ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2014:03:06 10:11:27Р "*(2xHH Adobe_CMAdobed            k"?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJL5\`'Bȩְ5 32Dnh0Ւ׻k vR֖HIUm4G~IM1/)I$JRI$U\Ak.krlfvCZ$wLռ5>" Oeŵ6qvbT>k-bv #VGMڿvVW?{ 廈'A1I,;Dx2`s춈x열|v=F;A[6l*uMi}ֳu4侻eNkF=XL:K~>sDZӲ/bOrtpj+mck`/?YfE۠N{";(f;8N& 8w:Du+Uu{sHwu.kp]gԳ sSgf)1@l,sAퟛ7X926dzxf>ec}z~U޸ 4rst?J_%߯>HBwt;_BZh. wڳu-۽?m:zM؜M?{Q~y)Gw2C<ilA?Cf*iYgڂ?yV#/lE1pM=*86:Yh&I.zUNo$n[:'Fw@X~ex^m/n]}Elia0%܁E_n붆tw$y۷]Xs)ͽ<5͖9$3 /88b$M ^QpgeUUu罝@CXA為Uu1HV2}'C g랯cqqqh/P-5r}juy[*n۶M;߲uh/nH[|WznsqO1ۗ[z[{=?|ͦRmsZuvM̶Uz5fk[UdMΩT3ǐꪯ!NkXԥzkF[.{(ӏ`u,k}g3kkbΏl7qqkK71sk}Yz2]<쁓FaeV=eR+}ʇ3256\ʫdv x[h5* :RZ\ֵ&ݯkc[,m{}:卵[۟]knM{}K?F?{jj]}yy^Τt[0=e~qqvmyl$skWz>]sk{eXu&P@9WWlsk;f/~?RA]GsLolB?Г u[3&\MZnW5(?}S" w9TM.ٷS2',/ -vo~x4A[yEDc?z*("'5?U[>W'f55Ƹ!_C.d$p 8σ$c Y'Pq6Ի(报;MipŻv=zWF=}e\U?k\h-v֖c{H֘r>Z륍 ȯkmk^ku >#}e\c]6{(s#uO1OPOWܥOwZǶ{v<-sngO}߻kkۿwJx/d3ѳ7@! 3>RZj#]NiƮ#*/m bQ7uT]jA[{Haś_Y{}c8wϺc̅w)cDJFXb L%!!!^T~E5 gGSAUa@ُ.sXmr7N``)`'^{5@ UbVokpmi'?yAl`;M$roR}`usAcxAV5d@{7{+!Ns?lyXpKU9;o F@ %Kr; \ї~ @A22M+'Ľ_3)U??"U}a\Kc] CXD oonO^.H:HԂ vxp ,?i~l/C?ɫ= FJ])g?8$󴏤5 -#\vU}咽=B϶3Xd4rLlmZZ}`J4=ϖ9OivװЉqꪶZX#M8MOΦ]o&Ax6<qjH4٦ݵ۬KA /wma: G\3}^Ou}P&l3{Jo~E%}U4!?]Mq ˏ:2;,/?hXT԰o?lʼn%;9-rQ[eGՙgl?sd 4ӰR1b%oS0|Ƌ,aS:C3cy`sttkW:oQ&ݿf9KbyX~ psY=x#j},;ʞ<,'9β<9DZKk]!;Ӭ:nfkI8Q'O(O+?ovf7fmWhcCIk_zE^-{riv ;lq(!G:AULfX2&Z$wx[K2? 51=nwtזW$2ubJAo^u{^" Oeŵ6qvbT>k-bv #VGMڿvVW?{ 廈'A1I,;Dx2`s춈x열|v=F;A[6l*uMi}ֳu4侻eNkF=XL:K~>sDZӲ/bOrtpj+mck`/?YfE۠N{";(f;8N& 8w:Du+Uu{sHwu.kp]gԳ sSgf)1@l,sAퟛ7X926dzxf>ec}z~U޸ 4rst?J_%߯>HBwt;_BZh. wڳu-۽?m:zM؜M?{Q~y)Gw2C<ilA?Cf*iYgڂ?yV#/lE1pM=*86:Yh&I.zUNo$n[:'Fw@X~ex^m/n]}Elia0%܁E_n붆tw$y۷]Xs)ͽ<5͖9$3 /88b$M ^QpgeUUu罝@CXA為Uu1HV2}'C g랯cqqqh/P-5r}juy[*n۶M;߲uh/nH[|WznsqO1ۗ[z[{=?|ͦRmsZuvM̶Uz5fk[UdMΩT3ǐꪯ!NkXԥzkF[.{(ӏ`u,k}g3kkbΏl7qqkK71sk}Yz2]<쁓FaeV=eR+}ʇ3256\ʫdv x[h5* :RZ\ֵ&ݯkc[,m{}:卵[۟]knM{}K?F?{jj]}yy^Τt[0=e~qqvmyl$skWz>]sk{eXu&P@9WWlsk;f/~?RA]GsLolB?Г u[3&\MZnW5(?}S" w9TM.ٷS2',/ -vo~x4A[yEDc?z*("'5?U[>W'f55Ƹ!_C.d$p 8σ$c Y'Pq6Ի(报;MipŻv=zWF=}e\U?k\h-v֖c{H֘r>Z륍 ȯkmk^ku >#}e\c]6{(s#uO1OPOWܥOwZǶ{v<-sngO}߻kkۿwJx/d3ѳ7@! 3>RZj#]NiƮ#*/m bQ7uT]jA[{Haś_Y{}c8wϺc̅w)cDJFXb L%!!!^T~E5 gGSAUa@ُ.sXmr7N``)`'^{5@ UbVokpmi'?yAl`;M$roR}`usAcxAV5d@{7{+!Ns?lyXpKU9;o F@ %Kr; \ї~ @A22M+'Ľ_3)U??"U}a\Kc] CXD oonO^.H:HԂ vxp ,?i~l/C?ɫ= FJ])g?8$󴏤5 -#\vU}咽=B϶3Xd4rLlmZZ}`J4=ϖ9OivװЉqꪶZX#M8MOΦ]o&Ax6<qjH4٦ݵ۬KA /wma: G\3}^Ou}P&l3{Jo~E%}U4!?]Mq ˏ:2;,/?hXT԰o?lʼn%;9-rQ[eGՙgl?sd 4ӰR1b%oS0|Ƌ,aS:C3cy`sttkW:oQ&ݿf9KbyX~ psY=x#j},;ʞ<,'9β<9DZKk]!;Ӭ:nfkI8Q'O(O+?ovf7fmWhcCIk_zE^-{riv ;lq(!G:AULfX2&Z$wx[K2? 51=nwtזW$2ubJAo^u{^ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$-VUL2c1%]Cتbx\زSk\6"c[tmؓ)eS )Db1-EvfXL*S}ՐPv ]O2v MJWzkQŚ`ң& (xWb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb"4XvM_/I> a*I,ARn$[V zF %IiɦY,Dtd$|6i,Dd8ESfMB^ޙd`KLn1'閜uO4zbvhuq8۫®6u6JEr% )]p!٩rbBV3 bO+NƖ#+N cbcH*'vQb*:WvYe=p݉žv*SLQ -u }Y )k+l 7+CF- A5\,Ӫ;dxD̛#m %L ʁֹ Dtsk!Ǒi0qMf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث$u]K˾S#3jrƒ=R<݆ZZDEĈA^ȼ5ddC1v>խ{eҝt=H(f,ů'c]kpDPuw#.'cޙ9%ɣU1RPF=]T!L%yuS8\ri+J f;HWbU C@Xz#!>; qZvb1Zv'qWc*UG,eɱ4oP c 78mfR]R:`(Xck|PƸSM2zZm8kMn#dyS\-CY9* )Yqnri" A?IyŃb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثy7ʲ+qV($AX -Fc{dqM2yk)p")˭=ۆϦ>Upqo%Xg6vG 1bn0Z%+v x8ck@v=WDl=1h+S$)6첽[ ([2 ;gDIP\Z j^kQK yvi'-' )-vpbz丩 * frW!FEs ;fQ(B݊ҽ0v^&آWcny8qCG*nrn⍬pۃ8LfHrp]_UGs?aP6r7SVޝa>hxlcv=pW4;S|#*&m uF])GvIbn\os 7ǫzh2r߸':4SfҸЗ)CO׾D_(k2bl[pXfV5|LM-am_A ca Vé,q6LNlJSʃO-^@⷏jFh].FEɈ\0˄M$4ړUm"J Θ&+0]#p .41nxJ;"3kdN_w`5ʄQpx!QQЃ~Tcki-n?sթLiˎvGivlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*y۞P=̭c''1:@-ȉQ/^M\8xmveҙ-(rXXb QNpp @؜8eqY:d6؄Dhrzb.Keׯk\ LKTֽsapW^8asr=ܓDq z ׍dz9||٠^#>){ÝHdIBTqTFN|O?̋yn/2%\l;2FB#2~8jgq|K憐7#A[$90QH&G\*7JZz"+]Z"Uek=R. /HLW'ñ:+f'lPe.+Ló;!Z)؏ǀb!qS&ا `gC)xdZ-f*E6b;lEAJdO6FL]EBk<=d^0%1فR VjY2T \YƝvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*>l-n :둞:Nf>Ks. Odbm-`M-yÐðs_u? 7̀͵4x0qݏ]Ю]Wcd ]-GQAcAYLhevڵy]Y lxk7BVrڝ>>}8sazu&>< xa})YEeJOϧ'G,'[g3s5#;eGq `L]Aq-z*iVu/~`,u rcolmLM:\z;Pal 2|llw,+iAFxk|$yxN獥v_ 6ɓbVe\4*0q@+܈\ qi;a4@wL˳VcLKeShO R/۲}gr561W}iƚ&MZ FcJ\9%'z ~'Uu)\-sk6m&fTM q4b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊۵]M>Xro;, *@bc$x[A+sYvޠ [`kEi9x+NC.ň]12+ ¸搉Yv. `Wbr0L*(k \8yzbb)?92}B׊֞\nESP2*ޛ(g`j&dXQӰMMiV9s#W.)ed$p[39ȮȗƷ49UcRD*_˸C59;!\gf]vlUٱWdgXt꜀@xddMhZ-$ hIZS)rc* xSwY] գ sywr6n??qwr YX3yЭm?lsy>k_:20Z%%1%{[PhaQv@ĖQ_ <g8&R2FI؞*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊&M[YEXWt]L1Fcvxl 3)""t8ի\YӀTa2lxG&13X*ZM0u^[!Zp [A' 𠡠㋺x۰MY܅)N9-LZпyҞ?ّDFen}|H - pPN ?d'*t''BX:g3*\LI+1?+9l&Uk6J%>˟"8n @1\@kǍh|kyq?aS`r?/͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊|~G%xZ{6$,qb)8jxT Ƚ$;sp$Y q <V]1/;n ut.q^뙵k /NML->.]k+i_[P DVё[=EjN䜹vV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*4э/"?NLyu'& p Hd1 ,ðSRrIv\4w8 7v\L]I/һ` L*z`!Kx=8]Ҏ LdioWn˔ٿ*wv3Gv3֠zX݉4ZT%ظ`CSʵlX#'ٮ ܰ0u5fm(;Ў-=):e.b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊04b/0зW,G¿wl Ѣi:dv]!FT9i5A#h?r!BL;{*R5Lc '7e6lq_rWn7n1'2bEȠ9"+l4 '2E[>ʅ|#g'5æGL͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊tSWgN%O^?%&:Q@۝E!CSonL<0FE݁AWb(vV"'+%]Iܜ$v'JaB!|ۥM2v4| ]@:d˱j(r5An^5Z@ɊM Oq #^U}f pZWx\s7mOFn *xSЧa@p'#ږQ f<$[+>6r 04#/uUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*1ҵ)4rR 4¢߼$VǻЂ@"#13B~UqadaHᢼJsd|vѰcSCm2YW@K[%Y ѪR;f*U;yI`G^AǞ^|r1w$ܓcqWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]z:8BC{-vT['\{eؔD5XWbǝ,KYcra(Wck%h~-db ?@L`_a $mx&vb\j-՚ԐL)h|,eV"֔AlJ% !=69&f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث{{mMn\bED΅cZ.biNCeg!%3pj-65fGf24"|)?2Q8]? F*ik.]!.mv͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثqzX !] x[Y-JeEdE*avV6](ebƜMpmܕPW 5&"C0oO+YEO$mql y`!#R*8RحͧOM$ǓW zޜC=~9 \|׃\͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbV7dG r2Ȅ`f=p;@vYAWetl, KEpAvVlG%1v5  0;;2|]wIf7ZجRߐ$SanItؒ[$ ZF' 聵k2KT ʌ^[,Ekr"r?qTׂoYscX0zxDLM6Ib͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbɷ\zzDWų]c.Va< PMx.zv5zed+cWbg.2LZe!EvUq`زƒ1nĹv́ɰ;Sv됓>n'rqEжE,*q;m+|Ƅh2$b2JK rR`)(v)!؛d2rP$fQWeB"02v8erWb*;2A=2G֗>#Ƶ|dL/=uHҪ7g[8 eq /PWvl dZH=:oZf) pS[L,i Ҵ1n>M8{Y ~>N1Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbض@U Q29杄/IMc[QI_g<㔌<>m7y FHy|݇B#)1wv sSգ;JFci%cC)Ɛ"BNL%ra.Hv]rsC_v#,v9EW%v.RBZ *p  Ԑ?wJ" 1/̒: ~ YnOLWƛe+O'db"56; G17 >y8 o^_hpݭ"8¦jqZ.Ĉ#(vV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊[5܂۹>-;ƅh-4hkOjw9㸇R Js!!rbW ߶spN\K_S6a<H^V\4Y N-+l̊C-;.됒8crveb).]nc[;+-K2-;TB)ئEaWeƸ{Vnezc,AkF,ɲ2AfL?:)NΟF+&ETCA  c[ѷQ`i<U%5_Ł"Պw;bٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊:<6+MxyJVAn}G'uٺ39/dTH#jY2 lu4`In']D/ X1&3Ybe,& 3` R͘šxm]0f\cXJC0eS$iK;19h*mpDv sqvn$aWc\URKA.wlDZv1"4i˻9S5"6mis葨%2#*h[o٤28? dm&'%8!Sm;tL?)%7ڵɹgj"RԠ%HOvrSHJpUVY7aV-N͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbAO݊xKR->1Ov%9|/RN'.;fCY<*Pact>[E4Rkݎcv 11)0y"3 nrf0^a[S2Y#hˢ42W #.B,E۰oI-p#stvGO(h on$qwd岊Ӧ ~l1 FSw-W18p+nC9U'QWij}%c]Z '%+\@9 b-ġp]3˱ǀو;F\p; m XNÈmʑcBi:@պW"~07]!]$/;w!EpxL(`)m$$q߅iHY[Sr@#x1l8Y#]`ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbǖ%Nh@U{lJP6DsΛ&TSӨ`Gp0&l!~~3H9 {S|oig r#pzᜫJ%~+f00NU4Qvs!Le:k1 OW5NJ\Ɯ!!ٰ$;1mrȥؙ9|B53\}0vQ9`Ca]$FU[0ػ tE~&qlQ<`FJM~|qgBK̎Ut?KPPzqV2zCCA.%W&,iZx\_cțrvX8e$q,,8cl7iT1Aʃ*c,B ֝1[vXs۱@͊۱毳oH-PdVʃCpxj=r@+p1jrHuNEu;a (7'Qp ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثOY)j)m+y[b?A7SCQ63G"faĭ7U p/˞!FU|ZNW!m.9 a/)%LL\^trS&m2s&v`0Se50pGl< cq^eRxiy;ヅC[v$vIeR/mUeҹM;/6v6#%f Mwjp~.vX*آbvHVe+ZVscpbUVr䭚%x뛞eq]xnU~qfX@ܲ-x27bNi7ğn|&X{Xۈ$\NWGKmEpsAp p6*ثb͊51VtJGc$x.僢њJ f1[\?-+nf??ۃlay>74\"-X\]opܰB>?#rb8Dag?Wr *x; MUl8TX qP]pO\.#"dS %C4݉U~i`c;(]O2cOa`]d]=:JL V b%m\ ¸i.voDxWc'Av;KX)v(,)bM/6lBLכ%_RsЮ eP-T좤eM;#,G N@vnoH´}i0 abT.)ؓHƃ'cThBJi 0%S(&O\gliزXJӱ'n$3Ay)> c]W $5%#.ag:epo.xaCҘ ޜN1zrNG ^BZ!M1+|[Me]jx=NLrԓ}7`.b3-3.23U(.)v͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbQo+}cSӱe2.WHovuN MIM5$a8ӓ*J%|0L[Ne<:t) k7zp~]ND1b.VdRwvG&NٕbGC2,ƘRrqsj~H> T1+#Lz":/'`r$HCF: )%I=\&1!eOIT*ɥPbywYc.tM'vr"sh`FD$H˄b(ۨ1s'5cp1 enG'Sp;e%JvE{FS<5Ȃ"]‹vn Webm ۱n2e$8zee.UNB0Z}@-cmZe˱24bJIMIHv!ӦD.ǧ\P\(#01C+ Pn0[v_ݲ$%+Lm.ST#5LpFk8Z͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊.;[Wmr/ R'/^`Q~iv _-$;' j~xl*f`3ZM0R._4p;.Sq#m0'ܰB~$70'ܲΒ%rRVm%Av )݃BO즹 t0SD5iA^ ; )7'bHIWf\Wr[c}CcJ|2҇cD$%j츛i۲(6IU|WbC;,-))="%]3W+PJMne]e(,ñ˭.#+j.td)ٹbp;5p;vOtrq"+!؛`rs;&ݔp;/59"5q &zÛ'hvnYf lf-\*, ]7]1WecJһ. B+saC®'c rTś@v>30R)uŒ:8Dcv2MӁm+n;vnX,`*]I;L+B%] *vQZv0|2jg*x|2jkcNɅbɉ%آ:)bY+nuc-N JRmظ5R>y۲3Y9lƽ6ϳ98u?rZuAݻ A[~?Pd?K^dmfC`9gL b%E7ӱ:drbA kdcSlC(0cK 졹+P]+Nũ2DXqd 0j C7cAv?FI;8(.Ƞcov9qCNءCCƛC*L% "x\uٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثSv_ኻ7ኻ/xV[0݊۱ [1)v?m4? kN;W'Zuqߣ/qW7ZuqA^ݍW(k=W4&´F=tbcck]QMڎM|ZTcFt#?xLj-: {?xkMֹ/G Ki_6/e0 rœ\f/cĞr+p}1 ]1O0Zx]xтGdӹ`kOw,P[~x](>+Nx.Gݓr22+N叠=YElܱpw,ӹfZZMq൦)٨N6v48x#l!%A)v6dm"nL)vc 80$\Xf,``q逦<݉y6;L60C‡fȔ;2ci\y!dSN&\ci;],fZ 'eD!DP`trcqWcL]-]]2Av(2iʼnvR>HvVq^TGMq^W[Gٷ{\kI XoFS++.0@PmȨOB82AQƵH;$]/QA߯W&B妏 h땒bل}Pup,%HW.tc`*mrVW ouqUxO݉5m ^[h5 I:-' kZa8m)Q[SUxpq'}pOn;D>pZpyׁ[qupƟm|34hZ};Ŧ[)4[)Nrx ^da7 Ɲ6ćaZ:YE\wbyl Ţ?ő\kfëAJf>z8c)%PJ G   `V8 .1 6[hiޚxaei፭;(ƞAZvWp0vU|IcItJ*$J(rSQݐp-f퍭epi\}vv8 dIkv]p[ vlxN͏ix-;/6ӳrf ֝Qi٪1Zv2ivQ6͂*CܽJ)}ڻऻ]' 'c0$;+q;7v$2ތmPbF vme^AH%ؑQ.8d8ALelPmNSr?LFXxe2P`r F%ƌHEHdw,WbeEJK@ӱ\wK&һVSNx  £ 7c~y*Ava,&ۦ3l n8+nm$F dDTdރ)ؘ")ev;ʆTq"0Ug, vX9*Wfc:ev'WbO|ؙ~BI rtǗ9v0*܎*8#Wf$ReNvUNv_#]8C8]Co[;JTqc5ȕvjW"v*Ńjzv0v1WeR>#(8 &Cc2]] oI7Kvxxdc020O`;# N€a>v[%*s l |&ю@s3(mbkj)׽6H:<l)S6g4S8${ ۋw$;JeeƓ"ZrjI ;,@ȥĮ*]A%ؙk.LeU&ػlykK]ckűHv"N)v5N*_;+bn9l i-_Z|iȶ:'ȸ b͊6*ثb͊6*ثb͊6*ثb͊6*ثbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*2ĻTp#&QZ㈢>16>͐Xq6̢TrW.Q]1^04M2a/٠fuɃM\[2Dz2;]йdQn2Ím`x5ʲExݓ+*Scl@nS⪻W*Ѧ݄z_hAp4mg`˥6$Wlf {\ W|[haH1Jd \Ӿe}56`)<W`]&, erG鉅 Y.,PLk}X˥U@V-|4N=.躜F.ŌdY LH6D;-\.=eN9jrU98ͻ pItq l CpkNs\ `(\ҏ|,xIA^``]Yq, @Gld\)va]['|R㚸B團K0ɫi%.,2;2Av,Ieō;)22NƘI]6%͓)v,`C;G|U71e+VR##H2 QCLidL%J4v(4 F<ݔE1brl4aӘ `X4e&2]ceә ٣=rc8PV?<Ǩf99݊!V즈.L$g"'c%%+eeا Ŵ6PFM\p0q^=rbGs\] Ɋ]a$["2c nLKc f*01M;\Tb ;+b8J8x9'}da4#N˦WMђ]_}MyFvr]cb͊6*ثb͊6*ثb͊6*ثb͊6*ثbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*FSEXzJg1P͐Xqdee_l+n84`ɆAp>86˥a Y:;`M;HYAR C` 4M!:5nؘ xS!̰᷉tH}+[&zuY81#MrOr964qv2* c\!ff:s " jfQ4Kn\n6|Uf1'FuxG *>x`x.LӺ+ 'p 29En +ZO;8 hed-6b1\[v-, LFF 𰔷rPz Qgm5u>9B2}* =ç>0Lc?g$C(Ifv#k=ŴgK;@ry8~cvΓL\rbU ͒?QvTWaHYrψZ?M#>|o,X"Cv&dh}k]3beQ\U05ªxd]FH%ivW/ *; 1CpPǎSJbL[\;19h*i\#]*w'c 0cݶک*nU[Cĩv<`,. ]"N5ݔ mG"ݛ+nƓV]NL*ܺ.Wee.˩\Wcw-;5N%i9HcK+3Q. v+n"ݙk%mبFݏ+nĔP$m;bGLI؁-SJ v(rĻUeq''HvWY۲ixT㸃baQ፯sq-r1F6[Cr;9D iuNQs d:)%9i.+sB r7T"LmrBKlꜮUT㸩܌TSCs`Sr9 E5ɉIxP 7%͑&I6otHїq5Qn -TȒ. TcEV-2!L rRAv, N@AvQdm,;-d=He?pX^cǢ8^bK~e(lvbF<0Aٿwv4];`")lj)9`!k\(ؘR]6lxD5pp3v[\SnXw`F/bx)̎=|L\b =?As8}|a!ɦٝw!;5NʅT|@yUats~Q;՗!$X+2,$Ch"t# bت0J v6E XĻ52iIv0[v0n-%{dm] aWeq.Y;c vnX"P%plF]NJ vjWe]&!*kP$rRl I$7ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*XG" AH y*sEʋ0b7,̹if]dihv4fee\,iixđOBx|j22>1o#Mi!dW|m-LȐKd59dc§N"^92A 06Orm)en+N>!S9XQ{E:favgH-L皖ēJiᘑ;6q^钙fj 7oIo')HtƘC\e(@+9;eZC⥣ $+(5.Fޡʤo /ϿÐzϒ\_א=.FvIW! 6m|N}Zr]8|1^݅_7o 1ظҘ"]o;<1v+eEZՃd ivDӹSQv1S@LᏄ5y풦"\e8ؙHeUk)OLU,bb'ba IG C&iv5w8ݩ.)۳!yc-0Ӳ‡ci] dc*Hv< ʻ72(vW1vW@;6$"vYxXk(!Hق c m4LJNi٩,d ;ƹ fGLqgeZ .Y%|0Wتp$;錍QNzC& ];/D]-rIv(-K.c6Ĝl, p[o9? L~WJȯuf22 ~22ó~~~1c :5`9 AؠQg!bqb`9pxaAزؠqPZ(pxx]N Q)v6.&\.%<.\+yY+uvW=2ox]Ȕpr%e+d v1'l H(0v7c1GE"Nƙ ]eaIY`!. c)vcvAGrz Z$iL[ZRX,㐗e5mwbf|NeNG 79`FYce.'5 b0Z&B\LzPc"&!3_Q*|NG! ;.[e9Q" 6kSB*CdKtS jS^ h!Q,Hv(⋋v'$ $N4c+\V9 M;+Z1s%ؙs%JRc PCE;v>\RqƜY;( $єv&d9h6$W.j 9<=[e.fp7eb͊6*ثb͊6*ثb͊6*ثb͊6*ثbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊\Eȫ`*={15<2jAdPd}i,P6VZ;⫸raXMrc\}6}a*Apd.α 2{xks A>Y\[4)F[zrWگ!vPx<"܉ IAGֿ0V0I.Rƴb2rOf avh[JYI#uu3Dl#HY`:A> m-6(!adF5#R(A Iiذ9RӰ>}4R|pcb{!Y%q}ä2wC#)iӚv(# w愇 3zv&I>9;;LܩLD]3v8[qv$ј̔nv4 P !.PvL1v +@v'e2ZvQ9(;+-Ndc.T]K$o]ŋ\!ٸFDS%p!KJ0&!Fv"ќ2A4r? 6q6`-vs,jvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ 4[aG$wثisQ-%f 9D'zHiI ^YPppRӋT iN;698!7QUW 2-cYOU뿎cˣ.L ԴXy%##ƙv3 +#Ke}CS"Nr7^,[F"EuF*6ǀ`Dco vP8|RˌOvQljz'5k(8Lj+GV|B i[șLUmGW)hbfʸr~|0Xq~,O/l~-Lɔ價b߇i'ܰBqodO⿡anx|'IkW(WpxitrǮ?29K7rF5Ti#],CpLGP6LoŤyw,]tnXkpU-fNO\٣ ~OBh?X_c:nEܱe_K9qww,\iJձLDk o6*?20jKv!bbl-I+&CX*=66L.sħ!Lɜx2w,W4#,%w,H-@;(L_߇qtX#f?S!Lw,ciH-e|[\։r`-5e\i%Lv"=p@."(ɀru)\\͖#uq" V#&d bfC퀵 }vDDz] B1 7M21v"fbkL7* ީɅvm\>poe,;?COFBPJf&lf[$9$;(rql) υ ¼.߫7¼.ٳ f/֎cGKxӜʲJ8]Lr38]Ji*^cC(O]4Y9%آ:92Kor:9'..)4濎N(r;49GB8]&AKN`e_#v=t284>2,X~ɂ.