ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:28 12:36:34 ' &.(6HH Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?ٱz~Mߜ>j;JY^>8iU/{ZoIMޥsi13pJߩo߶szK??zֳ?D}Kq~qpINggGLm+wo?Jg˯9ﰴSlƲYf~餧/ֳ#w??z"\]xfSw63UtKo:^_[kɷgҩYbIs8}SKtGi˱{qqv?Zw_M 5n6,-{߾S9w]?_.r_T mcLԐI%)$IJI$SݱJ3Dߓ~w*x ?~EOWoK+Uwչ6WM>1&Ao?Uj2 Y_U)2-'5m,?ɯ?Cv+ We{ߐ!Ml&#4Fe[XCϏ|H)[T!urUK?WZBI$I%)$IO?Hʉ?WgR[pkvF3=%t$#Pqug򕊾꜡)oq41Q{}+gRųԔ_ɬ:cC пŸwi@?Hʥ;.q?O,-MESW?wQPlWnw$ (cϧ\{;[H-g[?Kvg:wBS٦Gҳ %6-cMٟ_k-1qBJJ0;#+@do$|[8W>Mr]) ˟a^H;?>w[iue[U]kuk6}H+muZ9'^-^sq{n 8Kk=sauɭpN;]ow梢^Sg ~ىYV_.'Wu}+MvVyi|q '&XRSm chwNdO/jv0yIoTzw.~  kleo׆S_㿬*Cʳ=5Y749$vq]:c@v5Eiv}$;)ChWVQ9%` $'q}sW>FAuCWsE,oJ~9BiM>gU?#U;|G;P긗u>hyvCjn}#3*Xɯ?Bѧ;yFg\#<?+@do#%C*?DlObuO|[xW X}W}Jʶ;[XZImN +[nNrˮ8-s4;rAWZb9kw:vNVXC!wOuޯUin=/c`Yk}J9]]k"WS!1cWNJhXf1* 8ziNK*^g =) YU?sFKw[ׯW}^w8Ouߩ.{l{koamzv)wѵzv]5Yqk*ihư ~r`Ɠ٘G7mNt;-)?9+gX隻uY[{aޥO c}M$%drsGus^kh7Z.A{|>*m5mKvcoDOiG|as cr55\\Wh$Wd97}7{WK1X~JtO7T%MgYgS"F|rn&:nQ?kSVzoPeX*Oi!k\Ehڅ@W lCw7m6sKNw󌽏U_[eF~tƻpȼF5.DL}i{K@SYX,8N!~zn3|p,u##dtKi WJ?R@.\yzRܠli ҷ?f2惩W}6ӹ%Ž?.m8,;8-,G}m`QX?-]n;X=_Z^]s'.$OsHߊuiiiT;((vo]8 s~*haFY{k05:}-ۖR?q-'~V?\1gvc_v.+Zi8?ys6?GKu.:n(4 `9cmg{ {'7*3KgnjuoOӱxsb/.͉SgC܏upn,,2jW>KQK [Pɷg^r2X 9I_Oz\b^{6kNs`ka2Z !pQ)v=sN+:~ڻ6knl-k˝vEvli ;4Kc r?XwLbָY/n\{h?I moJ,cɎ»I7܍~`uLb6W͌"C6ȷwi+ ]V@n1WHs9e.Az x6;[|B# US.{dߣݷ*!vd=H824wZ^@F<ջ]A? xeΰ9oɛ\$zMZ?\DH{ߥZ[7cK7|mvLDHghLYւ$?-9"O,@ogg$w??ӱK+h/i"eA>@kIGYst.Q}NDV, ׵A{H=#Ȗ9hpr&  !*١$u#`~ k}IvgQC>C$ ƺwMD~ q4ևu|?'빻۴;v}%}C0/fMn.5[Zƙ.^iunlOD*5K}v¶5{-c 5n\f]/׻p\pƶW(@q<-ʆɌ ]_V?:V#lخÙ'Qef>-?TӲe^.{y&ѐc#]%[}b;?_Lv-`)%W6G 1k,mpXs_mSj>&Xf=vG:}̬װV1aNu[f`4x^b(`7go}QxIxx>7;VaU;18;XO m$xx>YMc;9U21kkh^ڞ^{OExRJhWa}e7ic QeWu?Qū0ckm75;hus>?}|"(\~^WUŭcnT{λ[B^VFBFѯ:{[gu?Rs12rKŲEҖv=xI ,Photoshop 3.08BIMZ%G8BIM%}Ǿ pvN8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMA 'strass ' nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong 'slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong 'urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM   Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?ٱz~Mߜ>j;JY^>8iU/{ZoIMޥsi13pJߩo߶szK??zֳ?D}Kq~qpINggGLm+wo?Jg˯9ﰴSlƲYf~餧/ֳ#w??z"\]xfSw63UtKo:^_[kɷgҩYbIs8}SKtGi˱{qqv?Zw_M 5n6,-{߾S9w]?_.r_T mcLԐI%)$IJI$SݱJ3Dߓ~w*x ?~EOWoK+Uwչ6WM>1&Ao?Uj2 Y_U)2-'5m,?ɯ?Cv+ We{ߐ!Ml&#4Fe[XCϏ|H)[T!urUK?WZBI$I%)$IO?Hʉ?WgR[pkvF3=%t$#Pqug򕊾꜡)oq41Q{}+gRųԔ_ɬ:cC пŸwi@?Hʥ;.q?O,-MESW?wQPlWnw$ (cϧ\{;[H-g[?Kvg:wBS٦Gҳ %6-cMٟ_k-1qBJJ0;#+@do$|[8W>Mr]) ˟a^H;?>w[iue[U]kuk6}H+muZ9'^-^sq{n 8Kk=sauɭpN;]ow梢^Sg ~ىYV_.'Wu}+MvVyi|q '&XRSm chwNdO/jv0yIoTzw.~  kleo׆S_㿬*Cʳ=5Y749$vq]:c@v5Eiv}$;)ChWVQ9%` $'q}sW>FAuCWsE,oJ~9BiM>gU?#U;|G;P긗u>hyvCjn}#3*Xɯ?Bѧ;yFg\#<?+@do#%C*?DlObuO|[xW X}W}Jʶ;[XZImN +[nNrˮ8-s4;rAWZb9kw:vNVXC!wOuޯUin=/c`Yk}J9]]k"WS!1cWNJhXf1* 8ziNK*^g =) YU?sFKw[ׯW}^w8Ouߩ.{l{koamzv)wѵzv]5Yqk*ihư ~r`Ɠ٘G7mNt;-)?9+gX隻uY[{aޥO c}M$%drsGus^kh7Z.A{|>*m5mKvcoDOiG|as cr55\\Wh$Wd97}7{WK1X~JtO7T%MgYgS"F|rn&:nQ?kSVzoPeX*Oi!k\Ehڅ@W lCw7m6sKNw󌽏U_[eF~tƻpȼF5.DL}i{K@SYX,8N!~zn3|p,u##dtKi WJ?R@.\yzRܠli ҷ?f2惩W}6ӹ%Ž?.m8,;8-,G}m`QX?-]n;X=_Z^]s'.$OsHߊuiiiT;((vo]8 s~*haFY{k05:}-ۖR?q-'~V?\1gvc_v.+Zi8?ys6?GKu.:n(4 `9cmg{ {'7*3KgnjuoOӱxsb/.͉SgC܏upn,,2jW>KQK [Pɷg^r2X 9I_Oz\b^{6kNs`ka2Z !pQ)v=sN+:~ڻ6knl-k˝vEvli ;4Kc r?XwLbָY/n\{h?I moJ,cɎ»I7܍~`uLb6W͌"C6ȷwi+ ]V@n1WHs9e.Az x6;[|B# US.{dߣݷ*!vd=H824wZ^@F<ջ]A? xeΰ9oɛ\$zMZ?\DH{ߥZ[7cK7|mvLDHghLYւ$?-9"O,@ogg$w??ӱK+h/i"eA>@kIGYst.Q}NDV, ׵A{H=#Ȗ9hpr&  !*١$u#`~ k}IvgQC>C$ ƺwMD~ q4ևu|?'빻۴;v}%}C0/fMn.5[Zƙ.^iunlOD*5K}v¶5{-c 5n\f]/׻p\pƶW(@q<-ʆɌ ]_V?:V#lخÙ'Qef>-?TӲe^.{y&ѐc#]%[}b;?_Lv-`)%W6G 1k,mpXs_mSj>&Xf=vG:}̬װV1aNu[f`4x^b(`7go}QxIxx>7;VaU;18;XO m$xx>YMc;9U21kkh^ڞ^{OExRJhWa}e7ic QeWu?Qū0ckm75;hus>?}|"(\~^WUŭcnT{λ[B^VFBFѯ:{[gu?Rs12rKŲEҖv=xI 8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$PFQ~ ~ I$jI:tI%,E2d&M)$HI$I$JRI$I$I$I$$I$I)I$I$JRI$I$Td$$$$$LII2I&NJ^RL2I$I$:I%I$dIK:I$JRI$I$d$$$I$I$I$$I'L$2xLI$2I&NJ]$$$)$&I:dII$IKI$I)I$I$JRI$I$I$I$&Nt'I+$tI$I$I$$I$I)tI$IK$tI$I$I$I$I$$I$I)I$I&NI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$$I$RI$NI$I$$I$I)I$d$I$I$$INJRI$I( )I$x Q> AI>x(!$I%,I'L$I2I$$IL%)$I$$$I$JRI$I$LtQuo$gpIK%*B;1{+ **>?rqQ~aiE38GNܚT%3Ke#B$$$ILHRI% 2I$铤I$$I$I)I&NI(ƳRI8a<$sWm~J'8viIHRjJO2K R!IĨa%THN‡;I9iI,LׇpS:d RI$I I$I$R'JI)M)%I'I)dI$$I:I$I$I$R'L$IK$IL%)$PUߑq Uߑq S?F'qOD*8y$IFRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$YwKNYwKN/6f?Go'+'$I()$I$VJI$I$AJI:dI$PI$I%)$I$I*I$I$RO I$RI$I$I:II*I$I$RI$I$$$H)hNI$I)II$I)$I$I*I$L$L$)t'NI$BE$$I)I$I$ RI$t"$IL T% I$IJI$I$RI$I 'I$I$I$I$$I$IJI$I$BI$I$I$I%)$NI$$$I$I$H)PtI2tTdI$RI$I2JRI$2I$'I$I$I$I%)$I:dJ'L$IJI$I$RI$I$ $I,NI$I$*Y$I$IJI$LI!II$I%)$I$IJL$&NVI:I$I)dI$I%)$I$IJI$I$))I$;'J@W(p|$˵)"J[Owih7~.=nB|0QB9Ͱٛgg?B~-c)[ϼQϾ5 BU><a슘nVmpVHhx+xs)RA(+{ 5VЮhbD'-[Q$ׇh$A+I$I)I$I$ %)$)(g0$F\2I?Hp%ΨiG~c[DdgXU| M'o}TԘfK"<ꘝSH5o'Ng^UJܫ4TPxT\yMʭEXxIsV֨mG!"HݔĄ)6HײAp8Dd!Y>J%!TӤ-uSkÄ$I I %2I&&JI8|>NO`y kG[k)%6yF;)Ӡ>T Emf&jPr b tI )*MׄTI$K 5hc9$x S!ՍKaN'NDhpCqP>33YBmN2E<hA)Lt$r! IJ"ƸKH?Q. :$Q]O~ITZ J;Ll{1axcU{h ַ#B"1RQAAxES**[ u%- . j.WV*'mIkX5*'աTx-SZ#䝭/j鹺8DQ8Ʈ4S hGkE_+pp2YKwSmq︠iB}N[))tK^?yxLp?qKct%2ID˛VxL};ORS$}F~^?x}2I6~⒙% ; oo$oK~⊙BI>I(>)A?qIK$#}x$xQ>$O[]~⒙&M# I>xߺ~⒗I7xKo&I>~[~⒗N3 Oߺ~wI(V~~};%2Lg$l` Oߺ~ct%.oQ>oROߺ~~J]$ޣ?x}7xL};OQS$}F~~{x}2I;-?qIK{|G'%.mxK{|Gޙ$]~䶻.mz[>$]~xM>g&I>~[)!J>?x}/Q>$)lwI& z)zouqILB߼&7?9xPIO)⒙P}xM} ?uqOJJ}g/SȞ︥{qqEIRA]pKgA%?_gI!}#? }#? )wR-}%%I pM8!{qqKз$/g/g $OBwSz$8']pPIOѳ ?qqIIRB]pKTgA%?BwS⒒?3g $O_f$g7ҳ$[ѿ)7+RdQ9'n$+ѿKY%jmBeTl/ߵE_őO5 JU?_"_E_Ñ放Ñ攬)0E?焿lܚj H`DSDRT[{S~&H?O7+J›*_zɧNTtܯ/5?̿/u8:oʧpOUIYry%aT褳LT]3SxURVefܗ켿/E%8_ʧrtOUIZroٙl5+ tYܪ LTdjqr?FP=3n5/?]UtP$Ktہ7_.ª#7пJu:P?Z:HtWIuD_$:.iwSdΑ9Dnjn7~+\@uQRkbrѱ^v5X&L2wp%birzwՋ~C[di/=MVzhtmUlN^]{>=(7bײַ'aGM۞}Cݫ~{}C_uÙ.>5;[[[ĻTiRǕ"Z'&$$'I U𒔙:bVaUg TDPKV+$hoxfk+ !I'UOodgJ MAs 5N9E!s]z}-h;.gf^\ꃢa ?SuG_8n/y#TFӡ^j[Adw[x?\a"{([Ch[Hv}J9!ú}(ѧI A1H+S]+5+of7972Fo7; {vBB㟌/4w.C(6n#GAr5^=ϒY! V.S*6VZֈm{j &Hԫūָ\2cwGb/PhwAI/ul2m;ӻ\|<qp%g^T JmP:h Q|Ʀ!J |B$-&جV`J* &rrW* iU+:r0lʰ/..'cb|I+Y<1r(WV9䟃B){C]'梖AD3ʀ7XHl;_Ob1 kAj׼]Ckk}ay֓/zd(.na~86pR;-$/h'ȥ/[pg\kj@B{n}^3Knw~g$\% 2'C> ];iQg^{$ϖbNB>Ro*yCߏepDBsS^%G_']qYCiIW-赶nsqa|>7֧d^} } oEY?\S=;$CGKUJuH>L̏g%67}*Qsʋ` aU餜z h!O)E RH$)Ja%,I)44p"+QPX L.խO-,ޝ3s[=CW4s^ژP' d݅@eRuKZߤ\Eq{ǘ;wgoOj)G$ϊ OBo+>;'lp<#P|mqHy{3Rn ѽ&Ox+~i-H|oqcs^u]xCv.XP"#b}Bx瞋U|Q7i˴^ȗ}ru.o~a`{7QM-wgqr~>E`r:ӮS݃%X e+䜬vX~Yw?@[gjN->`UvQHdTTe0TB(d:bV| .\cDUNg`U.j[+nސby笞aſڨ2"ovSpo1O.+u}2;ty_uֺ߮wv@1ϋW'*?r U 2d*:@MO >;:Ypi>?.7IE$ гv񵿎W)olV^AVf~%="sw6 0jmkOORpT>?÷ T-IpjnS.skycii=i6H\~E95ZC~/@3Pky.ktzy.v'%$ r:y&^C>uL7inO*OZ1EnMd\;WWꚱߓ^1$]^Y,ϭkEȝ,Ϭ_/N9/@^c,.[WMhZI$)2t'I$I$t$$J66.!v6.!Jߟ]'IWI$k$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I~ʸ^$ ׌Rhr9wM?Wdm3~gFC_@u?'&z&xx*:~[&"&Gޑ =ާ~c۬&|;j |%r`y}P;ZOH~-KGܝ&zkx@QS |'OP/>)?zv'M?#>r@)?urg6oܘ5}xM?z^K R[%>}k䧇q'CpL\{m.?>䢏oܛk|Gޘ#DxDʎ$ [([$E߹Gk##Dn7F]攟?*Uoܞ)Y>W߽g0?)>r@)P9hEE>k}-O'F~?r[ȍ)x%M# & *;[J@ʖNR?ԅ-MGxPRG—/'%mĥJP)8<'}GZ{r{|P2?C$b'x)' mwo7*Pu~'K7U!w (MOJI$WTK[d*~P(g9>}]>JE4~%JiyE(SF<OL3(H߽/4oކkn}<>,4WYiD =(?XߙMR3J>A8!sNFB[O~H߽T"6zɿQ@kJ[\Ԡ~{RJSN]=GQ@YB^?<}~{)}K\F5xZ?%6#*1}~RU@}>6']G9"Pjc~SGm?WP@P@}Ki@OOޕIM~S??wmuKnu9)l*J|}j.)~x}$ΡC#w;BL ~IM?~'$~uQ? zgBL *OI>ghwܟmg]<9?iJe4OUrqF䶹?/x>? B︥63л(OS M~Rt~+ClgwR@wQ8w)yUڸ߾>\oCU[ Sд?Q?]QBcJ}*\oM[ Nq?u~-лHT]wU)]Ua7Q}QUAC[-Swܗ]wUHq_8ޛ/kNy4~ۨKi?._G\?xǒ~S'Ab~T{)͚qr[i?߹i.qO4}[xT}mbo*ʹ~~Of7ZGwR=S.?z^O}QroܔR1pZT:.GT@︫(Oe[Ggm-a?rջP_җۘnco*.)}m-OտлL~o.WR!'T?nboޗ_*0oܘ2oܵ?W@wVB︫xk(qq{X%T%o]Ci?/;Oު~167CSoP}QG5r~?z #~F.VU}~3:}7]~_J]~80߼$~xKUPo~~Ԯy)OVQW'Hxf/ /<%VC?upH5[>oGKcoEh{-eg,/_3~ U0k?up[)~3r`_ +~ UX?5pJ>?/WDR_f\ͭ_+~ U7}8k|Տ4kOSg+~Y?ҷ QU}a>nHA꽘26Qo=n,7rx h}@Wtۼ~tgoYx ߼%‹q s @?;}p-YJO];+~[G<}sKZr|e]>oޗUa@Gܶ꽫GI/տs%Zzf֌qk~ K>IO}~u^$?sZY!‹aW>*q]K> 7_u7qiCU 1i%IWG^gB.:߼.GԾju!Ė bXZ||CVGl;c}d˦GYkmbx#ɮZ i}ba cooe~tX@4]W.ӺT^U=~s+Ҽ*V ʹ{tTltCBQbD񪋠>)͠*.tBI%&s#^feӷݧnWY?ܥ912Lu%ԏoKk?몃?1Z,ˊD2BwּfkKڟdqIu?u0OAXgo HӿI`;(%c961ĎSҸ$N}J\ٽٗYS >1k?$HbθáVW^w[;ڝJ$EϏU_Ə+JpT4 \(]1NrejVeWT2ݢL7p];~t>__\a;?|TYղkﻞ|]%#M=[L@ߟDK~>T|jrҿ*[,;Puqƒ^Wn@Z~l F'l[j%wKR,$"xQ\V*& .o^Z*% e~I{uXqpuuP#Shu2]j<`l^7.wᶯU͘0t?}Ex 3abd"4L2"E MpOtY%gT`PRJ;x]pUo {Gi.#nSX;MWnhk$84]Y45?E/k'?> {@؀O.['&{Ϣ 3B ob1{Ɨ;gCg{[#^첦68YH^s~%,֙yh<a%y`O-+(tӟR/="DGӺON>#Y*_tMBM.GedgYO 2ϭshV}?s(g'>wZ_V ~1 'OD%=~S74￾=;,? 6`{G?1!"4xkjj!Uo+sVmC'}o=y]^ZUV_Xo֦Waնg~l^[lAn-Us3/~k 8~;T` G\!h!S%B@ILy'Bۣ ~Qg A?5 hh I$NLI$I$I:I%I$BW~E.W~EéOqr7Iq HI%]I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K5Խt8gMg/]2|#'OKL*_hWOSK{}8IDFB^_hSI>?}K?}$g? }l4)}^dS愾O6OY8Y8}l4$qFB"J^^dR/愾G*)z/V8WhKЈoGRlHI)hE_7h?5)lH󊐶8$q1WcQʂoGRHI)jcl?Hx?rVw%# q cOj<}?DBHp wY= rS}(* ,?%?y%9$+ z:d??z_$%^K $9q Tz/Q$ІHW2D9(^^E 0+Lp1))^PI RR?ԢRR^hI RR?ԔYJRVzC?Ԕ%RI2?ԔYKrI_My% BJ}!^K)BhB)(I+/Tgԉ>䔯XД!~Ω/"KrJ_> z4%_Km>r[RK)(BOKu>r[RςhJgSOEܖ䔿|z(JgQGDܖ䔯] zI(CGG7&.GE+w^>%?}rRR޳JÏ>"SJ [^P8K8>RRޣ%?JR'J ,nHc~yJRS<Y Boc?ᜮ췙okF^tkrv4[ۮ*>|Sx;N?> LM=ƪY/䪣X!IDFIO I& #aA΍;1򊔙:bΨN6{k§9G H]wSue',G;#04AUŚ6QX rƐU5yZO Y.XkV&T,0R*iYH6F<+Pu+k 8xVVCiwP &բ~e*{1箠T:#,J7}륾Y3n?9s?#W rzPɴ-f?νļ_L}<n_xvis늃2Ȩa?L[ xƣu!zl)?H[ۣ T#R}Qhc.M@rBk f0I"tDĨ yI$vFBV(:Q jbGɭf.r ni V4$ mp.'*۩C]mn=s$ :Ƚvy[ĵ,w=]mzΪ¥nx`ʁ[4>`ʰDxOQt4@4lwGzܯ!1';DJ\ki%ڕc!J+T A6Ӧw( t4U;j1?TZ )/?tEԳHTN#M\Ŏ!øsKYMZ.rEfl~#eإר7եņ55{o$ܗ;~!Sp+KTX!M(3$1"HRRLShRi)$I$cGܯ[ik\_02} ΀~jSiakLdAy,sI.of\ jiHˈ)C7ԑ3zQ4qs\I9WOaݠ=KGIkcV䊣XIA=U91nO%.:Hp R'ELHI:d@@3TAhYF5ªl$VA!ZD굱nsvi|MVec>n1Ѻr|VT4G~? ./PîُhZ5.GFwޣ SǻvꭣR;u::&f:60oVoZOtFOWr/.~,}X˲ H6t۾}ub?W<UkI$ҒI$I$$dšܫ}o3 ~`I{yWzͶTjI_m롧x/a^ﭸߛMRM|+UXN[cʝjR'4?)-YVȡ&Ŏe.q%2yqZd?< !ٶ%ÖT]uu6cZֈk@)$RI$iI$'I$$'IJLI$I!RͿ]ͿR5?$ A$IFRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$5Խt𹏫YwKP/6f?Go'J~ hJZ)M BtRI4% IKR$Д'I%/)JdКI$RI4% IKR$Оҙ$Н$)Dd)$I(٨V\gZ(^+>z+R6 &%=fI$aɬv57ڢҤRS">LߤR 'ӧȦ'~H%wJeC[!I0sQ ;Rڥ) R_A~)v1YGIED|>Q.L S"SQpf],;\?|~+/<Y%JR߶_m" PT[n%qXI%J, M% oJ, ?h?rox~划*,64<?r_1],DWajcK?划J,64L}~wܱI\EҦ/.I+RDlo}~WܰI\E%ȉ-a=-%g_pKHR=-%g߂FCr,dIs+w)$GF IZK ©nw?Ys*FRϊMmۧ]%nwEE|B^DIm~ܧ]%rw*I+^DIm~ܫ]nUI$q~K>(-ە~qzI%q~K>(-۵߷+tq~K>(-l_d$+gM%nwޗ~BR il>*i-lm~)%J,6ymޟp!)JXlKSIk~~m޲RI\E4ymR?sY)$"g[Z߷~*UuQfȓt\_YaROa饱M1]1!S?dx`n+N:gAt:5"3~?tⲒFq40p}~?޲Xza/L)?nRyYrJ,=0Z)n)JJ,=1RljSIi7)~7+1$Xz~e/Lynvo%$e*I-/ۖ߶}$)IVXzc/LymI/wIg$Ly5$E욽G4Xq?[o?(2 8AԟJ#Y?gܵ~ckďݶI)~C;&E__` 'A[=Ku'3_v(.%3cg\v ?o?st5Tښր>Zh|ν^#onc'UK,t:#IqӎYPA3 !I$=!ȸQq)cO&)$USq9$gZ> G7Ā#TU!(c \dwa"8EiFa3Rp{ ՜jNO^#@>h((  6y?v5_HQ$sNLkT~cPbL@IVgFe`InmA^ 'QtN%Tac"vp$!.)NH G m;!))IGiѡL$L%hĤH|Uv=W*Jas.ŪߦcǕhD'&>( %#+Go%`Ji+!L$TsK*A%A<R㦾*$+vtU^A ʵ(ܪ;rlyvI\%9vx'Zn׀f'TPp4DXI%V:y$M J!IK|8Sa<\p4GJ[NQR$AOCGu wr^$ 'wZ)n"tKtjKWi?ݺ (Z0䙧I! G Rp+`1?J;we3O#EH Of;DD~ +8RE%0)BJRP)JRJZԥ)QI1ЦJRSJ2)IKBP$I%- Bt8Q A%1!1R*%:I$I$.0ϚYUg'ₙR%ସH HS/RC)G\(ciU؊~IJsTC}ȥ@}$E-|~5$,G G|ԏ# vT!RJ5_"E8HI2粝ܚ{?TI3>)&o:AqG3\úppWV3WEN'I$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%zGab]ԆSʹu~UϤ%7B*I$+TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Hγ":ʒHOĬ~?C$D;"3#8I6I&NI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$"6P?Vr6FQ{9&o#⹕Z[<~ĤXEID/q"9)' t% ' *ǘ߅P*S$'LdA;LuI I$sꞽyCSiE+t)ce =]JɟuG<(΁4O%f9G/UG F⊐?M; 5^-°#T&PC4@}2Ҧá 1PDm`); 91 w:풒; @)e>$H$$A 'V£]6ʢ{B* Itf<5 !HHRI$N⠈JI%: FH >UHX8jP5NS7ȥ)`S2*!Hk;|R*N&U!izA2Ay@p"B+w@Ӆ]ǂkL3<$%&@'L hF $H WLFƩ Fa=jI윕R'IX U$rH9Y<&'%8 $a;n !GN)mgU&T)ƈ$N/h1 D1ۻ&4d\ ^RiAxJCDvW]TJ :$O~R'_$#D(9T2`"Z|]()xN릉IN|B$tN<"$JBU4T۩\RV"Y¼Ѣẅ9%GaDNTZc;̩d}%<>iHS ~vI$ LI'I$B$pI$I$)d2I'EKI$I$I$$IJL2I'I*L2I$JRI$wo"swo"ᔧ~9?$ A$IFRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$5ԽtYwKJ?6f?Gઊ۸*I$j$I$J]$I$IJI2I$2*RI$t$Jd'I2I)d$IK$2pS )bTHRHN#]V~JgG?e[ܥDc}'|RFH(7SP1>~ G %h(p(1ƒ*cI]1I%w~UJQ]I!bPޏ %4HQK9Pq.n@h ![R>P(@E옟$t09N`iLiRdJJW̫6㢬(  J>{GnI%=STI#Up|$A#+U=P{" yE-W'DWlGbe#2tDI!M`(}.pPI$$I$I)I$I*9wxHUgܥQ'HRN"QPj#]RS7!%þI7LjJ\~IG9Ly4ZC?-7E|k泒I$X٤I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.Fo{U~g+ѭMe!|7Oo&g [?[>}-j29*PAPD[I#^ `'$.I'i~r5%)$Cʥ)1 ₔI)ĩriq*RI$T5TW*EpYAjF  8)`S L a 4IKLD44ADR*`D"1 Ys*'RvEOnSVNI!tÍ;}$$Hv05yVOrW()qt$3 IDbH]$DO I$5$+u R lD$,P' F S;% H&'O$ӧE(DI$>JMP*9wZ3I,+'Y< .OG.$Q~* DwCb#Jf%7(7Ȥ8/HpJd>iGWC<!N$J)$M?=('Lu_o">~  ')6w#>stI$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$G?VGtwR K?_sKu3}L_z*I$+TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$H3"<ʒ]׿ qS+>?FxJW5I'1I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]CUWѿ">yZꦲ[I{~3>\kltZ1‹\~NdG s'Uj$H1U-'ܫo08NҼL0!L!8IpG~JI%6+lrQzS!D.FdJXI$%UNUSjDj.sRC$Lf hqDrgDvAJI$,'YXx]~ :I'OD!N"JRb'#\.=Dit$4W( T)Ɯ)AD=O⒙T(ED+R*`yDjMb4NN| &R]$ݮʲj`ZfIIKnSl68ē^P E)NHiHTI#բYS\M 7BP{Hp:!H ~DHq}%.HB%pTڒ1IN={!‹B v )DgN I11)3PR$0I0>-|QJ$-E[q j\RR Rn(*;qH{"xCpS'4>%S&$c})^qI$I$I)I$I$*RI$I$I$2tTd2I$$$I$IJLI'I$$I$I(ȸeȸe)n?ߟNO&7h,oI$QԒI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$5ԽtYwKH/6f?Gઊ۸*I$jI$I$I$I%)$I:dRI$NI$d)II2I$I$PjELJD(eM2IHb1N}5R]V>H?+'W{JRr.RU%1 ߊpQC;S%T(|'IKw#<sݒII$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$:7Qbo># A?VW:.u n}!(,CQI$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$Ey X~TDŽ w'V']|P-r~%buhd["W̡DY$s$铤I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$g#|?DXu/|MeCo&g _$As _JĬT)hk:TCq4AsND YUlYF-,LBD1 hTHRI$jL+I"3r੉ +"Qr #„R:`&BCDJY A3y´[+60QhyI I%!9)&FI$Bo`>ʀH*NHo<4RbT悔I"<ѢA$Fjժ") )(9h)qg"8I Dn`$("6^>*+HgI%MșQ:'zcA tIGyF|uR?)$Q|AtV¬ U3 RtЊ%z(GSbHRI$A)HFI$=AZVhU"Cr"(N' 9riDRIRj5%)1RLT_D|]' -L&qH䂔I%; 8; B& e;G#)6R$#StRI$ZW ~j}R (m1+W)=jugR}$3;8QN9L$RI$*T%?*Q,S73x ̈́DŽ6eG;|Pw9$I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$It=(\z7Qb]ԃgd~)us]j FAFI$EjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I?*.'()1:gpWNOĬNV?:SC$B%\|W2RI$6i$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KG/Qo~T.X/Meߥ ,AJߥ ,C湅5vXcϥ)ql(%8|e&;4('L Nݝ䪖$$El5IL'Q9$Dj\jVHYEJ.G&G*EG)` ӎIR%Dtә{Uo`*e&;0;S CO0B$aoM391 Rd(< Y@ARI$FlQ:& $H:&N)RI$UU0\yI?&>hA$0ʐ70S𘩄;D14k`@Sb mUУӕH-J 8ӄn)I$f+/3W$tF("1)$DHJdJI%bG%i*Hb* ȣTi)%A2tǝpI(%BxR`Ԥ\5R */D㪁PBH($萄()tT]c")!A ! ?zvI$QE EK$$ZnJ% 8D8hP?T8Dw*#6GB `wEHVD%G$H)*t'L%,tI$R$I$JRI$tRɓI$$I$I%J)$2tI$I%)2tnmw\2nmw\27Q'qOD~7h$I(I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_5ԽtkYwKF?6f?GપӸ*I$jI$&I%)2tI)IL2t$I&IK$II$I$I(Iڈډ))g!9HEL@RL#_.k#菊_.Ώ~ @{|;U%,mR 67GpQJdxQo*GI?ș&&"M %s${|JGHSϤk>HbS;8L(.t3?*R~ʕ)ŇVo:goDV?F> %SefIlI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$EOD?*E?Q:K>_5K䚿>i_$!\֡Y _qc :b8vMa.9ʃ;,I:gun{f#KJ:("Q[ЊC$Iy'j B;$H*dnRQr eB>W0 :%3HRt<*׫^򂊔ŠC&~Kw0H$ON k˜` &NADQ\!<)dxPFD(PP@y iqX6(&*(ƁJ Hh4ԅ'S;(>bP, ş^)(0N`j_i\ $H=I$JI%bWZ!ZB!!b2OdR:u~ɎS :dRj*mIKǔ1AJIUr0N8Qp읩yE Eh.(O=H\'LCvpI$@I&$|J$-jJ|ʷT$Cz!Cz&Z|K]*GPIE&`QPI2 LA$$%):I$N:bI$I$2tTdN$I:I$T$:HY$I$&NBW~E.W~E)qr7I1 Egc8I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%1ԽtkwKF?6f?GપӸ*I$jI$I$I$I%)$I$IJI$I$RI$I%)2tI$tRjCj EL\ !C)'LI$y@|UVrk#_.ALG{|)_%`)%KU%,mR Po*n ;ʏt~~&~w)N{|<GNk9JV}$T3NSڑK$Is9cRG([NfD(:2byNdg>>w'1I$I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$It(\:/ab]ԃo# J}_+-\W|[W8TUH| 2 >dI$V$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$q?gBEy%&<'LWP~%buFr~%bu[ oW2>efHI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]E?Q:K>_E(N>dʚKW=K䙟M5-|k!k`40LSV4 )DQ~rI$*Ul)-+J VNI"'4ϚqE*I$[SrQr(!B`'%tIID($2Hʯ~ H(0&JH]$K\TH|PR$D($ ׄc $- Iܩ$(8`r4(!I$ H&"$HUU?jಋ"{vKϞQK2vVrĔRQ( F!