ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 10:30:21  p&.(6HH Adobe_CMAdobed            p" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?\kp8Ḅ[XYn+t#k\;R%οrfm̴ >'OJF:Yojs 8muX݌U,-`FnC7&=}O){CZDzi!hns,k,{-pH@Z$>ODI$BI$I%)$IJI$RI$I%)$IOs$h ѰemW,|Vэ*>m6$˟fhs}?%$mZ[MwV) ^@$k9kh?M2qsv&A|ÀG(U;wm`kIPװa_ScF3Z۶w {k.VC} aw<-cmnlja[CJ$ OwR~dux?uW=n4 j{ 6k/6;.8A#%Α wU["@XgXHPqox>j`J#ȡN#sO'oRHakg3&&̨]$c_~Uw\FVdjs5Itr b uTݦ!gEjvZp)q*Tax@nMK`ӌ`-']욭 .'=WM%?1W!a&?c#yldnzM{Z;$ S4\ )6M]S5XvjRkTI%89d<)0 NrXb{;)WN14?Ov?ݷCT'BEMkZ-Ox@*Xr]fKX 2RY`y`ԼI[M#mCv3qHXuvFz7Q{s\]ueIoLv32MNq.O{ն}R]79#@*ކ𭴺mk]e6iGZÑߛMrmpw5=p6`I +uڛ RDzʝUVQ`a;~j`ayc~^H59*SW-him?e;]id#]gb:3]'X;Y՛}O*YWhǯzutݱq;9{׵$Z6r̦s60 +;1؋]/s\InsCS,]rՂL>>VևrΝO}O{+}>)V]hL?u:ȑK^ǝ{LSO!sٸGs'槯6eǷsU}U'Tsm̏-Fm}ؿ/\ ]YkwߝSc>zρhc#_ev9KnIJʹzE?Iڻ9VD~3.-;DC 1T Axmd4:h8EMo(te" o}cA;TӎȔ;X?4TI%)1 IMGg/xJqlJ} oHl:'sN$&Ϫeg=?,:Se{4xIzdK`?$]M;}r ,p5[?^k%ZށhG?É/'~q>sn 6v1?ֵz R>7m;;\@oMG~MݶlunwSb\̸֖U]9sK:S0,Lvcun Cd񮨭c!y$pEѮĒUi$(Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMS p workbase_foto-4 pnullboundsObjcRct1Top longLeftlongBtomlong pRghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong pRghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM p Adobe_CMAdobed            p" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?\kp8Ḅ[XYn+t#k\;R%οrfm̴ >'OJF:Yojs 8muX݌U,-`FnC7&=}O){CZDzi!hns,k,{-pH@Z$>ODI$BI$I%)$IJI$RI$I%)$IOs$h ѰemW,|Vэ*>m6$˟fhs}?%$mZ[MwV) ^@$k9kh?M2qsv&A|ÀG(U;wm`kIPװa_ScF3Z۶w {k.VC} aw<-cmnlja[CJ$ OwR~dux?uW=n4 j{ 6k/6;.8A#%Α wU["@XgXHPqox>j`J#ȡN#sO'oRHakg3&&̨]$c_~Uw\FVdjs5Itr b uTݦ!gEjvZp)q*Tax@nMK`ӌ`-']욭 .'=WM%?1W!a&?c#yldnzM{Z;$ S4\ )6M]S5XvjRkTI%89d<)0 NrXb{;)WN14?Ov?ݷCT'BEMkZ-Ox@*Xr]fKX 2RY`y`ԼI[M#mCv3qHXuvFz7Q{s\]ueIoLv32MNq.O{ն}R]79#@*ކ𭴺mk]e6iGZÑߛMrmpw5=p6`I +uڛ RDzʝUVQ`a;~j`ayc~^H59*SW-him?e;]id#]gb:3]'X;Y՛}O*YWhǯzutݱq;9{׵$Z6r̦s60 +;1؋]/s\InsCS,]rՂL>>VևrΝO}O{+}>)V]hL?u:ȑK^ǝ{LSO!sٸGs'槯6eǷsU}U'Tsm̏-Fm}ؿ/\ ]YkwߝSc>zρhc#_ev9KnIJʹzE?Iڻ9VD~3.-;DC 1T Axmd4:h8EMo(te" o}cA;TӎȔ;X?4TI%)1 IMGg/xJqlJ} oHl:'sN$&Ϫeg=?,:Se{4xIzdK`?$]M;}r ,p5[?^k%ZށhG?É/'~q>sn 6v1?ֵz R>7m;;\@oMG~MݶlunwSb\̸֖U]9sK:S0,Lvcun Cd񮨭c!y$pEѮĒUi$8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$]Fç))I$JcDr|Rk#PM)$TRW~YT=m%%RI%I%|T)JI$jKH1 &%RI%~KѭJI$ᵺƉ4)*I*i+#V?fV&ĕJI%Y+a~x蛄,L9YI#_n9jt`[xz$f`A)Y%pư>y ITWIGpKpUE~5M?rI M)I$RI$I$I$I%)$I$IJI$I$RI$IN_i IJI$V=h;TEI&oC1;$:3gW%pI(za>ܯw4gt\z n4<%HNoe\\LΧkK*ցe %{r n=Rw+e+xÁudAiQ✷e~Ͼ'ov@Եl]SYZf;%i R68l25А ѯxk>UAr9)ŇSv֙nzA :{)3&PEJ]4 覬P ;P[]gH \JIct-5!m#BWVA-  SPH6TZftUeRD>i7f~*nlx9W9NZ-U=jxRWAal"dB;rS(UXS)jwLDSUӬBsZ4VMHJE(om}?Hi↺g2HUv +AdMaKx %{'YKdAQ"[LQI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I&8OX>V II$qbO)I$0x) B8RM)$U>{!;+$H> *I kGޤ)LZ@)$IC9HDIOB) ײFSai))I$%> LlPAT2I)< IJL$ΰT$I JUw)-rݧRI$OdM|5:JF|vAJI$4zImiakIJI${Us҄SRt3۵tL悪W7 g=YN hi #!b4YClI]+zm@Yl>(촋՛,"h,F -$Sh$m&<=︤t'CIL`}ɽ'RI%wM$$I$% )I$.5x4 Dކ1'@&5B.$tLөa5eۘo$α)Rmcs` A>]guudOpVlm纔ה:A?"( Wfq+Ѧ>(hAJ*L5ۤRI#*~w)Ŭ )$r %3ulIK~T$J.I? D $2%)$N^@:6Ou'xvI$]D[a)$JcOGr2SrRRI$ 8RD$$P]wI$Hj:)%I$bd#T5 )I$bgLRI$Zl W,<Ƽ,f@璁 ccd;_K}6 o#N7I$I$$J!:~RR\I"T "$Jv#=$T7jygRLES, L'7>I)ILOd 7!ۤ?q#e RI4BDm)<~)@IJI$8H2uXv>I)I$|T@FpS!v)I$`G -C8uB6PRI$1)Ni&S솤$IN F"I#ctFP0G*RI$m[ %J۲JRd)Yv1䝆Gn꒔I+̄&=6&O pc6Sʓ1'.I"3jv úJRd& i˜p<(IJI$CZuqX8*c1{n4īC'׵xDʅ́t\P~GpY%Dl*oI',]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$JZ!E#;IrI$i%&a;tG%)$H~`R9 )I$Atk o*Jw -Of1{;-.On WYV@L[F'TI$kgl;x$$Qk7hS .$:whNLCRI&" )A K@$HnݢL0T\uRJI%īIA!+X53 )IL(([e߂{ .W G M$Ec ɄgqI N$֙jN`fRkT)%ILFD½Oa"F%.d4. Rt#)ILN a<$M)(:vI2u 0DGIJI$7 H(1+X% 䦠<-퀆Ge >aA;PAIOUq2;[\~++ ~3I$juz+-<1v+!yV wDI$EjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$KB AR<@QVKI(9Si䖽i`I*I$3!t[۶DXƈ䒔D:I![z$rj[--~))GvR%BAv5-F慷ݠ%$I0I;]QH{ xlDm;ĝ $揤0ȕNJ5`IK=LI$IhI+`R).RI$Ftj;  G %I&o=]vTyRɉ!I(VV}V@)sDV9P2-k :$T6dfS]JO {!9!xI:H$pTw3fh"VhQD-o+\Arq;k%)(镇P@*F>0VܞS fn0=n,d )sud1Ja^%!<&K pY3C xr<)(I kFͩnJRtґ*>;$#7d]s%)$Ӫt8 dyܧ3IJI$~IBNot&Fgd=IײsCtP@JX(H9K`qP0 I$c@t)CIJI$p%Ô_YS@ޙ-#)vMj.2J`;`IնZQrҊפb* mUYz=OAH$+d(=/> ۬.heh kYnJi(s!PT`0(H$^vuUO)'tt:"JGnI;v`&-s<$AIJI$%5`8!v) I34~J o&rXب>F RJFv*S tcC2TFȒ4q %[&DƧq79C9$Z'5PţU>v!KCSjr%Hcm.wu&#NQ1z%ykΪ邦IBEp!-[CAФܐ4I:BrAh%_m q[Oc9O `C/-dY";GN, a=%iZ-{CHw죐_۸UA.N]X: &%;a7v .nAn zaʏ@S7kQDu ?zk; ܔ'4HuB""`]`IM+/n}(ZYɍ5DAc&CIS 8O&Y wALߦ" z@Ʉ5%C@l[-%I<*-q"1>]XZNY0F4FwU$a#igִ8Yy9USCVsI$G O䒔I+GMwS$I$+m,C|k1ǸV!:durPmXB%M,p *Y$(1jt*t{D*J!}DC%,uKjrU'~΃L )Jp!:IvYQ$(@ !I$#pI.vP`h))II)alP) \XRtI mu(MJ 䔲tWEEF}`$N% ƙHDϰ !8hh< KAl3*dV^RR铦U IʱBg$.I%IMJ{!`YIRI&W q~qGeqOޫ&)[%M98!)I$#\Ҁ #JIY$镆:QU!D2CAhn{\m2V*"UkGmih kY(p4R-g $L1 !tI':wѺ$JD*t☁fT%)1NөmsKb$\:{@#x%;D<@ߨLj,X}Ak`jJӫ4` >ސj ZL mcPƼ;>*v5yZfnx@r|Ğmw aq`ʶ6X,@u(Z {0ѨoayOeQ#ictgF,,p5F`ʧԺm" ۊÆZDz  Gw/بUX>`95ۚ Sq;@duH7-̨;~lF8-NjtZ+aq;5KV㮚P먙V4lp{(DקOMEvkCd<9#QgmA*Z6Tqk-#DwJviDi))g7p@p;ds<ᤄ.gu[b$Z/?; \Od(rI$$'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$Οa)$)$VtQ+ K*L;O^SF`@SIl2 ѻ QY.E xvtIKD'I"%=W!uG2h.Btԫpk'7qN;kdJ3+n%`xIKI:#LÅ(H:$$Hyu*6h纸)z>j$vI+$ݴE<q4Qi%@s$Jn$v5d4::@ !I$h*äSB hdy(̸yl&)d05Kps芔I)&eΒtU^rMv@J.0*9v8!$JA1K0mh I$ˆNI'ZPR'LFfBz,~hV9q!&-q VEDz6]!V"Ƹt(1mCHtVSok101Щy&CA$ Uy %Y̆߼~ɱH:Ēv߻E̢kx3R[_='1HgQh2ʫ`߿U:/P̬tGsbӵcIl4j#n,|y;⇀O^ Bvjgwl@@mD e;GqO@Uj3i`Zu^"EY@κ5>%5i;k<3^uޤ"2U|X4 ns_Tam?%qjI}@MSkoXcLDei5՘p>I)pUݽBDx?[C=ȕxyi*YzvFe$x,jv?f YyH!V4p9 zTf@쮜uUAѧY!hO0! =6ˊ V3@cFsbIC0sLA/>8  hI)"o>%El))}Ery!!~*r‹TKI.ȩ$24 T 6{,g}V% %Z{0Wi_%ϤIISI$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$bOR}BI%'izん5I*I$gD4̂dLii%,$h;6{չҭV3RJ*${6UםrY.4ILG*J-&['D-o_t%)2tm;Cy$KR%Bc$aX 2D ZHwI$ƐtQgGtpB8IY:d&G 094N~))nJKhjB0vX`;IK$1Q{̷F pxMx<NvDcjjHuI t׵!ĝx4$!n'&R'II WiQof)JRd鐋:GtF35}3=R&I"}?wd$PHВI4'M'Cm{a:d7r$5KIӨ )I$pTPRj RI$¬TiTApX9H9N|˽θ(+|Z8BeQQz$I4wL$PRI$;Rq|j@BJRI$ZT򫆙ରT<)&:ݵtSߝ8 3_c<: &/yбnhRbT>8NۇLjAQPAcAW2? km{DE%6d1IՍ㘅[?F-@$_!B~Vǁ 5L(}!߯vi'IOFW6X߼'T_cp#c=;Y~)y)3-5-m O5=uKv;G j;`ݧ#BlcNkBڎ3X70{'y'Z[SA "gzG s8Gi\`>#ЃkM-v1NQ V˝>݋H]&-3 =ú, y,-` UGufkDAY Yףo 8RvL\T_il$x~#HƷ(vI$S;ThW$I?dԈR<'RJI%77BI#X9NhVN'SnF67hM)awIJM Vjh {L SSYsvd ZNLDf9LЈ$.I)·ġÎFhJRI$Aӄ lhc$$I jz.M M4(;vQh[;u>%N'UKZQ#@IҒ$}u(d.“۽)I$tN[%<@ )I$r[$;쒔I(O"zn-4j&T˝`BJRI$T̂"RRI%&Ɩp@(:N$$I $_?@cWDH%)$D dQk0֟oFs(2I I]$JSJRI$&JRI$Ί@fR(N0T\4CΣkI@ale?DV9|tQZJ" 9@HQv;I$I dmOI$#Uit1)$D|UzhB.ߡ]VN׍yʘ+\ H "]xĆ8Wp;ru7a 7 8@2@YRM!X77G^~r,,W(L2vPTsK`{5-[n${jA9wΟFkvIP0 =څYQGa t]«CKG,[ZtAĮ%%:j}x}/{;!m e#cZ4 DQksI4J!im0<4V7~ET4_Q4=dO3?ԻTg͢}Epu_}Nuc- gT2'd|7ؔRm:k?':uZɳMns{صc&d;#ʎk31D:dFbU[_Z =$6${wE^CU.@ uHA$0V,x Q0znji--' %Mp*mdw'OOWh/F4شc,ֻenx=ձAk> ӽO&]NqUl o c^Bl>G bgϣy+[>aVƱ IX?)b侖NwDtAhHxDS%#ï!APv1m$c_?G$OnvAk\ړʿFI)i*sko~)))- ٓa˹WMyS{_q5qT{wems &s77zu@IM:[=%Uqc@\\sC\w~ſ ph$Fk"4! ꥖".4K:F!b--2k< QOauL$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I'g!]¢ +I I$NHKiIRI$a;uBi$"$:("RVp1khPkDN%dJmmTL*9ezw(ٸTg N8Aad/.GDܩ"G(!tI< sRD)2@ۡLlh ^R}{<=%)Xq>i!hKC%)$NXE8R"Ot$RI%6˝%d+A$$:MoT4-RI2 c=b\\`R&N#sh" JRI$ 59t0IJI$td%9HBJRI$ O< (x[cI&vH1TԚ򒔒I'm{̔G"!NۚO@IC)MR$IS$IԚTJRI$zXPJ'L VK/fjS=TIӺw: {'RI$4PtBMRRI$u;hnJI3,jq h{:-IkI P T t'G-p\@%Ӛ :9@=Wi+s Z C|J]\[m.k LTyQ!= |wBTWi*[ ,A1{@vB{< }7sDVObmĩzw}$Q3wq!  o1T"ְ)իGVqZ G7Qc>-:x#mܺ6$j>iJڹisxw-)^C*pB3s+-d5Rhy>QDhS4(%gp8?Tہ#QăA)8TOґ7p ;FP߽HP@;ITkFk?5b1;{PڅULy"`eBFi64mpZ)6f$kiב+8\G BYqi*^5!m}f|<( G7-xw)(Vאe%4Z^9> l% $I쫷uaU*ɩdCž0Zٕf}w|U9h%7lh|XLI$UFRHRI$N<(I`):PDj;μAHkwIJL4:CkyP# %t04Ni8«m֍jŲBtRNΡ!RI$)\b 'AIJI2t-ǔwqʓDh O;?%)$RDZ1>Ji'@&9HMNAEr$*I5LI$N)IJI$RQR%)$Sj=MG]PR銳Ip{5XU6%:;(i2I`$G(Afds9JI$O:hȩX*/hc$Z!ih,fBld[h5xC #i1ʭmZکCSʜ1<# t2GDCPf'P;" 'rdtM)Ril; \0ٚXA: WP|"UV9ۙWd&~[vV ~l%0nk_"c9s0IQ" kJޠm[ݤꞗ?ƽhkw8)ӏHk ,Ƥ?*nh$>Ju@ p5S ;}TΨ!uvJJYNjSI$!L؟kku ;)kZְ9 # >gb _PnK> N3%auKlsn Wd Џ\q%A$$$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$jR=<HRI$&SIDLӮ%I$%n$_B$ ~䔤Н$;H^0\<ЛP2Nk %J.t S>( ٬wY +x]uIE{.v4'ICPa& !I$-_2|,%ڧ`CiNJl#@RaM'%)$Ac 3T8R>%%)$IDk$v*a4RI$w; Lw )I$+<6]'h4RRRI!l{~ b%)$&`lIѺJ0H$dkCnPk!T*s^g l54V-yD`A>РmkLgO*5v'V jFswlfO) ws3cK_2R!8H$jJ G$F) .g%lmvx9+1 %LgTk4D`4\?J`- H Y;T-yƆ>+r Zv9asHj>F}$*,k]D̶6[Mn48xYTuޮs'pŜ}<>H@{Zn` hPK,$z-! y:y0 u b7K8:V[C 8m`CVWB1|[Aq4De{g_Šĕ@aY@iԦsCC@2G0tkN@![Q${GN^Ipx6*B@BJdGu6P|<+ULQpʾC쁕I: -[y#4Y#^aj-\BJwiyT-遝SI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$RWi#BI$Fʝux;SJI$兮 EA ⫺Z B7Q)%d:e#k,N\O!4I O3A <ڠ(aFƘ%):dlDjGh \$$I˶PĸB"dID;p#5P`[+Xkh T:d9PAH}" L)t'NID nLZl$basDpi*x'l9h{J]$ҖY#sPbJzmylxIJNNj&0Ia QL4(XKl%0dĂS:@ J]2tJ; "|JyIJXN x`%0L53[$&NwxԣXKG=ټHRX]=EX9\a:uo&O(3`"d,*IPI<% RI$ O%)$Q8(RDI1 IJI$ oAٸGuj5APK)L{Q8}DDZѠ1YƐ7.hcYY@$im.#Q*lyiDHTre`8y+T\|aVs'&8@m;*xQm=#3#NJGV㺯SK 3H G Ces>~MqPeÏ 4VL;wVt1`e$F[Njӣ%&2lLY?ƺl Vb́Sew8~IZ]zn>j|JfͰNHPmȑCAt|y>@F9@{wI᣹AHЫccu`_70GFV+$\:!n_hspUa8OZގI"O]\dz̚ rco֝_m!ae\n=x;'y /MոhuwSqu[BJUm3i3хƝxA$*o+cytVmgKc@Ui B6MQ2vʭ.:oĝR{6 I$S;[TUGZO$$J`Op&9I*I$ZaA5ԿxS `$$C`'*Z sC}hI+VH(^ $ʝ& )L̤9NU%/n~CS6iI$Sa!3I*I$,(+l iI$%)DxRLf<М nx1v$dRkGq6%,NRsBC*\<'7:/k>evRC͎:?Կh}e]pJ}Gl?/LSцV*IRkYaM$_OFw[>=gַe PS7+8" ϬrRZ o̜v \*t'R@scoumw#UHyә忎约pT۪,Ye w0e:IH{!-1H]$!mDۧ { %t$XL% MS_G=l\R)b.wTwU?]۷#Uwn'bٮ\ZNOf,ē!>~'b[G[i-}MᧀYi%AV:νq?γ Z,q+|4$wʵu'o`Oܡ pgY׏f(oP$ls[خ=O+Tk}[(1ɍ:}{Ñ䥐KN֫spFMuLZqWV]֜ڛ<79-+YCaUHL+e%I 52-u H&U+_uu? t.M%2CHSC2i=Z ^ed:6Sh5ײv].Z\T`O^濸-6m>-a6@> g~AA. 0SH E,k]ipx p?DwH9D,#n46a;q>J97)x%w}.% ܰAlU]k,s^oY1<d*Hp?R⒝&=hʛZU/U;|?9;sA Gp7WxTH$:)3X~!%3}'̣os5ДTt '%4|OR%9 lԨuSSUjIcy"d wc>]kIw:'Ȼtp)A?r:L9 sHh)v 8EIM^ K48qat";#{k`xz}!o1:J$VEsVZ#Bāy ;0LMm *~v%i}Cw}MRva 9kCM`5WEnۏuw51f7ʝ m| ;~ e I6Q@vIjC9M[N:IUqs] l }{nt0AMNn%]C< W|.2fR8O2A$k2;\6Q,u{X[E$I"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$ëPRI$c1 9Hj$I!LrH3))I$E*/wj:bG=$ÞI*L1V1Uc{x)ZNꓱh#B$Fd%U{vhQq$D A 4ܣ>L~T!9Q"-'i2IaNG1IJN::Ma|7 IK%2l:~!=z5Nv?5Zy'N)t)A I tJX o3ϖ+:IUevZi2ƒq76gm3-uDL|SloB"Qc[̓$\썤l:͵s*4XI3. $pq X's^$ \m:j'rL^'[-9󊕸Ȭn`2L?՜1] #h`E<{#n 8-GI$MR$dI&$/s%"-  I(I$%IJI% :I!RdBxIJI$%tRI'/sHQNJZj$BIIJI$'I$I[¢LJ9CcY0 Yr[\7Lw Apml箿OvꦶVEuNT2Q @>j)ARk]$ L(>x}(@cO uNn~'RR"ŀvB,q[.Z@.GeՓW'DNBG+i>Q,-°fA:5<]iM> @t]qe=65 I3 5G%Qo^CaoyOvXt;O[C~ij32u%O5s:ȩ" ЄlbJjRdeq{[ xs*MOgʎ6I}ZvX'g7K)>&Evʞ^(TG1h0sN5r@N?vXKӰōxT햷tA*mx.ؠ%Eߢstf`R2k 8IZ֟dQ9vau KI:I4_Raj׀(F8p:; L&gU-'@`E-H[I̸48Ю5윁ʾGH̐_Kv<^Qu$ẋd.?"7yl[C deG1&^O0Olށ, VSovp'}[״Lr6m4߻'k8W(׬YYԪ4 Mn[ڒcXoSI$b?M .3xI+ڙL.RI$Ԧ{ )Nח*RI$n{h:$׺gq:J(6TCd!T\Y1+ %$:8Gt5&Z`ਇn񴖑A;A:`SH"4hP\Bi%)2E &H*tռk\NII'm\h(jIIJI$n!iM/!8?N\I(3 {Y3 Lu*::dJɀpϦer-;:𒖄S->?*uFYʽ\~E#P'w|iƼC+3ٜ{Oػ>=jLkr]BumCʥt ?o.Qzy<:IrCSG3).cKld 5CN#Mal^2y*?gqhp+D<SA/2A!/U˽❟D5R۲(% c5Q{FpR6_$ AIGH?rp{&kFֈ8QM*עf\%3"cƴO@h ^RU[{\[A4ß̻O?=Cť]a.!,{Iqo* -iSf +5?iwM˜Tad+ kIv؎h2@?'x$s Ý 3D:Dt{eJ.MOaΓ FGÅ9ƘWXB65@WIGO6McRЃ?w=Fcࠕ[$vx"ޞZ`0r;Y'CO/k ?*WPqLTI&%@'rOhvmmsb0Tk D5,v~<[xhe6jG(NpȐS ^Ē4.CJ-5 wATf06Qc·U :Qh| RR2^[c]lAYyZ[#Mfןstܯe}өtsxNkIxkvMu<|뮷@^mq ѣM_v3 6b:<rOel[ ]TvI+̵!U@X$pInUD +9ž%E Z@>]UcVmgEeH7`5GhoRֱwm;jg q<x \XO cx=%`Cx)Ňf>:嬩G}$jS6Q&4DUy!4 u o(H$36ISVCBՎ5m{FckƱە=)X8<$9UtFgDUGt$r:Ktv au |"$x-,@+*i2I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$KB7J VR\I@xVp:$$JvV w0R@YI%by N̪ cV1nKD)*sHUa=ռmتՈ(0ʚTyx( ӛ8e%,'QP;GE!9~=$ȔI.dƁ3 Ow<थ$Jlx{:ȯ C mRI9ӧ(3{A>)QsI qs(x YI:zgY gYNOկዿ֩!dXg>=kV:D)>C,;l#GHix0<ѯmf'ݍTְXi`X>Oa!h ˼凞0$c"smtV!9Ξ ] D6l NI2)W[."Qk{lgiua{>+qWP(fMn,{KHڥY{wʯ2>`r.I}g?^2ܖ DUzϢ#Y]w :{uls+ϊ]3fAߌ ?J?jE77)gnKSG4g[I7I!7{EmKZ\~A)ױiY͵+sG_qd . }:U-TʁL.Un~!m/vǺscq'PV*}Hc8q JYx6aؗ gDTR+mL,hhE^VL%?J !,2 }7ނևvF=Mf=^F+5ѡ%6k\AsyU:Y@²/wlQó̻nGF[(-f{F?Ѻ qKSf=[%eN9KHz5%5GS/}- =n]բsԙ ,vyۺK?-Uks5s+sʱ+EGcEiVrgwIN_ *l;w Su,+1lS҉8_yq2l_tXT+szmXAqP:^5ˀ>; &F~- I:PI6[I&*][\Z\mI2OGȺTa ɉ#Yi;$nO_ťso p! -?w$(kLUS%lnh>UIK"tU*uLJKG~y3*܉\<*Zxn:k5D{CViP8Gv*. Ec0Gg#kFcn"p cݫO({DJΧB3*64S%^x슒0@Rv8 )> Ӟaf#Z}H b3Pt B̀ 8 -LKk6!0ޣi {K}u,`spk` ]!Wuku"w6T,;pq2}VR;VntY=4E o c}S=0XAJ=NDABŦVkgBTOFY >*unAH~Q6w@C> 6l@Zml${҅! n #{ |to^%^R'SWw!r63>%uY6zls(n$MJdII$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$JUc2$,sv$ID(8Oq).RI$| U)D IJI$AyZ dCJ S~Kj&R]HE"Su.́~=Ahn%,4765 #T' 4Ekn -p2xBdRRBIӱF=)4~ )hHM)ʋv JPNH;&k}ݔ$$x)I"tr<z38IK$D>NsMOua'DTg8  Wiȳ]?rx?Ճ8>7,Z+G]mZ'L$$LjsTRRL^&Rdn~ )$&| Ƈ:KK5k4 ev姩X s{,s>gmܺF;*~z|U̥֌gv}W4`{Ơyjn5?ذӹw$JJEY +%6~"5Yf z(qж.87lbDH$vFsNw?9c6>Hd;&ðߟoMw@ kvn.=5;qЛ3aRp,i;>&<-))+K?Iέo<Fr_Xk{a`(z `4-~zN痙q'$4idz44#msY:hRG5 r>mXLr=@&<KW!ض 3a:ARq{^?+Z %*f@, 8>EydA*$/ߚ`-%t"w׷uoPI?9UcYoO-Vrۑw{Y~Ma9ę:utn$RK[].j܏mq 塽=xz}͎} HP0`ly[^Ncm~zXu'{I)VUe{ZE5vۈVp f=KA5kX҆[DDhlPtkI@׋Los7m-b3LI&N$<{/.u-q'[j[g -k.oOߦ;m] ks˷>h,CLt):CHQENO8l,:ݬ簟zMm\ ơ&h)$@`)>Ϥipw )$HdI.ꈖTߑ2^ ^ѠUF@?ZOC6H<_vD>Y-8$r.15htÓֵk`Km9 -fw)QD&u('c?578DHԞaG$5%L Z8WppQÞ(=EЍBj`q$Ya[ݿNF0$`%gHB^c etUN{VMVv q'[%vBífq򐊓hvcK'UԮdQ}'ḰE:&Bð=s_QLjymٱW[`GUqKv#V 0Z`5ֳcu۬'/.I$I$$I+XfAjMI!I$% r%%I$ʁ<ʖ yIJI$Xx3';l;IK$J.G=&fK:,>_IL,0N'`@C;H3]:xEJ]:IB$ZFe~$j-)t%(nq&#P|TˣJ]$&НSZG+k-lƉ)t)BLL4͗jD5%,R'M}(oIJ܂%,$ Nzg YGJ?VzxNGկ:jY_VLOۖd$I){kЎ 9W2xF%Ą6>"8#Te_SsKLI\Ғ HN:u@;GDNI$$I&Eumb!0([;[JRHmȭ:^ wR}sPIYvkK^Zgo}&9ILUGQn;|o@aPF»=f$alN5o;L²I"wC |JHRI! ͦHGO!U0߁}@֖e%%NfUSm>OR Qcl'>-dtPk AJJm$vC(8}W9ŘHtUHi&NI$I$I$$I'c ky)xc)I'v{"RԕUIVh?*(>#` @Bߊ2I$(RI$O~Ge$y@j?Qxk" {AQǬ#Uu5;LJ?WOێr:J!¦m{AbIM &/{Ai9a-iHep$iC"d.-T =/sH&h &0?TɪMdvژV@=EE1wd 5M!A =|%v}1:Zth,sCptvF vi yt[-,pXZL Х0:: 3ײH,029R8KZgis1.&P#i桒ZAiz"Hv#5 R}2@Q1Z'tY o5I6Sc=Uy }cc5tMVEnq݃^U-HVY\k0> :,u ,lgP術a:uInf2ľKN?5M2֖`&xk13ik Ga'QvYwQfLIc}i>s )VݻFĦ~UXğs'»wݍ6x-iʍuc LZZd - gYN}9yOe_Dr{hlͧqSduZw5v rTNڑA,=bJ- ZO<^ub}% |Ǒ w1(~xIJcM`:sI$I$$I$I)I$߂qmg0~dF\  |e>k#ӞtC6XS8Hn`K6t)Y:\T*NtX%MUrDhQ ivD٬IO)YRJJرnhUeFRc :JCg^c`4 uWK$tϹT۪=\jY$+ѷFOfрG* CRryXrNGމ_HȑB`(qRW(.$Y!Wc lkDoM͎trU>լ'd?7 ^v}>AiUUuƋ`:B"RI%*m$RKWZ1?