؎ w,khwȖB8M: qAcDJckKrii+dӹe$Yk+! sKw[/{RbQcC/gXnckƷMCOx%?VgK4^r:8-4ZZgEO_%94FMsWGKa.烅>!C !%T2n9;"mw!EcT|ɜ5)A,FЧs,{fTr#OuPz2l!9YrLijw1yr=Qᓆ=ۥùc2IDrm|FZraiܱtʝ(<*fc Pʝg wbCb2L LՇ `LTnh N*eN!W! +-'L*qgqrlb)xNB6zm V81%ewe0$gqDvw @OZ-dd»0LxL npA.JdicS"C cpfraب\AqVK];TbdS& 0Vb \K&\I-NC ]7P"X$Sf &̂n,d "n\C`FcrMң&͑勦Jt?2 ')|e8Åme5x:nGq7Dw*iعxd8ezv9`leq,d]DA!mrĴK#v1NCiel\kƑLPC;䭉#h!Ep2=.ƕHlLJx؛-p]!$ 'bG%ieĻ*Nb}qvb0,%p露'efぉvW HvQ\!HHNA8C L%ؙ9:j᭘;r[bv]1E-بZĉ v;? ќrpcxS%:7◉f>f2[1v9W⌛ft dc ;8Mw[ΡL 2c6 ^kJj<̈́8㘉oS}#-ːTMFr>6 %U&4wѬqd5id1>K,mW o4B).Ԙ!g07֦Zǥ3A≳a2T[T)/[/P ݂\ݖwٌ4zbj0pY&hL =T\&_ig䑂8$2Td}y#EJ:}l_"=I0lvn> 3Y<'A%͆@U; q oFcro8$yT`k1q?x'DK1apN~͘b|1?lurG!6W7?xׅqm<*|dxp(4?ƎTcGIY5uF8iV4p:Jwq/ dFHM-=tVX&NxׅF4pC!n*,}Yx^N;PLC0LCla}._+29 Ɲ\YlkdV`SNo/ef47  (c,d;'YYAj1v81BQvKm.I W%ᬉuF<9bKIT UDž9txzPl15䍆39XjYh!8N;W)"Mۦ4orVYH.q#OƮ& ebe1Ně&2[V2|20egvb.2 THlćcr|BR0;Ȃ˅[tAE;e;Zv"+"J)zrD4GJQ ʧT`bHN4m.&A&P-'4lWLmkwW0ڑN*൧WWlQke'.rWb*P!ȫ_톃>ƘIW7d=Luqi'u:urͤ2vew-'T*%&+Ai7#*%;9i?V E;lOՒf8W#=Qv Kcr x] apvQA#&$ zFLI<+qu}d&-W(XꌯNGݐexD}ddK1^ e]Q=f)eM?Ž3uF3ʛbQٮJۃ2޴ -c^)wƫ1Z}){rAٺd 1ur2xeIus y?&N(-\ɬ۫_rY:ĆW8sZTW1rKJ,Pt*Kianj Z%ذ-6;8Y0 aAxxY;D ȓe+$7a(\I I;cO'.*1f㍧Db.͊x]𦝊8QN'#Žcx8SNrB)cL,Zv38xV1ZvS9DE4N8knO%v4HN8a»/8a]8a].q»JG'T)̻e2 S%R&J9TvU1A0p8`;65džqq0Pp%f1;ǾF6dZSc(%;05`ra;r8$Z3BPW `WmqEL\8]ch͂. 2v !\< qJS$,Uw%đ`  \qސʌb+`bP  - DWekvhc qX2cH|0(bgdbDbr.<㇓9lp$k2PwLf\qq2@b dY^liʲ“8Hj8£-=)waewPS1-qPděwLM; @ćqȮ,)N,Se`v\b,IbqZt%1 0rV|&f(0.qASa'\Eja\\>3ݿ釉/t~-}Nl^-釉3XӣoLmoLtxvXip7?LI|0X"xh(ùcƟ7?$w,"x _ 9Ec~YȚv;Ƚ Lǥr؝H;e1FYoYaȵXpZXƺrqbptf'?n8-ǮLI`\$'$,-?S0Ç3ݿ ճUd$vYO ӲV )پj S ZN v(#-٘.DŽc$-akybUO qh'H'ɉ- 16OrS`(Z$盛ɉ/ '%v<@'+2Ol'H;aӱ<a0LmuߏvFJT͇m;D&"eqd}}?టZ>eM/AGbW`q"GMt]Wq'+[n9Dm{{bD\]VX r0djd?+`ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊$Vˏ%kgtA1\a#zXqo& 6/)v(01-Lq|V5czI["TEؙ`]LNƺrs ,dB9xTeȎpYq"k;q(`YVMAǺF]=@,ʁWMrv/"OsW tK[ԪhJgMdҜ&nLbM^A16i T 5켲drɦ,b8݅$b3eQLDWq-4ám' Y@b LN,1\m)iw,cXpFS@U(ٶ]mEʅ7G% v&ƹDcLbiK[9G&n(+18e648LlSX=WrJǍܲoLI*T (!iDž&nkxisx8qvg[)&T8j9]Ji188Y۸eLg$M')#Ğ&;cĶ9a68iwK9h+H)sqʸ7Zw2JN0oBx_z$wKٽ{x鐓pqlGZ_ ̣C6\4nƅNenf c1;)`NƃRmظ1GYZ"0ݬsYڙ!DزI\H9)1!_ 24i,v86<. r6i$PrxdɣL8֝@ Z>A~8ƜYDG|0MqƵ=] RML` kC5ٍmr0, /Q0+C2b2kZ)Li04 qhx!ɌvW.piaJW)7I\fVP [&$e8ea9xKDS3 W,RNN&9Tr)(+l | }ʼ&_.kR;ܱV#zd 9%ծ5'TtǽC,hdbmdKa,TgԘm|edߐt8fVɶ0 |sMaC$5#Oa_dpW'>% 4[wXR,$S|S,t-"G\PXY(aw,o2 !zmMNQb rh JZ [vo5iQfӄkKS/ L00rي>"Mδ툶~C-LPF+qfiƔ(ҟҝq9-Ropqnj"lw9#<;3'e:|Q_S8\.+ =Pi6TH)Jb χVū^x8H݌#y=2lOQ0$+s㗌[5ch1Zdr9'LxnGJcěqH[@ӈx9 |- rO\e 3ޝB{d!FaE)@x=r`1vXL<x"eMָ[|'g%1w,GꥏQk";;)->.創01 T66!ܱh|Fn?3"DcŔ~#! QV]q,zKr2(8sƛ DF84ۓ㽖NN.q?\&@X.HsY\yb29?#g6=s_uo Ï}#ƛ0 l^ nF6~ϫ/h`0Im2q2i4^ A#.M;Q[`JDk\Y si2GABi!-j i2]Q"=Rc6Њ0T Tbnvɉ81ClYodc.ָZf<^6WrRNs"~L\D?<tOLiG^WF&j:ca ޗ6c=ߥKx^HHz^D6JkI5b[ Z N؃ F8HJɺS-U<=ʖ䉐6_3p#Rү 1s "[ ,z$"14̘LI9팠@%#PT"n@k0J×rWAD)Srev+?ypj/3+ w]"]X4]ۦ>(B적#8P1V#sOu} >&8lbO?XvK`W^82Sb_ `Gb-zb{݂ W7q!gr4\]UּAә6la~,vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊$Wg}P\}a4?e\+nҘ-1B{b+yZA؋-+cT B]oՐKCU)WfWeSY;'je2 vFT+vW"rcfAakA+!ro MAț,Ŝ΢Wg]AŨ5!˹ư^}9F|59W G&2@YiȋckLڐA LgYEWr9dJ].]ۜ'6&5k\7E(1vn<ƕǾHw,Qc"P5ńC+2U,)QZDQͮXV=dq7+x]w"f.劭=k^r*+1Xzulj1w,X[|1XT%;Y_|ǘr͢ycn9g e=4p0Elo||&+Pӣ+)B,Gc4SXպse6C!56Ž%QTY@3+K3|Dsy%eؑ\etIq8Zեi n36]P6Zxq5vV: g0Ρ}[;wCp٦3G\ݏ ba6qvc̘G .fL8) F8ĚV;gf` ǁ&?xx7L-ƖCab( gb)ӎ4_ @LDHOÓe ,c\|15TO\+wL`IMP2dJMKx`lTP;` 7-㋊GLjN9qKkt9Arb"+H^-Y!XzLg|HQsO1*Cf.P)xOUap0nWryHj#p+5 zf`mD&'ηf;>34ow=c7?r 6bȝra$Q &mGLxyCP+dO#V= g04ˀنERamےm؊{41D|o'36`e{,R_e87)"d:qXf Ǹv(f'Q-R)b.„B4N{%l2UzGd& [;!AonR Xqtm‹kKD/(,.@0;Q<fJɼLRb `ۦ@fHv3_ӱE]*ٰZ6\+eqW-ܩB ;dLnˉظف<6aixU.؄ɫR','ga16Eۀqb\U UD4zbX$Ž?|-kVdؑ[vZ@|rDmLW=++,O b~M ;X2c$ӹb"rvCgrUjbYE+ f%w,x'$P5ڌ][cNAE;8۟IG U 5JH[Env߾C".-+nO|-o4;5;v%w,g>썫fkA^CnXl|r[b][s N'! ],EH4H[c*wHiܲ~1&NZ EfO6bY^/ oOK|pYbYbXՈ)I1w,ҙvrJh2j.r&:OE)90'rܱmܲũm.jO|݈[b؎rmr_{1!ܱ;˻ 2t;*MR浛ca98淖RҸJVmpsrǮNS"r=VIalH]뒌,2&ezDA0ܳ}\3eXjicv;d&8ql [33b1Pb~26C`XiͿ>XS\Ŵ^)t]';4^3 2l&l[S,,1w,E>¦rX [C.aX[9-/C\rےz"~*l0Ԏ:"l3k,ەreLNY-DcܞT\ q/20fr6Z\[- [#e9Kʤ.!#TCts.<|pp_%@)#Rk7eo׾^qj']h Ş{vxvxMzKwbܶ='c.ߦUl?28y66hrA0ap5Ď (W6KʠP#Si4LlZׂ{fc%Dʇ"m".$1<O'sǞ[5J7+hq*&$`o,aj$[8xQ \qqtu)1 o_)!-m4]2@'濖>\%])QJTFqm1oJVzq-aMBE7̈b{8y(L@|r_ϥ$pڢ>DKTF88d!GڊI;SBw13k=F/g {p!QZ R2nSqwL)W.\"^2ؑOedf|N82\ݘ˓>y2Wж.pI߶g^e~Zb`d y|UQm\L]6n#8 Zلn׮#/ ǔ>NC3FvHk}#C8icCZ/Ie-cdOD̏Ί,sH4a֎gb$帑Idb1zMGY':"KL|P3mn6/c&jT?S'C#N?>EK&Ek#{%8`7N$2;inP߈| T̎Ɛ!_5CTGviŽۚat-]/iW~n@4G C3$P+q +b+4~0?-Y[:OߕHsy5߉ OO#={?bK.Kn;݅'d '`rl:'aJd"'SjҍF?ɐ!R&ܱ{e7 ~Zip\,wQӄJlA}+,i@"gJa,#'fylbɖvD)e=@M:dFM)ڊËTqPVN.&U1:rrqri{pkp厥\q~|C%=g{;"OtM1dzJ%7~D旀 UX`42⻽7Y29ABQG6ԫ_o eo1$T~8m:<2 qmnYblj]L9ci"13dW~C)9VN8 $leߦ ry,49 %GLR+*g3OY4ߨЙ¯azMiCSNL:/g {r--S˒?IWocٟI3E>XEuhRH3j<~*EE"2'8xo6^Xӓӝ6ss!0JpC9UrMfn/Ʋ+0a9#~dӶ5>;; ͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊%^T/א(l͔S%aI @J2 e´dii>9 HSFWv&^hWb2;a-~ v>ʥ(NdAo%>Hv*]%ĉjvˢBݎ |r^c.NDždÒ)aOap. EPcn+(7r8Hc; QŐzZx#ܩr0c-l0*\Ke:a dK6TfHevj6nge+2 J3O ?}2#4[6-كKI+a)5,񻗾(-)჉"n1'rŅu>앤ڸJ1# uszHd}ؒ+kQvS"kl~Y]9Jui*u|4uF)oׄA8xQi9m\|1%xȈG&-aS(D[%O\) jNN0kw/|8\V1啘"ڭ1E7냅66s0m^F<+n0R۹{ri](<6R;0x7с}]Y}D_?WF'rk;٢uŒZ K^(\'s+^!&Hf$^x(H.mNk^'M#{~w/|p3ʲ9? m^d=2 o-k2H(3 ĐBEp>.@[\ž=@\UG%2pPB>sۛP~> c5urh;/ ޮn5 LS3~n"waSd`cc l"Z,8yr:ִ է?+}ZӨfA&5.x֣LǞZ5m?yz@x0 [{+0~L{hQgeaP .h_fAAekxSS3$~/~S>eOrr~7? r9kS,<|9Z1ͫY-2ٟR Vf{fn/~qͩZ`O{ ]D GwlL6OɌǽ4~I7~~%v|/֦yza|ݤ!H¿FX24c,F8Ep_/qGq?M>AQrR;9HqeO1edbӊ@*#rvM@jD6dsDs.^l?IŤL;٤OKqaggaNXqDU7ި8rilfك |CcMwDXi`|2 3ripqoUualɋO"",Oؿlv3`21v 9qCk-i3j{PQݛ9DcPEi+L@5ԯșd`(<|3i"@ljvsNRWs(ZF xPryiykjGDPxcMy̏O#yj7_|ɄAi o 5PyHgÿu:]@*Y @tuF?B~ wW+K+J| ;MH9߭٭ѧ윗zUjT$S_뚍Fh]ƳbeqQBOx+l6.0=;pa|/j5.11Qi'Sr-u ŜU(Nmm,&4b, uO؛A' ZV1SylGz~ؓjh x>N.^!`w R~J1_T ^غ^3y\ZyrdyUZ哎_7Sߗ'`cN\eu|zm@+2їG~ֈnd #Kncf\XU7OG|}[ aND=agDˎt>~Hg>0}WFo*%|ާNjczߞB* tfD .6xc@z$ޭ+e㷈]EqbJ(ߦZK\ "bAM4J=pًkJfI%vON4,Jo(aO/htXGvyz~idFk۵S? \&c̈k=9@wF#2Oo3$f\QcI^"15gcXǤ]aZyH&z}n!dO*صmf줝\|ѬÃ,v|{(K,kdưGb~.}ýxo|l_ZeV'Oih׹z2C⃷L02yZc ]+r!$Fnr#r6rfc} ` f}V$]xwsQvثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊%S8 l'^`f<"$a4 Bm Ä[qS'ӈiL4QmqDKLdKX! &0ٚqgq lG7f)㓮2`sqf.\W凃} 4u3rcd#aلN^ bQAٱٻ#d;+2QRcm@)/s*c#N NHQ"9GlPL9xAn=p(Ő4TbCL)ܲPro%IN"Hi8>*c;6n[D2mOV1|Ef-Qc6fVRLLy;+S1<ēe)p ) ei񂓐_iLz&#ŹkB[yaҘ|0shvl|0c\rdN0Ů9K1nX!%f™ 2Uk2 a$ $qyn <2'rq#v#@`ˎ (ȁ?++k[j@V5- G]>aɖ-4V!!?P*ZD6b OneFZ̧'Pe.:yCr.,a)4B~'ˎJJظEf*A?~(ڟB}ی] 7`O:Nej0QNarVKTjֹi4Dq߹Oؑɗ |{D?~&I8(Zm510v,AF8GЦvzŽĶߒœqt%RzOQX2\l 3g0e2ԊR\rÚS齘2Q~u>s+Y?}[Xߪ1b'o"Q&8>8ix*DPi^CK'(Li8eF+!Bûǖ>GZRgA<*)eӈ/ \O5{]FYАHXw;lőRca9nݻ7hϥ;}d b[W/Kf)N%wlRwc\43؏_w*dt)Ҹ&(b=yjٯ:]l3Ǔ'uKV~U:UNM\# %v,ڧ,yBNە*Ă0PGlYj G 6nx)U Ėrtݕ얟'N%9u)c׮0dAn;{f:JTiY8 cP_ /eZrk͔b%bw88Ó BxK) ltzt~v&.qN~EA.›Z՝gj1?Np{M64 Kt#pwͯoeLS6ApGw]  @Ƭu;QpƂrT}AăjѦ4~=/zCޕo+(Y1) /{!FQŒf|Dt)&N4Q{dhU #y}=ٱaŹ >7<:xLǃtvzcxN<:cP?\(Hi?"_,v6ݿP'Ow> p|?9n]aW 3PL|/g?+8qO_s*ԞYAZ֍ŇeF>cdTĨ3o}X D-Ctę3qpr^D""6]^Rb+})&OFaɓPn,x;˰F,zŐ6؀]S"T(@QV-Z=ŪΡdib_s7l:5VpIKr&?ٛlZɐvd bp–#qw̬yv//?Q{ԞLq2AGBRz#o#sa^4xQ )lrp$fiR̻bZhjxHُ6E1I-@LʖN8ǦD+ 9,~k۰4RN樍Ep{E\~H8K,jG#[n)lp>mRn֎$xiebAxm@ 6b'r&1EH09y;ڸ`$žXHnrx%4]5h\7ŢD@tzl~x|n1j[5*WRuҟ[3N[MnJ>xʥrc/ڗNUӾC]G qү|#S]^c?ګ?P\渶cqRR .\ڡȧNm#35{c9e )ZW|evO`O!榫]ܜ?g儓?#7rZGV*9hS)2 !ϻQSnH9Xn_bᩫ~IfX˯eSqQp[_|}^ǵk1UկC r-+2Z 6wnT~6X53O' U];UJBҴv^>꼨ro0WII۹R_DP,0ڙir+ç=r='Q+EY iLtTr?xח+hWlhY[/Xqx7\[_}Tj\~)x>ϠeѭX#V$8J]ubdRg|V%ZmUB;U+/f%,csu_>~ &coPv_X0U"fW#W8c],I@yxv{w`pÆݏeJ3"d%i-ސU#(5?E"+cj k<_.<(5n=Jm"^<~{`jMY %yqԘ_ͨ'˛Ԅ/uTM,drۯXk\1.81V2 NNntQߢ<7=\pLSN}h&\#'W{kS#q6'QrtZo `|گZK2]=#O?4}t&ГLG> Tv9-\1[࿳sڨ=|̮ k ARpE#[]sW+|lv@O*Sﴝu +qbM}Ld p=.x}ߵ,U^G?~6K>i57jG 8yk?~[E|$ֻ2ӗ~ȗp)Lk܆k-O"k {0`7L|sR̤M>p\3!2mL׶LzuCT8@Wj-Tm\ȎN v~M;1eΟMfRx@cncڵșhy .G8VƼ+C=ӝ(#kS,8!uM; ࿳ӓ& UoޠEkoY(+bΞ&_v .o 䀱뙰CȟӹSo|BĨᓖdaLRk\RkΰN\WXBH R3NI>8y2cd J7lwS$P W.ɏ-ڝha*?qFƽ>XY4ӧQOSER/L6A\k:}iCn|8t9|\\;V7!Mw9vLOcCůr8 n5ho.JH6kXf`;=no>J&/jxPn,>c0s%<]VC_ tizg2pqS]Q- +K._6CFux\r a6f*zf qoL7Mlc7zZL1JjyDCv"V~٪w7aԎ=H;+vI7v60q;Ŀ/;a-T"هNBonU:kseCT|cdV^|ޟ3yj{xf8` N X+ӑeeG5><\h)^kLNnm?ծY:;rgn RI@RM~曵lw؏BMt}.̤Qˡ'i5^CW||^v}oHk5y%m6' VC,u!seZܾ4+pn-QZ໛Qs|,ƀ_JRV?@˸4g Uq:P5['MjD?0GGO+Ur/Fn]dBx^@W662OV5j2ĸ\-V-1C~*o> ?)v҅Iރ03ű,Ԛ)51N xfWDc1CJmXOJoHp3N0(bӦ2ܘ׶[4Aj k~Y^x x;t,CSλsz??I줴DLy6gꁡcaC_TnlkK_ ֛P?~yeELGnad1vlsB^('> ~t_kw}L?z>u `]g1c2eڞ+Q,?O]@)UgzksxIoe}b4;J/uE*pfLe]f/DD@bwBGgafiu7Vf`Z.: 6SZe/A'YU]QB>0!Nn@}5VAx8-mͰk]gR4vZ}`W /CҞ0xngin \1xe8vnW!_ /\ hd#阣/7+$#U_/,daZ9z}{;ro[e觎U?d2J-M&f|Y饽O~oj2j<~B}lU)S+PčSZ~81콤`ZlKz!< ֞ŧY&%AUUo=!gݴ3py__rLu"w'C;]CkvV9 |FCv8kUM)J{f7Of WQKHO*36:T3 H4rtޟ,Kf&ީ58z~dL?dfN9O{/Tq>cOXJy5`oAo} NKk0_Q$Y.|^WG̵@]r] OSZRx$G켽< ۼ mL+̚L6ѩМ1⻷djcK3F^~9;fZO 8 O1NZMLFnƓ\#dM8rNXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ tc0x)fcLDd-#kga_֕!]jLK'mޠO!Y$*WߺƼ-$'/{l'*|֌yբ5>#@qdm~',Wމ[DT ڞ9vdQ-d׆Wl29pi,Q?G 6!؜BUjO&I9N4s]8Lad v+ur34jbA H.w8%qL]UWcd>.L"99fKܰEOL!M\;2b #Ż"ƺ eѓl vTuyonM/p@`D9'Po(ۮTC0nVʏ S."'R$u2[x{m..ZS]\-wY`h`k56& 3±SBW懮:988TH_0pp|IQ%N{a݄c+k/ӧlxe CȂBbUVnH[~d%\lU${ s s$l p8 {R1LT:$%Wk=wLFWaL9lLܘrߛP|r"Dv: @fj]LUH9\i2YLD#gs`\`qؗcN( J#rPպ`PUFa?6/dG$"~F[]}ycb>}j? ?d}؍DeG''OiG쌰gyru]C@^m"|: eYuf\Wa pV?d eC&76>Ͱ?v-ʛ,uY(pN V6xfM\ |C03\hr$n ]#Gݕ$g|H.cF'LFcůW9 {*\>s H?c_2#'_'48޷.: ){\2aC%s@YK ~vYVIP70T6y\GjG%>>Ԟ=?P7h#%,H(mS1ui OwyIdPz{a{c<qF8܅hƲ|*?<|"+Fފ? NY]*|ey:j|VzLKVȕbKTr9 F:9Okߵ0XvqE}ROMsYqf+o''G9ջq~؅OSݯlkc-5-6>n06J>3:|?;OMSz%J0KEO]I7zMb5_iWV`9 9^^_7M4X\}fF+M$f \.5xf=?wt5x:sӃ{ a>"I }JOO+㹅+Ͽ6I FG)QcٽqfكM#:v)r' mm%|]HHDni,{ b41RrXw l_HQu,k85`٭ːǫvײF5 Zeq{v66Fbk.-.{CG+rC'uFVv۷]H z}hdqlGOr_5bf9f^{O #-FBAxh+fyDGgɜԽCz.p((fK[Z#qo4] ]n-\O=fĉ̋=$TAH1k81}_KOYD˒DtNäk_v9cٸ>G5)#ybw[Hg)`?X/*1BHr(vS<f϶( hĽT5> md2UG_nwCڝO@x(-\j8[H:`W'}.WjEbX;Ic7Q W%F? |u# uXWѹS1}q:3dmP#j x{C$}vblH S2Gr8CUdO*1qUA wo ɧWO9w p]G3b1xfx܏M``In$.1q"TT6ub~jy 5]6UGP>.}2MvN],8HXcC#7L䈝znFW,<"nsGP *$ ݊kYr&ooRaN$vad/贺m'Wn"[ %R}hS7޴ t84% ?h,rCNz essݸ^C)fa!tsyd|QFb~\mN>iD'(n[ҰG쏸cf+0IXTw<0'5P'Zd %k ut_"~cV|eIA5۸s8Dj^ P8 ;x}7Su8eQR=nib鱊>{oNitܸ)3[۽~*3c4ݱ6o_UMwvyb1:`P;"۝i{ѓ4qVM#煰O1k3 >H}gᆲ$@;Ցc^(2Sӭ ѝH˿äWdv݇;TbB g' 1e.,vɜOPWnŧc&&4jt uR5PsiF iJS"+gi')( "ׅ'&(32:yH 'lv1aw6m+P1Xu %IU,}fv 7s{UÊ3bHAi ފ_P^Ο3@֔L͇fp5ۛ?v {4FZB"L4˾ē7} ?dNYH_MMc]De&Г:P<{>s)DHuGB+ $b+Z aiOG?j0nVL}>,G4xq8S,@n.ḯKl xN/6>8c#Gzwè>=]9g:^ϞpLj^r3$^# z nj$>:t~~p01?Cy=&q#q@v>r2D[z%(H]MfNQޛ4r 7~iA$0cdVB؂k)V\1g*Vk6`p HOj6<||wݓ"+Q =5eoVw#rǾbjt#h}'ٟj',lc4BHH52qo9$)I84(_ݛ& 8ɱK1&HƢ7'*n2Nx>.ZL:Xe[Yޑ~%w?9"׾d?#ah58D(؟FX%oU ʎ_ׇG >j@6ښUtskqLdvwśyD=H~)(;l?_uri#?ҏ88'y%ɠ&3vy:ï@cYY$;|X)Tn31λd Kxs?tUֻ#5¤@3m1NN6nGMőz{dnDhfs6>'I##:'j (<19PB*'('0C/YDnW#[99{+8vDuzv,u5?J jR Fى&N-ɯ{^}CknvWr j I.2J|]=^4x0C <'5wWd{]fHəc㙧LgjL22ԟ'Żc 䑫; .1#NF'v1}=P0H[.=%p#l9-q VpEkT`U"fu0Ɍ"E0ofqvt=*[czsbkANrˌMшhtч\f"]Qxegfb=iGo^4D#|ic('Gi=;ƕqc.>YL yw<*.LEi )8lvmg t-z KNM ~EaXG/(?%so* k$e[WWyR>4CF]p u@;Dfe$ۗkq08 5r_ Xb -~uN0qkS @4n,)]]x0!k&I_p)L2A*ș!ijbz"f-rx`pVوz,4rV-03, =&{&8ܳ5һNf邽F2f!sa8=Ġ>g~2fq}oQl1C&}1b(8}8KdW0l_^+o`+s=5;ֹV9*oe%J~Fbe-_ݓ-~`FCz1A_)1AP|vsUs{3f@}4N)hJר\R޹"w~ _^&m_ C3>3{"~[pn#~8eUFQ< ozBm z{~'zn5}1ˋpi@O\kpDTm^X uic$P'PЍ݋x$OzI,H;y9@b(^J"3Ђ_<tډ>g~! RCN`&9o ] (3 <_=6㜡f ;Gh[jᜃO;S~chHu?Hƴ? ɾ6r G,*xfl=8#& ?!je wzm/lçX-hx,;UpZi vbecal ֝|3#{19|eEH/);ze|y4M! RqwsS_)RfV0FŸpɈ~ocBY'rۥZrRj${hJ(`">ղ6jz}}'Q\=Pw} n$f ~qWvYa1tJ-9nFZ^qZxU;eBpOp†-x}FJ+usʵ \eD#3)Go1{|PiV5nK2L0z8VQYCU4VDr&b ~}5Y7{Oh.bnUr;s)^ZSّۭ],vQ{c pcMD2MG. 4T;{ 9jevn1iqrz9I+)ݵ-"QQ옷n4lqݝ9 {ﲻ{6I fW:$ro0^.N=1nj4[{nB鍏Q#S&pDz;l5d TЮ)Jȴ^lxl01mRQ 1Ö鏆 o#d$ 'wH߽0 =vv,jSn-!\5^p"oehp#82]ɮm;#ب[zֻ:f<ihvY[}bc!(OS4O ѭ\q5Yj%Gz.g t]Z9X\ȃ53=>پr͑7xIc;GTs 5dn[ې̬f 4/{n)meȘrp2jd^)ʚ+LDvgQrvb4M(k$s=?!rd!K)ۯ;[v́}~Cǎ><2; VQMb 6vs<.ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊$U~:CH0s ߹cm6w4!jtڞٰKRlV>2zU"f<_<_ 䎄ᇣݸǏu4rzuڵꇅMSKBqzaJW˯piC,nH)ȆUZ}}9dggw3<5A#x22j/XE1W)\eO1?.ui(ɭw ];m~xp3wL?WjO]iv;bKmkGAG^LrvI~b`G~kݏ6ד(f^ rhs:⍻lR"<011Jh|MiMheySzhu5}UsyF5*|aWN?fp;V]󜽷xZ6ή1x;H}6&1F# 7=BҹYM0|dA_۽/+N5~b1vY0;^߆Hj;,v >KҞ'N]c+mL-|9xoD'!P.b;Reg+ qq`T}'ڠ͊Edw F6fN/?kH5+~ߓN>'z9y; }ܱAbe9z^;Y2ےò+\ɛ۴eI|QuM/=VħMrÎʀNY*؃Jmvh |;w./Zqr~ӁGb t ~:lݪ3.?_-o*v"\+ *v'^ M@]ΝudǫbbQk6ʥdžz<_lǞ:%plS5lƖWE֘-/@`8e}h <}4kO^~)8['Uk~˛G }8<7;?~O%XL0DHfW6c'l}5s`|RtSr72 M~oުw"t3ԷZ{nQ@G??NPVyWw<+AG+ZQ{K WN_࿳ ';ͺn޾,.D |5–J{v[")7k^k˕+l5c푋n1' MCӶEҏۃeAvqeۃK_l9ke9912]U6n\=ܷ[3v ֞!*_D~"x׿\k[޸?1}j{>t~ =DJpOr>_Xx]^Ùߓ#zQciZySQG^ڴ| !.s.d_r(x 2)nT)kv0x{ZJDֹXmNZ!䫿|=,ǿdwy RTr큌_&i>>~cnTvÿ bt|Hg7іKh4pEľ)1<սgf||gz܅EZ >eە)tyCO=?jmgzI4+,aݝe3VfTRg<_ځ=0|Ã58}{+Ȝ銨 l> y EO `-5az^٭}kn֮~Xmy~ǾGx]hx+~qֻo}CJRqtp-Iݵ.;s&-p{QۣicrdDP=jg]tm|}ZO\zu>"y~2CV냹ҕf<\Rͧ%#w˙4GA]CW*LKTj=;KPoYԭ`>o N50U Dͮ ( ~#q7 bKNv<b߾6 RUGٝ2HFwcRק]sǾkG%{̻0Ou]$꒪ˋRΛS6zXsr1;/HG ңQóvl# 4={cn5Oٓ;dwk`m}/65Ň9#74;>o [C'JG /J>uǎO{֞Ek9r^Qb-Vrw~C쎾^=֜ۗo ps=L%* 2?