\R*bTTMI Aԡ$E7t<nHH RI$lFp3`AJRt DC ^;$' 3ҮPR$0M> I,$kVTWX77U2uDE(l<?wS9=)`8MoQ~#H)D)G)3󿲓~~3?;))N*s}ߕ9SW+9EL_L'8PR )LI%f?gMBYcRKT'Lu_cTl|Jz1GAFHo4,o8AI$ NI$I$$I$I)I$I$JRI$$EK'I$JI4DsJR@JoDƃ:`JbS'I:I$I$.mw\2nmw\27Q'qODVv7hI(I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_1ԽtKwKD?6f?G˸*I$jI$I$I$I%)2tI$RI$I$I$I%,tI$RI2T€Sg(2T2t)t>ro#菊_Xt#VX= ܥ˿,n]TTMoopJdxQ[MMD>~3;)((~IoGHUMo)&TzLE8L R$\gXT'}?5XWCu H6/XW:.jR |2 OQI$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$Ey X~TLWP~%buF}#+>:Kd |jP"̬ԒI6i$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KGVg*D?TK?Pe?M_)CW4HVBXDb1G'pPb4Ol-;!I$/ v*IiRI0  4Fy$$H]SthR'EWjTФH$,47";E'(!I:ERBv΁( QR *Ax)2Iۯ}S8$>I3"8w(O%):d:YL O_ ]$FI!*RI$_ P4?ީ֮0 B E(DΊ(QQ<I4 x,oPI2 LA$$JRI% $I)I$I$AJL$NL2I'IJI$N)INtI%,I% ] ] ?iQ$p-Z)$J6I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$1ԽtK?wKD/6f?G˸*I$jI$I$I$I$)$I$I*I$I$RI$I$I$I%)2tCj ELJSrNI$L #菊WXYD|UJwLG >#''>7.*X&I6"6$GpE[a7󿲐MD줥K${|&'QS&)d铦.t˙~ʕq(M|*VjI$DI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%t?D?E([%MW4?M_5̭l++%k4Xa1N߿~*H$ K]$UVd;VDIC EaI I$@OOdD5.IR'DiW1 (&NrSfBiB$yNcNR)$M @׹B^{$$:%GEfpI)BjTTI#+LZ+D"j~Tc@=ժD$1(oE(n nԡLQKx)N'H\ b kT‰$ )T|P %DA L1JR'HA I$8 CRNgR&w%Nbc.IEHj%$Td+]U }[qTPQJ: G \g;u r5G B6GM) j7E4I $I$I$I$$I$I)I$II,:dNTI$&I%,:d$JRE$N:*Y$.mw\2nmw\27Q'qODV~7h$I(I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_1Խt+?wKB/6f?G˸*I$ZI:IIJI$I:HRI$II*I$I!I$I$JRI$I$I'j Cj E+9 9 I$)dNTo#O/@?K{|)_%`'r7.ywQRQH(3Wpߤ fxP*#7o.C77󿲒~I4;|*&/&bd'AL'IsycTi>oXT#x 7mTF> _͏NMdbyNu(;„w]$I$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%tosGKl_ g.qt}[+-\RU!(5!($HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I"<ʄ??*J LS+w'V'^} qܟX}{P!Ւ[ oW2>efHI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]D?Q:K?PWED?7/O ~5L|Ic湅CVZ'0LSEp1rԞvgd$A"ʭ͊-+H`J+"+<BI$`S 㷊pQJI%6j!=Z4!!HoDCzPtSrEr:`J! 2T HRQRM ₔ&N A$I'tiL<(%I$D P4E:wB$)$U+Eg!I$I› RI3O%UebTD(܊L&œG* MR铦N,Rk@%ΟrK&5Vq'>Bgs)C4KqSdAJL1L6 azIJNJX4')PBI$PTI$Uk+uhB ܢ7rJ@ 'L )$.I(&JqEJ SǕPU0ȇ<$:G GtU x(!I$L'%('L ;]杒 I$(I$+VT$PވPܬL(I(G3L9FH>G(B/F=BI"IJI$I $I%)$NI$$I'L,:dNI$I$d'I$R$IE $2Ϳ]ͿR5?$ A$IFRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$1Խt+?wKB?6f?G˸*I$j'N$B$I$RI*I$I$BI$I$I$I*I$I$BI%&&R#tHI8B#U>*?bS:~ SHIXIQr/wR(PMo&CoEwMH 9D<(|"fwRIRUا<]GDSk9IL^rLQN:LLsYcSSʖoXUNao:f 9* 95n%%w=I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$KGC ># J][+-\WZĂ $I"I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$??*./()1NܟX}{P-r~%a@VIl%\|xJI"Ƒ$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$It] /E,~T.g"o|*oVND/jOo&鏚沖"Vd)gLH'Oq-2*iIr $`U^?*Ii]$PT ԐIMJbIԙJa$DBtYhQ Cz"ܠuS>JE,Bp'HCrRd0(7o QRp8BNt7DI$jAF@>eHXA*I$|j1 JI$vjFʭVgQ)YEEDDN' #8BR铦N L!ځR2vL~:$>G@ B7FHA 2I :dN 'LI$)I$I$!J)$I'IK&N$铤$I$I)J)$$RI$I$(ȸeȸe!n?ߟNO&7hoI$QԒI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$1Խt+?wK@?6f?Gø*I' &NI$JY$I$BI:I$IY$I$I$I$I$RI$EMEg!G!铦IK' ,>*\[#UPRJ~ )9>/wS9>/wRB5p6$gpߥEwGxP =$9wRe %\|I$cHI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$.g"ogt??D?7'O ~鏁Oo1\me-l/+a2tȃPOF GEDO N$>VFҺI$҄ĐIT$DfNT*W 72Tʁ%A$e3ġӄh7$d T&N焁)|B$@.ɹ4RtA*I$ ࢉAx$$H:EiA I$)7*?DTRIXjXj\Qr kSS8QyIKNS$9P mԊV<9 5 I2d q1 |R$#V"'I$SGQw URI$Jv}Se)$V­W:𬰘BS*R:J!CpEK)(S))I'L*]c] )ptn vS { I$F\:~ dp>$/]$wΩd`(!tI@(E*I$Vk jcDCr!Cr\4Ag<ƓQ< %@DpA_zAXW:r_J7G o$%I$I$RI$I$I$I"&NI'IK&N$铤$I$A%,:d$*RI$tR'Lwo"swo"ᔇ~9?$ E$IFRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$1Խt ?K@?6f?Gø*I'LT+II$J'L$$$I$*RI$I$I'I$B$I$IJI:IڊK(G!%JY :GN_bd}T)3|o?K{|/.PMwop}$WpϤK3€LG3;)~pJ_HS4J =\k9EL\)$I$9?F,5r :auOmISI鬋'Ld<>o'$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$X}oWCu Aϧ }[+-\躷W[W:TS>d}!($HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I"<ʄ??*J LS+w'V^} mܟX{Pߐ-7DCoW2RI$X$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.E[%/ʅlD^ϗMOSWj\ke-\8 E (YĨR\NcU1:+6uU?$QedƈI I$ZDpRI+ וz Cz"Ud>b:DD7$ӄdFA2p ! I$tN(NJpO栥$Iμ<DvnQRI$8Kn#r#JRI$Z@ N'US$J|UYUƨ (IEȥAJ$)e 鄧 )IRۯji'jb?D$2NI|S:i3'悔:I{B!ڒI Xͮ-1#MlR$H!IxQQJI%jexihXg*Op$rTPpr$&IDNRBHtRDKI( jB$#qGC\I$ B|"8j$wRl$:]$GI%:q1 ϵRtAf*|+UBvwFXL@ࢂQ;"+$B Qd}%\k³Jc_fuW()'I&I$铤JRdI$*RI$I$I'I2tLI:d%I$I$JY2t:JY$I:dIIBW~E.W~E)qr7I1 Egc8I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%1Խt ?K@?6f?Gø*I'L WL$I2*QLt'LI:I$I)dI$I%)$N$RI$I$II ,22i1N2t,>*<\#))_Ho?K{|;>'wP(X&;R ;sFw )@)?8|I)~s~3N5$S4cWr_D|Tܧo vI*]$>ʣW*YcTj91t:٧l&zk"'Y9;₍()I$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$AѿAѿ ># VW:.u n}!(,CQI$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$Ey X~TLWPOĬN?A[ oW2>efHI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]C?"/Ugt??D?*Yz |k>R|L|.p))$N#<ш/$$JuOJgjRRI$IR`G^RIYtUL-D$1>*M(SwPr)RpaײuRBH)vQ:v.H$tPiƼQRB$y8 wHhPRI$ON:"+IJNIVq 2g TY]$VL&"O)BQJIW*F`CrPrY"{ fA3E(N}ʬ k#&\_U_)I%I$'I$dI$&Nd$I$II%,:dNI$I$N2tRI$I$:e] ] ?iQ%p-Z $J6I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$1Խt ?K@?6f?G#I$ I$@d$2RHRd$I"NI$S$N:I$TI$I"$Iڊ6#t:bN8CU>*\%39@|oNb;!MMo❩|TQJdxPxP ߟL_jq,GH=%> ?'?3NR)$Y$AsٿcP-]k{ʅ_)=YuOa'Oa',2u((ٿ;₞TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$:7QgW>?Qg WGu A KW[W:.u n>d}!($HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I"<ʄ??*J LxNԿX}{P-}#+>:Kd |*P"U̬ԒI4$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K"'VvK<~(] 7Fq,~T: =M_5-L]j+-jb2<,aI*N@I %I$UV- II$(Bj+A緊HRI$ iz2TI#=N`rS!!e)9MJ^ϚNKd2 ' Ad €YNd)s$I$:]ShxN jI'!H&Po(I$D(O?ȓy~s~3 )#O /䧫;xIܤS'LPK$If?g\?g\0fo:٧SNENsw7|PI$I$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I-YՀ7agR+A ϥ }_+-\zW|ZCQY$I"I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$??*.')ItDž;XwP-}#+< xJ6>q+5$E"I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$zcsK>_F??kg~T:tkIcM_orSMP֦!X)$L):0gNEwǺA+ęNWza={"zNqd3Gpx@NH%*I$I$!I$IdJI$N%)$O)I)$NII$$:JMDM"%@9 &NI$,?U̟?UI G{ S),_r|_ꤥp>)k{|T!3WpHfxP GO| f l5#7e2R<]GE菒R3Ɋt ] AsbW(ϿS1uft'[6ʍ?̈́Ad铬眀()gu$I$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$7abF?R+l_$d>KEwū]WW:TS>d}?FI$EjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I?*6'X~T];׿ow?׿o xJ6>q+5$E"I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$zSsK~t??D?*oVQYV/>~rW ce-LYD'0L2(Se#sʃ$$'gw*@II$Dj($)$D!8q!J hTI"֯j"ަtQvX'L&C!a$.2thQm:&N -a%.I&"9 B )JMQRj4)jd<dI&&8RhSGfIJI$t 2dQ(I`(yNB_焐LAlHN` 9ALLP<(" tӓ)4'8AK$IjuBx$"8xv铪y(5CsI.I#&}y&4 T:HV+*eZchK2[d :#5%rԒH~1P2*P+1U ʯP'H $$I$,I$I RI'I$RI$&N)'L%)$I$I+$d&)I$I&N:J76.w76.Hӓ'IZ ?I$mu$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/1Խo1ԽoOz?I$ZI<$'I I$L2IRI$NR $$II$RI$I)$I$IJI$ME )bQ RLS))tBU͟?\5$3?~Ib'U3}7U&8MoQ@c dxPS<( N~~3?(!bqK%|+&*U_S'o & t.I!|g>:NbͼNl$l$F^'Le< 6g1ԒI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ч[0ItwR K䌃g>ut=_+-\RLcQY$I"I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$??* 6X~TĬ>oIl%\Co*JI$cHI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$g+G-U~g+K-SzOϦߟRYZ,%6RI2 iLHJA+:]ń  4ӄ <$%h =fx/Y?C`o/Y^ 8-I%j =f)z `o/Y^ 8-Im> ZBOY ^<>iHX?pKW z[O%vx Raex7O iLZ|p?f(RX?|pKO {ooVo Sbd7LomZBOU[JR?bd%+}nmKgVoVPaxM+G%j VKo+ .W!7lB$\!FJRce~-ݾImJKo+6Q"cc:>$\!'#9Krw&Vh-f> lxh Rce[|䕭 =fxfxR?ce~D?><䅫$[◬9Kw><KoVooT%)X_pKW waO~ ZC?]?KgT%) W~<R|p~<KpX?a7෶VgR=-`~o/y?8--+WK7AKoxxY?9/Y9ol>Ka)ZB_Y ^|ⅸxx #'R%޳|ⅸx7,Y,9?v;>x%j }QQ=6`xov;-J!o)oo3[H%i }a&!W :"Rn7BJ.kJdtC\{$5FawGv í;v?V71ReZ|V~ kDi=ߨ2'@x8@yV,J %I$ĐI@kM'䤕$H骻G*½O\Pz"ωCU7htIyH*I N8Q(r۩!)((rsnuO8I I$"uKAƩ*Q)I$DB(7%)$cx>'RPBI%"^)RI$_RtV%b%)(IS#E4 )$L}$( A%,tƈVPg+A NMU<\5Ng$L'k☂IJL$aǚ)nho$J RI$<ʕ|S!I$1R`(2e$2t° PX'\2Pr!))JAD)NuL 9EJ)$C"tLyH& .:(x)TD$'I$NSR ϒY$$Ďܡ҈L7JS1ŧCfjI#H SpJI$f+UUV,P܈TME, sY[iHGܫ}dGBL$$I%)$I$:dI:I$I$2tL2I'IJI$I$JI$IdI$IZI%w]]?iQ$p-Z $J6$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/1=o,1=o7OQG1O8T< R$XI$$$IE$!I$I'LT:IJt$N:u)I$E$"$JA $Q NI$I'_DYTYb}eRgC:~#4#F=,OTO㿨RFH(W¯_GwAA@rxP$IM6g$]~Wr5R5'$vH%.r8`03]Y73x ֽa;͏r"IPȱD!}?z|ANc*I$~o/[BI$)$E]߾~w $I~wAI%- BtwK~RД'IAI%- BtKRД'Im$#wޗۯ} $#~GG} $cxC##ߴ2?;@I%ZGMx$C##]$c|[VQsy.v$uotsItwc  ϥF:w,?9?UΠ-`| &6}!EV?hwޗtZ-rJzJcKc|ܤG'#hwޫoKc|ܤG'#hwޫmr[V?hdwޗ tUऒ??;K$ ###ߑzI)m-:HoH/wހJ[hMx)$}##oH$hKhRIzJcx%x)$}##oH$hKhRI^X\;hγhH)&+pceu|hh&o 񯂝mj;7DUhdwޗ tYl7%I%cGG}~HWI$[ l I+2?;KGG}I)ऒ??;KwހJ;G[GHn#G} $'Iwޗ/}$:Hkw(I$(N/}}wPIV% EUE}yBI%Z'I6׳$I:J~~{?xA$IS?8yqIK$%WcI2wȬgkІ[F??X?mʛՔlߥLߤJߥQoo.kw֖+ZjUrT:er"$@WGhOI eAgUr`&9HjIJ)$C!91);$ EI&):I'7sI+$ILB'q2u^R AI$0HrTI#B^]E+)QXQ[Ef%PߪU#@1U񾊱UI$RI$I%)$I2tRI$I$T)N:JRd2I$I'I$JɔI$TI$I$$J66.wѿR5?$ A$IFI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%1=o,1=o'Oz? )$Z'I$E%,I'I$$)$I2I$$II2I'EJI$'L%)$Hr7T+tIJY8L YTYuo+NgC:~#v4#F>!%.n|T*$cP+H  M7?M7 I )].W5菂k9D)ژO2H!t㔒 H/]tbɼNl')l'%NI$ngAFu)gu$I$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$z7o필z7Gu!YHV}//TUήEun>32I$+TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Hγ":ʒĬN?mHJ7$@ġD+5$E"I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$:cs[~1Qo~Tެd6}/f6J-mE-\2EBJRr:I$f 4I*I$\°J@#1!E`$rj>dr5V9@0>c}`U~I$S$I%)$I$I$$rI$I$N:*XN$NI$I$')$ITI$I'A I$-mw\:.mw\:7QQOD~7h$I(I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$1=o,1=ot#'OOIN$$J)I$t$BI$$IHI$I$$dI+e&ZRQJNLRR'@-U+V[+y_DYU?%$/?H'o]T wo>EG?E%2<(3€C?M7 H6k$52R>iv)x|j#R菂VIbLPN:] K HWg*QS1udo:֧HNP^Ige:l\TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$"[?ItwRK䊅g#u/~UήEu~ FI$EjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IX~T$LoYaRR_ĬN?mHJ7d"U6>p~%fHI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$[1Qo~U_F??X?mʛՔ|l%6"Oߦߟ\#eL=+=,aI"&n?51ƺ2! d@Χ P$'A #Y%)$D;buL8RRI$jT4T\h\Pr)NTN'LP܈tP))JAEH(hXU( IEI0D&)LI(R91I)Ɯ$$I; 8IJI$WhQ;R؍PBI%-aDRI>J|*juVYP*eAD2P)b(OA:JRI$&Bh!IژjG=KBbd:d鎩٨&8!R3F- Y:d=A5zBI$^ȕA*+Ԥ&NU7\x#<'\TܠuP" *PRQR 09NRR w Gt:TPR&NIB p$I$yEp^2pdU7:r]$Eo MNTI"BYו] Dx"ĨLVFG#0jX!79 GUNY$7V}$II2tI$I$I%):I$dI$I' )d)'LIY$NI$I$I$TI$N:HRI$wo"qwo"ԇ~vO&7h,oI$Q)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I1=o,1=oBt#'OOIQ-Y$I$AJI$I$RI$I)$I<&HJL$I,tI$R'I;Q yFobQJN(u@YUeeQN~ǀG?Q38$7Jkx(6}$s®ϤS3ˆR<(ȓ5/I3_& lA ?$4Z~JR菂VrIYؙܧbI$I$RUʱԿ?vrwdt:էHWcM^Ige:$\\TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$[9ItwRK䊅g?$n/ʹ/|* 72 ~$I"I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$??*&7)Itu/GV']y~%bu@$@>e DY$,iI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$C"*C"?)YFl%6"Kߦ0qRhKl&N(LQ$hYAiAr'@~r@v-RI$)#BI$Aƪ]Qh*BRJI%f6ޑ |BQ\\%))`t:c!L )AH(4V%YptAj$(%DI1$kJRI$tӄ+< JIIVw(B<1$)$SNTTI#֬Vy+,R*L9H (FNJ:RNI)I$AF܁B2vjOS%1d2IHjN߮0I2t7|R'U<:U $HurW1NaA๋ܠ|w*d(RRTM)*R`e'hd JR  "j\'LrO8ӄҔ})I$r$XC~)8LVzySE(-]$G $RI~()X8#4" fBI`PΨ Ҥ _ʫƤ+W$Ҹ1W*U~I$I&N%):d'L $dI$I'IJL1I$Rɓ$EK$LI$t'L%ZI% ]]?iQ$p-Z $J6$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/1=o,1=o'Oz?2IPY:II2t)$S$NI$$$$I$"'IJI$$$I)5-bRT'LN:gUV?UI _$nGrX;ޛQ%(( !xUG;ʂq3c&wg"L~DcLy4GFrBk9 'RrMQI$]!I,>!QPwF#&3x ֥_̈́JNAzI%됑rrsRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$KsG? nt_%HVsEB|k>_s_Ѭ~U %FAo4dI$V$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$1gCDq%)1NHJ7N?2Kd |*JxJ?RI$X$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-_+=C-/XѬM6Eg0o >q4KNI(\%y$I~hB{8 4))I$0QyFg!I$63IZYlZʰ$JS*9*4G!j J!I <|I )I$vGt+IDvTRjdU)M!ƈ-f:df>%'yILa;2u^JIirCDJ)Rb1W+a+G.`G!Tȅ AD' $R G@)E N8h4AL $ޘ'|x$h$H)*I$I$2t'L$N:JRI$A$%)1N2td2I&I)$NI$$I$$J66.w6.Hdj?c8p-I%I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$1=o,.1=nt#'OOI%)$ZI$LI'I2tTI$I)$I$ $I$t'L)$NҌENN:bN:HuM>o(橳oC*=AKH݂OK=6' T(m ";"褠̨)gk&g6|8~D:bJQ>i.W [U}JR)SjNI) $PB$XGC*yV:Uvшɼ'L8N*l$SUNP^Ig:.W'1$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$:/sE]ԅg"YF?*GYsKu2~EI$EjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$INAN )I]SN۹?o xJ?ĬԒI4$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K{Gw?Y_t/Vs_Քlߤ> {~&o ZmRZf*ׄKN:dIPC!HBt$I'A|r2cT$B$J3LCQ!%)$D)TI#T©Yi4V T rV  %)8L(|UGU4Uw%5i]I2t'0R JRI$TS OZ$('@粘B%.I*j\)!I$x)j<LN<$;Vk 4U p\T s!Dw}EK)(' r `;pS$BDq ӵEIN D I$v)'E+'LerT%Xb) J*e@SbJ#L$EeA%Z*+9IbsPI$$LIRI$IJJJS$$TN$'N$dI:dPI:I$9L$IJI"(]ȸu]ȸu!l~9?$ A$IFI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%1=n.1=nOz? A$+TI'LI)I$I$%)$I2I$$I$2JRI$2I"$I'L)$Na Q.C<9 H)'Aoo+TȒSHO#x&zX;wYALRjCe*";;ȕJσ?31%.x?$#y4J~Oo)SBVVrMIܤLR(]:dH@o)]W'L:4U6>jPI$q4LCNc*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Int_a΍_$; K䊄>C5W8>π@*K72 y$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I"c:ʆ?*JRI$r~+<w': -7SPoWVrI$4I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%ЇYoUn_+ѭM6Co&L'|0q?q T,a:d Qp 6BK2A O4% -+J6+RI$M qϒh&IRI$R5jJunBB ȅ nP e %`0NN.E(NAJBPw Z<*:A N#BrŸdI"&:&NpDhhӄRLGd+$J(Gj !I$ T:ef( Gj!r Pw!+AID)' HR$H!?zP )5EI;ID@Z$Q<YuIMRI%#y2 P#%):d꽁*ҷD$HP>P\&)q@EruP:$~S'N )MRt"BA$c L*/AKe" t4&d re$h)I$HB$铄 <@P.I#4NtLI$-j4U*#)bTJP(@4FI,IPtBVJHbUloj~4I%I$IIJN:ILI$dI:I'IJLSI:dJ$I$:d$HN$铤IFW~E.W~Eéqr5I1 Ag8I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K1=n.1=o'Oz? $2jI$I$TI$I)$I$IJI$I$RI$I$I$I%)$Rj0Aj+SgR$IJY$Bo6}̯aTgҳ?#RC:~FQzl]B鰿w Jd|BL'誵8UPS3€LwB?3ȕggwJj"#x)4Z>%o)QG+y %grRrMQLRHTWN' Hr??0'L8Nl|ӒWa9AI%(h;↋RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$KsG? nt_%HO_$T'/?Pg~U.F?* # FI$EjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IN߈PSRI%ԻXsPߖӾ^??2Kd |Jx:?RI$X$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-\Eg4N5*C"ެd6}/a _% ZzU+)j"Xa2tȾgP΃E=IӺ).RI'ByP\@ ZI@rZ蒔I"& TI#3*u+HXH)BrV d1Ar1 )AH( xU\uVʨSJ $铩5J|X!LOdI4Ot0$x)$$dӔ'Ɏv)I'U5^!-a$)$SDJ)$&NZvQSQPrB}F̦IK$I,"+ޚP&5N5I I$T| c RI$HPtE'IBp=JN[OLx)IJI4S'@d)=J銹TnkE),De> J]8L!"4H$⊔R  SjRdA <) xA I< ǚDIJHBACp1ȈO):dWN~j]B#LB$3Sf4"J'I4UV+EAPrPr(PFI,JSPr0Vr>g# Wd@*ü|odRT$$$$I.$N:JRI$tRSI$VI$I$dI$IEE2t%)$I(ۿȸu]ȸu!n?ߟ]'IZ ?I$l I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I% uKrJRI$}-%)$L}1I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K1=n.1=nOz? I$ZI$I%)$I$EJI$I$RI$n4pI'N$d$H)I$QfBw( ܧLS)b$QJψV?Y$3iH M뿨PWVAF)_Z?EUdLg)V|6|OM_X<HR=h}JBj>OodRI;I$ IbuQP)'utÄJ9MWc朦RI$?w #|PӘʒI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$[9XksG? .B"YHѬʹu|\J72~EI$IjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IN߈PRRI2cuY@_cuA\d[)> up~%f$HI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$[1V?Bt#V?BՔlϥPI;>(>+Zjp~h0$"PwP~ .Rt 8џ=%J! QZRI$F0B"dLQVB^En (nD(nH)T rVN:NBz)Bz PR !H(7UUCώ N:TI&"ߔ|SuAJI2t HE!d )I$D%$ېRI$RSnJQRI$N?bI(I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$1=n.1=n'Oz? $(V$Nd)I$I$JRI$I$I$I"$I$H)I$tIRI$ K9 ȮB)!K$HY_6}+W2?e|"gO40{&zRrl/ ]T( weY?EVdEE@:'&V$~?*bJQ{|<o&?MG "LIܤ:d $I,\QPsU * j j$K?'|P2w 9$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%ѿ7s7DC?$~π]Pg~UΠ%*~EI$EjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IJ߈QRR'IuOGⱺ[/GⱺAH)T)VbI$DI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%п\o п\o oVQ+>(>*V}!QH|W,q S+)jjKN:H'7L7I$'7:t`}.I$ #J0QRBI$`JOܠ S I+'QsdB;9[NrbB2SS'L#D"9%()Tʶ㢨j $铩AE9I.& yN]IJI$upXBB Y:dV4#E:H!.hXI+VHN%AnP)PRr$!I:I(dcK4I+Q@g84I)GI%M8P) Y$I;|4FHIH%I*DPѨ. MyIJI2pXZhI$Da LzR(HRXħ%(5"eBHIKLg"‹Pވ7ӄ&Q$s7PB$y4إ$&N}!AHuH)IL%;t!tIqLRI$RsS*dvSlNVؔf$<9L9+IVj}$ B2gj$N$)Lt)tL$IKI$I)$I:d)dII$I$t"&)'I$R$tI)$(]ȸuȸe)n?ߟ]'KZ ?I$l I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%!QNGtI'&H$I$I%)$RM+Zx1?N; D! |\|R\t_TI(V PcVI)) I$$G]`T+lD. '"''*L99J 1C~S :P*tQJiA]:dmSPb#}$)$H@gsRJI%._NJ:Z 0P$$J\Q+WIRb1VƼID%P*nP)tP*gD8T邒H5LQR$LӄAriR;P<&SKY$I&Di_$DO4撖NAVhJz]$E:ƪHR:bբ,ArTJ‘E%('H'Hx;NH& VB.SH!Q*CTb2Dd)()IRXB~qB⒖R ZRk!tIsL )RdDb a$*%H@uEdBsCLO܈Kܦ*.7B)ȝJ~b`*E :d)2dL2JRI'NI"I$I$I$铤(%I$I$铢&NI$RdNd)Iwo"qoo"ԇ~9?