ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:20 16:34:12  "*(2{HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T6nETxJV}Q%Aiz@ ZiT;C@# ;|S/+4 $xh%E>%YovjгS65f*q+]L3żUst"ܑ$RDǢ̧VZݣsiQ@%[e~ӹWI(h볤A%\i-hc^ cFPqrYQ,:#zeî!5ѫ2nvZKYVm6C,wYV}cy%|rEeK}d@fݷMsz>T"oFoS g 䇶U{G$LjNcb` C[d)cYY{wFsqC@Ԉ4O?Zeb([l'~oVoRi˛.;^ ´eR50?@׹jN.Mi-!Gwi < }#' ;t#_Ĥs\?U0?H#kvjOѹ͝O-kU~T~?3`ڛܫRt~q <`< L̎)]sG{]>u%PUfu}2X1}?jvFU1XwWmVmGg<˩]nuF[]!jտ{SV!.+5⮾г#-u}Ol{{~--&{\$ǻ1suT[\᫉q?I̿-!`=koŧU$80z E;"y#VjEk79{ WeVEY-nF(kipcIʦ/E#ӡ9]m0;_v1ML# >̌~= hdžuooZ׾kX]#{~QsXvqKY-k}P>=gўֺtmv[}q-|[FoHi[x_m44?H.bly(XZkOJ`}cBVԋ&ւG\kcHv1PUH$N'yL^"O G3հIodOpDwޑW$7!ҷS6EnUr5?ޭu6y>o[`~*:wI-t-'SVVza$jgJ`\x,z22;L0YN>+}jۺhf}~uAB akv{Э5sxoYTuNo.sCȞₒ>b[.!j=Vݽ@ ES+iul?7k+qph$x@-f!9G08|l0 q5. {IL\ j:ȎF<䵞a{?]t ZiTCi{\AkTmKZIIU ,Dz! Hh_g㹎m?9qgZZ w7 KVlZ&NDOt*x4k! Jk`dUP>>_ 7Q ӱ=W76]ݐZ>4r8O79>*cgÔ:@FG昃 GǴ 8Ș~ )}Z{^"FEm?;?uRss\G~ ?]ٱz-;ˬqGܚjcX<:ԫ~[. F$1Slyc#ú/mt0o.2LԔX,(1u!Xq2@G*spAp:h< %u?;TTꆳqf#>?u_^*'KX哴Dq~󿖝Q+13C 6iz@ ZiT;C@# ;|S/+4 $xh%E>%YovjгS65f*q+]L3żUst"ܑ$RDǢ̧VZݣsiQ@%[e~ӹWI(h볤A%\i-hc^ cFPqrYQ,:#zeî!5ѫ2nvZKYVm6C,wYV}cy%|rEeK}d@fݷMsz>T"oFoS g 䇶U{G$LjNcb` C[d)cYY{wFsqC@Ԉ4O?Zeb([l'~oVoRi˛.;^ ´eR50?@׹jN.Mi-!Gwi < }#' ;t#_Ĥs\?U0?H#kvjOѹ͝O-kU~T~?3`ڛܫRt~q <`< L̎)]sG{]>u%PUfu}2X1}?jvFU1XwWmVmGg<˩]nuF[]!jտ{SV!.+5⮾г#-u}Ol{{~--&{\$ǻ1suT[\᫉q?I̿-!`=koŧU$80z E;"y#VjEk79{ WeVEY-nF(kipcIʦ/E#ӡ9]m0;_v1ML# >̌~= hdžuooZ׾kX]#{~QsXvqKY-k}P>=gўֺtmv[}q-|[FoHi[x_m44?H.bly(XZkOJ`}cBVԋ&ւG\kcHv1PUH$N'yL^"O G3հIodOpDwޑW$7!ҷS6EnUr5?ޭu6y>o[`~*:wI-t-'SVVza$jgJ`\x,z22;L0YN>+}jۺhf}~uAB akv{Э5sxoYTuNo.sCȞₒ>b[.!j=Vݽ@ ES+iul?7k+qph$x@-f!9G08|l0 q5. {IL\ j:ȎF<䵞a{?]t ZiTCi{\AkTmKZIIU ,Dz! Hh_g㹎m?9qgZZ w7 KVlZ&NDOt*x4k! Jk`dUP>>_ 7Q ӱ=W76]ݐZ>4r8O79>*cgÔ:@FG昃 GǴ 8Ș~ )}Z{^"FEm?;?uRss\G~ ?]ٱz-;ˬqGܚjcX<:ԫ~[. F$1Slyc#ú/mt0o.2LԔX,(1u!Xq2@G*spAp:h< %u?;TTꆳqf#>?u_^*'KX哴Dq~󿖝Q+13C 6 ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$깿#SQ7GK0'OW7d~zxҴ<9us~M2E/:깿/+T_ߣ4~m_ts_OV?f!3Gm_ts_COVsZ(0m_>깿/a*,ֿy?i"c?\JAնE/?\SaLնE/:깿/a+_{wm?RL?U/IնE/:깿/a+Qߣ4ȥ'OW7dvxҵ+~tk"`No?\<7tQߣtJOLOU:9t~m_:깿#Sgcc9GOi)LOUYi}'0tZȥ'OW7e?l7Gm_tsGa*D_?i"c?\S?jնE/:깿/+nYi"aNo?qSW/Gm_:깿/a*kߣ4ȥ2vxҷ+y3Gm_:깿#SO~7Gȥ'OW7dvxҮ5oѺG[m?RL2vxҷ)ߣtȥ2vxҵ)GiR&j~Q/?\J?=0T^Zҝfޚ?U?/u`3$PnT!k#6*m#%GgOW7e?EYTK*bȥ'OW7e?D7LzDW4ҶE/:깿/a*%YaJ_L//?7Nzi)?U;<_W&Qs #GL/9K1Γvӭ+c/\JbP>gtum?RLg2;<_[oj~њ7m6%'OW7e?^<054i"c?\Stc3Gm_6깿#S͓Zi4 6ҟ?ɳU=<_Z>puآ'(7m6%?2;<_W';^[i"c?\S;VMK1No?X|/h9GLч+m?RL?ɳU?/&?W)?ɳU;<_W}s7GtOts_OW4"_ 7H=4OL/d_m_ts_OU⹏ى~7Gm_tsG*D__tȥ?2zxһQ'/rVȥ'OW7dvxҮdz~m?RL2vxҪ0Ԣ4$ҲE/:깿/a*3_4 ҶE/?\SI X~m_:깿#So^ѯs3FK0'OW7dvxҶ<9GhOL/;鶟)L/5I5oѺ?m6E/?\JLGߛfM?ɳU?/5~`FhOL/QGrƗwm?RLU;<_Z>l/tum_:깿/a*lƤ8çՠmIK1NoJfTx&ɴD_G?\JϨkg3 >%'OW7d~vxҺ5Z%i')?U;<_Qm_S?V:鶃y/:깿/a*lb6m_|s_OUT%uGre_>깿/a*$9cM;鶟)K:깿/a*yOٌ}5 /H=4_LOUͮi uLg2zxҬb%9GLi"c?\J|1ܢ9_tȥ'OW7e?])M]6E/?\S扏ٍOqOi)?U;<_W2Hڧ,iG}6E/:깿/a+@~i)?U?/dQ)?U/[QpҴm_:깿#SM 1\w)?U?//GtAfMLOWe=#Sߣt~mK0'OW7e?lyQW9FhOL/HzFs~;i)L/>iq_)?U;<_V=#S˥i he??U/dsƼTu$7NALOTamo..ɧ[bP?82?=<_Um|~ H<$? 3G?K0'OW7dvxҢr(>6[i"c?\Jvak87[?RL?ɳU=<_VnHDݴ_ls_OU3Ҧ%Ƥfm_6깿/+_YHcV>G?gMb_ls_COUyƟ Itm}:E/6깿/*{?+OrqHgMK0'OW7e?Ur4I6MK0&W7e?Xxb_FtOL//Ioj~Q/?\STyHܜ:Ae_ls_OU.JqE;鶟)L/M葩?3tҺֿ?U=<_[O8]m_NoJ|"ZW1ҴUZW1/?\S}V3:nMK1No?U_4ѣZiZCt-)c?\JbO''GZ}/6깿/*uiN=t]mG_ts_COU&äkК7[RL2zxҬONu_ts_OUT!Zxq4M%'OW7dvxҪ$])>:NVOLCOV&}/No:?m6E/:깿/+&x8Ӧîi_ĿLOU櫗ƧkҶE/:깿/a*yr*QmK0'OW7e?\g$-)`No?VZW4 -?RL2?;<_T.?`~8)?U/Oֿytz֕aNoJ]/N0?m2E/?\Jh(ErƗVȥ2vxҬo68ۂ8hmK1NoJQ_3GtOL/'n(?m6E/?\SQ|/"j)?U;<_\jGrFmK1NoJLȠ{04m?RL2vxҴlqE's;GmK0'OW7e?m|9fzi)?U;<_Z5E_y/ts_OV\MFXtmK0'OW7e?X|'Ƭ~g3i0ڟL/Tƃ'7GȥΟoJ<)uiAZȥΟoJ_rZA4jOL/OB <]:5hֿ4?\J`Dž_X+Qbsi-:ُG:깿'SeA{vUbO&?8#i"aNoJI1?FK1NoJ|;|ƍ?H=4Ots_OU̲/T_4#)?U;<_V57d_#i"aNoJV~3GtA/նE/:깿#SoOQo?[m?RL?U?/G[m?RLU/IJwErƛնE/?\Jy/^[i"d2?=<_TͲqߢtȥ&W7e?S_/FtOL/͓ى~նҟLOUr>t)?U;<_W/;kL+m?RL2vxҴj:8OtsG*y_ٍ~ǠiRn4P&%LOT-xZ6Of&%1NoJ?;_Aa!1Z8ȥp&W7e?F=#_7i"`MoJQ5Q4ȥ'OW7d~zxҮ_6JkѺ?[mRL2;<_[>juDknVOL/zFXm_ts_OVͲ_K1NoJys{FM1/:깿/a+lXW/NMK1NoJa(Q|5WZK1No?\<9u( /Hm_tsOa+mn_նE/:깿/a+_j>di"c?\S7GrDi֕O6깿/a*}V,H:V:鶃y/:깿/a*|6IqLѻiLK1MoJ|?FJ+m?RL2vxҸA _ 'Gm_:깿#Scy^5I:^?[i"aNo?lyv8ӴqMK0'OW7e?WO3FA9_MK1NoJ4*ȣI]6%g2vxҡ2 5?I~M6%'OW7d~zxҭ>q}|.[i"b;6깿/*󼃤kîkDls_COU.h:iִK4MoJη,7+4ƍ#G=4_ts_OU_>(}',0ZW1/:깿#Sh~~Aȥ'OW7e?Tp '⋢)?U=<_T_rBhîi"c?\S`!SEM6E/:깿/+g& mE'1/6깿/*naED㮛i"aMo?Tr'+Nzi)LOV3Z0Z}/?\S bZ{Vȥ&W7dvxҫ'nqGK0'OW7e?U_2J߰POM2E/:깿/a+gnUY4)iOĿL/YKx Fi"c?\J<1jNvmO_lsOa*ݢAG?K1Mo?i*־5:V?]jOK1NoJy*ܜL8mK0'OW7e?V_4w13izIZȥg2;<_\mtakxt~m_lsG*󌽣_ߢtsJ_L/9J:Ɵy G?K1NoJwt~FK1NoJB$:6:փy/:깿/a+iىOM1Iч+mic?\JpaiǢiR&jL2vxҬՅeTO_(.텡oOL2vxҨC>l>!+/MtZ%qNoJeEi]'Ine_ts_OU9՟LU?/-<$0Is~, tm6ҿ?U;<_S5,ss 7H?K1No?m⋤i'slscJΌ*)?3պE/?\SLy~/>VZ{ĿtsOa+g>9:m_tsGa*񜫻ƃڦ_L/M癫ğy պE/:깿/+yH:>:ֿ)?U=<_[u"Z{0uK0&W7e?Zw&$?"q裦jOb_:깿/a*~no9CJ]6E/:깿'S{yUR~g3iz0ȥ'OW7e?rsQK0&W7e?lQS%0'OW7e?n`<4YNu_ts_OTRD$EhmK1NoJ.ZAS1/?\JO:HԷ9gGч+mRLg2vxҬ_:\'s GtJ%'OW7e?lak8ӥhݴSqh~ 2׏k_Տts_OTjdOޢsXѴsJ_U/OI9/]6ֿL/SΓH9F+mK1NoJR'1Ҵ54:ub{:깿'S + rѴ%mF`OoJΒOTh&OqV# i"c?\Sg2Ie_tsOa+̻?f:鶟)?U/'r$Nm?RL2?;<_W4KH9Gh㮛i_ĿLOVƴ]3H?K0'OW7e?[':"DhNh?L2vxҨ&8ӴaMK0'OW7e?W*ѯNWm?RL2vxҮ>g~(N_um?RL2vxҭ>j֞7Gm_ts_OWe#ZQaJOL/?7?[m?RL2;<_U=I=4OL/7z8MK1NoJ|3֟3Am_ts_OUrXqߣȥ'OW7e?Y'E?~94%kSZ'2vxҬͦ.#iV%'#?\JNA}*HlC^m_No?E"_:nM??U/yj>i?[m?RLU=<_\|%vErƗi_ĿtsOa*Qz8W1//\Jyw5H';Gm_No?Ugy|V]G Ǧڴ}tmts_OT5$iMsQo!?HZts_OToNȧ 7H=tOts_OUtȥ2?=<_ZM_նE/:깿'S2wErVZȥ?2vxҮo3ErFh)?U/N5նE/?\JLﵧ~i"`No?ly_4i"c?\Si\_3Gm_ts_COVǚf}s~i"c?\JO_նE/:깿#S+A7um?RL?U;<_\<)cR~g?GȥL/̒-~)L/[.?aR-JM2О]c?\JsOS=?= ?G3 2vxҡX,G?oѶ)?U/Dxo\?m6%gW7dvxҮL7d@>g(?m6E/:깿(OU̲4 ҶE/?\S;_/GtJ%'KW7e?R>l5rI 'GL/ryAF|jit)?U//g"t)?U;<_U͓|*rEhaLOW6ȿj5§,Z0u_ts_OUqrնE/:깿/a*k^[i"c?\S\~鶟)?U;<_Tqæi"`=?\J'aVGrGhmb_tsOa*4x/iA)jLts_OWOCl; hh_%L2?=<_PqwպZ`ftUu_ts_COT?48OAZȥ2zxҫetZ8i)?U?/mOߊFc?\Jttۂ:FtRL2zxҴ<04QNrͭ:O 8(Po'$Lqj @pejjfnCyWf]*6*ث3[,V#v'd=i}QA k&`NF4ZESVn]CmRS6YbTOWmiMej*?h06[vWqQm &oeztҼZsQcH-mx(.ٺbg(\0OAUV}2#*Ar4lOjc %cH?i ڙtiu~:a^a*ӹ$|(mTU'*_ ת: OUF.NZ)o[$9t Z\ثa F{Uۮn8Cۦn[L }n cJؐqU;TeОo >.{fp,:xA*EݎP —;w4*z f|Z9)cdҤ+WT_ K"7cé0%/YF6oG&|/3NB K)걊ö5qJx.߫ *:LJ~Ą%4aE=Ll9+mC7DUC!)4E9Ŵa/Bny%S`GlUS1lUʢ UU2O_s@:ƕپ7Ukq^k ~-?6æjk5|pj.TX•^sr8a<4 M/1nM0Zƒߊ<'eTto\i Vh_c-iI;c(I+W«7li|)\=!ͷJ$eOZ΋~QjUpBaM Vr4N-pү3Gc>;(?glp ayL([֤߆Q %zڱ*/]U@jp*|D{b*/;.N˲߆8W4-n;▽m:c@1Rih>#Oaqi(SIE}U,l,.Ӯ`8imS9­*; 8-vUKJn6TLSb$/SOad_^-I5}T|*$}߆m튵E#U7~`[kdr9C@*pڷĶh1t&ŶM!'ԭb% ,~;.=JpР^'7 d쿇L!.$i2ϹƐ#*˅+sLP <%: p*Jb@ZU>~{Oa4}ϹԜP:rUޡSlvs}=1%m wmā 赫n#ŌPB+#o^X miec_60:0{u;U ?cp;5wc_J4;ts*ğی8 -z p8P_(*ڣUX mWqDy7X@7VvR?pk8^~'$%A% Wb\[(+Ldq\T銸G]t8kִ]JtUl[wƗS`J«~mq,(Z\`xkk^s`:3S9PA !d$}N^:J CF6Źo=i*Ȁ}_|a"sx\Qbn|0\dQܚ`*9LDki]Ong~o ХobiW_|Fkܽ}0K~xK}TaS{j#7%]V¢ V'Siva|7« G;"',maHZyZ78UzoiS**XWCLk゜*xnϾgp6;Nơ@Ɏo*ƛ',ENqKM9;'OnS-_L{<&{cwn1Ts|J֐o*OM(P 7¶{.H^NJN6xz͹bH]/톐sp<0]rJ(6.ȿ-S7ܸiCsqq;M3:+8ԙ'65ċW0ݍ$iUG#+2W$u9in1U],BY϶j|7&ʪWw Mܞx`U"Ƕ61UN ]&1 ^iVKf~7f(*bqJUKunvëm- =>%#E} _5į쌶n+!j xe\⫕%0IJUَ1 6]*!  Ӫllx@qBЇU'midb~/m gϮb@GIp;. >;wp(٩j^ב>OBCն;Uonz8DcjaSez*l:DxƕRPZΫV8AyUUl1/]* ayA*۞؝kӏ|UR;r~4QQ[lSJPU?<^;zvU q~SɼL]#UuP3\Hl`RM<[aTNN2IW/ՊW} Uh|J7ov1$0?N0ʢ,ztUcu9Wҭi|ptªn۝zf:8OZ-UĤ{ҝNI FE=^1J6m?'|Um1? UE4ʿ8تΛ Upos\N*Pq*ک=ze LiW1D\UO~ ʼn۠-E\1CaZ]ƒX⪡1^;UђBSH+ppd<-SA>*ըX1pUNP UFW0eR>'9dg2۝Fy>ݼ1N!ziR}ʻ UcWFL#J'A0[W[hU(oyz|+f2I bl?F%U0gXZ{g|QcAOsP\s?1E/ƞ p_A_OG5iUط۠ mX'|qUz?gTxB9izfjFҀ}VIO Ag4\GE_òy6͹0 aS{rmqB& {}8wTNo V7lU I&*Ni1Ba>szvP+]S!)st} 4}vzd|A3vWf]v*6*ثWmFh'6O* K;^WlC:$v_2ӯjlKu*>R %ʼn2( &~la*w0߆80 x}bU~XگܰZS+qO}N*_sZf=Lu«*[e{U==х]Oy1M6W2O\mV/ [E'wzD**[_|늻'e_r'ZˎsE?,Ud׋ sLv w?v*ͮlilGt%, z?)aJScH]n͗3qT`JeU'4:b Ƙjb 58&6'Q_Da| 71b-C?:#r%"U:O{f<[0[2VEr; LXۂ}Ͼ<'Pi.'8Pta,h-.Tƙ1'\"E4޸@4<)트^'(յx`*8DtC@Wzsx^E I8@ u늬5|p+|rpiSAȜmq ӦO -FIǬU4uN:NتiemqU~ cK^U>…돊iEUh'a(_Z[2N7? (ż]vYJ]^ܞ6cw}=᱆"~ K^{W$I) ?3Q1{E|њI6?2xaW-;vJ3i_1EZnE0Kjc_O{1VQ u58UZ}GӅ⊻mk P1@AVoS雏A,/`1VDŽ4L_+YWU'rxiv>RAO#ƽqCfP6\v *ڻ_ SJlOrfdJ8* ݶ~XOSȣ +kx u}UQENU@鿾6Y{er\m[1O8W劭 wxoX⫖=rOL "AG|)^FӦ-[ }TkN6z.OSI\0ݷtb}ccWiV9baUeU]CIMd'(W/&{lګc_&bwcF6NNNn*;|J6SV- *9QhYW"Q?^ M9iГ(v+Z~s>-4a оCCr_iQ6U')?Kp1Lԟ2-W)O6ç፫d3sT}8-[˦Q*|liTWe8 #f2SW%#8xj EF:cǏ#!Y"cۂcylUxWp9|vqJ}O8!3(qUa U}{qGߧ{l0KG}cK^s9T//nJ=v_U?O=*۩OQr|KM3wrW%حޒ\;} 7FkgFàaB*K7sՏ3bT(Ϳ j|R7e(1B~o1SªLi2xcjmY[)_@ۏ|VԚ~[cwN6qZ߮%6X1UBcNe41ffcNpQGm"e^1PF[<2[)+va~iƐ R;9D) ­+ֹ Vʿl78vPI(vQ+)9LjPӃЩ8ZtM؝tPw=Cv_deIwኮOqNTDOA^Q8_ (X:W/78OfcFQ#J᧶7~)A,{ZBz= ޟ,R䉟g{mHu'ۦ4=7Q ̱iH!E]?϶8F[LUc* <*\4?$Ƌ3AiU,jSLmX?FTNjc $x`A'IXȐTwӋ%<mPsjQ/n=f]|߿ߊaj۟HP"~4Ho,k>jrVۤ";c@6U}/JN[UxE WT sǨD ;K1?vQ -Q~# ! @ZHbl;`JP(|N$S⨔tępR5]c+^UiNco)R# nB[:b)a*+TMs}_ vX @~#-Ӧ#xbMcr k8wU# UQn9= oUmOڔ_ڡd־d=YƵQm?r*sp9bS#ڟK8I? % VK=7?0M-IO }' QbwlkJOHBʭ:⫂Z ԧ]*6_,)8"*a)< Aከs48ڪ$'ʡ=p+e>cE뒤4 q7eVK?|LNUGö:zaU# 胑Gӊj? 2hqUoO6\9~٠hro(*wO|*|~Qz{~*a@_ċ逪%!HH_|*bo5zd2I~ N N(s:^v)B~.S쎽"r$a|?{?% \aӐ(#yikubeKWI*~oɸƦsQG *Fh2xU &17 sJ~)M}q.haB }~o)j6[~}rv]V3>}s:VmW}*SM]تɾm w'ŽQ*l[v6&;z O60ރ/ol*qUI߯14jt\iolPV7>'R UPM߮;ƐӱPS(—,^}7'"oDAA1w?pZT vvLۯ?VƒC_fcAƤ'Z>jIU=ODJvqB7V66kpԄ|="wzs%ggYjt =.]O/0n1UUX#|4/YZY*IU\UkLASQm.7^*7늴~|s1B1 A81-8WOBY6en)vEeѿ7=c,.`{}iQjvq|6۾`)\Z٪\UZcö2\* v1@Rik~QpWݿƃEN)\G9!Ս}U&?f!QP PFW~Kk^z/ƴRi\a>;vX%>#- :GT/l?\M*v\S znp!jD}w'6U-A,?xb\Pi_"ޔ_%ByR?[|qBlo_%̷^8$C#~XP:p֓>'i{.ns/s!sq>s~B!HQҽU8._.;R~j'(jIR䑎+Oo^ƐыH (@\eݺ<1UGƙ~)TKw7vݍUO~eoׅ nrΏaf>Nö?2/IO>Yۥo6*ث*6*ث7V]Y쟢_??~'87n*lip:⫖&o4Oj*7ZRQ~, U])T܆ Wp'2cjH |=*e 0r~Ѧ]NEmch='sUC`bݺUjxLU~~+r]϶ K\ 3lUzj[`UUDO,mB,v.M6WW2zcj*p!e6Ɲ5 m^=*=8(V4f [N3uDb劬ʮ*)&bsn`j8_FTW[UT}k((+۟].뙨e>5FKgIXuUT| m|9zMM,|1B/N>' ▨q(-Uۮ#M+}Q~xwc lc]f.6$.\ҿT_CE;/3N|VrK{/Lk7i sE%[aܫ3r7­=N5 )=6ҹ|([G;.4NbӞiNEQ n$^Uv{b3Fw޻/ze1Q7mA'g+Ax^ԛ%Y [ýLT*M[8ۇ,pڢޤcP?Տcfcn1!mGSIF%w Wt;QzUWsaIWgSQ~ݎ/A(jѯQaȥz!=6Bl(mos¨U2>˲#…E-Jlivപ16ciUH"U1_vU+[=XMB*EzIӦ4M\+?/UuR=__p*֔>}qS X9{`l~٧4|p*sO $.?dWƒ Zf r>;+Ic O]"v z8021Vw4鍥Z;BwoYL V8r8iVپ1hxnv~6%֡olxHnVU`U4?rr?ɏn?