}?̏6w]5}fm`SW03CEm&t3U8whS\jGNNQw!>]7!O|QU|(xڵ́tBV\bZLCVCYji4|Y|M{4ߔ݋pq1^>v{dc<={b.ӋW=<$N{֧\՗Wy)Z~-@ ;x>sA;ڑDt8_NY W0~2ۋ~ܴ-j?ح}6h2}?oS0׾Kht_(>%ߗɫrUY'氎FhH%Jm ;qw,3S\Gj}2kWfz/-7lbOldG!'ri_61'7> ۹` 5`W#LyJfW>s~._\[lkaIfDq fdߕ>& j32$8<бS2_k]_4z^Glt{S٣UE'"&4ݔz֙KwT8F.7B#߮Z\AoJj)ɧn?h񓎹RMҘ6KMHEzhO7·[.({fG~x c3ˈ=#bۏJ#3[[]fkVHwȵTϗJd|mُj$aw]G=d?>$ OH}O,݌x?k_Tח_lM5/fd{8<1{eP޾ؽl0j" Jo2#z,=㚪4ZǾ7;IJМXO7R|^':b/> )1efjQ6ʬZ4钆G pX *o\1¿N@M⫇v8u߉YP4/Zz>  ;\yҔlix+wǽj2˕̟̈́#Ahh1E|&&.½9Hѷ!_|Ew=a{)ez5~j+NN[*ե2x]8^vaxn bR)J1h8:½qQOZ|nt8kܝFp?+QʹÎn8M?rx_Z~:Uy~go~ #Wc˰ۋa7OONlRz^TWwT*rN̝>q=:N!&-لcat+f}@ymJ(ǃ#{{Lk#ʸ~KO\#լ/ͮ.~f;y?t_ ~;v"zn,b<-d4\dd:;JlsÎ~N&SG~uKI~0IsJrJƺakpxrjў:K=bm-)L5O-ݎpC H 帥ǵ<7^}-CW}i:jDj;x72h|#vc v!8/jMHn#repN?wbMo|upgF؛G\k3pLeGoPwǛN,a2|=ae6o_ᄊj'Lثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊$W?cQY'L\d1rlB>8!TPHD )mNgޠuʦh6tDk}b|^{h7qMLX;AQMr=yI-cETv7X^!RTynAjc*qF[^5-WI=U H9j:0GPQjy|*_*#{OexXb9t@1ڸuTNH=q'=68=< :)fߗ A$tYI:\ +~'ԟfNK2.BCl;^= lOݍ(#fm^;qk^váP2}⽍swq,IhQJ1Yvwhbos�"ܘ$⫐%ݘ,ŧ35% w>,<$:r_sO0P5ČXvfX$N]vbNRj3 ZS0>3q` |9x?&qtfN<&*Fm'y/>`qU2w˒^*jMs' z`a);8r`6q9$My-((&?c\p)|O8sS@xED,-F1ߩaDnٯm ?h9NM,-xDՅ; JkJ@cTqPuR@Qe=yc"ko\GWN*(}-ю[LzYyɫ'W77,M>ytqU;!J+=[1'ϧO s˹ilQiA,c{D++OPVaU钜l>ŝɡ\r>,e!r @&d8|t5g7JU+6h<.DlDJy 1wXvRwak)xш0C !x #۹'5DYɨ )I"QQe`cq1TPP`/pw=6'1sr;_~xw n¾qnoI>R ]LF=(I<wz^zxFΗlzF#Q}Wb)ާ)͢;wrI]35`I2Wv~0}!H.س%%Zt9@2ooAæ>,"OK;|ySbxݎ? 65y]PkF`/}o彫B ;|8@wtV$qE(A;9Dr }1vR2 *>p(vlT_h{P#0#p}#18y\dDILGSaȴ`7QfA;/{/&LFY4N扪 v rM=*+0d#ѷhYRX{s}?Wbw~ <[ɸGhuqi! NFYz lZFkN3rq/l ;jh7opx$}_M}|pQBSD2Ex"5#12iDX݁18BUN#jI'ۊPӾ[\Dc!;Tp"hb $ޘ]ɺIE$p6U#1sqKOڝ(9MB_vn'ؙ9d ?7HDuE?e~2BǍ=eF=\hsF kЌȤz[c$l.͒rOK͵~LHB99s NY˪U_ ~nIZ&}y+&=پɅ6ܾRz}i'_ImfO OC\ǽ*Li+Y v$ Sj#!.Wژ5=?y8AD??~G,nU v9Ј Wk'H%xrc YiS\@q=qo]߆=;`q1cًG&/-C ȬU4A n gie\3g4}qȳFH7A*};`$;VԌ˗h}t4 I4NTV~%ve8N\vvMH'psBXDoMnaw=),`s+\Hpۉ# |Yw?3܊JW^~ͳ?68;t9Mk#rHRG݊ * NfaJ0r;GbIw.٣ۈ.hHs SX܏0f1QA&"3EGg1F Yr ;.҉Nwn wj͵I82u;wd}>8W5đNJ# rLZ!8q΂P*Os2%0\>l)ĕ(W5ogp{7 a'ĞT}VqG˙ɒ" x==PI6rkzd%9PG?1@r {c'F&4ØclNDWqL;b7\ā=t_3^5#d~x%坶ڟ,-X(T@35>Y GtHD $Ѝz`ٺQ[}lڜM\()@GN36= ?ބ$jE>X}LD8#r{ٳx|n.)PÙoR`b ck}C ̌w6$>‘w"v P9#qv\?Q)`v'#NC21]>0C*8wb~~잓!N~ARM[@Z4u4 )2Yd{ kawޜ:dڀf=38\s~Ǜ8'WS̓ORzھ1=xJGSVt.ӵ0'rֹj4nٺF2ܓއt^<08nDZ֊:|w6vf9򠠧#̱7TtO 5Y$ʲ1O,Ȗ'Q5VV[M&vu8vʃ_@{aAbkL%85d?j@GA $zC15RۂsDbMC~ Cm^۟eJ /ߕX=~( 3Rxvcs#2ڍ}14$;XɫNIv!#J7V#Hwvw f9qh5|1>nxWcŊ' qvL\H{LDяQXOPẅe 8Sbc- }Wr{Ylm׎/BDok(iI*YAΝ F~4ٰ@e߆'#G[8E)X\ר+_Vd|.- U [J4OOm2r>\G//$z 33CG-j;{+txp8~LBq7]ǃ(G\O2!ऑ62^{?>dlxc:FBΥjOߜUIJ)%_wd&̾S4DmӅ7}&'yfk5ok Duph>VЧ5Sϴ1K;wz~xcXvL Z& x*k9.<$o bܨfnI@N{iaS)JY$gdb%\޵g3(ކa߮Sه)vRu5>G64gp>Q7^~TQ`13{P6v:Y&'"UVa`sv۬J9.1vQL{G<3ZܬhFUqzfNzZʈd{l꺀VGaԯ_Y vjZdI#s؍NE~XBi-CHASNqU/e%db^aKLGGy*yZ#y\}.kd@#wWcde.t9dfV# C99p'iڔIfh} mO4Zo+0ʼnNf5D$%u0L1Q~7>fin;-\1 d/e2O)8yrѡmB/59අŸQJoڙҟgiӘbP.n?@o Cڹl;rS6/$7'UFk.=j|s'<t9a_ipŢ;W- $-9^vv2DӨQ;Qٽ% Msk(ӡ OGcf` #bD@@57_{H; yc@i`ƌU6ym)r5zoj|cD7a9'V;'a\|Ca_QGvghK1&zva?`=iÒrZ4[. Lh4U+(C]Ž𖰍3P嘕H]9fN"pDo+NwGdUU5kmLCG<cN 9$|>3?Nɧ+bY5 @ޣV #nvF]! m,')$6BĩMtY@upR#g NՌ[\>;2TjE~YgOݷ(T\ ;CM6t<":{G~Ẇ߿wdZH]ym90 ; rHݶE&w{KE$~MX'EȻ&}Cbj*G9"^۲tS?S7Uպæ E` wlpq7/N1P wֶh0 ɷ8+k2Ad&v A4>-f?[~$'ܸg/͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊|i[ʃ`?23wu,Gq74҈PsGL18{6127 La EN;;}4J69n־,f >Wj%3mMQr' !2h_dMLr|{Ba6:pqߚ^$cE_Q[el-J92?vy8Cj{#OH %qy&@|>[Ui7$F3EQ M=dF<ӉлB ;׹Ç49lY@ۇԻ `b$ϓňc]+L*(9 =vUQK$^JTI֣i;X#rb㲃5T1jdDw2QO݆ i=~!A.k˵'}9 ?t>_[ŒMrNn]FګL2U0F ??L%]Ͻ|zGO 9>;bQBfv&W̃eH k4tR98O ^x} '9 zS8{Ep$R~ 7vdavD,HTوH2 w]ښHs~k\D톈/)(Kp' We1'(>rXvX&V4xcCjPQqIKbr˽|qoCEǥ-Pq9\`[.!"!y9fcKi/-'7ܪB:x=W #+ƙ|"<ȷS UmY&þ:"$kZ~!DuvRs+&iG0DzƔb\äTy1*yd']\Ai%rux5tYDsZ9pJY5(\8qeE qx6%g3.ܼoli{:XH=NA[R3BE79R}QP:-[ m֚NcWaF@Xt]:;{צE%o4ZӉ }D12#_r:* ;VmarQ7Ǜy}&K6:11@FW~gM؆#4,D'g pW*te`(zxfF,!Z|cԯIE7# Hdއ͖XB#~[sy>UVn'jS44:XCgޕs醖dp>ƽf{Oh1r*&nD j}l./)K01;-T1f뽮w*- w zœ.UR>"vV[fY mj54Ly Ź( H=*>s9FcgІBԦ"G݇/9 F<-|.%W|̼,[+$AzW)"XI~N)fo贐) 1NЧQAc9mWOt:9L8 ` [# .S8P'*?^4K*<:|p;%,vHLvYC}kߒxйyb#DuTM;Ɲ u31`r]I)-a@uڝvGM:R7$L=^ᷰ49HJ<54OjI*wd߽~<= M^ a%5](L>U09A$^ZI[x8/^{ Wr2Y1 nvԚ|E8!aV444㏇׳b |y,;S0q.kKusJ%\ukN]&%TV?.ǒQ:odKOmНr2=8ebd:WsfË4d]v{k[rS\=ޠ09O.B7HWXjҩfl4ZQ9{wXr K't5J/;fNl~cgu:QTP,]&ݦ&I u]'M׬q;Aى~q2kc xRݚ(׶cp4{GgC&O($}QLp9mj2:aH|d =֪VQV;a( ό wx\Ѱ<,ɜivYa#T`Kvr-m` G›prH(>Yݤ͟ $dS repN5a4}THN(*c޹WG7a9 חh7x|NA׌Wl:v=Z)u[?uHu2*6}EF8&G W0xqM~M'D'J \2(͗l`go!JZI햩NlR e2w0A N<,e P/.[6"w̿PvȪ j0׽0ŏͣå܇o|ȖC^3Fq$_Et[4MIL_W\HFTk {`tY;kqrx>?egr;n2'pG#A /s㏫;ci&cƮ 2!1{ZprUO=9?P*>S/p "9.vHn^"(9xuGlA&lӨJ|@usML0;^K]J;Urt1 OcF×۽`&) ~g`V#^ĭUBG}~",/XsPn"Pҙ>߂)jgEQ]-աw2TSf>_ylv}*|qF>#f.t9p]/«Zt+jf)Y džÿ [k:uV [s;'(DR@ +Kl2QemCLܑk٭}I봭`s֘l#!;Wr:ʋZ|# u?Z9Xv[Dzη.>CEx}RGČתjk\$/ ^)a^wMƢG5S$gv'qɝ̧/_lJsǴGݟrG?ru|%m*(AkmfH;gm. 4zKɱhꪺ8zɸͤF2hˇ#MQ Y ɹr!j©n:fK ͻv6cyB[D@wӌg2\pa_ü/j21;KAapGȆ6d4{k]գ&8QNlGt`x!J9xfFYKGwEq۬TI($ßN.ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊;A4!HY'L|%%ؘ [#Z(6ƗvKk_Xʔ /*k~ۗᚹͻ×)5vvjܰ@v}?֐u}>6rԮǾKW8n.JsUp^J0q"OO`ܞ)^t<@{fNyn@HlB+z0-#uӻ͒+Hiι˗~c~^CڅԙS.Bi_ˊ+!]8o^uOPӅ>v ~]7>|UfHڕ A󢱞a50;o0&h}Z~g߱5\9?Hxi|vmmidSiseS3Vmd0pz#AiqDIOoxӧz:TGv?inf5T/AM37Xӡi ޙ䀘 ԖbU@ӥ}).gKv'>W6@:Q\uÞTWܺ9h'S#.>|6~t5NUپVL ]-GrWǟ˹X3d1z?*t3q㍴j#ID߫4@M[,wk>1NqibP \kS\laMJ vy۠"1(l>aNj"y[\r9#ҙלUg*V1aa&FJEYW̌D6AhaǧmZ01z=Rfq[Վddn1q^5 EGӆ#26;3慄A:pRmZ1zGCBWX"|%!Ǐc~)Hљ8|8{xcˆ K9!{+/9]&Neʢ2YeP7P&Z'?v`ڕf&\_[s+=zL/:վZ ğh/b-*UA^k=O^ؕ/CZE(~9t!Lt3y_ź.a~ه*ont>nlJL4NoyMLj7<1Sz̡^˃O{W_Z/REzҸoX8:[wML|6mL9^OҋI-W8~:~vjOF!半_@hkiK?w6Pw^rzn)|t$vBpEֽ'xX_'ѻ!4p/rIDM{u^4yUvR])/"_WjW2ph.˘w}=lSё)Мsbj: ;jxf6~vn<8~GzS`K7<1/Cb þ:~#C!vܸZ"':l7Σ ^T2!k?HOG.ӶW%`Gh;LZ{v0I<{_y6?ցjqkJ~ڵNZQǵ;>؏pQpI=$)JfnSjt4{۟ùP 9 :tIz# ç_ ClzH{zzrcEi}xҞsͻKR\8hW9'"O?S"~IZ ;?xTNuחr;|=su,Ok18 ӿkpi[Ȟ{/㔲z )\$8=^]g;eJ|K< q{dحiA\˨հ3+rak`H+ڕ>|!'8"}}D4])Nj{d;6c.# C\ZCq+ =D"[(:0HXs;7W䌪ⴎ_<+车puwXErOu?@>;Cs\;Eiޏ߼#_^ǜGeJm\\TK-)sq b0Ȟ+u_Ï|8J(r}bEw Nf~{'uw_-X[c^UU{Sf&a-~V\EA&irb{(x$B>WZfnx7<;Oєぢxn5X/:[OncpՒ9ƽ0+SVJt6|>4{w98~U\ϼGMJT)8=[QJ:r:e2SC\_҆q\<•_KǗgx?k]䈗 ЮuVq?mr )קݕzo~9,b9~ c_Ut\6ȥ֕ˏ<{n#[x`.D-HLYk+W^ڻ_ҵڵ̨5*'~KLk}oǍ;WӕjcGegUbGpMomC~udK/;u}*gjeua %da;A)d,C6ZNE:)yn\\zʔ}ҿ0`x\r E\|et0vq+kϋt'WRx:~l G|gÐƞK9,V5V d||?iO ylNM5{PH{֏ǍkZN >Gh*r1!q2]>gpjA; S^CɆYs~g~Uyw=Tĭ Q+Z׸?j~E}L/_UuHuj\z-N[V\1}kSOˇ{D$T|Q?X^sخ'?җ24fEkgq"=:Wfm4:k>?u~qv\)fiY#U[e&jvNC W(9)̈aۛ<-+Q{=`)͞Σӭ+^,\~mz%wu8S3M {T48.~./}$vG2O;~M3nUNbd.'Ol0neίWI'ܩNٙG8/iZ:/@Uyo >=M='>k8oY'9?bjHʎ?̀jU@Cco0_ҕI|>a݉ͰieυE)J̽,|y"= 7W=&7iJ3ast/\?_lu|R>>9~7Z^LdwV_BNgaڞv wz W{UWvͣ\zFrᕻ<݇]=kzn,S=ٿwM0~fc_WU^rkfHNf>;O||dJ>O|_ᙕOc7G%=aµ#fO^k|U][׷t^^3!..+ýʎaa/Pq?o݄b6ݯm6_"nK18cTb퍳?254dKӷvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊[!qL`$}Af!nܨEn >ɧ|\EpvG<+"kr1Oݓ lV)K#u,~XI.f9\!탗Cos2|C>G8=s2'z(T~8MylODeΗ"@okx1^ R&*9㜣[Ңz1Vq9:Dolds$_NTQrނm~M^ԫ ΍VAbTJo*z$8F I=Yx0 LЙ>zW OMRʍsM6FʊzmAC w>eLm9g}+{~G•7xw\NHl6]&XL:In4Jmķ+(vN4 A?bv79d*7 ~o [~|N[]zĀi\.8C|놡'>a8o}z)0 x[n swc8F E$hݶ?z#FD!TPSjQ 4G Mw~O܊Wsp^l85OvaɎ^@mc岋^$u립V{97 ]ޠa&@'=ϭQ0 _ 4͏ji0,w™F`Om <]<;Dwy6MQl:`S#V. ӡ ۩Zrl3ި+S<7ow-A<~SBOL?h"}N#9f;g0Ai湊3e0OKt xo-W գz|liHt?ůs{-\ZNB5ˤ.RNDyKF* V)\u\Qw:^(. { kpu}N5yr@Jecz >~B"#]B-GSs* @3_4~"M}7=0hR7g{O$88wi=[}K#+K[s;ޔ'S 1h}ᆟqX$b7RH8x0 UeZ";)d7*SU"`}BBOJTW5/fؠ'W.!\SMͧ8CZ b͔LHK싏# T6+h-HS,]\l;9!;V74#(\o##Ol.&!ɗ߭岢2#4ڇeHpr(vajK(v3d{|}7&'&V&y}A('+8 r01WCnIns_$WÁ1G -F^jsZxeA9㾞W,/ >80 ?7{_O[=4@a˦?Q (@t!)AH@9[;ZI#WF!pS+bvRB{f$ty:9χ̬)H}o&pd__RV~egʑAZK@2NgnGOÙ5+ p―^]6hJ;p21) :#WVN|#ltZ$d&˥H"׈Gc_Z[w>IbO09q~K0[9!6({ޓ&YHav-/B)06 t Er+]_4eH$f~0ba=T҉ E+0ؚϦ9C()X`=Yj3#1i)O85:Q\괝!# ;ďzկOojgS_L"Ֆ:>Sm!_ER#=UϹLgk/kp#$-du858A a\n73}ciW54;/ \^Tjb\F@;FX8I?Sh#Jyn*i/U 0xCvß".@:>Rs?cO1>1̊?RnTf6(x#%|deќc1e26pW0LBd)Og1)>~m2knr)Pb`92ߩU퐨lRT"ͮVAܟWXc~Q|=wbq=e(ɰ_?rJe6!m4r)'}Ɋq;mv]LbxR5# ZfFr%gOc)P-N PJħpA#]FVK $LG1Æ!:8q%<WXJO©K=G 2c=].$0U}UpL Q%2x:`T;Qم36W+ț l&ߟToJ|5\Sy>9D|Hv}l}`E"lQC38G!'ӽ; uHmImMЀx3]jDnmaHz\ zw- %q/ɬ"d2lvmFExs;Xaʿc] ;}P_0mubM,)F=KT;jXr]OC}vzMs*$&xЏwwdj}6{ua0PI޽q$%<ηbn{dvbE+%(Ht 'XjFқr]b1GghtMN,f&'#-tٵk4;@UE Wi0dˈ3\_jlM48Db"]o{0q>L0=]i O}) Dxq|j[>UhhW0񽥣ˆr<>NCz,s'!9?7e#;cAuZ_`Y,Qv |bHvG<%,]+ԯ+9I7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊k&0KNz̮bbnlu3<`+B H]]^n+h]D82}ВkLؽr n3M'%[Gl$'»˅x-9xNx{AxaPi\s.Q˓S &\NYD"vASvwkN}@7PpD8،̄ yWi{BȪ,MhpIi|U ȞCp]HK'3JT;` 2uy<P?%ٺoU+4a ]G73㤁檬-}kpy)vl9qܹ喜:rU7~MKNɫFAH] f 6n T%HjΫm癮 .` W7ƿڭF"X%"h%I{趬78s>f+ŏ<ަxNqLn]9@)iv끯Vė,kLd~OHv5½;s)Ŵ*E)yR# iܲmaF^*mFoO|}9og㋊5ˢPwΉoҗ>@|@m [Dm la!a܃/WH]#u o:/aB빯llS~V16\+hr\ Wdnq@˒uX uDL&"hK=4m[c"VlGocbRrXQFJ5QЇ?12Ldu@"(G߂$QA4d#`C݁ ?lvzŘW xg|[D*6F,>.`aA˰Y*U>+־3#06yyK9zR?pwˎfS0^\vzs+$ڔޙ3nώS/UW﵏˰8Sl*(:5'>p41Tbd9C z3~c68}>D8G^+f|?KӔxҭIgzSê zmmf:tY11Ŧe_z7s40" svن-QwwoS=F$U)ͮAxnڝ.iRzj9,Z/NERwc‹bs/j۝Vcn68Gnxe=lJtvqc 5.fBB8z\>lV:4H$ѫ3_SF`\*v${&1-+Mv ||,)]} iIi!x7b*fQTt#K,dRMErI؟h"$ cˏ1>F؍>?p'38H{h>H+A+ǻSbkGpwwnSc1GoUuc{+b,$}`ov*vG6lKoQ*j---o7M lx,k=6[gEqmtmbjIC3De mk|3k?VWSPkF: . _,DtA\+!Wqn6:|ʏ'1fcc5†[lșjx"'CLJ x39:#gdɽ|\{f&@@,f݌% b`8pa]by$BьV\'DAWK!B$ r=b#(Ñv*G#1G;?Q ׶[)˃rvy@5:Ӷ,@pֻ$Z.$@j: Q {7Fs'{P΄ rqd,.=TM=A־Vd&>i3`f;=-BO;FL$AsvOSdl*UUXΙ5;u[\oC17 x[;E|b`(mL5> $/r6dj[FC)Ue^+UuNJ$Jb- F4V7Ɯv,x0ĸy=Gd>s'01 52Ga;qj/\@| eɋytq_.\U{KF"bwͬeK8ee-Dڣs`6=p`EU/6zo)ãbDA_D gPj2О>)WX7}xKvMI~yy*Nt7Cҟ<'&yigF'l6<bk3Z7/Z'ڔHê1ׂAW]?e]F_"K2UaE,)Arā~L7hƈ;s{u9w"hmJSmf+!9D0׶N;ӯ\`_Fߋqn19pw݌K\d#c~TpKƬpyz*,^G$~"޹5|2_$|Ekw<EF?sQ e_JHZyjq> NiOduź&ŗ:Q%<:{$&wk\ʔ6mޓBin|5LcnOwcm۔jsXx7cԭaoj &ojg3Usڧ9~*{td_Uzn./WwOޫPc>i#%ܪ_pE]ݷs[U[jT3H=O~UW;kq^^" >:S*>nGf;VUh_Cáݿ>!b_ Fŭ,ݓɴ':.6UςOE ]L%L ҞNe?. ?/])>+_%-w+r\&ժ9~\_>굾S[o_z|3 x+s4ZW^:c%44Ozf۝Ģ{fQO.i݂h{b1xqtA~'`~O h;?F)+͏QvS lqڭˆN qw;푞.ZonխGŶFPGh{3s?jţHnT@(]}~<*O\2Onb]o_ozrKEi5ݣĈoI/J:ϮN]fl4QV[1UW "q˥⺭: $%uB[Y=phgM]dO?T;V?L G8~OO)ʿ$'Nm>Kj'}0aY^9?.kW{G[}Y[O? {w~OoyzIoJ/t~|twfbx*>/5~?{Ֆ~{Sn])[~cWJ|d2SKb*wr})]ۮl%朼^N m]7dFSj,^jOʿff?k{gJ_P X$וifYw2vxxr\pSpQ7SuwmE0PoWq_69#O^tDpU_[^AyO̽x2>KuW0+Sʙ~.&6{U!x߮igGv)3/Ǭj'7'Zƭh5z>~Ͽ!?>O#7Qp4~L^3^˷qεOϕ|yO/ W$p_R:gkxj[ktQm}J2ܝn8>}*wW%۽Uq ꧭSN?NZ{C_owS}?Oː#z_Y>\E~;W-o kng3t{aPqWiU^6/.j'kk&Si6OSD^V_2~߰}=bOz$ ~5וz}5_,u]?kcK@k,QCĮjFGfkoxӟ^ p=WJjf v.7"ʻd^x^>eo͎3.Oˋv!}h,~;^y0X*֙0~s{ۿ=L5: Zoxr>;;!=|Ǔx1b"@So~~s× }U q\]*N#s&.k߳>,㭿^I$~k3gq:=wc~V"\Wr0zi\[J>'qv/Mn^5vWE[i5}7]{3Eۧv!s}~=wrq]nh; M }?ٛ4jϭ7_k4i\Yl_˒ /ṈϏ.oO6.۲;~W_h]IGG:U=3U'/ |;wU4–޵̸|!|o< 0W\!7.~+o+x3C營WwD2_359TS#v= )v=ͶM4yc8Əíަz`I7qڟf2 h:]ob~s rw\.ՂZ?OS# w|Ve!fkAӏӏx+'cڬ\baj+^rF_#ϑ#u}־͌0;YzKZrޟ<1n"ddG LDva{4G|8\)J~9u_kwMewoŌ>x>o_Fxq;v˴9n5ۣ/|/~_̌ظ^oQ㭾P)pZTe!d27Zo48u>3WAZé6)3k-'ߓvH觩Ǘks !q6_+߼46{-𗇭^F~׫GÄr=ʪ2Gy˗4_­UiyPS2ާsẍsNKJ,H[~~bgV+a3/,|78gbJl90pG/&_F.ĥp] sá]=_>o{=w '% N!ۤ=K7%WuavY)X,Hbbچ &Op;)clG)}^f@zw&ĥZ2S >TWq۹qLcf݉ A%!v+kGu8ߛMVSzLJ\q1i{IL_K-HW`__mS^y2J?.;Wsϗ>A\|]o8Z v|FOwciʽjq.#z$TҜ p0s~Dy1*z4WW~?1 }QS#0ÑۧCJaԽhυ*)ʾkuj$=gϋ8ks% )v/^{{f5vڪoz5pU׾(OWfG57o#z{=mvn3rJWf, #Hc.?Q; f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊g-*2s%E smenw1ɣn&<ՇL1 @dgv..0.{׶G"'z^1vy%-gZs$y}yiC:. v-3&1v'eq^ea@2x16ט]7mSMU!AF<Ɖ9EKV2H6%f98ql~[9.Ӭ^X@ ׯ)AQznl@'}ϼ8jֆ=FGn  t4d ":^Uœ߻ͧ-ӂT^@9P3aCW p[(Ҍ 9Ŗn͞0(|y{;,P+$q/ڃΣY({u:^̒(ﮅer ַ@hۀ}nj~:z,B\׀i1rϼ.|&ēv9LJgMjv6w NÎ"Lt2vD8;nac)N[!.eNFβ@X.SLH?-,cGs̻-9ic1==-x)TLdoLۑY (8[#{˞rHa͆_J<1M>D2{+ԑ(vٗB{1k#.ʣm{elR~7qX=WHA}#zԌ1˾⺸ 1w.GȮ?fgdg#Oʍj sW1":/9cejƽ= h#8G|;܊Wo 9a(;^9u-;NI.692Jg))+ot9 SU͖l:P"+p=XU&>7lcDqb 2/O[8r;Z0Op6[3v "HJW:oK'Ň~b@|Y3>$BOs q0rE}yP5R2{ci%($H,An fhSfu1Ō>}ݱl8F" oT:'"d*T93#uXL8|4b3.^N0ˋ5nG@8Y QMOͺ`ۮ.daXS~WX;Ȓv>ٮk]{DB/\qDf>>t=NíSaJpN/M춿F%? *%4jXƢGjկ\,d#c`6&s2)sIfLSv7m~>?sSc@/|ec=!iAƕޝr9c>xdwӞzd-:H#W @P}ݏH!QF#1˹{jb6j$ ]ϞXwcEHUQ5M RYr~J3/_ŗ0DY%R̾=306z()r}UpxKĚ]-8W,#& i٤/oj'cw.ަG܋v rI 8q)뽖\#lRm۪@cdl2mJt ePndZWg H V6?7zߙ'.vS46gojuJ)Ru&fLr,7g+O&nL'| [v7jO$@,[L;M^2>7ciql&wl(v$V ~6o|(."/77|uK|)K$ý#Uq5 fny7?4U0y*1$rQ87u08rtI'2c<:X&LBh\mxrtϿ2`+WbҠW|.gWo ORP_d|B,s1B<_>0KT[sv?|NtO49>k 6G+a)Y75$f1!<5?ޒGK$D5]뛰 1Xop5E-Aᚼgtє7CӾ}~3,Lr3#򦬀c'nm)"HXΛjU6J }'{`t(z}[Wۃ˪j}Hcf 6sygn2g Tl292)98x-NJw-Sk8N},}9pӳC#r:sk26#ْA1cÿ@4(z=Ĵp@{O|C"o}b$Kfg%3ѨzaG8b`ҫ_ irfzy ǚʨ냌-q z זYO>*Nsǃ&庱QͿ$W3ef ƫϪ mEٍHF7^!=>K1=/niS~>6կl7hc뇥xk`2'yav$sT 7#s8ӌr&A0MXzsv]B\Ǿ\݁LNٗT&8CFsU.@W0 rp'˛|݌H<ëc\;{y^Eˤ!*o$ؽ(;^W3gn:v@px v:=++OۣUQӾgc'^G9 TbN} jfGNč1XxW|JGg1zo)^д cAk)UK_O;3\O:I|grǒRobGԏfc\CRzBrg r%8ӹL:Y6>؞d۾]Bx|Z]7 y͖Da`l{KL3hrac]yP6n͖` |;S.Jr<(0(ɱb~y`G.4jb۰kHSe(1NL7t=1D@<^^,|{TYWYg$JMz$bGOqjĄfIpw)0BS|1xx˭!W:̹^]@>(4 &ЏYӑ+.{:G lFrTjya8`b~57uFMo4zoĔ^汩$2騷`i5C!~R'uYǦdF)Vfv? a7w; >WŧOh!;+NS׶WIk!:ߺUr/i#^fS1|!