&x A$IFI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$%)$I$())I$I%())I$vNpTII~BdI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I'5/] sW7OQG1O8TqJۇp?蟂o!FUyBIT ApUDG - HmS$J]$I$RI$$IJI$I$RI$I$I;Qv𜥜W!9:dJb$?=ǗW2?%N,~DPOd~F=9GG)=G(~aH(~a LJ??Pٟe>ӯqgH:F~Tbħ<gvB7ԭ";I $LI%??9G?@1'L8Njl|Ӕ6>iI*9;↉(ieI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I-Xg0LwR"!g?=W:|\2YT&RI$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$RTm]Sn??+n??I o_PoWVjI$DI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%п\o п[o oVQ+>(GJϤ> #\p0$EeT] %I2H.0gpWI$G# #BI$VuR$d$S!\S  ȅ ʁD*9J `1Pa/)AH(07ᢨ i\'LMLj5>tIJI$@T0TIOp ACu JY:I*R\mAt5cDIK^PX(IVQ @3Q bR%()($vO1,RI A&.WHxDI N3䙦>)4TILPߧ)4 JRI^ɔW]$EmU:Q-9P"&)$U"fB&ˑEI $(TA:dLS9%.L(4ّΨ)u (&'L JvJ|i)$Og$h )IŠU_0RqLI$43SRI$V7˄Q*EDK7j*Fn`U!o}`_蠧I$$I2t)I$I$*RI$$IJI$N:JXNS'LtL$"dH$I 2t'RI2Ϳ]ͿR5?$ A$IFI$I%)$I$IJI$I$JRI$%M$-JI$ $JI$$JI$6;I$aK *CJd$DDoJPJԲE:Jz%|BwF %j`lM"$GA~%:yo- %jGduL ?Ŵuoꭽ' hJ⎭ENE48{ Kn!06R4`BPxqds|Xٍn,NX؛s?"KY;DswV*'q(RnsC~Vm-' +  }\=HI#eb-]Z$4!?@5?_XŌ(OW[(P5ryɓ.|l}1#GB\e\\윟Bc!tpxʸn ($ٹ2?w ,nj* )P:&.:wfG!/ٙV=V`% $ƛJ\e\!$(n{Zv);i>asYvc怵-S4SʒI$(RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$YwKPYwKRS?F?}MD蟂RI%I$'J;L4Q4LK*$GQ58#u!`()*BJApؔZJ+JI$I$I$RI$Go ')g!9NI1NL + #Գ?\i%Ig" c{*}1V;$TpN(pw w6;~jOZϲu.=ӯɫqoIN'Q%(~ ;#$,o>jVqS*S1'$II$?U*QUsp0:үHWa"I%G#|P?wA9$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%ѿ? loK"V3sˡg~U %EBo!$II$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%**.HV7\uV7\qI!o p+VjI$4I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%[o Zo oVQ+>(>*V}!QH| Zct#'OeIr $Az9{u@rH]$(ա $H'ʐRIXF[dtW ȎC*NP2QRID)&'g $0 U{8zS?F?}MD蟂&NDIIIJIRBIL$铦I$RI% /@v5QI$R$I$JRI$77,P+ʒb)$ӾJEw'|*ľπ!%_L#x S9*NQR*dm?0[PJ?wZԔ˲u.*u_'g;W?wRJQwoGIݾ?OOo*8G*T&bw&bI$$Icu!_V SUBsqtÄJE* I$CSq5$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$z7c-˿LwRSP*{>sˡgy1o! DI$V$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$CTCR'L}#XsP~UJ3Ilp*T•\I$cHI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$zw_+yU:w_+yM6Eg V}!QIuXtIuP?I=Pp,2H. ќ"P\$e"1)$E )pJI%b\bO!]b!pXBD( & I!<Q A @ʶ8U,fZt:4IIJI$HL4#H AJI$h$$e\(-s !tIxDPI*LS*pHbT P)P7("tG)p R +E STNڪ07r]RC4$8Mp 䂔IԧD7%=#U%,2J>iMf=pB$,ʇ ujQJ銽QD(T)N F'$E%.I:qԂJY;S' Az+P. TAM !tI)%I$g,:qǀRG )I$_5*?GS~TI'~я~eu(IE^5: t[J,RI$NZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IYwKRW-k>zJt#'O蟂Td(I$:dT铤I$$II$I$)v QI$ɪdI'I$RI$Go FjrrErRI$SI'|}7WroH_L+ _L|՞ɜ | 0IK5E λ~j?wZ쒙T =Iλ'}*~$##${|S}VQ?3T슔NPI$I$_V|"Nu_a"EI*9;⠧"ƤI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$Fe ltoaLwRSP*w{> ]{>saDCo!$II$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%**&Nu.EcuAV˹XsSIl"W|I$cfI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$zw_+YUzw_+YoVQ+>(ߏRas WYKWA$< ;H~2@%$Ho>OTBI$ZXI$( NJNJI%bAWT!pXRD 'BO))p& A*wnȅQ ҸN:+5S6@cTI1HLF0AJI$P2<gܡY<$I:V!EDIM!pZ)Rd銷^<#5 {' bA'N%'3T2tOg"$' 5~vS8CNplI0>*ML'*A($2I:d)7꓇L<BI%=#4PySIY:I*r8MbzB$0T$5:R:b tN F'TOJdNghp8PjH!![E8L()7ySh)!tI$i()d$x?LJ V$(XRzadI"Ij-<R$^eV=a$2F|QT;8E,JD(O+H`P1oގD c} $ $I$+R'HddI$I)$I:dd$I$$I'L,I$I$Y$NI &I%] ] ?k5I1 Eg8I$I$I%)$I$IJI$I$RI%00N$I)ʂL&Nλn,YX#vD?cTw!h* xTlH;@RfImlOFɫ%pp$%cE_׏Rʼ[X_LJ#V>HRd:`~EEMI$ॏ\*ܒI+lkj kiI)[@U&7V?Aj.Ugc-Y+>;-bI$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_YwKRW-k>zJ|1f?Go'}D2rBp2t'LN:I$%):dI%)$L9)v PI$T$I$IJI$ YNE:I$Hy_̻7ȯ2ߦ" aY<*1VJOC>x_Mo)k~C g|UEL *CU\'λ*1Nx?o|n>gCVE]NPL2IdI,oy#*RUQa;8N'Z56)WGI$wA#|PӘʒI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$[X~E7N&;A?g;=GW79Lt/%N:|P4E.)!I$Do$$H` RJI%b5mJ+,P܈PrTʁNR`(>J()u ;{*̫o$Y(-]:dUA* $II< RI$vDRRI%W5a($Jhm ײ e+f|+,ۢ\`qHbT !C); "82BpIEȩdE !ۨDwpԚ\ !PN7 0LwOƟ Rt)H h8P))I$R5zPB$2\P1NP8.F)!pN䔲pH&VJC.&NMHLT4 ~)vOAK$I/RQyIJN$W*"e=$Hӂ'۠ʋTHNNQWb$TJ3"|fQ Ч G*#(*7zW(I'I&LJI$:diJI$IJI$I)I$:IN$I%)$I:IR$tI $I'M R'Lwo"qwo"ԇ~vO&7hoI$Q)$I$IJI$I$RI$I$IL'H'MJI$Ȗ$sO)I$-ݏtN&Nt#ۛu:o}Y&\4 jRsC*I":-ssx>Oֻs̓ܢ $<zpkt2Gĵ%1 h]B[!qq=Ɛ@`ulωؒu!K&nukgȰn;9Hi0OVR7<~))>3:I;}d)?.-ssx>)$CE$k~O%EHJM|SĤIAJI$$tI%}Y]71?EsKa-Gu*}F]dk D7W;eFiF0wDrq!$9]IK2,և9۹ c>!dhCĭ|V>_?,VIC%I 3y)A9bI%7=5<)Pn;R|RI%i k暹I$o}|U6яӸw)(Wϊ[=w3ⱓn)(I$I9jI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%YwKRW-k>zJ|1f?Go'}DI(VI&I$R$II%.I$I$$Ig %.ZXI&I$I$I'o(9K9 ȥI:dT$Ceʃ?+?̻7GC*V{*}0v @*KB""$I"I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$__:e;?g?ùXsSIlPj|I$cfI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$z'su|??cFSzY3~Og&o ZҲ'A$HѤTLR<ʇ%'LhI IDS+)!I$*DmRJI$Z=Vu ȅ μ"QRp'Q!ŽP,))u «w UAj'I"Q>))I$~9Qҝ?DBI)w"थ$J3O0ĐI; ֒&)+UtGBX@@2ܣ()($( N0;1B(5EIu6衣*C2tɝ3ɏrI&dwIJI$F9Cpu]'})A I$64JDuE*LS*!T|!I!DHLIKL80QRAEH(;ǚ4t1N5#C$:Z1S$$I8y"4"uI8Ul ? 3e.I"xIkV*LvY((nDr(xIW:bHG:c}x7C $ JI$$RI$NLI$I)I$R2r$I$$I:dd$I $II$(ȸeȸe)n?ߟNO&7hoI$Q)$I$IJI$I$RI$I$IL'LRI$B`n 4IJI$_Q|JRRRI%/A~ƙ :y(JI)I$.dΉȸ?RI$b-"64~)$$HZ#&,6o$RI%?F)z҆%)$DmesrLI$I$I%)$LIRI$KէҾ(KeIt\JLdY$C|FSINJؿpEd9RQPnGU tI:S)QH)I$?ҝlYNI$͏9To5s!JSPWE^,>kIu1MB4I$V$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I;Z\@IdPϩ.{6Èm̐o5=RO ]%w֚qoHyRVs>"GΤtܜ#ϷʲHvA˧)xx($I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IJRIIYe\a<dW'ezM)$+rjǵGSƏVƶD0]Rr(y_%Qm&X}jlG̕q6>zJ|1f?Gv}*WOP 'LZI'LIBH$I$WI$I$RI$AyFrREjQZI&dI$RI$GjQ*YNE(NI1N)$O.AX_e@8@_gWj301?*\&5@V yhpPS!‰N8Q(VgڥQ?ʤÿ*EKx|B݇%vCXTK{$ޙܙi$JdI,~!/ȫgHw*9NphIUHI%FPS|TcRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K[67oI1JMAYʹgG?*LD6I$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$RQRIJI$˨<~?VcD$u~*NfHI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$[7Gѭg#|M6Eg&o IV ZriD2I$'RTDHPy咎${4P $rATZHRI$**MI*I$jFy+u%Aȅ RJp(f(6h TkeX$ A(-]:d5IX(IJI$u)gHS'悔I)5Bt cJRI$Qƨ$\I)GLȀWKf|fpЊXT NAMj09IJ J!:rT():d邅TLr3 $3L2הUdξp<"ju0tIJN:ܧ5')$FE:CJE*LS*Z:xD)ˑD)@(QN'R /R IK)&u QAK $[4܂&NHx'N?I$ 9Fb{)qʉ> )I 5=XQI$+T*- `jD"&I%:Նpf$QAhFl)`'"88!µy H'[ }CI$RRE$I$I2I$I'I$RI2I$I'I$R$tIR2tN'ITI$I$:e] ] ?k5I1 Egc8I$I$I$JRI$I$I$I$$HN'MJI$I$I$I&NI)I$I$JRI$I$I$I$$I$I)I$I$ RI$I$I$I"$I->}}VfK,&L]ԘU 12K{(צIeA߷sw8l>N[IyV֌/^74e֓n:ӳ9~ wtZX-g*`1v?Rm ORw{!}?YI\tY༻ i:8c֖:&KWCEwd߈*p-COk-ndh~7A>#hTgt4~)%I$MoJLMi]韜HRhvx{|*SnjjI"$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$6 PTpm'RR^%y)&:UG`WV|4{!ŧgt+K1ϟgr"K{]̖:hA\/tnw[ ФC$ fمklX@Wa @{EZmMls*ii>k֙ʛ hVic}Yky Ju^:xs=mq/A^CK~VF7 /r/z^ֻW*\,n%׿+ti{~^?I%ӮnGA3r>a%啕<\oYyg%J$˃`(9Z*?8(\r8Co?4]NkTy>ְ}T4d5 BY,^d}[yK~}Xio+ }:}mhR~ )3W$T{u}䢟=<4J¸_BIpGi揃P~x2#?+]gԬKAfyWɟ0RG } 2p d48xEiIs .Ql?̐OԌ(Ҩ K+tx;0N2\K?Rs;9Nϩnz $fwLL.u%;6`YUsIT] >|++,{K,-Ņ9eL`d*$: &H:HWY3^%?߂T,@vv;L??igzJ͝3*Oǁ [v]umc*i$6dWcwmY1+vc?K%S90!j}O§W3qQI<%IsoeAIJ'>d:p|կ=k 38^ΛEB֏E'e"L/2]n{bv:rmdyڶ>oh9Tό(ZƒWf]y+ҺK]:ȼz |#'O蟂TbE% ҔL$TI2I$I$I$I3Az3\REjQZd)dI2tI;9Go Fo K9 ܢ'r:I)I$٩V{~b%MI aj+'Pߚ#ꇇ$|J*\&5D;|UUg<ӡAKJD]ʟ?S]ʤ*EKr]%%"Q-(c;{ 93S3I$:dOU~ W:?[ wSxRQgzѯ9M^IP|T2?w 9I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I-nJͿ$ԠTʵχ\s+I2YD6I$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$RQRIJL2]3l?g?H\{)ԒI6i$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KFG-Pz/oȍ7'DO% Qo5-LA4Z̏%`N:H 25S.Y$!8Ar3 $PY(HI4>i4L$V*VU* bBTEJ'P$' QΊ2R !H( ey [B'MXjUBI)I&I$I$ȩI$I$JRI$$$I$2tLI$I*I$:(Y2t'LJ&Nt'A L2Ϳ]ͿR5?$ A$IFRI$I$I$I$$I$I)I$#xN'MJI$$JRI$I$I$I$$I$I)I$I$JRI$I$I$I $I$HI$I$JRI$I$I$tWocQ&t\%c˄!atwR_~'$}eמ[<ʽyL8k\c]x ˆހ|7OKF;k FoMvvIjACO\Z.sm^D"LN=/qcñJFMbPݠh$v~?F Cr=֛hplc-! tG 5Cnp G$@_"H \O鵴Q;}/q0I1jv>Kj?nh90}W!C`d οy[}>+ o}blVϊOe"!RyEI$E I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)2t]j乣+ӾlkkDCuzܛk5~?EYCO:%! y==]c?-QZ{|k^+ԓߏml4Ulk$1V%o$'I@؝OZ{[wHp>2$yced?f&?d00VlLFi^~\hSO|))nw(UP'}h-fP0a~buJԖǎxn $@ʨ(5'aLQq <lhcAiRb?J@F:սDHm..wS[bI$ZI$I%)$I$IJI$I$RI%YwKRW-k>zJ|1f?Gv}*WOPL:eҔ'L2t'LI$I$RI$Ar3BzKCV: f$I$RI$Fj yFo K9 ȮBrdT$Bi@}3P2YꄔʯVdP>(RR5DMg?>e*>U&rv+oTP;THp>Ira%GS?T쒗rfrfdY$K3?EH+Q8 j9Nb;|ʒ8Ԗ@$ )$Tr?w  ~ƤI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$JLIBI)t'I$IJI2I$I)tI%ZX$SP!Zg~U.<~gy$fEI$IjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IJ>!EJ>))I]K+8V7[q(I!J?1%|I$cfI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$([g#u/|AѿQz[>dOߤ>jO_%}!\h|VT-\O'I$ʃ>㐒$H/Ar3ϊ B$(#)!t$ByI$LC|4铅^P3X{v!tIjE3xNaU%Y`$T PvE V)b7"8IUUtVoU9y@()$tJIR$)I$R$tI%)$$2t$IR'L:I"$I$I!dI:I$$nmw\2nmw\27QQ$p-Z)$J6$I$I)I$I$JRI$I$I"7%𤚕$I$I)I$I"RCD~q4L qDȉ+kIKHIՋkiqh~NAid\;jJRI&UFn<`O]-Lx )tLw أsn1IK:tIJI$I$RI$'I%)$L$RI$s-.@;W˱Ձ§ [7j]? +$jrFٿVMcK:}ֵF>nݻE ssʴy쵪-GUIc}vDc~ZD1ɦ"͙mm=7O~uKsӫgd[I ghP{)d&}t f~)ufKgI.+=L\V'R}@ak?Zc?+Ru15W/13iǵ}4m+~Y1z!~(>MF2O>РCZփpI`Ůy%QNsx蹶ҽj{A-z55>ФۙXSCGJs)@d[Uifs}.>d>Rap#f ~\ PA6bWl +*"4]I$E I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]GԫUU=,P,eoqr9sYvpίW%gWk:8H$uD5.iOE(O@h$]A,ʘ }a#fW)"{SI; LwxBIMGWB Ht\uDڛ:DS<& LcXcS]v83sX:5tN#]͛XAIMSS>(8Kt1tZ1ԃ& Ar jcX2?ކaH .> ?ݪII]t7NzHuzHndIGS3pa%$%DVݐ~ .{N D8M;B`K{"ùN|g;Gl|RxPuki>Bpㄔk$V=f׶6?I dw7S{BD)x%%>I)M4r0\ w*B=BAS F:<Mĝx'V6X](.knPq "!FZAI+R =ࠖ_ @<&'M;FJ*Yչţ6Rmp^`4( H)N<Ή<OKiFS )kD%Jd&ݪ[$giTP|dC'pq2;&&氃|&S"MdGef]]+ԉ҃lD$RtL ;)PS*7 HYNB*s} pILmŰdw슛 hô'R5DKL Wt"}ɋ|Td`q-)]p@5[LI % |w'%&mn | 'Qp D&xQR^Wi! n TkƊK_cG5}rmcVr^] |T[nO;Y cRʇGI$I I$I$RI$I$I$I%)$_YwKRW-k>zJ|1f?Go'+'2rBtI1N)8L2IIK$$J]$LPJ*\"5 "1 $MS4I$I%)$N؀9Fjr(NE(NSH*bI!4LT-g7d PʯUJ~*P7,o k>' 'g7VV[AAv&(Wj?ʡooRwzEJ菒tÏ>?T쇏(.NCI$S$Id_~EP+}W#’fhWrtRI$f=DHQK,`"L@D_~ #E$IO-_OWKׯ܊RI$jw%^~*+VI$%>^zU߂U߂V:J?cN0?zU߂_jܕE&N_dOޟt]?~O%hI$*t}?rAZ)$HaSRtxO$RI$0E?بĨ?r_(܍E%IBhĥ?w*%R~ Z[T`Np(?ڴ;K_+E%()m>(߳s)N?~/~^w¤iKiD/?zpE`u2UQըWܭcWcPEt[qQ&yR|HQ_[lickGq6FJSܐQI쥼D}cLu,o)ZW|^ lw[]ţ%w~ߴ(ZW|}6%ʿZy߂o~g7G?|}6Җҁwjy߂?~?AZ/RƧ'O;G~?VRSAKi@O;OwMC╫E[J[Jj<_'Go> o)Z*||RPcQ/c/"~H> oRzVy'|m*ϊVQd;HI5`qo '__]_X߿h~RG[y%%~_7/X߿^ow[–…__"KҭK{]~l)~Jy%R//ŸLaMW+ҭK{$_zq1~joؿJʽ+or[ܟc$HwޟN/ߵy[rZҶ%_r}Kc9/8~wܗ|o}jJ۝%_r[y)~qKV/o}ɿl+$lҭr[>;>y"~qKf/o}/8I-U[s۝>-6y"F)~GH~_?Imc/ YWmr[>䗦$_٘1?(?_Wmrmr$7y+R[“msO!C!,+]kha󵣲 &Nƅ9`9@)񫥌7lopD2 KUt_sĻqKwzs WSqR'L Q䐤IB5S` (3RI$:)7TI#!]T'\gbQ S<(;3NRu R )0`φΓ'u^Ӥz*D))I$s)%%RI%)V&hI*$$$Jd-hnv B%i.Rd镖I :| bTS*1*ܡ(邒)bQRI&B&P5JR TT > !d&v2L&<AK'I%!#E Oi:Q xIK$JRV%J]$F:I:%TTLUD?*8%€SrP)jJdA$(X*$T 8L!wEl QZb1S'1)$NBA &wtA$굄ėy)D}-tA HK$JlV*¯ZQR'BV*.ӕ"NQQ[X7BDZ*EfH`G>d5_衤I&N)$I:d)I$I$JRI$tR2r$I)2tNI!ddI)$NI"N]ȸuȸe!n?ߟ]'IZ+;RI$l I$I$RI$I$I$I%)$Do Itԩ$I$IJI$v'\ݾ($I"zx n5=A$$H^Jy&@*frqcdA2cIRI$oq.:{4OcÚ#)dj]))I$vGmqùĤ$J)$HRI$I$I$I$$I$I)I$KwN{ߴmXKc͑Uu{i]a_Ushu]sDʻOL{ݗ7*laxNGY1tq o;}:*s7OUA re|7L׻gT 릆c'ǟL$]zW 0-BZ@jKS8Y,HՃN 9ӔlܐTCWԗvmdAiK|??2 Xa7@hߑɝ'`_WCp;/@u .imsZ{I%N1,Q[ O*;TPZA ݬ#41I.o%X'dQ)0d!e&tHF7ΣU6 EcCԛ 7+,]6,TӺzQI$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$gS#{x>azvAs@I-< $(\Dyu M9OL8PJ Fh7Ԡ> >*GuBv;[,[Ne6OI ft|ꢉ&Qwy'(aNc50鈉.saeOަ^x#@BA) B 2AST~@"):> Ф p4D{)@*;/%#{hDv%DcDAhSPsLΧ ͧT(✾ )qۨ3 Lӣ^-#)6_%qR& Ց@#XRJ=uGDyY8epq c P#扸xrtj_2![p D5=LWF=ʑ5Que$;$ ~I4R.&{"[_D|)JwS)m;Z~jlhG B4>mTꑰ|7b$ Hq=TcS=(wM|GO)4TwRRh$J1@A7@Bs"f5HǺm Y2:fcliRx$Ik^a&S2}@$ S9@QIL{tCE |Vo[}ӪpZַ;}ؔţBwV;NGVdcv$Nc{ 2tI$I$I%)$I$IJI$I$RI%әwKRW-s>zJ|#'OOP *2dP]$$$B'I$I*I:d$J]$LPPCCI$P$I$I*I$ʰ,P)Bw*I'$1I$.mߧnwfd~TTMhV|pBC>(BC>))pϢ~ 'w⬷ ࠥb ?ʦ/_T>Hp>ܤGrXQ-쇏Q.z.N䚆II$:9Ȫk>~*=xNphUt}I*94L ,eI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I-~F7oԠB {>sˡgy,B"y$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I)WE;>&NuN~OuXsIlp_@p_fHI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]E?QzVϗBч'TgՓPI=K䙟L.mje-LO+tIp:<]0c@O?%$t7 $$J A I$vu))RI$R:"(nD(n9Pr*&N\b9ĔR !H(UAѢ JIFXC`rI'4 -;&#y$$JMl".P*nP)9 7i‡(AID)'Q*J.EJH&N*p!BMRdV."u1ƃD2tɌcS:L <D;7BJY$i JxI˲%#T8DTR:bԈP$:  E:IK)5EIcT;|Qo Gfrb1S yIaIIK$JM׎/3ӍlJQN' T"٧uI$4a3.H_l#? _ǯ$:?W\lRWQ&ɿdrU%\|^g/Qm+_hrԼ|B̯NT]\z]ra/NUkgc2u3ςg7\켯Nra3-%m9 EqEI`?q_o⹯Y-^ӲdH5C`ۿJtD#M %cq_o})O>g[)~g[)HY߰ԻŹ;?w -4KpI ߺ$z~DGe!A_K)~ï%甿w,b}][&{x$q'>+;pIuI ?DLCJ*[yK_-O8/}&0!*7 S<߷MG{Ս`V(~_M/?5*2@էJKƮn?(?)`cA1,KV:P]);,?4ϸ6[OevKocxyL~cxo5';W0_gi_qɬ_9G,%}ba׺KSrte׫S "eoAh$I I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I"X|%=8GܗEYq}esB&ghT/ )kLѷ>iNy ;!"D)GnU˶rttqQHFTˁE {Ri^e4yJX3iO;@?4 -})̞cTOi))\ѬC9 &[3#k{$)@ VWw5V9( Sf=8~mU~VOm!9{7!2 0&RkzaɞLIH<>) S Ɖ{iE'1HqnIޘ GEĤ$MdV30hHO ,|uԽ#;%@3Iy kC.i`€!1ӤKzdG>)HׄI$lSdD${${{r)kw%-8`lkͮ uQKv‘q|7LYn3q{]"r42xAMf NJfסqp;Op^d}1L7 3 OJ]ݲ;~)$yMtf؂^ ܙű%Ks|~ T9D.Ar*&9T]Sy(03)ARրEmV@ndF8h?+sĎ7,w s+x)S[fx'f1fAw`ӧ5c΀O+I$cwI$I$I$I%)$I$IJI$I$RI%әwKRW-s>zJt1f?Go'}DLZI$I$2t'LTI$I$$IJ*\"5 "5 $ALI$I$I8*VrP^*J%1I2pon,}?on,}/ɟMhUV =dwS?ԟO&?ϟ_#*8AJo D&r CMo߃/oʧ``m"ˆ?rQ߹,~od:9wĢ[$frf)$A$K'>~*[ϟNc;o ֍_@'MQO5E$JOCDp1$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$/,Ѿ!$ԠB {>sˡgy,9m"$I"I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$d|RRI%ԑM+`g[! u:VjI$4I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%t_(S-}7D_ʇVNm_$a=O䙟H.mjb,"'I$ H1 M1 .RiI$'@r3 uAqI Jh(r9A I$ʈShE*I$GnUjVbB"|*X'L,Gr)pBC$mD I%(ja)$H#JRI$ (V$$J#VHRI$tNZx V ,\TܠSSrIJ It t,$QFâL(Xӄ«)DRuI 'L}4s$ $tW7DQ D7Ɖ)d铪ϙOZk9R)$DI R)Rb1W+D(uQ NQ iw1J]$N8PxDCzJYI*MBluCQB2N'@+{#1.LTp{$&)$4Qm*@hD' >TʝI$Tk3dT N$"ha)%bTFjЌK) w Vą[U?zI$PRdI$I)$I$JI$I%)$$2t$I"$RI$铄$N I$t铄L"wo"swo"ᔧ~vO.7h,_I$QԒI$I$$I$I)I$I$JRI$vz5H\Ծuk|4w͹D ŕ+-:>$C-JdPI$RRI$%2JS(d:I)J)JIBIRiLI$RTe"RLSSɡ:H) )ÔNBdS0TCR NJg)A8M 'LJRRJP OZqrJ\OE;Dnn'X~oJG٪}oܒG6x~GG}JB[Q5_߸%jqpIZ1%nH_m?-%x}+-lӄS>u]2,=7SmqW126K+{osЁ);ѳ] GvVCIi?RyL'oDLSRZS)Gg&߭f_9rH/;WϹ'mI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$_[5yᆴ>pw'.]R7uhH e=ӸX/պa:&y뇾әJA⧒㍶G_4Q5 ӸT*\mcI1!>jm% a At|2TL*MlXZk w<߳lA)1{bxeB&&%ɠHܨ'J]4Ks@qʋ\Dmctrx#"t))?zcuGwOwD}#rOFyx~i-%H#U$Io@cbHo=T 7]tF5eEx੝vL n'IKU q&C\9?;%yiK6@RcHtyħ}mHum` R$T>I> dim5ILj`$Mi\ D!xNID8NQ~I)vVN ׺%m ΄A4A[@Op |SjILG P}bL LcX1=x56ѻHH $xI,"~I6 r#(-h;>ᡢ];#TyRiA %{8S !"`̐kwcc^| JH=S9͝R؂BJJʟ۱h#lUvlgp)S_ @Ze6.ܛ*p8> v=A?zi24*o)i^D5Dxit 0Wkj8๤I7a$I$IJI$I$RI$I$I$I%)$_YwKRW-k>zJt1f?Go'~Ϣ~ QI$KWN:dLA:t$$I$I)I$bS*\"5 "5 $ALI$I$TI;yV®9Gog M"E0IBRZV6ꕚ9)2amMg^W PN~ O6I`Up>~*8IJg D&(YQ%y͟Ig"EKBCq?kxTr%EEEiC$IduO~EP+SNb;o օ_ͅ"O NM_I$CDp1$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$/,$SP!Zg}tϤ1o! TI$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$LJRdRy?[l[cϦ% _8SY$,lI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$D:WgO?E*Y:!W{>5H| !+)jb4XHw*KI:J@z3\I!fcwmEvA I$Bv{ OI$=:l> CI<(rSJY$N!3粗ʅI))Id!7Rnm B$3bX> %I$zw:3w}9G`Ȥ,TJGlx&XPrCr(fUQW~ B=|o&U|I $I$*RI$I$I$I$$dI$'I$I$$I$&I$I I$I%dHȸeȸe!n?ߟNO&/h_I$Q)$I$IJI$I$RI$I$Ij}[.cA6{O]^mbʽoNKZwiu|o9/qDO#DI2I!$I$I:I$&I$I$I$&N)&I:JT'I$$ T' $$I)p8L:dTR RI$AKiNI$RK~homJKkY[p4M[b-WX~,Kʪ԰w?\qksc :M.."$:{ǡ妐1jtU \N?OnXy?Jf\Lr]KmnQ3~߀ҲcxoƾZmixRS@dh8e3w<8#`@obO|,c'=QsWoyi/oh^+]ݰ~fYwM$)k,ћq}m?"\6v{ qa}^n-ԒI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$mLd ⸕O~%KqhЬO ?9}˩c*{jJ A?S@~ g郇 [uӀ{@o?G5Oid_<IR Hqg8J$ELl0hAE=V9~'A`$w7a? QAJog\4AG y;l=3?bSOD)) ԲȂ5?Tykd~j#nq>=%+)3r5RvLpIL6 ;_ Mo#VtQ.'( K<;&4`Mso[#a#j[(,(CC]8/M3: f[✻%T ILN8f$j \NַNN@bO3% Lk)J` _a>nD3bzJtQf?Go'}DI(.2t$*RI$dR$I$JRI$!