챦#/QthKzL2SQɮs*9`P_li]Zfquke %%>ȯͰ U{t,O M/[9TۧǪr}ҨI1=@Qzlv}LizN UE0n 4l3q?FMdNXZ{aBˮ1 {Tc8Q"~0VXݻeq-⫌'\*ʻ~ڸ_sHx/)HQBSHTĆk ȟ["Q-\-8qA}o)0c!AWRqraň SˎS )4A3'(^{cp*x~9XtpҩMt:۶ ӓ#ŰWq&8m,Qm'݂lvW;UR/4aj~KF,M&XU+4(ď +2Ǯ Ckl79> S{l0Cal'ʨj3spfa эw}s^{  w8[dq_(6U}&VH) [•Fq/4Ɛu: Ix pJTzFJS\ ,*;.a(sɼ3zu+G¿_ !$nƟ>ql?U!m [`@DOƱYb^jJ}C勰'8UtU>i?ՁU<^1R#=rӦ*c1UJIAϯ$U ~inoĞa\fQ#PteYѠƼbzmI l.ˊrء@Fv*dg5=~+N*~FWč&=aQ1دڗslUTG"&- C =2~'ZG/9n@G]|U꼻F(15:mUV+ ۟~4rs_⪬cIb(:@>TZ۫ mR[GAض0q<`^?u8ժzOHd? d$[F#W(àǀtK~?.U >*|1ޗsE q|kV>'scx UcJNq@G f4AZ`UAoC_lhRۜUqc BⅪ]11Ҽv>&~RoAwwc0*!?݊p˰TبH W*5k׮*;~u'qQaV^3S;t -oAZ PR sʈԎ "1ߩ0*Y>ӷ!+/SS_$[[%?;WǢIuFԥ/n?`I%yO'$[ UARDžmsb‹CrOTig6r}c=PSm5@k  cٶ"cO T|dD!P6E3aC]rW*cN$O+w81 ~Ƞ­ƫxfqV:OUg.˷_ V`9AIݱK~],6]!fU-1VŲ vA>)Ij:h1Uh}P W$5>t f?h<2NqU;faUtDzu Ir>|4{v]قb#5;.X@E ;(-Žw-{iޖ4UY>uWM-\5 ~Pk1`,yqbJ%"0Bs%9⹹^Uirqݾ*KƸǛڢ!i?5n *"o ToCQJǮUkoӧfïqēӮ*xt7~-?;.7XanLm* *Vc۔_~0"dy;Wg/xL !H;215ęSRQ6|銪]{fԍ“o*WoͰxU u7?IƓ}-UDd 7ψ'sMOt<0`1Z~M_a&;^>Np%\bzwH%-o|z T-::B=1N oa ,~>LGM+-o? |to" >uW?hu1sC%XFJ%Ђ*5|`VX땻ubݲYS&W2~qJH/?F`7s-ò|<pڥAk O,*isFfnqL?_፮EU =78Ueƾ}Z%BˁT#  B9FsD8ތps;ǻJ_ 1])U$m? otY*QOƪ8sH_o'cs|Ƚ>d7nثb*6*ثѷlDv4}K?]Ƽ-oSVI۩K@U*`<1V㩊횟|雮tQ`PƕcLOMk_ *_5Nl*jWl21UTaWn3T~ |qUʭր mW9T=N]FˠhG]l*>'5)w&=>'5|m*kOƒO5U>=\I?k6*4A.ZKwˡgX$-U?i呴P>xiP/ߍ+dqk=}Q!}xU'd'B_i͹XuQEsPv \Kw4`V֛9S5/eQ X_lOOUg,UF*rӘ⭌ +lBݎK1_-P3kQZw#ed9edVw;?؜]V4x4{xOWsS LvR从1%im.Ͳt9goW)pï^ˊ}[TM϶1UĶ4ި{u8ƑjMtn_6­z}9Ár ↚B~cZ+P{20Qa ~?Rz==2)W^ /=p+^:~|@-rv떨OACm(;eU"YNp^zt2cbrHR'%Dj=;DU|gpXUoHvW) /L"ʑ)n6KFOc v`Yh?~z~fݢn-ߧHZ/QH,6a_{g݈<4O w'UcHnqM=U_+wN|mWa^æ0zoŒENEi8dD@} ?Bi,ͅW>s0ҴefvV?i{DNZ"Ech\" ھ*_aSZRӸg_~+}@>*Ӡ,i+ V#jSUX_UoNR /`ZDGj>,Ku8iy9XAAV8y"*n1-CޅэY6%4Ѯ|(?a#H1gUQ܎WNIw *&kXԎح+mYN**Z[bOO_\"4OSLRhdrGcJ\cSgwR}j?ƴ`kޟKoToM7m8 wƐf˨Vf_s`_K*">XړW 늶5|+M?)hȩoldC7 J67?ۅ:̛"8M4(SSɚxc}B&;]8{MժzLk^"Xh^B0;[xi Ѧ5Zx[_:E;D7fW0+s JƼ?fb( ,2K}aUAGGӁ+ h])xv9x>4N^6؞e^J:!8iZiUq!Ope21Z3OlMSU.?3z@}Oc7z F=#UJY銪 $l oaƴlvM*%oJ|N9c|4r\ۯ˦Y `-P_1 ɽ(vT(k/dJ嗷ڭH/P ?i/gf ?=)[ -njM_d?d#|VX=O(,#bzߊ#J5ep@)=On758iIh=*sg j(]A(EeX0%y+Y- _T@xǹR :o!Fk~٧n&\})i>Y~<$ȥM_1TlBڻȱ1@nQhfi #b썼p~e>o# $b̋ߛ{TE\cb MA?VFN8`7cj[KdyPLI1 DŢոc;G>!ē\U"æ< i |1 sb?ωLgUv26O]C^o,(BƙߩᗅVXZ#çztNڴ? n1^l,Vw?*(7*aU.[uirqUUWc~}qU{튭\K~X 9mkb_`8Zi;eGlUW0>h:{e:-qȦCEO*<򕂨j+fW (~ڥj]7+T t>xcà Bm3<"X׀td uN@:ª ;NRqU|z$(<Ŷ 䈟umW1Ws LU JVvFP=TecQz\UrOxXc`UXщCoi.LVk>\zAMɼ?}mEڕ׮(RO(*cq6lRi)Ğ_ TJ@]2k*Q˦)sG(yt.aT @UP+^%A1u'Ryu=9=v6_8m =X8i=j> c}|;8* C()J}``Cc_ *8`: bOk6UiJu*Ɣ|raBga®۱2ݍ1J*Gb d3NU%Q]7$ls/iIfa#d_bM}ƫnucQ1hRA,N(Sɾ D\^lPW;B\/n9(]v`ݏъO.#fo*/|^"N*64K:ǰ POslNFHmG\~ئۖcz*/ 3{ zF[~ت }BtThLI' v7ȒU+Ia UT|JEE0[F.dק)B\)9I6Ga!1!}c [4m,((L<ӊWkBƐ~ȧ-M,*'/x`J;{ei/N*2Ü"x,RYPm8;?H (Lp9=GhS|E>'J. G⣰}ƐšVH33((,e늭34, fJaӥ1[ƿh/qUU|1T OkƽwƕwQE2Uh6*,jw|k ~??dI;fj_/:0Ih}mcybxP KSTWe7,U)(m[Z(EWH_4p%{fzsh0Ɣ˦8(16vZ| Uo㘓l4GM1]CaSlU*k|r^VԤ qA\U'4Z]w83l0&Qتu딑)aWM46B}Ab'=Oݑ%P?X~)|8wUCaw78D?co iEacKjiǜq61ao(f-t9^B뛯SZQ^*R@{wǚ/RJ4?d}'ړ=N-v^F`|rL%+dC~f8R{c|! 2JӮ;*͛`ciqB7srZ;ݱ}߁*S}\ٽ*E#Gn9*[ḥNJ\I:tGA*n|GUU ]6eⅿXRqJ 8a, bp6 =Y\"'5I '7_Z>}rӿ\|Oz`dq#j`jZy:p, m?pǚVC9Ҹ)D )үE ~#Fׯ%Jg\Um44Ji7wr9+soׂU?|{cVi(ƙ+ҭө zs=:|V5ݿM >rv]F*YӊUb[R?Χ^_AI?ۊیf*ȕ鍭p)aI3Xbǰzt*~/r8z 1"<*7${ O݊ ʛ X༾#A\> US.WTX]i%U&PH)d4Kw{bRGK5^Z ]YdBH4f؀RM0R"1ҕˮZ#\7~͍k# ][oQ&{qJ"C1 Wq).P/}Ux4;V<Ǔ?/\@^$>o2j_a$UuE톖i*Ɩ(!=I¶{O97j>'6VWg.W쟲GShݾg8b4LUGXGu<m)F Olarzl1A<Fq[Qk6\w%MU9$2lUpTZ]x ޞ?v(X~[+6u(q\cIM**a9ad^`pFG=O{b"u兯O1rxm$|h`~U?_ 4HFɑKL IV?yb|O 0Wiwˠ*Uٿ1l*UkWPڴU8ک+vc0*xWl GUܥqEڞ3 kw=qTFj(J]1KtRy>.{lm\ zm,RIA3bu'Tht8kNe1 wƙ0*kƐwKt UV?_| ]lz!n 4'X, {4%=~ 1U5! vUm;K63v:B$!R7*l7>*U ;Aܨ3vZTEzvgoe_S}1T@$o ĝSB[ƕCl=8P{ז$a U$?hbB,!țxRuݱ =dztD\rx\ԝt$)o]|*/›{V 0- %@iTæ$J2;43nNW=ql[W(߈Tb0|{f~_6#b"ws(C=ڃSDpZi>֝*Qǻ㢶y?du=)]jP VN_ do`U$cxψ_lMe+l*N>v\(Vi{G ULjOmҲ(on=pj ;[]JMXHXANYͷioL`UM}* ali`FcdJMn{Sj}8eҾتT߭;t+L9|>|$KW.7/oUkJf\n^huGC1`Q_Ri\o;r_تZxGIA95\R˱r<řBh#XZG\4r\ 4W~ r>RyQ?o|w½:~9w_~)^_| go_zbPsǩƕi|rُm"Շ# %z1v83F~1'0Znq3SQ x,xYTM0$ i)lR8ksN*"q6| iWHbe¡YRv*^PۓaB{Л'\ (* .. T ִ~ kp?>I[-:>c#.?k+`^ǩ*C.ga=hcϖ#v=I¨´UmL;1Uf5qN6U +o8Bh(aWݳ=ƕGq 23lM雾*ˡZ/|N8/v2`˲UJi?Q~KAd'e^/ړ>L| :wJk.aV»*Ӫ#OZw2?iZb3T/A*ҚOLVIlǰݽeM J2S\`(<=~G GFJfzVi?Ban_m׏Gsck2A_55'8H"N*% H|2ToeO\{HqU8zW*߮48ofv s7u&Q+nB{ *HqEE]iT${e< 6վ#L $;uR 7aZ*i>w;UKy>W)Dd9?LIX"`HXN (v jOs_*_L4UE ޸PyLR s*]’1dR@H+n֥+N~i =ox4w8RgeR- u9``KP ®XKnƋ1R 7 vn3|,/1[Zd=8-wƔO9_~8[*>ċTZ‘Ǭto\+j]s<-M~Vrz\M+I a޴/dm*YW4ݗ|RQimp =J="Xn츓=izx?TFij;F {fhucy*۫苹?G)Eюl?hخ>P.>+!5oVrI¨{XvTHOlcJ_p_UH~q UEnzw=O_;0 GDc*[` /vUaK_cӮQ2W hV$Toזݏӊy|(>䫲Y;N~Im#MKP|[/oª$lOIBRmc Px%TZռ4շ8ڰsSe?;J vU"LN~)W(XHQ{ TF-c}V4$vx¨vc_o'cs|Ƚ6?>C tb͊?*6*ث_[tyd=iQC3S"cSR0[4I93\ T#X.h#?Z9Uj~6*(  V:ğUI–8UMZҕ9|Gs\Uic,Vw59DӮmP կ.#lRm9c->[7z W4ݎjצA_|-.ǽlmZjcj (dc8%lx1zTvj;x.4Uyo%Xb 朧# )WG@do lDzTP O5iFKT\ཇʭ{cjSXRzbȸk)1x s_*ZEOj1o5i튵l*~xǔ|ߍvGJ+=0Zzӊ@70+Jwj|qZuT~{e|R]|1 u51Cj*r[1/YN)mv@ғi>>$W)[P?*F!$FTۗ*=Y8Ue4*U2|+[~yXBh7o#'s*\c 2_*x Uo^'({TJmS7튯 "J cL]t9 =r6BI%s7 O>*kɿbߧ+ VvS*F'}T<,O/4A껫n^DUǥƒ4IcO|4^$'0F[8'8z~SKM/]B/ o- /1g.צ+K$NWnyc…*5ƙ@鍭/Kb~4ol #D*rBdW iOV N*uaGE.{mP<>Urզ@: ex\o"r% Nm.(]>ׄ*kV-}izbU wAj?x7dZTo ?޿#1T"_]mB~UA<!?Si$Չ'Eo@oc~¶[݊UaTR- %mc qZhF&UPra\z Z(?,ՎIwq?gl -CR\ҪlqqOLiV<Ű߃rcRWm>Fm&-b1P%_}OP@=xV3;{|rS4#fƐ«$;0)m#߯1~i ~7SO˨^Ve' '"|2A\)\T.i횞&ث\.' t 8) `W1Z]NY*O0Z\}1좘-U˼_6ۓO)NI+ʠY1CcЧ)HP;(ׂM9\8OWacZ72Ӡi|.Xw_hmvILEO{ |OWl>}rbٗVu9` U\vN*4+o\ULos雯A\U m:X`)_T*+񧿹+ZP=]2%Kk ~_1ޤK}8 dNV[qʥzlt,/х K06u8#jʉӮn*ko eO%U#c%#Bjè8']9^ ^a]# O4+m+di9`~CBt$XH.Y6ˠ`b*^3w0L|Heޞ8-Iģn^j&7ōӸ|\G"HB+;$;8žM:1 8EI C\@xI.*4n0>ɺ8=. bE5{{b NKky@Y^:}R6+T /NJpWd܁ Tzy;h<1vm*%dϖ)^'c&cOՁ+cX)( f}q1d!jR~N)V~}iC_lU-+)v KNf؉fsQh>X mMӮ?enpDI4_ˡ?kY.>-EvQNBNkwc`By>WoegV'$߮4c|8vf!b)pҷS, ?71E+38Ͻˈ]Ix2$b[m6@=Rz g&d bdaUV;Mr\i -:f; ߦߴrqVRw=2ISU })@=يeHAoҥcKS NW6n )oю/f ckLL R(dw4,D)87\pUSi|1SXMz*\|qUEN]7>U'ڮ(O_㊭> q͊*)ڽsTvXx\ { mPڜ+b9g.*olheN T$R:COĦx'#-4 [v83OGep,Jb[=c\ *@gLP ^W2-*#߯ݏ L43J_, n{c6UO.1kM_(u?FI\ֈs\<6W$7~W"Ez| Tv>|auTC#x/|kJOMzZ`گ>;.qarx )mh}ot\US۔SVĝEl*؄UEO :jBNW"p*zWsH*hn{/LUaa\{⪂2::}9U~3m>2[~ULLUY(c+!Sn* 5=OdIUtOJLkuO1J2-">1ծ^HZ+Evj8}JIOx⥩x (BT;4'e wX;[I7¿ b2\WlJik`jbaKuD8/n:}s\*OLCL7sS7xaCq-6R;RwlI.R i(UKr-b@ b-wGӈU#,a(IIj^-eY=_ Np%YӧYE1Uʀu9ǧ)߲ȔI%śz}^.4xirez(z}-(i$\TQV'gULqt977j0[ҏuFcfHVzp<n~g&sQ)ӿuпa]bbrsP,}b/ (CW10qIy8H[aȒDGnm_r۱ -zAVT# \o~mOs_D:8~#늩Cw?{6AL:J~ jk "B>YaBl%>'¨Ԉr轀}wd8ASZAH,qpZRYZs5S;[mObjO-M+|1UU_|[{ Ua(`U6oݱ?ۅTZj,x~;*Ռ|V$aH@+WŶ,TXĆO1r~m!2ö*E~B7?)Zeqk""bDGMN¼<>ݿ QV>}p gq 1TnjC䍶ڪn߆PRqV@r*r: K| WtWosGb9; kDBUa펖F8*mpL^rjx=RSlFܾ W|OAI s(n3 z )ji삧-AS|$I>_Q|{-0i/ }{X|Ulۏ mT&OR\f >}PqxbxxV-8G9?:??՚^9z|d|A3vWf]v*6*ثF[<4}K?=G<ȥE?~xfJWׯmox@.٪;`Zlv9'$KkC^;RKA*DSO UI>*Il3T *kOSQW@0+3Vp|),\?R}U| U *l %g$_+|]/[L`4' mZf9HUWō0JX0"1Tmn"-~gCh0R2ħG Ƶ҉vòU#Сy+Gl^ |u߈U)^#Qʥq[է9RNIUzQ2EqsG?Ol)R2>–9jt4X3SaWG m'e UqjߴvڮD*&3Pe{ *ޛK *좾;Ug2?v5Ǧ*#1UnȦXZtjbwmk: `t1Cl۞BR Wc ]xR7 &?U$MA-OUo*m~[,@1T98}IX*zg~er'dUݚNUU8 hᆕKבOܩ]K|U8`b3*CM0BX59HBXڠ&# `aZSvk{V<̓L58RO#s%P8.vZ*~,㉵ʮ+Uh$}4b֗܁p 7OcBjz92~Gfš~ M _BOb@\鷾0z QiJ}}rZ njxbbF Z df1 *l78iH>f0:{`B++sl:whLƟ,UrD<+q>Uv xPMbʾ%pI$xo[`)WeMrO8eMKǮaS 8iEl0g&?k8: D똶*_Ɩ8-U@eN(qp~|P4;$ VyWs,:7(Oe)7Q .=ȟbRO4m? DR>=h|Tw_…&w8;(Sn}\K߾< x i w}]r#]rErCc:4LUJ.l'wʡ=7֝s=\jc,8Y#Ⱦٹ1$b9DqB3<2N**-4q5W?s#7f =)M)co3SM* i$UBL*G4onNiTGzedbhٶs"3{b?|aj}EZOsMSlvm}N8Mπ~G\V+r+ EuyHGvc@~CTVgj=p;)r&F+͹qT@%$؋~dIJmcU#"OJ%- iY6ir8Jc,wZpOLO q^r}Bp; _½J?4ƴ'\ӠfW0?Q{LxPqB;?5 Kaqmii86_BmoTQEs{h Zbx`wp}ɡ ̂Xe#cf M|VԏnEwW$dZN(m#L"ʨUp_f5s.g#{.8-z3%7Z1Uy7;8 Wh3cL=ωefAx8wŸhimq/ӗӦ/šo6AVDF?y/h8SbK^m#> #CE0Эcq,0O#_G_p1`:pFmeOM&z#'6fU\*c,'ǮjbcrYaI>0P6ܜ*v<(SIͿ kHs4?R|7?\UTG]3-k=?vbu\[/6os9J!#1k+ LP$~8 rh>JTIDX!ڣqe T]G @kLdM NJF0D Rz) ڡMJEl+lR^57$lNBDTԏm\DғVɑ+P#^\SF˅ .=6\֧b|A_6 J5!-A7JgkJ`Wd8퀪Ėɶ_J ;a+eodi[TQOmS* S!]遍:cBF/Z 4Ui\W*=1! \lg .ˏEkG 1"ָ. )%zvi@h~]n5('aZ}0^vE,WgߏOHlwͷ [*Lm[ ߮` `m E?poSzmٺu]~E\Up-3?6ta0U?4WcY H}ad˦3w8)*16%.+TMxc&n1R8}u>l(R5aiER;Ronz #Z>Wv;aU?U1噂qZ[7Վ1 Lx/`R ses!27l>zAu?"wdq9.dbh60|ajOc*v )&fp:bHaq0k!N_!a~=dWU)U׏ /?@ªSX֟?ŭo DO|*RR 9Mj=.!FyFY=ü)?m=~*GhbLKnƸ!T'‹L–ڀULZ;bp! 5ŖM\U %w>e>V,-&6ql1U<16ƱD8V!4ӊx I'0*)-`{2DŽq)4Wl 4c_w;by*죑"WqU9d ~>?]*)$rEiQi[/@aZ2LBUnGIp*UN*|l+lUk2*ޤJY|r^{b,兦bn{%HQr~1.*/ǩUBtB n2'ZbƐ\ۛb*MϮX*f' .4E4w̻LTi2 _㊵~'Usd]~l1@jD!9\>[e,?ª[?C덮*ƙE7k);sOG|U`v#mZcJ٘U_ƕQlI~#xwoQ?v/ƒ7| y1%USGjT֤h!v!JML-YW,q_|(X>\dr%*iofsQǬ}QwNUH]~(sU6U-U=^I==TWqBQ%cAED1~W )^#gݷn[TX8ai6Y .nb.~C(w?g*F;wlrd5s_ 4xi_ ƒ<6DnʓX(^{fl:Va ^䂩v]⴦xm!&0ZiU݁33S(Z_m&ks:cF0Kʎ₥,*#b <=qU%goĞ~@ECeO=qMۧ%RIU\P`}' ;cC HOLUqB>*pZg=_8Ua2}6y4[EHR:|0?~/eUuPs\$`w&hoa`J ;zq;teybewy{0*;>l*a «Z`ݎ sVŲ8z|1 ;/Yj|*Bیg=\}ʫgWnp*AEztqR7$e \*c7z l6aUF!~&aE[4'¿ۍy+`UX|MbL~~"/eW4ݱTQ=pҡ,x?Uc=N,P5~l8֔.˷p2Z3/. Ě H(⸨E[||}߷4|Ur@ZchҎNxN*c<zPxnz + z|5bxԷܟzog$c lAcRjN* 8^+nh+F l8qA@AGM.WȾç`:bBk=s3,kvK/.u|:`\ACߩڞ 'ű ^*'o f>z`U2}TePSA[O|Q#~*%oJ~8h?kv2vQS[Kw`[ZbeHvz_S1??vEۤo6*ث*6*ث_[<4}==iQC27'8nٺu)M.=+\VX:eæE i|3Wl`>yO]^'ejt6*k/;(1K Q>'UU#=*>:ƕgLU!9Um+o<>p4'dUBLB!,"1)|[\7gC0ҵKG&lJ 'lPh^S?/׷. ]F-"n!z(l1=:xJ=پMq[m)Tcb*}H~NXz Uk;lz톐쀱5ÝSsaU/O(UOcMNFҽQWFU^\ gU/vI>8t~Z1乙(ZXx i*e'ĕ^]Z\ _1`0[ #4\~'.;PtolRM!8/8"O%Mzr U>yhE_aBizpi<}NCp'aBkn$?FE[U~'#熕M l*`ڿ2~@sZTUn+N@g] q#pb[ w4v=(*Q<&IcJA.=`'sT^Wc5mώ*;C'/QGUJ|ѱV1M"1@ fZ"N_ *Eq ͻ J'A, qZӱ8}AV|Oطl Z)j!( 4}lO !~33aKx);(Aj]L U~^mM8Ra+-cNP.(Yˮ6zt|*Q۩. iOb9Cw/9r4|\Rќ hrvQ朤"5+*k_Ӏ4G_78"*d>,vJXb8/eq+6Ɠjз6S#3F" UavVв^/^JOxzız{CM*q=Pi7>ٹwji:qr8ƸdS+xݑTӵ i3 ?| ^y+駂톕R-*74-W ~*ZNW.}*`?,ajN M+\@ <{ҝvH[9?iVHGi19%Q ;|pVo R!]N|+%M1LRUq;-dj LQczJ.T–VOr""w{˷.=>5"#$1H&#՗˅%ZK#FFP٪Zlۚi>6C\৷Ol*\bSS UEO7*i rNO|PFppg퉙<2 H<;vދL#5BB #Aip0 4bX$w탓d@GU"p:y rd*OLRFA!=2YGCfZBo6< TzTbIn6&QOLE t?]X6a צ9."#p@SNn !eݪ/ 1B(HE呁h1K}lJKL  -0ݭw4dUYcwĖdb$Z5H^c*6$%JO$_  ğ۾jYjHvt:$oRJ,pV+'ri¼-iP6Q;$* c}Ͼ+NUy;5OтQ ƂN1UF@7ƘQk]>'SHS%1M*6%lI-N9 銺I:{vLj…f cV b?4J>A_sNki~'l1)nv fT-+o:b ܚ~^J#QCܳbӀ;'6Vءs; d1XHPJwn7HWՉcඊi W('c \ҊTl*(C @4XZOS4DfFoa3[uolpu=ӟ8BN,OsKO7Cq!>*%#t.' z R~N حϧU#mȕC :lQ#&~x{8E4㗧/ƒ7l Ky1߮([/ xP׿oVЗzkbv](Ay>)4(>P1lF5\Ut_LźtªGSRڽN( Jy 3r'&uƞnpگUڭEO3.9E:blK}}qāX1g'oՊ P s*+ w>9col)i# Q"gi ݤ ۠(u?5٩4Qcj~8-UUoƒLR|a5⪊F:(cDw'UmG);; Tnי?V!K#|=tkhayW;&ZN ۍl@ڵpGXJ«P>Y*aU<\ձ*p+]UcTMҊ I'J '1rqZ~P;aU$b;!e?