ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 10:29:49 &.(6HH Adobe_CMAdobed            O" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?םq(y{{XWcCZ ny k[[Pocsf`7e<;ane<]tӆ#MxcE[\{ݍKe8F?HMV Z_0ke&z ,{X5gzuðe{Hkkm方̉oۣY~.I繂}̴0LK~ﮝ|+ysym%re51XI1}/ja{K h0w U_G׮>:[ŹX}fֵzo_3 ޖ.֒/pk>f~cׇӚ_!@ Z{뼵 XL $Qtk$NZ'~̶&'hoi {u4t}9$:nRC[Km6!tm%Yi.{ꁚH$ТI%<{c [[]o4$ZX͍;z1#7ׄ _ւGX̂Y?Yu+:2G*yUo@߭Y,fi?ኽѺΩڳM>^׽ٽ6lY}>`+{ s#{^~bާzv+mѲK7:˿=cG sZ%*>&ǭl>).g2{w=/%եg9Ö\GXaS'2m^=>[!ouպSk=47V!oŭ9~lv$[PZ<i湈tU]z.\\g~btQӴn>ݳ鶿|Ջj[Ƿ:}6ֵq1`4ߙWjm Dj5>[0 [#%jI1m\Z*Ρ5杶׸}Un㚍/kwROUgK>ӎ\-ڽ3lWX?Bv=guoM/ݙY6}u$ c=n:s}L \V.-hhF& k^eۋ\vv$+#H跡@&Uu!ι7F[b0.~,+uWXcS$*Dx$g.PޞkwWS%?ƿ"3G}x"k^ )nEu{"uCWzCu׏[|sć7齩)֪ڽz.y\p6u;,cL2?f).VVi6;?;Wr,x}<}}%u;S_*ִk9쨝_ƻ E:LXh>Qf^˘״ `j/Sdp'b %C@JQܮrtI4u5Zƺ/3 J1]?n67L+r#OODϭk s㱾!Zֻn49`ԦϤWT[mdRϊ漹."4EL` $wFnH׺X#zWlׂ׶ݨ-gv?[g|G>keD{k[{?>윃NF=N`-g҉f7~zt+1Aξt5gUťzO@I~=[F9[,Qܩ쾧4SVN;L1e~~3d3sks[U:I㺲獻-۰:mب|l3aEIK61s '@ )y $ Sekֶ ? +K{,s7ȏ^^`}c}1;ksl?Mb2El[\^:eE"Mgj{r} hFSj#d%iKkԒ~mm~[#n Ds*sYvf_uZ\dΜ6M 4=VXmLc:X?+="?lXˠYJ~K-~]|6=K]ѵ_Gv=g`26v8z e] u :oM 4_?Q~v0c,L>}n$:=׍ҋwk&ǿG 2inup/?h~s/sJ]άҟ~r>_S詞oݛX==S"Q4@}qIJqP&ۛEm\[Zַ/Qis5mSo/E_\3W*p-ݩe[mK:k{z~M;^ۯoܼkgܮ ?N-:r0VI-/uErW걕ٍmng~w;_JMޤޤUoe0ߎ.ێ^.\5iI4qv[ZX[?aRW:]k܌'9G:[ŹX}fֵzo_3 ޖ.֒/pk>f~cׇӚ_!@ Z{뼵 XL $Qtk$NZ'~̶&'hoi {u4t}9$:nRC[Km6!tm%Yi.{ꁚH$ТI%<{c [[]o4$ZX͍;z1#7ׄ _ւGX̂Y?Yu+:2G*yUo@߭Y,fi?ኽѺΩڳM>^׽ٽ6lY}>`+{ s#{^~bާzv+mѲK7:˿=cG sZ%*>&ǭl>).g2{w=/%եg9Ö\GXaS'2m^=>[!ouպSk=47V!oŭ9~lv$[PZ<i湈tU]z.\\g~btQӴn>ݳ鶿|Ջj[Ƿ:}6ֵq1`4ߙWjm Dj5>[0 [#%jI1m\Z*Ρ5杶׸}Un㚍/kwROUgK>ӎ\-ڽ3lWX?Bv=guoM/ݙY6}u$ c=n:s}L \V.-hhF& k^eۋ\vv$+#H跡@&Uu!ι7F[b0.~,+uWXcS$*Dx$g.PޞkwWS%?ƿ"3G}x"k^ )nEu{"uCWzCu׏[|sć7齩)֪ڽz.y\p6u;,cL2?f).VVi6;?;Wr,x}<}}%u;S_*ִk9쨝_ƻ E:LXh>Qf^˘״ `j/Sdp'b %C@JQܮrtI4u5Zƺ/3 J1]?n67L+r#OODϭk s㱾!Zֻn49`ԦϤWT[mdRϊ漹."4EL` $wFnH׺X#zWlׂ׶ݨ-gv?[g|G>keD{k[{?>윃NF=N`-g҉f7~zt+1Aξt5gUťzO@I~=[F9[,Qܩ쾧4SVN;L1e~~3d3sks[U:I㺲獻-۰:mب|l3aEIK61s '@ )y $ Sekֶ ? +K{,s7ȏ^^`}c}1;ksl?Mb2El[\^:eE"Mgj{r} hFSj#d%iKkԒ~mm~[#n Ds*sYvf_uZ\dΜ6M 4=VXmLc:X?+="?lXˠYJ~K-~]|6=K]ѵ_Gv=g`26v8z e] u :oM 4_?Q~v0c,L>}n$:=׍ҋwk&ǿG 2inup/?h~s/sJ]άҟ~r>_S詞oݛX==S"Q4@}qIJqP&ۛEm\[Zַ/Qis5mSo/E_\3W*p-ݩe[mK:k{z~M;^ۯoܼkgܮ ?N-:r0VI-/uErW걕ٍmng~w;_JMޤޤUoe0ߎ.ێ^.\5iI4qv[ZX[?aRW:]k܌'9G ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/]ߪ_ݒo_6o?}&H+$TTUur;A~.y%p?R,gJ{ggcMĖ?i^&kXMXK? w7?Ia^&?kIv7lToҩ{gA_y~gU;,/N]7-c?U/n[r^ܿ4oS+)1JJAqi.ܱm*7-c?U/n_ w7?IaN_ӥ?? iXKܱm*/}?iT$JJA/ҿҟ\ZK,GJXKۗƂwXӥ?? _O.-%r?R,GJAy~gU;,?ҿҟKzt?oҩr?R_񠯼s?3Ė_O%=:WSc IvܷhToҩ{g_y~gU;,?ҿҟKy?oҩr?R_񠟼s?3Ė_O%vXϥ?? y?oҩr?R_񠟼s?3Ė_O']+)1ŤOn[r_7hTWh#0Om%vXå?? O.1%t?R,GJA_y~gU;I,_ҟKxtgҩt?Q_񠯼s?3/O%<:_Sc Iv3hTgҨ{rWaNKxt/)1$?nr_3hTWh+0Oi%<:_Sc ]7Lc?U/nr^ܿ4~oS/)1KJAq.ܱm*7Lc?Un_ ?w7?Ib_å?? ėg?XKܱm*/}iT$KJA/ҟ\bK,GJ?XKۗƂvXå?? O.1%t?R,GJA_y~gU;I,_ҟKxgҩt?R_񠯼s?3/O%<:_Sc Iv3hTgҩ{rWaNKx/)1$Onronr^ܿ4~oS/)1KJAq.ܱm*ܱm*/}iT$KJA/ҟ\bK,GJ,GJA_y~gU;I,_ҟKx?gҩt?R_񠟼s?3/O%:Gcc_??I)%n?XKqr^ܿ4oS#11M/?,gJc?U/n_ w7?I`ώ&kIvۏ?Rܱm*/}?iT$HLK|5$_mҩn?XCۗƂwX??I>zGcc]6lT,gJA_y~gU;,?=#11MqI.qr_ۏ?R_񠯼s?3iϞ&kc?U/mҨ{rWcNK|4HL\RKܱm*6lT}Wh+1O}%>:Gcc_??I)%n?XKqr^ܿ4oS#11M/?,gJc?U/n_ w7?I`Ϟ&|5$_mҩn?XCۗƂwX??I>zGcc]6lT,gJA_y~gU;,?ώ&kc?U/mҩ{rW#NK|t4HL\RKܱm*6lTWh+1Oy%>zGcc_??I)%n?XYXê}oTXߣ ]r* k$L x?&7}%>z?ccOUurDn$LgmI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$u Q>o%()+t$Nz=H i4WIDJ:K%ezB,QDòޘ4RE.dVY4 Rhb@HUdǰ-)"I4 $qivԴ]$ҔjQI2t'-#xIJI$I>x?B'iIJI$S_D0I&I󴡖tIJI2t)%& $$J)'9Kc`JRI$$&10%%)$QI[D+V7jRM$hX-˺+!BDþaTG ڄh$SI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I-o}COKk n n.!r/N!"/\8HGś/@̫b\Ust?\:Kܿ SGۗƂ߽ciT.c~oimMp.1r/NtWh+Xf~gU=:KQ'q\2K_NX~W0 Y LOꧨIrd#oj_ҽݟMpi.Ɖ9Ztl:[n3?3%y?0 ?]6C_?6_oԼ?Ƃ>oSӤqcmI#?]6_oev/N/}lOꧧIst/KokIw#X:c,KۗƂ~ٿONC;511z!c]6_/m2^Լ?ƂٿOJ$E?/KۗƂٿOH&okIw'YG:6_/n^A_zlOꧧIsc3ԿkIwttx}?3%ccs0(\BK??_f?_4vzD0?OBwmMKNϬ\:Kܿ SKۗGޡ7?R\81?/f?_4vzd1?CL4bC&tqK1r/N/񠟽CoS$q:'>1M!0! \:Kܿ S2/N/񠯼öoSҤp/cc /JmI%f?_h?_4vzd5/DLOELAq .@_f?_4vzD4DHN_/lKڗWޡ7?R\?q1:!c]6_/m:^Լ?ƂٿOJ%ELAq .Ar/Nk:^ܼ?ƂٿOHh)\[]@ڿ SKڗWޡ7?\ q??/h?__񠯽CoS$qz'cc_tO5äl:_tx}?3%̟cc_t?\:Kܿ SKڗOޡ7?\811M781?H@4_4vzd1?C?Dpq? tqO:^ܿ4vzT3/DLQ?'\2K?Wu!,'SAz7?\ ?_Ao7\*Kw_o_௽CoSԤv/w&WBg7\2KƩ/j_r?N^0 ?w7?\Wwv4_Nn&$vk9_Pܿ SWޡ7?\wgD\:Kgazt_iCb?Â3s?3%2JmI{;۳I%MgCw-+G9OZݟMM7;mKt}Wh#Xf~gU=RK/?s2zo?]Cߨ:iC;x.w7?\Ɨ{?a5>Pn&xX},Sf:p;p}?3%7gt{?+?Cqq?/ev/N/}?3%?cmI%ev/N6_o{rWޱzt1GCL4\\2K_76c_/n_ >ٿON_&?7C?&tqK!r/N/񠯽CoS$qccoqcmI%ܟc_/n_ ;f~gU=:K'MKۗƂٿOJc1\:Kܿ SKڗWޡ7?\8c3&EL\:Kܿ SKڗWޡ7?\??I'DL\:Kܿ SKڗWa7?R\8X&8}11Mp.MKۗƂٿOJG&^&tqK1r/N/񠯽CoS$q:'cc_tO5äl:_tx}?3%??/d:^ܼ?ƂٿOH(ct6q?/f?_4vzd5'DLH^?OWtُt=Wh+PiT.a#&n5&tqO:^ܿ4vzd1?CL4/ Kt_௽CoS$rwoi?mI%ev/N6_o{rWޡ7?R\9= 9ӟЇcmI%e/{rWޡ7?\ .?q>O_'oYSoW.Gdm g`jECd#șcLJ6/12Ko./w&:WV Gn& uX)$caI/?M<Tzl?'ïX3oU\_huKk6$Mt=N:I$!JI$LSIJRM I$S'I$I- $I$ ]$ $I)dNdI*I$I$I$I.2tI$I$I$II$I$dNSJt&I%)#IL$T8QO)I$I$I$RI:I$JRRI$I)9JTa<'I$3%6ۓ% <$R&ޣ <% %$%CrbВxO !$%zm0)BPnKr0xB96=;a(RZmnAz)B RyM؛QJUi% zUJ )<Q/QF(JUQ/QE(R%Z}n@a(R6=D0-L^lKQKj[RUޖ[OP-!>ު% {Rڒ;ުUJ$w*ԽEJ%6wVR6BP-)-꿪zBSږԔޖ[KPOj})-꯬ B&Ķ$?Y8MlAVޖPޛCbA-꙽7 B.Ľ4ޖt(J%餦益z}_M-ڛ %?"⒭%S9H=熟A%/oKSkrEʸur_h.<wDm/ySn^.#~/R+>1pI$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I>%%)$@W[ _2Zu`j=Q.۴Ӳ\O+A:+tYIZU4NYJKBs`@W}hhՀ+ qFɕh态sA#Wd JNPC}#S%V{bghE*YbMcøV&C[Vl2|wg tR(b~j|Cp.9A(Դ{5RS[[2-! ih>8d08. ?4q/BʚF].sC$4Z,GvIZ5Y/Ӳ#\AP mKVL!%Rac\CA)iq:USakAӑv=^ xdFS-0i<}~EIŇVJN&@!%{n9XVs>}- vC/ =p>E#ITC]w~ 4%ΉsT=ck[b U v׏eE#_]VcZ -Z!qX)y{@ҵSvoVRc2f|ۭ`a$f1~1}wTaDϚLaR6f,.vC'1zͻ}v {(q!c݌B h9Zb:]~j0cP%$SFCn`'=K:XU"IUzh.sdxrޜی8jݫFBJuG "ÈP.ivtTnQ j\5i+U%6 <Ξk]5r =SGR=[(?c.%-76F#kۑ| U7}d(:,\Z<|'{GZp$0ZթPn t4 iEThR6he65*3":[iw&tV(8.IHGjn¥AsxʨΠNsZ@UEC\G5m{4b0 %\KaB~B5wpIGAiAY=O_Q-S]I[`8#E:P؈O4DGu$r3ˋF+M)t[i!Bp< $I!I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$m>ҽ yoC^_<M#Ļ/ +ݾ.e2t:M`uH%LpSS6P=" tp>)B@E[0hBw^RpWil@(x2Թ;rQ lMD)KeC{B+i'XB{6U8wUQd0h]iZ\bUi Սct(otӁ2Hm()h4ÄZASw%F&RxPD{ `p4G L~Jժ(s®m'&)) jEܕ&1N#Dg J)R)oN˜UʉOYPD<4 UfhVF" a;S98HʕgEpG*!$E)JCB`3~ +>lTxTv&r)Qg^eTTM M{H RĩL'7RV'EIˆRw !EJS$Q!8$TԧLRHZ4:FNZMQ*M Y q`‹JM.gYRܝڨpTz)X᪋QbB9SUI8SeACVa0z9)?DŽ膧z'lx'{!*N~+AX*lvq 21[)59YkhYo`Ze"7:S1AE*a0b-lB`STS~eXL#U ⡖-WӲA48kXS m3*'<"MiPêЧ*i %M%H)!OPt㔊A.u ':$RP*j+PG LdݠQiBu7h'p#CrQHa^rO*L51$"w*M*CPe>GU;YBIH$e.KI)aT GvQ'kW}*(訤2)fQ I$R8)tlQSbEryݔJA"%n5DX}bSѲѨEҧg+Y\Ggu|ؿiFoc׌S^,f=pi$I%?M<Tzl?'ïX3oU\_huKk6$Mt=N$I$I$EK$$RILI3SI$$I"$t$HRPI$I)I$I$'LI$ \I$RdBI$IZI$HRI)'L IE$N&O)I$T0)$2JTL$I%($I$I)tJtI$TI$RI$I$.$&NJY:d$I$$I$BI$I$L$I$$$I$'I)I$IK$R)JI'ВiJa$O )tJR$R&$O )tnJS$IKriLt%.R%4ܙ:IS$ɥ4I<$&M6ВxO )%D6(NYJm;O $2.M*ɋ$ g)CrbO (EL&܇1zhJ(IVrb#b ԡ%&ޛzB Jiz7 Kj}*oQV6&6B[TڕmLmU=jlzCڜ5jc aMQ1N>%BQvEm?OiRztuĘE[lhmO >pNa΀uSKKW]VsL1Cj]%Oj!'7UZ% 5V/RT, %jR/= p=VPcZMՎvyQvI:m+s2 cdv:M? ڝ/8kUb9 CEe?N[?[r_çqYB OAN;=p[{Fuq ?U=?SY}Yq`Dځ!JApg3m}Ru)8BqWooD^'ȩ@3|nT@pjoސ>k}t .; +=S(M~n>pY_!W}ncuW85q2)[7^rs١Dxb43->QPUViu?$V\i9zdȞ-c\e܉Uwx qp4粀:S'ISV;zݨ5]YshUSw޵}"0d$h?xdpƕ|kML,ai-p>35}@Hlw66YooBybFpf7jH x߰A6{j@L9 Ӱl'(t|6<,(.}RТ쫛g:$&Dv[zq_Ȣp,ն<˟a'nnH OrV}WIhך8:XhUkf`sl5:(CCOzкu4L}ڟVo,:*7[,cu%[4y['vF6o"зUg & kJv!@@d,$ ѻF)1س@ O !%1@FW[Gw zN)zd'B>fyHHU};:QF#XKd`nlt(O27'mnq#Ylx*.Y>gȥskl!s_p##WYrJ# 11HԄKNooG42w 72>@PoG?I("I$I$I$I$$I$I)I$I$JRI$I"c!䤥$bcR蕴~3#KJ 0W6ܻOZЬk3Rp!6SYi#YmIBDHNMFJ0ی62Ugp-7aW,k|wS fIDgGh!&F3W?hʅ:*v/!"t'/mvJ+CK4SX .⚖sK\T[[su>³+%o#u_ 1.A5F;]T2a$5ku"7@V,ِWy–>;Wu Jߙe7=kjq/U.c۷p? DֆG6 %MY)v׉6~%,Gyor;y's]jN[sY=PYp)˘9G)Hk X`  ){aic[m62q&&ɸnw5C?ک-C{ ,h>*X~+j#<`rC[bGXWYeABԖ]WI,r>+U` _H=ةuNUȬ@?kU7W0fb=FC>*ˋUfH:#אj]LJ1gabzGTuukvjm3U [Ѹ"9 +f+8hgEW%Nj.fC`c>Q WΣ74οpqMFHe{e8,Ϫ}_!89mvub~.k*~-Y-HC5ܒW_~f/Em.T;,Nxg"tgdZσѧ?ddH&[hX='KWk_QtI +ԯH {Ee-=-ƫCfTmֶ?UuoumldG r54nboi%|V_|;뼘d-`Éc❔>?3BlFzf8uB CkƩ%W~vyC\;/%e .kDH}Cג 1K}Xk0c?fYcuGmV>CihHE:kH^}u}xIcuӛ}Ӡ bc?:E!s`}oUhk OrsKVMuԬ`%j{mZ5Y+xWg`ҷ%r6잉yŽ;8J"P}?Eσ jg\jM8 NEXwaV{h]҂d8X5g$#oe!oi~{Z4'TVc4> /}E]vtA(x9խT }L{h};=Dj&.u]H٧V1{[E{-!PxMOm|o-kK2X}0{܍mWVG1Mgx2LJGqnviBy(wL5iu ZXAh DILZ(8j6=osw "FIHñޛIU̇H{9vWY1ybu憿/>;t,RsAm]s.!k2 c[=*z\A'pjekn<mqx, iׅM -cE!$~t&-QC}5uQ>pHt=u6&[oC15[cKO>([`He1hfoidHޅgOZ~KRǗJ;{A {ϝ;<([@0+WR6eʤ7tIЉF hHl$-Meh$<·HnⱲzuk|BTU]B8p*I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.[;y-w]+C_|7#wȼ w#Ļ/ )$I‚NM)y a*dҚѠ)T~ AEK@)SgVJuRClX#E0҆ P:[*́ UdP@ܖ)LVk:T ZZD%I֡Grҥ 2u C阜 9uDA <(7pHgY+DAL(I ]GDVYT |7[թBQR$R$H$TAR))gIbLRE)kyJRɊL0R))k,)ʓĂP(Cw(GڬVV*:&S젥"ȠFB< t3API9$RpL!82-gD$JlQQU2>*ګ8NxPD* ,"$#+Aک4Y ʕ/Ԩ%z&y1 2P`a)Tl7jŠPI%&tI")8AApA@x'BM4UU&d"zC!W&= ,J&T )ʅr)T#F-FS<()12 QkD4I(: s=WmBP <)Jr)(9@Ȓ)N"¸SJ(pTSWS0ŨhBD' &ѢNl9SN*w3ޭL?H)f F{)5@p()O%ܣ; LhCg)fRy0Q%j}ZSz=TMbrb mDPLlBޛt6ڣe@vf4[줻oGyY_ͰljiQ`vECRg9 -w&>.{g$E..JimtTtO;~,&]~umTWk߅6B4i>ѭh.F]_I Mw܈`5Qyq0I)QSQw@}'H wQ ƆxaT̃hN6[]M Sj"SRj;$A$&-֓Wnmq{e7umqkX;Iy'ggcw {>rCLi(xb0旸kZŽ$7n7=67qԮ[u\u[Z>!rJb+ix< /L N+{+b0A^~`[\y -a5}S.mi෱l sy+/L)j1 M+dK@V`t_X(Ͻ&<Κ4*5 H a L"HG CfH2D}%UIʍT@b@ʻ\:mk/脽)>IqxvZ\bUo"kaG`.#`).!T *}`#X58!Sٷ"ւX* #@<- nOeb[Kb`#[`k0C]~E8]NX VO1fˀc?kJ2)}m$K'!ڃeX>=ck>tm 5b@ t1whsu] z<4fdudf45q(V ?;ql]8 QԩW]OG-/YM oQөhHJi"4V@5Sk4k]*q$=ֱ7Ou̗&\dx8QmR si@h+k K윖nQ=]ڎs dHYN׫H k~ :짠,eK %U;&$SV6egߑF4z'AC;}`m&,0{.Cqaoa&q~xG$obt:ynߥ9YoꎫgW54cWXvq}ASNkKaYX]N,`5G!G/  3n;[u6cK'_h޹#skE^EBYx߫tˬS̵ݕPcZ$c)AM[p{J9·{%_$;I1U1( N#T[Rm=Nw#͑dy r'T'dJYE4#g9R?hUzn8S״Uc|p Tj p ,hZa yl ;r2; t;-3M$#D64c6UlV6'[]Qxr.<~"w<~FP?ig\_V=O>֝$^.Z[Ҡ[}Ӭ/GH$Iލ$I$IJI$I$RI$I$I$I%)$Imt,aXau8Tv @DUtbvoDNJBL#p 'Eh廙?t'{6$<:mHnT7 l|R5ON N;Wf5`"'o()aǸTN'`Qz`X-iT8V6aDAk;Gc;#-[@%Com6;wmi8il)]{& JI;D|J,f+^%O$ƴÃ.}u!!,ǚLW:cPhop4o )nd~B~@)q~?d;*ս>qk!À'+S>v"AT3v%~iZ OE;L8.ggP:V>+o糪bAauhgTKlo n?a+YOnc?UP!!?uBf N]d+'PUBXZd*:|Q~+ o ~5j%,=j+=EmpMvԱ(w6ÇJlWK_u-y&YEЏn4d>K_q4O>XGjYwL!wc8j"LJ>NcC``౾n yX=:KA[Qi LǗ7U0ۘ']wn:$ 2`yVjikhEN_E1 J鷿#YedAr̃S^pfU5?L0I&~))]ŒJoO%guwuY eh>s ~qF՝׍紐ʛKl-n%Kq/:;˫kuQu<$sn+c*/HT k_rEkou,Wp[K7YԟJ۱lV1s )]'Q9C$]/2EXg|`G#*&&;Nċ\~Vt<UVXgQSBL׊۪c̾+];e]ʔ;r! pjׇ8kBXeݰi PIj6z/k{bVꭻcϲ˺oMx->D]SuhZ8elpU󪌢"fQ__bcqTo:Q l,]сAwQkø{,0ճәF1H!UaӖìJYnF'E,JAY] 4"[4IN'Lkw[41dK]uo _L 7  p:mtl0f3hAH`{~(X[Cg;kĤT*ں2nt׀$ww՟kM/ۨw;:;s~k+_E˗4L,1~=8W:;]Dt'6R/~BJwz'QwP{nofX#_btPKCkt\VIèv3z=2$Tnc u;&1 #`kGtS:ژk@1q]9Y5:rͶÿ6+V; òYc|5ϼDŴټ~jfSؗ;׹[gNu1Cm'Vv.m;z`vL;qK-0X8XD[ip`'* Ի"QipΣc`-qp ڃ/s[b粰(qk_`אdc{@:*`pNCk[<ZXvܨ87`Pc],o#ZgUl+[k}VQZ]9*;L0< =H#/L߄lƣ0iQk<$>.ӷ)8tN9OA/yg K[yޫwVvO9S@D,)Uf"u~٬C*ؠCI, 4*Y؆(d%O\}XV) !߂{r_rv-h&gHvY8c#."_ʫ Ht[d*=no :H\J~L]*I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$m>ҽ/;w]+—C_|7#wȼ%ݾN\:H R(NOD)MjAࢲ%IE]9 cTZDA(wQQN3ED56p%4C &1N5KuS`LSAITyA>!!_QpQS!FRZʙЩʘ@Ar;$ڨ"PUf*ʨO L vzڢtChT:TC> <)j‡OL8H:*]Ӫ{7uTTHH'd0~ɇ .fT[RL:dWLa+ SEE-n(wAvJNAK$Cw(O;SjY *I;d' jB:S:B[!4G(Y<B dPi+ 2yJr TӀsiO))iPU8D)I$2I(IAyS e "QKv&BE+ϹF0_"!92&" v1[z̅>EAH؍T 'e$Ӣ5(Ba+B3;n%RQyLr[l!:j~0NC#Pw %8LSAtPR rY;QaRq)UʓQ3Œ8:D?4BS(6SeTQt:E5 #cMLu0yN dJ(#'I$<()&S?E ݑ?5@#fʬ? ;1AM("7(ChAn H&#TC)4Ȕ7t7tHS!鏂dA2pY;DŽE";ݔ) z(*gv2r9!R4L$D&)&w "0hT-mS$P(B#k)V=D'b(whSiCJT@Ox(&]QP*NtBXJN ]%)fly)R=7rO*MDL^Tڙ;S)7E2 ]􂂝?IEJJB@#~VrW2%kz_8:?)W9H^,f=x=?I$LVI/?M<Tzl?'ïX3oU\_huKk6:I&&N$$7)$I$'I1)BI$]8*)dxE*1)LxI%2ң)nLxI2Cr[$$Sʆ&$2@a(O BVRT% C'\%M[rz%މO Q6D&9?TzmP9s BPR%:^9;1U(V9K ;^Y0w)5Vk}-;:^N,Yg4xWj}K'G{~)-ߠqGT&tNۭl>­loH1>VoX&7l+1)o, ]-\AOp{‰e׷>J#?S؟b(?<}xCrcj~ky*')*Ÿb)H"uMDڳ%0J8b92G$Ut@UWTJ1S V ,Ѳ⫞{3)N`So*'\`ZϏ+J.3ͩ_4(;:q:z"wqL^B~3blqGOW˾%h@YE?91tyxUjCsE"Z.մ㈭Oޤ HT8EF+<;FT: Bh:[nWՌ{]AR5 Fk΍ѳXwR${YmIj(G"v5u6[{¥_x'h8du.MO!npg幹rߤ?yC`m$]x]՟V{ $Yaֶ%5ݽ\Q&W_#MU 0c|pۈq:A3N~Nf.&9I $“s>!Dh"wtɛc]L]&Mm { |caoGQ;tvCd^uq/jEǕ8hQ*՗<Aowa~;)~4w 6"R}"< :c,&@8aM{rKq ~İuntoOh!ḯ?(g18 = ӌZ]KvWV<sM0wUum%Q>!=j3{;>>щzGuk$}ǎ.qh:S:ʃM!   CxTΛf8ppպksT ܘ'q2H]d{rS^.Yemya"IKP$5.ѫD"3?k{B$ޑ1yLJ*-pM(ٞH;*9Ĕ)=eD٬MX$nKҨ nAq-O~v+MۇG~F1\b#w֧6?m򷅵k}Qlt{-3=ק5,=W~F.$L^)$I$JRI$I$I$I$$I$I)I$6FZ⺁ ^g`Dh0sE!hjTv.$@1tŠSi𣢐vIK#S `BbJ}P٢1!  Sv`dZi>(%W97ltvl5q'Ts74{e6~X GH![:f9ef_cA(I-qZwtn||m 1uNeiCxwr':֊2X[EV.uE8dܫXg"W33i1C ?[0]1z7\G">hqO6Nc+"MS-,ɟM%_}nU,Am䉑C+\5%>΃)6쎒m}]Mx>}xUF̌bl-q6]VeCu>E ; ٫&Uil|UJl%Z5VnaF)~Im5L6#ȏTNvZH~ikL*{+q*XUmFql 23vHwMi.{^26:RSCK}Q 쾏M3GMped44R7ًn̰^Js.LR{du*S%փ%<Hp!ޭ;j꭮Sd1CpimB;q[hJu4cĴP@- f o> 8TA>JEiŸMra6?Ot+ 3O CCWFu 8։})0k&{,zU1q&H'Su7*allj@d݌k-&v4;]5\*[;huv&A&CՎk~ !>'^HՂ+|JE݃6ͭsGR~?Xc2k gJoŧqYc'cD9sAvr8[q;-'r!CT=`5w_A[ (7tdۏzC_Kd-?ds.p+>:Xdٿ 4BfV#BjAF`.ӌl^K]-'6k Oo6!7^@s6읣`ЃʕWD9 FQixwB}n(l3{WjBn@[1<( v0+A>$ŏ%][A&x7F4D Tqk)0ZFa "Tѯ`-.|Z 0;zb#e$vz84D=f$wR-=:q1x"L8p4PǸS0T+'3_0]cCf`鯚>@;Tk{;y*x77m3X;ʁ{/iiZIlYߔ;N[zgYWaJ*OSum29L('J^"D[8Via#G/tU1W \wX񯸂U[0 𣛉4{~Tk^gop7k?쯁O sv]RVÖꚴHDk&l0aa$H,HI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Kw]+o>ҽ )D5;r>Nœoȼ)CNMl"'TyJR %H&!TM L) ;GT9=z93`SRM@Ҙ)P҈P*% +9NTJ( e,%FѹD(G2SX4RPJC#U5rSUaW(hSEID>F fr` ",$y PtiBIB<&QR{5h*,B pu tQ%2T[I EA} *eEe Fp G5n:G'G8('jdEIo APtE ۠Nm s YnZŔNeҍ1Zqc+y{CNS'o*b;>J|٨FP<TqCK3u kE"If2CDItШ $I)t ;HR:9AJAQ uL9NѪI)h (jw&j%5*ΧbE2PILXQ‘Dx I` `>F 21IfBUpCw)$RO _EM & JrDZa@)|)TJnʙJ d€`"hl_jOat"rЈL!8P0e2xK$QCDH'!/2N:(7p>HXUc¥_ IAU'r@|8jBDq2SƊ'.B'CuEh%I%I'ЦL(?1JCО=)Eڸ'F} t}%4RORM~i4l-+e3gJl2%ie>l_fUrY^3W!{7ʸ$ID$?M<Tzl?'ïX3oU\Whukj6$&E)L'JRn12J[RR$MQJJ[ 4Ҝ9V9 L2u?L锩MTKs!<)i#EMەcM B')QCkpMU oE/E*S{z[OG( BP Β[Oe߂*% נiN@~TNo B4h)Tx_Or2AO^-U:>e*{ [ j JNjcb{ʁ*~K*禛 Sx,qO _hwbUOH:1NA*>dK*خhT}xld uT$WTO)$BOd24+~CO諦/r=}?l4T] %vlwz 't[l)LsPqMTĎoSr䕟)*Rm}]&Q~xgg%U85X-MPzI]oT'Uf mwCs}񣊣)n@4r5HRJG%~Ī *Ⱕ"jG!ٽ A/% >&rM@#hJ*.zš)lqT5\Ba)@U'6_(%ɷJ?T/w!cdnV0)9ܬޣ蝕wuEN~R&uB:1k]UwzOVFXHg x`^ߢAIEȧ9v7B?*c%c@) -o+pcP.hv,`i:fqijfa%Zk]]A0^}vMHakY~TLE{*Maf4c'rT0C[JU^djٷ26Pm& ~j{hI$'Tmֵ|}hicAr}/\=@9CZ-VNƖ%=IzEL;GX4 /5czDIO ;Ɩ[@>^F\wkVWY$Ge`{χܘk4U@>ADxò8CES5ON8!Oīh\Z~s?Rww옶!\! > 0F 52>:vۼeAy^]SiߐDF1&j7a5ڛ#Yn;k<>؎㺍FTȒИO XUvj&*hRfZ)ƷNJ TDGtVݖMT]vE%_ 7Gv>IvBr) (0BM2Fʝj|J'|4U κGإ*O'poτ[gtԹہ)/uluNyLmi GdeVGR'EZۘ\N.F%BpE`ǂa $̴HIJWe:l B_%H{)ΝDp8Έi'⡳$:@iZuĖN$)|H.B|MNMˁ!@B=ȦNI|;չG B' LH~b%E:ORrְq({q]Sz[ʓ[Qth{`Kd2eA$0'va;s۶!D@lRq.p'_(7"UGޚd69w.?)G!@iqJ,%W 󦇺3%;*l-B^S8ԧes֖1P,9:oHןס $C;SlmФG}ZnԺ욪>!nps:D. r`Gd7o U4En p*+Ǒ+2R)ټ3iN#zrT*`mA~f䍻c@eZ:]--^a .Ub`;VΜK)C>!?<Ѵ@Nl49$9@bh MW!2c]ߑug W%2 .>w) 7?i{mc+ŏ_+^c5ῥ!^-t+2=W~F.$As$I$I)I$I$JRI$I$I$H JRI&&zmԫf 4E C%LΥ(-;tTFL2u쒘#@4+up 2t8h))j{`)ÎVKXI(,h\,O~H^Ge\灷ď@[99c!4*lyY՚Pd{)v5WU8خjvk̷51po!Vˤu~kKb\AQϬoF!K%= ވ i>I3Ħz{*n[K~.2qGfkJnHíu^UV2}8K;JW g$n4M+wk;q*Gq Y:)@u׃'ৄT^s M}EΧS?G bsa)>क़DZB lg`ocT- =sجJK+s-mwu,"5y{C8,Vj~(և>0uvX+=W1hնw dTm[ n!ugMZw5@y YĨWEYR[cA 8>d:)a64cܺ p'u_n`}O-eu FEXP^HW[yFȍOxP!5M 4INh%U7a/.NW:?fcK㸓"{|;_ǻMT~s8iO=9ҒםeEeythf ,BװcL9;Z]n{lְ$ѱ.k#;fME4Yu焔[r=GR_C|k?