%AngR I ;@U\Pٝ9V$c m_ +nd$D8|Ci d:DžR8n1)ZB[CdzeMeH@б=:0X@OtGTmbʉ'奙]sג>7ʹԧZ۬ȪXjZ9}:Z׷C]ִݛgqoPLjMz:'6'/eEAЭMcI(E/ = & A:7}7?=)Pd5ajzuUP6H[o Hbƍx ԃi - 5S[i1Mn{n>?[teY5eV_cMp6lW}V ȝڃc5YwC*v]DHqU¬w=FyÕk9_Q]\.^\Z&d7w#&uwnA-3}/YOX 4Oy;W~N=oـ sCwlOoWK{]Z86:cZgo 1[i`{}ڧ 1 -OIN`%0V#js+U w{vTz[bLU)He<[sM5v65;4/.y?ѱ7NyX> nch'Nc"Vuoɫ:N.q?C, ;%ҍxFG歔{Z1%) \Qwjg;M`Ej#M~ =%#A#JAHıtx$zT&\)Ԇl'TE>)7hݧ+yt3H(e;^8{u"?9FH9[ uU*H.*̤Lmu:Ĉ@UNѷQB=!2:XOi%h2ǬT_DH<x(YUjKk0ABw42HiE|m]tn66 Z=̛HJԂAi5dE=GB#hpЎa^2TGXaE8m$JWkwv-sK![Goz͔ˈ.]=]i&K-/FU Dq**DA :-8ڶ~d^vRɂ5L4XYCI(n8x'~Mqt*xY{pj\W7zC>:WfX"eطVz yY6[vx@I$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$KO,| W+eDFBY"\%໮BXUj ҡep+؎*b\c}Vn%PhX'QaSh IJI$v D-4$$HeDXQ-I3aHIJI$5XAUjEAI$VkZtT{cQ+a\©_gdkTm|&M0 %(N)TR*SWU:g*1(**Nߟ\I$,v$Wcgh*(ֆ'()JcYBB#ôyU^ݎ-=܊I$I$$I$I)I$HّYP@S^BJRz%&ZX4*8X„87qD eyQΦ%e-XN ID,Uzz*JEJL2 WEKIQ甒RI$Ҥ5H Dei)I$UŪJS5W!X n*nFhH&s*( 6 pBN*UVܩuc8$~TX4+]7"ҭ_^ͅtSASICg:z>?r 9;}թG $fܕ!ڷBK6yDHu$ P?^+ Y$R4NsM{G'⊖I%kdΒQIk/M 7? ;!%2IcGs}aᴉCIV[C'PƓ&xHfyQ> ŭ3@> $m0{'k02$([KJJ?UPĒOcm- {\ F )JCUL =c[ze .. 7]dZ)7<0y%s6)pc?'t hI$i$I)HPxq FIXxl}'p=IHi0[j۫I$I$$I$I)I$I$JRI$ΕoK]q۱!k9E-FOPl8UTu bVW(e(ʾ'V@QgDI&sDSTЊTI()N)I$f3UfeEHM%JQ.䡼W\h+[ !k*ו' F@AHl(.DyBrpBRRР2T޻VY#-Vj+\`k C=ګIQ&>jq Hh:eAOL&.V_S6$'ɪIo{ª嶙ԉd=v)#݃ZG>3Xv(i桓un{ǹkaݡl?j"-?~Bؐ?q APou5AP#eB@7@0$ܕՑ @ƍ'(˿({rފ㵰 ;R}UNBnj~yXsxJ]z{ë$.~k)+Ĵ 9ISSmk c踂~JE)Sf@Բ?ҸZH4B q-.J-su^=VSiAi$O%VU8ݡPGS[75IOYAmW6Pvg͸!D?qOv-w5i O5ȍ,KcC1= {?6*vXl2`xN.sC@1nkm77yuZwe ?[]2'pR4dck% `x4#ŷKdCkm=04|Pi.' PVf ܪ170IN|6>K$p$;WapsGK\3-Mh~cZ$DY>esH*>Cs o3mciWm3s4#l{uF̰]zG ƺSQfx뮻~j;?`{S 0ę {n_}KDv^LlZA5-^7Z0@</8CwDLvI 1s8;ľ KL7pޚ\𛚎1Z ɉXɩe1?{v08j&u>֩3ͅNLsZִi$1.klɾC'O̥٘+cXIKb2E|: ^w!Isn$NX[3$&RQ(HQI<$I$I%a1_BWG?A_B&⥍L-yb  '$hI%*B SM))$ Bt1HO Bt钄R<%))M))hO 'NTHRQAKҢК)JJg)O  ,0 *Qة_μj 6N-"6"^5EKѨVLWA=\<[ ;@uT [*K'y\?*Tf9nJ VI$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I"Վl׀0D$RI$16F8Z<UspZa>,(\ީ[AS+t8A N%V_ x hRXHVbR4~$ԝӬh@fB!1a0&|U DXnH";%]%DO9&E뾻T͌l`' FXӐG6ULcZ1e9U^5wp[0O7L䍍ݮ#(ZZ񢦥_,^=Ws 'kv+$ RI$"@0;Z9CѢ園V.:w}doc+ohI$$I$I)I$I$I:m))I$xKC1A/#Dɩ̱[q$2;=>Y)I*7:Ie1_㔒I$I%ciK?6\QY6_,KX8ʈ BI#ʛ[I(QR8*E1BbRR)hKt))iJSMtJyIJ % BhMʉJ^SQd$S)&TڇpP*%I5Cܒ J.JxZI @ڋQN5xkePIN-&PUFKEN'_%g (Z kЊ@cLp9&IU P+{C\'~a6aÅ auxVlGI$VI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I*X%TC_jII$|܅3Nf]IRI&P2D*H0<7K}͔bInh"r2eȞbQَ %(jM0\Nd8ճ[HlY8]cHnKu=լTd<!めDꝀ)b򜸝 hsFmG%%,tC'2H )bR4N2YP7HVdBPD;LZÿF$iQ8j |tR 33d=J>*3HR M>-?ԣxnդk?KYZݡ{Pu6jsI h~ZI%[^-589M~{# nvKk ]YlÛ}O=E&Tmdim"eո1H>`s:S-78[}NKFd>Ql Whuy`Låէs1*M4WSX~ +1~#t,1L%9^Yz,۳%_\ZINYL;ɔ|*漘WUS$P{@#O9mVKϣ=[IizmKM`4HRmU;xpojhw,KU 8TYݵ7 P0X] ВXCZi-laN>EVH۰(ѰYK k'_,I8#/ۏi;32fcmD:h2`ý]ŨӫLXqn *ul0yINm.@5ǏiI޴A)^'ek]/cE@5'~^<1UpskO]%8溜{,{76UV]z:́9s?}[acD\ahUlqek^KGem{!&AN}▶nuopw9[tKHuVPf!ĵV H2)yml81>-6lM4kt7AR}w>aHbx)tw߾N(vl ,?zMc 'G">)PS_n'㧑)﬇H!32뱤:~7->.#(by;BS#D)C/?4ǒ5u0esA?3lD"4FLJ6Lv<$5AQ=Dߩ)ZZ4*CCqs'3 }d=SJ: df8h5X.д6H9 |/;k=K@ t;0\ dΞi{6?vsq ǔ7otF3iAk+䄩pF)tio;|Mh66q>e֝*BıJWg"PĪ!>]-ȥ՟#7&JL^kG1Z}}Y-ς#DlXvVgb}i+hO-`vOYŮ(^w {mQaI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$[wc;cJRI$1qHQTB$J-:z >huP9])J;I90 4Uh5l'(t}aI;E!';mz7R30T:I~ Ig$)!I$ait%Jڈ8@'^RK$))f=Bq%$j$$1:$D DY[HI4$3p; hI$^Jvy& .pI]$R%`NegEӵ&r!K.w񎋑VѮo`:=تdsDmn3cGC1|BuRZLv9#8N-{[P0͈"KQD[A`:tC+{5'0kIf7Ǵ  j;` DxY8ބ{ò(tݑ[\N#戳]5+x\@I$jcRZ%)2I!x`.$5%{+ٌǂ *ךz~NXE{X V;[/ 0RUJGDϷ&%1IR ~UeYcMlh>nJkdÏ#Wp3?17O>.C}tmy4n{yWTzqwo>Rxƒ&>w/}7;`:}/oH%Q~r\ET9iԠ ?)3wGǹB:#-vծkxvԹa^nb\ETCHDv= ⾰{z}]>ǐbmh{ <nsH0J??^U60 B9CQey}/ lHI$I$I$$I$I)I$r~-QwB'xhLMRճZ>5?Ow\'K֭z@Q$uM^'R cVSY24j)qk\ni~?Mp`(VdH 'JlD+!&|#XsAy5 }ƴق|n`V'8G6X fS`jhԏS:/4N[*?0_ )os0LScAJaA{hqpJ7)Jd"3yǴp1 GKi 󪝌 k^xݧpSp$2R/B=u1\^!%;$8ȋEk~)M:A:"b_S@k UkMEո}Oޫ2q %B[X%55mPsDP^\#@"Iu4BP8eB{fWRSx&ã9֕95Tp.j$=a 9h=pGOb;+*j}4I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$P4+ԼHRI$xFkZ$5V@m^%LC|jA0#<5iqtMIJI$HܘPgd?\OQNyIHo:dFcưpA(ҔWnIOUHPRSp‚ HRHIJI%, IR{+#aOJ9Yez5nq@,gﮝZr^+?#?_j%a7et2pClʉgjleRM47@g k2lk>qZX]=`4#{7$y))]Uqrr[[wm8]/IQeMհ-\:Vvj3W~p,QzwrLto(C1…G0ʵ?3=bO|1?ӿ~}%G@}}WPv*AxEcr'S%4?¥:>CC)YH[ l;I)$Lh#U&R$)$Ĩ'4TϊJfVS[ dG5pnڮcȈ*)nA>:N6]_8 +7Sz :ulkцw7Bl'M޳[F4 ~{omCu*vcۤZ#4 2<*sF3w?s,Qկ.e]rc 0wX %u^`L|Ղi@Tiޫ=RᦺB{$vETZ1hs& v" >Jos?4#A, N;)V-vYGwt+IFI$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$IvUfI I$5WA$;MH3+gpOD t&^ED"d( lh<6$i I$A)oSey[ |R&JT4zcR2ЍQ dɷ*= 1I]0CG c:$DR0rxwmvrHՍ.auYR43 axI"͎ǵeaTCut?WrTW-Q˯_^aY P %I%tcZ6C n=tV0нqS)npv$i;w)XI2u$b5UL7ʃ+*iya;1y4gT\N@I-{ixqZ.`x==a4)0i==JAɄiiJpA&I%i kc3UZ_4%G9G s))>X vḵQgUʵLU?L+TE!CDyZ]7[?v#tv+\\ޱ$D?P¼>;>.bf;(NW/y8zJM&ŇL&En_atzT>t(xCPy?g𭿑ʵz#E oXw?+\N?䎨WEaV.0݆ XMկqY'bE/J<0~-`e?=d q/C;A_L.s?1t_WG<jz?R^oX%밧+WW9vT!R>5#u濷oBM(c,o_ε|HM֨bs,_~ ʭVFH챴QI;lpkD-TS(w{K|'مD8 ZI< c0tsKwar鲑X5]K 8 p"A m2^DJLH< 1gLH*ŹFI"BL@2zAxkQЫ=@& E4]/86ȮƖq}^[d?.qmuߚ}YuS2 ` 9(LS9Ft l%ڐy%uk(XkY x%do2nz3;]$GҰzg~pQCec{?K`s#{;R6J1Ə3[ZcDxixQI \DC||Sj<Πp.MT{rA w%Ӭ}s< ƇTncg}CCCn5'6?$X~ݗdL|9h8)5]|8B?sqڀ#s+JƹB4;y,~98J˦>ggfB꾡-紭pԍGm% >lF7[l>En@,ʛuZBN3A miŤk,[wh:@A-wZ2=4@OfC K8 Za&#ݣ_'H%_sZ獤'7AcĠ׹tKPAa+lvp5xծuz5`M-4:(cKLh4I+:=,{IsvݦSDPiq=5[kujkLd<%%pÇ{04#A8@M?Ed/:ѿfֆ|HL%{%a:T}1]cSg%Ħɬo JĴkʇ%+ .lQ~u:yO'.1׵V&i$,e aZe$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$2 , pkM $IR:>Y$C{Gd e&d4A N:w(IAtE18kɘLA*Iڲ${D6F)yoJL(Vq.$*{{~A  ->A,^ShyN[{{HΜNY VoۛߔSfT+c>*V dlLg&WLt }@pԴ- r Ue0y(Ziί!@Uֱkx'_#8KLlr";nɗP[>+ &If߆"{hvNW?K=Qa؈VYht貞PmcO5x]obRÏ+m." FM%-';.Njl]_Puip[}eِ%m;cRpa9P m rZwR vUL;7 wZ<\)V >24O zIxO?<o#be04OkȀBkxG(>8*4N45M|K\H@>1PehD:Hmڬ vT w:RY6HY@LMSAUݭ QuZPH& 'ګu1* 8)]PC lq)4B6Y 7-1PtjǴcl2줷h5k6=۽5E$ŭ mknbl«plwGdR/՝7p%EƗޡeoԷlUhmu[ccYhy[}K@Wޡ$r&L;=k~H [Nˬ[ Ρrx]g(,v8 kk{,c߱uo?s<~ VdG0$\u~UZ39_GSzӿ cyƬ~)Fe?qCSeemeu pIt́@)R=%*"?,[JuX>AmQ0toO^?A>R2q#V22kktn }?Qnٱ$-at=zTw-#%&#Y?}#/)eZsvw<+:Ϳ٧#3! XKF{ Ք.p VuI!zLj2] ʡ/M {zG?=hcZGoxɫWd9g}_[1}:muuSm;X\or(rznxcxK' :'L,ӎccBqp{Gp{u\s}C|kZ+3;}VYYU[yu cD~kY$㩼xߊ?vt!΅gR+ u$K}+>~c+9}g,>Q{Lq5~7Oʏb/?/MjynbU9T*APw nQROeCPim{+/E4c^X­V;2$ϸQoqZC[SynΪN(9C v?uU 5)>4c)~i ƈ"h;|A?΃g 2Kk]d[FZ|slym+ʑ3tx#lXIo_;z{'DC 1NwoQZtU$^7[=^ 1ݾ08/'j)\:qO(S9#۠T@'_Β4L^I옷qh kUC ʛe36s?Dxs1/l w!Vw۾o~?ns-.VLiU6JƀRSXݼ͢sϻB_[,9)Sas4$hunvMäGF Eźf?*B-x՞#?I[S{^p0G xA,x蕴95 aS μubmsw4򇙎KE&ActIQvꃋb!8KdJ}L`O*^4Tɻ.- hUB`#j1yo!tW1"]D(0a7` ohԃ'Le%6^T" ~)٤D;/M6gdmm(wKD>F))zih29Q-'L.kO`eJ :+nWse%"wp 9qU\dKHiV/[kMn.8\ze1y<1Kv? TI$V$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I) x؝Vu/\#DI'3yHl:)$\?UyqnCGe4'QhS4TI0r%nf#ZPRI%HhRw2ܒI#nD.jDr^rV)dARLU|ĞUI'P1A|`tsd!]ajUCŃV˴(2$O]j&lK`Ϻ) ;,.&1hP88"T\@$Ȇ$[I dnO$B}P]ߕ$|*  McC}k:"v`mٌ$=Dxj{}*+nKC 8 -o+QihsB#tCmʣլakm'ҵCr^rͤ+2>j +T`<HtkaWvז q+8k[SMpZ*u86սOsWy} .FmVX [ 8!0lt^e7*`5Tk&4#*}Jkbt:`p 4/1# /$<m[s{je>g*-zktBdSW{~DkrU[ L*i$tII$RI$8 5&w}6.5Is -L~2<+#F:7k$![y i;O쩴Q75ΰ $O*ψ7ƹ/~KKw3)Jtꞷe4}G?ųk;!q,!"6_Y~ۯ]Rڙccc,pnf^ޠ%m-k]:7B_v%uj9kK%=`{5g:^I/Ux;msYhצ6[,c1vܳGKNZj sÎowsXUAlp}ROR{ RzNyN}b5ۋwm֯?6I0 tj,h.lih"H῝*߶i="~ӯc2$smfi0^Hmg?%uEa!:rYpe" z GV~ZFmnqpËtKU+q̴A+;3/`}@iv^[:i0GE0qT~xJ-m K~iu4$'ܖ{e5V6!hv8D"АȻ7kizF7tq<\kT켆 xդr?wPc)^ZLTō:ԇSIt e}D;:h1?*>ٳD?ܺRk8|OFa5<}']-k'NtCւ+%-m-dw˶D$ۚL1I "NiO *d\I^Ǵ6@)-2Y:{6׆tZsK)vÅ|xzI{+mDI6ռ {b`uV6;F Ƨ5a;4ִ0yQ.dh̃ɪ2^\I GisD)à[Cpiol;d:Uf HV[-%!xxEos$mՇ 3*B Q;;ݬc YBKZ+5W5-Z6=6鴂'1nI$j~Ⳗ t)$)$E a$(Er'LxghUSdT|NYRLJpH ()I$Aq›& (IJL$QkQr qI+'I$yk:ŧMQ$NU;"c%A ƀApi\ٶ@8.f{x.=$iTʷI3̨D˵ }i*sLOM\pL(< 78k\ُhQs0Ci!HWc/ ig\ۧ׶^Oz6~}bKAG/q\/d.pz-0N#0 0?I~7xum~Luh |Gޖ>ڙPg [ٮˈEqܟcܻ $%T?Y\9Zj_Htv={zvwzL'Y>?$Dmd῔tK2GcF1g 7%\+n(c5 a 0 u)JPRR|T Bt*g  wL!yAK@BsP ?elZ!Ź4TZt}H YJDYA4s[%ff;,D 韙H$c6{ c S %pqUų}`kv~?Qf4\˫owއHqI (pIpo[[H7ؾ6*7IbԲT`0R /lmoQﭵ7q\PސezC wqpKu?%Z[ب,h =k_-u?]0{VsA^ĩ$9< /z}pEt?4#־1ᆚeZ<Z[LH=qي(. i'^X"'NgR]?Z^Fӎں@i!ò?N=FcZWB-&[3f G:$kϒf.M It=@;[AױUi|Mߒ]M2$H}++ɽi8 -<4Ru#Z?!h۶IN/f~ ctq7P,2n(h@:(QIT1)) eq'sMn`+mXuP'RP=:Al;jmAV)~%$M#bGae۝Y"5:8mL2F>\cEj[ȎcCPsGd!.,'<}ÆDZ}׺֏ImA&!Oe>*^5MiD 3RFA忕ZҲOP D!̓qTkQF ;@p u N@JF:~AHfCbAfl"I;BMXpGlw n渝P{C[@ϊJ_*kK$Wc7ihE~=;q$G -K5&5Ti)d_>hlfVGRrv@Gh_N%B.i#*M5TBxʽCMZim`8af~K o%f܇3B$ dmO\5j渆U,FӤ=򈉎 oV4} VAӞHldD<&&I2zSZ]o̰XL% 2ԨjOdU !M$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I'o#ⴖub\>+DhBI%:<7 5 h&I% xU u1Qp"$)Ƥ}I vSk0𒔒I'c L꣺ ;@$j8% o_RR.-ȥ!s g c stf1v ͏'SergYĴvU]-i,G()*Num*{CIjX iӺu&mZRRpLꝺ=_ͮ`$2@?Ru p̅"> )gݠ:TY{?~)ՂZZ{| 6ʧΛ$U{lQ]X4;!٬CYϤ4*>QA"|#~:v6m?#;vmhi7j5p: 9#r$H "gtH%c⟰'KvӁ Oaj%rLuXd )^q 'DGL{U{C Dd*ñfFlk 5M-CIGOd¦;r>ͭ pS/Q{$<>gDBth+PD\JRLRĤPNMjIJiNRQ)Ld'LSO%(`򘒜p2H%=j"gQcX[$Fc䭌LQ?Yb{kKh;wԵ;wj <O E7Mܤ$`x#NJ󄧨4w>*n&@'CS0IIMath[$ G)nF4<!we[+Uyw*Y֗X֤}g]<] aԸ:xͪ+a6vVRݻ$wu2PI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I"P%_X_\I'!N -SDLL"w0NMU܂*fC5M q ]-!I$IӺ%`4AFLEv$&N~۹DuRJLR L|D:JNIG 8e? ȍ6kR@5 Kk (y8tݠt§Ǘnh zIa*B6mBʬ85zl/G!rAcc@~8() *.()ȢֻR|+(qey~jI\0q*h/tˑn4 R"ܧ+k}/ERl3ɪj>hVELs(C[+-m^_ض).sHKl߽ϙWECt!xqm&xI DƊy 2m)SϵVQJ( LJDBM m pbܤJR2JF*[S"U<+@y{'Gu!{@Uޜ:O>Ivp;Gpx')Nԁ-v'@y6Zb"HMk>rS7  >#RM>Om0eՋ>#$jg&H.(KTMc- Aal*xovMa &&~:$IF#_4FT_^gD"KHSptӄ'5 0#T`es`xRZ[on}m}gE'=⊘_}"vĞN 8 Ji_ DA3s7( KX.=Y{&t1uOFZ=JD;%tKcTD ^P#]Rd;Sh#RM{uLg&OQs{ȹ ^ؤ0ӈCYy#M<̖^1uOPbWt:`}Q샣<{,b;+f0c!.t5H;F 2O)HkdkI4ZrN'hPm9c*g< Nѯ(9םǹN4hi3ftq3?I"`m: u@I~(xogC檺v4τ+zM h=mLxBPi0@o \ZKNͮEĸ5Ļ@K fKd_M ))Ă#+)9ē?ކs\fH#%6~˜ۉ0F&ƴ$vƆA?sFiB{>c*h .>*Ue7uZJf2> u"4<ǂ;8^xwif(.N57q>0l;LWI$p|J0O'k[\1J\|+xEϬ㐂YHYW@"CoϺe0C!fIɆ* H(em> g5?4*XٲDwVuWnwQ3#o@'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I#}3W`cKI$F1ܩX pF*Oq"I$:egJ.*Ĥ'I%u&iS&T۩IJI$'v7nY/:Rݮ %I&IA Q R`r0I1k4jֹK3{Ge$$0L W6C|h$` ((+h pV,j& iY;+mnt.(Ȕiq"drY ( ֎?rCKlrR+p4$>Տc)^THebmw1}m&;[iaowȪpSFu1k7@?MU&nIQ .5ͬg@yg7R6XI$ 1oB.v[)'1LB ndAIY4VqݡQk= gD~D{ZTf7l Jm ٖ{𔔳N.:'Wl.%a5uś4:ˆ2\gRR{? B>hOD;Gq&C.GZ=u:0CJ*YAhL74AF%m2dƪQO1IԺCw[ "!O@ӒXv{g{5KFl{h~hAK3XgA(.~#hD[-n㮊8` >}EzqD< mA;cd 14 惇a:u#pHґ*!uD3B '*%:dR$JABSJW!A R%2iLR&[ {0,[ؠNR>%jKih= ĝJ[%tDOܕ0Ӡ m8(dopOd6@Vh=KuQ(5Ѥ@AI*Tct|U(V9P!PD+Y:8T;lϊbn'wbccf8nh#<:􂙶9ֽ% yV T]CIJGyR`qNIe I*L&C[ ncpN10tBȡ+HzdlFsF׏q:h`$`wx)G (l4;:!4X^Y~AeN!',%$-5ӱ 1ZLcUq"- F=5V5I3Dznl@?KӬD%Ck.?jT[wou7z]G@sCCL6էYk>oo%EE c[Z L5?}ZÅ.aVmcDؖ]xςH 'e{[\HҳjDS5t9|[Xlp"'d00?JZh;_U-`Dg~n&cǕEd9B#k7@9K%h]ng'U,nX]hsvlSlJ-6+n{]=\t v8=-y-Q/Ftl3uC6 aceB&{ 5sb{D|blkdʽꅷ8VKH&9jn,=Z|js}PrVn|>{>CKkT= 4> %q9&mqQCN$OattI$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$1my,cӴI!I$NNxL\IOlrDiT\%)$QiScSѡI I$\8@ TF~ %IJ!h{)z-G $$k)pѢqnU6qGū)P'D]*XyT_v Y(I<) BSC 0T$KQsw]1+z;D5xU ǵ U͒@$(ؘtUjY6: v!"0cu#DtnCѩo2VNm,ƨ6<__+=7̸][R4i{K\['ot65G AӪI:+xa '&E`+^d G`Re{d8k6ϺHUUtNH" ND7nݤh;(D:8!Ow"x`2; d ##b|`(69SYkͬ$ɄT 8L*Sic߹4e8QcÄ~|'>9H€`G()r⬋cݩ tBY%~I/Tl: Ԣ)@$*Qm 2bP'4hMmDLTC nlN@S4"FPe !pL#]3V.KĭHr% SQ-at#fcȤ!()ݺhYL.;bc9u TVDYl!O%U/p0ߒI`y'RkD6# tmM$Z$kOU3*GC(`F #r*cmAi" κpk,ۤQ;]BmBγSKHn@kOlln)RcD"Lj{F(k>GLۣ<+u5bO*A pOa"lO"5'#q>c\|gݻ,i#~j>;^H/40T Slsyo()NA ^I:Jf\'̃V@cǵ  Y ǷtP~xEIqru(|!:@J8k{Deq{gRyZIIZd:{ ;v[CZ,@grixUAvS|1h:fk# \C;W[iBI%#y$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$JRI$O;)I$dKN{ )I$I;I2I;8 JRI$1İ -))I$dn*mƱI!KZ$c!%)$CI^c%04RI)TRWfx9*U.iJU7CRI2t~g)I$ Hb/)I$ HAԽI($c [OIJI$$BI)I$I$JRI$I)))I$dI%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I>RRI$'cbI&I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$CdIiۄ) 'IzI$JwtIrRRI%%?06LIHVI8Dd&$I#@'@u'^RR$fsyV1˜z}uMJjwr R){sLlKm3vO2!uILX 臔^dUCYq¨lqlBz&Բ\>Еr0g%#c1}J $ভǔT[@Ԧ-pѼJ+:{-׸{kmf])5w!{6'AH'J4uUPO+X֐harI{t 熎UK\h#SO*1Km%%T%!-QڎBbԉL @OМfaLxQ!T%e=ӯ޴24H"|uo'SOXP_GuecʄCj/`ȟY@LClhT0t?Z`У4mՆIkK?]JBmxzn h Ƹ'3fABhvB (z%%0-^d"P` Qq!*[ tA,-RO2c70B[)u7y׺KRūs3p|@&n(a+ay᣿=5`cAna7%q{Ȭj?dY9ͨtuֿcw[COӄͪ{HRQqv%lƿI3c!= 4W3;{NIHXI ָ$J] N 1U΁t=3sGSYHLxG-ep5>jVbCMq: %vb+nn@;A3[3܈ Xqh+u#Hf uHS շ@gqS p ! ABk@m>rT{ 7dȆkLӴI)<0lqN2 =`J2O 5d#^-|I kHMd|+44bZ[M{\ޞ{W9!Ik4ɟڍ{X拠nsKAW7RUpO9 A1:+H(d΍1ۺ8 !~#;nILmsD9{l3]evR;nB\}/yO4ptIL}1U-xK]Iq Qhđ:'qisLBCv;(kc㹮>j-oek\D *X.=wCkmb~ !O+Nx%3b=RΦڠ t<¿C] 1?*axP;,drODlyųrZd?]t.S0I'I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$jq]iIJI$RV}6=ڔQX&iJU* ޚ5%]&ISN#+<+1))%yH%8M R:JTvBbj)'HB#RRJd%HIKI$ţDkSI1 CLtIJI$*CDQ))I$LtNA)$I H% J*RI$vMKrD:d6h)'iR)Kp9 %)$Kl[:)%*R= *ij$K &HJRI Q8=0R!%*Sda %/)JdN5}Q~ %/)JdFgOJ$$I))yM)$|?f3ī2J0_iR?4#L2Ju!gW{^Rɥg~̯īBiITR*T_'TwIT*)5V3 [RRDrٳON*U2IDZGxgLaRR&f$?f*U.iJUt;< RR&TI%;|R&I%'Ta%.I$H[I$K1_! %)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$nI"SS¶vp!LD$ zLB%.Ij1ԫ!)GpR&I2b7hT>ԒYGvZ`"(R)t$FȣcAI$I;Z\`+uKe)I$%!$I$UFY撔I*i+_a3m&JRI$I))I$I)?hRRI%I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$Up$KA'Lt$NQ<I7t FI'u(Orv^FҒPN"d4 -#JvM]IJ<({$L$4i:VLeĀ'Q RD$гQpm'P]Gd|JO %y(YMs! #(9x>jL`ǚ.Y""Tsi%&1s^w Dt8Di4s$ϚJSITCu2d!ȁdePKuh*65*A;Q'68h0h‘lB HMAo|Æ֙ܥ)qPDEƞi"9"$v Ucq3| :+`ٝ9)gDF@n2`s\$je?n'AI$Cƒ7s(.;I .ڍRB:v !۠A.?DO;H_*oJ =x V쯺{LLJbTi\8 a $$&HMLRIL@LB&!Ej .V\.[tegWI*.qxh㲙=;CI9h?''Er=*mW:\6gztxVRȳiu(+!!3պ=@4CqtV9 ꝴC?Hn.27lx?x(?",y@"$OikAm`1 \-l9#p_%Ȏא\d6D²ׁ:K[XnTЈoGUjty<P,qpi=8ʶ z!-<>I% AR[%#nA?Dst4 q bSp`2"<3W؇5 5N,yV٦" iT׸Ș8{!KA I R5zD#*L<)p@OUM<%o?`&O`*Y{ A-cz";8UXˤ8IqO7Tjqy'seRikF!Œ#0\F5sH T>ԭ:yƾ)Yt })T_ҮM[cSςJ^p%\3] ޴f5?jp H~b_m|F1T ]>1'R- *pfkΤ3a[ߐ=3t[=4N.ܹdI=I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$RI$G5#O矹RLA/?V8`4J2V ôSn Xa*U3IFRVNZ MNB)^S$RM)tIDhI))I$vm-ȵTAml7Y*XR D ()I3܈} $a0:M*@Ɖ)I$S&! eLBb!Kt$LB8))I$gQ#`I7 xRyI.