/kJؖ10!ǚUn6Da>xim>ef$nqUƪ9|{ wml/$rph`;b#'ݏS̭!=F$ ۷=`rw*SŖ3 WN kN`? Nh{(G*]/5xr^qҫAVrfwnT01oJ˷Q*i~X%R`vy*'s,*ME!臊 `6x8im%Żxt_aPmFVxaV_x38 bU:uVy?XT@'?X^PWՔ҄^tV1Jrr%(>̼$-Zvb78U 5o늪N,PK?Y`m▖#'|I'||0ZT6{SI }Lt?~׀)Qzb_pC~At.!NRࣾ.(T#R`g1N}%DpSNgiN⩢EF(PoCy]! 96ت [ǐ([AAUhsa;J߮ǶW&}a⭘ =*Zig'p=* :cn t\r*_j<>ZvlqU:¨gc/»F>:[v4WEx|;XTSV?e΃ğoׁUQ}VrΏaf>Nö?2/FO>Yۤo6*ث*6*ث4?՚>% z be'"?YtR˯jlUܼ3|m\24h^^+: m+uFf]V G#*+}+pd7,)+9r\P699\Uԧ2G !*;#Ou"1.;+㲊#[tC0W[Mr(F(O/)BH jw=}1x aLqU+oUPGMէ"ҽwvQ>8`'^[^UN~hU?78~Zşq=S~ȩ?@.2;m/?L(hzi a ֿI$xE._=UԧXiu?yªfW(ۡkCNG<[2d1T[w=ؠWoDžj_*~Y||wlraEI-NZ03qt x VQTɣmѻq'R#THC {*ʽ,FR;qLj퍪I_P=+IcYUcA=*W5rpҭ24Ҩ2UVLIQGTQS-saS*W\RU'Sw g<=m+G;i,5S ō[rqTdhTQGa,y)Kz'(6 X,+TPPl2#aU|N4wx`Bvc&r۝)D*db`צRJu4c&}R8}qU[P6!$4O[0; U/u;[KCTLN9~oMRI/XܦX6y #۟#*8jFo>6l#щ|ÐCAÉ94&Q 1 t>xR9U'S|Q}򀯾4.{|#*ǮU|2J? `Si@ W#kl/a\g%m)Uىc|(\@a ~XUIe (YȷLip:b뉴-*yt*zJk1G*U"`W*h/>ZN˶X# V9UFz[n*I0 /!#rOs7+{f?\!0r;;`)BvL[D@U Lzӊ/y)رc@rI;wKl[Y8Zد bjkB z4+ ӯ6=IݩЮx|^.I In~#}8#;SP4v1ZS+X @Ȉ@c|y&[%@4P+Zop aWSlR{"j|*("nfHשR*ֲ M0Ub"ą4l78)w8Ҙ2/0\zN Q wh֧rh*pK弔E >4e[Z"!uá]X1fOgJGG8I06<1="q< }Z\wEN*R(1B~;9\B mdg 'v0quo)14'*7QZw; wMߎ+k˿aj|PIz51_ iႃӹ?,q(bWiSF#Cror }K30sV<@>U8|gvqBw>'(M኶7M54Ȣ`4ƕr XB3SӮ߉mKoa5;oqU~٠)=NTUTJd۟æQۨ"}+sL ϷLpZ/8Mڽ+BE9)1HBiP/=V*t aw̴7#u ?|T|)U{a[e5W*3}8SJUEv4wc\Upe_5]|*OZH6PŜ~'69tSXFUkbݏݛ݊ZyO CEGU@۩\s|*C}\@Z=N qE\?I?F J[!Y]ċ5^Y:P;~0+qx܌įk{ⴚXEiTK|^QhinE$=뛯½0%rU6!NF3Q4m\ߧ\tꑍO;qUIݗJqUt\Uūs4-n28zcjW/|UPTTo (^-'fo׊#v8]cK1U>#1鿹jWc\Y"c&^Ұ@. GSa Ӌ(߫IO0|"8ɠS0[$09.ʻ*Iu AvIcq9/]WWWay+, OO.X7;4Nx/¾O) JGnMb\(K1b5}eJc?u0+WW1ZGܰU;mRI/|| urOxBweq,hʻiUmr/)OW} hċ&tO\R6=b8ܜiTvMώY!})&d-zdmQ n9>Pr?~*%o{c*_LM'J"4]߯aZTUABv4'li-،ASdTw>8m[Ki%4߮l*GzvZ3Oe6…l_mcEPT[27•]6y$fv"4})m![>غA^ oqm`x)XT]LLVe=O |Q [ُVNRM8R$5F@Q^;' nw&m\HgO!JI^UIc*NkC~e [^g?w-ݷ8Ux^_ K|ZXc oxBpVuU; ~}0l G"\\~PmU*< !O*ؕyl9ǬawmφU/*T{b#ݿ@ZXˍ,Is0*Br_|o醕.R/N R>)fér9TLm-h4Q_Ўt-P{E_sbsݒ86-)Z;n`VL/e,EU܈4l'Sh|WcR4[-=L((ٙ_@]I8v;~V_ǤD~T 6~xUAy=9GGw0I'aGGd7nvlUٱWg*6*ث?[<4}K?=G-?Y :1aXcKxcjCMU~(4,(\d5ۯߗ ۟TR ~*ѕF˶]%i.PE N(,h:mʢmw& >@9JDcOl;x (^3i[OnRM~\{ cci19iF$} N kETeH[ OJ|4-U؝%qT"|V*W %c\wSMo Zy~R{WpU߿ߗ@:J2?nt醕_w\i\ӵ1Uԯr~YXaiڙcsޕ742H#,%V +GpR #5RڋS>L?a%n8&p*#?x H"GG^ݨ.61(G|UeK:5V#݃UM_eBj6I0CX/تonx/i"~(q^4y&g_d5v$늣 R%{1Us2x^UM׊ *I̿ }PvSKj:o>bDiXcLj+v+79a+֧ !cMǥ?p*\*~0`vm\c#yO?@Vv+TMVrboWsAe1-Vʡ;++⫽7xle*EVLr]R/¸I (~Ȯ)\T~x i݅VLS}A |T?ޱ3qUTcAL*:&NmAo>aT[f=M})8W.&dXEN YK?KBwo!>b侑g C4;ŚzGHJ=c|-?lx'W"?8}B쟊Aq'۠B6J0v?7_؏MHmƹ=݁W€t/N*[y\G}4`cR2ˢp%ٶ_æn`t YcYmWG9n@![#?/*=_~]3}i zuҺ8+{6ܜ Ic(T4FX\fUv\UFIڕs{bOlP75.78V֕Oh1īJ,a u;J+7QLUqFtWBo !ЎNH>9~%aJ9U5%2 >!2*,_ 9;})Nũ?S=zqCk)ˣa[(78aMB9 ?Đ.=kj|w'^!4T?KdmPj2VV?NJ1Z,Qvv#_3nRrʡ;UJ/\AَZm𫉦]|Uh$Z۟l}h6*;ഷ$E)^Pi[~3Ps -2«O||w =SljlkH|R˓UtqW*~Ÿ3[v O]Uz vZ,cl!TTN!C$l2xKtޔ_9HzA[|qw6\~\:x/l-'%Ȍ]2(UӸWw:v9"#" GL(G$$`ArLVF ؔCbXnʤkWVK4 Y )q4-M2!شVN8ӱ4mz;cvqm/b@jzmt] e3 F!H-V-8HW")퀗!eU8cNb)$!c%[،rł{=? xiPv[2JA$G.d=eٶ]6ǻG#k;^LJn78~>ءrB(~oҧ.olސa:-X"U[a*%Ww?brI'Z/ba |Md*\*l¸rx37+iO\[xcJӉ|)U~p)mk܅P>>(RyXNv>?/\* /4s_oqUxqblP=WOQnتsNlUa˦XZz71kw-sڿ~W!bݴU iIzBcwI>̿o-ўQ7J&t*@+;ң |U~xVG}(R.,G*֜w8a1U!(f#ڎ1 G'm[7nB/ĪMJ6s e@nY-MJn@]V/T"JfFp,?$}U4'v?Վ>/ՊIpWoߎ4_~UMCocHOM*sU@B#7–n_.SO,!=6cȊw\Ucc1U&a&TbDvaG&7w8ʻ Ӯ8F}1<ү"/JuIT˶jl17mL1+*==@ª-)~ @W(]0%l1V${,Z2 s߮joWq?i뚕~U O\B*u=U9fXyNTýq=nOR$zdeO\z"xwoEW'c`lGoZQEcaJcX+ƐAu tªl\(Br|[ #ۿZ@g{u8m\UY@O(R+1t% =M+ѷtګ#ۯXU2~I\Q[rKtksHA*ݐ6~8!MzF^|irƞUQcV;ö2UJ7C(ڮXx $&XWTEp}m(T湎pud; ӯZMy;nƽ(*N n:\(JKCu5+˖'-8von}fs͸)¨\{W+6j-BcJ{>>4 y//)h~6,î$k;9b-$X돢NP,fgv%K7l(9jqƴG;ωO]VOe>9x1BP(UdB5R%M $aE$!&*B>z]Za6DSmZgag*=6kU08初ɠT/£\PQvQe;bN|MN ] +m2s$}¨Y?iUO~PD68_QA(mV!Hj9G ǿ\f"_|u0S,zNh7nجqT<`|+=<:fID_ͽ_O^%x(M:B)m2ASҺ^eԓc83ݭmHr?ȏkp8**_qyI/ɹ?fP6T<6oZJJAOٻu8i]"=z 2~:<~a+j;z2w2HPyš(.E}6M=F~Y!`*1imdd*6߅ k LhӷaU H|m 1B8SNvĞF> EGã9鉄i>';bg bjIIwGL+̐ӊ۝D+ `1dS͹p*g5~T/7rbJI,ĒzmQP>ѐiN#]5w(Q?z҄t*zAgHnɊT$AxyH ^/x' L`mB8Uk1?_?cSP|_g)T?(nIC~S^IPC'2{V8x{~'22w=0+o0_W犩ƗM+Ehċ8QA(b'ƒŖ0$Z yM.wp%'f1l }̪I۾4TA˯|By~%|Oj1)'tU"ssE;[. =nNiBI& 99B NnK2;K0LNˊڅxʼn c[*|NKo_QSݿ P,}whኬ,Ǿ5 j$5cS`J-A!E{-L(hGg'*n>XS qzl6bmV6 }9UA> xO4U[?チN>䩘 |Se\=1Ba_w58UDO7/ T>;AZ㊮ _ƅ'~Ǿ^\/ռL}]# *OT(ܜoJ_=1Y fvG'9Gw0I'??2/] fҮ͊6**6*ثGVd=iQC2*[8n%x- P~'7#bN4**a@B2qY%\x$Z-LHvD|nDlFUi%4њƘ+L|I־*pN=Na!N|NU#ve>ٔ/aVwN_:{|U{?bm(-iѠƗgA; sն#TAҧ熐JHZe|0jOZ8' B[1AUaoJ V銴#z8imaU-aQ&=1iaB8ܻWw4IshG#䣠'犮)+3䊟F=ձkKx =OaIap6 i qdvTcĴ-}[ ,qo|27j:\wfWjlw8?T醕OѹRcGIԚ}Zla;N'MzaUzĞbDE67l~Ȧ)4 !(B ()Ry=(1E(PbN8-Ze"UY[O4V .襽5:WZ}QWQt\lbŴKSsU1ibh<SK.[zgpZ0qJ0tiR&oNݎ R}S{9Nz_aim>>f#'vXeTvUf߯L C+{KdpR~]/.8T1VQcqT+=q fQ,=Z9mZ7EJiqYqpd(EnpZ鬛"2Ljea*|_.yt&b{,_a&VErN;k1 t}h !o*GpF򱯀UE:r$|0*O~&PX새\c&3chV[Vok6Œ ޘ!qU%=2ny"!\rۓݪŒ$z B幑>gAǠBf-73߰%,aSŏhK&֭)eH~?4t+8TGk\cIN*DkU[} ߗndy/~.2Ӯ6-bғ^;TQ_U|3Tbۥ1D!T. =́ws (RICHT|4E1M*z#WIp!z?d}`{)6Z; Bx[}-헠]fcjU OĞu^Lvnsq&cl HzG7]ZMnO 2ޅD*ڨ 66{U[?uIl1U"w;}Q5W g"^SJW|n RߕBW?^Qi0u) PV`a$f!mp~İHM#6 !!Dl.{w\/T}Zi<E\}BHDIH 3x"UjW[Hi9oخT8<a*4Kf z$nF \݋e=0֞9 RؔtQTWpff64-.`|G,.(XS3 Uin[pӮتȯaJs#էŰ%QbXo' pZaBK\:*532WU_I>ee@*rDS]3MbțvU!y9"li]ʬxaf(FzjJ<0cCN' E۱ēC{Ӱ+V5eH)NҁNdž'rv/qq`ƿ:xi["zaH!$@J[Ɯ8i]Q3r$۱('i1]\p65ȣyLH:qHbB; ؤ/Xf04QXȭt.şNpF6™ v BNv>9=2d+."*NMPEV6=<("nt\C/6h]OMXS`>ѦI'^c@1Kwv5 bi^4.aw8)[{6_6æ &E#s1*bҝY= x{ #jxZ'F܏ƒ?ᤪ]UH1M5bN(G[Zj8oWUF ?@6#Oh<2}Z4\UQ@'(oaVASv·]6U\)5[?, [bT3 4Ka,J>o^J?NJһo~Ȯ6![­xe'V7[Zdg/w Kof$|m] .n hኹYUE埠b-֥߶4UǷAw$UOU['H;Ϳ㦷ktQraiFmgP ֝k`0]݈ P-7lP^e)^8-+cn#늡橧^&q&Ш_sJSͽ܅Q>,BI K/bO`nEn7_n @i'?G]n"07L6ՆW?bM!;t)`EޅHT [ee9UG;,36e'STLO|| 82`KvXJ[4KUUp'vƐcrh֐UzDӮ6Ton࿵-cƭ-5az 46-&*|b6ȥ|q!E^,;W i41?N*Zo\⫂,);Uk:LR(ZFqU ȭ3pQ `iӷ5cj&q~+HIe|>ƽA#_nT@. @mBMO|mS 2| ntǤUKuoՊT7ډ߮WU ޘ:cNy*0l|LoW4E <Y}ኴ;~'MqU?_+ UOLV?aBG2w8cSF68r:b#U8.=bROh|;T٘G'Y۩XLN*?@ƒOW?Q(cBLc5p*12|NeJ?zDu9gHzui}u'RSIlc1*OтAQ@B⿼ݿѣ'ٟhOlVyx~mmP6ep!O5xJw>8U7/Jug*?\Uz6q|Uq3mXت JUcM2޻`^M4ԫxuDžTJ< [2E}j7­tUh*7'oO-U^? U)=^NkVl1RvU?遹­\܀tZk|[-n|- @6WX}϶_7m+k /Ô_lAM~+LiQ[RC $w6$[sTLz#C_H[+CEeoF5f8RvDOՎHkKveŒaT$l,S݅T8r<ߍ*.N?U!p^א UR+fmL)E,*w9b?8k: iT$z۵1ciQp۶="Txb _Un1>-(O9Z'JJ#__dCi}cJ.4icz^PmҸ=I w]L q*/]bm')DGnOƯ)NR /!WͺA%B _x+dG~#O8F WCc0L~U a”a{k]mPsݖ4^@Y7?U1? 9Ls*{nnGEzaz1U&? ')}isϿӉ]J2oatO*WLr߫ 94] +. i9`&+`}_WoaU)n| } !D+>߰Ծ㧎+KHv1N*bOr˹*iQ;U+qA*8JK~ {fjڒ~.nHPk3E9W%)SPGy?FYCɉ'b{H`"@n/bRS꽊/c*kiJz{ U?vC)! ! 7Gq^+sR |;7݉T/h)/iJ{7-MvS{Ɩ'ݍD,wiHqOMWfUr'QҊPt鍅\'^1?/`Uj $ ?%VyOuU0gbeB!c7,eJKlY" (v+i$߉fqUz$ݿ(=? QA{ U2MKGuGsҥ> @ Nb"iP5J~%@dz4%S{M3TE ҚX@4qB_X1B y~?oedmq6'MUholeKr^(oq'qUdFc1UH(=qU):eNkռL}}'J~8-7p7p~/l)Xf o1B\'FY 1V m#ZLJg=,m@*qKbrm1n{biv!Pu't[q$GS݀oǯ>[2KOgvI'RpaH : P9oGw0I'??2/HO>Yۥo6*ث*6*ثD?՚>% z. beRn~z RWŸhO\UQW_1V ܆Z"c5p+nj>Y+kRx.,\o)~Tk114|9`[٤?pƊgک|M3QHQH*ѹ9i[_UB۝Ttp qbS[WmS+anNҵ59aI+DO_4>ϲ_8ڴc<2hGWl=6Z;ՏLk8UH@? iP[ݩo տYG,F•7_f@ շiw 'lMl tD|08cZi#O|pHR{>Ǭj>xPH۝ xTYݍ}z}4q5U} J,uf=JYcƸנj>aX~8f]P| 1c1U9D9bV1cj:=-> q_& f2~8)m[K-7on"<߫ *` ɑ/"ǹ¨]QlcN|U],m41&cE>xia33X XI Jǻ?=a(tGBwDDvCnw犭 =?d}ثEݛ9a[XgQW1T_Z,`q(qUe_Rq}A_EǮWw86UJ'AfFRR5qB{UEW쏿Uږ鐴*zjorO\4-˾*톐߽1U0FQ 1n҇څP.`&Zz$t>aˀw>U;]φbkNOZfk_s-ggo8bI^t8^cl?嚕¶H@=*^*!_RBM?^N;A6Z#_67m ƃ\!.f[xUƾ++톕|ZMIi cYJ/׎!`bmݿi}J oDžQs!EFCl%T(9mދX\9|Ɩa7SA3Ҹ;,F;Up.'^#(I|0ZW=ZZ>{ٹS!Zdӧ~,8UQ4p*Rde*؍=1UoA8lzjQ#Q|UM][8'@jmg2?Q E?V9  }*;ę^< H[<1'GҸoՕOFg /8R4Œ/lwT4-!,qh]x~ Tֵ9(ݏGŊzpA?ʟV*BcO|YF"4}3J kR1cdc^걯1ۜNR o՛aۏX7?LxOߒ?뎢/])@x?mi Qs퉙si]m۪l2#pqE;D*qʪ: TGi1۟aqs-U㶑/$G㍥pޚ12q]#eXXOrH|PV!# F[ WCQ~>ҮBeƕgFoP W v;4z퍡r.r>T[FWgBDƗL Aa(ZGM?U[S7/&˶Qzl:`償ŭ%tRWǠ"f̕qSqf;`bߙnsCZXOl2UB&5K- x˻l #k!2mӷUEPc~CT,O9NXX&9w1V&+^<*؏oa*>8w.=\xS m(>eªfjf_:z/9cmcj~/a|UP%6[bwmV_T_LnB֘.銭 ^ U li UN4+UjW~<%5?1#հw; 1\JXP=[Xd'. [Pxɶ'Fևy'kےWa6sOG;=Gm|L".D`waEiOc 5Sňo 6U60%LP-2)*_*KeޟSD]擱‹oO">lAȚoN$UR9Y݁Yd ݼ0-r,H@8i%qP`b"]m-^@Iv*i (+㵡/|5˦s^lON5`l]\DD3%Ewlirv[Xhh<",IgfKF 8v#%,V~<Ԁም= F(,i(tU$|gRG#)T鬑qҍu5Š&G55q*$Ei9(уE26ʁQ$2V ge%AM{Sty$N OqFmx1bc<,d^ Nƒ C\Xp c+Z*䄔ޜ<~L\q'R}oဥ, M &gͼjVK,k/kƵہ0#_nXU|zT%_z©N#ae8-q?6*U]_ؼs_Bmt#+ qz?bS[fa؎,FD_pѐT2Gm*++ Y=~p_aӘ_$t~0*'1JH+7>Ƒn1_q1.0.kf\ʥzmҸ_j]̷c(XN=Tى[ҸA⭚aWa7N wُ:ep*Jtf5=M1W|+W槎ثE7>1x-^]ߊX,.\+v?%]Jo^Kbu{#?&ՋsjLVDZyn2޽)&ap۪rJπ,xii.i1e „#3+U_k헅V'"W* Vؚؔ{ 1U5''t4!m`T3l78)y:ƴw*d' !z|7jjþ8)`SfA⊕PP:=j?F)fvLl Rm5scxFҁ+%{bm)=J";u^|H퍪N{cy'Ҡa#g;Zi i86 5j"x℞1zQY${W!hǨ'eǚLܷՓVe?Ħy~|O *&O=\N7ʼn%\2-: dҞ)_J[S'to,|@W`r`S\*/oվ]*4jUp@b78>?n~⫻*6%ߘ=6O7=V嘵1VU2WiY-Ɩ=+bEU>*!#_| v}l α}V=8(78UIۯ<2xaUen4XU8.Q8Pᰪ u늵Woe=[}NI0"1?r6_]W>ߧ=OaUhI&V/#<+rbYN M&%,h@2n!^)-@jqC`|ݎ*f}ii R;6sob )m8}'eU x UE }:oqUFˍ<^#;qTju࿎)/?F(C,)@5)`%4XLETdj/l▏7}ԩ"7"K7w=; PEv tm706bpfig?!oՌ/N8L Қ-NTyc^R@~;o1J{Y%P>kMqzi .LGX>h1뀡YG1Vُ~}ت^j rF[0b&Ϯ2*M\sZ3Vc  i\3=l~R >ȯPl1V"}P-ǏLQGa„4Lx1OaF2܊?N&b*|s&"-a+ot ۟iyIa2=/떪qVB>kጒWCa$}'K1ĎaQ=qDPEIġq{#Pz;Wy6?*uxiS|GTX .*m-,#%y3TODi fUNi-~9@)9r9t_,SX{yw1EϨW" v ~ݼ{eL \m dǂ~d'*vJjw8U< :ƐUR8mUB>/_TG}+;x/{߮ V?g>[*$??Q2HC OUB~E~kcw=v ڭBV91VǰlB}4[j=Ә)sEyC* \XBpa}Wⱷo,,4dƖ} q\z)1Z4A,;*XtUv["m_LiWVU}L8ڴH~늵ʻ(,SF JSSŏS-  |KffPuM:튭@OKآD},=1u{To=XJ=/xUg: '?``O1VO2q@}M+ (Ǧw^sq=M7v!kHGB>uBVi:'|* bo!=% XҪ4v=139?d;ab$GŸ b "8O,3] f[I$?4Je~xrpZҺۄ5 늮棠:[Si4]批Zs_ ~Rڈ=&lrmcPG!4 wd|Mn~A),j;4Yq'߶*;F|q6 J!,sSME!4_jqv~ R(*8DOoZ=X~XA늬@x U%ڸNOp=.brO9A+6 +ࢿQ:R,->{id-iPi~)OeUbsnG6Ɛ'^Y>„^6QL\,뼍_5=N*e[a7RvWsfi#!i*mxدaqಎ8UzhQ/o; b CSn8mEǥzZDAz$ZaA+xݪ~]>S,WeefoM:R4-Wϲ a㼇l'1J uASnbU} W]B۱O㚄ZQ ZB{۩VS_}Qp:o*&=v8ت=uUa|U(1Si ʷ?^ kJo*ҷ'7FFf?glӦ p/si>xJ~Xux]b_ҢeS .EwNcՉ4?^ý*q 8imsL1E^lU#~!?W'P7ݎ~Ȯ*~>& A+_s1tx߯LlztjEq] MlpVoƴo\LOLR śR.ƑjmxgWR.f\TckM5/;Qz \iD}==UxX/KMu̢#+YG4Oa.ҭ-Ory9d؉!pW*ҖYt *PwxwI=-U*|[2(sH\pOXӑl<*R'fV½kʀt|_ U]{/ƙ9l*V[uMڃ9?vo+P;eZN*R:|cH@VHmԜ*U:f LRѓNLP 9[qdLxJuƕM/ҽ0ie@3AWuGrD zo2GM+NdK0w`g'lIa۶HF@N-tM zD7%LDJĹ+´ um!׾bQ3Χ7i淝v2Ȉ7 FE-I˅W~V8[wnŨMߑd{$uP*)oH Cf;*B0-@"we쇑4aQ@I$1l⽝xSHSe "`76Jtk'v5m2pG]R);WTOjOђw41*Q1OA`pHl;E#x"*~q$LW[YnyFwb/$psopYdblU;Qt -aҭN; $P7M&혚}Ur!ml13ucKxb"#흱TUrr.24Sk,(b1k/݊AZ,O9t'4yzho +M sJ$g4pZ#㼟\L`>',)h1BK|o *D6\ UrOIG*Q? U O[rc}X2l ?gwm>UM__G8N_]ҫ[iBܑL;GiC 1Cn$8jկP/t IgYD^ʯݍ>}r*Goʩ%[Ź N9!GU9@j|Ȅ}'g"٥hwc]kz)̞-_O2*[id}836ZE}ئ=jv+sTUo†kՕUn3q]x횀uov7.