&nKj6n]~2mMSxEjZY0{;B{4H!6#qw{ۤN}95r6nhLz2 Xp*=SF({Fe6q8`V5Uv- Rap& 'i\B]s%n`G-XGPv7suYa4c uC!! @&_ߐ)VֶWYU|z>D~l )'3s&g-IvL8<79+s~CHcHmV.nvxBMn> R?iu/ (YOwa`j{" H?rJMm>'b^M$s<ӫkqm]sYuV4_gvۓY6T}d8M}MAINݙ5ۉQot3rp.kqVeTy<exσAS̪ڽ+`I5&S]K]0_NuZ% ]'''X~֑/g[,xdعuu:psܫp" "!ʭtÆ1}~\4؁FY{a]VǷm.dkg_Md DkKCjVck<" Qak[ oɬfP]>ь(Nmr[BgQðי\onUk$ng]cۆ,}M9pov/qUN!%9XZcq;嗚d k1P1݁%Jf8IMnU̲|U)ŏtvա[[\F'BͤNT=dW9QS'0ԨX;HBc _ )Bc=NWmдNQRd T*udT%jĸKaNQy@s}H b}5/p).a>J9l25R@̩B]ؠ"T&TrWFr&vAwyByZBxH57*݂)JOrC@©oS[)𣼍$l_YH %kO'}P,|pudlCOt[m SHEx"ƮZO_s$vU)SJrg>ܑ;"hc0'+W6Um%7.KwmʿW++ʼnlT+.Gh|R8'mSoZd )-պcb} ui,k-Qos_rRi#󂙲3tC6;0q t<\]z)JQpݒZϤOd+|Jp&oXI>O]V!O.W NZhцh]cw})l $xD!2`D8eخHiʲ:sydK!(KD ,ɮӴOBZū)J-}3*KO)&?IV Hz %GDRO O=GvVո&R e;q'bmg`K2-ЎA#bhvr73*lm6i!O{m} Z!kmG 6\{{- .eyBk?.JL|j$㾂7 p ruQnx款/{c(JԴiru3h-xK_k`pUƓaTzI({[{wVqcg6`N@%L:Dq56ۺ'Nol.C*=,eb~yqYiÍط  ~)nMw?ਇ~άlQ!Ǟ떣3)DZtYʽH'bS|,jOu4{)7!շI.Uh y'] 6ʜ;an. CʝFtT _HW-&5^%͍5_5-ԦsNC{@v[.]u%Rʋ[y*8qUm fy+;Z@k||ZuV:AUvV'T-l33ʧm% %k uT-qЉwD{$ڀ:a 2y* mW͸mpV\=OtIx 7HF /p$Sk՘*sT;E\ѣu?Jl |P^:PD>hrI8E7)5n+uenw!xEhe| TKcP rõUluqIvӰAOד}@pG LvQaL~Ce@ն8FםPn!by!"{j\D5I S$m D%cQ{ᢛ&Zn;]|U% ų*0B%M p4WFD~*. ^Fj1'u2;}5'aX7Nd E[G0| s߯]`R,tU%n3!HEդI>j9OL]_Y )y=ydz+gF̶Gf8od6W<$(>ƅ;*# Ѧ7dOeʑS:!KhΚ"V'Bq Ccӄs68;KR{Cu> U~HO{ݯ*8 I @a%n44Ek⅐ rLL&s"=j:Ā0%J]'R F 7PvRaM1&ED ;+t1 .(3*'JwjRnTMO^?Li$Zdu]q+e"׌| 5M%xs4䥴T{,Ԭ1췹xFb /uN9I:.ҷ2*p`s+.ǗUv\gF<~"%pHEwRb$?y[vu -NI+^-{?3Os%kI$I$I$I$I$$I$I)I$K_P6 !t6J]ԇiltV@4*lsI ] LlTR(dRRt{P]Sh<5MyBv+tIJ.lPyܭӍY!:M.sk?N2"A@kZA17VؐUNek\;Q(y<Ps 8#cHo9t=`s@-@KLԭj̝Πk]1Um1E ga=Ǝ'-}Ao+AGe[PZFuNNkխIP=#SئA|RRvִLs6;i!=5lScX L~*BǸ8(eZ±Gp:y,hLj{9;eV OoUO 6QI99PY!lbCr0.{ %W6qYtAW88p4![hhܖYMѰ}FW?˜;.cs[0GvjnTΰ׽tv{` 1CEk=AJ* #sv b+ s8D&XEhty6#C d#,p_{(hCLi2i$oj?OsO*nzFn;5t>?Vnyf0$wm Ź0\~zln"C,ݥ͑beE5vVyi?{ .:n״hͧ: vX@Ymyǎ*gd}6ITK=[Il1!%;{HmfthYn zx 9ugk4yJÖۘ p%nC2Z8i|m6ЖV)XuSKtԟ-gOuu<)[αPIæ>V?cm&;T2ˤPH&O* i¼;ec3's>GEM[ܱqzNk h&?"\Y0QӐA5 t]%ğ8UV]}AXVkm7H.psat}KW숭^VW[dzl rC*ikyӲaG^kxA7:d_c[[C\Y=6H'CMmm>p<=Ֆ7Yr~#]YXOöQy ?SYdLPI1stFs=R<7PBvul c׼SϴT o=ZMTy:,ʹ HOUe;c\2"52cI'𒝞{13wm"GT56At1r2.!浳ikvWcfrkt[:njxsdK"(j?=̽ǟ--'ge6> eչmp?8lcfI|Ѳ1@ۨCXRR|g5΃3IhpU;wiSq71Ws,TvmԀIUPׇ͝5Z?A(9VaY!uInUp@~+;=4U]guXC{[1ʃZ!\$7*h$%k vU XֹiZIhUB)aݺӢDAFO ustf} )!e4RTUCG=Ȭ~ig:#m/qx=M^Π?{R5B1:5z|R)1M$I)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]goC^[;j_ l_e܏>_K"[|~EjAJ4h0Q9BT* r). .O*MD7JP0ӢIAܦSxQ e%~ rIQ d2t)NJvP*L"R6ОL7(Af|TƄ(p)纈RjQ*H;A)r GRaAܧa(Bp4MITI?t; "ʝIKd*H+4jPS9L(=MɇTET+;LBd,8IEN=>)fҬU %@T#@ MeZ%TP)ȩ-9_R i5 A5;)EJPZ䞎 I'$&)0H"LC\J8I8NRPa0'p)gr$HN%E$2IP)& ӄI)b1K Rjt24DjH`+TZ p%1nD&SE ܢ7衹.qX`VGeEϢ_ÅR,V&RrpRZ{!TQRN:EEbtP(@䚓N)zYUq۩LR ȡJNLDMH"wCg!TsE@w}TA[LܧqM"(Kf|kQ|X9R ʉH I,I;HR%@ra R':`BI<&)fJ]@(Z8c?Q+KkZ}'R\}5M4(!krB.ׅ 4! DZP(ĨݫPN)#,)>A#E0t g*.#GWr}"h݂1LORSP I&NIdI&Ga>lj%TMZ*AIUĎJnLڣ 8ILHӴ&rdHAMN$( w)J$ R䧘 %3GvQ ޚw \JfإOAiNʡJt2HRB\l\Wg汿Z?)[9ҽWȭ^9OrWȭ\ I$fzI_N?hM( 6?}Up_K zcSEceIJ2chTPk0J*LHl1BgsrD(pIR0JQs"T 9=DĔ$ ҡ0) Z& 2FһӗIL'TPiZR%D9Y}k+ѯcNXAʱn6^|GqZ|8`Yz9}M?k`0i]۠ Lfӆ%kF.QMTϵSJR$bԁI8)M)JHXwCpDKRu#le)M1-bLMXX}ec_]bEṺljՁҺ>@6և> +6)b5?&&&<{>B8kn}e3p~54 yO|_KQQ/QjBPRե-΅1kl䏡NNv$+uŖÈsceB bx,z#94laQ 齥HsȊOx@6"Uz-6UoǴ}R][B| <-F2HlW & F!x(H=7ޯ)#7Fc)_eE2o(q$ypbt*i(:yc}&F'$nU)p2sˎ醩Es黨eV$Or|-3cJY,y`*=S\[Ĵe > I5gؗYE,C1 {Vվzc],?qsK/0ti[cEeh4YH9j(_,+SN]emlq'RWEzZ?x.lhe,C#L4%9681F OT6ϙ 97g2&<֡AM`p'[;<euGha}Xt9 5\JЬfX书k?Fi oum6QQQ|[+@tn,&Kβ}ݸ`ɒΉhzy6\tqohK,<-o<02XMpXO" |Aus/s=۹>zOva|r:uW6*tK}]Lׅrq0F'qc;څt*Æu;'pvX i}nofW'lZT^kx4 -XKy}m.++얳&$Ö;;дx+i[GRK\q'{Q6~Ƿ_\ Iihm; ʤ@#U02EiruG> c ?m}VKwU;$qi58X+GgR7D [w}EeC~;ǒhUi;[+G90cգ'u>dqޏlٝI,TKgcoiOOqod&X\tДZ Ъ"z+ :L85{V>$~Vo% j:$]AyJD9v4j@ߎ8r\̗dNJk7uT-p%E328h+)Ct*vOEġmnN4@;wSpYlwn< gM)7EqJ[ lV&SuTmۏc0{*ul \8hў͈CM(sNUQ tۻTܣm`El!p3&^ǖTJѸ F»ԝ@H5 ma$:7^'i0 Z-x -nuAK+nq j3=g\62\ifIe w?:Xcߝ "n E?(lxԪ.z][#Y'6I?19Q%;7i"o~FLf9ީkl' *i{I>؟ΟNxJ7|U)J`I "WX-! *Oa쏊H-|} SJZwn J^1qIXՒg3ļ8C~5*^7NUbO#_%&'R]n24B4 -Z4"a65Ei$)A# \̒MKe!kjmn]1~ƿhA Ij1ni:Wjo6R"ȝ;¤ۈi:hhDO*At줸nv@o꣹A)kLgـG*oXIscLO:"2 8xN@(7:"#{ꢂnQ);+Xf{t&9n2irrt~3ayIA k%)3]S&8Q.'^u-opX4Dr!TH[";TX'M Dh P,Q,)448Kjq#n.Uj|'/$7Dzvh3ntFM`w,otV6]S' :B}SA U颃Z\=50y=4jwR B3$G dLn Q-0l@LBE|cA' wn%&kⓚFK&ƟL@VF 4 ;$T@e+|KIH/i5l{:FTmF7I!H8)ATk3%lov !'\@;H'R 8eSu﮹r`UK ʮyNZ Z#Ek"T۳26d{䨇k0 i^l4M0u4JY?!B~(/n(%g:[<%JICS-O⣾ hjIwV…5G|3_LbZVOLMX#BwQ}xq0?Ȼ݂;.gϽߑMh~OyUOLf:LLv^,YUmttv^+Y~$rI$I$RI$I$I$I%)$Rnp%u.sh]#J+ 2xA*A/{  -7 2gTR|g$Ω%,OEwxRJpJ iBڽP 8j ATH RxlOt#NnjܢcP*e=C[S"e%3fFi 04Sz%@X9Q ո  BWb8kͫ::ni?\Z:~+/\x1B]tsd|Ty5s-uv6xg51z'EI1+q~CG-xIUۑ6$qrq31GoS.1&nۡ#R8OH;coiD<GE-`YS?-50PR!){[%+nWR %]F]KΗYpGV4cۧS{d%(%)kNWU⻃vE+ 'U[nˡGu_l}v@ ?uG#%xD* Њ\Cu> i)|]muw=ǿ6D$1dJzyi %{}7`pDels=^)&@4 9>]>`u޽&,,%ϚMYVI=nk<Ҙ7ۛtedv46ZXvtS9 ]^.vbZak{Gs~ aMMd9cdIt&!Vը|Rqx"ּL0FEM#B~r&V=Uץ+Ӳh'~%4V}~jd6u1qMzkrh%.R57n{d>[@BUL7igI Vuqf Jp3Jٸ~zeM[i:u,\i7^2iݬ1Eߥt;_*g)^0pldrBv?P t-}u8*<ڛ:2-9TH`'qyiS 5ԷC䥍XLR!XJmݱU~lnK˽yiUwO}Z9\LnPf}D"Y ;lP{]U'Hk[ve^`9 Ual&8gWwMm-Xڳ0XtwI8Fzw諸cNM[IKS^> bڝZl%rzL&i# מ[K, 'Os4Zx9XhdvC>&CX 抝eOsX`1>>ֻ G V$k$wRh"4waT 5p sµ;t165ś[lT7^j]5g @*q.(\\)!_K#}do_lHT >hs ~( eF׍͉ MՐb7rچܡ9Yk ~ )XY | 82;obuԲ`"C u0(,`J#ڦXEMLl7ݑpDfX}7LϹ 3"I0kq$tPxos {X[ %RahT֖]`O+:6߹RƷkĂƤGY|-~T28l,̋4`i3VVt2C{*eƀQ%5{n mt<}>\OupY]Ӳ]Ptx.u-VR*I$ TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.[;/;z!Rk{/?&o]ȼ )5ID)aP oB'T"E.SBv')vLS[ئiOf; jĩU(puI$JHڗDҢNԦRLS))uQNr')0NJ*S|HSNaxTI߫ DO+ȡթBT̈́x b ܘ!ry5TZӵŮ Ѩ[88@hBJy00m4\/O͖w(%9l("')4Jnpi $;ܶ>Y-{{UL31ձp+Ȱ1H*%k$[M>:AP]c]gNǷ0|G;!GbmcBdhuE| ׳񿛹3q_8AV S` 7}X1 ~[sn7mVSmNc!)V0< L@Z Y_uFC8r]VT,Nlqrlm7d&x?a~tgUŽzL%y]L[eGb֖Yt?F|T)qLl_7-sxQu9Q2OO߈(BRR옽-HOq-<JY~Z?L XḣjgE>g}^OHNCzXExL6=>],Z:}z ๞@ɨ7CsT<<ֹX]GMQe(Q\Q3#woլ3Ym3|%k}y8>{\H2A,t_xX̾׹aBq^#.x"t^KCl!x#tR`V7^eՈ ’>O?$ȘxT.3cдi?_T/;8v2E.]|s1]6yIhUzSK1"UU xml@/c ht@YNd72 rNH8O9TXѵ-H% DFv ~YA=O@gI'ud.{naZYW S 䓋_g c> ?u,y6j>|w58Cuęq_.լ z`ljcTÇSBu cF?ѫ?rj鏽V4׍qGaP8r3Xˀ/'BtDޟN+OP"ۨiNWҹ*{2\|I_u*jn.k= x+%ѹֺYӣxhHTU:^MT[gFx1R9s5U#P5Kbzdlw'*3:w.Bw:~Nk$zlu!E#m=QH,Mq D]_i./c֣` vg;d4-[KYwlbL!Z*a'Jy(ۑYn|Z1@."H pjդ;+"ۣUsLd{]55n5{\9]齅 Za:ᚔ F2i)J{NKK5O+0+O5kxa}MOtv d ӯ`4SΝi.{ͭ:Siu'wqU>UzJف2w~GUyh#:o:nd yFY!rhST` ־ָHf;y>B:kdm[u̕`wN+'R}ث:4hP9Iѭ]'c ~}DžtpƒOY3۹+K 'VkO!Έ o?L鈄f󴻹Vhs.1PKO'U!<)6T8+U7p|$8jn@k@/]$ `7:NI@@_e1F։=ԛ Jzh@:wQ$!n=0pCe3E lF) $ H䏡'L㦺&8`ڄ SZ ־}NDoѠxOPS=\G\uHhb'ffD<w+;8!w!k0 J`R6T*йqhH("b?թSG0U]Q)iCkxU;:Sd<k:BcTq,9DZ$Dml+r|TaF(k#w@]k;Вa'NR Jt!C%m[AZxL'8Z`:yK+ )@5B{0]%p aqZ4Vkx䨶5ݠ&6@UŸD@G46S/WËXG|VUfײOq:pfVDcЧU *V;(e;$J슫.٩R783ܗ}O x۬($'?Wh<;0c Ώ"Kچ:ùJ R5R% w6̷̔X6 :(AE`pPÜQI"'2kuwWsI^Y0:)hQC78"#,#Ij&oAKIAIT OFLC TxqR%/EDza3ATS!AL,t9NOt*Ni?;vI$Sݦ*Q$ :k#h8ʔ.-hBA!T5@nN;(\%Ne.5D6XCRu;jwhOyKN @aqQ#ܠ^fG_ 8;dpo5A1Q2@5X$ *tE9M} !iiE6&2["_Q>(-u4MG(vK-J4@ hS,ako*K@PBY[I3 _$KQshƲ\BC,iKDnPg{ki&O(YݑӧcZѹ5>RχEG ocA}8[X-QCeHkPX+qZg!`f9̮/ƟIj澱`3!ikOU_泝4Tnfb_^@28IM 8վ,tCM ݫJ@"vdeY;?*h9P86FQS "O2SW9iq+uF[;v(؇бՐCKRٌpAQqt#_g2A3Z5/laȽǸ#+lm&|kN0+t䉛@i5gwqn{ U6w(nuv:Z̰؂>i)Σ @]1?6=;dr㲋ny(ɧqT-oOtJZj5ȧ܍f+F5 )ӻ JI<+k U6 I"fV^FCi W@/ k-ή<]vc.%[ˤJodf:Kّb[)V7ȀVQƺ?M+vqiGo_ 6̐`Ɨw#$O/iOEAk"\;J%ƨcZCD㽕'GaaPp?MȴLkYwJhaًCmi"wұX˵S٭/GQ?gӰ@t^N*c}-zRyw!Zk^% tstEk]IN k#GC~~j궴{,25,\1nY?/{GTf,qpmd̘QykIL0݁C+{`)CMc]԰]eT!ܭP){/w.REp}Ĥ㼹nYOM-))qsOuxBʭ~5uDWe6!? _X P4>^ PCc]tWMA,`Ou HT*YU 'oe@2>~j/Omk-v?)Ȇ5b>isÜ= `C:蒙ban "v+kF?b6;p wWSCci&Td<7n!ʈ/pLI @7hCMkm,^#7krwIpl4 ׀e A"zgG#撑\{~ 4Ԉr$$ANh֙`iɃwcuL's Qx cO"N)x) x˔k.|SM'$!E- '{Q;YchIS}aȔ8!;Kߣ~U|fG+2T \vKd{hGg(~iޢ4FZ2Oea%% R SLżyQ5H dR3ƒTp<*jWh ]~敢H JD)ƥE&e%'@;RПvwKe+yI2J @$I[ILP7T`SE2V;DNhA~*z4 \v -ԣ퀀B G 4INfX)t55Н:d)M(NѢpNЦ'PϺ @o) 4j:% U'i"ABF 5):)_UF<d'l'Z9D&!$ H) =0T@ͅIAP4QP U79 04Q`\ &@Bz8.yD.s/ m2?f٧ K" @*pغ% Wѻ ~(Q =mLB X Td RB*fD&qʀSjLHHN N iK$)$BA9%&)Rֿv|Cݵv>+G1_J$6s1s4e9OɎ; "Q-V,0։%p_`<_O`kxI=6LV|Zy }hZU@*ޛNng?j`;>Iџv!MA ?6bBϡݫ;Wz ߷# |G eAJ7T4.]_p1<\~}QY9b-c}V9 O渭uZ -~xͨP1X }'/}Ih0f^mLzF!uL?I:h WzTf3Lֻ-(d7s)dˏ`,[7XbtP@$L?4d`3$5^OggPaRgE[gȂ@<.\\h\PA<ѲkkJ|b~ 'HvUA.8S:B_xX&vo:vp6 gz-wxUDwW۴rm AqPQ\usc;Ig̖7pѐ>+X<-L`w!!BA]mlPF`.ߘ &.1' Y_%8%cFu!lG;=q?yg(1'RSfn .O$y#Q>jPӎۀf G֤̪:V5-1?oGk\׉EmPkiur7t-WNW-ߨVŇ ˋ-X?4]BVF IV[p rpIKquwAKyl]ax.-xr7P.$A W[)`hNjx$$CEhh%7r-ipj>)S%m{x(ȷsCH?|Eos{Ɲet#NʲMZfbCu&cښ[̤kd\f J^ y5;P[ ̖,u67GfEkPHJkD8FE )˫l|aJʭ{20JXVQw#K:qyQkQz}&-:%ne#t!N;zG/g84k#䇔XtcX(WnC`Է̺rJvrf^5cY/pq"$*[]T+mnUVpo2 -6GgW$lUD cL9_JvkƆcU|VX'Ӵk~7J ky58UŇV8ioGsis^CΚwLw ]-?Q*D ))~[,ɨ~p{^Ϋ6U8Y~3ƾa/O{,\ d>Kl:q5$pG74@=IMzl*Y8ueYwZ ̠gk5j5]vڟhhUCssJ纇@&&tII$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Ky-?tG*CůܾxFw^q?]P9E 96wpS$ mIS"S’2Ҝ"}&ELʓl&($N$)L&+JJLTQPaD0O0NJYQ*6hBd%:p(f > ) o P;(Rʁ;2`Q' Iq!QkcU!‰)AAJ+F2NTXtM0TdnԴC+J 2j .+2ai,yjfPwj7 LԨNs -i(b@B--樋\Q%"P:(BnUQVQAҝWc;ƩmQ)\TwBѥTzcvNc Y W(QiuLĚxNЦ=Vw)XtJTl)LFmiNӬiI$Zy&'2R<PvQ&{3΅S tIg+Qt Kj :9-mrrSJ2.OD2RDyOh<α X/Ѿ({բ8JsjJRX!oWOW8=p?dS_x ?kW YqNi'{HzNfAOw+UN귝)-nV8;aH}dEBJEeD:}ޟV>_?Ŧ]pca]m3m c?WE']]\ ZZAo-Ry> 4@Ymv4gZlU`;κ!gu@0'V~&/p|\t;UZ(XRe_0d{6N2%)~Y|վ.s\;0o@:Xis-#Ud l֐Augh0!7s1L&Eek,3 NvUSُJFOKU[zՖY?5W;!,l@L!<=0tkKN$;HN'JHN%`Xf\IVk.!sy>nk&~*yp@wEH>Sbc3Lc ?û%깍sKH NuaXv oWI*βI$ KgM(ÛsTQz9w l!Wj>U%tJyDH$)E$&r`%IɀGj\bX]LÒU&@% 4&H(R10S) jI+THS )bS')Ow@/9iG}+ f]5Xw??cwuQW Dd  j+V,4]ppN-՘ nFH8Oe,g匼 ii-p9LWu9zA"5j`gG=8LDhyNWL E^yPV3s zȬƨ]85>`I*HUᧁRX11TY_Yx/k~%mtN*`xZCDu)##طA㾺}cvU 0Ï'{q2N2I$*I$I$RI$r[[w)kji{^ұRbrʆߤXr>rt:Kh>W·:M-.q^s}V;;"c% R)-pE Mï^h8H SzXu~f' J"BLdFb?Id~]DJm}9gbd`rXVc;}f gR͏Nj }CeReGkWeטKGv^n7Uwt-YCm}Gc*Y,qEwti85]?D,X^ۙjs%WّjL~poݷ*0K?c^gWJǯ! iX7%Ô[>4GZR}pusbul?-{>h˪71? +;yxLާW=?zCKKU~Vt)rW:gC~0#sBw}|r:=-$89݀Y{&5<+t<I̭4'bw3XdTq␕\G1ˏq"T3hʧ-'⁐]M 8t|/w6`#AZVt쾠?Z~١Pc;{5QǙ4"?qG^~+:m&tsݤ˦qC-> ,6bʵ WFUm:~I,nh$8LI Q*_W_oŲ+.p˹+_Գth^L;w[T7XC@Yy}qğ^ᗧx߇V(ƓؿE9KQN= pYx7?f; ]_G?O%5s:lґû.܃68v_ȟĻ))iswԗ~ko?.7m (d̬t78A6p2B?(;t F=`9wDꖟE"4^f `*wcՐ aZ kvO>*>!\a{vUrF dj4G6L"ufmmUW@VMLh 5Lk]A{K,(%:sJw!^ͻu vmRu4n#SٸhUХ{'Y IGYBO=qUI)ѓE$ɅQaKCbRo`k:H*KN~`!jݏ4ΫL[#Td*U<$Qޓ*Yy:,eڢ5P@0B; eT մ{IZ?=xc@ 12m݂7-V,*PAhSմo2GÚ[\Ai4D|>{__N ΥjD)o-DB[,h`yti>PNɝ$VI*A<+%oa$9c{.=9'H߮ 2lӈR6 T BLю7rO*\_X##;^Wk{K\Р: j$wADJɔ6q,nKhR|xFyap"ȡI/`w 寴N)4b,?F<ׅ7KU5\ݠ@{"XtXDyJmMA'˷* a=&k˄ SzDz)'TzLUL][CyI):O;lcb-wmBPF\(+Vf9UV{mַC4?u *T9 vX^K"63i?fl{j<Ϸ%,j v;Ѡ*Pk@}d:ǟ0wH'3kݤ{'=znrRٴ﹎}~mw՚YTY Qk,dwPo097vjuLuUYw[c75آ]m6 D̫AV [l5#N~ N[1Vy pé|pΨ c;쁴3%G Os 'iI%45>^XFҽevumI xNm}&;L77mU~.xU]NۤuR-Y?gDb7$!M?b>EO[^b-?BNsL;xY>>[d=*X9l$b r?4r f"dٕ^" }&qpR\DɃPgO=<8M~9 m@t *eS]4Um`Nf[[Zf7.70cR{s*p X:%CcO)Mhciu9icNS՞ {ft7QafY%$ ͡ϲZqg嶺!B/hpڡ~P܇: O{+=;+t-iO\ג )?hc*,o5VYI2< )C1\\4 N5ɏw,C_V=M{N7cM]t2 jeGx(2Vs՝tO]|;ەv=(5ѡ{Kpmv8<,tk \nY8?A{]\ {#qӄ'qh:eXc[udlR| ~"W..͢8$"\m{lY><$ tew*Ϣc,'kKodwX3-DuA[YnF...XX;0Tkc\%=\tvҤ_gSS>ƺ4AևPaj1>I) !auQ^C;@~r͔<ךlseh_U;T6ǴWoPl{yU>ߥ! "u^-FT~`u ({=~=Us*¦ːih`]}Բ>G"`)WU6#^#cgnkiڇ4ՅNP~ivΚit GP5ڂJ 6?zUGt"wp&˝\4پ:@t jL;][jMfCP.pNc+lZxFɶϳmP#\ӵ܃E ܋6ߤY? \,/-,ZkkXuՒlp_j~Q+;ߨlxIM̶#$ĉ;U&)3YIaWrf;Glü⒗k}78 X%IUZ[S#z@Td \ژ I{{%[:I cCtԎ7AQ &Eiq:AQC8H:&~Ji=xP'kLT[TpTRUbŠZ)AI=]w YBZuR t$%1)&JwRSTQ!<6A;yHBvB`tP~:(4)HP&B~TNAM@)!@G<**%HRL(42 AfAtSjtNR9Q*OQI1N))@47e!EI%@&ǒe&Ɗ% $ *NӠSLS@ng&(;ExLHT L*;P\W*$)0AN;%_ CڞƊ7ZQ5BF즽'EiTE% J :hNMS eE8QH)#*suQZuяqV%d=VeTr* ͼ)wL0*lt!j(DQ!ݤ!8꓌&+%  GvYEiw(d',X*xMRuW*< L rV$yBҜ JdҤB \NJrJ IBTÂtT@.v)0{j՜4 NQy[I+UCwQnlZvƝHYnvD8鍥K'Rh|v^>}[-iYMW~涰qN'O0 iBe[5. om$MdXPk6&\?} e[[_]Z3͠[w]dElwޤ[-(L..]n+ق@jO.P鏓n5p|aFI)ݡҷgdv{ `^_2i Zc )Op;irǬݼˊ )ii=a? *m"5!vǥ|{eO&S9f/:X Ú 7{Oc;qZq9{A\0K aBG> mtX+ TlXu'*7ufyЉ1+;37GqnU{ ljlZM! ŚS6S TPɡmCw'J U׃2kCKrsj5s Ng4mV<^~DD8h9GýUhJv1J\j'CcPn;։'˝@ʽD&uVv-tBc.GJ~}DwV᰸sZ8zd1#?A][A5>2 $!b\lL2H #& gH4\s%+u~)2 Yŏ 3>}W{}F9-/=\TiYojq| Z߈\j R%uSV!864}MB+^ HutN|aclΛe5#QBm'+}zK)p+5n}gl aayrN1"bG3,dߣAnIźOu.#k?ήc|Jw0k xbɃX.d.+ v jI$CqI$I$H$^37`*Cӄ"w?.g7[:v lX%?ɜ !ΙҲ:L{>euR,xz_Guz46  SJRJY)%”:*i}$&]<g8ϐ)2g9졓V-fۜ+Ͼw7v6 9\ȵ-oί ?:XB>4.[/6Q3>"8 ,-X06x6:ͻ*wm'W^m]6ю!?rg^'kc8;X򔫞:4a;,hւW{XC-nл8=Ãr%ck{tal9z2Th*+r\gRiˣW&M1kA8t&~ F> H[ !.(1в]_Ĭg AMKܖ಺X~#h^SW3әCx*'-8RIxIj{0?MAn\jtoY,;Xul3.Aj;Uksz*>'.ПoU&>Z2y||kr+=?70?uo5l;%j:TnI>HbNb]> ҨfX^Ӹ6uU ?I1*M^jT#T8Kr $qfcӒ!HǒPF0!?AHeq^,osX[Yyxjwd|8HO^ɉPX .H ـ$y5f!ENàn$,ݲ~KAH) }F+k>+)ۢ:wmm0;(lV}GeF7əM[q26s]kU}x~״̭ZbXHj9PXRhz,\LVM%H"c#Q(ِ~WEѩSmj{0sf*qN1wmBhԑ-e $LͥƄ+ ;G rEeɼ%.XC%_Պ>(vc|gc6S2@$-*l#Ǻ oǷg"b?vS+#I:ς6M{`Vh<nOP:[lR:ư9hӘP€4N⧷F RC{k̍!a:$gy -1̤C%$f; O*T}=Ǻm9K"tQQ#/9I*Lun%*t1 JnkZ@S[R, -Ҋ';0HLۚ4RƽyJwXG ϊgKB>5f~()q4E["i*L-[A:Ry Hocn2R tm㺎Yu,A,&?^}Ϲyx W@#AKjP mbO#{5SMZIs˼Ȼn uo%4m2J3oCCa=IHnUM4mj'DhPs $NY6g9vJ bQt%3_<%&)hRL4QXH!À3M5) !3tD0uQ5*BAAJH˔H?4G d')19)uRۢba9aDiGU%/)e3 |83Ʋ&&Q;tӏiQi"%Ė['8 AĨJkq(&$4hHQ/ [6BpAK 5u >4RU&J=8r$J#ttEc=U )ms5'c1'淁`]k RLnFm` ͇3cTfD+Cgg*tef .H([֍ nqy(mDz\QU2c`a-l~^8kNΧF?Q4Urn0tfvmÆ;*; 5ceHeʽXa&Z3:zcD1PE6Ƙ> ]I+`,y.t &^t+;UI@asaPڞl&WfI ?DzfC( um? h$xDrڛꍠ8Ij d)&Tx%J% *k`ޣ8hTjI%q_?h:y3hl[>soG JRgן+^B/]z1yI$I$I$I$I%)$I$IJI$Fgmn iH!#1 ׂ`%J9 eDegea;Fe$ݠ%8wpDu6Y 1<"x삖$<K!=xjB =)$3/Q ngЀdrp%b}?DzL۶!$\:Q=Z8v\M^ܦָC^= "Gp\i{\^4eXt1S{2 +c-?1>F=հ<KA}ɪygk^4lACz2ٙROvk]%VR5K\'Z~ݧP prq[g[[Z`as?U 5 )5,91۝6oxνNV\Hq<,Z-#=Ve`xB*ߎ7i*F$jK}h>#%XkIo]j` qϢ 5{`;XE` JXpa?uY-c#%:λxqg~.9cD&~T{IfδۮeV}/IV,SeAEߢ@yhQAS[ݍywPչ缾?m:Udm\~U;~pv*;Y)!GG#c4CI.{mGoAOt2ZBӺm;IH6qKG]epQi)3 32>E6na{\5}̯0w(qP-`#iZ1kI:z]Mvlt(o7OM{>!ۚ\Ov˱FǨZ@s[?z 5evkՋH` MO %³1*[^)k{zw\C).&A2~K6H-f=IIh9ڵf=VaR5>ַHGQ{F^q Jsi8[i2 >Rf 2G*t q#+LC,;=铹*+AV2-䔟{Rlot*V{XI ]\m vrk@u K: &~fu9̒ +xU[}oT;۵rev=cRͳWc@[AN1F1oa{giC/''ȯp n1y5F d>nG}U[2Ks~ ϒ ŐGIN6+:2A>$s-.g[ qGؤ+,#[fs,$?~GXkna@97A+:"5>lsEJ~ܛF'$[n~x|J.8z+d9,fh⋉ AkCdJc2/kMg=Qά*_ "Sp5i?VZl6qv5[] hGK"X~>M~Ph@ ?=6An'Z2uE;y3xj>h}7z$80??n!T{uLP|e-धZ/c]YKSc jaAQ(eicJ5Rjg MLPؽͲ*a6–=k};MJf VA%5Lʶ[ fMcgFd*X IReԸ,ڜ*s\O:k䃐}IHݖnWIr u]P[Ѩ<՜0le~!s+t4Ik*R^7uIIÉUp SpcMkXK`mPY@C8"SV{-EÜ!Dtnd'*um/ KCO!D7AVְHUZ߅0ָC[*jB!tV##=-}:ο۹Yz7նz8@{αu?V8;o\P6M j;1ax-  $`^}~'s+ 0\z`X>o( nݡf!`!Cvk*mB2{SqQakw<. ^si;{cgS~Ud>։hXg\[c$ g{r1i _`USm!=OqysY͵a64>a:a|Փ(}+sM&ʽ0FVHñ8H!W~\FHl}tqrWUs0kI?Uٶ!5m< ~p#K7&]bڄtF ;:]'ߙcrobwI,tU[71pv;7,[W 򟉔?MûòCChƎ7<絻maЃ:/\v\S9wq3ÄaDϸ˴:~K=;w0BO/ vSj6?qq $c+I/ K?w M(ÛsTQz9?wg=P|drpQ@NRL*b)E74D)Rw b):@JQ SJyIK%)M BLAJQ)*a$5,Jd26&NO2˘9|GS^dA_̏.s oonQ|5Da~CAuP}ۙhx%Z~W6&L~a7lo>KiGwRҵb?B#w5U5،V3\W8ilьϩv9k#+,/քwi ɕNZ!u! B@N5 x7_rv!Dm}`֊x X$-XUIY1ݘv-r侣V\ܜͲ>K2꾮X8]Ջc20/ 8dɀB?ަIN!mv--?%d,YZ`dtE^=#Z){7Ȏp`.q;ԾmȬߜ`{kWp#K&c=?dUSK]ߨ->[U ?m%'%2J@JaZֈ#d/4R8 [ a82JbH!8Mʳf[V>%[ܯ{c(vkGu\ŧ͓uqOKnQ%GaMUn@}?^~gdːe<|bNyruO kܨ^rGLxe>_Q1>aI׾dmj>B&2:g[V~W"} ` IQ0eMѠNRNdE5h0 eÄ7XЎ70d 9Xͤfc^k[kYswwަ~#Ecp+h mDβW5j)js8H pݫv@:Jp QBM%ctDm8Bq*:vTeVu.