`J!9&$E2A;A%.IQ)JRI:me<$IS  RR$M wN 'T)$|v&)\4RI&^Bvph%JM)3BqY,M#JI)LT6rJI]$(>LG @BhHRI:JRdPD *M)J{ w ^#P 2ICrk Fm3b5IJI$`PY3 Щ4I2HuR ݡI*I2p [*#HRt,E(VFdIK$0 ivФLR% LVrBRIY9VaUTIrФw1]cBI$x O=e-hi4Ie:7Bֲ`Y8JI(ZT0 Ff`&d^s D*vtJK:(q0p5A I$tE%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$&IAI$xL$I$pژI:)8FI IMR$$Itl08 )I$1΀S65)'_iJQ)Y@ pWk˟ʝv~AJD>] q*$4VMǺV'o#Z3NO.qChay *^Q{LtLRQ ;KXNwcQ7KuW=,$tl8FlNk(7X߻ F}k9J:k 1ӞpQ,qX 4 dvcȬiTKAH:$u4gǰS|@McSQߺ"@#T:$đĥ^#K<K7wU JHi )"yR| l#p akvӺ GT$""x(uRoeYC|3\̐g@K D芛 \[Pmoqh#Rֶ msRYQv>Ks{9Th9*.cw=t%CkQ.xܬ1Kv ;As)){*q6WH ܕa$3cIt%3==#}">\$RR}SSnq]q>֟N8;i` U_͍;V4\urDe;dlh-0 A"II xcX&)k\=c^Ti k{ A1TŎD;vF} j]TSH 't鰿 mMMnhsbtVZkeQ`kF$ luvLq·c^q:tEe`:?8D4~%?:vCc8j7԰ X5s,#{<۱O>HY6X?FP5rv :DŽ vuG%iINcoU-`KYAEip+t6=4 N$Y\4p:F΃B\$NVmmd@81QHhXu!)E <]WCO+MxQvXuk*ƗjH҂qhOMcӺ7jyj:VMwqkZ۠}5d;4I.O]j8ǂkt$j8V_X`<*.nyf;U9Dq#hSuDztDX<%N4J` 㤧ةqy@~KǴ R,H[}0 DIؤ0Gu8WkxncK]a`F%B[z8J;7TFRlcuJv:AnH ﰵ \ŤL4*جx*7Cak`DVmM|{U\s^ƀ%T PZ}9uwc;Īǹ"|6{w EǕIY5Ov6~IJ \4@Ho/i:ZKA KOeI$ 6$I+I$$Nn.: :j> )Iv(:$I%" MnN4I$ZZy{L)5t;Z$b:Tg%=k;AOc~J%b4AK):\heTg`mv`rJN vt+VZͮs 7N\6 7}(6%4㶚K[tH#SM~Dp?4]rS9@(uĐw$  '!$TAt,dL Dv\ּ`NJhHӸ>%5ŀ8ġ j`v6a !Ƃg@=$AJJFl'N>5gt85Lb @wckxLqqwp8Qt@0ylI=CC|O*m4reEÕ s =;X4gwOsR%")1JӾK UhC P`_qQV+Uv$P R*0 BdI%=*Rb1I(ЂT%HOWk2ejiBܐ;teh5 4$CT'h`Ĥ|MuyJMߨ@/''{_'3t5y$ҀKany[r VC9MSF#O=)$ 7k+E66ֻs%$#@i粸d vY6;cw߼cYY$8qh,FK<b%IyjktI䢧L4<Є)A. 4o'Ȇ0`!6@FV+j5ʭO4JLLVIf!$I$I)I$I%$I$Vw )I$MУU qLJR3D pRI2JP )I$SH RR`)j$"BJ^NR B@$$Ih!)IJI$ T&N)!%,$LuNRI$Ħ&RHSuQBI'NEQؒ %)RRb!~RI2I4ʉIKJ*I 0)A;))I` )JRd)BO]撖b!% a%.I$JtCTHS) %%,I)0"E$e0\@rp1FdD(@R*$J$%)6И0{ 'I2 M>) EK)nt % %,tLA)hGIRdu"%J{$:gH ܓuIJI2E0 ÂwP%%.`9!1 H$$I4jot$8L\RRPIÊ! RR'M  dIR-R<&M82%)$& GD`RNs)$iPLO bR\♩I%.L2r' f%%(H)r9))I:IST$Pk LJyL^C^B4$KQN*I2jI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$Rmn%)$QxEf3bL]hFJI1)`ϝUq[HFj[Q(dKjpv))DIr(EtIJ IL B `JY"4"=(!1$O) %2LIH$)t$ң hSE Q)p2RH҅DS %%2I2I%M7Dڤ9LB3!1vtLDꜦNnD# )p5P*M('P5*dLMK.NmRJY:I"Ow ltLbB~ CD0N܊&TtIJLxN:&S I4:x))IIN)ɒ)2Ej4JR:G7j%):d!&NSD$RI@) I 'I%73P))`0NNcE%,$BpR$L#T5IJI2HO;O*NZ(w3xI$ZHqc!I$ HűHBIJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$H %)$Z65w <;AqT2tȮF Ӻ#XG RRR8 *[%.I"1݂ft;@KlςJY$DFh8})ײj:#aJS9M)vu)9Bp$蝵'T% 'Ra ̧kGbLֵO>I%2=36y$kxt<(A%+l F"6A1sC6-#zSU^CT]kDk2Z+g)kHaqp 3 G > Dh"L.uƚ*%ɍ\t DA+FT,60l#p%Gn:⚷ h1䫰:xeAHK%"ApPp&mkqJ UU-/0ZaZrl. -nv<8y)RZzuv<n:ǂX6G6>ѫA,ad '߀Ue2I @<% )J2THNJ )yLRa$T2PuCGU\1O9B5%Hc\\8X=C {]3“ 2h$fZd -!ݐ.MKNkH s%'G'*.:ʈe$p<tPsA@L(s,HdLbAh5 鮟F{Fy8HR7<Ciʋln*LqA4Ťh a;ʰF!N$oqR{"߀@ktD" J lml`eߣDs43ZZdD1?=!B5 Ĩ#}L{߈C5l52T sKg)D6ĺ$xwQ@5R5ǂJbFIq#ݵA$}*C0A.i/k]1rhBFIӵp&4?hS9o>:ߩhtkgV,5>[5`B]w쒓 lbLM-5;MgTE{B ʕ/;˴qR'p2ILީ!v^\\  KjhC̟#i>'>y2A /v!]`2Azk1>D@ U[I;rK|TF$ςhׂ F;PVw;AIůE-iN8SdsZYԓ4ZeӤ"jisbS+{ߦ'iD,}~ֺ{yYfwbU2I}Go,pØZژw^Wv`ηC`4:>J[2i$I%I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$ZJRI$Vr0>(iI$g' '0Xjc8 RtJK5v8L)-(J!U.d:>o2Jpi#P)B5n2T_PvuIKR%9v+T #z2F tLyO%(N$*4(RRUcpY )yI$EaOV+> U hR&IVf Ψv a(RI$ha83$wvH I&H6F .IK!&0BJ]2I$|S6ԔP)%8djI$ғZ*3 lrJQ)NaAJfjI *'BSRR )I1)JnSJRI$$[ejJY"ңSTI$ʋ%D$О'L= ηZDIKIY#Uuv2HI2JTnsK$mI+IWO3*u e4BH]4)'$SnHI"NR)$ ۢMNHS'%A:d'M)HВI&I<&II"!%)$M NJRiI2EJQLJ0%)$8*/ b^L(LpR铦H)5QEI*L(NLnHI"S$)"D SAT$S"9 U IGRS)1I I2u0BD&)JJCE TIK'HB'-(RڒJRM(\'jb`Ғ&)$Jp凲JRyQۂDJfS( NFrjJfP⫸)0SvIbǼ&üT-'BIIDL DςHH =H8!Bu2ILM)$))D 4(اMSIDD(ZJbJptHhLRNT9S!0n)` IHDJRI R))tLtLv蒔)&*E!›5IJN;:l&%*'8t$$d%)&I1Q!1Dũ)Ie8*-*RJ]2I'IKM)L'1RIv>Qk Jc mR!0R@L^D(jؐl)$nLI$ mD%)IJI! Q)BJ]1I$*Q $'L %)$J&cH5%)9LstDRTRI"tM*O ]$: ׄu)"LD(%!%.I% e $'LRk6 RR)Q ڤ֩'IKLSqQ )I鶦 4LRLD@C(PZ&NtH'-2!.)I@ )pIJI$0DY،'h(Ig_YxUn!!$.dJf` $I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$IIjfx @FH%L1RԺO IcMu@IKy' ISDp@ILI$;ǁ"0))Itȅ BZ=Je(d̀mH6<#$= {r *U˷)V3>(`4'@“D6\@%DTΣDHk O19h&<r;d@s(o l:8 x$$EJ6[\4"׸xBL vi3ݳ(,u z`hLIkg5#thXxԂ\Uwq,f@ӝT@dUxW>2dm֘RdhX9t 4j;JPn"J%;CyNp &$+vUjV+56JLGhUzݠUZʬB 0m*RҤ NڊJR)J @)3LJT@EkTB#RK"P^TBztĩeîq$ѼBCk~{D{ 8wJ+NǴT@il5"f9Q%7xgV𐸰Pc'R5DhO@45:a%&sF_,nV%\ w8>%NAա =͑#_IY$5# J^ƺ$>)JAI$!1}! Gu&%̣=L=C%w`C-0D0\Ȁu]@:<$vSp!Sd'寁"BvuRc[a_gwh@p1:cH J!'wLmYidqIKGEs)&@B4 SPSdTV=ǔHJǸptQ 꽠HFw07ʘd |Di'T V!I2q.ִHI9>w}d~ ^`'D#omSFa&5)@1"4'=C: o./Oh WmO6GiְDkEpyw\=t!MG:a&u1(Cns|,<;Gh9-Ema6mk $vKJi)63pO'ǻc'o'⒚Vxp*ԸI`KD8K K8~;LC弨r{Hl_NjBuV`WӪZd$q-HHToC|uTXݧÕMtYV32%r[}점i-&.%P>KP vTp45Ul,u I'YI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$-䒔I)-X QKS*L)@hRJ2t  JI$О”Ƀ/)҄ ;d$B PILIJSKjxK%).IKhSHM!%-)҄"SO@Ʃ)I "%EސE/))pP5C(y)r}DDV@CsIV$(EKHHn1h&PS2!ꖨ5kJF)$ ) Q;ބTNIIL)I h(mIJ)512SʌFH$.R`e:@$tIJI$ɊI!J]$J)iHi)jRथ@I$ !%1\$%:r`RRJ8!4'$)$ҢRIJI:JPbM2I<$%>jRRJt %)$PJSSI$JRdHO)JJTLD![V(EK d%ά pY9t: if*JI)IA I$gKh׎FJI4NԈ Xl`UhNQM.I 0[Tʉ))RI'M)JRI$)BpI?(Ri7@I&H!["R"R$C]mIJI$KDAHS /tph%1NЖR.< O )A$SJBJ]$ NA7$$L]jtN8IJI$;(`JJRIܡ4')BJ\$IV(SjJRRLQ`5>E I4!p"Bi ))L ( o%%*R)BxD:ΉRS$r}x*5V~|TN9 pN!H^Kj(oRkk GDNC/0 TִCA-N椠⣹$!S DO)FRH0wJRRP5Oc撗LIH&PRRI)Rj;e%)"E9KnFDj)I%[H F55>j TId0A+T{%Jf<3@ S5 )ISmJS) IR:JHLRstQ"*X”S0t‰0DI$A+9I)A:A$Pc]1(LJrΥ%1<&Q*0N%OKI$22N)t$(S %.dtY@Ze>N0LnkĬ C$d$kpvԩKS$H)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I))I$ׯVLςQ0xβ@ScoЯDamzvPBJT'jb'p*M >HZ3>.>+oAѼ E%Qst%^QWlh`=T w$ W$LfւIS7YN]pιZ~疿@*iױkh/c6iRVeQ5hmM*Ik71B»aGz mKaAI-^jdoI7RScrRU (Sʐ%%Сb"7MR Sk$GbRB3:r|㕕aķIe\@J*@M{Yf@'P|o:BHQ mh!>I@\X$y!D~7]H:)槗YTŕG+i<㢮xRIHV T8wUbkE> Mk(ڢw@$Ȃqԇy |tC{vDԘ'D &k$r%kyQs OjXy#^6FGˁqOSW'hDŀ4Q݉IΩHjM|dKLl4O%Yp%yr\AѽRiZYkͭ!R8 lhU|k=f ⯱y*C"\uVsA);Ʃhlq0Aw>u?$yF}'O&|Twq*[['Tah<N(,L8L䷀vS0$V5 4F)&tQqO:(TVyF8-Sj`p*t) beCv$ּ3v$4wTR;ߐZ[lKn \xEVk+nOCAc *"o-^$pNA:sƒdIMI 0y)0 Nj5Pkp$L*L-s n&8Ry-|[,aZ8 LO,|杛4x) uw:_8TKp}-?pFl.\|5mhiPZ~BZC#JsP&[J )I$d]sRI2V3<Zt+hP$S M)RI$ɥ' $ JGPI$@P))I'R'CPJJY.%Ob[a3a))mJQ)DkTlM]gTP)b6*NDk#U I)&kT;TT)NOR3 RI' nH)BI&PLJ$1 tuE&6Q : \!%8()q)N#RrN%1)NBɄJ]$I5*{GĠ&)% SVd1 $)5*RI$JbeFC%.`"7T򒔑I$PgTT$He>2 RIJI:dŞ $JE$DTd+RJS;ޔmR8JHW %JҔJ)pWI2JS1!;!%(銐;J`⒔MNJuRRd-"TD'' &91E2JRPt D-IK'LTAT&8IJI$ʌ%,$JS+R'IL?OrjQU1!6RQx& [@Rbe(t)RI$:d铤E2JRIMt%I$hJħ )I$$9JBJRI$)BD$'ڟhZ%Ғ)KjP$772 s%/UZAZD4$BH#UtU)%gpQ"ii ({R"SO Ro nB$7CLxRIzg=BS%?Q!`C%- mN/NJ& c BJ䋕X)AIV42j. ) )4;J \&!Pʊ.!?PJ)N-Л" XRBZ%0Ng[J"PžILR%94'10rJTB[S䒖Jrmɥ4:I M) )tEP5'-%>䒅L$ܖ(BڟaSܖBR BbfR!ܙ$=ڞtSJI4ƒDp$" eD IiJTbR R ԔRSJ4)&S$ bAD )yJS$THM ]ӤJyL'JB ]$Ҕ!0j'"R$! ԒR&HKjNRIFR&"nZ x())p:=9ۼ|v4 U.)R84&TI$NS$)mO)RRLDhRM=RJd`!7%*E)SRI% EHI:dTTj jJT%3''$+\JiJD!* NN!GRP̄2p1 Je$ :`JGTIK'I2CE TJI)E2t)R'Iee8zV(HHdR<*9DmNR%W2TMeS\;)40J%H4BHv!ۏ-a-#:Sm )݈|S}w %YBa$G]Poq D$B<iCTVI*=nW%@RWTqI$0e$RI%;(6^F I$(O5^mLT9H$I$V4^:JC$Ή)dI{#P 2O)'TI$gGU[FOpsJT(I+) =Ԟښ NFx2B G˸Lֱs9kZ =IKw)T}.|hè1?8 s;6pӋw%/ IkdhOޑf$9~eӅ+of%uQZ4%.Z!O*Q$RpmhGN=:fuO0;^Q1vƈ >_%J{4M9Q&L#&K%}ĥ*Йߛ%tlԧÎ. R#oK@K1`nOƪ̝JHIˏRcCWv2ϥJƊ BΦ>Aԭ>гc(Xr i7/( ^??$AM !T64\tN@cd!A}`2m STzk&ඍZlಾ![y+@F+^M E,3 *ح? ~ؗ۵\ۺPKRI1*UAL3'G+szI ʵ&kpD)/B2HXc<&Ra ; tQa(Pc'r ,,qU#iy~SH!8U}{-SsxhUI +m-nYZABqGt[FA(i>ؔ I;BA /0@8{tOW44C{ 2!(`3%6F pIV ߀V4A(IqԱȩq{')hA)> ;%_f7]p˃\4Bmq;tH#N!%$sn'vxאT.!/~ Rq0%%1y ОhwY .FDFV[^hN. ۞;y29N(`64Fk% ma5GsHlvD/©ԺxLxoȝN PP %Tzed1[LI7 I$BI$I$I$I%)$I$IJI$I$RI$I$I$هcB'i4M*xXq[e ""ҜQ;'HĤJI$t$ȡI$}$$I)JIJ`RbʑE'LHQ!5 `6J)R,2X)AОTv!&:'hIKbNd™*2)e%O('d% R"T$DV$^RDE( 䩴JJXD0j>H{t)N$"2t*;w!%I e*ȝTQ AK`StQjc NxQ- %*)mD R٢T])M) KRLR$++ 6:4 L05Cqrp Jm*IPR&NR PLLBb҂TI@Op!%-)$ "ܤ )4E Ʃ)\$\JmFHIJI8rr%@R%)$ڜRI(NvCTIK&NbT>(JPN:`TB}RR铖)nI%(L%$O )I%)JhMTR!%)<*[I)$$ҔʛZ*AJJ\ĦĨm mDN)%*2XaMt)zߥ!LP"GrϞ5H1E8 O*G5!FG2I>4pT\Jc)>ሚ%MpoqALuJ)gz\RR=!$cy<&-Ab"@LK*$0PN+D&CiD Ӕ!;Z#YAVPR$L99oM($RIJI$Z&4J; +E%IhS#J]2Z'Ou ԦlrdTIyOdT)P' )8NtHj> |EK'I$Br@6J% $I&:PLJ;Rڤ$'L`{ВI)RZx% BCDI$Ņ6))$JyQI6aR>%/)JI(lH8( rJ^RA-pOt%2JRDS"!%/)&pTr%/ m oUm!4$BR&bS%%,ZJ9 a RRl)O(ޱCILvڞRAr^›jJc-I"%--Ҕ_\)_j@Jc64$ LAH]DŽ%#OM%l8%!U[IH̥"P&*⒑8M dcm%0N ;D% I}a)[RCmRI-Kj(ILv%M%h^]T%0-)DTxL$pDJg (%M%od* g( d19b܇A{;nS, "hXdJT%-lR ḮsOtक(P))N&ЅHW.RS)MS( 5BHJ R)As| F)))JBhgV N* ) N@d)m@K2aGrt ż)6RudBJIGE H$2JT7'UԚ%JM䋐a . i%22(iI<$1 IK'I2:%&ڒLR' )RI$'1I)ISMO\$!8IKEDnJ]%T'U3\!MF%,R:b-vi SD*.jpcړJr(L95S$)*&DP$ĥ -05IJI$CźkiO) %">I!*R<$NB`4J$$ࡷBJT&})6O 0D uc1skOhUsIZtH0i:NTe+V*uzvOu= i!j!Y9hʃnF:Jq@sáFUhU[($JfZF4 *aC-@ZiN*&)`v%IJI)HRI$(7 Q:$I RH$$JID)L HRJRR$& I LBl) JSZ'%-)2tɶ% LTBJRIk[a,CQPQ{)HB]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$JOdy-Z9XLyn+mM|\ IRLDvb{dϊνPV>IR˒eg 8AQ JF]y4Rjl)Xݠ$SDGIJL2SN?LITIpvh0T$=RI U9Dk}"cVHj{%tsNip($G;t;~+Gȷ't5#t 䈎aݨ4uo95X>G}~SmemsHxKv~jXhq(MGv9"#8n'c_lpf6;<\5w;Bϭk >i%b\yWDrJvm{C}& yk8}_uGu5:#Ha>bG"٭ߺNsX6.1T/u WؑiW>GdSKsԔxYߴ{u: D@CeDq+Dbv%8<1?&3;LhbȨ~pM荬ҭnQn`3|VSzt ; 04CwX=W'sKljN!Q+-{#E*rg{T`?&?h˔ZJ JY2+*A3G:5B~ >9isWYj5q͇kp{긬s-u85hR,W33SuUSRڻl`Gţ]`,\͖]~}lO om臑װv]VFd`[?!12r 8wmt !\4a^Qcca֞߻ecq{̸Jg82Or8 c&Q#DI"$I$I)I$I$JRI$I$I$I$$I$I)I$@O 6!%@w L2x4(dI:I(RI$: IL"$d(RR$(>Ԕ钕Q6蘄KPhSIK0*P$$*&SHJIRI'S %3Hb1I12 24JI(% )I$~)%I&j ΁ R $B"g+e"r*!Hi@JPJ:dM&恪SSI;*;J@A8j(JAb<۬=E!(DLH0_dp^J*G )TG+: EV+R-RQRVÚSnh䪺RR)CVwwNH<*/R8BԋiJtTЎJI`$l%D&a:IhR0%.d@S5)3%J]2I}aJT% S.H(,$Ҝ <[!I9N%1 )INDIK$:&>;LR:`(IJRI S4'i%)9LRJRM )I'IJA"uEK'Q!I$I$$I$I)I$I$JRI$NuiUIJL%xB?Xly $+BP%iޠz-zJfd0'wY뵫=$eb%0l)$E|N빇OPJ1ڸJp}+GJI"}oܦI$l\1,}jw̹'J Hi%~ZyyPֻ#BxLtƀ>?z}mNjKUY^P]sE;08qC~~EJǟU߸)>M$Si}7,} $'I$f\,pR]$lKAJoESI[_,wޟ_G*i$( t}z,hV_V;@}~$2H"O I$IK'I$I$I$I%)$I$IJI$I$R'I8qoξ,怒JY3I%߬9mH?_֬X!A)8k:T ˟OJC]n.5W]CCC?[?m$B8La:I$jeBޔ۴{x \N*X:J(2e.WHçSXD+|wro -$e tvU>_Q.i$('[\`vPO$|a]ItT:~!A\ $Whv5}%y[P*?D5+$+鬭Cg{Z ǃWRZnI]߂Mi>D(oDhE!00|+-j8ֻSgǰ@s<"oOZ tw![It녀iS~}ov!`qMn2\&tXdO^Iif}`i֞CtY$ aQ'Td$80S$J3/ k$U-O F9^A9I$;% I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$J6֖{XrRI2% 5hRjr$b*`(k& qJ'dP)8R Nt$S$$dH(%)2tJQaEPM)ʌgV(T TKЂWI2tETHIJI2tPv!EAKQO*Tꓵ*U 쒊v)4J{)5RJ\1riB%ɉ)R*JtS" Gu"jI9&R I)dI2T*$TRL I*I$A)M<$$tJR(Sk)Q-!b)Б MbMp$% HT;(1&|! $i 4Jp$|ԒRx)R&I$Ax )IKLl $o/$?X%5$v8L$3p Aۄ 29KaIL8`M邈[ /)D~cQDL^J_r}) RܧAKKpM @Sy 2ܢJPe-JRS&]mKqH<JJR![e/OGy;&☀;3󆩉j ^JZ )APIL:h`I 4"NJdmЖCO*'%.<)<$)$% I$&N]<&I%('I<I$I2x$IxjmRJR l`&0)<% |RwN^d$JZL%j"Hw:%-&pi)m! 5⒗@8zhS-MS ԶR%!)QJRJRM $> )t%*0 R&I(I:P2In)RRI$J[op!$RAYKIKJR f$%2JTe)B]8Je)J-|S9JTRP JS)JTbR"1q))(KlrJTIO)$RI$I$%)$M B$I(P %):dҡ BX]3q$%@ ׵$O _:? 4IwMN=G%1-HA 8` &&)!FRRI:bRiR )I$THLDI$OnB@JI"aCe8'hQRPIIN fQ6%HZ!"S5QsuJI"*2@蒗I4)$()pIK$2q)&9jJRd4`΅9R)!;LNS"S QRJe$mI(Ґ mS) IEJے-Kl%p0R%*NlD+-쐲R/6&-kRGt$rAPZpSSơ3ܔʄwes^7L%+U/A֤Y*e gR V;-)Rh.)>p!-4pKb`)2yKAFp\:hZYnZ DT:RfUT\+D''ښ !CM= lưR<8NDJ/NJJ $W':4"#D-S(TR /LQRM|T g$IwPTݪbԔtLoB=)ItM:PƊ[A+2›-PRk)DH$6žPNǢ$V3Z $ANҞTKj#=pJ@ARQNTe%.dJ~|Ӄ))d)QhRLF g_ 8tTʷHV"Jn2]]) bD'蜨%H8)zG)Q"'ODꟄܠ8I$JI'HLI$B i*RI$VU.s*ii6V~xA LVI$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$GJRI$_`hz&O*)!I$'T)EJL$IP> %8t()ܢL$2II0HHY$$$Hpa$ԹH?)dI:l-@Q))Ie:ud\{(Pj=aPQR)'~DfqniYm:" a:* 0 !@*<:+b] 6U=LUVƩFqbW iB'ou!P"S ,}%,l-{T,"$iKyH)ڒNI AIJI Hhy !: Y(I$* 0BJZm *-%\rpꎄ*[1%0R4'CNI$ :Q{h<&M!)*;J )IBRe#aA'TotBCC)I$٪4B:Y=BBT7<2TJE) JyQ P'DF:e;BrJe)()H9E8 )tIj`BDJS0 p$(RBA%0qEL"ʒD"4s)>JRЖ1.ޘxI*jA$]=IJRI<% IRڙ2I)iN:I)5'JRd6QIRJ@$]%PM% %7VQ⊙JtTf$jHM'VHCyqCIZ#N2`-~qAJa%0?ӢS`lD>A>y*p5.DMP1 PցO btJ5<'M }J o/ (%69AH D$.$25Jy;)K.A)@q ,wxI&RBxM 'O . m䀍10xALl.wS4Q|H=H?(3mL-!ߺûPR K4(cJVP wFOp4NkV R=9q ND xH9LS)9(]$xR#HJRA(I$NsYRRRRۂR% a3;l!1tV%;ISa28 ÙJH^RQ-\NDod%G L %*aJp;$%)P=Q\|Q>q n>*dO'M I '}{ }ed蒗З)K1 @:JRRBDt;N HRJb{ڃšJPh%1%-%)O))Qʉl%%%1ܤ $IRI$&RI$R$JI<)IJ$IIJI$I$RI$I$I(I>ҠZRJS!M)ZIKjxG09P64 NrAI#eyQ#ZڜI$)t o))IJI'ڜ<2RRN^ueMJ8N׹S)lxQ/BJb<&ڍ&œ?weiJ˂bcm))h)IBP>"Ҕ(ֶuJ SN$.R$5&P)0EK9I"$+N pBJ$!rB¢8jXJADj:J S$'Ei!e%,$ˆ0a3Ou-Jb$rT#5IKxIDuGBiSM 7!B %L%A$H2I3f4ITO gR!&))A"I21w))R% rNq@$$09Q&)L tZ-"Q-=V. IEL^B%3\ZJPwNuL9N8HhRRE$#l AI@Pp(ķH5I$~&6˜IJLSeA RR Mt)JE)IK!9L]"{JRRj:p*LBd䨝T4$$I5D1cHQI"PC NuʒdGy%J))b!"I& Ss %PR֊QL NQB+l2P g %I+1:(L'kR26(LBgCvҠRT `'"I$ g5$TL(N8R1IJ$r ]$I8LHRdO)PI()PW &NhOE)$ IJ铥 %PIRI$nSK+XTS|B:yXi- Y!gI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I% )I$I"3vtמR)$J MmFUp\LS!ԅj{9ڄ@B򔦅X`+6u[2RAqi@ R$AdtJBt%.dBb0JJRu0 '%.dB*))I'N ve8))d)&aiQH$&sARLf槸*SFB^CYM+mFJvDmD5kVQ5VɞTZyA Mn(ک)pS9hD8 Kۡ [*^QA j j>S(SD'HPGL4ޞmǞSĄ!gTjm h+*,@`E QZIH L:P6bbJ M!$-DRU >jG% fdvQ Jg)IIA Z>g̦X };$L>OܖtJ<ɀGWT7IJ4Dz}& RG6~)JZ90}Sh[i>j[ hx;IKD Ky)!%)-S>Ir{"y $qTsJcHy=tsk[D 6> )[I 1'ILgRE`j92 d0*fKUf7{ILMo$*H68F(Xyw8`$R*p'G⡸|~ R?B<%MĦdNa-w0VѩEK J@-Ĩ:skZ%j_jd1I).JVHmC˜꒖%2RBtao ̈́)$H6Q%,'&y>֍eBS$I*I"|q>(iJJbe! I"|Jp8ILd)HJ SRR)JbRD6n|pID6tI%.A$I:JRI$4)RPv ׆$Sd>VvEI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IO )I$I){n"^)I$U:6 zk%^pR4U*c>RSJdBv#J^TRjS <,'h(c;'pApuC79*H͚7O 'KIl)7ԨyC}D6B1" 6'TvU_Nx*m{TOtC--6[bRCS4IA+t&R$:H)d(N{' p:I7 ))d$JA RR$di)J]2RB@$JJRI$ & JRI'S)PJFTwD(N,$BR` ӔLB@(IJH̗1`$(ԵG*KH= 6,Y;cT}GUAq#W9N &R !O>ރSE{vBqP/% \5҈Jr'UIE uNtHH)Ta; %A:`-F)1"JnRI4E0DҒI$&N $I"4O0JIY$Q.I:RS%%%)4'I:@& M))d:bBhR%@*RढFGu!d6bAA`)O ;T6iw%2uHAVS{|RPȨDEIeҁJ`ҥ  RAJ$ZOgu {$IIK$ ta8j\ )IJIQ-D.Q'rJ\OA.ka*R$IBRiIż=K$ tcDHM)dܩmQpIJI)" dR铦(&!&))d$(On& 0) Rҧ RJiHL$Ktpr*S (K)e8r[IVDД(34DRޒ)a(AJ&zp()AU>J>$A)UE{{)J-RJd9KrY<^IPRYJP'ޫ{BI @脩I%1oC! u|R5ToCo&k4T\*mrʐ'lJ]NRUSYLDrC'̨LԈJ`{)m=x|͏wzdu=&8:撘t$;BSk<[$qQ.H?⋰% j { !%1䔸gdO hRB?LDIKu0s%(4J!)H90 })KIJI>KsϐLY<7ZJJ[Dtmbc1Y;J:O*RRCos I Z$ ”% R)Jd(EJI<IJI$IAKjJRd)JS&IKJRI$ᲑRd$R$JE)I%)JdRI$I%)$NI%)$O)JdJJRI$*BQΉ)I&/h{B,٨Nwr n m44A ZS8ZxvD#ݐG䔘i Ju8j( n2ilhT<[LZb&$RLPQu`wVCeKДiVR ޤ*W_Ѭ HJ|P&EXLM)(VH!%2ID9<mO )t$D)T'QO( e6ԔI$ɓI)tIE<'LI&I)I$dB*RI$(J )I$IJRI2P'2I&ڐp!JRI&R7LRSۀDAZbpA=ú#hc))@MM-𡽧ׄI"UIySqFqcFJw -RLr4C}-''w) Цy)@TS%p!:iJTe8oRHAKNLR&5Q,H@QS))IZ;!XPp铅:̦ʋ]@"Sp*DGxd'5ʐjMr}ȡiJR!4!(GC 'Q H(7D FÚX=ETBUN L4MJ@`8O*<$RBt٪>)a,&(193F)Q! c"N I$I$$ī#-XXֶYK>Э$I%:*?`VW% o2I$Jo$#[m_̗2?U$I) o2_`VW$I$J2?U}#[m_̒I$*?`VW% o2I$Jo$#[m_̗2?U$I) o2_`VW$I$J2?U}#[m_̒I$*?`VW% o2I$Jo$#[m_̗2?U$I) o2_`VW$I$J2?U}#[m_̒I$*?`VW% o2I$Jo$#[m_̗2?U$I) o2_`VW$I$J2?U}#[m_̒I$*?