內\i LXLUc8]@8ڭ2'**ukfv+Q#7^bT+r*%V/@Q{ U{Z)H_񶃭eoPܵ풖tHEħA)]`>S$}-3X>XVs M#7Ri6+[oa ZMMaX UjF\-"CŻa; 6 ~~n;vqQӹ8H:mP78VmZo YČX-Q n#*}(]#*8RJdS…/eQsV+.Ǯتzc}_avv˦1U)F[oZ"NptcS4oእbI[oMeńonBB^^w ?f֓iĦIw۷B&QKt OR7oO¢=6Uk uVT^\߯%;ySD{rQUprT҉pIdĀN 93 /§lptڬn1Oa~ѯYFAzlUj:SھP~5|zo (}j8juUcN]>!߰SָZ)o P/߆UUz`V—szq}" *ܳ새uSM_@<[cU`J _vxا1ɢ_i=HG9\.6|O#=[ie33g'LUY"QӮ4T{=c8ҩIs QWZ].e$zT}i1.?X"cq@ )ƙ }_An#]V*:.˷O|N"Ҽ <*KhoKq]|6[~$QOa .nAv ՛aD Tɱ@.v GDUH4[՜źO8G}VWN`sT |*"goj۠.!#7^Up6PX.~xO>,R[Q|{}+J'ZQX-'J?' !)YT]>1xIna/f7]Tq)4UQ|{4* q*Ƙ; UEWv1e U O^v܊U=z|(?;ׅTNG%]1w>Sb~Q+Űª!v?4)*濫(i ?dW}t ثN1Gb ~^TTM$UX+CF9jKNJy_e|F[a<Sm")3:~ mW,/aUffoU:Ɗ%y(>ȭ>?o/cs|Ƚ>d7nثb*6*ث3R~{fO_??~)3nHώ7N7GfK:'kui+Z6.XX#iUin 7E#1H8j$Ǖyό`s!c|NRclv2{튮~ȮQ`=*7"{S GSSOU2jz~8P^Xiv{犵}e.žfO*'bh=ED|NPqClǰ{펭1[׮E3np]<>V>y˨^C'.; j!~Gf7`l,qlޕ:\g *R>C1jb*o|=Mq&*) N MN`8#v<=69*M='jx 4^?P0*W0;`ҪٚUƗc.$+̈S<X?Z+AJ *פsjbg3@A`ds3,B{}x7l?;.4_iqR=Z5>#n⨈ jX\"M"哨?L FG'6$\S\D1 >쵌yz~X=T$)Œ;U -}Qs!.?,,4ssʝ(0+b2hiFJndZ|θ?aa_W4_naVo*}nē+ć@&8N Ua>L)]ȟ{b?r“]WrxiZ3倣Uczl*ܽjx8u'Oa-]*ڶjV+ӊWtxLk?Fkק8>pZaО! L5;6}^;]5o8U95aYp=?bUn(( 5+e2fړib]~ sAlxB(~GP-Ts>p1cvm ?.]*[yG#I)TQ%2"*[tKoOl1ڍ}U ̲Kz{l2Zl)\lmDoO, i M1nL-Q^4~Ux>1|yfzaW9jqU/8;Ug"ݫze; h<:nX>يŀ[V4648BG@(=6ƿhlr_|R(;_.ۊ ie^m> ib߁UiSA2c 49bV1G[-XWiQ3u4U]-xm!!]!t 4Njwm M}m^GǬuSJ$~T$Z),#Qō0uoN:'9W7t񕽾 U+ tScGУqRG8Sx- <4bz0'Ә~>7[5A,#aEK|pFs>2«}&=vZO׊%zTUa :?,إi!Q+jMz8>(QfgLO14ܜmW"$H7>OvT{mEGa}baL1$T,-(R{XIPpv^_`r9p̌E\4>UBORtƖQQiQ"UET'E0źtg儜a1ZU[p>W, _>8i (.+j-+E4{[M>v~ M(]j6[\8bT8/.^6"_ێoAy¶ђsPxrdXWҷQvZt%w~TfO\ u^ ٫4"w8va|UaGA_忳5{ Wq7:ՠ샑9UQsҼF.?ȪO@=Ǡq]]3p¶ѕ{.8 ¥osun-[O  UTUK{`UJ"m+N7|\#?i)nE:c-i V@HCHx.QR; (]cFb@QŏC˜!v+5ՋNLdP>C% C+q"4Jl/chY#qŮ-Ž{#ua hҧsz6p9?YaDυT(&4UE-1 ^^~T@IkǵpaŒ=* o'qF溟J0řv% < "ňv9mHmNĠ٨~Bh\Skk\qq t*j{퍅J)7fz z lqs-׉="֟klY'9rHvLLfB ȩErͼpK^ǎC\RǠ8'AUi@~+nzoݫAYuLi$.myE% d`,)$p3M=+JK2mUS"7R!G㍥~UU⠓Sa8c ͛oly/v~" dơT6;m%RC&=@0)v0HP05` w܌X8a9XJlE&&Z WunMG; K&L'LNdI=XUd}"F֑FL@81_$\#(YGC5dXԌN\ o=-籔pH{}bLmp{}1=pR"8xaTx)^J7Ϯ9b Iv(LO$6ƳVN/\ DAzTo1JJߠcJ`ue|PѸ?doU|7]OОPu^{|@i.[tVtf5>i]lէ\U雑=:`M.ݾW>=?Urϭ~Cd'-URW-֧c4>iƑk ܾ @xpV}tƙA;n{bmA_,r0)u\*V[ҶSq a/?p+M H Hw??2[v U{M6xzݏ&6dȪO&jUt;Si9t~Yo *z'銶H4㊭}V* ݿDUB5)lUNk?l`{e&3]ठo%ݐuzH?V+qf<iFL#xȍ)jmli'T Ԧw"v\Wi뚣犹T 'rxⶱ Z|M(}U̪rb}'/]Vr߭;զbJ-vb6z]6ŶT\6$bG#oxRuam\+qcQ~ ƋG=YXݾ, X Jd#H=pҩr(#f{bfU`r>9`톕72iH\*tƗ'aҲ[comX1.߆(i w?t #cySU:~dN*O1l!"HZN4^aXm@*Kz~Jua[C4ȯ.߯W,,U8:}U^<:cU?|l_1&1J*+Pk&qJ)p;{..|iԒOuiMߘ#aq(*W+ɿT[]oy(?'yOkM3k#W",^6w,fzaU]}'"UQE74P3EZ{R2jXUuTA\|pziq« {lݑ!t8ժۈb3n .O%pU*TL #v& 2V0UWk_ Q+OPl);IUxP^wFqJ/l,67nU,i5>#U[ iV¾8Q*:ω,6MGnSKnzcV"¼W{c*hQX^]o\i~_`J|4$uc\)OтoDmzn3nqUt$?hh>m7) b|N)LR¢54);~0P[8";Sa-q(_Tm¨&߭srˊ ]A~Us4PP&x~VtLlU\*'UVsnxlTF_l(+\3b|I(Z*V+]JUeW0*(i|0ݶ)4JF*FX@w9*U6v\V8$)lZ\(Brzw'ef*|Le~#*ܝe$o^*Qɍ)ԟQCHfod'Ӗ')n6톕i3WHF ?|R"?h<1mP$¸Ol4,nqh+b )cO|A҅F6jd5c Ui#mJ1@߯(QgsQL좘* dA0?@«Mʦ-?m2DP VxA]"/&Ƭ5;n+jum*~_; 7݁ |ڛNJگNM81#ǫXUlzkNyܟQVyk1[ӦciC ̶1 эWv pcI_uiVƖ1U;mI`J, HXӖPf/ðܮXwo a}2b2S0$Mw3/ E %B:r4Wս)?gTt)EY_2"ё2!?._bwbinLh'u8~qp\=q9'1&XS}Lh)UdH\PuPgy~.5#9⢧bE"<)M1O_PQC~ӒF_'db8Di hD/]SNa'jCbr<$_Jf-rdz6u;qہڧ _;K*uݼ6UIvG~ c=11@*p|~ $hY#PsKUxqUtY)sʑǨ |P[{w$*l_UkpSSbi| ݎ3=>c _>wSbeUu@ '\9{ UgosîUHOӛzmP2jH҈XAnH]\tgﵨQıܞ$&Jེ*2OmݿJb|ssb_~تh'~+~ݿ9Gw0K'a',f7vlU*6*ثҲ\P[XU6GNt wqA;ųíWcMv{'Ꭰa,sOS8х-7~(V?Oe4䶧Lhb4T(8DBƹDN9cZSk=2mRui7A-Pj 3$Bb_\];Χs&Ьcآʱrs᥵m?<䍇ܸϻ18Z Hb@F\"{FGa,G^eH_IiN48r&8ҹ#Nm^₡&?c$t[EXӊO~ ׃A'rn 7*{bU.GrXcA֕cE=㉙(iD->) >}sQcJٖl%h[ZoZezZK7'cL[ҪZ"}~B`<*jVoZ2>XxbC 6qF8}!Z >Yhb2WqOM(Xƽw84vǪ(U~G)>azaJ+1l[Xkڿ,uq[*[wg71(L),1TLd OqO sb??M[l<1v>/.KSbmbRI.Ěxt iCly*|HMMOE{}>;bz‹QQD, UY*B 珞x }T^7cYMS\v6A{~z|_>@ƕcצ:,,_Uo:,Lm+'~ a114}USV'}1,}pXӮ46 Ycv܎#ǩ.1V$@=q@6Ucbn_Xq,kݯӊ,> ڄd'?~!.M6.llOa^(>ʖ>'⪬\;{e P/q")VH$lM|0ZbiIN)B@c9x~}:o?AT帊!] -.>BīaB[dDaA#BmF?RпkE+*Fkx__s}hF?tmhiq)Hi, 5ѓwbɤKX"E{ &#\vp]qȭ+tD.j +kjǶXZ 3Lj T Bx*U?(+WhcM}ZҪAN|e`V zn ^czbW{tյ\kLRe {II>UWofgIID"cP1 =v ot8@>x %Xl*#SBOeX좃U"ROιEa[\&w69BJl\mo3ᘫ6qW chj*VH iztNTX M a𪠷5Xbu}Lm aU7b'-jNJ-8X+_bPuexF=tlL}2?a+LxB*oq(7 4K]*ٹDK7b Rf$*n>'Ke֕HYFY劯TE 튴SoqF*_P:b [Oʩ=12?FFٍv2eZ\m2ZVX= +FedT倫W ڛ37#uq( o7P)r|0;3K̒wvӣ%K/cZƛVx9gmr@ )A?ۈ6È^j|1Z۶Hy2`1u$^UqhH qo]K1һx`u+pLpB˖*Teб$vá'p1UM/# )l^uH:؁HZTH>+UꔉzȐܜ3<ۅ; CuhECljZ<~#f@ߦ6c!wAB؞l7BoL!lb|+쭲1 -3Qaqbm{c$. &Dn ZmF#Ely2劵4?dW^#=d4O8~]mд6~Uid6vWdxn}'[CkܟHT>߉- 07?\%2l2([WolkH)^3i'ۮ)Uh3QŁÄ$n~ڿaKYP+E)6Z5$ ?X5GCh"PepҴnZdsޙ (j?=K<늸OVՏn^>;eu-ӏ7pj >1~Up6^7Wx['MuS_*j{$4K+`{6jѾǪFYYc4xbXk  ] U0&cO|*Җ`bsLIQ$1Uw}7w8ޣ7ebvh=V_ޝU+튶J]ϷLpM7*ڦ~+dTsk-ZIӲV?֗0p.Fߣ/.C7_B{mM&:<kHc~[mQj>$uniX(BrǮM0G-O,lR؍ٷ+Ut\Rw?yV"'6>P=N68C&tƚaJD{tSRIWv}'_ Ǧj⭑0Ju^~}UY#=cªR=?h"Vo2Sa^ݍN&qUt~U~\*^.zt?N*51&8"RޝvjVT761U+XFm׶*HIbR?! MיbbJ҉'\XI ܯ&gS *Hq4JYSY cVqZolepvj'f?kol)k'3f' (#WǦ`<:aW15|7[ ^JqW3l6Tdy.wjۉT'"t?a۳|*O,RiMj!+Z`)))~aJx ;e,UۏO*ӅV/Md-a횀a YbU](E}uXen?_qKi_G)HE~KTΣ̘?ZC"j?@1Ji2WED$/'oeHI'&V։B(,R̫6v5T 0BE $[{l>CB0?ΘϾ* Mɦ*H[eabXYg눗'lU# q w8ҩMwN@:E7X Uc/sBp]8MN_| Z-e- cf>8^p*!~,'}@U&N0aaORCX i ] ;/3?BĴU?4]sFdqqA֝1)=6iVPU_/)=IU#9KDixH~,ʛ@)iTIzQ}\MO&5o| *dFC}1(aUHl`LP8SO\PLx^#}Tv(: PBͻa0B۞8*¿ke*"y>퉙Kt4:qU@ tW)iHb6{8㧾P`F9enWXʗ;M*Hzc*q)]qe\'1qUC%=s<0Z1~t_ VK,eNp+!-v]φ ڋɨz$MCoJ1L?a~Y#Sx`{.7OGmώH׋|(:$8Seq8?cq-arPGwlpt늩=VbJ'gf'0%5->rSl M|-o9Qc=W?K$sxN؏qb$ $^3AOr-Sbd30n?8F…)'y?of*|MbjH)N J+VhguA3}mb- p+%ǨWe3Uf5cԓ1@#pQf۩8#5O\ L|S' TnlaOI= P;|KԏpIq oD}>?a$cz䘮s4nɲ.is'e ,_^=vm 1 &w8APOĿyF]-[ߍcN«rj$Lg_*oW* >&HҬ3~_1hm@:PCEZqH1(n>"QNg&wՉ'Tu6 ߹>zhNs`Uc7~ѯ[RG9{jKxʮ7w4ف*_K?Pԟ* 9gGw0I'aGGd7nثb*6*ث_[<4}K?]}QC1"?Y:JLtͰƘٹxcjK`}KE:nq0:ⶵ=G(Pvd$?k*v cԟ}A0~sSqZ\:et­s |N6a_5@]Gnި-] W-#-Nǰup-}XAXU"q!8Y! !{8lzO]ҨүMdr?{i1B>a=(^/sz`W/'?ROc}Q*CSKz wUʰEOW:%qe=:{fV٩ZI.I-aP"Tb4J' ڤ\ƟrH0q)!kټU> 8m_Ϋ፭#"gI=?g*FE"}2qUuȩ̱Cp-U,#T%4,'LP{S~?N:iVsN?SeV'y*~yz­v*}*;(NbRykmvh֟>*t /کƴЪA~{␬Wlvq=TE`3R{*,}(\Grۨs*p>|>Uizb@4ڣ (mrX(|4lx_$)&?Ol =om|os00UL1c=qXڂM=m~HP}E<__iOM-7}x ܜBA>}|N* #A\6Xi@1U-(lU!*ȝ~UX).ۏλ(V%]L ݍ0"~o+M7Y>Ѡ~q-zҭ b|m*GΟa>—=P[p:hYoپؠZ Pi}(*ڤ|z-W z}NUX#(aU}nN)U&mbMq+?liYJ!-z 2ÿ\`0cl4_qTgT&bj /],m>,dp_~O PRV|N67cs1Jᴍ>*(LP$ \aWk@ɯ\3QvUx.oyl eAOsIؓ17~G5B1DP߮j U{ _|Vִ{q#|,x]Raϰސfa[ZB9Wʧm*܅\x|#(5IG#q4OsRy擷T`T!?.}'qmE츙<3#64GiǬ?N [Sk{b J:*#QN!w? 2̀lUw9McjJhfs@v VJzFHoXMXs}0:q*57rV1VY*:!pLjm;Ie<+M,h©ӮiE|OLY4Uv 6z~l?mEo/,"jXě+umHB,p h큞BO'bOp>5P<6p⫈_$5;K>WmV./Ϯ8{G|*&,8j:ӎ *Kop;cIUQW$ M+**kjzbLpf+qm l nƾænrJg5@\ooƴj'*WᛏHwglmV7 $▽R>`b2ǁ*LkPۏް۰ mJ"NhQsp+$"zœZy]Syر\'TvɈxMഎ0ݰj咦Te>8Yhzezml琭;hP1Pi#TEV_PێXYEui.F3Qr0CɆOIHaDc>" ѷcN & ̀tsT4em2!&*YA~ u8PRI%@ޙ- t))1lUc=^}w&XOA*|r4ω!hHZxokBF/6Rއ%,4JW\ ;IˆiɊ%<:ᆺJ>&xSGM/li'Z"lM?o@H.zN\Q "TsFX*=zM:m#!'z,N ֦㈰ KdӯLQX??CTm S e6бA.bIzwƘEƒjP:ʑ'F|P{b2mڣ\HKUE0PQZcD{$DD%vȖ[4/.IzURW(0Xú۾ FSꂛԌY۩QEO6%%|' l6 LNUJ@`bB7O$M,: gҖNJaPku6U[~x*ѷB}'6: @6ۦ&XK1Mvȍ|Y';5`z{f^+C(6!y=n +A6o`[U~2h\?kJU?ߔWCc?v«r iYT8-W|=[#v«M p۠qBc KcjjVo>l1U>t3cj0⭗5BVvc\ hmR||0Z{k1,,yߑU-WlOq[0A ,K\R:G5|UtcJٙdr…,▸*Y|q[.YULR 늷N>>vmWߧޞrھc Ӧ*xO+W֟@\I;]ꪍ?PpOM.(SoTwoa=u?)K/tۄw |J~̪?e+b7V݆tԐ&M'Q 67銴]ҽ̢@W"Rzl0*(ks ҴҒ)bOR!s#튵4$-3* }WC$njYM4ݹ?k,zn)?`UEeY??~d<%6[Zl+uX OpҿovNnߎ)X?ٔda+ݟvƳ1UDD]ĶV.|QT. I$=e' Xlæ6I|d"d4.BƖUjzcJ ԯ\iZ/N '^@6?pQG5+k#}xmմ'vq#&*KWU"H#?]ylUV8ęw”B%4PW9Su+d#sI$oJ iYhjnw&ogrI„]6#B/|ba* mW7am.Uc'Vl;b*ٷ8t z:yslDGJ[櫰Ͱ«Kq5_0ZQTI I/vER-ΕWsu'GP(pcXBw8PaP1U]?i `UXn{Wݍ*3W«}0:8Uo._kARp%EHiR#_~@j-)A|8^-O7_ƕ=x) 6frI” ^Uo[)T^̋\Z+Na-qx&0Dj}ALISG_,U(X穢[Wd]Nlm+* I&덪vg(!> ս:TՓa@?Ϯ8~X-Zߘrospn<:b`P{v]1ąTy6ĞN[ RG?\`PqUc#ɲ2N()=M1U*M=cªObTbr˄XR 2R?7.+7(:cو$!ŻDԣSZ_M]R=Z~ KMk,Q'?q69 v'%J,+ۨ?|(Dfg'@W^+2IVĵ$z!wiWG>~26T` 17UX=q<*l'mg+Q=b *. l1EBEF ! "1|@vJqۯ,I4cWp?pR1;{rU.-) iVcl?UQ"&=qJH QbOpэNDb&|P{ U ~ҡfcATVtaK.oIg싻=.XFz8kNLml8DW4JOlU[e.UcMz⭁N~Xk>rMXa2\(Z9R68/(*ܿ U|p71sp* #sPwUB~,/\g6,}@{Tt|Il!lۧߍ _*W,Xo1T*zp%e]JHeրz\_Z"J_lB+:? OF L]J3蠒`Xl@0ZՂ)*Oю? az)[1OF[[Af /d*iX-~&zSLIZƙ1C쿎n<5_Rc<ЎP +R@7Zp{ҀR %*W_ozS0׽kd늫{nXVssbJHW>?`dJDt -.f5'HiLU8RB4_s*_쿆XRF є/ݼqDBNJ *;z(:b8sV#TO{٧#3\G|4m:s%w1>8U/ߘ1C-Rzl1JPk|f- L*|fHP#XU`e:??՚N;Ƚ2?>Yۤo6*ث*6*ث51[SYY쏢_??~/n"48h{fBN.KUGJU6@F=1ȝq G䕯IۯOe'Vŵ<|giW|D>'(/+m 嘏 q; +WگOoW*`U;1VvjZYG^=p*^*lcu«9)k9F@d`Uܿ_ag=%U#/lITJ!?a8Uk(ӮP利 |P/ъ oXJU7}\@iV.~$o?dWUAr,1}SC\V{:P|HNQ`إ jGEln[ej{$uŅҸ˿㍪&v9f A_5ƻ=|?9n_I)$+Zq &ie4KN]~A|7iNVm8:Vag^}ݎ*2\]bcHPosw9av =id |WF*5Ʊ-UD?*qwUx;tP삟*@fj?_)/^Ⅷԓcc M*eN{ UO|5+aN) VǀGbl]cP:Ww2ci\7lm np*4e2[h|) dU#o OSZ~߯ݖMyٺ;cO !H}Y…|Ϯ<%74L[9~Wzz2r,|7v۩**hxŖB*~]Vp9W˱z ҷ[ Y$#% vb۶EkЂƐ{`1(' l~/>o׹liJnN4=vQ\ǰ* <\uOz * |i ܅\v1VU`햣W犬(eU`WwƗWT 뚌w;{* 7Վ*2@Ero UrZ ?\LnHsL}7bh1fA+AjNM}'"v~nF ^XaA-vLww>ت#`5oaU"w8ψcHUG#5x. =ǦJƧlޘS[k|EQAݚS>— fW*.+J&qQQZ[`RҪ =b8 UaŊ u4L~ Q7,ݯv1FH!MolZ#MS Uzo^肘en^aR\`Z Ttx;}'qoMqܷƖ==Lo,Umc\lw 6逪9Ӧr<:fH^SE n[mP~'&`F_4 ~ (c6_6qA-/&ob (TĤo +趑ʕW4ܚbq-ꛋqk ^I:C!o Oz{aV@FT>)-42;,$eu®GM'UǦ8 PWvˠڵG~VR>ѯƓ~ 8|6ȪoO\+kx{wBڑomƕc +$ RF[d7oM٨O] .䉸-1UBaU9-7ğl'Z*];LR#lҥ MJ^ XENВq'2 //$42D} ng?~YTMEl r=NM+1vR+ɦppM/pjf`~8HxĴJ""f2f8f8S焦+'5*xR\2bRMDؒ|pZF;Tʧ,O9 i -8M-OELAX@\Ilㅹ9.t_|lJ괋jD,FW$N&2V<8h~(9и#sLZU{ Z&fѽ)7i*_uOG䤸U7f4ChRwclAk1_ݯП~سn={3IzǓ{vJT=̦ƴB6VO\Dy=>:`J`nmŴ,BTv=[X] NWRĻ %mVԮ)6KaDW<) ]&G`)A"Mk8]ntބb *h|q,KBa R*8 ST9ҽrcNcL+ BNXjFl!wjoWד1&2>XfY8GUxDY7la}-$8*{I-45* I^Qku P#4ړ! tjmq''L9Ӯ( IƝWj{+`(?|i[Ү715=:wO,xmW˦j}'U6_7mAS12%QYy0L}*UQYTJq}fn4Xrw.ͷY*|?v \g&*\TC;27 T3^_]|1l~'+ -H8t_ݦfbZC1 19Z4W4rV@[-L኶w;|労X闅V\ TP̾5Z/Mى\PҫicJqJ!+q()UV5ǤMDڿF*Ui BsME6>)Z/] kMI6ƼW(~(|*iiݪ&p*UvoNՠ=;Dڲ!V 3OoyT`[eU!# (X˯*J-#yO'Y4Z; ,i_,-#{WsiAZm>"$,FSp!j|Lk3ʦtQES1'•UwcL$w]u¶$qm_sOVW_NQܜ*!~wLA_so{ ⭨=m}k+ԧLwm Bq?,/V HG}SإYEbOonaS'Rr?/n@F{תSf6MHW(1kl Jz[1߷.uOoV>X fS39c\UH EkD*s.yI\ ̕b_' fQXqU-_N[0U>|`UuOITu;x T(M+((֛ITKJnWA1 qNdmUV ' %"~&e…9$/rkSTeh68<~e1QqU(⡓neGc(!w܄_KW3 ^7c877< a-Bq/a^NP؄c9>T(h5#6۹Hp ^ɰ/گXiAyQcJBpt=156^TM&pRB-c'sJUnت'O~_IBu:dnw8¾q6ӧပLV:[3u poOnCBQ]Ǩª2j)/HMKbjI(w-k˼q)x mU@֢Wq_e \4¿g*:⊝XI=~h6,ͰԗTSv:$+HM[w=xGT]W3|#j|K<_3??