擢D՛9ZTLsL~yMu9Q]ϣ!R PCҘ5Fc3V5=ç5ĵ릾ks )S:YEfU wEߊq26 YyX$ ֶDTZFRoQ`:1Mhp&a tMa.f!fgc8{cUtSt1lxͥXr|#@an!GШJNre;lAآU"aVEq'7M4O6KQX*4*uy6'!! $Rr;)-b1\?;UydvB$DJ-k~*.4ѩڂ=v G7KDILƒd젎]u#&9F+ :*0)14S QJ]7Jqa3 ] 덺l|Mi)xI}Qf9v}:ZHUm2=D7XJه}Tn~CGr(M:I) Hib%L iKtpF@));xQ'.D)`5P9N8wd>"|BBIKM$ sDMBHsPJ}?`Onڤ4:ptp$اhMu>iI8>*.F)nmpRafaKlL*#ĥJF5N*m04L'D=ba0vԩL6QB.GYN[NȿL 6>)RNJpd)Ҥ+'R/PpkߣV3k3G 8M1]Χ^f9eh Ъ s(A KFmm읬|4LL085S'׷SIwDŽv)TéSA׺ i'"i lOsHO 8(1\Wc>pK)p2O%QH ^)SZٿ?+^vI'{4I$I%)$I$IJI$I$RI$l;=;ZĮ.mXf[) uScdbS*EEIvRsd3HSmKuALN 'ӄ@DO(kE\OGn$Gr7#d!;^TKLp Cn׺(ogiX=\8a_˼K$ AӱRikS{ARK^]ov :Wl-H(=ZlBx{k PK#_zh˪C>h$I)۴LppH'~q2\]p߉{Cu\qS:s|P~DZy*6.58H</WUW6.h *Um{yRa<_jk_[#INĮ\ jYH0'_ks,s[2ʝ=CvFEA'kK:qXjl>Za$= /cw ςJce. yg/=XufuB薼KKZ]ߙCĵEzdmvI5fIsUQ;Ax_*m1ppJ̲^L7ogKoc iy&G}^i`j9 ŎKkKgQcCZt=T'S?NoS} d4]=YTXlɮunpAk[h`LImpD7P}=_kYq#p ^}x$[[Gb[c=1q@Ķ,#W]Ya΄Ɖ&DO> _ffMJ>K_1# @cx'Pf gCwRMLX2'e{V4{ӵ~n3ǴIvEۆiVtp<PKԨ|x |iFׯ{+$Ouo2pߓNc:kZԱ)e~l!b\Q(.Ihwc5Ai-AL:pŻ}/W:YO4sG&=3fIXOm}3e-, ;>wTvV1Ѕ cYk5 yx#$,cn;ۿN3F+̲$xBǔk^ĢYα܊ͱPv/Us%;n杢F5lVfc1Vm+Gb:#wڠcac=Gl"@B5/:4hy;hi I!VC}_5jJOeZLOӢít2-uXHVr -~ dI>a@` XSwxh"yxkw~٧؈1]c֟lٴVӷYBW;t>*a4aH0A<$drV}]_tֶֶ8R{ gTZ%idUtmdnڍBJdƊKD{Ȅz]h\J˱~s]B1=h@qEToe[;$%}[x k9![2{骵끵 o f@*黀GJin&/Khʓ,%L Wmi(9)o۩;,fe+6 $L`cZA`l)mߠ(>"!,|qKq:D+lGU̴GtRZ34?EZ{ ZF he lwF|4RASfKuoGtWXWs[|J ;+U𨤒H1I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$[-?O]+ךOFWJF,ZI\\E_@rs?_1 &* n2pr\NS&rQ:JR )C!Rj7d\ g`Q("tAҤ pu M+2r @HQpRD,PR &HO29:(xH R#Dq!zhN* RsgTӄUuR@(D Cw:P{RR(a N (90{ڙ:mZcjb5Sj$TU"tCrS %I"vRvpB(P8N'LRDt)*d ;UtQSBP2p*d pTQrxQ)t&ê9MUH'H'!'ID$:H)2P(!+ V*0U#xPEHBgE,gF<[dJRB:ꠢ8LBp*fJ#4B&`#Ro*mMU- T n D;D'{ˎU[nmO|QUnۘv\0 c5YSJ9x9jvHe) LND"6T\BE@ (ńvCڜ$Iҡ) 8 f3~3}Rd]=&p|r/e \O]9/4`pV KPh@GĨXV+/@?QYjy=᫣]3Ke &ko'D~iތ/x}J CF- |f!U"2K|gW>$ ۃ/gnSlaHhyGr]PT}ǟ%V+{jeﵺV[n 4 )[՘eeA)leZ~=08sV- =ƋMɴ`-kOa4±zXfܡߡ_Z^}1y]^"LӍU/?WQWҰcAg,^gVfz }Os]|]7O5,Et3հIo +s+D[(XZ p?Yk]gM$7%t?Yrr211^}~sk$ +㗐օ<&KS{bemyuU9Gˎ׊1dƗ8걙]JB %uTV.꯴4UwTEan<`cwhenZ}S) *PU= Q2="W'.cY;şQPhǍoR<1PB~3VnvP~ef;XЫS!e9@SBGa.[v04X_Ϧ寰Ԓ.%P.aΫcUm~*Hr?7d&1-%ܯ!sвpn>Vή(8%d_x_TI> s}0|ꪇ]ѧUz5(qK&Z YXgC8`.ic:|?qo~c=~ }ؽE\H:h"GM[jCM3]I4}cpx!>u^T'@]S[b FHC-XVgN5<زVD|$p~ dÛ[oHKAٶpBr,,Uqr2+}Bb#/\}z^ nem?VZSJIBƼ)R$$TJe$o>Ƙ<.T{2y!z? 2@HYWtM;F5pwNa55?~b嘭x]ON U 3G'7)i@َ8^u>]`F?\'^h$;Ykq{.=ʕuX5<;; s_ꟍ+]zu+dKu+sH{ˌ5a{q˙˔=l^p頳wo޸Χ74DR}/qbc[ʁs}Ph~qejӾL655fu9WdVoy|V!#Ukީ 8wssCӾN#XY*gK}W)o/;TM<3V@HGԜ}$D z G[b1*OZq?tOe۷D87 B(>EYH*7Ω-L~D?x"?5_$O Bw8H3dhKS#q~02Y+_*B>E!;g0Szy;+4Ѻpw .no>jhDK%9 '򫜙{"Ar4GqT')7$U~+:`Uؙ>(NU2+t)ݪ \}^|.i>_W!VU37Ze ?I!J@0EWcIqtw!otkp85}%[)A%ҳ/33CW [Tk SSM!ƥժ!̀H+*NA7ⶺQ,a ʵxe<('K,AS&Uc{*O›MΩ7H0: FxLoܩd7^~&ܩ iIjY' ,v Kt쨼 -7:𫲐Tђ1 k*Ӳ`$>#iOus#=ۤh8U=3L׊WVӹQi2Bx6 &aSCHi600>+^ ~>(k?&{,Mp<`pԁ-d2weWp! ,~VHࢵMuvT'^g# h0y]'6tT #۪mP9P.\LɠSM z!P[7m7tr|%яˋV#v@jz{ c;mZe1yuV.l/1d~h)3 ctlJ{8} ޭ|:Wh!FEc8ΐBRV*܇q%  JΥ#&!Me9LgSqO:$Jb .RwQ $ÃDNLJ:'&vl1(@,⃓&Sljq;rJ\`cx;Vl[g H`ѣGEh Tk1~RѨCY OIRsAЅ#Dh)=p=T\;tJڄGf~i ʙljPlS#ELDmQ-Ģ@I&c68 TSM$HQ&W4" ?c]ߑMs֗9KʭE?{/SZIHI$I$I$I%)$I$IJI$[+@X+魊D.CRg*i2H=$ȱ)%xN sv= 2a'5 QL1 hpI@qX7q$;NW"X5(i(\$K$P5ѧI :p/;)KNMjnc:=OR{I$%gk _{(VܔVC9eڃvC5U<i ~#Q6{wO+,krL??N`;`+8?lgRIhU `\n۱)!ٔ wW=7JֲZj 8vhsHYb` E9M peR;[li;F6OuV\$i撓u]Roc ʞ>Mַ.jDT:nAu<[emϩc6g& {HO{ yMCʾ N+rXD9mՏU (&_!LN~F-A ׾Sp?ݮ^Гܗi~zn<4r{,m+cWE.S$qK*NEƬs8Zq鲗X5*wkK^`Xh)wX{{>=g)b;5xpC_ƢqHtt6Ye`1N['5֒גMSӑY iA3' 5Zx )6C,pe4[Vh`!xڬdcAplj }j,XݎPm֐*;3) )qA8l-kkOUEG jP54—>]%;c$:gPqZHDC]}B{S-72;MU 轆%'pQeWCH>*/5Xt \yQ6 l YM>e4Qt`SZk"Yӭ͉gPEe쭣FZr_ӷi;V2o' R=wcQ)APsӻt1<*QnU#Q1Z^)u[CO^6 ש-~r7L;xZ\ւC)Z[lLdKVSCN-љX7,]9ϢР긗c15[*,-a}d'5dƐx$ׇc1!yN̥4ZjukM/k>f԰8mvt 9WPe~eBgX֚ 88oH HZn@iNRSf.ɋڛ-pJmm=ɝ2k}i.(}+N{ٴXd6u:p OM ,u))û{Xcǹ7m]nV9= ^`ksdu^@sZ U~asDa^}Ӻ4(~H<ʃ6mH"NQ$AB[CBAt?MşVS9C˽}oxZ7AcC*{XI6H}u۽1%*wfN?UeaӴ4rqksϛebY 3| S鼴1 8[þJ`8=ψ AINdT2C!KPЉBYWP; \V@@ ~ 渗}5%eWk@L1/[S/y<'[~s cC@We$BDYjCkWuIG^?t$85uD@~ W9i?*[:k,-h%-{nU,B{th%jٿ~*Ә֠YQo>joLF;葤!5|T_蝬EMM3*ځs M" lDȑj9C,$)8ShivPGm: 5d'"PlSy,M`%gRBvGeCSK~0D<5t S9Cm%23sdAJ9!Cmw>jǂҷ + ԖI;@ xY$ $I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K'ym?tMjY~H`{/?&}rs?_ϥ}E_>YD(K)N)JA:@'RIR . aU2@h\r`)/BdrI;"4Cb )!*EAJR M HEuTW<(RQ0tR>Uhx)a S,T@Ec Lj)qJIQLT*fTޜLO e:(ێnaE -$kt@JJC @j!D+-)FJU35QI"ZUϱh5>ԛm:Yat%Y фPuPT4fJc粹9ng1 nho)nxU#c5=bPe{6CBq;zأW:N3|ebqEmmn$r~0.0R9rt` js:Ys*ca.w㯂,)*Ƥw5A+(Nd:6 ct{NܢT i1%W@3F xmX$|ªJ#odD¨X/Hw@FHfEiC`9TM-yʨSSKuN(e &.PvElG}pSHQ+ )nBkӗ*THV5T2p&~vMCߥ߀K 5:脲v\!{sK.trR2f6opH#M5R!|xSSܲh/;X 'A \6?؝YH5dI g?ZI$T .A% YiJk&@'n>aNJeRFR)YVm1(}ҕA'N;ND@ID{.g*F_rˎbp"{DtUYbEY ߅S3W/*Tc8q}:4< =?A]BlXO}uka0qm$p5Uhi0:s]>?X`h&=lk}74H2%p]s;0t~ShZ8aPʴ= CBaA įebD:jf1HݖV-5:jZGǬ\nn:e Ħ>/5[cLt~e qvw+ġK;NQg$9c7xš0C6XtԽccOS "I Zl]J++ȅ<yY.LjI_^q ]U4LO 'hu K+\3hV5~5k_Y@F0qMP)Vtʅ%vAmh%sU&OTq\YzB1vQ!-|^ u< [Ԯ/xZR<xPAyVިsvT ?GFT>3ujSvW.;^H-*'M-k@T>j=FW@md3]Iw[k2gl-:,nIw॓jj;W_qa$4w\( (쏣fV W.1`/:r@JN_]ʥVd5iOvUq6OY;qA6ju6/N:H_`q$sh?LHƶcq)PHLIxUsYz^Ezۜ@H9 .^ w{SoGw(-oXQ6W;/[voe'os%esB>aHSλ9XNv4dMŎ1ua !X]8V$Ln mkɸ:Oͬfp]cMǴ\oǩQ;*]GW;<Ƌ^c;ʴqXmj[>;.Rr鍲 78<(d}-^-ދ[Z^oܸI9sԤK?qBSJ?/fꫂU?`^O*0?/]FB*r|nLmժsyP>)IJBI"&: iE8O)Lu8 )bp#@BI$ $*SBb %M8Q A0R)EP;E ycS`$Z0,eXr-aܬy/`MAS:ܐ 5?MXr$L}QSqc,X~? 3Y:߂W[^U~,j%f&XsEtyэ$.h\& @꓅IXW0?٥ + (I-.ݒ"8###9Ri%a}aΚU'u7Jz3MkmoueѣRʯsHd#jS>Ie3f͕cD=/y՛[ߨ]cJRdҧXu$d$ NIpB*u >I$vݐ!< .e /Ʉ4ka]6^dLxf DJDX`9qOQfnZ~D:߂sPF*h;Dz.g&ON1?>ouO8,mq\?[MxW?\8?mm/yԮo:Ik[5efb[O==.3cJ0/\<ށ9]CCy?/n"+g;;0]N51 ?r]de x GZr~j2\V՞;n?t>)mN\SZ[Сk[ٱXZߢԣdOUU|PfH½@/5`>L? ^sc6"y.-iX+G"?&>Jzڤ@pdqߦ-O yt>vU*{Sw=*%d1~;p<|-V=z*n E64n]6V+f {*vIљ~NUoYA'vޭ`-G8W p*h'UZCBJ4`+2:{pugPFurƣTd`*:sNp~PB6d(ihY=U ;Xʌ$ۚgd7@2ô^vBQS U6:#UC(5yFDU;i5 8 5e:BtX懲(G@E)#UFʮ#R+/ 0|UwOKvV9i yOZ߭&s$xhK`+W@x-*kx*e;5e3>I1FtqV·[\ְYEKO}U+ۑU;p?zvonDM̖k9{GNl+$![zL 8V*~㯂S@N %jJostΩm.@LdMԢSR.'y;( O;@ ̦')2$mN@Ε3!&̗ '@u BJ\E S8w3d`` =Cz)-NB PtiL= w;l 0JqHR 5TOu A )"+JS3%&!1=ԃ>CT"وN*am(ړ Ps۠C6>RSJ3H0ĥƇh:Q:|fnotnEnB;- 66QzI $k`,va2\x'_%^i#/l`~kӎ|}NMw_kXcfSeJܼG챭 Z+x}ګg׆6Dʥ^~V ZYZ )%O#\1Q2vSQioW';V82\WMk}`@yG {q{:zMz٫Ư`h600'0B9^,92[@.,h濨"^$8ĒTC&g nBspN%SQs”(9RQN:8TbR Nsl*fYU,@Tq1D@ԩ+qAѺP's3zFNCС72N~ԫL\a2FPu|疴 7'}x;SN1`I bƩF Ei^p$Y ~ 3j: ަҜ<w} ׺{ʘ T)HEBs bnxNgLr9HhG m]-3H{ho\?N?7Z\/+(GE?x{e)yI$\$I$JRI$I$I$I$$I-ޓiu xhDxQ "j #0}20\K5H$`kGry3*{i)$Z$1(NgnTsE6|*pee`61Z;v9T7W=tp_Pm֚DoY4mRw[CV/ V+i 5ݣѳ=+ itAT̻iqu~pq]F~olA2zR͍DOAXV9ﰹҵp,$$=Oղw8p@KbdɩTWXc#@zŗ\@v-npDYPBj'ב4#F}3'ZwnTzCuMc\+S_Mo!#Hv>ԸWx|T)Ĉ⒗ɭ7k~{N4Q4@ߚUfVo0H{2.k.%cv4~0CG)K};+ڜ\4Q9h%BM59AȥG<,:xqVokTinhkk@># RD9aw0轰ᤅ7P_KBmbc^37CCVN=sn;]Pf=l2qГ~oGɝYXrz 2K]X5u+Hs7CĠ:IE.eU2!aSkyVL[mMd;*6 [%K{ʛ굎&vPS.u>TLw>[ݵhСcƷqFJ./.,~5WMۣC'踉SJWP X.`& j _Ѽ 膏"a5NkepO(ltq[@΃I Wet^bGe57l~u_k¥cqq,֚܏AD`6NMO/{==ZUsB2mikNOt,_Y9Ʒ=_UKkck"UUS uu:#hFy(lo:O}SfC>CJw?C.`4}5`],PNF>>[`>ÿSd1Hq@lnm,:Yi@QK.쌚vdkh U1ಬ9<s֝[KNgj"\ƒ9MiPm;Ѩ>ApOo]d]Db]>qkch`=lü"8Jvc̣Ns BsbJa}X^Ӹ&haZYٕ}& p-+;C%6yUkOdKzTc<YqFDCOAhb]]i"Kg:U..GhnliEͬm x~r lQ%5K8Q{5q:CiFZA?nهr{z{c}=M;DȯdI8Q%Ԕ15nKA |S\%;Rkn(6qҝD;b;PcU Ȣ:3~jd V OoMAΟ%3noT X$ Jda wÿ8h֖elR->S\T^͆c5=R;$?hDem{&3kvR{{}bj& "a!@I+6GUuԿ;>¯~8 ۏUh#'d5T HmۜA㲍`L~ K\]܃•;H2?;tNҞ" w9R& ,.![N1!d%' AYI$ lI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%u;^v+O]+< F._cn'Sf|}C_:(z-KjJoPI7=TBʨ3\yQI6$TqKyQIGoM JʩR|JIm @ $W┒$I$I%VOvQI$I%.dI$RI$I$$I$RI$I*I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IE5]eTTWE < !A3B, ګ ZC-k1$'@nCv[8*:+xg)1U$P\kL;;.}5>a:6voTB\zcA=]ٗ^NKm -Əj7R]Fh]pەSZ\@abW);' 6-jlgݺʗ2<汥͟Wwo]&K~'ys5gwVEx~m O&(u[n{Vf.f'M$D-]OK5eU^="HP?:z/X6cW+W }u>>?ǡ\,yo~kN[Ʋʝ }#sa8,TC>ձV7PZրl~K-ǓSp].M.%{!(R1dP9dd']#xtk{|OegoM+#2l0}&y~+FVWC=?Qgap29Xn!syIau;q-:a~p7w\ 5ɮmLfCZA,ݗ7s|}KZ7X&]a?سǷ5jtF]-,.1Dȴ*trbQ@^BV+`9wұY}S(t,NU[24W5WU.]Y .\c{Wh9V?6M]m@zgH̀4T򛋫 ke[;+=TY\tFЬc[K|>FHh;Oo*"'oVuֹt> }%Ҳ3".ĹsX:kvs+5asBZ\/Dlzי }K 3خc۠ uKH/hd׫["tv}l2xiA+Œ+Ln'٢jxl#0FmsuEh-^r2̒<hQtY88(On耘MIM^\ hQnhW*_i$PEj61 iTkf!6E]ivK<趰-z{R ;J[=ExQRħY]>DnC`.&<|Lϫ5}.h[Š[/) vSÊ@kƀhSu[S_B4Z]'_U91ﰺE.%7VN^)A/Z{=P,oߍJGPjF/3]Yonh??ūK:8kil[c>_tzE@D$A{I/ M(X3|AU/.0?/]Oڭ krzJU?tPbzxQ>JDh iJe2 x& RbI"S&K'R2A$8)NS AD T1NT'S#qk U׍E 3gpkJW*Ҷ0 _?>>7;BбpT/}~ :auDhLJ!|p"t+bE74> :cdXO+CMVk/X5_Ӟ?Iw3fdJ$4vM&*m]/‹iG-??)xfҴp.W>?S6<԰Y8FԾ>Gjd)wTxzQM\2 5ple;l߂>>O1Mܶz.(3Q-RuHɈ){$]Hk[)pK~iDv 'M@0Sh}nN1O &'x .4nI@Z89hd۰y7AIF4C4,V<.>hu ̈́ĀL(EJIRn*AҠ]ۄĂ(9yȲ{`HTŒ ; zpQ*{$ Rcd 䤖E5MS sࣻ BvW$xSkMJ:EhSlqHJ$ Ԣu)$AByO 2甀6b\ [P{»OuktUHuNv@S\7=ێx{x["u'♸Fe BT[ZAUmκ%䟊c@j斑!Q'6>pRV!eǎXu$1]nzUA ھUE?1:'$觪ATX@IOH O j\&\\ "LMA%(G|; A0Ԁ[&l:ct `j3=0cS6;Q>Kӱ !Vm;#dꗳ+>q?y&J2UNgw*Mh#^ *50')!;I*fQn8l,G4`hs@<5&>)ˈ dAT5RFPk;-d@LAx TneO@Ll2L`~*]?UwzV#3թeA`ʃ?FC.uDMC;>d{_ kCG+ZVuŮG<\`Oޤf>=ܴ~nվ$*J.4XY,n집z etpËIJ^HG>Hڈ7c1-4%Ծft^ݭ& WrҺeSeOg;7y[lW5"wn2W5?"9|?+% pRȧ9f/a)yI$\$I$JRI$I$I$I$$I+wQVk\=J%{U2}eSS6GȀOU#IeՂvvLZl=}_`n-]-y|AJ6gU:w97^pॎײ͖ "UۇZ&˦\կ1:O*o YvZQmvjX{ ݦ{)Wea)X2 I"tmUBNAlJ72D9]52OSk\@s)ZC~aF"Zy )c\kau]k>tg](:%o>!F<tK^nH> ِ,sb4*7@आy/t-쁏]cxAak~d0l{ yoSK_GXwn<3]#C8)%Y"yV+hnC.A -br_g'N;kVl_ߺ54nɭղ'$6V=cڨcI }n Eyo ղNqlddaXb$y)㹖H2林ip~()oڎefCCE\?{v65^ P[km5ڛ1~+zO277eD:'cmgRZ^u'kb4 q>n[Xh!,66 *@6XVyA/.ʕk">/MNb!06Fi;hQR⡺HOhm,;x%%${(I >+ UcwreG'UeoriG7DxILCTc;:ڧYʃ,G.~rY (VZ7٧JIeebx(`zH8\e;wt(VD ?pB eM GƂ e-%]EbdDGb(kK&u@(}qF{{{nBk"`,ްуNTE%e7V>k $McHI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.Wʏ?tX^O+GğW(9V?&}v΋迮oC"$IUo)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$OI$.0sAq^tV^@3k'hNy$U7@p;KO,{.%͸}4ۢss !(Q{Yc< ]?HMxLxLtպt~h;IcF4_|>mddPzups4LLVchݯomlF GȖ.OgkkZ@S_Ph}68"gWTbel{z2\Z~S`Οk$ء7Өk:4p{Jf_ yhAs7n'赮O5Y `uzAdkQG4,qovXG:hFS' ɼWilH6cQRơ"Iq9[Y㱧!FWϷN1FqY8~wfcƶ i}V&˟07iWzO.$OѕT63lCoIstMAaR*5ޜcv.aVFFKZ}ZE=E>}4;*ah۰j]K>R(0Kܩcְ4oU{nFIe_ Tz/hp "v^~NcD4`u; nn塀^E \w}%fuoM۹0uwmZ6u /-ޖ7^:yu^ WlTt˷.\ጞ  :ÉoEHaJ$.:Za1_nfƷ /75Er8 >;*[D7}4zA:%mQCk],rDDڣḳKc.fN\Zh#ߞg#j `6D߱b 7}hH.q]߲VL(i!ecʛ*6jʄAЧCu l>3 Se`6۲y!㯟ޯ2%OnIu.ߦt0G };>;x+S '3X*ql|.p(5e[F<- cOڱ_8AҎ[}Z+﹠|]7MȖ4=7<~|F]:(4Y7K}`\og, |#WZ{3J;tٿX~[pUԜug(v}]a#շV?7d}8FNg bvk&`;1YmL_*_P2c~TYm+5tVr %P+2>%Ue}sS51SY0@Ҩ_!mc-ɭyL&)sWM|˃\W\}'怀e#syoY-Oi?*M:Y B>?ASVcs3cA!4+lI2tqX˰u|# VN\JJDB T$>T'JC$)4E>LREKBI rt2JQ L$ Q S 2Nl58lWr)Ѣˣoh|  6Q,;BN@ꏗ;k8'Ī9lVn,tcR{ &nb Gc)XcD:Vm*kr}seʅ5n;W!μ!9t (3gw(v:hp"6&.i`]QH>!)Jbۂ4M8{\9omݡA;Us2`~h~d1a`Ƃ@~;9v=/]qŀ򿐼Fb?;,QN+ZZGbF*x8ls\'j,lr<_!9DGl,~H[oչdY8v[A1Ob}dS\ݕͱ367[\W,t{AU]e$$N`,./Rtc:>ҶÏʀ=\FK6A Z`ʑNnKd):!EgJv3iB4nw]2^Cp 8A4nNDee6uJv:*PX`z0>!]j`xx]Tㅘ3 D.] Lm\@=_њj.%U;*LZ#TTJǖ<(\O}Jibc ] w:N{mg|.0k||URʆֈNk {  亾Y7[eU H*aa3`O-*I~Sѽ!BLN SbS0R X J"T#DcYH &r/'BALG :F035=>%hTd fR)@cQӲ=D& KD3"`*ABkS"#H45QqxKtv4H:~ggDAѯ!"LFR5F(.Q_ntD I Cڞh2G(04 pǕ,_Pw S"cű`Odt&uU,t S:j^ir蘥 '5[^ HU^KvD3Nr_'V!M*h!ll9RԇL!jέ^w'#b*`HM#P9&Sn0mJP#PxPkc⒕:hC™f8H $hALRi)[J-N)߸sbv;n .%ij֛9:4Je x?R(VNohJ5w;hcɐ dzbH} (?mmU4Lq2s8]_Կt mypw-v>0q[8T}XznN-V~uXo A7˘{XF1f@ jǢT@3kD1->13ߕs.VMoqI o\L|ZsXmpt1\xv5 a|u,`Q;Umh|V<~"˞(8GI9|WԻc/]:)p^zS_Ys.T9$dI$I$$I$I)I$I$JRI$..℥QGJRb2XcS'!WgHD!v?'ra>&>* DgKA+k)9 vNHjY{ i'Uu> EVA%OR H*X*ѧOt|ԃ*%8mcq-u1ȃr=5ͬULGfTnQA0h c#HIL.O]ߔLZ0uxAmcH&$F8zY.n ;F;BcpVI]%ٔcq\~oK=.Sqc̐?7+}I!ܹ`6XN֙ 7\{s[L;BU ^d+];BI,F " m{գt94+Ob2nk-~\ [\Teez6Ac{Wb<:Xg#x1ƣ>?ꗧ}Z{rK oߑ뢷tt*l"X<赭n'dke_X?ңP;2|jn}~ ~3w]܉TMs]"5 q s><uc]S۱Ԗ_d9HL}fʛ qVYuEnhO7)?Iװ T8``4Spu醲 }W6. 8-Ks1Ϩ_Qų!.< Ad**TX 0-0)19C(V/J-ͪDZ0~5i-pS8T_n~TZC_ItZ_LUhĵÂq $4?ī$Y^an)s!0t5¢kw! o>ìgwuh"18>HVx:_cF!@I-ZY^jЪ״lCp/nL U ~AdIQ[2mo~g>6DX,;p.Hme=d1%TzVJuS]-)>*kE/xJt_>g*3fq~3rXk#_)SzḺ1's_kj66k6IŎ]q(5dшZꕦXn{j8*o;!56ꁰ7i.į;a8w ΛjwVgڝo c'7Ocj3 }$lW2]Io&:xgJlYh$ZE<]cd%-P[mkƍrw%p|;_8P-sNQcGmCMOL$t\$99MXb|.e2Q׷cFU.uE^);4Oݛw=u wXĄMuR ǨT\>V` 99AqoQm{jW7jwliN6Ƹ1>Z"I2`Bĭ'#%7]sHs@-#]?deNȴ. Ur诨0k@Y's7{ C=7">(MOGPYa@ࢄj515[unasL4xa?'o+-nvsǵOi0\t߲8NyD+v ].*7Tql"RRZU;nW{ݡ! W׹Y1slktrgvX'B%2U^ZF;u[^1V䘝Õ/P0cKy2B1e%/A=!OI ~&3y'Iٲߝ­[vL67蒒]a԰0~j *x3ѱ_{,ǰ {Yg.`u,Df>7Pyil,v=X;@D?+'#V!<'cisy$ٝtS[[t4~yT>S* ݷsWz[smxչF?wﱋ+b6ڪ|s~%[fmsZYl!OHsIldm$;SĻHQ^ne$nm؅6?f]oֺ69:⾵d_Xgd}5K6b/ֱ4n2`Jhw \^S!Xv=ˌ|n11_`% ƫeaia^I]% hEk" L-WF[0{v%s]{m7M=3]ED睓_6*v]K,>WNmqi$ i9WVVh?buMv;ݠݡTs)/Enew !D\;L-絛LhO*ת48JE3^0R兩ssKi'l4q+"u8wOe]WOeu'E}}p2iԢ}Kb䴁`\!sZtj|}XKUiwIEw?z< ([ yM*E{=kx$ w[Yk"?E ٵyP>M ;Ce-%Sֹ'O/󑊋KMh ʴ\ :Uny?%eNLqWVrXmh1 U0@@;-|LoMAn9?u\[WCs66Ic$Ln?}XmqV_cyE1csC\!?XMs5'uұY~CyTl"Ӗ-;' WUTW$OBs .bZK05>ϡR 8! \2SZk .F)?ZQ?i_6/3X0v}^* [?*ŵe%qm.jHh|H2BI$oqy[SJ?/f꫁z?wˁU`^-J)Պ.)WU">AjCUB h\ByDh3cC@PKR:$❥S4Lঙ‹AR)GqwB`0u((R( CM"TJuJ2rdJٻ 6ƭΥVw -^\P<]΋vt;v+Ƈ]B*E 4IVMo+U{i0ܪEj~!%-VM9/G@k0s9]1)aHxKG*%o~(C|B<]r׌ l2G+n#oNF(|BC.9m Rnb1uoޗ_<5 )tH˜PTdA$3 EDπLtLRiTI (T'Q%8)$S)TN!@V )xDɦd7UN\Y<1y[}=y_l2+l DPlCv\֋bԿ#t꿶&۳rs=L8S})Yv@dO dNT:h!|֎[\$4YR>7wqL>*lD>g]Tܞt2Ƚjw^EW!ǒyCsp[(3A(&댝8P“buL;JDO@u eNqO 6yCkf,chPT:²q<,$q=V썐|;PuD>)%9-<'E /58lP A'pY NWkl#3CY[<짢ܪ=|b[~ɬ[+IJǂ[ZUe4{KKp džE}ƩA #@]ch2-<~u̅OF=mp%Rs|M/|F{gH[SElyn[SA*niD!h3$F*t25lqLP-ȶ{w3" mN!l#nψ<`FѠV&.unvYZ!P"L;}F `'OASC^fC94qU21,k*&ګ@sR$Aei}ϊM'L^[O૆tktvlf4#B4 mcDҴZۘZC`ǚA::>ڬWpsOs~K/+}XKIxT>ed4ia˒ɧа|3-CX!1TzKNYn[/P;[EMp*EuYRҼ u^p qṉ{%Y3_ 8[zMu,h,/»X؂"tXYGK2p5]qUmk{z.1%|$^@{nc4&tRyH )N8 9GNOS}qc3LD'VZyD T_9Shw3͖iSAkZg!gOh"'T"J⛀GgC[Fci!/PзOX.v'6Z'Uq-nK;H?5pP.į&Z-Wy.``?%gnCW}B{:~FHp^dXwzOE&)A|Je‘l! OMnEr$|w﬘4۷#ˢ-#U}<Jlkkȷ{[K -zO-p8SjMƗ HܺރCoy{ld43G댊B4=Nǂ`4+fw4!V~;9,'W.pH:dBkH0TXx2ʲ}hbu*KRyxV}d5HyfKY\RjǐK+^ĆBkl%ofGyR ?DDj9D},1Gx~umӺt-P}-%kҭ-XSks#?-"+CH0#=K+$c;cen\> ~ςԧxcܱKmi +5S\m=j>5liwvD$6@&uԲZ̐ϸ,sOB}ǾݗV I;jtw x([Ǐp:i-ɰ+hx,ޥEX6aڍ}Ծ+pѫ {Us[c GW67_. =I3ưO7*Wtkp+UQ=,MЫ׆\Ȥqt{}\ OL74[evd52"`n̿g-{uN{=]wUk110=t?LKv'BT>GmqpGdGbY C9Hׁ)!Q21!|>Q)4uzqwʯUur rCubuN; js?z.g*"[-/ wc⒙ :v H<乩Ƽc%eܖQKOy*?plU+qd1چSHSNLOpXauu}R板Ro%sSn*78-p6Mdje:&V@\֜;mlvܦkH=WuPh+YeHuZv3qrvsefd#9¦mkQ:";y.6̴Έr1jk@ -㽿CW:7Sm'ۻ7`ӖMeI={M8: OQٟ$#ex Eņ:%1ޢl=K{uk^-'Ȣis; U{2wP {}?@yN1 VFWntI!fh u=w*ge=`ԴVuoH?Y祷ɮ$!=t yknʭx{^xBƇm4?褦P3,ӲcU~nwS ]Qh"`W}J'M2#`id~(6'`B 3))zf6XI.#q~5Jގi<'[FhK~uwcoslmJ-k}yl"4q;wUּٌ0bH݀nJJjbeAdk2[YeX rһZC[sZiV޾ʷL V 4#'i; IXZDʅI))ΡA˨qrƋ[c[j |ׅ[45xGǾ4CZ!UWf4:I֋Lm`Ē\t#O*rn;̺knIһ{^b^+kA\iue@R= Zv4J@⒓?*h@c*.%GiUq{ϡV>?1ӏSkVjU6?jcpU۰y"Nx/E;k@Soci& tGMWO?FQÁx #IJa:v))- uAn+l>Ѩԅ;}L`>ֆGu\:F^mi>>*V ; ^[q\,"y@{A~Ѡ"W,$B ..'~IU9΂b `Q8Q1Al)8?I ptQHT-veuN+Ypf-,j+9Ac6QI$X$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KO]+Q' ghI])L]=ALjm ̈́O Ij'AwC<SzSr~S$I)dI$IK$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K S_D9A՝$:Udg@(s$[VbX^ZgCݵ~FY&~ր hIg_M4HsϱP56Kٸ]c74Hof1ޥqip~mGC`=O:MLf-ƌ+XU.X2>қnp6lu 80݊8Y9sG`Gr浛.*1EHp:@?6 WW3 lvƤ ;K42hCo,e1qa1{zzf#[]]_%Kf\ < kYv)ac׆Ud8u 9 JVͯ\ƂK:6?oK}Yez+ujnFC +;hxVvVҢP»N7ɝsYc4r °!0?ĂѠMvâ4. ~e=m@v7rIy!bt9FW`5CCINR0~2-uِ `V.|mk_2u./uTcc4:{H՟n֬h> iF(Z?