`VW% o2I$Jo$#[m_̗2?U$I) o2_`VW$I$J2?U}9=8n$$I)I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$JuRm0Or)I$RIh7s314]$JίpܭF$B4]2IF׊pA)%EkQ ^S)a(EkS iQ.MlMb#X8PK9QsEP.)KGG`*d$1k‚\!I# wv) :h6 <1WKBx"& (r( FNӻNiFdFСi4P$pB >(O0TKyM% 0FڜN]*0\ P )BI̎%2dNI7))$$Ih򒔒I$:$$:BT Rd^QC'l({$T*Nr,&!B5D:J:dDNSL I$ !ILQRR&N$'I*I$0%,$pJRIK$$(p$J<O n}"rvP\T -@RJ J۝DL8BmQU3{(vR #nТ BT$M(d4Rs@QL$)ZI'ERKRm.VTFXT}4DǮ^渡 2T!H'2@Dd )LR )ܝQR&18IKI% D)j8J IJI$ɂw2SIJJS}5V4ũ)yO*@ŤVB rBSQڒ$'(H$'L%-”$e$$=8i4ILbxIKiI% RA$vML3DRR& J[Q gJԺR$2o);I$F9TYhq&Ѳbk)mNUJ!VpOBЬBbpI$I$*]#w}]TG6zI$JnI$I)I$I$JRI$I$^-fۜJ*>YΞn;h揍v~kI$S^v}b?y敕1y蕡zgF~%.K$I)عXfIc_h7UaĆ !V긴kY_x}%}]mY4V<VI$Ǩ}e {}M$4mڮfӇQ0w+iꙒIds:~goպpasX<7;ogI$INӃP[8K<=GةMe>"7oWK.PIc5֒I$CA̫ _{J2V%Yoh{ H>^I$ώ4>:g?ҳt<,n=A"{pnEM{˜$bI$Q^[˽+I ;u~+;,ƸDnӺE5?!K}ۜ7LY$I%:ؿX&Nv^zqq% EŢ^;*!GOZeU:sIS֒I$ϪNZܗj~Ua"9J:637аJEjs\~ I$Rձzc76xUY Ӌ`%?,>MC?ӎxï3+a텭sus>I$:Ÿa?ߺo^V1#vo9RRI$RI$I$I$I%)$I$IJU:_+jO I$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$IN\JRI$]A竍hhM)$ɐq!('W$8 R$4MO=[JRI@)MFĤJLb(jM)ԥJD@'$wJEhDF֓KDJO(n%D"2u:)NI`Yv#C}h$ \yI I2tj+ej (' rY @l7 v{'h7&It 3gvQr<l!sPnJecv)G!Mf]<$XJSRRNhH$$I:dJI$S)ƩBI$NʧTjԤ( q)%m=yTIRF+75'+ٰL*6;YcMUG PW2^ª:f!)5VbJRTxI3r%II(JR BI$:'J$8I(IK)$R$$L}dI)HJRRNIh)mIJI2R;HI8lL10LV|('Qܢl JpSkR$M*mĪ⢦ڥYM#H(}̩ 9*P%/MН>HFLAflQ/|:LIQNJrJ(P|'$IڣB`HS}(NHNPO*-aD @n(%(ICd R AKiI%*P"$RLr!!JT$Re ԔRJTBm$J;"@J!*H*I)8!@`$>2dI:JRRR'L'삔1I0pRI@&  )t$S0S$* Dmh)tJb*{T(F)FSJl)BxR I,QxSQ%.JiQ&$JH)BI(NJ]$&I:ddH4 Mt$LdӤM)JRRR0>JGbPR'ڞS)4O%- *IB< (M|) R4))L)C=%1FgpP&tAK' d& 4(p(-#c{u >C<(7LYG^QqfQw.'!~>e'=V>ԒGa) 1(=@l%1>() DSQCO \UwDy2Rh )J%I4jRI$l!NSBJT$8Ra=ԋa0oJ]1JR#RM )d$)IK)-0?LPHJ%<DCALtHVXu RI4[A)q4P/)J IQ$$J RxQ= *m9)!n1LNu)IL)R) N<(Z%A ):}2%- 'L $")tI6Զ' )RI(KbJRR)I%!%8M )Rd)*{S$*SBI)t$aI'Ԕ$9ttIE<RI% 'LJM !I$ i$$g^(mO :Jdp(Y8)% )'J"ԔbHKRdx'-Q/ &wp5e pSA΂HP*JHڅ(IiN(EM `JRIvQ)÷|PR$B\) TIIS%3IKI'$Ҡ rNIԁ <Ʃ)ItAQxL*L=C% }H&$)ND"B')$ RIS<&IT\Z&:$ ' %Q 9t1G b hHhBA*%:E$qDiJI1H(@[PK(M JRF%8I1RO*)C:I%)$VNI2e"))IIK:K)Jk$I%N$)H֒i)DQ/C OOd(V̔ңSO0)!p)b2tJTIR))RpHd$PoPJBI §"eT!tAM(HԤH)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$*]#w}]TG6zI$JnI$I)I$I$JRI$I$1']nK/ØCog'?ѽ$I%;@$j fuUzkg^Gl:P;3["ǭTû:K[;eI$SSb\*xQqrqX k8osDꦟ;fC~QgӃ6@ԒI$]jOKm$}^wlķ*M$npwvW#dcîsHa#?bsr؂I$޺%.?]X_X٣}fKGfh  =ٺllWLo~cI$S/=p==@i}g4@t1zTy2~"I$Jl}`XtY~8XjȭV~o$I$^v}Gw~T=:hsL/>2qgI$?\E[}Jį%X#k}o=VdK'dŭ4@^$I)0C(i%4ϴm\7ճمnRn^- }Q7lFOս:f'tI$IM/]Q/@q%?k]OWvNԳ:jzՌ I!Hn6{,]m{knא76f7rI$JyL::[}XXOͿ}s˙Ww]9!;~zXqXoWlI$IL~\ܶcwYm<#gꀁ }\㟞W)5I$IJI$I$RI$I$I$I%)T\?/kI$Sm$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$QYc )I$u:[^Ck!M)$ҚP(k@.U^W%2I$D 4BJRI&O @(6PLDkT' JRSJM ` ! %2ua<yRI8Dc\{U!DL8++Ԭpy,%yCyP}m/3Aza3X_y%]szk, 0x@x3IXYfkSG)=fj<IyiQ3Y)k#ܜ24: '׈P+cƂ\4J rb䀤 I O n)Tҝ2bBT[%pH$T[`(5D9,uM Je4),QHL $'ILM2N2 ,I(™6Ԕ铦آXG |$ JT)$R mAJI2R5N[)PQR%)&"()I$0 'JR&I2PI JBt𒔒I(t'IGjmP$%)$ -Rd J:bJLQO*% QuB:dԚDx's!I# ]"bRF˜'"RZ& AENqR[$*b)jRNSpl!8|P`%! URP8>\#E7QРI& J'P))Iu #=drwJTi;B5U Ve"#h]%:K*i غfZDGtYJJbP=7J[;~  OcΑz 5g $L7)Q.J)d QeS*P D)J)TTTdSp$U)$iR0TQ*=ԡ"JI&"BbR)$d'I)LI$钔:I!4JJ[$BIZNI )M,$)rS(Zb R .%R'VJBDKpBR?NQ!(D.)+U# !H)BP#SJ JI'L)8ATN}ţ_ ,@'UI$.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$*]#w}]TG6zI$JnI$I)I$I$JRI$I$F =\6bOsGXt:L5Ϣ?~ѻnĒI$S1o,;tl\[`szjtي9ƸsX+kUTide>I$Jtjb*qk{v6oV-nEF5_K\}[e7dV;m,K:7>^ }o$I$Y8_>{Ypjk[`0AmV5< pisgbO} a->ַoI$ySo^vL_A#+Z&FX}f1%a N,qPީF#=cXck$I%;eVSY$& gnY=0ݜ̀E?sz7ꫢ^iauOI$;n?HoVs͙;Aik:Oxf&K?RͭoͤI$J6 90;"eI-9R鵹K9`ƆLm2nKߠI$_>ͻ1r13Y`yN5RfWN}5eAc͞Q1}p{Y`fߧ]vlI$IN/Y˳Ѣ렝clг z%=.0ͯsY{1t$I)I$.ɶ/MKn7ӯi$I)L Bh:c=`˫w/[b'Ge5f/n#XoVv$I$u%[X.I]I$JRƹ[U:_$I$I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$[JpRRI$:b79^ktDi4LNYth"U)&I0OFR%)$)(DjʊJY:I'N5E I$2u)*%:H)hN%IFa$I% ҔBI$% $IN )t$R!&蒗I xN;'hvyFTLJN!]Tճ9rH$XqþC\ VېIUaw*)DD1ƪtVC)L)šI$|8HKTI81D~Ty(I$stE%)$$)I'LtIJI$4'I$$%yQ)$H$1 )I$$rJY$O $ bQRI(N%) JSDJT$I)$I&NS$IJ1IKI$2 RI'J)Jh3*RdK $pɄ))Ivy) RI$N dRI%-N &qL&L&9IJI:J`$aDJRR'L% %))I$I' $$e蜄JJ]$R!J!$I$')rR $ U609IJI1*%F4R RK%SJdBt$% TCथ iIO)t$2R 'IK%2I'M )t1L *PNpI 'LPRLdNMR$5RkQP4{H mj8$@I:EĥdR$O BS $%)&M BD))t*.*J02uS IH'G%,tr`S )dKa3̤'L&IATIJ'IL!-PIKm BIԧw)JSmR%<$ !JxI)'%,$!pa%(E"x(E '9OIK)&QyDk\e !9(v l$Bx tDj@PYw(h@֘-(4$7$( j 1J](I%=ɉ)%))d$&''LE9%)$(@JpĔJTbSآD$$SQ Z&NS&N R)$S&R )dBe0DXr-u2]1 (PW,#TZ8)m$xQi&uD5Ƈ*I'!aJW>Q{ MiIBr@m%$&FL TD5HT@o%&~)p!DJHPv ky@@$ 5JHɞ'Dpip(@TEM7EX Dn:z`jSn26%&Ucwt3q%7w - ԃWp*~ J\J QY'U1PV6k>(.! t꣸@C@ B qve!I[l$I?)l𒔒d eF! <RO> JDBhIJN)RR$}6 RRҔbN)gJ\'L#%D蝥$.銕pR$[uP!IiEKBI)LZ]CT$ ĀJl* LTN M)N)B$O H1L IJTQ:$JIB`qIK'O <$"RRJdTd'Kll%,xJLʐIL% $Lt%.dBAI(IK4T $ҕR=%j@$RDziB4JPnT pÕ6"tٙi @D-ה\@(݁Q<өk"@)n ZqCu)4IȻAR4"D]0@A"N ;)QVyP a!8CƪXs3QC1vQҀ /+ufStZXJiXw U t$_M*'W(P*F~eup$(#t vP;dp-,I$;'ƈ^A\,4{j8Rm Tn  8DJI$I$*]#w}]TG6zI$JnI$I)I$Im11]}?Eվ %v=?j9~OGeK80\ I$KS׋m:kB#Zv);)5)J>ܾH#/1`FR_?zyI$ItOG`s`P:ؿln&4sz|}qǓɇY_c4}&p_|\jI$>8hk|Z}jqNECZDJ(rrɆYnxq?ϙ1?I.m%ͮRz۰}Ob<^G=d(3| I$2ɃU!VK;kv(8g9'22}(g00Lxx>U$KItc9069]\,uN夏W{Q!O+.,0C抒I%VM;c .b}߳5?y&sˊ0@H"Iri+]/ fd6y?>2< 1pM93˂'G$KImޘ[ Nnk*z]L{'2Hcdž|^BQxh|"I%$NnΩ]Ɏ~.}W08f2;D5Zv[^C?wtw[:N/}YPz9=6kXn9r?FImV:_?7b5V {WG#T鵏5kzUq".wk,G0l{l55 iͿ шMosDn?M/ zy l`mN淈sLL  ޡQkngϾEgWϪ2>[q75J˲T􃋫i6TL|6Ert6l5=g"I$ zSr6.UYup{=?/kI$Sm$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$'FPp $RM)$* IUK%KGd<J)T:A'FT%)2tnHRIJ% &IKҤE$J`Р+RA]DLS 9R N)"$EMB[j{TINJ+*N֣1Q2VB}΄3X]#cQ: )/RhA"TNX ISy 2Ep $Ld,VFP]i^SSJ `!HI:t\N8O0*N)I3IJI$I(I:ISPN)LJ]2tjJRRJBg9FRIKO $L ()I$iR$$btIK:iKHI$hH)RRI2`%)$(dJ]$H'LJRd))%,$IRI'N)JJY$R RN91J'M)JIr'TI)Q8L4J &CiNE?*R򔨦A"_NT8Fl)P/ BR&RZDRB#[Dށ<%JgDzr4"P!6SI8jb!IGT])LSJ04mAFl.>)hD&'w;* e$R*HIYcIII$ȎWHDu^ 3%$JTCRƉ9l($))RQR IY$򣴩@$'S!V'I,L\ɀNRI$I$I$$I'I%)(I$[IKjH RJ4"&!4B:}LHtN$JRIJdɋIYR.5 \)1 $$ J[J[S$(I:yI(LtIK$u4ɥ-)d(H$8LpI"vPrIT8M)BA?))tL%Lu"TJCD)d$R-H%))E0Nq))dI&9HBnSGJQH'I"HRi )ItK5IK$2bJ<RI$ Lm)mIJI4)N b%.:J[TT9J%,N5pyH(ڑh:iH .SrL$T -A:dB Je@I&NM ӄL-B*$J^RLIIN J]2tp AJI 8'xtTI$ aFa\dLDT!;[LyP8ILLL&(*m X~)TR‰wЖЏYmz9-*DE#xs}yFN $2DD*ɏVUA;"JrKUHTGЎ\!:hII+U!RtT}WL8N-L6')5 byRI$j\))tBPKt"%)% )ΪmwbM)L . )t' ())I$$$I$I$xDhmRQO$JRKiRSj IJҒI4Yh:j)5I)R!A%.I$(BI)I:Ja(ħ )hI:d tMI LtNOPQe('!$BAln$9HМ!6Jj&)JdJmJIY)I2ԦR*0I$BGT2JRI$J`dP1IJI$mTIJJSIaHjTLI !8AJ:HAIҵ1!4)F Q* =)`TTPJNJRI&I$$I8 (IJiJSmKl')yJS&PQu`SjxPJS;nmΧ9 %)%HoN{uns 8Bm!I:I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$*]#w}]TG6zI$JnI$I)I$/<[dVG']־Gֆ>GKSscV')F1ɇ9OJF&\IduOA8$XYN˹;Bǀէ諧8rc| rQc&xNX☖>:RI$ o_(Y?Kf g[@o~jGһk,ZL;OǛ d?~^}C5œ.Y舏8_:I%Ӽ\8xZK)ZCjkO<~wG*2q+K[:x7jYqYql!q8!3\ qI$ԧןO{Hw?Պ-WXa]g_B_j1Ms&ye9rBsGؖ21)2LJ.\pr ^G=6j" mz}Rc~ Lm8p80?b ˒3rKQg꿛RI$)4uZ\?mYwɹ> gc}y1͟ j:I$JioC?6UMfgѳIŋMVVE_kEfwWKI;[9ٙ{3_ʃ}6摹ÿYt'>}6[#z=:=F9O]=7Sk07wW6.:?7Z- 1T6Mxlۇ@ksL$}(R_ʋzmcl3q!wzvȽw~g(o{%O0K.R2&Gy& ѭcXYhmnaYpN7#VONu# {vX[s2678N0]vENIQ)\Jƺ4}i~+1$IF³[cpoi6"tVN5$I)I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$HT\cDL*i5RI44'ڒTd򘔂&)$R )IK%)$tJS$LDSJJRI$ *A)$)T;j(QQ)7*/7P%8 IQ"!IΔ)p0NMkQ둠T%Ajm8*k j2XWui!0l&sI6IׄU7:t읭0[a"i%aG"1bU 2TFk;XȫХcC*"WƶB.RkaI$JI$1)RI2A%$Td#PIӦJSJY$JE"JRt$RO )I$$LI2t7*@$N2d4$IK $9)RI$ TaHiJRdHHۓnI$9)$%)$O)RRI$ $RI$D䦔I$IKN:tR%.)M* Kjp TҔ2iR RB4^ST(S["TuJSJ[a"AH6RR)M)Gh)lD NkFl% l ~{0œVGdV̸Q^bPM9*>JIbTFOΊmR ) k0=)Q=:ɕ[47_Q%xcDn5c4J CI9(Og& 4Wm{*j̔x9)MʼDPrt]JR(N8LRHt$Ҥ ̦ܒIBbSnLL)LS$<$:%TT$pw*HEKA$k ն4Lב vIT岢Dp b:pR$JqR)N)^RLP$)I$}R$I'N'AK$I$$I:I$I: RI$I$I'JRI,t'Q. { &R !Z<[la*ꅩ"1ԃ@Op*) 'I:}BIJLtRhL:b '^R#ƉÓQna!I!;]SCRNDLM*DܩS$8 I9)%)$Ӊ)]R"RR$R (IK%bRIK)QJ%9l !%):iOpAࠥ&O ):4nPEa)RJ[#Q*LЫ,&%0&w * zqX FB<(nn-R0ZATC{+vWWM"v.N>h2Q^C-@t-tJ)M%tJSRRdBL'$!nKPĤ$LT`$20Le9 .I)5ݓ)'I+t<'$IKiM)O}JT'M)'S <j7@ғ ,w*b w5" : zi(@j MWI2tqmPd>Ф#DsTR *bL%)mJ!4)nS))RPDB&$M)(JМVRJŒ> njԔ%SʏtSIJI $R"!8 )t$Ru SBpBJY:dO2$L 94IJ)Lr@M Jz qy!- RD:(4$xJH9D&AJ:uSrTI&I(NHRI$% "&)$ 0j5%,2R Lt$ )tH$loCHIKBPIF4$)hR<&M4)J^Rɔ(Jd)BxNB ]$(Bb%%.2J)BA.RA:P"&JR*EDT\ԈR%ਅ.Ta;PJyHSl%,ANA6:RKQ(*%$5NS"% H)RdmLIOQB'2Ra)NyIJ24&ة$J[$UBNV"K*{1´u $-XxRXbK*Mա(Ϭ8СkpT+LV]rƟOl訝rdf~l*2UQp#)SiDĮJ% 'uS Dc !EiME΄&JDst "PTIS )$S SW)$S)8E Bt(L‰ %t) !]:(JAA<}-0S-|&ۨЬqQi M)I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$*]#w}]TG6zI$JnI$I)I$I$JRI$I$I$I$$I$I)I$JUT\y%EuPz`0.5IpCThoQslVƴme_,\8^v<4Ԧ=I|OWYi^v-n\6 vWصzum 5%d_)&#*fKhzsEq;c#}oRY{ T7#}S{at^VH鶹ϡVM_y買oikt?槻XzI}g\;Mbe9Zrpl6cU>^EVխu-=6>U9@4%;yg\zMqjU:}6"^GQs9'YMPk-REٍmM{ֻAUK9>vnο~quU =O ow=T5ǿkU>V]7=c\&[v~ŝsooIy:n7J˯,mo6WzιhP=|4A\qn{ c.= vS:nv0"+Bm^2Zao?*)}\>:Ъ~F>#ve@^ލ/{wK9tqIk;kMMvC+SgNs蠭&kYs5fu[=??-L=7w>'ZJQKN;n9`{w[+Wýֆh!vW9 ǫrsE5%`.5fc k ?jWՋVC`f]aiƲ'U>:n=Fk*eXf置;}=ƿ7}deؖ6YU ,s}3Xd>+P͎piUoB]8uK=@6>*JIyl >/5 C[,ί?W:^OF_:*ݿE{Ic=?\ݸR[c Y`%#GG؄,[./cK]f5?1W&w]PM7h_ITgQeʈ4s7{Yyb>s+46cMV럟n>>4EBe3*}a5FЗ_Z0wUm-u;\tZo.A$=Us1A,i>sg3rsDͨӐoa7gQw$I)\AqoeUԭ5SZY^M \?F$+ik tWrI$Jy::V%2lȹX\=}Ьt.^&K3ʚ*&}0{_[G>1{yc^k/{n`zuĒI$XLJh~ޢ,ZYL{տSn=7i=m?z*I$JRƹ[U:_$I$I$I$I$I$$I$I)I$I$JRI$I)1 )I$KNm )_`&iJU~%i YO)\S JJ]$Ҕ)$NtҜ*RI&d'$(rHФЖIJLRH4$ lIXbCjwY'N8 Bv$O l@a$<ұ(OtC=۪3^J v`X $KDР;#sPl%kQIZϾ$o~9v]+Ӹ'e<[h'Dҙ1*&E5NSҙ%,$IJRI$RM )I%)8$I$$'LI% JRIN$)d$JTIL:JRRe$*I2`) }ҭI&%)P)HЂWI$ %:$'L4 )RI2i9%)$$'YIJLiL:S )tL2ʊJ]$Н"RRRI:Z(I$G(hRRI1HBBk%?(&*%|> '0x@Rw@'NN8)*ـ(&Av~pNԶwʉt蘐l'"dN&/u!ON\+Eqy(WdmoKi {C'd" DuWX {'pG3O}UK%FH*0K+(c{"fedKepa @'1䟄Ǻ[te7?@*^A1ʩx 4"؀(qhV  mDBueI[ r)ЈҦP dI")HI%)$H@dLH)BJ]2I$L%).RL L6%.LJrXQxH$J)N)Tt$ I'IJI$L$L$I)I'I$I%,PtJtI2tAJI$I$𒔒I2IO )t&.pj *tR*]8l(@3rRAK LL %)I$e7<')$I%)LS$d% ΉIKJڦ IJ1 Vsi V2߹VeEa " jG A [ʎYvEF!Ja-II<2H3s|ah4Q(ЄJ4I CTvFO:"`%E8ڠ/P"dC$S4@ i@[I~x5pI$I$*]#w}]TG6zI$JnI$I)I$I$JRI$I$I$I$$I$I)I$JKt񼴷Q:9TI%)P]1l2ߢgSYkww7Vpvc9f>,S~{ۖNCYK7F}I=sY[F=[g["Ilfqɯ%Z5SZKjY+{[S}1Y)$y}G;zǿu{SSp_e6Yk nu]GnsgR+`=G1_nߣRfM@cZ#wީH c"ӻZ;cɫq%۬s>h$~W]>mMckcgqnoPI%hXYx\iy d:L^^Gf6v׷cFi}f{(`cӿ[-:MȨdݱKoY$bUf-_+.vS_]$I$RI$I$I$I%)$I$IJU:_+jO I$I$I$RI$I$I$I%)$I$IJI$Vq)%Xho&I jLIiQ' QRNbҒNIʂJRI$ˆS,R ( %.A$JAN"&)&*a l0uEjĥ1L9'PK(NA:E$ )I$@@4v qN *LS O  0Ң%DEjѷW($A.Ӳm@#: Y:-SL\L2pIJIRI$% JRI$2tȡI$J2THtN%*'I9)Jd$NGTA$)$&H!I5ҭtIPaM.n 4HH 3)TX`ԅnLO(ʉ)mP0q Dy"Ʀjq(\GqHQ6)6Bj&)*/p zr Q΁|D {ƺ)5N ` ?Ȓ^ƻE^{C[ȔQ0pE*7Bf&n֩<(Hvۜ tMǕ(QDl H 7)V7R TJcwBq#۪A+TULC@'r:#H-ٸq qh\^$LC}&ĐS<)5朿q J6PHݪF"rUلNT\cTڅ) P)I쒖RL$T)$'QrIӴR )dH$pR%)J`JvNIRmɉ)@O0ڤ&$S)I$I*LI$I)I$I'IJI$)&NI$IR$d铤$I$I)I$IQ.)2I$r#7ZIJPf n))N/oO#Z;Z rcTA,8yNZb;!kQq# R]iP`m CB.[ M in}==W0kGu/MD `bƻ`QUٷ \Ϣ o<❁f)ײHh.#N m{ ƪ6{ӪC oUVU0LUFEoM1+lPŀ )fN[ʊjY$&<$I% JRI$M)' )I$`%%)M %I&NS)$N2tI( ')%)$GD%,(I:@$5R%)$($R)I$2Snj͑ ^Skt I&NI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$*]#w}]TG6zI$JnI$I)I$I$JRI$I$I$I$1c8=gt[}8vU[kR{+U:+Jf^[#;v=5wی({"I$JlgힷK7oݿٽ{fo׾+8_fƾMնlglgUUD}Y4vz~/3sjckvR2S8g5nemOBW?ҭއ^V^nkYY56m%)$I)Zr.ʪe}{=F?~W웯߮Ui\milήdX}g?Hw6]!c C궯Sg.s/6}i'k*Uc~ѤI$^Xtֶ[um/,kWr=6lv32ƺƚsI;ѿ}2C;ۑpu+Y]{?\Sf+U7V+mgz>BI$~*+} տ.,cm ~zB,2F;Z >o0bgUfٕ],Ā7=7U 44b6I{gI$IM{~SԲlv:,~ =;}zWzՐLicƮ@-uy;\wט+,u8I=Y'Q~nCj#ݍy~coYUԒI$u~:mc}ak}o3#= r/56=yeV;Szo*lsIydb屖YK?}bd}W-ƿߗUZ)jziYI$IM꾶ۍ̚~-y-6czMf{-Edm7zfƹW`ٱcmwA/^w\P*&^EV7RT_YG=~=Vh}̪uޭ8LXVd`֧ԩDI$ db0ȵXngU+VS6mSln3 1?e?TF%XMfk]kuZm^z_+neNfMxhH]I$S߬~Q[wo}1pٿ?Gzʣ~ⶳuVCCO];}_IԭʽOi:WSľz1nKu]p9Q3>aSUF%vUCKݵ:SS?Mz$I):WUwP62,kU>ڬ_53[}5WMVw۲(s_,z~t$I)I$I$JRI$I$I$I$*?/kSrI$JmI$I)I$I$JRI$I$I$a0pJRI&S;+@')˔:dĨ*dJ )I'Q%8)$!%)$L( *RI$Dd)b $IvФҊ*PO)L"&)$4I)$TH!(II8 R$@0(NL&)k~)9 :%(H%=A*I.LJRIO &*Y$$TJIBI$'LQRI$ҞS$Rd1IK$ QI< $I 3(2uLjDg8-vQq!6Ӆ6)4KIVY3PP'E'7̭}#U 0x=g K{5w EFzL79(HWCĕ4*h2@,;Ɨy+P٪ɒSBYUQ<'LI$IP:a]o*JFT[{P$ΉV=Ҋ JmDBIK)JiI@@B e)Œ)('NBdIQǂHRb%"ĠRRҒDРJQ))RI$jy $~C)PtҏEzH4D)$2ySgQ@?(zh+5v+8<ǚp+LP>' ]piLVxSU;D-QߎƅCeyͼhU@܂ߥR]JN ?) /HeI>{+V=0%lnRޫz qOe b{ x?=~}a 3nCRdADs%Q[XheL I'G0 7MQJ$"`5B)RR lAE D%i/RL$i=ѴR JpȻ;ƙEa-o LBs䕪ĄRѺBoptR&; U54Gd G,S<!U{>LʦjSe4'UoBvU4@G>S_XhIAGnI. $?H(zLuV P nR )nQ"Ɲ FT;AB(*:O) x(N솭}YIM5p'1kOu5_QݢNRI&Q"R$O)JhI%)$NS$$I$AJI$LMtI1)$ ]$Ԇ *XI$NIJI$BPVVel2ծPPS SaBKC+D"4MC$JtI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$*]#w}]TG6zI$JnI$I)I$I$JRI$I$\${gU}lꃧ}.ӄn{[I$hb͡605 ^p̛ӿCW{$FGknOK11,qI^7ffG$I$3*fh%GTԽCG^eI:ڟ#[67T]'Z8u <4T܆Umo^]Ti$I).͢f {GWh>ϲs@i62l/3PX)O-[W۔˱g}>1iwfdoYug7zVz_ w I$SMˡ֚c X7պ?Hc,0,>m;g_5tSǮ?j3^(m}[/Mj}hȫ[)csj5Ze6}4I$m6z>=Hݷpݷ}-mȭvxxE1[[jF7S_W?g=?jL:vUyA>ۆ]$3 [nMUogez_,@I$̺*ƶQI72Zhm6I`pkȿޢm[f.{6م͘~>GOUR􍘘y/V܏=ه^I$J{pq7@.wb_Qf3 ~fEŲ zN+KCs-O}-f?pbEbm2+2}UN/RI$Sc9n=k9~zJuk n-[_^miƳ (4Q]C &7coo2ݏVf6?CF~s_Av\~u 2^պ}zuU>/$I$+ǶI1D_۸1,p{\ Y[mv~~n3r_~h<ΥTYәF9ŤZ]ɭcYWYw_7$I)ʺ56Umn`;K[77N-kX^ֱ.^􋀷VdM̴)gK2M͡}u[w?Տ`b~ck'c[hNW/I$J{w}aA)! k_b:zv^xoGӏO\-i"]oU  ?mqi$I)q~c2]UWJ*_=7zO\KzKLcf=W2nܪZF޷~I$I$I$$I$I)I$I$JRƹ[U:_$I$I$I$I$I$$I$&8cAIJI$\Or` \E$ɒĦT bN:tTEJI$ڜ)HFJSJbDALLIO:J]$' CQBI1KiJQB$&  LH'R%I:dJIIJI$9HS')HQ(I$I8L RI$101A* I0)'E I$%)RI:t$JY$N$%.I'I2JRI$ ml 6%M4AHL0uOĨ)P͐ڏ#FN'Yk>tn$MeqQ]g0H*UlI ҙ5wO8Auo2e$sܣ ʰBvCGgkP2;"6~\\"Snlŕ$J2*()I'I"RI$$I0N))I$Q)%> IJI$LR!8%.In  Mh(E1:bQN@(D S2|S4)I<->he-)Zmi*[|SQR qkq[LwHesBbΊ/q$n -q!H7IrRIThM-:m J&Щ#K p8A㪲4-:Jg=D^S ֆ)1[D9RsS0y(w:H GRoTkw:x)ID$uP.e*5R@TCnAY $]N{HH5n5JF*Z)t 'UhJGdշMQ{+Yt3FVj:H@hh☒hʄB2t1NL))I$&J PIBtJ]2I$RKaP1QܙD Hx)L$Q%"((U2PɓNI'I<"&HL$R&I A I$t%)$I)I&HL\JRIt /-K% ID WXALeH0)S$$2A(LBI$О#EJJS'LL LRI:N 0t&J .$FI$I4E1 )PI%{&%.I'JB\&e%)$SNJnQv Y"a%)H:aЦ#N,$u >JnAΧ`ߕ&&;`)XB'4(8Z@%)+jmK& 6DފǷib W1!ZPPŴQ-lZ4ZaO\{dp EGCbTCJ~5YE8Q!D)S%.NDv)e)Q:9*2u)Q)9IJ$H&N4I LS)b S$铩5Q:pa%,Be$Ί'U#4$IE$I$;OdBJRbtF9ELJ@)ZҤ%1yFuIKD:8ʐqI &"TEȠHx&z{( $k*#Hy)ĄVD< && pە6M2cRT^; xHP,jVZpƊ$j.ِv0nrU۹ܨ= :&e^הOn#wټMr!@6 }N5QkS'2c-+5-tH%4a ΎyHK(ZV)<$tEHLO$yQ#D40<):ɚLiM, D0Js`S$)Q"S$ɥ:xLe0%%)$𒔦NS$I)R*PE2 :I)pI('D!JRI';MO))I")SB>))I%2<9RiPR$Z tZLEܫj)l졶S@VYxQjyE $DBU:3WujP,URx:Ub."z`Q`3o A^,no(Kaܢ$ iZY%[/ǃ-G(#@bۀТ@5,*! 