔃\])wԢXI :NK[M%0a"I rc)s)ĉ$ǂ)GxL4;ZH $ lqw2ҔӡKwQ/)h3NH4ZbG1^ #Q Z;II $4DLW:CG4Mވ^bL G(25EIr 8<(rB9JNCk IO)i)գw$];4)aXQ̞0 $t-`RRA vIIN aCy-4IRyy&}reHJe\7R84fLX3-›@u)C)MN>\2[Ne  j50k|%Hr:6Iԕ'%T^t1^QtktgYJIduR胫i4x4GT] ~TtIS9TcgGd="H$<6{pS]u &tւ">5T !LYqPqݑ^uO$h nt~!O2TZ z[:I({S":H!!R7vV*d$Y} %8m "JEF<v"zpu!K$ yAI^{27D0 Gm@pSXnvIJ/< SL=BJ])LRUDjCycH]0rZ iIP .xGd4=lnA%2&LRPv0t .`Ec`:[ZJ]:dp5 h5S$۴))IݤsM"5Nb`IBI2uHJ@F[t I$ێ7irx'oґ$$I$BW:'O%N:Lvqa{`QaRR&A3. s U%*RMu?Ƅ<);D RO0h'NJ*T)NX)d$I&4?)'3HtI I$ns09:]V^ {J'LkKsvqxPeLA'I%fC|P'iJt:AR53 4z@$)$RonEC'òv#s'IghTK{ :mQy?5`cjARtK%&w:B{^`p kI I$ ") IHnêJRI$ǽ5q@(dQ1XQRI%bhVv5F'lP cD)G7y-t8$)$D6րgT^3AhQNI$MP]k>0 ȔVN: $cIdBsHRI$9MD0FP|v C4) f>%7v) H$@E AdL)D<[LXv${*-wJ9Su5/O>1 IL0$L(̘U'-t3ud:{(vq%3PyX|Od=fRܢ6K܄̪SnPG))蘔)hv> O(o> )yI->]ԁVEƊá=C$*;tNTl˸Ly 9 Ĕ@ }%2qRlx%+jSlR. vQ yIJN@)p# 6V6o='%)DLvNJ@FBT;-|K I%3chF#@1Bjil_p Nhi!$kuPR꓌pSHClD@6vVvV0|UMDŽiAvNQ`Ϛ-Ps6ew(8w*@!C\ F$GkI=^Tf$˜"ySkMwm{WFO4 akdQS-(wwSЦ-IScl"6dj*|taG~E;@<6MxQ \=՜gl0uPR&H6W7s~hn2"5= B'PS抙Ʋ}wNe 8O""Pi !M ,tΪNtF0\ fZ]Ђ)-'njBv &;bI*{甈R[Dς *,.#ܜD¬])?kxեw:$mƀ "a뙹YB+b]{$UmlD7Tc֝'^URRskFvbWcCfPgifA 'Ln[n=c{,%!mu#MTm~*VV,iiz#5䂒 yQ%'IT}!Gi!h/[yIJC|kp <"WSΊl{^daIADaA%0f0A J}2aZSC[’(ynJ7ڟfS~))kwP>P2uo-oQ$DJkxI0:j}.n]gO\*~(/s)j= ad[s|ن?pAe6I='x$UB%9E4nhj r/ cdn1iSmo{|aMqq!Hu ˶3Kk$*3+un,ʪu ` ۯWCDcZ g49**p 2=p ײOĶ=VQmݧ'VG}i#ʮ'ӳ{i!\=<̮;$"{_ f\*{uE{5]ѡc 󕷅{rkFY@οt:4OisUNӆ l;ppU#_U-;؅YNxq"6> VF 4Z8k[5ADDq^lcO ']2U|^qZQs-."vOʆW}*o b bi^ 鼲J3ۜ'ԭf+w`p]]V#!=cuzHcw 't2V[1m[IVdջadTrfEzw{~r?WOGWQ@To_R{Qsd{0+Dd8|a",.ijuaG&kv"VUWڬ7jZF]gYp;P*ӋCc=?cNӲX7GE LAU@>EVkNYat?zS40첖ݡ!FK>I%5;'pixײ]=9;MTgH@MwaC{#w5uRUk| ,դyS-lGIk!Xn-kd's"2;ŢRJ'H.tQO*-;CC\ i'RX4BfcK>qpQo KPڍ~Q.sCX8@sv(F|iƂNv5tvm:\ E5O.8" DŽz@p R#4Bhs'P6Iԑ5K+>&{| F׆9M`cOe3O,sr Gn:͓sƑ>0!c0@x$;@2cP>ݍ_ M.>D%X*fН3ʠCAtiA%y䕅z`3`xF c o3[ęT&Kl6y..) p%Ïe)5KjuLr~b| [gGII8JkG;'#* $҇k]3/IQw>%7=ij=N C36ZO),Դb)gV;‰i).\@g4,S׉;Lj$HVҧG` ꈵj,2ff>aJu0q{T̔~SIUm%RZwbۈ煣xdreFcJ60 W=`;Z~)d4Tj(H: RnE8CI%-1h<$d5|°zcO506τekC2K@u|:.S= S[BaaESƅ"; Վ#JטJ[> ^gvEN}fC]V6(BsA{ql,W}2t}Zkdp,B hfB4 ;OP晑YR DbN2FzM=Jĩzl-fRR4 YƦnp'H p&s<9- gu<'f.:S'D觰Aphd!"a%,d % ]Gyh|R,ILݠQiBh-ה R#D%2 [5&:;!q<)X Fh|qS&$r)[@ALH6o!5'E!ALC!A<)?=N8$ NI)+04p#Dǐ'TÈM#xsfNL(mFNJIEFS_az:&4MCsk?K #Y#cGlsSmyNc1. mM{A:qaĩ[a/:4N0{V Ac8F=16>(ck@fTj-v丁$}SQ SgRRh]H*/w# #kBԍ>(_L;MAqHB ruӴLfHQ !F S4@(bm:0BD! leAr~Ӫ&IL b"<񨀆^ vu${Tߎ{` I0X$Oe_ienOJ]xv4yIPS~a ĞT5B}[8L<9Qɶ9 )Lx$hI n)i $K{cp㮩)$|s4&+v u ~\4"PӂDj}%e&aA` CIEH@ĩ4) *a6 Nq;n0st?fcxKdh5 m$)2B*g[^)3T{ (j~SC| v ,L4 hfcR.dMcXǿ%#",\^ŢG'Z$FaKv"dh:B>hexD ֑Q p0$"kIL4)cΉ40~ m :1$4EM @Iq>Ru9Sd-{dp4Re@p*m{@;΅.Zf\AS{LhQX$K@ ^E)\4 {[ϊ1qFS >]D)q9I2‹]& .3 %#'w*Od <&`A y?r3HI#T'5nGTx'*3<4Z ;G1 "!@8FRS]e&6Qii >> \3ǮRw?8KdiG̟ޏnݥ*b'SUcg@}h"?"rSJL&1䄏UT챎+͕M?kKurLX5N0G lx`LpWڒC/^\~acv`N11 oT~}{R쯽{y/^\>so>K8 haQ}R_{ՋM_˕Y'#: ,Ot, ͏з>G:}87Wޡg+wRbϸ ]aVhѧBwOƬN(Lk@L"X{/RŖ\?N=M#U`;YTӞ+L#K5{|>+OpYä U7|W `=wa ]׮x IT=+A#Ht>=9` RV{ZQ=S8l^a-rzKn3MaoƩk7;7_p xْwiI$uR$5؄&8gNhZ>)$H/0 @U1V_Qa2Od ݢJ*<%(mZ`Ÿm}#PmIKJ-\ \&E I$-\DvR}&'e>JI$MyӔ tN{^5Qkx$$dVYV(cxv+98d6 U;Ir0)Խ7SPSu|7r֢$:M ;\7Ne ZgBRL4O%3T]!I_(RI$I#\ΦD;,-@=J'M qI[A JŏPNeB$&-IJI${֩*[)$P``pa_d:d )(=*Ċf~*Ny- =Ǚ@\U:cLIqx@ '8LhD¨ 8A wrSBeo;f%^yRH LhS}Md< $$uZ{XtA J%)^SW^@&vBE/P4d&UDSUű8W#dZiZ[Ί>` Pȿ BJAK"ê8pwUpqt"ce9Is;M ))j}# ̭+x X}!X!h$6u60=wf%Jz}M`wZ &Ν$JṲ+;e)͜I_Gݢh<%So&e8u@i [7V_ӭcMe](2n2ޙp(:N4Ek $J ,o,&JL<nc"/#yUFʵ;S+<_Mi;O:-JeN'5cFgnq+lEP{ꂛ4FVY<p+D?l颮\5Ebj該ͣ@`"UzVL(2BaJz:'%BJeydLɀiAtFFK[Qa;7~pIL̡Ke>JF7m쑺ZZKG"%C5Ԕ|RR¹)Ohܘ,a}<z, )[cABgk~*b8 @`*@$\[⒖, iʉ̨>E^s*v2׸o4#Q,nIB֭0$* 㺁a FG7 DB'j*I^}(xp*5QVkXCGq'|   )ns'xSk];(DԹ0e[5RPh|ThhCID؂uNV$8L;^PRZK'@>h b7o$je`8 *k6Oj+=UvhvAwVpuT=`uSqF`(5"e%Zѧ8/$Ep;Z@pXqƈusHizm=+UIDs3ʈ`&{x%~cQcD;,+ExRutCIxQmK=B_֒ƻ?&Jj=Ի`x!NXlyo;z#hi쏏ӅQH8 V\XIUzHӪ2b~`c>I -fVjSj~֙ KNƗ + /+%22xT2cCV0fڭ. m!Qff*=:EC%=mfm:8jVQ0ᦼ)+|4Q=rO ``4Otƒ% Z3o`5B(a渵 =:@*6W$qV݇mwcU= h5 ɕ+=yTQp]o jӯxDhM^,Rk=܀ZYĈp-ޝDC̑Xqe :[XI{#HP t }>XX o BIkS)GWФ9 I%:j\J*arʿֶ@lAMfSnD$P;uLcdV#*vJ8m2H$_j@')))IJ~TaFڤZ[ʽN#]3RRtY166tԒw%%%O  Snh[$9L[XʪBuJ,~#} dR$"4B3rh٤p*lc߫A!%0%W~ nwU 1@V)@pYna v?*sfuYfF8IB  ׎#ۼGSx%٬kh x E=[핊 u] Θ714(ꏧtay!ih)$ϰ7]=JNjT(Rg<H=trIx};9j%Drh]@Y_Y}8f#5SŗWq!۰?GPĽBB]FQ:taםtm2Z pYpsUi9#Q չs:{aYn KItꬡ3WFFYTfl;CE:@δX]HV&*}&=<>eTHmWCa-<|bsrZ/%یAZ&@akAapwd\+]b Ŵp<2@y>*2VZ"|XauUGgKb!9ook딾Qkfd NqU,dl :KC+;([1%Ih;tr@FKD*ۛ;WL|-h܍%P$,V 6HsՍݔ4 m0FE(->cփ$,2 n;7K:$,IDSǦ~IqE I$}`4N ~䪭gU)6QL\nӪ\(I$VKɢ t+ sAї EImߛ8(Qi'C_Ba4 +efE Xg&:7$b }ߚ8WpxQ;xQR L@vkT' Z%D%L4JAJt'D$ % xbԢ5S{ILȎ8C|g朻MTKY(i#`H2IK)#R`@#S)čBbט0 L_$iJ` N)e TZ{>*f@!IT\ )q/jIӲH<&߅"~*RK (8@))Z8Lh%8 '"QKC;Ahj9C#S@BfΩm3'mshiמ)S”[Z'| uSiS2'Dp A͟H5d~I1 PK0|y)̝;!pJӔhsAwe*gns"WyHU8C{ w;K;%&ϧ$LD\:.<L ݮkLA jHɍ + CSQ􆨻$qYA९D-0#U=BZI l{N%2 Ή<)o"vOb4'kh{\IB;Rr<'y:A4:5:&gϲhShBp3N=ќ o)%6dH hl-!Ǖ#`Gt'44I840PS- !S'0x̞NIAn6%1{#N΂ QpAMlsJS i0S).u=$cHIH7|8(Dt#hB#yA`w:B4#s$|G ueKIf`dH1 {8wO4?a9-DGSLi>ĔON[$}$ SL]*;N@'ġ$"[k:GޙD0RmAƨL)H" z-([$&k\Fu*5'YQL3R nt6 LfS@JJ NU'kZ\c" `"5D hJ\28HRu&$MaI;ZOc@0S 4%*FMK˛-R>#BK'pA"8|RL ;\ILԨ9*NKMi*;%3mDsTZu)o:ޜ$`l tv-:$(nS:(%06@4Ek\5”6 d߲^R%3oE7$%' J[;'#j\:Lixtl jP ꐑdG@L\]V[wDwBhs3T'DŽ6ʈq:9'<@ANi"jU 8O(0 6mR$8@tOg<GVD'H"wmv$`L}e۱RuS8\3FMݲ_A?%aq'Q/F-{4QWSX2ԿI 1 Ucumdžu:O]"~ecӐucHpir$-Ww S8,]Ia4|ϋaTnwOdT Ust'蟽m)zWnpپO~!dhTsOߝw[P~~!cXZuB;3bm7J{r~`gCq_UP>%OvLt8rs7 Ӣb|L홄0ƃT ǷAh B@rIMe3"/I+$l ‹v-1sx=RNq Qkmz[$D#d NIcXuJ{H{{SIBJR`2`I瀐ɝ!5nׄA%%.I 0b%X> Cu-.Ai{ N4H:)Ȟ4Q%.I#0A$pQ34\% ݶ]@UNe;b>i)d鵔[?"IPD;$'E}~D{|1s_2aE-@RӂRC$H.&:naH5nCwK,tsrTN 56-dXv })d&@ZAdxF7p-:)u> !tIIݩey)²A#%^'$H;t(~ u%S\vEJL2|S T 6Q$2qw AK)($} 'qyӓld{#f抔I'?$ā- qNK 5,| SgC, 7AfQRI$OQ-$R*L $Inv;74 s, G}%)$НBGN8~S8O )I$n5kONdwCh$4ILns+*WZRh2KRQtB6=}<G15#YR9$Y)zC:Ư OtlgnxS3sT\IЦU}S­0rmdMȟm#9"/΄ӕ]lYi"a !#[p[RRcCKɟ5dy(9%kwhYfB STI2b' mLO[C0 JeRf7&8%\X hfe~i s $_^$$oՋ1[?A`zŏxc& ѳ{C_y@TtS \e[vwvB6rish϶ Ga=T9&4*ip (< &sh$BHL0d)k@54EdpsˇdP&||RUvVͨdΩq`.U ֒ #LJzK+Ht> Jm$`ֽW"|>F%y 1h@.rz{Ʋ[t=Fʣ^0%P+5 4c@Ef1ID+$>BS?QEi{ǢNQuVr|LenHjQGT~I)eqk?tw=@5jq$`'¶I$I$[C֞ GŢA`5 /%)BV7 Pʿl.Ck.An:[yFCin n鏒Jsz\@(# x(Oٴ<缾$yI"E&PSy7AM~B2I$%)$Gne:vCsʘ@6=gq=SY6ź*y,h.;]14{iv+N=GDJ/g\A%1gPkDFz&8e.VdAЉnc`PO %%,[:4ಣL0ոs`IjJJsʲ mh0Q։},u[w@kaSc\_,ȯOO-A%7l.>O7U6Y?ǔE'#qQI$ŕ"TI8{LxJ}u7*K[N *[k*JO;HS+xN43 R ALkZ tGd).<@JJRI$Biy?$$Jo?{_9W=ڊ;E+P줓&&}A![-e#y ֋Jsl釖 4_ +Y()At#T<=fn=%}FqUu>GM=NaٮAQ{LyQuNoE\مsZ`s-('LL&{99!p8wYI I$6R!S5IJI$=8xpj 95cSԏIK$$|rg> f$IK'I2aYwqܩ:iߢhmcDG$WMIs.;dnVm;\߳9'޶c2@ތ %>(f_f>(H$~5s%iR\{%꬜j[wdpIU+B-lsFzG(c`P`cI>%=6RڀZ Aw\و*otLI Q$ABm6c7D5CMnJRI&÷TGx:+08 R(lyM$5n={lҒWs% D][Qv߾7v).`_[;vn(wo3^Kw !UAa,H ) nNJJq,: N-xA n-4Gd$Óƞ&9I,yS=xS ;-qB XVF(v\8>*ƣBMADjm# tLHڊL5> ܜF)5Gr|;pwZΰJJbqHS h5NG ;!;td%3*eeAڀ;)HenyR8 dMv2Oc*p-Gy JiõK`2G*v{\<1t8& #BtN|$8jO ;;KNR"#+FD5jkm y$KIZID@BQQI<8`&{SX 肘4&8RcM{Y ƽBs\ISn9D%b :"pSNA&̤k& yR-9";sGtI {ГO\NΈ)D" fY 8(2kLj,Wu w7F$"쭏Vd~odU:7v, #Y> mot u:dȃQ{_$Н.=IR RM|J޶\As'& ĥL4xJ&LqMyPxLT$ꕌR gTŲg9#%0/$8N6k <'n>:$Z$k'ePdJPs6p:5-ǂp=|S=Oe# .v86#ڝ $:%4uQk%:T{H\i*NsɓN&Gdh%$yl% ZL%H4H1bGmD5&N{]:1i:Ԃ{$hA:'NG'撗c@tl@*ls@~ @>4r&?*uI m!t2ui@A< Z7qJr#&&4#T#Rxa0iS:% -lhAp.˜8I,_LjA19i 0ST:i~#i\:v?tM\?_[#J?d[X{Ίҫi?PmmXVlsCu?˭?_lxI;UX[Lv6Eh .[ ^r%=:? Tv s?#~u?#~H]o䟹ˮܓ7 e$)Z7}3wM?73wMti-oI]gީ:q1͡WD1sG@i8Wsނ?#?7}_̯{=:a%޽q^\gD b4)4VЋX{y^U¢H ʃ&{:Tqt$*F;I1cCuL 7C)>6PCL {|dùlI:jY"UrH3}S$yV5,L*C)OOcy0>8䱚$D5D"v TUu2;w]\O՗ڍ6:Nڍ.$p aՐ<9YV)uBXE8*5ͬ=as @f|RǏMxBs6>GI&Ob<%A4J[~FEø>PtPm'D eAN@t 駚HT'&B ̩7RR)VCRebyPinp%,tL⤒qĂH0AĒ<S&5'05;a>’V huK0WxB>G}i?>"!.͡I-n*/yZ9ղƸ$'d5DIRA4|UF&4v ,Ma;*lVJi(LֻMwө$hsO2'*[>rHQps8_cZnKnӺyI+ R eK`PI$-hs4>I]0RvƐ4I$+6 ֆ{)XpwRBN"4|cQ{Z,| E"6@%(rֺlMaReAWGG$’+IQ`kgy:AAǚ5QcX縇 %)$$W 6䃨 h]|QY)iN斶IưkP kZb Dαی^}ּWNebcQȶ[.f;{x( 5"G*~{'PLNd;5M'h'X J(H'N x9`iʈa$)$DdݲB!o9hu K:(Z :IB[$IR 9 O Y:I!4SgڎlKc"1RI$'II 5#a %RI2 COd{hj7tG#E+:L :soe!KnZLa%)$C®TZ\"4UYbVD$)EIA4njh},ޘek9l݄+it2w s+.o*m.;D@Cv)_Mma}SAKcZ=U؄'NDJY$VqrMD{(TMhS[&\ZcT裸!SQQ|*yVNs B'S-(\sK'U?gj19/qf{A$ )Ta ]YC$$I$$JU̷E=^C i7|XSl!ӫ^%;7y7!ޞ&gQ ‰ȳħcs^ IJPS-`T5CBOkii{$3k* ¼KjJHښ؀pT+nsܯ ˓!$hI ,xaoxJQ@ jXABL}pTh!Ss )VgWQy(~Ѥ)zGRu>i6h 6LD |;%żΊtA ;XfiN ^aR'P [%.S)Scd PU0UX8UNOv7p>䕻OA+ pn41Gst<1[& & =?RRVΎUn1Hprk?QTl*[dNߊNiKrJY2t@ixݠ-%1B/;Q<&~-sTS 0k"w$ܜKVvβsY'\TZ0VثkNa1*rRS?i& j:<0'ҀI)I%-XrtI}4@ơ%(eu:v tQSt:sȐBJnjW.9WZjO D*DO*,NJ\渴''Xxu!Z]NWcӷt9Gen;(UwK'ptm< *sL4?MsnnJD1jŃxwUK_uNRI`Nye[` Dt ӪҫYe]Ea$c,;y*zc8泹AhJ$lc+ט >S"PׅA2 }*G1pkn16>1Oalgu.f#XdNߌmk$:[p\D$쬷X$: Q_cZNUF5ĒF9/1eAcAT_0?r]*' 'O :!k,#D"Y'Ԛ(nneUK M&4Aů%,&Qށ{hnw(}.uiƾ~W6  >TnmXL;[ '枋x%YDݭ8!R 5rSAR.M%5hy\_[F*)ѹy$tqH BT#UI6K<tP ^-qiNpY!P,%*Nc]$NhFC8ȟടMgW4}ɦTi8̅ڒQr I=|4u2)i Vhjb{f̓>҉}۞d@D &xb`!:Ny|Jv!4"HEjI2s{zmi>D|npC[Mf} bIgAVx(BKhUa'O%j̆a䭳R@Jq 2EEw#i՟It YLc,!