{䮻\dzX'E8`{,yo2 xCOv}BqIV]AZX099&#6MyrέwӲ+ʞ]ysc;$Jb 7$q}\ZIt:IW;i9$O`wU6&mt74V?G1h:woc㢰FbUPV^vS.3#Z iLqY6V؍mdanp0AFމzW㚛p\a.vtβN:>']EY".9͘ײ]%I^pۼ@w&8C^-1#[d6~Yy&I`Gj[8w?L[\Z #pWT8{R\IDwA~; yg:: =yNVHihDGWEqw,'ko'\wu}KSg21 :s#kLj:辱r)[v+1׹XFPߥ(-hV&Pm{uVnۡTx=< ^8*`$҂82oQ;bki,k SI'v0WBz::ӧJT4F Tɀd┶YpӺ 떞\{gR@oDRSQi>k\ t$RR}6G,uO=ѬF70r@7k0}3ڝWN8W+:I?vth'B-;2[G/+b?W~-p Dx,߯s1KgH ͋t٫jAKΛvؾzC:{Պ*m3_5ŤJ6W]$_Ko OM(ÛrTQz9?vJP)>H>mSMh)MnMSdMUSSKDDJh(N4L]()Trj.LQ R )H%aRLyRmP SjLHLTPrRQ8LKI1Mc7\EE f &|UZU*&+ڮdW$zVYcLjuZu^0ĻO`L :.L}xqDcàz<ޫ^7;W2: %Ǚ'$@ (U_KMD(YM O%qR_Qc(3(◪ @1;(7p#X{w(ȍD`wgt0PϤӹ-p5g]r< +wbGrD)yJeAtR~;0wZ-ww5u^O/)Di9zt&LSep!L$PxR%d<&H)EJd&SZ$l!Jz?En(&ș$qG_q3> ;eL6@0&;O8 Ur.q;d}ճHJflHB2d%JjXvNPy]ڂN:pIDcvN'JSi5Pr_*[B;iA3:E#H@ԦL;GbdĀT\xATAD H5Pvp&HPRRmS|@ U8nXWKQSf(2GZ^DrSj$Lʋex(3" < )lSćPf;nS]IK @ 2q[@ux&dh<qX&tEöu*/].'^s d4=]1s84u[saEZɒd8bۊetjƋ=Ynǻ $s\`B&Bftz"@K^z +xP)ڬu$l˘;+}`e!% U~!g׍ u|j;2;n<,/'z;w.sqۣ{X@=Hcv>*44T&ֺ\'}7cT^\ K;:+d%wHȱ{u+kL :F0G+Gɉ8bq:-nF=%ONc[SWZ(S,Ӹn+>H]oŸp_bo9[rqd'iSÇ^Q1sGWp&@c`x/(y =by; ,I_i3ZV,q@2FAZz,~^UaGU+nV>S2Ą6yR & -бRԝ-puNhlkAHheJ˃N6։ösW1eCQCSgև1ٺlWcx[ݖ>vmqUf;:ximB "m0SxS\ ?֬ukܠvR$ؤ9'g 3Z#Tn)7@Ti()a 64\$Th4Ka'@BA%82BgS"鍣RnD5/: n5n$ptLx;"PL^gچTe&$vTôcn1[^{)_~M;2_G.s?F,Ԅ8G׷S+2r[P+ o]7ɀ<@Tcx` >(`IԢ АIQ,wR\ !g&s@Dk:GL ʁtO j )H6MHԥs**ALkʶ\U);fL:@ 읭♞>HҘL0q Uk JrSM,Ө':J LT@ ) DTfaGMi*A\̧cTt T O"ׅ1YEiҝ@6>*d"Y#"7iA{F: ZFENL eb#S 8lzU\gj ӫY CoPPzZ,o=F~ Md^s]@s HVim3k^Sm`sHs+WH(]4ہT 4=ۢl5{kph%ǷeFnB I.Ve5 V5v#M'Km4v瓹0lpU\7{8s=ImQ&'7j8ǻxZd::iIkips5Me5VbXᨕ j][KIw A2G)!kk,XG==Y]?!6r◴6mk 16]~-`oot>}#QQeJt5W*1?EV$& YeM>מNEI$,L΢񏹦v(51{5ʸq$OyQ=@^H e6ϻ)gTBݡo.#Vlk]cl{huKx< @l{VZ֓dBdmaSޡtc3:$%Yem?V᠎fXv:{v2t T;蟽׆P3)lys}ȩ-/.*K:Ύ'*δY|В?SE *`]\Y2{N|vmW>&xJDZ2k&E{XO^-۠plMmgJE|6dWU_\MM5Ds\˵㲅$ܝB(ho.qtwZU_ ev>*y,4*TWud7\Mk<ۘ4 rqNV-/h"Tkr 4> [Lk0`u:džq&%7g_509)7G.[ ]I{FoX\<@yvVn))9G͋~euG; lPxii#eS1D\ \k*iu[❜ R"A-c42ko Vhh2[|P}1XӤx.8U:O!kIL:=E]3:wU0wRM6^Ǵ-<\ Csˇ VHV|鬇2`iMڅAh!7Jô&!3gq?q X Lp#fWlr+#XIk;rZR1QYfIlI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%Q' wWJ3|WܿOoC"}C_:$I*$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$INHI>)SJVDa-~A R r;ra=Lw$x0Ǹ O-|N*Ft;mvCIKrSSZ9|@AsI'LI:I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$J85Mdd}Q`r+cc/cҎ_P9DK)Ⱈ,k $y2%UL;Ml?Zh V@ԫKc% Gd ם ٕXhyC0ߙs g>̏cps- 15Dku%sx-l d$ڜUXnv;_"5||I`ȱv_&plHq.=M& ܳ}*Ex4{,=r$w xUcQ*5CI$OQ` ~:&iJGvNZu\YbO9vaų?"TkMPY,NUgd]14rz;<Bpls5~s M@k8k*cB{O͵Ɖs};ګ{sH~jU5\;.?F-u4u:dP4LHZA1euD:N!sG_.=pnٴD Qu3YtZOP `\{=M}Y5mՖ8~l בew0O6J2XIiqO=S{qڬz[[ :|Ն$ jT)˜~V谇;ehpiXD5&dB={Y|U*m5oto eZZ5,mn"t]v s9hVyX= MCFőcˈݬڶ.>O+"ڶRХ͎7t벥cNHn`0c\cWeO`Gykt'MS מ,`t5&5C}+ .:FU~o?G*Z΁1c]mDno~b30A~0hW?)Y_e=HBc3ְKO~[Ǹ b޶  >s-|mGDG ǝ4 m. qGui6j -,7"bvx*1m{@U2f F3jNbqku&0JJi{ \hg jZ +!kk֐KhPMso!dt5M6 x)okG== ݒr..g:S,s J6Vl⥏[t#zx;ku;yQ~8UQSpɤZѡ*&Ex7'lȔu"\?I5C"$~X3'KiMV̒KATN)=A@y$j \M,kkt$\gvl c y<, LP?zdU$`>;~!u-!tl_fkԹZUKb*xZڝ$cnN؈q)q$I/ KgOM)_acmW9?wU`^HSD:T4jEO2QlA%NH^ItqFq$'D$iDRSJ54M)nJtO R څiI4@rL'Jx nL Q RQ*S*%L' !H&1LS$;OmQS"aGUhoBN A%5{(Ί.%ܩ@JW`=oku< >rB^x&-Q-R] ^4)gu\D( )$/J[<5T 4E<{F19Dlh N2ksXY6 kA\cĮ:g<4UɗJj&'\oo^`O0TnCVfxEjbSiV5MD('EL` ҧ]NJUP$_~lGc KH/Wm cDR*jͷ85I\Py1uq?Fշ[?" #9/ nBZ(@JG5qdQY{*tcoB`( gbX!Pk: W;4K]TM74< wqP׀0b% !+l5HDbuCsg_얍Nl<#z)'Î4N蚹HhOtT͛Nh_$;!̦p&H#tHLt0ӤTvW-;ӴAZ>hYXɮ jbpW BNc>цw65ˁwL}z&zok'Tg ßң =BQFCi0ugTm:^\N 6OtpFӷZKGQI}%ٶzؠ9՟@!P}rڢۚ5ha52 V\ ٱPe(m'pJ0 ppTu]S7qCtjQsC^Õ|p4 #Vlg tVi; 2OuF44}#t`"F Kq`RЧz ;Cg]ԝuLq}V®#Wx1P.h+gk dx!quA?Ntm8UYE)2s 1EI ̃Äio-S2SNottB)*M=HPvSJ!;EГ)0`%. R%I>%; bg_g@:"< pMypnƲPǂfJv:ŧU$x lp v>j6:[Y~%9@)Cv:LMkK )8PpHuH)s+lr-RTGn?!H3JvBRֻYP#Tj@T&2w)|S@iTaTA}3%DiƊuJ^撠k!FA0 1]"XQa5[G9KHq|MXFDCvx,k,՛wҲmn3+ǃ=^/8}ZY`K;%bx$\_vuHN5t?]my"w\^$꣇gOriL3eE*H:A&Q Kr[&x (R"bS&tJ`粘y=Ӣ:j a%B!HP'Tɝ BApO INӢh* LK^`~(Gy){j[[Hh׍V^>37>#u`fJ#+ ;U2"0G45rrkwn%SvtiH&7Tۤ$hL75!8I<&i:G(!'&u %hA;W $Bg3qP.! RF “^-Jyh i*` owiD-L I#{ RkH%0kSd4>IDHRc8TI# xBHDcZ9ฏ?Ni8j9Ych5LJi_fL,vÉ@?Wx{ۢ) -O2 3KMnv}rr7yq{- ť4mAeZ j&8S{^H .밒Ԕ0kj.GFO5_CXHjQkhnkEh4(UVc0OdձVcSc!ix{mnLJշzUMf$4wVVnU8vqyU;~*4X ] ^e@ ]o=x<.pVGqu[kp9&'r׊ {t$kٵ.~5 .kh,f1u.t-d:͕_L8qWgsrOh\OnEd~ %j͡' =-[+w@6{Z5cX'@XSsXuߗIǥSMf3m?tr H)+PvY{Τ,ucgeVksǴʪ?jQ9qO;>ƴFTܝohUB(8h%Ϻ m?]6?yl]kc[HϻwH{wcC[fq#o_ @uNkwXeE.CU*eOD֙YctT9ڽ R1ȟL uBelZn3__'D.`5/69> )m4QOјY'Qhܟ=Zeweu1qֿ;tqU1nZѴ $BKq !KaMnqq>% U XypsupJ!$FcX+7osA? trM-XCXt䣉Hu^n-i} a4A x24@Q,/!|TowHS M!EL̠:#)uSa.ĞYU큡<q49$Uhx5)Rv-2G rxLmC,gIK*q0 =vSimf mּӰNJy~gPۧ)3y6 3. k.ϵ&|f<)6{h8SsYP٩ rԬ Neae=>Zhu*6S^ue@˲ϪKZ =#2`yX \K/hxH'WmMK>ճmz>g1~KcGE Wcph(e#i[OnJNXYi:!=!gc197 [p tlW nԭkϧ0\0s jo&Q6p$J*i\ؑ⊓]G";6˛Dm n晗<7%^,zr}O?ScY2I%Θ\h#A  !0c`p[r2ց32|!fFjO?IZ>NGhgq .M4ړ9gx5eգPՌB .m=OPrD!<lzh@: 5r8׳wHL 7RqGj` Ȉ=ڍFƞNv>AShm4OJhZ;36LLxR{2&>ݨ7:lGoC[#'kf> 2ukxCV-$aKe3CkCJ^܏,DG6#E hCj?Մ|I0 gVPuAeN!K"=NDap jJ*UV ;#HMC)l4@:{4 qkͰexf"NCktO6;oGB&G|'h"c }2P l-suD2i Xo I$tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IvTIz]*?$ҽaA"w/7Ⱦt_EvΉ$JyI$I$JRI$I$I$I$$I$I)w)I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$N'ZƓ*`T\I<Ɗ%0jLȝT.yÉ9G3'SZ<Ӷ?Ԩ%*KM! Tl#OL)&NtL<'i*)$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I. [ kd< =0'I KѿŽy\ ΗtMnZ7jWq*9/Xmn\U31Xδj;)@p_O:}G'~bcKA~w*k2`7otKrnSF#??JwX㲹~tO愝 YȈ$轨N\x.<M'43.)._3IW\s*ɡĐAzm9ĶˇkRp>$myOGl4[;)fG#U,nj,kfݳqV{@.9Ī,Cne x5س Z%{Q0CDVY8UiuvC_s=&ckQX]@i3;?;ز:e9op+[&sei颳T;J\Gis+Ōa>ϭc `>/*.Rlix7V^C+iʥqEkKIuj'Vǥs!s0 ğ>ޛGQDk4Z1oǝ@y^c2K@m`cbxzr߮vsk2vY606;g3"cCD4@Yx-gUK}iqqy+tRnkr[4i"TZO9ֲI|$^R$;`ql+is}bj;=ܩLeC[6g[ òꆀtcﳿ"yBXKT;KqL L #D]eMaa ig\Gc\ Aʝ-n8$UH5\ OtTM;NJuOOhfuY8v*k [/1&;~r5YNk=7}! Alx+Bd|Iտf@+:ǚϪtL;MK}Y tC_5[>H|SZK:v躐F溮uR x6j9!iHH׫u*~i~hqC͋Hslly\RV/ly/CgMk>\|J9./)9$81cAU yP-O}jR㶆c+}B6]#.`;mu.yT ; QC)`EfהW*c!4$B%lD c xBɧvC;b[4>o? _Vvo g_SjQؽ2W)ჰRu [$;E1f=C9skvka+6Fu>K΍4y(sça*,xed7>cm]Senn# iA.]BVNMҺ?IU4e4%t21?op\X#YR2DŽ /2U>ӟ'.rm,:+В:3Z+~߽U'X- &}jwEy_N?oMs֒P+)PktH ʊͯ o$N>Bl>4Eb#xS!$*^[XwtPtp ea{u5?OҨ/Mܦ}-u`H3S&N(1Ҍ8Sʣ'U\ID1 h 2wQlo:({(9 Y*OW&T*Đ] '8PlkRDRV84V<%&ډC,ʘt$`&kdcQV=ӹ YJ`"uN3'*>B~}Gt:cj`TC*_Wu-s:koP2<1_mjDB ]2#D80I5t3,טB-Idpqm_gj})*P0I= niHJ"܆պF?GP*]ccOeoIUKC;YX1zsYE =w  ×8i"`H6 Z&T1JRh(;DԩQRf4OFB\jSuH{NEi)~*1*M:EL@xBvh O9 朐tFtR)MO p'DiJ h~)xHhR?ţ$tLx&o)uSi8H@r<&9F6sgm$(Lx:$ RrIhױsu=dm ̄=vIڑb1*{qD-KCKJ^6:H'D%`e@Q$NfCR3)P;C<襧 4M$b;GlJr5ʉr)>)A04$rIPcpx!N d;DI6Ark5vt :3=W_kA/Эg.:BPU¹ye&4=wNsH]}sYd{eXkWq?H I%:tI$$:y hL+=fm].c3MFOq,/[`l`~+.TQ]>}T$EvWf6gk^NU[}Y~ZI>QhhDuvL\Mcˉ-?z#!j 0y)HfѸ{hL "(Z<M.o@&L!8 vNO^%Jy'DgY0[ 1ߔ8Hk%3 (l=?؜Q@D0LeDȂ5hpt>(PqP$q"5Iù iH␞J PpKHIkh gE+$ OtBT`Vr`*;w"Gdς\e'T!<eS #c@uW,-`p3*n${'ړ㺻? (-۩2ǀ |s'zl3Z 䦞Gei*![Ê\Fm)RRSvC ҝ5H&Dp;{$~ ȄJ^*g Fe<DNvʁ!=t [>*@d'Dv3JHF#SΩ9nRu)'Th)ۢFY:N4N|2ZuC~HHY:#]R&Qk:):DNordp#ǏAuO(\`A@n FkpӔ#.۬|-4#i$jɞjEjƉ1ȻB7r\#S֗9KʌV]eGEgJבm F'JמI$I$IJI$I$RI$I$I$I%)$S^*{Qt=3#֤DWDXAʼv 0|M)2#qQ|-MBB5`۸S<~H$"yp߸dzAUkZ?H>hA`"Q}ָy x$*/A(\L4>ioR{@Ǻkt,2 NJ7Yl׾'Q+v/U{ap'X:UtTzFˤo.7cC%:ivBh QC=. Mpp?HجCw=[ڧ;֡jWZʷd3uMn iVq KGuLs4H ͻ%0RHxGr:zLcv0qr-qHٓe–efsO KE{>;х;R ?GєW`?J-OrA.U :\A,jomdZѴ8'YV{.zl}VQ68=ͺĈ喺V.?%2zջCZLk}v],\Kzfs\[0߂,V@xhbb\w~ct-WzGD֍̓b]AcN UgvE#d;)ن널^ 4,Mu'1[6\?|nN),k>xl>o#;$0nfjnqđ:ju k KFo d6VJ8APZ6]*Ui.v*hJqk=lY@E{!#uE fg{787;e#nUq~6{_Jc)}MGP!P3Zl:@{Gbl6\4'Ɨzs8ȥָOb}}a{c1Aszaġߦ'~ZA G-h9͙Q̆Dq*lM v+ [s[kKr:>] CdURe61AO^یT:ʅ!Ǽ h$Nc'ILY &fVqqkw}4A`"5Wd69Ā@ e~AOO!˵x1Gt0<衇M<LZǧ`}! i!@k|KO(!:0]]p6{ ?TmOk_{\G`gJ3)yUKLU2Z. ps! b' uE44Fmqm\=ò=8BW^LV0EM{*IR/wÅc@$*c4VA~l\zw?T:l)o,k$ŭ`msPe>ǷԬ1r$I4p즦 O}0^]~i!|Npn.kw44qPU4=>FUԚlD8X6Cgo-9fԀw[H;븻@<@O ))qw8@tQ{ln_`q$Vo#wܢ56S]#- %&6÷?pd?%k&\;'Thv4Ai?5ś)6<6@6`tM-2H<"8}:6ÀU7<O ;w|kB=ZƮ?ֹ̍;O WIk] T q)͟OJak!wM~[T/ AjmCX'cj`5Q/8h+fv=kY_̒/ %vXeųP,֟ѵ#Eɠ$ K#BEsX!hy(nӨ!2T\ j& K@3[o&{rc>|Jr Qv6=/ uV%<4߅G? ׺&}ƊycK`?5uGodk}mLILזBer;X\vU1lfS}/Zk"j5Z[ObS)F5-a`\فSja5`\y*־d%*5&K= ]TMdX  |5|tk*Aݡ%62u:G sk =I ]@>h;*'k,kB);FcCDhIB7wILvDKAEp0F57^˘ȳձ+/[P,rMX:+I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KO]+Q' ghI])3"t(sH)KF&'Ш$I$OG2I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I*Je4>\/pĭ߭Hku.$}ޞ1gctkc/)c9xkchOO܇eLF?D<;AܬTCѨU񉴀DZ{\ׂ8p]tfiȴ40\?1C޳i,2 KG9^3XZ#EEFߺ֫׵ d!~HY6Fj,t8?r Él;C [7LL(X[tS& U[5BX* kCxkճɲaÀ89sYWV8mn?5tXck{Fu9(>=$# 0iP\ZCG`hs[<ܛR)wY.֏V{{*KϯUl񸆕cjŲe[q}V*0Z5~;y~>;HGV@^@?'a 3t3xtOT=צܦU>]?KIyTǶk7/Q7 q r/-e5VHv(=E*tK˸ukV *Bџ%~+sKA<N`nz M,} Z,0hJΡYI8{EC {n<8WwbAe?y'):ؔ@ 0OdmJi rhk4k}/Y}ku[罵شu . @*O潄6'CxS[fUDHJ[.u^;|_ ʛpuݷe2ZK#;;k:Gn-<7\C@Np]up~z& sI"_!S]Acn3˦cHjYee$Ï=u;tԤ_뼸h ~DUO#f' hrqJ}V 5JvTpk ZN_Rm}'Dckf5춨|<~S!>KWo1"Uh.p#t48}ĮeCXAp;rR퍡[Ai>-/'k *AYA;X^'!Tf@[?X0=,L7;˞ȲV.<ς_ݪe=JiXC~ӡ?2LO{t?7 YDP0TP杼tVYߠlno?jsxT~kzCOJֱBhI0p9 } V1A`nk.i$?sڪ=RY48Z el3k~:+.hڴ5B]<}s\l_C#Գh5cSԌ4c,%LoB11}-nItl_fcn #݆vNnSmhpI .ۆ\ZI$duRI% K_OM)~ÛrTQz9?w 0ҡb7t_RceDV*ݪWe8i%1h^FzNgD#'t. 5N)J7TҕJJt#]RЖRJuIɀ.D%g] 7o;<=n;ܥ/YM/+[⸪~9 )Upi@~$)Э{U1hmw)K:uxzڀB}q آL}S8+07]XtrPظ#W?]0pyK'0x@1Iz֖tXpb quqQ.Ņ߫V7TϾkZb{D+xGI$Ԡ*vXmY.4F $ Q1M)IHT' Q)@ +dKAUqߐ]bI]K,TyQҗ~PY[z6wEYߺi85J/X2$Rz7زhp:?Y&, ͠[P:x+P<@Ϗ4Ɗx'cϡ}L/#][{\ߨvb9]9:g~{Y2_O^s]SkG}SB!gI"ODlطñ[] Jm.>.KFT ]@nvGA(Mn *[S RTKy$d 8~*mg;F,)*sx:]ژSɔ0$m@2<2D"Uw:!W&R23@Jf<κ&xS rxO*`[a@ (:xN;dKY('QtɃEIj#H LHKv "<{@tQyR a;Bc'>ڕQXOʓ :!ND 9 2QG - GӲZ)XTK;;`ɶΡY`N hJt2VEA|cۍ eֆ hww/R=sn:) Ǝ5S}nŮB0`uޙMpV''@!|\Z>~t`\N-:max+6P0_Y칵tL&KI$m%w0W_N0qdW7:orSȭDY-}:5zK2aJx#@!IdYܹC($]$6NZF&aALXC2{@ghT}A2AJiH IDt6%EJf9!;(/.>)7˔ȏi{'$v$.6"HS\g4>jMH)H ?4F;$) !RTH0Ҝ` DʃP YDh # HEqAqGtK YG*m 䍍:|;<\ZqT#TFD0` d[<6i}y7Nh)m' JQZ6='踯f.Ԏȥ>soGzҽTiOs%kt?F?=I$I$I$JRI$I$I$I$$I$I)I$JO=ʪJR$XAE"?I'8ZvPm((7@׺:m:%%"dAs4BDyJ hP$"h֠& v gDk+#W9 ӉfFjd2VMحhe^V:v]\om_d}.C&f0Ύ:{lҍ.=b`6K9p+kXC[R$ Zo0%ߙ?X@ijsn~j-q W }eh+"aZ %+M:0~)<{ȅΣ enkls[P jDF ONz|L\dx.YPXw++7 2 ?= caguWze:V-$Gt|V }hƷo龢zoi&-h_33.80ay-7;^">+rv PV63q R^k[3R%N+mK.uj`>Ań|T(}Ca֖Dn5v/?h>FX6HdԪx76\9;vlK%ߕqsox 90\%Y|T7))OY61ƮE{tkE.wfcu+6%̅ntK^nM iL\,  6%$΢2wD![nvγTV=YZuWki.!wiTW8Mnܝ#o)ZvC[ܤķ=1[O.,[aeNن~N,i/ՠ(V^ֺ CPmoR]JQh BwYT'*l[F<5J纾`{.?Wjc|=vLg}+5sku.%V@E甛K+{ILVM,DN-O V&|S;9T==hd52n1\cHE6> 8dYԡOa$+vn3ɗ8WQKh~<?IZ{[ZcqO4WV DSc6iӸGta֦]{F7/p3yY{ N/ (6Rt*MqqQܨlq2>h1D>$ Jt2,lcA“ 粨il 쏣GQ-hsu:G v;{OshdSd8-#f;Cˉ+Yk-uTI=74] 〳 ν]e{\\fgNӽ{ {I$ueufw5r=V?J3= Ec"u?Uւ;cFF6AژgH+*` V=y=պ2$5l4㼠{~6@wh%kN%荪YUg. QeX$5#H>%B2gwSǖRi;"FqQcj`eGi ȥ٩"~=-:9AwѲeR$!Owa-+ 0"[\, ݗe44@v1_֐FAþ uj9ߤGQkL /p[V-0%6+a>p:=+,lWP$?[ 'OK  qOV'P2}()&V@a#y(G%&4,ןM5l`~b]SZ-kBe|ҿYkaFHp R/y,{wq+U.kgZqZfGiېm..ԓ4Zft"ֵB%Y쭀p&>JZxL{ mYXxP̲6 xM-${gT}d鹰jiPn'_:SkO5׍[L csr;G#ѷ23;x |; Ii>5\mvJ࡝6 ~b55 .>J! )4u(V;fRS;=F$ +BUf| MSaEE$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IvTIz]*?$ҽaA"w/7Ⱦt_EvΉ$JyI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$2I)JM0TRR<ʏ ]H&k:lsan|;c)R"}0q3Qq<(}BII(yQN$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$O c!L lvLUP?;=½CtKK'hw?V*>+ÿ<9=܉.nM՛jkvOe J'D0l ?b2e7~􎥭-X~PqmynC@i<֪sA'[p͆IRmͧ=Τَm$Wg{A<[qSM\+ Kݳh$5Rv5o.sq"7{i #<fӣ`4%]- K:tD]7M./q_gMN̆[U` u?:~?ReT5h_U.mͺ2L5 *5[p>k~5."Ju U@YGb |N+nx}e1|o ԭmqd|V֊F6Mn}vN4hɺ0<H̙WTKCXk*.C#_?OA~&T[XѠO4{5Y$r5NW-PyW2 wYζ)>;*{^=orU>lvd En\罃5cIۼ6Ο\պms+ wJf j5Vr7QͺÍ1Ֆiis^Ϳ zk ]gܡƈc gY;+BG>kCwޚ^.#FOb aB[%K!xwiwjͅ Avju'EJVzo.ln*X}bC@:[Eȫ~NvKV]qnf1fNukLi}X<؈V[.[L }I|VCDBsGv#(Y[ &UJxbIˤ 'X&cEdzʵf;lIQ1Zչve Ψy3$mkxJg4>H?r)-ɭވd0?Gb Þ3ڣN\ܳ=-0V5uH$%Μ ʩ,~=Pr}@* K?[oGպ%-uq A0l 1/Y"4WhW_k> Ϯ++.B5Wp4WGͮm-+ʶ1 r},E YT ]0F鵛hp2$Fr%h U9BE7]{?i:FS+nK̬1ObcK3οXcpׅe|d@iy$ˤ@KUUw2}'$dALgwxEi:Ƹm$NU5n`Cw>*y ;A\ڤ6 vx';̩zn-QH/,-o jcio C/ ̰hOy\ @#Cݽ?&,ЪtMoC}2`R>1q{ik{@lo.}Cj'IB$K Kӿ_OM)_acmW9?w7GraShT|xVT=a &s*d*0PA $P H:)aKSpR:$H')M I2IBt)iH u'LI$:IOa<FTJtJ. KR/x@|T5`iwdܫ9Ku ʈ)<$ D(t">OZU j9[?k7VW$Fs1厣ړj n/TnN%5iEߜ.{ORMXAa$m+#,XƙYYR0p0J[xos^=wW>m)l DS$`Q1LʌJb!1(jZH5"O +w{tJB2;E~8qʗiT],6XvI> $\_.`Ta{Z+ qܕzáH6qEqAVC)K_4gA1 >Q1s!av`юXUp'YeA\l琲zC@jӯGGJL{ |q[Q1%FyZ88.xyviU 8*Hi=ָ!7vӧtܒ%P{_hO$ǏFG`aX ay@easEѠNݒʩͬ3Z][+D<yheZ[$Z1xP!FtCc`PqSQ1O2t ԼRl(;Bv'N991%;\;dADDqATDʞJXZ~(#SICy3)uO$))4(ailS=SIE&8B J L^= mH v1&<6!6ɮOu6$ ^BuP"#NĹ1o*d!3x&q v*]E5IK S]ۄ bFUdpJq TJVDx%@h׎O:HԔZΈjV4MTճWit7#\JS)K5B g=9>IN=@n$'tOy0S& HۄH#) )&w@09BHd?ztspEѢb`BuZmg F@0x ^$ ɉPTBr]v=`s5Z_!q. A!qúNS[Lʭ}fݭs\x uP2 y.;zM,q) Y>.?;64!N_ƶ\JLɝ0Ca.x{Q [:AjtNrǚ_SxgÆ_vǼcrl'Wmc/!v4A U.!ݿt+S:Nm2 .Rz>- k{M͘ZWʥLx(Fΰd(0Υ9x%BwI.25S 3Oq*,d](%Ja qʝ{uG[@iSq vNʀөLy 5Q+ sK3ħ&JCL$tR2|8Qk$"q'yH'% 3q}ޞB`MeI:@ ``j ;JB$ @j<C$p[R6B:6O&ĂICk" GqCieLi> 0:^wjlALYB "\xL["(%m #9.8@kv,xH &R#P䜤|iⓄ:( i S:&K@cGug f8(wC[R$ ˧2f @BDjO=qґe잜p{6Gk#曍G \ a?Pe ]EĈ ;xDa;{&$DDŤꂙrtCuZ3 $&=)ڃiNѪJ\ߔDA1`wiiH0S۵2p۬h 8H SҥR)HN%4Q'MK'&D뢏tSDDG)|cE'k;Npj8';yHy@U0۬+l5ll-hۧޓiGi N<'ZVkA!v ɃÐhRdS(Ou&4%&}CQ*`DQh=%FT烧̩>;pFMNB%z)+&a-'SIRn.*Rź&1I'Hm'Ej %4Q1 u$'.@tG)$;G`X‹<)6HM9IK)AMM&@ Nv!N֑" jf=r4hb$'G/$J|"ÔHB0 [ 0y%5(@:{~)+ȻFwSb_is<|p/U#ן+^Ac^*=gJמI˞$I$IJI$I$RI$I$I$I%)$I$IJI$[ SC8rc(Yt ,D=W[X~OiwF$I<$Ѱ$Wocw* &[h7:Vmu*uJΡ{+" k:*ӕjC$J-hq|Jlf́=MkYn05 >AsZ?5}VwQ˲oΑp<'RnaK]rWS bU{KZѣ_Ssz-=O2RνSs0h2\t*] EDrp!/Sr2EM ?M sE0:ihXj_qeUjsN>*wB/-j&T9DөrսbtxGsjUlCD->ۘU~c[^Vw3oTcmxh .x9\^KH]C^̋ h'1{ 9O(}OѸ!TLfP=@CYo# sH( & xl^NR!|gb]i`u[/Zp(nUjqq~?w N8B[Yй?݀܂+WH^hGrd}^!O!kRy$jU۰jm@Ԕծ14J=95<{:|,%sY\(> dn>/Ae!;Vu<<upяKRu@IzՊ9>h>I xynnCI Fם[`ebdG)c1M7SܨvONn.=Gu7<*{XLRc@ܹ?ʸ`hТY-4s؂ZxIKt|c>ֺI?-E-:8`* W#iy!ܞ!3= U=$5':R/k=2Wq$T/΀И'6]v[[Zp'Du-B#@tWz~EmijGY hYh2fa?Շ9srq$:Oc\ ,W3Z%wJZ#愶*!,Trnrɕa}h.n;WUf\7nYk#tKkv.*-=\d[{]k.}u z` <8OfpKti2~;9"875M]op;'yz,Mտ۴bzjƶἺ;YVvڝQ27q\XĤd- c0jH粎3nJMtj! O'w#o,$슑[k#CUp3.\*m2m85٪nѷBGRk'YWwrLB! +԰XwX?uj\@3Ⲏ9,vR 6N3sC_$0(/tjPp6g]\md{D(22v9Z9Xl 6ςkOvǓæ|Q}ΊI$ UIc`! Nc^ dž7Uj7 ڥiba%K!a-!0Lj{q}˒u ~;q#Գp!kU<*e\}'CH*m7`'ZԿ3u-cHIU@Caw4Qf9sti>=WwG.?5;4"(6a:hQ{h3 yPʽ^cuQU&׈`fN@u;ߚ76;Z[Z{;s^#TX#sy(kk_MèVk!8h Nq9U$I3 Ĕp2tI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IvTIz]*?$ҽaA"w/7Ⱦt_EvΉ$JyI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$xIK )Ld ]@!GV Qs|4LtȩI҄I$I$I$I$I$$I$I)I$I$JRI$I$I$I$$I!7unFPSpХg?fMnõ*tW&ݣ gGkkCI2CCu-qI{\6K~H4c?z&#][\{F$eR=6#o8ZԬ~CsCg^=5q+>s~bPْH txL~qh ĩ/0g^4@$ GeM'f`6tńN;1^fpWX].$'='>ݩsw2X)ZXh7s o*3_emkoFǣ!Vn24ɭG۟^+c K9'K~%t}6 9Slx: fާUcH?c8CI';)AzL@5ŭvi>e?۱[W4tznX ,LY`kZ8-ȂV}Zd!e":k~+R9p;M֚n6kc[,pHs -܆8Vkޮu 7I.tbq)sVSu?3Kc0p3ⷱ]`HЗkWz d7F- #Wݴ1ˎRg데v6]b9t{ʯR}k o#-M}klĮ9+CЉE"uFh~\[ &ݵr^YEXGW*=fs7NyGQs5jIMom$DKK,.0q-[SkH&aIF4ײj nO0dG}$ti:!EZXsA DrSZË[#bAh!>KX'bIhsA`r;64 @W Z,3zϥAk3lm65pq'NӘ*C<oBxe@m$*1Ome큸pG?\]/ckagOw`-?`Ls'u{ ~25@o䐣,.8kgpm͗68h ,Pl*}"u{  ù3\iqݫ`sO (\KĉAprCcX n5I#yBյB(u2[CNZ="pIwn{+6Ցω:M Z;)6*`xWT,N{')6ՎXoP2s.Cgiwc_y#@RbTw!K,iȻd+S*F>|1pptREiv3ەeKk#Ctx}ʹ6ƭ:Nѓi o9x~-h;+&,zxq[J_,\"x+Wc-5h@5@pԸ #]Ei}]v \AD.5$UI$ +ӿ_OM)_acmWo*0?