}Z=˙@Fݺe={ 9RsCL4"Oƻ(xppCݗ9 --;A==7clu0t}6ijoO_r8|Q|qϦgH obo5^)=<#uF@a{vy:Dl}ÛHw>s,dt;Lq 2qZ|b'~?r1NCk0L@GZZp״ւ(^D"֩]);}}dF6,W{!E̷6&@;|B3zcO. V< {DTGl5CGhH34OBxERJIr bI4U#36^6 >< .M6`{W j;>7"I,FeqrQ!F Dga\)6ۤ<&@{R´浶~ʄh=/qc$ ڭ:l34\~@it?"yKLp5o9:z27GTl"LBCԘmr$!o_-6 Ií&"x:0ݡp2dw2oy88yy }VQ5! E5aA8BWN`gj_owzS^"GH*}@GOL''])pHm=h 2TVο-˧|sIoc[!qA 9vFr#.͆(l ߽:Zv2FQ^?6<1#殽E" mqs G[H!˼7KTCR?ms)?'i0񱉏QZty5tGO=K,dD uvLmi z?1u=.}7~|Lq=|Nc],/U9"-4]QLz}-J|89G6! $NEEFP(N].3D_h=c:$#ܐzD45hx9fYvȞ"9*-gw@}v<϶l0u"Ew~m0zN [fsAS6e`,;SQAS܊BǶ1xQo]CMY?t?\r71DukaN1Ũɐ^]h:gF@wLyjM죤w޹[pcؓB}rz=MTr@AȎ` 5fc,w'EA;ccXnGߘS3nwq0 )@K7s7Syglv"l1m$,ݔ9)x{Ewؽivڛdq~Nɝ-EYPq#4:(2oe=>8;m{TsklU3_EUHxSӄ9w΢GX|yՏ۽Qdh`tz8Hv~,ɊS$Yefvw:xQ|<׶3rtr :դ߮];D~t=xN=>'E TS6 Pb|7#\&[0dK:5O9@z᝿oiPA*67|!HCa9#UGĴ4mhæG Yb|L\6Bdt6ڍRv qF5%鹞ŷ0{/l t©*h ڹ"9n69e[DlHG HUuﺜÚ#A/\H5@)3setY|F%;"O;qrаB5զfTƶ#QxJ0m"|p:N˧5}aɎ,O$^J^_ƽϳ{+K<ҍޡ]Q.e.@ "'7\ p2'H;drico qQ@\L}B" |4}=i]xm9k)M雼Pڪ¯\SKӄלJ1Cʔ`c~S8&,p=ᓕӬ٤J=mT5ľɏz\ $hʏxؕ|.s"סN\]>i|6A.>K)HŊ$t-4aDWAⴧ-ÚWbWBs{W<"{nרG|(X6$^p u9tsɌqjpXZze-޴B@Ï.`U}$Mq1Ǟǹ5i|=v$S)'KЕ⍧@*jHaNU8}oٟe|x=ɳRi誤S>eo_Y!~7>pX X{ꪤkd$OJ-):lO-&E*)ISzo68UGr37ɒ}\%* ^<՞|=ti̎AI?JHLz=N :!fj3UƆ]L^r:ܤpVz$R7\η.ɛOP$ʬ=&St:M6>{>er@s#1T;cw\WA\\ C$ ȝ/ONؤZu-fh2 \IMX%% '/2Gi'{Vµڒ˱O#9JG*mm?59g ^i|ܵ( 4ٕ);26:5\<p#A1siLpϕa9 }>A y)mz\gJ*C˫@ O?gmIQ8'~@,ВI雉NyxmhǔX2;V xe8Fb2@[}KSZV9FCǫB0r urRŝ'뚎<;^'I<|ַQZt ;FLc<{nG/;}𒼝vqlXar13abû]6kP"4$}<)՞ZZp@D{-,Sl/>59-TT3L1?М,!ԇ*O™Zzr{(P=UVN]NiYVDj.H {fyC4gPUm4s]R"Y{7:T2cOsIp{mfߊ9Uo\ڭr_8KHߧé~u:˕LE)zNIjopGoW\ͼ5d8G #pi錺A+U Tiq$e~]i8#w{MU&5;k&8]yvgG\| I(&f*iiH#]Gf6z╉]c!CJMG3W1ܑj+nK1*0{HD7bʆ_n6N..gߡ)3XԕB6zcɧI|bH'bi0C>X{4 pkape <iS`S t]nGhJYZ5CUP~ DS3L$/SACZbG@v227k^GQ."gO$ؖB160ʪvY52y3; MDdA;>8mzmmxND<ʎNCvqx[]^Zbr3klTWc%^iR/v^22O(Ņwl18sDWŤt3i0=|޻Gw/`o+(zt#4"l>!i+ wTxƟer!j!ezD3vGbcٳ (wrSm{jxz\Ϩx֝i\ep5aG;Բ5Ϋ<1M۶> eC?ƫqp߮jfY̜I5%?f!V/9m{|pE^Ȍ괇5q4J7y!ž>{vZ>&*Oz4r}0j1f7d ;USU,vJhIޙ$E׃^(6ֿ9m7$?s;.:=BqH5iҊ t ;F=fM1lyr]jwq4,~s*7w;݆I{I m ƞ^N$k'aZph)M3R.667v- **r|SeK8@s[դ$qNݩbSsb>a#Nf\:WU4*\젣&Z$#%mVp|]sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊Xs ,~1Pt9!>IJ Z ,ܜ덍S`a}jqz'6 SޠQߌ~ziLQAHѿ߶:$)0{Lq-MP81ߛ GUGzj`GjIdFtRk&IR6QJp5}RWL5Dzt޹4a+$^2~DfA^OĎvTU~h^% Pkν 6pe^ܝ|/_ GGz$L*?28C<4UzƔ2n7uq>skzË*#x9?"x~}?jίOpULCOpfN7 w6z|8oCWH ZIN5}~|= =e^;9']~oM쇳QC=c4-~NGsݥy9q{=?1='>}fEs?:mwh~s UFR$z EoR4?ۘߣ{1Y% ?|9Le¼V0k!r}SCwK&ZrŢMr<]=ck1]O_ ~bۥ3*sgت߽h[4\#\Y.NW~$H~_U:)  SOz#uhh*xne6ön?r5n8pmn}O_jx~:?fǃ?j}X~u?2O'YCV={`AqJ`N'A omF%:CO)*%;?8}\u]Z$;_~/b+ Z657R.&}_p,ʖ<'GرsNrgB_ە|yz~/B::8͚>:L<7c]mܷMf Nj4,=9qqph5 Cխ{cx]n/ <<^|ܳs8$syDG>CS?z5z'h2Ux*-8%~?1qj<:ۿ;2P98"i{:v jFzN7݋oqv0_gvSCIe S(:/u}Ο\(BbqR?O^<ǛoKiޙɟWNdt\Ϫ:/% Z|WC;45UG~^ާkQǘNXܢ؝̟W RX|K3Dmވ^FF/Bi1xd'][G)ZF~%׹6a>[cL>2ܝ~G9KJ;ٱ/{ͬ7:ـ~:rJ{: >~qP>rh0}d4s |/7I~xU_ԢL"$훍>|x˻ԖOl(gjҿ6Qy҉F*ZG77G7Hknޛ`vQ OHZr4̜Q?%]8Kmy0#g췳f\<2WX.@xzu,Q70=q["g t3t٫ 佡K|]Joߕ>\FS.=8Lx7阽Mtw]s1BË=,+"nY'u7G/˴?9ꪭ۽Ol]pPxWBO&'m%i|:8rtkJlgVzvD1=ﳞЙa#y60Ric[OZVFB8 \=J-r-GIH=N\ +JWeiKѣwWSoaft#xx77^[] (vok@;ۻ{ekqz5,~^\=͍/IƂ6){K?)ǦXx9Ѽ]l=HܩJx<3{nK[-!ӟJ7j|=轖uF|P6!Kk.Ut˒n {dn1ۜr'?QUm^-dټH~Σ.E+cQ~SֹnIVn.m=_,~9jfQvpӭ ;õkySw`D'cn'i11ie5YLcn`%]n8d?a:zҙNS*5xܸi; شiΝY?=v*=wS2R\qU~* XQuyȏgiAӮy$t޹*ƅUo|ꋂ#2g;:N=)?y]Z}cJ{fS_gp{w(>z@ϒ;B?r wa+8xwDL&kCJϱc| ڨ+9Fw95Utptj-3X~uzWnn$r>*gGtRˌkOϦ+B>OhqϝB>]*u d 9m~5oˆ^iIpsϿhpZ$ss+>io4 8E[-EDlmʼ5i/вϰr?MQXûox5~OQ#cdJ\>QN{JH%>3g_qUtFJ>b;|W୾m?5\E=-uQW߻ص ku 3Kg_S|=_ؼ%{#];:ĽQ8̦)Rwev}y{ʠI(Z' ANٍ '~@t.bzq85Z[;,MU|ֳqɖeHySOoe{/!+ޢdl--BkN< k%ZZq]}C |0Zx8Ní\*R! )Jo̍1>kq3ŗG]6}W"Mͻ95׎M4(.U;t\=o}=:C>[t}A"I}Uco.{ɥN=Gmh]pvFz̹ yCߕ;,~Zxeژqx`7׶Iœbal,,#xCa띛vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ŃxqWg޲W_I HxҸ8~Ɯm>mr@M<GU} q)Ifg'i7yL<܋gJ\[!8m:Y+j*|GXqQɥLݒ5Y &Twz.1;GBofӈ# `+l`6V ZB W.vƧQ7ܷQ$ ,q#aCk3id#lǥpf$;կ Y~@[C*ywG؇kGm1Ilk/fǹů?_2,d~=hQ~Kzbi 1nd4eV"#CwN0!f!7orO\Enn @lYקo=',mwbWI|m(K}Yclkp[ BzǦH3Ę"Q]Npܺyr'VI]0z&,7_}(`89Fcd;\v$4xzj&65] 㰦 ^㍎>85^3~3V1=K*#'hsu]GNߩ1e8?U;6wd*j^򊃭|A3V-&S!dq1egf[ǐ ;LZ#̡X}GӒ8ľӧ&wm_4c G&v)B`c"l4wX= gq!J;߹9bi;XJ;RxFH xԟTWj <K3zA)M69Hm+b\ We@HApֻ`it9qwÏP6M@ pKь! lW13KLb')9N/3A\i_OeVƫ%t~Gl.3I5͗.H%~gm%k`};.L>\t\U'\̰cauX nfۮ9by$v'SGƉ}9`tz}|P:^v5f$GNU$6fxҞ=sIǓ4j{N&>lV,!pEԩGh6ڂzMHD\=XDH2/teF;W͎=N(scdE!k\nY@ K.)cgp?'ozaJMFJp6Z5":/KG(GX+),A=3Bz8.{-bgՂa[w@0T[zSl9#{o[1 @$m/ fOZcDO<<2RV)$~qwI0x6uowd)0vA/cYLM8[$m9:Vav`.V[tAZ; fE{96&ű Mw\oZd9 jx{j8y'0H$l3Hڲ"Aܓ8z~)vnCR"bcC$wZYH <4@+،fqT9C|5.9 .KK"B-a|kcюH$Q_L|B;jƄVker-s&>y]Z8T6ܨL;U0g[`@03cQM7mٱjpK1"ukbr⦻x!OtHF]EWr Bo }Qh8|8?x/c*B]&w>yn17<"qY munŋ0fc`\:oZ;3dZ̭6vDzs4~A" L6YϜښ}^,c$ojzdWOSá2$y{Su $M W9RO|$3@6.׵5ɐp!Ǯ,wɔbz3 #:Xi(Jxg?SH$ݲ^gdžoJ뛸lqCJ3gL=[쨜9{n(bیmZuZ{:=?nc>hRhêoßGgkOpD_Eҽ7[qp>fidf=='.ϖ-JP6 Pk?j6+>wM CwKҝhoUNq݈Pz5O54O>I| %)$ VHsN(VJWI~G2ؚqoܗ:0ɭ4_qf-fFc ׽՘kR:G@)M1\u`{⚬r;=(Q^x|\=s}$ &R9V rk %[a0uHxm'&Xn6*2oc uiG5F_m\7&u1:K ݖxQ~Xq30㏇/jpMw'g.&@c|7~2džN<`f`ef0K%q&<8|[% t͆Y H&'eeɾ8,vn4:gaK䰚ue0cA|0꾯QD>L&z6=ȷX7kc{7M &ȯ{‘x؍zl9-w۫fz|CoP{"733)< : ~FB|9,D۩ +Tnzf4 9@ZS ^bgUPmʐ[)DӟW ^T[XMXIֹFHjç{+ܱaH |1L;dÐȓ˼rĖ'1?< .=_@Ů NߥXΑl`couin9$v͟-LJ8zU<%CsXMj\1qj8G2MNa>86)*kNN5]-(#Gn)\kb+G5N/GA윇X% w)klTJ)fie0W}3䇒ecUz,[W 7v柴da 6+eD<BA6hF_s97^M;j{fdLԩ"x݋9<@SV<1ȍ[iw/^lM+riݍ[0ؙ_3bw@HԚ0rءp)٫FY\ wm#= |ϒ֕v$=+`cS|ǡ?tY4dWgxr4˸/I g.NFWTwBHƻe$ϘzMY]U)f/KOhXs_-dc* q!lty#c-+Ri@>!yp{6 ] :?VQ(S@ҙWVrØ4n8¢aqG:p/jn ~s9kcW F&2ddTl8ts˧yy?>T{Z9E3z_7}Eկq Kjz~)(OFD.PƛwßJр8"Kצ?}&Yӡ\٬*T^@o 95}1 @*{g/Uu*ßnOd5(xAj]Sd+,W^K1g@un~bj~M )/0e440,W?11 lSn$6R(rwjG Q]rfyTV|j37>x!/4l_9y=rDpjIDP:MP{Ov6o])ΛS31s%9a!ux[IDn#nDsi 'g85z6k^ iUX6{dN~Ŭ& {pIE&홦e2mtZXjUY 9\:`~ \7(Pl=Ni%9|lD-ˍ{gR)qNK$?fb#\㺍y,mR72I;"r>MX\H%'BO'q-?.a3[ ")=xrH e<㿹sjٲ~-]dd=|OGʹ-by~%I:жvad^G}2'}TX_. ur/U aٝKaIk4YE*E0pB{~=5HW>D31ޣ#"1 zzg^6%Y]Ebp,2QjiM>B ZBp+%F&wm':c1DH>r! ͨ: Xƾ;4s}1%~t-Q)}g7k|@г>#'4Kԍ95Ie3BF2؎IU5}6!Rh\yrL >ɩJ.tOAzIߡ4gw#oz~@+FpkM3:H-R֗Qzljr?>z탴لD#`#~]@?R~b/` sĚԇ6]Ld!.Sѧ=T~Ha$B=;VAS"O Jz~'^hmC}gǏqk )LAl2گO)ڝ"Ke;(2YfRZZ1iy @荹o 0\tQ8]|=Gyh{0@qв1QO=a!h  xT.{_xDЌCzR:۵:tϔMg0ώ5.KӅ$;wR\裒P{uOʽx&<\Qu?ɫzsoAnGJ oɖLL7p +ʑ645S}vt3 ХANS^yrG;&yy9x08ccֲll=}8;wbjrx,+K&BKЎi41@7zJ: NL Ms!ΏK8@hJ썰 ~%ۨg#늘҃M8v0 9dsebJV2nbhXڥNdj#QA!GvILTvʆUN2ǫ1;,{`lux!?[#_r{6ٝ#j)_㏈ˌ .C7#LgQ1>VT6mG9svF _ķwJ6'c%E5 n5l(ku:|XEwM}!^BS/Y;fF1o lgo%j&@س(e-.C/ӱw ½{iط2Rgk8yeƑ Zܝ?Lw qx#h(*z6A"+Q\g5nHyniČn֋I_-Okt(U"y`$".r8}꾏O,.`dtz.؆[v ?Zkff%d.jx*R&J;;䇥0m2D@dY([ypfXBȏ!&FXU>إ|pe]; ZP_؋Y#=Y~3ms'P..Oq6W >=t4fׁ {.65Yd2CC wޫnY(J!h- sY>>v'cjg Cu| +7ޘUy|U Nٱp{_Q 5 l.J(ppw"3&@_s8sԿۺV)NYةjxat%Ut4 ZZ*zDqS|#ǹhG!T~ҕM$|@ oS V:l1!ׄt> b0]_9CVu)oϸBuqD`O ~MO]&b1)2ū"RH19Ge˧҈=.B?/i).% $W7v/Uyy .μTVaս0[Ip;;*`|^=C$ {?RUnaMF{UیLycvOd9e oWTs4Bi\eݭ6/]Y /> qr74:\ #wJʛi"E>3\XN#&PKw² o9f3y܌IE}[;>͒37ݸ oo,ަw4 'f~8yj#+ً,{9ٺXcWYWAW K$jvd:goqO 8.x2 e!n;Zr6$>ƂoJHjΧʳɬ:Vr,l7aUWN1̍覿2YmhvL@I>VU=[whP:*5jj'1M,w[YI$a|q`G2#XP$n9V.bO_٘ BG|;׃S͜'xh`}2Ņ[aqYn `wlǞIOKQ:ʉ 4:c / -8+"_ ̞`QFovmV^ x XϹp@0=Z㇎Wq2'~|׬Ӥ0EFZ$|2b=[}vP0v D;W|5Tl٦s {chChmhg.>5` 4~͖Mt9!)wДA!jpYd Wrxr uxA4vGJo3hÖ&'Ԍ GYHlE_Od2ߋӖytw y_zGAk[,Rm3A(w뵾ݪuB1!@'zwV1Alj~f91Of ;y$68=>i_Ot3ċ(+"aiCNVn;K0DW8Hܫ٧.^˳ ؋q>%ة1NJn^x:k{cMTrẎ cgdr n%Ý/0tR񹧂:]=/`)\tqjoafr w=Nj5;f۽cpJ\.7PT7sR< ;꣧ԃBtuv#Nݫ .A_Mi+cPjI;cKK;lC&W@#J#jlW A0vL+讽`;fPD.VC(1@rEJ ^`bzJfDzj3Ac]Aߘ:LDv V }.1jECJx$u}_CiH,^ tm8/^!TDcU]Ю zf~<_mɣ{=$aiw _{s w@9S\O"jk˶gJ@߹Cȫ͐ɏ|>$]N[-'7OmTCqnvtQ@HGqV_VuYiE"Z>Ǧ Fg_ϒ&\ºxpQ{U?hsM~dcē{2D@'l/}G Ěܾ]Iq(LЀyCpGVpL6 T72Hr&=nLvCnA?z-'#и*@]@C*^{{tUlzY0x>4li ہg?6F c LC, =cvM"cC, wڂP,{ mj/`qeb|ܺ,tDt`q/-Eȡ܃f,&(ɜHH+,Oe$Ђhw搲r)2({ʪWH!f(5w'03|N/oipT ֽ29*͸n:\:5I`I!1 zhJB$ '' l+\1jzuV% 9kt&$pD}KNlby{ʟlwZn*| L^a6]fYBsH&} (5͔"-Fgq*LI9zxo(axڏ+{y< n•NL]փˆ sY4ߜNaň%e`=AgV;PS2rh=/$y ;5q̹08y;:'5Ϲ4DSSjXxbu$e}S44R?vf 5'ojt4{h0NOU㵭ڹæ9/{?%6jkAhxQ^atp5! )\j:qc~_ uV rRޙt0YtdV2_TԊv˿-Ֆ~7,"eś~هڟ>ou|Uzd/ ZۮjtISc^Զ-a2Js.B%;XQ3֍_$R t~LX7mLާbf%, W,D׾?\9ӈr _C r^Wf~[zSvz\Eݠr+_ ۉxtr;uUFcTPŖrtl_5Ů0NYYrX˾IK9QNou{R GrwȯMFrzV2s_avi'#C]0߇^A,*)L>_T&_>|\|0|>^~.,)%§.{fOx8~6]HXabQ_l_t/{3%;ah(8ەpw(׮#$\_үZ nNƏ'z;tw}G.ULKҫaൿ[?ˏ(W>yNL!0lÅw+08ji_dpίrH8^Ǐekpxi`^ }P+ژ~b<\w^帣] 9:<w[uT]4$LE)1vɏQ=5D|k` 2sGk=a phùmF×@{f&wtAwq;YO%63Gz1.+}3KxGg _w*Qܐ)>Fw ? ~i=)Ӻ7 *gp*_WO7e <ݒ+{@ ed;K:w̽94x;#zfiHj.<u\݉72 3+MgOX*Co% m{R3Wj2p>ӰsOǶCG;>7Ng9.Sccz_`:v$KNaأk|a|?ϫݾ#^H᭻ݏ2r~qssv*㙺IGadz̍L46 ң1Sr݃AN_`G5:'aTu͆XD.b?^b赇p+3j,W"3N5m_hKN'5.#ҙԏ 1*\Gj!Q7*tdC }VKT1U4#ĆѾ:ň5sd Fi:!@aߗS ]>5yx='e+*S\?nLU|jݖoOX\G9a>pKZo嚭x^M:-7X!Q1+ML^;}S3uZS-TNWz [vV9\۪\EW^6ndlH'jf& +7,4I> Ow:lߑ7"TW$|ZyrO-Si{l&5xy򽻐| w߶d`/egR/ SF(S5{PW^~G4#ڲV&N~"oB Sc֝Th糺tBF}@[(ja6z\we;B_g|[ھ: ޵47C 5dX+OšZ( U8X0|Êz[T>Q9~iLx|Dߑ?7-la6 J5?㘧BQPkyK-Vܽ ֽsC~e"dnl%q _ޔl13`"W2q}83N"|]=6gM =3UCP8 _s2:ZGjhR7OvI*:?k{M/Æޟ,?@~vx8OZFFW-~4p㏁;t:.8C5}6V3SgЏe\[]}q]芭]:N8%\d|j7A\}Sr K^ؒks&9(ppG}9 ~\ uw]@Rx?,|ﳳpeTWvI^7bLx~_Ak=y8ićf meK /{G/-%l4\/^0?>-7oK|:{:oL8].|^y{`6ʲbn]ug̊NCNe |Oc T-Ls{dS.FE2mmRywpzAj#0Zd]]/>߿,vњЭ*Ǿn8"=ϝv,utj76M~9_q1k#nO O\<Ռ$x]$XiPڗ:ڝW>Όا" W|[T0CC.?r|{0b_N2یY /lsr/NW~h%{cJ%jրdjew҇]*B&&\Ӧntھۣpb`{k~%dC_FMqXx$a̵ .%MsQ8%P/d>S)ۡ ]@-UkZҦ ڟW=֜c*%[m?GXU1g;4vdI#'Ei<>YN-WLbW^7a֚ zL.òلtnϞQ;=<ݐmĭ\7`f^27OU0SFcC[(NN.Y|DrN#yWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*)la)ImУ}ԂU$Rhq#9qZcdˏUV5^UASAᝤCT @ݸ;p(}MWp%~JVE׸#V0A"0]QزGCلDE km仂 zi$d =Oؑ5#c 6Ew!L|oIb$>ݻ ]Nm!y}_ *!TT2pߣ4X#~o,f!$0{ۿ{|??؇r=z"heL= ӮC& |<:7XG0&`N3Oiњhi@˫K(d/?zm3[Qfu9dA1;u',.2Wac,P$LG <}ăy=CH-E.T>`j޼Rp?%+ Hۑ bR"= A3.T0 tr"-86u8 ~CA2f9죪M01.: ,8ǧ#.@yukIs 2>m&?LA[ \ k\3\uzjx`w>qc U{}DxfKpz4ڠx~Oc8{i/FAdemfu4dHWYFe\ i}"$j<0XrGrTBݽ9UQKt[^'MrvpXҊ>GU|SC3!^.K׮!;[l4Mn[[]w]Mv?4UQQ998x3nU9:ݼF)HǶQ0d]iMr{#o'/<;|q'Ɉ`Ycpz5' s49iгC|P1XǴ]SN uz5` n ,)ᑆab2eN3q@c݊F>ߵ!=$9m{{݋#|DXdAvht2jAA3rcHnlR~BXMw;p]qaR,a@$ Ɇ9CrpB@v>8Pڽ.qt{}|x1t7݆w7|5O,é5D@=7D;%H>ٷnj˓)Ԛ;w*ҟQOۀs SucP=. }7MvV\r:Qbʾ-gnN@pX;Wnl z<þv~Ic.C09'ӥzf&8 {^X ~4v3[,_kVo!RMuv ֿ7jWі]W =W/Ml1#gRܒiYWh̻'lcHi 9: F鶄ʀ;Օ8=B׮JGn6Q]+g^o1eiLA[[{$bJS 2#汭w}9ߟ VH~78[qjLIs.y(XynяB |;A NS 䈩%֣QOÕjb]j0yvLy Qp[ |2,b;G: `kۦLfCg f'm*:aܹͬ1=;DGGh@KY-5(%pjq*HnZǏmEOl`b8۝>Hи7ZR5lB߶=ϨH:;͌;HP:`O_'8Kt=dw'fЍ\:D%"C ' '_Tyѽc2#40+Z;w+W n!WJxc$7IN,zSd"lT}ٟR{g٥_.B^ە^Bͬx h2DmY^uKB> vrטkgw"+v.#w5:L~ןIHp۾v]Gj~CS/O!5U?BTl\4ar,WM Xj4=<ϚOq Rr/Wf/fewZ>Ô?Ì[)y8A= 7Xz;q!G.:%Ȋr^F$62GrHdt%'b{GE |eGF]ͻzlOGk`ʼ{gWf=W9wsv.X}UX^ㄷ? w Gu*` I^I!<_z%\Rs.dNV |뻹ZdYí5K'j8dŀ^&@C*O @g ϊk˞ʋ07͌tx̓ᮿ r$)ܹ<}{c#2OkcH=ߡݜ ,jW6~7׹h'pקϗr6K(e(2|%CßN0f(E灮EEai˽jd4a{C @kSL0h FxG U' "rNmᫌv=',R;Y~{lA>^9drG 3 _r:8Oi$b !%^%]'2%2i4٥ݞ]oiǮ`'pmySܕeEW 'h 9Y)ln\%c6 LuL@D&qJq_1u#i [$r3`<8p\QsYEwFʓn^;}xzv=9ew'zel$$_4YbI~|d.uhwMͧP-A~vö;+#`t(3<-`>:|&3h2#'z?_iGQTzBGFiGbD(E}nԎN֘*|>(t'&3CsqWJeYvޏ08Ij})Ev9\r K%1(k9'1"P d g8E*s_Hs}[4Ys&u>H'nso13i;.`d9~:)؜ͧ)ʇ͎@O};ؗCqRw9e.71ɘN8MKͻrD;e-' bP4uSGˠ.+aZfe@v2Oi"K65p6^i5YAo+pR4ЁƄn0lm{oKx J I-SdC;]NSc4pcZeQC@lŎO̞uz^ b2HvQ#$O|)GALoNژz,'<#a6M핸[+o5uTc]ZB^e&[D:T,$;>OWؽ 2gϯ$DxaW)Fbiw t*mGuzTҖhб#~aMn^e19#D]r;uas'$ć+bfC- =Ʉ 9|$ 7ˣ8u4ֵ@#c)GGle6+D}Xj.#.3?avpM$n<8Q૵{`|^N/nN9 xsV LWB·2|+Q {ދVifӍFٛLd8GW9qJB!?k_m0P|[qe1=d'y;~,jö02v7oq.@vKXApE7jc%$'#}`o3-EUoP ݎOE.)|?~ D <{d=BJi}m倘vokB1H=}û;Mq I@oF'놃䚨OL4w.8%F x07Ll];`qO7g(󑮤~ɇU׎ⷛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*1S7'$sD(,m+;dN#>%ژHz~Ȍ2quDG40_f(9G;,5ʎ3(Zֈၘv9^LjE|0b]2afgvi RuRiFVan0f$55 j,$Wݗϧ[IJ[aԞ$\Kz١+UCpo$Mr;v|3y{Iڜ+=}-x al@yl]DI=j!I!uTُ<{`/RrádpN}1'w^@|QPt!ti}QPSN-]k]XBX(ˋz7ZG Iqw6Ho\v/%-$.:7DLv:>nJ5Q?s̐3{Y9HCOLToCL윝&}p1i16n M~CB$.Q\^L u ]} ?j`LJUz3`/zFwxmSM0GD!7;/L6w Xʿ4ҟ<GS͈oI5kHYv9s=/GATI*%W< 'Wa)3H}l-ou1ܻù0A>e8~,' "L[Fiu6+acc08 $"Arhdn[@6GZ o ;vOZm^/@tz\[jWȅR^|B`rŒJlp"T(bv0WY+DqNpVMp]HvgG mܮm EcfJpx$MZA7}Nq6f7` %^ J|s 8V>S $abȍ{],; cfvbOC8'] PPl$ j RcUđTSp*6̨E>r5 e!~J&↧\zS名j>}BQ3k)LWN$R#[o] p`L=~/g1. 9zdIW%ΰ۸UM.36ԽFFCB$ ;Z._WextЏ @x~aDoD_;3T6ae~z>Y'r44'OrnԦ;uN,,80-/gk1 ׬u|"Q^0Mh'qМ a.)mC8 {goLmzAMq7={ftu|gr>Qؙ9.)W0 ҧ3p;xHⵯx{|vfT$=(VFp=$7sP"qxm>D(׶ٍCk،@jW1,?cie2+ZLGE9 Wn)N|5SC /C{'YÈ5[Tˆbggdc#WTJ`|.ghqC+%8U؉S'$ɒ}z |.2(__s _7bA?5`l|v"0?_?{O=s 3糣GW`yf_ſGoH]qΜFQb f8%Q* 6AvY@[7hE;1{W)1G;H*n8O;cϓ*c#W iF'rM$Nd$v;LW˥ĆAr]ѕ2Z2q ?+/$yoD$WQ+1/?Sgev^PHɎFޒ>v|9HPr0$TQ(׫; p.CB<+c<<9*#\Ct`& _`hmVst{.q z8'S_^7N0bHMnB5;${wMͤq/!j kzCܙĞx WRVX /%×<@ER3w0jGT/#x|>;[$2PPGљ~ zogn`{#[l7i`xsO|^:fc}7]+3)}o-*+e}/E\! ՏD? 6c'd2\\]eNHlbM$0Djp98v똸̎@O;y}_⌴&R{{"=Dllm O/OKH#**x`3($d3B>8MVp,JH0eF?O}KҎ8 -IVF/gK=.ЖP5C5?{d"rZs5Ww86٤+Άb xTlq_S}ڎVa@dِs(jxyS+QQ7eґHe䬧EiHZ.g 7\NmibO4 5ZNjnZ X;D-~jѕIݿ ǣvfz2Ə}Vǩ<'jf^N! uڟ&^.stNu/e8 V68 ۣ:?F TINzkp?[/ Jg1:~O&k4E ou4z{Ҙɴc&I Ho{'By0$ hvh >XQsMA 6b.Yјr|Ѷ~g֝XRo1fgn٤_qb vg,>k0ݫ)# ̼@eͤ#v<{6o;[emS10~OvWlbHN4DRNe"@|y@ԍ; )K}"OS@ @)6I-*iZ^B=i3zA/>뼿lahAoYR5Z:xZe--mPԟ ֜d|Ϧ+Ҍ璁LY5Ɩ]-혹1eG~hiʥaU4:\:㾜{CYMOyCGYAz4w5#0:w*c]l0O,eaR6|@_ogu2i$u uNt|ҟ~kokg jtaqw52$1%TλA(N g qޟ[]s ǩTmZ|(Aԏ $%ґ˂;z7=;ۈ9f<'\S~ݾ톋+,dPm̘c]Xb$JQψG~Oflh ޟ<12;ٙ<QsvX$us{4v0_7>Jpev "09 jŻ 8\YgTRd# r#2q!IӜb腎6" 7\KHYac!H~P/7 .ywXnErAHT٭4ț(Y!l i~7 àex qd;VhiC~pZWoM>P!