%]xv%M(oB@;*95@2]g3ninH t |(ޭ¹*$˜>s5=܂;&"J.t RP縗N,̖7ѡ] c&Hs%sv< $ɖ1SU m(D6ܤ*'!Yh MKJ3`l oXA7U{DH.xTcnk];ua'I1D^DDž Y&e=Եb;;,Uf%qnCk{Z>?D88Rt0{!,DRyI%::!6iϊ lsr#Ps&k0pҕ`$<-^wNqMDtM )MhoD :R*O{MHUВkDk*ADF)HjAmu<~:uRSwu04(#Dv)= LzgY2TZfFecI*Nk%'fDx$\#DBa i:jDӻVGJHH1&d''A3caS"Z5& N ̔ Q 0J *JJ_#O FӪ)Z` 8ʱP NIQx"HDtR۬(8n(jUM<ŀa$)#Dk.1# /7vP0/mxCyhT]qOX@d1T4>8Sz!Ai0!LTnhN& IL uHq:Dq!өH9@QS0&~IBHcIn*pI&8DslO:"4΁,Ƙ(< hL?r z&D%HN &u=qH<rK4ja$ABX  "'D 2D(8ReDj5N+ =S#=Nu3=#tPEID)&3۲kghЩ<T4GO'ZfL{x vT^|JF"\T >%D>Jl,{ Bu0 k\/lAsaj  @naA4L&LAR۹Rv b 7iN;NXP{~*M"%%,ð/DQX$ƽBNt .;)?Ǻq>ВkeۉSs[:PCU70 q*&ה!%qPΩ)䚱$@k fJNn#x S"R4vIǴjLwQb| )4:`r;RcJԹw&ylKM"C@[Q$"{Qq.:}su )CORk3&|T@5)#@C^E@e-sf 9c0Цƒ5qBwĔCt XaU[JԹg[=KP+xټғvᾪ5SI$6$I$IRI$K xX}B3<Қt1i3 \׆KȺ}wB9D<&2\!,6>keHj$>BGʃ սgSOhkx,m'*iRa=#:ו^70viE"kp@V3(NVNhO>i AxzJt8ڑq#3;W:(ygG>i~0&|ԇ e5|,&(6/NuEp]Qđ.KK#;Fx=`=ΗmtO(F ʶn@F' @i!H0.i$I<&bRItJMa"ZtIK̥ &$p 0B|{%鶥 ''Y$ `Ԇaig BQi;h;$<)<:HOtDŽdFdLD_8%.DIN; TAԤ0 @ӪwS>EM;5#DT2f꘎rySghX!yIL)(;G5!84h8 \8IJN;y"UkX'4 2)t$k>L4Ds\%ba/4,}nW~6LBk. w*{=lͭ;NJJ!P `k%Bmp1"4Yc~ % O ˴)p7mj O"i_dR\y uLljLwABП04Q{Zӂ8jKI㨞,#`4K+d]W` O$'C}aźDr2 !)!؅ %5d"IF|dCHV@Hl]IKNaa/:"Cƒ䩱%)1N"#HRcDI=Mp@$$$7 @6;]Y%Qݢ&m,m@tJI*ɓu Y揑is`:"~ *0D;cN8DD+ N mTTN6"GtZ#RI$SxNÜ|)>`' cTKE N5w HhN@M)Akߺ.w E'9s:i)!IUS ra$Jip`jI2tW|7A(:΂e5tR'I|<7Q, w kA']TPR$*\Zs:f=H%NR+xT̍L 6c'UTIvtWxx@Xx*D>*X9Τp<Ӹ·@4DAMs-cW>I*K `;{*@ic@JmTP`n纘s\K{|gm!ѠEaR=T&G )Sw$ bZ6QC>nHnd4v;$$ ZVN[j4d蒚e.NSfmopkfJ3pZd Pӱģcc 6M^$6;cKA >%޳%ܢ3Hjs􌨗)R&6+-Ы- ƎԷ%S )$T({*"wHj׸pJJF48+a+1pUmCl;e#YQ!%%[v%TQ(d"ݐr.W.l..Hw7i0H!2v_ݱ $Bƻ@ARU;p2ߤ@L'.=6i+eZ -:.ayUõɭ-o*IKbLJ;^NAī4 =&ĉ%Zg^4:`9R [q*))m-FN3 )1.9TȔiQ ;yRtPP֝uB47ʺH㚛%7@-;hzd)UYG*5G( S ;Dzϸ)? 4M|PϲA@6NC6ΩfcQe4C5՝\9]'79F:2o%4F8`lB]Vhiaiᴍ zHGe757q*$YZ_T)VJUz VxIH2h5&%֊_3=L0֗nW;7_c*w(=ڐ8w$9fײibM]Q+i 5RڤbY]rlU)IKB(*% cv\y­µ}U7BeSG{7* XP,2IBJS{`Vql6,RSa(NKA'K:QKl10 E %!ȪW[dr4Wh&X=j X+#)zUZRǹILML%X=A #_'zvHKikZ^P5$ȁIml5$>&gQ"ZnKﭾ/In;C*YQٍ ǕE1$hPpG\Oeu)I;h0`Mn<B"%:ekCO:Jճs3SX 957v@xvaL-K.iaib** ?L6hKNōYa_mH=R<#r,k|,vZ^$ʧ G6~(Ke Mp?hvr̪h7-#qx` 9d5 (L f㲰E`4IUv1>n챈{ Į ~bv>g7"n=ֆdXIˏ*:\FiRl֣'V#g[eno>z)2Vړ@{vʓXp!:a,S jm 9RLIt)IdT勍gonluw~05CjgI68]FɎxy@1hXl Iobu_'.<?Tc_cvYrcE«bN+X~B qQcAN1NQse64RDea.:(dwdV$RO'bI$ۭ@pₔI'%`wi%|IYuUYϣ>!b5#Lm|r \ CcREȱh ӟ5:K #.vVIJlAS,m6}^flkGa˔Fl zNPEo /ˬHaPl%Bje2cx c=1$P\y#O"laI*I$zN옱B3Cxstt$:byWQqq2X @ -JOe5 B1mrƖGbL@$؂7f(C"ldMlhj"of Y{;)BmnQ#YR\8@@ jݽG!jt(~;@ Q_n<6tb熧 %&7rj-rJnÉ!PIU+=`Hi:!&[57 %&ɣv'"{J}򙎙?4e@156F#/vC*d *.ӺSfa@D@;r !8 /Gt*NB#{ uN gTÀ-{ILy%L5!1l@>OsZH=Ȣ`4Qdn 8ž1(ҌriܡtOmOau㺴ݡÂ1D-iI,dieYۋO=ՇU:d|~aB 6ouEϊJY6;/YG`siFDIII7CdsHwiv8:!Z`H%-jDMЂ y<:skl6gF!)>^#p͇CQ!I$7m?N`< T@ )w32HO~BNh4.)!F>E&FL@Q UөOI&<`xkv'HNw? RK1#A‰ MwdDW3ur{"1T[f) lͪN$L|М|'W#i:)'=;ż}CA@E&Dž& F*%ۈ43J`ITh#@@ bIGe 5 bdO ʑh:ԃO~SF%yGtf8]CiVas9^acK85 743k{*vFtGpkhBZR-ς ~ !L1h)LC4q:~j0QR (Px :䓻x$ `5!<@[IJI2C^D+R"WLG)$N%;[0Bp$H%(%'7AJEH t#It7@D]'Css"5IDi5\{hRNcdSdYsg\t)%G sL $$I@nRUtenl4j&J5P{@thC PN#cLB$X 1= =tFqЕ >Ԓ$;)97n BW$ +q}x$RRka<(mPvk*OE.4ǒNI $ cYNJthHz"S~$醚'O_3.nTXII =I+$1SmQix%('L% (Ѻ70~j 'LN6!6>4As%!:A:i2@*5A 7!0 $)2u5`8i(n;A@olG%W$JI:O{\aҴ8-l!E@ JJRba:Hd*VY b-v֟oIK)JtТFH#O$/3SiXWM)iK$ISK`h{|BtBJEX}91@S䒗M)RvO 49hV!$s[xO qs(XgU4O-"5Š0d,]^5[Ƈ@3{?h]S@F`…c9H 8HGĢ/:1SiW̾ڈ !GPO XiHUl1!HIL pPu XmeXT"d#ѓSXĦUŵ%6+sk($9JBt $7HN^*.ʴ{INJQ0F弞ۉL4sQ%ԂOB Jev3. tNیӷQt[cPO]%XHUP t*!-piZy 0(U`ウ0UCѢT E`dvMt1(^cWAG [ jN$ AILk2CLGAC8v$":{BwRj@OEƗnQߖn4Ea L|Jzuxd] *e﯑‚Jt6IEC5&N888 xILŊAann kHqeD5+f#SZ T.Gj .qkUSVǍbRR֖BBFN&$w&I 7yI$I5 Sf-.?;L$*95C~Utm0Nq%]䕻WӯutB2̷זLY } q}6*^*`!AK쒙JD@5 eH{'jJQ[3%Ae Qvjf2TmBm)];(|L ӿX{FV aABLDPRE H$/09))DI3$R7<$&>'&cTıH>>_ݱ:" CBNXIR/tBl~!1Ȱ'@׈S4ILEr'n5@j5VLKݱPLܩ SeТHLX-Hcjk8HL (ck;s8%8~ X.rm #(c(WN,!0 U0M/Z@$A:)y-pL}`Nze j^tԫʮ p% $甔$Ң_ JeN_n(?kBB"DbTK2QNPV+ݼ$m2 _W4ՆʷNUY͝/hUo(בZ쇒w%Dݥ"p“hcLu5: ї]k ")III D* -c M')sA{s 7sT-uCszX؄OC?>68Fs2 vh]M5KpMMH%/u˵2UUglAxcZuUa4'CsSyK6鸴aWũX2*Ůg:}'B{3 )sAŹٍs-!$" ;+k -O(f:pA4'IH)etVJyLUD{ TR )0E $tSLY2ҧkEnb **- X #Z ;v;Gp:fRIA߷惰x#f[%O*L<,[V^=⒋SW 䠢Jr[ ˪2gTԊepH8eNvkZ@yD?q.;(hɉ wL'O4u;lkD#O'%.s4O ؄vٞ[sDԁ]Ttʜf2gڙ[5SҭaatWz-QgSPV*hyEqs$$h.,2:86 ~*W- 4o/Sk1ǒVϥǴ@pƸ+V06<d e@{ sG$!G WWDU :m깾ޫѿi4mh=sWMɡh:5ag҅WLG,ЉF;&&liXc t"Su̥ 5O7@e~1|K/'_NA`1:貍Z#EoøƫRF6Y'X89 )|_ɟuI>wCc]+V B I:Z;O޵:V>KYݮ@R.3: 1aQPlit<ޕUDU-6phxEuޙX8uS@t Ga$jzFfqi셁sw69)RS:xE'ŪM(c6U$L 4tRUsv>g⬤'){&O*T9-Վ[=ajA^Z SL:MLHTi gm+;Or(RI$-#Z̘̄"ZT\s)I$v?&oQzjJRI$ wds]S'%)$HR 'x;$$IUY&#UqYq/k^r[~A'@CpP6s+KЬK+kw<3@йѪ'OlR) @쬶`J˪n8;+XٙsECuTg+Smt @h*6 +pF"IQsK8HI;$4r1uIo3Iȑ 9 O$O<(}>:߿WvH8H.tABԈ$'Jr5 $ Rn7 AMcdO%)ö옃PDQ8SDtS#NyQ&8ALK!0=~ 8gGݴwN gRB}$`ds(8ITw{{΃TÇ$eJ#RRp'׆JYRqiAJ] EےFJhjr;( {'HR0y {!cFg<36ϊ)[i3܎ tM%<HBTA]GkxBwlp脸4L 8 F@I0t(_Jb nbv3IJЧnQJ1)#Cgn<)9I2v . wJc>j,8)C\(h0T;^;wH4 x&h/xAL]#&DF=|q !jX/vj%O{wG ;woSoј@Bo }wh)=!_%&Nu쒗\S$'4L]4sʃt~oO2{ }z%3t|H!5`>) $ȷ%A3%L~i)G PtI;Pk1y"cE &uRhkT@>j%4LBZ [fM[tRK'qop=ril;@{=Hz!"Ja[{N@I5ȐZ[3)L\ȆsQp"6{jo ;ـ]'ljN¶[ 8iJNѦ * <4Nݢ-t\Smq shRόI&%e1S9'Dl(oF ~(WT'p)0))8hr P 6PA* {#a%{*տs< DF91qb ΧTN`;%HL(nt3$ -J #p>7?K"9{%(66M"AݻSG"4j #!c1Й]D\bRl;cT3L%J O܈ϒ^].S }.tj5V NcRw*mkIBvvN\ݣJS=սvDn89ݔ{5;ITi>w*CPOIbϣg"; J{ iQG|xx"[xLR #䑮>%)vN5t&ǍT~) jxZ7%%i/}̓F3^vyNK^}E8wvD"'R)p,- w@9P[>0Ή +d:3] `L&4*9%;-$L[k$"|RɄYʜPXrӄ:j#]4 PpRrman5*.0wQk`P =ЉRբd.X&P@$'A-?'^TȔ:|JJfH&b @㲋` :v 346#Jaq1rC̟ޏw UmRWW?2|[ TNI%MI$$IJI$ K?\WLҌKR!f`I[7 kj7ܺH"cX MN?*hHd@ 4Ohwk)cJtq$K KbQc7Bu|RSx{h@([*dp5LnD0꜄Cih#sb@#TP`5RO;'SAsHq))IBA$ţr)JR{Si ڸVY|BLTQ'Qc /Xǒ}e[@I*$ (ڞmUw±eᡈP//Ѡ{$5 8ݼo&Q %T;ZHIJH"A(a#OǷp k).EJQy*{ {%ߺ݇sRRLMA h4*N{v iO +`cyy<&ͯ,;<:ZFCbFt'^m< ('xQC%MH(͎TS'P%ZޡU.d̃dDLP[$"9R%,8RM ::!lViCxIK'L9N\[$4w$&s[JfH$$JU9:̕Ili"jqyAKJ1RQѨТzW@k*6XR͆u !J;DtB_lk>jGV6  )t'E~I\:s `RuJݩthRRI$ԓSi'>A3XݤV0))II"?m8Pk\ȟZdw*N;]CIPN$$vzcEy#`RARtѯ{߲"PNdpo :ILFTo$$Z[4DIwMidc"$Ig\d^`%{jIRI$^qܢx;FD#d{ &ṈO;&A@'CYkm?%ZUv U^) S ;|1vxt-jѻ5hy`%*8oЧ%$:}Cr%,`' CE}T0agC Z4;q971Α"`h4yAh |U@Wjkq<禀>T 𒛤Jvkַʋz&6-C“qʖ В2>H iLJD+ {7P cz[/,j)*?h.@- ψ.0Q>󬄔QŎ s`e QX3iID@G۵Bo$hX8U ՘Nc]IV8A(mQŸBz)T}7B ]n%-{E,tT]FD[ƪ2x~+xAGm2´vRR,nVIɘ ||9&Lsÿ oiYm"kIM,mCsAueF|eMӔe31k5JܗZ6N%-NhvV%E%*m5=Ln UtJo}3dP/ngz=3dhdbWu1rMg}ʌg3ticPZal ܇!DŽ6X>,3Es(lmïXOvKIKcaW%VNUΨY Ui%"®SȀeߑ\;qxmrj;k+h|ޒSij*tls(tc eOć4T&RZ /}8$YuUɯcT`)hqt::!%*J3[`Ia(dU$HnILl5W%Ѹž]>̪arr NJ:a%"99^kqvu OVìʶF? %%:9Yp7kCO0,ϵK`9V`$IJI$HG~Cs%)#0cRFK֠DĒ8Qk|VF0ImqxwlyRq-<W1!5iI%; "ghwo2=xJx%rٴ Q{0e<+%\$𔪌% -ӕl!:lpi~۾E%(;*@ݟ ,hݤD>ƈ'lYL)#3{7lqq'DtشZæ!^G}!NW 4 +WfIMjj$gUs4 ˛,n1nQ®;L蒛rf ׹Z Ȕ ng# xw%)% 鰻JݒOf<e 4n#A)k〦USbMq1{&:&]UU$!^J4ɟ[%JoDȸd%1X\ TaFj&$ @N8U|j 06o?%[%,:OaV=gߢHEk"˧D9š a(0,}t7{hP `{\ wޱU-j%6x0~Ϭa͏Jg]Js `gg]Lmahi'4tFc k$=ڬnʹX6c+ՁQ?b!څ =K|'mM;&y="@p*v|Ƭ6VU-0B޿^ G+c]-!67Փ' o(n?U%$8WdS,p)q[ZK4 GwדoVF着S/4m-#^خcwF}xCHJYWnM¶v?A;GNz +A$"f98pNЍh4Jdˎ1#V0BֿE 5%D}&Sq$1n- qiNwYbHͯ5Qe&qɤ;a{wxH,\ (ƽۏ҉ǟw&8Kͬڱڽ`hmzFU9/ ,AZdc84Y#~jc:& .#p\%hL|f38:<\\2 j!88422q%h8*NW`S "DQt"mOXNDT䌡PVqH峰BJwrQvfSc "<ockykLwKX>(dԤwwS?h t̫Xw:nY5AU2XH"y3Z6@I$I%֞Z.V4#Y:ued_Mqk\3'tr苠ևA9\}!FAh{;wcK'>3h=:J.8w?r @?<ҜI$@v\q{ I5Ζ94 `:}'S85otp!0xF-$?G+&\\@Ju mN hL$]$krvh5ynOs?!~r.h<stIL.;^[tNڜۭH IJI%4> utOIkYѨyG̖cr-Oc@J](V̓ OtBsښׁ jƵ Bz`u? e7(톷ǒ"n,T^ LnXI~6xLRޣpv\%&{X\y:OZ "dѬ-sƺ#F\UfBs(E%cK7m gտR9賫}BKyF;jOj"k ʅOJuz`F,7kSFQu0@P S!R]JHIܬƝ }NN=qe|i$ %32A3 Qm]C; qAԣv7Q0w6HD73:NJbDExA&iEO:'g)w8QGi:G"SanӺ~(a?D{EJT\ ǂ\AC.c;Wq>&'T4(^P$̎$IRp&> )5(:.Sw s:IJ'vPS8P5%HfLaJ P)MII]S0R{<$)q8LvN]h蝬:IQ)۹Ђ;& HDdy{\$ϳaiJ5L$Z7VP 5ONHK!6)H e=-p3BkKt:xS  r%H  -V$"B>)cZun I-B5.ǂa[!OtC$8Ly)i<0q$~@Bh07y?x ?JNbfg35SzP#D1D'cɉ:'5nL]lQZo$wwF/;%JDjK`{ {x];I6AjT0Q*Вn@ttjoa95sb1Q_ʦtNnӲ`™:0<Զo d颈n"e 0N#ܦFs))!y8)B#`:!hiӏ6oO'hH䔙9A Q/1`! nPҝBJmG*.>j-2>*?hvg@* 0RSpA›]GDŽJi<*`Jgrm#4s'H%< 1Ky")3`Jg{$(|d0$I-`&۴JNhd`6u$K?IK_]ܧ|؝w4i#M<_׹E%'6LAǎtXH;[{搮LD~spx $nNBM>2,QZtB5q)͓ 'd[:vB 'S mXԢ7B*l@ג^ ;lOewII`&IA/#_%#hgE 6ȁNi"a%2pl}{l2~rRퟘP8%'9HlaɷkӲMG!Gt;$LLDhRS0TbH&Ou DO)!0l0c%/4i;*;wߪigFONZOJeXVvQXQ |Tqjy>Z`trJJ6;״l=-\ F.#]5SvD|RS&Ti6 Q>DLIו&80-=~ BH!@DkXZ$#+]^n?Wg9l!OGI+LvO__g[OP+xټғvᾪ5SI$6$I$RI$ϰxW<5&dbܼ>OpS??>Wr9wx,x#MΔ k9!Jf+#c6!Y-f`0u#^v!+QR3QW bumlCqUWR蹄z($FI)햁DU' 5Q'QNB ]~Sp+K*U&dBr*308( Qg7CS2qԉ8Cw2qLIJHj:8N \>i}.B[>~)sb)NwR&K@D9t&vD;FtK{И ۮ ݒ;pgXS2||I\J;&p=!㧂m:I쥻ErHI Qo܅/wliEM\;O%%(AGܘz*fU6׏q(]ġVv{$L&6 #~ ,!H[=@> !tLSpFOeЕg`*m7tA*Ls֒ttvݹ!(LI@1;al{\EKN_<̯Bci`(<3NI'S,1>catC@hm@:\2`:vCl#8Nqo==%0XNP("'Dg f ݐi#iII;Pi=Wf0G I'YI~vd$js LjJpi-}`Fɴ$bRxL :MH-{uEHh<$Ԛ L~ 3-Ot4p8 %IB{ez`S׺$$IdY|QO=w E $=hp:{&1Fh%X $NȤTPI`Т&NUh9|k.Mc'qIJI$u{;2Dc'd;"R==IJL1)4FSedAp"wb1Rv\w!psDϷ 0 F$JIϬ4 >AGZ_wފI"jws]MQ#S`~S&%(ڔ @6=sێ|mV2 >[VM=Ǵ -#Qek6mZ$ΘൠLY½Mi+9=4~j#^|슛ƶUk+[1 ]vm ȮG~vY/i~ҬX9&P)-VTS׷>{ElJ sA#F%jӰ%WeNy$~~*Ֆ\xL9DJM(Nu7i )w<0KZv9s y!]Ci4sͧyCRrI)zk7hDLW4C@2˞ 0R;1W |PlfV" QoS:Y4a JG2BL=@RpMFӴr1 ñxH y*l;&A=ժ̺:} ;DےDJ!