/^%QE*6 DTBzhPbYHBvta:[)*p(B)+9&;J%BԘd$J)|SL&(R~SrD)&!G"0I(H8*AGP )u RLI$IJI$, , w "`|г 4X'kN̫ߺ @XfѴ@HԧXw%튚`JPGTdok9یOd˪xvEL7S{YO SU;rңZ2(tM ҏfuVA9 ]'G2B8h7zOEc|7W&GW]{ wW 0TL2⏭Y!8оDJxf;Z =G\EdW#7##p#sJ#[Xi1d"%^_DiMǐcezNJ(% L 4BrH6}1jJ\D@! XaIzCXL"Wy: g;25:#y7O ;GWcO!DkW Ճq+_W!U YaN Fמc6!⣺ ٌDC?,5{"~46?ȥ[hh2@y.l Z+Wl'ﰸ*+n[{ˋ}PC*ԏL8s m`nPT[/mֳX4e9珺/ He?RÄZĄB6 fk<Ѫy'|<;s+=$S>7c ) Mnbڎͽ.pвsDi“$ON0NzbW7_Gekd/I3F ΑzN zcsr"Z?+w̆2`Z Zյh|_/+dy1N?M 2r `?^yme-:A|xeyHnJ0=ܬ;j)9F=$ѦLF60PކT ŸxaMKNu(왭1&|#K9ғHN;5@̨!są6y*# Pr41Fx I<'yI9O R;)𚱬ײLx$N.YRˆ>|S)ʓ]?Ҧ!9;T5% 9JƓ |i;Z]) ~*3: 2 BڢRaJhIIN 5E@QtϚ]TƗH#-D*3:Sκh _;ѧ Kp+ӰZ> tY]{~#~3` Nj7v[u_2YuO}g,N Yuc{w0YGP὇isV~ѐ8gG'>GNC _zo/X[{E}SY6 lzcpKmǫ:3sOg*yX}YSg۰g+> ) %:zןpdry紸TF\`*%mpjk.Td4:a=vd{`hE'PQSjgdl H7n*u AӺr3Q"SM'fEàs` ryQpCZvO0] ORP.Ɖ)c:dN+ >G NH !EDŽH, kaҞ q;eEx:L3L0<xOkC$Rݴ`$4'D (CP"08ӷLn6fJpE j~"6 ŕv> 5dnG*_Dp;t$&&u^$ LG_ܘt8Qed|nu&8~  M3i^Q)f]i)@ uJ8S & O 4/SD0t0#Fi*UkBsׅ 8Lt-PuCBD6cRpEҖ! 3tRᲚ;'&88Q$"40HD úpcMZ83$ j +Jgt~*'B&c9CDv ; TҒ5R gZJqomtTTZ)%3{jX$c :QHԤI*S5R0΀G:;4i)jA2m`Z )9cEF #;"<IK6NqA"|[CEڢQ+5BQH4h?jخ+gG"K%QS'M?O"J׏=;a1yI$I$I$I$I%)$I$IJI$I$RI$I$I$I%)$Z&&~ iZk!0B5nI|dUZCm纛 *]Uڽ M:2Zt2&{+xġӽƞJVѻR;->dzu[-yRxO@mVg|VFN5A1*Ÿ7+q HW}b\݌\﫮xVC~nWoԈUz]AE.Xpc k8%"֧r\VSujq*}3#$ f>iMp->?T.@]D Bq,s~ mt\̗C\6@]"hVlNۦSs9h*tlomw]svWYhfE̗AWí&'֝I: Ĵ@C8|U>=ZZmZ C dGbgwPַ͞O1af7_ҡqͶ7q*V03|2$$Sufb}jΥ 5K}Ht;k~.kSM7.E.'B ƪA*U9MZu=ʋt"Dk rĖI>(5c& $[u?y3k8H*@'!G"<$bbѸpUg6B݃Ey9Deؔ fE3B?pPLNJfvUh(ÁQch,Y~.Pq,B :1r\K'F.S5 ԇg"Tj$wUJ#ʥ %|\H0l5f*YR|v &Fv=;Vj`wS4R} WH 流%Ymipe5!Ăւ{(8XX=lj `B՞H:Mj;c`H 3 "V8UR%XZّPo>ayw`ګC,lYa,1б4 o'JȪ5ۘuVs DN|̫F64pm@*e2>OY4 /2%"G!XJ:T$ I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KO]+Q' ghI]+kik}~zN^Agw4FtZ/.qm0=9ߤحQe{]q?}K.ַHШs NweyjZI-<?{DõKOoVm~~Zx~OcF'Xv p8(ځXhNau\55 pI?BCO3#kү*Z^5?[6'׆s^cZ\ !};74Hsh[e<5Aw?`jL{2t;A lUK[c"Ɇ!f7hG\ͳQh2F!XQXd$mmtC}%,CݳlmRӥԳd:I~c6-V>l eߚC蘦\slof[XIl1Uin˴Z ?`A68yltUV 5U~6u&YY;"_wkZ <'WsCάmt О?y[.s{@`>yӄOPѠv>1)mXʪs$ . 9h>\Ѫe{pc{~vʦ+^KOSwah{u)M {WM;GVI #B4#OA뭩="ۨk騞:i:vzXS%ֵ^C@u"ZN;M?O ۮVvKe'4Z7X1'r]m5j8 u7;HMu2}WUDn>N:: 4eSpG9$-.-; 0om2OQ։$4^iy%k?(V7sX7?AS|U q4ֽpkZ%kD99XŴ[t4Q2<52|ҤƞDt%\6쨇7c;>vjJ;u~hIߢKKkH;vWk}/(2ժkk@ FݠwV*!;)=5 e{e5̑ksk,ä+Эc<{@$,$9IH K2l%WJ`JеG^H gERu8Tr{,{CX#e !֯Nsw6t@}0С84E^G*/tSNq{KY*%4䩇:NY}I Nf=QW#|`;-/>LOMe>7`jdzbƑ>knc%pss=Umhqx~qк|֎Mĸ5Baȍc ckp^_[[S}ͫl}9Z7x-xҷ;pt k!58ks_XY?dk+qOhXK9*}Y!gV];<}/5},9֖`9/B6$SI%+$K +_OM)_acmW9?wU`^t0OQt_HOY2TP(H)Vt'pS5QivTcD i:)8HPO)R09"%GcB )2IRQ8IK *E1R ƉbS2p0N$RI$IJL% W̗: IC۾OK FUo#UdǙEzxŃ;_Ϋosh:PߦO*~W3Fi;awW63Zy"~{ lv 5@B:"ʉ @0Y*{d"CPAX`i%%(">k$v 5EX᪡V#w^泬ө\<IggBq ÇLWSiZW064Gh"!nͼU{Ubv" bgU w5X>a^n!a?? DB;!H!CALZ4FZk̮F=c!q`. ZP?$r7%!xW~Bx_YQaN2%! ʦE,r=:ppS$h-Iʧц$'㺍У' U`2G)mc GS {y\$¡7@wrc *mu[*[ FEDL-'9<ׯk[$k8!& _5zd, NMXtxdukO.< "SXA(ŐLohDh>uӺ7 C8CmWY1b_`n沗}P1t$&h5v=<@s\J&mUҲ:{\ e sd?_$¥#虧w4 DBm) PׂL88AR(FA)k!HDۯ^,lRb}hv;+8ϗGA/<S\Ra*^HY(9M|QCQԀٺOީ?d4ŏ+!˯0a{*a9KW;%} ?7҃UzN{Ƀ^]Fͮ%iwNdɓ?W4^X?X?; "V+a"w8*>x5> yRBPL.))x 'Ru}Y׺[~Milg i0JGvB!KQsaΗ|I!3&8VvLh]TLq!>^=NHD&yPqI2@kKn AGa8'H bu AB_ӄ@S0G(E`7zMJNthKN\,hL;e ĀOȧcBD%)0O,uLHi*0F$xӄ20((B@fô|QCL fBtFG8di*a'SRmߊg&Ohhu1QccY*g>*ech'3pCwk>jMjI5"P; py$W`8E. |Rq'}4),*!Ăqʁa(Jw7aJDJdjfxEx:$Z~^ @3eL8>*z Wq4P scOs!RD̟$e.d|Qv1É;t5SyN &Oޔ}$<(8Ϊ/w4Dio#]!s)L<8r1s;)DC8X^@=f'OH1C7x@;h"g8D Q!'H|S+t;$ ;fËtN: jb0`O"7$BL0$RCR@Sh&> yH8v'_R:.H:MHPf&cUc@K yN&kKOI(IcR6HCsuOe;ugDGu2 'U S-3M2SgL W%Q#2ZDr\_w~E۱'hc)e֗9Kʙ̀W?Vr /NwtYyI$I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$a ΑW/|PtN<يwFED[tJ s?W*LS'H?aǸ:y2A N!hPZמ dZmkVIs}{鴆.~08ʵ҇UW/m6Y-CNHzFvK큥%'8?Хκ6= Sg\(huoypEo,f8R a47` G$4Ut+m5 km8YXpzs,C_ECÇ客/m95&N'\}UCg_j문O I!oY2_ZH&$<:dY6ls]n/V̹R}G!^auzzOT˺]/Dӏ13r҇ |1N;S xT=c]>N%ٸx͡O/;߂`iV0,.-Vz7_V_T>B!AE':f}P ~ gtzk#\fSSst'SnyͶ۴hZ#4\~CDl5_W챭%좳?L+ h F>X[q*}GU, +_Mo\mfZ\(ǖ1AG ٣m"moo ְGu*_W6kXuЮB̮8pERǯotWQd<0H :;B9 8gD̰9Ŭ@qY֟F͏onᨕ*I`quOX6q #-HݯX uzӰ\oAĩ֐hAd5R VMM5<'eiϿc\FQϋaÝaJ0eԞ08FI[Ҳpݴ *x+#)` {YxUzkyYY\1*%5$0̚QjuDg[,l;yWqCk䭶qԩFF1UkCg]D8$A"7Ӵx7jQ,%D)eیyQ` Tr=-F~}cp y5?7m#iU0VH<$mv;D䴫pv:-sYc}N*7+o˶L6@>JYR$qaYEpG*Y}9즫C\ p懑 ~A{JNhpUrkni Q?qlD n!:zvU[BQJu@YrW]45 ? o2D]SIe[~I:l>;`<+=q֠r]ig$S x!g+rkm/|O.ޣ]Mu`70VǑsf˿Jd{$6Hy+5 Z%0s*=%8yn "Qa-.3{̑1U.n5~Kз$n*q֏~rsC F+\Ӹ}TrZw=Gu;gt)Ђ <:ev6YVZBǩ*yXX;p/ n6\|vYCs[l ]3'Ɛu' Ԡ]n~Tu{O9Wc^zk4u9KHU짪@?ʸjwvw>(s 4#h6I x5Mkh&rJku{-Yvt>nv βC] }}խh&~c|, 40_;6#EG#'cͮ;|J1U];|1-1?L&ͤd?Gk=?Imݸsu>5na5i *pfV(U 9( u[ճcasn_S~5na4gk_ zX$_/orԴ5MelBMk!uuP{l.qAL\ζ EƾHp{ 1/3nsgvzh[_U7lj};Q1ֵ,pLΑAl1s\$;k)[P>au~g"K\F _s7nh! {Tcl;@ƴ?GjG+JO+2a$Si R!q^x.S1ZfW[vbXBzm-#O;GM0Sf4ďF}-l2\>k9rq?+3C$iZ yY^vK'H 5n~i/$;+yM:9qu)rQ/1%lf5=F>w-OֲIݢj\1=ެ_Y菂ZHRFԀ ]Br+CLXvkq\*q I6$NKX9÷'} .0HW*ƀ&tú*uU;ϨӨ(eg ~šϰ?wϦrv-0b?V lp-+1g:#I4oCգ/O,x"/DޚI#{)չN|P\_Ҙ\2I$ez4I +ӿ_OM)_acmW*0?/^sTQzI'T]OIJe x$w  *gYN-0AEEVŒ=@B6hDpC觅2!)JBJ` } N #DD&%:J@$$؉R5,ILJrb AD'9LJN5,JII$RIvq+nRpe._j:|XRT>agICu][C~y6fZ2JHDz~~ 4MKiYe8{|P9Sq[C<ʫղǣԧW5gSy.*u/Ȯ9̓ (#+j.ԲMYs.L(a^oвUʃ++pfl}S%LK̷UOKʣLjZ1 m`.` f_}>?-ֱMBCIuMfUiZ:ے͎̕\ϭ1Ϛ:ht*WNwiMuk%O'7:@qr~S}|!=ɟ;d,S^ݗv{t?H +W }7˻Gz^X ؘÔzOSQ=8Ď"W}v6{r6-WhOꍃ< tCgxYzKp{JDH *7W bD)3T&K -iQPaSs< wkd3iO$dLl0mUE iO4@6lz WXh-nxa^H^YYZzŧӏOۮ}zI$ I$v10%)1N\@j'R]Jpc no谺Exm>',1,DwZ=Kbu6Vy{2ū_^ph!԰v/5+;qtpnu04K^˕#EH AIF"`($F(6R"{-ғǂH7-p$JԠ'^̩;Dx.$(6 TTŀpSL‘ĔD$m?4)dvSbgR[{~ #MƉ-g[Ke"TǸ O)؅-R#R$ $B 5H›&b8RaҘriB9^P?SJDw)@dp&'5H;r*'S v?5JhkA#kQi EI8QcB@4r{O=y)m4AΤVYĎBɫ_I[ yF {7/ g+P 76|خ'l7uW=M~cGĢetz^ݐ8CGQ:&BFr^ɻzn`@Qpח .Oa%- ϭѮ܀G@]gSi^eY@f~ yrJY,d >rlX+}m2,ts)x2ȉF` &m`NErǒR&6_?iͱegcBSkG"%@ *EH!SPhaE 4E I ƅM۔)(ӪE)-&k3Ы@n2Jָ<06Dh mDySѣ]cT+ 0{QlB2bP*d$z%O5*2 $$P9AryG:h@ĤcPNn8);5SkFJf2&)HV#OKٻ Ӕ* H:(>@B` |Ti6'U&BqRaXGáڊOG a5E. Lt)4&)HR%ENJw w `/# L):Lq)RLGAH(m:cD&Ra<w"NkvdBhyHI6g!R&eFg১)  ,p#̡%8uNe90mLKuBƲL` B@:(u1)5K^TX{)<#)b$H*,igY :t*`i JԻa*) <{`*FbR XJ;(RCeqK.ȝ./g"ԟ_VDuE?V|^*Dtb?+^zI'.{$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$'-Aht-FJ6}g+Էv˙ tl7554iuP`%*RM] ku#JScّwG.&;'ads\Y/Z.hK4Kv qwS{ ᅻO8%:G*/WB"՚Zīx74[ }e;'7mow~ 64{-qmm7iWoy82cUpzQ}]6ix7#p2X}9:ᢹ#xIOqctn00S%ZɻU;uhow܅EOѤKKv] /<M2V]+svHګWm%<_M<0leƞ&cn]A zh ȣeL.?*}TS\?ڣGP{rN@sRޗҾ}6j wҰ;:u}Cۄ: K -${Qٚ^Y}KUGV*߫( ܬv.~>304]t^3۶|Pz@BrIng>f5k7M*klu&gTlNXxMv 65Ku>e]bַaWfFc-AW>!v40@ >g$fATE)FRpmn{_;%Ҷ.kKic*qЖV;yu\_JW]C戙 _Wq>4ǔj%5;}G#K70d"ODZ6yu=.y噛gP< EFlck ,Vg^wG8?cCd4lNf['Էet rs.!LyoGS誣d KOgٕ}6tՎxA2b:[ݦ Oэ2&(۩Ek8B_qVnzċO%s82qN1m%^k -o/,Wq?KooM쥦{d'-ٶ w(z~CW҉.6`i!_ b}<0luޙWNSHx3G ܳ2,ѡñ)0݃[VDHp&c FOvOR ,;ohTw^t[:.J2يZ}6ƑO>_鲆\Uz%,e"4 ?lu5qc ,m+]s 1CKԙGlK:;n;rū9%ec@VD.½lkEoclkx6\{p͠.2=,̊n10H nTS[>Ӫ>6 7. wAk/ 4R]OQ~^UԭsvWoedMu5x0̼\cnetcdVƶz#sXYkzE}|eDzxGɢacw6|_e9ĉ6is{ATs+54I :]Z=8ؠ˚;ec;uoqUmc&@{1l}`nx&ȀA$y!oU}/CLifЪNuH,zkylޕvF]"EfTḾQ_ozxu۪f^% cTs:Oت: ˃Րʨp C++w3*۽i[Ua^G<^wL~V <>^[k/t1S9&< aSu4TiƸn /=Y{Wѝ˥e9u|Bj/v"O.?N \98xVtYQ lQaڍ,kp6C.x11:&i.)B{t;\B9GzOw 4iq3Ɉ qru=SJc{ShݣiTonf@ ̿WYƫ?V)%-$ pi$tI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$a+GğW/'O]++y_r{q>yE_o7!|I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$2I)IdI$)I$I%.<LI$I$I$$I$I)I$I$Jd v?$ɒI$IJI$I$RIc}m%茱\ ׋,tci#_=8 Ea~!UvX.>^qnI{ĈkgW~e^/O5Q~s֟䏤u&V-k;1]MH8%%ߛi&wDHfZ@1 c:YGm{^6yO}]e*5ĖԾUfZ^${]j`7qT#` .noFO54Ʈ:[1AƪxPޫ1:9ejqeo\_piz.>ZƘa'ևA'"[mzL{ >Nܘ>*`44Hl4p$w KwESmhs\[*>+z[YZ+g5̇bsbɫ{9D9;HlO$** pvpY&5ƀ-ZX8xpB!(5; wKmX2rad0pO-oMź@s ule7\aI> #I(9@[׏X4Ur}vB1g?s 5r+eD knvS 䖧J57m8w'[^ E|K@fdUHTګj>!ߜ^]xy&c ?7Zj. ż.SUw}H>e`}Qf5 f1eajOǔvw;ai`ޭfTnC#[+nƫ6Ht?o\Q`a9-/N_d[a >g76!sVm㼟ʷ0lȘ>en,qGa1W219,pIQ^4ZbadԮ5(^^~FS Z:8}AdsVlpomW5A^7&xoY5j.& I2erU2GRNc^ƹq g~hx5&;){ÃJ⳻` AqM^ :O-*鵅Fְn vCMqT6\oRJluΫ<X0J/} b8]%8̡8MmL +r}|P[sfQA @JMuym. T2ll[ɒFE(۝08oLAi1Cjpi`v+_f%Z.GxYV¦S᪮E\H\[V?8oYokOr.;`#_YLve~!> 4V}f|^,na;鷸O[ճ^`Ip$ȉb}w;cC@ܶmcH+-s<'̭ A,HHZNf£ûA @Pw91Β mns\@vjYaߤ:] -y\Gޢ' Y:$2$ku&z;D=!Żׇ.=o9 OO)Mel˶aY iT1 <5EMX@\4zhݐXw @b ۝Xn.颊\K>*mmÇQJL$G<{h嗗O9ߍ]qGKs5z[Z"l~5ٍfC[k̴@wazlƲg+I$lBI/ +ӿ_OM)_acmWo*0?/^sTQzI%E|u$I(҅`ԤfdZ̅: F kD98hTYB!=fZ! Jr!$(HLBS Ĕ(Lt8R !MR. .*A:nS)I&O %I)$I$$J=X}Kʍ1$b7\yq'#zT~$Ft0p117^ [NB8rt %Zdu^?u\@]:1+ch}[fcA-VeJ"J:m.7jQ=veì^s+ CB~^&K@%yiQ#)HMO`iN]dX*; \+×9vs^#l+oc?/25.^gqj+W;OpBݷ-ռ.g2[Cl>)s\"q2%lva}~6So.62W}lkOJyMYmwT2>Hݍ`>Em?:exL(kҠcKBu KOw3 }Gה#O㍗,--#e+8?+-*]b;x'dpJ?&X~#Otޣhmw,'kW!s~}0g˝8/ޥ-su+kUUNXȡ _V`gof蘖\F̆q\8P T \qf;F6[-[:>N#_`k=M J\ʅEQܩc7exbegE;vAhh.a/$׋ZMbyfkM |VnOo՛Z<]_Pu>A\?BS̓%Xwג^Y{aev|"dוX ]CL.Rc@={5_'#=9GT򿮟[,Ժ+i#B#f ,Ko?Ҽ?'sNtT&8Op+NQYiLP B TnQ OA(ܠ%BtМx.ɥLuL NG.OwtG@QxjBUaFJѪ-D IBQ\|ԩ"pobe 7ha0$)E ۯeg9P=Aod# )V$mDt) = h!h[g:)0T# rdA %9,djQa-$ G@@Aӳ= 16#T;cSx:ٸJwڠF@Dڴ0"l;ma(.tJqakH'TRn;wh)|yDvB&8Sg弎'wdgi?DNڻYH "5N @MKKtP{dAHDא]TK% B#AhGq0;.Є2$ 8POd[5a~qO.ob4{&m=h'i;to`atĞ.~*@5N^*VDGOlo%9q*.JE2I t(٢`5}`-><qmy )m w& ;B{%:hDH!H#cCZ%7jvQ FXyH%L(LCo<艰8Qx A /"tR'NRf8C%JuUt:/b)u;93430H#De.0&'DŽ1q1i{$SLHKH&q!/ANN$uȝ{h8"I,N#&IɃ'?D͎&p%,Ɖ Ф.TĄ|y$BD#AKd0dI |dH ROL l茂02t7?q& c~ ' S& &|Q$ @̦ BLiءY[$ٔ8H&-|AL *ZHӝ;N\H¤[)m@Th(P. DDpkvFa"IP,y\WcjƗwSa6OZ|/*Aio_E?vf/yi$zI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IhYK&)J}i}%th5h9!\1G2k+0z<AZy`Ӹ44N cBuHޔJ)v4$qƟN-?V][u]72 Q$Ѭm(cIdHXֳ ]d Dqe-ی=hp*D\ZOd$p\>iO(5qsARkZt\ulA)Bw:d oi.H PHm9OÝ5N[t Oq5@555YONr4KOD2eE^ZlsYQkKX\|VYG hк* S5Sr۽e1O9{\KODkZ'EC]VÄ̇T+5ߝI_Y-B H61u^h;kpxkO7鬬Ggc3,*.nVxcA?Qs ɝk&^AW.:GNOcVGIe9 ƭ }zV;0mk2F諘Bښ F[*h׷wv)p;|6ϱo v5`t|;%Ή$h?y_ʳ \KϻTӬȮTvhݣGOvC-yUm=4ﭤVHл]!U^\5wp`N}]=X8{`¢FlfKCp GWSq'kG[E/y:- Xkh? =u@yFp#L~m1톁@ fwsz݌܇^`4 .nIusݶv9k%sOGI..=oĝv\?Wqtz\oz6KF4^S6U`7 }^kNNIIg^}_h>~כu_nQ`m݄=kAx?UlaӸ%GefطW_cG,s>0/櫵sx6W. NZb|3v.V #QhK[z/ڮ9ۻ ]3 Un9~s7H\Cfjk uz .SK& FJ\Ւ\6UM5V 8FuT[k ctSsnp7O2?ʹx;-?_"es&~ ?#N$D[Q Cv%ta{ #;ltO@G{]'rAP& wv@<`z+؝'-ڍ9Z,XCw ~p;.*ZѤLZpzod8sv;%xwmZe_hd;Xc[۝B:4΄i߯.$ϾK[ s_H8?Zw/5/3gil9ԂAp~VʰXѹaZ_imF L.^ ,۝I%#I/ +ӿ_OM)_acmW*0?/^sTQz풔T]%.R:f (*w "nf΄%#BW kEI *eLTG*oPRhH51 )$()40RMS9QH(LR)H%II$I:HYhx(`L'G\}5CsSݵ9* iqX~_̬BUΥ{8'޽igh92xoԬm}翴.et\_ⲣICxg߉Z#?Iߑ^'\qc+?$I[:۲}*Vr j`RL4|ښly;8XCۘ`Z;`pKۛEbK-0w?.ۡZ77yyyל]atUSޘZqtj8¡7j0!k8߂фe>+{lzqِ(.4E3\/d&ûG;WbV$Jκ[Wȼ Pdm; "a\L?Yc;е0{P+ݻ`%S:0v lugMZ]?@>?*0^T%:VK.PF+a}gJϽ[k YTk;\ b;Dg2P#3tWOgQ{\B<0CϭdRnip4\% m`6H|,x[.nJ1;^OsY?9A7=h"*>-2'i_U-(v$XC[MG$!Uĥ8x۪V?X0>qu]G`tݐ "n#BR iT2`(~y mDCkאR73Md0'A탢FdTݡCۚ#%D g4E_4ǒ](^Rh#Nolt&`l.&G!z?epp~^zZfuGݧpW7sXt64(T#UtR޲ W @vlՙ- O $HWszP-qph$Vq2t!N1!-uKIGōINH9[#;(qNJMtShJ=C*V{uS*)F–";BD\d)iP.$l 1/G  B7H3؃I+$tNonS8!; aI;#H*D@b S;AChܦ_@w)1)L|P!k7EKh~ J\Bv?u)ڕw P{1g -B\'xQq%5 iNa8ӔΟ(DjuNRF:8O eW?hʋNt蕐9)D%+I|/X HU-}{> e3ĎQ' Mi V{g@ݯ@0h ‘-. _{)dG Xu)kFѹ6oQxC‰f㴏ة̎C'*JmDp'^Vl;tff{ [BI9ܡ䂒fHycæb>)p4 bRJ6Fx.24*V#HBt!8p"GnTJ[i \I xIYTLד?gDR%7Zͮ-J;{駚~D3%rfT@mMvӠ;k }Q'Rh?K*.$']WMdqyhZ h%:at(AH{) p cS6*t>?-D)H)7INuAH?8 80jS9)$R$@FI.4C!f l}K6btN$ha4Av S&l{&>|%@\yP~1J)xvgH ƢLfED4*To&}FO:vA$4KI_cvS"uQJn?{Uv/N뢈oՠDju0]BЍ@O` A"cGֹ`;@tҿY_{\?~3鴽xnLxIk QR#HȱyO5Vl֝rh@<E^Á2;iIA-)<$f|B7hvLV,t5g^?sМ7u)T][搘$;$7uNyR 3(C< QC%R'n9ys_PVi! 'H5ƛC[A'rDrPo69?oV~4!ܪ[n7Vko:m9VQ^ [$4dbE챆[ Z>[uFW=KhjN?K [CuH'ek7wqjYsXk r|܊,O_{w?P/gԃ}9*y̷sl]'~vh E6񌇘|iָi7_6^XMYFϢB?7k)s10r]S\btW-UT29<峾en_1}ON9zES*] GdyxYx⭐A W5x1#7ry+ WK zo = nbf&{|>TovzeZ:$F3'{,=ۿqc=5nW^s}3377?[ucﭝ#33"=F氎Nq @e)NMlK2jH۲{ݣރ詖ӓ-KF1OKsaȨb yۢVXnM0oNc+Rƌ5(7F5[Ggju>-2keoɑ[  =Ou (X8Kp^X,1.3۝MhDeX[WS풣۷ ;9,[{-r|Ӈq~gP33eo#r,N}b4偩׹k{ĺ5)&ֿs,kh/óqi8.Ucӫ?Uþ &@+3j<9Q ΧrL_Emp _F4U+5NUlxx`{ykt1L O+sֲsG$6gԌ|Ve>I%(Y$ G u*E kVV֒r6'71ʌ%n0DmsE/JZ%Ӵhq0Dq@{XY7tլ:>;-u,VW}*:+Ѻ{cq\+n'Ӯ 5FJ2w`k=+Rh}/U UE" CZ:s9̿M3h]r.*Kns-xkeõ8U-4U'ZI[[@dN@1\Q%V_.ì%ո-ѿZn;*aTIaugpkZZ dz`ߢ[^7 >6XHAqg[k-Z@o8=P*{ @ԋIl~:h;} r1 >*9U'w? 떸FEb~h?RV]ܘcK5%X{aOkv,[6vNQb3%< ԏY,h.<{GZ=A#w]Y@'<D!n?TT@.q$ \d1E j;qo1U6ezNh% 1Mk?&W9VCt#4@}M!L4]`UjQNiJx/p2D4r}߼nhEz,n{z N`@w=_(uzYEeK=*\E]Dz+y*oeDj{ډyR4R9F 5/qstZT~ԱnƂ{mb 8&Dx'ne1aWZϴw,`Uӣn]ĝW!SGOnl~ݹg <1aAvD^kz H4Cu^};x4nf.o0\Ư:NUѝ;8 uV3K3ATb\&?Z=+d4mq5w]j=jkѫDN*էvx\kI$6 xKOT/ە鵭N?*#,h:\~~V=qc*g]HuwH|? Hx0[K"KG g\*di$œ mPwӷ "8Vٓ@p5#Xk+Σm:-Ѵ(Մl}h(h t[պZ'/93_9bȬRsz1s%7j]<Ԫ\$4U 9!WCAlGywF7^ s`566]?V0Dڨrms]$ca0ZðV)8c՚Đq:\Q׵3!i]Nc'Y?v{np5硖1skXb݀ZV>ӒJ̪t?fn%z5^L5yc~⽑yzPwR <)Jb4J(li [F#>[T!{]O*94wHJ(2^r]^x6Vʣyث9 O}q*#Nҡ1֭Ŏ6S1+%0no%[!C8*NAs14- ȢZNTrl\Z\n$*_=IƮ]O%hJTe@KyEpmf>jkʘ;HD6S{s(n'aNu;jƅ-NCBNCV6DQs l$F, J{L5<{$Iǿe"4JyOHTRSVH`we.DD ZR%1RTݩhx*Z*:S1~Ȍt*0DG9I35:Qꅜ1%LT/?5'`S|朝dY)s~JCuM䘦@ 0ILxT9W.n )""8[khiA\9]u Z#iSy c[MB5 Lck0{'i4L$ `ptԝ 0~ '`)@I …nSI(88~hdk<tSc-8:';)~J5R)T@ 纕ܢ tW Rͤ8OWcHv!h$Dq&tӁG m~"e 5n *cR"w4n @~};p$ PH^cFuJH>IR -:k*gܢG~0-(Nd|ä Ӕ|!<`B(=do1GpѨFmS#[G*fӧBgG p'TJIHZ7Qn `[t9L@2:tQ%#~O`H3rT,Äƿo)( g]ڞ[[˵Ӕ ώ@H< '3QFN$H!@8״6EChD:w V Ц.3^TnsF Ӫ;) .0 F\D)e:OhL[aCpjp'"3("<%L>JNls)܇3`@QY}L'YSTtSe$oSo1ʔ)G R4*D7BPm{ KBBY vNm2H%;;'& q zk;lKĔG&eIvC>4 3(w7Ca`f6H=oG+^Fi|392(flPc  ~+ĆL{R ^c x\/taxDhfMn,p ?ŅYvN N8Fĵ xN&%AG[.xnC?Vvg50FJL:&#vFoN!{]a {$%92)΃T}z!@4縙 dLQfuCʖ@xh w(~j%|T7{TR1*nKDğ`D)pAN@ʔ5Qsږ\]L5 mIT|HP{̩ mڸc]ߑvV;w |x~E.-|/*u<8^*Dtc#f"I^+oH }gF/>I$=zI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K[ȜY+_MWGp;D;^.stM0$kۣg'% ݁gc Oh4 $W RI )uB;\;.#䲛uamŭQt#Ǿ/'q HenLK\&w4eZ()n}ۡBU߲WZ 6 4d]MDDjQA\ 3sS(2 c-b?;oY8=ưb݌NK_79vMGDq깇3u,Ӈwj]Hkf3Cw OW=J]neVGLbd h8>+9?̓">: sA]5*_'lh?rMlӍv6iyG p"ᠱkOGSç\mwհLtf%[~YW5NLp˶{ȞJ#eOwR? 66>L ە*l{d kvfwyGo4fbt+} ~2_bUNS"w#r|+!͎|3o>A@[i^?-Oa#Fj;.L'_E/hwr}b>z߽ǐ^ [[NJ?zp<ޗ6_+S `.}`XWP]u [v"tJX jF?z[~(~ iWq-xF~Ҽw ywnn$h.c"u\&Sѧq5חlk8 H%׫(yw[t$}Fp-/q\HhtT0Ax/W໗XؐGޝ69z@5Skga?5Hk3<{L뤭sw:a ugyGޢ܆u班ɏPmzjORE_jáKH%e\3!qix`#Y"#/GuhH/7yDe2\ĥ?5\~[MIs:pVXC\ A8VY\KA}9ow}8|4'έyi#8O7Y1廚 Muy#ss`=WDM& +@vNZ4V*H[. ;LȽp&mʛ2296HsciXAam7cc~7`1r#;]'qUddJgM<x'$IOc#ﺶ6@ɮ*iWf yNj{BcRܷ7;[3j>ۏ4F v*ah:J~UT{jh Ot |2Еصkx M<2e^y*ZΘ1pud5i7YǪKY! ^t*?P Q c$tP`dȍ5"6)5%8I<|b{u2bOeAqpZȇ@)tAl3!U^Pq`%5/$@.G);AQHsTRFE8z[Z6ryD+LyK4]oP+OˬΆ,JmaI+FI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$?wWJTIzƒ>Eo+_cn'o7!|辋!?/I$VI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$1~t2H]:㾲uhIAR?\d乾 ?{y.scO 9qR4no"'VLp0H tc3")}Cja^{'=7Ӱ~'`0>gOTV?L:?6.ٶesHnտOܣcX汦?Y.&{UY5fUp\ttI݌LB=l 5jmdTCI6lYީ ]k?_nⱍ&~[rL6ٯhV\7[{/,yp$"Bpz[>Z+oO{}̩Ơ}˘?Fڿj+ACu֒~Fֶ8R,cav $G ?zb?XH54tsȺ6V],S [,I%o5z=UUFz o#u~QK4q!Ft<ǒ~H%2۟S-}][:MlhB)s {KQ>lk@2 R$ħ`>q3o @rtj p<R?U\D9h#>4{@uI} ߛacu K&c͕8q'r_Hq`+m_ Di`UG*%Ĩ|7QֽCo)/㕧ׂwӽ} 77sH!#U%]WlwDh{~+FYcf:-)e}V3q>z}pf{UdouִEfXO1޴zukuoҾwձ,,h{dvp}Zor[Ű˥ >_~őE׿3 zkhunJfqQ*B~wx0CS?V.,cFL|Ck sa:,gT$5Z Z>=4&JԺU[ߕ`.~8>uʲ:ur }P]2*ίt)8IF{`:`8Nr˜Z} ci:KZѦ[?Gfb=c{ ;3ԥzUg}z5yeWոYݷv,z0+g}ݬc ;*O#H#Y3'0ms6Kd?[Mk3 _Jmp7qXHH~`iԸ8m2Yui qR?3o :]kCAi6 qݐ .cߣsށ~;kkC #BIy$,67a}@}V׹i6ԧTN{s2 >; uL'pgG+}"SD5Ss]o#RZ gimR3 hܕU[`'7CPUK]wՎgY`\to[ūu-v7 @Ƃ@>Gf.sY-?+ #Yd=&enZ~Urc.