= %.Z9EjI$I$I$!JI$QQ*X9M"1E HonY+JϠꕘ9o"W5MIrb.g+Y?R'H$~ dH?b2? JD|#9_EK?w%Ԥ*)B榣|Qm!SER9Ew I$$Id_AT U!T 'ut:OaH}HRI$84L sRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K[6Y+[6ԠB {>sˡgy,B""$I"I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$&Nu'G\lZ矹du_[" uT uY$,lI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$AloPч'VT:tCg&gϧM_YSXH*IrI ȯAz JI%Y$VJJRI$|Ro8RIr*Jq,TPܤTI2QR`(;U^Ь=W%2 AD)5 8SQx.I!3R#&DA I$$8)qJRI$%YoJDIWTGI4j(𔒤:bTv3N bT N*>Je@JPRQ I(ID (;&{&p TGI 'L{JM5)wAKJrJXZx(;^JY:d꽉5NITJyA#U)Rb1WkSrPS!I@NH$I$~P(=%, C E6' 6uEr'd锴d%2RR$*)ǚJRp8UCo0j.I#9QovE*I$Ykx<]+ V*%Hff yv)`P܈Cvp{W%RDx+wHaW*c}$I RT'I$EJI$I$RI$I$'I$R'LI'EJI$$I)2I$IRI$I$RbFW~E.W~E)qr5I1jY5hI(I$I$$I$I)I$I$JRI$&ʽ΃Ut;Ҧd,^`YqF8H!pYaTN hL[m3w*ʈIȐƺ_m=0ZM LI"I )I$)2dI)te)L$R&$I.M)$HpdI2R )2I$I@)LtS$R2I҄: ~jV"Wl3?-0AmNlcgCf-W:85 Dm9P׹ se|ɪ-ٞ-c6ikw71Xv [iqx`b=uc[`67?mnf&̦$935Wk_]Ai&'R|Am;e>$c~˟SqMtP{[an~yȥ_"N3k}?L#NΨX/dKSV[54V>3}Cht [bM~v\{K _oRShuaWa?KO"sm ;x7$6})7|/x7)alqIEw#o>/?k! :$hILQ+ gQ`lh.9"l^q+u`}]?wI$A*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$ItS!\fܧ7R e{ՙp+J8RK|tVDqG~Uqc`|cpt"(rL 75"Oih[NU1uVٵۑPL8uLY"9h%?z-9HC " /-|xA)D:byG9h.>\븻orMݴ@~Zy]25M w )qh!&iT )3DI)zIItIw~ǵ͈ Tl-A)$Ih9u.oYq~)d25>8NA~2HNe3#$2; 0kŦ5#a L$փ7n}ɠp;RAL:$^{wT9IjrvHoHw#dH#qg%(} &in<&di;5L"dƿDx? <i#O$vx$6ߛN$Ihwq35H|tHN< DLrQS$='.q-GYc0#Y2c*51堏h?y"$~tI :Ψ)pv@+2k5xQ6?}% }~ -d&c\\LRO65;O^#q-p]00u*'4-AnRY.q I<~jnN?5ClǞBǀtmQ-)} 몉IIhkviLO8 w}#93@$7gv .۩x$ Ǝe;WD8?{T=?VjI%M|;(E`.A&08ۡpi c#IC~ Cquh)ծ5Ɏ?ò>keo\;8Y\1iB.M$EI$I$RI$I$I$I%)$I$IJI$әwKRW-k>zJ|1f?Go'}DI(V2II$TI$dR$$I%.I&(OEr*\"5 "5 $@)I$I$Ivp*QAz3\$`I&wJ R~ )C7>!]=r Op'3"ID?vqU?+,FWG'%_ӑlωCiGIRRGT*SSEH;l)%LS $I I%L+WUsv3xNQD(t7D(/褒IPpd8Pc*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Ik_`Em &;A5 95k?=W<T~U$,9cI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$vr'g!%)2t˩w?rSV's_T%!}}+-$E"I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$:/Qbտ??CE(PN-udϧLϦ>i$c湥&YKWY$!1܆)$Bnlr I% ʛw Sf!I$"~5Mv$J3*|*u+u\(nD*S*%Lp5^wHR !H!‰0ZI$ JRI$B"cN)$DiAQ撔I N2aI"EIRb2_dv 0x8. JS*3E2S9)$М& 6~aF" '#]SIrt7IvkEK)5GE&8L!;I2|Rts?$$x@BJY$Rܨ?  )I'U0* A HNS u:)Y:I)V+IK> $5IB|N ȢUUAEjP)J/V *1$H)*tI$RI$'I%)$I$ )INI$I$I$T$HY$I$RI$&NVHLwo"swo"ᔇ~9?$5h_I$Q)$I$IJI$I$RI$I$I;LGe6{uayr1*~Yyُf 8j5?+W|D >>!ER|T;2U=-`粍Dޭ?xG}} IBƣ!+h'0gڦv;4}r'N?7P}}E8uK[SN.w{m\t?MǪ4͵6z{F¸ }%Dג5}FzΖjY=7:[Jr qݏ}U}3UTqE`c~)qpܧP==HMZ9T+&ƥZ5Wu+-{ZM٧:?IMC=6ZêƟly%]8)ˆ5.=gE2tjQ0Z% wK S!G$6HhC+Id3k<~}7CA$yHW~xH,Xqol nw;$:ISWy4 0# n\x nvԟY1ۆI%6)3Wr0 qqv|I䖋a9s`)<,K0?Gc#RgCCt գlS6%ƮxNB] 3ΗKH13+>SBFƯm؄гCHa)UhI &&5<+HTzC "%jM;1 O. Zȫc:{r}vbC\ 8+I$P] mq{\ѷ#Vd$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I-gW;~UIJUk()%5jgǝÁx$Ɨf<%]y <;~!@~(ō AO_&:|U}3J-M!8i'D?maM7 53q?' :'_j px>u-5vIlkLLo'`< YeH;` _Oމ]Pw*̂T폊g)DwIIaikӧ0P塚<4(usi_-;gT "!ڠm|Wv@ħs'_dP5`>I3ʓֻI T4cuƿA=[vHl $6YehQN{F ^Hom~))l9(HiO&Ӹ׀- )JCpӲ5 -))v9P > pݨtΨ-$D8 2>%À'0.}.{8[RNNt u<)UU,%&<>3QKi()& I:;,c_-@ Gn}%`H<~*pyLĤͭ{Op\=tF10q'0u EL;'$g5^ݤ"8{||*. B{[z?F?}MDyDI$%I:I$JY:I$IR&NI$I&(OE(OIKcFI)I$I$I$v7]-$g 8'NC$;V[9oR%GT+Q߈W =30G;IG3dvp?X?Gg$V菂E*$Prw+_(K-P OߦߚOϤߚVAe-L_E`l$HF>(F]$: ܣWpI I$$ I"8hM ƈI$LiVTD,TTPʙP%1 `b;{RH( TtHlБ=cCaI&rx$HI )I$s1)I$ kZč@YI I$Ѫ$2t[*1rSrH"rQRd83ʋR $i>j6 *jjN' ^J2A I$<ꙺy$I I I$F)i$IkNMlpC}I"D%a1N] WhP nQ RD@$\&I$SPxHJMQN.$q PAd&Nڌ(-FhA NL~N'5 %dI.5N t'L*!e@kA HRQa"VNJUԫ* Q*EDeG(܈T(wxVW*E 2I$I$I%)$I$IJI2tI$:b$IK$I$t:bI$I$N:)$dI)I I$nmw\2nmw\27QQ$p-Z)$J6$I$I)I$I$JRI$I$I$~ ?ga.M[lYyI#u,GC?EUdy coOP|jiXO~kalhv$y%$jGg4Ą^ 7qtS'][ qANۚ\`=y@τ k|cDjuDVcS>i6N)N6V">?IF縻k#@l83ܚ̠dhC@ChtNG&3s撘5q!۸g! >K`Z$!.O5X5OSL -"8CykCl80y8%)p )wT=ʚC^O@q: 'Ra\trj:N$Lh^s4Pńi=gRk[<gDIMcw>8>߂ͯDuPylpJm%; @&*LĝIAvk`$^AO(RKrosr=d0jIURxj#| w5%>03زr0]) :& $Z72#•hi)껰?։'T#5:$;&\G:kf@~-N~ݳ3 Pn5AX9VSHAΎ<IOHMpӺJ]f h̏m$Ė0#T>\ѱHiԩ==YQ!JJ$H%0n$Ys8F0>%1##O51pH삙:ncp ߣ<1KxOb tJ$:'lJ` H#E# S ~[\$ȥ S^K|JlQo۷4 sʨHāADYO?yDk 'Ohkݼf rUyHxWs>J=.ǐ91xCn$tUA +x#Ȯ9m|2WI"I$I%)$I$IJI$I$RI$I$IYwKNYwKN/6f?Go'+'ਤ:e'I$I$I$$$I$RI$ )p 4I3I$I$RI$YaVRRDŽhP^ӦNK[+[_->!_=y|B==#ހo \$x)sR|YVE*$,D}Pi*v=WԢ7柚?M{~ _Mk w I($(,I%P+}WTsv0:>h!I*?4L ,jI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Ik_ !kO &;B"o;=+]o{?W8dyM"I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IJI$˩?~Ey*h!I$*1 M$V)>rRWQ AeAj$邒`XrRRH( ;S9H8蚵tIBQ TQI(< #I)Ɯo(&?؅nI&&[ՙA I$B3ZJya¯IV pb7(P0 8LTd0PAPK`ӄ¯%:[I!I$μjπNJCI Ltz(=h!I$*5BPwQJ銹TwDr\rRrP: i:R$t7DA%)8L! XuU2N'a hLSONJp)Hh>))I$%F;k%,&N{!DrgA HR.e2VNJLXav'Q*EDv0Aȅ ȜVT[ Rc*ڷPI$$JI$*]$ҝ$I%)$I$IJLS)I$I$PtTґI$I,I'I$R'LI'EJI$6.w76.Hdj?8t-I%I$I$I$I%)$I$IJI$]gԚ!ܐ߻\~7;)t]԰~[uL_Dޘ[R4M&?% 6w}7Y-~ kn'Rxn29QHNOA,g6i$N~-F  6{eOж߹#@tJM.#IOǔ$kRmayqAIh7j1[ χ:`$kʗlJ.iTp- ;TtmvVdDj#bT٨ H9uQX@oIՙP~CZ%DGU/FN5M"?fڙ sIi6`Xlhcu$o>my@ Lja 'Ea"71ӬL3s,H> m[Z ϊ^S -`&3 ݡHo>dHŭy%#W+ o"a& 5?=T\5;jkϊJUN6Lqsd;A'XО+t4ft1wI1BLv*>f8Ty#C55 N `~Q kCNzD&BHA'_ dOP~{'t{ 7Ryrg0DP. ~)%ȴmc-ZWw"EҤN3An|6e@nT'Dֲ~?m8W?Dχ]u<'OLZ}R xRRGD8v:;jװ1=/j6ԓ39I>)ėIj$H!%-nnkZ6 I1h%P l`;XL@Js Dƒ)it1=Ξh` HhI?&x Ok}DԹD e;5q[mԃ Kg[66kwݖ$>+Hs[KI$OT2tI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$լ1xgee.CZoǐQ Q9?fı㘁j%ir_l=dF Ѩ1a_fѤN`AADr`Dt tjOAE4=?1h@:xLJdNJ v?6Cyx@PS ħ{c`eV羶3 IL>vQ B$ -skǴH'otN)`]<̐4)Q}/1T$@T >)'%"\5Aה\ ΧQkܦf5v7}N$0{2>GޛjDo.-4X;K{y&Д챮 ?$CJWdmyl sD}ԭǵ!g&gShO o ;'i:FRlַB&JN]6N"PLCH)nSjxtĈݣ f9,su:wO~dȓLhm4II}'hOf#6P]q-cM8*M{tHrw:۬ łdRSKno$ `ii1ȍ6~LLF6R%HTC7p1u |!̏L ߡpp#4  |bTS R7^6ZN kV_Oy{@n;'$p9HFD;4cJS-s^Xdz#.c}P7juO ,2MSRNXk5)6Kt g0s3[S3j#8+-Q#(7'a-xk85J :SA;~i=kܞQR5ߤ5&4{A4p-lkE=Z4SO) TA'Y*Q%moN>a oTEp5f {'s{' ))MNgdi6X h GncXc;& 2fϊJL[ '}%(!,\(j `2*Zr*RA$`tĩ\L&t2vpJOI$Li?)7NJ Rd) $)mIK'I%^#|gGENU $HjR:er! O `S0)dIAȓIJR *A ZuV'E^$ӄJ+[d锓$$R5kRDI: ut&uA H{(J"$JlV*iq*>$T^$RQ((X7)"µ*!ZuS{U2c}(I$ Jt$HII$I%)$$I$$tI%,I$I"&N '$I(I$I,I$$R$Ϳ]ͿR5?$jI$Q)$I$IJI$I$RI$I$I%Q-~GҸe}KyH;sY7&Z@XƣW}Ӯc\5t'@|tH j!9׼ݥ'OLDjt~jA w]!g>BvhI X wHOtQKg۸F1HvVe k?ڥźy$pdBOi)i2ToC* 1<:!Qd0A$>(l/49R{vSj4R%7Iv) axPx{Ct'9z`g:QK;Rk4?rI;gT{O(;3οQMq:lc}@!?ӗID›DS[fI JSj fwiBB FT2--,kFY$L)2o4"*U7#^y;A ߕ[@X/;m1G qLZxIMiOr}6'$$"Hv)< < 8cB] _.?Lr=7q"=NkCIk:vY?X=_F NI[!ڃ.ۙ_9b5>ӛXb $NI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$辦ʹQl|? e}afX??$ۤO=ޘYO-w3Yd»\ˣqdB.64p<eȐJ btIS'ARb^ZTcCk9Q8hH{mI)pןFFL{ %IO9r2mcn>NOrrOmO' _ȢZcE dHAH y)ox΢y%DtH@N {vN $hW 8;HOTlu&HE4Ί!)=Unhi$ItR3 [j`ߑ$$cR)mRoLSL|4ha0p;EHQ~ )qhZ,`H(m9'箈Z#3 <5 %))AcxFv?mp\&#Nj[c^h &H[K7 HD)j2yTxhh('n:hdk>)򄔖Fu7%ߙP$$m*_@qtE$uhe)hH:iEKxOY@{myb<d#^Sr$A4ڒg_IK13)ë@~Kl'Snڛn5]M';#NwdHb gM# dQgp<"7k]bA)%-S6sFɮ}oԴvL_5}I #.n`)5I >AyZvd'BBmcOC%2e!߻]mNuy[Knxw;O-ӫ-#].in"~t9iGmWjFI$K$I$I)I$I$JRI$I$I$I$$K󮃦c>zJP?6f?GꇄL#RTQ-c%)$BJ[`M)$BJ[`K`NS%A tM 'I$RI$I)2tրvp(V"@S+%{j+*HcB=y!h$@"^>cAKR??jĢNw6Rʾ-QT[.G&zwE Z[>J\#TBI$K4'YWM]d*I'ut:Gcx*6{I%G'†CE$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%C|BICgew3?W6L,\I ߤI$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$R'L>, ʵ?"Ւ[!:T?RI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.EG-(7G?m: |YW}/M?ȹubYkS~$VI$xS$puQ|.RI9!I$-h_V$$H4*?$E*I$em*nBBAe j%I@AA꽊ÊjH\) SPI$J0$QJRI$ȎuL5%)$DqQ8VIzUt(I I$3c)2teX JD%T]TR:`:R *RA$Liy$0 A!5JsDRn$~*MUTG$Q0S&v&A I$'NҠ >)%dU:R;H]$B,ө@FLUր4 gG'%L!)LJpI:d;4E |RQӸVBU{PB &D+'.:e-#!Ɯ(9"tI*L2*/269N$ΓIJH$W #?I%btrO RE+vhP섒Q*ED3$f 7^a(nD(n(BdfJ#)V?3U ʄt&I2II$I$IKNI$%,I$I$I$N:dI$I$$I*L$NPUߑp˹UߑpC?FG?\_BYؿ΅I$`RI$I$I$I$$I$I)I$K?Q\*/z]>l e0?.C>ր<{~E'' By{GP;93?/%'YA$ 52R.-$șB} I p|S9cN!Jctڱ]O~KSN`q f" u'wV*5V\D{_c?4tQkH=4 y04e5mi.hQߏ -:1<`}XR\4^RTNht7{BI SmInL U䒔I?>=k@G2nѲ"Ht2{!Pܩ$o;4EOčUВ"#_3n50ux]M"Otŭ:s>i)VK#MF3=ܗڭ2<#Ol"dfRg"#D^ x$3HęNG"D 6\&#Mv:JamfeoDn'N[7k< ~ٳ@y[N#/V9{"|7Av95[WkݚԻ& 4FNXZqI${$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.}w_U8ԲEujD3ۅ^e;Bady\C`*#tkBd!kwL 0bZ[cP4Qse/i;ugc,kȝ꘷y<(YORk~p'Kh)< rǺHs `)@L׵D ABQpm&I金 Ʉ] 6u4\6}[-`nswS&KpAMHԔ~_$TC5 Mx9KpIKYQ@. g'R9P}@p'搰 IФ!2ԙg:#YB8*@~sޜo)!*w0 @Pp дD|K΄Ly(2`:E3yxJGd' $ .h2H!q~rtG1H 1'RxELv]SDDHU՟ T`}uL[!M3}itsz^8 k1Y't28Ekׂ O3Q-h{)Tv%3]PDL!nl{OGl%1`>*nr[uILOO,@( bgCZK`(Gg &G_..&L))3xtDA=9e4Hd !9aTDIT;̤:KcOp>06N_gQ*`&3[%'/Ci#,w gAK[L)>昂I {+[Hx+N;u[2a&84?loi^eٳ.)zk-^ux:dJxp#۫iy4f^Ҝ]\I$I$I$$I$I)I$I$JRI$I$I/1=n.1=nOz? IV$I I)I$xLI$I$$I$I)I$I$JRI$I'EJI$ xU°X99M$Ӕ2teuY0r*+}! k>:v(I Z֝O܄_ խmX> ˼cO i+βc6 |%0HE-pA(ʏuȜ (VI|v$D+a'4||!4v' @db!JF$wi7KCWH 5<"S>i3 @RR/RÜ\[ %7+qLj vb|K#Ӻã]qM#A!"t͞$X\&g6Ŏq'oC-mgsk: .i2~ΩLh@*aln yN{}O3p.kg8Cu'~5CF7Kv.w8kEM0gOJ4ӻj`X"w9P$:~E|H)9%$[Iack#AWV?~'oޢIP#h6`<=0miB瓮N!EÈӈs#h#_! C4Tk0b `k02t:rr- DQc:͎ ipլr`y#0S"83RG\ߣx?Cc sCth"N?UN9O6$rc1aTt#!:7qFَ~*nܤsGEl"pWh vWe=Uh6L5^ʋNA5 W6Ƃ% N` );=ily)x#2X\A򙖐O~!@6ޤ#DH>I)3-x9pt4X %?0yTkrd$Koj^X: ʛ+2uSZL#SGR tKds9k;%~04jmaG :JV )P!q^wvV5ø\wןO>;'q5+AB1cp&_KVAKc.I$OczI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%}VViğzlĬx#twR~+q]侲u-v0R wi#0 2惷R{vCdL(˃̕EکATHJVkD-DM%D%&e#PqdyvL-w *wtkrVh U Z+0lpd☍?zJY.hqRo>5D:@N7>%D:q)Xjp;O⊒5%Hə#~:ȍ`@}GTuQ О{ITJJd_/o<$W<5{AS&q;Ldlh` 2S#qMF4ͻx~)Y`Ѹ"P~JbȒ#1i 1=R-'Q#II)`:. 7>#Ri!Ű5N E6ure[nZ `t 1AtHĥws()w^ֻ\yI/VfKˉ(a3*f; %'N4*-il.c)'O0,Z݇~ExI2Kd#U:ySI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.G? QgпcE&A EL|"K_o.]jቩe-LRBP+e$D: dArIA!` ڢI$+4@(AJI$)4$wNŠTI+uVj"PzPr**rQK (*Õ{C BB>nS >I]$AiQ RӦ)I$[N|QIJI$H(:NڒI X9*N#Q$$JZ"5۠r%~:$$%jVjʲ8g!ByLTܢQR:`!)(I 6'^;›xC(5EIetI$:HIƉxTI')#1 )I&IWˉRCD$I$Qj jQQJ銸øT HBb$.pBB􊔤&^aW Pث+ A L2/ǂ)%IO3e=Nm2H/A٢iA I$v%3NZ 8vᱳuU@$!IOƃw j_4c}E?J+\I$czDI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%%1Zȼ/Lhk#tV\]\*Wls xm%3[*\( 1:qTe!| ʉiHP09A)a(ElAQ̤H mv> CJ@AR ?8$@)gD\5:FJD$"u!> 4a-:gNSi{H~i#";h~ !f>%6A;ZA<-v;؈2G%syC&퉁Ox:[:\Hϊ@N8))Gs*lL5DƒCT2h*``5EMFD4ָ2R{H (G$Hpp#K~X4"&#~)qAˡTyc ;Q D7IpL`3mbI-2tPw}P[`k$SJ3`Sn>ILlj H@kHw< k)ĩFIl69EG[i-;$ &la0s'H:`p#O`yYPyWܠnj]Sl'滮ff p #mooCW:I$I$I$RI$I$I$I%)$I$IJI$1=n.1=nOz? I$ZI$铢$II*I$I$RI$O %JRILI%J]$I$)I&I _R ъ NS$)۩YafpcNIJvT^t*2 U:´Vܒ 7Py?"U}ɩ!;m>_R{*}8L;Eӻ?+_PJT5EIJIYNd*JV{!RNa;o  ?h5zI%G+„BNc*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Ik?gū!k?gũ$n;;"!hd2.#?W0dr>(#FI$IjI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJL2?"F-A/qWdGurTurVBI$DI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%t/Y?mUcsK_o)]J50e"| Zx I$7IԟEGBbdKI /N$CC_)I$ &hŠTI+_ s"i!!b222RH(*+/Z H( *HSPI$(ÈBсI&)L' oD& |RJ'U,P~NBRI$j|J銵_Ns(8('o qHdt`HJAEH!{|(]:I!0jWgَ .:e0R5 ݦJI2|"g⒔2pOtI$&iЄ$RguGl$+5v5aCxDpCr:ʫ[ &9UO\o(I$JLII$R&NI$I$I$I$$JY$NI$&NtTI$$"RM)𒔒I.mw\2nmw\27Q'QODдVn/ZI$J6$I$I)I$I$JRI$I$I#8"9o^IyMTWVy2_9 ; Aԉ ;4E\Z#y$e)IHw:hK[wb93=~&8tؙ?/@}Jg8mGߔ ;^DVk U19e7ۦgj$8L%) 綈rDƑoM]5=kGZdgA@윸F&$Lj-cF_rf$LA?y˲%^s\JZtCD4NILo9̉GJ,m۞\D]hFdf ]#NZuHDO%0n洵꽏S "d:'I2HsR & tۏ%1kvF=G"$ OMh>؝u'qp3&kҜQ"A#S*F=ڶje"ͮ: H3i30Op  XDV5Cd GGs& ԙi® i?h4HH&e;K6)ILo HMnqxd 嵐[|TA<&h3̴6?N))0{\Ryah3#T6I0|$%c~4x)8nȜ"b:=3:3G62FA}/?qFFw}C`rRt)nt|2Y0@:o'm{'P<` F vI-H芑CMAAEed4LcIG 0yNf RnxvQ3J bP1h=ApԼh|V%i]ܤ, D!!A|R"mf|П D9' YS~3)|+;Ⱥr -4I]Au]wԶxzyO4I'i$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$zWʳzf >#tV\GSa{%v he^Q |PXeFW2@ c]G*̑vh{šD`P54@()wSO=wmELj<Q/hcH͢t>(8$EkNDxHy$oO M-53+@sDdm.ۜy$D*%5"~)ù$'' )Q{ yI2 3ݱ44IK ie*jgD"S9#X`. H IIo7n'xy`#D|,=|RsHNT@\D'PRt#-Q{)& ƪS%3-tS586$;0k5ਆ2'=ӝyHGJehѳx$A/ iLߢ81'Zh@=#@IdGdn0D U2<$6{*Ld%'A@, BL[Yycgms<:hgO$Nxi 6R,;*em h4$ ;DN.uS}k% _s͎'q2]" p$NHb7NcR@=J\ Du`ɋp"lnq|%LiI -5!!sX- Kh#^k;H)&$ltc]*&@声H5%3is`&5)9"u'X $y*LLvH wH0'PMlz2,COR )Mx$Z S0\4sSԐOR)BHFT}B5I%DZL@TmD|BW/͛Z~'iٿ8yy.Gi\N!>ߪ>ƤHz4I$I%)$I$IJI$I$RI$I$I1=n.1=nOz? I$ZI$I)$JI$Tt$I I$&R'I$I)$I$IJI$zʮ9V*Xʊt#)L?V\E _!^E{&zw+OUnA,Q A;SQ`J }MON>ϡOƴW|Ьnh(rHrD%Hw褥~j8!0BI$K4:eտTޭBwdo <Jj$K?'†BNc*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Ik?gū!lt/gũ&;B"՟+]FGVP]$ɀ|Q#⎒I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$:eշQ_^-F??"U$B;OS;OSI$X$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.F? PgUn_+=C5)2 _J50Q鏏\şH,ŧ> I$T#]QZLiPxArL ü!8F^$J<"0!I(ՙAJI$›9Q ME*I$jզjPrP*j'HQS$ 굊k(+%Jj &tIAQ)I$ A ))I$j9I!ƚFaB m+t)$RJEtEJI$*V೐#g()tM歄i=9Iky [ZD%G4Rk\ߚJ`ǽH<6=k\v?TaÀ 5Бǟ()zMtS {(䤤ΰ s ˲ftx0;κ?UL6:& n4L N; xDs.lI˺ɐChHQ#D_J#R0 l4F~* ˲cf@C̦d'H4gVyrMq [iOnͭT<Z|~M 8QiS;S)N2 s<rFp*/p?[Aޖ5$뀌"[3l]@?W&N.@ u]oHJI$4I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I;>N@t /M $vK謸nOZrW `Ŧ5¼9JG@|y {#?U/hWjyQn%D`R";HSq1vRsARFTVV 3~=`g\ aS͌kZr@H`$+k?T8m<جpVVoU.hֵ ` pJMtK}.u@kLn\v)iIN`x54}u쓴"P4FM%6`5@i{y)<( wR" CDw1/ [!Et<0 ꉧ}%jlo{p[&eӸC h2;0LcIl:KvLp<g wD7gH)iNN:)&;8NR$B*MI:v-Đ ?#‹D;'kDtҊBMO|Y A:|lgP#!3)&&GH@I:A# ݧOp\ָ#W.gxۍ!IѺ.%ij뾫|I$I$I$I$I%)$I$IJI$I$RI%1=n.1=nOz? I$ZI$I)$N.R'Ld'LdI.I'I2tI2I$I$9V+#BAz2H$I')9Z,~))+ܨ?W3U/*RRH($n upzRS~iܚ)ܙCCx_Ay _)I$9(AgjQ_JI D(rPIEIY=[TޭBwdo )BP_I$BDpTI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$_BψXc} >-I1Hv-  SO\Kr>(GI$IbI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$VGY}{ѿe* ?NJ?NJI$cHI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$_+=C5UsuU&A ELe+B* 1iciX@ Iy7aJOomɍ̠I$7VI!(ՂN()$DRyRIZeZa(X2E5QS2pZU֤AH( *{BjI$GEu(lRRI$S;'ls%)$StU$ RQRI$J;&a@I)Z*l(I$VTZ!C)|TɅ TN5Q*A1%) 8L2!])I*MU{(TdI&wD'DIL(<2gO$:JoDI)jBR:bD(u;BXTB8%1$S$IK'QB"T iG(d2HuQ` V5G`(!t) BTO8I*L$F” >~ )d铠 (!tIH(@$Jm(AiIK&)f;%WlJX\ġ#_ʦ_U?2O蟉BI$Rt$I$2I$I)I$I'IJLSI$TI$$tҝ%)2r$$R'L$Lwo"swo"ᔇ~9?$΅qjI$Q)$I$IJI$I$RI$I$IKaWI^Y??*#D/hR!v<>৓{qlZ׏P/XXj\z: [4$T֚6Ke;+5}:q*~)7?F&o>ӑhi;5l IV.*x}_(nom-^^~E\B}2@+afWX}$t<ȫ;'%Na}^/΁v3!ǫ;z(,vi_z-pm}\}Lg}G~ŏfͿEl5jV0ٔ$E+5cfʶ[ cQ'H{l*G"J8;v4]YucO?7edmm_AG>?r/vePuNiX 5sv:E2@F( hp@E"NA~9L$ G@Z@q)RJ+)F1Sxk*X;q:$iv4u1M $$4I5HNΣHL$'߷@3^\$ELYH:L>ֆk]ȕs u:~Ru,y&TCONu2A s6KI}huSu\D?;Dd ;O*@8L8IH 8ɀkcD!G҃ $Ήx.BtiI%,X!mtհ*ωM.kI:h?}Bۭk?I13䅑qk>D RJq11ACBvEa =1Ze5s'h/K?+W;QrnWyb?I[6}lq#OӾȵO%GGִZT}GCy=S;GC},Zِ^ch?ɵ^8UM!c?OԊ[pwS#. DUUYp䂯c^yg?tñ+,Gwe~lXgzBZj][Cr?[{fˀE/ʹ˘55ڱFx?%Xf:ߢT~tpGک~̂__ӇrAp\[~J* w]wmr54~5vWʰI$7I$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Duzv ,F\?x~U鸠@KW]6;Iq qD'9b4$ScH%$%\>hzt"c]S m*x Iitz: m-$FR.=@TA䥋w٬mo;|Q4 .O k^}xĥUBI0Na$NK{ѻ08jq'k||t}P!C^Ι~0\͝-xIx%h' jqВ4@-ӓ" 骗v0 @ĉ%ĞrsL'sHlvNB@&1ˎ i]p@N)k> ߵ  S q:' &<BJSltAzU[`iqq =Zt'ㄔ&ﴹqk F4Lj3&d;b%$)p@tL?5?RpH&S:$Vt@=&\ ""M.ya?9 licZ&Ot&{"K1mm>pP[cև:`p'@\#R- и$>%1IH24%.= w6d3 d: .%AQ %ImT'tw-YCt*l8O4)N p9xTccF:h~hLy(3֌m]%-l>䵇5 ZvUJ^<]gz.p1W1SlT:I$I$I$I$I$$I$I)I$I$JRI$1=n.1=nOz? I$ZI$I)$I$IJI$I$R'I$I%,$I$RI2I$J]$N4@ 8NR=M$(LYMBo?))g~ */ݾI;ZYqUJ j!H#?(gpSU;U;4 jGwfUʊWI?3 E>`} $IEI$:  s ݓxN'W) "I%C+„BE$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%оuо||ֆGO\/jˤ1:|QI$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$R'Lk?"F-FQ_^5i-TT䬄I4$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K?я?YUSG? PgRd P;(- f#]s V8irVqH tVCO wjlkqhXȹtXe:=3[n;6`}sUر%OouNRח;BP E\?AV=\bxU@ -<@h.#"5;C^dPC|,heb '4*Tͭiy-+^4;A%^VvC=W6oo-ggYՇnUW绀$%"wRqp sz6JP[n(ϥEgMIn6uYn[`=`(nM#Ɉ Vn|[Y'ĘRǾtnp CwȝTb9:ŵ=!2&\1ݺ@%q)ӹ'2q $i̤\8>c-SsHUHt2IqcZt6JiN;D"OjRSbWU.s$ ^n᧳tڙfGmk K#I|g"HNݤ~2m,ciН%+~@L0A04QqLBXuG28Re{@iz6m1Dozxx=XR"||RoLJge|It!I" FۤyN o o6;F0 *u=…s\@tx3*?Φ\<^ҏ&zU~S vCë]eߜVc[>L)) At}%pҰ1,u#4+Ɵ>ھ)-tw@}B?;gpcβWK5V.=rO;=ݖ,wK7r3B^{0@!oL6C;!?:>taZ#_>P×t~㚲zu6˚8ձ3fa^Ks)uVjׂ >2jN5,ODHutu:9鷺ry:ㇸrp^?sN[2*8?=]220Y]ks)e:8\o9BGVurg4GTCK$~c]/mʲP~{c?ۈ+ $EcI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I+}$n˨(/Ip^yyՁ$v_y*q+fIJy%8I%,+ctqƱ)`4NcY&RJJD :><6d3m:JBO L$$$ZLO&a. qJͮ9$Bq:J|ILXֵyH'(F N RJ}!%%j mI:(z}õ?HݓF;r[ȔRd8N\;%nD u@;c씈!xNH쒙mqtJO$ӲvGqɘ"A&4;p.unx"|N{?5+C4IS"$%)!j[JXۦS5DiA-`hD n IIp>Iv~ l1 ,rSh4D6G%<9 鯊@$ HAĥ))xs5'&qB}l3c} R`]3"{8$( !3JF:8E2ą]#ܤRn][ n$WAjFKA}RI$X$I$RI$I$I$I%)$I$IJI$1=n.1=nOz? I$ZI$I%)$I$$d'L)tI:dAJI$I$R'I$I+RI$*Xgbd)HI"M,ZM,ã*YwRw]OUVUr8? FMS>$®>iܚ;A|QP*PI%; )%C訄9BI$)t++I$IMP&"$Jp5aV0"S*()(T8L(>Bb^ĐY o( 5 IF鯚4(I1%0i)d:bê=d7XGb+P܊_ʦ?rE!j~gET?3PI&I$I$RI$I%)$Nd)dI$IJL2tI,tL2tJI$II)I$Ϳ]ͿR4j?b:t-$I%I$I$I$I%)$I$IJI$BAPA/SdBeYpq0>]z" wzպT9]63IosQC~#Tvqs ѶŮy=:]1=6UߴTu5M}\p|¥NPvMW;}7FǺlg/9ņ2NkT0AeO?