%3L%4KLy5UIJwA\D# Y07:"G܆P~m|U7t ?z57gkUn[EH#݀3y Om@IMdVӵ*MٰO3FYIC}n)IMGtKô:W͠ LV݃P*>kkhc %1sͬtH-$דs˘ 4B bIa 9IMlFj, 8s$ WM߸|jF5{IwCKi<C`iq6>`\%%%L\$ \ƺIUzaȳ{\MԶ N[\[e,E!$Y8Oޓè3V3\5tjz8Ψ+xƂ,t$,,.-2Cȯ/J| m^j+;/" V'W)"I]H`Sa$1sIO"a5o=x91>j{;>Jcn^K^4Lqa.h.h )īuaWcAJ $}F^Z Mc68jQZ S1J^8$)2slcѻQNɄW>LN~))gcD,Alc pvf00*@c+o.o Vĭ.k)g n5~+A$J)7;hIJL#=F:HIJAn37Q0*EeI: @(vPX|QvmǺ}8ʊJMN]Yk*mQjjƀxDFov!5nt(2Ve f``y ||]!ʛh!RӹݕT1&e%7UFX$6!YIW lh !M$_'>gdG7= :=N,p&!Gn$oa*))'躓&~ (?zM,X )YD;u&=WtGYB@IMCu< ̀Q 2WWĕLSB*H;i2)JP'T6p)mߢ)JGS:dy(dFccL'f=98Nˆ|B^w;R%2uUg8<(?z]m Jh($!]I\!E`b?#1))pb0܆olǚkĘTQ i!JVcfaE%:I(So%M%b'Z@ TP{蚁$*Y]Q@졓ս M{f<ꮬ2 }wM`v3ZT}{?xN2JeKX*crZ!ug%:(c #Y%8ӎ/n]DzJifk=X9ʒ[+Nc]f7T0G};i"VڝP餫]eAh{#aP\wOUvl:e2%)UyO`5JlH<`[uAO!ϤJEnU-'lHw4sk2PY9>=>+eVʮ˚YY&S+Y9h9cvNaaKXy5H&Vqqp%ĈQ5}TM`K)uKf[;TC`gDpyaۈ'$Rf k5j-(RLR)КIJAagN1p$ jIH!Q%Wv;hGuuYRYu@ Y y%tBGdiSՋ]'sӷ6,!Ba eJBJg &򘧘H"!%.&דctEšWc\*~$i⃟V5Um59|CLNr(j!BcLkpA$ӕL٬(UA[`+uUmx'a5dI%2I$LS2HʱNOnM2D!lw0a^ŵ9% ]CU87SNN—NE JHv 0UPiʜJ S;ל[)^u\'@>րwi:NՑ/;Fʟ^\ImoIA{Z@몞g K$.Y\4 =Am(Y^zok@DZ)7;h@ Gt  WQq$DWv2g]?HBcӞ8!hpAQǵPIJ8 Jz- ƧTȭBlYaT-sU"aV<ֿs LT2OGb԰Ыjq 8<'NU_.u-tC~ʉ$ P_nqiap$y*VqJӗO'U<0INg*ˑZh;'I: ZjP̷@Z0Dx"$zR&Fݍk!!.v7Jb\_`` nEn;C>7gܗM}M y8 OoMBKj"d#}! VXƶἁ˹Vd<$'I$I$IeXVix %HI$02`:=PRI%Ӳي,uE6-q<\F.׌0{7([XI'H8cU<{Hh!8%)$Qn$y-͔Iec}"vPP6@r6TiD+[>]< {6Z.T)Y&$tF:hII U4QGcsvD',RI&RYcC . 2[d: x-hwQ>"N0r{H3Q: :5C˶^FfX2Y4V4)z + MnѪq⍕_pO1ʤA-䷝gN{p~ RIԱea)NDoP6*AoZ]&Kw~*C\ukCO@`AЂ`*b@ו3T@pTNt<脔ʑ DjHnvL)G$TIEJs䘐54Ѻi @Q~7'l4ILl&JvĝnTI} uHW#*UP$0TZBbOi☼IQG(d[u^F6<R^SO(BO@@Kp<FT]CDPAI _Ts 7|eXu ,h$ƀदQU6f0Tې^'aw $@Ie$3YB$IdB.  H{wnn!65M~ $tN|d›7% M%%0h LK4 GQ-d!$8A:A ̵@ k#`fDat>ixz <4οrc2wh @&8Hu%fS))B;Am;;"ZTKqii;DYHO[ vC3w[#^"x 6̏4[?3\dIK>]ct&ti)Ƹ@E,](̱ge1h BV/jT8k *kGuCWh{4S=iViqFʛfVHk>* )Ucԝs3;86u .l ⥱ۇ$@k*-.~w0sc^Rh+% p+&B: ۵dll|P%,Ħ)?qNѯ>(xdp*m!J 4@:19 !ӴRBDt{!IIMgV$8'Rc69>H<ћ3& "2 qIG'hl|5HXQAr_ɄE~II}&BB_Pf;"7>RKpRKNT"SE~3ZA@#HpBޞ[: rSCJF2߅p?q@ +NM)ˤS^IHÛ`@L!& =̞lԀZ0 vAy$vLB=5ӸVk cwPˉ'* DY쒛"$TI4S~!3B 4B:0Fc_h-Ѡ$l|/eKO*MĘM!g08teHv BHILY]mA {ّ ܟcI vAӲY#Bw>yeܒl[m>LʶIF /ʞ1)qۛBL!%# x'0{HQ]DL<9ȂY$hyp#h?FF9cIwe7[`25u!:0JDzK`&4 8RhuFԢ΁>NBΩH쒑5LjJЄBu1.h00TwwN&#T3LlkZH-ljM靠M'vBr!DJF@E0~IǷRf2Q=9:'k [} ))dop ;B&R$XLPs\9Sh bX&H:6XA&ӺrZ)u _IL%DϢ]_fpԞ 'v U#W'Jg/-?8SBTzubF+g[OP+xټғvᾪ5SI$6$I$JRI$n}IZkѠU1W0ƞBv4a !t' 0H,4vQ{e6LIQ?Eг.-#Qa$औq=E@h$\!At#8ZHII@H&Ʂ@j0D3%%).KRI{tfG\$R Bg7n@#q'<ZR$PDO)ƽI&Qm{K`Dk䔞$4LRL[✵ ITBLdA"QCw;XIKD)|[È'8IKB$ qWx*B0OHdu]%Fg8c(]$)m8vQei;*b8*xbj:, 1T<[]k7m>T/}9Kg$~a5J'+0 ;dwNl 2I~3AiSi,-cT 'N7Hpn%`Ѿ)m LI.h*j|A-76[ f7nYA-#vw)04k2Sg zN'Tl{puZ,LwC&?xBi> ݝL嚘 8:B~QcCEIEJILXƆA(NE$BIJY)I1L"2״@$L(o;A*IԞ.2$Jb5!:tIBS&'R)Me&Q@'I$I%)$I;^ IJQ}mTRl 8 &P%oTh m;ls>e2I)g>vϤ9bߢ~ Jpz"[wOȭh+EC/6ʝf622\x4]Ƨj> ,~k%ߜLyĩ]s`L6";ۨ@Pnk|JUH}B8p2> f1ĘBff[^b#UftJa ryq:ʷD\uY؎ģq:"w $bƳhyo$XFmw Sc:64h;sj-øgJOw;ZntF>0ݬA`lhА *kt2V̤kllsmӭm9 D~kӐXL5cRxBɼSK5P>wFEĻmΝ:NA'Uzj{?Zq$Hi)F7A UӨk 2>K0e t\0Tsݭ0Zenfq'c&oV~>A[i'cG4xީ~EWH`hRI#II$H)I$2m*"x+copb;OE Eo%6׿[ߠ$sc[I$hQDh6@R,82I " ^`)9%)$Qkô)܎K]W q-FBxH֔6tc6 .mEn2lp~0YT%FUKhZKԬqA x"IEsBs4c*RIH2+I4I$U+"$J)J@#Kh5yAJI$wɁF8׀I!G 9 (RI$-nCk$3+nWM]54#MTs$l͆ ݩ a{zF37A'7}P~3K.H6$,4!iRT8R`p>KcOӁ`Q.gCiTTɓV1k!:/PcdБ$7SLclj<P3HY:Iih[װ4 ,CpЄ( t%IoEkF+G(.dG%<<=` ۨ"Jj؅3!ڤP.3' Di';O {G))DvR l|Ht?%&MJh2Pͭ\T0TKH;Jd)N)*M`4s%Mq1)g>xԤ|%8&SThHwQpAooKQ> rS4ו'IhӼw4$v$>icD#%H$)jhcA(#&I !tHF D=^c# wINJWKF8AJ Fiv&8Q"yIIAЦ;HѮ<(Fx|떞4DJkãII0luC܍rm:P%_X!IF⒒H!m))U`OuQD#dY*$s*unlI,*vûWP5o&@% L L()su fĻ{"HC8>Igr$TdGe3✑€ AHXAD>E'Z|ARS ;`“ls扼4{~j"n=Ո1u`;C>'ZS57QbIF!i@4'\ٓXl%=73U2$|~Y3))艀YmH?sPOvyE8~p*& CAMClIUۚI|QTZcQM͐HD6u RGC)Ta=;J!BZyD{`Cg~(fI7lR艉 s<ĜGIRihvPs6;h;$.$uqrĸ:3xI0T@=Q"JJ]ܝ!EZ5RqDmnYB\\;IMWP}G3lZt!C50#iÄ/L & MX$xz hQs5)l^' T"ɈRdh<vԉ<0ΔC䵿J  SN%eDF~PN)HxO;0|"'cc@5H4l6P];l|߷슒43dΩ~*lc {wޥ7 xР~ŵ[(ȳW)Y@6y(=T]1< Ü*R7HRhD@$5 Z] FL{tByx;%1:&svG( #lcH<IQݸSEH0Gav襳hRc?_+]_Tlc>?tQ[?_[#J?d[I8VlgI?%eg[OP+xټғvᾪ5SI$6$I$JRI$c,uHWoҳ'|u87P[|w]JnD[D> ܏G4j?J;?(U/|%X .kmoiﴽż!P{DF.uM'lVH1DVۅ[9>i:GpuE*JUF|BDvPIDʇA e?r-@2~)d|S#iEoyﮨo:4dmTXOn+{Xn!?tg^F0y> h(=4S6BkN@S[ @A잶9%1dUW#H+BX@0&aiVnݵ02$rcCp"rZLx&I eNh35;Huj$PR'fǕ!k g2i Qxw(mJa=ӂ'MSN$[I IKl|HKwrSx)jpk yIe1PR aӲRHIr dH$TЙ Re J$"%8#_%v滲wV t)'(H?PgA7raDtQ98 8O!t'Ek@cO+XKNY$X =( h<'}d4>).IHiL d&C09k⒔E%3POHI$pƹ݂JRIRhBdjG&)m H%):dex!!H#rV8rIJI2t Zd2YUTܹʓH{I>(tUql\V{S@ iQܴ=PPI:e25@0 ;^4Ck :'LNr>ϤL1$]$}Opbvܢ:  [ <R)8fi\<S(>)d铦-L0LVLOKO$)[V$K\A>:H|AY uR+CCq ?pG9.,G%:T5RqI,C@N|IYusYʝVmva:D4%, V,ȩ@I e"ps Xdn$pL$@p-O}5h ;CyE JId6w5m-h;Op6D=j)C)hE[ʚ6Dv49U &s["R5N|VZt@-{d _#[ TďJShUH,x<VLcXJ(,P4SʰJJo`R5$Z0Ez>jp})~?doG/Dx h Rb⯄/ ~IVI/@+h$C)<IV$Aiz Z!:gN:JLUAz ZI,6xURV~Ծՠg~KJL}i}+E%A?mT57ٛhTh' *৔ĥfu:Eߺxh+g)}-~OEߺ>md7Ħ(*J~O⒭Q|/?Kԕmt_5u%OԿhJJHeK\IS< J@?ُ_f>*Jx+))Hf>)}J 4$o9/9YIV}^)WJB/ܗܬ$m$I7t>W_lR4=%?$UW$OE z/FIU~Ox$i).Kw*Hh^>%?I QPKg%/M-*i(z $))lwKaRIGx $OJNm) )dJ tJRI<$$ҔNt$I$RNdR$&NI$d)I$I&JRRJS"RR$Ĩ$N&RM!) )DI(Ni I<$w'kLR'|s\3D7̡fM|4A9 .;PI ]঒ɯcP)wE/pwDmVdQ]!xS( A"<'$Lpk.T*e*c/> kmˀȷ*iis+5 τ^08HI[*Ų4'ؔÕpմeA$#T!1 ʛj{ I c|%o !/TdNGvJHuLK2C"A*=Hv:#Ygw:*ٵ=U- KmcqJ<>ZZJVGQƽ;`%K>!FY%: &=GcMͽ2 IцnD7)*8qavN Df6m 򉉐3c<ԒhLfBRºMik+-LUS U֑&SCو8A~G #^ԪY?;}7FON$]NC( 'W Lz`'WwǨ4tU[wZ.#E Kny ɄfKl=()eYcs){(psOdbX(>vҶ8qUz\z$8$ q;@$)5Uf_[b\,&\} sF?ŮHZC]X![$xhמqZoSIiq8M.RW[Ⱦz!?;"JFjbHgzo&_α@(9Or( P1ۚ,a`Q۝cA2I "[1HQY;&SUy]$UܡqvǹC@bKe$ᬈUEsmQw_'s!$jhP;H@[N>T;v0u$*^LJrlbuVӚ>%Pi 15Xٓƪ'hP6RʠRiЉ[2o .LRwOǺsǸ4Χ CLn ,d?߲DG7oS@isDGe:)P[A z GɼVAs+ \1:eϼ qڪKZ4rV -$j݉Sݽ?TI$Ibu[V!Z˾r7VVz']T\ 5uꚿpL-B" .}u'`ii(EƳi%Pim?ls$ 3FmG7vnF͎Qps B+FIpSVg:JXZ>*ih$+e.vH\ZT. uԪLϹ lfCM eTNLݨvp$xۅ;Gx:IN,wnaT,hx"FhvHf\ql#FLD}L:,zӯ ^kshH'c!<뗧UAڑBl1۲|]$[U0 vi( 0*,mOjf6HRIJbL̩, i#Ys$]$Ҕcs´PCP2݀+mG)tg6TJ{> ->tIfôYy#{ 5KW$'d%8Ƀ(!LYiPd=ҍ'A6C `ΧdΘ"Mu?HxjDvCg>L5fńBJDwHL64(("D\'EvH4;THTwK1ڶU"RQAu)fLDH3'OCq's`GMJ]৴VS4Ωi)ғy"BHUA {a#BhRA5p|q%G UXʌH;4@eOݪ3Z#[D v)+diN%7Y'J`x Fp,Wx z#]~ϛ pߊBFh ?06(w<$puC> .wR$;Tv6$hCGsiY: Q 3 IÌ )B> FƁ!?*ST NsDEֺ|Qv !%$'M8AŭQ=\qŞڤACI'F ):O&A TxRIN[lr4wMophXuAڃ v*"gD_3杤;O詫u!Q5`בζAI_rQTIHC!> 1&KcU"۩;C*[N%0]I28 &9j[@x!KLWaS.p')Ʌ(Tʛ|ԩ[IIK`& 6䑁撕 B_r4H9awd42Ɖ(G}Hςqo)!IJxJ|E;JʋN(X"a0r|xFNIK!ÖƖ .p2i~Dૹ͈SzSHxS,ch;IBIw!qd<86a0*H2xIK &.=4&ħk@ L[YX`J%eFV7}l#Vq;p ;BRO4 ;]'O!i2IJHtɯƂ5;a5w'U#1%%($QZ 'T B5Ԅ72I2J-i wt;Lr;$2j%Nq%.dMy<(<67}<[;)JRIL "Q L'k[K!ǺJRhNADSxvB%Mǂ jI]$ärv#NKX1䘲C%.d~wR.A< clO%)$)TT yQmq|ScJQ)$T偀9n>f<I^e:aPc`k OB#tNN$Fd5 V.;^+i<PQCЈsݹD*$8 MsO<$ r%0I%*PI>JI$BI$%$RI$IRZ;cBvGUæ¨;F $6-{TPU)X=D{L4$v쥎uk%F~m3^P-8{yBп]U+ I'լmyk Jξ7|@Wuκ^d꬀ M452SvbiQӹ-"$ǂE2JXrl>0'V2P-tD, l{N撚C ׸9N*` k[IԽs\euS?RVnEovָY>/`l=i+hc\uҝ%"S)$$)I$>.O3$;6{O ./~ڠJ}'EeW"qJgtj "e}U6uyDNeV7z|$tOI$RI$'I%)$Vٜ68b&Uqdk G}I[}F3]jxLV'\u;O.n#E.~Z Z;>VG{7c%Gtﰰ>',tkc~#{zo~U>J;( /;FK[Attc斿>!w"J_RW^u\j!b?ƶ<'%O;:[EoJh5$\lgVU j5US`w9TYnM^a'BIBI;[}[ ]uI0NK<ʵ="% ->1- #]%:zD,kJ&4˧cDq |W|7Y^-A@64$-z1xhZy5G!у̬4NjɮEn#2hy,׸kKzՖ[M ~VYSKZؿ6|gd&غ yF*(tKѿ5A(Z)׀Pz8K\5b[S=4gob c`En] "7Oj,)JKOsѨRZ UYcQ[l9N5ŭ.pi[kf|I$RI$I)$X:##V}U,7(>)ƭ>" !D t #e;9D4'v3}bX4)og#4]Hnԋ0SNftm*X}'-7Vx~G,uJ&ƪZp:EZëջl:~$oX= 5Qn䈈 e3-z% 'R. !T]4[=^L6;Փ QkΩj/;#DI'7iUAQidrZ:JN?_ܶe[PuX[sutma6B|&AQml"Exx}ok#PyHd}hQ v&b4k5pQx";,11ݒePL)-Ξ(n4Rʺ|Bϫ>#ONqhinփ$g YȈκ&h$j)ͪI{640==К[_ILF̡1`*I&mZnykt oKs*>$$J,Qv5IQ%_%)1N=m6^ʷT.{֍+-Y$&eFî2- _DJKC[4u0RC xD!UMW+uOE_ghg;Kr ‘;BߚUk\ h8+ Ʌ2=?{ B 4p)9%U63 v:P-%Ļs) ڃJQtQpL_stZsP%%I HI%jJuaDiQ"xL %KI"6 )ZΚʑ0uLf @(nTtrh%GD|S堓(l<' 6A> di .&OmIJus:@fKx$Lִg֓Jv*@&u*דgD߲焤rb KN%. s )H4qyi#@ JQTu) 5VN#kK=tvC$!0o cxkFMi{NȑE st׈:(= n%Α*-xDOvhN%.#AʉS&5qʓLbi5%f.:y'-ꓙ_Hݧu6Bd!K0&0{"~ Ta&$):&hPSZ{Ud4'@` 08I*.t$t;BjC%M♬BD{L*=H S| S.DZ 5-a X<@P & 5jUvȞ gkCD*Շmk=C'Lv)TcP$;)=y*$K?wr~I42nJ[$)1:藨ݺBs[cI#_nOyn%)u)Žƥ5lkH3i5*;0 5BJcY't?`$xDe="`r2@nݳNdx(Vݵ'.~ px[iXcٷ=Cs wIMK`q#p]hDtVX !d5rNx)>ʋRAiD6N5S^) !@V='MRnA M2}W4>(lu'x&b'k [:Nݏ /$'1k?))3')D\א\>b8p;PZ 1 ncG_N"e}S8} }xkLieoF5Tk ,k qyojc oI]^Y`-lmw_Qcc]Yiʚ[` :Ɠ T5^_EeATzњ?W"g3+W9pҏ?lqawy+kg[=OP+xټғvᾪ5RI$6$I$JRI$ѝcFUQY3h?OJ'%!duN(""m @P;ntRg8V?*:ig<~Egi -ޝ!]\p|{!ѹK [㸭ZV䒰#:uԧ4oqAЉL=$ IN(6?9ke4)6I )fșHO Gf Z5VT*Y[;HZSKiIAAmUwƪiN [ <*{< y+Ż+s@*:"UsaGf$)TcXt{AžKHhB0 D 8ÄNV7kV=HV? w+&0ˢ$H \PT\]*UQ Zw4]Ay0)J<>!Kn#k,Dv8|{in=]Km)ljQRwrx'/[~| [GISy\t DjJR{mrS4C̕9FlwhY[Hh(.Q> p).Y$I۩APbRmT@nm[MR1NquF^߃bƍH,>H/i(V>C]['S#C3IY8=o`2aͼ:kn?ڤ7~P١)<!:5'$5Z9!Q"VZЪt{F'wIxucuָV#i =ɢt' vTg.mSg'WK6<O~U rRn!oW%#pT w}w*L%*Ģ+O)\2ΩَKO}V4(@g[L\`E s%!V(>쏾Ϲ1}Veƌd& 0)(ՖZv\ >%FT^DzՉUp(3 Cg{`=,=%߂rb?nFv6LA5ǖ0OG XЍpƶ]S|`a~%u .