퍱ejȵϩcLmrc 6H| u6 Ы#lMew|W^@x(p"ͬ&vgGս,l'/3w6XGJlgp=9Qͱα~h6[ǟ(.x1L tLZƲAgOj3[<1g\Tv Z PYo$Rkr5[~ck"eS"ʹg F-MB\mLƃ U`;OM5kgw] }QOw12@$;ۼ5$]6uvƟUNVKHnon|ފh,vҭcaw d8]^ >_艏_[ms]ݵc}=W11_HL͋}SH+?{F?&Ν{{^cX\2I$=I$ +OOM)_acmW*0?/^t4Qz%(L:OJ2IBtRJdBpHIKbe2p%EnE&< C&D &o<% htM IyQ- 2 I$ʅzl.4MEDDLj[XY*溦btQS#ikYNS)'&y|;l8iiەW"4Sh3(j]@%H-p7=ԝ! `34Iaj64($HrL}NG(ND4HU0"t!-9 x)5 5L@C&8l)9ђ !ٕÕ0~ *LET=rTH0dκR `ȅ*q&:5N\4MǺ`K"b MuWƟ"Uw;qDvP$ R4UpV W2egNm{R$BuBZH׶ܢ;P 2 M> !R <8T %H Ge$ uKiѷ@ mLLS 17t=ԟfRM@:''MRa3F͡iL҈RC }URk8I懨2:G'DT'DPGTYBDT@2#Lp @XGCu~=Ո.<27h!kGe0ѧl<J]ʛo:*n1Dj7@,qg,kH@k7psIH$S7 M'_ <<(Gޡcw&I=S^u-t =,a(Sk(ةR ;W˴Qwv6ݡNa3)'PI]d<8 >1!ПyL4B(;xe V6[G\r!HBJHL<ġBy a#rR$OJF #朷@j=BwL$$9!$1s♀)8FD@x!';ګú5Dz[9F=ԪUz8WzM {'X2DP{kGT$Ķc*i; 6Iq0qʛ^ Ӆ<$RS'X.GD+i-l$ (ݼgiܝlFѷA(4gVABKthz hu`!V\GeZ5Sp4IL *l nBw9cZd|mq$G(0uS)P/s-l&8Oo|_V!́zJ 7cb4ǂ/k7I$I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Kgꨜ[_U?lR;!Q~^Ѵx] #UPWB:nq]IP~K'r 4XE$! >iI&Gak3Eۛu vRC-wsNʋ5vh詚뮩~,?=#\[YV%=M6Yܫp Op oUJiQ%9QWVGBnb"B4p_m )9 Z JSJtEL&:$S :BrNRS(9H  *%M`)qE-ٚ 8*cq x*vu.L % )P o$\i4zcERsПq:%ɷsQCȪ+fLqth,>!!+?(KG#[NZ0zw;8\皞OmBK!;,C9YfJw<|UqOxv+Sշ( J4XxOknKpTݮ>E'tU0lq$T#SSo[OHUC -Ys@jƐqM+Z[Bޛg0`[!YŴ6EO;ʱ;eB|Uc$ _6A?8u onϯ,5u<rZ]$#aP{}xZ֒8әAZ;<ʟ/By C%L:XO1VOSg M^]Mgq] xa%9!miZ{.JQeFCtF%Rʦ\5K &pJIaY _q/e;;+7_KhsG=TwmueqŨ OSjcYk` 5y,!\+;HXfyI;p7:u$n9;< CZ, 3AS'YΆ5IŽ&Xѧp 5*/ƢBK{:`fI,wp:{΄iEk\ߏE<&B*L$S=!<-l5Вq[2Uu+%r=w OgK-.l\:I$$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KO]+Q' ghI]kZGCc͍hvk`QBM}:GQtu^ wkGk*pڏpZ3";薗^ANJr.]C^}pznUiJ m3Z[ DJCD 0ʖG9Vؠ{-|*>-h I'_c\]cTc9q.2G +VwJ 0MCCId=-lw2dyϬZXȓaO5BHsZ?Wg1 \G#UceZ+ޫi*tny}Wpt^i&ƳVטk~; n d ׅߎuq1+8i񕭟h|VsgR+%m[Q̯C;#FSr侯u$O]E]Pliq?I ?oN8 G+{x=pT{K]@ځ Nlëvb DV-[^ "Cgu198vINkI }D?8C*ey+>pn$"WTtA= CΥ^걭sY;  5SwO 6 Z:Urc߶oz5>v1AZeh |K|CKY%:$qE7n?[uL|gCLhՒIoeKzqq;z5.n\מ;^g[C&|QsZv }L?k{wݍs{Sww2.{c#HU,vjOj%GO3n78m K,Mٴ844 ,{kKD(5b8j% a;!vb>3+% #dJiMϴwF,ީuo>)K $~i5բmaxEk]?2QcS H\HL|#; x'.@I>ILI 5u塾ja;-kѠ?$&SJc9p*]D<%DĦ.)m&œnM%K~󪋵F`(NԴ:y"%&t@jfOI]S1J+@E hc{pO0윔մtJgJI_4)H6VZ5E@ TE&U,pSh4TYL t4Ƅ'n;m>.fcE6t lӨNd!JR6ѨQ*{I܆uNeJnTG4|ʈE <avI!: n$:t Si!uC,{"Iuқ'mpոk["@8LdXI?8ʫk؟;<ůA9'.lwKW}TҺ?LZ=X\3Kl$,n_ʺr\ާ:e^V\SJ+~߆It_1ྡõVnk3(}bˏ ,>Ɲyϯ8:9z#\?I.9eLƑ ]-h~a$/=^3n ­.'O ǂ '^DQ `d\1O܅X>(ooI b׺S(% SY&J#Gi=$Vf+ͥnvl$E26{=7*p>wrA!bٓhꛜ*ԟ@}Lj +髼L7N2SYpzI;b!!1BѴ%UŮnsA8Ae- ZmV)?UuGR8Ż,; ΰW8DAmwXS '(T S܄Gt$R:Q)A#7RΒZ%jKdOXdxVG6{CtGEN+zeǞ+0 w -\c4`oܻDgIy<"P:EjMF w[9mXO'@UsRx:~;@^@)L21:$fR63|L\\nI=lW!,۾ϐXUFWVlo9Lӵ&QjeT]Q5j^NS|%։Cr/d[cdžYzج*ȃԪ- `k$,XV8+\Ɔ1쿼Zx>,oB{NIKFȘIA8>jB5Pk CkFlej Z }<bBk'jk)]v|t & 6D>8KvC XF' Jڟ]PkAVTOUXSN!?ZisCo I$QI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$]*?$ҽay?^v[;C_:/yDI%UI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$N>%4v?jON92K@oi5b|?9 nDcrSٛx%v'z֯ƶHu{9]4e3 a~F+YYY!ǵ[_im00-TvmYVke˾KC܍Sh%myW:6Ck[Y5[m~Clg:>@k?%S}beڿ>!\o3:4 55'V8*;y EQ0I1S MH),u4 obEZA Kw=&zbʡi|%ێݨXo#= F߿:;a#oyw`ݸr|L; UcK~x FU`X4[? M:Li[~+,˽}IBǢ^14V}z-8-imwV1zMbF灱!:B}7fPieZY6=egI n{ #>mMwc?[BE:H?NlljSݮi?zNgip kʴ. .{76 ~>b!%g޵:.MW?֭y.8ߦK:VkoZ@ˁ0LJO/m;7*mm- rU2]Xv (MݭxM-cX洺'j#s}:Eqt.Ǫ s 8\ZKI-gbsA{&Hؾ_:)SQpniwdj ZqlwL :E~5F'D^eUNsFeY>;Pya>)00n:a~\=,lOm˸AWsgRHcj]F+XS˷9,po.s=ؼw dC޹^,t.kwct-t&xЬ<tm<X7sCv[bXh&jZͮw-ۇ$mkwA"Ǘ;2uvT\Cw}Y ug\>π]kHpr}^R?\%Naʮ|ӻGysk+˾ׅE.>I?=3XC5Bp;(\>DG[%f]TًΚ3qAZ'+hf6al0k~ǺGnpH|Iy c1I1䕭"|COod eh0 FC»FdnTUBJ]ω_hUŲKuBJIх%5YGp?Ë7vvBf }w;vZR`jc}M>(Z 9 ??DvOF\|{M" ;g>+Y@oVoNB;O2֠c:ǖ?K)_X}WZ[V2 ꏋ3dTmKj\ isغE0kU0i#k@*Pskvx~+,,vV$y뙾$mQjuTh:th!se$$}ou h6 ?z/8sV]x2ϦaW-ˇۘ#RGD|Gkोr|*N*,kt0->pଇWHN ȣGwh{AZԹ6z.埑i =c~7l[81ݡco_4c ڟ')>;NœFҢm @mA;I"Ω˚F?8NAj$)d:% ?Of{ H%ES8ȔS\ߊv׸I< Ly)JBq%'DXD"`hI\~*!Ӣ# DS"@wqD25RsTH!h>C3tMdu)|c;N^ B,( g5n.9KPTKJLHSh&i:5IN)5LNO&tIFq=뮪LTE@0l yNhj]mvtỒL_Z%J$w%'1: Ku^J Ot 3E&4 ׺*gSďgCwHH~! !JXHV%`kϔ}-g}N~*ǃ ('s)81!sʎg< b#ADv"KG*N8Q9y~ײ^@wQK%I$ 6;XLrN{TOq %-1I3ZdF$Fu}OўZKƱEW}NXӷS7TKH#Pa}bsHm޺Cp+?USA<e^XF_ob8Cb?X/klkuu ų]]]"8t[_QK_2 seg.\ŝ;#1HA󺓶@(G[zWLxT1nFm'Nrָ|BOA{v3kd{KuL}t ?Rm@pb+-*l㌘gցn{3-?VoMjn8VGGY63Hu*hR{0HIZT8'{p<w6|S((\HM*b.P AiB{6 vT@jXʋhӺiT\ uUt)3Glռ8":L;r_i(N8t;4NX04dƸ9(Os\Gx)i‰%aJ#a۩!F8:G M-6 ׏"1]!Y f[v l0@"x):T% V$A"f>4: I"40`)MK\4mH n7D<$IHh L@:E vu D:IVOR3tc2r⁥Й͏H:.4c{. jZ?xu2?jsjug͑y >.1-lc@8֮nm=IfYlϱ4IyB\,wYfKTƱWOA/oOq5_N~^7b<k6 WQM4tv֏&c~x d{[QΉx vӔ/.n[gkTUEx]FIp{W贿t'MMoZgRL @ .sƶ7dݽ 7k"#-au[-P,se8IBjP_Nw=˛CevSj#D &v cR;BUoTt;mB!I0=GĪZg(6 Hh(.jS&)g%)AKSLJm%JdB!0')5>jQ??/ʬ3U]GKiC"ǷGZ"ʸC?Tj਩J!M%ƪ'(Q<(O R!#uT-\Gm{e͟Zs|JaOpSKI#tI d(cZ_sh:Zg`s#liUj>cpVq#= ~)t˃-uHriշ04+F-ΤV7mrESslg G5pan4T w\]27'c6< -tZ ׺:l>  !IsavdT DGW:K~5f@/ ح*lǃlJ<,V$ gS&VOՖXѠ$H+v_eGͳk6_UW̹jl.i"!@s@l̟:\4K@4VkMPf5{>;z\\w wfv1f}vq+74'i?%1-uZ͕8CM.е Kh5r_Y3ߓPɱXIVUsZId4|}YG?+Ѭw@?Jz;[$?zvZ{vaJ$48$k 5כ%jqSnfSzwn4k ;P\ko$C?o6>洍g2&. itqO=[UFUK]GDP _QٵD1 7$oԃƩlm;3z^7`Bfdd7sEOk;n. i{Z\>g_JޔOڞ6}/o**~؏[/ G5,潁4Fruu,/$ @Dn 7djz`nA;}'U[a'ճFѧVeeT^CZ^Ydfԟpu$wPz66rV5 l5?nVk[ ;3;8L)KFn5f6+WחiվmX}O-ݎKzZ2==C]G,]2CHaVgw$kc& !MZǝqy]ALpgܺ?9zCZ=G̋Naw8v9ԒdF760HqF=aq64&Hքj^c} KosvZgAh,p"Q1'^*|)&N ke$N4i\f㚟4SZH*N6Go/u7AvWos[0x)+N7Kn=R1zqn$HiջS{񵍞=OcbUfi\?3[v68!t6ըwŇA&`5"'u#u|л9.a$'" `Iph:hبn"+` ht~qmi:=sK>Li ׵3Xp8_IC *t j d 86dۼeUuwNN*.l#۷^Y8~5fy7F1It3*fm6I;*Ow<ʋ1#Ԋ6D[gїpɮ 7OwzU9a΀쥗iR`'c}Ñh )&dN֝61S4?Vhlpt&m{Z\}3_KgeY45n#}k\,}cl"w{;vUI} @`L@)UYI;Êl"\yR=% T K]M65.s}}65*n5o"Y2\?u$f4^MWc-nܪ"'m۴NCh!,ƽ!UV֑[+J sh;OO߫oއ =F $fP^]H״ |gP9òp g`%iהeڶw|JZ-Ǹ@1߾%$JM^N@;m,z/ԧC4OKn[Ŗ Ȱ #)v vG:½EoqPal7޴ۧ#HLM&,1*i\ ܏klwkŇqĸ8E-*yͧnƈ70JλYx:qL-onϸ{%McV">|8)ջ0k6ez cGҗ|͋UݡWtΥpíi+2WI*ΒI$ OOM)_acmW&0?/^t4QzT\; Ī:/kgTR)LD6JTSŽsgeO(L1c I0NBDL5Jwd(TBtLO@*\BԼ&&nQ䨵!6T !Pr~N4:QSOdg`F.zUe¸mᇿ G}G>>9Dÿ g(*UR>8T\jT+iS ,2|VfME ?krw]<#mԈg.f5g}J8v^w nQLJy7˕Z`)mtL +\rᖟJ=t57ssO$ M 'SB~7Ф5hadk*5q-LtXy FXr?/d_Pk{bفsZu^f>:[ E׮RfCJgC G~k)ec[k YjT Ps -P5wOH>Iw%159Szn)MUZ!8i iM)b^('$&Bqk *@i0 A8 HhlMj_Up} K R 8j*5پxژc˸`5Ho9 |ԟ4Z94 %fKx`g9h#DD[%ys~+I>=m4 ;'QRѪ3mk[{vF`S5p)PԩO:) F.øV># ZHݡ>0\ @2Bzo)oh%lX m7!1qHt F @wiX>i *Mp2{iLpsHsg^T(AJ[KmtRizj@yM0ROqࡼkd}\uErs~JAIADk ܔ:&~ISg1D2$0' Iga)05|Ӓ6AC:%yisT,`8WF&FF{5hnx/Ur: %ߺqs%UfhսzSpNj%o0Ibo&Om1c1K5嵌l0} WU>_^`@^s듺jҦS6e&uNi Zo2re'ZXAQG A?'8xH׺n- \$@׺+q?kD;v0SA;"g'抓z; IO;AgSJEpI) .Dl p2I`@4L-gǔpwdۚN|88"LK^)lCt^5N!F8Bg:S TLLT$:2%!iI@.: 9;vD)O)9'ꅩ):3@nN Ri3% 4N4b]o$AHxO3{H6Z<ҍ5Qx|՜\QcѯuB%NY>IS=֯PqBк,`P09i Gu88h%5su9Q`sSy4 :|ռWYERG~uT48F ohQBNP|}O`9O"aʋ+Fqbtq .?c"TZ|}o5`tQo :&U@h UYY {55K?vqT'?W OoH>V:;gÕh~ޗum2y64J.+aacDHOA xb_Yl q(F6;qxsK\CVxG½mcFܫuي5fa,.5b=VWHݖ[mj ݩ+ 'r* 뱂u-zKl;lons0ƞ$:x9\s\P;[Ś8$ …vUaf?2ByBQu!w%jM wC,,'BcvLVƗReT0Cm{stq:xM('Re{eYWީV&%tۅn8{Ve-4yFR: k2Lyp&"!@Q Z2n q S;A1!aɄH6pv@.o JAa.(0 w:|neEmOҟCƫvIBh}rg5D|/"ReFOўuMnY"-xQCʦI$Q)RL\JT\P0 F*O>3eaW OVnGQ>*BV#xUl(f7#sFNvOA\>ٝyZ? ٤I!C!W[*TK}▪n7/>s+9=S"ڃBs8F@}O-?M+TAr;=OT[eYA`8$\3cď{ \Fe79nkr2A=?./TczGɮZKkq VOI9m6[;*Ȼ;ՌY>mlevJKm4VdXU޶w5!`BLv+㳴1j!|O]Pw3g#Nlշ)%]B G;+A +Bi?3-`A㟹vFsde,JK׍QkR@5&yHW L1=^eЦ1EtARq/Q2vD+WÓf;DBdFy I$QI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$]*?$ҽay?^v[;C_:/yDI%UI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$$4I$,\NQ)JLi{[0VޕgSmu ;o\,1Ng5v\Jdz3yb\ۦԒcǴ*PJWz=!yN7h;ꅘPri`q] qTsًCHm^NN+C&ڸ"TZa&<&|LEOgռ, 1KanOQs8̻$7tU9{É j'j8 : x;7wPZ`m emk0mOqN?jwK p$V඲4&?~W7 6I?D_2譻Iȩźq&?Mhp .;/m7vH5w<ht :X?@pM\3M7Kɗ/3]GKyGY/.w,K-+?go}W=S>wLHB0NW]mcѸ5۹>~|JlZ!ѷ5=>Mx:nsX# Ϥ$N*56_a6A6?^=v%Z}yS[qhsJlq|ku7q,u>.I~ݿB!];۝m|4W{Xkw&3u7o_,چNװm4HMK "lG]V;︖׏bf_SYk[ݿ״W_<5hÎӬTq[\~qV^ v]!@c\ov=H/.\b5g4c0Ih*bςSj ;mQ<A7E0vCYߴ GYq2Z=MWmP+25Գ\# *8T8UlڳuWqڮUHuF$.ʲιJ͵P6g_s-Ł$+#qX!_{ n!H']!F+m'fC*cuZ[cf4+>[ua5ܹw3OS%eۏGrc^y.֋hkw~tgH0CyK:;>'kn dz12ȳ-{;ϬtֻZv^s:<[aMߧiR_Ån\]g-> ʤlc6%߼ЮSskkLnxhl-~>qk  jvpB#cNJsYZ1NuƈsLHha7.{墳kBQK WChn#wD d@k-Y5Xf$ q:P[;5 .!)t}'okCYnKC}-}bZL~& iUn~ Os R|7[c\Z}{jҦ2֎ݔӵh% t  JUCqUS L{MS+۩\l~Aq`:֦<4FnH,VvՐonu @-o?e _}.=7FA{2pXl"x65׺K\ ~~ݫm{r{_'Sp>Cm߾u5Ω9:UY۽D <i;qh]X9(s}ey.kikG$c#Md~cmUCGn%qR5WqE\Z )-Rc`;u܍(@=HV IiyC,@!V"f;kiD1gTᓒ2\&տ޳qJ" [ZZ`@ <rm[g;.O!-exvYW {i.uwf 1 VȐ]PlLYm5q+^a!|07E905̪9sck\b5-a.ތljMa70wdKsksx7Ә55X\_߳E͘xTII11FaOxRF@CؿPΏcla@ ]_NHį&u[K 5#5=zFe7t;O\*I$= I$ŸWM-?4~Yu7͏U^9?z?/GI2S4)yTx4JK| 8LG y))lt&SHTp!8 9N pSp )B)Ʉ))ҖROPw(̧1 -"T+H@M& ҍ*/f_79"X*Oc$YJHdco=Bx~ۏ>S#?tKCZV 39rN1C`wht2>jJ^u75Ul~bۆp`{+B[ ]&D+=ZjBޡ*,+*YY8-ac-oF",h>}?T iQi`-?xU,z7#*̡: s7,p!vVIcCͫ\rGÕ<߫NgOJúv+&PgJɷuѿ V^{voWe}Yuhps] Ų~F[|Y:-uD))U 0`V:~25 R悘L*}+Q)m:AwiZqWwV j]>&mYY׸uF~=!3.cc.7_mE۫t\gi.DfstWts4d7sw+SAug&N!6\Ō,;,ik aN TW749$ yIFiq삗 &ȸku]kxC%E7{Jh%<ozo_cWkvss~> G$%ʭD5wK>8r`"Rj~ OZɪO! 6 VnuA׹(5Lp4Tֹ򫸇T>SO T\S$p9LDJ~jT ΎB}5 R&4XLȯh$|T#% kNqF"'8Qu O l) iţh Cۅ/P3#T \a3cTnʅTzaz5g8nԛ#\xO0 ݏYMc;hkw:'optpgR:uL.}=Lk'` }G)((XBc>J~ͱ $$NAPkH>uB:OjmP_I9 SȄJd)K;I~!NtCsȅDB(%_n8hOsxav\9(Lq*|:'i(ZeImpH}!9Ƿm۴HINZtN"lH5ᮨ{A@e HԦe7<(:RS74>GpUgE,:I MtOt03's}QUGhNZ k)TX>с) <&hgEtO^Q| r>(oOdW M՛#`|UwνߦB]ExJc ᮥ5ʴ;ͬhuMe 1hlL^_`]CyzO+!Qg7XWt>墪>k?/S3h?w\E#$ Hoh2' ĻS7%C1uEOsشMT~Nh]ܸ)"ϓwO:-~}+>=+sGloDn$UȚ(b]J$̨sR sF@VlSF@s\>.QGOodi,E亰}(WeLulq ~(%:dTLR%IR>1).;@[iĨ h T6߀Q֧ |c57d7;2W?EwV:Q:j򢄒I5 ptC4I'&Xy;|t;IYtF1En?DK* -" i]JO<[U`.&F~h!+O *wvd#5#D0xqoe4jNm"H1[e1aST9'+|\k 3*hr4)6cYLV{H'eM>{+-hѪmqpN78 PZ{T\Z` =gEԏ0D]wS+ZVZF)lrej Vv8h K.%$Z-6I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$?wWJTIzƒ>Eo+_cn'o7!|辋!?/I$VI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$X_Y5$qUx<#1R w,@g5[w¯_q: \%qY\Ih$G vZ8i_+٨ebn᭩ۤh\ݱzӊ6w`68\Vϖza"Ƽ?eeCD +C A<~㶺ĺe9VSI3xoI]].>/Y}W&3ټ]z62r9Θ1kV5m4}8tk\6 ڧAѬw*w6_;$+k*D@l?"lj=#1ދk{aՋO+XHhFYdtU)&i ~6Yc=׻,-v9U͵s8d O]0ۉ( Ie`htO upAs}~!G'NC ګ5[]_*b84 i1;@.T7cl!ͯo,ω h!kubmn]!)B:/쎧e WXg8Cg*]2-ɩk-:h>wmB~N[eZ}?/GU-}ǿtcoh7|TѮw+m$4p&>#RϩN= ګ/GzQRm@ ?OXtlȭzp;c]TᱨRw B)/y#}*J2/.tNKP^npFL j̗4wP $~v~u՗~9w5ecR=R`,c|Tzum幥M?HļTu43ݡ%SZs<k[ZJ϶\3%`hi|BqOvp ffS0 |O^孀Y^K6 1͌xKM$vrsaIwobRDtvQsO5PjD4scUpz}mh.bqC hb#w˜Q-:KKοdnvY=.QdZֹuG(ߕd,c[-9P>0=-^ksw$44tW8Q]}6eO/K\͕b~1svu[_=Zd Xߔ}{-1灣6}bfe;emqtvI}CHw觙{*m0ݶ?vcn.cֺGL^V+v]oޟ%#H?e\e>NvI+7;fc WpLt(Vu#rT9o;m;EM%o{E~to.H>__o޹Tݍl\b 2v,}[V>H lw(6tf?5\tF5oq;9z_ZW\[k5{ReQA. ktkDOm> /A[Z=/M O{\լCl­{}0~~ڳ?rWvE_['A`nxs 6~=Uʽ9i#gt&@IDӱ쨸G)o k \}aq]CAmY509i%?3OM Rzm{r36_"pۢ}i\v:'~,mMh\;5OyU9;~<ܖT.hݨaaLXhIeZ_e8c?ѷk&s,'vCfY5zAL ?~yle I=]TWY iXf zAMVOպMZ;V+Wt0˟@4}|Ŭy ʲ:q]uA2po,7I?z };8;i$R}bĬ[e u ;e}o'{7KG c߱\4h[^ R~=ƥ {X?w;Z x 'Oz;j4Y5Ccsd~އPy6]on#.VSs]"ٷB][*bi`DY5Oo>}'t<m/~}7۩q?E]J sahTNũcZ&&yZ_ d4WBê 5q# Hle\C_լ\ڟB?[}Hf]m7m$߱sTz 1),/-%w6culv1"cOO_,Q}8_cgtDI=y%206\\2D7gkVѵCSeEB/hzf&]O¢Z 3=?(gd`2 W4*zU7azv~Ȱy"{/ -䰿 X~Mz^. u 4xDµ$2 jB/3K=C\Yl{dwfNp{+,l6ihDqGpx衶1m$M^$K?o M(rTQz9??vBb7EҞ@4JM)[hI7 EKI'i%($2BILl)I$JbH'64DjIBfT!"c R@*ovR[wln+b=2#!| .86dÒeEcڲl#51G?Eަ0#Wi'kQgեG\>*_|+liwRt:ם Z47aaRnW(ULN PK+pj174xdx0WYݵ߲U+#|KYV:mE-~|}ʙn'P2!c]eF]D r%O Ƶupp 8jVk.`s"]aX%,:bٌi/+sK i+ҝ2+2ca\osOar>v 3k{t{΢Gv)KicX$ ]vvkYM^bfZKӂ[\ -CʩYnj´hԔhgjm \#ET,̡ՆWE_[i*Us6C7@B;uSedt"E.vVWW]XNC%FJĴU{x[{~r>+vv N_z|c~o~${tp`_o sA?p$}g eXD*0]CB* ShXe$_ѣu+C0ܔ6 gBnܩ6H ӔW{b#_Z$o,c:W+q ;(X AȈAPNT2*Y6Li1 ,i?H^hUm\!{|A=xӹvy t3;))&g MshG 9F8PKA'd0:vS=SHR24BI4bݍ' ϺI5LGl=uԥjH>|"}ЩS|ӈNX8 tEI s;_-_> .q)0SLވֆΥ96hd%[YQݮnN; ȝ͖R,&QEIL iNRQ42Nvɒ  eD w t$2<55farmtjR{%bȩDHv)gO ԈO .lu5[ @(=?ԨUOT:F׹s^hV+;egN[{7N5Ӵhآݮ $Tx$Qڧw[Ч`hjaYo2 9(\nHRm5Q{Dꚹ.Qx2%I1x3 L*y;C6B-'y$H*;\GAEi:'r.(ƞ3ur6D¯ΰ{ fD h.*u $k LL*uQS nw44VGUK0ZcBhNor~C3lq˴k%^Pf@Ծ'|z%/61/'.γ 6Wg}_/ G~ m̵\I{YR <$Јp$futwExN`OvAuf[Pl>)Oy)5n8"LDP?S%wCs^)mޘ:ꟺP.k$k^Ay7Z5) vW$Vk$uΧD)M{D$@Pk%Z59u.! IIBr Ԕ:)0gQ߸{xy$_̓ 0Ѡ@C" vScF){<ǚ)znSmwV=I<TfɄ1Kwc' /Rc'Qےlih α(RKu`Nݼwj*f~O8qC w܈6٨>)'S;'ph>@úk75u@Љ'ŰAD@ALÁPuQd+n&L⥷HQR.0drf7 S' (cӎR!܎OIKpGe;?ʼIB@F`qF  GtH4-#@uD)VC+,n*uR$ƉRyΟIQhw<7T7< ۝pƪ7ښDbԧusxvE R B智;(iifgZV/|J] ݸx'Ql(Ϡ]c t"t@9Wjp3*.!8BsKψKi& F4'\~``C =}ޥ՚uLzZtWX#D:،aTf}F֙`^(YFvR{ =DŽϳCcS2LUV Qg4ʗܠ&IN*]iQ܈DiQ,kuDAW2]ߑv9\ȟ ֧7Kq֯ZOuߒ\eG3W~F.$M\i$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.hs ˾!G+)+t =-̅ۢae vs\d\"s7-S/^%ܦT\ID)ead7`!<8~r(TPk@lY@?T2kQ3%G!NK\TIoKwh^Cg+ؾQHp:O/yL$UKjmAIYcz{Y/.qNy/tT"өe8З@=6pĪ۸9wLG?Zګ-D+Ms#DL'i:pyDESx#ېP:#aΜ\FESw/*s\kgA)6׆:qN (4*'@<ݺr`9ӅQ?v紐UuHOǒX[.ƈhS֞2X^c]w!$!wq„2r3&GynK19ٿ\trx@H@!>) o0"#<Bf4HKJaE5C)&%*Y{ ?j=և+x9(VS$K3q'HV<LyXX^+i1[ Zߤ }ڄDY n/%nd?<iЃ䝌$(0xGd^\Lh><+9Lr vۻUͣ&59ENJDV Y}0<'oʅ&Oܨ==Ďi\|-CX?UkGܷO 4SSŮG(ާAlfb㾭 oyIG&&QyI Adn4mv{H(nt;i"<,#o3PjU[t qL tAV"Iph>J=*`~=<(Rׇ:vS&S2tM\4@69{Bap{6:+ͿW_Ԇr=s 1Ofu-~ʎ8^JI-&e$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IvTIz]*?$ҽaA"w/7Ⱦt_EvΉ$JyI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$IXC#_{l\u?H5S-+Wtfm"DAk7^ߟw, @ķjcI-/۵P/*oktqؐEms@:sDvK~ oޔ6dạ"qgQ{)$T f}mk6z/){lpw9Z7>e#aٶȲF)UT $HT36O&$U]DZ8 p}fK P׿#vC(caxk@讇mDZL5ߛEE\k{+H2aZmmB1k>~=Em~h^[LdkQ 4g2*pl4j~DLm9cS{$߅]ݮ?ϢZr2O888Fms6\CDV}Mg79ÐiAx rhnq! x!^kwHSǤk:8{?ldz1ߥ?*pQd{G{ } lR;hXqS~ZB# %wG U,32UjE4n$ w"ȦnNTA^]LN{Z9g4䱣v,XXOU+./'ZݡOcMn/a:*O%nhebY5{:4iPi>?U/ƱVKMa.±l$hpY ,wƴkحd\>K'VYkkct^mvI X&}Wk 8 vJS+1]}l#G+V5-έM据hwW-6];ޭv{Xt6',M88#]%},s.ض̩5XTi:6[]wOրra}Gg9^^p907a~?1tmE{g]Ƨmmԑm/{2\?t߱z]aӇacWA`Ws/X#-GYP*r~32H>/bS!Ӊ^ynpkƸ\N}|NyܱmGDA%Ri;{'ֶ XaJmeuffj$+z"U_/hkH;CL}1IS $l.oRu[).ͳnũoMW `t5ل@}/J=f.j'pqAv &8-8fw 9.-تmk"ްk?Xj]MYbY NƱӷRToSsr@CF=6Ku;3cDP:n~nZHdr_E8PA9wV8}Lւܚ5yN3 U>kʪU:\N˙:X=[EuM,ɩ509g :ޘk4K~,< To; h~c]{}~+$@]?BCVQ l2J!\=J}cnGlV4 KƟʫǧ+5lt ǻ~bzoiq&ޣ,G_UGA˜X=tXx۸;t6bN=U[FTha2cߘdTCw׌ؕ^ly w/Munh0=.c?Eûz=-kn}8{dշgKglidAF1VeMV5u3eUݹIKO+*̪kō 薡# EB.>T=Wʬ8mzN*`b6d8 6[[> rr͎cֱh#wc?:]72s7'?w?h¡f#M 1U jkc aǓfUoDP6ZZ&?54}b֍l?l,X3Øۨow-~sĵ̑;gVc颶_OzsϱRs1kk,?Z'~OnNKu=؅p+xcjn'OҺ_Yf9&*B?zh9k54 Ys9Ou䁫Dh6|.wc7)-b"Q4@sSk*$*8y }/J2HtT,@;2+"8tesWJע/;s|_d>؝"% }[?*_AomyI$K$KNk`OM)~rTQz9?v`$AR&'St_'IH& e"R-oޖ^_Mϥ9u ʾ)Gx]U,?υwpmop7W$c-b8 uV` [ek"4$²,pEĸ'Qs]K,\\x [låKFGPx <@.tNΙZDĻeV8JZe|Zq|!ЯT8jJ)s0nGw] ?'=Ո+߬/ lWFGY6pIgE.\@]foKQ[؂ O?pʭ%!}0[`h9w/$*5l%߅U+nUmy'Dxt|7< wZ= ';}VcnWF`CWZ2b{.h#1?g]ߩW)>cq `kK0wr r0~?xED>E&cWv];x'D+q(ld)Hj|H!_[)a.OedA%o ́ReO )]Np %2>*Q)nӄ=aOCNFd aeXPaJư~I:2SQthk :٠h_$@S:*l sAN|785 5BsF%`wǏ*+/8R:Sl*M)FnVI N%;9w<(N0-pˎ#ReIӄR^>ccO iY<p>}q 1Μ'o43`t`xN% Zϣg{6T5Ӻbt$-;)1%Rܑk5Gǫi.u㢘=骎JRR$|ŰQ!4iENPʖܨpR`;IV]Pƈ~ ݉M&' AE|BHec[;9h5Qps@m|)eđLTF'0@H] )) _GbW^A :j"K炉[@(ay(Ia$@ȱvgcT3g[xT]:('Bz{vPsYpGpOc5CTBEѱ}!H.$1(5DP :pI/r[24<)5'1IS4g|R]T,p̤w(`ɉ8 tC${ @*N|n!4{i'.΀D4:) NJATQP͛@PP$@fSWʋQ{tq,gO4Z\$L}tTI*Bx!Qs*҈HReoۼ{+PϠ9ĢQkwG6*/x멏Q"4R!+lxhE{t2y8OdmqvG8x<};0!B  `´G1ʨ$*d\w~E0+qȝjsI$WzI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K`u}MKe*|+ f^~[:;Fϊnrd-^ѨMMہod &um!w)SJh+PZl@:wUs]XlZu.`kC4.