@p"zLM^M$+W#}Q䙣W+z@MaG's7OJ41p~1@2q@m_ r7? 6p1 )RC2KKӈ@)O4:+o92\brQ_)c%BȪHɆS0-ޏ=͇ Љoz=.F2<m3?$iL^RۏE#wvPOK7gD>*;S $| Bb!^'z䵔?=c3^k#W/d$K !~x{\G\:m1[yz|b*{ʺm ')ik2})D0*,qЃĚE h/PNwN-Lzkq` i% wYdGm?KSc✸~D_bkBNszMT}ns+4s9w 3trG-$rV|R^[1XƂG}|P*/*j/*8eߕ_ym_ʯ!,s"-@;g5qɭq_!܀iZSYKBX!5߰t9Myt 2=r puY:l8ѫC#x\vb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Go~ZǞU7#^ƹ1RCLsQ mGnR_ONA2~Rvz f`/`3!bҐ5돎MK`uԬDjAlˆ.6>BE"O.[m׵sO*|pI|sl#Njc(>a! !3#l@^[&Ǣkd>N8 =YJőN졎|W?RKo0ў꽺W烊ţdCZ~;W ʊ9rlYw57Q9 Z~35O7E}|0xo+kLKwxG W z1kuvJ. \O.#Lt~JF6Ƌ^4̚0cn߳xIvK5y%qH˽HwŸcIڷuzlgԴۃ*Mi6ޘJ!C/{3;SO,f5"( C4Tlٶ06qF?7Jp?^GEĘNQ2eެ -f?.AſVR:e^wM0'e.Y=yYJ66DV?E55 ѫjsxR{}oxqožߎJ 8a) k0~L|pzdjNay̍,x+zîEq/uV b0 =ynL"n<^.Vf: Z}af`ВA(|8e與 iMYzgh2;{-OސzW|(_VBNgJpq9;o{K-n@4tPқ{aֹQX5Wf˽6=%RhHCB42萠kA{fD4@{\|1~ihxi3m1eӡwWSuOl9$m5٧Dž#GpJdre N nwKP wǢ"uJ.}"޵MMz^T%>y{3p*؛Ts5SmNqfgHiLX8kk55+A\R{pM]>YLnq]kkKF.ɃꇊCV͖~cs W6 Vo|^\Ϋ\b5L[:Ro<ߖomLm(Kz~X^Ko|:5cZ\3rh]nB8vz^ Zf}ݾMc z:aN h?bOgk%$W?<AwNIw2S-c7 =mȥ2CQl>rw{[޹ {:<O/\aDL^+07X8n HCb{q6yf^N8&"`X'(r ˎ˙Xu&Ȯ8. Nٲ٣۰L2>˽ Xo2[x19M>"+s_@HG%c2~hW?$=zWuiTrYsَ]؂K; rz|oWzJxW"WV]V?΃;gsO4QNW-5ǐ9/3?dVs@i9xq[n[_)0G g l(+OV('">8q'U;aNmj,9Oa=r z{һ}: HoX jPjrypg}wD"7L%&6Pxe>]ȤX;Ʒh-dE Z?eq=q<Go|.y]/gƵX8>iKҘ iJ~ @q$*jkrc `/O? ,HU3P`z ۾X mҸ|~{ٚE^֩0j7M2 sS˹>G.g 5o9x{w{/ ?gytY8Sˣ$Z:6Ø⪓\ .nوfE1xfJLtc &ݜ"Ӑևm!C/;_DE1T$+# ?֊+Ѭ;W0t gBy=L&V0bN1]1-h)fh2&~>jPIqZJ9g{ob3n+͐p`ڻ>>)RƜ1tv:q^~72ܒ%:~L87`{7;WlZ,v7|hkw{Yhx uֱCҬvR?6朾,vmiRC/(BF_:1`5&|40/cPN Us;2]4GG ۫TؠzyxH^L\).&S2eҎcf;NF!4v;S(Sq'Jٌ>7n_` إzNXoQɦ/f [4azɾt{+c>Jcz޻?g?v+ n!05l4qoO5c./\0Os|ia>3KKZݕߎޟluZa FWC-> %ޘ! |eZ2Q/NN\zex@9Z.}Gsژ6[AbLܸPF7pwXQy׮\ڙ #\e3jl{çz1V}>|%Cͼ:R`ksPE)L6sڝae:ҋ@8GJ2-PWLeq#=#qACڎjI:̭>~oi&c ۛ"q'6ՠlf;GeԮŗjr?FHlq =4dpcHvZA!5F))r^_ovscirc"VPk1d08NϬ/%.+ v x {L+@oD=^\C*E7} tG/r)JSEe8 H+_"Aḧ́!-0J %+%)3pixs{}FiPkN=F*z}tڃ[ X[C/2}]3@J~hN|M0$:b=Gl$){[F,hdOԈ yr j񕊢:*aJeykCv/" n$T̝.. b}n0nˆ x|U_6V)㷤 kvjVb)d!2tq{O@0HcYx>>jv\^5|xx 2c@>C<~cت,'KxS)qh(2n<ø!3rJ> \6Z]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*_>W6)f~2'\jf"w)pZsBN\W# &3}=^j)|V0dTLžaoAf<@$Sgka+`E+TK> dtTʏ~=GjGOR mUw{0 ȣ?=)f]/a'# ?=bF |+ԯ_Q#(>)F@ӓK=L'<LVwZm79ǘcTc1TkFF6H9icxOyhcϧ1#lSKU8["r^1am\d3#|[gG r ǡ>ZxW!MyJ˷͜|IU\;-T#Ȏ!,SD)yӟZǀ[1nGبj{eP.nSNG$MV)(׏P9}xKlr=;p9TKEFאc)n5žkI9n{s_ 4%vR((kӔBKHIE@5mhri!.ER Y=|e~,)z 7΋E(ǧ7;0l%‡ Is"ZÝ-Y]kj-Y=` 7rY]b5Q͘\bMpGZT%ZLKXWjvQM=<}CN8f.F5 L,|0R̳\!rٹ'|"?!ZrH*dA0[r4Y `no-&%0{{deݼ %UGpO_2ϰ<+7yc}{InV ]nSG<2pFoހ:||U>sFف';j2GZ&)ăӅFS~'29gD֘lC ROS wLzl%s=:dKؙ8 ?h,]Wb"(M#@Mk\JJNC7]K~'[THEjlNk!0͋v8;c$"PfQ)>{<<&-`r: l^Jl wɯM$ oIL¢|&;^8Ր$D} p"* @NSLpmgNy`K O <=\pyfuP&kg`iW_G.K 'ٽB'l'fjc(( Ѕ7\0ViN0ƏWq*wQw +@&.T2]~Gqm@G?ZW/Q-5 {TeGTr#o3EB26=\›a߶m8u9u<<;__wMJr)%攩̓E23 g'P+Zad񹐨=i5Q|>FO_ Ðfz:kCzC|N n82I~Ǧ|GN3(Gɜ (Cei{*`PyUE3.0۽jc[S)hf&@Gruf:bf N-(;grzטz޷QrN:N @%k ːr?ؤQ[` &O gb.8nsYsEb u#6(2|[b܎17|݋lŹvٴR8c]S|cQsa84 a{iD Fs23-Fk”!1:Z>vIivT( z˛cgc R!' :lɉ.JGo ǎds\.[ fqK#m6f4^9vxQ2<#ZN}S(A'8Klv'6c>zVN(l?Z5Z2'Ml(_#i$ԩ5:)@=~N"L=yc0xmS㆗\k34 ww^{!a@MߧCx2ץ2ͱW-P$Ǯkobb\v=\QJ8(jlND}0E3 [SE(~e;W"ZL kJOٹ}F̧10ZbA,8tb2Y;Ys֕PS/qcJ `+%fJ]ȸ+᳒oR*rg,t?g=ی8Ƃ$VKN@l{J9gsz~KR ;ak yRb پ`&~h5(%wάT֫ڍ.<sJ4#s#N5.d5 rJ1kti֛~a+yvF3wsND#hP}ٱM G,z(3B鴹&DvVWVN.eS57ǥɓ5CH)\]&+ԟ 1x~ i-nm~"^aᠦ5Vl\;{ I&6Ok"Dbd4)Ms\2xn]pߤ)o,}&q]?6Wa}<(鈍6epXwT:[#>|l ѬnGLǖvxF@6Eu{`LV7N* kᙆ`}@K@]BU? ?FN5.*>10NF~)=(˿dD_ 3$sAUG~j1HR]%oWcqv]jǸîÂ}!9ۓFH n;톥nu,kcd߸}KĎA1l{atDe{ ˀ8.=|x1DwmKm' `T b5"XE罫lFY<#~f{nWe5™1exq ˥k!F|2v͖#Ik<1h[,7ʎ^WKE&_A #E!_>o{'Z RbI2Fނt' eogݯ1Q3M0i k|9;5gW M *3;&GaHȁuiۢUvi̎EM.溭s\SqYd5aL4#Ř9M!BiLf!T_]s/,+y j[ʶE77ze`u ՔHA~_X}. "ClucQ^hy`*M(033Ӎ3 . %kSFI1 ed=yrd >X>/c4M>ܙ #y[!sl`t*|NOg%׋^U/}w')szQ(+O cc+.lCwק\^Fh1x=üG㻼{ `K^'6\/!\@n&8YvV}}TN jW"W߶,%*YhLy}.Y],$'H77[1>OJOri.8-3Yt$jXG)"vN88]@2B$=vIFnVzQT0|Eώ{y-@:T])q9 ^ZÑ3T}lCACU?pãp'^{QVpۼ y`F~|T;91;zCCGz-+Tw̼y̙x-@/وCNCcEN3A r![(nDOW8D?[EY@9jq]G8=`ӜyLh͆UŰ+'v~|ddq]AEn9', .aQu; %h^G9bL8,|N/x2X"d}/eūx~2]щ#I{WQ #[GZp? Ŕ3E2vxOy+Epy(tmӵp1O ;Rr5M묑O"v6zhq]Ʉ7/F`аW;|^)'G9n8cmoLChwfVzIw=pOYc}e5 9ͫ%Еd%w xľ9r}oti.7y҃+rNצS>y bh&>=ft>&;"6(# :ufBXO z` 웶@YL 2} zjU9V4Z)^ 1;uuMl 6KPn‚I)ˊ5H͖9ǖ|e${ɗs37ovW w+Zle?#6\2c+44وNi'v6K^J 0=+M yޝ1qiP!8X=pGᘺ^ɏ/H}OTE8"@Xr纺LK;L3QH$sc= :H~jaa;#ijʺS]NQb5"[ r,Qo#< VN5[l?hp+8^ |Y"#:f> {' z)e }% I!AȦ5-ibPcp;~m# m-mCVi P`*LefS'͎W ;reJ4R2RsJ 9y40 xΒx=ЂBM(Fo~B}y;V)` $ꆺn.[ :{vucA^F{bCˌ`23v?eN2j@?]sr.¼ N͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*q"Oo–jSE5 j}PKij( j8CyW?1Ʌ!9"c~>'5:8`#Brn$kHr}:CJ현>Q9_O:u=z;㸉H]fMLf.I@~eOJLI?AAI HyŀxR 9DG2//Mtf1Lɻ ;,[JSLqrh͊0k9g8%*ؤolx"|dǛrÀa!mU|qu,X⣸9NK!mJﷶfd,xn5`wx~mt~r͉4sMw}78}rOKյuܩ5ލ\LǼ >!w|G+3_i ZS/ !v~F!9F)^6sG!xdrթH!$i>n׳+gSE"cg$J;,ҝ ;ZeG4o l,q͏-\i;<إRo˽$;MCgh5|Dشsƪw- 33k'Hr;{uqs]Kw;AnS"?~LѯW^ }Vtg`{]GiDkxe؊X]W|8rwݟ\d# FX@@V^Ғ)_cJJݏtn{if e OqYz {щ8d>>qODYʖ)Pm"ܗ ;e.x;F_F~{tݝp ۣC[.{aCDQKF_V Ve1b~o*u}V8 1r&lj0/a˯GmxGQ<;U*P8Q6q%8KZx8/dsJQQnOD2Ҹ<rn$|\3hQ6QLMi-\iw"Q2HWٹ#luqYAVp0NRnW N=^sRx -'<좪qc&[l,I1D Z;.xBsS)M7iu9uN7|!3m HHaH4~.+Ć٬8QݞYTv7T۽*5m4}$hXϗpfln=jv8xqOukt;A2Jo^̏9xj| _CMJQ&ׯ%$b#j֙DLI_%1\@`mRg{ EQ^ip[Y`2ߥ yrTG˵cƹmKY8Y<+uH;R9Tpc.>wptIRB4 zuF9vYĎ}ژLHw [$qab0 1CZcy {jc\9wБ)v59n[gA8~}ܨ>~i`ž y'Riނ,pOHg8M%~3<3ZaOS*ּMl_|;H% Г|y{,BdJ2{r`2 rEqLe+ ": Au]"ӈa-Pf]j"O?NqğdҞGq=1,M;rX\qJB7cGsǷ :gU=23}S(W6ZI|xxv꜁?Џ& s&r$gkF%h{Mk8l}T?k>'y@r8+xȩ^'9vWaa~.yymqY!ziɕ񾥧ÃIg%FY"Ԗf֔l^\mxӀ{C'B9 mӹFh0K6懶eiD9 d>4M+'f=QBg}r* 2:U#~d1"ѬC,/A$EQZo!?v F b.( ?ܒ|heGOw|z\@_ ,()\?²ɕ-zY8d@=KSh19 yY4 ^n$B@==x @8AX%']=ކ>uJdvʽvװht y. UZ__<103^3߳bJm]dMe#(d/ASSTc~g`{1*F<]@f+PRY8OQv2>ỈOw]68*K!Sh4b̦ (BK^3S;<\k1rS>=\QuqlW9]f2ѿ,qddr;f9laReCQRFbdhd÷OF.U[6i_dK ]~G`eN#:ujqtdcǹhۭ3iϗ4>bjinD[XN;1᪔z_؟_tͧ]}͢1]]/@]GS_~ 0O|ݍ0TzbǛY,f~ !BG#>d]A%v˥rt8]ADDįڦǼvG1:,B'" ={f9(X#3u1uZ}$KR]NH7>0jJPcr9ubcv;.o?g|pҸpGkI6٧mN0q"'տRs`g^RQGgf˗q఺#\ґ=_Ӏpy}~ 4*[!$ OGOg7dfn;M0TqUgPiP c,zNB$DuGۡ9?Dd}/{Q8uxĨN0: o+I(~e8>&{A, .\ÆaͻCuAnuTƾ42di+E)sWMzk8ٝK7}}dr^Emѽp,:]\H/NeppnԻjY~T&Km+u"ef2.OIXکF97܍#y "Tv4- CAR*Gv2Cqޏ]20\;T~UlnU #TAѨ_/hIp9/xn_/Lkgb$pG/*r}X5HdK!Mfd>:q ATڔ| wsA 'oKxp:{h+vd&µ^Jd{RzYDwFX3^r~hy_GpI5 mz Jֻxc45>?{8x;HCLnZgK @uY Fsۮۊ?j$s:7ñ1P޺ C$^|.g>!M"da};;A./ߐ ;#K *@H v, uYLv)+pnPNrab.=+X"]_݀56*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*쟔b_?|#v$PgUB՘Ibas4#FvKxo/M뒜8>k.x+f }jܖ9#&61 YI5nLQ1G1ԡ4ki$~v.z,xۖnq %6>5t(0Ƃܥ? w[?bq3~l̂M XnM:a{>k(j KŠ! |}ddg훌xm=Cq؊~DS]=8GS:Qc-2fb?|[ ڧ_dPR5 1KY}U"~$#F.GWgCTa:|zò:Rp(O~~ w'GnW:q[ReHw̝N?Kq)LV~2rNAV "9'%v[l?jIx%9;v*I̚D:zQQ<_t eT]x_NL34G>/J`xSFh<_ ,E젲zַe: O^}ɋ/3-չјDurh38 齇gp܀Lvc"?ѿSYrp;GzH}E~z"5&s{YFCa_ Gz;U[0 G|ppK1y:)e1cX/lU]^S5EEpeE) J7><.\]䀇SRB<-4F_3Q>R@@J=dҘԯ=."H kk2 1BhL߾ehqy7!=iH =k?sYEdžceSf1;yFL|Û Ok5z5B!Hߪ,1clKZ혲 OM9GX\ܡrP4hj$w,z#ަԔPiv`.}zGh՟9!rXO,+΃##kF>nʆ; x˫M&Ya)ɉvnUl9H+fil GwTMgTSiǓ.Ocʸcq'@ )LgB&fb;F& _ՖPL8=}aр@_R\>Ma>:qNC~LrSރd#l<.N\8 x5]_l֗j$xk1[qZָ S$㙽j}|cM^8O<.S=XLJW -cM2²:n{:vdE zSk M`)>8{{Lgg!f"22`t֎7ዎVr.n_<3_\9C1 :YBWWXt&vv{|JO%-Ɉ4v>1o!*=LІbkΠϹQbwJ+]>]sv}A5ʍ)\?eKY{kPtzi!N) wBBQ\ty;^ZN\U@;o:EVȦ26Eۥr|0Os*Lq,Ñb)aZc;A%+Q{722?Op .>x[}n =w&8Ѝ dAj.Ǘ<יHm6Czx/#=)fN2i[?x Zfi4f_1<8mcϩZ[K﹧ Y%m~5ݵI:z2Nޯ 'mn+~hH&i[ ֹCB;;H s)ubkWQ:\c-F< S8>XL$PfXҊSd}6xp>ؚ`LRy) m>erq sPX+Gz0]iDkJ В/*>RT]ۆyb EH5nmAR;5>y:~D7N\ߺR}Yo'҃;r1ւ̭Ogf+]lZkB2Ov'w DpEoE瀆1~yLj0܄AFIuV =kMyxf>MYDcGm_Ѓk'P0m s^^=8 US IwNo$ 8AA8rO2DxԨ7~.ukk}Dlܗ:a40ghɦ1+5ۉqGaGrD8\rG%Vc{c {aƝו:fQU{SϦzv1bژk/pؠWzfn_ߓ꽓#mǯB5?k&JM SI9b]nG3k}b}8Gv+%jS6ρ{x6i,v%+! _֚+ XBi4*\{3s>a5|ރAAkqDg#j=&gq}~c6'oxnY}4>~mAY@eO}aq Cڈ$e$OIqUO-a'>猁ͪv_D5seq~vKXo4&<bjbvGB}Q ;yMMDқdٽ"Hޣ4/올Ypm9dSvgY]A 6Ĥ ֻs`v$gGG 1+}=X=@<}Q RKJЁPm8e)oH \%Ԥ(4o6tk(?qN"ւbE7}//M'tw<e#Ȋ\^ٰLf;٘kG 2L@".b"ޣlI<3Ϝuó/dN[kZSm| xHkp.\oJ1yD / o͑`mlK1mTW "۩|sYKhm߄NS1pp% hɠ4y8&2Z#aB1T]]0zx 5[qh*ƣzT]QzTfcRYDHjOYm0匁Bpaُ?hfqv>O^4Y!kusB}aM뚈[۸Bp-3.>pԖ+{NLWF=A7·g {ENGҖ:K#l1i!V9$q[h*Jf>U_ݕ9x(s\$B|IU8Vծ[Qэ+9Glk< ,xf"(;qja_)kqܲr=j0<2AM|؇1]@߈ˣn>N}VqbEK1k,ڒ@Td+1PS6/xo+'7dέAs&8l|n9߹'`_p='gj0vXE2W E6 ;xz BJߑ3:ivpBYAݷ[ik>ȧnsdEAX2,`=fޏWؑÌHH\ 0@A'eO=Z`6p+s]rѳ(r݁Ƙ yy@ScUq./EoLn7p:).1bثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*R?\+n$P)9꨿x_՘rRcrXy7R*DċwZI +46Ln70NxymɆԃU!_ft5zQuFFw19 6DDȧlrsl:P7GqcFѮh#urx4> asgg&`,>iV1PQZJF|Qٝ0{'͋ZȗA>f~ Njg88;#%wbwtr;5a]( fx1|8b9b*ZSޘ3Qu$m]nK8e) ӄW@npi#fu k ^Eiu;' Fz("  -i'\lCCot1ZlÊPkSqO?8/oyM4R9k~|lXH՛jv,z8r B|;On=#jG/eҤa]jEvʻGG#1˓{Sy3Dק̩aDљ NvSC t-YEUI>Y0E=cÛ9"ȩKNJZ98mҙQ>K>+"k}rItZn&|gjKO N }qejQ-Lwhn\IPtpMwc-$%v~䢞`I\NIzffL''cHJk\Kҙ>$LΜ81qcd1 ReJӤiBPL<=]FsdHwԉU*0I0o% |3]9dI<+(3ڽۻC!m7ʂkC6W GHbZ-ֹV\^7+05lIXc8r gu١UA9~߆ˋkD.Ȁt#|/u5 M]<@r۾JD|1fU1 wY< v;S^4K-B GAvgQ<3O]J]@IޅoɇAzW-Bj˼>q?G(zq~y H[bƞCA]7mj&{41IAa)ݘӁ7w1뱑 E̊J |ױ/S >XˋW.̗g5.q_0;^8&JF(Miu"D5p[!a^[5#' @>ن9qEoas[`sk' P;F\]Nʱ0p GVNΞ57{H%[f͇,rtgF\? j>xYxn v_e tH\Gl][JeSWQ:iovRڼ_Rّ @vvd{*T51\a4+ӦC6v~mkBmlc>3< bŃ\χds{|{6SȜNRWΛ>GoAÑ'S22iZ9>.ӏnƤ5 d󝳣J e㘺[9i~\ܺ;ۺVsYSvn1I_a3z1n7kc?!݅p_ uoL1#8YT>> I?;Y{nL=WI?V7GI,NWdǹEv2MvQdJ)}L`r6B=زi(erJrjcnO2;Jch2~Oe77 |+T20e#<ރ 0{)fir3E2&)ұHJ4[HN9qZ9}n^$+?{ꝙqoee]eR<eF>wS=C|3wBvnsN:/,*ߗ\ztF) G*WOXR w(|8a6).k7˲b]y[Q$ Dzy@F%gor&A!#j~6'Aۍ+%O400駒t{{;82] {);ɪC4/"v< ֺ9e#{ё(aQ$ͷyVT!\V[iJc$/6qJd"&&$F\7B*rƻfp |ԜF;n-)jCe|m0u)cN۳{oď.u۴z צ-6TIpG{zy5@eԨ蠚 }6U;}8hdw5O-ڽ8q\GXoafwͮ>85ӽg/ܘ, )/N63"#w_Ҏ)Y\FW09VS2p0)cWƉo>ޠ] 5#F*DŽ|.j2J )\i{~wk9va^s:~n#<C,'f= w}SM'z `jp2h[NKG{|Ɨ/2ǵmjGy%Z=zhEi]iړq 2 =A!I%z1GݷUr +%} e۾l2etF$hܳRe66w#92(\?)Do_Y GOqyֱtR_%V%vQ:+\ya?[Kz亜C8UspTҹG(-H}`MD[H'1]f0uVbBn^[U잢"J%QoU(ZeS%'bdcIuw׼ %m3FF, Aq=c{ySF}e/] 0B)[`̊n3?&1SOE>38loψv+^ɥ`ƀg?'h%u) ʪ֝s35,vTpwK哥QT# JS`~f8Qf| Z$׶O׶sxW{ V{Iaa0zZ T{ϋ$W?=xu;80FPEi,C]>8ا]ODo }Z=ݴT 5<˯s$M~>(K`jkOդ'Fddx#ͿpxLoG {+S2CwCSnu:g2*q $ߦ!Y5cO)/psGYp˾ $JnKbePxQܸ:-Lb%G 6y| TX +:eYH$vwkLOkKg rZw5>-di4Pˋ; JTrś44U@. xk;&4n]0̧zfϳ;J8iKva`RG Wڹ g^ʙ[oKnjPmUc9^EǤqLYp_V'mIQ)uhg.gYt"caZE>"90ȣmjlđ;#Wx3g}a6rK^$m㒆8Oiyt~iMӏU=DV5Z 4Z$Mwe8/q; <`AZIAqj.k+ߋGo.rܘYj1$@5x2tzٌuiŝF; f֚b:hϋ#=KToMw&pI*H;Fo'm}yb_T{ǚb6=T-)2}7<J{VJZ08fe- }ÿO.ֿe$MɈ7':>1p7SN/O#('  ͮh>9,R: ǨRj<з6)Jv'fYJ4;ߢ;'8~QȍmX %:oSԈ 7 J-g~[YP:SKRQ\r\ڲE J23ZfxڟNc7{[~E A\/ ̈́ɋrש`^ NfV(ˉ،vM>zyqH n=\p7hf`$T=kˢ;.A )cQcLdTF eKO"gGjO^h،.#/KHK!tIh VyJ1|Ge\@ iuhlO0bHOl#Qɰw`6/qNU%Fe]iIO%`ō!ӥRoTipyS|'!ӟ㣴{IRxU * |Oȣ]סlϋ׹y(2KSNrGS"J ᘄv9ggOU(:r~yolKHPLi{V󢔎J6:oKv V47 Jz|#,Hv&3$؂d~ JN<9[82@J#>}K4B->NKT7Ԍ\QN _Xa!)XHEkJwzyOv~]c/?u%],]0},Pv5=!CϯsG,{pLiZGpF`py:oZ,`*R}P9kjTR[,ޅ9tNNڞk'J{a;HXHĞct/e2̕u -=iMt#UDLt%W_z0U/Ǻ}[ |.bqkO :NLj5JrNƀ "BvGR3{͞DX.d/%nL]>$}~([9f"O FhM{eYN;9}ٙ53IiUsUVN#Αz"(E)q.">/ECIA<{4l^7 TC#f9&Eo\kr1p>N< cR> #?*J"w}2ÎB}Ԯ lj:`G#b=+EM Bz>hkJsCcg@2ɟ =(bPъ -)fBsYl^ٮń"H1r=#<~KmSdd=pE{VRr+ jq~ol"!Ó4l˖ܶKCҽ_ [DkHc ]F@+[ V%Sc1;AKf7N7 @AAڣ& Px8ia-Y5TktR̮PTu/(ǩ;; [ķ# I/O^/YJBi\d|}ٱÈ[׼] *+nF S 0`*;Dw)IXTWmOF@{ O& 2a\8 JZӬm^Ix(s&3p`44ͦa`iy(z)v~ _Oc_ |G P O$%߯#,y{v׮XzzӮ%um8x{ex1 LmvY 2Fܟ_A$- |%o}͏9,uQ#hǫ) Kmi] -Oq-§!ZWm-kܕTHX4 >ױYzc3(ԏznTRT@!Pi - ´kv!AqXyi]/Ni_tN1Ra2L{}A)JϯV1Kt'F@]=1F'H͎\qZ0UExI#,b~(y7Si["8(P.vMci6"f$nu7GER3#WT F% G7Ạg z6 ;ygַ˄J$.jt5H_.,2[TD5޾KG"@|C3LS>t-b#m=QbOjm_ !w]Pv)miy"؊f6 "0˓p p$ӃQaqE&O 3f0ǖ[kI'>>ÆM8F.P]{ү,Ev%cxJӑ;}:7]ϔєocO@bC6w7zJq%[j̈́3ȝRԜޫ?z27*)\EkOSJzfVYB|g/Ou8XQv5X9.[Gڊ(rqMl;=F ekH6U ? F 2g৶cqռdpkG}ιէ!ZW$ h \H؋}Gڦxa ۘ Oo׀y@JPwvK9B22&) Vswĸ^s_>e;W#ֻf&W!fFD깝IUFXIrz}Q Bzڬ4;;or2CA谯0RKtџy@T5 BYtlt~Vr$yN[z$rx=f4yzh#r~ީ=͓4PPy|W:fVǰ tʙ^pbO_9v`QȏҪi_l.L&Zl+faM?{UL>"NuDNAat=놺Vb6s7PHYej ŻTӽ3uWS4ȿɻ~= :@ՙʁ;*|d_$\z_bY#ƹf=8i &9M)x-5kwndhp@cRu^M8G2Di\F~CdF⸎+ؓkwOST0O4s&uŠv[8izIPbJs?>kfY\~D{u- =xk Ff6?mi>2<1]x)!S6 /Tߩ1Z]:,a "z'ާ)<>ez6se!R{߳riP7xNJZo\&-偑ka4JZ!3Vd6r=2mtN(9Kt`fŹ;iz2lQ&T(-$`7:9wrx|qՓQgӦ$"*zfdmo4Y|@xMPe邖H'bw.ŭ(PDɺT}jNOӚݣ2rv19e"#~ԫYxpLVLqQ֙YNqd6[ٸtlu:giYHl.">k+grMFpd81E4ӇOD:s ^rB}Udcyӗ. t a?gʢx:&DDPw"Tb79R8ةa{Nvdq|s8贫yQJ?,Cm.qWѭK:neq8i'!`w3W3(y9;/g _LSNcl΢:LS4G[ O\i0 |3rG["*{ L҃8s>?Z"~ƖKqtURr&<^@߾b hsȃ<*|Jꭢ۟kskr`HUy߽'yq-?iM@Z?,3K鿓`Lc{]0w V=MOy<{]GR1[Hh0E u|3[(اYgHY:\]6<+æIPssUU&vCZ ߕ EmڵaU/e-,IXvyStrKg=!6QUOvTN>wq1jgϽ,wQ^=rtu5?94vF<11ݿQr7 [O9}˱>29*UW֯eIMTY#`Ssg) wyqc;f6OOq8?|$jk_=Tt6+ۥn֑K_0Y PoS)$7yS-cq1`DhU텲ɘlwq2jjqӈbD̝܈bq^Wz2WkMc?|}[A!ɢS58c&SuT64{eq#a(qh'!gn/ ƿ\FE2tpeۅjlpÑ*<ɖsm]VT҂ (/utxB͞[Pc|ݪZx.&-Ţw}G{3HflgOX|ylLs㯊 O2HQBnY\}D;L˲2e02.t-Nk\DvpӾ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Bc GFဲ5 lm ?ZFcL ib}/ rͼ 1ߑ[ĭ=܁NM뒍&_%{5HI;WxJ\Wc. {=)?xni=EÇ-L>:{Zl|އdV|]9c +0!M\cOȌ|;QVWͧ,C,OT@rG1aZep;.`4 1ܜ=o]7ogDRlqdL\{xdgG,w'wRè8@ _)a Jኁ2}8I>6B142} Aۓ;^h>8"K #!< iYͰ;aTl[ (F$9oibL.Z1bCP8#Ϫ82 OrQg竝<mSrs- #=l1GyIA{0Kr^jۑٍ<^?