<wE0l: Z8v3^OGh.6>&``)c?g`8 vC~Jʸc]N$l7#MS5V?I%K6Q>LJʸ#V[R4-O X}NJȦ_m{3||V}<%VkFi}nC5.ly&9c4J-T :4) OMQ[U{;̊)Y ҸdB}‰p:;DŅG =isL }.irv)~> TX}za+(0B\r:}Vntwu*`TJ1Cْ (swNĒQ( ?T("e"ȸ 9捦 zR1=|> + VFEvV,mjKbcDlgݻgHAkKR* 1Avgt_8 3UVqA&`CȨTѨINJni h$|)P-mS-q첑1[hBƾC?t^ny=KQYk\\Jl붞RFJfK%kcq?$ 9y[X yֲkh<cݙc_TC[򯵥k]D6DMBey.>%%& tOKA1}KuVk n^ihetVUGYsƋ&.sslq)@cU&:l kdxUUn4;pmM+YT׊e`IH%F^=[.()K=%n»7惃r;U+ 75ePvK >Xꎮyi U\FVUrOK8FuP5%[bv YJdrtJu37 Vt@ԤI$LI`)$E t*&<YNJ^)zL|Ԅ䌞@))I$Mjtp!OZGlTL̔ɋR:9nKҹ{N-y~UJ]g!c2~RpѽneLѯ>i*I$Ѣc89A=$I;wty揢lfr~ )I$_Qu%L)N`hk%5i*̡A\GkgyN$`%ď[t _5\yiF%g;hU^'Gv0j'\0<%=AwE GB:;ʑa"9Pߣǂ=aiyr)sdKN@6΃FAѡ3 -Rԟ4T&-OtRpT4Rpܧ>撗i棶d;"t':p3^dx<1jT#pIH$Oe'CTMB;LDyH A=4JaX#Cd]@ʄLNFC `(Nt;iA\ }uP12BLvѪcYIMr=4LL@IqI!Io4䔰o?'.uc x~I)q(Ν@7XchmE=ݢ+eeIӄBؒw!xF6 庁Mv $`jd;nH9IQkh'UF:O))5P4NΓPŭV H7#Bxn)kΠ+ A*eۋJap* L]A?"LIiCD6D읬 |Jf@AL8}TُfLe#0^ dI) >H w%0.dJ5TIfd&4KU;Ztt4j DP\$^xoҔBkdF1 |:eP'4Ky)d|ԍ֗ "C/L01w1KZ`jǝQZI //|Чctwފ[Ѣ?&0 ڀ7ˤvD<X MB Yrv[+L|MA cAPlZ *$$֯V#F4C˵Tې¾池>L)sgf6[$ M1ԙN~ i'ih[LH))}'ո0>!;NR&tr`L6ݧRRh #V꜀AkN |AnⓟwQi<$"FhvI^%TL pfCIH`'B|[))B]Rs wpDIP$wQktIciԦ}'th2 {FIQFq ܂$\u'DwT{'${$SF$XH6`Ħ'pNԃ2xH; A[pSVȁR5R55+\J`2SϘ:T\]Tp"xBf"t @8;D<BXNF=@9IJ%HU:%DHO'P|+ (fl +QCR4ƺ| iR .S?iq|`N>la*=YqR5v~+Vҏ?'+J8tig[OP+xټғojtTI%II$I$I$c&ʂbSe$KbI1^%EZqcw:wYK?nwS,a4Og/r)$mCҳ閍O&l;DBΒ$| p>*<"\p*'#V4FNl *ݷZo%O*@j&B!s;t!B豳Z=w8Yسa"#_c=]ճN'@tI@L:àBq$DÁ3 ɝNd$L~eJ|Q{gB6L7@VA'D) NUT UW3a$*pAӹR NtM{ ]] rrTZv"@A'4 p~iciFAha( @LIDh~i*Iێȩ`%<'Nk@A#A&H mWNJbRਗI$KYByip 5>*e'T{$I%_h*5>z5W0KRQg*%oa7XpTܧK][Xe.vS 9IJ$v!-";JABku9Ss"51))A"H"`e%0iki1ދ# &\*;CWx{wk|/4pͧBUs\hA$pV4Np)EdfV⻷<61ؤ$cbLL)d;cG:4#MQlkQ4GN 1'@3X$D5RO Zj)4Q ˽LGw@jm4揀I O\)5߸OS "L7oH.M2BG|ԃ`ϒpԢIWmΘ{>JU2iV]|VHwy% lV0\~ :C]$x3u}/h)tG`⇼rq3LGp3E&?~ m>sm}( [ϽHXO~?XO|M›O(mkLYI%P[A| `#PS]ZT Gtv 戁)WP:j;L˼a& ZTI.NGHΐTp@O#"tDJO*T$ci|ÿ9rINSZ?OHx%>i|kuo*UKZ~%i)&=ʂTlt XvGG׵HQ.XFOCDr< ~C`xOKa*c A>ik@>m*AguN~5RJRvKU#◦ac|hAQ5dA*&ϜY68 R-4M2DTUZ$[%@AqW#vHa`|ʌ䙔hxS:lR4w8Uv .R;&ܣw;ָ}C,Gܹ$l&1ܩmJ~ڸ>У~pU>e%ju)S))0H(Qha& R4S$ej5"&PqȃIJUu40D'8I,W-@pc۰$^O$I<䎡N< vDj%OgUSPIMԐ7Vם I$IhۢglLfZw2ז!%lh{}=a?Rͷ}Wyܐ Ws[^l5PI]T^&a%9}-ӤT+mBn"!d6JuTC⢥WNSCb@F=Epegۯeo)6\#!@͵B|  {1N,Va}Ĭw[tcY;LG<.js^BCvij)׹2Aku9U,CYV0(C ^ AٻUzؖ gmHk~ZKJNg#E ,*Rqo cheT$ =SՍI"9J$dKze%gtίnU§xZ?q#V5s6NP}Gq'WWNnnčv{N||Iq1yG9C'`CwojM&moB5t |!5V2R uoDZq92  Źy;|V[)1dr.!8LV]i;:Y]zF:@,t#t~{,sF |Egs5[8,YeՁiR{CyײEjؒP2kz(6t$cl@UsskoC0>&Gjm@pZ/Ȫ!| YeWV0>́c"-E#k6ɅWYXᦊ Ӫ!S]4nW:zl>D|{A*=َHt@i[g:`+ʖ/KQƪI`BϠH%INKmgE,YOSi⥔Ik"({B 0e=зS7RmǗ?re|a<1d3$F(pitCǶ;r6YV25h& -)sw-KhBrk2 VNq0U1ˏ}Sb wd!: yGTJD ,El;o$YfhѺJp ($/W;^`)[_cfm嫤I/Jel|Q{ #T-4Tbc¶Zc~[R"">n3l%"6e!@cD0@$RNgX:upMH>4`8j5Y##âvrg0)UšԝmB$ ?A/!N;>*MJF2-k*DuTOOr!`>au Q`c+_:Yh8$CG&$Kw\{'5 gJRI$)wӺJTCkOܥ4rJRI&W:`|J) z3&3Ϲ3<,*<0Z=xɶS ȔH0I (Ϋs6($ OeuVQKk]7}z%0l@Q[0k*`C" T|ʰT6yH65D )AźBf- MXJt#[H%}tR9SvKN]ʃDB쓀n&i3&'0DM.:ID%vJ0Yv'MR8 ꞱT91x^!8'8nˢ PRDQ)63čT cT[R=36I"xN^%1cb^u x<ۋ$$;X%ܔ )6y H{L79Ԥ炥`h/LJHv =Ή;oA opy2[p5IK>3hR;]T ?=E!CQ:xh!EC,5kF2ө%HIL?IEKs'H"|ԃʓHdെND5D$&Nx k 2Ys$r%2gHNX׾H:' 8n.f 1hnݰ7@,?m3IMs}A[uw&x v=y#4=x"8UIN:'ϊaxs*-$l8FuUaiw ;>H)iw20PÁpTǏC-;[Nc 8ѡDuc@ܤ~"\cc{ۿDN; .$B63wEI4)4rkcʛlPv5 wA JIkg47mtv7)<Tyhh3[Ͷ憽䫆&tL##]))蘘/6Rx+#Rs0ȑPDh1Dj5 IJfn ł|{·B{@> .A^~q0֐L{S&}Ģ8i1B ;{9BPq4P )#OB *SyE0B`+`x&:IHΚB^ G nq=dZB%Q:yuEǘEJ-vQKC$(84xu+ 3 C9ᄤ4UtvT%ɥEºkU8DwPFɓ )=~F yyRw64 Y'7ԡp U`9a%)%" ;Q1+bSn#hqn"=Ţ[ڗ" ʟZ<~I1SXD4(1:~ u Lv'5jiSQ 2L6;'9Dƻ Sf)}7v ʧA 3DKŭ!oZSG7xY٦ꜪfnCN?K%e%QTyumB{Iak6@>N CC#2Q ̕S*tjS2{(WBw#U~HfX> V $U28)wH'+aö'@gwN4&CK>ϒ 4=]Չ8먕Ơď~::s< &)OD?wbOd0,i﯀R;c1Iu%,"Z"d䙧D6u<^A3™JRd+ toDDH?Qc@xFe"I6e$Ag~=gBmt {A9M&st@0@2e!{I*`e*/ [_$< !%/ %)(85&oLL˔IJ^|hH 27Gr*m IJINL(Vz=ѝ#&}aۡ8T82 .l:J% s$rR.TCJA'{=69w~oit)`']3 Li)]B~밇#Ҧ纷V|VXnRU dyA!b%WyDn‹mk϶PAi#^nhILA$LAOƪZIY]=O{}!?yVJJcf5S)V0i`-࢒ j"4>)w}QK`rar5S, Էg杠Z70*.4GJ4wi p?u3}1GS |w,t5 ,xmǔ @91#N<&#ZzC5߂F9a-x\x-T\n֡9QBR[RV j )Jf4ǸNBk buI"Gd҅]84wAg{~;$7!TO dk&DŽ8-00;负ScGޜhQe/>'J'ĥy8 ̎LNV2| N@V䔭dq0S-ZM2ƾLnG䔌#81zpLm$60~ױX!*M/'SvSmdzM;$)n'D4Dytd%MK@# M^s&$r)n|^ ͠cI>A) zr{KhSD4y~ao1?$WRcˆY>g@A_ڜyBQ5U2'ty(iwRuEuφEѵ\S {H8~h'Fi{?pa uA]hž#%JPG)!JDQ=AhNAUögKmp642S~*%P_5KN9 T9UFա&~):5ȥ뽣Sa#3hR8 }23E٣(Y]#oV%,Ho)>&P2@5V}kۧDѸU^e}jZx)0<kgS|C!X;cŖ\߹7k 7+ _搎> NLrG矐RkY)Ȱj5jO{$gM#RK@4F>CWidraZ I_w8 `9$Y}og܂mՇl tHmFXv3Q"%1vEÖ2e9ΟPeA]U˪c0{tV-!ocR;QS6 sA YJZRaRGqq9(hIJhgR]W7lǚNgP8INЯ~)Kъ,P˵sxAqII%-AcQgTNj̓ #cz2*xj#*ø<'m Ψ qa w>մntQvIvq m#FzՍxXf5l aRk guL1Y:sn}\{\1C\eݴP&u<9 6>31m|(SiPI%) Z I+8{lyּm;*xi)ԽJjH.纣 W^|Щ .Fx +d+vAO"a.lt!c%NfRI%045%L$JNIREm2'ZQ]̽Ր5Iit%n]NCo{kcpV/Z?mm- zc]U7?";}`Xr).$}Pz-oݩ̕a&T~DU;/qtq*WX45T-Ƹ e[{'yN=W 4Y8A p* OU:tX(`^V2hpu'J5*>8䚛茒I$pI$q8Ȧ۾HrvQ'"?H;e"?Wp4[ $p৷XxRaxJ:!%)$K'R{ÏIK$%@hn@uf[ BDJ `Z rII}ļ򫵆qB12q(-$]SǦI3)/ׁƺIZ=+{LKmЉ<+c{ςdIgǒ1X ;Q5EsC)2Q]_3D, "I:D SnE2#MR#cc%-tQj{z-u%g:Fʟ(hH+ۧ~MQpP$*FAr)KBQho I Ei.v7ߴ[ETȒ˒tGꩵۂ ZT!ӢA?H}@nֽ@ C-TM+6H>H|~*UOkNjݢ\naj_gj.Q#$ĪU 63cZ?@ܑ0XM-T8' tFB{ZC< v)4$/ZAE 3 254*2vd5>%@ΡJ[\~j>H"t$)볼"^ 'A ҥ.oP{}Q7iJbCO*mpc@SXwv8:ƐƍI{$AI$n)Tq:4n'DhY*KpM{=' $|<IS0[<7CLiHv[TW[, $y@|}a=X#C3+%O*sѬj׏KqI%JSed{ySh9IKZ%ku*n lBgGܠI>ӨJhpjJ^9Q. 4\ӄ#iD0Fdw4"8< ALH^Tu=-R;\|HbDCv*O'MV@ͪNT:H쉉cwltÔ/Ich(%y=''hZc]{N[ꉅKiƪq2~J-[ΪL-lj#*nv Z@H<@MΒiqLYmeA*^t|p-I;|IPF)Lp~MOSXN G$&ޢJY7i)P@GIAZ&IxQ )!qnj\>1Qar]qwFP TCBgh*YШ9HH0.Jژ;!l>׷I4(sqX'hەXxDc)ɓ;D&- 8hA u&p3qA$Q.2M)_RY'Ϝ'/[N]:Bs??r1R%sk9l(9qncUW̫Kg[=OP+xټғojtTI%II$I$I$ݾ!:E]LW@64 &kIV0܋9BrmߕQ=W۳*tfp-1P&e_$VyQhi'uJZҠgM.cMULZ'(@Q+:|Rb=,>U4CS7M: rYR<3ef x+7-l1@%u -.OPFYNNMuPs~ 8H8ʋNAֆ $w([JYteSo"<',gw(*E0NL'.1RLjLNtIJ$ڠ<(BJ]E8Dޅ>a\'i|P 2IK$7KFT'R>j`5>=5vI 1)B@'5(<pJ $N gi4D۔$:N6uI!C{!)$PF1 u' RD xAJHLm3zXJƠ%O cR=%)4 ):2@3ʈpD+ZөQ, NS$Jt76^$O!;${"UmǺJRI;`k#h>J~0] IJLxIJU0B5oCgGkR"$'I+{4|Jz^`|'+p%KΧ%. g O^@TUKUdQYc)fo6A{{!0<{!dd<2*[Eph)P%bXS\ڽwi#̅!q 7{9EKKTD褢CzpѥMCBRpQ2xP{AЧcT`ڤС: A Fpl> )p1IsO*sk0Q<6%D|?-MhRt )Dҗ'ѷEV"Bss#l,w.M;R$v l0RF !(4NHk*.: A:5=;up513yR29):VHPf6 8.?tvSRSm W,RuYk|U94-e0Z *Xd,ߠ6hm#Mu*~NY/Iq<%Rpe:si>M p5>矼 [9*$<ZvKkTOo<q4qǩT+>跄v_̤=;1NtG)^w3,"R}qQS?rqܢyK?t5\~pEt>O!X#8|3!ά\w]w;j>z9HpRG~ͩBK\v!ݜZQk{v2ʜ;W wNFG Hw iB5UB~j[|T%pzJdI$I$my6#t-J^ʏ)* a ys=m;ك{CAmuQ] +~*-R_1i#0 RߧHS]V>DKe7!)|p]6 :[e:#\]de'M;?OhNF(ILj+V~)<>5Q,n@xpH(JBH a0 Ë)sk|Jr I"ԥAE͌>{9m0){j;YyNB7ԕJ4 ?7M wh8Le?H<\6jrTZlW0 [7^ݓ}- &;ļpNp<`heCN/$5_w) )!mik8>#3O% LaGa#x _xW"u)3^`mvav)4=8)xԕ^BG 9x38⇳Z%{.~dfdHզ| DԷvrzvǶ<:a0'ph]IAs4J9LdGԪ+|Da 9+2PN:8H X~  hfȨ %> F^d$ t tjOvmSql}ӿy-)*Q Jy>e1;t> YqN*L\;5FZOIkφ'wLx|RvUa#]"[<p`i?ikq, imYpQ_@&ZH hv|a9̗4693@ʮmEUV:+-U+:MP@i1/RcpH Ԙ|E;I!D]t ۭ /oa fс`ΪTQAƨ$̡b gkk~+87L:kwIJ ,m 0Ӥ1@$c4A )dOOͺ۶)q 0{,`  ~iݼ;?h8"2.ZO F%MuB ts=KE&[uOm*۹Pڛ :JE7i!W*._QZ#SSdt>IprG"R+Z?O ޠl 4\{OJ;FX/slߔ*Itj褲_Wvuhh >+Q3 #[H?MC:  98=VII$hw8rQ~aGwI*c3yhV'Cc4 )I$VHkx)2<^anW-a$d{FHh| s1k l@0-SEfeםNC=wh (=$zOcEyJnn>*U:"TV;X.zL@HAB fB2A:&uw{`/qAwI8?HHi?GZGi<%kO$ώwL3 BIh D'Q }rAͳG|WHich?$7K?p2'}8y\fBΩ K-emD 鹺5`(>#T Vy{jp]'s>a)q7sj4wVШ*pFVQnh#^T٣9af4*j BGP+S4.+kMl'A~Dϝ~)5[ahIՇB'.{&&I0qhG|5QsK4'4 p8rg8EJi41qN0P1c80f^ mh3hϏd1ѪDG)˃9sfu QRm >Q_<&sF$<d9ɬ8 ?H>{&-1'LOHBkfA$1 e#1О>`(gMQ~yAL[ceIv8i'ueJ_*wi?TƚL)<#; $DAX /:”;( 3ϒvxQÉq)S[ Ry!}@'=Q"38g`d앀8j$6:p L$yJJVYZ{Ƹp:hSYopO oS甒\55v B+AߔD}g8mzLzm 0ӻSJiٖgy,qӄo0DAbIHN0~:)60D*Km|Tv"#@:Hk4|%3mh6LJ<$LcB4C{#MFZBwU&G%uL@:JNw@SI&@M2T RNqOh)SnhH=&O ) *.^ANiVc^LS: AC-@I%5[[ X\vjy*Ƈ-i#Lv*!PR!ky?5=O;X-(S7NZrN)+1؟. G*69׆T@H1S] 썩 )y f)n'McOmdA:AK2U|hQAC$ou9)ѯׄ|SFU7wM4 =&yB 1DT"(NldB{w KL&XrbRR`4t2%As~ISƁVs& Ga31W[ZavHI{) "O 6Ze" P̔Dv׈p/ABtE&:z6 Md2D;}"VZDZdjǖtVV7k aK4Ho -v4c=ehȒOtTGNkvrН,B Y?dy !Yb tMdrt[n#3{̼+?IEi%4srwxݵ0x ^ߣ?56Sj=˃|;$;>ԚLS%&TӺy@tQk:$jUTvFnn'#C[N'pC\caLBHEײ6@ӹQ-/h:"Ax.3&s0t %ZDSHkvOdNMh"FLRn|ʈ|y$&78?iՅI%2הO 49)h( I%:2KE76vDO(zǚ jg{'']Æa ŮvTH=N0\tVJJa N-iТѩUvP\~HJ O#o;[R!j NN J 5p1̝n 2NړgM(,M }F_̩>{'k;O))#-ʍv53;&c5:(NrH]xvL ۈS Qc@0T`7kt<4IΙtπI+ĉXQ+g^؆<>|\:rj1rQs'A>4~*ʭDVWg[OP+xټғojtTI2]$NI$$I(’D&)^hȦ-?,WN&1j-|6c$x>vd,iijC#XԵd-.3!QyM‰{\ܴ1ip#w0 LyEI(]i,z 'oޫ{QqI䄚S-,cj K#HB~I8LSOpL~TdZզYIB̓>H{yp?W(|WOQ֏&vǚo d)96߹1l.>8\ ,$h<}TT@p SI(rITiw0I'S'> U,0uWFͣrRaXd*mqEYGPPR  lm(p<@8<E kɬPR %C>=ԁsbu3{D@0RI) ($ϴCH.|;ʃkR|0Q/$C`h2y @'Y%$.`yJ[CG%I\PNHu:4M$A.sSxQ- :yt%0;)5Ou KPل:d:)sgI:BHRdPI"k:w*Vo;D櫱|w )p`$:BIh;Ų*,ݚA>uTRSLEԸj{ EݶKFIKJr%Gnb%;1}gOm#JbS CہO pԙ(pc}S*Ҋ'I%̈Tðu%.:I90I>(p4IJQRM X懲wCu%4N oRRI'Kyk׺1yuUC\{eY(I%"̨'k9*v:H0INRH( dL˜uNtGܢMS!i:ZJQ=bq8Kb<<3 H)"3kw=p1_;4wd$@0*V3svI{ w̧3Bn%Ɩי!:#RNS(TJgp~ָ #+l<5Mu'9PR)N}8e-gsQhh<5_iGuhN?Fױ>;)>#UVqoD$A Y3]_qT~ͮQѲ)& ײo|I:,ZkP߻ֳ'n;W/; N=ڎR{JtUՇ E6# <1^e?tNp7vuSw; lp~ yC}$ЭI׸ٌ.RaS3G"[v*,Ϥ}(O\YP | Ku؅dEHTujeJ̀džD!STRXxt; %+9Ixl(o0\*oĩ=ļ?VV葟R%!2xS{̽ NKɵڥMF%h6Xt `}9r)g'SL7]/?ny /]LK~NAG'u72)7e,M D|*fIk&;i33ȄgL[y ͡i K<ioiC=}Q=&J=60XwQ:Bv]!kwDi˦<-~Цs5x5 vD:;?J KjBl,gykP!Bv/ʇEixHsp;i'7^\&Ƿd{~OS};\%IJT6#X: ex2sD@.$?P Nՠ:|T{|}7X= w%C`gdh);O1)4~ +M9@9)Rxh'T<@$q\u=ʍ,.