*y hل$AV%Kd}lywJome^ƻ26w^:TS8T +ab;tpYN>*hիIv@Sxjq;娱zSr1t7=[>l ŬdۿySucdeTK%m HD\ݕWH|V[/P-LR)D9H1SN;'l(5^(VrI3tPqcI |c iLi(ӤDgY#^gCU)a0 3e;5{qD,Eѝ۹?-%Ѯ0Y벆\D8Y7~ Xcg= 6wG G;tUљ$8>G|y @vG(^ާ7`X=J sΪmh峢EP)Y1*:P+@&c2b F[D 3܆3Pĭ9vbl\ۛ"[;зiTGLq \TzZm`koVasi1*Dn;2@q$EzrP 9Mw6P_-<ga=.ot?>7GN&QwtZt*\yrck0D@ɘ`Ȱ Z)5y ! *9=<[ ĕd43!9 -q1J!Vhu2_OE<PaVqO#ǂ7) 鋞 Xf-i^|`F=6p{Ęђ7TN߭F wI*l}:rl./ꄶEk{q+5-m C%^?fnP˜lAWxh|L(Ahkqpq- SUst|s&Dod&8 +ǷDf8M$+s[S=AɒgcX#!adGO茛%mۙZVۀw1!c'2g*t\]\_ӱ煡A}MΎ…64 @~N^ZLۛ[#^$qd4aD4 G}Ϛ3<<dDŽҗ ۺwU#Zր m`īn} gW(İ~`'Oߤ_Woa-s`B{ߣlD%ktwF!??%bN^1B }fmQ5tHoW{klqnߚ07C>Ϫ?X3yhn[-qp[Hݎ;,,6UߢUE S~|~3#nuK7;fE=fwK[]ikKJYWgvݯ kU)rў-L,5x&wn$ceii=RRGIU"uƶYxx;ͭ,MeܬKkexc7S1åݛ`spx?wb5ήF_Q#}ܭ8=ջf!~mY>DV'n;Z!oM]u$Ƣ_* Ew5 ުT=> NY%${Yj,ڱs 'ɣzjt3fXC_/j-6m=G(}IPLvWaَ@m s1>ms!Ur񬺲w ?=Yc)&Lm I܌RtQ! ,ztY1~QTK">in%0Ϫޝ- 9V徒{m2%s0ݗEkwzmwgkk%܁.n(Uh@hՋ[qDŽa~R6@㸆#1_s[\:8Oёk]Skl8}"IN5ck=UMIWNkI[/&w|؄nFw h$VnV#-m<1;}I+P2<{:c,͹YQfڍpt"60h\GVr)sFlj8ᯱ5oهC.ۧiR7@cURYUu>i_)NVpme:nv=Y`mg'j%nE^u-#خ:wYdtp9Z6Z|Gr\l4>*$J+`7>rݦns;ΝGObXH5Iz9XKtxTq}q6 #V-M[/DOX$J'{`BPA![R굶e\=:3V/ZCd \oC?P9$5m*[kj5eo_m2- 2cKD議K1oRtn{X:Hn_6Zmd0/n%z^僕n2c?yV[ >d{+h5>Ӳ5ۊ-isOO+#T3 i6-his'2ul?bN;IІ0u^sIs}cuRpM=mviL߫q?3[M~{knF;/21n&05Le)뭌Ǣ}"t cvi6P OҬv0qrft,tKPI~K;#܍@ 񺍍$J&#-#݌dacjK5jyYsC2/{nJmt߫MȬi0{&W95[ca/TИNmFk =A0=wMX#L86@*:M.?ٱSȮM84rXnH5N#CUfR4Q!$<(wL-Gi ƝGhFSѵKeoUvRdjl0uSCp:.hG8hx۵ n;NyI$TI$I$I$lz"7g_KoCKܿ?*_AomyI$%I% K?i M(s TQz9*0?/]r<:O*;MFRZ \shNC `R>HW \(OxHFBPa"S(Ԭ) S6CT"nP-*M)=DSBD& H)4-+$J>M )$ `**<ZT;rSDR)P!2SB~iH 4JhV0dԙVq!p7k| Ռ\+6 =#䋣6I>d ,1 ϿSQoڰI%]$R+d1~;0BqGIG,9 1Z{^E6cMN!ecUY ?r`IQ]A͉Bpv.;6 ?9s>eF?uzzG].X[ i3 MuQbB5"HN6y5;! @LJѺU:Zʀ2Gdڔ3PtiJl=ToOMTj.t$$AMʝl١)6' w8vPiRc%TXdwհk@'IhnNS!z{t#5%0y'SŢSЄZKpX#̭O܉#ɥDHGeQ"-?Ex[:#\\ 9A߼ό'FMZuA(AqL7<gu4AaDZL <,ipgIE4H͒`vSk*3 qv9ƃ̪VhD 5dΪcu';X}p@#ʅ9 `'q ?qȻ\wȝ ֧7Kʄ8zOk#7usZI&zI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$U3+]_Ա*-^#0RH& ՊNIEj9Rrt` A5CW0q͓gym2sO)&>~d >x>[z+x~A:p75AIE <]%U`,#O*/ꁼj~Z$]NI01eܭZ7hy<eI|Ept`{YcĻVC?~k g,6dVAi%%1q0T-j1"L DM9 lEfKs~F U !jbA:z%eJ(w`ȅXnmSc*Mʽ lx%8@R,8HJM+zGL}+Mi9PaNtl3kD6 NXYgKnX]Om[*|267[dj,ndjS76MOm놯W|Wokz=JgcbWz TbaӈV^krZ=;JuoqM/eYȭĴq!a;7{tJly'3wJ߼ǹ #I6XZyu'Ɨ+5uDD}]16%ߘg=wkO38 w#+:ϡY6thN<߅8G*v3Z:\r]O?oy&ђy#X۸5 r|P3%@Sn; `RR;Mg3q tH+~&d\%Pe}џȟ.|3"G\<6CK# #(?tZޘ`böy-6hCRֆ}Jiw`"Fu~Sx0DBu'\~Em\&ЄaI77Äw<j ^G6wU۞q{w4RȥjH%Yc}*Y#skn?ޟ3NF}[ٓl[k lk{niЬ^s ,6wp .sa9ƾ4'Wg+WeOZZ@2m{@RtF%7N4P`q iUisL"t 2u u9\HopvueqBtrtJRWXq;@0c<-3은);{gP~J'wޜYTH1U2&JL0uݶ4d7nrkJ+|u+O=bAT) I$QI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$]*?$ҽay?^v[;C_:/yDI%UI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%W)=gǹ}jwz1^S9t9AP'v>G54@xwmeߚ8|Vz^FQ0lj[?z;%ۼ KprH_fH?E*Gatoɵ^mOJd7O+5)l]'O6CᫀmR(khhDT\րcs\ =]Jn~|&sn˰4v䱋̾{gMLwqs,s:6:A+sYmu8Ǹn[]]Ĩ2zb$#"tI*(N/v"?ի22k}Q-+Zg4䵮n =PN-9mnKͻ뭿Y=HK ռrMM 3YE&&4GW1W1 Sg-2d 뤒ڙbu fm۸{?,x.,}?Ev6Hx>CwT$|`h[1"eBmcZtxj}iG$@SSXrP"`8Ck=\)۱jIa #C2s (/{aY5 <ƍCg! kڍұk}5wڱ꼝5H<5gOֿv"Rv@1ߎ/y?=sЂ`lWo$h GPGn-Xa-F״oqW;zg"}Ն7i#|^iRLU$\uݬB2Xg"Ƽj4?Hy.{ C -.s4Oٻ~=Ez{uvm'@?u&Xe9ŻX[99Aa>8Nv$-x.~+4 s7kS$^aΦe{_]T2:51NBn7q4~bwfD8:~z(k "Ƙ(Unw} .κ-l;$bͭkkWO#Ssvq0Z6GK30`c/-6l: #Z;P 9TgH ~*뽵o$ eWw}/ eM\k kx.tݚIsﹿCsqc[#c@4κ'}o 0m77ti,QǠXw @?z6{ϥXwDhv n@b:3EI9*!A ?9iR 8K#R~bpqÜl.O/7w'ө_`dj^gULEZn tlDh̥}g4>,h65?O['.hswݷ-xnpݩhqDj٦5d<ՐeE%4:}&ǿ Us[]m!o-r>En~Oa߼gYDh"6(׫Def=1#{k`!LxC۵gUicVzLڤ3Ng)wkƐp^fpktf73,k@gЉK;M5\ ~zC cgpq]/_b4~r{D~Y*- |X9WrhFeEHc VV[a#wH>?NXG殺<˙Vmi5Zd\`i Ѥ nN`$D4Mz<\UQ@{Z,n5Wr s~-fw/Al;YӍNnZu?IC[ ]Xx?_bmhW?l,mG ?M4 m}Y̧!LǷ{effc}΂O\3:K_c}:n_.BCZe'?Ec[wt@@Ig:=XِC*C/h6{]UI$I$I%)$IyZEgo%j-u9/2O~Uܿ?*IXK$Kk?o M(rTQz9?v:T|zN'O> DSK D%) '!P%%(&DhTP) uS"IE씃Q $u1ISD)S=8R)vB-ЈZa(jxOAT7)T#R*#S2)CPH$Om蒗 O$ '9nF!`0 T K)Qq PTKSʐl{) %`)ʃJf(I<&RLl <ӡ ݤ8?W;wZXz6WA:+jǗxS;Z32I 譍 lTmجd{ g>b2ӰjW;UN]'Ͻa▙!㡃/;}5pV}#]嶶aI*O,th[?s RWۢ>)1x`4 LČ :]Vg':ɶKq>t%=< `WZ=Ӂ+&IdFGWO}i j/$I' E4ic3*Qsri$‹!#L[:'?P Z{A 4p=ԋhuR9mK1/6 X6E08xOe/p&]aΩ8Off}HS ,djY: c% "B|YOV>T߯gmt s+Šm#9vl:K&v*ĬUKCX83:̷nyӰ]NϠ9u, ?V/X'4*tGKSC@ܯ*CGRB=0yװYl%ݕiOu*p]-zaMn;S % x{F'}ǒʃd4a~u7ΊD<VfQ K3\ͱ+kY+-> '/QJi s]_r[vߥ'fn0Py Dw<ǒ1P/ kA$@VYSd7% 'TL_5:$3ꮹ6G'wqJN0eMLYf ^@$u=ۤ< qhbgsHpTKpfuR0 itEen.a_kZi$?r[*`Gh'T7Vȭ~; >`tDR q'`' :Bf'E"w:$7u Xݜx )74C/coS]8LR"B& $sث{$iy!-syJ/j= P\F;.l {"\(X 60b"UFht>JL$"N G!KhxF`7钞Km .:$cJmJQtͬ.;IJhMImRa$C>) )W홙A: ms [O8 i ,tO=:#O%1%4Li=h5N2|+4Tѹh =GGeYi65ѩ?%v[D:[ jPPMH$S(ժ%Rưp L#HW0xDYN 5QBf\a:ݐ J@aBc~)4O T3Losˌ-u);I?@'$̔T4%ս%M>J.&?V$)ByF8o3o bCZΪVNa@Xb =ANZ+qhNJ@;x*{ .Ѓ%BK))|'-_I?z9 A!#DF'$x'cII#l &<U̠tUmp>4D)53MJG}>5Q'$4(;MPR&TbSqSwh8) Xt s&R-iK- f1J?5&CA!hMÔi2~J*l|;zo:U5UYgqJ4kNxQ:%%47 ?D5NȲ\:LIHJ)I6/0.#8`-O3c &H&[&=i~gS <@^Ѻ%&yt.6 L?eF"YFsx,_g1ߑC-9@q]I{LB`gka}[CKGw\Tj[OW~F.$T)$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.X%L?Q 2lB :WZ:,>!mt\qRն6qshx<=;$i 8Ƕ'CQ"W66=Y:|a^ϮUm s{c\ pC26PFH"9OtZҲ2g:1ů# N$v몘t'aE:)59KS¬oivdI` %>}>ȯ DsY:@Ӈ~e!:YlkԲ7Px}L{^ R78T>s v :u׷l..>bUgKdFwu}[[p#̣nfmm_P@Tl%hFox}WgosmqYOŵ4_۷'5L3$vUT@s]NI Qn Ԑva˹j<-Y{iYz{2)xwjVgռU³&O~jCc{{!t#IQs*:F⍐4KRjmU8y4G2KoC6XsNu *%Y!| wqK \Gd?2y9*QŴ]ՙҚeV?It#u~T>HSl˝ch7W?8:f#ɐN{ntl"ֵkuvdZ.A-r22KNT8#9kmX>Fykr`,t\{=D-wN 6lbadvm858>]^(eMs.*1xSm&#FǗ:;DK1dU^*t^LXO?Qs ^h "tF%K =6vpZFߚN>lw:"NF͵!anD,n#N\w++r:u=J$.SѻV-цk$+*O\.1$Z-D$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KO]+Q' ghI]ޫ_q,v=kʃLV =.fW fCx-,r8%8doatꯨ8$4h7ܺ lՕycO"mv]?up>*s}L5O1]#h0'"qx1{c˘{I:H:j ߘct}OQ>*swCK$ ?gEu-=۬d6zMp:?Bh6jsif4f:߳hX\},99Ӿo7B^cÙaYT>[_zYٓgǸdWAEbsEKSm nFm&IdZ=2R^܃\hA88CY%:W%{ln]O kDͶ>Js+y:Gcss\xǭSb&Uapv/?WA`;OT]s{ i-$0iupVl=AY$?i?ѱĩt^wnEO%b] [-w*?`o~=,?5]>پ927> #F<K ҙnGxsfi$.ժm8E+$?7`tSHzqKY^u]JǏm3cYO.+q^{IoP[S0mKm!gX>ѷ_S km6f77Yן Qc$LPur{G`@u{nAɱ-2+pknߙO/ <go{62勭i l4={?ReY\pݴHWcin퍤9J7$e@OE񺳺N8֗X$8ԷTluqZF;nw /kk-8ERvM6vlx}=KLf>$ʧ[]X~%9vck̂>~bw@OW`uֆ`/Md2H$2Q[&߀Gunrt~Z:7gT36JT;}i͂!k(sjqk0ZoMM {=c}bY^ 1hm$=܍q*Gi&9 en_P`9w)pOӘqau[5D8ph9%԰ƐO? ԩGGn8[XSEclcr C;O)=6o2fEac`bliqlӯ]rt{ )z~mti?@\jeMymo j6zջi|ycnF+:Xk買^r|: u;ǃ@w{>Ah`NK.q"g0UbD[kC8Ps*6淒4\aݶ}͙]:3.P`- T[]2cp|dV ^< jSRgPe9 75ޯa,^\i,1洩pn.yι|],- ?ZxSYsZgtp?9˗a6K `ɬ->[&xDkRM[ƀ 8{О{/R{2!0 \oXfF9ksqvsQvxaF og1@Ŀcw:m͉b^3X_Cw {nCV yBM$~ҔYk4ˠZIp;?a[s<%Y9Y.c2N_pwhzkZb[I?xT&^״ƪ; e *Y1KjD"0 m0%@JRHKr֊ǙMJbSB6=ӧ1<*W;~*Km x6-p9[T4*L,n|eMl;w: &)UVq,=ڤJm[#5c]QdY$V h| l~k}Ќ+ yp.<0?pӮfA 23ef}jyڃ{[Hbq.33['^T@'[fu*;DNNH(wtE-᩶`sI4zęGGs{#;oiV\@r8t"LI#h>6ХH-;!Zd)vt(u%MS H)Ð%,áS=8w ڙ 

Yq$xr(Yl X]w'Y;-wQT7<p7j|^a fzUs9hf8~/rl`=\u.5=_.{:/2yNpԣ8$ΊNjt+6-h{A-0Rc1UjVMgz>{DW&~8`qirc=ԜL2 wH!9ϒ< ţēGڡUdƼ*Xo7) "O|jIj}k$]:<ߑ t4Sӏ#pAMw bnX LJ6'NA)Y,&#I;)47 JzBk9BԾ=ah;k[tp!'Oi !S"D֓ D̄ F> wH> 1!Ew*66Ge۽0ʮrp9$\B9CZyPɮMOht|? w_U~kqS]1Z4vjuN-pV~﬛|?ȔA{L!C$kCeRVߖth*$!"11 E #Q*'INK0Un;2}W"ZZ[1D,rz\\sO я^3vRB*` I%9뤒I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$U\z쾦/WJQ0K?U](xʸX3*s6U-q5UF'5dnVKwƜαO-u<s$(U nA$L?5j3J=ck{Y1kL:DѠ+jci pР@<\ ~Ckaj&G f~,ϻx^2Jd;2Y Y9iY.Iavj8RVr8cRAz<|@l8гM3"a{^vj[cc9h0")%E]4 행&Pu(9܉MÄB絿H :~ H˝\I*u 0F$'3 JXc UI䌓tcvĥfXf?a.&45O%.P}3L2iDp;*77pџflFoVt}obrgUKµƦ~EdN\d:DJ`J}p"KP]WwG*8)mp'C^Xmf ?T*eSs>!`d9Le7_pWެmG}Vx*@[)ȝU{i[W|*.n-#FuOGi{vA&h{TN :\un!6kkU⇵5vK3+!yAxӴ1_M+v}b&ϵ `ha[W6h|㼽4aՋ^Eunlw1$ێwzQw~oڃ_Wٽ$4?: kRՀ46wvl]n9?'-mG,siƨb Rqx"Q^.4)+wXht:̑c>}%$ )f8TZ$nng],,k{ʋG{*c2Cr2q' ڮu.l5~vkZ!WcKuG:^Hw d>T >tz yX nNE- #we mO7pvû#rfiz?6*~Z4y$Ը54~Q!>YOSuc^H v.?Cr]M}AsaX]m/0lܣI}۹=O2@Zo\w8Gonm>#wKsj/ ?@0{\$~{ZC L'0.q4uSU-Zd63K=ۭ^U\}nIS3AY ȹ3lmnP [른̰5ډG2?= 0c_[h[y@.e칛yϣz~kvXjܖ:.c6鵾_*/kt.#wEO#x}2Jn $ǀRY05Hsl m-hCأӽz.>Tӹ.o:fqpgG5s謘x.$I?͵6L  [V:V>yh_[瓧nu\&HS.X`i ;Go*-S '^K>Z~bC8W[@&<7m϶7H.ەZ=gCOO `DJWԂ IVXdM%G٪Xcg%Jn촗I{=GB&N7@?Gz'SJ)ymBuB96:HDB׃L㲒ʼn\9#&4:XX{`xej`{M9I\x12smiզt^'+xkLJzZęѮJ{u3\bAhx^GqfAi-IbϫuuN];t6G gYcv nD56 _7(ΌoI\Yq }Q-TN!aT~Xvͪ?4e>M{_aeM}\lk c_biv]*,t8mHnwuxN^ΏS4DGwjcYh|9 )˽YՌp=Nbx1ӯw;{ G32KZ]Z=lgf=ׇEPP ugz7~\'c5ف" Ys׈`x/jtHONo1@!h[+gD򴭫Xp+lYI$+$I$I)I$%go%kЃy8J՞Xk/Ao̲/G 6ʼA͑@I 6ʼ$V$kx M(rTQz8vz&>ҟjSnJThbAHw} !KP ARi!- Ub1Hj7knRB˜K✒7#eKjvɏ*MĄoU,ᤧ(:' JAuQ%(Q{;s._PcQ[Y(ƈVCH]ψJFK0 ~Klv En&tFICc5M$HZݒ~ ^nkCK\kH<9uDrhU<iW;B,p5&Y>֤RS' s'x([TRCeq>n]ʄr !J iSYӆ ({3)dhԜi#^{({R2l)1 MHkʖ扶T LRgN ~㦉;yL5 4OYrfջS‘F4-> $X)ja)5Tӻ @"P;OEp.Rn#=M]'}h@[E[2sC&)#CM-μ;VFYC sW ZZ`S.39쳩6gs9b'Q&>bK!ӨIp] uou}dħ tΚ}rޣPh8E N9̙@$c2ٯEb^Wu_91Q:P~eqOgf=%“&/.P *݅zWvtH2TW{X aSI %&!17;?jc45XS:T SsaC#8M6aYaX=)H! 0^Oe T!!J`/kk<5Q”];"?( kAKz^yԪtW a5N OC(%5k8B6UT"AS%oܤA<&-TtښBXVD # 9`:ʳ)|@8z\^PɄNkws)=>aW[m f &OJJ^nĪi:'y1p)C*rD!Ґj|8G'R5FyMc!Z`Tb'Q gK_6t82c4CKH#-os=RS8iJAI3Lq!2fNAlC !۷vHqe'4Sul  c@8EڄNw=׿uT?UnӢ|SA`x[GZ΀LpT!c tPu]ܢ4>*{`IL<4~i@L̪fNHQ0UtjT2)cOJ08GY1$,q-ǝ<];/Ui6tD.Ph_8-8Gݟ#FkY9u k2}LgE}dgB{ xn>fY਺;W'C2-LP{|PIa*am$j]+4YUgzLǂ5T!ʓhNQ kʘ-%m 0!ғsB'd =֭OO+~uWzu*w:I$Le9 :u _+ A%犲I)lPɆNJ[kCd\ >`9|W2>7gO?-D :Чn0{ZA<e[YKYsrLpb^]>|DYggdXG$Ki;$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.-vTOTz¼z ^OmUX4pѺ96&k &wNN[O 4k]:&Qq8*XX 8>$Ugu5-s۬?@?UJ`? jr?!9f un1^0߻;S5LSBLµAOwe#G*)cе2 M)UG|R#JJŢQ0vLq Ɗ\ Z%EکP4I1i"PȮ%ȋA4V`l7xiٸ5-`TN[ԀL! BaFLUb5U6"(mI2-쫆p/)5РB8V_qtZn$[E.,f;pAxOLd=9C81۽\~ 8Ll gU :57S0$uPӪ&%2!$ZuISK0=pqXOlHiuK}OsMMVI0Uk['@KU~M_߽edwA:hQ5Sp&%ɔLwBzvO'RumũZwx'\ ݧUO|} jt}ۏP:k|QMO?iHO4> =y|}jޣen"zt}pd$8_(;'I/?iZU`u\k̪"^@8}WLXQ43Gܐ1=H?g8_iVk .vhOɸwMx$r?~KgFr?Ґ_(}wޘd[ЎMGi~pF$joJ℣eVRu5;_%\g?gT }ǀFǥe4!rѕWֳޥnܴP+D@T, 3ٮ .$5AI|? 'v'87Ե%rcZ+#Rn?FZ:0ͷt BAI\rI$5I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.Wʏ?tX^O+GğW(9V?&}v΋迮oC"$IUo)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$ۄ(Jf*yf`YAH@(I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$:uЈJN\=2Z?(da|UvE\j閹/iWZ5/w)zS[L~mK5٤ꚯҨ4W@V;sXͮR8rw{ښoS;@XD8s?CˬV!+؆Zu}(FSbCF--6=֏ozꕾ猆s[YNH{3Vx dZp$+/Z2etG֩kI: ZvğwZPM2N=s-a v]y s?Sr`7il^u;[v_42_y;V+.e=Re?9T^V?(T^);i(ﵖZL\~@{A \Z,s #XL@mg3Gk86t_?Wn> `ѷ>+XkeٵUVKo81DG1}X;^%>#q\}G['RH-@+-h !MX-sZZ c\ebn,}E3ןYLvZ֝7M4kL*z͒%;XvOAʧNcwwZٲ}=IWKY`HsVXܧu'qk}bqc)ͪocCЗj.i/sZ4$q^Ώ{Dr/e:@>7q},OW[ɗy.ZX>mMKi5')cI?E1-ijKi7P? A׺qǖW wWUd[ei I~֍F~~ŷ8r6=YIAg!K޳HsHogzZcnDFKׯ}MLwh+cC*eUkٸv` kqkk$2*$UC>I<"'f^ k4%FX8yBs0plŭ= ;4g⬼,s>اi}Cָz{ʩvyֆ0=h\ {Vc͠-=Dct@p|W]'{?A,fypg i١V+ Q1muY>-uٙ4GM>,[[!O8ţB|Z9'Ewh@7Wz>β ?B:hUzh&5NkmUnd"!ԍ4[1jʹͫ ^x3o_ϐ=w,wK8 F/:i6k'V,}xf{ dV5O6M7U~ւ/ oR9bIj?<DzMY#De6@\0_.9VlWBu[~km ~k 3tʋkZOY>u]a@3n]O~[-6EuY\Y{U\ՉН}D<5{ 5׻qqYTHc'VNmE1M\7]pq54Kw,li3w.2M9^=?;xsƵv]jS%Ļ_4Zk5eHo dZwZ+hfUD4Pt]@LxI$)$I%9UkZ Z'B+c=/?b~7$ ϿV 8@rlXu9/3[phaG{w[g^DG 6ʼ$SI%k?q M(rTQz9vѢRܠ*t_SB0%-#:a4d*:y 3Lwxr[|$ tJyTB[)\@ * BtIL)JcB-JR)H9-sR,M$)P'=0r RrmAS S))L\tBCMR@#JW)Dp#)RM> &R*0Z6xeYaȩ7t(zm5N+ zk"udXϩ.[!ttwd1?TvMIڢm P@w̥5! r|TTˣHԄtiHo1TZlKD*M]ޕABy=K̡(̬`4IMs9Jkwx+=x7ѯ*BJ3 " յzDp% #!# tNƩơ"Тp$IL)LJVP]!$]羷 :pdIAݸ$:t]u@ g.a - nҤ4S9k*MB*mgt0@e}7܃sGkh f֤*IBU-}ܲm]N$ ;$YmN҈#hQ 4M\ְ:!qDG$gױPx-s*)hsK$@oi>(hn 8AD$:OpCj% ~G*']'1iTx0klTV+ )&i{ʖM Gbu8o̼q  B )[KC3ap{HG{ [w"H*T%8v 6Hhw`vH&4hNjIN\V-Fl J RR Pm{@=}BA!" c`ҳmgsܫHP"5*l9qr+3ak!ӺMbI IV.ѦĢS^4{svxW <朸6KȰШ`}neq3rȃ'=7: sY1Ւkx-~W񷻗h8)7da_.fR _\X`@zan-|R5?^ka fCF;ˁHx,kHӵx)$VYC"uwr˸Gm9 s*a4-qO6ci µdڪiݔK@JT6*LHA/2']}pDRi$JJ͢C:rkXƒ'7?q Nrhjd9)2yQ "XַS@]Ur@2Ξ&VNp]a:({>WY> .t 3aCsuS2д0뮹ow*gB_]) 4 A*S7Ӱ&wtn?xLҦ ) ){ (RZ] [pBkc6ӹ*>io7V`]Pa]4W[sʎx; {@?C{F׆mRvZka]qiTl̀+5=eѰ31_Z,'m5E=ZHN|=FYIm/?Qɴwat?J헊0Uf}Xh-6K}]wN؎iݡME`Nq2x \Gdd].i]Jhi*6TD.Һ/Nx1U_L-cmg_wCAk.}?bg(]V= +`l8r xK(4Z[[4ęæae 2}Vz%ueUcjpĹ]vaׇMUE[Z {@tXVU}d5*yhN+]'z,ɱͰ׿t~[r}?mX {IgnBc%UZX͵CZ6 :AYHAqqkUJkVX7 Y]VU`bYc-"ڛ.${ FǭJ`I W0LJ18 HkʝxcE41n}mis[\~1[eOڶ`@NBwWߠj.ens٫\GB$yy)@W9*xe}+,Up5YZszhqSNKK( hWMgcnypq͟MC?q.mt ]S{ZX@w*]MD*7U<&.}[*sg 8$K>׺hS}SoPu;+0ˊb?nC$H#E} Xɒo÷k?>Sp_kzuiƲ 1<*xӵ-4+l}#'$c7"Ӌm4L:V3զc`c$x9L<P Ze%ޠS\$l|P{:R={"'5R[6]N|+:V+S4iPvƤJQI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$𒔒I$31,DoM*RL+/XNJLpKA)=Je*a;#J!Đ%seJCtƉV*M$V4: oN5t{>ku1&4@(P\+ZA%s:mgwZLp  U6߳I}bZ@\ P[ OM`9KTHNqq|s|N>7R6X\bK/jη\[ %T꤫U N))T"C$'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%Q' wWJ3|WܿOoC"}C_:$I*$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Kcr0WLJcUʱ41KkŶMVCv?\ivR|ݑҺep`kCU>'lt2ڀduYavǴ+X񏲲MljJZDJ5Msd) *.`wśSƷ"$ӽ=-_}2ɧ5>?z͹]44n㱭ogDOF8&54 DT=PDhmGd C2YY&w@{LZzZ_n*_ͩlߵG.ZmKs?=ɩ};$V78c*߳Zn`6n`"xjE}:<mouvXeΩ0GE9Խ q]4T[Alߤ [ů eRaIc66*3"_oS\Vcvm ô`tP) MdHݸ‹Bi.~E'm$zyqNv`?>br tU.Ch'!z)ff_XX7=t1?_Ƿ71 c_w?Z8W_"]/@c{LI Z{Ak?ﵻwV^ R:4W1wVdA<,3⁙R4t)\;ݷC39=Bc@>X6%|?uh-!B`)z:ޫ~$9WMš^|/jشzև;V{Іl{6Zsa;Vq]u@1p\c?6!uݕ ~6n6xZue28MCERl沓_cu3+wTle-$:m%7C= & (փS}NFonE H~b.Xm9Z4-ԏ-u6%GԺgXau==^.3/e; ??}U} 臅Hn<7SJFCq ;r/F''OȲCDo~Uַ)ea?:ݕWiEL{R_?ܬbeĈ_5hR W,ǴwH L8UtcWzo X9V~H&Im鰞oU05N|΁L9P'`8LA~bZ݆v;To 5Xhs]<궟5ԐxX^GE6"PYZsDsI[1uXޣM #ӷ9r5x`N=0j7.?Ofz]ѩ}}ki.M.s~; =S>`m'{~^OXd=p9n, +lkh]Uo?ku pd?~݋}5wSq&YEew ?ju7Mv\~8E>=Z@.q:͠n⧝&,hc~,QH%›\$\O?CU?skhp̳Ա/Oozd 3dw$.M/%G5^^d#j VdAϻ]S !fP8ו1/۠Dk7._KoCoƂŢ8#Q-XH8:~I 6ʼ$S%I%?qBSJ?/f꫁]?`^?.0?/]) LuUL&!1I;Y<]nN1tpO–J!+S))n) @)OWjdH)$LAIJN'(MڧR򟔠'R AN H,MD 09PHBX)(rwd;ZE21rdJw3n8F &5H0jה'%1ӄڤO VM)FS7 ^e? von &qQt lt~,K`z a4[DRGmc{\t49hu@% c848 hԞɷ ƟH *-{w`cP 75>tfL^HV^EywSqkp1Nzjzkh.#!Z*PѦrF7˱[X!z˺t o0NǶfQ7txMR&ZY^(͆$ L!wRXeaG+vkxDyL @!Ht9MSKoV> ݏ iirLD4'@Iw#@g#@ך8mpsx*V"|l{d8IBTmSS8LY|4W.jnuB$e mVE hOl#TeQŧO>PP@a ݊z)ڸG?p ;lE7XeOo$@SP~Un}qC]՚kuvHZNa`xR 3R;&A n'sJ̨(v8-];W{|b.twxW{˓7T NF )X L)]ƾ\'lN&&-v= 2Nd4j{&kH0"J[ $T_U2ZP-Mh)cxq 99#rXBNn)m$%))5 'IYB4a#{#8 #FGbDV|[}KYk2lqlAS-hOo`xQlADu "{̢ #RژyjznB#'ˁm- F%#ʛYU"6KIe]HШGTI4*`Fe9,h"V̅_c+"h!IH4ḑ~wܑR;^#cˆOwdORkcOŠH0e:YܭqS y[NjLزf\v[ura[=}yN=ߴj\GqR!Yv Ѿ+ Bfmh0?H['=O2X%y*['J:uxZ ]պbe< -Ưk^O!EuB.#H29dg/M)Hol=f<\?;SA_-8sY?rڙgDh`"mN>xQ֧X\I# ѧ⮺ 4 B `i楫2'C D\_W :xV$ 6ǔJR4ڙYZ濆t ft[Fjgׯ $HZtwV봒AMaUms =ABs5ӄJS۫ AXN;Lw(ՖhH%w]H&>n0vW=Afo?@'Oٴt!4׺MIR Kc@t'e 65r5$S նER4H<S?°FH'4M`!=%Mni<$ j;6=OE  5 %G`P<:˜x< 2 x&ZSzu"Q.TH{~hg.i۠ dEk64n'S$鶤 D@FX)FIX:vAkrF`NDa%6kA)5uU#o`(m<-jSxyIMx|AuAСYGꙌk 40 nD梅FCxov{L3$?"I#NB$JJ`:O"1BHr:@ '#CQxD)X-Щ6U=D7SE!O RSnT}ULe&m\w$xF!Hm,(@tR6{uDih*n"FӪᤠW.4oMR*&0@@O;5a{e'FhjvKv+t82aRӸQ2+ua*GSݭ'׎%jbWjj*X|e)KMGP_cX<ҹ_v%Qȷ%e 1HpDw]%q?C'js<`S9?V$O\i$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.~\"~ ` &=ԩ7q%q!ExCߴ.w1G/}ᝤsk~13}#^퍭\)Jk@6vSj+~hv{1_\q7]o&?Ȏ`"1D7Yԟ;0m}>dHN4B~gu_zHhPz띉q;yg 0!fƱhMlvVN3\gsՍIKTض2r2-c:z뱣o[YrՐ^FQ1"P&GU%I`ųj3%f=lΩ}M+tbfI58lՐ.W6K'o{k A7"D_f!#ܺ<;s"==ߢshί*In״58\^A:eյanA7!h|Fs$!_5xx\J'2ը\Om!e3 =z %JY[ad{u mL˛84r#UՎK1V9 eecSZђPms}:nVNw1z չ,-[OZ1\ahdS$DӔmGЍ|eP[9wdI۬?kw)Lte!ȣu.,,lM?vfY6cyI9 m4dEdN2t0:G9cde:әsin$C*5Iq JO-?yW5V8Yc^ b *xxP܄+zu|S–h7oQz.nY@?=\ōN+FsǓVKv5{Fe AY,/c4粳I:Hp;_L) ^Ǿswߺ>u&c᧚͵#+lC]YT`*ua9J>ߚMQ@3(ih9 2́T&?5gfa9 kz-kO^%'MgM&6Asƶzoc؈*>H-29ӅHbvp080k²\%EqngQ"m-[/e j,\b{ :uV^XaXOebZ/'T)w.PkV(/x/pQIg2݊s,TVgAǯ%LA- ^UˌhhFF/VÏ6AO nʻ=ЮuM7"`@Z,st o-==!FqpE0[OrGBoR4w8hGt {颍@ƈI04As4l{@:dNM#h!