-3DЩz=7:Z˷Iq6ÎzOE0 Z׫eNΫ:Vp #䨱ʔ'0j`Sc& q*$wLOo5Yc#tzst7Raæ֏ȱ~~5`W+2OUAB:_:[IF ItV:ONvUkk筻}N~*[\H!ԏ&7?MTDƇ8Gr2i:ĥfȂ @8tL+/pL䃪a gej9RI`Izup wLuQh"gH)bIL`N#\ts@ p#BmQ5di N?**QPZHI'B T `nA|`4PIScxRi$ Ǵj%~InkG?I@dFGQ{ZN<>dT\8R#IQ;)Oɰ4GnkRb|6Hf?j+[i'_<&sC|9%MxSCJJHK5'e߇o2Id՗@55t=ALykC=QE{FcYL:5O(y5AW?;=i7][\*U HU#ArI h1nUï+>Ǹ|6s.L ]O ٝ_v -t]\۟LϋYqUm}7iһ'AEyOu:q@֊Mw3v1b>ZJF/?.YQd:9J6E4粎ܬGt}\I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-OR3Gz%pS q c fT<\ 81W s&yIӲ_A`w)sInJ J Ǿt}\hR1L\ DԳ- u&v b:xTiݯ:!2ѹܐ5?DH$غKE.sti>?AqPsp*4<&iRxׄPS+o H)i*.#WIN&TLH4`*<D"9͘2S= )N&O;H>IDƞ*BNLHCI:I9IKX'|L2ƾoh:U{Hqk``Jb p|3 )#^LvQsdI)$bFBe-JpRhQ%$̦Ѝin){e3ÈJJdڙH36NVǂop )8K=T%0$̑بkO;eGpq2=$O )@k:LKCN:$ A>`tOf5rtHER|S\$Oyan)wt$pN8%3 pt8i:&>c]B"A$SxHRRދ̉'hv]ڤ~)xJJHX$;4:ILưj }7):gJ 쒙NHsM2G9-Sϒ@DC?RS'4Ǵf.)v=ei:SqNƒDfrpG :ςrm)8)J"MGGcܟHٸ $d$D[?G}eMRL$u9%Gq(v5Lm2?i#c$2zv9>kf]gO"SbuLwARI$RI$I$I$I%)$I$IJI$1=n.1=nOz? 'I% $I$I)I$IdIL$Tt$I$dI)$I<&N:dGzR^4tȩI$,n,}#tT*aT*|T[z$J a@)g:x T~E:x)\w&ħr7@j IJH}"C*3AʌPR9N>aA$)b1Y}cT* XqT]J-RWt6I$, +BE$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%~u~+y4T+y5O\nm+AtGr>($HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)IUfuW~ȳ:ѫH2KdĩP'UX$,iRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$BUU_d!>R|[喞1eD%`l$H:hBD 0>I8'I%YuBz;t O*$,1`j I) mQj9E*I$yVXUjDUWS*JT\\ k* H( `\C<> ]$PfB h!tI:f)$$IPZ*Rd%Xg%I(Es(:ʃbUvA+HG"yS?3Uϥ:*xG*I$$I$JRI$I$I'I2tI$E+&NtI$,$N:Rd钄H"&N$$I(]ȸeȸe!n?ߟNO&/i,_BI$Q)$I$IJI$I$RI$I$I%꘣LkԱ^Le-W|,6%P,7c08wSf۩;^-C>ii`u 7OӬly4 i$Osխ;4x _-W,i{lgGbԩ56`uosY6;p?b5eiS{q'T;mv+nEz6bEvy^.+&W̰[w'D+y?*Y>ھ˲]^<GgiP~6F?gG=';1-h0r;+~ l X~[m4z&.>e]/N Ѩ}]j2*Fqjde6#=bqȼ+vq3¥u.1#GKH2 v m{ ٩#M;d~zu8J;%ճh-X1.]W,0mI2ODqܜU=Ϛ^buMR;L}iT[_sJ3g؀ן&Cd|Qwm4 % I3t oL&g_ LFCG: 7TEL%Dt [$<Mx]a<;-&DG 8CHL$$%gJ6vR{"|JC6>'*b}P"IAU-yN?t5‹]5D6Ӥxܛ)9ox<R]ޝh` F'%NLʌ  Rѯ}'I`:OR-$Tu!$~tӟ揦[ZVf5ksw@I: 7(elӡkfEd [[G5Z?]Hި>W!ѱEw7 /5}د9X#v3kt7} e~=5o,+&X/`*?R> AmˌnVM^T=5?T<׾nL|AH[KMz3FVGX~C++RM&XŢ*DZ[@ONԲ}ƕwӪ%3Mz==[+=w?W~nMJP#- 8u]37ӫ>1iHYg?_X Џ1?tzVnI}: dj*x~]չ)'.y$NcuL$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$IN]}JRd/ph$5*K'n3K9n0-vE,պVAV: lxkl+9@@)UuYe{/@BȥV1\FS#jJn`MŌi0Pr-m$<5@ۨ`)Jpvˀq1sO4'(JXZA-I #t[@- ņN)2y 8I 2KKV(e%:]Z'\ێ=Â% 8'stBDp~$=G9{I@4RSRRIhSnxQqPiAMhT%0 '9s Z`Èi BAɶ7JOνr@g(pE,c@)Ky(`]19 M8 %R <73IШvp&SC)%'R2RORђ4#T$I܂<虅3J%J LI%676 {'9 ֽ@%')Kj3^86m7U>K&ԡSoXil۵ 6G/sZto]HX{^suo2;8'U @(E͔loI x{N <:gyu?"V\򪧖'lЬhDI$I$I%)$I$IJI$I$RI%1=n.1=nz? I$ZI$I%)$I$IJI$N:JRI$)dI$I%)$I:dRI$6")$QB4)Y֐f-%(𭏢> M#*~ ͆Uk$TTBFfgBz8ZUS5]%I|߀V?QY!H}%7HTw}g;蔒8L9C I2I$gXqYC}6UgnL%{|&RI$e8~HH_ sRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Kc >-Xc >-ItwR*ѷTYu66$1:GI$IbI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$Tߢ,޽*go[o^iIlwʥW';J\I$cJI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$sgFU_: AI;~(77* 1iǤ%"6RI$V3}Sr&NP# I$ӄ$V $HbTyE*I$²8U24P*e@ΉRPr*b2pZeʵ!R !H Q 5 J,&r>))I$';?T>:$$JZ @ꒊI% e I)D"VJx)$$V*uUi"1*L9EKr"xEK'I$ 7HM*RTTn"Gq&9$2I$N̦h >i0&Nġ?TCoӺIRtU-n;_!I$tj֊T:ejТK(7(( OQRdB'JRQRFF^WI'CXa )1NLJ)$(E hN'6 AlJ3tA NH9LI*I$s5hIt5:fW0(n04#yW/T*R<?\$J~e $$2I$L$I%)$$$RI$I%,tН$I $II$TI&Ntd2d$I(ȸU"ᔇ~9?$εi,_BI$Q)$I$IJI$I$RI$I$I W[|`/,K>!z?heYyyȳM7WePJgW:x:j }Ǖ1-:*- #Ôd6bF1%l?giE4|%ч&9gß ~89Vپ7Vǐ7p:~h*Xãy?w,\cjat00Jp"5BoMg֌|fUav,|Y7@tCd\&'Q%'j!'Tci*: DnsDg3kej;쾰 :agfƗHǒ\I;Mn3+o+B1XkC^#gP^·Osr} _a2#v}M&6ޤ\4PMSE";mn:OMau 2)'_r]> A4mt Lmut?Qi} u&託4$ w;T&8OVxzr#>.E)&ff4OPiݬIߓ {Ȉ:aD8w; AIok<~j*9a2&Pfg_6H'HmcUӲvT5m#F1e&i5NMٷt?M:> g췹Yp>:i *wp\ ~W.. _uDOUDjvv_Wbx1G[6<]VI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$bٛF j]ZeI1JZ+kelorJXk4–ey _.UK։#*3ϚyMSWGm*ACs&|R6><'.ͮ\B`5Ne05I-RRs|J{ 7CI!A & $RLRy2HHhPN7;q;QRLF u?2lc=1q?j$Bm ED8NlPI>it6!d'ړgٕԏcCFqawI&e"OkSm2{Ƀm ڦⓤ N<R4%ݠi sPTjtN h$yu'0&BpJ]S$" ANs)̍ShHJRR L~ My(䔀J%-R=SN']Rx$%4Na8(QRSng&.wiH%*;(<>$p82I$$K7}&|YGrρ98l-%+A" ԒI*y 6W䂜TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$_BϋV:?BϋR]ԅo#抅o#洭m?r;.U1>!tI$V$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$.EoY{oo[g^k$B;OS;J\I"Ƒ$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$Iot/W3[BW3?[BՐlߤ> #7C>~?rOH,ŧD IQq*z  dv$UB BEtI "תQI"6JI%n uUXo!pX2Q\\QK1NU[U֝RZ)OMB$G,pI(zLIJHDIH Ҭ;WIEI$4GoQRI%(JCM:JCVY0UXj!syD*)ݯ 9J &%%)$Hn:# iRXSSwNؠI$̩W1(8ꝑIJL%0\uPp1b9Cy?JY:dDgOQkAJI$]Q+'DZE*L2XE'D:lwCNK()8k>J!C4'&N?d'"ؒTUV U@tx+ UԣT:Hh Qr4JIY"I)ILI%,2t! 5I$8SJ'I>p<#VLU4vh\7"Cr3~*ISh_E!ײ~e[3c}4'AII$'LNI$2JRdI$$I$I)INI$I$$IJL2I$)Y$铤HI$Ϳ]ͿO?iQ$t-%ZI$J6$I$I)I$I$JRI$I$I)V%` Qch(eyμD+^:'XuC LXyLvE"8 OO L[ۄ)K$iuQ/lCQ;Q2D~{7q?[ 4-a|q:H>?3Ƃ`xAKaI'!jId7@fc%L#|Ok2:JMԤ=za@삔h42#*sΤTy=>(SuHAģ`ɃLjm "dzdb|}'kZFJ'ݲ (M|&>gOvRZQy}2ٝ8bs̡@(`I0k Tjǯo?~IJ˝ cpi1l؉ԣmoTئkfֲ|d7 .iv$* $Fd = O\HӲLXL#Jl6@w HyG>*u8LjinۇHHniIBxIKZq N'HKjZM!@{D'Ј Rȏ~S=#XЙ1vI&>ꤟHddW#C [4T!1OZ$ێ;vN <vIũ)fkkZhy* X ߬ C?D?qzQo0ˡX$~$OE[kkL94{t#ƫrtZY[b\>I$D$bII"$I$I!I$tI%)$_1=n.1=nOz? I$ZI$I%)$I$$II$I$I%)$I$IJI$I$RI$@G ،@H'(LL9Y}7]hVuMEK ߢ> eiD|Tڪ_ܑRS L#fm=_BȞiPaW.wH]G]G$I$[?~Tg}g;;褥 &$H%I$| Z]cf)nRQԕSP.RI$8~H(| r¤I$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$A>?B6|]ԇo#戇oeowO\"P |>!$II$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$][>ȳ:Ыgo[o^]}A[ RQRX$,iRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$Bs3=*Bo3=)YFȭC>~?Nߤ> 7e?FjƏH'0I$ tDNn;wj$H/Az;@~!I$CV$HT!MTRI[v5,T P*}JS2pZ*29H AD)B3SPI$ yIEܧo&rxIJI$,xrI(v cD`I)BIRI$ jaV^u\Ĩ2T]*:tEJ ILd8@ _M*RTT8)9 D I$TퟒbBqINO§ BJRI$;V8 %~h!I$ZQJ'L֊Nu|Q bBG%2I$.7H']ulIJRjC%WUM(d2uQd GbH L2&>)IRI$|OP|:|RRL ku@$t:'0RJI$AEJLSf( Xb+77?TĞҮ_ܑHa*7lcCI$RTI$I%)$I$IJI$'I$I$E*L2tH$IRdI$NJ'L$I)I)(]ȸe]ȸT?FG?\_Zn/ZI$J6$I$I)I$I$JRI$I$I'kH#~cCO{ZIZeO#䁾WR[#oP#hxAc$˚~`f\=)䖚K~GJ߯w~uCˤgl7{w}Mwx+}%CK1R__RI,$q+KZ>!\EOq3S&(vi.J9?0KZ9?0\BIpqƹ?MN]K?%8i>o\!\E._ON%dl;Aq?'5KI"uv7O|z1&}k"DT߯Ͼ$%gqXW*\!\E]+mo_L66Z{Jvhk#&!sz (vz޳R>,#U% 4^@ܻ^%uǏR'qo9k?RW|`.oHXljnt>#V[k/dSDè#M_5_hۿIp+ɉzx-m4VL!Ypo26W3OT`AêO|iΩ}I$ݿCxlfs0@^?C-_Q5\c4KznSm#H^[g|êzoE.qʽv 6֟t^_NWƯ7J'w?5[O[5EG_T<;[oA.qȎC>2p:M cUh)[jB}1R >y"A[)p>CgPl4\ wH;~wގwMzyi q/տҏ[P?\G[K\AFw ˃7E9QL}Jҳ'DPﹿ?CW|"qTzCxůN~tik ԁ /4Tg/k-a[QF*{<^g~|(;^tjڽR,sUg 8J'Xwx}MHg[->,K{k;)tGqK>{ 4-=o&\0wzkRW[TEcR*( Л.p}JNxN;uYWyQ7 YPɥQ:,8^OeM(1]CbJbey˾u'k5_:?̒*CH*L!z[~~/M1 x=/BN굎Uğ@W&Өo8F=^Dj1 n@3u}4>u}SAem3#rn]۝璄nAƮ˛:ie Z8$I$)$I$IJI$I$RI%1=n.1=nOz? I'PRI$$IJI$N$I:dRI$I$I$:JRI$dIJI$GBdI0)$RH,?wgB}UO Ew%e|K0$|_GJl_GOG%?')zRW?~NAEdQ,y~Tw}|SzTWc?xK6_~!+Ui(zKo/?._~!+Ui(zKg_GcYImi.Yʟ[ysH f!QI50Ђ{ɭ,m* t}ZhA3%`챯'~g|H%I$zR) ?pxG|PI$$I$JI$I$I$I$$)' $I$'L$LI$IO $TI$IR$BW~E®S ӓ'MVuM$IFI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%1=n.1=nOz? t+T:II:JRI$$BJRI$$$$IN)$I$ RI$$JRIV+@z!JA4H $CqηX"~ Zbw*[A $l+ ~Dpe5Wz8)|w&NQ;sTC_Ql?h(%?sR)PSPI$$Y_|hZ]_|jxي[)(TSP%%I&:|JA"ZH(_iTԒI+TooQĤI_N 2TPa$)$@WuxxJ : w xJ $2iI+GMw#?J$OEyKoV'`On'ԩ\AP=/Ey[|Rn'Կnx7ԩ\AЖ)z-|SIX_r<jo۹5*WE<OEyKoV'1qX2?j_2?jT pЧ)&+h_w7Կm߹*Wa( ~ǟ޶m߹/w7JBP?/LykqS?z>n_߹*Wa @Sޗ<s#?o#?J x%OJ^ԕ'8qs#?:@jT 9yM7+uܟǒ?0<1\KKm)* FMh|\|R|s'?愿n'Е- m mD[ދ|wV܏;7ԩ\A% ~|?V'ur~>\A% ~Gx-bQRq|z-.>)o>'Xrjc2OЅ+0)-^|w-`~hKWBT OE^|?')XxЕ+#IOo◢)JMg/+0Ig^|@le~o_qi"zMKg] R_팿qi"zL zLк=c/!K_B+#Ig/I] x\_\Lz44i"zLr^?t}˦$9TzEdP]kt~ K)І]zZR Ge  X> RX?һW}VZ8 xRG.zL'mmoJ}< ;n )#B'C{wt"I!YI#4ƣS'8I[5VVX\*S*9IEҊX '֫.ZԖAH( (XhD $JgZZJ銹XBR!NK('(3ʒN JdI"Q_$Q a ʵڕeU42u Jzǒ@RdI>)RIRI&O&N:9IKHB0Lx@PB$!?ȬJúnAGI'ALI%֧WJO1KuTG*J?(xD]I$WV3>*;$I$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%y򬥫~$u! XS(.ML<>#x|B:I$+I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRdVϢȳzЫgoGY{UwIlr~%JODw*?%I"ƕ$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IoV?BW3?B( H|[RCUb#Xa$FFo5-S8)LP,Gp=,(I!tBEDI"0kI;$$Jz U+Wʃ\"N")d ֫/ -,Q A ;&tI5epQIe%)$M&~ NI))I$jUkZ&QRI$Ad#ףe$)$NJ#CIY?ԫ- Z NsQ Q) N*:S'$HWI$UӔqziAQSjUbuNQw*BRC$I3'3l|q "I$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$AVT~U:ӳ$u!|Vc?rkȹ4?~TtGGI$EbI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJL2 7} .*?ȳzЯhd|~%NOGT:I$Ƒ$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IotW3?BtqPQo#Ub姍>! $!46>.CɈ'I$'!X"8FqiBI%8*CA I$ m M"$JrW*j\*L9L&qNT8LޫZ*քR !H OXDPI$ma $TID“4(F)I$wYʲZRQRI${V)I$Sb%6$$J&+-VYl!pbP(Aܦ%FT⢊ I:]R'LW;SJ6q"|I8KT]ttC% ܢ8 I$[PQ8T:IL'Ee*U) (%#3Q QڊX2PUT>:+HT*8GWDvXG*I'II'I2t$$I$I!d$R$I$JY$NI"'L$RI$I$$$AJLSPUߑpUߑpC?FG?\OZf/Zi$J6$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/1=o,1=o'Oz? I$ZI$I)$L2H)I$t$I$I"$II$I$I%)$IZ*R 6"$HI"eC$~ϒY_Pj߂QPޫZ;B]*@"d1OBl)&3;TR(|^JY)d?rI~w=_j8**U \wQ<$I%2I$+-j+)H|XwRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$KO8I1Hv>(v>+eE;7"@.$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I]MAoY{WrЯ7?} .dȼ~%JOGr~K$NcJI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$z_{U?"6Ew#9+y5rKPV1>dQLO LdIr$BўJ II$Eg$)$EhѨQ mtHRJI%b*~* X2Q\(1N'OUVZ  7LT&]$LQ'z$$J$mD9*L$I(ĎVJRIǔV!;f 5A I$=J%HIt\gU2PSpNK;`Tu=y&4*^SE(D@AH( k֠PY'L ";@Rd/(FԧTI'(]5 z*$$:W*ÄhjI$;"P))%I$vJ0jHYD%# J3N!*{)2x+OevR) uT~ ?ʄI$I:IRI$I:JRI&L2Ht:d$JY"II$Td$2tI$I$I:IL%,S')/m?pUߑp~9?$ؿεi,_ZI$l I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_1=n.1=o'Oz? I$ZI$LI$2HI$t $I'L)$I$AJI$I$RI$=h2 $tTNS&Y_ՠe?V UU>PޫZثZB@BD 4J|cK}')EH"9̿)$~wJjU­g5|UEJo׺cI$$JVi+)jobRC%ʒJ"7(%I*H| "I$I$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$Aq+1i/_c|Q|Vy"um\M(I$XI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$R'L??"BAgus)xJz?%I"ƕ$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IntlW?BWBwe"QH|TM>+Zx酘5"XtI;O8vȟ I()%I$??ϊ[J$Jn)o)*I*))ݯ?zHRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$1=o,1=o'Oz? I$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$G#Ԋb)C$D&NS&T2Be<G5YYl|J́V$$ AD))l~MJbϤT>S(̿?%K ~r{?|U¯g/J* S(I$JdI*=[XտoO1KuTG*J7( BI$|>|+I$I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IiOBq)u([⦡oog?zul\HSB#r:$II$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRdU_oGY{WrgoGYwWrhdȻOW'S,dI9*I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$̿^o ?6Eo#>[>+ZX͏ZXqc I$@4?jwr Ld$<^$4CƈiP"1 FI#4)kʃI#6QJI%f*YVP*eAȉ4NTJ*b&Nܪܭ<ڑAdR2TjI$Nd&)IJI$AH; :߆)I$VYʵ#Uk)I&N v]ԐIJxSobt$$VkmTOġBS>cID"t9NOdR'L{#@4M mUy*AQ:& u2L2{&hrt%):I"D:?tU$U(E $Jh;DE*LS*&%MuȄNKDNУ61N ?R*PS L!9WN+:ru Pt+a몯_&NLH3&/ $JI$hGcdAWta(/PB$pGBh TI)W*ի,JDR9Nڅv R|,?]r~e $I)$I$JRt$:HI$$I%.$ 'I I$I2tI&I$"$I$I)INd)IPUߑpTE§4j?b:դ1jI$Q)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I 'DIYSq Sv o>I%I$!Ɏސ $$JpxKVIRI$8>H*Y>VI I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$1=o,1=o'Oz? I$ZI$I%)$I$IJI$I$RI2I$J]$I$EJI$I$RI$zƉ)bb":`9HdLQ3kG3T$՜>*ġXZXڂ5IEhѪ>J)? %~ʃ~ʰPȊ~HLn% tqWUY_V[%AvS1BI$j$JU`_, %H6b(T_Q /(%e$J_# "ԒI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$_?1it/]Tԡo⦡g\HJAr}3)tўE$NXI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$R'L?"rЯ7,&Kd_S&W'䱒I$4$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Ks2ȯeGR̿+M;[>*V>j#V4Zx鍼0$SIDC{a5rI |¯b;(/I$x"5 !I$0TBIRI$תZVk( ))-STp ܪڭ9V$AH( #jI$1D&RI( 40$HIJI$9Vz`IEI$QZfIH9PF RJI%fU*M'C'TByQpM ܚQRL tSR'_$$r8U JSjUcʐiʁTI I$M wGL $JqgL NJNFӸ _V[­gЫ?Yo 71N;PI$$T#d-~Y APIEIZ%bQR]I$ #>;$I$I I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%]RVDxP xY- WW_])tѻ~)$r$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$A$R'L?ȳЯ_g[w]\%.2W'T:I$Ƒ$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$In_aqTz_{SNdWr>jCU`ե"Xa$D׏c.~ Q.vArI%@xGt!I$X'P((I$+xS:(I*I$uXd*U5D. )Ob 7+OUIR !H* 8=5 I1PIG JJRI$1#x(IJI$Dƒ I;Rf5E*I$V4UjV!,JS;FS7tTO r9itTI$WY^>IJRj#UR5RO)(!I$suIJI$_Q?rJRIjDQ1A I$ J-Dx78E*LS* rX90N*MhT )LS9@X%"0ZcNUA*tYʰ!VEel:e=8QTJ'I9uHP:IK'I%G!$% =H)I$C1W3TRQ*J.Fhȵ;J38E,JH술J&萯_ܨ~~ XG8GUcp~'$H*I$I$I$I"RI$I'I I$I$R$I$IRd铤HI$S$$)INI $J76ȸE_"T~9?$εiOZI$l I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI2I$h=J]$!&t???>M. 6~iP9qJ]c攕M>9 vBR]D~ZU&IVv}m,븕'4In`GkԿI)Iel skaJ=qb'֞HJDKa?SΌ?}ri.}U5'}VsDrZG]%x@~Iь8|BRZ%]npW!IW:8=}o$ع蜗\NIIA]?߼%}xTWbr_39%&It~)RI]arJL(/Q¢7߂JL(7hQI^߂u/AIIAe?߼"5sLI$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$1=o,1=o'Ozq>xBE%VVq+UE BQ Aա[?tX7TS*ÿA?(u?}MS| ~pQUȬVV%JivS$I5LI%O0?A[Sȱԑي{IGEBHI%_+ou$I$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$:gI#u([)Y-r>+WT\>+|Jh]4n%uI9bI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJL2+mPBgGT:u\%.2_'T2I$Ƒ$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$InaܿP=X~E{/=rk(H|oNG@}!\ǟHBZX`"Xa$"F GiH;?2'I$7.EqP I$%6r%M!I$3Dϒ(E!I*I$YbPVZQ *L9Q*Z(p8BrjZԐY r2.I'blE )I$ kI(< <+$|kQRI$#*GbJRI$sv(1%)$Ve *xD. JDr3GU'TBr ?JZRR$u^ҥ)AMԩ !@*@$2I$:{t;?L#d>_܅dLVw(xy!"ւI)5(CiE*LS*qT+ dNK(9E '1BJd铔u@$0U*˼ktUjV )1NOLLN)%IOPwE"J]$܄\ I$i ZF%)$ReWgĒQR*%% h *ʐܒXTqxTqT4JRTJRI$RI$NRd$II$TdI$R'I$R'L$$NtI,I(_ȸU_ȸU!n?ߟNO.'Zk3֭4I%I$I$I$I%)$I$IJI$(Ƴ XVGG</%XK >JCDoAy  U#Gcx:>So&J}'-ݫq+)+7{:{ BVj};s.QWRZ~郛? %jWMC[?zPғzwIop~.X%j;9i18h%(vgަ[ \BPpLNsZ.C9R[ p.B%j~{̒ #1?5$؟co޸䒵S?zy!u ./Fmbo޸䒵S~?"~]BKzGbjJnC%Ӧ]OIkhI=`b_$C Ӧ<.e3Wg[\x3&zU]B` SnhS}Gwzn?r\e\dCYf߈[|Gޖ_94xE>'T7x/MK8gR[x}zh}S~'\e\Rޗ_7 j}*WAWE4c.2r_ru- 0~){mqc "xW~WU^'T4a=u,=4K8æd'>U[HMVEW<Ǵ-Qjs.G.Ә\﫥v=A $T"$J @_̑}o??5Y; IEeIRI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K1=o,1=o'Oz? I$ZI$I%)$I$IJI$'IK$2I$JRI$I$ILtI&GRDCz*IEEI2Jg꥙JRV ?4 o XIEHET(D~_T:*`ߦ~JeA;Qg﨎Wѳ ~p$-nMU5%);y)I$$JScC,uԁ88,e$vbIY QJI I$2o+~*I$I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IhtOJZRFPSP[!\;WS_#kwĦ` 2 ?eI9bI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$˨UPWg+UPWb7dȻʕ|sRX$sD'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$Int_aQʏ@e _QɧvQ+5NG@}!\ÏLn_Ȳ֖<"XaDI$M~'y; .RI$JFy< XI!v3yp #A$)$D mDR`IZXbP+,D.X2TL J*b&NޫZV%AH( PpLVI&hN%)$Q(4vSr?t~))t$?t~)z[LJ~Ц J]$Ƀzoܒ$(PIOK~_IK:J~~_&)I&JS|&{D7@{$LE$IJI$$$I%:o()S )I ҇AQh| *%BPeĀJ B2}Tμ4ωS aN jjzv0"*gL_e@lӞ4菚rՆ߸%:?qpFI[gT.qzLzQIHO7 }oRWۙuŎ.fU5q$g}5bR6[ĀN5uę k:Uƴ@9sIBy)\tAHǮ5$JX4J#Rjm-澱IWGsXQGf$*?@w'⏏ZI$*I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$1=o,1=o'Oz? I$ZI$I%)$I$IJI$N$I:IIJI$I$RI$I$I$zIK!؈b"tD)dT??WU,翰RVVqkPR -? WDgT:R*`S* pʰ*ݔ*%$i)I$v+LU4E+("Q[Fb)bTʁS_TX ?^*7ʄI $I$)RI$I$I$2p:dI$$$RI$ I2II%)$I$IK$2?.ww4ȸE!n?ߟNO6'Zk3eI$`RI$I$I$I$$I$I)I$.7+J7+HI$Jm.()䒔:J +XX',c-=/Ԩ熻nRRCPdƒv44LOiAfMlvրJF8Vp~O6uU%3VhdSCJ$&4DL4Z/š2uB*rl\$4 1~HR 6ONgn<[=K,$GINZ.qa5>Y\?y%6P{t ^ ʢ%4:$r /&XM ):J/x`.<2\81Ρg[xĢ[} f⊛ &$[>"eWSϚʨev8_>h)"HU^0*I$I$I$$I) u}6BJRb1] O*D):J@y~?ZygN bFC<"3Ʉx#cOu#DI5c`c J$HՈ`܃[$Ϊ_$D'L^8OpIJjMI#߬_GB .wPwQٮJ=AW%XĒI=bDI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I1=o,1=o'Oz? I$ZI$I%)$I$IJI$I$RI$I$I$NI&I$RI$@G%,b*:dDTS*Y|XYa%.c}b7;̠?A(S !IY?߉T$2>)eݐ7"|YfD$yH>Bii*3_ŪR㒢T%D$H)I$u/ mu I(RVq(XRFI$r7櫣pߚpZTI$I$$I$I)I$I$JRI$I$I$I$$I$I)I&$I%.I$I$$I$I)I$I$JRI$I$I$_A_e$n J/n32?]39_cSBw?dEi$rI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJL2[VEG2ȯ7*=kXDެ# ~%=HI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-΃?"ſrWM,dV>j>*v>j?>+Zxaf-<_憒c I%31}nA$e@ A]$A{Kb{F@A I$tl D$J} 1WS*%H&N«iiʭAH( PzƒI$բCb'dI7u&II&xUܬY QRI$!Q%$$Jr:L~*2Z 9 Ds\'LKdI< \/4JmPSjIu_HdI(SIF)2t!AK'I$Y ($$HӢD1N!US<'rQC3*@$)1N: /")0%^eVY@2uV`A@Gn) FM8l$dCv'I$7j! O.I&a# 4IJI$֫0i*4eQX5Ej~]X7!8ZAvR)Xo*TqT4$$I'LJRd'LHI$PIR'I$2Hd:b$HI$I$I)I$I$JRd/i?pTE)qr5Iq?jYxεj$I(I$I$$I$I)I$I$JRI$Jҫդ BI$]QRow$$Wz'd~Tvi+G*u cY&@*}漏RR ʉs69<z*-[OO{UtiO?eF?PGiR'Lk RԷk<#g(c03k9qD'jXcb8X_-"6XLxMs|c\64w?