>R"y/d4)+KEotI4 Ɖ7~cx)17[^Kn"Y`dnL^\%[\J5Omq ]/O!? BwD"mÄۿ1ܧ9s;rҒh,~)#f) G+Շ[VN v<)zIAY~)qD,>)\Uqj7\M:7aĴB Tc=&$VpĴS*g߂ppQmq +WlX{7>{=)U\w;{KݠR`$APԻEZKgdGFE)˃D ARK#iS| W12Jn[<:z=7)Jp5)c}\K xoxLf$P;;<Y'nT?L|څ`}&rqX~J,Z"2O܎EA Π]ͽQ/-!P>;썊ƖqKe ~f-*-1Iݜ_=Zx$@^ֺxI]5۪<%> ;A sk!LVHCHM]ucG<U: w=7XׂFcwQ!T~)R Wl.>R۫{+U㗍Q>%nWA, oRH'rio(d6m<:5X9@6\\(\dx n˽kC4@%I2+T+w69 >#v%4+XֳbcS+\E}.m`ipT4hYSFYn#qd懓ܘ.$D+"LyU+_8TRQP) Nd)R:e*uGsySNlcaJ%nv;È;w۱!ɄkmeCs+$y"&B-uz49/#@[U扒;]1WދP:UUb:;Z`$`` np3NI&IJI$!Yj}%F)t`:%R'ၲD5㼱 JT{&<{)z eWxWYoBWΈ}Ťm[ o0%*ql9QUAAi9%6Q)a si{%L[XBݱUA#idv.vl@n3 SοW9y$r>]vi;SD-:.#N9;VmX5`g}QjsDtlV?U@7BXZ74hmX [P]Hdfͭ>h5ѢϬ{}3[1W:Dj'EH}_ٛNvSΗ:y*hY@4)yM1kJR{E(!Sּ{?rc>UcH]1 Xd".fUTLG裞?wUYkmCw3+Sxac2GUnY6W[[sbGiYg? z؃mf/%ǓDq{}ĝ8oOQ4-1G+ӗ4^x {jutYMߤi6 $c0([88v('"w@Dpe&3רAu~ 8"Ul.Ѝe\쁝Sf yZmª@&kZA'Y'ۍ^E%_>}A ©8|JU%:%H+%0<%Ύ0 wR JAm1 "LB#q&>ܠaI)Io10U~mx"@ lPuf>E58 :ځ.OesWK\׸jd&Q  Tli<)k)%`‰nQdSNI'8iI #MaRts%Z?DwbyP`p0HA8Rq 3 5 pJbCcMS9׺*S2gTu$blHPx@> 8ԔOtaBu 5Od$2v%,R  %inSjtHs$o?rL:IK8#@RwSq䨑DIlI;,aۄw2tx4)8 S>CRBILjSn T G|Gc_HA1 )Q)q O*s'dꥬ'@:hQs`mH){}TrrgU8~N3D& LT]%pT@rBb]RpJpԔ8QԩADdj=)7alNILO ۸Jdjm )lIGx$$&#pO$O} *;B0'$+ۼSRXH4%'j`wQs )~ )DC@>*@xP|eM3$$Ǖ9g4D 4E . eXWVhkdA@0SR )wL(bB2n uQi{\4Yk=?Q2D$x$Ntr^HU^nA1PZ /i")zM.3DeC2~Izk`vI.  {gtpRStDp0A'Zi ~'L8HG92^@St1Oty`{T,jR'n?{[ $q`Hw \]e6T@l#Ti `jS[nv1q:!4+9Q AH]Vn'uvߚ+4dtR\!;]Xy7AB`hp"QRi">g:t%3'( HD:᳸I= $Ɉ eS@RNoSRJ;Q[pƊzvScICs)]&}!:#ZKuЦϡDI04)$ ;icKLR:F'tWc#D6;Ay$FL[H;N=i#ggrƀWc>?tIuk3Jc?4OGIŵI|UKjg[OP+xټғvᾪ5RI$6$I$I'Q%Q Rb2(=?-r&P:qU)4NQ-;-v,ܗv-#X\RkrgG[d"uF{61nehga{̞ڭ Oh'INT?9NP'U VJ`#'rRo)iBo$RhQx$w1;b%. ,_ Wh;&m!¡ǽy*]IY#Q {gQ@$|EHz}s\h;@a˸lk%Mt88E,6*qۺݳg8:#E!lRR= utj-&LʇGu8vR;p! 24@v ykN%RAKX4Kʘ#|w8I QRy8&: Ӵ|CeXtSL|'ߡP!3UyS>ѠDPd$ƗEv j/8;B SIn=N&iӫQh=mygTV# ;OuB|{6A>=;U&{r=T:xO'vLujM~:)SxvRiStEM}Smvjm=D(u~<) օc:{ Q-QRI$ԬI$DƥS&r Z $5)I6Y[KutlfQ-,;\S?8j4OPh=ӵwop>'ڳN8Lv)sM#Sj$w6v8J=x|a@  =;_wޜrO#۾ƳS~}#>^VoS):N`Pp,c&@ɭ-) O"A^̦mig!LKZwmYN@w;tw ߡGv*Ea䍏(ӳq?G b5 G G  G!Ҧ|?rM43>i*sG%ЈG}DH0;%]/~qOBFOr#hS=g⊖SCĤ̥ y]twk|0+)9;G@y%9`!IWk|x@")w*D$ RI$6i{v76?" I%J.`{k}o/HI'v?𜱐ƅ7'] R>=8UE=I-pv?Sc'ci)Xyn(oUۡT[ʔȞ3ƻя?CyCX9v8qO`E{]'_*2c̨6yqIyV?AcO:eZ4wIZ}?. ߲DGQS# V%ߑD03i2eCsm˲6,CgR']Kp5R`{|QP=y')X& BV-Ɏ))RA+pI(ۄm'q%ZvD 輤 2};P+ Cv]n1`My-FhKV9opZPՅBrVSai0{+$}/ʗ^_EvLF#IUI܁ 騷c];ni"Pen૆P;W.o]5Vp(؆P(k[G"cg F̆|EE^w$jV!sX;rVYD P;Ew\fNGxC q Lܸ\CXOMOn5Ur JwCSYG#"að$jJA$rQS+ '_JLp$JfX9Y97q{* 9h! ǗD%6zT)_uE%YMR b`UT%.M@ ¼+0Mz qLo=ދ TA!%5)T5(uϧ:ẍ́ǜ!ba;(\SF4h֪N}x |ꅏ}Sx{"w,>esB ^2JaHwu>j_3UbI+8bNI)uC;;.BUjqty/ TeuMgQ Rv2:=_8ᵮ ڸi`'B;½VL [8SP4pn`Bz{ɏ~Eiȑ&8 -l !,tU`Og*}Y4?{6aVmԷeo-ou[F8̃UTK`%l[McA>i2a-wQpޏkh$*6Xq/wK`$K:r%&րHUm{YT[+A.tJΙknp3(u.nٕR2\\F6X$ja廪X݀tϰ۷D|F5xSvQ!Ijt:}2L ׄpdJJK/f-HJG9w :wYqo0aXWb4gP?i9{)+}E+Fhw%Vf@ QZ:}=1x,;ܬtܧzpK j<@"3M=NC|*2Y}l; hx6 Hx5ᴲgUsg6Lʢ1l.-BlaVV!)p->ӟ^l1y--㔟APJ: vHxqkn8 f|JXꙴ OLpQlɶmH@D;#Ag0h)&- pNO|GY:Iui ^9bK$L-c' gq- i%\ITA'Oto{t*f8iƜ}ThCIp"rlCZV< D4B tm ȗ04x*NhsZR5LAWpc_;@0sH k6+<~8J~$+yY{ ;͚ A[͍\C\y?۠Q.'*Ck(ÅK bZ,?$+|TN6#OʚzF0kIK4q3O]!>It)I-Q IRYN&g_xV8 }4LA'# J'D!EǒJT50' 㪐:uBt4ĩ4Ω;&(+‹w'k>ns ckc##J88Nw A'N3Q88.%@Qapr)h #'Ɖ)$<S鼁Odő8M}ܗ}[-2 MAK9(vu$Z$Bua乼6Fs pI E@QxH y ;|j'8O %1%{ngfcA";"l8;"?qպHr#heI}7 jݻ5Pp A)lk |?$%A&pio'sg{:$;}h:Pk 4RksoX`{e"bun{BL)p #6DrMC{KE.:uPu&ugj,~we"RF"7 m*;N )׭DW*$*T;OUΈ ):{"i$'iOJmƳ街 =D xׅ6 JJea!/J_'Jg?-2z?N-+ʖj9g[SP+xټғvᾪ5RL%MI$I$I$)$ I LS+z;ʮYFO~M'X:n.wadg5_ShsZ2JkP%P']Sgkv9L~+9?/pmG\圂WE@>?"Ӆ|Fz AN\ABL8CPscƝLH$@ lhΨI=DAԖ`.!%2L5 FwSݠ읶87Uw%.tOb! ٴKj)!xH"9Jwg`O [fJZ#T%#I#MQ갓A (x .ԓ&xIo#tIJN'Dβ#Ɉ ԞD KP ]/PTjӮ&XI*.lw1Ph!=RI:󷟒lH7:A$BauPkwHIK' BJDr;$CI*N(RI$]|) t߰D삕 BtLtq2Ou{wE 0黟$T铦NjkI.1=H"Tݶo RbS({[7Aڥp-$fe'Pv!%.:I9` {CZA BJY:dI$GN}' s`=)$IK"S%}?) !I$zLrXZZ-Jw>$)8p떈tB1eq'q:y$&ЧM_`%9L " Mx JRt"`-?My 4 {;M 4H NL:i#tWm:D 6% ;$aGgtY`Z\⧂ǻ(1*,YT>A.]EEP6j_Uk>pJ#rv-A %!x$ T^"8*LuUd=7:d&ˣtƞIS^8-ԙY e0Z{&ӕ"y"n)L([ND&a~PsxT]ClvLW{8pw9fѐ0OQD l0XޝkYscM_朴.jZyQ x=ILE/IjLSGx #kSE G甸Dg5b[z-kC|Tlx,g$ xvpEX|pG OS\xrI믋t!/Q:qSCvC/ 5^'uEP ;m$`F'i.DWRTyN' o0^|O n.y H{INyN5V|Rx0R1kqN.:1)Rېo%}hor7JX*߷Kqr2i\6YI([o'V$~>]l|pD\Gu-;>ucT*[wDϑE K$&"LV#R 6NG%RJGғ vH.%9f;9H&mBmÃKA!>RZ`E;ZSk`kR"yBKLreHYO Noʲ[0^A +r'@*IKf4[9obO%Wen<$vKyKӝH.>eL֡z ~cKe}$*|iRI<wҰ䞊ZN@;O[f撴+pdq K;Y&?%1kg(^&U08* [Gb[*wO->hxL]<ǏEjRDI|f0mKͻcKipƍXKI%W|[CJ@OE:XgK8pQy-k16G}"8 AvID"<(&?'>8윶L&U#1$ w%or@'5X81kY Ɋ^J I%RvHOr(\$ %O|i-`P./*M7豿z{mAZIE H)[ x wnp9NuM))ROZ$H8}Ч, Dnoy1' G%:t~jZuPh)c} Ns{w" yv /)r Am)Y6g;L;vHN4PSW>7cNv3r+0Tu'ĄPuނu @jRSC h CG97ڒl>&u?'Aa%iGq'qPR>0-pkkUqQIF֖R{Ij02En|aY>I/'FD!g& ~︤":ֻK#i77)CRM{}6)k҈5:2PE $}-S?H$#OȤܟw?Jg <^֣#JZ+]wjR΅#%;T=yV`<*8 =։ޣ4?Ԋ/[cc\n-0{aRclsb%>>?6 d]IG+ VOZAY[V+ho Y~x+mUПq^lvGZ'OuSaȷ{.8XOwSQ뛸;$hbzGG]MI?-6 wVzB~CѢ9I!%4z.1gdUzŕXC@'SRZ`INIA:bʑRmn"@$|R:`XӴ*Ϥ>!Y­G28쒙[*Sڃ-K:VM]7+YJUG=(xH+m.5Y=FàƍTRF4^}/pn-w!%:*$cߴȴۚAQI$j,JfJFlH x ƨؤW`/pmRׁߍP/hZ@+?lr`R1 ?3&k\ V}>rF[wO-RͤkNJ_%J{.M Q{õ;2>ǗH {H\&[]19$“׀_Ys=='S2̑206S+Mg[m;yoQ0w6Id ,-NIcd76cdNԩ[nž VK`wZXLV<]t"JD[9$JαS>%RWݓ0~oEϧe]lk-qI'AF_W]#.K$#A(> 69Z7!DkRoˤ2 u*ugk^7+c5  \0dIIeK#),&;cM:򷇝^kK5Yu:i O {M*tWwC\kDIDyظl/rAOIvڶV7*lfƒ3`do p#F]htBKlQz-֜`\H _EUAv0CP%8COhCfU A6k,;[sq2`9K6"JZ]S1!/M:*Qk $Z;K=IGS0Ք'!Pw^Ne Ƈ_OU(O{n}g{kmġ!fa/+S?]S, ??cD? l*}/)4̸:BI$I$u}`J˚\']JurO%dH[DrS.٣|^D&NtM7F越uۻATSݵaoAt|Pw]Qb,VIn;O>jmr q 1IJI7tCZ;9O0 23mqiq,Cc'e~n@@QA$I P(. "ZoHHdLLtwZ=TLI%!Qh!9Qp$%)E)&w y+Κ&JIpA{CyԦa2-:K?AV@ FQ uW4>'Z9[XmuQ"GZ"q;UsAitk<$:#N4P*>1#`vh7!KՄ< #^']e@liԩodRP|){EgJ4l ß4B7'΀HL${OvB2 Fꣶ{wexUZ4vR>hp}"G`u!ETuj*\;\I mk JXA!lNuI<t։*zP Bhsߚ\Q(i%.ZgR-$(꧸NH͍iMݡӱH^Z*a ?ڤI$q p0Bv$p<|cBiòsL`$B$$.$jlRt5DkN^<͵Ђ;&emnjTIP rNuP'{DȰLfT A1',`TABorv⊒ohm(϶9 N̐Dtf )<)&$;77U7mil=:BZ g-j3#û W8lp|8RxFI)%MN&y-PoTHP@sNJ왾ٝJ}#R7RGޢ.=4JIvN8JOpǗ6b$wIKPeODI0Tf))O.#wf׻SfS8r{(H0jq'JQM  \ &vH :x't@SLmײJVJMjBHIDOl@%E֒sJd )k vH \\@"͒{to D;"=(w0Y=Ј-#lD"tQ$ajqa,Sw )v:u<>):`-1&gp $6 \:h4:"@.nf7\DǁUa$i#= dJ6 Vv9`Q}C qK koc}H8hTlIp+, k杣xOyEI7hIiC}[F{$c"!Gן4QscT{6HDw8rm: ;D[w&~*b`qA-&sKT}_#F!]HE03y{my v%"=;\[Υ9>{tIA5ψDyDդ%)=Ӹ<6{ ^i& l/`D)CA@@I . "F* y2jyRcD2P .Ƒ'W<'0ʛ@ gt$q49%S3 xQ.k悒I!Aqςl<ĩcY׺;*@6b J`"I;)l (H69lyvOtOTC{,ɎDrdGХi=3bRG p?St$D)9:RiBNJrNtŕ&{'V'3Z㦤)5XCL)IHˋHBV>IyLj=66ʇN( ";D;IL8 &Iʚ<=*D{FE?6KtrO0O0z` T?rhs?Ԫ--_Jz$=v]y Ҹw?8Kdi2z?N.Op+?G Ag[O3[?}U3SjI*MI$LI)&w $K4 *zѨI\SҎDN_/%BGz7Pͬi"V։fk\8V&`0s.;AxwTslsw8W* 4]ōu5SE *&r:a:RNx@ʙ> :'o#&ręll:)ۡx4SPT‰j+MZ>a':`Ӳ?"FZ T:w1 :3:B~_KXe׎4Jvg7o24Ұx3HBvw9*G@M1p4Smn)JO)'R'm?Izrxt%`@:*2ѩ??X,|RCIw'mAb|츟kDɋJ\VuDNJxwu D꽳*}rc|{I')38EzMSj!18h2fϒ;\C`fGۻ^J+U !02o<0ZdAH7kdx$H2ɤPś: Ba7LEABݴHR CTAH\|PЏuUIG#s 0JbGxIJJRKEj ΩL?4t bD{JRl4G<(ޘ42J LςJT$en)75,-$6ƣ%($'O3PK[J{@e,>$$EE,0R{.:#|HRIpцt5L_@,wthStϹ|Qw q)YW6YA$nTl=l0~ꋭo!At> !bmGG{8I%):ѠIJI$c4‹F6Ǹk*-kABzk䒩I${Dyk\Gӱyr"ZAl !Dp=CL | mhpyxx d;|aIձ))yHI%*l#i%>K6N] ts,]I+4b K'8tvR?Fy1cAh~*eq$҄״hTfŠ4S On({d}!IKӄ0trqs8EonGd!H$\;$ 'Qun !:ςrv׸$N8`y'Pf,6$%Hr_YPi@ѭ:W%.<VQs|Z!~rJ>*_5o 7 #_ѰФ;;ڭ% >:{)qۂ#Mp*`gk+*p`BAbQ&{{ |U-vg<A{ P9`y̳'v`>ȢTv="<[{[,%!U>A;"KCdM&54 a~L&/M#ħ /H L{ccF>]ޛ@I {$@ P ;otƦb|\(, H6 *jGTk:*+0~8)neiM1&*1)cQcΰDž ajOi&[p{|EoO.e 1k~&[yӜklzY!&H4Ð%6M f[\>0M"$AB#e)DBt7 IЀ>vyY8 vL;(!?JH^~jM?d1KN7x%ǀ~{eK'MjC,k$^Nڧ1UL\πN:b4'maXrRN n @=!`n9 j;Ú{  '>x&E?P<(8N(zG{5opo۱EhӇS:{$ S?:T?46X0G(}/rnDW]" mCǒv @m5;`B|B4b8hSch? <) <wߤ3-{m ;HnI 5wiw<54~%$O$K) '@~_( ODXt:(;S.; Zxr^Z7 i %A)5qd8H.h?^ߠw7}FɶH8yR׶xE(4uv3 }A47oiI+8JwrEoh0yksYFKxlrP) D41[04 +ģSP;\ &/ <EwukїKԅeญ ڸ4:֎ҤɭhH5!`Y8T&fHY-α4rKJֳa.2 2uV8 ps I"}۸CI%)tv3ߕ[)ָPn $32罬;lp>25 wGY[.}eU]ɮ(Pah0 JY]K @us:q#TR S ZXƴ i$I)I$$PJ79BoUySO?mLj-Mw:+5}1125 Y7`fلk{Ku3Su>ER_hپ 'MȪd I%(I$I$$JpfD!6H>JUscLSI)$UeTCG:H<ҮXݰLMp$AS7ˈ-|S̪ƺABqL*=7f=ܫjQ-#crPQ(Ԛ[+_I^)vnUio f9#A*V3CZ@tWKH45mudnԍa['XV:X*PkNStkONDq(eq[ 0,k^i$ʯz=\ d*:AlZKacִ@?lnm7# v-Ur!1g>efq!Yew%/jzXV0h y +얋@f?7P"Y1 R5\_iAV&&Eg]ѽ\p1 Iˢ d+I%{Wܔ*Y w x,_[Ct "Y`MFqca*ɨ1ʺkU\R{^@5Te_cr&yZBW04xOaի]Yc2^YhXqȨ8V_NnkrlÁ1ʩOU~Q EU04 &vd UHX IeY&R-&JM0A;ih(<~4 rXUG5Jk*6򴰜/:Gt^ uKmqBf2sv>L5YM%v㢺\YFʩ;k~h(zRUznM5o(VYakX\'R_],a̟)R%<4J358<\ư>!X0 5Rs6<4Zl$%W+&7V`#WnkgW UvW.S',JD*%ǒHnh 2GYkت60ʺ:0I5M#fLqR-~9,|{4#U18wBp,:&َM?PQj*/ӑC|4=lO(RI$,­; ԧ8s$):dun] 'Geg'K))tJtV;V ]ZUu]Ckwi2EcGMݑ1sL!8ʶ}n iAE3 +<-,o-ʓ^O*'K6L롪 oI7 .iMOf>)9GK}-$URwHAn%`*iBN<$=!ڸ;ǰE I$۠.;2sX] )I$v5J[kA;<WyK۩e%($, k΁^K/k4ƥLBv2s{~1'(ӆ>KD%al):'nGh,\wNMwq[Eb0ǵ)eт)! 6%0ؐ りal$ݣNl{I R]6ROFIB$}!Ldq$ZHDA8R 3()gѪqEBFr\79͑pDaJdӷPkN܎ZhʓkhHS7Ou׺be$HLDw:OiԈP;H?MÐ~)zgd*=RDYMkZR4D@'y&{2zi OvnBk+NƝAA8ARFEgB mB )6恡 KaHL MEB'YA*!`)H~To`&tH\S%AIt4P@H8c夙kyIL SCxRa-t.䷏HpIJxSn8HC`GwIi1c&J"F$ɀ:wu3NR{?vItDjYHiQk8vx#"%L46U65@%Q/Pȫl>*,eLX; Kk5אdI) (M5jd*2=cKu'Xv'9n II`|IHx;@[SlAx,i* ;SA{LN\A'iII_& $q8kHcTw;c0 L 2Fq>*o #R-.|T&%mH%RB#_>2eGeMAIN}W|cK&I,ǵvdˆu,xSy DyTSKH$"0ǐIL 3Q5> 4 !85Kua`!