ՊL I$dUU@_N`;fu(|qUŽblhS{W)50j=i{ӠY 8@8's Kz}FEBN@'6_ xaUqZ\7 '0Z;`Uay`]Sj%?]݃d)36_͹*p9WGw0I'aGG t]v*6*ثs0ۅ3I?DETP,G~Jl>gj7TRtH/}4 DĞ70OL+4\ 4RXf<}~ @ lDժ1v  \?UW銭.10+B\鍪Bo.1M+MAUXʪ l+|)wc`UIM01+ڸUEi_STƙTlr?xGQfnb(b*|sWmaZrwr­Tȯ7j[Z+QYTOq!兤?r>-1ZRi'?s[$ƕֺ|c?i{ڣ/ I ooiKbn[ U 肕VݻgQTu5-u#A=ڨHaTuV/sz((RhR7/QsLU >qUAadf b|F,k ⪑]w+w!k*q)\*-ToMN0UXi⪜kH[Xi/wVrqUf/յm ti^8\pƧ"5aL(hrs_Ս$ \N WP{<4F|x*B?h JHiDF8!=6UIeZGn iJcOLaP( [Z/B\[i#+1C.`m৻},֠=OR>5AZۛ,tP@V<,w'$+A x htN\4%olC;opҩYVĬ.QFp'r1jG%]>-V79e~PsQ\n)T. NaS{(˦Xe78?S|S9;LUA4s߅W47Т]+~X<~mWaA&Cɉ?4>'$T Flq_~Z^< i1Qk {P/a3?.޸mWGc NfÿKc>Ӯ)RvASr†oziY,,[ƐjMJx6n RIcK^iu!W|YcU1BYþ+RIb.X oG`(1O?8_e߂@_u?O?棖+ CjqUX=}1aQ~_؄ҙ)X@!gl1}m56ciWK08NHzU>_iTvqbbVoG쏿c-}1]*a퉴؟`%} z bvDM\Sӧ8P7?{/AIgF,ū|>;4̩ixy6퉽)xU:DUTX«p=EwB P'ء;LpoihP:p(EOn N4kyvQ2x܏]VcMT*p*I$811K5cNUg6I-pJzbPu9a:`-1./mڹbX'~[67qx,du_4vKo8za ZQ1vi7oB.45ai׎Z`Fj*ƜPdo\mW\.D,xA*XjTouU%jn"K7Vu`(&tId4UuilzUMڹgX\qw¡Qvyr B E ¥ۧ߅zD8#d&rX $I܎&9TE)L)='QM0,=H իT,-N2NEs@N cjM?&i=QV\jFHI~>}hH]H/RZEV' g|!pv^&HE2[--{+ZI:W%\LĖNZ!ھKd cs$np1B(=G턯# YR2^\KHT o +'ʞ+Zv+ۑv.bŁH;[ m%LZ;̲*U\5Tri1^8X9R[AOڶ0O5^CO^R(YF_$M,Q=rx!f(4}<)ҡfnM v+hiVoN!0)@7=q޲ĠH¬A逫$Kq!;8HPDm Vjt^Dq4=Fb(@8˦v*ndLil4`&gWA|pcM[ERCzฬw&V#MT}ic Ӯ ux޵,LmNhEeqPv#me 0VA;'Xog"h߶T嶹ku %M8c͎]N'?0w㒦I~b0xr+~߇\`0*cXхW$}-i@pZU->&QsQ"TPe mc!ƖL*'.cyT)UBv1dzs_*\7l t eqv tj$7B3O7jSN8iWZYCf@SԜHU\bSe3bL'l2C\~9`ى-ʡ;⫪oqV_N*CυU.X`Ue \̩F8AN) oj8ۧߎT-Kfi{ ;ooEzUp~0[nvUL{(e Ɩ4cWIOBJP|FD!4f pa5cn,HeCRO֗P &3VĪ„IQ>+w/1RrW1CͿ?`V{8nbPb`$~ȭ+Zz5\NL۷ [ gJTM Av'i 1BiNS4zžȯ+VQ߮9Cn\_<*X~Ervj+"=׹QrUM G;1>u銢jlW\iVl1pK\p^ت?}S.O(4xY)دAcKliWgGoT>u_*,M'UUٱWXY*}9h*JnqUMTu&ɥ`If+\|tM1~1.,+n ۯ;7`qA}58h#Wei({⫑Ko튕{lcKkfl1U㕁W1Jj7Mr C}\Up\c7-U/&_<&Cw …9&U_x z^*$&q_ }?&]UTB6a\JJHtcA*듥BIp7ǐo J!~̶ɰҫ"|R~+(ofQx$/ Rv%-v#ݤ=~&?szw;(ݪ\pWžN}bL79 [([h#m$NUYST!?q[\YGL 6v…2v-W+9Ƅ,qUPm*źoWGjMv G$=*\*u:t‹C?-ɧ|xQ]>ءH#G0ڨϮSHNæ U"M>=q>[XU^~g~…Y6SƊQB<1:oJ4Rk_ 9%]¿keNJu{/vfMW,U[㊫ i4UP aVewo,m-Z vOu'`2*PחEQV?ꁊ s;dЈc1%.K9$"mR@($ԦZ*G1`Ukd\ r~C˧O R?kBam7?)TS}þQŇ_,)a0Olzt *}699%X~/|1{vZU"st} 4vzB}&n#yWf]*6*ث7D6<4K?ECTSv gq'7N*2*> bٺ 0nlpaSE9lPe?flv X|0*v+2@ӈR8'jfKBKX_wcZW=bpFKSA*K |oj-2`%iU-c]$B\ Q#VU=?3Pۅ (-yI, Ԟx\WN?a Z"#yω}-U.|[awk۝u#v=̒ V1 :g=8SOPHd)e$n߁(Ym:bM364Lvƅ-I^vܞ:b^UAߏ`s\9`) 4nwNJLtRW Q`Un~#S */Z{0+e\OQaHб8TUe~C^-+v9jtU$=ɩG)O'3ZEM1i, ]| A_L ޕV@:1i8)oٹ•ff S+deQG^Ү$n|I"_c_p=0ک+f>qk *ݎv)NF0*QSSyPɨ0LW ,u_-Oኮm2QOU~lBkbaBJ;aTR+,*dHT5ڇXCYD:ot8ABX(gn#ٗ} c$K朰L2(6~v4^bjL8qai0Ku\pqUMOa4n=*O`h|ƚw튯RvKe)J_WOzfjuc\UtaH׈8LUV;۷㈴Ŏ`dKP}Q>=p1=LaL~ǥ7\*-GqtUKhI/(~*7„4+Q{@?_L>)AQ11n)Vˊ[0L?|m =䒊1GƐHnqFZSy N6ؑƴjc9XFr’vdp1s$r> lܕ8R _ s[a9aH;{bJ_cY *ƃ+-l1\n>8U_S-$ <\u}*~}cYzdmiU-MtĚ!-E,T*z`Z\xl&_R=#]vQ0OEQ# wjhItIK]T05f():Pt!ʼn;l1 JH.zj1jxbz1 -0jq6"ƢI<(=CSӮ!4:$t]so M>(#r?;m0U=k %ȐpA,E YO)D2UP S WVbGPp5-^={eC5g+w}%j`rnnɋjS[cd0,=a.)F^jSiثh֣UH'بj}Yixs0) Qj)pM tzR'Va׿>ixJM$-72 O)\ vG,+#+D<)m0?ր)m_zbUX{U7=iNԃ@56aY.ۯR.B jRpȠ\2< /P74vfaKý*ح) ܢpQi8?>B*|pFy[z# -=F#;twF~.)#Uܟ Ʒv#$,4Ǜ!+ v,NX#sz !"<Ԡ16Vhщ(`]@He^8)NB1!|*H]c/6U2 Rwr0n~xH1 Yw,ȣe5煏 t}-V&O#HQgnc3E #L 4@ [0Waď_vɸLjw8Ƣ늫I㉴J&+E_' !XNEOUqVnoR8qa!i* maey ݁PgZ6~c\XO:3nqUށJZ_J1~nRnjpңchA*M i ?Q\Ur:ʃ8Os(mWfye:ep-Lz.:t+xߎU|1V8jNًxb?aiU"#qUXQ+\LjHP{}<#:kQXwWa~O댥zU`@"ኸ|rz= ϶(Ago0;RY"TGn+X?F(unڧau-ܟܱV?ƱJpH~Rѯt)(e da?Wӈ\j*uW*;Oa*9M)Lctq,@o]qB>?jw;VՊ=\k?nQ!w>8 UTq9昫AEiߠbG'\m_Y|?l ׮9Sa(g ryUkq_@ w-VI-G8H]ªjdbn nS6i1@=6EnoRp $ bEVT#S7QSssGxF >§x;*M M5aUi\Jl^ۓŖmScT$O\KIP|1z(LxSJ] {*=**79LUzf' _ u—T^`CD9UvW- ST=UTtXi<|)Z*vUQ|m ^9E#4•;r=6d?S_l~sTeVt}!Z+`wnv4W"U~)=vJ̩اYC)+%I,^VZ$~'qbxaUQIZVeU4uR3NsJo ‚8LHoFHv8V{F(E+S0R@?E_7?~)? Ux4$&IԿg8ڣU)$ = m/Op-UqlUMۗg [x.4]JEqr v뗰ðƒNRa[*0,{Kt|r$`W ~ܰ&"ʩ?ga!~ l:7 N3W\c1M6eT]eּ_cB0?19B/TcZ4?A؈WbrqU1=߸4" 5c_̡~/#1ա ?oeqMN"r^*tiO~|k%Iiqh(>(Q9XSZ\6M4//v`]1犸' Hw51{iT.Qo "~/`"F!BNH[%?hvj }4f:VNUF.kƾv*jc\ǯlUz{u8ڒ~ϏT |{/|v%g:>\r*E>yzP~8ony716zzLG#`1C W0.kQDDžQ9ehFiF*z̤ZV[PUf%qr$mc^좧 6a(Q,jO"14%1 ޘULHt|iGLUzۻ}ƙ dIUU=Lݱ[mac >T)G5o`@[0\ѬcWݎ,,dmi uh+iߖ#7o};מmKu=N8ÊWGƕI4IW4" ʛs< kdT]|8u8* 8m8$⪆E^LjO}!T^t,Q!? Ir { d,U -_Ǖ aI'*}⫨N?7#튶Tܠ1Uޜ+c1J﫢(zP\/ENUƒr(\W/UerOUA؁q4޵,qR{sT6Ǧ4_0TK5ɕB}!P9bq bZ7envWr9W6|[~½M1Wz`TrXu厥0rSrF[!;G!̑N5ޭMsk((P'VV-? /Ղ? 0U\z o/}#5 0RZޢN3)PƚWz!W l};VAسxsLN߫ЧK!2$[i/t=XcnnSyB>MT}hea)گ>@1CצS8ڷPr6qc[XZo-E:f4↪{c>8Z?݊ @<0*k\b8 iUU1׮kQv8OV<1GӁV'>ji6NZp*֔\PtQ7.ˊӌL?#ӊ6]/eAɾ&C.iPyqmo¸澓?4$`2 <,R-4M UE^s\ PoX iU-/UEq]ZU8 \ s03oO DZouFl+h)omn%b%9.|{cn&4V؃T)<$MчcZ-==%KMZ卵rACw5}4qU@|+נ*֠F18)Zo OaQoD=Wlizl0&$DT }79aOxE>8oAsJT-էn *|+LE/5g$Ci7u+Ap3 @F͹qA9ӴU.3Lk㌼Յ$FJp] c#4d= ,nM@ƙJo 1LP8 Yk'&Cn doGLi4ř} !f'H'\~LV'DJׄ)mF'$ ׆86+g QGld"j8 {n>'>GHRv?^\s!PtRԁQS]e {pq!god+T))xi πqIUL0;O]@zb ">!p#;*yrOlѲ#=:vȦ֕w$7jWۮo/A~P~SvKsL WcW$ȩҞ h'2؆\l+1)KXA&ӝCPW$5kieguHn8pIxzPEe$(OCjw+i@iYa\A̐&ZmLr5퀞~eq-4rBASdU,X2Fܶf|$ Ӱ! rD1R$oC^+7`!Hآ1ƹLwv5"/#*("v ?a9!wNT pU5`z !v#P:ɟ 6j̊426 &]\Q$>4ڄuƘDێ*{+aQ킙6dɗkFaZk\@5A䝜bKonj78B؅Dz[*}I[F1؟|(U0H0?Gl/,/_`W ҪªÌyb3Vπ\jol11\Bzêl2 g,v1 VGV\{iz{e|U"0+oQ~101B_~ª.ëB*HϴgOlPOڬ|^78/Xư'v8|d(b51VcSsXgQSr쏤hiH }*;q8ZCUGnz*}bot[t8&+WuOjjpDzEݿGe(8`n9}cyѭ; 6;Cʦ0C;5X0"8(y\Yc ! %sNc|*e%|>эf~Ur!GzǧACI[w~ >>[ sRv\&9`^l_si@np*[nLjfUU *SUN[\xClRfԮ`ڬ w+-Zz7ƴ{`UTj0aU ]:cK9J7168UY!_ LzqUaOUz.I>| S 2*ܚ rCѿwoJ$ iГie'S1_l=4=OR~m4J4As9t/ń%!}Lk|mW,|EI1&ثJG ʛ ZWA&+s"- @7 &,Ŷ]TU }ǮXZZ2E}\ *!\Th;`Uŋ \ k+e, *ƽrxmZ1Iwn[|U"}W,%wVqƒih [S.l:,%J]rzCSll@0Rל;۾XTȚliR#O~倪MI9zVg_\ Zn8Ү]&{^iwJnjN+IpF"Qa^+i\7sOl|vŷl+j %"T %-^ UL{ v⪫h;"'w8FS}re]sqټ+OcD.7cSUިA6E] ܀xSa Bϫ.xrg;aUޜpǑ$>;UNkOa C$t8׸ _vď'1TRG&znp*O ;qJa&*|NZ/LUlb ݄ZKƐLP̳%vUbLcUYɰˎ9&19<xTu޿[V'|dEg,H :(aWU-#}ԜO(¨E򕱧'6U +ZPwW/^é0Ҭg'l}<=vorݽ w%Pb|$wg4lmUcW~Q Z<=a'v;BK>8M(C'b ?yꞃo׍WGƅ*IS]qWR_X~RbEc'?vȫKZ䟆? VT<1 cnqUI.x/òष+cHKRucBé,7rmo5Qp*iFl:(G5`z <-6`!v3pҭ{v\v݆*m*56j \(rT0phNeZqJ/kƝﳖhp+ʩn 7m+Mݺ#+~JArl )a=e[^˰ O'X~ Bp66!yz}abTZJy!@yGyODQR~PMvUiPk+1Z?~H3rrI8@B6ᵏҀ.߀®{cxt 49@W r+KxݾXU[5+Io zlUA?펭jO3EQ9\|~! Z})I\7f&Ic\ W |YaBw8.[x>To|x/'s+fj|+&Grӗŋ['\JoYbFx㥈F@X:>NĄi⇺bT/t¶"Sv'n ~.n KP4w8/R#3zt4G*K#N*$[H:(IxڦjGs69?xn ;ҧqV̔SoחQ;UNGSXB~&ޭA/,vڭ[~?e('Up>:b=ßr^8Lw{mw ݿWJMO I2eTM)/xe\U/7?rΏaf>Nö?2/G쏖A3v͊6**6*ث7Vv@K?]GO ǀg~yu)O\Ŷ1\!XH,z ^Mb[꼂"e#FO /z i6U-Tuh[6'lz{J% W#U &y$(1۞Uc7f14M|QWH4x3-[[VlRio[)WZlxEH0G*Glޢ/AⅢIM2VsEiPZC(wj 'T$e$0&pUFKɅV>&\Q)D *zjWԜ>H߮#A# ڎQRx/"v*+870qUf~#/Jo,_3FKQgLU # {Nq(& {E}U'C`îSF,U|jB}8[y>i(OLUpFa=qBJd,zx k =16k^P)ai#cl O:Z)Ol1B6~|鍥nXq!U_pJXD٪:kO0ңlp'X@̼j5?­r *9j˦Z[8u8B̠kb?cO1BWOK6o׍%zO/~آY1-Aҡ./}̇vy}ІۧM*==tHZO`RɩšLEA.NR rOVT)_LG}ҴҞqSW? ]U|k|[WA-_FJp*W}_p?̣%,mpsOJЫk:\-^7?d}mU J޽+~(Kkg^aU܍܅LO}}q\ {{| Ul6 N4N*zF>UH/|rŵqUq_dDJ|?~Xޛ}i.ܪ~ө5t­ Z/'lUފ>'^O~0F)QlNh18%TP>q@/367JkN a%⴬xcIqLQ g+T%Hѧ ! 6[h>xqcROǒWǩrʣAw y!6eYD/?[*&ӧ#ӕ_5հ<41onU0xƱq6-UcqUyT=݁WsQE}XZZ2?Lp6n}M|鿹V,lcIg* o«a\|NF%gᆒ,wiX/<ȽNR+Ib/tOA FEq[1g5JD(6bzUqǦ,B[MO* B=c(;⅍9! RG| ^}G |ApߎU AU7i>m4 s\*cR7X=ɧϮ9cc`[Xӓ~qf(Z~U1eKW5IqPv`iMr>BvFXō bGƐ;XB~vc[7gҨIvy^ͷ*1?kVF,}uJKun+XceU*f&Uܟ-]Uu߫_wƑl7$#r!,d @EՔ-:bȊ`>g%T>v_ZjV*cNVUܑ7}:u‹Z6Fr(}OE7q6blNG&,;_LՖ4s1aN#@=TrLlUھ #'c^7E/4z텒Xۦ4tS U@}OsVs_ JipA-T6uK jPw?nDAS H~td6k;)U$ᒒ>߸φccsźJn8@j=ў?g5vcAiddQt?g/,9o@zcI*_p'V*l6;fj UȥĥTFv)*X~ȯӠiZ-]h?|U%1TV ѕAsNPu8ҶZo6«ZEO p Kl xBz aU'.hت>SIMaU"'}2Uӷl>;W l1'Yb?467qR,d4~$WEFJ-Gl)^ǹXEwVR>'Dcg1ۆp?s+m$wq YnW~ ߿u,^C u[Jրzm+q Œ>pS蟳P=b%CI0cAR}sˊ-9|0*ґ9D0ڷ8Cw?ەCfUsp-Mf<bw8ڦ߮bƞث1(l[y8FN(1VJX,.XN(Riq)RiKt/▖"ۻW&MqJWLrsƱbli<ҠG2WD)oac*go\inm+3ූI8ڨ[X's"_0lzt0=[Ss U'_txvfEx/([hYss9?nJ?~:Sl k5;%PQnˍ~?fܜ ߪ‚f Hh9th;({毆*a\U]N9ZnrcKbʕUjiWSO i:u*צ_ eiTٙf8?)\ T0UVhOoغ0^rxSjTN^3҉7Uj_g!_gon~VsSNT hJerA!X()>mF{ڴ N K/ح=Ws 5QSx쏤[im2WrqBX ,SnKin~ωl F[ڬ{MfeOTQy>R~OA7?Nf|PeSocKjr]c6?>צW$Ƕ&wªz{e|+pXU^] k=zإV(N=v7dr>=ǀUc1H'sT<><:ɹ!&<j$Bݒu?5O47FJVzeMSjTE >n^[ʡ=6ƕTnw9{.*S&\i],60Z#ͿAiR? ӮJE[1!n 퉖Wl2EmZ+!7ŕ(6nG};|Ug[mU}N+{u­Ho~v˿Ei`B;x n­#7N(HQTZr> c_cSለCS `7 !/Q HOķ*En!Xm DZ''A1 VRhڪǣtMn#_.XԚR5 6SmrcVC(6R8Ms} |*V㍩o *m^nl-[:˥1UkϊW0zdmQ 4{plݗaAXiVFϾWT⫾,m +6*;tOs8p3Pw[i7%1U֛Da.OLUUbU]|3'm2'ǬXmMxP(_o(v?fLR刞ʽ7# Tj: U۵ᚵUO4zaBw?LثU+犸S7 =VlG87S~9~s7 >cڧ冐h aUGMqz jJlxbA$ۀx{,eVcCzMZ..+ pUF(SXG.yHŏS8bX׌*#_)ZUF()]WpQ!M'/ZNl W/< NU37R̞~o­~WNY(.?l+?hW](/c؁*'<5faS3Ŷ>+E'?9tU_I"fDUpw? kOSJ)A֯ĪOAU qᖱ劭iv^~+?ڑ<LO`rν"3T/A_l>i6~4zU?LN=5-U#L2⪉mlWXT{@)\Oo-*ڄߧ*`UJ-:qV; ww0AS]{Vv^ *Gw>'H^ni6џx ~H}ib}Oq'LZp_4O1TRBQ9db{4-qdt\Ͱ{AA]G&]↚bvc ]rۼbe`Uu*'Jl׹:MB mڧ8Y"'1A0Bۅ-4,xWnqE>ɰU3ճPv˛; \$r?l^-:G-+h 0}5c$8D9~"ea}O^ "gO}˖I.i v-z78UV~1(Z Ue0*Ӧ6^;pZҢOP 1eɲŹٱhyhfY\Tl <HN*l> =qVU~qݎ(RiC|1{ Ĕݛ߉M`DhGse{b]a>i\'l&|qIuo]ṋ??= nJ~v8u*lzW&a|xt'l1R>,(q[Zv&,+k9zr“&Jto`Y+hOǷӂa=Q2/%P>fYDWp;A5"+87v!2OGl|1^X|;^uH>ؠ[=Ap2>N&WKXrRZl [eUNQTް]1"=\FSܒ5,e&ߩ5R87v- {eYjPTt58qR{E)8_¿l"7v#-c*THxŞ(AT݉{bW2$7=BNg"¾kI?F=c犨Ewfev|!.9E\ҤQK0dd-97db $Fr gq,[Gl'JbRѩlpyxbr :ak'%NFĭլN8W2(ǕbX4YkAp(.[ȟl~2% [fZzwRBЄ,kO֢0%z@r%L_ ~"=1HOW d1Shn 11gJl؟$6Dt!Ÿ6s\ORF$>*&ˏ)㒦 &~_PծDbHU\UPHz(UBq;u*VPxU-,{7 u[3Zߏ\iX_Q$bvHT߫4( XZyz}cj7qU'|#S.((!o2QW%7" eW'b :.ثUfu? =/*1 hT` =pZV74 |=e}icm֟\w*薸`鎡Wr ɉfT $A\Zt>=c PP:"E*a}9KbL=1#6%D m~gV}x ݎUWA_qʥvlU Rޘ^һ2}׷4qh0 h/ =EQ}W1ƙ{(*jO#W-]UtMV \kI \UMRi+RV,vV$d7J_tOsW*1iWulH8)6TQHw8QkIƗ'Xܞ1)46]:'spjXAotƐM_4m|q^MDU8PgG}bbg%ޟi©_sv6c VY4aU]_~mmB~#X6\96aRzdIUJ/-1cۦh |jbbcrtm3W\*Cm:ZO r[zⒸaIb6W o͇&{}Np' Y(*)ֽ0%_V+f}cHP(v)]*YQ~xUEc <NW0'c3Վ(1nNSLm+㴒Mm8[l G_s .kXkoz˽|zªL67S(hQF>|UM,-V,nt*Y܊+*i3NڴcJഢ" a⫋*/ՎU#<17#劻'*T{ P28Pdox/Ķ~*%X̞h!‟af& 15ȻTIPOٮ^Q@H64d6??,Gyf- U5Nlo. X7bTf@;Ⅵ阽:t[+bSaU-ӧyl|=@]<2[H@[{be +.0BzaKM:woU#chi X' 7e\"sm$|12Y樄T<:} \d;{cCR s [ m{ȑA_!䙥}x!Y$iO'5⩬[Jz US;e8i-.e=zZ$A{P1Ż }(m­ON'5k]<4 -lRBk|al OlҮ3pwnsW逫; , ?k(+N fKu amOM<*(`M6cyb I4\z!b l4FY0Yu~ophnOӑ@ .$؎ i/L;vA B!ܲibj8A!*£-aWHBݱKd_1ݷ'80#l=Wooldwܲ;{bwdmB7\s\Wo+ݏѓVOA!7JϾXR*S(\ā)?gν1UOJk\?=*W3TsA>˘ ){ Hx%aˋӜ$c4ovCfR/m#`jG]As`1*KDB&OO$aT@Po >' z{tO*?9\ P?ٻإp4 z@ z *K+U}χaW<~9T$]{> {0ƸLҸ{ UJ|M@s* |*ҩos[n_՗@w 7q~UM>{e3ʌUQ!(/vJ) >s/Ώaf>Nö?2/AO>Yۤo6*ث*6*ث72O/lCvG;I-jqZ|28-Ws1E3Yd||C>u0m E?!.,/b_~ %Lwr$l0'UT^"'S{/qXǹ¨iwXZKN䓎(?v*LdZ6_-yH iFm=RUh>3:ckwðU\"33lڴFy9.UyA1 Ci0%|vbM'ӊRޟdS OA(wj =qKM:/# Oeߍz{ 8\;l, c#zP{~_< o|,([a[ijSdq!