Ĕ^&<%+Ye6'5mm葴"< $,wE3ix@FfOaEvQ]&`\<6%]U|7TvkRvִOG.־l׉?5'*x3 Ca[hhװJm /Tf88H*ط1i">h7@T3(݂Y'?:[!+* $J]$I$IJI$Sm:bv\: v%hs:FC6?.cMq`m-0Kk{]آS2@[T~T6v՝UK3|V܏H3z?aKaR5iƑ$M_ DޛRI$j~7}/WwJɛtB{QRR&jҧ~I 7߬?ҿk9(C@%}1$OX$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%6h$'=UGn[ *AJRIYJshҴCRG)t$ Kt"-T;CK%-N@Ct%+5%y9B8ACtJJH B}ng!EK:IxHcxi)$PIKJI!$]>)?4JdWIYgOLt#TI)TZMs%K.iIe>_` p.dg$;;AqHM)Jw4Äɪ]$I$IJI$I$RI$HxSiRI%F-6O`>hRI4+cB߂<%KRI%{Y!<]%TI)TRZ#3*CT9M)JIj ԾW I4}#I(CI')LC']D$yGC-[4*Ċ8(]I$I$u/w|BNSJJ=ԕ^ )B࢔SI$O O櫤$I$HI$I$JRI$I$I$I$$I$I)I]ߪ8x'0>Aogö(;98,% #;_N%u.V?9ϦL[TruήC*e~eI$IKSI$$I$I)I$JF~%$Ԣ_ܯ u?t.g#[b]6*I$I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$.EQ_3+T~EG0ȇVS>4Gw?G*I$DI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%пWrTOQɥlϤ>Dr>*V}!*#\ҰV8qc I$QHD GG?*j$I/II$ ٢II$0DnmSjIRI$W^0,T P(.(S2pkU$)oEkCBjI$E(LEIJI$)0 {RI&yV(@w)($L 3 !)I$DIӕ&he%)$VV[«PVp\ 3b!I))pH'RK<"I$W+ _ K6)U)I3I$HN *Mh:Jfb(|PRI%]:)Ԡ6BHRI$_sRu [Y@򔠱i Haw\wxΨT߀ljf$jIQhp$&x'LJfOq:(mqoL 6f5N>m'o1?|3R&{I%LI$$RI$u}6B_MLWc]Fec)S)>i+$iRS:#fis겋 i؅Ԭ}b`hVG5Yټ;©)8?b*up> $?D|#G9bTI5H&RIX菊ojf0Su?$AJo 5&xZ;WBՍ.w섣WQ@|bI$*I$I$I$I$$I$I)I$I$JRI$I$I$I$$KC+ʆ'窑SIJpR)tINRA%,t="%,I"(O))I$x)wM)N)I$1)IJI$&N)Jc䛄I$tM'4%)$Q% )t$[)$@HIH)r%)$Q}lC*4k1UL @*RyLDza[SI(*?W{G⮳ѓ揾xQ/ )rSJPP!4Ϊ; $%0D @I$&$IHe"䔤I< %1'$DRI>BbJi))I@HQq))I$g9FSJ RtDJΪOR$v BN$R$I$ RI$I$I$I$$K1=o,1=o'Oz? I$ZI$I%)$I$IJI$I$)I$I&I%)$Nd)I$I$liq IJI$ H,B@?$Q(V>j齶O$IM(9Li$y5 ??Zg WoVEKJbrTJ I$I$~PXي{ ՜n *7% I!dUՌ>*pZTI$I$$I$I)I$I$JRI$I$I$I$&NzO[S? ~PSY-#L6e|VlDZ?zq& 'Σ8ևq=R\c?SƈSTnGTNvߤ.u-$8Aُ%z'Ni9a0i `tίge г |3tVu'6ّHZ?tRc칿YP 0IJ73vN38Ϫ~PJI dEwJZ=P/IAl{Lr{>кl]* E$NXI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$$JtN֗OOFͿ,?))I&ZbaS-}T~EK0ȴlƷ54F೺ ud;%NO*/Ʊ4 i*9?RI$X$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-˿?"ſrW2AlϤ>Dr>*Vr>7q\'Vbla$dH%1Jf(.]$Pq!=4'IT!D$$HSjt `k)%I$WZeuD.X2QJb '?EVԐY T!(NMB$zI7 C)IF%Wze]TI(@$)$DRaQRdIRI$TGâIVXtD. \QQ<(NSR)LJRI$*H @{&,䞰C@&HԧBntN>䐑$PR']e)I$Q%  %)$U*u9ASDI"W(It\uB!)`8 NԔ1N(. Zu@N:Uxv 0ϊ L2(8Q׺JRI&Meg )tI@vBW'I2uv 4*t)()$)V3EZ%Yo芔TJ3!ɄW1(gTB5w?r|UH}J?3VT$AI$I$%)&LI$I$I$TI$铢I$$tLI2tIJI$I$)dLJd$Ld^Qe:I$l I$I$RI$I$I$I%)$Da\Ta\@)$NIRI$?ȦRҒt}/E_xPI%,t}7ۤsOMuAI%,t8#O0?]FRIK$$oL4&7!$I:Jn"~!/H $N[y@⢒JY$$:I)I$I$JRI$MWo$&) I2rI!ʧtr8)c%\DY{|‘gj;C*G菚zĉ$l Gޣ*QAJI$ 5O@菊=OA+&'L8DW JSRo 1&(;WB .obԴo*7afIRI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$q߂!@0`SI$R EKIjnВ$LR$r@RkU{$:JISJY$铧Q)I$pr))IBI)RRR'II>e4JY$H(B}ĎRRI(H9)HIJI$JBJRI$7LY #^)IM:`DyLIJI:IJRdI:A2yIJI$J0$I%4I'1)JJRI$3s"R„2I'.M1*%%)$$]U&|`()I&& U6 !%.I) >w?kG"a)tI@$I$I)I$I$JRI$I$I/1=o,1=o'Ozcq>xBE)x'-#O6|Zdqt wAVH>jr*fVYlXƵoMsG:|P,%1E$R2RS*d䷬̟>*׷񧒀O'鏹 IG6Yi-q} GܕpI_"VBK_'% $?S>%X?!)%a\%uS-%#~?4J$=-`$!+ bmpI]_cTqϓC^lcy |5DKtᒅRyϯXj\ZtE.-wgI^DRgPloކ]1+/X%.kQd$mVj,eiуa6];BU07W>l 9[ 1N0j4ikq~.싞0wp]: ՛cĸZ P`K'uxsy?65k@h@O)B4F9uS"?7?wPY<Nh4@Tp7apKXsq3o{GrdQIg˯\{`>½☘RpƏSƆ2rGEid6O+ʎ+./#q?pp ,u>D;4D[x7׮xxkᄁ@UKxUjsg of\\>?Ke:;gV$Ŵ\߆ظOg-&j?節Rz8w%ET^:j]Mg+u}|h2+bIjTg8.=AiAT]]ZzMG.q$vOt̶}*l;"pr5Ғ) yt,koAIw/Jdm)I#} !r6%R(hS>>$*+?*>GE*JNVϭ=&G?.YI-꾤u[97jO󏭃]}F.~߯׻J*YԮY%-6d_}V99Aj݃+:\z1awLhA0}Vg.?el[K,f( S]A E-tQzp meulnNE;kH8``&t> 8<+0Ⱥ })ֿoQOQ?žlEkљ[U{V}7۟vLdI4$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Ko2Ȯd3g Wr7 g#|W0 1i☬'2I$ :);M*۴(.RI$;oF~ny>TI*Ntz:W !I$8IT[SjIRI$TaYbP* @Sr*`2pZeʵ AD)]oD!A&tI5h*E:I4"%%)$P~Ww*˶$%$:FIETIMIRI$O*Fj!!C<25Swr BpI$I$T ])EJmPSjyH8K}dI(qƪMdR%)$R$T.tWr^nI:*))Rdڊ#BB)pK;T'TN&N:a *PR !H!*|UN:d00Xl)y@}sTI$H矒pS2;!rNJ1' .I(1𫳐B8IAI$|,ZIE+&)ʉDnFb)b7S**J.$Uv73P$JLIJPtRL2PtL$R&I:A$R铤H)dNI$&N$RI$EJI$?O\"i?p~9?$η{-EVI$I$I$JRI$I$I$I$$Jt}0T}0RI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$e:~!E[X??*IRd/0 M nGTgU(-uI.nm_*X\"7Eźut'i.xO[DX=(]ulw=+Kq8V Nwڎ A蚱/C+kG`ƫX]cz{dV״^',[aqW3f4_Qk${Vzƿ #O[ HD`o\}}0ֵWW@sV`h~ ,T.,os?Xc JUoTĒI9jTI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI${WBvׂ$Oe,RdB[T #=JI$BbT蒔I(ܗ vVk0|ωIKN)GJRI$)L$&N80sLI%)$JRI$)I)A2S⒔I)m蒔:IKHQ)IJL$y'D䒖I:INvQ%8DI.4I97)RI$9$)I$t&%%)$O)HIJI$%3$a)$'LIK$$Jb*Y:I%SJ RI$1Q}?%)$N ))I$"h%Zw yա lLUI$*RI$I$I$I$$I$I)I$1=o,1=o'Ozcq>xBEP7F;$Bt$GIUHm)`!DNW^LB A6JoS6tq1:O vI N"B;J4)$6]D8RRЛjJ箟UCtҊԶ$zyV/ ,vBJѼβyU>RU B$rV: "ڛjdsgtD nRД'I=-bG!%- BtűoUwb䔶ԡI$_T|JbH0:JeCqM;y$$J.5lP%bD4~LVUğ\KMgnN]X+ƾg};V{?JWӰDsƯ#]!DBMf׬Rx"T́14&NfSXg1hSufD(8왤);N=[GY~XƉwR(̄I0q<3%ԵzoKd; yM!)IL\g^TKuMr3iL E9"SdRƎФZ؁>~ \%<#s @)nC)F)-dkoB; D,fv(ÚI-2 Ax)IJPK #ir@#^K.'S:!9)|JEJJXyN[Q pS9-\P%D|4?#_R.Qs"0{)6TJSmP5=Ҕǎɥ37kQSXښѸrv=o }d̻в[K,5r_:a0 4 B@n UT@u ~lUOn#U^\uKGX?o]yIgu[sϱR?̷BaWK1䦏ʤV:I$4I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%W2S̿+?YBՐlBng!Gei7a8 RI%8 n84y4M\t`!=VEI$ S@TؒI#43 MLҤ$$V*X*QW,TJQ(.R0N'nUV\ڒ B@C 29MZI$_DI)0~D Ф>I)I$@yFRRI%Fd!y"1$)$F&@zF9IrI%fi*kZ"7r25L>JOQt9N%<5)R$@8@&T Uh2huw<iP::HNLT?NJt3+BRJY|Z8YG*I'A I2d%t$$))t$d'I2I$JRd铧L%,t$I)II:dR'I:II$#k|dyh-dtV|?"f}Yu43't{&H;1DSgRǷDZ ã%|ebMꦙqu.˫%{}͉/SUo0βOyp\b ^C7V +tKCNֈ *p'Xjɶr׸^a~.'eeYv:ic$::>H۹cDhBDj> qn#W-vT Sx.OzX#uNëi+6 G~bϷlEbU©Ӹw[or~JWnR;xL?F߂>K? o\1 }yY_?o򬴒I9jtI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$g{gZn<Ẕ:bM1RI%&NL>))I$S 1I$*)JRI$R%)$$E$d%:'NRI'Ni)R$I(MJRI$`$k$I<%1I)LRI%*\{'IGTM $IM]$I%I$I$$I$I)I$I$JRI$1=oHX_WWwKZk?Fڏ1O8T)QoxM)n슜[bgXF|u56LI;JpIϟnjDzd|IO~)KTJc[#Iź:{@4yd|JpJbZ;ɽ3F iEzR/jN )Dv|4FypE篘Qs'⥧dɁҟs)tIj=y H )hԸBُXi83sH93%" $&}Q+dOfR͝>ݒRפB(h:=NZpKt(eH9%133a>@Hr%"V!"t~?*4@!QuLMTe6ɉcU=HD߯>jla'@T . %0!1 IHa y[IH۵u MEJ3GnR*GFs\4I+>wXXaO^KSA]P*:]F޸,g)5n};Zm XoR:F{+l~עȩ[sʏPuiob4F42IBPQcfI$P·e%)$L3q,whV$XU)$UWMNsӀ% RI$$?fxe. *I$tT'XF©I$I|"$I$I)I&NI$I$I$$I$I)I$I$JRI$z/.G6P]X~Es#?A>j=Iq\h,ŧb, RI$N|e&:&'5rI$A: NQt gI TP*uI)$$V+(5D#T\(T8L!Ze*TY PyM 5j$zuBtIJI$T)))I$ k%$)$O(DjZJRI$&j$JjU!!C(C*.Q O:&')p & IJI$pVd SjSbyN51ZC4I@4y*m RI&IN( R$M Ȍ $H4jĩW)Rdʊ3AyEp8%BS)R铦JP\x ܠTQ A TgUmEVt@:jGj;Dr:e1=N _iQ&uj,?[I$I$I$JRI$I$I$I$$Jt0T0RI$I$$I${0TIt1PIE UTID4wߞ$JX5cM+Ć4%R5H P{XȒI |S$e8%$I I$I)I$I$JRI$I$I$@aT1gI*Qv(蟂*k$hJ rS;Ȅ-EcMBxsӡhM6uiYjxq+d8#kȥLksTx}t{1ً=^etU0ƳWAk'kL)[C9K"RNέ{.aL\pCecW/qYk̶0HZyR/u0 חꆇ8m5j5\[ ?S^;5\Maip"T-0/PRS<}qiHa 3 mpʊZ6 #LixV` ;O5fл'^NqY5Cn_YǮ3q$B闷#2vr63 |EҘ+cGiYI$ mI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$KUDlGmyDRI%|ρM)L)$Bb[TI(JJRR$iHJRRI%)O*))I$p4I'N3)R'LJpS'I$JRI'$o:FJDI<&ft%)$IL0I%)JiRI$@!>"{$$I$JmIJI$4RI:PN2,,%%,1 'G2J]$H8)RI$:JRI$-Jt%)$QD%)$H' )jRI%&ƃ2`JJY$$‰T3|> KLI(I$I$I$I$$I$I)I$󿫺W1&|t\oku{Qf?Go'ೋxj-K;AC4ϚwF°X4wD J^ ݬUr[a ϴ?I01XUid6AD<hxkRg[<$HL^7ACp 5 '_.ɽ0?*!~BЕ"R6D|cIs{;Qu>{]II%i]΀`;d-[N[ 3d"xoHL > kxH7!+R@?ꐲA;FTp@2AMACDA撛$w HQ:NB5?۷ >ZG0;x&-~hdG5RuFui%+Rf{k !۷(kHZ@ui:oeX9O޻73l ~}+->Uٰ\ u~,i )Np*i΂;^#tID(RI$f)]JI%0u@qL$JrcE: zu%)$G']SAwmo: $:IMv|mKqB@2AF1vw*{ʄƉiJBiԘ3☰ȓTaYwFu[\dg5Q3%?KT0< Àic@ Hp9H$>ڤ0y9) ` :H!80t@uC"u4}q3̝dj Г^ )1ǂ #}$LB{p05JP$uLdAMu-Jr4&%F!!$:x$E&#*-cwmgdFrwl{R.'T(̤GK҃ 4xsЫv kh@?He9D[ ]n#wqοKе4ZfO*6Z@0EԾPeq>݋>g7;=l>e1hT?Ģ<#Pcܾ{sMh[浕\m8CO{Y'OFS G9im@RasRsAp$IJaEbkIN9H4m- vxBtN5]O^t;'L2mn{vٰLkRR)A @nGt)JJA%j63hGxS5%):d $O0 "N8LH$ 6h52;'H? %d"I }첿7 ']]\H oLH;9ַ8ZODcG+/k}Nhc Ϳo;\7O+8opͬW`oI-8QїNLOk*oM9kuǷWF1l6G~c=)%g3 1dY?uJ-&{$I$$I$I)I$?\f9RNW2lAl=I#ŧDbPD I$Rb`hdǟR#Ie5r<'LGATA]$A)D1$)$FMTJDo2TI#° G)Jr' 7*+OUAH( B WI$֊J h%)$O MQ4 )I$ܡ-ԡĔI#F!I$ LEII$HrO'rRrQvQ$TE ȥ : TT;FT0P(+%fh$ &NOʐDI+$2D@#%('PވPނI(3qN%$Jl Ufe"JG#7 1i)`7""5ܳw?rJXtYB~7ʆIRT铧LtRLII NI'L$2I$I"I:Id铤I%)2r$N:dI$TIC#TESӓ'KVyU$IFI$I%)$I$IJI$I$RI%:~WU*~WP) I$I$\I$Asu>Hi$&)Rv-$4\)hI:hC-{F05ԿIqN/]yoTyRR(Iۈ_M>'dO0%k"A1))I$P  PxpI?U0xMe$@I$I$I$I$RI$I$I2IIJI$"P&ƏʠG!J/0 RQ໪+VAx׍>Kd1q̽-s({ NoU/'h\'.Ytָ6g[F[|Qᐾ]PYS?dceiJn.В(,oktnGuh]# /N kUwԜ-;Cpedeo;,2  :1ufyl.oPΦ$8aml o^雅oq5j3 $w(`ARk%L3>%ale;iMDž3c9-F"TENJ(@( o 5 Gd3@{NrX;?"HpSq>&OeB[â[x6u֖Z q՞I(I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$vx&I%)$Zݪ# }a4SdE$ DO<'EJI$LTJJRtJbS$$IJpS%))I$)0HIH? Fzhh1 ft'ohUk4H:<"GLp?~Vs]OgVHoHrnuHZDϊ}0 F֩9-^ VHv9{f#~\Z0ϻH.y؃9.{sy$"AAվ>xÒȧ8Ûo}iD<?4$oju߬#v) wsQ3}da,v;Ү}p 1b"|֓XϦzoNqy?)Z'm9~AyӾ}bxiw~RY>Ѝҹd$Hc;}6t>%+GE LLgSh8ku}d-;y|O;~4k"4F-Ұ{yH)SBŸ@&>TYyaj$wθϸv4<r zt[>?W`W^ZϮ=n =U[fu_76YfOok擹>I)!I$Pe<|{&&cH%)$JJZ )I$yT%>I$$IBk;|{tIMV !V 6JJth>\?t~U@]BKNp`}ws1kg!t./IUTk $,5eI>*gO"ym];!Y܂GÞƷaL;5mv`i0y )w OJDǘ:LH-ieF߸'4)LHKDŭ/4ͯ_$enА`|{ MI}򒘸sL`o'HiL])J`p#@OG] h']M4Ljx΍di> ILCv|T#Y$gxAN"OdO9 R}/ <4-vI՞t#ȧ)IK:t(Lvoܣf&SǂS! y5mF'y$4H'LR#Bb3)= @ ?%Ӹ}4R)))r{wO x"xJDϊiL%%,֐D@HW%mt!'y)L$iq"{܁@(5HФRo)|*]|DA!W{ %hH4ӶGOfk۹ָ4>2xI;"CW_^a }o.n=>ٿEByGuS]F.uV=5DžDO xPmM%Tp!E>>*h!ļ" PDm$@EZ$S "?"9AJI:Iv)_ʣ5$㏚IX'I$-{$G:pi<%)$L~ΣT0I׉RyL󔔤IANd|!8R4'TM*Lĩb>[1R" L;얺w3TL*Y$&V1t3'aX]Ѯ)e 5⦡ge[uly,EԄcyRCeIDrI$I$I%)$ZX+6P}X+Y?Bd0zaB֞1'U{ViAQp'cNǟdI$Av%PTI!AR u$HhT@Ro)%I$Z;*V+*%HEtRQ(p8CzpV^]C B@l.D(n2PI$a֊RRI$Ц2 IJI$] wr{3I'sPJ%e%)$E) ӏv)0)$W)Y*7qVqC*op@rʓ6PNI8JN$&I${W6)V<|s |$(iLI pDI2wgbJ]$grYC*l)$D;9M MТ$ertAarRrj{S$SS @pBPvڕmܠPY'L&v|+Gd)<ә&I:bɀP܂2t3"+RI%Q5r<I)W*<jV[ಉRQ(Go FnrSw#pIK~g~7*d $N.d% 'IJI2II$dNI"&NS'I2t'I$R'LRI$)dI$I)$(_"y"Ԓn?ߟNO6^Ueah'ޏ(v&ϸ|}&w]'_/󊎗qb/r+q%9K'G7<qO7<*W.@zJW+9r$~'\aw޺_)`a8bz+o)\oܛre\KSġUNje7KrfxKrf~ oޥWJ׆7lO8`R*3eBK 050%r37hXc/ƿ_c/Ư)~F> oOmncxYm 7<態62z_c+<-XR}.\Q_,Hum"ǛЗhXgHu_/W~.1 Se ૊=M klcV8vW8ȥ8 wrW~.1~)?x({$8o"7~)kKЃ2֎|wX_;'R?"0?rwa?Oaa_pKsӷv I~g_?'T\" R~( WEyOOoCz爀pL˟).O-Ȩ; 7pd|T`_p?9>cQwM.l[O9soE O? 71t`>56Ddڙ!x^h㰱˝+9Ů IFI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$WpvVu(Gp>jcv*h쥊I&Je(.I(‹!2RRI@.SD蒗I$ I)%=JqJRI$)<$I)L vO#%)$'ۥHI1rR>䋂@I>c#$BJRI$$^IJ $R)I$E4'DI6R5J))I$PPIJI$'2%)$J5H)$LSDI6МRI$y$!%)$LDIJI$ A`IJI$JTBrI$2'e\e#qJ{)II2I$RI$I$I$I%)$I$IJI$ϫd RSFu2#֮Tx/C2H $F{'mG'O\ s:m?Qw_c&='΃is@is : dhj"TW$4A%UZ x4:XwmtFִu##V8H݀AuHť#󽉝XK\;@(G&wh) \^Di ?) aHq3CjvA5%oim$1:4HKKGQ${ 0<~$}ELS&LǏ}?vL|H)ce I> ۺxq_Yu^ 5- r\~CFIdcS)!gA(̪ !):q z)nd6H5?Oj5X@jcEʨkK O~C{yp?Qx-AlfLu mseIf}hvL(Blإ̰ik@ktM #R8s2ߵ.^5Cô Ao1׺@az4$P:)I'm{2%F{:y $I;Bi%;| JRI$DRJI%6MT{ILBr' 4xIJI$eDN# )I$x%HHy )h;ߒRI%O!RRI$ܧ"~)TI-SO8|!$$LH#<('$)$KD)BJRI$ :%%)$O))> P $$pL4)I$ۢ[#4BIQQ*EDC qd+. 1@It.^gPx C7mߤklpi&@}?걯t"~)ƪUltGL(:x12Δ 5<Ҟҗ:')IZG2c$[=GyH4=%qdHax?~5`:8qp.3G]G}#'IH;}ӱL6KGH<R9RDpyy)kڟοupv`WkmͲm~77צ}7idދJyqnPA#w-t}/rXZ؈w#mqT77%'Vv.'b?Csвw\O}ȝQ6?o}@lmjfk]K{b&2c.e^L%kG2vZ{C3@@p|B(Z$2<ʘn0ǂ)k>j?F t$DO%(:$LhFb]vRᬞ5 >))IL];D)Rk/ )JTN]Rip[u<,R&uLtv5$$)4|T$${AL$%)syLHL|NJ=कJRdj~`y*:RvG*a'j!W6Rwū+CW/Gs:| 4M2b"PI$I$I)I$;ZfS4k#?R^6b÷;V֞)rP+C4ILDhGBAI$6IGsG!QBI$VS )ԒI#aI$$V+VX֬S*%D9LkU ɪAD)] ɨ]$IURI%#(RI$ yAU;ӡ6I$:%)$Vd|ű)R\I[DZe 9  0JrW $$LRWXE^RAMgqwrzd2u 'IׅqAJI$qD(҇aRJRU(tDI$@)TI+9rM ԥC2L2GDQ AJ AD)7*ӕKNtҮثU$"}L4/JY$铔7z$I'Q&P4'$J-0UHUDR,VYgJFg(D QڊX ȎBr zлHbv7ʴ{o? $RTI$IJI$I$JI$I$TI$I)2tӦNI$I$R$I'IK$I$HI$?. w?. <7Q'qODejI$Q)$I$IJI$I$RI$I$I\zY8zWń8r 8wYhEHsŧ.&äݕu } $#I*2% BI$)LR(I$JRI$$J1rtJxJB&ܔ&!(I$)[%(M I$SJ$nKrb:dryM ҄I%(ے$$\ShJ}l;K=G`%XŧEbpDα^0 ?i_i,I+/~FR!(BM_%h=+/~FR/U/UPエ0Ȁ5'dfշ'/~DU-Gg)=j/k\ A#"d6] NЦp0<2%!hnW@~\O>2Xywȩ$ rRs` .W"P?+rw _\RI$: $I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$J+NJ ))BI%@%4')I$rB))I$o5) I%)aJRI$JRI% %$JRI$y P:dBqH<&.IJI$KD#JRI$G`Դ%)$J#7òbI%)$)Q D'I4vHK I&)uNgKTI2^IFa%):djR%)$K_mSAJI$LuR*))I$`&ڒI'BfEARڒI(e$%)$LhRjJRI&J4N<$ }R&IAh֣ZdԺI$I$RI$I$I$I%)$I$IJI$]?.^kp}YjR |"Ss|j??}C/k\u m-.&FO]Tz/6ȸ}Ccru(kh;gFA&"{L"5L~"?yU"֤vKAv1@A| s*OUT^ {rPsu:%Un:?W=aۨ!T;@C;܆5 5?߱0ut48䓴4䦫#k1>=i\jIA³Ld#k$dV@ALFk2ḍNv@;cv8iO_bFo!h ߣ}ZZL4 }g!?;Alną7V7D`D>RV3.#_n` ik? Q 㤏jv<7'|OR;ZI<#+Lˇ RzƁOy;G77'%"v * mv$G?u'\k K\dJ2 Nmhy)"b#Q/fCZ}-L.Ͽݵ+4 {U,Z?;@&c@D]>8 x TP|8H QRG<$ ˧R/cZ.;O?˚m;\d~Q \h'o*"K>0᠁H:~a>=lK5:{vH]okCkphMD~Ժױաޟo>%Q]`՗Hp.(D}wo^b1.r`}:`5ʛPQBI$ĞɚJFSI$ %HN=ӃIJI$ɔ~$$R lH&>))I$ZDx'>#%)$OѬ%MOޟ⒔I'JD{CDwIJI$#T%xI$yO |RRI$&t׺xNRI$L#HBx쒔I&Ήa"`&@%)$HꔝDOd)FI!I$nI TI)Go f0R$YHI*) ʂ#7.Kcyʺ \I*$=+X/+11hܞ5J vou*YILαRm홏wHh#GrJd'IHZ#4H 2|`!T@uKTѿh< d'pA{F<▓#H @5QoJDXvS>`ܡsܧGoʥQ {v:/5~$>R;@]y?ԒN#2J[d'O=c8 @1<~ԶO c'MRvD->ZxBy 29#E&7Rx)D$nn⓫@:DŽptD#BeJR:$F6O|?\$jtSq$R:4N$5N)w*/a#`O"2T% h 4>~Z I?!*KFʬWn?ܖ[7]pNҥmZ|lr'aQѲ O>qPK:$O>=GPDpGp!7"~5 ;cTND3?KT~Sv᪞#5|yI O ').] &q$D}} )I$Rn| A)rHA*M N^ʐ çT820 <K?(IJL I݃SjtDh? Rn.)D>>ptO#AJL>tsis^atA-<|V~C`'ĨDG385Vmß =7x7xt[[g T!( ~'t[[If*=)5 ݢkxZBhL%;iP͵ :+۝4|P(f@|L;@%">>a/.S#Q ftnә@'(BA]2tSD$)$E M& A$$V+V+U zW,T\TJ*N)OUV\ڒ B@#Y ;VI%W(Z,y$$I> )I$dh'UJ6~)!II)PIKH)V :“.RI$W2 t% 2;ztT 2tRI'@pA Sjx@!4TC I$y)k0uSFPR$" !X[:G'L:VT*lI$0 )RI&V:#J <"XAM*LpJ$'M)Aw(LjAw)() NUxvĦITV7v" R|?撖I:d(8AR?%BJ]:d 4;H#Ϻ ]$CnJ4U`~J2&RPRI$^Za#UZnR*%QfCw9Z7T9~~䒰YGVgc}BNI):dI2tRI$I$I$I$$I:hNI$I: Y$$I$$2II%,I$I"&NC#TE#TE4n?a}O{ާ%ǯ)ý_ҥUfַHyq7o%i^0x7H]Nn]-x"s o\MVy|nY _mHuṔۘAԭT\TODz:{ۇDq۵m~в|=n9ڋnU9領umueL8){kdL69c>Crkt?qsy%\Q~FُWիa/'Ե[#EGlìZg^ԩ]Hs}3蹎ŭkUG(7$粧ӾA y1{Q/TeY9e>ܢx[':4GG~ek鍌X+ AFkDJkj~)'O4g3,].7g5 ]CWW.9w_I$7I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$O[ПW FiX h쥊I$|%"SIDLI$BR%@%):I$I RI$)LHO%)$I8!)I%)$O~'LJSrI$5H)$$JtTnvGEc j5&䤦6<0IpdJ~RKCK"#hI$)RI$Jcʓt L$A)KID$$II&IKI$JZRI$Q%I<&SI$hMKr*RdH5-) $I s)RI%(JRI%O J'DI Vbӷ+1E5):I$I&)I$I$JRI$I$I$I$$K?Rb8;+4OKZ=jOQ'ӳc|ȸKrpk խyő\M"LkV; F8Nߦ N\hԖe{H&NX$?Qe|{CO?Ep\{Oj!HR"?51SHq*~i& i8<9n{q[wXyn5KP l|MK.q&{ Q#0jձ^@?u3_;pBJk4awGt3:܀ۮ98?I?ҤL{F"uj D~2G{D颜t}ԈcD4{ ټKDqeҹ쇐2}󿲫1kw-3ϧ3_n{'_P} 2"9tW$:HO2Ҋ}IxkK_;}6kSG;C˧7k}?dɨ4:Hm]t \ >s;2~YXs:H KZd;0Aݶ&aAKս- LHkxqt;j$nۧڤnj&<SW07B]?9M" _6 2X>ɬ馼(֖<F㾈O 'MZKʜCAT[ioXi}_EsZHAq7"|TIo;!:I!3MTuQ>hI$0%JRI$N $$J`n:rTZ{x( TI)5N!6@I%cN)I$AM, 4O L&|K_@S )tI<<&"SRNJI$p#TŲH%)$Lc3vRy.$:hI!o4-{jI&|RRRI$T/S%)$R:a$$IGn@pSRR'L9Ve|iRJʋ:hT@.g%tKeہyny^tO>9k`蒐4O DNܠ#Hx~E8I|p#D<'$0uH_N`||R9Q0eS  HIKCװONCuJi)BE)ExO'"yKqc g8:Ȕ8P)~Tcy'I?-s3Gvr|j)D<' b|B#hhNHE]dF-t4 j5'kuzhny@HrJQ?8Lx8n =[lL}NR(5s:-)d8GZ4{-}=nB:DN(|SATs 5F֝8񄅛4HHO x3}RS Dn$oqN)Uf忹Cs|h 6۲-c९*Z$GǓ x`cm0@iOpd:&۪#({NѾ7F4RΎ4VϦ]ى'*olpw8R;x֍@!63sj$(5v ṄXHgTӢ r"4|Lawq,ʲR=tZW1FwS"Cdue}&[b`=SThi|jN'Et,ٸ8h1OjI_G3 6;ǰ+UΆ{xx$7"bN0y-N0⊗K'6<<ns4O)Q9bb!L{BG@@)3(BJ]$Jx&v4:xBJ]2E9QhR LyJTɌGyN'ۿyimofl-LCKܦ߬6,,a@ }ooS <41X֒In'M*tZLmGo7-RGuOݿpOna.h>?9GgIaPwo^E 2tUX'6]4q-yݶ~ݬR:ҚL7o5z>([]DWW ĒIԒI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%>*  Bl&N&H-{%MQRI2$d(J]$L N‰ )tI.4L RI$ irRI$N!(IJI$4'ڒI:e"IM<I>LZJ@)I$@%  4I;]ۄݒ-M%(I$ gx& $$2C;IJI$i| $$$)|R'%)$7)$PRI2PpIJI$$JC;rI$p'jI )I$y#E N%%)$R|R)2tOCHH)dNL|Tw$I$-YRâL2tI%I$I$$I$I)I$I$JRI$:?RɃF/3)S>yG?j??};8N=ϫ˚5.Zfנu8?vh kwm2u$b{h"5*#lk)m:N-]=튶z\@l-mV69n%tZ~Rq;s>rgI`Ğ?9Cb]ԚC:~k'@ߤj1MOOk@0 Ekt`B@k2x{6@{uHD,cdƝ)kh#Hp?qwA4dmhY}ۻѶY;YVXƇ{y@'C?G^󓵁I68'ȈIAku"<LI 焔,c3h[eָ54AʀgQ?*i\ukbH/R@riW#ihgNjn0sb#\9:4dsw~ЭdYVA1?LM{FDfgd@>NtNHu{,{LO=ZZH-h MU-i.j@ /!.pO= k`QN/$IHQ2IJaT;O*.*p;$Hc% RI%)N ($IL$O @x$HO>!FJ5RRI$)Q<I)HMH})I$hΉ' %%)$L8h:;4I(T)OI(#gT:rRRI$gTKo92gI4>$IJmS%)$JSi'8:q )I$+^8=љWj))dI2;X;4F! 5+I %*$+g)K;.s]l{.7GM;M^xw~ot]#9 w<ƪ$-Sԑ`iLk<~ds{x!jGdJBaMBJeЙ4Z1 N2"`x!O&SbJfIwi!> l3:ATCOi?4 @SDs&6onֻSϊZK F`~ NyILp$LA8n &m8J23u:撖%@h$8|cjV  \$ I}$C`|ő'qDHq?J!1h:꒕%DNN[lcA%BCI@׎$wIh1AT|R繺j|aFcV5'TRHa>(mhA85dcCl٫%2< % n8@ %Mhw9EkLIH'_Jg*#Y);%h98Ο2CuQ!IV~[iɝb:?4}>⵿_?O6Yr(IUO)~ѧ_敛[IW $-_4J_i?ܴ1E?W3<rᱭl2@-ʷ|OȢQ3GR1mAה2t$j8APTI z(;T؂I#6BFD)7RIY,T\TJ(Q*AEbL!UZzj ,Q AoE(o&5MZI$h RRI$Ii )I$o(CI9SAuRI$iRdg_%*+I+5⭵Ui" 2|S0NR$I=' %iI$Uʵɥ "74Fw)I$GQ!@haH9)2tɌBE! 䤥LVw(FpI)&rQJ'LTx@'rRrLtL9N8EJLBw(; AEH!SYhRQ I1,(ה"h#I*L$@C|iL))d$HBz1 R$~4XOޜdY(p* ؖcOܻy &x)o+?JoZ)px ?r^ܻݍ 7}˳}KG;Lql/B9]ZĦĥ|~oC<k7&[>L&:y)p*ec?z_U#Kg2,$Kyh>|p}}zmS [Ħx%.P|vd/B< z ܔ\ ÷&߸z?Q!