{QCBS:l#B&Tzn`{9:AeKkMJAncIIs 6uHHXtBX$8"8H׸yǴ 5' hPd&%@Y*/ˢu1 d >!9nsL*5\HDilviДp OD ƪB>X߉L(;tSNDuHXƻ{g#@]d!;%XtiPWN f^  D ڃJg$>))sdk䥷NPifcy$qDi t) ߣd/N`9IL &{1͒Pui?uq|!BΉVi:G3x8p:p{}VT`0ZIS]D4H=~O>sL70c&RnKHե mhkzLlGr]GJg鴈qIk~H/`ic@{;EcwѦz7G))-neL,x1?L(t[Дƶ5iФLѾTI:0:,L {i"|\ q!*v?] ƠNFw:ꘗa)sB hò 74mx^T9ܤ+-u왻<6R>izw)+kUop~PUx)n#sND7Ff4ABeѯ+.ܣ?O~ Qa{{HQ߫e3#kLBJ`ADMu3f@AH%ck ~ -s`NA!<!/QܐRS\RF,c1R56 E~L;I"tQ4:I<`t<tk◦HD&-"R2~ dGdvmg 5wT9vp+Ws3Fs'+ʏNpp;H#MB?:I /6oҎ9IehaaxꝲݳZ"A>eDrAAJT}N3P5Fo:y;F;Ϲ5}7Ӻ!"(w@Od>A&Shy3@aGN J+" 9vjߢ6U.a1*UM!՗cY[SV%9ym}M"4%R52yAJ@ ͉fTcN)nHɷ;I pEI"C$dy2I.sdh )#Z@!;fNI&*%#TuIKRSV# ӢVHrS5h Wga.Q,sRВtfp8H䒖-H6JJf[fhד!`(UY&Tá-%(yQ,AN "̋ "t=彄9LZ[TY`;<&Gb lY$|L`};kn oN0(FJ W*JLHq ;"1uV-vcgmTP9'k'pF|B=tCN"5#HƂaQZX>(%EI?)jC^ֲdq'~(Xnq|jգS3E|"c'5Bp͍ ):#^]YJC2AWKGm%-׿l X`y','6[^JfS'̢U:](4'?*#smty-X4HR7>T\[{7%lOJR%MtIO%K{ xwSk5r(o]Ia%G=ʙd{ F4@ƥ?R{AD"wrgV7 lϪߐwd;DC];h 4H{!'HiO"~jlw$Q>< eHtRv @M:|ǩ^/ OR4<(5ĝhR-Խ-,t{\$pmXS;[֧AKswX7c @~[t;q74àu%IhPTATdkS >ĢL%50WfR9M%&UC fO/ Ymow)9͠zuj[0`x:&]b;FOl*oW)5W:Z7;JO&;$۲fC~Sg)٦@H4K"zWp NsFLg2v{l|ԙZ9թȂ^=$M+؟$IB( Pw0?*.s*DE#)qQ.P'3Hj$K,"Bpq/wx)H0<g A"UXcFcwfz|6P J7|$'ݡ :ݣճmP *y"P* XyCcHX q(0Kتѭ&Uv~) xġ)<\|E`Fب8S#]cPx))ݸonpp#@xSNBʏPNJd:$R>gFX]B [ISJ]5@OY/,e_uquta XO*;6dX :!RR|Ϊq5UcC9:mv4h_Xyl "L$ '#/54]Jh(ULyZK5IKJpgQ8W[f uWqKE} =g*+m{AGlĉ]K1Y?.}`W[wuRJ2e$]uvJb;- y54DZ 56ӵgIKso~IvN,~iP"4*>kk`kגXR28PA8+33: rܚZ{!%V%@=ߚQrs h!%&ss*ik'N#*k1hJN3CȊhh;(Zl;OfbX 2S_@8GGcӸ>(ŨV x_V;0wCweoÁ2+ r]6L=Յ'FK PA=|U'H,bh֒<~ :!Ae߷pToHB4lkٕUgkOX}O]2Z$AТLi#D/6'1xsL|U.}cTHtGە[[P 1M<R]_k*6E;^eJ`A%1VeRlW3X!uC0x;{ݥh+u wq*ꗿ76op[r)`vѸ|sKZ? ': Zl_ѷ}\׬=ΰ@ŤMs;9Rƚ!Xc;c[bV2cU,Km!hԝ1)7>']{+4XI.2u)$ dֆh$,Y+TFCu>RJ{FLIp5)R(ZA=~n\dtMϹ󷲦JDB - m=VroujbQ}B %aJͩ\h&mqQ>ňh!=ОJYelk#XdrzUwM겂PU+ETNUꊙY֖x (ljLSZ-W5 3+G9i Q;|G#}iaIO !#2R>k5s~a9gȧp ֌ f$2L#4pLy$pyRkHӷb|2H}z-Ώ?gsD8!a|%mHVA2Yv݂N;o۬-pĠtEhPJ0JhS- Oy~@hb<=C@) ZvI=C( PΟ-&Hm gS(BdRk['Ulp=%" Ɖi=(I*ETZ\#&2'5<)7S䖀A m.W{.u>$nhN5RwmoURL(0ڵ)D3 %+o'4 D%5w>I)ů$HPòHScBF4hR4iR9Cgv0 wo;[ r>r.wsQN*. h)['JtJ^=ԽC?0Fĩ>AGtkd", 8I9HJǹ̀#>uq&%,]migMElCBǽ4))Lp2ٕ:}[/8g8򘹎PD=6x&v8kE>OVKˠBkAwA(>@l׶KG܋&HHΨsm㯂h)o=JD1 -rwIX-q$T@ԔQQ06ُXny)ו!uFᣌS#+ " 3þ@L08NhĤhʘ0< )FklK51eG4y$@t"nn1Q}5 )|Х")6- '؟5ʉȴu*_tBpp29ILU < ۍSuh&$ x_{yЩՑ`ڡLcAR6 6`l"HBO$Ѓ>)ۓiIQA)@IHAsPײDG.r_hx ʋ-B5;bJqaY〤]‘u{'$SI:Tu%1 HhAw cx:pFXu7@.G}&" ,&X>(n%DŽ4 e!@pBXSRs AVQq&3ci̼?7A/e'DT~Je_HNސD%Y |a<yI-$ m%%00i PC'/? "/. `vhI$[Xas\upQIlP Ni3{j]'kAJY x HRuS1Ksh8Jarڴ3Ip2aEĝ${w ͞Sl$}e:8yj={=yd+]Zimr pҏ? [kݱFhxW?:I /6oIUW6jZi*X~Y!./#{5[SV}1k}N1`B@Mp#UH}鍧 wn6׺})8R{DyHSO&6' #ÓwpuKWtH)pЍў $L3( '/@9HS-HLjO) kCBT]n|U8U&wRS&< B5q9ZtJO`䨳٘&) R;E PZ* :[K.F4>n'Z$ci sbN9~{`5#T2ƻDL(ӄIJb=a>ݎǂy2}i֟mm%))`!(B}4ƤP4*E,tPs} %D@u74Z=B@O 9pԤ3)$.cMfc(udOkJ; 'M\&eg*嗸@( o9ԢCyI!E@0)Lwe9߂t|KvѠӑR° p*XHqPfZw/@Am JY*@鶀h9i$V;_<4FX\wJ]DP& s[$+3/:Bb5aKcg>()xKOE0aF]nTA,otVD!UZ梒˼J?c\Lbyqả'DU w쇳-])Qyl*umK^E>H gAbc@۠Qh7?q ̩e8];ZF*ԟ^n$i0IgU#XDl|B'hV-l$(kbɘuO[/$0sd|TEemL2Jۇ<!/dpSGMB. 9P5JZx)_O(cr+}?J?w?:T =QC:B&;_ѠVӰq!i:,;Q}ݜ&BnN@xY8pt)w$whq gT;c u+D 'o)?MhyNT=\8;ls5)+D(;[L caCOSmX5Js߱J^ 5V-v^|D NjSߐPo{CC GN N}E#]T.>Jki O[ rQ©m%?Won) 1;v :@S)w> 5K{ (7wIBMѤ~N >ae5}F&˭QD;Z1 YTxU1S Hf8)QA=\c>HGoߤ~3'; y3m[ QP +C45i._X I=ȗ0P6EێOxRg?UXDNɂzclކK P>#T_ .DXۺ!p,fllN]A* +Ql LIL)B\KeǺMӴ)k:]SH4k`O7*Y6zuZ5_ Ee3eI-S >.lVjxり);0N])>]Mc~Շ1e`?G ."$֝ug{IPea\-mt{!֓!Dp28({X%V2j9c;}`Z$51xIMB N;% EjoճĥZʅ s>ԫIV) Ct(9hc9qS±*!J$:M],oy␛h=A h+Z^aE bf`%3t:Uޛ8+ Mr@g%$~gk ݣq3xNsN'hSm&𒅈]cݣ\6Z7R.h5S,K3S]{;N`ꌒ\i3N<%H2 VI^]i %*M,roUW8U=FӔQ0 4Y7WV{%;l#ߤoXjth8LМfpǴ4wYTV*m4z%'AY9KDzy?νtI@sH+6CvFy+Wt|Vm7 qpXK#pS:|֭j}6 v rl'S -Èێ@V*68 FCh:U1!F]y{M7DRSaKeW#c4]oYD͡g )OuW:cPMZ~u𪤔$&:I$lZ}WrDʭz74?2[E|V]-V͇i>Edt!99Z6dz5QJImtznxbТʹe` iÃx|MSRkCDP:djN  ct1veҒ -k^xJRMlxV<Qs(2`y %:m9U ݫwA҄'bT Ff|wXwaնD 3*Et6B_B$ۮ%>-`3!OU };!gB.dH+28ON#JΊw8SE~cnFkWn'kAiqo#QgݧUBdet.GT{ |I fpc]g;j_k osO]{ mP'M))$)Zmh؉Y#]bt߰#Xwe̦Љcc:eM̸ȿլp Y9T0ɻA.kpNIZ{&Q6 (`%I$JRI80EA|ӡ̿!W($ZY9wdyD$1d = M>@K[j RRI+ 0'|Zw/Ȟ$'I$7WLrQXv a쒔:dY%W\͏o)n 2cUK7 ˩A]U"Z;+a7 gC9ǂo8n\v^^xGnsS@*_-J ;mrW&gOCNG~a65tr&4 \HRbgNR% A@MmD xA >P<% uA: 4N$ܤL$&:~I~0 ^dT)]"5$<K"RBw#X1j;tH!4=Me4FD7VЋ' )w ̻h]Ht GEdrnt{}悕5Rp~4 ;_q"C)Di>Iִ1dH3q{Lc1cFa2G Mio$ns8 I<DψOݸhl {hB 8M۴s>]: y<?HMՖ q'mqС=&rYo *-< hF ꙤΜ'aOA4Ng| @yP24R~DH)^f;_ʖ2`;Tbdaq=JHxIpDk\CG))qR'i ŧN{\ :%)-$DF Ah:&/ږ8ScvĦ#*I*{H&7qK(i7#NQRG:0#\93!?Aɚ O:"*:%%)'Anq0Q V6~*MSޓ],080$ABV[؉+ CRv<)a0tiGu-ł"A <vK/O߸Q,3$9 C~j.U@;R5ud99BxN'cZBO'n4MS9iRdϑL6ִ2JorS=huAK.D(Lp[bA4HŠ6yDΚ$-ĿoA N]'% ţܬν]Xw%%i U0E]#O-{dSz])pG"Ƹ8FҞLA 5 >x?$ Gp29NtHO~B1YiOijHB:0 t)7D)];FTh"P'4VA!W[It)Y?S0-iUw80kXlJg($C;#aײqcX 3<'wtotέ;aE̳~.&t {}NJJfk+^ȆƼ (ckH\ L?`Q $–I ʚd7Rk9!_x3>IMpxA+J{G=:e7";?K 2 G$/Aħs?E&pqԔ-w'7iIĸLi(wg (37!&A:)w:Po 90>у( 5L`LA# _k/2?P׵w!•=H))fhvB~HTRm3wI`kuItDiqA,_~ѹ ID kF֎#u)5@DɘD9Ib@dDR{C uNj4h؉M[`!3> -yqԨ;tN |J}"3%%f3)47*-i?2؎."[1;Nm$ 3C4*)nv&r^B*U˞}2VZwG$GiO[̾;&8VԔ]khcmSHarXٗQt(o%ëA-+Ws3FЊ~i*x<U?:I /6o3R紏Z9^8UZ8&BC&JJqʉ x4EP]J)wrcTF(@Tn8RI`aICP= J,!!qDJρ&UzkYc[|B#&/)wiOpsҵ~v, E3]R=m>bxIJr8#&⊘t);";%yQJdA,0Fi#C4|yɚG(P8h*h.&<N"]=[›Dk*r;(^ G\D4{%] )n4JcVdxQdXϹy 6O e%.xTAp@ei}-ra:9:%)?=@ݶuD,bxP:vJW-"SHNTI8C,<I'(ȝO>I햝| ݶJ}Ų☀믚J[^'Н;:HQ}> L[hDps*X&O/n@N-;v iJ'D ZL4$HOcwhB \$ tG1Dm2! ùRuL[{q$c %1)Dr&۾)Mw3أ K*_ltš <'(d;Suu|थ`G 6ˆO8)h#f`RS&Jd4&5No1\鎩Wnk}өRs|Pf-kP;yU.)R):vȞ?hUnϟ'v) #%pӺf .ӄ6d:5%G7Z%t I$ kDM4g]a2ΰ|cTTI3KlhҠvpQ,9V}"k.|Szo IT] >LwQp;mx&`JGkѾ()\K~\r?/4aL !G suQk DS{lk4TYy0Beh1Hg'}ҡg*~ƇuPݡ$59 s$wP?=6( }ik@ lrK;gtQ5Q>\`@F)yI%"4INH7,i dǎSOQQ'MsAgf==sv%D9ʉ4UccG~ leۤ&4_4ɆZ !L=y(6\̗S o%W 6x'FGkuRrJysj`艎O0&xދH)0PlU}(X*n(cհ;;RkNSOZ}d )l4%D6L'yyB ]*tOba?T*),mR=J f+W1nyvml*!"@ ˋh5)H5)cTidyFI ҕZڙwIUĩ%Y)$M D($U[ U]Wg(ҙā OVk)QwPeMQeAl3!>! huw[e$pΪ@okRϨXkčBjMv{|P48*kޚ軕,khり܆Gbl;5AǼALA #T2;/էD *V}$'jࣈv1@-a'pPڟ5lHaQ:J~ODxPl=&}3>n;T [6+~.p|Ή.tjXl&Vln=6ٓDW'$c@gw%QQ3^ؐ'@RsFgJ 8LZ j T*CϙQ{liFlK)BC_}6ʄzhQD |T~IWk jyO?zh^@UV>{k&T=HA' R2 Sqote\y.Te%Aʊi]2I$I$I >kq% Z BI)Tϴ٥$nt [cm#VwШópc7jc/K&tJ\]bGpZH{;c70dA@ KM hxMP,5}u0G1ѷ+o%5R'(xT_hdK]= @(,)aM_)G4}[˿5]_RwvR=[~??UhRJ`HR$ V4Ct KXK'8Nrq"&.Bf;X`䢚ln'P{42sIgR^4<7" ْjqmX4"Bc^4PY]YiHeN!NG[$RX}jIL~{mn=Vv4rZ  keuΞ be ȅv]i<'24*{F:JL.9ܞV+dt+okғ!Հ\\ՐYەg`mVQdSk )j6hu ɬP0{*@A]!eaUh$ d0.sX=}|u+%zgei;[šyr& ~j &Ԍm\!3')iw4D~CHc'1IH2[ݏ$ « HʸUZ꬐5YT9 &U٭`u o tm UGc*;hn=r%XcC76&{ >$Rlc0@*OIwV0M1#J#2m7hI) 48>H$1Suq* $ j Zm06ڳZUTZ n+wȳ$8m󈕴VN@ƁgjJv'~ߥgK pn K~CeF}O82I$O)$@SX JQhp$!d0rATX֙ hKIgdT-o07Yk4h![ I(#"݁ +kُUi`y'ܳӞ~ RS(B.+דe, NV'kj$Z/a|+[/ZӸuWa #uEq^C'v}bkUe@V/P~k^FdQsj-.1s6ďtM[ i5ÇDe-@Cбm@xZͥv)S[4k i iuÕڳ# kuDVǻs ȕ`8;3YZXgdBk,,B|ۛk@tVen}0!(5[=di vѼ3Km  (hYcYIVPouhm [ WLĬ>dgU`kNA:^YnbD-PuRgZ"Uk\8U3m ~q z56R:(Z$O0<֮& VRΨ]G0W8s%!tlE I a%g@kS> 5UuwgϒsHI$nANpLxMsI)AqAhq$u{Y٨SIIJ$[Oq(tK,$)X{x$$ex Mmm2૽,>=8[QILt"P)t,u;4is?m{I z>jmWUcIPquL@0i.kTmZfL 3Xr*r?D'U22 ?P;6i­z+&if`]rƈOvCeȵ5 FxEa*kI U$+m14xƤТZxm<Vu m'tS=<@(.4"Op =RgdWpI7;Ac~`k=L:+>NT~Zu*l&V[<<wƢ~f8o v7;:Z x$HjP +?i_%0ƾ FitNhwbIO h$&VV78&xI+>֍Cs0=mc66]@str[H8A!^4DKfL- D8*Â`Ӥ|ɏ#0Gg]9!D \vMt  @$n,cP>Hv6HdX\I#Iw)%ivCN2Œ .{J& e'w;(fjkeS ۇ@Lm'Lt-oN׎|B| H5 CSW$#3@T O8'Ce$2w 64ԔP"#;ys>JA4S =h~SScu] 2&RPG27x\!V Bgg!YC9R\!R5]!/P<ѡ>J"m.Ex#T&4SN}C$J:RLA(poX~%=1g8XNlCA'YIJc:S~jwD] l>*e0'65%&@XxP&9Sdͨ|T'tdvIo#>i<)0 91vze0rJ{uhԥtAqƇ!O"lS xY{e>jf͑F "I!A |ӵ >))L(y)'̓$R'/Y#cXeM8Hba XCBo*aퟸ&hݩ'&Dؒ>%8Nm0JCMxH 1Tk(%I >{(;Z;ݬ{uvե%-cf[ B>CuLk&D[lA=ŤY=ԅvXH'DoY=_p~i\wT1]?[#H9qt2Zd+K;pZ+?:I /6ofR=Ի#T3Z~iܝrM>(X…YCxDJ{2u(v  ^hʰ!dAUwm$}BX v U@MB_8c~/f:+6{ZUNޠ o$8F{SLԧ4JR?%*JQn>i>"FXOƉqD2rp`Gb]^B3Pl.fhpPw7q+Pmp$QRIRaH7F> xS)`;Jc`P :F-.0Ca^ rJW Sy;ƒ}Ƀ\Ss6$OJSxO H RcA&w)y& )kk\]Ρ P "i$9Bq1)TZӞdho*Up-FRL%;3O@!Ys%i2Dq,B T I5(=MZAJLD10nߣ֒e@Aߠz JV<*m2Mc,G 5al'PT1 )% IZA:'-lvX6碆tp"Uk+h;!I Cm'y)p'@@Ҏ fI\kN:${ԎّHNΨhq'$ Bږ%%K`0qP.=S|S?]JJ\$!!.: ̙N]]RFBt\5ռm-xQ.NLnE4 !"OP@*ke'H%)ٵH"zS\.=e3ERaHJ$s|HXνմ.l$WE6qV2. Xu+%ִ"?FHIՋ{#Ѳ'RQ`_8ortrm׺dR۟R|(ʌ}Kk?qv*lwr}OK@|JFO0noZ=|5'nw˲{I_DήL }JrVD)6Se~3:;&RDJyA+$% / }}!y(_m6q"v},&ΟC]Ɖ8LgSmxKx-#|QV7RR|g<?R3S!;wk)Zx-p)}G4H<%34l>:R3J rsIi_=bkTΎHiJLBmÂGQCx!4r]Q [tRkvU裨)Bc (ܺ6E;sܔ)$'Br-?t"o;&sNP @E5UyDŽc/%H,`@T%$M1)jyPys0?tr7h*!oh )J%ICBJh#'Tn|2F1u]O/[oѭ%]mJ4BErH#e<%6SFGDŽސGWDj߹.uObyBgDn#kǁC-?ft b:t\Q!9t|T\g:q'IB B@)w*.yZwk |(;EmV_M3p0eM(rOG$jL`SII UEp~֟_PW 8 A=kܥxiIiond 쳚e#pVtǒXo;6nl|\U[<)6;S>NFp)%R! hޑȏS)Q kw;#c }I!GQ#JIprpEG}%!(!)bIfrҦ*β !`pR!BZHGu9M5QWp>P%s0C&kZl˔V~*q 1QJJhЈ^;1}0CJ,G%l)|Ja'ͣ4%28$ Tu/?zJQ'D5H`suNI]F]ÒJQnѳB螚).(g^TIUM&FǷ UVA$zW kyD{D{HԝcY"H|B+H؂ *[{P 4G䝹?x@}YD4X @oY#Bv%!;|GTōoc1}QCݥGxikRGU5ߚvOHwޔHEo?xJjY`:ơw]_YN@):T] k};;FӸ!_#N12cyoii3^֘nd I+F|2y%d Hl{F܀ZKj4ΓGsLH ͌qhh 'hH 'LH$J(7;h[n 3UZMz5IKee7&L,zm"`+⌺.