`5-M0\[f ᕷ Ǡ ?d`C*XqJָU(#Qw}Oa.Uh ޣm2vaWS߆bUzqC.~KjOdl%D6m{}vk~[>GiҬn T;8ӼOo4[H-Uxi$Iݲ8r}_~قӠW3W}_B ÷, Umku'\XLiVS3\mZ{f &UPa|mWzdj}X_+t w<26S*گ2ոճ ̥p p/SO RD o![Rd&XaEPCqV̫;NSyܜUM!cH?Yp9| VYeG7eikM&w•u^=6&کc,q@: lYmOlMp!Y-lLN4qLI—=~xFkNKp:X ]Caw O%1Leq8b TV{ৣK(8¡ҹt%v/di~?~, !,pg$|یi%XiVX̣S"6%NY#^HQ2E}| ğc^.Ҩ8Uvx6-iUa->krpRZF(8(Pc#4\ءj6Oޕ8ƝWa`JvlmI1;QPڢn~#Ojmm].zj/r,im -Wvy>ꎋաjfcVxbG#']4LͲ+N0khs qU@v+9Lⴽb7qqr›\]"N B\F;aU;Rql"^|P3ۦ+ !-N T=VipGԒ-s26o/ԈqAm47< _$g?<4h_N0c9ª~ǘZ;U^}286UWQ>;bGW|SK1YYZ NvnpmEZ.aBI7sXȇb3POpxNN@w8泝 Rv;w^KX(1^SKvPoqMՎ|MB-zTdV%؝MĎ; 9 v2;; 7?VQO5Cm앶Ƭml\GpE'o|U`bW8Q({jzb|21U.8  w;T=U&.osJLUOO=qR,SZX*-z&\?S«j e;&5FZk> zzUJʯp!?Bᴅ@9c'助®[c ]Lol`#r>'>Ea D O aztJ۱ۦ09J!YWev\4;h1)cJ%?c ly5#OJ ӌ4(>ˍ7A ɿUA^Wm?q^O`F-EA14Z׮)(P& H7=p_=)d4z8WaXUIPxٌz`V /x b)c㊣!QN*LTYnP7… 'SLa%G_ YۦjקLP@XsҠۯ?ClV!F۾<(]SiWi*v劶q'wdR?vH0:aB[n{bwHCI56-Tj8$ˉ#(6fU],4o1 u+@;cZJac2;Rٯ9+|d B <0ZQi[Wsޡۂ'dSj^^H5m ?dUM-.z?`yf)LmlbPxөY!(ײ 8|2SsreZ{dZ}Ns3ONUBVڬjGo0qcy"4lp*|j؉( +*?tRqH a[X坻튭VNW1qU3=\ NJ/Az䐆rg-<ǂSBMP1ߧݖ=XWޟQD`}ӿ~V"?۷lQP(߮*1?g18QNr)U2 1\Ÿg, EJl{R$' ޅO~kJ| r^?mLI"٘)?ka0m/ (? ,fCɿa$ZT?y L?<.*M%r*r?^*/bo˧h{vIZg59lQrǷ\U7Ӛ媨 n*Q\EoI0|99xB8/zoOK!QL*ieTU«?cU,~8U7oqOy)3+6Sʕ?Zdo\UEܱ$"Å[( h!yo ҠeU|OAqV_!C[ڞƱ?O㊪?`)Zͷ}π./eCA+~_o'cs|l}d^d| HlUٱWg*6*ثKX?՚>% z c>dPoEb:Kz)4źm \*d\qqVO4ʣUUm$i~Qb>B2j~XRU^Z0*7?~h#æ5U!OOio4aMĩР_s¨3s4_昿b3Tuǰ'iQhrq6 *@МiW"=aU?!WU,1Y/lvw8U$ɰ,ªkhQ.U@&N#^Ŷ)-.7{vlƬpWzJl!+;e<1VܞM(zc ':刉!Ez01UfLUzU$~|(PjXo4U?jU WrTڹj,}UW16e"5(2T*ꐓ^gs,2`ܫooty*?r'Mvo[A|y>#_nXNd~=ؓ'r7rN*Gs|1k\1U,{`*Oo\sE}m {*?i{ }ϷLUL r#րb|Uxe~XRҪ9\B<QcV@{`V+|mWe|U?a[ onb<*ԗ=)^!nM#c.K{IXB(?^&> NJtҁ\k|M'cU7WnEƕrǦ؛L{l1UhGqL^Diצ4м o^+d}r[d'R`[BID- 1GAݲ9D m=`qTu?\񱍦(lm)ɿ *w?}>Ib}Lvz\RzGK5a o"zWjlf{+mt V8Pb#q]+W 7F1z(p.\k5:bȯDUmHj<Liڪ}آDLi-{r}ʟh"Jei5d"#&,IƒUD9u\fǬ@vh&Ǧ*zcӮR['`1Uk0:ɾ)\,cIw0*0&Ͳ<߷Qæ+K:c gRvaJ8FhⅆawqUvfOA֛wosZҨF9EMqBrB|%#_!.6ޜ5_M~(V]N[H|Iy,<mVJh%*kȓ v>\]8੢v̄3ugqcnqƛwcmX(xag4Җ10yx`PJ0)^RPV}2ą8Lב+4sN, P7vDxb6cr =B v,v;b0 GGW) ?kӦyT"~jW\qX^ҨPwʂSqE9'\SKgڧ 4;qĔErSM#a_`=!$c!&\K*q,'.Jq587lInNp$bVѳIP/8 51#֒ȢDIɱ(bB@99'醙q[n t%ibC|Ke+ _ZT"CDhwDJđ7k^d)tC̺?H֐U'?x퍴nBzm#NU=ZMƚ|UV b=+:amwק|a*_?v*eu+z{c`u늨7c1LΉݱƕIMcY_ b[_sX7F8BenoY=9~,8ǯnmycl#\L02i[>0EAȝh1ƪG˧\ :%hOCЌA1aa{C 0;em%-4m*8&}Qտ҈7s0n.`B3<#kSF"(!8I艇֓6'Ċ~-Ǥ `$meZ:7 1V:E۟$ɬ ;_6ʄJh֡ӽ 偛K_9diBQRiJ_\dB>K:e?0O~T) o/ߌOƽ[_{ i{a%aO` ܧTw_@-84=RO{SadAِ>";{)R;U nMze}U6Kk] xi 5ޥj 6PfW4O/Ɗ:( (nJ?jGnMx< utƓ&UW`-W.?a*ǝ(sT~^vNpdaV}acKӦ߯HkxUBx+lnwªM9 !-]A9qyz|.SEտԸ)WǤ\]+I5Hܤ%<8o=ۦQTqXnq h{EP{`_ !/ba6SVtUcKw]c˅ Kצ!%v_ƧڳN&*R1by\ 1 QdL6ߏn$J?Lja p:/=Yumibso20*)!Xw~2Vb~l$Շ*[}AHqT湠vUTHd;,lP78צ*]o)R~Ud$:=nFഠj 6?~?\ddM<{[_~gl ?tZ« olL*V_x}8'\SvPd⛟l|;{R،Y7>,jʣ>l ݍ*l TI0? * Vo"N5^1 x]Eg6aРO8j|LP1/O\caJA]E[(/W#JU }¾'y^S<0%0;qQnO4wʃ ڧM;a)UA͏=X 5?:T S??4~: R"TX+¾|Io.WSA5U?,T$MZ1UkmI«*vp; sh)WGo;Maݺm}=8Svg;<2\mW->9|VbʗG\CM*‹R!E*a5?+k69do4/9jݱU8_ Os"i!@TP򞈢1_Gn)GLTV<"})iIbI=PGn8(ZrijIig E!/7݉c m+%P>˯eH[J|OVB s t»r?gaqJ_x J7oQ['"Ŝ)EƩLM0ǐe=QK kvgR7mV- #2 u[2?_2Ijl- Mj`V?Ch[*v[Ncy%=w?ً nGGT~WvN| ϚsL$Jq%\|Q$/IpI KIQ/aVI`UEFo'RO*Uq{*^˗û_s^>.N˰|_!~'ݲ ,_m _R?S [.eOqJ5*bnfg®ofnqW_qvUU87j͚{]Ŀnz1JD?k@: {m?5sUR?Nzpo ss\g%Vi;c"haLݺEٱWf]*6*ثҒ)1[S'd}=iQC8Hv9|&P/4H=bݡ>aҢ J_v#7JjxWIT3t10-E޿,UsvSIOl -kN_7dR}Zi`EOnԩ7Bp+Eb-0R%I?)g- J'"*6Q6=9LEfQqYm:UK*"p1Ap*\qECփv*U6g#?(1U?ImBŖ=67*KѩW< l^&-Q,\vVX qBp%Y 7>8USzfO\ :#Siٺt8퇶*AoW/ ]!5o1|`uIH9`FB9?mpҬg8!T§.z P M5|p¾cDV[r~1\m+C4jc9a9'Q;9Vc"j؂F_ƗfaU8jrөWzŶ@h1h}hռ-u E=60*LHosfGiF-Bwm%T 囘aUM&W+Gmbt덨)^Cwe'R}*F[;|I6F$൵"x6]R7 T/6y/l=#jy!CSU4e7dF2>T-#?zbl HD$!vQ* ReLVfG|ww; *vW"G8)6cjm|O9\{4@>sQ|)pS0:{`VɊ{~+m}a%Ų8Uc]bö;dݎ*E4GZWKc{`wh=&ZG@+WI:";bPkۓ݊'ҕNHPk~ ƒ\KRx7z2 Qd^*Wҳl mUR(}Ͼ3өを')ߦY }U6Ƴxa^W XFmZfDqS2f-Mث"wo0Rp*.w -I|1xMޥ 3Q~£WsP'S&_nGE- nc 1 ^Hk!,}Ҧ0v o :~Up11UT~x_TXM*^q9bg8.#npBZSq Թ F 튨D *oZm>2'ثU~ʨ78@V&h<XFm~cJ6>k1M4}ϯ݌iE*?8HOD.8ϖ*>plUiUwl1 ? -/>8֋ƚ$8G^Ɯ~?\mT. VۯOlcK^+kǠ(5zqBBl<1Ζf?϶ Hq%K;nۍx2d0.Dp5NWG.5fnmkO$19< rd1FU0 Jd5'|AƘvl[+5r8Yy6 /( r'TA&%kgppRHiᆠcbR 0*>)@LXHɛdF&m z`,up0 Z ;D}@O0eQOAtZvhQS& \LqB+p%$; -Gu>E:/~AN>ر\k6%#jqWz컑ļc_{d ||qhX8Z`Şn4yГLI#pd} .î&E\_o|{M$EM;en2;6"I۷Z6*1ިL6f߹,5|׊OVЁp1#"NWӶ' PƔG镺jGq({DvokX>ق_QFQ9l8n{TܸNPz/[rU@TYW ԡjI,nI');Svn L(`[[IZwޘHv/e`2Hͥz-޻dI q` ߵ0 }=z|% : aNHanlhwnؑTqM+LY&EpK\i Q U4놙lIOջ @!,lkc='iˮ-HQ6Fή-ehfpb:,b-8y$@5I&+Rq ۦӊ9y*{e AT:b2R4RPE17n46;t6Hw!3v]EӶa^i-ԞTW m")eqHkfS"6B>N@#?WL%mۓ*Ir*<) rQW~h顩'SI=0O߆>;blU6T]̶4*F6U9} pATw=Ljb pG@1,YcU#bN M"b/ƁDe'k햱{aSv@:B?~S?a$?;U:k1hm^_9SoPW6߸U~,X,0o![GOA>y$\N[%WN6ǒ4{[?J}YY$8@hU3vOC+|pm4+>xG? U LUwlޑ=q\`}QKR{b)d^ŖsЃIz| b9N\l1rDa[Lz|- mR4Yqva~ 20UR`+xYDsr#!6ݥ@lAj?M tRp9]"sZV]c=@w@w$.iV:0JGf>+XCvukb׃6ɸ$Oe[1{e / ..Ȉoq f6l46 *x|NپX5>*o.;byStZ$DUSa[4^}=U'qϮQ\6߮X`Vى1>A'0a._Oi 4] G&~'*PN~uWz|g B8ۯ&r?Pnp$r7)X*mkg" LUL WSw[+7Gn8[q~lzb-WM!;.cW}ϷLw8Unip!M#y:b\v؝(ðݱE@!VZ{ ኵE]e_*|qVi\;UkLhXSg܂X"y _^B>x wnr*gT{ uxu58UHz1UNedƕ.~AsvZh CHje8Wi_W7#`mS7<?F T j_Xcڴ5OX׽8[p*tRM0S?ow9 TqQ1'6WZ4e05PX+jmq_6c>U~c=:}W">9nI m -9fiqn;G};bNTQ.PRqU A,taE' (B(ɿϾb\ۮ*2*'@W–ӮùPu;! e>+m,Up(?m*K|1|#˒Ecj6Nh8[amembM؞4j{_c i }ƢBPQ!j]ZQtt-\DosQ~sq\R9_j#?0Bw=0F` {uj>U"Ek'2\Zzf>4OI9O­QGSɱ`Z^3n26ԚtZm`*蛟,/(ZۜuV_oaʭ?l/n\6 /Ӯ.Snu (_rxkÿ|kR%>#P{H"t=a, p"Rҵ Uyw;VDTiQwb(?ȯ]~Pl-UR*|M-VT*=qda$2.c۠ u߰T$ bB۟ e/ߍgLUzBlc/J(cL ()^<lh鿾)Ua|[{cLo~b|6xǢ\St=0*j $\+쿎_lU+}cǠ´/V2'8(_b( ?Qs_sG\ڤxGu@3]_u[x?O1H; (=2;a WOǩ2MO_ء^KO~ӅP*&t\iiENƣjb΢$|n,.mxN>?ofڝG|L#&O7Cbu?^˥?Y˗ZuZ1TSq_و4S(~ѯ̩]*],8$f~)O'o GGfj~BMzUSvVֿg[ï*G_|1Uu@?ՁZ' ZZbI⮒E9@Qԓ@0R[G9G~˨yXVN,(v”F$gl~ӚOϾcTs2F>s/Ώaf>Nwl}d^d| JlUٱWg*6*ثsہ_#Y쏢_??~!渐jWzu)OE}X O~*јOlUZSD J+pZW BGkHVjP68=#^mv6$W!OM5ݾl1|ZThk|_W##әz$ӳw좏zo=pXt匞b7Gzz1U'XϦ U| u?v6e {?)VHo3rf4x-2T2I51_|UT[cPx cAW}6Mp-/+QvkKǻe8UXFFlUēצjD+&FoQW) wh<3r'jī;=O݂ bg]=*zй`X/RϮ8DO UGJUv>kIH++0W[q+lv#' +Or#DMjx **}E\Uk$o崌z|8Kkq<4#1Xay?\y*gu_Gs\[eB 'rmױ)P1I\\LYjJl,8 K+kAQ_~8,ۍ,OAW#')4(Ǭ} 95ۯIbEcOî6mj"!3F97\p vOm^ h!8rƕmZڞay?|Fzd\~[eGa_|*-۹ p*B-x-U*KW iPF`ȦR؞%<7`5쒟o׏AAYaUOjz{bU>'#Zfew櫿SAڼGSbO9nZD* zu'4#'XXqBKW I=x!=6e'E2v2>gh>PHl JE4_ǾQp:$U:͸9(96ː'!V/XTx mYwB Gj)"sDaEH϶X o &iGFh &JZR8kTvr쵦qᑾ YԞFx` / kㅐ [rU@~xI!I4l&P#} +|.]DU)ALEN`,P'^IfOFD%4>%ɸl4f7W`2wŅ6 EqѫEZ,aEtJS;lBs r^r<<2vJ%zí:Ct 폹@01G&@5QJ=Hc?zrAh;%Bܰ>Y+O6^1*|* "wXdTEOs9mfp''V|(<;D.C94Q1n]8D8zW5ZS]Z-bTt= Tv4ApAF).w-ޝK\QYPX,PX7ȁ#zT W\W]an ^ )v']rHN]z =: v$I!ج+zp[jE798au9oz XNǿ;?2@S[7kjJK I: Bgmj\7^xJB Upp\M7bJ^SV'E+g G!< H3=%+SA)ZS+Uˊo);x^MLORI%Nҿ,B9pZ<+! , Tq ,%_))~#߮HrSe>h $[V l*װœeX˖/G㓾hp"B9f% aZJz7Hk#uxОmiyao!B#zúP¼ Bܾ_8ޝ0Z(=[|2qVT@dm %=6{.(SRlbP96bw; Ux"FaU_; -֣9OHrc~,}a-GzhElґQ1bRM,AaFZo]L~n~,K](D)3}*4E5&8ОT2:f፫Rzt;uҽRsEȔҩ);]zW*99Gk*GSO6J_vV50l{iWO?Ѿ?QCJKN݂-m}*MJz_%9]{os[ @y-ln&:Or$i iӮ[ 1K{{oL `I?똡TY;n09#l!EXv0 T)FvΓ} q[T cɺ8U3B(j?3WaR/ を_p‹R3W,4kUV—tqIiUUDΘ􆛶[-[JeUM-C$Ni(@   5#9b\V'{ (C}}U*En4iVώchUb ~r}8UG Zl?%S=U0.N'%maUDinXձUy/V!E0JB놑h RxV p1-R}ohKuqp^'p*Y~Nݕ~K˦)Mpߠe Kxn|s*取eVo4i(J,!a3u߮*m\siz@lhflWFo|u⅁M5*#MaWfQo m ._T[)Wses ^J+rѠ=-ӈ),t{A(poRٵS=bӇ6d;(TeOxXpA?-(#zZn:— ̉ڧ,U` tH$_+ӗMSR#[;emmYſvi>?w|Uz.vqm߰* ? _ΡNz[uT\Idk?`y"1a `KCz޸Sz}P;n|p%BBʖWƖ *G~bO]VVD vy@x CO|xBj(?]ka/ݲ늯X|M'*v®;+^-i)Z|V:/"+FaC)v^?o7{m܆z/ec,Xy|Ot} 4vz"}&n#yWf]*6*ثsSѶ=vG/lCvT?Kw/t7%3xd,h%PXTdX'e}]l$;B~v J dZwPH8ә`ZY6V~o\)>vU[m y8.V8U3պbm9=1V[`>c7=qTڟ<«Zp;R{J(8݅1T3%~&,qw&ڬ2K&ʡGrW b}0_HXH1D ronUzwKUPE˻|Ek*)ckKsS-ꮱl69@aKen9t8ڭaIqiK샑/ӊi ;~e *#>(Si=ʕ«ztDž4qBKAП: Y2Un5lPPUn(>[N{ pb&@:n}Jߍfڴ-lƧ-bƕcxbBTF~|*1w5De@9_"/VrpR}`mL*$oh<1N$p}ڱdR/ʠ⭆'`Wij[=r?(1WQf zHiS8/s*!Am}۹Rzt]@zr;aV~ʛ([٫J8x 2X-[91RbN^*Sڰz= 퀅K$j`K)->#JeЭ$S?{KV%/5nZ?F M" >IcaUP}ͽXUB~8Hi.tUbe~|'eU?kƓTUN^ac :nr)u_sqM U6&Ǥ*>%Kj2;}x6{b9X>Ɛ/J۳uLEmyEf{#b-+6)Be,[%'LY-Ef) ZVwƄTokYx&k]ǚa'_xE>'"Yx"mq 朔H$4EM0$e$?= -`d֟G[BZ֫(n6էb:u@Y`ZR 6sOl-7)=/qVd$kG!<֡!8Q |FRE b8cy (}R\ZSBppY$^Qp|WkW^S}pFGC%>*h+(B]]2$"!FM?h>aa#"}N[ 6uqr#DjKGmϓ9k3 wk`7miT'M,W-8)z.ˉGЏd)&MMl96xƝ1R*tNGS=Ցh0~n zQ+98-CBmNkwZT tP9! A'6TDYzl`g*Q7!=޸1gmo@,nC'Z:soAkG#26vaz]K#ZNr5PE@?$6;HcyZΓm$ʝw9&@'xo \JZvs2|N9nzdr#׉\P<ΪJFX+dZ  tPjr:a20n@b6c"~< 75>'HlN$9E<3 mb *b @֜yV9 4v?WJ'$ #p;֤{c~Q-]F. ^\JZ2jdk¬c\rJ. ^$@nNI$g"+2ƲԩZ)ʌV6z@1;k7W?Fdğs\ń`nG1T!;ЍPJ>;; e{ʼnӅo2;0v'*=OÚG|UjӦ*>,(M!n3W o˯*+-D6WxeuW]ݲuUp˷T ҙwLoz Y-݇/l9aGg&jMP0/7b?P8zi7w?(w?8O8YV+86?NB'c' AV%Wsn[zWC\_$[Vns_=l ۮ -O1UN$)^•PBA}+^&rbڅNت Sv*0w5]}8Pbw5q_GZs1U\SŖ={b,-,Ȫ(YwSOng'TmOiGjnDg_p,OMUE_sfU'(jI_lU!QJ$)mL og)>;vli9 `T$ڒ e#5D8ۏj)]5#= I>_V眆ĝLѣ}(*AA%HZU=0zp*GN~5J5M;a,{b ol@­-e$tN*HSxe s㊭|16b۱*Ʃ g^R@kw8% ⊾ 5:ݍ0*l%4 ~9~"? ["#^dm %?1c 7H[ ݿ~&-*Q=ωq>#AVԌr?& aUhyM jD_s!t 60{î ӛjK~ zq+*Yg1ToǮ*$޵WK3]L EB .(Q$ķVȝN8Osg~Զ1U*l7>9E®U-q* ^0Ri}rˀ(a%T/PM]1r6W-N1W AUQF7ٺu8]zuvi6sW*eOMS⅄<Ӧ(pP \4+/Y`xcJ?а -P3jadEޟ6(Q¼aw8`foRt~XgƑI[$ SPcT/፤Xlh$SJP?Bk;X^ fmOT3>ąeƗ-Dh ySߊ[}ؙ et\OV8qqEQJVl~+B̠|M؟^1m!ʡ;*s X۠•&%?㗹UVn@`VcyG7!#; mP0?3O1csǮzm,&~w OI2rJHA)C !B۾?(}C)v_+0%A8P7sS >!B B3o~@kn첾C\M~&?FRZ_ߏS~V'bEtͽ>w_#Po$3?n>װp4:F0~n"3QETdXo׊b6헰nqV_}6vޭUO㎊).i-VA` I> :WѴRI{6E&q__ﱈK9v/!,Ond:"A|HVB9HKOoA=!9_&\dJQq0z^ſa;cYϓ̋ѓ쏖A3v͊6**6*ثjn {>>g¡XO(o/)WfH-5v3uu6潾'09| ݎ*љW #h4\f Q疱튭iwttZLaww\M?_­|Nr)==*z q_ V?}'_ 6 \)UDprU@*ղ~X\*/ajny/ 6͹H+\4XT־W2jw.oп5/ƕR-&ߗ's'@cp38b1@A-4&$f+U1(ƞ,?@ƕh'QL4epS:b7s\ivfae 4liU%Oon1k0%U"g+gN)~)bƮiV=, ?!"qE){Ms$wp1ZFg }qf\ U%PTlN톖_L]!AB kscO݁ 6 )rӦت@ڧf [~ \" V,_jqBIe5|qrv]ҲتRG¹Tm_8T`C@8熖caXi+as'sn,pASe mZߧϮW&=0Z kV}H*-ǑoVEc(Kdנ,RSIӌbc/oяQvP꺅٬ g#?!5ܒͷ*2IG>}V6Uƽw=2Ӧ)T[bo0zPi UP&W/WLij OcImT"О 5$O>%-zqbY~ˎ4iT@g8Ɨl~Ӟ#ŘÿLjȵf?O,\mVLM(l|q4KtUdCMr}(jK7z4ZBw+bI8UwU w:n|N)cA15:qM+AkS߮$]#kH#+EZ6ɴ`HbZ/1M|њo<<u]r N0&1.;!HM}2`VA#ǶNaMt(w#\(Z^2I"˭MOZYԤDMT"Er} 6]xmsr[}˳=p[r@^e.> 'R% {4 Mg(8m$U`{>5ޝ(*#ܝ\"@=p]Ks,k"^'~ *yPxLJJľ4tf8G&߮A@Y$yt_|%"Lu*7 1m3C)(R l\-5i]$h#q^DSYBXIi I?vOlPJ ds 6Fҟ>9!cS`sHDo8U4):]Ւ܃߮Xw۫׀"n5rCBO{[$*߽yN»j~-fNX1=IڣKQZ)V@?_!r岜\r$B8Z[ZXF>.PIxM-7S=4%iUbwD(sHs) 1ۥkSQȄSEb\Xz)r2"Z M;iqs b7.bȸe"6 jJbƚ#|d o@lٮb;LXzA-Dz {L F >g md%$,Bl bQA5+Z`bI,pQ"(袤׉dҹa?Jܲwum=Q}\m.