/U!qLo{{GT<'v[G[yuuLZXx ׮eYYi" e2`*3<5=*[.SƮph5 I$H)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$J# * |ըSGe)0I%)N D:f,$ )I$inBHRRI:bc9H$$I)@)=VbRI% 8Jt)$HSNRR'I64.׍R'Lƚ%') )I$}9IJI$5)먽p)I$熐Ss7dm3Qߑy[_jQ|XKZ }?߷TuH@-5;$)Do#T.#Vl=k]Z6Q;8sb51wOf(sDR5H8$4%SSOS%'quZ5mlI&u?KcW8XHr|os~CfO2|ChvOHk< hz=$: w^k?{TC21 sX =vY?͏q- 8Og3KDs؀ӦGfy$,-{큲ӡ^tzzs ߺ6{7އK%ܦC =s:HQ1 )Ih؍י?栖<4u{w-.~xxS ;%@O~^nC9@_~&A#ᩜXyDQvĴNoF 6 ^Z-;]:s\6ˁɶۀmlĸ?CG}!$OZK42Z|u'R@'`$ý]q!h݌o5^$8?Mu&̈=ɜ!O^NikjE3LϘ|S\Hu"AFnGkȗև3^><6 0cTח3w \寮I~;°N'L溣?Z\;G{˵t;([铡BBNHPI#䝺&> BJRI$N)TI' J-z )I$t]|RRI$y<'hA䉎RRLSaxRI$ڥ>)3!6QRI$pQxkI*I$|nӈInE"! )4JNռr#y ]>- \0\$|$` 'IJ.uA.#;@/hO33kH<ʩtOHutfWNI> OJlL@<g$'P$Wkt)sdYl H=qS RvIIRg]4uRĆ %]{?C?:9 (IB ų}gSnRW)~ѣJgޗ٬zJmJyUhJ_hWw]UZf}/ Nck|u$̫]3RY(?rrk3Na)i:hSORZ$Hg%!ARI$TbT)$F mQJI%f! Gb+DJEL[$)xQCL VI'VRRI$G)JJRI$@ra $I9NNu𒔒I"6(&J+I+Ui* xD$1(gG!S8&;jI H$R[ʱW PSjDpyKSA ID:'#IAKN'./E?;>))t'U#5C3*uITʊ9E*I$QQ NQCTcU1IK((OQR & *Wh~jTRQ IV<vJRdKHTI253d3ₗI2Cz#JRI$Ӫ8:|II4U ?RQ*J%ò 5REd)o?rΏ%w?rEJYDOZʆI $I$HRIJI$I%I$d2tTI$铤I1I$IJ$$EJL2t'IJI$I$R$RPi?pKi?pJI7OQ'QOD "Y8_7I$I$I$JRI$I$I$I$$IkY5! XTISD# OR$u&$$$I=D˺JRI$hJJRI$PSQ 2O )I$q$A))I$yĘhPI'$R1IOIJI$1tIJI$kҞ`rS$IQNȝT~ )I$qeHD$$2ȉ$ IJI$J\.RR'IJLh)dNRRl%E蒔b%*.*J%)$T3?lJ [.I$I $I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I+C5lS <6uSe,IM )mQTI$4ʁ))I$SXR )II"'D)AJI$@G %*RI$$Yh>$ǝRLgI)tO OCRR$Z'kͬ:Q5;B>2s0$I hRRI$yӔЈK}8$$|#Ei\ᤓ?G?K.!r93FȤ[vwI>gѡƸkw~~CY\]7M=駽sIk4.iI['A๧YpRT1i)-yku }% iiq>1c\ I ߠ*O>C.]FU[ɃN =IptC<$-kHig_bm ?}7&:-5b,I%vC'+] GL+w'O.b>%H,-svo*ǒ$v7R4{1qƝCH> LjZ[aiq3r pq\=aH<>{L 4t4 ?c]D\]<6?~Msmvd'n,c70VDx@w܎C'UjUU`6K?8AnA1y`q <r#AЄ;%+DmL;k܇{s { 6LcTb$$m<)VkD )I%L$g4IJI$L> -G)$KqJH%)$H&{t%> )d$%0Μ&RI$5) $J[tZ]wiN@ (:DDwRIXnwp{VQII,JQ+[Oi]"#'^+T\m.΍}+ϋ|$?]:;=\Ӎ8p)DS/h&&~]59 5Atc]SI)M;.N{$F;Kp#PuN<1JcJRSVOj(CuHr)d&'AJm!HR=O u-#BKNw2ƟscR?sN|KM x44' Hǁs'tP:Ob E{R HQmj<IK!@hGra[u ԥ1(22@{LFZdi9RSfG(KLwRӝS"hI0iJJX;H#dj0lv4A H! ^NZ ăOu|$@; 4Y-FF`GN* )yAY~(.ahMLO`3c h>"tTsus+y+$vj86'RUKZ;IT:p>ݳS ڃk#Y_Mo{cc7S|lYx612 c*qnlU$XNmxAO VVGo|vY CoCzCu- ??c@jahۉy$ngkI+Cu}akTϦXli7lrQ MM%?M7P¼ \ugЛDA2> mih9>Ji:5>(}[@ݬI eA׸{u<YŬ==lSKO%F%8:ރZ >_=.d:h6jC j| aW9s ZZ4ZFZM %ǃy =FHc^C}oG Zb) H ZtRÁNJXv9xCԐX`Dx7ڟ ixPs- |ji3#TU/;?(}" GyT% OOoiIW47xnN֏dB#r (p=+JvKG={ƨebL`%˲!o۲`D4Œ%-rBMj['ܡ)AH=48Gؖ@V?]}/Tk \VզX~EDUzbxMD|Z뤒IP-Fp I$Rx(Q)0gIp|$VVVU",TJQ(%H&<" d *֫/*AH( (oMZI$U$$JFS릉%)$@P%Nm:$ISE* RI$&S#ljI$G: NJJpK(G!L $qa)JY2tJ*hRڠySjILIܦРI$0%HnS&N'|9BG([ǚJRt*FBI$F6%2vT:JI)IH@G)F)I$x"$&QTII$d) b|)) )DR$vL['D)RI$4$I%)$QRqIJI$7)IJI$RВ2I$M )t'N9PH>H)I$.Q%B5O )I$}ɤڤRI$O:(JRI$IJL2#^B|R4'IPpY^wU ):`$I5JI$I$RI$I$I$I%)$_>tXG/T"tԏ/^U[S#m4M?Fڏ1O8K.K=@wG)-鿞>dii"@N&uh6CNCpq$&Ie^ f+ʲCK 'ɭ̆gI90A:d5x'Ȅk[:=0 ē}ȄhA$GtN$C?Bm۸?Gw?,2F|??VQhiv#N#Qq'p?HO1>S#cCߚaH5ɖ:Lzm#h߯orV7B?w(j<~4ATr;Jڬ mcS!pB?+DuD~g Gz`'MPdIRkA_EM7PAum.vi; A7C7#o4:@J#0@&(opi]"`Y@'C&8H5cMoqnhGhŕ=.G I~~36N{)4{HSI-!27BJasLni<|wNEMcC.G;ӗ:5τuCeΨwiwA@}(d6tD-#BS3=})+&48mH[dT +Gw3b.D@kv;u`O0 #D N:iT\xuP))I$ʉ J$)$R $hCM/O}RI%!J%GnM$N-hO>I$&Qi@O')I&Q`v! DŽJ*fdUZY1Ϛh Jsg$-byH)ٵ`x$IcTҝ}R>#I0)ˊ`{%%)$KT!11Ω )I$yHAoI$ǔyNGc*RI$)R )I$uj4RHIJL$PQTjb1+g.t2~%Me5}&rcnx?[=2I\  xJAN!=LN>a6^i{c:IC%ӧn򓤈m T\0$&'?9q~w'/J< PJJQ?Du-;EàYcOC =!էzEkYzk/羊Ex"|'Q:v>)nu61=y{{"=@?L5@jAi-}7kf'APZ.s}ZoWkylnts7nVK iԣ{ͻNwp3q&Isu9'5`HqaQ JmQq}mѿر_m@nʽ: 3OjfԵ>Ѣx5`o vߣu'dDi4(?A<7MN5#YZꖪze̒}Թ[7lb_.giYv}Iʓ=EH-SosNSoj~ù2FGX_tR-▪w"Mmðw<8e- v;_k״ݨ&5iTHpgz]E q"?N>d2ˣۨϊ%I! $pxJʵnS2nd\`{L{6I oﹻlAVL$nLٞim.-kZI,}Zfި89Nϫd>7+v1YSRs5w-Uo7VwaK7gP[!|iwGFgQ0ýUw}K5{ HqVgb|iTrjn]\ޣXtL:?Ǵ%j\]đ6ƟpWGUq[}5˩ L2~=ovQlk}\)}'>$vjjesCļ[ Ksg'ckĐH-e>5$.۠ջYwZ1  G7E[p>!ԟ\ gy:xs%/[v5~i᩷\ocd'Oc}v9g2ں!ޛ=Q#\jZ*S}e{H# }'0K㴍{ DC//d;tJp m}sCu1?I88:+ Y&as(3[^4|KE[51&]}'}&ƖAQѵ \YOYk7k 4{Q~͗~bu^XeB֝cF- GL챲3j5˝t:1.y0Id wߦ1X\K,V=Mclcl$n>Lhl*RYЏ5%!S!^>!c4Gj||X餝2Pm,I%^Q+*NBI$dLv$JjzXb) )TJ)`&Nܫ]²ZԐY {!5 IDB䒔I' ADܤ$H:(cRfjF)$Q*U.S)$G1>jue%I$jUjV!!bBS9@j 8NR$EH'H$I$5YU@JmPSjyHIT I$:)Ji)I'LhIV";IRRIW )I$aJA<' RRI$Ĩ |%($IL O'IJI$k(:JQN$O&O$$J) RI$ĎgʖF%%):dI!$I$2w '|PrI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$<7Vn&NM|)1` U)(M)4bHJtIK'I2F!BJdd6𒔒I)z E( @AKBtI? $RI2I RRI$$ RIJI$tN @$$I|)LI"E$I.LR`;N=lĤ<% $I$D(I%)$H5(K%)$I JA%)$M *PQ92N<pA'1L @Ukpڴ@h oad;WǸc[dt\clqXuM|B>Oxԉ$-ԧX4!N"H#ѭp8G qitS(LO)5{ yrNI yIJc\Z= ;uOl: 1 3{?=5Tĵ8oAȎOvL7ئ3%6*?DΑͱѬsKZtv?Ky%2&4;آS2  pj8X]k#TtuisO LPmf7& ID=fI>%!SRGa/y4O*9 kZ :h{醒\ّ[kYۯ&kwNzDV17 3pIJ-#ԝk3nַBƈm[Ulhw}]D6%+;9?8-OId}np:RCmg1-oޥt"={Ƭ't7{v?kc Rgk!ou~8ՠ!1>I4*&NwB&OI&0Te#`cI)÷|TAIRI$S ӝRI$ ;p$$HvQRlIH]LaD5&J Y:I$?Gܐ QRI$Sw>iIJI$)=Dy%*n\v$ 'QRSBDdI7tSmK䒔I%O pکo`RRI$GtHlTI e8O(I'N) u GJRI&tƉ5&F)%J.RLVFpUO]Y+N#".T+e3yəu`d^[c88N;PS\;cHØQ7=;(ο N@Gސt%2/;Ip)hɞѵFTdǔSPR쒙'o>?u0ALvK"6;'(M}SkDAnj8NeJ|T5'3Y<'B{SijpJZGט9X L)IKИW|O>(s "@:vRjPj.'Gy- WD?BKǍ!?*d ߑeg(٫ԩuNaqK|Z>qj#GX#{| t*FomgV5̦Q#rnƵKlS29#BH[6^!Lsr[[>y_m̈́0 ,5 &NƟѯ1!x*GܘYg9>ƀO a?xϫԴk84n;?XŐ-yOt7~d}^.y'Zn GJ' 7}3YX7`LNLv: _ :L4v``h6{?ϡ\~?AgvH2\k>Ay?bk˧tG:G`è~6'#NJJn< 8clT@ dTw`w7z"^+Eh<#g ?~(sFL_hCC?TV?֟/fMHCcGV_]`p/sIpy;Mig&AqKsdwn2R i\8Uq'I"O IM1ީ !{*y ^wZ'=:;@w;7QOm[wC`4Z|K'VFR$7^Gf󿮫[!5𔆪Vi's^ öL=gV.Fݻz{?)̂v0u-.p;}?Au4[ :Av~r,y`sy) ?sSyk{>}.w<eZ5$sz_; A.-~52E GN@?+u:1K sIQ?YDϚz}ΗBmkaKdSNfMv^-hcckbf0G,zl !ߺ w" Z&cTCk]&z,nˈi3Ý&&t qXMd98X@lGJñEx65?ѭWVY`s c?⾚k6W@ݴIG{M}'{C3hps,0 >jQ^@:pI SpI,`/um"R,I}oA[v+~k.o?o6T<{ j:qnEM̷/#I=w)k4~<U[mw?akާ$T]n{4{:.,ϟS2{K퍝flDZ[fG MF>[a1;u /wP?GxNnUndYe{w .:U{jDG >[+q%gn=7f~=Ke!.LHӲI$"'JNST 'N>q_H,ϬJ}IGf+>!S!\ xRo:O+4'Cw:8wphII$"3UH:RgRI$ҊTI+4UTJ*g'LQS2pZeU$PY Cz!C|I$"VxIJI$JRI$iNe $IݢC_5Z RI$yErI%fUQi" 7rɦ0 \$HO 8I*L2e^clJJmPSo1甉?$$PM?~h)t'$a+AܒI  ܢ1)$E-4NR+ux@pK()A@|8CRTEI2E ܢ' TTyWr?N)pf<®Q٢J LSD1H$pa%,$ '(nIK' 2cv| R$:>jJu*dI'B6UZV+*%HZ0@MڊX9@G2nYF~䊘o?i,o? )I"S$:dI$d9LRNRNI$I$R$I'IJ)HI"I$$JY$I$IJI$2?O\r?O\yn?ߟNO6EpoZ$J6$I$I)I$I$JRI$I$I"mh>+ZF+|V,6RɓN\$ Rd2d*22t&S@QRI$<$KORRI$KXII6o :꒔'I:`uHd%)$K^RR)))I$p>?$ IFtL IJ)t< AʎDI2\.)I$i1IJJRI$MtRI$2 BtI;@HQ%(h$i*[BRRI%%4'JR$k>hOA-ʗI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$W_3iLx(&"2$rRSjI'qxI%):I% M )II)=>I(O· PI$'J"$Iӄ' %)$I:hR )I$LB\'0I>%-dpКIK:dI7dhЦN)dI4% I$` IJI$w4'!(%)$JI$I$bI$S'A I9HhIKItXG/[^KKUrGV׷HӲf6_Tv7/i݋z ?\*Vԃ!R2Fۈ}Φ :ȎUe}[A-=2I?;s?=gמ CX9$]Mata"'oBnI1=Ԛ:pč> W2:wեd47yjw:~3{FulkC΃I?Cm;ˇbfIcnT`wStIZD= j^`:DpD74 ɑZ?谖+^cswڡA"L6LdןHw5f?{h&s:Y =iitvU0c۬<` Ye5xHٸxIL}1腢9 4'*jִD.GɶƍtDjdR|`膖<" Ɓ-ysD4چ\ P$+h:~#CZCqAQj&ECLr Y1ް 6CeIc-IX"tgrzs=3k}gC>Ck1ہYX$qܶLϗb_)kuhj-˶l -ߨa=jy l5Kk{G]_&C]Lh?Lٿıp0A2%"RfeBt:g!;M(I(~&$I*\h(RI$#L5R))I$EH"JEJI$ۅDI9&oyIRI$ۡ?5&|SOsK )I$LL'JRI$$IA O#HM q )I JRI$)t%)$K][ANyH84$I0A0puHjRRI$p`ϊe %)$"<ՆJ m!Xm`TT R%@Z%?*li#KCSĹ5~ 3dsO~\yTOR%vHik$ #D먑LADI%/2'XM9IdLdjx aqs μ($H5GX3(m>@ rSb'QAmZA A߿0[Ϛ{S)' )p 1r9Qk>c F` dSQₗs`yQ/"IDɐL|BP;DhhBuSnpAחg~A9 D;>@G=M=ځTGyH {&," aH9#}5БsNɀ)B}R))CD%47Nn['Xo;0,moj}tm4U4Yq&SI$J?޹1xTboV>ߝuOٙY [6?GV8OLzW{]o7\ KI?k/3XNUL_y!G'vt!;}&R\FYqnVNW:KmjًQߢ$H~+/.iC8v"<8 FӸyR7 ?TXKO)c}6ΏpoOX4h?IY-.kH?E$3+3{$̗ONhdzsQmT` q><`lv#UkQ H>ѵ۷U6[wЎk0 .{ XCQl2Mχ b7cv7n;߻ =gTֆVw~v9_m[ ۏgci'k RH_VH1IIh:ˏڋ 3`:}}/zI.k\ =UXI߿G"i;B^wU7èDVֻf67wߔmMJM0RIM]=W;nËgn}F\W2yL&M~@NOVlpi?7⬰s &~!V ϔ%1ehjw,%v˹OYִͻXXsQkMuDmN:-7ݠX y䓼0cO"}wn+2+i-y?C[k InޣK 75Z'x{ ,GdKu;qgqۘKؚdG5 [zUkł}=hG[{1y$'Ɵ ]t5=.i v>-$>609n =1))jik,i\os>sfǡni .h_;,c Fu_X3; kA۳'? D=kGpZ?/Ɔ":G}4)IikgOi!G8m }.Wx-aA];/>ﲆ٠.| tkt28 .w6C`vtYOuu7Oxz: slbMgqzlqV%rݎpsK]dgY.h<ڽ? BtdQ 4K:J'A)MBhIK%R)tI2IIJI$H ,hhS<)$LROE%):dBI RIKdv4I1>I%$`eH$I$( %$Jlsvgd8S'2t$ID$I$I)I$I$JRI$I$I/䎥Ior.Ui?o^Elu t^C "x+~9"%7mG?}35ĹN[ã]bo+CKdmc?57+sQcGp͊CsY!>쌋?2yvPs4a8dVeЙeK7u/D;JP1WsH]Xl~Ճh[e͹]?W:D! CKùKiDA+Tj )y,> &\ /eGyۃ<'sA|1 5TuA[?5 Yy{\u>c8?Jm>:: w|{$0ua-1(]Y='8 ?-,fv$vOb-Ρ;:F"9v &GvC"}t:㬝};cOD;6{I߻|6p $HDp$λv֨Zw.X+wcfH䩴Z&d!c#M%Q]='S]S_мw.J8|#zC"'NBILK=(PunX!V<.L!@<IM.)BQ.RIodƅ6=xN%Kj@p pA+0痁>P|d7X~DH1II'çmv&:R$tThCt;b&5HH{bT4M̝|PRj='>-. VuEpxLc7[N}CB=I )[$v1R.'B4Q-lyN.䏒c R"#Dt M "{It8 0e)EIߚ#&I86m>~i%GE, `)F)(q⪛.: j)v?z` ))®A'!:kܠKxLR() q2,$jXtZ{F5f~57|+{ڄ8{.W<֝F6OFCGts[XLgc/@x➙>S7\ޣԒ[;gFoǑAie~.Te{X3:r`ˆan-\:4?Ko8\ 67enJCAp[5xLNMINlgXA'-;kL-b~6;kl{Z{}o k {4nN淀}?s8cT}|RR~@ ~s?Ѧvc}+l,L SޚZ4 5_gUccn! F{BDk:6$wGO R)mcֺ]'ps|Q4g3w4Ӽ9N)p{9Q{ޅؿ_[g$֝Ho=i011?#IR[@>?HA[8i'l?ccDgh!׿^bnxlLs08V0\Oަ`a6&^@$k7lg%oIǑO~趨lqݮ׼䝤yr9:{߿>  :S!y}q[7s?#cCÇ*U hh=߿F8ˈw's6 w.1!QmNcfyIKh 斴ƫOiqF۬~֘cw[|SXU:sտgX`0LA_LNv^5<-is۾]ߣEs}C{;n<|8u? cch`.gTT_N.o_ {ZO"Ōw}C+mpsv7Mzkcܣk x$~zZ7#@4'撖[SR i?RǴ4CAC5>2^=ߦe`5 @ \IlV{6ZKUW:L ?7_ú~ Sa~絍k_ w{_an t1IxPI~~MfƐ$i\x6;qѵtyMQk2ˋ;HT>0='䐽#cq hխݽyy$s `no $SS1L~?I$IKLd铤2p>*0:;,UB 5 > ZstI@`gGtI JSEܩTPBI$`T&TI+5 'FaYEEDNJ*`&N«jV䊋 BA:=7q@BzjI$D%%)$O*S j\IWɔ1(W))I(:d)II))t)&O-N)I$AД蘧))I$[2 c"a%)$Q?qp_Vu WKr R_m'2wl1\PN'cOΣ\khu/i \˔5 `qCGe_KdGj9"|G[k;wLIQs\K>,~,4ʩ nlaX=kd,?%w{{]͵!<11O20ĘW鶧0[^q$Ud5ecYgU`Ђ#0BqD$w3$( wRS[\JN"*V5I$ HEJI$G2Tƺ-lkp )tI(i \BJRI$x򒔒I&.I$$I$yKQIJI$h$HtRm$<uI*M 'M>iK6!I$mTSRI$F-RI$CB%)2t͓Ei! RI+I1y.4Z>rY[Vk<8OܝE!^m0A~.i|^|]u䁭oWLŠ#*i)܂=a<č6TH򢒙nLa'n6։qx)DK(p1Mm]msxP95Z%i&H$/.'/?LSR0y*B&5cD54 hDO%DJ!<)1 J[Ì,#D<jq)̤[Y_:Gޯn).k}C43D[\ 0[Hv|Y1|aԂm*@ˤjKַAG8w|ȭņF_NތϨ_CGځx -j[6#K$};CΜ]ytT}~ڤZmCƭ1AKSw}'0-GqsK] _>1/yy)pd@Pl|#E8ѦtRTo~^48Š8}_#_'vlqGG=ihD|OܤZȀӬjhkH%5tL#ޛ[$#~k>CGi#h;,L|5$(|1 څ!&]N3Ej)0L'-R6IяΎ Ϧ4 ?Rhpt6ȁշ{_3])Gǵ*d0ZuI{R!0׶> 2Gl"ZMl+Lv8B"m߱ϒ}{OZZE{`p77?CO*ᠹN5ݸ~ߢ8N<'Ԓ;xU[\W6yWmi6Kv;)m_X[v *%ܶ@p׶K ):pa>lKgzmv77deln-uMx{}wp;3 mgOritH_t13acx 'Q1$[@םCk/}rH?yJZȀ4nV+%l ѻYm5:O?8B&Xָ}4;jlqp?%." GЦ?w5Yic>NnC]Q\Li?2UEֿd ۧ'k0[ |}?]&9f:_0 嫌+y3WX-/'Az\֫GLv04nּU4#p qX [$~gMK$Y .VC f?ӥirn"dH4:0xfݼ>^kȺG#;íSoƠb$:8?NrNR $I$)I$$@I$pm Z+3}/J;1<+}'*[>!dO˺):BKdH%dQ  I*Rb*u$E& M$Gg v|U",TJQ(D' $ܫ]VԊ BU.I'T*RRI$ӓ\YGJGN`5#3#Ir,]9]ʣg]'гY_<8go랢{pi$tLN~Jx~Z_Urqc=F~.><_{w0\IO;ڭ>޳.R| RćEתX*/٭gaWӝxH ƃ*RI$R$'IJ$L:)1IJI$v&RuIJI$R-)m))I$(L|R $e%.I'QڥO))I$cI{%):A%(5H%,I'R w r׉{)AJI$ $I_I5GJRI!o:'_$HT򟄔IA)RQ%)$HO!4$IJI'IJI$S)&))t'M)$%%)$HH )I$A$BJRI$:`!<$$I~RjtI17sHG!A$$K!$HLR$I$JRI$I$I$I$$KϫKmeq\G:{Խtwzx'Ozcq>&ȹ1M?r@䂪я W8Fw v-HFsGB="" F!:o2~ciu6xׇ;#g6vFߧĐ?+Mk┣_8/K+UY|~mZ*goHSq %ֿXu $~#vĒ{v[/џY%;56:uɶGbF?.}ku`!gpfn& H>Iyt܂ZZ:xÌuiVSn V֖pgt;g$ll:4Q54z;'Rd|8޻n0 qP6uJX{uE)|/6iM<wz_^C^ҏ?]Y6=+-!0a1#Dձ31 ߪR;k|?b [ϸkOȻ> 0ΓX ^~65OuƗp3~j.·z5 }k>l$n?~]+?2} lvƲ,w>>u#VD?}KF~]ϾϥcDP"l LGeA=뫧Cf-, y4lEQ.BT%BI$:I#D5*CIJI$v8B{r $IJ$|")RI$<T="bd͞[hwc?R[TH%/)$"KI䔴RJ9,>xNA$$QS$)pB RI&M4vMB@HIKIKlQRI%<5O۰e)2u x!y'  I&IF$R$N$$TI"H4RJcI& `B@<(Il2T0!$LU >t?T+0Ѫ#ndv$r͂se.,%g[PQuaBh_[moj>0FjGq^ygثC]3УL$4IL:Ȋ '5NHJ i))q`lPLK Bj[RRmL{plӍ@ QhpS"9MJH0d&>@NjjvII]a:x{r'-?0) x!e% x 4䏗*#(RSBJL1۵ xA.NTtJFvB> yQ{mTC?T~)h4$ kR; HpbQRmu""UPL8Z4%6k-p?`: Li3K<>Im$?r'!&m 䙆5ulӲ@=4;?7<lg߈CCw#jMIpTcc ͎5\{[lwmb=\gƼ`n;/ua0l > 4Y,m0K/YD+I'M}G+UD%$.;[f} od9b܀#A{(nFiS kAssI:pik;EO%渁ݿ`c~s.UKc@HI95?D:t:' %nI*%GВLwIL m]cҫ [K5n$Dz=GLZb涐{ }{5 VwV8Ob4"6ۻO>wCbkuRg˄A;cwCm$9]M:F?Kq׻s7~jU[˧OD85"e5-ݩ06 6HfO?Cz#l9Ѵ?3M>U< πǽBucmI?Oc=_ov"t& 2U'F Imnf IV {qqN;p-ٸ O owzŕ=kmR.;O#_?;ZHDkZ"}SJw:1OH)P9V)qC\mmlO-n7/5 irU4:C;)LƺNN'ڟ%6i& O~ӳ)ൻg. Ȗ!ߖ͚ByasHߏuMMTCg$[Sp{Kw'wcvϺ >ikOǵݹNj,k+;gqmJn 4q8Ap 4)q dq=ɁtIU56K%4k?ikH"9z v~b= vvLnbb$*۱jL$g09_?$3Gp<8Z;V-6Uah~kZ4q'cVnqvkM,@$~^ v+5q`{7-J!E3r>;_ ?{dH!vhs}>\QsK{P:r:s.vp1fy& (PU)1L8:G>b|fz8K0 t^aM-߶l^f4vG)%%2)A$I%2LtI*RLNgb 3Ac·ѹBtV?OYQ:~ S3#%t DRD!Y(RI$TZRI$У*CRIXb]X"`Sr*`&Nޫ]²ZER !H*7BjI$EBhI)re?d-*L=uUTz}}2s&;ysu3_`]ge-b0n-d ct.OGoLu|zv"8U2:i= ެ:#?UG6 RȦ̳O?ռn]c$zkګ8}Q#> ׎1s);Pu^6R'g kInuntᱡոM6rӃ)y&)I$CvfTIIJI4wN!cʐI&S)Q-JRI$ d0e wG)8IK$I1ו#䒔2u K3ƃE^Grp-,mk|ܢ*LܟLlo%Z{|nc6}GV륢\ $Ђ۲]oW'V]oj]/wRc=FVג;Z+j`T`)(LI% 'I%)$L%8Qy" LI8NJRdNAIJI$J9J$I' )RRI$I()B RI$|J p#dtJZ>t$tRI2ITFPR)JRyKTI$R%)$N mJ RI$ԦR)RI$Д$I&Qp$$'L; GyPTS G\OcFZ3 &Z Q-@_)cXЉOswM&t0{GofKӭ35߻Vn'ӷdOH69w_OŁF̠!~?~ķmt̑BZ??ILu?m"|>z m'?7H11t, nx>aaGw5_JF40ɧ 4S6j#Ź>k4"mۏZ.Li$0xq}A%9Q2dk⯿g᪀4Z]s6x(mLsx1HǨrqKwZ?Gf4i=¥N^` }Ώ+_*эSh;UqY:}')FIhO6΁U|VG4U0)R1I$)6ID2yR TI(4"){RJI$Skd!MdGe-al %.d6ΝB3L(%%.dZ5/0*[R&%4*j^+.kA{)mLZW ^Z7]Jv9Fr}IK"RLA>Ix'kB&B Ov[I]%JP&ڍ$I&L"RR%)!1fl$H{a6`RprJRu2ALI2tpQI$0)AEICԈRvi;^:j@*mӔ@Bf2Lw*RtReј%֖3tƫ= [nU+?V^uc) `SʏHiϖot+jlhnۯ.?[feY/?uZϰp\c-+kPޥq &?JԜ]{a@$SJ^ǹ3MtskI`nc?>;ݿ# !z!,#'16CC׵^;}/CV@l4_vmR@b^Ұ& 9a$d~EsNLΊL {U*& [YM7z"KX5!v]Gc,ohn ]Okmls 5l{cv R\OvgRE#n^ymObE''6wJٵs͈5ØSFH: ݾ=VA l c_ .kwpRv6I$:D2I+<}ĒkM$* oֆ?*Q}toV4wv7*{O% vbw9Ph7IP+dJmT0)nj8];A1tWohvlQ\\A 6}n#lIn)A:ZO"5$9ƶﱣpաkD6L?Foak@ Μ&7Mǘ[v^AZk#DnHp(%vO;˷۸Iq@[ZA,9y\=x}`RKM͝Kc{"ڷ'GM`Tp{BCG!~IvӵcXl^l<|4\7:w=[D;c]NEI$4F'I$AKI$I9LS߬JզgwL',}{j!0N;gI:d(OFAz(RI$:AlA I$vRhQRl"$HVV` E!b"P d ʵ˕kR(,Q AW(vpPߪjI$uB%)$I8׺C$$HVi"e HQyAJI$:5ATؒI"*BB+I+ui*ՙVY!!Cw( ܤ!9K )IJ'LڬNT ȍPSj"|R:dI()x( %.:d{y D'$'LJnNI5Ri&"&NZ!B7d.PSru!M%2QR*)'rPJRPSV*ws»a+yM(+%*蒔:b!A%,IԢEp8BtvB@.I!9U4I I$ZhUX5V+DZ3~(5`X @-;y`Zv$Re+Qeci$LI$IJI$$4$I$$I$I"HNI $I'I$T$$I)I$I'IJHS!4ȸd4ȸ$ӓ'O~l,|a$IDI$I%)$I$IJI$I$RI$%[U)2tWq}|ښ _TXqO5btGnVzFAm Q\8v8rFb1=4Iիd E <:ܖ{=?wX5ʟPʁ,RJ6ua5L<{x!+-?UXJEANE(60;}Ux嶷cTo;+$MO#T{۵2qKsAF2w6֐B0N6\-?ծ@8c'9k\Ͻq#j; B \'ݴ&~}<|CN|Z=FʳsGi'qo)L) l*Kk@t~ Xbu%$PtI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$ۺς ]N$e}'RjsJ))(EMD蒗I2t9L[$I8OPRI$I(H$$`EJI$Uu;RR(DI?$'2AJL2`tRI$RI&$JpEJI$JDRRI$T 'I& % $'L(I(HI(I"'DRI$$& $IPGDI2hH%)$(IKIKE%)$I2I#JRI&$#SLL$Ӧ  @JRR$tRRI%CVs+:?ǕYC-ԺI$I$I$I$$I$I)I$1=lmi~?mX[p]w?F?}Q |F<(@GByӞ?z*S#P|b4vR&4PP g>?$!1@[%8 |{# M̓DJZ;t&~1uh @9~_S{i)I9L'D?-LuEa<ѯ,JPHrOϼs?m#ZscMgVbuҟѩq$Ib* `舚!v c4p8>[7<ѺP+nX֒_=!yVTc]lp6XgV@vngs_Zsufa;Ze~,3X<"z˟&J @(1o[zc"pe)^¢+*3*Jl0#)O*?Zc"?ƪR$L%IWuM9G#-C$~)X䡰E,L*DJn{'5]>[o ^~x- q[LXH(2qۑ[K H/~-[nW}uB93z\_EP٬Gܧ|ո>^*b2[#tO1ȏV ߕ@"`&)'Pyj}MqAmOЂKOxVM)*㐗|[1_e jCP'c!!b%>RAN򓰚u>0;kR. i$,[D ȘJؼNC!ڀ'ϫv}i-!|w~rYus6ossY5Miko:f̐m"!F6rgYf3?w-Qi-xcxw=ߟ~I{Kw7ag7iYcZQZ j~?Q${:$-wurf0 =ܕ6MRDȞ7OH486ϟv}0 \?Fk*qi!CCDzHQGV 2"~)m&$hSZHIԟ7)ls"Fױ$m-hi/ozNa:BUW2F;]s\U^ 5"&]I w?=.(n29G7]I0Oyܒ:ûnnћ1AEo>ouZXw $m~eW[,v6Z'B͍nF^֐FrcDhg SeZlx!8d}=!% pO;?C؊]|É[vC۱uhk3I656ЗU)\ӵw?Gai ~_ct8`6Owg)[ Z`~Qآ:Cd'i8q~lԽD‹]$S+m>F~xѻ8n5u9[Biy&0?aJ62n-6Cq?.Dq?`uEDp2G$k}ahH&Ŭav;]kmsi[bAc8 <8&lfu# ?9! q9%%YPù?HDG\NF3o$;id:, :q]ohWcÜ4}@CQz31^wQ%s.>WԛKDjwT+Q2B#p/45[mGݿ箯 5mX DW >m߱oa<DS!2pI$ $I$S銐YX0> |Jѿ|BJѿ|B$DwLt2;2I$; oI I$wQA' Μ))!I$0I TI#00V+ErEEEȡ1NT8L!VYzrER !H #ޚI$"֊I$y%)$AyA$I1DbNIp)hRI&G+MY8VZrD(e3@Rt($T0N! IY$Rʰ܁A[#PyMA I$T AJI$IBxEt{?2trXPv$HIJ'L(+}N b'(()LELSH;R BxTVtT4BL:Q|"!IN$$7'AT&NJ\I$Ѫ:~?dIM,UXRQ*J%v֌ReMeH-;yhZV>I,J?3V'*JS$:ddBI I$I$TM)'L)$$I $RI:I$LI:`%*RHd$I)I$OO]OORK~9?$?7y?ȶRI$L I$I$RI$I$I$I%)$NBڧGxYRةJ/’eq0xoγ#׊k?cZ;kK;2`vֻ2x⻚ժQZe3ˁ ϔ虮S\7TZPQ]RCckUtg1\ܙzi\vRyI JTJ/. ь?{{ [X- Z??.yPA{3R!}g:0IL+`?$b[y֘o5}V&_a5?[;pk<c?3^;!֘oP0 E2נI.B\JRI&'QqS$(4I @N ) R`„x)DI&-mI'HxMܒI$Tʙ %):dẃAK*IVWz7ӧ iaW 8[*6a:9䐾]`U(sG0ܷa_sՋ3' *=>^CW߲=Fml44eIO>p%Gd!8)BȄ})㢕reFө,ns aC2"ڽE[Y0QWU>1qOI6,0+#.?B\[NI$$I>%q))I$ >$$IBI$$IBP'I)Tk ))˿4I&:Z$I"RI$dI&(N)$MP$LN"'LdN ]$QH$$I2xJJRtBJRI)"`D$& S $)& v%)$L7t%)$RRCQ!)$P-=IakZ[I=I2eG5):d$J5)$I$IJI$I$RI%-Cְ243GDY Sn?ޟlcq>SFF(G=ސJHtdw_oOڜg=@I<URH&??I3O-P,Gӝ {l3JJ iĉJOA}ƶ4*ciͨsNxZB6Z{?xTgujEBL^%lAnkc3Թ#HU= u5[{ 49ciDƑ]F]Ƽ*[|n,ZwOjrzu-ӧkAZ%\Q$yʲ|8 ~TH?e\!;|Pl,'k?[zw2@?՞=Zf~j a)˧BW[4g]վFc0[X\uK{bt:@a%4#ΊNǑ5h9U}p.;X'FGت3ώ^|5CmqAt-ZpJa񌍣+_tBS/{'V')W02uo^;(njWDz=u\x* |R}{P',Coyn'H8^[D~^+XLK|DBӿŬ?8U/^9mZiEzfw O-nӻu,3c : F |AO~4m3E;~涭uuH#oY7%tv[xO駙IO>7V')7@p=Y+535ڢ%ڙ+Lug v|5HukVY q7&N(_.x5 '5_N6by@N-uh?Veohm<-#IU~ )Z2~ӎ&VAux6ө2JSǟ#<=02I]X fߔ .