㪸y!l &my(U[h'Q7ꩬ!¸ZAY֜9Kr3th )iRNd)ˡ IIKhP&%OjH]$ҞRRP |$InN%D)$"2yS XFI^wR- &!EܘI-wb;PX$pQ:,ʆ9DsU{Ij*gV5N[lPVISLvNɕK\J.S8q #G"46;;ȕZ<.ZMT\!$!! Y4!TP)&-]lI)PN%$)Qa:xM%IM I$IQa.0O `&Je $I$$Rd'%4 t &RM IJiJ$raL:P`D a"%Q򊑧NBhNSJE%)(O $RҚRBPN$Sƒ% ur1$, Ή!J0`em]ԬBwN˚Y͔J(Tiڎ 6T^)u TANGD)(ʓ<$ ֱ)KA("2 'Q JL|)Q )b%I4L t7$, P:6;R tu)q Z 8JtwAO)ơ+E0}9 "I!@591)3Z$- (أjnQ-%I:JX2$IJI$ħ铤2D$$IvФtMpI:dS$I'Ĥ%IQ)Q%.E:B#޵HUZ=7|RIE8Y $jI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$*]#w}]TG6zI$JnI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRd$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$*?/kSrI$JmI$I)I$I$JRI$vd𒔒I-H4h0bͺPOU64BsH XeeVE$ʎV|4))֟%mQMeDvOJipו&4䈄^ԁwj):f\ M3"t  KlHn&X*q0q M1dn's7 MM I&R/t򅦖 ʜ$uN|(!a2pTJt$%$'LT)JTRA2t3!8)dO [ӝRR BJ#E0W))LSBxR8lHJR10 vD W%F;IMIe2( ґI.Iӄ铄I$$$IJI$tTL$JIJR'LI$SxjNv*%%,4@!OQsE1()mNrTIM)$'I$8SRBLZĒhJ]$$pa(Q:"%)Q=⒖I:dJALSlJjNR ˜$$':ILLE2yM()t'LS$$L ))t'NN)#JRdL O1#[.:ba' 0yhSm#s|TgLR:p!׶aObD(/$cV׼(Eu^vDBUYLq 6T59\x\j>Fiy[|ctU(ضn!?CC U5")@øh Uv[)I%)B@SJRI&( M0) QqNJ) %.E &AJ~ P߂ "EO J❚}'Uj.BO1J͇M4IU6&hu"g uVl @xH*=DŽ4\NYޱxH47CE`AϹ6 bӻ)G )3z_@v8n Df@QtGD<Ҹ2lϒPiѤ)$–J,[ 8R'I2&S%.2J!LI/ %<)tO B`TIG JIJI$DNĶ&ܝ%-)JPKjpj`y'ӷiLmLw!Bg9L!A &&R"SILM '7i $BipkQ-&Qܟt)(/ I2rL(–RJBtT RR )$]eNQRmQV B6?pIReU^)a}S2ʼd*( {iF=B;,kR,3UbUw9JB29L%rpL0AN` VI9Q)(H@h 8 \9lrˤ5N )INTRIJL%)RAHb6>T5D J(xVFU[I$I$*gaY.$9.;9\I$I%4cgܗ|/,ĒI$SO>}~BϹ\I$I%4cgܗ|/,ĒI$SO>}~BϹ\I$I%4cgܗ|/,ĒI$SO>}~BϹ\I$I%4cgܗ|/,ĒI$SO>}~BϹ\I$I%4cgܗ|/,ĒI$SO>}~BϹ\I$I%4cgܗ|/,ĒI$SO>}~BϹ\I$I%4cgܗ|/,ĒI$SO>}~BϹ\I$I%4cgܗ|/,ĒI$SO>}~BϹ\I$I%4cgܗ|/,ĒI$SO>}~BϹ\I$I%4cgܗ|/,ĒI$SO>}7e- l$I$I$I$$I$I)I$% ZThП5\$ɡ202tH% )d铨'"n)I$hDJmI$RS5T:mE LiKJ2)T@)B)9LQ9 ba$jPc!S SBLWI0N' )$$$NIO)AI%.$I$JRI$I&))I$t&IJI$H&AJI$BI҄T铤IIJL$)L$$JA8L$&)$Jf)JvߣJPNJ\&MkO(]p uKJ)I(@$LxLW)$tҐIK$IJ@*(I'NJR2RI$II&2I)I$I0RI:e R%t $BsL5AJI2t)Z: @8)d]Ĩsy!G'+VA쥹)%OlrTMm?ֱM5U-vJ\KQ| ƨAیHkI8  (< }J|GA6c2 ;K@NgɚwhԨN">e;А!H70hh8UQ& 꽖*"Ju*A;"J$$:JRI$&!9I%):d5IH))IO*%$ܤ' $:n8M))IDҐ%*SRD;5 6Q|Bɶ(w>)o׀ƀ' ` K;EFΜ {"7TaFr&;[ipRdsT‘! mrF1$7r{]#9dc N y(5ݓNd&"5ԈHjyBq'BLRNJp%%,$S ))d钄<&KI()S@I2pHJ RI҄\\$!:JD,yLd$an& R\r (K΅h5qKoYI:j- qֆς#2uhQ.CՎX$}BmPl,"@ [V^`pSઍDZ*R \pQmO(]j)4*1*$$a=J !:*A֐m)!mO)>FJIY4&!>ŪAǺG-knO) ( Jo[a)%R!) TI'ҧm2BdJPՕ`Z4Y#Z&BӨ@5xWE͕nI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I+_mOlUͰН2|dTI$ڝD)HEJL4(by8)R-tҒJDq@.4IQ rHC6PN"4'D kGt'TH jtĤ$p)II% *M)2t:P5H5:jI4% :cIdt'LRbStJ'M )I$e%RL(H*\I N$%'I%.$$RI2@%$%E(I:yN$') JY$$Btҝ%)$$)'IJN%IJIK$ܦ*@&I$R<($:t2D& Q%!S)B PNd.9IKJU?XotYgpAb7OergDrPP=2J(P)r5CJS♶읖>t Mi .6%8/R x RۮXDxA{̀xS{1r .3#X5!AewMHq!>u=е%+ : Fv/#L_Q*N kAOxD! ֐a4h+#ګM 2ᣐ@>aG<L.äv*3qQeClxJILSڞ&n12U)% )JPBJs*P },S(N <$)$%- Bt$;ܒ<%O D=4.ӄ'% JRJH‰r2pR/2@J T% R A2#HY1)#hP&$bPR<%x PS$!1'PN PI(RM)%I&J$!2(]$&SbJJ^RL<'0 aS')I(NR2D$R))tIAnB d0EYaOb&2I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I+wl1ⴆ7O`R:d>*$"$J)JQRI% ~SₖM0 `(TRJ):d< $I' %)(H"RBtJI&I$TtH@v4p%M0)&JAKI%BI)I$I(I+)$)()$LSRBI${"A^əX%XP4h% ۟Y x.$Yx֞PQRt&$IK'I$ )BԲI'Q)DU 'Ja8)B'IH@"H) ʊDN$TI$"TIAJI:@$TSN'TsYS9YYh.0NI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$6>9%GVu$d+!$RI)M)&IJI$)BI$$I˜a&)b4)m($RSIKJRR4#'iPy" Pb㢬P1]J0C"I8I$$&0N )tI:xH$QB$A8H%)$'6)gSҢp QBN;J!'q'-uMJ$$$RI)M)Ĥ$2iN'ڔI'I $I<&I:A2xIJI$BxM)IJI:d%)$'I$R)BJY$$&N4IJLIBR10I򒔒tL%):dc) $I1H$PJZj4RtɉLGE"!@t@]2I҄J6~5)("΁ITۧAc9`h)"-*D \u*MOuq%Hb BS@ SBhnhFɦSHqM4hHO /vd OX)2ԩ0roTyhCwSIp *TAVTܣ:JLU; \4R#Ex! @(JH&IJ$Q%E'L:aIRpH:'187 …|Pnv@lȨS%:@CJI EOڨHDL%HA۹1yyI ML( 1R &IkJbR%@ G]4O(tN,?*BcTZJYR^rӓ $Vl3U :*<axp٦ YwV\ A|SfPOe9.T!DȸE"RWI$1LI)(d HRB҄!(NRI,$@$4N*[RBLRL J ]$J`BRdQ)d&Nb✅H yH#$PAOs'D)(VX}Q 4U=rͳ-{!+^qlۯreQ}ڨ!)Z@8#1uRk#E"? 73bƩRyIJL% wRpP"RR<& ӧSTIK$2A>Hथ%)&H5:RBJRI$d2JRt:p%1 JI)d$R PI'$J !I$x)BpIJI$&N IJI$@O0( RI$6im%ZiNN% U BI &kKp(Җ&R"SD!Jb1*٤ u$ %Jd$ )7T@E:b4( hApIL R$TJ~RI$>SWL;$ tE,NS( 9 ڂ&I""&)$ST2%AI$N&t$$J&NTBIɏ)PIИBAEtA4\&I<'hNBu"I1) Kj5U%)C{4NYO{Xm{LSmGw )@. +TZ_omb@Rg=@)NF )l Qj5s ômx}ZB tAJL FHR"m>Hjg@DFG(P)A6(FGt_L%JZxRP L&N8M))dI1L  \&"S+ հun /a>%d]ek{J՘V0.lM)ʧTti& ' ږ$@wM2h^I pLJbI5r:I$ ntP#TЊ+ xB'C/JjnV($2N 2ΥY D!K'.PJUSDaʈhAI%% Rn% S)I$)֩$J!mjZ"&I1)qiQ SڈR)4 KB)jl@VSh .'N47VvJ,sApfE )R!r`CfI2 IM%AV B'\IRM )t%*< aI])Q%8QE$A+u:$LLm[x:vnҜS(tҔL$铤 %)iIJI$E0A*I$H$$I*)%)2t8()L"5I 'I2IrVNI$5*NI&4$$J\R"NY)L A RSII%FSJJ!:hN)%:RI8LJʑQ))ttĦ%9Q%)$Y4|6҅ӤI$ RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I:M )I$[k$\$hr$ &I$ H *RI&PE B$@*`H$d)- BК2jn%$MN:j% U^@G$%b"Bm$I)NBpBI2pS)I$t2EJL2@"7J'Y1RH* 5-%7 BjpM\2I&JNI&JJQBI(NҒ$P)"HJ*%JtМ$I:JRI$<$BJRI$'JIJI$ɒO $JRH'LI$ҒP%.I$I)t$% $R$1I`a%.`9j䊂Ҥ ˆ*`ˆ Q]1 $Jh(!l%)J#T֝^4@CW 䏢*:'`SU^өE-E$GUn}.; `$ʃ" ^'e}% sʟLX; T\eD& Dc9|߽>(M2ꕤ ݪ0SN나!9TE#FTd5ƪ$'njQ p Z*2e2mS$I<&%8))I$ȅn * AN)T6hAY')<7+TY rt FAMT&J%8L t("TZETNt"8SvSh(%:JܤcgU!DG' C&  eLPK0B )I$8 tI'H($TĦ)')LJRhNyLD$<(Q,vRR)I"Si $BI$1N)lI I)M))5< փ;\b "L\gG)\e`<>PdKh T\CD>MFRѩ8-_UI)@2\t 'Ta<CQ ]J6[kXNH_9ULl"ZΕP(6hG SM HT:IP$RI$)ʉIJI$$R )IJI$JiE I(N NRR$":hIJI$s(IJI$$$$I)RI$"$(L%JSJtI8@A d7iD%@VF%Ui$B\u g@CuEsUDe R60ipeN|R0IBAFT\ВNIp))I$` JRd)JhR&#<%>ҊI 14$$)@NPRBtJSJP"BI$&RRJtRD;RAMEĢojTV@Pٮ`E1A6 *AGt$JSɊrIRR'L)HI'$%dJ$S 8RiO)(F*I2rTIҦXSlAVJT۪NjS`SKaDBGtIu@O)%*< ȄےJ$P iNHRI$%-SJ(AL4HI SHC92В$< % )IS 52*Y:E$(!$+lN1L 0R $ ҅6B#TFPV**eD4:(ڤ$Ӥ'PfU'6B&)CTQ+Q1:PpV4H9Si@*`'kK٦)H2'ȩdtАP:JP)JМ'R& ZISJPRJI&R2tН2I)"T:e)Z 1)Jj`6 FkyP>MF#6 S`S=?iwHCQ!Au08T(Y) 8 A"RrS H% BdïIKH'&N$IA+I"[CUd5 cK"ڀ F{j|hhXa?3Teʀ{GUr xMU9Qʪ[Y!‚'eJ铅I5r$pa v)!eBKI{PMhʗpdzEcZO}zJng6uoܣwFc̀ US+d[5EpU쬏ۨNjr;❠48AYefYCoT E7VHy(m<0{aTR2DpTP׃ G!uWTmlS !7` ҈.dҠ$)JSLJbSt$$&CE !!NP~P #QK2J3ZBC_Q eP%!-PVP:$ NY<&$ Jd)!tN)"!$R GtkB@' TST]$ڨƊ N k)jlhL^0PݢmФRl!L'FS LA $Ptty ,M *2E'I$Ĕ)AJI$(A+'I$<$IJR)IJJ \%- 'Lb AJN" pJI1I2rPR铦FouihA <8T:OeYpP{LY?wpQ ;j[_qhSF{7/AD(o;9H'@) P㓨[|hWTKp^QeDIV!DJjT$gQ*] pJdMB$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$KSV䬵c `HRb%%:)bt%2 $$I$$I$Q @&N$ILSD) R -a =A)Ae UJ;jq"! 2GUcQI(I$ )$$0I%)$I<&NI$BNLU! )B&^xRqhBmڦaN-6FI$S!xSڔ"M)JJPԔI)P!$MjJ]$ҚT&wQE dt$A*I$' E I$$H$A"dRД))d$.dI)Mr$I:dRI?)(%)$TS҂E2t$$J JxRLuIJI2tLx(R`Kn) hRDZi̧pCsKRa S:!] 3kb;).cYzDjT Œ:Q>q}5H#l;yDߕhLGt-8D,ƈwD4!Gwm98 R. ꔦ4T$-ÔHJR"IOrD$t'!D-9 U'M RFSb%$' r$N Ɖ99 A$`%JgXKmPbRqHW9vΩQ&T> (l LŠ !8! 5D0tNSPčS=ҙ3BO $.J)(oByEzJBb3T P)TJ d`M))$'N JN0NL2tJD$@$tLJRaIn4%) CDI 4' !I$~iN\dc1D|R\$R`RmsNu<|SPkGڋ$ZK"Ot'Xt qiTa{;IhӒE{ujټ01C8O[EaB 8nhRVb-!F#b}HDʮ-$TIJpTI'LShI')$I&%:I*N:D&8KI8)BpNI!$IK$PPnS'I(I0)RI)NBI)IHO ]$I8L5NRI%1*nv Hb"Uc IS#ETE*Iuԧ!87t(g%tI"JRtҒAjAJQ*ReHJTe%ZJښaI^RJO(Rv<':pe3$' $HHhd%)' "&JRP&S%J]%R BRjE%.Rp-HRjBmI)ɀRIKt0<L'NTJ~ɡ,$!hNJRQ)̦%)$I:AHI6@$BPJEҚJp%- $&%" 4'M05LB[RJ'I#Rjk !d4–4HVJJRI"$5"60Fe6xS-PИ<'RdJm_{l"^_`jSFD3q ]*MtL#5%Wp/lL\R/WTtM$$J>%".t$(!9%2:*@ 'iH 1NpȇURN:aʛHˆNS%2!;;B*]11Gk硖x&;iN 9RJ )%)$턒I)H$HJnR)BH'I:IB RdJS )$$)4RI&%F{aJD"A`"L\6yN(zvSL$G mlئ*| &׀8E!S$*A"5(M H)dI1O I' "V))$R$!I$b[$*tkTND#-+5ǒqS0hlpsa<|l&J@ v?hf(8[4kB^Ң]\29D;qQl BxQ(HQNTH'!4&%t铤SJY$SU4hD$HT7JuR%;چFk!U~(HTZ6*Ȁ$vt))D'°n)5j PCe]ʘ RhALLb )d(SSBJZSP S$4CL%Gkǚ!Gep H;F%P<|6¸ 8JcůE!:o^uYS{yīWw/u໇B .Axy dgWݥN(he/O'vy 5Щ} "**[S6Q2SKI RM *I'Rm(p%R$vRE#-IQ-QpBҹvh>4H0)$HACN18J Bc()HdĔRJNtRPRRbSTI%)wMZ$I8*!8)I$IELRI$JE2 ]$)R RI$HJJRd+iXuw*5؍S+HkdP"F([Q_P_irg2eT&fV $ANjWMLN8ThΦ}y*i t:I$ RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IA%)$ZX69͂bױ. ddQ铩BhN *RL`H$$Mj$hҦS ĨʑQ:( O_&%4ʐdreX!+[&RTwWiDRQ :I%I$JAFIJL2p$I&NpI$)$H'ROJRI&F5͞o;V:j ћHtFM:y CL7L2.&*isBIE Su -f4ɎA+=|RDHD` )IIjL&%yI8hN@A$:I$*RI$I%4$IQRH'LL@'A+dI$I1)$%.:d'LBJRt $:I)‰IJI2p)AH$$1O)\&.IK$xLD„aH)RBb hQ\yHBZ%uRCL!@ҰI0Ts$tL)4'i#TT")4Q*"YT"uO &%:d- I%(%I$IӥI$DڤI]$P*2Jh%.$2jhR$)4LR \'!IN6JNԩwPY()R1NvЅw*lljh> [(4jc0Hʑ)( M µHN ,k#88xE 7F2*ɡ3(<{J%zXZUg^٭Т)2 P )nJTe)IJ$L TIJLS(Ф] )iR* %bTIL\\N)J윹 ꂕ !(NI8H$I%H5)$Sc'P1VL ѡ<,,\P$)9bEJ6";x& M~j*92k*|j>;JGj{6p*A4'I+I$I)EJI$LI!I$d %I$'I $4)&I*I4$S$LhI9I%.$a J(ΪM||PfSBzDq eEeAЕ^bF0 E(L:wEnNU6n3Z xxS/@ I+>򇸎(Z{JBM$BK) SSI$M N%):dN2H)tܧIhf!WDz ,:,2)|(6BZ*J;p@6Sm`&Ѣ譊E Rp@*2N'Q)ڑ I? uY4:t:"(]9B{䡱$us#M " h!NT%8Ph aDo)r% NRɓ*M0RR&RM JdQNxD/P&E HL(%Z4 ;8ʫ @8—A9'8=}03|5=Q(.q ;I)  x[3@*RN* UvPqQBe8{~ `'Qj py jy{`r(A4fG aD% TdM)rTtA R$t4%)2tD(M80S$B4M9a<(S)Nn(a i-tCILP@ @y'H(Н%"hLOdPRIBRS Jt$RNSB ]$ $I$ IH "5- Bt:*%%):d' PJI$:I)I$?)orEBJRmI@ʐqLHNJqYhHL^!@U;emiL@u܅]cTg OTR0H*mv4MB$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Hlx@L-LzHRI&VG$R $&I:E4$J@$IShP%;QBJtЦB a)1K-RH "(TS"h'"RSO))0%D&{%,)8Or){&:A$(xEJI$ %)2I$%%)$IQN|@&$PO(A?H8H|RS c50>*`%JfJv2Skx2Sir Odމ9rA+uK„I]$NO R$xQRL)2I ))IBI&I$򒔒I$E2JRI'O & JY$LT3*Ԝ( ?)mHjI)I:b)$Q A2yH)t$E4()d$M%Mi)ItD'i.2Ni`t)% faE2:4O ÔӺc >iQE%@Bi+_JAQR7juJ<JI0N:nSpI)BBRI*I:b'Q%4P9E<$R:I% B*RRuN4I %)ɝ ";kmrqAV2eZ}uL/O*қƻ5YP"'T+LXN IU9D,'eP 6" qX (m*^=@ Za2o X v@'UdBJ߭94TàxxHV +>h7d<е#r\ETzR`uH9MDwC"W2S}EX (!hP؋ X"V~( 9Q 䄭" %O*#E6S.kPPiD\&e#uQ@MvBmpBT0h%?BbnPjLTK(D - RJ"BR a>Ѝ"&Q.Krʐ AZ)r mfPƴjRV1*%T ˸A6D'-{HxC@xC<+DڧhNm=m}(5-:tC|J'RܢJD&꒖$Ȕ)D'$JRDTK`J^RQI l).T NnL B%SARiI"(8jIIJNy(a%2!3Y$H1N4 RI$O)A*I$<& $)$NTyNJA$$O)NxQE $N7 )I$dLI$SINZij!vGHWLBI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$l/0M`1g!pRbII19)EK'LDФ$eRhH0A]1JS'4JnRRNe;Bf6B"DF'p)!I'R.)L P 5rE ' 8NJ]$I:@'EJI$ AEH$'I/A$JY9I$I(JR'JS!IIJL4Z)1`"JgwU0D " HЩ@ DauF^fJ%'fP}7J  kT%6:C`Vp'H$ i'2;{Dodmǂ #@P4Ss0ɔԲiITI&#N Vr =܈L!rt'' `OEݮ&R#TNuJW4$ӻ+/twJZJ'w)>RH 8mEmI[gLpq*L9 a)̡NQȚQ3+@D٪ԙAw2S L&h5R'M%I$t2pQR'L')BI$JJRI$'%0H$I(I<$dBA$$I2E)N$I$BA<$$THL )!I:iN BJRIJIB`R)PI'TSmT$$%R$:dSxJ.$&I8IKdO JnQJI:RQ!):d' J ]$'1*PP )QЧ 0$)AO%$R$S BI(bRRN)m!HҦJZS'!1 ?Jp.RVZtAK(Md !@jHRmp:)V{ʴ "S Rp$M1 UIBTy&!.I)' @IJI4)ħHI-R0RdIe<)Zt JsD.Ge'@!\JN5RL8wO (ƒ)bNJpH)@ILBt2' p"SH)tiIM/ $b,RFCs P7vJ!?#4A"D,2ZTIkz;@G>(;[Š&S,k{&ueICl(!:ڛj(P-2SSJʨ/ KriRi= ӁZCM)I9;xHpLDJK}$08iN͂!5s!tNRT^% 8$Ro vQ T %kA,2pd()%%,I2J@LDJu(<DTLR)! O+T AL"t#yI^B'U0 ɔL>iP"`N8NZe þE&( F;'P>I8A*E&D2<Bl򣴣?*M @BdB4P-K4AR0I:E$H'L!I$D$$$N4IKI%М!$.I&J'!%)$J)$$$I8LRI%&NN)b%0l)$yIGR$FRBb!&AJ:HpI)I&I4JdIM L&tN$'TdL$&NS)4)SI4$DJY:P)I2JRtJQiPS -0o:+T\lJT+"cHj.h:Hm)OB#@@2HaJ;Be2;E.i(YؤGvE-^EI#,<z 80HtNBjBjYD' RR&NO0 A)2tB'*giW}F)[$wl܆I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$oVUUSd2P)$I()$KrRRNHRI$ JRIF(QYELJ )8֤9crMA:j@wCM\:1p A%2)$hNN$%%)$LBP:d(O $R[mN֤% $SQ_0Y腒*P$?DP"P1)Nn09V꭬5sxMGQKbQpjiVP<)VRuOr;fi&ASk@*63a虖h;rW6O@Xd\<_L:SGqH<<8. F4I30*[Ot"$$nRI$Д'I%.dBP$H$EJI$% BHRI$𘤥$ pI$P'.RLIA+I$(IJI$ҢI%.$ܢE,'I8QHU (@q!8 tPTaA@]i'ےv& 5H>("JDd( ]!P6 : \%xf`jU0K\ $H4&I*RM (NBJ]2I&I8O )I$ xI$N&E )"Rd&V)LH%pE:I$%)$M)!8EJ)% I I P'L)JI&I !$$hIH$()EY$@(RH%yI$'M:J]$&Q*D&RR4JE$*R!4N M)$BJZ2PL IKI nS@2pRjJRyM)D6 r JR2eoup}\bi`nZ׹x%tB$h*WъBiEl*yV$$%I()$0E ' %L-d A%>S ORS BJRI9LӪ*QLP)DI$ ZCtc$#(=[PHKkQXERvl$; CaK|QfkrQ{ml7 Nhѯ ahY[|Z-*^)ny8*=ۇ0%)M#[AJJe< A+( I1 )yI2pBpI$MH$RI%$NJRI1 KjIRtJ$ A$SN:pRD&$ɜTI*EDQB铨8IUoebIYWmtPNI$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$AYJЈN\2t2%)$H"RI$ JRI&N0*`"e&B$'1rbS)ڇg*ePPr8QT!B;̈@:&@ꈠIŒ'IJL%"SJITINH)I&I Je%)$M:C%)$R$)%$,$%u <"2G\GpSvO KXXL4IÑAdIj)ҳx4(A' ѻT48pk5z#fl5=e<JN,t+D 4Nhsd>FҘo %7V<"bWdV]MA$K#wݓ6 8Pkd7[dH^c̠@HOtҦ %HA@ $8Mt I H&(RPtҒPI' LRE)2t JbRPu-ɉH$RRВI& dd)$PI% )I I)E2tR@ $R&!,R N $$A" )A$I$I)I$t$)I$P򔤥2e.R.I&8O*Ud҆>xQl&۔RSڠ lRiQtqDt0o#PH)rT bSAa!KqNR7h+@RQ"SRhI%HL %V jK<XsL!$%"ƙI1)JdL#Z&H *J*;U[biYBW)XjbUG{T h)N yA"mQ!.dSJJJ]$Q*0BhI I$B)bI(& 4"W )I$]AppSRHO*r9TyӔĔ'Nnm"?*'AShO8#suQ = Jvmv;>Z΍yCxo)`k|ʕtR")@w[\Zt‹A.N /h_vB>N"68>T+l$vMcA9 5kaI$I$RI$)N%)$LIJL$I$$I% )L$I$I”J!JLQOje8))H!$):I%Q!>ģV' Jm{!Ф dM$QIJLS)d0N4'Nd&NiVIQNtR&I$Н$II(L$'LS)IE I$𜤐 J*Y$LJA"S&tII )JY%$D% &QB)"ƉBxNGҞTSJ )ԞtH՚IDҢ ZP)PHrV%4g 7p h$,Z5Ѻr渲D B=ƅSeDXBC"hLBjM) L' 6䁔HI<*@'LCI"IQ)zr! AHm-nC2(eS)M\I:I%*$$I' JԶˆ #h4I? Sʐj[I%)A-)R7HUID98L A% *Н$M%IKB@'JTTxQ) TttIa)9E )JA1 !-)dZ"tU PT\h(pxU(eLJP(lhEx&*'TI6O"4EJ uLAU}gD*mS%H($mJtBҼMT@B(o\ (D2SJ !$O :h%3uS"TaDRĒuNAĶ"R !YcP /l5 +l+" mi\m+d5HUy VUI'571 reMz&=B/d;T{zs9@sCQscU#ZtQcril蝎 ׍SnjwPxOpr{[^Y$4þ*,$=nA dJI$锡1H)$$: RI$<"%)C")C$!I1M $I$$I% BI $IƉ)(Y:A1S H$'RՉJBhJ&N`a2 )4I$d<%%I%)'Te6))IdRTe 'I1)$$$xEJI$H5%)2IFuH*l6;Q09*]Bc?rj)%MP[%D7Ty5LԑE"b$HE"Tht:!!RV~H[2JS<(RDN|I1tZRQL 4MK$'L@BR:d)AKJRrA+% R 0)JJRd'IFS~SM0T.V%)2D$OxIU=IFYZʹ=dMBI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I"Ӈ>I)I$hP` %2E$КR)BI$8M JRI$DSEKS!4B+BhM b&hK6YڦkSN&&rM0"&!;Ar+ JPRQ a$$I:}' ƈI$0i*@BRRR$$$I<)4ˆ R)O΁Yk[Uk8'tഭDΞhF n)nAR],`{!0  5&{RN;V OrAʯvZ2 o*63QHr{)X<:F>ij0Pb!;5J*Bp=|S I p (;`}:e$',D{TB7h㔩V.5P)s|Jj-).کP01tI7@kC@VE!TIH0gaE"RvꤒIӦR 2t2t1E I(I:iI4$$t B Y$%xJ%%.iI2@''L)IJpH*a"I1IaMRAd_ʝE@$pUhL%`'N[Œ B)i+$@NH$&%:baO]Q#p ||A 8;v y2XvS !\*op1H̃lI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I+}8ş%QJ )INEAFE{" IJI$I$ܢ$J@5 S*MQ-`ĩs pԔtĥ*&D! IL%TL] ()!p`0RQ!8 )I$I a$TI$S )E2E$:xIKpIKTI#4-KjJRI%*U9Vk=ʨ )a8,(/Lv.doYBr5NI'T4S &ixnc)!<-C2żSu)mTG<4( /&eMl%vT.%IScBۦT+LpxMu{­Yunߔ.fz=ƉiceX~i@uoU'%(@(kG{;P({¨j'k x 6FxOA!K_ТuS-!$$(JbQLAJN$8I$:bd B PRJSJdΉR$N8JBI2`pWI$ d:"]I"QpNO E!pe%ǂ$Ʉ()dI$ %)$HK𒔒I$e I$$ɊrJ]$BxJ$d$R)AJN< I4$xN!8HB ɊxLBRjR j.R)O:hRsDM% ,NSp!yNu@HJQ1:& E(RIJRJ$(OZfW*B LA,A .JR 60*lRx)9VڈhOK^%NSĤT#DTc L*Or +ZBU,bg 9锹uFES 'GR2iD@$2mSB*d yP>BԋRS)JTe)B,EڛbHe)BRV6ũ)=bmBa )*)(%JS$IJ* 2H@B  jhtPR'FxBT䓧 ?Ӫ;`!OvѪ $`TX|s(eΈt:Ni̠N%Ws a^#i@as#T_)eE0^6T@BI$L$SJJ]2tI2JRI$JiM)I)N pI%1 4M*m"5N+D*-R1IE(b,m" eDvH`'!hR:iNJqlB4PE l&%M"҅(\r4 ?hꆅU.29t_p t6L (( SQ22I2IO M)&JaH)$JdTIK)'4(P)'I0NI"A$t$I*JI4:*0 pxLB*Y:d BhNI$N)IJDaF) yM)H5$N)Q8))tҒE<pSBc(*]d4<*N:xږ텢BlZ>j+8i*&4CzH:7mTeFRB5zN)&HKjJ)QBf(`*qFWrEP6!d_D&H!