{i!zFHO( hRE'?4pw ;QdtqW/ֿ;Besk &f+UJ1$WڍI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I%kvC|V5BO *b]` 9 E8'4Ip2QM3L^HN,6t]L-hh9Ev xUI%6] Jr@$o]>ҲN+j M5#\O*SlAҩŮ/yG(d+ou`?T+.T.'%MϓRljTq!P\OhT裰<CX_*NC@k$}Lϰi |ãBJKP=85"4Cש~*0v:x"Ax!lڃ"۩Sx}$ '#ɉ*2 ֍7'9ˮ>qo d%KG5Dۺ͕A )cYV%} e?}v8`"`m&ui#>5®cF[}+]PިRJSP׿M˝ wuB/Q ?47Ī6>0?HZݠ#q;%4:WnmX%VAhF$7P[\°2kcGdZl$7Ewy}8K'"P$ckxjZn7qr}fqEbuTj{(f9Mw,tΥ$7j|engmG0g:\᧒м$Tc-<'汐Ɲ|?z+Gh*!YH&HSnIOBرk ِZ \o$ސ.]CCv8a p_P'/Y̼j̏PiXm0tOBnzη`5K~5\싼.o`WH׷d`*;y qo~r7m!v{H%gd6\w%ŠnHN~a ʰܱ\Ksu27Ii(I 8—JH`Y#i w^ H`AIE$奼LI$I$RI$I$I$I%)$I$IJI$I$RI%Q' wWJ3|WܿOoC"}C_:$I*$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$DTNYs13?O91@.dh<W`nVⴽ7^Vva"}:@pu*gkWu]]6;)]<-X>G^j 2>ڥͽռmpY x|KSHb#?I74#wb3fY4mqvRwQknd >Ϡʮ~etP ortExcu-#iBYe@=Zs[[Hwt | (_Rs]k xwZZ?\6.EeK+k#ibnK{+oQk`k8J;j/n$H1,v#{hRs2BZ =gY X[gc@k^k,2~7Gߐ?;+`mnϭzњ.T5<sCLI5aq.d*3#yK'ƛ7TivUq\dy~VUma |~ f4#1^ݾH}cd[< ,ڊ̂`W?Y0tZmYC`6Cyte?mh?A6xasT-{yJ@ :1ٍ̬^Lsv뫸Xd1OڱUT٩y/>eX= kt<5AFYa_eMmm ̭Jiֺu衔%ƪL}Rhc7௻:-{6/{W;~idk5[{-m. dH kD́BfI=]\d;]džx=ݶ 0(:q +?3( g絻nZt> ?5g9 k}Ɗ#5"r")˹4 sF'SQU̡Cl1v՗#4u@Vڪ=F4I=F?g6vLɿ.)7~/u[2}8&NV[1 g#e9Ucv#v =ͿM*ۚw>k[>55]mum?U( 梒g[LwS3V݉;k\ZE'oa}+,W,g_ikIwLΣMK ??J.CcޡnpprHН`sDwĸ>=RٍC 8<Ew+FcqaI3_?*aj4)ed 'QR0[7Hva:+8T }̛GCkYݴ2EjSR*}@HKJHn+@+Ӎ>cò`d㽭i9iOsjm!1ƻt)o3 ՠIAJpTtA:Ajp:kGZ\!Z BG)5 VO7)4wD8<ˎ z:Jhm~;O̗[-9TdRS㜿hwtswWVZk;T* 7@o_&kHm4oK#z[~r 7Nk\qG!L?9S7u`=5$4ԝ; 9Ӵquz˲' ; 50ók疴ls=֤SCqCcv7WsI{^UH5Z$(dTvƻ.ưCC wOc- 2,^ iG:k6<4m{ZN⋻ݷTxq Z$Oz9ۻS8 \ǝZ3aGx9&S )>tVwRXH!\>&;, o35Xϴ8]Jjkc$5{Ir]ʻM *@JI(KP h5JR *CN錔)yEɹOJTTTOl1 IH H \SIObD)ʐjAU4OibQH:oL#}kGr=6H`i:zsڔf&p a~6SN%h r#D?[X%9[[=(&0@^hѠOtRg82{4W Ѻ&@6PEnaL 8Cm$=mhZOxs6/y)u.6jcV}h(>]di! *m,r|kB I:>> Nt+lBs|*EBT퀛p(|yILqLT~+1 ];Q.sEc+Sf4LysTf$vT =Ӝ=){#;(9Srno?TDQ*L8@VQagHY-{\<QƁ4F -rS ZD Ӳ i*n{BC-'T3E&~^H\]~jF#2W(iOu ':&% 7D8C`{wPul>d!>%6i )d='!`2YֱS;,yCfHBP $s1 Tfio)xZTdBZ8P B6IMqGPp4HNi"`״(l3q*a|}R(m)9IL7:k8qi ѠUvEqQsO RS 'DF +<(C\!M) v\_N $XX_ h4*R#BiDi Xy= >u$A`pMh%-Ur'BU)m<) rQ'k q)͍:P~K4b jԧ6N_;<q)8)9ú{(;){3)R0|$9GxB56%ӌ@?$oA 'E~6:Vq 蓋!NxRhAJW\y0NF> .~ t=m$ Z|Q;nh"ZH7b5l@"SL0Dpa00gAwui[{+u:k,G_YcIWhra+Ae `.3Jg/ǣ83s TևZnc˞LVeϴ;& &ZRLՋ;j}Ľړ̧e54DTT@ ҮBq^UrVc+qȻ>qȎ1uʉ+ؿH^yU9$K$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%Q҆.w_UHm 5./H7 FCJ ci+m<tl V* VUZ'qNҘk{C[\5ki d'sO<@ f/ʪ.a'SwNAW\$w+d-%WL>t>l-%A:Gci?̒Ogd䕿b%%&M}O(w\{E2h341K?(Q|W-dD 0yK{ Ҏ,G$5z*2Gׅt4ɂbdӻ[ia)!/ӎiwqUsvv'[Hy{$ k'DJ ȟIIs[;܁(/&Ӫ{N=7?P^'iXO< }o57g?҇OXy}M;Sg",YxG&yY}h]?@kTNK5kD xMp ]̛r-`@xߞ#&_Tz3׎xR\:v5Ocʷ{V[UB GJMʩR~+;kgcF]uӰ>;9dc^d\N>pw #Zvj{ėn9ɘU5x;.Z.ƷGT3B\tۜ/ǒdINPq+;;O)iū.NDAYc]M7RLU]-\WZ{kkg"9Uz7 Щu \Y =_S|D?Z߸xW'㴒-ln?j}P\w>C>[7\$ :*g> n=YiLY=X]YjamYPKp8ʤk%"`2;ǮSkpe¿Qw5}e6Ѽd7A!ZuX?oCw8&I"yArF,{-!CI@Jo0](LY."hC.-ؖU"dǻ􋏿u|U fNUgcnER {xP KF1^W|BŴ ƈ>VV7M`7U,<\nVF}/b10#=:k )Q3k^AMccG?ݮ~%fQ5[#lK|6mJȸ[*[{F?jXåuzn?잸}x,&Zn=0}:?n۪d8ps>'WchhH?Vt^t;_~AT nͳ. Mpn@k6_yl@71j7"u yޱ[KwFOs?6[EöfmՐ2As}Ư趵N@k.#>#N%) \[:,mZcI!k@fsҨSdr$[΄]2][et55q @> 'QJAN}U@YiyHR$jAyJC:!:[1FG: = h| pIXE_@"y(p5V('ҍSdt=24R!4ą#-GCGu"JnfJ9.-ouaFUb#-]6OZ> GDS*լbCu:^f(yY )[Sv*)-Hd$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$ t07Jx%o3GDRmWC{[Cs+l/lZWX\DNJ.Ƃ""R%ik@pe dەZΥ[:γ\8I!%=T./y^D*:mUI=Kq  @5B“Y;92a٥q8 Dˆ~鏢Vϧy@S}f@H0,~ 7?$WM[&OiߑL ~ ow8i+V~!Eǥ|חߢayY°kt"[|:T2Xkƪ t<%wA\%E cH%].ԥO(%%gt _HKy mcf@I;#Lz- (ZJJbmLɉ0FYWzFc~yVӵ:BkHEƒ;+3ru7X#YgbX- Ъ$>JCXH%%mf=I%6)OPz,6GT^2[a񧌧t6IlAxHq$Pݶ"J 6j㢰i:~id 7褦 }E "銚thVnO[$Xwj_tc?F"<Щm&zyԏ 5AL.^q>U$Z*/8A⥓hw/p>|-A :pmˎ[H8B)dNAQw}Pe75}4ʖ4v b@PJ<;G0"]kDj ăN.h= 3cuc_nhQZKfU] S[+*Ud1>Rɲ[!c" u)w=;%Yulw|'l T FC, sv՝әmHs!}9,տY-s5ĭV>韠$ Zol惧;i)3olzb}&hhE=e O*y?c2LCi^M]&9lGrqlu wIMec c|:4*YY!0tbEsPEĒu*TAm:IlKN^S&G* >셏CU)jdv3A!`Apqes&YYX}M>ԫ}nժ~DDȶxQkX˴Z[Áykh)ka&ۏ[5y ftG; ,ww,.{rq.$i<Ј(׆Ȓ9AMR5ND)4ec ϸ:\6S4qn֑ INuX_4OFf}ò+ n6X uO*9ܙ6F gGW9qԷ]-sNxvQϪ\@%s98z,ѣJLq(*]Έzs^4Sy??5/KXtPژy{?⑰Ωe91>)!DvhaFuPAЫ4z!fM}K 4m,͔cMmw {w]Su{]3ҪwѤ-pJj8hwklPk*.>وwY:C?sSc+5mN;Wzc6,|zswˇnV6.%U.$_ɯk? c05eKE .;mo@S6i'H`ma9֝;molwK^:Qno$z{[/#z%{ )=oݤHlhd |=U#m`)[&{r =FcTb適sc& Gj{1\Y`- #ݠ4eH2xOi kT,jWПTш`0߱q/Qe5hfwz(}גDYk@zճF"H73Bji}{<icڜGPp:boH疍Z'aoD/3qOWƒHݤo96{\gs!̰@6 P:󴸛Ng7@3:~"?q^ ̴ ̥n;'A[L-Ӟc-1s[^חKUs#.דkY o.K-T3KMeMkS :?X݀~= ļ |T4?(v3*89׽4%V[̇ c\4,{,y]7C\??䱭kKKZT(02kp8 @-+*\wi"tHk=G A}R }CVp8{c7!Mx'w#{7{=8ih5]?ۭKOK_ ~OqXu6wO-Z  7QW:0=Vxxhdϰ{,-gAJ}gyvI tǹXPA 2%5l_d5to'FC!3D~+h}@'q'<0nqUٔHkI\q$7e~)ָ1t]6?N /5>A?wwZh}&p<)ȷGMjl0DX\[d8f5U{@ð8=FR?-߶K /ʋfEcM?mP J>w6\Y]`I3go!1I-ml[co}ikh׵40;~fnNfw[ 4v;zGݍFv^~r{"yh?J1\ǕZ?"+u]j3@ M_~{ KS\k8 F3puclvHfwՃ}Zksp mOSĸ|QljCjȃV@n0,"{ אZ{i6+]QtZƱ}0ww;C\ Ǭٯ }ݼI1+tXb }^憉+dw@] 2]"ۀw/FNBQ= <6cyoooY96\`pAݯ1IyaZ@Jӹsw9/3XDBi s%0 {^:AwSȽc%BvE$Z j/K5g V#rh4\I{29HqEzRmUCFƍO?* AOChњJ❻F y%=N> XQy24wV6D4&p ˊCư1۬htK\IĶ#{j1u>%X.JSD@ T tV;P I)S5;DY<-LmcA.>Y^ nIR9lw(ve@F83QKIفv5)5UTj O KTZN 793B@ ЍBDi"dJN&kI @i7R!8a?v':&xL2|U{s($BDsd"Smyg - oiBc'TD (t5Uh*8C %HV!H8wM$!jl\X)5"[bҖ䢦L۝7vLXd$o dI H:wAH]QwvP[&9gBDw={G$jϪڄ@H[;tUv - AἔHH0wEI,T'T>Rө#FVcPwRVVF<Ӣ^J5xu3(L!dĻO$iH\S8k )Fhe`'ͰJ4OF$̝@N<5ڧCvyIgJD\R#!)Rv2Ȇ-3R.0RkqWn8>(u |6drJ s IxIWv>66M_wI諾 nҐD޵1`5< :wIѷUHPx;tU\4MQL0%"BYNsKp1:k{F悙0mג#TZ4 {djTCO#cl"/p4!= TS;t*#p']Q$̦߷̦i8?jݡ{{Ă;+!0`h JgvBphCu)tV+ڷF 5uN䬻 CC/wH &*lh50UMiw̧APd;N)GA :'s[PZu_/tUuet̅&;_4B (n94d6TS4Z15>*zt  tMT Yh<{'8'MDB 'x)a3:$@D4J2 ]!O"v]ܧx*nJNNP.+z[9Af;KAхN/3iED#!蝤TE tEu0uLѪguKwdJH9% Bm ';h(D5EBH)z׆o#^ A4BOʜ$cT:ANh̘O!8 9rR}iiaԨFLE|S(np ԄO5 Cʵ]OqTeFtHSKh($ 9h$5ú}PO )>@QG& >G>~1: 2> )BГW-"D"4p$& st -ݸv9 5Cq-q1 ѢDȁ5O )n;Nַq<,$mQnL]&NBd#j_q=ҳk$#o}JI=))q:{(l-=@nqR^#`7J[ayO8fG VE莲T JCTn< : nJXiO!)JbAIH 쩝kT0Ll) RGdGpo Yϊ7)"ML! l慤wZURj]:*lfǂ%^7&uUM d\lm[YZ0%$8NI ze KU~f18Z{)[" FI)L)]5U u~1phJ̿8X.ʘ24ID7@wgn.:#du\{nt?IYӷ_? ԡmDf"7P[b疍YkJ l"'ayMnBw0l{q06?]ƋFqȟ?js{m,0b$WSw{ mFGNO1\O EL8s _V̳?J2 |Tr`?,F)׶Ƹ R.wD!yhϿ?H3!CWhK\utU>K?;%r.@Eq^bޣcypOçQWs-i[wom{"\5Bo+e$iܚ.i}u3Cf Sц /Q8'jIy)7%XG X)\qf1GV[!>Š_6OEtC#Egs,NMK]"vq7}sx*u}B> GN1WCl dan6uL[8'^@UO`酲E.!+ꬶKdQ1vμۛ^Ϭ]C%ǖ˄G 2ZxB9k >fՠj-۷S v2FF):Ӻ~[;$0汬HI@.l+n;>U+"8)!pugͫn%uf&<۸`GY#5/ *Hg@;j5DI^0@6cI\{,Y%#@W\ȞHp ʯpf9MV3#s').9Y-@yG7 2K8) kh1< .ix.h4Ylt7}ds4G! t@[熂u!Ġ7iv`J[5 Gpra$OIY6MKO>8ØZ8*Ir'CA^O6HQ' vznx.ΫcNǏM$\1А &>sݨ@|?[^44SP)$ `iZOT2o ҝhB .ثP!׉a=r>* wma-#v:?󇊩i{(/h#Pm4sy pF+)>ui#NfxY^;%9۪5<] HYSG $BtVt<p`dI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$O{[eVZyx瀈JQy%Iuu=6{F϶J)`Ci*tpK.y.|c)qsKzSIH^ZCP-mnq5ˎ#,X qD%nG qp,%:=5]'Ke9Ɲ~ҙV8AiZncpi 57; kˏpTn %Mc.n#4ݤkP k2+t6HEm #M*~VVP@upcQ▾uE][.ױ1 )/dG]nu=w{̗Y2uhW 6;F0e#+l5OU8yd[~<ÚtW)jp]O蛦 !΂ qc="]| 7V`9DB~s.kY Zd87 #ޮYqKˬiYA`*d6ZvXf;Q7_e&c cRYa|\e[1 !V@o>hKo [HaŲM %oƐ,hLJӚi:_Pc׺r4P$>XMJHld۷2DPrC2M QzC {u"ѵhh#^t-)`SI٩#uW9`.s)ЂV FUjs=-d'}Z9 2WI }J f! Cwf="E6*ۧSٔ]`I)(";Ǯ`-.s%0H*>e:vA ѐ=%rC@[1/A6@IIz ZGBͽ֗^//`8J54as7 FfC\] <&}z:L `8}IMo}BG&OtJmim:{;H-<ӽHeUĢ8`sMvFJ+j–cZ+k INWɥsҍ}IhUz1EyDF!t{HK(a~c#RcF֍V\v=Skcr4U:q5V,,Xm2xߚ;*@#V}nkh{u"G5$y(2K2 zU{h)cy{N=Xͧp'K-]5pLkE~2a9?e䇅UaމkK ض>v >abЀ]:-joGzEpDZ' lf+U_\3 E 1%K<]U< G̣դ=\ Ǐ,vD>̴ZYvSf1Vr$䁗CK⬖}t4} {i$/7n/'}Kǵ[2ER0G0V~ tTil{:|?1Uln 4 A8&t3g"L2!7gswZe 5} 55>!AZA,p~F"n V4*Dn fߚc8@8Cg8@xuEe[-ו6sؿg~D~E!Õc Zy 02@SQI$BI$I$I$I%)$]^Wʏ?tXPs;GȭM!?/]}#n0"=u??]N3Qېu]#^Bael/lAAx.A?TOc]GoT-kN0|՛6;}]bqFm,>N=fd{wYadXTXvZSKqZ_%ǹ%PuAOyL2h>,e.`ss0?q멌s>g"˳> ~wҰerInn D50]ƪZ q=yT`nec\|%|K+`?H£_REG,C'a?Ps(o޵n}+譬'ʞMml oL7#q?Tn/K۠yE^nAsD4QWYh cBV)vdMcQ8P%/&-89wX:XͭzvF@kd|yL- iݭτ;r7]"v(8L&˺Cl--`Ksڣܻ %$Ob./LmߠoqUcV ߟSzOE۫Ēb9=KKA- FI 3 1d ;o8 pHi?˩smyY7 /${wGlEM I^0anx?si;Z z^/doq>jpێn(Qu:Ĕ6IQ oU!GhM۽&cǨeF?s}:++g[⣓m51>\YJj;m#l mgwIHuSk3"k>?{nٸ ˠ [uSZlh;G`}iъC<]Nf .R[avχf3\{p[>P$%:/HS_Wx dZֱ^cTTokNܚٞǤ97-k?WmN6 s?Lݚ':8݁Rz y"NMO'ؠ/I.yݭ@Kr)&X#-ʜ hGBuL Sf--c~X}Gꥵ}GXa_A^FwrK qrf}2nG'>\6[? ^ZǏ">[NsO׻jVdP柤 ^gDij]Wб+2>{Pr|9/0Oӡ"|pnCW'b>e^Ї>ec6z4BN HӾ߸ߊdaX`L2Ɓu'+ƾ}lpmu4Oyeu'˜=YK s$ O[9eylAVE;gq%ĕu9<*V{Hv;;},w@ԃ[X}~CkGɶn NtصMXUI ,vho6_*ι{L C8k @KV闟PilI@t*6,5Ѯm9%`h-ƸgOMXW ymM`a@uߪUky{$?_$JAǃǚzI -pKfK@;$V7V"tS)\c?17*۽Fzs IpmLk@_Vق]n.,n-Fǁ~f,^,k8|*_{ku&?uQ<ӟoMvUnC,{u|[*t`5H ?UŬ"IU:M} *t6j%{?b} ѡ{hk]Td1,}y?Տ51ҰIW/T'#9Mlr.;_@bظ^*I-mb:i7Uղ$o#i8wߥW#zR9 7+x~?D s{u?Qޣ+ cGR[m6mb6C"B\jx0o/V %n0=?e;&MQQ][L7ŗqF5.a.P~?~V,"Pik]ih'Qǰ:&AfF8 ksv5l64O`a;VcʌrH^^g~C=C~lֲه%?p}8K{W))>U:X\OOat?Q,uwOگ$IUazDI M( 6?}Up_K z/%ERyI1U]TOt(K)ڝ<T()nyR(SSrL*A< jiS✴rܞ7K|!0 $JTA9IR' $ %(!L69RteGT8*AT@TBgh`NBt,&O~ɺ.r46e]q%'\g; nY8|d}4]&d:F[Uq[6=ޫh<_V1MtN =%F1c}w}.eSvu{'&O>&7hiL̗}61zC:es=:ݜo npn=Pgcq!tL_+k גCcs$eS!Fˀ^d+/EmFu)FSL9-[rD@RbSXѺZDBJ 78j\ǝ o'ZbJVNV..:#eD&Q uOLv~+;)\F q ݡ+u< K`<1. Lp ăt!LZvy/N{2kej veQs9~_  f<bͱIK|]XY7}Ws> i/p .ޣkvr!N$'c~ugM?}^Pב"ox]10i Qϳٌ xʬ}4K+wMX!sTK$n-^K6(Dpbf`òz45@<}xct2~K ޞ<qӲ+t*= iFlr|1c lṍc-qI'䨿S'gt[\X|UsN#ȧNim\|/# wƧ&G<4F) ;"ō<By#Sߜ':D.~eUxt$ DE5NX *\r{xk!ġÎZl3Έw(n׎RjڢGuY"n$((Nlj=BGEM/'MN;xxuR5#3dəO#CCcuC.q}!N$ʘJJS&{&56Ibͣ< ϒ[q`:%JJWc^ǭS4Pb@MO@|EXljZyIM1ZqD=MXWōq|8)\>e`K4b{)sx-2~*8swXNљ#S ۄҚ$I>(Ge7 j4Suo١AʝmIDT0Ӑy4ru*Eo*$SQ$ۨ*5{KEkK[3Q`")uCWz))9k[;|VqA/$]rR.i2YEh0 iOd7;k{[h4 R͞|κ' %E%LԔ%3cdGN6և>jG4 wL5:$>A]p`xVƐcvRt4{PF9E!8!#`G19$*{HI @STel|UhiUwR4!<"40wOtOm6'3jmU3HzSff#7Zf;#Vŀ'tcXmOiF.cE) Re]fƇ vS$|(9tTOv} L' 'U9I+Q Ny@MvA*Iu45|tĎ}}b8GrSLo0y'ײ(fYײ@DwyFuq $tP!IxJh{ktx+<x!݋E IXS)-BҠɅijN-;OrZT}_Z{"nhxtO+au*n1 .1$Қ~ ZsK'cCOl?*@vO;' R)23(ml.$v OB p#*>&8I : O5,tXh"QPuXf'^P%4/{+9hIV6l.F#ֈ3`˜%W-)T `W7Lp9‹@o%X;Gt*AuN~Y-i_r|=b `o3X<dĕ͏&8N_ H䪶Z{P/(A(4Ew0'M5l9(Dd0HF;FMhӀwia)T֖3⇶=[viR}.d"sZ?uX&^ *ִ2= '] UEpgZy xP Mzl))%Y2\5H9˜-ҵp}tƀʵ>VX+` >-;H@E ot*VD9Lڃ4 d.lck2LZ+=[AELA+l}uF^qjiE484L{7{j;JJdZ{*vc5n osWk  t*YL wqߕNkm>IM,ռvkFFٗ3naۼր/ktLn,]K4IM1$mw5h 7.}ERnOiH!=9 M'ct}!=if۝6mVvEv%.A-* E 'Sy7ʓ_ BJNveUJ5 !h[YtePgD-)1(@Bkƹ `0#p*t`HE!:.'DTI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$[{Hig ^϶!܏ۿ4;̣b#Sdc8Uc~(!n Qm |UÔ !ۆv^c΢7stGe/`u{?׹usv>[Od:y<u)%keqJvP5>%䏔Ɨ׬ X{[]u2k$BFM зP|uPpqhU;sy^GшUJMYQ]qk4vWe{0 jN "CC) $Bn4]Fd{=f[ŨeiЄڳdFtUv dGm8C%iGf&e`zVPa>3I$ 1?4[r!8{p$D:kcFke8\n03&i2XgEa85v)S{xf 7u|1LbNZ]zco\XUkmd! K4.0qXƓa0;a:'%;km0oV+k.<]5!YP;Mg]ԜwI^ tv;F|eni抗ncA/-J𫾽msA\N6/|˕qX Oun<݁SyuM.aӍ2q6Ly=g&Ӷm"8tMYűՒޣYn3ptOBPL8vBt<ˈ3P18.-)@x^}o#_+@LeIkU^ ~e@+>S_ O([i]elt}?ʵ}=ΟmKC}$))+cz Iu_Ώ}&Tų!ϗ@c t{M/q0տT-;*IXRhDZHYYZA;3ּ٣[!T:rM8ky#ue@D`t걙tOd|9Gl` iWW"[qXWmON-VnY"Kp!Jp a: Q{If˜9?5 )sk,?I-v;.ٱ$Ɵͥc`|Ѻ{KGg։ȯtf@Zm ?G3-y{t _G[t_h-q&$YRf?{9<1v-B۲Ϊ_huE[srFv z4INImLOu6USqi[8 ۜ.SQ{=5Yc!pןlúj}W[֏k[ 3"Opk[QnƼu˝W_m7=G7*cZ['G"Ƽln' gUV-ȵaWo[8kp1?=U={C EҴXo.)--aװF k*n5Zѩ<U̗l$%#U@uA$*]=g6ny00.nENy;CyEP=1sn g*R/ !s vCs}B=S΀"=d9! œ{^w9 + )\yV+cVHSgYUn#X%v2ʛa |k0AVv) }nAKtV[NVC77@#&G{rr7[p9,h\ '7 kpj~簏Be7j-5t'ɶ}= 5SjGa!Qmm G,]ZJ> Ao1熲_4R~VEp %׵ŮdvC}uN=΂_)yx>tSP5:$ khhZx(u$kJaVvꋣ$?,|119\8X[}?=6n+68kr.q8XնAo> 5L8n:dk(a! Ofٽ?ŗVL.+=C!\a,|ܜ}mcG8BZZWPkkPF[fIMZ)sln9Dȶ"t8BuTKkF"2;w򐲱7I4ۮl=4*`jJJltTFmV[7r;Ov8vh-:8R *lkCA'T`M)%4m;,N(Z TWoĴ4"G8L hhVqP+)Ӧ]=H81%hY4S]- SK^\\];v0PoiQǚJAF$Ykw47]5 D}R<Yc68x#AeVU}BtoD Sk; T r[q>:*_:e2iỦ;ѣ [y*`X}Nn[!xM(-PB;xTI$.I$I$$I$I)I$?wWJTIzƒ>Eo+_cn'o7!|辋!?/I$VI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$UzA} |J:Iʳ?n*Lqk7u &]<}Lߴ,aAm ԙq!l1@t[ 27Bݡ@Ah|Bziu[;o[Z}}q5W.uuju ZCy{]_Zx3}W,j-7gn8Y[k9ߏJvq2GOٖ99 gU,V%.@|j"EZv/j^&-UV26i)Mϰqv\|d&w6bs؃I;ŕ M9.'Kd56հT61/JitK%9|6or[W3GK.s\?{c7miKs[?\ c.i%,̣gOTmww<$]zs+WԀwEc=R"fe@ZZt~k})t>:a.6k}Wz{KLkAeY7Q3D|8V`Rf 295 d*v^[ZvGr[fKwaSuܮc{bI|U1G e~Ekmlˑ(um LG[*߷Y44k.֠ٙEVޓI3Þ5-h', vZL]* KN;t̩:'XmoV@(zn{eѽT]̪64{H Be:~sԾ5ъIkS^\Hw}OJ6e8]F,L^N;|D)+[!V:ʍlpcwW}nCޞXv 4A8WK- ~F;ZO$ l-5itc&^ßS/HC.{wh.Y }waȹVq)~l@7in i{f(wi$hiC0\yVg IhppoIP.h<@$/Uc+yY/? q3쭷ւZm`kUS^+n:FV?L,$ O"W p4&{c5U K%h͊-Ai:iPM:S0/"3Q2wVG {~ZN} ~:YCse3?ulhEH"<ܣe-l7A$ rU@SѵWƵ 7Ԫ5Q{XDEa7m*fG-5I|v:)x=]QݰA3nikhi<71g;?vhU!MuF[K5Y.5RL# ed jƛ!8æm]Z2+p83vcV 1ܟ-FƫXǡns7zb=?oiW6'5͑kcdq1*滃lh*]vKMދ5I}T1Q=ވ`>~7+َ󏦭_ګuu)ۋ۫JT}nuȬc`,a*P%Ώų3kjVfHۑ[l;lo?W;sAdz?gS!p{sZfIED5v:Ge_5c'q7`8&(uSW[mn -6N}̬Zoka?qbO]F,o굝oQ9w {Av *>ke;nȀ̉("h~t^>{}fvαOQhl=?vÀ"ڳ;tp)^\kڒ6cWgYjwkL7 nw66gߵ95 o-4y;ęk'Ƕϼ!vJh qzC)Y7~d- 3轋{'UI$ԩ8LW%Z-[ud|--x8!oK+m,x{?Jmn9ᛕ' 0#w'Lk0Hy}el8qzM]*I;_cױKlq,mԸ2Ѕ_~̜{'Ep $$Ň M( 6?}Up_K z/%E범ڧyO/Bt sʈO M)%K\SDI)I$ЂW%6$|RhN` 셩d 8&X[KddezV&5[H.r@Yԭݝ5:7~h$:,S6|uƓ%}!LV+c.r.S'"TE>O_r6Khh{׀d䪝GaPB&FCiX}nz8OZ\'$H#ӓ6,R GLc0AT?DXdG?PHYF~ɬK0G]al:etӹ'EC$+'1(S86s5:#:#& Wglt&u^mtOKe~JD#][vi.ad27FU>iru(5,9ȏ ]7>VIyP6Xr^EGkgHkY=ӬJL 2{W RQ\,Waоu\r+7cr:/ΟoX}j] ?t8[T2jn!&`U.HǘkcQW ]m n'fdLWßPU1ŗ>t{_pmG+wEu|E8X^6;߻D!6uXRHie\f6SƳդg ,,cU-= ()i Y5A`D2oVt J a"B[5 H'~)*~5Cp %KI[FAD > Lq#ET!8ONBI=Dc080 zGz1A6TZOH08K3-SF0>$賒l{iуN7Z] 4tI aLdJ,JjI׹!MMm ݤ)Q5@A.%6uQ{i4 tR|jrLvN!$ny$<:E%"$ @HQv䐰֗: l<(/n̍k25O7jy \L,duVكبV7D"fRbFR\p^n5 '5Q-6Hw$*cDײ g=͓eVl*MDWIZ%ǕezrKH?@%t81qb&& ܕbC#jmܐ?TwIwwj&kˇKlF1ğS;sbtJ-ѱ(̢q0D$ƙPSU:< i΅Ns˦{x'0 xLw SPa4< 4m 'Qu`miDf$5] 2^Ya:ljm*nG(|n:i1M-- z> % 7rE )R]'Yq;-5Iojj!fqw:x)BcAL5I6ׇkg):{)>Z`iw!Hc\ OmH/Wdmyr0 TXHArS!"Y- Vrwa]}v*)ӨׄV44ٿ upv;-t݆}1Qi!MRy4LJ%}?ݕ~*~'3tL(4TuJHE )0c\ K`?>eALžʉEI`=qA  #r;֒S!BDҘϷ`kOo*$H47U[*+i5|W/Wy-sw|#cX+33+㵠l}Yc2Ǵ?H^oC8:o s|{J $Ԯc4 5h(Cz?<.LeUg__tk:VM:a {o=cV?U8s2[0JE7(n{r hhW.h'S4f9k&󪋡<& QR; ܢOu> &SI2Iqth̨=~لcD琠BFR1n!f5w1)WDsSjh#CpoS䜺4 n( )gTi>|"vo&#Dr@ ZUDV9SrXƃʐa@M'XJy1O9Xiu!1xI?Nȁ*E Sj^ʛIǷ  g\EY+N[(X-\;y'wV1(P ;kD*2j^>!Lꍮs=O{GG MC2ƪܛ}:yܻPB Ti=:}%Z@O+mwF I;c[e#} CyЈGlaq]8ŏ{wSsHy/pN;/Z{8U]/$4oԜIEr]RcOҢGĻ1ZӪmƽOQcƒd4Uj]C&/Np=B~u.ԜE!4j}(NC+{&f(< L&[Yiqn#2o.'Fâ+k$Jg'x >/d[cEbANH`$vDF34hDTQq'V=X퇐RvS 3(H {<9p :]˜:&&HMRSݔ|-TuS$pF.׃)HBʐvQ2D(GuҒ6D΁y64w]\g3w~DxQMkz;9'3%ky^+t%kI$^I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$l/ph䮧[Fۻ /YjVy(Pa9e\[0"65*~\`)THw JyRp'4d͞6Z$ne m<3+Gmv;AȒ!X@J -76IUٗTױ 3`BЉ'縞@PDk*5t Iq=ʙn"4NݣWhV׸ƞ\+nThx=KJ3]md)%εVݬp'R*9eͰC-F|aV{1pK!}kG5Cr !P_ExtFnEMİƣ6+;fwH_S7dӛVMZďoU vOlI:kξn>S7kj67A$QSkt6t]KA%.qmxJ%%sw>Qv8cY',AŮ{52Zd 3>tI-^05NJ}6 H n~Cw7)Cv|9S[%q)PuP.JJfƖooNUؾ4= Y8gk_P2\@ot e1c ayhҴmҳIH{+s6Oka?#*PnAx4g7nnwji=jXLLα1C(XZ$6$ Y~vI'ʼQx*?f:d7҂O1g\k2 p<MM{@vt>! >a\SߣC ځ P4~NՃ4!~z/AꞿiM~e5=Ξ \Dzt7>Z#'Ļ2!$(YS,3!T˼~͛v]OmWG#(X5 gcѳ6]*7 IxS2+Ǭo!Q"ʲNUp)gM?7;m{`-\C !3Ěrhk,:tCs}!1>E%'>ߢ2 H,eU5>)l4e HaiR~#.V),4K-{^0!U=/C΃tGRž]-x0Dh=k-F;pH.kk Zy0QRaMOd?;DLz+r|΅Xe/"4Ys\%ÛI.깞sRv#K,C*5ۨߺZ+;i|<[tFSv̻/;q;.+ G[膱:;i7!iڙl`Z֫?^Ly=m5#_=KI8hw%$98Xgp^6Qevf?ݿmkO櫍Zʪ{K^f0S[ˇ J> #i*4Gז?TcC$iZLڙxWfv`l<^cE{ l=uoco))#*,-P 5ktSw*TD"0o>hH=SO s5tJU5qaXXY!Nk,{ -ájE.VVS붦Z Tmc (yf. isa3Yw g`s*UAr@s}]Fn IYd-Z^w7.;@Kpli"$wog7֮m \9۠Tq2=`C"s*861U )躶-}`IJh~#u