#F>?Zts;xZ]ܲ\EKGo)Fk?PmgC`zo0;bOAYL s]qI:7ǺFjB<_ Γ/>?7. O{ \ޤ> zmorc1k|>DpNI9 }!5gdRtOZB8I16h7|a`oz?Bm1䝴$'^{ݎBFr扇x(ρ)F)ϬxgUfsЧbfv[b❵l4?yS!f?7{^F%{\C'YP.irO(`lH^,MԪ* O΀?[Aԕ7<3EL{>uH^ΕC.KxK*w/,h oi׳BW?cظ|#z><"R -SY˫uv kǞQvey59s];R#W:4AsIQ;[2lL롍VX5sOgH9IxIS͟:HX̮54Q{^  Xk:0I?4A@q F|C CWF f!KZk@%3Aǒq!g#F>d|RU<; MM>X<& @gADudk :Tx܂wxH߹a.eF[P5 ̫2Χe0agL"{ ; Us\l-_d<|D=GSQVzk's^{ˢ,6,|#jU]d{2[6+73ݒGyBh𕕐HqtEa9$<Gڽ qp?\#EqhwRλH` Ƈ_*gڅ؏0 8BImX/a 8jF]M5[HaٟC?zd 'kױӧ~fvICڈy~Ohcl#qI#M?lyHُ[۵iHثe^3c=Q3l huPրvfz,Οݻ>QCAk '!cNOQ;5 S:-3kdkwfǘ59~kKVL}m*Uf,ii Ã@:umC`)tGH3a#@J(^͠ 7mFMo}Gvk{ߦ|_1 zcx!ɝof # E /">EJ^ݼ$r)m\֐&C$4kOb -l0jsw_b&c4\ $O(^J6K ` {nPX4GmLH;hqo$?ƛ{۽k˜& /:ĸ;g!=3a{XOvmmkNЂG[LOi{I#56.APvh8hJv059D!'8 aAwө6zme=?}h; Xb`x I$>D81%6iip T/69m΂n~Dַs^֟9;S4>w=רh|jdqL9cB-PIIIvΤ lk[YegPPZ 8YO"bD%Et$:Ͷ@piCAls׎I,T`sZZTH.a:cՖ8݁AW}e5H {߿2 lFAV[W[Y"y=W4XwyO"8ޓ 8mscB% {Cr2]~ӵ:}|8dgnEoϧUq.䉔^"FsĹuq>Zcǩ_iyCck4;sD=I%2`$I%.I$2pNo_<+'*nW:/OY BD:OxIk2t3?NܢI*oQX܈O(I$(a*MI*I$Y1WbRQ*EDA" E Vi*֘AER !H*ICzjI%*PjE%)$N:(BJRI$`BGI1SNQ+IJI$eMvP m!2teXo d+,Dr9EMڨBr ԂppVI$UX2P#PHN(I I%@߈N#AJI$;O'|P쓩IJN:ʝh!I$*9Q L2trf+ ,\TPJ]2t';‚B SBPW J!I5hAfb{$)!1)J$_$7B&'L  !tIEΐUI%&a*VYB%ID֊Ab8rDrRo+4-+yR+蟉Qe~'&NIJ2I$H)I$d$I2I&NS$$II$T$tIJLI$t&I$EKN$N)LPO\ O\ _iQ60o-~m$I(I$I$$I$I)I$I$JRI$H|VY}6BRR'LÚqiA ͯmf= :+eZ-wg /SKKtp31Ӳ?h?S]|Wc>Tݫ=OݟZxvWxج8Zxg+rjҬjD& s:wSh}.ik2r_i:GiߤjbAwIauq5/D<2jnӳ7έDĨfOLp/FRXA#A:*E[XY[k˿ՊOm s ~CǸ[Wzs:}>k͏2%/6=[LðCPMۗ]&LW[khc5!aaUX GR;pL$I^I HH0g8%):dq Gd$I" G()I$"Z᠈4&'I(Q HI(ک`&#%):dU52*u.9 g84Z31skAljj>riu8PsH-<,zyip_yi_A1} {fS<=i ak X+oR/X_ɫU,gYo^Tb<>è->`Z,c;w8]Y#;D%b~hs0 â\{lն!41&/?z[& ~u ## Uh:Ȩj/o몸g]sOٛO7<wUz%[Hm  =냹 *cwrB'&^ Vf6UV*h`SL,dBS*]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%4aQïԳ^NT$JE>HI%M D%)t'PRIH%)$&(LI'k 4J0D-h3IK9I3D%d$I2IPRRI$I!=*RI$1nCq$/֙G-~]V67"N?#_Rqjs(dӎ?&"'o1ކ)xN Ɵܛ>KNGfSNnlPSgu""it.F3fdshIf9[] i0vp!DW8=H\8hBbG*>4|thu8jaDM!ߢg4iF:cCdiRGO$?L>?H>i I'B@ )p)nN7m@'LO=`|  oKlk䊔1Tӝ<|d)i4` :H=MOS:%,|D5<ԋuLmI ?>JBHIS%;j[c$$l:h8)BA NI:0l4:u @ q& #R.m DƚF8NJm*dLDb<3.>iU KfIOL|9D`qRR9̸iEk,Z&$cgnj2wF0#ݢ9:JZLuC;d!N)u n"ĉpS(Tɔl x;~!MtH)C'PHԂ99En\GY1IwqoamSI0 'TONZç  CB`t=n`yr8I'AMx1;Y3IKX&Z~No #HLX7yJqii#C 'ݰ8s\<*"&쥵8HW # dx&#Oo9ڻ`<yL8A7;x~)1 S{|F$S'&2ub5GO' 3wO-d1c1L$.TGmDO=zѯ>#ĦӘ)5_K 8Nɇ0|y☶4q%& \h Na Dmי$P1J{m[N,M)Q'˔Q,h!kNJ}|$n$JrH ;TK7bL'CϚטOA{?&L&G~e?$kɢA{kSG#抖'S0OCF >@'qHC8Qii׷IrEJ:=H|5e98Ύ:MHKR"5'-Lw m;_ A)4$On #^ցׄ=N$d@tRSˉN滷$H %-oI6D6HQdAR":EK&u k> x‘p7x$t:𧼃%$8΃ô?$NkL9CFǚ DxGN恫Apx*[k8>SG=)H[AHV`,@6 $QojC) H g;FAALvq[G=)ѺD5En~E]õ(unxvL8N%RQ'}*5@jG \H=:V>1 \&y%&k5`9ֳop\ 24^;c5W0L? o6;ZϮ~f~]I ia<.룡~kOdwY۸Zwd7kx.$=;/g"[5=.3§1˦¿w. kI;@w; [@[g4^ q"d< !5|_jk;GR J)6mq힟r5 e{:/s?F}R抜?8Xv~bjnx憂"}şOo6G' @ p~AEI 4O۽t!k$?H3ozvulXw rlI OKI%j.0 OM;n$DcO C ,k`۩?7s wMֵ#qhM=%2w?ec%)4z;ۮNTIԝg ZT"~C:mX6 m#{H=80C}? *K  ?CU E 5C dپwYz/W̲_ˇܪ8uܡYVߑsw=[˵嵩oRIZxL59r7l{ 0C{}鬴О?\IP~eϰ0%OcPV+`_k7Io-ߟ[i$J6I$I$I$I%)$I$IJI$q2TR'LRI$- I2c5]KI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I+&\l-Yڪb~(J"„2%1b1hTMPGyM.oopOSjĨ*fӺ$Sڞ$d\AJI$IFJ)I$IBIR$` p'I(J}JRIJIBPӲt$DQRIE xN R~$$RLIOI)yI$ɴM!:o8%.I'$ҝ%)2tT$N2I&IN<ӄI1I%)$LIJI2J0':r)tI4&!<%)I$(QI)*2Iӥ hI$IP d ?D,CYۏlS$*I$R$I$JRI$I$I/c)Z9ߡԲm=QM4GW >m'^C"Φ;Od@u o2{uվ}IsAY*?6C5/K6o(V~p|NN17/gad=lcⱿ=ɭ!mMcFTA.md8~u~J\J-v?HϓSĐ Iw@;?Nۀ78 \kT>Zib Wf9)GmqP:CtiL?=8Kk~H:}$lWwoiGr2B_\rCD;vJ. /#2i2I K+ơNþ[Xo>,6~{~wVFC@ qsHx~x`l|Ԏ"gUCqϴ20h>[0CuӞU̎m=t?C5;gIitt,Fө)ic#Oi, t|9RptA 0>S''D?$ťq'!d&!SÃ68HA$'|}| x1ǚaMƞ))io?οGvy)rvO!;QIK"8Q-[?4ƺz'lL& Ax1#)j|k)L]I =$|RhO{ H?,,Q2hN1!xA-598yyB DD6t'JD:rDp&OvR.3-L1<i@OowiL'#xRU>E8dxTI영 6L>DA>?A3:` Z"">Y0rZ.!L5> 75!}H>R[L}na!`EH\OJghU`#Aaʗ@&dT &]:DvJLE =D!a>J#@ pL`t(@۠%HOm8 );#kODmZ|` %K`ODK]$|m  Dl%"d;#~N 0'{8l:VL t*^7 D?A'TlxD&-2gXd@Йy[dH"yi!O2I3OQ9&$Br=I r?T6kI' ~$!Ǟ3R~4:f?hsCؐGpvQ)A[-v~jr{Z||SAn:HN>Otyfuqbf􌂂? )n3;dx4LXi)jH̎Hp-oJm3qR8K@v2|cIՎ|Ccut*[6OoZKLpĆ̢dG~M6t1Es)i(r:IA {[rx3$ Op:5਍'Bus)}(Kb jS~I)mHM_-A'S*mii |4Ly|P]4"ϑvl:sdS OS@3Ou::z?&{1 Fc(Y`-jlt0p<%II$tQs&NJ1 vN Pd̩85RS h̨?+۴I9P sI)2@G|4/TIEu=Խ N1.źPTEMdAS% &,kxk@4'#y&4*3D> ROCtm.?vʭlGVD+T<_Rv[a@ml 5ŗAi>֎[Cc67o?Ep1[`vkZa@5N[LL8:;=gDJƭӷ %Mgj6 l4֟kwt֑u,kl7AiΛs[ &@X{En=B$yk=+vs>(x9-8 ;\4^rK/L OhF$}5Zۯ2 Sc\l<ϡ< ė~k_&ݮ:i)?qi%/v0Nch]Ew7"r]S;i N?y"۫m{D. $j"v?&k4Di d t?&don8%@ n~ o\ul#b׵q\O=얖04ΗF, zmd@ ͖nQ>'DV`-PgO蕞#PE)r22Yqד U]8`[Sxuw i;uډFǝMA;w1Z<}-niĝ<u naRC+(g.hLKsFu,s2ІoSYoY%g-۱{A>{ywe+NѰ>{-.K!=GkNԍKa֒dL}$ ݵŏk'OoYK]=c?&}q6{]@=o\!De;,56D $۬;%Q;KI]3ҥ{nߴ5]CmxsHh׆Ksx$v~jkv/vGQp@cDE- Z旵w<;n?;mb W I'(->y;bZV6^9u1?Iw5m'qFH7ڄn$?BIYIA:ZڮDZ{KYĿެ0C\ҟݶk~cԫ#s"Lfv ΍dKN+lAe-Нo>q:~5$v׍ ?u[`ӟQWdWU'v2Qt`|ּgP-v9ܮFU=$[Mg"}0Y-Hq$H7UM0ͶY_%h~BF;}gFI? ZiG8tDI$jtLJP 'N'ATbT 3ҩW%sL',N?"bP (5 ,tӦN4+\PyQBI%]+! ]uJBI$U&4"$HīLYTJ(LST8L!kaYztEER !H*(oD2PܚtI=hZ,$$JE STKRRO*)[ }RRI%o?owĨKI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$@I $$KXHx6B;Z0R%*%vNY0'|JdP.#Obg;rqY&Y?$^yP@)J;R L}'IKɷ%2({Û4KhM1^f?rh uaÉhdS4>ҮBh*kj;d,>) ϊd;W~E. $goL$B:?K1]%>)3⭀^w;]%>)l>*P~׫](_f. O%=]c\AK$-B Pl#KޗS%_iޗw~ Y$ڴ\Կl#K)R-GT,'?0}q1OiBmegS48ϸ<ؘ]_ߵ~ q)$q(TlU~aI->mBz?@ju߂\CNk*% ju߂_+~N–[U'uٟyCd. JR4YTXwf7Q=^ ZSme>d'5~M`\AJ-ilV7ཪ~O`z\AKmho\4*`ԿhH(*PU?onB.M޳hG}I$I$I$I$$KvC_#YetOm=[ [V5n?ޟlcq>xAF<*̆uk 5/h~m?ۥɬyWomZM3sHʧE %ؓ_$@-&vֻ_)@Pq5~;d"2zv8DCd͕K?l:>=w[Bݯ>mMQtqNDjpdwr#m%ϤC`]oU+t] M|N\4jڇudv $ˊfud:}.5\;Ө4~f3>?2hA7Io: ?w'x~ZKl7C{Uc_J#?hGR$Liᮿ?{u4OxތC\;q a^w٠ ux}]`4%DƆ~,jt4 Zc۠ﱹv:c?"qę+8;/v5$¦AeFJWe6:%mA6D@ Jp'YE;884)1%. k cns4tL:'I[)d$HA;BbF*.# qN }IL9偲gPx8N$q$H"L 'Y$iiDR6| "q\ą'L\ #Ԟ$`Ov$4A TS9vN2d- pu$ɄOݢJX؁R!'Bb|AtR-3LY`Ω4|$ xAiy)H2Ai؍u{G?#ϊ*X"&x>z&?zGq ;y~ÉAKn#< >NiI g3$KtBsl@  3)/?wGh& f?zNg<!Lփgr IO$yQ:5k\  $<$pZ5q'O4΀dhLF$8ym-9csM<tIJ2`'{|@DGg˺pIgD۸4ŮDLQS[H) pAܔK"O'Z[AXh1>L_a`G!PRxeǵ Ȣ5ӫL9|'O(;h{)6AL4wTC7-T}I'n1&F1IL56gNSKA*A:q "a<OrdM;xB0uljQ؈CcÝaFiʖQ׺O6PuDΙԘ=R d  `Hy)m:0r Ryvy$b> *G@@Dʐt:Ĥ`iPwTi#9%-Dkq?NtcinILLL<:vqH1]撘5 L-"FQ{MMґs`d|NmA$2&'E ُ+k0 ΀$BZ54[<c–IR>BJdA0u1a$)$|*B`*d<4ND-;Dl|uSnlT w:@bÃ7OAjq NJp}%L|0Ga m\pָ@xKݺ]AD.ݦ<@?5vƳ:Fu 8"Oc.䑺Dy M|@S4< %8cOBep>ݯ%I`\H.1(ݮG1&> ĵѷJ#Ahtvk$1B>J>Xwوj@qk<jyHԍOqy5ALi[!ݠQ4}g_Uà>[uӤyL]O1:UkQč5XOIH㕱{q_Y9bIcFVo_ae\'P}g?qFZ?>=F܌NT;S,mnm*?]6 5KuwR>M 뙏Ru Zw,[Iy"aۢt$-aI09źn<8/@s8П08E7騏^CMu2!i[b3ZƹBc?G4#NH%c{*:˚ CL~wڡK\F\wן=UMO'_*DnI pt-h$O{vv鴍>ЍLcIKbi:?t ŞIk=VËÉh>פ.'!}A Ri cGs% v@&=Dwٗɬ9%{3lWny԰A;s[}KH;DC7=7:Q"OG6&'Of|$?t-IL{pA` ?uEߣ>XN1M{LpqFʫ{`shCH=ԃ5 D?Տ{NP: !a5{"S*lyq[1͟}Tvĺ,f `=%}߱ú't_O[  0ҽM1{ HMH55&?GCoN_Ahp/N5r~mw)s&KNM0 hw=Q }1.Y=ȟP?r*esET!Gf3{>c aq"5P=W@>6 gZ>5}2KX%iZ$:`6P%{x*LiI %kqt헍Z{Pq*@%"y{-It8^7r7̝j1V 8|g@LRg }ݾ=,͑Ic T< 64:^XO F?T2[k$ī mcSk H2\[@CˉGMbec_]\$mns,Fv=`pC7q_׿5+u>9a0cNF{I{Z&y.#Xc\]o&|{%Is@%c{yrl@'qwEd&-kk'@F;}:H2@_. A׹C0C2w$&NNH% BJ% $d Y1 )z֐Y{t$sUG DH Q:Lt2aCI 8O u)֒I#GII$5jzՆW,TE p)oUV\ڒ B@#B~5 IEU"NJJRI$L!8 )I$0H2, AJI$:*uI#J4 MRd+5|Uԭ0HbPPܙ'((')r4)H$$~ʵ={J "5 :E'rA I% C?x)t${#8\2t J-HGZBI$E&**LE*L2_5x#vN b7(( ʚ*]2t'rPJR !L!?NU[(’RJ1Wb_)It$I R$(o@{!rT&NdGtI$$+WlH*$JU3HeUZlV*%HfV #ʘZv,էo)0%d~'eOT4$Jt$PI)tLI$I4)J]2iJRI:HI&I$)E2E4NI)tħLt$JdNI$&)<_S@e?y_k7IEEI$k$I$IJI$I$RI$I$I a9{$I%)$I$IJI$O;)$$Iˉ8I)I$DyI$tI$IJI$H8I$IK_QI%)$SN2,nCI%)4'IZy{c$)$:I%|S$I) ^8qԆUCI+R@N8ϼ~ySNURFʖhRI[=V/D+GY$ПhNޭp*c%I%zޗY#Tj[Zc=NZIq1ږҤJ wBGvRK!I$;OLIRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$JRI$꿍M%2I)I$DI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$'1$֫jqf9yϠ-=l^}6fwѰr??6f?GKo!Jq&r RN=߸"<Ǵ)P[xM A>){|GI;yL.g>)Fw?4;6}~行[~[XYT\> \'} q9%.ѧViѿ$7pI.;@粀{YW;95D+ENW~h-ݐPx!vo*.nw2up5n>{ o3&`c#"!ǹߛW*>DCZ&e˱0U\ؒ"ݽ87kGs:=\un;sїANe^mrcGil9s: ~`˞ml%*K]-ջhƐ7O8O*I0@R$-s sbnĝj+sIG&@'8N"N0_0N%~\#6;B53

)g=!%%.&x# ;g~'|܉JyCv<y"+t8ԔȖĦ O擎  }m| =}SsӬn~Sˆ}܅t˝ѮFᤄ=52& 4#Mh`F HILu IN,.$ sLqqI'lu dDuR!kqph$5I#ݸRJlnǜ&#C\@ܔϴl?U$'Q5eHtp ;9+Rq={ 8 y h?6*.l vPa-;L)9΁>: b"cd؉:Hɏ`iR@OpөINaS,GLS ^N'OP|2)4GK4)Ku;\KD-@;\$&5kQ#() J'tBlG'XLFxWXՆ{˴Qi%$ )5#v0=k9sAp:-`5NJE>"dr;BAo3̉:vO_/'yPjNB/=r TX\]GN>ӈEI6tM4/6]Q&A:~ ǀ1ڒINK黎Z, ?5=>JMv48қ$.V#OI 1E$ySu]>: { A6DIse<<ҵ"m"d~=AD"L 6`BNsb]: nhy I 0cЍpI0|G 楽g$iqs ڑ$ȏDnOH"f4P?{#Rg^| ?Gc|DAH]#?5V`5n }US8 ׳]< pLFZu3T<92$8VM>h#˷9F^aH01qځѬXix{ŪJ "Xe(duzNWc'oF_Is>;[ z2+_]ڗis>իs`G?H[;}  $폊yШ<0 x|ezxw`G ʚa,<|WKdИGK`P1*~l@ S f@ sؠY-%6vq $٠o_M"}R9ߛ "M G&{ÜXxa4n}dD<DB5q0g-V,fs&"ҲQ] =Oh87{?5ew0 aʒ> Ȭ1-ݠIMCs7 Bf Z\\? " ·t`}<aq([:AIF!*&t5-7h=珥%%:Ҵ3s^׷PVm;~gTl`ߞ@o>Wo0#!#w@78Bi}~6:\gXGd!D8'#¬OWzUs2ZCӴ9^pKgGdfp:3eSts9Q?f^$IYX}/ODMlN7V4Ő o{5e CZ9?]?dk@} esSI&y+[tkupc{$ 8_;tN>$4r$Y$H jUSP6;' (DVH[_4 ;>4VؔbSz~H`,޾4VQWR 9*G ,-|Bsr>3@EXD'L W!)$UMʃQI? I I$TT[“RJI$fr1Wg*5D%eTJ(LSI$kUTY CxD(o WI$ԋPFIJI$ KTI (IJI$(P!M!I$(Tآ%I$jVZHbP#gj(('L$IY2tC^UW h@JA LF<5R(SRI2tB~' J]:d.NQ+A I$a2tdv@'%;AANe@r2**J) J*RPSoSU ’RJb]$$&)")6SR$t7Q"tAҒT&NPފ'I$0 U 7tI)eEUUe,TJQ(vV)`27"4NNV`Z$TOUV>?3P҄$ҚSҚ$RLN*e)JM $R)Ld$I2IBI'IJ$$$Ld$I$IRJI_S@ew^~/5?&OrX}?\eI$k$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I󞇴ev[hi}G:X3$zHn?ޟl'O:`*%,GXx HU|2? i#ZψuB>n>]>~Մv˫3X35oZ.)˸!Al>Xt$dw?)urseGMn6T\aαv[GXpm ۛdcS'ѲG;62SH c\=C1H  1t}ڛwIRlww DGh8jHH@$8ZM'q Ҡ=g{45Ǖ=a!xi2Mm fG'm&12/qʷLz o@0?HX6IPu5?Fv[>R+ uzpmB w1Ů\w18 㒡s|rM-$\LW/1]X2Kq5VYM9o~Ln`o70^ ?;Cq:)Xq>?-V3Xq>څ+;H]~\ iO5 tT{7ǿM΃bnkFH Ӟ4'_&~8f`\F"u3)3h-QR6}MI$dM^Oww;PD'qMa!B̘9Q<6Lk1ѭڒp@[N=} P'vW4I5&d1TcN-2H2~ꋡ;;UqQqOԧ9Il8jx4rq-]D46 M%7 hF0k $VIokST|cUˡ4ƭlK9ŜHyi)r;m7L7RNvrI;~AeM'"[+r'YDT5; U%3;$-I;$W5v6$"bI6o?) 8 ~HN:A[v8=ֳqap>SAax5Sׂ@HRݻ9!9>/ZưtϵG4'44Qng3I-TFih?ckHJO09UF׵ g{;rɭWC_ت[LousM6iA'^?19H@bL$=VTܫ( 4B." ba<8e\=O'Ԙ@? In4`>F/_y0HwS7:CoL'>\t/quj?h6Ć[}X;3i߷7t}w<$<{=Ӱ ?U,7MZѻۨe'n#깡jt$%K!h2#[D}Es{*A07C'Poō.OuCeAk&vQc"z`"@ƺj i;\ I:kus[o$'kkih4i%6  D\ ˃MnG+s&HhƱUK538N5(D48H$joAG{ΚI ZTi}P =(13>7F@ކG ikoEMhH妟S:dLG%M "d3DsA;::~wРH2#D "t;Q"|)߰LƉ)1'p؈$O^VC{K@l]H hl \`u@LO*y,e@8|oR\A3*`w~4Kc%UC iY!1KZ!ǖb;r2k{ZÉ-no":I蠆tAR ߻xC^O<@C`y;2{JG;у1 =l hyDa:ѻvL:5 uRtIԎwk"G:IKV!60ZRhm{d~rY 4ΛG)G~xH$#ioҎBGg~n Ti.ƲxQdM]\;ށ^ֱA矟b_^N~"'ٷg{ZA"Nanv #q-1,F]ɏ; ?+H.~w^ڛY"WW Aux"ZK.QŦR5AH2VwIFx{[_ ?_CIkAw Tkt-4cZC\;vݥź45?HRk`xKבc{ 4}ߛ顗^Z-.?ml{C ?d;o%l,vԏ7\G?7&2Z$Bө=Hެӯ![Hmm&!Dl~ -N IzU % #¿ UwӠw~ֈN߼Gkw8 's|SVPܱiqyv`]⦳9F^gG9nw.`AY#Oq_t#p C̈"Twos#E IVpsck˝n?jV77C ]dz~֓=Mc-mu+]\;軁 I,kqqLE8ˈ"GX&j_]i +$mkV `-^GosVX_PĈv攬!AtC[[q iR@0GtCRL1c5^v;~okaǟvXdjVwzjClˉ$qJ;Ϫd5$"QSDt=]y.1wSmavԄ ٌXݤ{@;F>}-nl A˃\Fl5QdLAV9ƶ|O4!c^D65%/c Gz0Lmkzϡr6\ Jsq\ D{ZU{[=:?}=[iU!@ ժ iԆ,Kv=7 m{?X?ZuGj+{Cl$`mk?ŋxH`loZD#Qf>k#+6g蓪[ =ˮŤin\mڐFDs]w >$VX"qӟR̈\\tw\E}t>( ۸#JakJtI(IKNSJpFIJLRħ 7q_nVYxiW[>!S<+g,>jN$#ol#I Jw#XI"qHr)IzV劉R*%&)NNSHڭ9VPAdR ފP{&tIJTFIJI$O7sJRI$PJRI$M@WtI)J'L0JZeen'(7(EJ IdE+&NʳWI@dF5BDAk$铦:&II3(OEt7蒔N$ZНE)$SRo**LE*L2Y(ar'rS@04EKN"R ‚B * T҂RQ I1+&)DSBpI$2pNErB$~>yGDIIvx+ E!eQGj h9,G!L-;yhZv>H0+"UyXUI$2rI% $JRI$Ti $(NR $"&)L$SP@ВIBxAKҙ$<"M)JdBxAJLࣹ/TEr_S)q?kӶ~_rX]8?ȷRI$mu$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/홌w0t-dfaj5.gj79<Eu';}>m37sK|D*.s6Nv֗0 ^cӲ "v?7:j[uEn'G7Q})l1ce 1)Վ;C?)g4qԏ%Ugز Za[F[Ie%US-u#A~FcǥߵQ?\ F$f+}ᦟG?C8[WC>M/x[\qֻήYc9 F,piUG[o$34~zc9{Sld5V6wSh?+U:J78&9@WwP:gZqfEOTKgkIB}AC^C:m|Og9uPnlYyzDz3qlчn$l놗:IgM\|9ۆ6E3-'r8x;I'n;u'%H%6uL*YRXݮptӮ$WC>?=y~uM `񱣟g}an1Ђ,^A#if4]V8kX#T>ˊ@"#̥wGadcԒ>b'} ei3^Y_YAѢ?og}cZyYX%;_pu3e",i=-ϲc`ON\fΦ*}E;~[mUE8W$6v#/TiA1k? dlsO{V+ɘm/L{NӮݻ7@qE=.'_}dVHqM77^ t^}NNE_պNuӹXɬO%Pj"OkxDm~[N Q24#Al3EKi"57(o8?<SW4n|kv勲px-6KuQNr_v|Wg+.a ZGy=}WqCǩ,$76:L';x-ŷrY_kH> %/՟u6lX‹V9AHkݸ}^U̧5y8扮l knls`3 ̉llt 5l"!LC{5r"},WQmlq$E}*;{ѯ2٭!ۧgKNO}5Halq$wj蹭NK{h&܃#6 gS4b۩{÷`G*%<rHݦѯEc gay?3e~o$A|3jDs)}a xix%[.CShx, ޷N^W薙mDL 92ReA?XƑ;];KN 610$˱qHQ%GEq>:Zf@x{ag_Ojsԫ-Ȥ8 /s}̫}Z@:nL.0k_{=%C)G wM"׍Zi]VWC:CMĭ>t>⚛͙۟Tk ַ_n_c \^{I,FѺXӻ_!?U>c=6VLn.sI& І.8Oh:Wqu-mbCvx?Lq@Aϵy_[2+q$ Y?Y!\LOi깿UK;Oi{WN0_hpLp]q E14$diHVki$O^\>;3a qcŤo fE$`JwfPA"8 E!7u<a/]FO"IS .i˴g씇`N뗼@ }D0mOl- ?殯vk89Ԙh1:?p/ =Rhh|P9Nj"%K޹FeA% R]`hsZ-]4)=6u.A}ٯyKܜ_|zLl D}%qݰ4HZ'k jsLy:i}xR7hn3..fun >^.X$m?JZi' RM @sjOl= sL:Lyq- [f]moc]oO5}apGtVph&,d 8 ?"% v/5h~дq@έk =buc*mV 9ݹ.aY.zF9Ezrj[L!i}.@wZX4[N/3w_w@NαԘe[S/e6[Z;mI$iM:Ithy",2eGwmOџWAvvu޹ʠI^nVoE"f[Sy?{>63nttԳ-G2b*S$Jʭ,\g8{TImv;⦅^yθӰ]tLP.܂d7?u%=Nsɏl9]Iv=bCZߔ'20[fPu$b#?zom:l~{I yCYGka %piROoW1s턘ВONsLheI.01dj! Mֱf?=o,{4)~ƶxs('C%_6: HsOʓ}\KHwVCΠj;@{]CuAUnbC@~ObVuM'{Tfq;8 n+kA&8 LVOc=\T%ħՏP`9OojC9I.4Y'^Rͯ\>/q\osǦ{19{Lj@xvCn+um-${:3+wc}#&=gYk]lklpK:X2[W9;@5X?ꔾxhikb'Zˢ&(]S|8S-DmHV1SZMxdxvuoiܲO4=[=ٓn~q7`}ӯ򿔹*sKj"! cX{lϸ7]3+ƃIy%j fmnH~~Fvuo6;[gח[`,HAc6ͮ׿#./uB\F{[jۜlxYufCJ^v44+[勺{\" v9N5ewk?quo{~:V16N]r0sg!۽lviAJd|Uo+3ط5DIgWj捁1o\!yki\e[2|Rk#v*΍s-qsy y;ǀ[ǁH t:U2J?7rη8e0-_xܺlLsGjclFzwq?VWITf+XLh~lI8׃.h'An}v`0LǒOo=7ǽoƉ \O]O.4Eu#?umfXt-:)7%A {)q~UDq$@?K>S:KK7pծe[XNR<}I9x߱ 3с'ywr"FG@,mZkH?E~W55Fѯ'[lhq ?Gbki4]`{Ct|÷@'qE$,& c[~zqk+87VZu?%&[gCA05ISl ^FJ*݅7Zk3ѶKC[&ss@<7NnX2i2u?d4'CSw,旦@L9#sZo}ߤwٳ5 ZZWadlJ9qgns{MVo-y!KL?Nƻ4gJ \:@|ԅtmTy䢆y96BոDhZv7{60oiU=ި`sHsǨ=9ÚLȍ|$ D,i Ip!ՠUQX_}V2Ɛ 5~yݱەnPvA$ϯ~2M۹Dg؊O=Jk9W65mXӌ[$[5ӷ~c^bZVYV,41ѳmqBKO8VQ?D;P-Qc@ɤ;kw??ds+s>߱Z;wk:h[0sE*9tX XwK_ju%LkiYmkFp>)Q 淹Qu6v02^67[^a#a @_4L&c+ć8$*73nD]3۽hAH &cy=u˗HkI@?Eu.{{,sysO;.u k,o8:xtWWZ95>>{pKpV~WWX;BJh}_dgĄg5+K5+UA&G>dGR?jwܪ|҂cg)}#şyWÂy j=&E^M|Խ7LAINoز'>,Eh(՟WHdUQ[ be%4>ǑϼT] Վ;^ VjZzn`MT}$M\AoEX9puLhkvTOJrFCA$|E*}615+Ws|nJw'8*[IH39F?TM.zr6c2ɥl{N\ȭ.R4n?]2܆8]Λ {~Vv3ìnE$IFI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%󿫥:׮Yi1]t+nf!kg.Zcp5S?Fُ1O8Q8-0|smVqFkx~{?~;0ʤ̐Z\ v)9c QsѨ~*?kÂK|eD˭nXn&Ygs|)[ʙ^R·MF.@%ߥ"UsߣgfS{ۈaj'٫^m*>3p~RcImms;d[] 9y-c~B2ޚjKO\=I6Pp;|5bX.2|\3J mv[*Q>&^KٿE5Vb4y(UsvmIeh!ge4FZ@vz6ǽժߟ`>0Xo*^3s\v{vQMh㝰=KOut_'QE}0z3!v?5+įKop.;0F-wRј~*VCv-ßRVc[S@E{wбeW_fkӎ֘;U]&W5 k>i_pR7:b[@s2<'2| )Kbc} 2[A>?KB塾"G-C^ݢg?OD{.CGNLK ".=NI%AR{0{ c-qqXu.-mpXwoӶd Nt=%̓Av?tNSI5{A"p%Rf5[75nb9.cl{}'~zqh2<$~)1 ?\x#>=Tml$HJoZXNjW`PyxO練~( Bmd0 O!73L" Ĺ,p@lª!khV6[ Zswb6[8F;?4M 6yhDRH(V#洐I;'In{Г60 ~8駳~S*v )pi 06NND0&5_t3K13ͦ5dK@(5ql4l?_L6eN|5}Nc?bNsp f<Aw:G(#'TƬ:1ϸOAkv$/hsj !ѡnV0Zq=Hnt wkQKu" >Hm|{j@ 汤NHHw!BZ26ǧV]~L;)mpDŽ G<(4%Hjg jK\$vѹ#A'|hZ6ZHp¹Sh۷}mx;w )d*?Kh7ӓ ,zun1Uh- l\[<՛\ 7{^n gO7iY&u;& S 8DF!ZOM 6L4Gz}'"#hOuX:r&)skw{ucFnq!:[﬉<{wGe nFz >㻺aRLX@ L^uNS*ֹcެQ׬`mvcI#z-;b}W[B4?)O!n۩]5Ih N0dt:oȘXkLNIwѱI%y׸QvKh )dj?;@ssC`OE-ӫ`ϵ[gKX:6A;ysKgO`Ϛ e;fsOSo&9V (i3BwhȤq0AӴ)ntK@ ;H{B-~?\faiIݣ3ޠ6lHӯu]'R'e"$B8Oi9HWH)9n1$6#5][?XF տFY+y iAuCc#2@-/IFy%18,c 0f?ψc18Zu=Zi{IpwG@.nӡ>iy.䉫r'N51SS "Z_f8CSXn"9.Vl?[) I Q #H0IP xߐjbXMKaO??~Ր!nAfOZؤۜkL F?Ht|L goIQnw;Y6 D?` trw;'8Q`2' IZ˦c>lFmP\CF 4mhsmG840T]O10NU[{%?Xf#MQXyv 9$x7>xCFo(=Km2`}-\ V;kȒ\?&#8)f<|`  ..:3.vaMqsdjTm9OmdcHlѡ??MEf$O?Cn$q9Vcw~ .% Tگl6=25#XqAAE{Y Ow_#Fw0F4 Diʝ@H'Gw+R+CkY :I!SwߝBel4>6YՆJu+@C1l.! ƣ2eiXEO1hS5=p1w7w*趇z-tI>Xѹ۴OC{n:x'c '~;Z~JgiеxJLpkÂ}?lcd׸8}+Ϧp罎:{o?D[{^k}t2Vyj͚یh9yLvQ~QkCݸ֔Umv=H:jlmv68z`\N5J`rj.%i;EmsbO: h66ۜպG_ީ}ZβNrm쩂2CeUojkˠ q~v;8CҞk§lŭ\5Vq8ԮۋA&yGѹNF̬l;>mFwݿ܏CCE:?'E.`Q$ pzج>?nN},N{ $pg)$9:r4jC$->RB2`fh.\nPdmԷzî+`mn–w[L,݇p lM>ZuM;耛W r cI-ӷwyUu:d!Ōx[O쨝܈QXKvLĹZic(f<Ԕ'!%ڟ ߡITq}@Fso{6<8NZ #[,65I:{k?7.w>R5ÃΉP@:kI(pa-cv?s BmYfVfA?ȯc!]>J5u nA--)l-@h`"~-:ĉ$v7ղZvs7/{qxc$4,7"\esLthwAkkA$ÏoÚ\;FbNP{(' I-|楺}&Z+ {Ud05V $=? ֿ*tV?E=O 46{Ap'kZ6&DrqY'vψI- 0 g?EZ$3ozβPnA-{JlާӽiiK}-a-pskxR>̟=P=tޒ8& ܷsvEgRSv\"8#%{?3XJW\i c}#9 N`ߢgTHp2֞ݥptnr>2$ $].N=#m0ju/+5ޛA'ÀkϷߣ 9ۼi'QnC]cA<$&0''_vp={s/C\I-SkAsW&8۹ b,sGw"A2GD]%s=)dV``skyNGf}OiK1VݭmݿA5wV#qw%Ѩ4Hn0?꓆