[ʵk26u֣o b~1Ĵ'm]&a OKP-Kr+ťH*J0+2.P*}^g_M<E2+7ԌD׶,h.U*X(Ǜ7D>`3TcL_zg4@ȅ3q,=6j)`ش٘,q-؟lbFLG K0ʬ4wޙPd(icFƂ˾CUjr5L[STms]j0?1ƴntRT)bEE7gQrCY&+$r$WՆ6$TFZutt!ȴ0h6SQB{!,=Y öh Ӱ|ge;mLఄ "z(8%Hȉ3TDUGLUKHkZor$mbX +vp5;J1̍e΋ }W5j'~DS&WYMAF^J&6?aJܓVsG|+MA@c`4Tw(B g Zi;,t=ϒ/D~Cr:`JXJz f"qQC]iJA#Ҕ>ʚQsrcACP#[؇ʄNVdM+PG@|qVnWѪ$ZVӶ2L^e;cfc Wķgf5iTvVW|%5esAJmrɕ&1%x,*4QN+^O\&*Pԏl@ʳ51@u8)^gڬar'r6Q$ZqREp~*2\" h9a_G0BFVv4g L)<8Dp$rV O'#0FuEaKܗG7>Ă:ͧKA1NƙM5I]ZTZIErpߗDu%ɣ"V9Élى-BK4Ɛ', l4[v=y{ߢwE],Hؓ_GִXH($;ԜeėHAwu"U{tp)"С] U TO"ZKf Z#b•?x硧oy]]6+y~'Q,%wa˄̓>s >zb *E7XtZiZ=yVܟ*gs_ U>9D⭮(xUih:ul|R~) ;}*W'1~8hxƖ*?5Ci u}~#հ<ƲsJmkgv#_nN6UIQ+mq-G_@) ']4[f 8# |io (^#?U?i\6fGolI1Ut[T}ʝLUJIi|M2](S[v]6^zl1=qU:DzuP.*]̞ WniUfvt #㘰^Xt-U|[{ xnqVmS)@T$ȣb!/L -CVxc NUOEO) 86"qM隼֛T?{p%7ukagsCF'T(Ӂ9]:dWn6.q%UR.W^7x坽φh |O\i }*U߮jհ\|:`Vw8wxMcZB1UD&}2Rkaᖱ$TW AmDžv %>^P ZҬ6&ľ';J(zps\GEg38d#2nz#þTW>GQ&ݿ m1BƳsaUH?k8u?Ҹ}q<q*o%>1q&foe}>Co>v^g9T-0-%o@:} *bkܯkZIWU+,)'GRpGmԒ_AĪE*m9YcW%0 HmS~'cԜs2I|O\X(ka ž\7ommbO |PO'{e;U?ev_Y[~\c=2nAO uI M#xr{qKi_vĚ^ZEEiO[Ϸ A'*}{: +[oJá.TUa>>:t¨~)~?*攷9L|w?մ'IR:e(q5woe־[Pu B== b #_@}eafx L w7kazL'佐|=k NIiƟޟfq/^8O:8VFo_e$L歍-5D8,h=(̟{{vWQg1Vi{E)G t]v*6*ثspO?՚N% z. bjin1_1wmcj햱W*NVmynKrq$'zjk%i~O~6A莲}f)[YchWfMV3/a+u?y(^DI梏\QM+k~-3$!z g:{b.[_zcȉާ,'!B|;sPIe'6פj{f ^UdS8ƕIqkڸUiz}L}UvE'`}$zvj\_z U5s*' =aLU9$_+?gᖱWo]| j~GSA#ڞ.\~UVo,'ai ~#vo+zb).-bX#?'SOk]17l19 v;9~^?Չc *ci @v )vUWeNگXAǩ*ʉMp7 ztmuxֹQy7T', Kk78(]U^`x᤭2߾jewof=rE_0v8ǭr=ȕTT8ڎإgl]+vu9{ p+ [}d$Mp@:yer[_|U#}m ^ݛ*F;㚧*+շ#=+n}_|*ZYR=e<1Ck :*16&=rOL*JkL6uAO?wL|PI1~X ^/)]ܞ.!lR-TT]nkYːq_YT0?mU38N_+O~Bŏ **pF bm-6ALmQ)gV2HIl6袴] U4q#v}TI-*jͼmCS JQߖdD# r;o*}4vPxBKvM*25y7?v$C9%8U=qTB׊n < /٩҅qm-]}ʳU#WlpJ}B@62*Sko#+p_qn wJ^*|zpU*;wXoׁ׮ƗqU:cwn~4O¶7-ZXm4A19:,)'a* &)%A>(Kﵸ-vAO x`fKd// ,.JƵ]1 !rhBw&? I);S3x£/E,@}i !W5_0jpZ_F7>ҮQ u8pRzmsl)nw8􀷹)}O֛آ3ju1SUU# rK#_e9$dq))Wuc\hR8!ڼ}XU]tƓNW=,}P$_+Kxxh<8FO80ܯq`)$]}~*<2.rےjLRُN0c %1%O3RkxՈ*a%`@a /帐X 1uoq(EPۦ$diQR#, ? b/8 iA#"M$!{蔕@=mEzߴkDEĝRzagjō;WC֗0G y=g3VpqcjaN|m&FJ+6ĚWb:+ шTK-y8}1CT^2RB\4U"kud1 }I/sj^6)VvE,I>Vp$L;n#Zq} bsI)ś:!e޵+F!R cWE$ޣLAeǬ~$I&AB(p]&PUB¿j 5wMjo0~،zt0UMF }+3s*F4F'$1FU-\ =1Vj֜MH¡x=᪃pkܥ鏈ݰ> ʟ\p i>F*2s@zu (E  zHuER"{퍥jW+W! z{_ 0_R ^8̶Ae V h9X jSck%ۦ#` zwf,kYEm9iNG v6+Ϳ*f_HkqoA{F}>uWT_ՇQ pʷƽFj֭cq#7vR)[]ZHp {c‡$5|K{S%i(LJ *Eڸ9 ĞƠbϫJS߉O Kxʕ4*$k*o (AV*0$rǢ(Q(LZ' ]F(Z-hp"5#H؎bTd˧ja"@ H0A^0YE6Ov@ڴw )sab"/^=&8P%څJ- ekVikA@bCt bB̒ w炜`(IiuBCO+BҘlaQ ۹ c.W {a>[`]WE |szZҟ9Pm[H+Rz`nC#Em! l$yHN ].)(:қζMLZPG22"4#E*m4DExb1j-(J6{0PFHMiB`*Mg)55%O4R_7ZӁdD^Vd&[A P BVy.[ZT*g(~&*;*2*,$%6Z~XF`^d"5R6dPʞ|z:ВdW OHKuoJrMLF›\֐vPCzR:XC5A_5;w*OaaHSS'҂c&b>%950MGz{q}c,gwjkUj%>oAZvir$saJڃNHҧ 7ۭkLTl-ԕڢOeC›{dx Ex+S0ٴӥ*񕐀|qfNδinj 18$U]- MM6HhG}/CLuT[KU5g5 Īh>I( *Mm-c+jt)𜹭D.-ρŹg 0FV$Xn{kC_[9as*='p6PT6"-S3n}I8F~0n-+V=Ͼ8nWP9IjF;>;"W16h<1Ќj~/B+P'FF%y!nH.k۵"0"M( &Ԧdj# dGuFaCR4?7M©A|En>?bBb꣧9EqVdNs|N4=1Cb5]s5#zt®,}"sot!vbPz&~إrD_OZVϰƒN@8Q2TWp*ݳq>RHi+z 7]- 5E|O\\F7%'IlSJi)vufݎadlZvqTz`B!!gj}v?W,'쏗 yv+r~oT3~$)1aTuYV&ªY Li^;bws4ȥW_*|qʿ1Bp>'^*UMc㊷w=:dUV},1q5AV']X֓.XIʕBe84qqPrTC<&WS.lJgZI&#q7b"HM(2nmdw>=~$%5M U^+7($| D7⓯L(^xAqH„5٭* (;.XMenUݾ*LPŏ 1T([}x\p#5=QtQ`@8Y6U8<qb쫎qU*ƳpU |_ҽ~UPh?,/aWPusS 6,V1 {UKWMz…;{aVj׮mUO'#j^Wer\Y.#\pOQjm(g1xUqM*K,GM0?g.)Ǯ9V dqsDk^s5|\GoxJ ]^#=؏b3\e>Pjzn!VF"{1UgާY*7>'IzL-Qˆ7ù\yDGϾX#A'U拎M|>S2W>m_/e'??ٍw?~* >BH&In%\(Ox{-k Oo3n}% H tN1۽mr]LW2v )Xm(〡QPJ  'N6`nI4Gi?PR9 8|5V pZ* K=*8z)jb! p҅*vl(C->&?vIkes^aZ>:qUaOæ1o Rw9k^(QDž?!-(_v5\Kv1B A>qƊ7S٨_IlUQTE7,A[p[OvnU'5Č)mSԹߦF3~t} 4sc"d7nثb*6*ثїZ;of>g / ~9u),tGKzHA˨8Ԍ*7˲epZ)l♸UJR>9N.R;NL U"ˢ EbSX/U*v).p*w59[*$Aڛ"GA难8j*{cI0ZQMs~XqqޭSy@cvXIcӮ߯U>uULհhrU PcO\*/Olā#? gNˊ7,!=OъӪ_sTӮ_/ihl$Ҫ/">EaU~m2IM#R~ˉWԊ>ŅOeT#jЖ࿍1#KtW&sr+}3+55؜Qt6(?8G6 '_8I.j}c zt8qNEp퐣cg݁+uݮ'/LUo$~d\o}p ^]@Vqf_(\v1Uր ic-Uv_-!qj}flRȻ`b2lS`1;'v9ƕ*.9p :oV1vxqUe'4)ePo8rwZbqEݷo(s%e/\Uggsت ?k1UV;z9צsP;`W^+@p!Tel.[,Ur{b1BGR M9FRɯXğX?khG-HC[[x3W#/\l3H(NJ UX4[vSo7bznqG+1)=M UX~}>U;)D=` iZ38OªO5wv;k !Mu\/VN?,ib⪋Mî4銪,N~ gŴBъOoCe&eoM>Q5{c.V}Pw4銫%0(U ^7*F\8¿2 TcLpFn4dTGjOjbI%^u "R^/. F79>U%f߮4^Q-@=*} צ6q _i*ǩ(Cj8GZW4 _:,V#|_ȌOt&+z 'KBym&f? ^=FJ.'>Ʌ4L]-בEiP0Z@X\VӼ~;-**UbTqd(7GLF;$b;Iukla3 BGqb_w̐p}.,>t8[wm!aLfaӣAKNK1YZLi}F\EQtV3us %*SjT1ckynK8瓎< Ȣ8ۈ 7dK(h7>8Q~SfWS!GLQM사*XvƙWq󫫐Llȅ!)'fo*f1M}Q]fuڛawTcIɫ q%me傇QlBze,kr`&4m8-4OGÍXߊ/ }|! [EhGaJB㾥yih9jq VF FDٺu%J˽qҠq TdV;ui 1muGӘ@;TB+]ـj`z Xrڹi[jw CG w5BsUw"vpTq-;?<VI끣ۊ9OFиCnWwr_( 䢄&Z!-ڴ3R6 ȶB<_#ld놘a&L 4Kw#Dj~.B@v5%Zz-{o!a%ct"NDRT$E64 `%< 8tAPSaj;v bӈN( }.KS@ F$ )j| R[ GS\8TmKY"^cfvz< ߼ JN1Po.vlj%޼\D܏`M_eG1%L:ˊ 2iWSG/%֡q) cI>mJfe0=6N) +9AE4.)pXH Nj=ka02ఎb"dh{D4]+(v4?j{Wj(;軚{2$qAiuŤHmIgKIJVO#ZQ 92!!XoQD(VN!X@l+*; ž==2Bd[sc_6*:7JT(Grlmw8U?, nڔc 㬴շDvXkA-\^H* %q/٦XM\#sqR8P WeMHkmļ]7J`"f3mv+&si}ڴQ6cZuaF9q$~?<N+Vא,¢.ꂾdu4K+7cM l }Q!itg_}DQbQȍ%"6*-:II 1`Sc|O%Cg<,S;b/z QʽF⟳ZGǧ!ecEcZ޴bHU?%$7qd$toĒ`kͦ4"4J)z?͓BH1DjN┧%S{(ΠCZKEq$ )8bdSƽ7_(D 9021lļ m 29P CӀ!DnPp-? JL7 FX ifnEw+Bw6H u,,S ji_z K.&IJo\E:"IO -&zVs5 @ d'{$ѧ){rW$ ;VG#qS#_;3!R"QsU<ά%`ܽ8-m$2 J4hh+[zk\2jc,w-)SȎ[[^D#-fm1M&C Z*ńsALh~ek*;HPE*+@,b+9F\geMi"ݷ8@:np_' UHcs/k9\0a X^z2^⪜tVn{bZ3gA՘ctV4oI*򞈢v7c9PiWwz0M;yJŎ4En1܎ƅ-SZ QPxEN(AI3ӫb)Ŏ7sҀaCeK7˧L)h) Kݜi tQq}{2zJԓE@? 9os«>>n:`l9_Tz{y%dnʽ> _+qZOW28[|⭙@c}Z;Q«>eV~; 4;~&8?UE~9; m\(5O5U?CjS)_Ah??eF~J7'рU'(?kT-QJ [Q0bkNݩQyzہ@-:@>eȾJ:)[PnrtǿYN-$&I ݿqWVgvq0:¤<ߧїZu0LzoqlޕBGN7(Zmb?c q\Fo$]1U@$'N=ADM3 s\$kd UT<%7nLxǹ1\ ,k/G쎘N*Bx pmpOž'Unp%R )m߯шU늢cz[V+hkmţ߀a9G#c(>x3\6bmr_'av*J|bW}8ڽqB:8im-*'þXRk VU7HC)wƴal>GwnGs5) k]__eҽqVq5=8 u 9Rګ.8l U=1UTu= Wn}xrqeJ*}.*:t;HZ,uƗ7D}cBo6 mӦby?\צEinc} ]un "x(ܜm)i^Gx_rݒ8<S8ҕX;,۠kp1rv](LJGskOc€*UB#o-v-!cB׮* uZX&s|GUc_XJ!M~Sª[|GSw:+Uڋ\*o_WHOqRke+_ We H'0bz`V*xSy]SWsz U|M8~^l@E-XiU輏VEyHNT5֮?z Q Rq rUިx.OQP钥(p:`=i?|yw8@z}̱ߧ J|?kǾ8oJ_Q!HSS劏eR: 1ozv *[_tƴ6+5b\.ùZOCo|Uw/v |Uir_n(-(ke̪XRp \\(M_ (B;_1??̋쏖A3v͊6**6*ثΫ۱|GIDz=)$HOL~Čʻ wn#[)+a?Vn ߮JjOy+B(c2Ig#뉳J%!7p*g; ā 5]8rE~nn*^y,dWw8S3rbJ!ƾ#+ }8FCO {cJrk\Uh(PtӍ,z2pZ#n ] ~#S?:Ux>AIJJ/^PӦW`J=\|G*dTJyD(~8X+˨]vc UTf=> !W9v Ozbņ {pZN#l#i[ (fm5?/6n8T~udג(Zl02F<>Ow?MTzS+s*ù\{0L?d>`}ivm]kZWr@_~auZ<]ToX^W؞#[bQŔEz@[?T4Fe3W"QqUQ5z*:xZH?|e U:e4ac(n1ZmqScHSkلWe 4u,|Ws۽Sa횇 wzj;UNj(*Ư/zPר=\i` o+Mߦ7vܪ? *.Z}xb㊯\ U@Kl^+9eVvwZZ2N>".m߁Ps^ZF-?7_(o$!%mt{by]7P|x"H&I>Tj+0Ge a mUwm(Rcja)}wǬc9. ;/((ˠB$~XƔv•ڱ= }WXQ{r῾*1qU2DzcU lIaOM$Ktm"Ȫ!!f鉴!UGݺ)aXK{ UNKNغBA_|!},hҩG bKkI፡tv81>'D$a|ϮPR}X\LjƑjMrNe| QeTlm4D|P Iۦ8#7xPҪ}I7_}[|.7c \Emͼ(@֥|kkد>Uzs'f(?+1mT#XTo:{ Eqª/A\a`=VO]Q$ 9إpj\J.)n> fء6[_|UP/p $1diV'ibza/cz?v(T5>RWM ⫣o׉ Ur'l | =vUIzn"{#$ Ca-}06uOaZyO"JsXC\rW> Mwt42@Z,ZCgo\ǶVe DZ1M]rP}8lmb-yƀ>|hmo~ZA/S.Pq+.F8p#ki>0(Hr*--"뛤h ۲ v.r`|"H6zkU@YH$_441R9K 13#~KfclmvY}Kts1zm-DEr\U:c_j[ħu0ԌfIJC у7W82b)|Ad'wY* @#o+q´N}jp XR-BEP;ܪI':(F[sI;a]h3qΩ'zm+^ @bi'LmnԖwq&۾%y*S@;d 0oG5>88jEȥY-A$\PC`+a\V;a7$ma]_8Sa1BjeA:oqFqRZr؞!QW'|V4@9 .-jeO u>XJBLYm+g /L@^GUހwƒƽN/%aVe cK;Fp8 +;W}9 ۾ 05X.JJWaڞ%tN)Sy"Ӝc BR<1VP;*v_jOȔ$/88hi־i6ѺLN)cq4zqL;"g89gS ˓߂&ǘCC9'5x%g!"R{SCO|ꢚ%EO@,iɲiAgV 5+<|r5K٤q0WبT}S;('ݼs3TӶH$5j7났!S^þS)wMRۈ&ڧ|"\q;;k-1H,GF nwn΋#؊Ad܉VrR]丯v&6w ==-˚5jv;m#/# Cݕّ[zֽHTqU%~=R/@{UO!Ni ++nv4:|/'KadC9 lF(})ZP`RoZ@MwS Y_rB{oL)6lz`QO2ZGߕhI7BH"hE:WY,‎qNEngJI_%nQT@&"z#\6У7:~9_2gYg,,i'A`v1;2| rQbbZFRAkmtqJq's^[$ΡA߉=evC/a3I+ XrßmfARGi/P8k>+W;܂֪G_ ;WP3qy3ˉ9ӶT*%@1Ɔg^j8A>/^[ avlcU*65f8wP5zҽw]%y2Gw=ئg8vMv?vYvE% vR9S/m R!8 ƖȒQU= ^TD<+Yvj;x̌'m:W%p'bFaSJ,ܫVjqY}226V9D܃ebWcZ2Mi:xϝKToۭEJ#)CRߧa]۞׏2YAySG0nKQtr)Sˑăn׊8&WdlSAn?mzzer+pȐ"cU6_׋*lKf#cȟ雕Յ*Չ_yE-&<"u#6gpց|WI>&`HVԎq%a<R2*oFQvv) s@׿HmwW&Y@҄ĵ @&[DiR9[R |$ M̓_UGozWYCĤ)@R@W'l%\ԟ|FE⎪Ŗ"wR65*Hݍn6A2=+C&Ƚ?cy$gPCi%M$ %\n`JAg' Hܐ2BkɹA+ H͈F2E[ (\2GO$;UܡV*)PS,[ǒ0MIJZJ-b( N A) \/8S`)NH"ڌyWsz`Ȅp65X/5 QYV쎘mY yoJLHR뗎JH8+vR+ qtai[@44öK_VҟCp DSTE=Q]rg9jjFn ]aP2v,UhVsum*o~㚸\<(`o5a">E=>&?gw#o#%qT'),VQғNo~r z7e9+TYGnOmqTߵ1u . NIJx/aus1B$0|L.]#SO*})nIq_⪱m4-Q ǻ~=s,DU]SoǀMQ%wx͹`BҠv'YS (?j-c߈z|1n`}RЅ㿀3UU"_l`UO:|5]@ MQbz`U5Nip:nzbq]%$)Dڸƈn UUHolR$gasci q:I/FJ8H`CI>ȥ^6k~ ]S] 4_-& ;d5?g+-a2kvBޗ tV $_ZOOi/O_BSC\> ۆ{, *!sOq6LBZIerv.>>Ҩ՜[{֓ªb/'qdr\XFov츢7(I*DiZf]U:np2ww,[Q"H7; UcO]ۦc cos\}c&sU '\wշVz~םW`Uɟv޽#˰(+}v#}n/V > o |,`v~,-piF(F2|6 SW?%ɧ (Ɛ*'%w5_G"xoT9{kk:oEJu rj|ui|ƑNPNa:ck}UmҿJ}Uw=?،xZuJ(6:q|p)oR:b{`p+Lźlj!?g|an]6Jʁwm(>xqVn1­ l:1iY{f-iJ6,5c^ˁW c"wl4Rcc97'{.eQ78=N V- 5?ob{J-)D]SPߦm:|1ER}IPJ;ۖ\(ZHZR Ī[J(bUz+9ðʡoaJEݱ‹gRw8UNIU>|1Uw9D[ _r=pү|kHsbۖeq=vXQ>?:VSuo ْxc%J~ݚArۊgJo(aU.c᷒cDQԝF 1sV=nOnqrڏ'v"%Q?0vE4c=,<ȒO{1 $"RqB$)}GSy= m1VOo"ڧa*ǻg8Ǟ?c*K lsH0~,}㊪*< I'`J*;~>1$>U_:k_GqU>?c,aw|qBz/2ti_\I؝ EC'@x}4Ϋؕ]%,N⨔/¹Ipаxɦ籎3㚞 %ڇq]"% 6!")Ȑc?c([wnbOn6ǽR;lkT!{Kڽ.Mώ5.}r;>'nYg(P'Sd[ŏۏwƐ%>=o+-~v? ~)G>N&jM?*Ok,;UP [8QvI`.y> gܚUVk3~t} 4ݏvgG t]v*6*ث6oB?՚Ng{O*y 7[6\:Mdv)\GHcU؏ݭL@tjB[s_lar|~Uz«ҕƖUD]n8DzUcvQ\wUaFڔ;`%Z[͹jzuw6o>0ڬs71"z-p٧іh-]2|Lh>c1VD+71WzGqWzŶI9NUII>}8pROoZI?^ҷH#|} v/Lu?*9/†źj|7mqJɨK)OiPsk<;ؗQ??V_i\NMJB8<ʊz͸w=pڦ+~X^*Q_}“TEjˠqWwl3r'jߤzVM w:qBF¿v]OJ~/7P{L ~vjUYVcYsW";-1n\[VMRPS/*\l+1ʩn*i!MvA\pT^4WG$Bпsl2*!slae_-A}ɮ4]b4E3/BHT+KsA$S";Xo|^8Tl3rA#UgBr)^Y@A 'ti>PyܸE(B#~FJMrxipT[7iъ3n!UIqR4HҮ]g'۶UkXlT5beҸ5q6""'߉~LqnJo_9T Qjo+{mTKlʽqBՍށ}\Lzms`?hJ߰}'.gUq5hѮ'7 >ӄEv&Lk7&ӁFԷĚVn ,*Zm㊬bwێBmXi0]ݱU8)_ 7AA#M}z`nVn)M2˹֗Gi$1ݺ0&974=Bz#ʘgq)ҴvurcU8*e‹Xv;{ei;U np@U67*cF߮+!M(Cy Ț՛lz9NDcsv1tqDxۧ#4Ki]\wzhzRn،/oy*2mMxC[f+aI HkӮ0ztj" iÈaK=c-V0N/;[AO*(yYaEbiv1JtTi **URz [ΙL"~_=3)׭N7l*#DZ/8 M=U6F*|ŕvQX-)/˩  n>ѯlpz5c@T<ձ퍯«?dS(pI׈YzҘCr9㧥]ʀܻ,xC,ѴR;5k7&~џ 3i q)oUC+m3gCR6ƭ4F䰥XBz`xb/+) jSw(]v# ᵍR7ǥˡUXь0ů.ny9\ zuͧ]BvWħ]^80$ү3!5 &@>kY8$qQS^ň Ҫ?k 00)q[dn54^@hD:P1VL$8?HQKhˋг2 <0YZ_(ǩ8^)QJv臗щzUjĦC֘7,YhW\>@#e 8}beg<ڴ=jq,K1I>* -Zc`5amsN6ti7b:NVEEgGc\zt?wPHq&P;bK:JP?̹+A\x4 iP{y7Al|m%٪(FvFeI㺂;&dek|e+ P Gm4dOG%@=z2 Vf@QveNmD_1BPWq%gXDhoޠ,-囖Ff?mB)^(I20%JWE+Ll={Aŕ*HK AIP + ësv v4&yu8 RJ `w6L=(A({S4$Ϊ ӭr$AjEF-RʭIj0$SYrBDvCё5I}G#kt(Vdnc >toa_1n]R ԪCSK$Մ>C/pGmbf1RG!ljЖ\ ,H jʠ *_F ҭZXʼn9#fj!pci-c2:|&qq+I:; bOO U@ OcXl$U_S#|M! ԀvvI`XVWD \U?N%-#,0 b"eFy#=' 5 `4#cQֶēVf' (l} ''`=2ܛtz]|zZ]ݬ=2J o$ i;h/y ܛuV()jv15̦)siԀG8O>.d ~^f^ Vb5yTU"  d;WwBԣPXH_I@B}di6iaeQAc%F]nT6Ρt?M)iX/#@Ǿ"\[)!RkuDnG,%۰$GZG,lm I+xG[5޽rʱҼy0ym3DbN[:vN=4L,_g;@L7 yUZSʘ EԟЩP7&ڶhI[v4;WZ6dh!