>Iӓ[-za:o5:h*3d8~ǵ>MT@^-IM> 숪ԥim0Ži rWiVHn S2hv@R%0E 0GxЖyns%OZXc#Spf$Xٺo nnJfeܱ qj)^5N†Ds|NPwj|m`G-^#-:/iO'^ 4X֧uǾU*7ˡiȈޛ{I, ܱ+Iܩ*:e2҃rh.EkFfNω]Xt/jk 2HIzff=8Ǐܺؖ@l ݉dӠ]ۺc\2szkKƓbFp27<:@z0՘ǓG/A|Droeku&rfNVA;8 /1)L#M׀yTmgbWgzͺ_ݑ![$j}O{{Nՙb;u?pv]A b12ZZ\ˢkݝNM!hBTUOqL[T ;i"D߹Wd'N?25^&ƴ34|j}ɨǼ@=}zb(4vGPfe**)f^L";:_G;܌b^ :Os0ԞnL}Br1svoDo]ieQ#^|=4H @''/f FMG}};~ ?Jq"ߤ8OO <+=5ăgb굚X8! 5b;;>=BD? =QÎyhʰ:x `8 ٿl~h'RxC|3שkLzw= yO|pԥKژ_Ʒ DS;/DwtS(|~W rKFE +]i|&񝺕STmt1UnMNj_uw׷=.k/-͡]^Ε ۱ub|vgk[U49Sp:fߟk2qpzzJF 5={xq{YE&aο) tn|;= ys<Qw#(S)痌bߢsM.g3QJfFvџ+"[̹HqL[xV5刦 O9\JưOQ ;SGS<5W^q줵0 0O|~xFڶ<>Oi'&f#z61 'A2Ʀ<۞ˎm.6.ؔh<6n|;DNNB!2o2]$MBIr-q扌φfK@2KoO.Y E;Po0k]f{eM"l.p:N=ɨ4b^d)UfD.91'tgoꊻ?2KS?~a4XmI}|NO{"0}໩Ͼ]&(ń`dӂ^.Ox.O>(DqyZBW$҃ GlNx >]&NJͨ4`kOkw0z_P7USXқOHX"̑W jndŻbGm Jݯ_|okpI,;jksgGU$Sj`~?2JhὗՙFKx٭v$2D_?[G {Pͧ?hu?\2 5!xO;! tݕ\XD#=E&>fisiFbj.%6 jpN}vGcT]yȎ)qvv8ɃR:ZWd^ FK{MW#:mm}r/gvG>Ȝq7AǿT۩l݅ ?cQYo^ZH;m59nŌ#̻N,wתTh9nD"N{im"̒121>k.L$Gz{*D5d}/$\#oz$6#1W{&Ģw_UkUt f@/=.ڞ< g*MmX<5Xrr] f"EC=5lOr' 0 qW3/zXEާh4-U@~`$I_=j 9Ndtdȏ;UbND ͎-(ۜd6;Ѩ7%Bz!ݱ-W *Hn8Lէyszi{{zxDD]Xj8ݎgf _I6s4bdFh'~"/9-ryk;29ݴ78Go2:$q֎qIq u9=#/L,quߥ1Ԟmy8 >8?gs tq 7;mj?Ysm=MG/ 5O|à\jL=}5*$ާ'@_8MMVxӑw̐E4 }Aרu90ڄ@[o@?_/̗VZ _/;4Hv=bjY{ 41"v{I%<͓O .#;}D(.~h5N0橁_'CF>ˈ^d{S_>C @hNI9e̺O81M_Up2N](.}E]Gn̟} LS˜*.,5yz^`ӈҖF メ/䋷FO"<S1amOS}{Q$+ǂ9~P8&?5M "C]]Ի>$f}#xQXP8r->t+SXܟoB\zGmoăSf}Z aP6os.tV+cO0Jc_3A&Oof?2[ejzYHsvC]n`[XNs?fGz~f~q w'Ї\ğ'OQ#u\w]/hͳo'_ň 憷3TvTʟ's]Ե{CmFq#HyT"_5s+gDu.}ɚ GnsLHgDq%9QTdgMb|#jE{akRCE5Z1z>|d8KHc>$E>Q]D0OTpH'l .EON1tھٖYYAץ51 זhm4AbxMz{?de+=ˤ!W̞Ͱ= !z(LWu?wOzZqyW2؟h˔FM}U|NmvIȠ-߾t#rS̈́w[pSu'sG;;jqT: \iIw˚(N4#v';71$4$9-}ˡMs)߹̌dSx*)pϗ0K`ңHc`z_%ӑ!nWX^I2*zç|CcyE>׈8juwO2QAN29̮ھ?$G_8{Qr/}`%ʵq)Gz#?m6w: QɂjIL ω~s*d3+8ᅷgFb5%.48㓸Ȼ$s iRE3^}o@t7dG˾o|K姙 KtXO ,RYe\IR37:bA $[l:aWE;=2'1a;; Ak9eYb at O\t<lL-lb\ rMZ]N|2Әl]O,t͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*3Ѥc.Id,7ocÙs`XĝOqXrwodD ;a D}ÂQL"ڢMҙ?`8~7[o}':uO3ZȆU_ZmቲyϪ|kM#n&,2#SCZWr)!6Y(k7?}ˮWy?\󕝣9 z]rQ 7 ǔd4NgQNQ"c/>;Zl'*^=2?l0hfd&尨#w_mM9Z.Ξ6[."ٻe@Qt܄}Z+ pFӷӁo\UCs^ݝƵ M⌨mf;&2)qk*:m[o˥!AǐjFqSJ<)pak?|2Cr=2od"iTި7YbpY ٳs~9 (ʛfQtz04⺏һ}6<1\Glx:NxRɸu4'R=p5W W|8+8 '8Ҵ̽>2GWC!9eڹvr̈́ŸtRG׹"4%WECQ[=AgĹ'(u]K ^0]f ʯ8ͨ R@l`lѧH)ę;S&׬#`fj .Sl6󫚭i4{ww}At>pm?WXmU* | .A5Ԋϐ}+l,+QQ' Hϒ^M>g ?$4)Xԍ9Gqan$ BSldE+@Rrg·hL >(JWeK,{=%"wCŠ"^u}ؼ2K Ny&V ce/ m@R9( D]:5.化# Z^,`CAܲp#-Ĺ5fErW0r> S`iP8`l1T'Qe'6Hcʵ#2tFFcegXj? Ln*I\VWcL(o.'L"K,% HO0 j`6?Y"HmeyP146Zul`eC5E?yn|-2'J[rt0`3'ɞ ޠ;oNYee$ɣC- un$龭fW7ʱDMqI߉(rz9,ʓc=M|K fZ#'##j_lr$% r/XKgzvh}8 8NJJ7+Te恔h+޸!$ A=cNKqp3=ªi\V;f2*\q2fGXPW|Ev\`4h+ܰN.$Ya IxPo]xGӘp.lG,Ur/?`OͰi $/0<4ݛ8-\`dR!qֹ괰6U17" ۗ%:oQ`HUsc%M~*S5p?'N_ ,'pg$#oTq]ʊ@kN~;p.bݾ`֕s]NB]DÐ,708: iY1N_Q̘iׇQ*8x`|OLD뙡f5fEpqqce92r/\.= Y#M,~ʎN8mPk8Kv̉zy_ϪL%5/fDuq{R⸌{` pog+n7A&x! x9 XM \g쨝rC48}m`ƙ[L/`v6voVMJq^ /R2I]zdbER;a&$^/2]OF9D옼1ekT0#p{MpW ńR8*BP`9Bp0-あ j)LazPۅ͈m#)8si3Ϙ;~qC(hS}8߃C29*s ^)1[/# 1%4K0m꣉Ŗ#&8/=X0|i,\ c'LNn͘pXur$d-\,\|N8|08qni @ ep8z1-_lL%Jo >8p tz Q`#` mE.)JFHf,m`׉QOFAiP9&8]%SkJx":S2eOEl0=Zc#$kEjtqZlJq덖ߓ$4LZ >Lm.]5D(O3c*{LJzw8L[u̹X't2\@W da`v N2o gǖٔ0\<.V%>Q1gجڙ=7lQ<`lvqR xF\DSiFܜ?5T{襊\F6 0ʫeXn'37gwU~<;Ƀ2ҽ3kbػ"!f5?6z14rbmh Fb̻\ñ02V 63F VkBثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*^9QJk~h0E2FLZQ=4|'/M5 ]CKw}9Ԗ2TG3$uZLXu=׬W{hd=8\d:l3vh.|͞1dc+ ĕ@ej 4e)z>˖NWYw/GfÎQOu_+Z)c@,JS#%IfíI,mo_2F2aQA09Q6,].],4;Dp[fwCNءeQ \[fȂZihFM5B |"gSScpH C04VxvcKU)s/q׳502h{5`8֛xRV˷CG•ve0?ŽDϾX|5##P2Wn;Cc3U}4}g&0u%JY7\bHΟrՌ>+!C!ϢӶlr1 ]cc-(+l#Oxf$2ǎ}={q莒^A#4IO?n[mdu#)w|^1*L.Ѣ>sq9x<"j3~Iz#i]7|9VBDDrt ⌕?WڵȹW Iry2A#n 0f1/#iU>ɥ21kŚQ;oˋ6vXU&*0sgkvT+V}N3{ǛL*(1.Yd" ~kHY[KjYJS#&in526NVxYF9ve2@ ]+Za?g]pqG;G\˹p)BՁ W3s:Ju8aX 7kҌC|UR`$hFX q? :a_k|&JVy)@iMjr9 G'.3 { +E*x8D<bt%˷qɔ4ErĜj J}䆔ҕǧ) $s29du|CEQQWQ)t&s6sh&%Bw,_KsGoCRO!wyΩ!0'vP uNKfoԜٌi\R?@jʅY[|(<`+\Ð1W7`y1ˇ؏7K,l.Ǡv!R&YĞINLI.9O`\F 9xJG[ 2>x#[吩:hNqMҵHUJZ$98E8$xZq[Nu^ӹ^\$%7#b:B*i54FTy)G;ZZzU&2WU2˄a͞9<5NaHC,t! CHSl:k8{Uv\pvȝLb,jcYvzX^ƀ[*3&XݣO Z2]eiTJM]r -\-zS.أ$lPc픷eGMRPεRǡgz3WPK8*9\PW0:x(r* ͹#2C3sP9ZgDJdi%(&N..q1Q 9`Ve= 3p&f"hņ@Ij8ibn`T(UzpnA<&$$| l؏ :4ZVsQ3irJ$.,N J1su @ vuRD$Ew`k8rJQ<G0ru/p, |Hs.V3T_Y 68% \zrv|Nax$tq9jq[e5Y} baeY7Lj/|ɶDҭ))_|FJR3wrreuΕy{ Nr@7.N,rĞ|- lw̝>H\>L4V>8d|,g"Aif퉧&?UѻWsV#q͞j5s+4]۱ׂrCf/c!ᮍq?l"V<mzPrT\YoJokOL|/`yڧ+z8 D׈4ch*V"q%gAwc?es#jc/׿r0qg y92zc4mǔLբY+V 5b93J3LJ(Shs%1Qf6ptLCoҙL[-ŽaZ1ɺ!a{(.^&/F` r6EVlbHH3b3 &C&}q TQwܶur%e,C!Ӕx8wȓ4LW@䰈lu-lqX"veȸ7Dii v~r#{brb2^wLprgg@|`'LFV)+quwc#vDߚꑎr;8vr1N_6ߋ&N$sr'abrˆx:; K,;rYS<5@5ʌ$7jd@_:LZcQؕcT5 ;1س:޹C#"N1 A!RrJRhh&i+֙#DDTi`o!u=pcg!#ax&WuTҹ< <&6IiWlJ1/dpo1Gm.+2z\W|PLrq76ۜ#?Tִ28Z0p 9$*: .(]V T`h(6K]!@p^ktdH; '{P`ji:UBs \ђ!J E^R ˚j홚^.*<;lK.b oMd:[V7 55/Oݼ 0ϫPs}:8--pe ]3rȦЌÙeA@dlLFI=X\#w}|ya?C{wTU}2AdrПxpםLODTo;!\$UCLώT=vI$}$l}f_@TSzeج; f#'79sx㯛R鲍˲$ij0lghI;8.ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*hAīGpsV@f&͑,^}7F ;ˢ_Rh%ǔz5(QcoI'2R>!ڒDH ~f:J$fX@{~<1_D>RRydւv6m(;Eqr~ֺo.VG?TLW\4;~nOlt:{`jA:(e{QlF;{Z o07-,aJmy atf]I"}14R&f k05iADwuCZaba+i }N>8#]64ܲbM!58O_41A{Mp> 42zyqʚ0ARGڭyj$.9iu_ܓ+zw3XӑRX/Ɏ{/3Br?Rي?6)˱x[Gyw&K7ukEU$Q21|ڜe9 Uq8&ٷ |R8\c,AEW߾N݆<"ؼim1vx vD]v1(_/ާ-҈8$MK,]2l-AYrs/6؃Mɧ2 f9tc];>'+Px0©Ĕ<9:(Ie0v_'nDƙ(8/pwE kLP-ď.cw¹N Ca?JM:9e[.23q,: Օ:juN>~jĶ4r.y x4u.mv$u* Ze҈ܹ(Y 1XIZ GhJUuu2 잗H 7u1 s6qNd`u:e:n\_ "<\j~U8.=2z|$\=|oӇ4z C.c(**Mt nss%Tխ:[UsVq"֣ f(?<;aD)8DBG\<>q#F#;K~RfJZx`ͼx{gG곺`@Zji&G*[jT ŀE1Ҍ|)S,c(HrÇ'98K@5ӌۗ'L ɑ w9D8;\QZYp[nɱ hyh͓;;hhNGT<8q1X+혘 τ  n].EzNE 01Aιvǧp]0d%` 0oq&H-FcJxikx4oeڍ3bjfVe|>(n\c 1=[pM"2t:ͰÀaraP3#N|aSaQ9Nً٭ɺaq?ݝ~J/f.c_)O\̏_G+C>贑2Tgt1 nA)0D[F.QȊe-LnNJ:bGa'ߩks6? Z5gux H*C>kgoIWV$U$T`O˳\@q6"; CSښ\W'p,SuBin|TR8YJ8[m~ْq^L1 rcg=V*NC#Dޜ:1:ar1i{%oc>-մc\U'wWE~ s#x 1pr<ݱ s6PK}[u޾80Nxl;W|Q)I :1&D1c54c;0~P%ܰ?[r2ozia#3;&R0{JR<29#ƋTawtR|ŎͿvM0tsk tD94^2& Z=%xD-F7xr+;vugC/Pr@̱8gwѱ!=.jƧrr6j4l*\)P*z 1 V<8o6Q ϭ}>ayZl!#}ȊWa 0ϔ¨l*>|'|u$bzF+UrG q G4Niz4i `}E.Ж3`Ofq2єv\ѡkG*mMJ:ÓCcNHDƈqtۂʳO],)GV T6 z"AwvDU@JLDˏ7Fvz2 i*s8#Å!T PwQ~!C@m-1G#wj=s7q>lzeV|-VVݡr#b. Gf/ F])*UU"ۗAV_G٣ĝԁY *V̧S5rdoo|pi6FLՑ)ۑfq=S.g&>8BLɄmhrS$~ ;b^G q%܆Q_JgɧJ8A#1[~kxa]*ZeQNO27K&̪E#C]ٓ A/HO/IHo2g$@ssFj6u# KŚ x*;suyGx+S(FFb2) ͦ>1Vb3`),rDbԀ)'waJdi' .<hR. ErNQ<>h[ ƞ/Z>\qթ5BC}`HF\"(J lu|l35˥=~bQ|9.n>Tф{QC߉' (NɄ8Xv񈮖 =ߗJ{b|hwmPԈ3P(qܽ6aİH,d .c3_ 6:lFٖS"2 rYHT-qvdP-\J~zS8szKԊ+#AP5bG näDPS%Jd#s|3.J zJOɈ yCpWn2qK .4m_6BT;(E= PHpnwNYE=W<~ѯM.a 3/3ABͭ1[ex5[Eʼwo>(w0qpse3h W#Kv~ m#m#Ez)eG~<. 障Hl\*gqŠqCeq*8 Y< a ao܈IHd 'Jj27 ;R[0;2YAPICm̑ (*1ᝬB(CC&an? q{ԐQAm[58TLniC!V[$&#ň\r4G0uzHUጌ8Cg']q=\FP}+Q}v (Q#1lqby= e ,|qr>*z07\`W᯾. h>&MbJmNK9`Eq}'#, GWNJTƩO'pޣ18Ei{p8qĚXn9Ɔ*፝ ).#3A<L 2BVdݰq'/4!%AdxLZf6qU7c0KҘ&g>ّ&LWHalw6QDs }UڽlǸʦxpO6~^*4ۦSnYxz( [01 E qң7Á&2W~v+r$RJkbO^:9ڽˉzE |A[#2ɑ#jQs摐I() pQ3;)ǏsH9#ͣ7B1P~#b z)Q hf#ln=rqtƂۈB7AJ?8x7R7oKvf61<>sc$L+nW(ůb٧ iK6,&u̩|A[Ac3> A|@$SlRW~ZLDmӝYpٕ@13O@ (imwl\Jl֟KKڸ^Uĸ$S%,Ĉ>JIn2.us)qXK "GK-0z`;Po#J7.ѐaߛU~ #I#¾0RwŤ@q F$'C×Jb1N`}9X%#Sb f. |0eu Lv%i@k'=<0ycfe7+gdE bnﺭrȃզ1.l)؊2a͎y&ẜaLǜ9w9P#&A+ɋ4G聽17yzxddUAܟMA<1Z3Q/'LcFhէR7]05v2kHpr ᇡi |;&21Xnj Ǎpl%B{>(̋h8w4S%r$@da9 z|#1p _Ng9%Hq2[W)ᓁ h8 JޚȉhA:b輇>aj*@~pDP1H>It4\|>ٟ9"[!ZW+87ndFY?j!1i m²x44sQC.pf &nDʥ{đtϒ{bEq9KC\XĺYH+U# 8O,׋/5u p4y|>^)_7(5]$à9=4j5شfO-ßG9')p"F>D\ƀϚj[xP/,<[۱@ )/320̎A(V.cVO~qZT̬xDz9^(,pɆdXHWUr PEqH#c6|>,ڒn$n }d,/ܗ]1pQ-2H} 鉩j0q48I vƑr!6y sTgHLԉN&Q]gF8ӌ5솧.&"̉Ntn ՜T=Meq!p~T(I#xhC#ܭ21޸JLӗ*x׮\2Ca/eVn:^g &5NۗPiv>H=O1FXZac%Dqu W&CBՍOэi4dF8&J>hwi#4eֻqrE@RC-FUQۚs%?<C.3IGj[U';K%n2jLEߌ LjWE*(v 1&.>SٕܿǶT `oUTlfV8&[27G<ޤ.\fv#.NDX@m ITte2;vrydLӃÐM)3X'}}F2E|SI2QO4N&q#$\0(F$ X?YvU#}^20[70~Ls 4LEuؽex% d6|w$un@N$e?TVEk%.(U"+$bpӥ%0K>9Rثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث׿k{%4P3 r ]m9O"A^2ã|b3C3J3ү 2Ff(vZr$=fhsN&_څ1WoRw_vbd'2H{u#g!xƩ2p6`x~"Aq cf`kUlH1K\-q$, Z^"Гp={`MOq :ǀgBCj1h1v9A\BCg|{2߹ώ$]H\-1?vtZρs:` -|2[Lb.Phs 1 CG%HbleWcm;"$65Oݛ]&COUkm(Zxx|Q;v3ҏO ˹\\Kq fG rc m^jNT5j9E \ܝ>g諷[(pVtPW[j3Z+E,_cxKɌa+Nc u^w9bYrXn:q!^5.慓29Ҥq$Æ:okqҍ'fdz#GnâE]%E|`F=XiY8}빉$*[r'^n DoM̩?]~tR5 S.Y}EMψ94d~f1¢§RO$VZr`s"}>7iOR5Rhzbf~KX]NF|%`;dwBT 4g3v:G؜NhN[lO&siD%yǰSW"=];:9$젴`z[xӇVO#Rp{{&}4c2-rݞr怀͎q~"= .zx`yw9~ݏc%H8"Y+sS<1/k 3P[!ByaS`̭N8 87ޗtGy?i'}48.\{xv|$saٱͱ%L]i$"s0_T|qwuZ̫SpKd)ɡїX%K"9pc@nˣpn5)(^۔qh 3:>?YC 4bA_Y/1` H%o9T;/}v~xpyʂ?QBBr:\ʢR9$yu( D*:+ 1UprȎ#~$!^Rя&nDŽt1U$ewkVDs7güN̆nd@%'繿'Zk3eAny'Y #<RKD=ebOքt4ps#TQ&{ k)5-;] "4N ln+%7*5 7#XN={??gp;;GE*OoS?gM;*UWcIuj?q.}GNV.̈́qݝY_6vg$*4G38vd2Msg*1)A~ za݌-2`EaCC [;GQfM$aJoDy~_M_23GdGF>ʀ?SH(2Oݔ\X 9"~]Aܜ1FzQspJ,;pܟΎ3]tr9n:̭*9on..s5݉AK*c"ziDZ~դRzSĀ=<=r\Yw2?gnhB Jv'P}.ğ ~I"X*kv)Z7ݕ\f^q(}ge@ܣ4*R5Ep<3]egVfu?~[> C햏g'!:|C YިO_锶&8z+Dܨ0M8lkrC0id)J~ V=C}n^~7fwdp+-n*l;;?bFwgsS5Aehġߨϳɤe̬!P}ٗA,}DDJޝ)љ ߶c;;~i4I=TOLsZW V CCqq:9;.ع[稩(WcZ̜f<η.-I~PS*K"PlݻeRs8$ piAW}(v:~'e 9 7%dJo=m0'üX*WT^407՚Sjo ?cٽ fcD/qWYQ @ZxOy5= V~P?k7F)7ݏ|;j'w[-$VtLs}#0l4a8;cHPχy(p$aN''üqS$xcBɍ;? eS :}"2QO uc1;5bҸ6f@I >0_*vTSe~`N'=-8; ?SWS67@7c|voGeV~Ԧn @bڄSӾ!t0,aL`s?gP6U(jkEP?of>ρ<ڝ >MpT0E 塄cunʁ ?RuErw86ۚO_cyw$d$o JRMs4@OU +C hX'>&,ȏd8$^RiOSdi!!q2Ƌwp:XZپǞsA+%T2sM<d|vl^ 5kZvjvfGES ?gVԻذ- f6M;'Yٰ9 c՚ODi13; v|x8-&:}·yA=TSm?AD40~vNԦ^4Uropi 2sv2ug\SL&5*˂"|ܜ痗VS^ُUo7^ǩ"EwS8})5b4P F;H=#w8,nTmZ1F]]yG$ $(Vh5jʲh`:qqJBu/%tg: x`y4eZԚ3/{htH1zl"FyK#GF\ob%-݀̇#w,FŶ0MP3#&sGw9rC~8Ў(ɔp&^WJw0ζPFwL3WЏҿ+I<&2;Zɼ8xѾ.|U oI9F[{Zث$ƻ`IfzWjGK9om7En @w;(mpj'EcmA9͌[&w3G^&=P(1uo ?wN?dόڌcAdxz`^|8j3/Eqs>͖H7"OccU=@+(>ov?Я#"358ݣfFh2FH,"GŘb1fhSfv6"]u9<:rkj*Au TgL'Lge~[(~d?*d3L'QB 7y9t?gncOejxa) Δ 7"YS.F~/u'} $;0O;:3'b}F\?>=du}PEb .ECxS?ga( Bj >*fVi1b2?[l )ޢ;`{`D+e3KmZ5 o "ı>م`#7G(GQ$7-XD3EP?ew6m,1A䫨,_ ;wq?Z{:~ H=$Oio//m Sn_(m?crȠMacN2GlCw BKIB o!].L= t?cn(HOSJ02 =LjG! (VcV0WQȲb[eYF&E֝1[CUe E٢Rӭ{LeYj,w+.e y^b8-f lXS9ԎA6:6MV%DC!ARM1ݱ H?cn_֥ovPza3[ ;^].6Lq@/v=p4>VBI?eǵ"z{>ZRL7ܭ=(.fM &3lÂl1=p\^Spi#&ڿ0QBٟdw&vJ 7LLgiY[qlƞIh 7. #>4#[Y2G;wG2rN. = G'bP|:MRтՀ*s):W?aWmhP+rXWK] i2ܺS:4`|'TS&1G!""σS Dhҳx0'hpZx`1{䆶'eҜW}i{oeI֛5 C!26ʵ*|0-ǪiAGX#йpқw![_AJz{f\{N=d$A~#S*t_Tu'64:' $ǪԎvneK܆7Z=-d]?svrUu]/'z~Ϊݼ=Yb Q0ۋ31e^#Z ny. 2o_ 7Mwjqh3@:W&z<MF* rz|^k%@Ok>?2GhDt.XK^D''JVD2ˡg",6L.=BYݖ~g6kIE / @%8pJݯ4nvJDnkDzL:ܞҝF>;_'˓la.0dn8p˨r8/@0At2.v4 CRA-azj?~l)OOSJu2Qk'M Si2k]RA-`˭^^VX1)PEè"=1%0NZ9,c8+>)Pƌ _|rO$v|%ofB= K1:gW)$eԊrh+<: ˱tpHNE,B ou. qɭ"`lRAV1ɥIK~8.FrFE8ɤHO_ u"i;O8i2//.cWZ+1lMi `..MMY*b)SJu t4VV,Ū+0ffz 1@[ٽ.̬ZJn/Mjj)O>9}gRmCi!Y`ynu8Ԛo]džNNnUI4otidpCp"ߨK4ɯBX ̼zág8 pdk]y\Cg 8l)5o3&L! U# K9еC(u GRA-`=.Dd,< O+ᒆ fe4$t!Gg `2 S`hʵI> f2~0ٚ h 2 wN$lNaR$^b`EY5+ԓ-Dւ= ^A-nO${p$Y4{6e S+4j{&s#FrXRs$EB5'̹`Cݵ&7ZS- ڙVvݍw78xt3q,ڇע:9bN&yx{fVT3tl˖ 7ҷv[ȬyxSڲW|ti C!#GYQ,^ B ]3%PS'r˔L[}VG%xe@n8 Rq.3[Uȇf$bs:Nɞ >7IwK- V$.XFskӼңd+]i-0`*3?2iS X$$d@kʁ@~8'$'c8{7@4imgvR jq`ȫybt;.nuxkP{6L"3x^~my5H=W˶b 'Tģ R*]lť-U@h7@ٞHs W"5Q32V?K1;hRAO$f0#fzGI of3Ձ^B@erRNT jչL8blY&Y2-+;VV{r[鐎ΣQyqDwW@@7$n[]x$G~[m6 '_'NdBK:E~W3Q11ғGۘeb| {f~e#0 8tWmV3[ &N*"zdw&jң1c<[j<)`⻌:OP,FP*񅸾(%[N{Kr{ZT45(YK.A0GFDKpW֗"!|ݟD{xFiCz^-Fibl9n]whΣ09m#R:c}`\x8ׯN2qWJu<5_?:P$pԯjTmf4[\=\貳֌p8Q]dsOqc&{S2a,/w3o) *KCn.6=11"'%X Ir iA3?殞_ vvoV5= ^]aN]7mB)Du|p%Ɯ8,sҹqst| %]#eB5촇-m$^Ns=XlC g`Gw4ɵ1 4mh!X^dܑ@3oՈB6ÜrH:oevMQKXbԐOP>} &8J@N>}n-GB3O Qhv"޿BkCPkz\뛼ߟcHp"j̧] qAveZ`PyɩfUG|]$ݛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث?s(AcoU9F]nR}A|$3r?r|a-F1wZA@4,]l(ˎpH Mn7 Syqs wٙj>}ٱT纚sC9ݓZ@qeO@᎟ XLhIڹτ6 &- ~ 1FE5 UslOjF3 `Hԝ ieqS3TGvXEJYMyeS|53h[XYX)"eԱ\4ݱ2u<5$di)%I̡P*v{C4qP$RT\>`KWjud<>Tߞ B?3DA)S+so}Ó.((qo]{zs?K}C$OU^-9nlڊ<.r2HLn)%P3FCQf}XHZ(nab,k$ - +$OsrnK3u#082Qť!$S)TpOM3ƺ170gE%Ů*_w f8l[`) 0埨-:@JqVR@Èc)UΗofM&xQyWj|Q ; l)U&a41M*7 CWg=<,0mq15(?Yuyx4@?fg>piP`ޡoѿݘ%Y*T v<'pLf%0]^t?`#MtBx ĉn&J'a&DDv̱HYezo"ɹ1SsұGG+!4/F={4JG F,0߬r]N/G0-Z+Z4 k1b(k4Քҵ%@L^R)z60~pR:+UڴaS{֜ija\T 9.&:`hd-^ftD\,M)JԘԗdʍ EGcyvb=acvWvc)mahi9A(!'. yy[!Nr[]=HW=p>NLHg9Hs F4DQ}'ߗYyğcnۇtDzDTl|m,'xhsvn%Iv#JVr;÷6s^<5$Ɓh;diJed<\kpv[Ko,^Rn)2TDPb򝇧QX&R\!|? /nKRcU!V'zW+ĸ߭C+ޘQrHתޓW!*(Q<⦇ OKo.\2e((4邁hN&t9!%dyu*zc K~1M !ݍD+/Nإr$ZEںTf:O3Nve saQ16Y%2<+ 6n1f=zavMKvE=M@`٫0EewbiDV}DȘ j;.F ~0TBz+g42gvQ(b~\Afl(rZ ևgeզP WUS q_HT~4F]Ө%Ҷ g*R*Ѓrın Frc)Yl]|xצ@cW.lx^5n|9$W\GPS*;1Wc1`b("43D/@G\1kt5'Tpx0d(AM c8W& WpJ8NhS1tsJR?}׵rawaes" "x+rjb@p#;}+C^'`y2mN8J o#}%< 'oʢ==q_'$,s27X.)BDfQ0ũǗhTttZ!˾X1i-K~|GSOF!hEW%m=٠c1Tc#+8$9d5Ğ[Èmn6'^lӾ 5 T'o\{ҹ4 Dal6z:嬫P`ofQ wUq"qAOqo] gjHX,.a7^Xۯ\,W̜!Yê4AoqyQl;<&Z5)2:s"[EOG*ۨ%)jt|"d[I⏦Gow"سޤt eD}JHkL h[Օ_䣆s<4ݪ 6?fLrwtr4O~}ǶUc79mJHþ0/myh|uXZ|v̡ Ps:J@@}*@8o7. '{PD΁ ȅp1^ .;E+|)0W0{3xxy7B1[d-(q&1W`u. #aa.vP'd9'wood`"l^Be:Il o#zNQBa8]]gmtduDjmg{gpqR2kb;Ń*Sk2(0f܏x>DŽy~L :i L9F/g0wK!y =l-C=>2:ǁKTa!Y9qJB]kbڛsPͷevl'9I7W[W˴@\^}̇L~SȜJP8 ON'MEF[;tg6idĔ}& P=c-u:ў^"{w&Zw- %6Ms,T0RmF2/MyiM{\ΌdӬ?,zjJQ+r^={}-x^!K\nt77dCġU^w}LhQoi9G<ށ\/58un.TsN)U-/΍@~wъ\Q7žWz!':6Mc"9XY/֎.ڏh.'uN"84ʵ;2f5Ta}:n7| lJV'х_aԧ6WR*j(;|99a#Y3Sts˗׿,+4JMtF48"ɍn$L*)w? h!><:'4o] ڂۋKm~ԨK?ʟ0 >ҿ/UͶo|p T#SN_q _h5/ʍK\ژ<ûnY,$?