ЍtJ]A'^Гm?y!2kkA1d3,LFⴵɝUMotj}RD3"SSq+?hȍS_"a %aK' : ӇI4&uUNQ]LYTJmY3.)ӱ` XeOk))d<1R8=댴 0,3­%Nܛ-\tCILp~Е{oh JV8 (UQ+`=ÍRR QH< e$e`PnQKa@]l`3RIM_K,>qjJH _#[/tad;cu:*Zۘ抋ju'ˠP@ot RXeTRS춹An  5k7q'^Ɔ8p '6Vp[3))z^"uW)yqА \ 5Th?, [(a XqJtժĬ9Դww-Q=v_^D4#&SE{LjSE#Tƙ'0E#Pd#A[de_!hux3>hLɶǸHSĥٷ8˧Smȵ+%J~Yv p4`N9m1@*^K$Hn0"yV}r,c] "bPzeY뾘H*[ޭNmo{53>Jvd[- EAͮk'JB)}l `B[ƴ2UX,aaTsz{* +[t(UouY3[qA:-iZZmn!J+rFYSX> 4B`F4YuB@S-V}QؗG/~c\9U(̿96&uxO2284 o}f>)@Bu.V' XHnl~c*Mܤ\OoN7@׺yTgloīTxM%m?Q%jtQGo>SneސanȬ`@4߂;UOu4W"N΍b5Q%hYٽN[v< Lc=|| ukq˘d X LV];&V@yxus\P-A tWkw J ]A+Pv9I8 Y}]s ?,^L)f_(#t?bZ4>(GUM@9gUuv !ΝkO FN Z;AzZut<<ƒ>I c*VtQ"vܴb;{B]0$jP8L#f\QReC37 gRUah!Kc]̴ 9̈<8IC$ʍ-=UZֳSgn<1n_Qqs",%M$螸a.dA/3E- 'LzMuOʇSѶI,'Xdƀۜ@Ap;J>VWxѽ%lՆ׷*ii!#:5J.!vj ΰixQj^{%]pRI0I>?4Z1V^-y pHLGI(X؅R.Ӹ~UzCCPdm<!6/0 D Ou0w᭮;5Ue^ V~fVx؂ w! Q B@V3C*O&$J/tZ5teMIY 2~otʛ"@ѓD! D@(d d:%+oаw|R MB" c(ɿ1JCvScSNc]$?c*ݫ45\I!bTB(EhTŻ\R!(S7@K+p"ĔЩBDVz{]o?Pʨ*(Hn0QEivM9ƇUͫ@6X77 Ly;)ݫL *d꺜 v N%t۠QJNP}f&7vSGI,)8 aJ㲉N0Lr1ߺpS =#IIqKRjDKE,0*[ xPm a{T]HpAs څ1Jbַqe ôZˉf*1BXsE3YQsL()A'c+F Mp"a)2$&TH-v?5*C3p4 8{}1 v.o6gIJ"胺 n"`ehG(N},%(;ʛ4$h Q(gTkdi7<QRBݣTJ4(Љrqs!5`Υ9{Ra%[\DhHp@c XqBsJdN?Bk\9\cDդTNШnwdh/ylTHaS~esmKKJIM‹XeppAy"->)1ż 'YEqjw9E𐽠IÝ q1 )):Fml<'.hdO[QkFU³!58Щ /"Unh:(1ӡ[t}$C}k+%FמB{\=á𝤸 HID-4☀Ӣ@|pfQbF m8LA BL88p%]N>ӡO NF ʈ=))i4 U;S:8t($hfSОRRk RVx Z)Vc . ;$%ѷ[\'8%)dq׉*\Lra;))IЄͤOE3oNhS#45NHФ̋.*%8DBNkvTK{8d%hqS@D Tkp\gMRS &Lp]RI2 Z Ӳ?W.yw\j?4?'LGrE\fg[OP+xټғvᾪ5RI$&$I$JRI$A$%)$]/~rGJ˘IQs.TwsƼj{[936{>0FEs\QRہLH)ɞ@-!3Hi?$xhwQB)Ω O;CʌFKh)ap xP;GkܩY[^CGdԶ'IK֨qVՖcrmh&RRڅ*@uhs[jJ3\F)*:M42N{f&@U[ <$0Bf evSOp%1H*@JPADkx0tj(pH$TG>J~K >))h)$謹 Ctonk8NG"6d"ʚuE)h!W;E.YE.Oo1מ<RJCD^h9C6I{|ҟLH%3O6SmID!<'ATħӲ#ONeRv9HMxLO){g( ́*HhyщI2`Lki濹KmF[H~H4>)8py$4Q|%!?t?$oiq'8?~(%[ZLI">橛vhHsIU>4Jb!H C$nt F; kɇn(5|BֳN &VLJf I 4wGh -"kxwH~-%HBZv)'hqC+^< wbTjEچ! WtVR Px+BED)QWݤRppoUcV;]8ɔV?zo.*f+|} NfIM<J@p|r.wphBph$4N'LJP))W]{w9M;J>%%jhO)<>-on#EcC)x=!EL(u(8ӰÚTX`x%J's#'4 |8) $vL}Qw Ğ }QG 2> QB<ǒPG)G|$\‰t}&}ɷt"UIiS|T p-VhmbMe:{ K #"Qn|Oif<3'>hL jDFJZ<ۇJ|&P>zcLy۸X^a> mrw~AEmH+{JG:?Ka!I);(BkDeAGx 6<ڜA]:9JgV9l|/gLpÇI g$+m>2ID$5% (Wk()GyKEkāLxIpM#)`D*{2åXu}D Geyv)ZldllY*Hk 4k%L9&.(] QAJ"mYmfHVLSIK)(I8> iuӷJRb'B'2h'^4P ѾWQ0&hx(XXJJKLLnkKVw7*kTnǴX\ #U[.L$DyKA­QtXk8)$I)tI$SsBf3wSZN`*VhpE7fȍRRS%afH%jє;ӑU_}St誤^nB%7JNl̒uI$IJI$Hh-8njJR\dgՌLDhs2 Efs 첳-1 AGd]^]B jcKb09W07,2$ek/[:r'Uq:91̅ilQ~UGF^o*]KQY4rTy(pJf)Qk:)Z W[DCO a ,ɯ>LBQKv44vX Ku:+kX NvC+K}3OrȵޣˀomL=. [oQs ba>jY̻TGl;y {y AfJnɫ|GTR§ҩƳdד⮤ޖ9w  SKZ:"潧D ?m&Kfl`[_X῜Dlɷ. p;1rQI)QNTlZݢ!:e#bS''pVWWp"}T,Ft7cB5GTi=0;Jlnk$L2ӱv;ۅUt8Nׅs,/?*)[؍Ŏ.dCjג@$<̦%Jn%'IMDe3Lm>e%,4I$ QohhD!D *JRI$䁩R4 (B钔Yc\4j2RI%k7$-&Kd<I IDPbf -&S K]7CQBRL!zR@-QW:=`;)uagX?FԾ`bD]״À^]h8 CZRiS\ uGpI[pCտ2&BrI$yaGITInINm|g:*$ Н4;C+=m| S> 88P&&_="W@1D,C+xkt7c WfݺrdlYH7Z̍T=')VVyC)!H I$ʳDr*@ItlE+^XtA,aADHy܊6l!%BB(2 ATI$B$v0pzi jI)b%w ]0Mӳ o%n$}. Y  Pw%\nTmAŢg0e'2Ə2k=ƾ* .)pÎ-8 x:x)f߸j|ݩL詋6hv5‰=*}fb>i)o~^\G)`LyI)9HJJH wiI 0N8Qh zmiS@9hYI)#kTN|&`QxҞtjI v;4J\%AkBpûʑֈ:ȩ+:$\\6T*5>]/ j9)T=B#E+S5$` 0i;Le)ۀpAJsvQlP-E+B%`!iޒlnhL5Si3܄_>6DkKHP"tonRRP }.TK*S 'cH7~ТyKH5wPN8"DjTK'4ޘ<Nx3L\I%RtQ54R榀pSzAĩ7o &8QlFSμJb<nD!0ƈ86J FA#~4|wb^DNPt ~~ia&6nhTEe8a->Il.t|T i>?đa3)l pX7Lk7'*k "W rO@=4uEi0R!?"ULA{'|LR7#fSϴHM\);D$l:@hAK<x!XgN%]|H y&;OiE{$ ǴTZ׎OMYR/A'C^Ƞv*6m<))j8úa!5gOw)h>)6#TCJd _ZgEѯ! 7q$hlЇp`p@P 5()v5|VA]'Eb૗Ьcnp!Q:tI-[sCUjfXuZj^Lf v I _S"JeD:Ѡ;l3-aúk(d)%U퓪gV"B Y@EPF'SYhN]{u)vO$G߶СG w;ݡ gDi 61$ĩXg&IEL RxaE+z=nkƂ'#mwLk?\v:|ú&sE=s\$*,Ʊ) _:Թ&4J.< a(e$d`wxQIΑ2B#fw R%ԁ'C kXaSx0)Jv8:s uD*60AL71ѯՀƨ|Rk IQ;Po!5=\֞5C%8}ݒq%CRfxRT h Zr$k$Gd0bd SxIKM`S4H16r#TɃН1,ۨIJ.B!9oA7# :$^ALI RD)!<$RsyQ!gWYQGM`ϒ8LJ]`P?tE]rc̟ޏ|Dx2A%\_g[ٸ;HuVy&3XfC68ĕ?t}~oީSfd!)_:&g~f誏d #XI8W@Gަ߫yϽ%Q%_x RI ʺz9b}Y6m@i[@ôSZ_.o0?ZZXsUCֺwګK2;&h:DfT\Y(l۳O˽wL{'M*`Xw%F"ѩ:6Ӻvlvh D|YE@ 3lg04TӁ3׎7Xa)꽖ay 8v#BvAI"R ~R6If;5d'L$Gt3-qL=<"sO;)~BP m@쟲klCY"z%H }/SK?E<; q"LXZk${tOHN['jD;PJH]4 Jt0\d3\;n9EJI$ǙB<SYڤZ'RR8I7YQv1M gf!-0hJHk'"ʀ9EKyt/lSmLs3!=Gq꒔BiNR3ʑ-2OtwݏdoM8AJ%4*2Plc"փIFht8Rvѩ$A9Q<%D61Krn[SakI\yIK`R2Dn \t h͢;|Slp*$ @:!;^RS0aJTa!J[`q-BoU!M4_<8[&<O {cƏq!<&|Uۧ<>pVsqHx }Ғi@Md̤K4zJ]5YL~iyR! вmECs'e)7%E8q*mйw2iK~dh'Gr7GޑA0|ʀ|JwTK#RGt{ ='h}#xPQ0=g:IJ u|%9aTVDxiȏ~c9[ZKGg4|J<%\q LQu(hVXkt:I/t/ږVbO.;U(ZmyōO]ǏpVO+=] ;(./Dw.{~ơ`H0 I-$6<+:q wfm{DxJ ` i!L0@k}42uh?(Au:${< Rl o}8}۞!a?H.v#`PBF;#BPi ZA\ޛ{Jߊq=%ף'#{ݭtI0Cx(q-vdz*{|[8XH{[YS?U'O(-AuGee6Z@;[)<Gzz%%jkKrOʯsB'{qOW{0 ߲mEIl}G캉kt,:c)%#\!>EDi%^E̮\ O9"t:K#(CH)'TTe4nQ~]LŮN8BgKV¯tFS4ׯIG-pYAMᯒ\*dp{|4DIo339K~\Hp쀵6x+ .~Bn_~Z>\1-}RQRqSfS!kG [I?{qBb9-KL8w+.hG`kOWx%a#C^ (6`փIhȝw-.{ ƉH%[w#OQ%3S >8'v pBFi ]ōSm!b5 IRA:%u m~ Mj,>᧘5H$C6=ZZ|e;J\*-hXJmBkqƲ,ծ'ȨםmF&\}QC6#bVu:GGwRjl},GtD4Q}7<B,?#QwTܐQМ@#za8` mߦ~hdR>wΥh + 7?$J89ǀa7<;F,Im߹N}r\%>~xHy*xS'sUԷ$NE.1l6Υ)$iSㄶD]0 v:*'Rv>֝TSۣpѐMT Pxr{Zfa-sBvVnZxT)6;J%>5 u748Lfא| pƺLZ7GE_ڴO DZ~ frR$;)_R~)(6~ӹ ;1\PE{BsTv?zM::m/[ X-.cӺ\ίҳau;#W6?Ceא'Y^]%3^LGdVmQ?세$+$EދDzsTd ah o aqwS ;"H))ӆ#Md Иi<aST9$Z:!]A Y6Eg)M/h 5V_^2QiCvEI0yCIM*>_MnI\A?Fn,pphuΒI)5X3$ӚjfОQ/vUI> 0 Jida#32]ctAz!l–Mb [CG2=F4ILpu*9i 8Q֝~m*8!yCe`H? Uc\KLp8Eu{A'EDȼBI$x2Jy 񱛐 TSe`һ q ;9dUXo%i!ٍ]b5McC\@TQ}x#ue%/Ck$d+ p̲CA<#; f%FSv'"6`}Q#䧓E/uYo |2k2Vv>^ 2a*4hu@ xn U~Ncp@fYǎmoC@y*Qã$ $j9T.>˴EW刍9=9i?M.θZ UB<| mcvL$d +XXێݠDy&xzFUe³uu|Gck`TzP֐7n?Gpb~49zGo)W+=?%<蛪1ُ 6 Kl{ue" ,` Z73u#^0k<#z,V-u&t%g]H壀*FAlvKA HS~h$U}NT)8PgKȱaJs,#wOhO4>\{;:5DF Zڛ=/2mAo"`sl C<̑Spy2Sxz%[O^Kj&gRu~Vemms!eUE V?K ǺȂRH[?)ߺcm}"ub&$XN0փ:Γ,Ҁ tۮ6jJѻS Iʩk̳y il % *k%%Oϳ07Yj7gEE h$k†M_hGcrƓ+O[Kp5UuB )3[Cr:=9,>~As/h 6Wj@I$1Ç z [DKt򅓉qWDDlbQy%B<C*[R0NB JRI$*t)WI%- BtI$RI$I$I%=0+H|jI)d a%HMet]t{UiLL <\;UI4n: JB B4$)KѠNi $e=bSSCbS9EK5)wE۬vN-SHP, `7L${*aӨ"ֻ8#T/h$pAIyL$FL*LD4uF4e: JlPIR )yH*us%2$&` '& eOV@!-ÔR kLqp@;RuAΓR G`H}`=^R LwQ7>)sөhʈ%3”jHA#a"-{)-ӕ 4Q ;gbv9!8{zM#NeE T]i{p38N[+S2n6G1ݽSVy|4ܦsp]*L hkl%3k@(<vGLAtw574螠.$'{EpILBħL8j fԖtBI:) Kx( 8 !)p ^wt Β$%1!&L%3s@aH~~iϒpr}))x&/w򙠴(zeO#[I$!Jd$ v8lpR=v>)sHlw IP`qS9LѢ;`>!;`I?47pov䫽đNy:q>ʌJv0 > )ʅ~Lw!%#}8:<"CDdئ֑44Ц~]JJ]ڏv-2]Ge*-&NHAw%$.X)L-|6NM`)hIt@s@ 뻂Q^4%^tC&NeGMw?u3)F܎ȡ[ Oi翊s%L fqE`$LtI,v'믊yʚ5Od$뵼&C.16@7;Yǚ *% MKH(>t! hkK!ͺELBM `n)#8g>)KNT"Op.=4FAGJd`jyJ5MG+EbJmռ5Cpk~)%R6Sy DMA)Nu X'O*;IKy8IHNjKlFz@O*@;I(n 9KF)s|;(Y'Xq3jq0g +]Z 㼏+Ws3F8sKZwj*x@%q]]-Iͭ?_lxI;U@3:fK?зKr[ږeJxvGȥ߇EZIjKг)Kг+-$j}~_m%߭Y ߔ80IJ,s茳m?K[ .\cY[ W- h񨮥KO6O=$sXȭ=C:;Y9+ͦTX|OyC`Ż ʖ!uД6} T\RK"R<xSff9: PgG LNy1:(G D% -W7cDheA]'DZ쇛|ۧ*9YN~ѠܡX;c?"JU ZL' YLu%̦)=yx=ahw^&M^4> }m xOevL1U y 2HP)Bt4:bƐ6:TøEK#U$>\}w O[vw HÄIBj%3 z$()E)S֝ 6Id %,H( Ǟ;#p))iKrI ktKlݕSSėAQ#[2DvE4 P)W 17졜8ꂙ%(~`pU $>0Ϸ`{D6uC4?) mp;܊U1D'1:BB+Tt: ^xL$[hodl!hINn>ILSRFf#Aܠ^CWkƗ<{̸KI^cE e3cRL\dtB$bHRI$I$TI$I$$I$QJRd"َ-+zC 34A<>t@#/L@Ztۻ9*w7OqʻZ~̻l;JQU768;]:Q 8 Xd:-1•`δm. ޤl4xeԀ>h -m-fQt8X f4}=4GOӭwFܩٛP>>jwD""fOd{{$0CX>fSqK+ܗvyK i+n3{y@I xz>| VNFqeڞ+-%Ow$$&%)ɠR'I>ܦvF) g?*JRI$D)n݇ yCdI/qN N >RRI%27 )\ڄ'UX~%6IM0d&NXgE#EdqӔPJticDIK @&]Q`$HK1q`Kt7TݭPRI2 t{ߒ-w|RR$Y)Y|kZ@I÷v#T`@*[g~!%)$(i3]NJQmLطCIRkV` LGbPqxQXE;GY$镪mKu?%A>k M /bkEej侹W-VٟadّsckD;WMa\˄Xtk4ȹ&}8缮JX κS+Ylxi>* +LLM9jdfTN :-D)1;hi9 vf2DO[w7INIrm Πȃ7FJ%^ݸAKdILu 惉KC!NknN xqRRl̗ǒ|nV!: 6V I=s Cs#%׺k0S74ILj˪ӵ1(p]]m8jU*kNʣb|VnW5ŭ @QAti]S2u`49!}6I5ReoűXtVIy uFGTc>3#%yV tB{ٗ[KbZgnU m?j=[,cDG~xW%f<4iT3ƨ.$UUnֳ 1X\u/[4ؒtY i^yqVvkm`msU{u.5!v 8O eBΥӘlw7! &S†'R_H.xL>2ՕM^an<!aQc֩ZhI/Qf+{t::9`_ȹgatoq3+GYM̰=ۦV_﮻ɰ6Qr2= d[[a? I'M#oVЕ+"K9P88%Swm;;͠{tVFD:MeUaf*ג v h3F:ߐO@ݻ;i _ӎoxapJu#+:TͨjwizLʊhv]'c@cb~FN " BɝUS-c_I]讳rrr f#gdb5̹:eu_V=f 0S7ۺ"~V>S@e넌t ȑbyY.Q8"$-tL|hѪ`K(H[-|'2b$Jn%ǔU:Rm$ʫcaxբd:v42 iPQyR4<('.54Aq#$А++ZkkRž@ ݏ/ʢO  ^uDGD.s,L+ip]@с?lG)"Fkp>)QSF~TGryQ跄Q{RDp]F59\Of]dHqxF|+xIJR<QM>,ָ}Os:],}d'(OF Dx)Owwj&j.i#vM2aIЭy`ʃr%gWccwmoli,l\K;Wիpp5M$c@R@L*ۏP9ZO}Z J B`&.s&JXL@OrN.uO bB)Yu5ii){s {X (eͳrwvIKmh@2"s4o /t;6L'a1:h&SH`T-x̧-1]tJ ϒ\}'qp>%$,Dq1~e8 #ANӄŰS!&AtN@t}I 9F< 6Z@@U 6HhJyiFU,-w3II(.`$+ÏC@̭wgeUZt֐PB{%Y[|!Ƴv2c< E6<(QF\لV&wU@4߲#l1{')5 Cru! X5g#T*]!_mxIOS&J5PW `@2[Nv?Cٰ^ hs]>(~yp`P[➭!hkn9Se@h!%$O&8uPqTa>)I&ۢ QocPp 㲔:f T N&A) cSBv[&wH7}%2"42J GxIKpB[SLj[ #I"m#AF JXvD{FPu:wIK?Q-$vHP--Dѹ~) !bTq (bӻN p]K4RSG:?GVU:ưƾ(YY 3]Lh%7(ILpܙKjv  cd'܀N1ʘkANO(A?s:)Ω! J(#JMhBaLZJ[8k )p`nT❢fN'Ů%ו0Z[ "UI @=2˵Q4~x%LICgΐ`${ fIS 7vL熴$J[ LN}qJb=6MTgvKDd'O$ulsDjxs#T!IxLִ|.k= 9؎RaqT;[={"sZt%`h({nwK`w`S^x+yn}U >J uPH}aӤ#:|eF6䤤w3[҂6 A JN2'NSLELN&10gx*!ΤvRsǒ_G.Dv'|>z[dDSP$ALcc^)%@vÄJBNAy%X .z<ȼϒ+ ^ J+b>T,$ά7@BٔO; uQtO"4t .%M 3D;^tK,( h5t@L]$F) 5..3~)rS`tM׹<0瑤- &whtIKG6u$L)i^TL sF{LJbtӒ[Oi;B#آ ?:Jo7Rb?7S5:f2]$I$IJI$H $K{IhW#(O[^/sys>BſM\ՇNt.'\۠2(С+B{tG"qnH6('\<BI$hx`+IE fgxJ:RR'I TվO))IIYŗz5[X8s]I|֛%4_]r7X8^o!yYlg Y'\uK-zF >+z+`kn-r&׸m$ J7UNwQ7Z C1Emv !G!y| <֞.k2dbt)XnIđ杘X74HP{ hRSA ۚksi %v6և=$I)I$I$I'cȲѵBkshv騔kv8H'٩RKr+QbS !