@T8#Jg)ObܢN*.`(%Xv YPpÊN`(&H'HJJPN@ J )MSIJIt)ŠDl)be4)p$(S'D3R!gipfS* )Lf&~/&QE[8D+@ [bBSKtG#;\{BEYJ7I@٢g[ (i@(̢,S uDJSʌ)Х0) RRBxI9mP!"'NH L0J)") IRN )DRЧAKSjdz*.(u+F>iэ) C[*o0}~I7QE"gEd rmkl/rDB㪈 )xAuv> Q: E+mjr\<Љ-S Ʈ#U n-;JвP:FcURC 8"fJ.F8n.sCQ!hBƐ`s: w`oQob[z5%| j PJjMGv@nkRU['UfB{[9A~?T[<$5U' B"vK4 tK!D(b*-D>LRY'*#MG  BI% RL) ĤRS$L$RV@)B'Q2yRiPdG (ʙ*%;SD(BmyR'ESΉ4'sJSMNIvīݦ*|jQlK|.N@EӐ桇՞F SŢakE5!ihcv)f a^FSBpR$)I:hOZI$&IJtQ: 2tINRI$HIҔ'DBВI')I? ƩIJLFI& 4Jk%3d Y'Q HNxJPRIICwj68 A+8?JmUj=DͶ R")S9I0)J'8 .S$JbSV5{=l\r* X37tof¹*jϤov;_ Njc#"vJjwJt'-(0[aD7U&nIuP#TkD0SI"QBН2xP)FGj d&HENT%5NN)N%%, tНMR!@RH'!2v@AB*MDR e%"0T8LBQ%5,Ҕ:vDiAB() Kɀ!M EaVIVA퐯6rF[ !J ;XX`f u\YU}QFͼC8U4t)5@D.uHyMJ&5R @ aqH3_RBJ!@h'I5K)$'JJ&O) ")$LJRI$ I%)$'HHpIJI$ԟ5J6ͽrEp$H!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&N&փⶃD$$D"J2I'H $IxKjxPJI›HBHmJQ*i$ BP5L QhD`N,HQ%9*0jl*5" Y TU'S̀H%)RLI@)ND"$RHRB%)JCT(<&"RIJA1%)(Ʃ)t$)JP%*I$Tj"J 55t@]U?qOJNiTjNllG蘃* p(kxrhVAN:K HElɁt8X5Ci`)Rw nio|Xg72# e Eb򛄓W/ :ID(`)NS%#HRI$$RLI'JJyIJI$$ RI"IɂHJ$Jt jSJA%,@)B[BdyX6ˆzwL\b ڤi E?³])IK䜸F~Dްʃ); 焽?!T@'H&kkaI$'$RI%:H)tI2}S)"&NLdIt$:HY$Mt"% $RLJRI$I)HhI2t Rt$I4$$tBIR'LyLJԤ"yLJPjBtQ).R: P8L&:$&NpALE"JUU@V1g|I 9JCDN k+N*Փ<)b=LqadqʮX; & [048 3CdÄŇKT݊oLJn{)IhMKK*^r@qK@I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$H7ⶁXx,i[mt II%I$H$JRI$dPI&S M)I*P' RRҔNTa9 0 BTÐ}JSf*=j[!d")' I$-;"&I2@%%DBt&RJa%*$ФRI4J@)4'$TR2tSQPtU&3)@8Jt"e@UHSEBQ;+jU6K%YtpOU@-hZan HABy),,&u&%Cq7UT.Ӆp(wW FzޙU0N"Qfm&8< 5MIsL#9MR *{K 5.%=8O(MpiEPtW5Ȅ͝T5=P>Jz yRM)!MhJJd0:pSI%"%-RLJRI'ڒqI)I$e&:b!1vD"R5)U)GtBNuV KMy(5*Np~Wk>(`T" âa=UmE6HWU rpT(AJ $$IBpSJRdM)JQRI$I$I$LRRI$&I<$iI  ^B @#jڦVyPquJ<RSRIYLRuKp R @8ƊMwbrTaL L梶6m҅)n:'i 'uprPT[`byVYA(6r}#(- $(jA-IFAi!SsdkçTR%1*mHMTG'&$cQJ*NP)%R0RI$JJRI$t$$I$JRI$I$I$E")8C%.Sa5,2p(}Ҙ(+' B\"WJ;dN }kIBq(FU x N}X(^w*FVg*#Y{Fc-,V[KW*i*m_qpאH*2jBh8L%$I.II$R:hOdR'I"9LI$xM RI$xOJRI&LD))I$$Z)˥))H' $WLRIJTڠ)өJhHELFJxJpyM()I$t&䢥$`)'.INI)"d$E"t%)I$Rt)I4$:I'I$RI$  ҢbRe< L I]2IBt2S )IN'SByO)R&seLK S !8QOtAK %)C[LKKHZyMN8:d4 ;L('<@ $ƁV-.Ԣ0o7RBv:^T܃]n[,N_"GtK[ Q@xJ@xuJ]$( `Bx RpSʊR 0Cj\)I%<$ r"dH*nC"N"$P)L {SA`BZ[AOLH Ep-.*H6 JihO) ZE&i9rbR*/`j(:T0:SCJc*M% 4):A(*njB\PR(L9RntbISi4jE`8)!ڧ'ASҖ<&JSJp$ ^r58%v@Ea K#w8LPK'꬀!>XX#NQ %-RH:wQ!@!XNvCaPҩ-@Fȶ0&3]ʛ$HhF OtmDR6$+p+^C S\U*ꎜdBd lQek +>ۇw ڨ>H3D6suXiv4'{hsvB ܥV'sA^(c~á\ԦeE SEqW5BR0j6 Sv0: cL[ȧ䟵  n3ʀ3+F0L wNuN!0ӔPɸMuM+ L'L%2r$4$t)<)*d)q#IHm;&SNfRi<'5H:R`t::~yA+I$j(jN iXTKTS nO2ZQS*)+邐HbSJ T$O iMSVN$)bRBIuITKJ5KjvPUtIrjDE(dR -2 IJHp7Z UЂ7MIL4Q$k`By2OLP:|Jp:Qb$铨xKj RIJJ0'IK:m@NJbRJI$9 &NA Yy8hIZ A:I$jI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Jt8ߊnV.+wZ涚!%$:E%I$Ju@BJRd(R L (RS)lL4S)RdpԚ bR*$)5g$IP%;DI7TlR՜aAjƗpjN^7Q snHEZj  R铦N !HTiNS$Dܔ*Rt$%KpHmI)NB RI$00 I NI2I RI:Q*M NLT"y!'ԥj0ФK')ǕZB, 贄7;Z8F /`<(;tArB,$%v ~Dj1|VɈa6ڭnܫ(WNT9ԋ o t6[;LQ+iR*hVY`~+iPjYjR;BoPDCmMP)4 `$*0j#))t$Oʏ n҄KڔRNR$ФI$:b JRAEk􀫀Q Ol77YEPJ4@PZdiq> g6JAȕZîݍ!SE5L + n4')H"@NRBtI$N:HRI$PyEK$2I)I% ӤI)IJ'LI$DRTI' SB*%9QI*m'E@$P\}$[eEര!Gt)aHR&Q UkJ CTSX\RkP* ޤZjR ; Nґ; %f0FJQ鯹R$Vh E A;QcV*D50N0PQₙ5AD@AI0R JR)IJI:ILJY$'4O)$JT$$\L(TQr ]8L&80NH]2I"1X. T'ȤC~(W'OXBDtהaJ^:RsӄU{c@3|9.lTE6vdA#݂E|S$y&:J\JRI1N%):dEK:P%-)'LRRAJI$I$RI$yH&I$:JRI$:PI$KDiVd&JR!2 ]$J%,I&<% "&I$$RS$ɒ)(NOD'B 2r&*E)Jd$II$N8IJL2A:P*RIJIu,:IINTLDr5+JI'(d)IRiRn2L銑nH*a L(pS-u H MQrD(W>q&F˜ XcYA@vOlǞ}I12do ;`p`AZC6 3}q䢱Ԏwţ];nh)=jePKiFB 5O]LbҿQ"VgD2Lp$#|SZ 1twR3<&x$ZУtFL(jTepb aǺNH*.cEq>CoAJD4S>f"J`\{PKT@\d Ⱦ9REJwH3*$tR&BRR($&'%.RyI)Q/Qp%@T'Ir@dPCHR)>Tw$D JiA JB8'4)ƓO8K'mĔ9h)mSkF ]vNP.B% )zaAē:tFrSzp{)AS(He'UGcp<(X29BJjNnBvv.eܢ8F"St( GDHL˧Hj%\E!d:pQX0ERItTE#(LJJ)RS (|50UxDn=n}N$hD#KY;i)nLݧU<4tH3HC@ډAmy<L W܈ltC"}U-(~o&PƮW@pB 5*EtnJ4b#Y:VSX6k{ 9 w Б_ґGJv7n>  V@MnzAn/# 7wU 0 $8[pHr3B!;DXFkt<){tBvIIúnޝL gթO3@4 vP\(C.+8L|HR)4\3OtQNJ\g$БH)$-Й(AJJII$$I"S(R*%Ӧ ӍtS,Ɗs"TtQ*|D&S J*] )BRʌ RNTJIdԲ & S[E1!0*E(NT%4'LSʋ6RRФd%!ԑ[4wEqP RJ鷔R GELJJBaʴ+jkh. 2{Kt<*9NAm;$uB R N8"Jf5R¢ wM xfA8IJI$:NS!4)&(%t$%gT% RJ^l8)N૲:5! 72ʋ9v~)$(CswџJ ǔ`n E/&ot:mfr Ӻt@ޯ#T'65vBH j/"eeo:_v9t8B)E`C(jڢNm&MxM\3Dޙᰙ*MN^ _; %Hm2yQMС8 J0e!H9):bQiIR! J<B 8HEK0Qi'Q*sؠ S(*ML %%. )J)4QIK'1wx&I*I 2J]$I)4$P%aPMi]aEDmI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$HcOcb[m TTNJ'I"$)*R%I1S)@BJb$˜ Q*$))B p qS[((=Ҕ0O DĦtIΩLNhBp4 ,Hhp)2@IjS9$QnVk5UX8V' +HG{OV\ .)5 rv?ò}ZʃW}gSr}/M#QoBTktG]rkkEYWƼ[^j! ^> IgNkyR&IW6 k@$*AE8 )d&!F%.SAhJPL$Gj\$$ʊp%%*钟6i)9H$T"HTѪvQoV3[B[-:xUy& D7grdzVk:*tyVn^aEIBqSrJf#BSd%9Q)) P'I4I$):I'2tI8SPHIKRLBrJ" %`S LRC$ .R%DEK SdBtX<*tWvS@,7ʥ@uZt@(3wJD*F4lr<&Hlm쨹W2 w* YconWJ IHک StI?II$I)I I$1)В IJIRI$I)$NRRI$4NTd'$$2rRITJI e9 EL$(LRI*I$&H $RH%$JBhO)J$h򔤥'JM)4$$I%:K$t&8(*NI)(pPJ'LSRI$PI"IyAKJ%JRJd)I &3J(tL:(D B)50R;5;h(uXs!ԩ4E#hAk@|SŬ(MA 2RgEwLZ!4i PF*aw dF4 V2!4mtM9>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$JUkąaT I-DA \$IHI$8 8 )IIL a#b*Y1)-%&SLJJ\$S"5ED"Pr(dPZe"JpB-%8l!`S"[7=0y`U;4Q oiSBjA$O(7~CX炞5Ai׿f8U}[B-gDR46X[®eDgBjR pRM xO pJa2Q)lJ1y*3(RAH VI<&HL$r %0(N4IJI$ԤR'Lڕ.T$'M)&hUڌ@$'I*ġ2wwNCZv|DVɜ[ʑהU` 仅VI:#Rk*{ʶ P pDc[`L;vFùU䛶uB{Q@n)$R'f=l2 XC^:pZgt :歃%;pO- vF:E}S'=tL^Uݔlڥl@G H!I+IH)d$xH)B$ҡ B$!t4 L$:d% RI$$$d)&I*I$BtH$&NSBJP%J]$JhLTdtЙJI NRJ))I$NILR$Sd$ rLt8lD%JRHҔ Pt)mNNJE$D蕍TawNVP"P.|h$SF6By`BJ`GLijjJ>:L| S='A0!M"H.tDɂ l!\QJZ;$ƅ&҇%Cx!Fa!j7-Di<+%$Q@Ӆ]x XC\:NAyG{a aJO`#@zkYZTNiFvWpJhN@H|PmH{ccBGcP3)LR<6fƭN #.ТPIU+i^  G ,'Q%BAҤ:CהuNBge4 ŠQ)E$I$I $I$bI%)IK$$M&Sh焒E (r(کJD)$TQ5 H)`2I뇸BǬp> ]p+Hi *UBxY64VKT Kd}q@~IHa#L >U-̴Xw(Bi~f3_W+[fPQJ iWK$J}Dj.tEhvӶf[ÌmA)aL&E ڡnLgT-) ,2$CPJQLyOΩesI+;%(xQid*)J(<(MꙐ$J*mweQ̈́DkRS69eE(2J PIG' SAj*T)%2'$$iL?$CL' (Ke@RPN Rڜ2iJT ;e;BHdTSbRpN!#杢RHRD*'DO*)҅h ^SHA)CT9%3ID9H8%6H2RR(O)2e-()tL rcvU+ hVպCEu ASPI$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'kL$$K[(X ϵŦBĸW *iWʈ"KR PRTL2)lQܤRRܒbp@dJ mD`>T6e-|()%MD)B IR*8Ea'>XuX#꫺ h p^0DiSbV1&NA"4^k08NH=hsR{\ `5VܪOе2enEdj*CLZOjI҄N%))I$ NJm()t -J PJRLjD)1EJ' N JJRI>@I H(J ZJԼ(RI%N yDS/"$FɝU@|%Ԃaµ Y6B]*p8S_ݤm7HQt<lj\ ^ s$iO*M~!EՐTF>m0XweNeeХ,\$$F$鉔FJ\IKU-*]"iJSBrBJRIJRER:'p)$Ѭ+uT@UZ%T譒;XVவU~r|˸I3FG(CО =4s&Q.3P2I<&I$NJI$iKTI$ $Pd)JS(ФJRIJiM HIEKܔ$4cpEIRrv6uEK082|pjdT6yH餞T Qke '&&T^N( QPUV)T[\+(DZINxA͡IJȽd5ӺƁXc|F !{ݯeٸKYH'L'F2TKD$ٻN|#Ql$K$S:zbJ;7"(Np?I&yO <*"CB )CHQGLj 1HƉJ\Y& Lΰ^D2K|R'L hwI;VfA:DQ C)(8QpTB&R4)&(8NbSyN 'Nj1 $t㢮lЊD&`#DKRTxLQ.ژ<|mgZx R.L|D"L tU#`hKl[)MD<T!aQ,IVșH(! R iH1G65$&r~\B#D@W(䀥#Ku E @R4fdwNELD@A6NhT H(Մ-[VXo T,06DoL͊>jT}:N8H;PJƉ҉Rkp[=qGBpZVpBC1H*Z0Xj*o7F.;y!C PQq=,2>Mh |w 0:v^OV[e 2 ) :' >i*@7IBNj!R$B`TR ' 7KT)0jL?R2Lr3aΨ)(HJbJJTI<&qQ-mIJI4*$*[S ]2RRi"R1)IJT\ $`𒔜(J))K8I0)JINVI)I2e(L|RFڞ!.iI4M)@HRtS B`$- SB$JRPd-RJ$-0)T4))I$p¢Nӄҥ䔂*4H 'KԂb$E:hSI)I&L$HLY$%HD&)tNI$R$I'#.)I$LR pԔ2R*xi%]o ZHY/y<{2ͺ,*>L Ra嬃S PhwYOY G/dAGEe k9L[$ xঽP&8R^ZRy xiЫe=YP.A5&%L(^ ez0-a:#Rh)Fn@7Mo!=U;Y5 )Y"V[|'d#7#IN!s!2$ y'UbcjaF!DM]iL0A{cTd< r;JaW-)J SW&!:MI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$KKnYuZk2 Rb%%*6PGuaNBI$hOEKBIɓRJR&JRTS $&%"H5> $ԩ(r| S2T(oqSC:PbT l X%Mp&EI*h4n& )&T,y*`DiTPw@ZaX $4L'y+OlI!T8(Z4YֳUuT+::IQ3Э,2U{UB;)Le(Qm)%F!; )A:b!6IL$9JtI$\2JJT$%Gr.eĄ$M &ɥ9))t $RI#(!j`e IIa '!jaAƪL%L knDQ;P:pZDФ8@)%0X.8P2T)tMڣVNSa-ԤXƊ:" =lO;RTЦ !1{ mBiHP` (B~T&SDSmM\jSdwS iD쇼Rj"TA!&5DoNRnЩnhNPC"?Um!v* Ӳt&G b9NcL|;+u͓mBhcU{L+*cT%7:'n$ujb N5L V)7 OZ!rl⎆jIMCd@Vֱiv 5lCnQ Gg]ҥm{@p5uUDygk>*mM"*̩9W yNUߪg2$fQڃQXQ 0K&h]Ԥ%E.T'I1)ŠEJ%:IL:InPRI:[P )hJOyQ)(^DIH *MrJZ*I*^!T밳QXJD׽5l' e&e*UN)=4*27 KJrTJHRxJI$@$$I:d$Bd$[*B*bR% PS-Q$L`$d"R"$iI$$QI1 %.tP26RS 1 DV )JII? $I"R)BGD$)H&)kQ%. H^8P" ai۽ dfJHK Fov!BAKZ n%կ(-SIn0IR3,XXtFUGnZ @-- "ׁo \u*lLH*fuNhQ&F i})4uI*onB##a,zr Qהlz*.:,=y ~Ď&epL+"O*^U5 P6 b kA,ZtSkFq*ΉBo m#:"J!8{=4ń# $JA:P%" $8Hkʔ1 d*FdKj$b LJG1N^P%-Rjb$*;IRmE<'J d%&0SRRg;11pRo')JiJa>pQ`d!9&KyAKvDQCg)< I+1ȬqP"oV̀i"VTmA @ʛjm 2I tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$]!lce6SŦB)J$)$ G)f&qW=֍%2HDNH)M)&HJ )RI8) TQL$JrTJP 8JR JQ M(%9 >NZMNFj4 Ot@P:P:5 'LJ[SiN'%4$BIRI$Ii&)$DDBJr%H R QLdh ZkFL’PXTJRHh RI&Npԥ<&%:hR @MZM*P%I"BN4LD)hQ\ʉ d)Q[ 䋡@t(wJpCLaR.㤦l$A" 4QZ`L(=Ӓ|TL L0rDiV&0=H?YA-T\`p-AM'S*-0$'j=ʉt7E)'1 'I)$2tAK$E*O &%4$%)JdBJRI$Rd&RRJRLBP$I)JaL)& ӄNpSJE2~D($`S@)BhHF% s"9 ruT)hN| KiQ պQ3GT)W I4@LHUYUgQ" 5*`*J84@LGQ)yVni ;NwKN)p)ߢaAG%'|+QZjOtvVt:PDjf &]m2<dj BgjtA+IHJPR&:qढѪ!K'w *%4'2J d <&)Jy %IIDAK@Ҙ'IJI:d1NSB*]$J%8J1I%>R)8E R JRLRR-O .w Y(N&B)SԈP&H5"RN hJBI)BHbBIʉLTaI JE%"R$&%$'L|T%*H'4L tR$)I$I$6QRI4 )tShPA!JQ%I@A<(%JI%mݢU[@*;+s1Q`V~Eۉ CFSPTiZ: XBtQll<R{4B$vB{GaA,@(X59Nnp`=._/:Hmw7SxTkj3wdG! EBdT`5ݐ ʐ q)h(eG<:B2%3mʘxBZ[J1)8r[D9P4QRt$eD &-IJe>S)nS%'(} 0BTAImM1I1J%)AK% 0) EWO*r&!섔J*CQ>j.hG{AdL1An' X*T88w*%/2f tBtI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I"cU[L=0M LJE2r rREr(IPԧI)`-&)4)JpRLi*AK@&QhS 'E - !@9HPXTQ!LnN5E&O1Ap(8 CeA岡X(n٪i Y )`XΤi­}-i¥v;)#F\ّ*)1[**5m[hQ "8L5NrJTI%Qh W!ADʉR<RkaMI f 8ʃ UxW)fahXdy+;'4}{i|NJoOtxB l%ƪP^2X^dUd{=TSD4 (cnW wLqkvnp( wIYWCsnITmAq~ ]Ji\nϢ>j;DDSS%ox742'UB{{'kDzA~UaS2 ;~)'y!=ӧe2ӷe\5d&!T0gB 9@!@҈ LDЊ !8P-M iALÊpT8N (%3'C!(SВR)J$B&!2)A%(M )I)PpQSzALtN $"Luh\')JJRI$BN(E"RRI$FR4IJLuNriPRJԠNI4$ D$LID҈ᢄ$Ө SH(H9Lr Xҝ#xR !°5@Q+&$% kRup%8“*6n&|J;)TJ zUsxB.h䠝i.~ut*'T'H&.\'I2pmTIK&NR*JtH$SJ)&)O 2)NIDAJI<$`,I%)$R$I:piJI2R8 8IK%$Q 9Q@R%.THO0)PLN J]"bh$2=Rܤ$S}D\tLQi;L5(: f%J)8AV!ML;K)@]W;2$:3n08IčR2@N*^SElF!3_ VX3ny-Cse;"@p 1= Sp X@99u=6'T PCr[B74$zšIeclDTf8\5ZKO*k(D+x*|SeHx*s#Tu+Be%"tˉ)) mS )@Q18i=;2T;%FSTd(nKr'R-QS)IFTJS)%jRe0!Lꘒ:'R;`pNT+'w6D͂"ו V C2`R)qBjU BtʔJ Y$LD'I2ppR'LAKjPTiO)ƪ`’*2P<ښHF|UIՎEO Fsï U(nGh])hHxB`nTvơH&A,R;4 % k ;&# p(US-C4DaJBG(n!G|)ip3D;q [hj4m=Aym{rAU6&ߢ3Kt*T:*nwJ\֦q~"â#F|fJ9Ah,n$& }РDSSiRPE eʃOg:"j\!M욾\Kv WяRR.WgޓeXk%"opY&I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I+]:53kLvCV)BKZ10UD,<&)TRɊtr T$:pRR ))JJe!D4' &dH0D)3C}{B2DB*u{"VcT2S$ S(Ԕ)M)JI)NIdN%*a)RJmɥ0H$.I'>8i%%(LJ[n.H 0\M> r@\b6ž ))J`T%*xǪ?DT&))DT 8IKQO QR:RS(𔤥JhS$])S R? )5H9 JIKJg&&_nmj3B+B -(@ySqA{=Z(uA 3c1ONU閪 QAN DC#g_{8R{ ڔ@М2c"vPծIQiWhSŤ>9*L$j3#*H] pSgSgԜ='_2Jΰ_QaSW^~ ~m gyRt2P%x =ڕa\fYN^S)*` PR  ˧U&$\)}! !GUeB-VHC{SJv#5ʓJ=v -D!DԶ 1j&9 TN (D!4$@SB&<Ta(R%2FR@ŪpELB$%M0Ta YpQVWBz۸AD P^) uMohڶrǢJOqRYk:^CC,̪ &`je RpݩN5O9 Jpc&ܛ`g*匆ʪL%É(WcЬ)P BA(%E2)B\)x'/GE-8tP;QH; f  nN M$$ R ջ]Qa8 ZM(M)8hC:(3AS9ҢLiMJɜW:l :)!PgVxPނPBZՊ( 0SPmʮRi!43uhNi AGVx-(mhQ5%8Jf])AX^%TPndqeTa k%GD|2]hZ]i#jwʆN wwI#@÷Q.4%&5h;BtB bD@;G*<J-pcLʃ\Fv4h #DaoF (i'du@ !\ N#(nJh +V>*q E6Ɇ@iz%^{p4iDٿA j5*v;qexM@9 n |BIJ)A33 n jQiREB`I# pm=Mɡ JILʈL4IH:Q7$@Q QN⠜MD,$Н)NH肔bNNJE%.A%aD@*$BJ\'M)FaJ4Q!I$&Nh %"JI- 0 ()pR%K`j)yI@#VcB(8)&!D)%LD$)2WL2 Z!t'PqIADBgA<&"yNSY'LD'BQ$rN:d $$Y1a)dS{%HaG32F\^gX#43VAX .! ogf5O+2ǝcb9Y:ҵ-dVrfU ڹL<215 G t\aZf1" V(fA򇗐چ酝oU`;eu! m%Zmm"Rh Qs:maHN~Чp}DTǰr)0{,1OSM{Yb]}EĒkF ȫ-h7AV " `HlLdIφJ d5P{WC59T6hQ+fBdI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I-.ҳSB*Rb@VnpwP!`)L$&SФ&HdD&S#ҕ)J) )R RB䨩Q!:pByEK&)1 @(D;Pĩ1JhI`jT@5)H(AR ESS)M*)B*Mb"b2ܘE TKD&D-RS D50HE)RRM a)o0wIK&NT P(@%38QnRl7%*RI%63)HbZNnTuJe$EJ'.Q2Sς@$$IB(𒔑 2&R#r3B$ ;T@%RR铥 p%-ҟt$JDڜ ħ܊ӪۢL&PR:`?4J[I'keN!E9Q{(SSBg(pt$JSSBrRS KjIQ)*@'Kr) HE BN)H'.RNIڤbe. 0(JJ*]E"TI&5-jJd[Tۢ#F "58 r(N)ڊ#B(b5(΄ Q5O =QOufj3!I1R^;B`1CnCISZЉCv|՜Ft>-n{'{)24lM |ʱ!JU &tt /04DF:ͬуqFSe!_EhQqS1)GNxQޜ&1(bR cR7E9 4R%"۵ yGx22;Ju'6JݹEa =BZj"J BIm9W0PHBhIIO*T!"@JpT!((M (6wVw*(&$RR$ dLNI<&O)D$IH%)$NDJRI$ ʔT(J7$1.JIO )O !8)$NhNT`')IuH3]Uh&0jZJ4@QADzGb`7 wHvL$rto) o 'D8Rh=ѤZ'@%E@FHRѧ]S TNTAᦊ,:2LvAZiw*4_T\p&(-oTKv㢓|Mbe-(YdR%Gdʆ(Up(sDġH=%+\3G8IHɜH)%DMSnLe>e5!P$JI4b1R'b I$JtЅ`I$HRjI]1)JNFnl2H,=sC v%a*ҞnrE.R!TDDLR)$D)hEJI$I$%I'II4$)!yI 3uvV76w歼:bn?n@U[Gne0<;4!E.ۂ;Nv_RLJ nGdi\(lFfMK0S`){T1rTIM)ЈApIO $ E{dJRA +TABJ>hXʰ!A(#DL\I'IШTTtL"4Q"Bqj7J[ΪQ*n `1iRQNdH$ (!ADʈH] ESE2ItИ$E9i̅H&5akeeD8[L4eɊOzCNT`p*dNQdڮh[DmQ( (J$mGUgKD<-( Y%:6+!PHxVy",F`l[>V:#$EwrYvL1*oxUkZAnҢi[jn_)9a)ֶ7&B3g n(-ժ\!eBs n!puS\Ll4!ڞu Usa<g҈7IUΉ7T-Tկv&q~ 9L>yE89).M ._w7QvV=I2㢢7hUj . {sXecB5Oe-vp‚8@W@[xp #n/@ڛ褦wzSIeh'0Gx zG2b0j#: GBJ(hnpѪsfBFM4xBҋ}aM*@Fx!8\w!6i#M|3A])DrID%Ty4Ra#\Zݺ6S_Mm H '$T^<RH(`i`7S)Çu"PRRSQ *zcQMSQi8Kd0n Bm݂ F_*Na?܉Vk{rZ #-"G-YK~8v1 (tYImWx³\8ha,f*ϔgTʷ `PliC۹6VZ%& '+c'cݬųʉodwp J0!:A+i%6lVd뢥?56a_jy$'7tfxCuH)nOBm(W7wB,+2ʝY WdKZ5IimST[b3o R]S*x2=/aIIV;/3\JŘVLI0p)I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$@V]YjTR%U{lh!8.h8NmqF *b*RE)Њ] za% Ԕ5L DoQ))bSBtP S)@1ڙHIDUJP I9jJfFa")AIKĥFR=ҢZ D'FS8O EAAL)M)&lNɚZT E<[3Z`(-8HQ-Uv:w+jsD) G)ÕCi?Ia4)m=JRGdO$ҜQؑ'&䤦$Ja Q\Glj()n/!8HH &Jj jJ]) @)^QؒJuSʈHLuIK鎩!L2RSǂCE 1M-)%J_rRS$S )yR;Xॺ4Q%%,\& p%D@ NTIIO4Qs&*.}SL)%mJt$:d)I$CU(H2T+N\ R:J](I ‹8S"Hb9Rz2aH"44+ vO/!7+`0,xXZyY-ӕb*Zœơ85:0H QAqg%cV75)ˣN uu*M$pYqP"TcZvϒ異$& =L<`1iM軫< yh)\F'OGI>/&Ȯ |Eh1.Tji=V5Oe|?)T''!7hObY@:' 3LI pTNӪVF[*.l#w PXE KDeeC 6‰ ˙<(G)$NAZeLB75sx>܀. (elEkQmò3m\Dԥ("1b% P$$>)QЧ S9JTABAVjIf#`Q+thUW6HDr$2D'PeI1NC)M)$XRڥQ.!yJS|ŒjO)$JD)%)$$O(JR)JS'kTĤe !r&>ݪpo(6dn:& \D;r#ZV0h#SIԢ9 Mv$U\ ꓵ'\ Od 74Цm-({G$4C.L+SI b |jxPmyHR:&T\TCJ()pmRL$րxFkb iB@%)J"&O)M D')R ӀZ,J)ˡD!LS`k|X!Rׇ8H5Q{|!`%qcZU\v1YTp*ͭ#BBP[yDUppɥ#Pt$$HIL pR%6#hXOPA8)$$I$I$,hNSZ)yL%)$$JI I"J$)K)JRP$B2T ;Q\FK6HtEp=ARkȵje>%i o Z KaW@ہHkNA (]F(h2*OvTd+ [K1L+nй S-6Fj&u[xЧeѡCɝjlyBkq{U[TBӱV}'dJ۴dXmj^} FOG{AL]m`Uv<;PQ7G({J)iMDi$' 8%T=EcEF)7 <!\2u=OB lTLQmn!%퐝EE)L(¨u|SJ.TQ&kLTdpҤXbSE *)ƒ)5)*.0(ҐohS)$")JpIp$LQi{,"IK$-VdZv V8:P)| R PtAߴeJb+ܢ+s V:p8j4V"4<'-Peʖ8J(fxLej4Pʋ(@AJXגŪѝl*y5^@M W+2vʫaI\g:7kVViS;!MA)i 00TT $BQv!BaHPꤐ0"PÒ T !eN%.JT*Mrp-1awB~l5]WsĨB&DFbu)D zxyo!