#Bޛ8WXז"K?ܗdK球7.wk5EsS?z8' [},Ьs73yn|9SHi]˚7qʿ0^)[m(iUr]MB0ɘؽ?F6}:fSAþK'?I lv;3K(dl1n9&D/kj2Hh77qזS(_=߉|?ꛝ[ Lv@,2r_6^Ur/;>Q$SgW*蜏ɭqwт,|tJImvYa']'"+Z?6cƀW3OG}IbkC%APwY|O[ v| wz*I5y5zl-K]$Y /{?!77Mv}~K G4` ىMȨ4/e~h5q"?vQF]7THhyъi4o̽eKZy˾jìXw Zo?0r̗L-fم<88^ҞRAmF2r/}鵶Ǔo_A=AdD·#rex$ /{]MFXyON;m(UsI hH<89ZlO5I$tU47q\yǮ7VKRnyppvm%e'" ?ˏ2zWIfo42ǚ2jOZ~Lw{\yWIdoC!Nu}U&vnF ?!]'o1Ǜ19&vqwєb m*{\Lo?(oCiy˙>{RIqx+]?Rsv1\_@ gySuY3Nڻr~Wirlgp|s=DBE:qU't&\ypsXǵ .?,4 ֹ'cI9oHiW=2493Xn~L-ZibY(I9|mz~kW% 7VߕZX'?I4a}i\Fe)ːD[w-ÜΉ~Xi~8ϟT|c[g_Nq+E'KЪ@?FB r$d?ꛕx^jDߕd;?t;38L cm,69sLl-t)929)ѿ}2z^)Ɣ^3W fo9͆g.=[SjŜ0Zi&>vc{?߶ziUqj=|X4gxHOm62*Q'cG㿘w_ks:V˨߾Xꓟ'TnkN,ZoMe|z\6S/.uF!E +@);#.?^ŏQҵ?(?OY3S?UYs,MVC]'ѕ+Ͼ?( q?h6uoTI}{$1I?ߘ?V@33{3&tv[_[Y~,6k$^I]+W7_SvfF2֢9O/O~Em'?S9;+6?0 8w'Fi},AfJo\B_:Or?],.z$_&F!lqas1yg ieŸ˂b~`V"n3{OYDzt?2].?-/5'Ӂa@Izo ,Y'.6?ݗ9 厘Q5OO~70%/ d;em,I0xUY:280M'@5pY߲nrM1Yao@kvO/3'@7_Sνc.6?9ͩa0'ӂ~?]'xue8Yϲd/TS,ԎkO(1syD]N[Y'66?vO=Wi?ÀM'䝷sO,zp.pKSqZ8%$t>A,M9~b5t/n?S-}~66?GֿJWug;^4?6S]'@4oX=6o\We$ M?]ߘh6FG6sI\by=ߤ&sS5\RO#@G.),$qxohha#-؏Ȗ-f,L+Jk\oF'kw19d{&|?cN.CD\M^.7uSġ{Sݓh[Eh&r;TsT䉃K1z2.C?7_S]˟6?;> Hm_T~\i MpAvO*~E"t/ vfȿ&X̧7EP0bN%7WKs]+@M׏eQy9,eϷ7hgt]~Oi`рm_V4xn%}ecnOdcFs؂Fzz&lR{]?5~G >^S囻#J]AXF'h#52Ew~Mq) $‡_7#_d 6Xꓴ$aB ajɖrZC$hjOMG2M=c";Xә*)I4⶿h#Hwe9wg5vF<ځ]q::Hē}S1jvߖbWֹܟO+ESwe9fmARD+'54cOuI4c~AOn1g, ڋX$UTU>Z_I4ca)xwysTE 2$ʬפ?I4aLHM'SgeRuzmu&Hh>%֝Y3O?)PH)o?Q{>I=4t='/#X5pV.5?x #?Ef3QI2x|4$YXYܵK(g1`SHzwe9j}] Rq9~Ɲ0Mp^LJ1?%D#܈7ӟg9/=Ecpsv6<Mտl:p܉91&?1eJG) sg^ɁQRp#p|Icola^|^L))<x2"UQ󍻯jÑ7vA<.6vשCzRxXaēLʭFxDBqJfQS> zgUU>eP}'ݗlSmWPqˆHDˈ9{Q;[y&bKPeE\!d݆K.N&vIXWRI$ Yd2.絰x.I9sz L!;& to)ዬvs]sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث~G5Df>gSS7WeŊod5#nΗ##"S0esFLf9 P1@-2Aҹ7nЎHMɄw5 6M1 '}d5}E&@w83%\@9A)1:|{95#5ݫ@qFb1>.F7/՚M8aမ;9j(ɍx D PgG،b}&am]~Y@q.;>Rr!L:PКxOvDpR'k|1Ӎoᘚ~l mޣmX8g~Ƶr!}ㆺ"P?~ٲ1 0kQu/fJ8N$-bq@X\c:|Zs %ҬHۏsE#PCb:1Z3G\C[+ £!c0ywӟ4FKx#a%691 Jx [e.Nzi\]hܻE hKEPN%ˀ<v`;qݦI SLGDov\gOe#ܽekbA;~,2GagMYYPg<#$Ew/mG$ՍWՊETגØ4bXP) KeFw'C?sv<:fn{&Z( e_/@T3{SUfV&Q_D;c (!NbxB;I'2ǠSf=1G ia{?FqecW92'FD01H1!Rk<x> dFU}L! T[%>/7`0Kl*)>?a#1ȴ$nr@~X p!GG7T1."z&#_ !ݾb8 "!|͆#,<~G2]#PLGZXQAp-X*`b ~6^*@Q>%{q \$ y ZAf^ ӜB3_8[LZ_f(S|3ƹpߢ#ҘG0s3$wH*\S|͋[.تWW4x*VrAhx9?Fŏe-nIfRi5(I"S%vda[#wD.y .JkˏuF48^Yu n8&ARcEo;]*Qrijw\kd^Bq% 3.H8'iL d3A|kY20&iĸr!-:bsp2k#TPcdoG7zmwD1P00 AMAh S@[N9tfUʡm6x̛]C>^3Laݦ2r<0xAxr;|pݵ(NdE4vRcLjI`+p4bN/d|-C2f("<N0;H&26Ok2[*4(7<\{ePv8'?NP&Y%sĞ5+kY>npU21gbʘ݈5υS)Q5tُalrFYK tL2iđ tg7E+S4Eq94MG)q13ƛ|E;b\kyMǮ>ݿxYg~@+2}zUL23S{z+ Mq*{elj74Cc ׫>P2 dә.Ɔ2l:EP;\8UDpS`[!˒GSd #pެߚ@6V`gG_E#V4Sr[?/o#RdqCfxpLlx̣k5I98~0huFvQnN9)ɔ'&>s+~(*)/.eh͎_4oz?m3{Yi5~eq? Lvo.:яWg鲋n0/" Ril:vMd\JCb0WR吪@z_|by .Kԍ4\gjp Sr)ۋmMΜ /}O Gg'HPGxl(>Vl.;J%;F,%~cɹxjE,^?(|FW4`\Q.8=`qv<8~uB@k2>8Nq(I7NՆ%ž F|6p&kugG1Q_c=!E;dN^>e7`˘j{ 8AJP{ KWRߒs(*l*Ňbk68c68s b-{YtoTtRQ< Li }nl9xh${ۤzA"W(9t-S ;3r&FOсj>1u#l&8F)(kYWU2w ! 8lnTE {dDcq+' _f/ki1oܫk(B/~׈5JA1t/A1`wj0nj('Zr܋xV&.8m2m6hR<$~%#i8Wep#;N!S6IiRl3" d6Gl_DA>a"J.`A`sqy=cG/ Ϻ?k)SSſV~ [v'W3Ry%!XόKcJcԏ Q#K=1ָܺUYYv,Ks ʣ|0rh[=?@^|YQؓ;?cu}ȑ6:cAnW>wPR##ۍqWPSysqZgF{KhՄFZB2vNf-|o 1OQa#8gh1s&G[WF*G؃2/-'ڲAU33ckDf4\vܟ #91mymk.c. 55'Cƚ1]2 |~6ڎxzu?d/_r;cPA8Usт7K@ /1;57lw%ezx=*O}g?e4IM?q8H=n<f]C#6;\[ e×j9?_;h|wkGq0yB >\fgvh}'eGe'B^r_۟3a`QZITdz{ᔙFUG<kmW yH=#}ˋqK[˃TN9ec̐jX|餏/18:~ˋ˽$`ϲDcJc!-!E~=??$1ƤM~ Z'ߧ/f4?ޡЯOT-X^ͽ_r+9io8oYU=:=H?k!zh}nLٕ5'B{0y\Sy^ф<|b7e _84b1k[PޒB6|'4[L?ٟ'B:hAd7m)Oq k_m/gB88!ǿ/kO:h1v׃LWLbֽߖп#J'j]K Ώa O ay݂k4p}-?^]?8g8c!i ؿWqY-/^=q\6?INΖT?'xzG!^'||py{V1h0%=#+~[Oו뽞SogǪc!wHqZ9m8יo=T7?^F>/:?BYK?6󦖟7 זKӈ=~*?͡+O49}l-P/ij͡,JM-~?_cc [+]?h?eYK?ƚc鋯6Z-_vj 2QmxWcT~SsyIO6ć|iE5gjL[?Ǣ77JyI(y^ /1 oMAk-ڕh?f2Mѣ~-QO%e/11NM娸oPy}/ z!QlqGo5IĬO7iR~)S-1gc&娩_^B> GQڣӤU[ͺo*dSV_,W娿oG/⏟bњ ?)įo9i#> L@27?֋kfN$st{GG?zH'-o-י/g;K.#N'w4~SY4H LX2^ϖk}7}//c1h?)ĸyH??_`uf-Gyn.)JOh1?)Ķr SC*?qTNQwg{9T ǖ4*/1v R C"(|8݁&?/[_-E_vjJT#/iڣ~į_9 `3^|֋k{#:1Og1h::{KκB?[/1qyj/(Cџ[?q=QO%gJ_[O?:m~c?cJ;q?_eK<E5āhtf[j*= 7fn/(tqp#?J!]<2]_QyN?gu[W '[󦐨]bj/(gu6`~qmƏ+WΚAC/3бݎZ /'oTG։G)G?%z]K8u_FkZ28=ͷ75O%RO:i4o[P[ /1%htzh?fu~Į>s=#+Oв_[ />$/U̲B"|MQl]i= )t:+L\3]帿h} |F<`G?<餆<)25m /0;?h4[j{5 mv?_e%Z /: =GO4E\uG}eCהv`H Wx+/2i%V~S]sM!v?n>[E5<ʽy4_?)ĭ/x,qgajHp$WxlG4ET¿[!Bt~ϖkؚ'?[N_1iHT~SZ<7}59W5_^jp{;)@|{A㡪7J!.O/%!:]?/%۞шϟr4bF$OTo?qBW4זGc F#jO0Zx5wnv. \/˨.̏4æ[κLuU7Dۅ<֋k>Yqxq2k9hÀLߤUǞGRk8gn~[8v6|8s/Rv-ǨkiE51ؽ: '"vr(M鋿4E5K3pcmG ZnJM$}lO8>?Qy]=nGuu\_bQO%_yNkk_efπc,t4H?QO%zyH&[/1,PטσU,V2%VANɻ]-4 QO%0F+Gp9oż>X _`fɯQ$خ|׃ ao(ovZ 45?|_^m_r }#Oq҄Lt)N_br2]ם.d*qg?zs)wQ_o鎗q@Pyݎc/?(2ҺB'O55>b2;jJ|ӧ ʝxʋqZyj(漺 ֱj*m;1oGV< )טD!mdȹ?ńȳJm$OuQM2Y$y_cZp QU[mw͖ ë7]1|ݦ/.<8?,隇k˻WN\{7SF x7{X*TRmpſ!'$>-Cכs8C{ިm,4?c 5rO%l>_-Ab@@x=W_TO xW?umb)8(C5hi_)ġƖ@~ 2)|הv 1܍G՟QūCL1;Fxf/36\cydٿtQ4 om8 0֧_^fvaNZrsBgWW/7/[icm>漇gv# z~K9o/W3S/#O\;YLņj)oHڧL1aO-CO_^avdj>}+{ ~fLb-_oK8ʟA5緻+|[ww_1c7jWG Lc0J/`/*Ǟ](\=_3]?Ɇ9,[JnӚn tۋL8D!-5;#I(fdU;N6Z2@FUIĩy vo]~YbtƸxO~ zyׇ>{O%[P^z4Z+L`^e' jiTyY|2ƸI<;]/6ۤU:joG 2 k΃0}S1/|_3Q#B/Zk˗xSOH|+s\S[w;i8FyP0u8h躅<^ I ؞iC!5;,zlY%(_~l%[ fEjawiUi2b/۴25:e~?y?J| -_g|^!'Yϐ_S=^^?=wl!A>~5)p brl~Tt.B#(7VɀJE[2޼É@a+:cR$0'I9ADuDG~zeibZӮQ 6X_+WnMPfrpw^nO3ZXĠ' 3dC6Я#:Աls;O$no4von{my<ډHQ.ǯMӤv;+]9OJ'?uzd;!\'f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث~Vaí+H72O@V/g-2Czx.N1dA"]e{DwIO.3Q4YhʹU|NFKa5V>ߋJ;yiAr{S焎-"xefFâ˯5{~>+Ku=1F*fYnDzta) .ﮠ6 BEA=0+yI}C=V^;{ C(+XEwrzń>}.Q \1#iܸ V:db̲í:|4b/+ C~[~)aR yf]!~YbIr \OY (`}L\ӦE'AvMOQh5r8ESQ8LB˜ ^/!E?3.@|_]+N3ᙕ]=k %Ng:^rLCǦH?4Uh|0Sc4lDQc-Q&&e:<> &]׳LI w}(+_%ky=/fu_shOE,`Mog!jB.ߵ0WӶ 3gؘ^'Y9rKiu3[I}sc6]l6_c=Q!#"d\ev'NL2'\[6i q_-ܼZ` z3ꆇ(c|_Fc?QVrL[;aa,qGf0Ȁש9[ HH ic`Q\w=hJWq^,I?>7Sښg_i?d4!ds@_ƷsJOImӢύ ˼!dqN|Q=3O 'u)*8~f{QGM8P c"7:?Li9 2t?v'PMFT3,Ur4 2I qW^ctQ2Qܚ8䗈n^[)(،|.uq]4ƒR~=#P}yN1y@GԜ5l=xq]]#qCkŔAt$1n;T #;ӮWtO^6ݖ 7ncoExJ:@11;퐙2>+"j1-N4xՎ4 JcK#1#LxwQRk 1xa^uE*F80c-.hmԭXW#|<4,<5+l:`q"MwX5˴g# czeӀ;2 GGVGw1l12r!B 평GŦcU'UjЌy5N^4?&bWj$7Sڝ2SrL5P zu:F6 ?S2xQ||q>L[B%^؟2$y3#či(r61# C(#^-v̘%eLB9Rkb (Zu8.[1{D C8 s q@f:tj}.#ѳ6_Um8jʇ-qh=E282N^liSߏ\mAǃw[jFa)q H{מy)QeəI.W2-˔ҧ'7Fa&( ׈W}CSrݿܓILx^l#%x'1|>@ݧOJ=q=XsQCvj~~NrL5\s㍗~K6ff%dh鰡[\92q0MX$FfA5L6IS OjDŗ|fg@a%"mSsZ+9vqԦDuegS-/Dy3 P.ǘ"-C w9yV#; ę ~|Ѱ#fCYy^ݰLJі(8<1x6mIv"b±|hI>ffC8keU-=831vͷF*7=1Q!2Zj-D7=G3'}<z?0 k`[j7#|Q(n#h!ؓc}R vȌˉ`6_NfVnfr-<-{ue'RG$e'akDO$$54!ɻ퐰59C^\\؈s[#s{d9EF_ZABz,i\|Sx'իS,b(1 onNa))9890] w=2v#)<+SLkJ8Ŕ-?}1n1m E'Gھ"_]#3. ,!&nslMFAf T_iJ)l_pn&qIڔ4q1,J614d=OqV1nrɦ?R ;ִ'e3^oJ[FoT0u2QkX@I=g_d3I(cPf-ũ'hsgP_zM2ґI?x$iZ9wLxy!lI=B>![ɈmMMrvA'Q( #t6PXKdIʷY.j:C1ϿzDĄqj{9Dh] ^R2#hDZJŹ xv0R.sjUgSLX4S\BI6?-~0b xz/ 8ezeP+9jx?֙rtv̊o)]9=Y8&#e۠n3fV]TΗ0 q4s\qǟ.Vn=XeˌH8U-SP1!E IN=L"|{y~E QlG3b(xJV^f>! ҹl㶠N(ˡ68PDڀcyHDŽN^!Cf%L*E)3+lq9\6T(+Bm$Aũˡ4-#r@,)0?@]EO=1`(38[15i&4~c7Z[-lv1BESs4K!!-R%*I>I,ƨp˦6a4QcG4Tқ`#9OrxW#MPqlWgO_9 Bd H~($8dD$_*MNc;@_9q|+ZbĝLftcL7)ceeV+c Rq?.\6"{Jm@My7?cL ~d.⹭cp0G*3}>֢7/IKRhE ZpZ.;TZjAqGLPrAdž#O>;vWbmԸ$kMNO>!9YG #%Pw'!I6fV9tGD71ZN!"ƓAkfry;coRxf>(ӹ<(X"[=)_[dODқ|`xGMM-QWW6L9LU{`R=dOTN#5DU9a <׉;)ȩ5?%BG3I8}5P8Bus4ǏN9n>!U^^Qw:ۏ{fm< b2Jԥ…Gpiӟ?:ϭJtH9?z'gi% N]~OkXq(ۦ͞ uQ΢PUC-FSm|ק\228`#*iBKaLa]y efp1,FQ؀jG{hѢKvWhA K6tɖ2ߘrXF"n}UAvwaͩ>!I>hkoոCvMauhˣϷb#c@]R!3!jLirl^ G=0o4.gSv^4Lkѐq$]';ያ'qvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_kmFTqeyc)9bc( 7Q=JȜ1o 3coLǕp+ww|pdg|3q ljJy1qڜYlO|Do5ܷ| ^fDHV 5Í5 Fv;^{J*Eea_NPJI~% }ge"U"ג?k7#Nb-}^wlEw4iȝHvT< T&whK7+Z|S,{9T^"0^"WNgO8؜y(Z4,Xv\ &f?/={c qo 75ґ} 0Oc~j[:`(s^..~O%C$Mܫ(5ܓɞ3 aB2d^dJƪsɐjGeuC);G/T7Bkt=&RV$sQWfdq]Ǽ13j[4X4h>DWԂiB+O%U=hd @N[{c ִ?8-]/ZVKdp\;[G*V-?h`ucԈq㊕0Ky+Cyi8nŦ/@LT2<ڏB[t?1X Ȗê]򥴛S=zaM1D~eZhcSGX"8i8R5IJSjc8F-)P_AֿS 5@Lg‚Sk) /| )~ppIvk(2Y@/lި=z]pՓDaRFԆE.:9gb.&quZߙQ.6KH!qω:/Xem/rn@@W&Sz:վ/_9D5b=+G.+W; N5J4DkRE~K2݈WL'2<֧UB~'R^+Rr95}RP6/[IMiK/~Oc˝4~H-)T5"cRB2RտeHKmHDϲd:ildi)L.jD2QDAfNnKU hѪ:G66l喢QZ]1\%ߚVq5ȧLHV捬qMPm{rgX;˳LMXEfa?`9<=1sv?ɲ _,ir<G ])VHO%KNZuF#s Sks?.9u%_9>GPkhyK(]kCՊOq Ҵ,iqz܃t}R_%d0 #ْ=BBZk(K5NKfHaN/T/_\s^KXq u捣Kdt\Œ?ci..fQ',X v/4B iq|drkD''e=Bɋ,^n qڛo4y؃M^m1$Z As&ҟ_/vҗCͼ{˨Z|\S/HDW\DM8YN~?H|q [JӶU_mO#XKqF}nwឹ8S^fev^Dz KM0FM~6gmS/;LR{cvtmV܉8bZ|C&'*:sx 3x^Oav3<+|[`!!5z@S:c1-h5rj];c&?02e:&H&#yҴvB &I^SF@"ns[s5|U7C=ϐoUk9BMdtaU/N>91Om@F m  }Z sjmv Mw[2r$]UZcO) v8 OMUۋ([ū8UU'd[$6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثRZva%ɔyn,=26o$rE%nnT#nQALSJ@Rا ;9sㄢdpl A_C0=\?5ZdK`Com 4KPyD"e#[.Sə Es a=Ccx_QHZI5-C_4|/bt]xrGzMbTVW43]2@O+p5}E>$xDH'pk`z]5v5>8CsqOvZ6PL4 u (kiJ 9c2svF~y&c)GryB A-&xc~[T1By`1ۮ;-V,8c27;W11 ]ϴūDmG1y|~ 9,~9un ˴1gwGbRE$+% &ZkRޞ#4WLx"W紞5z5$_ +EQ3'D9=Owɛ$}z']/)`99ˎf<|qy& #᧎w2'c3qW 1v@浮!ѳ4b+x̻Q&q%.MvzJh ݧK s1LM=Gg+5` xhTq#v iJ䄀y>ˆXm WN#ާFib6{c7D#> VV|+c+V:.!}'rC*p&CM<3ϖc $~߱j~ӯ'>>M>\E?v⡝d4>nսW+h cVO//O j9mOtIQҙ\~O%{%^ \8.Ոpy|?nkbb^Jx:X5{]W^kK} Bƙ񘞮D;'z>AAߪ_O5#_ OXE)^U-/4C-_r.2}DEǜ5W ɢbG9 f=٘xjv3}8;C)\䆃ڲVӎqEUwyX$}?_8(=n J15(J^?3 XrCQ./pV-\Jԧ#(K^<׬=?8!#p%VgYd;r?~Dd:83 e|䉾n5_NO÷3,rr?ye>eo5ژѶrħzx>K,|ݪiߑG4VN|ӫ,/g޿q/r95JT>mG[,\T5XyU9g5eVGu_o <⵮s(I6gjdd] >Ay6?LU 1%=H rV͜3˼|_ g X)Nws6IǗec`[[9bUi̲|unA?_8}cٸ>Ko|ϫHɎrQykXIU%A{9ρƙx,0}U[_HOZi#O5TR>8WO|sܳ= w VW62?$d~oN O+>]D/#Vj?ϗ?6c2?$;W??̌Z9|ˇL+ })ae 9=F9NJ/]Z2o3-vy\|cȟQ?$;yWɿoXpJY2~nA?%1M[gIAzV_ o9 z%# Rs7Rzòq Fz^p*4咑ra٘>M2jW 5~"r]8R_3íg A9\K}XfՍ&8ƞNG#K=Tf&\ZPywϲ$=uu[ɻ~KOG,YvFEUI=('=2&FH6!R2So8 L{1ˣ";++3jOƗW=j}mn!# IQN$%?rtAK#2?qfpbѓqKGm(4t33ɸT9&_K%5Bċd1'}//ZwI\)ϼ Ŭꡫ0% sv|syQY{ji~㑞[q+E.8řŎ\2;7>Iߘ!/QGVmY;/ >JyܽM~ix>Jy*_#[9+.N@~ay5c_$x؉_Lj^rF9-cs)=l%:Ƥe$P 4HF_H!XԓĢb cٸ>JSSJAd2dz0|PRnqmx3>M1jV$=pYif`7e-L!๤PH1DyP,yJE?~g_h"]d8sN!2nmvI@|N2h04|E.dOW%S:}f_#ZW$$Kvv> c\ٹMGKZeƽN]';ޥ-2`ߐrݣ:cM_/g4@'Cߦ/i 0ațrc$OP^b Op4|qz?ޙ>t݁ah,ZE?eݫ1?%ֵ^_Ly>H^&2ic㓌=/插=kRs/oŸɷX~RZԄf^XܜGώS6yt8>H;=oQeXB-3|G 1g?qڇs=V}~dGWq_| vKF}-2aBrI;>Jˮ_m' /b~O0|ƹ|?O#|wphU['pOA\C&{_Xn=h!ЅN,rَ͇GاwLR^8w d;6G؆*ԿG,|rg _$wKZe>J#er8L _%Xԏ|K;2?!-ȎL'#-Āq5S!ܵ_HU_0]2}*i#9n) N>_H]6vHIdue66en2u8^9\vo ?4c+\]}(3@-'47vZds4I4|YcV/kS/ 7+ 'cV(8H-;`}3(=! Bֿ/Ur_~r:PY|;q[I? >]_mmݙN/] >\'B`cҟ,88WiAݳj5bS63cb\/g'DL~鷵yn>9מlL<3&{K~Hx߀l ;"OC jm!Rچ$#*wd8c7 `)#Ò$đߋ$c!f(܊m\qd=cnNc]XLe ECJ1D*ߣ7yt;ZDdRE͔p 9G.ǹukK LS؜ɏ;;`qg؎m ?79-&[_Fhpqv:6gO#<\w`Ȃ;e`[NV[Q>wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثv'w οͦsNs& (.LRKђ 3X&PFq>/nH kZך\"Et<`˪WwjijtqôouNXV˸ͶSuU"5;᎞ԉ?hvazv=e+KWE'$7˷l^!C/Su|3bZهD[(һ3] ծ#ҁec y̓3U] ;:6E~CcF';_<İ #mAXA|-p}^s#.f\R)X:53Aގ:L+}С* 2 ,}EW$DCuXx&1Tk;62&By%Xc#u돸b!c 6)qGB|זF^Mc4# ǽ.ҙa@ [`t;kXݹ1pv|1ge{[HͿfgXF2vl0)<.\ʶ|rTI~#]3qx{c:gԴxa=q&|-KS3LnbOC)ENBPp;#$ FMS~+VYXPQd8e/Gؽ. JD ;]G埨>f?-9<և4+\80IKW+)S Im٦*|8ܹ˷*mO0vTsWIqJG~XܵƐi8Uϝ^R`Wtp7iˈϺp O%hz3isDιq}K<=v_5y8[ɔ^XGS7y@&C`l$,.(sC9Mwؙ$ veC_l,K7v9 a:h|9{› zAm,9hY)!bRw"߻=0TQ2')a\ȧ:e2!DÏÉ 4  k(ZX fx`{w?-Z WnI'2Ŏϵ)ۏae eoMOlҹV ,HAҘe>ّ @2 )ҙr9d ^8sbqpRHOW,!Bs{cd9f,@R,v.Ğ 6OJ,P2W8IUʩ'TE]#S(o)e‡ikl*P؟da捸;4/GOcp2VF x̻o; b3;c c*9#S"Q&Zb(+`c̈́M&.8|< nha2RJ`wFMѧ5NK r-ơMYP ~>5džfQl+S@6t\s#M.lc2+\K#/;X]cu*9u;#1̘ΓU5q>+r1bN#ʦ6\RHè4@$s"+t퉜JJv鍮D!D'480yLlQ`d중1ȏJ1ej7Hv' GI NLdټKut8 REl7LTdA̬38Bc3L8s$JMOBbJs$K\3MeP[pW]f1ɽz@5s Oe\G|TrYKv4: fIqOw0 -Yr<,rU1)$##¾9K] hr=0O1\,,3zK4d29W 9a0ʼnCKDqL oD&q8&՗5r#6nE8I!Ta֔xL+{s%DʵL{Kʫxb'͓}9GV>c_I[3fDI;ed Q首V:cOHPW,H#}eEFVѷEby}F o79?-=7I}@U?i[*sÇXv1t"K 3g礅?5eMlg9ev^G<]m j9מVlL6f F 8xIb0#ezPel䡉\|oQv;D "k=p()Q2 GZxAvA34rq=WgHQv/2Q8;c!Wwv'qpǐڴ#vyug-[v[ FC.1':6^<=AwGl >GorC﬒);q`-/Rsa4sՙ4wZ;fF*g[e"kb/xzHy:; TK$j?RbÓ}e46*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث7V T4s?Byg(!zIs?VL9 CRvjӶSXw~vO!"KJ-uH=|j1\-Xӷ?;+%lΆMx~&7EϬXL o7;Xi4y1v&oI`gܧs4g6nT N$ݸ=x|M18`Dp\{bڜ\-rvoVL'/SXuCjamIP,9ޯ,6pJϟ`[LeلicXx'CT3珖?^}8r@ک4^$ }#^\~43d'ԍi#sF`~VpZ%ڸW|d1^|McLu}u,?mZ nkGRR,_/cK4TJOŗcO!dz_Kܤ1 ϊ LRhTEZr dƊhB|s(O6 wĽ:ˈ&;. eypl%E@PxKH%\BGYra.nJdx7̨VoӶd * *\dєCiR$̙KNU0̾cc (Im ql*z`ޫ[DPF ɒ0lR_*&*y- q{)RiQV#j`14OY1q"LV3RkM\_[$AeAl=rzҟbˏ%-ʽ=Oj!BP2D >2 J\YO-bgI"$q߻s.)^Ӧ/ KyOOI?|n[zL5ݯE~r`^/aDsĀjՍrR>񟢏]?< =+Nݖ{7rەEtd\2pc^zc ̭nS'Gݟ ?:4_>,/[/=/^Gap)gzf9 Yze818T3+!~&$142D,y11LxsBd=H̏е;*z[xhzbI/"Nt4&V&8iؑty:QvGM.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbYY?.ie'>Y8+LSqb nӛx J=.L4TyiR~8z:nǢW5zxo#ͱrMb‚|;̩9,z`4YIO֟1cԂ!CSm3П1)rݍۺX?ƺRJ>icMo^5ڠAVȯa1A|xG $rAo9/jsorCFDhg!/mD.ٹZ}O:jװrHCǦkdї=W/zl~&ƙ1}#wo)6$GqxW<9nVʼnRy)ߦ P0F5YtSn12kg[ VMriPԕd{c󾆺KS.dj_:@4~xZA+K%j|i$1FRkjπe1R!ȫcTd&9޾Kǥ&`4xq v냌2;(][ Dӏ N VC ?c$+N",21;xe!c#C(֬EMAQM&Bw]ǤlhbGJTDH$VEZ{g+I{ws2sQ |Q'_4j괮5ȉ/OڻulG tsXu[X4 b豧Knϲ!R?0t'<>>MQy QOen u[p7 k#Js⍄ Lhz|,jW|B2n뱇 <5f?Qp*`=u^oO"PP^7S}Q}=rHYv"8+WW;a+sJPVA%n+5q%1.F s(̘ V+׾(r6)sbIC1Jӯ>.