(Tk6 jWQw UJ_jD& N_-{5j?\қ6qn__Jy$lб>ɮUS6] G u r> Ka<8E-6|5q]<A-Ɗ5Ur0n"Q:{Nϊ햳Qcݣ*Db 2q~ƳbU ToI`ib:V6&s46n,fYtf(JpU%IA'ܕMxP1H$a^¼s^ g^VYɦ*p$!8A6ͣաlFt:~j8wsKd I[|A\3_:pT:d?%R,\q ~+Md׼ P';[:0t6t/Įh rB3h $? $RQ$euƗv T:JP5<@I(ͭ5OKG<3UIREcJ)dFh()E&{=IJ)$X{ܦT o0A>֟$1XёC!%oP"1,kBxc?.Mz@mE1 \T^S}C|Ӳ G $AV.˃)(zR4Vz5m3ݫ]vc\o,M-a6QkᓄU0ߚ\4'ǗVdJaOstw9<]Ġt.xկTẌ́K9bI(W 6r}Ʒ݊wis{BH]2t[;|Lps-JΊwIK$uѝZNc\4XY lFU 7c#EQ^C0@(Yi~F)97{ \ktD+^&;U !Y;h<R$Bt˪Ʈڃu_/miptƦQMO ܆5$ȌL\o{,Z2!9Y rC< N0Ѹ+ u/OpJ 819Eua軶f@ScʭU?*kd*kk@4im=MsD"$; 1iّ풬tW Z:6HWzn7,Q3!#fPsbݽS?L(tB6*VYݱysvLi* N|QEJI$I$RI$I$I$I%)$I$IJI$Νa.Vq ұێB+< ADk({Kt=3;N o\hpvSHRM4 h E@&08XtB~Gҕ$;ưe7– EZ}I(dôSp!LAoEۆ*7Q:N$ J(P;XF; !vx'ljH)nDrD";\'IҒ#^S=.5QuI9n0xk@Ó%, 8OY=T'ַNXJHi;d${ƍƷl,{IxT G|J6#RXdHY)) +FL@贏hN"( =I.PY )ԿHjn3[2Ud8@ $DQsCILZ%Mb;FM-9kRh)![H9GrCySoB$ֈ'LinTI,^7 73КhJ'NeNA& zHf[\†SpcDM{Y))${#Ω24#DLJ]2 )} P3NlDsSyηH ,%QOMxRM3ʓߚD:I(O;D224%,Yj%ˈEInA,sκG{xI |Ta@5E\v(|;9ǂERFC%,ȟ-!AB+)R|c.ZI([H:-nk-3)9\4L[ 0%Et@H!6ָk0O0l7Du<)zm:%rv5g;kZ~T%FA 6tvG jF kəIs94R,d o{5Qs TDn% Y$AYIHׄg48y&mM^*ln)E;qr\k0dn> g5ILl"R-|a PX$v)F(f\ . ᎁ!se14I&S5%/IN\Z"5Q{cnOux)IirHdu~ HjhH4h ʘuBLY>I%w#(N`B)D=#JW_;A\sQs'ÝIV<.]W>?BI /6o0WU[B u Gt; GǸpC\|MSP{5J|WxC?%#!ʮoDW1qB-%΃jSwH401gi 83(잯1sF? OP♽oS0+5 hݕA:FO&VXUߠJv'(WB} ЬǒH09K$jw#\}E ۸7SAH[{ʞ>*@D6 BbO(EjxIK6Ҝ<ҒtL5e&lEJ:iQIԩjӽM'D;'O[0jX:|+{-DcA(z/'N\&T|QS08Oi| )3ZHh)3@TmX=܎E>$,YH9ԚͧE(W Rƴ:;QCv)#|S]aj%6 >Jg<f9ۮ:uL0􆽔4ϒwC̀D) (xZRS$%*%f-YL'%.I'eo5S5B ǂ_DL$ r%bs{dI>)&:cq0'椔vDs=ȉ)nu쒖J5I$OUHIDң=) 'O%3h#@<(NĐ' '`L AI*LSRx>$f ٶav*R^)= T{&)QkAKSOhNR.vL#x\&<'5=܁5ˁX<Rہ4OKB> M/T-1Q4QR%;SBHzs{@R` )t%Wi&|b"`OQ3%34$(Pd8 M}R- $%)OmEruS}vi$rR9rZ~Hcc\Tu&>؝Ȯp f$A>a 0ۈӺ./$JԌ۩BXwU6vE)I$$I$I)I$I$JRI$I$I$I$$I(II$#rkiPk᥾)zfĐIeq!`CCF5CIK$% c>'0Dݺ;(fAR7P?H%.dwTNt)ݺRI$@E-*wKL!)I$vlsHïm~RI;5ԡ"mk>"fhI!t)"$I$vIJI$DrK{lMզ< RI$.`jf2L=JqiIJI$ep7#鏘I^ZRRI${!%)$C-XE}ǐ8dC;KivR\vڴܒI2iAmѺ4'..Z?#̤]$==:& ϸ@B&I% Y8B{`2I4B:)VZ(2G%)$& -ͷGhT[TaN%.$d})#V<6ϣIK$2d 8N:w w=I]$  |HH*%I $3/;GllITI$eڸH5y%-FʄI'4 Gc9ԨO0 IIJI$#EnU)}hչI(^T$$H-:9H1BjMh>)%d)'c;C`Gk\?8|z%,t! A*c!}'>)$?H5+Hv!0TA$Xw5R?|ձqvN!|;av3`E E%/A02ǧF]DnvLC׀)O¯mh

31m|uEI%nSCu 弑 U*IN~OJ9SZ^I߉^A;T&e 2B[x9,8 S &$,a{G%7RĂSr.}RSfL/wULv&yV-?EX>guuTݰGUQ* $wN+$l4$R^wO&~+Q$H会CKJF@)_'pjkn:FnK7@,幥Ā;*XL|{"ӎoeEZ@D4u@f,ϻItk'3-đVl[3%05I*z/=a%/mɣuhth4_ǤQXkcIyX R?SehJ2^Cǧ:KS*wo"%]IedϦxG?55XX ̞PBT1iF̎a%6Υ '*x IS4u e6?I"f=d|nX&]4{i!mnq8LDx}eQw^M= "J~@;p1>rn1 =yZrLϯ2b!U̼_so hc?FcbsC2 /sLʻC*w-QݏcZ"e lsԪ/'v>p%T"{,k2 l69b'MAk{8Od SecFpx }{ e[uVCD@iV.㒚eE864bv4syq$hW!H !pN&ehu|2$;,Vdl[f zNŴhYDr~ LVSVu^}TJ{]YӴ tHXs=k=TYXq1 Vppí tk.Kpo Lep] De2mw6DžHPqɇI"N 8&su0m`䮴ilU>s%f$2nsCK5M#Ҋ`5ZZ[d :ׅfde;miw׷NPt0m kDP)*JխGU^xk? 6*SkpIK':ܖG 6VeLZCkŸ^D|2qOyY9}.=W(W1nD*qj:f7CHN y*"+JM5(D(7=D)Y=tj[^#ħCvn:Qov>-cLzML)jY42ҞY[ sWv*Iv)znDÄ[ÈM RBN1SX7jt>\&"yoSH!%,tsإk L\O))I$քM6ܠS<RI%-ߛP껆I[ JRI&D/q=W+Ĵ>A$Jx sϢ2{Ȑ4d#EE@4>wKZ o hR"uR{ %$IqNp{&aASe0LxH:wS1C-qZo-ږR !$B~ KhvL] s)!pLp4HtuIF%,F 6 q0ݢ%Iyj̓>iiN)t&oLn:aIAaKLh~iDϒ vBfa 3^S7MlJk$5vN3D< t$(_Rs 4QĐaLqC[vtLZtSY*Lռ$HuN:_`iNJw2cA$uRLw JY颛\%GyvIR`%t4tuIHH: EmP'N#Z R㔔C`L JKU6 &hI D!#^ɞ'N5h8`(Y;Pa b~ FN!&ѫFX)ډO '";{Oe:k%!9=Qgw} J>IL ZAMp ~vS:&ƺJH'Kk{((J5C2~ )i:7ƍ$HV>*gcN:(`m OR6zh)G|cB;"@D27NH8H|R)3:4 o; ƭDR]j`5Op5D}>n=V_u-hG*BKLTNh8IL~iC e"cGh{)5O)v:M$g$ψIK@8 IJW9tD5;D7v&-<OLDȿnp:PMcYQCqa'"4Ԏ'l$yi'd LA"4Qk!91S3.tTDFV-3)C{\ JUI.1BON4C˵5Um9(VrRRS_EBS瀀ZHAv h:RuਆnK&X p1w!p`S60EDj[c٣RRv-&/4{ On {GdݪqRSdoi1`I)B}Ғ"JL>ly`R:\'Dyl |TC84N5C.Mn!Ǚ-#Nȩ p"eZ>uO!vR3:<7 b۪#|psq1RjY!TNG1c'@c]6H;ÎA:%2`SqkH-%zi {#zddIHvFGu]%b HTv #" ?5/4-)UB@_61xwRvB!i<ƪ.i5TؙlJu^ScƳ*64)T$g4AEΝ`Ɖ:۬xRqHI`wALk|HLFNxkwcP.ݎȮe\?4OGIŷݳV.fJ>?BI /6oj\<gCO"Ly.ǫø.7M)X=*/:E1ABDO|]JXJwJL;Hnn<ְ>)]ScQc*4`V)I! fAL70F$LTlDĻ1?NtL&o--)H6]Υ |l,kRE-4&00D0dH(md<)at;8rJW[I)큯d պ|Si V蝤 '$'mv sCIӡLy$48셑` =(!0'fO)wRkL?@ih ą&;^.$'$LBd"ʶ wr w6ET8(g9syOx28I}KYILۚRxPq™I*񄝹%%.LrƓ&S{6I0*dH%#T 8SI М #GIZN$:OCS-&IRsĕ ̤M ja{~jB;&@옱JITJZ$ba"P¶i%DA?$ROt# SnDDI`Rc û( ]BEli!cΊCR n@CuD2tPRG "nj珒AҢ熔2CF(Dǂ(k– ^SU$%yNnJ\U{A'S"9@ 6x3'I%?uLx`ЙGKsI45sB<C$I&7̩SD~*A%)$Q}EIPEu$ qBIJI$E$: RI$MuML{#RI%1Dč`ܒI(>)5nni1}p䒤I0vF@;LI92>h r))IFk4gޖ Oz?N%-tĄۂC#Tg*[1dr _D4kwQsS-i)IKUI^U RRKTn٬Jwg`~*F䄔)!0B4R5hIJI$@a[eS=G L#\A2Dk/oy't%TI$좔IJNJmJTU6IJI$H'WSs#(<8$J2 xI8êHԅ T:JA#oc`$$Jsƍ }rÿ6iRВIOOi: i-)msF|IY$$~*! 9%)$^|#G0|BJY$~JU 3OtK:'&~ "<ㄒI3KZ}w? c)a$EzǿvFJRtڤ{;k &G 2t%:O*D8"$I"5a >!>ƝXpB RI$׹_sTMA~IaT\#$&N63?YYixqk浱 WYZVHOҏRahיXd;A.Nph'fFTɕoM۹DܩQ))I6PʻЩx >?hh1>V+)ld G8DU\e\[H1UBܧmsDH1Nޔ[xt(X>fQR?i$M=ŠvTt6ܵS,us[πP zʪ7R@Af5IH69Z5 AYY=.DչQh]%;4k'A%7BnK=F2I"SC#}P^ HYuA ̫"}3'HpULR2QݓWvHRmPe8wTsHit][[ʣ B}2NINN7J i  |op;wκp(FcX`򒝢aG shÞ%XiSCTȣ$0R*ml47Kh=L\v(%}a3W {@q>w@W_YOܳRSU~qa%8ܖobO)2o9n* .0DhɝcX%2u*o׸cDfI*bf5h%6WѓݹS:Lr JD7GfPڈگt@VTIʶ*2+x+9i-镍d <|U[!tVS8+,XeNā^ǫ{d&{#7yܺ3lAzJ[+2NN*I2n nZ*yv·`$iF"7Nϯ;n0$Rx>"$w5 N⨇#a/7c S++( [h)Z-<%o~`GSf&݄eP(efjn$.Wp?pȭԟxlqrJ3MncZ*]tޚCON0?@֨k:cw5fn[:icm" 1WVq_1 ҫ u OY #BTYԯLwP0N<'1n6CkZCNjBt+zF-/}`S~K k#u7Rx OƱcV'Em4ʙ!!e&Ug1ήaBR[3i#g,tQl*BSHOlE`bTh, v<;C1븂G^9;B=5P:䡕ӫaq45T%@{tVƱ 7'h!ER[V[*Uucw '3>)Ԫt"Y.?X;!1qqwKjq-`Ջ$])TٽWcˆu[`^ތ v)TwK=)JiU)cqvJc?wbfA@Lch2)v[c̝U5kdyo(XvvjDz4njJs]4xW[kijXvJSB@STh@J`K"]G$(7<)WI2u/Ko~ϡů ?>I|:`Q3bmdhYW^lܭ^U5gTc2ţ:*hu!<<Bj9m.{6!Ë́p\QqD}!t'A >P"5EJI$ %Zz'jOviM$h m~v0]ƟD0\ۃAlB'3R]ÄWYVB;sZ~δb忊`x~(Y.l l I-vv)H\YmZrXey@_($*9.dAUETᮋ VfճfG~9C0Q1*D3XpZ@@,`,jHiIo*t8;Daa)0u-SvYAGd8iDn醘Y=M΀i3,UNϴR+[n1Gp FÂn˜`.>I#E9^Xt\gN,X`۴zdBp(!;B*sm`$f-QZI0p)M)I I$e-4$$JRpI'S $ )$\:D' 'D2g3DQZ G O4JJd C'`9Qt6L˜AL y$i'T ܧ|FNG*&$.)@?> mk >ji)O %"\\~ c@vA% @=lvIJF^D Z='h'lN-pv@8}-FD&>R-DaGe= 3A|PFqhHi'rt "L(z{ ."hZIb0pyP?S@a!nD%0G|;Hy)z30{őu)$N%vb Aq DIn TvVnHh>e$,CI<=ƺ!13`HH ;VlwFܔ-,́Oq+H.8#kN*! IMtNbTIOnICxԋ:  )]51P'RT mݩ)OT͆|RA@[rT:d$))oi ) OD)N ‘:xH5ǞnHQ ùN\u>)a)tMFJAtalIKpqӏI&$\x 'qGޙt%2M;]k옓 O F ÒR8?4]{!ӨD{ntLbY6*Mfro!uF}l;2/4tg?]xDhDl|@{%"ysD+4@Gt<0-QOy3H0qM4p<8=B"Gr.':AlBF!$cC"MFz CQ^鋊FH%%hopdJ\p졡ОzpOa?pqdܥS瀢Z {G-;{ILÈã _OnE۸D`9*Uȝ$pCIgO n'fSYGsׂS*wTCjyT}6|J#X}40v%2,'AV-lA<euDu nBm ?Bꜳ[?}U3SjI*mI$I$I $ RI$>|O]UZ?L.R<Ը>yv濜ȸAk:.ĸK֍3Έn*g2b9c^@Q&?DH)w rBe"tUMAƢ!3"y6"7(08--fyDSw9So v;DV]*mm:~* W=DTG OQ#U>HxΰoSҎy4w74%iT'R,o1/=d';<v{0]"x!ΐ #=Of()TۜvvAELPk;O< 4-1rѩQI) 4Ak:PC[Ji"A{A:I:Q:Nxr-v#@yB ``ƅ$ƚF:@i:%3:$(&59\ֶA'֐!3Ci.&<;' `GgEbփ(xI JaEIAd`d8O)6Z~IL13 $L)Q{kz㦉gX'O*S*속Sִ4-<$dN1:SjyA-@[c[k'lQ֍N\thˇ@*v*<ݠPdp5&JJH!-Ҕ`aC*7" g;fuPcn| B3IEk4! $)V{'HxNI+4[JJ{ܐfj:( $-4yOl@4ᄝR-q$v%" )ᇾr֗6;wEe{ A쒔]P$4S.O!1 E'hpߣ׌N'j d4L !7 ]a5@4"U'udJXǸ4V46ڎS@JPqRk! I*UFWl 4M.$Xy6$4CN9 XI$4I'%4 $$IJID$I$:JRI$I$$J/QR)븳)-RI$8%&>)<@ψIJI$liLv;EЉt9%)$Qe<|Eg zL<8$$d=ՙRݣzJwR铤& oƉO~"$JE>i'甔IL 9jS69{|)$N x|FpM JRI$Z{NS˿x&夥$J[<M*mRI$ϤICNy)$Da`IKs Q{AJI$҂'F~U6OAIrA<JI]2I&~I#!9'$$IOx ΃TiS7e%)$(l. hu:D- )t'C`-SM?$LPQw~(m>$>i%IhZGM.d(`'#I l:(<8Z]MRL!(ą!O-I2u\dFqQ}$#I$}Nziog()I$8NGW`&NI82 l44pz]-}}I[xt W.;Dw(#gf6ّ↔#MgoSӏ8%&=þ(}2ٸݻd+8 Y=D0D#bዘ\IJifYdyֵ Gp3#U.Ű1UbIJJV鸷E%7$'x  $q2:I$$He:R\̗o{D+I#̴F/I{# Ԙ]A %e1ԧnpkH IU:sX!qGzt-9[fIV] jHjd|޽hxk?_5K5c ʞKSe#XKfLBCIgb}%5 }\܊\\_uVXj xkɷZS V UW9 I%zFVGK\uFŸ΃/8;tNCe# '9zu{qʱF߂Qգ$n vҫ:w)X=OBTiϽ(Ec\$,v87B5[{v>c!^̑zs vV iЄ nF+fTn\JҪ4*hieKݚݰ<^gS%ޙdO6*sZ WM!lVhv-p{ˇrLRkS-^Lu{  Vjw g&7UaP,*?TK6WkqE[7}DyQģ`y*:>d,[YIX:] \$!TkJX֏gnBi|;VkCʮ&tCOc57v2FI:(MU@c½Ӯ`z(Kn],i0es][Bŭe䨰oʔoyypcHatGMbܥ]DQ%a6.)I ח$;wSkg> ?sI]4&SJr:* gcc>^;R 87@OOFI&sЦqn jC *GV^ݯ> &"L(JP{41b?K5is7+"Ҳ#Gw(X5fQT46u5l:,%H&e-;R۬@eh%5aʗ8JL{ZcpYymc.aP,n94F%3->W)$0rq)ݑ{dlw0ZƊ>Hx":$@ޕn8ePnIu[0(2m!hf$c O b ӿ$O3{kǴXt!X+eW~ |vWqb[L VR״]F %`-Vp3 ,q 3#ݽ]VmTU.  [ݺ.j e lYFXC @FUd;G)R$$I 0NI#a}f9KcŭoH+Z (wq#QJFAZJPx|)59V \NBN&> N8jNDj9NY:JJL." I$ p<&k$ZHVL R#i%6fC6J;ƨpUy#;(Ri.;5Ԫ[(Mk' p3C sHJJJ5Dv(f0BvvC2G[DH"OlA;ӯ s[]D)6*[ .RS7&T\IӅ@_X1 1<E;> )3,$›/4 No`Bl ѩR蓉vIK IeC ׺w 4l1HM|Ru;\` Oo8ڍ5H B Z )q1OHhIQ8Õ004Jd[RNsKsܤ5IVBҒAA:$$Aqt:8o'R:4)v. )L4nr;`ksݡ(V6C¬S(:KKhIMD}!UsVӵ4T@q)`HɚveoQߨ@a5:xߨ* FOL hIO;~Zà۔OoA"JJJrNTC15A 4 !a򥴸$-p% -666ʑg#2 |Sm9DfbIIZ$OLwZ $6w#5HO`Nn𒙗[Z\c:heD3Slv\j D@PRCdAkKnpi1WI$6-Ax0F+mqnoL?_TEvk~k2p%\@.{8 D אJEq&TCF0 5 Si)"4%$0\uwv?BN9ppZI2xL&v IK4 5*unhBbEcLp.w*-$hN' hxKx6 pFi mam|S0tܧ t!\`#R..OhS`dLq--*j4w*M#AI JIVIjtA֍O heIûq+7K/ټ=°vQUl=‰-ShjS9Jcdx $Ayr3ϻR<4nhuII06`: >>(:v@I&h`) JSd )DwN^!B:ʉ~I)ZDwj9hM{.t4h3(a:B癙Ӻ4+%$,-ӐT"#pw6 8 A{JFA(m#ₘ:ewܠ-&! Ố|*wIK@)-[*fOr`Bg)3*[I"ϐRk8L %G=Fi9h4ALx#RN{KD.ײyx\؈ 昶%& k0C]3%!`vBvpyQc[uIcx-;@u))gpkΤ- /q#@~w 'RBAQS0bGr`DDHGޟkt6w)̔?BI /6o#'xw ˈp9;*igĩؒH`!EÕ`8l~PJ.c hJx'sDπ n2p  )bpu md&DJ!DTMr]֤JN8khi0SD;$)R.T)0jvɞ1'7 >R)OV턒'S>oVϚJEI|(fƊGǺq Y;UlIV~AavD7y)8O nHD@Ui`P}&66EsrhpWK\N͎n: HזӶAEqH0rI&uUU c!z4E"x,~F  DnP`N<;X|Z/q$QEh)F 6Tչgܝ2N?470Dj۴+Tt9S