> m02aL )MD'QPWLb Cl@F9RBAEY sf@=jHE ͅhW*a LTJE2jWN NSRR'I9o)tNZ:n5M(|$SBd I&[uR" L(2\@##XT@tN-!LXVVBL;R5P1 ܘԲ0N]BhM[)I yNW=7R{d,cTz2Mf9 H٨\Z~J-AW ahXaZ^4)떐;%"6*Ą!>!j<pHE\V#,WW75Ut@ad4H 4RtKUs8}[d!=ǒ$$+tVXuEBKrsdR (&?!4F )~RJRIN֧M%(Ĥ FL{  XV GuW^An0:j٫aceA+t &f|Uj5xG7 ̬~(83djVr|UHxir 8$Ջ Bll NU\qU -PNJ vꇍQcB\gوVT D@Bp))5ef{+\I6OtIH]XGr5tBZe1*t3qԫ%2 | [:C-F腾 gQٺI0-Ba*Ø愔C\`*5O[CqRJ`򒙆ʇƙ )~*[F@)EHi p:#PB yC.L!n Gk)D))%\" k|KPB,TBBRR_D&4tCm;sDB)yALh!5VnTQi$Gi )tUF Ji&{$A:R-|jgۨO1jJ]MA/@PSmѵ>M(N-%"`6 K8JfNPEi1Rw%7Tɣ88KT<ӒS/>%,\(@$BjJJk#!>{v*@;UB74f~Ho  צ˛*R%euUEUoJzD[A %>[v&UWQ#Puh EmE;TD!R=6i**=JpHe*'.g n=p]N;G 5WXfdG2\!%-ԕvCN<"C4I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$.-I)I$ݯ&> c& IM!4)VXpSsIׅΥQі"*%r*z.0 ;m$LTQANnk{F;pT4)LD)D$\ H4ʄʛRSJ JJA1%-&*"QD[Z($ (JxRPYiMЛj 2(JpS$R$B^ "TZ$VZǚpC}á:MWV蘇7d`{1RRS)N5SN0 pREHJbTbyS2|LIK) IJd&ʑi)ĔIRQH3BT!HBTJ&)8RBtj( "@x!)Ô HE""T]X(IIFktvSLZ[pul+ {`vGd'c\>8l 2-;, COsBݢvCK)1!LAMfDVa kP]cA/v;BEVy=e* mk\ \Z 2UC'ܴ* U dn+Jc]j[E) 24Q&() rJڕ-B)DL00 M 5RHh+"HfAVN(^Xbt<*ְDm|S<35TYd84b!IF%4pvmlmNDG `9ܔvP`Siu{|1&6%TAVZ̹,d΅ bj(S-SY̹ũV jHnZ XXXX5CzʕG0aISGp"p8C!4)BHdJP-L%Jg)J$"HRڒ$RI>ԡ%/ &(L@ P*^RLJALoRJh)Bb-;\4ׄ1 !"PsDyV乤y$KLvV/c*A֑NOE%[;,rx09!UdvU\"᪯eE|dƷt{ֺ~ @Ӕc>j›(׺xhCmB -7 a(N)ryLIGrEȡ'OjPkB}!D`S)7Jli}pjN i]SP"T\W%%&kHC tRM ILS`R"S'%4ʌ)h WJJSJv!;BjWR@Q6EkaXBt+ZT!R XV{Au7~w4Pֻ"P Hbג׹#=Q=eXoBOfֻEU>yt:!dd$cZ,ߒk=A+6r>%w)f檖0[9Mp2}[\$(r3r(ײ ADh&B]R%-i4Ho !*DSHN[#`$̧D 4N<)S"TFHM , Hi|,E8!" 9QC BACO~SBiA,$GtSC(0)&TԲLSa )vO Q"uQPCxWHfP˜@!1eL\%0I$Tƨj@ΨdI1S0%1 Ta }\tn2)B+U I$& RI&L~ ]$& A.I)4TdiB[=C$B!W]YA$A9(TMmu*FJYN-AФtGhA7@]N (M^nREEJ.$2NT؂ބBa^1 TRl' 6RLJiL\5EQ%9xIKpPH?W5o ?*Gm%TB_"|R@rFZAVhhn *x?E25OQ~39Y/n%g[=ΞJ^[/BPfP-ԧTypKF(f{nljТ% OYNsJ][T' a PKד n,r}Fq  {ʨ2[ S4Ȅ}) d:SΝԞ36z}Z66LW;cRS{BƆ#@QQThhQޡh^PH$JJS^K&6Рx/S RVN5BMk:G*-8fTc7?)^X\Ug;,ӯr W;]pk.~j S<5Uw &4f!ReÈVYh)K=6+JPoK {ݩ ))Df<9GpEaMQT;^ ? 6T^#9WI scPTt%2AU2oghBv1YG8iQ.3%6݇pـUM#67PΥ;!%6`#]nea]'YUf c @ʓI$E#D8RJ(i}zS9 hP0HPp%'*%1U@0IDmr!(nbJm$rY@T)ݢh2<3U )4'idILKKr6&)p!%..TĐL*9C! DAlUCXYY/aay]f^w+Hn6EL:[e$`]gEQL'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$@i"tBI%)2t>+?osG6t DVgPSY0E6/Mh!Wf)IE(7QS S$B£ eɷ+#u,i CGc j ܘe߾S]ˊ\J%Z.<S:H57=\JjAZIu.ʩKޫYձ Τ§BwV[/}ʏ|VBHq"^EL? 01}Uh,‹hJfI'Nhwk6Fi@xRmdz*M)_/eViNV[iЫJƍ@^=V#E`j%͠TBgp{P¬ʉHII!%W{HA))Ch!ܒ%GnP,yS6=bSZNYaB^ehmƉ)VY-UkZL|Pf1UrSn*u剉VY`IP0I8Qܘ9D'"LBIY4&!:y%I8)S(PN\R%DNJ)jE2Q.($Z4|bvX'w? {PKc$6|w4!3v<7V˸BR"6{)D8h@`[2@*deE\Ou(.ԫ_D&uS8WG.-'!=\+.q8˔Y)omڨ9ZiyC))<)nۧ@{iNj G$\xIL&-ҐhHQNdr.*!$(IKĔM0)IKPIJTJJRI PLJet^R%0H5LP:5O0`5S")))bSD@NJC>`4Qc ;ʹpnZs{H6[s*P"B0Tݩ84 U[5Wl VhT3ݒ ]:B^JRQ3I$PJR%( .2tI$TI$2yIJI$I$RH$0)BJRd$RМ$NLuRLL"' )"a8KR%5s0n4O  ^֖UA-alSbw*o`wUPCʛ* ڢe  'E742&T΅qV!Rae|MXU/2HQca-ڢ7ܫ+p*![tPvl8L- JYyN ('&g I:)Hc&RBTqE1! ;)$G !$vj\I*%99(%E8H& -6uQ+RcAErcI۪y{ xD51PIdHL0V% D>A,Ӆ $B#tAI(@;JAN)JbT ZHH BI"%I!I%)$ 0)R$SFRLDR!4 'LSp!2[()up鉅 @OͦKdw(A>uLJDQqpAT$rDyޢGtRp#f-`Ɗ&f׸'{jAAsk\jQrя>3 I@0* AI{I-v⇰!hYqD\dži6MV{9v?eQl8#kL[EK q>ebĠ$`d'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$JY!DϺ t,D'INYӪ;J& $I&JI$I$I$$I$I)I$I"SC0+^[Z7=JI2fxZ顟M,FFD̘FQ{C!5  KXΈNj,&-F> EʼnmGkԷ 4nH5ZiE FyE r#89V% &˜f-) 璦~ e @jʃΰ6ʜu)4Y "{6QPXCjJ7 Y$tFCQ5ʏUcPQK ^YhO*?HJVܤ ( 8rОRx26RIГNHRTĄ$SSJ$gLL&@1!(%$)pI62Rg:K T( liELκA&) (v M i!} i8*mvV֩H"9!˃FG!V=ڀ#D$xpSY])79Zq)(.nѧeR{[N$yyZ8GV3+4!WkRr(2!Ҥ64EK)uSI2HNJA>rХ L&a8H (OS@RhS0DcgA,\Cs;Uw )R@bE-Jz˝UZd [)QI6KpDM2r$'D2R&i5P&DRjB(j!L\uCqTɄN`BOt5"PnIRs`BMSSn fTиA~ָ5ߢ%|j҂O HAxcIjU]FE"8AiO()괗r.Z2BhXk)P>Fӗm;N DzʋP{J$AR@[Hӯehj&g \XD(QrI}[p A-Wi V)- {k]hmƈy]4\aZOnpcIN>+FRkGeriԙVhvVCƊ jfAI.WHV+V77)P!Zu )dL1|΅$!Q٨U\;!@@qYQ08I DwNAvi]}J);&TA>iGt`CxAU Ijk`ƀ4*c6*O 4$ q(T>+ʻZtD4<|L A mU_€v%6n۵FsKz,%Jv!0 =Ik5;{&nT%J%LDih#Xjk1BIo4Ʉ8nT@R$LԨm6Q2uQ-z˜1‰&DmjHH4Lc%9xPsE=>)#T$(oD ꚡ.B;(2I kDV e ”V\ey7V}O%2:葎Ɂ.#&ObF\eOSbRRkiJ{!aDJ)o[JJ"T t2γӷ;h׺" dT M,tpeCNA*I$I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$P^I3ks||+,x@ZxͭƨiIĨͤh5F%@ rV{D'JAyELS NRܡ (JZJBaED)(BMt%1ԥl CD"&BS(ڐEQ6Ў% DI W1GhB,%UR)RN*{|2Br*h)軕UENQkR 9 kp׸Ma'ՍPƿ[NVJi bl@IWlC5BY/aiPZ<#lzXIswd-fmTB-)RKntP.)`pLN1 /ot`O)!y&9<MMb9$e36hSaL5)C P DxILC.ĢRX- A=H9\@4+=-+>2MiFѪ \D"ƴq=۷tbtUU|k6=L냒ҫɼT-:^)jz+ڭʓ{!;I]LVsZXҞQ.M$S 4 pR E QR2"‰ EȍPhS%0 Cw(r*@)[L'b]Nx =8)nP)(bN>ȕ$1 tZ#DBMDQ%9PvpJ\uSkTQYgS5rj0jxRn7Q A%*\TʃRhSLО (jTBvP)=Z )})Pg8Sx A0 `$% e(Nt A(O Zb@gꜻ6䃔LS_t23hriO)mJ@JV[hRtjwG a+/Iˉ VňS0P7^ZZ33m䲳a 3rM3S5V!G)jٷrsYA쨽MAҘ K1q.@H#RZv[g]{$'mлoYx;k*#UԬps{.#ÞU'vy>%`u+66K^%+Mt+Ynp]FȶwmN-3ֺ)SʒSB]%*d(H4JyLxH5J{$ gAIJ%2E8ShݠGn{@=^Q[I`6U:LspMK[% 6+S$K~K'p2aU5FBxSg5WdBC`IVjvS4JwH ݼ÷? *D@LRFPwN0he;$-<;2lLenGy(C䤤꧱TQ1%?pMJe&k?qQ8L0EaDE2Cǻ77p@}G;G@k'Bs p&sא$G —!& )`‰)tQ0XD7 ƺG Q:$2dr n; JZmT'BFZg|WgU]F3lihq-2fpqEq%QI$C$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I)+?O0 uV `&ڞ]`{L} w&TGpJP3'aOb[SR\ No'%E"TKCD$)4xի\ReĖC75r0WG-;X[t;1+ ~9\ocjy:M2%@R pE3 SPd)Jba2PJ'2SIK@FHoUZRFL IC4rtGIMT4M AB𦔥)ɔSJIBI):)q I hH)B#I2S#jbt:"滲Br<(LM  %a)ҔRM %)[eȡvL$%:aV뭔~M2a|OP ӺPcIPҪ/PHFq"*rj̅X X ' Af@5Y0RNuLS4 ( d&I?)%.dNSJ)$nT1AK4'NõLCi IYTA2 ;lR:/0ܔ`6UYPxTݧ-4A/uPv@,쌇Tc0Vn֠1sG6$HY5}U3rYmxJ#}&t/-ki3!^ޣAd0Rۦ5擄ɁJGtĨqIL!yF|ӕlXOG)9xUέ=S2NA[@Q+@ BǽW/;*QQZkj$uSӔܧ-ܓ+%)NplOܟjۡoEɈEsCĄ8sxIKNu8 |U:u- Ҡeۊk*l04Q%"7SIf!C{&cx V{D#\HtALE`$<4uFk$j`j\8LВCQfeI&2S9S-*쐫OEBf%3B$c*ʋNe%768 {!VDh)nܚM)!gT6lЄTJ-Jpd${#D4 "AL%"eDjQY_~d)RpQjy<LDqh1i"N9a!ITJY!@3wA2uN NBg9-I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$QiiIJI$ɱmSkhkt 1I䫨uSRJzDВ(Z)4E%,S'LSLIԓ&jBE2[TI)t2uNSL$% QNqDkPڌ$BܦP5qd"DAt*D(ᰓAkNT.ܞID}ht@xLL$[PR@Q`B&TN%D&0Ql &!誼jYf])8R8H :9d)Lyh)jB4I:f<wgV} ~Q_1bJsɺHȇ3RÆ#h{0j$ ]U,=-2)=vgt\xQ58aa P,<;p :h7_"W%]|~YlJxC_ÄFNJ!+6[è('8iF4mԤ(&Q/ 5"PT%8d)D‰|P'TBAKiR IL^Mbv4C62XxB$ P8T_֨*}b`UCQ+te\m-@Vί{y̡ [M3VBKTӿy=5h<'&E=Z'ԅw֫K < ]>0'eֳVKXr!ݏw~D*Ӹn=x- 7սۜf a n!9<#V*7B]QITyQ sL 73 %:]$+:d)cCnjm ;:E;D'5 8LƄ)J! R#D4Fh H"t$ Wjh[&e^LGzrAaH{ hH& #x׻*S5ʞT N$@LhQ/M2SmSTaLĨ&܍"цڊ+ ) R܍) DmeHT\rJE?Qzܤ*HTQRTI4\P4 iTaX 蛕"I)P&(tFSOlI&D(N]$Ҕ $I$'%):IO0&r(R`%:p)JRRO):\ H5JR))&OR(JR%$'JRRLSIK$<$L`REJ*2!N] dTeI& IJґNF'RSRnJRdr\$M)r%)N \NBcd销RO LQSOe&9NA1M)$RxI$)$I2PR)$O)nQHTJRI2JZt4J@BJRI%)҄<$JSJI2thN)N:JT&N%$I O)!IGen*=RR-T*\%*ES)H)$N$)BxBlL(NRhIL&EH4'!SvbIH4)@,05TCP-E*IڠɜitEPKSgB BEQZSҖCq ^5#` @)-VH)p<I)n-Bʱp?NU4РIh}LOgt* 8WT\M0WVY!H=T Mt*8UPy7u7@d(9Ij腣U C dDkυeODE eHАP) 4dH$ QLAIKBb+pƸYJ$hB~=dE ctl,[:ipS^"gȍ|hSnDUK_TVwsdn$#h'X5em :3aS T݌閨ۨ]AxxA\!Ғ{(V2(ogtO4̆C;9UOӿH5-N:()!@H!idD )6KELIJ:(ퟂ31n()tJ ;T IE&W[7&reB,Rj|_u )2J<&'+Sp22"%0A5mkПRv:B5x\AFn3|2v[k;@]q›(ksSk[H?w6}P$ĕ 2% u`lEлdcO;))q8^JvO|;!cR4 VEa $"=(.h Ǩ!ܠXEM*m$ B]@0VyunOe{*EM*QKTG]cU"ALATNk$JE@BmLuEK9HJ^(%4 4왆)BpS'J@$n|w& [c%$ݦPhEبNTF'2SɞB!lJ '28Ld&O3NӪ \@ .P^$&v'N~@(MvL5dJ+=6!'N)>r^e6a*Z=ܧ` B.Xq 6@W|$h6JRQyÏϔ2aH:tKhjɅ25xS .T!Jm) 4$v8j`J Zó$8B!0U_[&LpI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$M&mjl/08yJ$ф*׺5RM ˗Z(S$I'$)$N TLT)JyEKJiN6ԡ9LJ ^RӀ(QR1R)(H%-)JD%  IJJTQ)I&IIRb\ /Z8IHȅ>QE}ӹ8JHB %De$TJ)e[A ZB!URwQBrfTԡt=H ra0'rDhX96@!BpP”B\;=!j9%"HТ&,LR *\$ET\ÔR;tR 𔤔mQ}beMI1rI CQiȌԨ<}`@dQ>9roCpEMr4!<{aDxV(5;UQODd r {ACLtAWc}2 p},3X9ְ ar z*쑹UuĂ|Ep-*-VUbZ`?;'2Kk;,uL)YNڠp]>P<M7d9 MjzhM'އ> %QӪj6NޔZĐu ~cAnOT\Vͮm#*k(BZV  AZL!= s殑몟)7A!jLD+~{KO~ -!Àl“l%Rݵ+M&fB vV-"eZHBQ9JO(cch4SM1\ GZ}LB H\S^5sznsD޿}|@.w{.Ϧ[8,xJ DvJ zM*৔2BQ))L$(RPI1)r$I$$$҄JJTM%9tQH)A:d@%2qJQL1L*@)mD)tҘP:%)ȔI 2A1)BhO)J4$' )$S&IE J`$Ĩ)p % :PIL"R$`$:I < )LM2;BJW)BINJRI#)Q))IIR:(JI NS'Lb$TI(t JI% rI)IJI$I )I$Jq*RdBJ{SBJ^RQ4$d:I'I$))I4(JEL* A0NRtБ %)RI(N) RВuR'1Rt&JSPJJdH51jR!1%8*% <)$[r@&P4BBj )MoA)Sm!$ݹMBw> O0[2MhkR}h:=1(dAO[cHEB! Nt)nۄHbʃV!3U7($J3(MDf -bA*RcP*/f9NئpM+&=AR&MD0OMIJ $L&"LSS+X-J΋'kb j!eYRUt*K\Ñ)ĘL-߫F:B^PhaA¨/! w[Cotp_vTtI,Z B'YW;gUĢUsYEBG(€Ş2+,dU<Έd  6S .JIDn:* 95-(;] BfKDmPKiS f)Qw A+-l3 m 3mP-jorS@YiCtL'H28L 4K@Ke %=x~+aB6?1ԥj7iQ.k+_FP3(YjfRQZ M&5WngN#Xr{2_/sb~*6>fN^Ar##uݒ_L+##N_$Py<'#e3mfk`rT`@νԴBy/tv V44pHZD"075mTe#RSpVjL۷)8HaAK킢AG!P~(.+€%"PiSI&"T(1) T@R)%yLI(죵%*RӍBpJPI1IF% ħN :L8e9(p ̖ @XXŰBFV)Q&ATud8вj0IIp-52ƃQph!W=zq lɑ©tbx(RrBJlR{*:UFV@U6VwJax!9T^uוx#T}%904Cx.NS1T4±S>n\Se'DhiII-KQq %gtU:&N7pI %6p0;$-pDsC-?dF(Lty6&.K@$2mA8` Dj%9rDJ: )d(AD#M ֺTzBf7IE@tLP$M#{L ƧNS|SNA#\$DzJXeEDc'_)O*$PJ%lmR%-eИꂑ5{+ `"ݣ=30S"49 3\,P Sn)s`!^6ʃyPPI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$Pڞ W10J$bQz~, ^;[BEzQL&!(QN:Hjt~SNtR$JRI% I$1$I$49JR$ ~SBpRJR) RS BSkRĨn*aEEID-H7T9CrDʆDe$ѪL(>8PcJ`go۠Mײ:- 0gO5Zׁd5xtq.~8Q͠)68hX~j@Zef'@mƦ/*Ά#O^*!MbZN3hF~1"3S$9A%_( ?GPJj4U" :j2+#Stwf]W!HxhhW QD+8{\L'Tݩ)+jPNw6&wSCt& qk{_FR_UOtꔨnH;6sTyNnKrriIMQP?CLeIMnCܖE!F 1S"5RM*2%STぢikG;mbu eɋ%)5P)6ʲ#\2\D6m )z@/νӊN$L(JE ڃŤƇ䧹1*.>()=}ՁS[ yQs܊:> =t_n#3W@>G]7O[wqT^9]OHqc(וּ9NO(m~@B)BHtIF)JR)M (*pj*dQ'ĤL'LBR%,$RJ4IJH'M)0$TINTJ 8*)֊bJvI2R1ӄ2tBxLRRI8JSJtxL $BbxO %piM*)p)!tNP$I'(O0LRMH"TeN"R JNJ@J@)HO)$BR)%.%)I )I$_NI I2INI$$%II$tJI](HH =epERi옶u%s)ä$Z"T ! %T 9*2$ LR)R8H$$$I$ɡ R$JM*@b1NM)ÑCR->dT@5JS$& )b"JE%҂d K%;Y A*aBbJTIIQ6Bl)(oҠ`'ӪxUnlA!*jנDDJD+3O lXPʰʯ *N纱xBSNepOTТ ;rH? ULK)ڠF7B#NjJ\ODh)˃wi [eS0Q4H!ED%H6NAȩ\&%81 @J-uJHRtݪd*5Dea{ RltVZ^SuD DAj8(q&!x\ڢB@H=%SS3 LkViYfHEz h[Yt5Ps_nAoOG;F8ꬣN n69S^aHIaL KeZBr(ʪ# YkbfPѧtrdΈ}SzRneM*&;#=S!Qٔ8iH-;5U*8AV_ O 9 x!UEk_itUPc-p$NI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$6>9$$H('ޟHJ+(k>SJLrRU& N)LJJRI$ S)2J!@B IKɥ:pFR%%,S)&NBMH%)"$ʌtP) JY:I$ JRRLSR:@$T R.ELJbStQMAJ'jQB$"feM<jg5M SJH Jq^նQ`$na R7P5A!& [i:*Sq7D 1IB*.)AEjkL͝SSE& wƼA Zt(n1SNnp)NaѿOST|PK)*U#i(h3K&OU1ЍtQIᇕX4N )ʈO )C5#eKrrZIaa"e8()%Ws HQqr^\uEU7C0*.>* #iH M›=Htt&{13D:)Gn01>Ғۯ)ˇpcDޠ'N qR#h"T\l6ѤJ`H6yR&9{Ԩ/'"m @6 _IĀRڵmh qL AЈW, L.w*ۃjjg'چ_ɕ06_9Qs'Ej|ՏFxSmpuGvLR'p$擻ɆD"!q$ˤF0NT@Ss(xZv*os%+]3)-k?r;qjc`K@xEaC%5[큤>v>HMOd&ki |Q/7A)JPsJS@%p(ؤ%K* uIHNمvѪ+:4Pwu6-)oҢtA*ؖ $fTRJRQHH*>V(VAܩ TQG S#^A]6 K\-!IKk»%~GdFn!9B6h{Ȁ{&&p/2U_PM!aT,yRi邠U~)_tF]HF4B^#1c3n6&>8BL#R)STq<(N&- 8DhQ>  !Q#`QԨ  B*`TP#TFx&)VADqG| S Q%D9<$)Brԓ9ʋ_-(6Ta63M0GM$5:MDӪbɓɔ@J ]1I"Sp%(&uI+Jb)LEij%j\ m$189*xo 0,L%)gfdžWߞ5,~Asd‰h'NJfYc[/(x&,IM'QΥLXtUΜiG2}Ɖ)5թ8IUnˣCLRޠeR5" H2˂HMdỸIH[YV烯 ϑHhm\P[ B[@oEl7b\@ C4\U}v!ƈVQhku:QCm*yl`$*=J6x%CY6ul'7VOr!Iٮ#SGJ^hqYa(Svĭdj8)ے6k!9̰l굪{E[SSEcf¬X-"B mEU+XÑd&:jUEpM*km$:O&7Pj$P䨗 AM4Rme*Xc4S(PɄSm #t@E/*; m!Ɗ[EOH4Q/'*rJ`:)'.O Td!%,jxSsE())j-ќ>A]TmllN95{'veuˇxYΡLB9-ʬqYv<@UjapLj6 *pQl`pE? Ƌ5 Cw=-B+ (vD,){k G> -@'TV-LhӄT{p cQ'Jdx3O"DmtAcDDBN%0}DS-{2L<'򇪛L""eG IBx'yQ'tq))A(`SόtJ.ݭCv VB_VgD;o+ "'Qf-yK8(0Lf` V!ܦyuTN ;FP.D RR,b JѪ(aU u‡ ۠8JL! :({EHNe'tbRR2ѪU r1"HJc!%,;&ۻAʘgܐiiEI&!7DʶBIP_dAMiE%%0(m5U{!(c~IM)|\z_´O30Bc#͌-sF0%0 ';IP%%3s\APo(iR1D6L(Dc JJ`Õ7;hB S,M JFAԔB+k='{JQq)!ٚL%xo#l&SUaDjuOE+ MyS2ѢiH{[;8IJ>\mCiI [N)S(1(ѦTG! LL)nyTyE(嬘@ YO'rVպ{Z[n!REv\y)I%RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I%)$I. Pj%^kH()D䨕8JNVI$HEJI$S t(I$RI% T\R $NI IRI$N`JRd' (IJLIIJI<) ӍSJQ)&)EH)Y(&(EQBpTIh@i1a )NA{G"T H4\<>JJE[ETC!)Jq >DhK JCG @#Ukޥ*α8cOaOIH;j ^x%9'-8ncNS %@">{*{)QkYfНhv@B] $h{c!^mTmL ܪTJ b#D)p[>i ւJ#4ĕ'J )N)N+k-ӪA; %<(S'2.#@%Ge6LR8L`'߻i=l-Q\(,T J# x"rZ(63\D68s0ׄ NKRւ4 tWΥ@FkVPSUwJZX#)g!46TNp@>e ۸:uִ_-G܋uₚn|Qa?8T0F6{J %Xeej+)aSx> p)5{t -%]{,̌9P(&9 )B}BRC\cWqp2tW).۲4Otܡ)%5[LvK||>[;S鋾LPR\%M#!hh2TRT%)EHv{@:#l i*D1RH":poL6JfʊIƾ rQEH IHʊ ;B~Jo4I?rA'etJS&E J5&uRO)JPS ʖ ` S)lhZ %ޣFb9Ztmy&BHHc``J $S '))yFhӪG"<4 IT`ʎ!O*gd#,jD;(%D8hE=ِ,0Hou6XKi+]36v  +?j[ah3fiFNۖuQh̀ZeYt7@J%8vx2(A%L4V$3%0p ԝXj%##R ^_.9qM֑­m{Uw+y T_l+{A*Tpo *AFJ dBJ @JP H ,R&鎉hI"R'-O)ISBbTNt*AE$I2yI1O %)$4I<$))LND"$QI9H ALL)N.$锆R !IM!1HJR 2t$jjJRID3B a$.JtL`g"D x*Dm `5d*M4Nv4ͲTBc`:'N$hD&'*USmq<oJJ'EIԤP혈DD=IF $ZTl L9E$4I&N:PI1M pRe)Q'JRS)LJd8 JRhNQ Ab0lP&)@P,RCSP)lBiI6BpO -lFަԆ:hJ[% 3$QkFH ʑ'-T,'DW"WLDPhS $T!D&*ͅ&n!3]*dNnnҁ B#KJTe8)4Q#qJԧr1O a$4")&N)+ q5mfXQQC{L&x!1U7a"LP`NT9Sb[*l#Bbɤ(JruS=E Rܕᨐ]IBN,I "bD$QqIAH&5 L\Grj8 r P BINS9<0"N yQO(%dO>)8M )dyJTJԴ&-RI6ңK( t(B.2JOETl04HEk9@ODXDa!:V`Y m pt$L)( !:u R%EHjt!L K"BJIBFI&T7)& K()ɔ ')RLTRnMYJDJ0B[Yh(Uچ)se1W(ddkV% =^ %n1^I@C,:>.{3+ s:y/,H2Yu ;i[9A,C/G8,oZbBׁ! F}|{yA ,:O)!/(}@WC5-dŒ?N4MDM+?!ZGT2F!((,#V)6:~SLkʃ9"!;T,2kUqYXuD uDJL|74S.\lr7(;slPH) T6"=FV}#]Ot@:$'Z)?k/@H4G8!D u5Vq(x&Ja !# )Ql蘙 6{rg(Jb]%C]5S y Q!LZ6>hlpP0. C/;# Ei(XoXF_((R?$F;@SF&sD&SR.e@&8IL@Rr‰w[Pr{Д*Y<%)%) [d&$I S. \I)W-V,m͖ʿjtNt;tߴ ]%8+>k3;rDj{H#{].LVAodk}!c5';ƺ(D8IH# wQ'Lvǐ%-$ -)5AK%eIQ kڙ7hP۬=Y̩t%$/ kAP٤ڀoD@ )) r!Δ,w>JkoJԢO[ݣ%^9AAD"7h%,TT'Y3P+UlIʮrV-Ԡ(7xibITZ+lnӪ:3ݸiub$Tȷ 5'n4Tq%0 H‰z fN4DkU]Nm AHkʛ*-7ZF>B8—8Q.%0>!Wxw)a&T'E2B|vHDT9tGO*^&3[&E^j{Um_\q 2IODNJclSJ[qwiDh'vjeLmHS60PTnԋA:(hEn7jsy Hw:)B\AHXҌӑV<;N@ RR XyUeu(spCA4()) Iwrp*ۨLB'NI%.TG`V83[0$Ugd\l:6 P*NwzTz(CcZbQ)hz t$Tɡ"Vd+‰wF8MijaaL<PKYa=wwRe 9(9Ѣh'n9(P7 TWpQlĢ2YGn׆vNl+&QcO]$𮱻D*آOI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I'kK7;qK4Z`iIHSƁI(NW%2I&I$JRI$bI:iN `RRJSJR9L $I(H'IJI$AR NRR'I<$)I$M>)IK% &$&JRHS)VLT?m)")BE)KqNHВRJmI B e J+[R3Y:0MH8$-un)haル )xhNX6W"cb{d o,NRޢIQ>*89A%搜h9R%D #EYer BfI1z"\T2)4J`#0RAӠCq)r< ΂{.{9!11Pq0P:'11l#RoSYRh 1@ n..v4V'DڞSo윥Ra*Z̨ÔUݕ/ֽC%;x;J4D@j) j(BţR2ݰu0UZt{cD! j%DXe6#T@RC|8]nsjbXF ~h!${m A%2%"Z{ ْ#YFH0"9f15a]C[Vsˏ:;MACmn&eQ.'X;(n)zJ}Ц9ڥ^;ƮF5zmjTsP/Kp*.%׳&(̢9?ƪ-IL@tL%pF=9Fl䞶nt{e#^ - rAה Z5tFPX{zRde{@Rs& %uv2G?z& ` 8q 2]TS T=%)xRsL!z:)4%%0{HyVk8Uﵣd>t M!%1u-2I*kDT7˽EaASk3R9 @Y2:P\@:$FV\n*-]QpUǚ=e9!4*ov9䡗JHj4w; G: S6!Zk6{'$JyQҒi 2 iʙ)FR )l)v]<ߖʌ4蒘DtŠ򉰆iH#䔤qaUĉs4NSVDvXMB]}aQjiFգ: ߔچjnre 'T<\.6F'Ex@"?XM:ˠn1ˤ¢A[9"FST3%pVE .]%d8H@:!I4$< &M zwLR(B2芖)!;T (ETNrlI*J~THRNO)(pvȦHjB`R)pO ~Si%-)BxEH$Ttڠ!j dJr 's$@Z<&I%GRZ&5*u( 67IN5R+hqfgM*^t ݴHJ:Cb͍SLWRrIeS :V'ER+o()v `hDgEIɊJK9`'T09N  ) tLZHp\!-ҘEH(2ݼ)b{PSV]NցDM{L8KgtT=}=%MPhЦqQ%'LJ]@lz%'S S Bz'RaRNQC-%LhH.