\>$[ULj9!L+;sl˄1ѫlǥpve!L6 ^Y^^A0!F}$)M߽N[Ua|yOzgBL7 + HrvxYnǗbZx㣭rS**ǎ<ȈƓEE1rQ&2-ֹ@Rv4dqaca"@oe CwF\C erlXoPx8*-XRT+JoWlIΟN Tr#l2m+>4 [v4̼$d8Z[ )7qnU} |iĖ]X"e$+Jc{f41ߘ9NN1+H=Mr\¨fWO6?bJvve6wY8kxlOvTlyC3u(9 ٰh5SNEm+i&"ρ; LA "” ʝ0 eb$|*"u|rr"N[)Ed4r|DȋBS-xL@>ejH!8h4^,w5UcS+4ӊWq42Xh`x."@|z^J-v-dv`aMqʿ)1"9&\̈́ lTflUWyAqeK6?qdc*9`8 qdx\PF"0b84|17+6c5Q"k430*f {ewbBژDU78E#;9}WyvQ#P{bo%;M2#հ, *#TB1b)%Ҹ<THjF><ݏ+E V3}ّdL hJ҃F17;a$.Wpvtz,WurؗĊl۲?&\",f}*iX׮KwfPqF |"1@c TZڨN˶&rce>UW[ ):K,Q.,EȄB&ש\c2!EFWlK=LZ$rE*mJ?LZd A?SNM`eA$'m{c>ɦVHd a+/2Z sݎ,7m'ǁw3)F|C|Mw1(ҬAE.2O*?{{_RU>kEB ׭3¡"\V7o>M^[nos殪+>3!l,M=P,bt2!Y7hZ/tD*7S]ݧچb4,gr59F9^S: rJq@ًk*)sE9a[靍Ԯ1Cudڙ8ɧ5qח"- )zV3qj?wC1iwU>Y>:0>򧃅ݠ* ;S9x 6 =,C;Jı؃sbnb,DOW`KRJ:l;_ErLm}>OJ2;@Š2Xxצ@`%wݜ3MRo,t&ũٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbSXWڗN6BmN9?t~d)CrNُ)8܈Vopxc<\іf-#*aJ 4n$y7ܻ2F<]ZQև;%jtE!lūrWqNd Tc|&KW({?rJUyr@:^w/CQaDrھy-b p@Ÿk] 1-r}ڹ<@Q$/ri6.;Ӯ坘Jm~Yj1dk2gC:yQ#jJZ?Xh1n!5ա#>ǷEϵ?$ʿէІO/!S\(oe;./-?~ xS#os|0|z~C;>.8ǥ~_ߗ|ٮVҞIZ}wxs 8cJS5=3A2/ͼyU1~y2 /iÊ$wfWd~3 V\amJ@v#'d&JD W,3K鞟90)4G k\LYN=0QaDZPe"`$tȆؕRS`+5>L4- Ӄ)Ur -[_M{b>3*,@t(^H  u㈻6 @ jQQ\z,ll:*2XatlQ 9b)YgPUf# _fĶ Ќh6FrT|yvDB-^hk)BX[->6ĕOL#`1U2lZ&@l#mw'7ol Tb37Zd 99 6 VM%|28XcwTlAmje'A.DKWc\Lw9 X9pA9W#]-8l8F3e^jf&t x0 Dž`cНckc V2 3Q!W.W/ \ Ft~`TEqT§qUdN%6b /.AwkPi%RiA#P}58࿶*rl;T<@r`S9nr\etr{ldLƞJwޏ/-oM{?.Wo OH[{E>ˮSǀ\{Y˧Os,ܟ > ~ryhԧ|⌣Gr<=aIN҃L-m)td?d6`˚^yc0?/Bc~`)\+ AU,_rzܭ/+Mp֟Qhyzծ8gZ4xHv>$f 6}&(nGO`I53s5oVHQceP럡P2śzY鴇.?-[ kny(f ֽ0Eibg͔'sTu'"\8B@.O4f$%" -邊,}; fgʹn <J`rl'Y,U2Q`GB.^zG>a8ˈc%rYE4bhv9u3;=ާ1̚C=q("e{Cc!1"W^``4܇1ƢY9g:0n9j!T 6le>wͼF`y6ߦf vuE"n25z#~Gf{xq8:1#f\"=M7?^Cx$a]ݚiO3c(jSC]>}~&Q:7{_J~I//1r>xb?NIjkU>qުg6Ϻ?_%qWi&t5/ /us7/9'_FoFO ҟݱ8l3K=?K6Gӿ$pD~y}CCe?c}L{bEMrV͋G (۶S*3A=r 1;7-F] *T ?q[ad1,׾bS1k5>n12̫k8LB8viU2,\ƔZ eĀap˸-''כ؊K,}NL@vKp}ʵCOxZ䊱y9vÊ۝*0\c<ͮDrʯusPKTS;{YZ ҙ=2Ocŷ"W]/˳tU{M{sO#Қ‡RiJ4qȬoGgj2QKSIVSRI«aJ->fEt!j:CZbT}ޙpW?>@A܊W*cj `'OZ>}QJ.W\"PwF2٪JǑ͂5ʘ"RȮ1E3"%ZI-GL^X{ef<-er1&Vryq&B+y9LyqhqS)c,IҦ.w,i˧+deF#tӹb2IMqiQ)~ЦX [ 8Hk\LBH@ɴLMJkCˎ15ҹ hb)knU nSi\jf_\|݉Mط"kb*%.MEwȐֳYC`( bh2bHlo_4$c߮Rd7 # 4;uɇ+p3ɰ&C[c^z&ۃHV !212pz`"A_X*w $^|mORlLBS̟|(6DO? q̤V9b˥D$IfL|E1;7lՕqwʵG5fVraT͠ Lq3&WeW30dbCclY2tR&&Hj3,^7ak#^K~~aG\/Q>J+)jxW?Dv&ojS=6|(p~[Jӷ'#>+/< }We=?Skg/Wܞ>o@r0#,ո  ?=ڷ?>3v軜=1饊o}o(3Nј9 SAlw=x)m UlۖnujkjG;]q9׉Tkv$ǘv}`EW  P{l OC v msn ^i\?sW瑖.&<.a2"Z#ꝆΎ638jZRCOTM؇E̮/"C=҇3_+Yv8SRvpM\?ceثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbuq[KXv>o_㐓8 (;|wA\DA'eF1˦V`\0;(9}KSFɀ6.탣#11 :!g2_Lޟ/p" E#k[@VbMG|,6#ٱ<@}'ThwǐLں<:y@PO?}!`XFhk&s.zQ/^KU `I(呰fL$qoAUTn;e95GrX%21emGݑ2m- Z`8hX+)s?7W#R'݌GWSeqtX>fli`i<1#17{YsynUއ?.ל2y~)z n0k"-|Dc"d+mk,.Dz6.N 9Jv.6TP#qIX-JÁ(9e*)@޻LsD1tLHyXf:|4 .gֿ~>8&FVz +'\GB@ނa.#tٱe$b=יT5ӶJȰ4(]Xj3x@Im$%cT7j:gďS~c`A[twOd2O7Iߦ嗠4U7KyF2p>M:_vhgmZ<D5~Oe.s;xxrhv#nkAL8r{_ԸTwW>OS/dq!tq@f"1f r)}@i:Ԁ\K0zc-zepxa݋r|Ö.$̵!#I '#( ۖ"ǣ-\l7ʐZxeFxۮ NFRrrN^Mrd@$N,eb)3lB>ؘ9}!;,ݚO28 VXrWڢ(?Fl26- r D܀~#yT1+6Z}=_fт0 kqLS$D _| k6^^oug NO9/k5Z1vL2.G@#ζ{$uc(xf.(Q;2鷶v|sĬbޟN|m|ݫyw73Ɗ (M=3G]Km|As3Q7Ofwb4b0+C?)6{J3q~g6?>mVY<Ѭ&^tn֐"Qר;>o1{aUySO}KNMZ H|==[8}_WyR#LhY sA[ؽq%vBQԌ&0 .RC,C>9jOŗVH\0Br!s/ʢźDN/RdBb4d|=M.(ӎF2L73 d{*w\w/|f' Xӹ{3' ܽ;/,ܽJlܽJŵOc]GSQF`D* \,^|L2c=p//lFgM'f+!E99Pi Yp+CFL"dq+s 4۩\qH!ƒ0!\)X]Bժ\LAZw,V^Y0֝r lBę&AXtF| A Ҙz -S#|F‡py{f&3ء2k@|16L>84̌M.W!X7,5ү\ũR;Ci,hLd(Aٸ: , 7 P81T.`A MOr7F48򫇅 /q6uPwӖ["]wvŶבS8ґ6ڌݎ[)'FY)PGSRr1Eš4>9s\Ū rP`W=rL&d'Ͷ9BbF6pxXErw-ia,Vҙnhuq^\& #D`0*>rAVUNJ-U q+&Kll!)c'p2@z6_ 6\ 1O3%Q( 04 .,HSZ Xޙr4, Tc'2hW#lV5=p-HqkQ*|)n@anǠ&S145 `_lX8CSeLԶoJ_kv Ƙ<|bUTbb#cj@6e)'0VP|r A-u@̌r1"N(fRuL"v,d1(P䬹L3I9Ğ"~mP(ZfÊmP~ h%mi=VŮc,dڬ-6hb%H (#Wl R+]uV#Md{bn$ALCS B1&v8 *~ŬOy^#Qb,ys}`ƍxJ/9c<_Be-z@o sdċW{4##9vIfװP't^ۦ=Fr&<ä__\c˄]KVGwz"i6[O Ev~RU'<;| 'Nv>)Gʺ;KY)Uid zWv=y@laAIS|3ꗗ憬d$m7;ǸϾ??އ.,!d ӽѭ.;<3r?k<f}:$g,G']7~ amS\HL֘¡'VVZBIY!de) $+Jd"Wj|rry ~-wsaLUB?#mp 9'#:.ʹqS癚y̎_c~qsܵUM׮]7y\9(L^ ppÇ W>"n7pElyrwx˴0$AKb|f/ g`H!b9vfl ϽOmo Y H|Nbj̼a 22P.f᥸$@:1)b7 *{Eh;X[TA,hƋ(:FS;ONOXh8?8ǪF3LBuJ՟WoEqӉnǔǟ_cuboo)-O"ʨ=I_מrqu@-oϹߓQ_.M #E3P}U|og?x/nKtGś@╗hݵ|4 O|1 -}{|wd.3ifGg(5p]"OZbD`Q%6\l JDv'lo& 8;2wk|J9Y]olS eL0\KˈodyR40m Oyk2,Q+PUb5MX5r<"Mex' 9[Sf|˅gp~'3i8]L*)eVndH__ xToL00#uZkx؏TgrCS}%}F"CqCei4Jgb8;A=6^OXʆ9@~Xo;^@>l[_ZY9SMFvs3"6>^O}I@#~_Vvfm>#˾LZI)ܣquJ5;[&ӎ}P7sʈP}U`ȈH ~e)/x'kA4Es4P$?~vϵy#$c3Lǣ߷<q9 K*$m4 m_/Eqru:HBRMF nՑ:l̉Î0;1"@vW,a9zv9f7{./m rEoo|n@26 987aG^@UՑէ2Iޜ|Q)bNdh!wyvf~g耭-s_Fr)fNke' ۡOnWPq ?oϟG;ObeN/W*ڻ)`O~*Ӆ?^{4rD}O6!C~vυ_+fկm?g߿=ݗv>.YdO[=靴XLMgcTOl{@[wͲLM1Z)4c"r6p!%.Z >0)rZ؄i׾] n°i> ةB0 ;%P٩ˁtg o eqv;RdsHΤ3w.R˙v!e.` 4J:805GtsϐQ5GvL 04dG0Sݟa2jQ|0y"Ozo6!cwL7vD:\?Nq}rT=e*-.v6cA y1o\^l6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb΃}7 B:W*XgeB| 9Y6a˖H F&Dž~,O~tHDukLnEWLbj?!սf{@1O齫 H.+gp\/jN4 nY=+M{H/{6l8 *־,oZf j W2[yi#_OWsz+ʕޙ[Ckt?鶾R^4Ƚr_l+yLj1Uc&?R{r29t#PtX"%y9 S2N8L>>B9zo)=@hi<8v̞0MN~ }[kezACQy(6(9xd0ϐo'q4FQ U 6:;[n֔꫟>96_W!Q|r T(%v2d[bTqp[p+H8 c ٥൜qܲӎKHYᣒ)qR>c*J4nν>aSʸZ/Q]WZf<{.+)\ 5㝨qW2xvF4-Hư j*,&A\IF< R7,wc~5\tx.$M֎oq'"+s?sYmE?fg=^g \$'?7Qk.ԇ:(yy>Guy"7!SkCः)^i=;U7;=w_doc#᝿}oŐԅT>i׎z/}8 GuuG'ٙ#JuxT;:B'Neb|Wsjj[Ɣ@3r>_;K&nh5_+Mɒg\yC\c'13i~|40~lEӁ>}\R*4Uq5́!LG5^ؼrtʧ>8f<8e,"%H5<V`vdZ"'֯l6q61/Kz%,IO%uqݐ.*ܷ̞TCOYbB5 qC%LҜ3ԯl $ W-m^1Jȸ4rJAclmZr90c+8@;-׶R#@WUZm٦iAv0D(:`%*YN]RaUȲR'm0 G jʷ|ݻ}qW+^B%{c98Uńڙ45,IN(I-q@[<؄|hv.ĜБEDkLVQD dW&/"SgW$CyPkB*>pq]&~=訲WjR)AśO|cU1XqT1;`t)cj=㘸ӶMcTb.2$(qϰ*( UVC܎ 1罼SskvG OCgCaY {O'#hݑn憡L}ٯ`r p4QAN,7e/W%LRM2ܤq1]B{vmbc]Z6wݍ(m}o]3Ά7{{g+JB7~Z /'vy^E&8<EiiϺ_sD|_.ӷT3d }.9_eu jqtXr37W+@{-`izOgn^_/y^Ce=d{.Ğ9E,2QXIiTb*:fF`9 ju[n4 ߈XTS`q#Z%3\ CAeeko XAnDTrN3.JIlzfTG{Jʹ4##uhI5`bCJB-AisrEUnSJ?v2HHP\Y#jq2߽6d x2?J(Bg殈 c4KK ` )>reT[tl.s$ d־9ӎ3CɎEPo֛bW?*c |mR~N.N:<['>A]ԥѠx֥) | }gM6V,%L IkY3*"Q;=w Wre/{9 yt LnSPx]"F&AOz^Temlepb;Ru}3×$nr//-TΪ,3Z$7S3+!X-qUqR@ˋ5Ϥs; PJ{w)ǟUQB]0Wڣ HMz 36fC҆倧 j7=N"#Q䬒A-˷OflZSkb]2VB;$\$c1%hiS^ً<MZ&'tБu|`HY Rrh"33T9q{}X|JFOxӛ6d:튲eib'>5ԬW5HaJ9)6 Y`81|(!5B6y#l_|sqeٺ2CSv(V[( (7̈b- [4P;➓ FD4sQ5X 9 IنYQDc)byu3an D3}[vO>>/t_ "UH~bKing 2d+muZ|15FOzvhmuڙfE] *<ۀ(JrAڧ_WOB8&9g(EFl'~.Y~ݏe; Ic˱'iɒ09{(7wK-Z9aRmÒ3%\ۈFԟ2e_'$O ԢX{*R.혲zp2HĔaxOANßanŞ<4yUN- ~}06 <0yחU{GI9w:c[Hĭ? Y`EĪu`Gڛ"b#2uV69Zޞ 48o?Wިo?~~u5HiI\HՐŸ?h>2\ym$HJ#2P}c=-_|sLD.RƄc;kD D/x)RB#OMɚ7 Py?Ci|ўMEώHKa!#C2*z咇A͌EqW,bzv̱ACǦ/3kL2IEѩ'jE u|,lEDỵm\G^`TcO*$RKn>(1 -:s.duR&׹5LaMՎdGvت0'čɉ-FB;\TN:TtJv銙kHnR-f7=\o}@ 6`rMoR7NC~ocՉh/ݝ $WO uȵiE{-vσ<_{/z4ZRccwY@f>q{CiȞe¿BһWoYq@=fI;ml+Il~?*iώ-yxDܺW{ǿ7 x׭6L smڹ>܁syqm+3}Ŵz( ˸?#}YݗLӘ;[1E$]J~xC?VzJUO515LĀ5XW6E4'2c1dT[%v^ɶC^{FNL'oFHYN߾l1z uë@ڕ;}U5`mϣg/Gl{f;&\"Ch Isv1Cv|;{Q-㑝[OA Pz2y.O?ڝH@ +WvڠzVF$.) ë*JRI`8n%9/{$t[E k SyXFB6 Q)Gэ:Y";Wa"p1~q .ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb'57N  YST4ʜbcc.n8ccA.LW s)n f1S Lt$FD ~K91|-rzXycL#{]&HH">k#X}9\8dv'ݿgXQeXէ.DC!b\R1#츜RLu#o 0☫] \E785i[t)63F2uFgc){79rdwPk:D:~ByI3Ig uy+?&tc֙HSQ5L8[h`v|Bz;3zI%`nMCԃ`0oPs(\H t=X3i:<#jOɈdf@tH}g<xgxyBxO5n<u=EڈiQJNa3""y=[O=t-2v;w>î&ߒҊTsSя8{_K~SjچjR_С_Ϟ~VZ7?_ןCc}_t8^$HϺߓpľIEwv=<<9!/]rr7,{cW?ݗ`MFhϷ*[}J>/6cwxrJ}?ֽES4OG?K9X˄N[|5=RqbGs*Dj)v/w9A04b-A$0J+#E9:k#gtĆL rr-q>YWvK)KX|Gq-˦YQ |vx<.1Vc\pfƻTxTl6B4-h^F'2ɖq3}]qֹߙ`x y`ND jɋz7?5o,@F5`po+;hX_J:X; x}{K>:x XU__7yMN})Y! oVWgz.xJWREkB-CIz7p7&Csۆdžpݗu!H)w<ڕ~0j!ܿp'B^ajÈN3:\|}. ~ ^T^TP W}Ε ypo~qd).(yQ] Sgqǩ ^79?gv~Oq@~?W/Ԃ]H3jz :J\'sU;}'\&B lZJbx?BcUY-e~ۮ5$C\K#{v'R[.!/p ԫ M߶}=ANj}`ƍm;v7=lsyeQRdP7[լKeȑXIR<\yn8{Fp1?0Kna}ЗHq}BaF1Ո_יZ߉ßxy, Ŋdc{yǕh,?V4i}ktWnS!|ݖ<(+'q1ZKUuN`>?р_:]{}l6o0;Uq5(ocG>_̗8iVƅ)ղƸ˽gITkeZL?i#\3jP:RÐ{!8) S73qX݅6G$oJH;M-?n;Bbda +JͥjzJbX O.魬!Vf|:Ԅh C0I20>*:o2j{f:1Q22O+gvv,)2C22y molyS֎|W#%ՁqằSar鍯 AA?Ӏ^uٱLGN 2QK¶=F|#.u]*{u2dv9HNj-vBMv4jVM̭VedC4!K q5'僀VRî捠d* ۖs:ÊP>g^{^NzğLGq[avn G:qh幖ZDp),!ںF$=p5HIJOˏJ~ 8qZ.Y"CJМl7]qO[P)[y*pKt F1$J;zGQN)d䌣L.Tޏf&ʫ{+K5\+ >m@"9+ҼkL=-f}>{U̅L=E28sqG'Pٺ)DB\oHu?MM- 1qc$>0ې99N*sFP, J<5E73o2jRV z.:6tsݧ$<(J&&CϞCdL[Kj~StY<ɡmGsy/t.1ɥϞ9Ih[juݯ={y#ǭ9ZTV8~[X%f J1~h`tpDzg$v;{˷ZزyYYE3m` «0hPc}FZcq?4Z/h\40 9[[ghvVO' IޫUI$Z6X-Wc> )YGs?:/pګp9l~1d7w&@d_hZЧ?(u,Kx}f/9dJXuF186>QۗaqC}qAC*o͚%k>g鳠cĊ6{S=>(zk{{^0\M s躘Vpa;jbAoXсn=?gvwu.fd5 ~,9]3EԘ8b7JSr4}Нkis՝M͊|go{N>|L@E1FѵJukIҸyouk/x^' lEGQپޖ2`lHy{-&}s4% &2$ 4^Bq*%Bwlk<;'le&_^cF\I ^iFW1(֎OdqR)Le?%Xبd<qm:zs麖2{O>4/.ߦ4{C5fw2hJ.fqWd]W =>vh z_巘a51jL6M(&]oN?Oj;G[,:9}Տ9O=>o$ +RR8O)6H7+ni@Nٟ7F d=(~vw]쾧CNXr\ 9y<^F|loa(H&79AEن9jpyI圡[b\6 U+B>c5>NL#>hf$)_}1{Xmtc 3NF43¡4}c@BI"_Hp:ku Ã]U\Ab"A5KE+iWHF[6*o̞K-V\ڀ-{߶=:bq0Dc9*|R9z@=2z2A!*GjwKLFEreMhW}#>vQZӎ՞=AD8y/g}!P+NcyF Z.Mc^eͲ-Z[ %L(j Oz!qX7s7qLoN i{mi {@@68K:\|p2Rѝ6[8~u]ؙ43 u0bjȺm̀5=0z弖K,9DQFho,~HIssZ\+I]6+:~kLp]2XA*9[m')e j4_q^hH*ojvߵ}WPSn=IOK7w-:Dҵ$qOko'5d}608 }FWxUݏƧ1WKnRr <Fqotk!Sm/W=?? qqsUw_ާEWI_R\}4oC&ԯN4E۩-׍;POt=inhp^˦9,GK"$e茸u4@ʅ/R7ێ%/$oNC5g1>vuU{{' Sv"KQeqoO[Ӷ}tO\hJSdR'J_JV)8 _7yJaִ`z Om-gM=F6i=f jrg5E)n8jEe{o0Ls#T55B?Qsj"xLv#pO3X(^ѯ{;Q@"L20c)ߙ]b ⿨u\??r+@ySGyqhik}GXE+Ȗiz.=Gnd:I|9D(x%w?ʻZ߭8FUJ7oyʉ|֚Μ y @mzN3F+'wN?m1-> 9so[ZH+Q{tʰWd_eujL%fGzW4ΫA˔nh(_.8wqo1󶓨rKx'2Zti\AEo093+Q @ŢHAbgd'cͶrl,щwnP''#Lol%ދ/hGL@cZ` >4s^.zO}~yH;iw*$"5$ =.X7Oy].,pg*" u55uUk`Yб=h/eT!$xTmg:J"l7h:KF=Ƕ' .CWiMAg.>*_ Vϫ<8XcNxyȣ\iTӕBTU] \X=6icɷu7㦍fXߖ;g_>h:̈́m=@J%\벆C{sU=dt~Ⱦ{(e: L^[ߕ2y~Qӯziβв¾躜Pw0K15F1Is|) WR48'yvP.i74RCQ(|=~mK| 2EŘLB0 ޘiJ̵L a(# dQ S,(Te-]θX[mdn:"8X=?A+0M҃1sy^˙_kw4FFf6~9/>fO:F@?sN5Z7a1?o{Sv8CBx`;<|$;g;1%y(lJgOΤqQqCev]= [ʝW(ϛNqVߵPObi5|]orx)5D2h9'nU^ }8MpVcD90rL xI/NN8:fEz٤~Bs>kcƙ}.<A>NIR)g r]O)%阐yæD*2`Ӗη&rW#f޻i8_H)rL|3_5ՠ{]/Ww_JYk^TL&5=_d3x#jv)y}e*ւvr޹@x{:X鯪&QpD1ԝdq^TSG-qڙN6AmI >0n8±w\v})2p֬A'tMo c{?jqq׳~CwZy(=k埔\9:}_y>ZOgOSE#(CG뿎|6j|3-ׇ] ׿]?}m?dsKG>Lutt.]MzO~&Zp;g7bޞK]|[pzK.UڔEĦ9x{y?⽈wf|}pDO ZɥP)?g|}w~__gGKkP=Yt2/;7:N_!¼J~|z|i!wIһSv~Umt-?^M(n|xLּׂk6/m=D;3!xzqr޺?7})é͓źt#'?hږ烫 s?PҴ;/׾qnQIvzFv@Uopߕx毵=c>=+75`~v\]y_eFJc-^5=|_"yX1 ѵXXz$cjS>l/Olx~!î:n/u[w S?7㝇 iOl[P]IO%8S5c-M_vOPmwVY`ܩAN5`K8jjzOenG.7W;ַP7\7G EC\~6$W_`F_7//>|0"^| 9Ґ_xE+gzƛο(_ہ|?|\ҫ]ͽٿ8r=B&ƗTϗ:B/ ~_op>xxk~WG{v>W_j>_%X'+guz_Nv:Tb1C Ty~p/ր]}/Nh}.a^U<Go1Pq?o9P,4k-Y.K٫^m^)%)L"oƟ!O5kһuA!ʊ֝YO~adw;>orqzOV^Oϑ:b1$qjUr9:A~%M/~yTeTƆ+ FP|:E3 1Wɒ5^.?*?-NHS6hg}) yY|k5I۶ MR.|=B+J)=6ڎ@q )FUJ=ʚxޮr(y{<%U}8OUxӨ녿_>9&=NiǏ8V>OEz 7|2*>*Efrsb*wU!#YΦ.=Ke~kJz-=>kZیЈ//vE^?). =dU”5c/WM|coyw9$ѧMh_0|oܓ\$4u E~y?,?8G'oUSJǍ~O~ Wݹ؞$cz~ׂ`I7ᶀjB_Nk|yiͿn൭)= ~6:(\5ˎ+|/%_\./?}>\)ZjuC{J;fX|6V4v~<*Jҵa>{cbHƔ=TW >B?-ϓ_cLF_ԮV0CdoM~'(_uIð#xqKr^TOJr4ƹ[ɣq_E=z?fg$>W/WOȂfǒ\8y#''򹘾ZOz,|/!пEpyiJ}ώz~OSZSIO|}7õ#Āts wۏJ </^-\'6&t7_WZY?&KV oFޔ>:3DPVR'ӽdu)8/4')Jyqj_s`5X07a..b,9LTk3v?kq\kC 1z_Q'a{9+?kq}LC޸]}~TS+͆;dz]y~λW}bEZ|jkO}yf/ek>Ftعuۭ<3E?;J8xguwRgA\61mϖ{ww?,!O5O1@8-wu#M靷lg v|K  )M ҇1&:u.-Z ?ޱW|*qɸ78`4=QVg zPท̹xq!->X׌Z:\01ws~i8];cʟ=s.!|k~{)s }<]/᧖=fq7ƴʵ#>E-ītvo#U;'#>Qz ւaT?>,GJ|n*(+L kޝfch;Gq1|Tn)C=yj:Wڼx U~1/PV@~ Ͻ;kjzZrG}HߩZ4:gΪo-AhDyھ"ҿ>hlMW' N>Hrӯ ӭ#|_YDn+!mgG]μ )C^DyXC.'R8vs?>`Ư̞\?#8˶^z˗mڙ~4aL0{ޛU9>\V]CVur~\;st/4:?oҴB.[{ETOG\<`+%oG_ZÞեi>[Iipas >CĿF?~J|5#p~Lkٓᓕ8ҷS {M.7amLd)1̬Xi͹.}8Z{yOL;|-##-Խ~4+>pOyj^pԯ3tf rx~[ϰ)ex8j W?zDk/Sn=;,}xF>{? ⧧=9k4ԿzpCJcG<" cѽڵ/5GUAÍdŌ}/w5ɚ|.)s@{K$~ ?ֵQP}6Oo{7?7#{Bs.-+PY"r+J|Nc},N|u#龇A`wޟT>ׅy@+^ e9q[M,ӕe?es̿_?-,y@Yh^g!6Ip=Xc4^<=&1D]?0h̹&c_֔.pm2u=c끹-ҥ9ھrZf~YDr]Ѿ{/Yb⮧"}GIX9rkJu9ã=zgQ}MUu!oeuED+ڿ٘˯wQJhr~xMO)Jm_0sjL-r}w W;o guҟfC[mU}ow5h;W黮|~Zէ2|r͉*We7w?:U3z4wǝ򎵧ខ؝m7Bgw?૬mFj˟,}>78yZztff伟=[_^_  z#y?^u{ն #=h~׿62c0Vk'gU0+Mዌ|+M 񥇘%}[-8%i9n}G1 {7b,dx8c>Wf>cgw(ȧμ?Zt\\D:n5a r8]B4 ?EX~l`?M: +S:~3ߝ{fqyVǭvҜEkOjV_[zEEkP{b8֝<-8H-$+ZuOE Vy@{܃:@[Wէ2cȌ&埆+dJ~h.ɃԭiN|zykj;v?8e|7o/?)ڳwb}8sd%i'.rӢ;δFZS6}QU֋On圫;'Wv?u?]O+Ms{ww?$6Þw[0Kz^Q#Wj}C~/&\Mn* r~rpKkJ.ÜK˜q"\iJ6$xz*֞:/1>Mp_[QuenTLbqCoB@a>||W\1~OejdxWD8?O/j'[>>[<]_90Br^cÔO.˳?Ϩ4/pŽOEx+ʵͶ_/KÍ/iZQ7o?Q_.G;9䏕|giOχJ*ҕo\~937Sn4q/Sx5SKIgz 6:5ڋwǰwLk;12rBX)/VƗ2 4[Kq<;jDtqD9 6Oo[ >7{>A{=fs|wu>?.UN.+\5{0kg?1KӖxi|}5dw7K;bq{ޜ}[ i:r3]=!kPUr\wC/o,>(H~#sS8mk.|e/-ߋNܮqow_Kwzce_M|;O7~oυVz>t_CVg g˷>S/Cm/vΒʔaڹڌ<*SJb1 MM:B+:zOrk|~iW&Ssky/`eMNw) }t;ݝ˺N+lc?w?!GZ" 6ܞٓ ?}ōp}-&oJu2=28-.ZÛٚWjy#~SH?fy ݞ9mGNI>\G;|.:ſOмt|ųOg{}aD|iM\iV㯑i Uqh-H8z*0gf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb+7kNc81,Cޥ?oY.A0r7r<1&3K~!ʤY\lNVKAܮ[$nYɥcjq;5^~HkgJ'Z7I1PF51W>E.{iO4K3&A5[H;6j7$wwhU]TWbpa0J/TD8Z͆n} $BlUgnV'{U)_Fӊ92\ycs)O`Zl5b+D7m(W6 |֕$WRbr'}@xiG 5{]T~2s8bGG DPLd9uKeAW逼\陚? bu]|#tM2lq!Ğλ^L boU(Ʉ253N INGuk'wʳzK`7 dL4\K8Fv8 p&*iL d}@3ㆋ(:KxgqG|,Pȍԫ~E[P =)<\2&1E&(܍xf'߯>{srs!>C$4רpviPcBFsωpvo7e!R]S.({>C ƻ\RIK(y^4טnns?%Ow]Fev8Dn[_Mll#5u|Y.w,Lr&gW߭35Yc\2x8h#sE1OUX+=?=쯤~Hj\,2ja<@:>E gY\3$z&Su˸ 6,<*2@p!o0?ȑNQ+qdE-2Sr $ GqrrL''$D{GRDdGax۵de!*J\9wInV|}GL zrm{?Up &ĸ ul1տ^,,̚+9>qXFu )O]M0ș &\[X/83W/[K i %MrUx <I }U;hH ;C |lP 2E/"'W@eP)"q@BHwǘѾ'Q \KfHL' lǟ[ًXq5V[s~Y~bygZQJ9$zp$ozlyʀ>`Zi2@$ &Y!CִmF[X&{iSU #>Q~`h~]DI $Sfd5] u2>=>"dbjO^|g|r}?^kzN0GA>Bek.#|se{eؚYu }_tN4qy6޺GH6 8&I|KDJ~NO)_$eC6#ѼèQwgmi 8/i'>