=N1',nnnDX@LûDcC +UJX\&5BqI)JnPR`IRtO䘎%):d)$ I@AR M)Œh aS$%(@ e[TȔuBiL #K+T,tZuÎ؂x2Nhif-a$p˫o5*0{=lt!WevQKM~=uZù+b@E0vP maWs7@Y2(TM 4L7UaD9 '&( XO[:V)0j^Xl& '֝&fJKx)4)nT_Tƈ.aJR³_^ОZRq2 LIu !f1hvK MQ!(=JXI:ls[:D]ZS\%S%v8AsAQS !c;)\PKiHBJJPx'8}L(KSnJg@Cc)T!ou~ NM.TM$4x%1RAo T["3)3;*E6Bi*@FW?!-1 ȯHV [ V}V- Bӵh+Bƪј7 FZ kNiOSBf!} Ml'TTyDxL÷1`%$HyPP;ZTQ'7"ʘ( ts#(D%D"Ͱ0jZRNp)Vj:pvE3*0FA@SQaT.bKd|T$hk?L*.$.F'emx65D@B{| f#ֆI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$nv!Qж)I$J%u4ҒK%2I')I$IBI"%)$BI%()I$IL$BPR(H%(I$tI%)$I 8))I8H)BJY4) uR%J^S)(RПҔ Jd)5JZ!L ILJiR* G@L().rvB&Ta$)!(`(z!CCyQ./TRS"8o#X+Uo+Kx Xt G@Mk\N^Z hI 0UqXZ%\몑> DΨV^i(}̣  )&btD\ !8j}%(dbL <'1tAq' $Ӫp%(%${tBmnxG:piDJ@A$4 <#!'Y%)54NjTXcfm2| 4LHTq{ݵN\g@"A܊DmeD4dF?jS%0h43b$(3 $jyqׅ'LJN@Byx#]Ը.#XeuP6;v5wQ-f;T)&{l@kC"僈I, D螰w"T{)GE!꽀V5V'q<~dTM!<@|ZF5Džq6ۼn.qۺ|HI *ÆN5jͻ>I)JnBIb',H4@B:$ #2ɂS+-𝠸4BD{ m 8IR8ꑰɃw7;@OA,͍<(8a60uN|ˆDi)Crʓ,k Q ]J]g=;k{;HZ'; BHyG9D0IOa=SYQ& F >]1U\ƞ4HOuB+A!H82ٕ[VCo9Pss|\ₒXF0#\5R.LSO*F:8 ^[ }JbSJHB*a<RRO~rR)3(#'D5HҒJb iQ%<ʐ(JJbhI$R'DƊ2))inTH.&- \$)JJFu:}@0uH4w<>j)l{&LJ*aN&R6t9ЫAO}!W鬽YfWR)BdS!6(MD 8ILwBDwd@R)JM [RR&EСOOt*e !)(' '?>ԡ4t΅1Ӟ29S❤pSX IH t5$njB.39I gTtN)ok%`ġ^B;ZvЧq&hI,vR}ci)`aG{4nsgPԎEU_D A'kDMY iѮr:]%!$ZOU{MGڶNԵAi%aeRd(6%q02Z7a COβ qv\ᤑ0k]骥gN)Z^\&W֭KO^aezrS+6UE;UkSubpݪ "v\؊FQp.Jve)]"J*aɃTp)DLJf(;Z~R`7)ҒT  @ԒL%@(ሩ$@$KMmd$hUm`T@<$pJadM* A>%2LSJR‘LLQ✤&H)(S)$ ƉJR!<)5 42R%0)ƨB"V(nE(nDnA( bO("vew=P]@S4Q Bp:&:ֱ}oA<;D` a9?YB$H [؄"}$1 `upj)ȔHK5jSy.ݼQkuBsa^,ۺˁҳ^H^aCKiQ-A,iO)JiO(IJ𔦔ФRRI4$DҍDR:yHBN1$HI&I(HI))OdSJRR(NFJaJE*B'ܠR& *MnR8.] %ɉMh2Q7h2ARQ D BtN HRiNDl")h!"eM+UZ<ĬbB"U% '>ҧ 5D%*-vԪ0aH<12)(ZbZ!:RR2e4BhSp)V:ED)&()Iɡ:~)IM:""ҘI$J.SJRyI4  `IRs.DzEaPsv  d %Pfx (NC EFJ XY]U aݪAE ]:d%MBR$ &9DQs{P;LpQj3-ԣ@(ov9QZRS8jvy*$B@ !2-SR8*%$0 ') g*)$)A7IK%RJ;kQ $%iQ sGe%+tJ@JYHӕDW*>+ai5R- D%¯ʛ܅mƁ3_"J1 ?gh3OziPS'sv/A>E0)O%#u" LU'1aJ[LࢂƖBIϒlT SG)%fcʅV9PyQ N5 ѨIZE )N+ТmQ (R"Ss[~@ (݂A)ݢJBIJY"H35 J v折n*ӛHCn gPsҙ))@NƗjRh $\d(IM0kTvZ̓R@t)INJMԔ4&Sw~EDzBcpS6 E&5QqRR:'))g8LqI<$'TȷR9IHI1@A|bm$JYHTْ" w @1$0e3T_ܦ ܤJ[R)fJ@28OIL$V晀ɾLB IK-( j#4 !DBJ]"LϒLj)rjPi<RnR"%.baD } {ISh %#IC{'0ȼp\J-hD )#<(n-(pNda%3ݐIQ{W:ځ.=9DC#AX=Qyii%mѪ^[?KFB~6:םYс^[o_CAx +8LS[(;cA!VMS>[3>j-8W(vЫM*$QhA+40hÂ](QqsĔ$b=N7Uh3F9t*J]i.D#]KNgG0(n}/&Df<+'Jm*[tt|7XEeZcI{U{F)n9񕕑pc = ;'sܢO\B *j~O[G@}+U]]AD~(՝5Dp'LrpGNɈ)S &xD“HO=:4m0 `[ߢt螺HŽCH sHQk  ġAEOFeDPc%4J`h')7URRH>8Gֱw*)S <'W(Vdꭶ!eT|꯭4R*`W+乥ZBX}ദn@ &sN )⧹A) fpB+%/Q )ʃ۸'*mD)ƒ"$(ns^䤭-ee;$UNߺs%tpB@ʄZyS;5(^rbK_LQuS; z%nNsO]W&9BN KSPZ \uD653C8^|Y]c$ItN) 0Fy )$LMI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$E&I[w(+h",T ) $t$ $I&%))I$IIJN:IL:ILI$E8EJL2xHN5HJA"M0TSS)&)jTi%IO)ӥJRI$R3TbS6!I*ʉr+u;0 X:Nf˔v apI/p: "JNS̭:ĝNvW>WJ域k"]F\Ns+3B\E44ېpGtS <' NWR (1$KlAJ% KthTR I(8jALH' \ S(A 5rhbOc0(%J&.ѪH FFe4'K-*&F}a‰rX [a1TBJH⡼H8D<)uIL^%>F/>0D%PMA(\NzhnD+dUUR͸,>Ɖ"BtM`_`l6ZN%O':tZ/q. iR 3-LPݢ#D  IHR H 9R)ˆ%":B/G(~B;)h 0d$pip斟$Ц ʘ0:kZ! >P9BOQE9O=oFW@rMT8AMJZ>^esv1PoܭU]`}"vmta66(nZPiwUPm: bt .Á+I$r~MpA]B,hlAmk g#@ƝJhKދDqpW;`RYmn ,cRVahT\"m~{.UJCdnV(2i۪Jz{JB\]FAf(״‹*۱L]J zٸJ|*,`lJBG{LE >Ljԩ!))ĩ{@D)t%s %8j}[uWE{J;*zwYl\Ԫ'lH5:1)dJDR9HG))ID')*e0qu0RI3JQL@'8PShIJLJ .*cT9k:&1<)T0(= ȭ*{t !L#jlnaRβ`SDK}N#|ߚ}T!G|蝭~̡8xvj6<rrA:)B[T!hCp zz'(Or@0 *حїYhEv5! T ׃8p{+^ R GG%D JHI(IyEI8Q!(RJ]$ J`RBTt0IJJ:IJIJY(I8M2* )( DDH ED- yH9U 䈃tU6䊄$(ʛ g(JTHNBT\5Rx&Rxz̦jni3\'VG!5΅PxI2HOdҹxH)*$&ZX)&LP!M4'LҊN'Oܩ5%,K-*iBO*)ˆn $J dzB0F&ȃDžFkaA ~v*[eH nJ*cPEH9SdTI%eJbIM2`pYOh$RJtMR'PTjxA,\S))Dx?*3'졷8%s $`  $[*`%3Je@iQ"5Rk)! \&)" 9ơMH$$(刕QUL)BޡeU-l׉Fn loowuB*WIV)3%hzm =m4;!L=AV(yM 5Z8P 1)=̪R%X P`{W8e6ԮUjr9% %L$Js#DT'O*/hT6#^G !)7XP6!I$QKN83u2T,l#JPsy`=EŸP)HĤu ԩΪMG n%D )3)lMF`HP@ )!=S®w Xa3yJ%3LIM6SJHQ0 wL@HgUdSؒ+~ )9ݑ^ T^w$88Gu'@*࢏pڗ RJC` $4vԏ‹^SdJEi#\ D)ݢ#<:N/NOQ)D0AL@ ꞽx;̤SRS?B k%3ݪ`S$PRINH*]%gIܧ 0sfj$&sDw6 VI,C5ٹ" 9C$wP@ e%&vDˊ@QTKa.;HHL)$z4ml(BZRS"&BN> >xWcDҦ6RcwL<4i @Ɛ$b{P)ALuQR m S#bt<_[;ő1lm'U`:TJ-r&4IIw(~%e 艳M܊$sIP).pD7P0T6ޥm:aT#EkZC ;YՑXl*ilA*P 6c'f<|Рk %ܧLNI 奼jSQz6<3R}(YvqDU>pcnxBuwS9Di3j[Y |+ H&!rP6n]|O(`Qf(wXn9k(nix({$nB3\ MEpߺfaYЀ ]@+%P`qr-Ctʦ*`j y) DG`n )[ʪ˜tGJ:Ph o4BmJgkl#UbwN K&49Xt@6OmyJ' ڧ!kԬ;LDt5NL( ET @)ca1r)%bTRڤE$$$2RRI I$JRiIJ"T a1 _h *Nv\s#tvRKuTPs(!&RJFY:xX2 0qQ-  1ׅͯ<*\YO ^0`D/%M~)T2ݎςfqM[ iJTZKNJd"Є3΅H?AH_CA'a*GBJx=\JL&qTyL'`M,.\\p{!r]^'ٳ[Z)4BϩhգBI$I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$vIJI$kK'+"Te8O W(NJdyI I$I"))I$rByI%)$L'JRI$I$$I)I8 )I$`hS'Lrce&T%FD(N*R ҊJS8 m&)J֢S%(SoO1IРצsS˹DsMjUwGPa2cQBfHJu#1)ޕ ⭷Dհ4DjJ*Zʁr@)j l\!!6N')J&qS0TĦI-@MQ IIdp]S6e$ĐiH蒘JpBs`aܧ2SIO4ILvh>۔۠Q-R'-!F) x&D=NL!>!_Omdj+Eۛ-5LOV x.zvxJoh $ }MQRE 9Lm>(4B5u*^%BKBTB9VR>R~8nALO wE湼jUot4G:)Xe䚙-YnEs' Q*hUuuUqcN[shHwPq)eB)hTBaL+k D 4) a+:x&s) JE& Ήr !1h;_vRkʙTQR"(O#g ֩x6y tR{ >Аl) ()r/$ :hlu$LwiS7Z\ѯ `̏U.y\u M6Tc詛-k}BdD Zp5R24 RRw:+ld&mx0mB pDk%4m*O~B$OeJ֗;xy gЕm-vU;tS(X$/]Dj<,wMv_y'|LmjJ(ʓݪBkv*W0' rAqNL #DRJRR NJ[cQI$R))a':$;ӥ*2jD$vMH"tN NwAdƩ.mYPkm\6> E‰tptIȄT c'P.0jjvM )y Li/d@-qhbcE"~Rcwj0 Q{{yQ۔[ @Zz.)ݟޝutW7YIւ5@uKC1K#[@Ii;uK5+R'U,&JOtQ ԈRn:K0 g3M9DhΊD*CiIb۹W-?reA~)a)Hi)m >`<)Or0PN ^ƒ$/lm ;Pħ!9NsAOӲfӬHBa n%-G)DjPS!KY#[ o*xk4o*.v  o= g)#;UYvQyq[쯐7[{>ȡx2dL{[Re4_AWʎA5md WMml^5O Af8M"yBfC8|Ti^EGte9)6ϣe;e,f߽^s F[L%5sEأ6[Zn)Rc\KO2 guATl8@UߎZD%JΜ3_1V4TwIc-Q;gQ9W;u8CSvPOe{cOe6OL/ߨ:!ۚ>`ʶE>?Չ<D$OEiofT+o!D'E'^L ]?QeGsḆQkhM~KqoY^אH|WB"bq:sQbE>”${rp"Pv@Qsa.TeOt mT\k$&De%%qPMSn!0Dv꒗:)Tv5 Br)܆S )XR%A8PH%ha wdW3S)ֶ:Pqϊ"T*DӁZB'[(f#q3QFQSYC@"Gܫ%Tm ;LOYTjNwfL!}td]XnVecd(&4=T6IP--VJct) ܐh/ªA)#(5-Sʃ ԜRsRR)KoB!JJ)9nQ%))tۓJHgDN)5$3"Bg"4"0B#P:HNHhUCʉRxk3u ʓBsDB7 R**A SGt"a7)‡H5EJ)Qj:$TuRyGՅ3TߪTe1 $' BE0NjD%J\ɥ)Q)DILbcʉR&S]T9EiE 8(LRR)R𒌧TFNhB@4-Ui'TpR#w+D?*dH^g8=Ŝi uTwA+_f=̦6 Dࢤ81 @RR LaD8 e)ˆR B3<GkgT΁ 9fWi [tQ|1 ;BX*U~(y r D4FvУڇaКt !;Mj*I[=4{0"O*/)f(tZAӔJD!;DSe$aPvBۯ#n(1tI-:$F58t`NAJPSrRRJ@hOdBqLuM A )eTΪ.vt4LÔ҉IIuZJba!U4ySkttIHSc|SW$ TPkeOhH5H PS'Y&/2P4Lm<))~1^ਗxBl4(a9ol8B:'D-Z A䂇mPsQ-N=̓RSFû:&U/wF'BMf Fʭڵ-n% ? Hml}-a'e' t_HD`۫<_$ %P2IMBv)*iILAqEb74C/)yRpCmMvY>) 1%"Lm(T"B a "vI"rw nSR^IMMQFU߷P̤y4BWMVBf x $pܬUZ5Q'E!@5fNB!<ͦiAQk[>-誼Br~?OzjĸGDٴ) qHhSƞJ[ZУmmfX\d?"g6?g6"2@'T5XISqJDa5w[bDj8tLP6BZ@'c:p++( Z:}WS\}c{V%N'_QTI%I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I+}6E{y=$ԘLV@H$S"I$%)IKEF!2yKI$EHt.$NR2A$I'L }JyJe8)%)2tE2))xN)S$%%PRj A%2LRLSN%))JOD' IJI)3-6Ɖ)L(P8*Ņ %%%, EdaPj54"*Qm2HnAH6S bT@RqP-rB@II(4CALh0✻(&E.>Jg؜qL  )vf?ڕ HE%%/ (›@SP$Ii:)D%))2 "BrKY!- hGy{B^n!_`f8\>jK :/Tdvuŵ3PtP5`T4 @=:ʰl`4~)U6-0lÞtB$AFf);4Dǫ=#a;>?Ym Շ: )mn bkl P9ScRK։>BQLT)sę(&zCqG%h]i>ƷB[!?, A@;vO5Vsp;!!6ӯʳWO ׀>;Eݣ#4iQ(%=ֲnw 6q=kƒt{(U[y51WقqM+BJMc9 AIL a\ɻBkO#TRhT<R(Y!0R!1%,gxNRiV8&L4j=(y#<eMdJh>y@0NRI=QIJ?U8*ն5DNFD;(\8m !âxDh`cDݔ(uI S9cQm\x@sDrS( -mcԪϨ5̈́7ВL{xmBA:{ tG;`BӅ'>u4AG]E#|ʴw G*& @)I>JrD r(tUhξ)Y8JsC߮vN TSݒ;38{*xai$-.X5RM)^Ŭ-Ow*gY&4)cI%` UazvC QSDӬfu(9(S@k:RS[ :BѺ QՑ)T SCT4VZȡB ѴSA$-P~E`"-*'1-TwNZs-ݕVvN3P["Њ h\vKȘhRe}e [/U={,LW)V}՛:< ,Hj8gA#j7J [9lNSn(QKpM)KaBE"R$x( w9NljS3pMtQ:&8 T!j\ېO m QE.*|P  wVJTh5P}o<(;)N{ (q"썪ze 7 ˹T/UR'pY"V_G/An<&~)UCMVI{vZnr{8 {4P}MUD̫ÏpHT`Y2;-o#%aT]mY~ެў+ڈt ;EuDjuL+SsKd#U!kTW8 AJTIM*)*PJ)*%2DBrS 0 GTF S $@䨀JsTFְ:r &a+J$p2*͔&h,:)YS: ktħLBv$RvSIKL&L{eED"et`S& \'CNl!Jf4(4QS")vL$RqP, N jb DP*i$S<(|)8& gU**EDT' 1Kjpɓdp'  3ELe8 al"ZӂhUMݢZZPR 7E8h!=mkav)1qi,G+NVڌ+D$M7adM^pU\Sj5{jZ]fzgBOSub+<4ԩ(0K6:rUvG `BIQ2.t@90#6)S'0P5}e JL'1(1rBJbQK`h.)5)kBP'D=ВwJr ~DvB>t hrYARueCQNտ >()CE0RSY詑dj8@-OeqDմFDƈ09"69FrL |+Dϊ+h9QI&$F JaKcda(1Wn!S'hNGdh'U& (̤2Q w:Jr;T*ARn?%=7qe )QvPhPjl'4JRƨaۊ% u0D:!D@tC{Dv4I QU7TߴK@wB!;D!“wΊ4PҢoQTJ lWœ S#BXZeVq=aXhDkUQy+(ntvFBJC]`E81ov3YN-`I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I-NOyYkW+7Rw 0)9QHc)J^RLE A$)$NTa;$'L aGJIRd)' 2E:e T7BEL=&. M5I+Bp銎䓸`I P)OJRI$pR'H& a)ID TR)PqRk%LW QR|jlCj rޒr֨"DcuUXeR1 ' @vF  "4 5%(n)BpwRj PQ.QsAgi`S@L'Dw3cT)Z9QH䔶lk=nH)V {BJ`>И5DQc)<РTͳ R켹xVC4,-8juHL΀& 0M IR.O)Hyj) { @Ll  d^ DTșQ{I:FF?kW"jip,\/d,RD1Ȳc -:[§Ki_fʪ2o$&ǿc~q.51kCOv8q0Ȑ04CBF@IEUMR5 i*}v} LjoJf;!&N%qR?ݠEy  }pઆnp<W۝!4WX Wwl66tΨj5!f-s`FOfb$/LXv8WA&F*3 F[CTIW f A m[/$&XHKYOtk"2:=` ڄ4"2^e6қn>̈́G!ʛc#B))F<BGhK(:BQآ4IQyFa$VO[(Ť{"`rԜ*O(!׮甲 ѣDDf v7ˡ$)!V}َiӺ{}ߤ"W]%D8ɏ}UrcLruUL`#c+ejxTΨt#JpUpmaA ӅNdmQk$ h <E>r%ht*׍Tu*6:)N))!yI$O0cy^'RDk2p*`P3/k9 tPh*O ڢ:4 *r8*xgDPyPw !6Ca}ex5>NR(A}ĵf c qǹ~s ^\uP^.(dP((; N6wuUi ]Gܣ ( DV:2&*DwR4wQl)%gdPKD<$$GpQN!IԆD4N;#gǂ#000;iĤ懺<@rJ}ǺyD 14DSct2%< d;C-V%kb9( 5yN:w@j3 'qEK>DBL0)ApI &_cH wRnC</i- 7$ȝ]׆LxV>Vs1]"JTw\e. wulTIpPf"ut8f6jRCw^ #mAV ,nͤJCY&u+9ئ5A4Iܢ+ Z^8tVSHrj2~;2&Pn#Up@DP7fVIg)a + βѮx$n0)S̯"no=ɻX&cY[< 88f;e!K%6/: Po%Q?H()XZrV"=**!Ktd4ӯgQ#wuf]•H#xC,T}HN@Y.iZnF7B҆}!tDABco=xRuA 1;yiI6+Тh`ls;G50v@i ӏ2S.N+S)QMK\_;N!KUNq[v 8(~ઇn4IMK1Y{xT|Dj =3=[wlsݿ ! ;iII;.U,#N~Dg7^-B{ IIHIIN%v+t߸ _wBT*A0gU H)0#MPJJ)iv\"#@Vk7hj.w(Ųl g*Mkk*̳o ŒuCʛZS !nӸ 9Tݪ"Ս7:F>/pIK:R>\֠ c a:khGej;⢜NM90RN$$LH H2pS4B5IKO2k ŮӅYL+ {uj bUl3^U`Je+D%=A.`BC[6#TrPSm#UU(ݔ59|RD$/cWXJ(t(n!M-'TIQZL)Ûu`LhT,)!$uA)9*=S5S8.%J|r]wI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I:-JTбٽ-$*Q*He80EI2tE%) I2pI)S 'TI2tBCU RIF'I%/)IE8JIJI$'%)$JQ)?RR&(L' H蒗LxHN-MIK4JbQ\|B=MEHL' RLD߸jZtW }"kIPi)VW JC"4TX YnT!I60)mbIPyT7Bv @:ґ2|ׄᢈ=p[N24 ðQs^t$I':xI JS))L%T'[<'or@CRhIvEK4)xPRlĔR %20𜆁)1`JZ%J qJSԄF'Y4SF)xK`n^NAፔW 5Yu=-48v3s5AaI,~* lg[CLG& ʚ0a3&Ы5ZښПӃ#EC6MGlC|Tyِ+l1o`n S57=Sgnp1_D9݂X\OFY@8HY)gnOtϏe6w{L:h8X]59Ueb-jyc[Eu~c@%*% 5 jiP* k`P5)V + u\y(MOZIӄ]Lmb% lFMʐ )| :2T]H>*-dr>)m Yyp腵1(/hPD#T/dG z9˝HRk *^"aG![c0^H /7RIgߑ0uZ٘@tb l-: Av/GlI e%+qS =Rߺo0&:JFD$50ZIOdIK%KCNhNHQ:ɠcM4JP$J^c)%0Iٴ.^]wu cݳ r9D1"zm%dAgx4p:xG!\ 0&Tˆd=SRpD5CvL@e @P9={54MWXGtH#O4V,w(U@$Z"1{A)JӶ>W`o({{̩ V ش(~w#T`!<)z+U9nqpTHpZIN'BR 6s|81w*n{) 1(!`("aSC-sP,ugMVéۣ{( C=12R.@ܖ)642JuA!X(PD9  YH\}pf[0tE$9Gz[:^wV>ήC9=sd PSO۔ͨ U;b:#TeS'kt :"mlte$[ ktw]@1k#@8tjt[ L=3ԕEˎR[*A'_$s6}n"J!NNַRbVZַXkc UIM%EC`*!'qNS<8#D QZd&-;&Mܑ2R' PTNR&i8M()OtN8 l2k5t9*D(;BuH!((wCB ):ɂnIU2#P54IK8HP)T"B1H͇U$ `D%ʑ 2 & @&Rڛl$8&*=ӄ)'I% \I1'U&ВMnj%nΡ(J@ʅB MipxJI B& g<꫿#i9ʛk1![~6 pt:Ukd PE 6JJWWx*oi9=MŐ9Ydue '5BTQ.(=Et{媵l2D%4 |S x#Tur#JcDT mAN}JmPnpO*>B-J%7Eq'WfSm 2TĄD@;& 1RRTkA*mn'U!VTFY(nɃrGtLR0FI8)V5S hD Af7<Oe"DHUm@@ HD2{)4gX;& QK)=MYVJr2TASk @Щ{j|JQYA^̂u(W-.0Ta9Q.LOj9ҙL7p5)&JRSBhNyL\%%0 {Ϊdji)&Tp xRC5){BD)TWI@ 4(UyJf h%ӪϭBǎC krmNcQ F!Pjt;\69TuL"P ʲ Z3$mtvWAyprc8A3ʹUv)ot`-W]WknICIH}=$pPe3kdm.MPi hAyJFI撒S4k' #t =ESc=Zhm4PcIԠM㪉I RPhB|ҘQH Q٪JdA %ѨKA̕Vڼ0'B5UbgTiD !d"L iHQM)ILJd DzJ]2AH$Rje&uMe-Z M{j)ppM) ^f^e0LLJKN;u [Bc!&RLRBw ZtN9Rl(D! nLFeyI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$JMx-XM)/,TʊddRI'RQ#:I)dI0N JtcE 2IBp)II$ۓRR'9)R$BIJI⥻F!HM @)m SDJS IJҘ B aHRʁt%P4"'mzr=; JQR^vNq%(Ss(O<5IH+**m`Quת%[ \+-!Zc ҚW5a: a'::mQʁ|i 9a. 0{$LhHPyˇ~Rhݪ)S))DrRlw(oL 8r[0'6GQ,"S`IJ/<\)x&)Ih%. D7E oR +0ےCqDq]>VSUD `;0ض8 B+IG0]fw;L6):Je^|_k2#wI)II:7Y[=䂪5mt'yR15 T7\<֦;kh,#lp*{k 4}%Y}0Sg,5r'AUKeYu dQUTe>(6I#g'SZ *=/Uinׂ~{5&FdrtV)xx jI u}z;~C_$j>L @vSW-cF!I.L[ OTCTR#HޛG N|hGdShTg>xIJs`r4O]AݩEs )UeIM}#=EPtQkZ\p⊙I$x DnH~0[gPeZm*e[ PA-9xGub)YtlvhֈV+l!V a+Cɷ]J-'Uqiq;mkQT]ϝ!1f?;JHRT0U%QӺ^{AC$jP kc ^TcTάxVEpP/40 e$5]TjZuhE)J)JJ@XB!& 8%1jyPpsEsA4N2R%0žɜNI"S jR $ByO)Ja0AKLd")5 BP$T{%'x%d7:`*Y))xz'lUi x&E*nS bS Cʔ*%@(' *`)IHQ/Nrq  NyBԔƒJ `25jPvNTyEINRa*A z4zt'WJ]S] C5˜L#. `; XU%$tT{ms&4vQ V6mx)4=*Nx*N\ޫTTtZS$ !!lnAA@$ANRrM LD/\ ;$e%Ȕ)VI S xJ7'%2is G[>R{jQvh[Jb_*~²%RE҄D@F&΅3 JJU 5ܡ4HFѯ HΩ) %-kAD! @H*\-@蒓LArw*J@SĢ'NP5b!Мa`H)M%eQ<'m\˙\% Ɨ6R`0±S8P/MF;)pq-WKcQQQlOq l#ܪ1ۦx4B|"n%.q%PIRjD )T0BUs䠟r;[!'Jkf>D$-ݯ M Y<yOa@rDC*HX7JpoNQw<)!E%(t=\)|BJPRC\:Y7R (Z𔤤A"ix$TRj6eP) 0)r V%HjlHJJFNBvuB1:(IL&@IIujQʘ%)T\HEeVs~ H  JnnP|F''4sJbH.)g< E 1 %#s1+(sF )tIϕJa%5_ b=)UX`۵(9J*\F"[(wRÁBSJCbx=tZ %q2|wJZcIoII2|6J$5;2RܜB J wKy;pJܠl! IMR0MZ3qJNf4 L]`T di;k'"rN Z\B/o\(W!:\gPƨT]hЧZe+-~0`%0TŕZݿfitU.o=M,#P2fxsA$.KY|GQcᤙ,Z7c1KiNiH{;+guJdm@x{BTX=);EޭX['CƫjBtQ±pXP3 UM{(m#i*6ha;D$Y31uJ=Jg&jW2vٷ@< Tl~Nä 7yIS*Uh́Ev' 2'hPUm(A5@6J.A{*4%Vh5iV,qk P6yM Dr&P5̳]D+>Q Kwrlm]`s%F!;8OjhEΆ> \xP~E tꂛCDS!IZ;!yh!jT5J"JJN=7pIR^/'ɶW<"-ò(S5(J[:!1))dЋ]u(̵r  R+ n;Zq3WPKUq}䜔ҙ<-oe 5R)4Ғ X!(dEK$D9)8R }:;A -t[yvYFR OxqtJ*l3_V*ʮ#_1rKuK(BN6R|+:PppZbT-;63 T_0DDCĄ23?$2٪L%3EPRvBsa4hRk6^RoR+-/-v&:\ʋG* %3KgN@Uu2ZJ9(Rf;nktT% b`!L)) 7#BD#BhDDF"A8~2Xc^Hl*y@c7W7US f\UFX  EҠܤÁM 0*@ŠvI 'HuL%( Jh& =d쒕)xrǴ8iʐhxBj5&pvUPuA5:p;:vxPIk09DiܢySyJQ%(Ծ>))!>[&Yڔ*eC Rq[2B8v<(Np `g<*}F Ypg3ZJ+/:w!\܅}g8y=9n5GtiokƈV\@U!=8ޙsUy㲬I1kvRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KcPwr`2bdb'&LJe"RN8 )$)bDBdqxp( )i@TP rZ4B.<"ˆSRJqAJ3kM[Q q"TIQ))hN AWuB7jKuIAr%VZX@B & aUTAɀuA,\ u';jrR@CyKBsGiL]f-)MnO126)@ EnKs}Qb?qԞ()Jf9<@ 4:)4荬ǸNѢfCB" Uw$-"w')!UNjTM#$śSK&b1 ؤLCqSDĔj?c[H h4Dk~(aNTwJ+.))!T n~|MA]P O&QjQR8h !CRmbʩ~i$P}* dp |PRkrw=+uNPm `ħy˂Hj0jlzIp5:V CQkKcPnk ;襹%,k %mM*Jv.4N[F HIMg4|[j 9Qk\S vtPu$N J@pHP8j8RޖR-(%"͎])f⥹Gq)H)IHb`):NHAT a5Fd 0BЄ㷀,fG;_]nl!<;\N&!t.>J\ tcDnC{6yDha(ݺSiwm>׸:1\O\rv Y&ݸH!Nm"F<'KɮAEMxAH`):ӷ LJeG<&z@0)cZ5R$)Ή) ht!5D][I02:ZѴ%3i3(n$) S& 1!A+\U)PodmBvPouɻ44qswMB›[kiO u X?h;HUp;yoK.߰y;#v%ltVhPqi2@ Š N)$tpܴj3%==}f3sU=|{5 c7I,lyph$ fWSjj3#Y23.?t]ٙ1'ESZwLw 6LVU#E/Th\t {2s1_0{KGD\,hp J*k2OZ8U\ge $HOn4DlzIw kk)3H;2 Fj XySuLLKCQ#8A,i,|Ԛ|8~({ɔХd׻ĀT.-lvoܟNJ@ 1Rp%29E~)4JEtDO.LKQkeTDN %?ISD|=ByO=ӴF?J~ x eCC`M;Mڙ)4N/vQi+m@W'6+ILdFT듩Eu3}L֎ܒƪc찑d).)8B Jl5ӔeBKK @mJ!nP `!)DdD() Af7HZg.gBA2;xv %8V/H@ bzmPlA v))-Pϊ< "]p/iI, RHO~SڛqJfHؒb5C;ZdmuN@Cuh9J! ZFq PT\UZj_U` *a /c\%8% CT}Rx-h5%vEn1JV'I mzgR}m=#@IM`<'7oPݣA MyqUs! Fa;@UxSQ IM5Kp!WfK\!;mIC Р(  V= FI)H AIGd'@hR#D1HIL[p Rw) !ED($*rS+h5EFqܩBpTI)y YC0!<@)U2$