@MԪ[^eSd ;T SG|Ȱ%O#ALe+m5=cp pllKYtMZ'^8YrOa u6k|iJ-\tS4M:(Q3 {0aaTͅxf?͌$iZQ~OW"v]*O+EMqKy/?cOz UV+EO.NDj>'떱« :zoi7sAfbfDめLo`7ĕkҮj9F@>pboqkVU(h;Q4덪Bn\}OZJb9%Cp\QcsY'hyvMyMĨn2;XcH튨\,K]I'>ػCBQ(.!0U%=0Z'*2KHO2~?grGsiZ,Nˌii늪Gl_wjh"p>*N>6d(Afۦbp4\c=p%]"]lmk|mU8ݶ sml.˛0!鿾Qo )^:JIUA\ Ԧ1-. `Ws銮3ajt' ,a9u'ݟuOX*b4v,q|1|ml?\Ҡ\DuvUq $,y9%TeP{ A-p*1!H׶Z*אBWn1UQc ׮ U۶˲Kʕw‚ԲSR7…?<(]\)R2<.˘ȡrîW^fUj|2Im;/$[x *8?v9槎>oZ6߯*{P=rO~.5gsኹ;/\Rjܒ$>튪If2}@8W"1.4|J*W:96?ُ,aUĞbv"97n&} g?ʨWq'roaV;{*# pO0K|cIN OŻxbU-aQDn5\8Na_lLbk[a)U }EjaՎ`[@Z6KScHz6GO1"nQHůbLI,>kjA(1#W_@$},qE[sኬi_v_`UAO3$e; i]-] _*"2s aˍmĪ ʅ SnqC䐆%[/rΏaf>Nl}d^d| JlUٱWg*6*ثS 1[44==iQC6Jv -oG@>:nOB~Xz[ b ;8ړ(v5846_FY۷6vfilAOæ8G 粊 p_4ݛ#Sbm?q^آZedW 7ث^a~])6Sq*y6ɰ֒@ZW|O?مUB[9\AW >x|)*]Ƞ*U2yw]I0*([~9b2zV_>MWvkɲ>Y(h}nw;CUqWO4ъ~(犪+=[3*^E7ǒ.5g=፪UݿoUh6$-4z^^:c}تT4J>ه&4 j6ܞ*->B9J}$jw>bV%Xoɶ귉}Mcoqi fSJ8<a+V 4fLG/_%]zkm|v55`[I鑴--cH' ^ ai_lpS1|w¶ק\ܩ*Gw?4+vkc}Apy{clwm!cO{F9pP: M=cmV$J$8Tvz=q#3liQNp'7qw8NKp H$dOlWhB#A7d},v8ڴ$WAWƴjjk|n`J'_mbIi#%xG5W5*q-WXcLph }' : `(XAo'r*&. +`WL}`lp6a[HHzFw>oQa䨪Z/u H#y>&#c^8kH*&1%5ĝAV"cdD |r^aǓxH*x.~gUE;`UWr+*]{e'k|ٛ1R?8>ѩ6o֋q@: mTͫI\ܘ-: f*[uy t\'Uu/S-3}cMNv8rqUuW~9V˪t߶8GMRn l2L U=Q>' P|N`}zGt,Up*SaB[xءD3x'إUaoZ⪔a2'.^\Ef?;}9"ND08t7$ƿ.WqIuS`oEýɌy'zD6rTlGSeG䢋D94RL[{ƙbka vX+{nOcjMJbe'z|; `lft*) GGS"ImQAdGWW4N*]O+bzM)]\& 8O$ en#mZ`e1wl''*8nѼdy2Zu3w\RHhphدk|o[F Y.㺖&cv @؟ W|NFh4#ՂM `(V @YH!PrX' J"QS\JzqS+' Ef׽+Ir S2-vB4|*p1M0Hj,H 9ƙ! ٦0Mxw -YO'ܑc ":6*{lޚF܎ .KXnO|lIVf6 폒с PàЦjy- +܃Ŋq7^]:`iޮэ*ʡ>Ira{ĒWC4h$1Id 5AFeR@ҭc#O4-QWW)!yFWD+#6^6'`NFlU&-PZe=6Ʉ2/NX ( ߵd튴2L1>&3, 1N8 c~Q#w˜K_d n)8:0r-EI";pM3BD\lIĔ4%S)j88@͍҃],ɛQ%|Kw#"d0mOP@zz$2zPӨNxR[c %CW.SS8JYI= M!W~T>>9=i,\z8.+$OMyf+ bDT)%iR{P:8v nP;{kp*H-AҠ"뎂G@ vM*2S'~uB'c[+JmȁӷG Q(6={ƸJ5&CPWڜK?|^n[Pgp{!Ks^mN{TS@憽"w5'[Pʝ;l&ĝhkMF[;lH0Ir60@";2%%:Ԛ AH5Or<25GtZ%n nܷjxİɐBDQ^B▲ NɁ?:dgh#g]l(1.Є C+ x-.)ҢX4߯ BJy/F9fi~Le ރ2CRx GUtKDR|2~􀻈P)L e-7(*,SbSUP5퓲 mp=Aʛ ORVwz* %Dlʣc:<^R>Y3f9/b M hFDƓK`𘔬gjqz^~׎XHRCv54ҡw^Jq̻jړI[' ŷM9\f!BH$n["$xiuT2ЁMXEd,ME>SQk/Q҂|b䴲޻ K8/.:)F z6l,9Uޫޔ}*Yqcȧ5NȿrQ(ZJPuN4-(1gr"@=GKmCCF}4U`zL=EiN4Y~l5| 8e ԖW*,}Q0̨Ur=1Zcxd*W!_mHwEaC{į$ql_®(?kdPV >&_}X_縍~#bIy`o 0C!.@/N$ҟ*Elʑ.LR[Lidzeq{r놫,#Z([+܍ڭx#l*q+*Aԟla9h--d!L*~?N_Y¥i$uaf=81ʕz52tdcѤۇBIsDcz\F> #Գqe_N $7S7+djd|CI{X-F,xOPݝF  |F e-1.#PSN呐ASn#A!匟QJXOF2YHWo ¾0pUG$zQ 61)f7JIpZ҇m4R ,#_ZՃ}HR|N5bЎ*p?;!-D[ \8+R"^Jԡ|(fA?ihYE I r)JmB-75NשEĬ0Ӧ@KwiiRƪNe1*ʼnmDVU"HC{ Q:غ(i$kKd^%Wr $H'z|*Td&nZ{d3LjPuKi㛓Ɣ[KFj3 lī6"4hW%hA=Y<=YXH !'ctK1zJO(Ÿ&O4M[;NzC/"{?N!E*ڳF5 dbMmu\qSs,Ó tjњTBi^Xі?͏HS3H.EcM'6트jTQGN\< 4RE'rܹ j¦%eshDC7:C^AV"n|q k>`g~>+FAP9?ЎmǧFvW#H| =k!݊+;m(~'8$g#\Vp+VV:S [eLr TIAGi6[zRiH|Ϗf1T->1Tf1?Y>pbD隅t]φX WzQ|r-/t>'c--J@ro1` qC&♉?:be{|RH_*CE=j83!; 6TYjIԬG!WHٺ퓤 T;Yc irq8]sVf/QiC=r㌹'V$Kf :`B8)'QqT_\]*#:ĥ$pUU=J&CUoY$#iK}8h7N۝lF)\MqRP{ T8L Jt-CVUȞޚ84ncHRc 2C^-ԴcGC*J74IU?'[ CHd:̪.yR?v%\4P{~Ǫ^E_~{c7`U*1)?M'Y U5Pkw9C~QᎠ * 8Ɣ킎rm.p+e6w4…%b^ Qتs|_-QHQjy!$68"+foOS%P:D}8Te3{@7c)X 1zk"v58i^#kE'^J0*Ɛ˦*î4_)\sT _1SRz awҞ8NG8u"ִϊ!\mIUX-28Tm/M U wm'~׳*=O˯-kol=MX_+k@>ءgrCa)[N2JǮ8.Qiߚ]J|Lrwc$&xGڽNrzг+ׁKqz7'UFS߿'`vQb'sWH&ݽmg= *if/l1CI64z`UUW9Gw0K'a',f7vlU*6*ثOHIDETP,[̱r߹܋tu)YDMDi mtdz`bfwl@tĕpBk+sڹ^'2gR>xJb'?,u}JwGǪad&C ƸMcqVO]m*+oQ\iqUT=2be/n_qʔ銩튭wᛏӆnFc``pRw1Uԯ~YUƕէmk+U *@55h1J " پѠ<. bGj,,20J^}UOg2|n͛E5?yy6e…2k*t+"fn>8C;eW ;XUW`VtSL*sE~yx~8!_)H>z+>&?Gŋkxeno5cj:|ԶЋ?f( Ƿ_,i+΍pFȴwR1'„d__J ƒ(Jԓ6JO%@DChOSJ ` /c.g*cW %M SZSDcLP[ocZA֗(s}mwmϾ*STZ|qDS; (Pۙʦ~]rK buTlZu7sOaw;)Di@[lP%ڍݺ~8wF[ }c$4=["Oo^*vƖ逦jg"V1_hv;o'(:b؄1 ҪX Wz,p@;Wי>XhJ9~Cd ā| cIOTg}ITp\z`rayxiћ##E ۟%]jF{ʯtl3\Di [RzGiiWF?k$שQVF Uaw8~SxG'špFX/\R8 ʼnCv-حKmǀdZf}zbB+k}L>(Z[]˥:K[Wƙ?U[fgi`DGhoӍ4ّvOXړSbH1o똷l*ҡޞ8ʓ|Uxh31ʣ)Y$w;(#C? tYGMx6oxҞ*|s;tɿ NJh=x!y.DvTE5n 4"؝c\RqF8Cyp4JOe89Q?xƠmvi>z^J0>J$g(sG,{tȳ yOHKbͺ`cGp8= ;") m4.Y\!<4m,@r}ڃb41^nʵBH0F.%Z C 1 l,Hv?kg #xisHg<SӲ$ &R\vI,݊M@Ū?Rc{uĖY&bS::%y=j:Caݥp DD[Wթn؀cX`,Io,XRS{QhG|T|jA$yQ\ mv=.qJecAM 5ӳ,OfRccgcH k]l "\!" 3e۳:lAA IrcЍ$̌\y2lDJ9bp;JZez>9\)L4. ᚊMl%jʐBiZ]LYrVEp=_9\) cnLB7zW(D8&GJ*p@u/iB;?<=k9l# lz΅876;H璏ٯSpJz*4;/iߌ6mI] ԠoRBk1#DGʟ< ZCoGzaX%PQ;p9-(q5Bw,V6YgJyި(P{Kxt")kqeI]xH siwbrz*e:55*=܆xtȆGoA(f(6~x:IA qcndW*4)Uo>E_yPx$A0,#:|Z++߶]I_)v:r;ͽ~9;,H"P#/ǰvz N*CwP*b̰Q|_ے"AA*EA%]! [-.Pг~+csr` 2$j oAC$C"t\]܁ŀ^4 ;n?~İ$\{uġ]d~H;5Vֲ5^"Ԋ9>ji@ '*Trmmmm0<1J &{BM4#pn.`P)׾$m.(Vg4=J=!7˓Mf(#l-% "0 Ěv"z81ݕēb7A77k,&YK$rDSSCQ2/5z  9TȩJ+ciI߉p?r0X]%[rHɤ O{%YWUm<#BGTH Վ xZ 4g~XhkM}RI\К(cLgX8,Qvaҥݜ}^>!S 3>P[#RA1郵(ŴwIGg_yS'p%ɹ$@_c} S5`Æ䍛&c̩}m,*y}W"s xo#HU_0uR[8Sa6oR9)ֿh YEGJ!wҾ# e^$A.XcwT2zX& ,"ZJiЇ5oS"v dRduO`v8S_NUV~4Q퓉2e1kR;T ӗ}%9I'%$*\ѻB<1j^7au4$qH\7kȧ*+OtE!9/uYV=hMA G6HJlei$eT\[(a.ҧ#XiKw:JSq'pG' ܹuރ|AXed@ чmᖡ YcXP7#]:͉zkR~X{V!{ӦBԨW"Y<~"J80!I5_lŻZV&*(7)?w"JyfnK+2kӧU-R%?sr}Kėot`VsJH,ZӂO_;2TV%ꯦ/${V HI*C-ɏTWƔPkD$`z)V7܏қIn!ҡ8 aM4Z+NHEE(OJxa $&>jGﷆ#$W^ LtSg9 ޴jv #PITR;u%CB"{S\AE<) Bj9Ae)b CJ94>>c}"NmeJWj@jW*\B `b!v= ғ_Ĕ6JP0Mq *~TroIic•xy|S10CVi .T)ݎ*ٸ2LFȻ[;D9o1JAqt+v&B'!o =8W)**],. V}x~l|78i[af⪱FxV;/8UcMmYMnT];S⪛.fq9{V|q)u:{=-xeҽw8Ui4; p?v(X\ {ƳQ ڹ )lr)8UEX_UcPի@1Ib T~G.Y`:}- e SJޕ[`; ju;]aw;baQ(H?`xoVSs,}Rytejp7=1"`TJ¨*zKaM.H1~qJ .=|1(+:>pO]*`>rXIlƧjmirPs႖OׯjW^ŠyvJYA46Ɛ1+*Yj0ESBGoI1r@! pQ1aU n+g@(/Dye UN 2U )ciڃ8B!ovY=(Sk(v&e(|Ov$X9ƿ X}pҢʅኴ҄kr!#r$Qk6-jw7+Rq ucBiqIu0F6O %0H|O}wJq]/]aB'짿s,[Q"XoxIpX({8y*eˉN|p^0w=JQk?d}',]J`Vw4ƱcaW" ?|{c TBu'tm1GtǪ"<4)$n#c'bH0{aĪV3M/\BKni [ӓxb\+Ud#i1e zqPz UAj's6X4xJ 9 ʘPG$ؑ'e-4KOCŏ4*T]Zzu[lon֐ح/Wr'3Nq`#v&'Mb:o#vF+'ix,§k}װ ?kMźbn [݃^Ȕ-=+k}eom]73߳%ӊQnJhPf;ڐ w8g;J{tUi<7DpSUU)R~XʃLBU늩8v,m q,{uolYQaR}mqDvogTWo']ufU"[7w8[mN+cKzES*ot񜙱JHӦXU6オ ;xƒ)[MqWn$V+ʠ3Ǫ3{ TI4qyqDGX$]-1r! ~"] H=78/ڠ\SiEWN2{he4ldk4~a,;oNxxL1Ot-.(SavO_k|Љ[st\^BrI #RpєuHA q,\CPCRpGm\R}䩕*qobAԲ5=U t-"5=Hq漗.b0TK Wn)7} ҧ yHcG$Olan$$\0*ۭM0].S^Qhhh0N,XD6b %V)ljaR(x#hn}˓H1/WGqd"R^# -VJD pPQz- "4,5mlbn%}AN8474![-aNb'}iJO-64W1Q=2#aKytpAdK#!a3(ԥ <I^2*PH5z$6KpdiAjxPeQ^4w3Zۅ!h#+ƧqJn.#^T]O`iZd-S .zzQITT`&q4aLB1 ȣЎ"d$04(T{#|.X\m1Op@h+af=:{[l%(I$u5<"M쓸pVi0Wt!Bւ}>c|^nm#P'|X*6VPT>`}߅IdV#md 4jx> hn S*.'olU܄ .tͱhQ4HgPҧu)5^$q^}#(>o%HHML#s8Nv*Bg$]Z̅C(5Pؐƪ<2 Df'ڝMzamEd>S^l3WkA I_*]'S"5H$X`zX?UTʇaNl^\FKSj|UXfB s+G#tc{ HEG7 XN3dY Yͬ1h%N7PCQBgvi~%Z& ɦ5$`iEIdxjWi-!Aln[FZgUql&@({tp捐כN)W?VfY:1oڛG !QG*c47Blk֞?,説,`+7>c-֡/fGpMdצmONp39"A([c|X,.GB>ĂMVMo4I,EJBvP<5)*@d D\jЂG/qM*Ĭ6hz(P97"~{ qU\5{*iOx{煋~ !jzt*vpp `ՠָk"Ht7EUأՒ'$^?q-*RRHJ'&Wja2EYeA[widZP6䢼%\ħ᫩M1[ޫ̋-< ;dNJ /gcGp;_M"f0H8FeW[kVDul&AZS Y/)"A`›v8&u:Tr9ʡP-h_=54R"KҵGO$7>)ՁčEݪ@ziojB,#sHlqvb0AjW}ky\5\*^^ , ;lx' Sh&GMiZ\Qw}^Y#W~J2rS%{{>qu-/Reg"q6J}N$cePlI$B@y d: GXiщq@8P.`N93I!\(Dmk핑LTo 1+M&;xCW{f\=d!pFK~PAPS)Naj<=4#-A]k%$Ԉ~xv欬ԑ㒔2JH:`;)6Ȏ ?햁{@델uTlyrK+OBvŵ h`/R 21.^ԯĉwu o&MGJ{6M*İqUqM_lJ2dCنH䪗6x&G|BwwƼ/iB!TŹ<1{ ac2Ҟ G44ԅ ˧@qhWՅXTʤ=Qh!y"pCWoW_|rTDAdT5q{i-ggPJ*<0i-rQ +'-A>+ bz9(ҝEG6 4&sţ*h;ɝm*h7&Tz9J-R'sFSJ:[x+qUy+UJ+ao-]#1OCֆfP܎ƔJ;Z2zb?R6oJmR;pHyZ-ξ?r Qġm1k8чH'市oy~ [^@^"H**XCi$ziZS/Z-Ċf8!қT1ՙ $xۖ)+ͧ5HoXS%>}o|&Ӗ lIZrU?CA B?&RM7$ŗgn1162ŠTtE;icFSCz1]qƔGƛm &@exO t:]GuIln^&%-Pv5 2e(Տp42Mت>Oh=O X~6Ո٠]4ʟ uRUOoU/wt߉]2N*c f ׮EM3l PF#|U);.u«x6:S1R;0ȡaB=Y.p7a%J<Earj#KVĀB"Rs׶YuOsV'zbo)(m@[ª_闰?ٍ-]w8oztJǪviTe4LS_qUY̿P6>Pō]6r${@oN*7SP砦59HGK빎}NڼݱvTp_XگIYKxYA#ദ|"]z!qjt}&|arztiYa AK|U"Lv˰r}:oTKJxf{ zlcߴr>|bޝzOs]i5JքvJ8#+M0{7Qw2hWu?<Ċ7T0H#]HhOM/CA­e'<ߩY =*'Q*LGUzx&7(-Jh<;M؜U8>}hG^PQ#L %"cct sjWki''eFG\].շG{19fgRUmR/{?6ċMqjS*kSwY*SjskFvW)d>'eOW.oՔU)'ż3VIj;p*|)0\§tLm\GtȫuƖڮmaJ7\ \w}a[R tڻe [jGBo#WolQjtS 3Xh'\!)_W26'>z?NDF|Jn agJnpbR CKt[ vR=:2s1U l>qcj+] Ñ_lkŕvݲ~(ZW])qBcu*-8]az BUV!@ROab $A>|NP+|pZu끍:eҸTUilv~I\v_v]ȫEWRGa[irA,{V!C,"/ V;PvdJnnu# U t2\QIƒӭ>%sՏ.8;-P/ (B ͹Q[4C*lUR8)71'UF/n1/0ZUᄷ?وJ)b WfUpMx$_R> ;V=;?GrBI{M[XocHga#asǩ8$좀'_6?،r0YzlU ~'r =n_:O0gr 1!=miQ :}Qq& sQQeIR(qT/۟ P-o--݄* 7qG};!{9?ge~ȫm:T59)&dVՔqW9FsW o+HTNIAN |;cYϓ̋쏖A3v͊6**6*ثS1[Vh'6O*y@CjIb:H荪叠*ክj1npJKlez^m9Hv `UIk\VIGx_"zl1UKԙ4^|(=1Uޝ7mϾU|>m[#˦8)aasH^jȶ0Zh>'jt$ވ,i-z04"XaYX} 6uCr}[^tEiVoz_<~ރv58mSh׊M?a] F Ud?Ռ,X~8W փcNZ"7aSk\ąQ7#}oz  KHl</VU75+7o\YQ6#y O_$ⶳf%1E Pv,|+g)jr6Ig5^=ZDť_a34z Eq>Krz1U)oznqTGA_|(,z#b/!^EObȝ78j}226Ū'~_.AIܜ*u_NWso$E1VpCUl>d´KW+Z8k/]𪗬ϲ혽6"`ş)^]"~-3>˷FC5$nqU_R@40irBGoKMdnckx?۟钤-}>}B}gy1Te !M ҟ s6UV.qUSo*˶P$d([-ӪboՍ]Ĝ]mlj25#b삧HQr++l;"߮PUqþc;[*|1%[6QiqYH2{c_UZ;u2-#cl+ni;o# R{b1Z[٠=q?Oa9t ihf[>'8N)Z.91-}e쏤⭴N}1u5\P|*Ǭ,}Zғ\(4v>؜"030%kosrxmC@‹0%1 Ȇ3^PkpiOO"wUlHPci'ze 3 % 1Iw\kHӦ4N1 'ޯA"7g]VƜkm`yB"Ijp bʮʕy 7gC(Շi_R 6P;w X뗸 '"#1B~j[ޜvH1.ƛD10o)Yc 鍱4Kb*#Ls(w5lok%gEI$"Tu#ЊmٶZhe\$F8W*ɾ-u[:H\j׍ӚH֌u9Pxui}g$B9l$n$4{H6dq:S@rM[1٢ WcĭSi5L bh+Ȼr$~ ݎ9l)qHvhC,l I[.Ğ5 Pmᒦ"˲|,Ƚ$^*`QآD9ևza 3큨q0.oC_Wffb줺{cLb]NA!sl)4" X {uĠȗeG$aپ$nj Wm-ID|a vVPt#œ*|rAO1I&cOj~4Z}e:5BOR֤)+Rix\t^c#uIUHeO:;ⶻ*AqU=in{NpX:/_4s:y|#PB~-enŋ\pJrz WŚ@3[bUieXbaYƒb׃fV/h@jrCJ٩\>Tؑ]~IXǥt-|r|մhwxZɔTmh֢?P@;_[-,Qz0ZK9 ՆM@D<@ǭ8Fȥ8OF/W)3Ȯ xؓTYfS $ҤvRUF瀮~7E2sUlqK#GEG(Tn) h8cָ&=2",vc_NX9ZQki3D24kF?, +bV|+ɒd"JO\Vw3)~m]Z 5sPJ ~) ҡ7(m'D9;ӂK%E$,A[fD9I+k+Jƒt ?DR sZ7;7[=Ĩx$T`Z(RE(GŴoUGO\ EC֠E@ I$ua*+Ԧ2; %S#9#s> ¡6m@z;Blw?k=T:2jv@OB%oy%|c˧ 3 qhT}/PRxTQ&j73Uiw' d v)u%̞WOs;}{uW y{K)jz^,-N*xzaߠeMz[(Xv܁^cY]YKn({)JJZInzw9DW~ͻiFe%ZG2jw,-+$oM2FNmJIUJ\qkobZ({K8 EV]^W,jJq XnZj\[rL)%cO|Hgiؑ^MliGrLxBj>TTPN%ܳ2hڭ@8yvbMGZ-ZC2i;.Le)@)׾!Y'r!n#"JhMBfJwol4KOAN\:rP 貝G a|'ci])༒yROU9!B t9t6m=9e%1AW`Zz(#fjR?@?rvHYoPFޥWj&y$oN ʀt ۪G\%@=F< сx7=1. I-Ӑ뒖mڵzhNӰ5;pP )~ݓU0ѰE$+T50WqP@͑uBZ8IOCIK% %^lB4+`?^I)*7'OLW9JuOnr Ul<;dᆕA~qBN(RtܯR.0*y?c@Uyjm ?N\@ރqt=IjR2?hoּ0/z ;2?X;\ $H,Clar )A횜w;4]\^7єr(\^8F:)RyLXs9n3|BA?g*%oz|sWJ<7qt#͍x=r㊸tڽsWw |Rq쏙҅VDis\l /e iUlR#0K`vz{cjާo|ҊX[e-V"Ǫ۾*yLs3nP%EF'>XUrOگXM\+ZƟ.Ϧ* un~k0w8R(a퍩;!xEM`W*!~ 1uV8t}d{TWk_~_lPY[a_)xe`Va10Zcثr:EsT=p[CsEbBosUB;OUne3HG&siZ2^7:5\IsRIƻpzVG`1N˶(^ƾכX߯1aZ &}UOolULvaWԸ<RWWiVuu8o؟5TyڢH˜<ԣHU6QV!# ↽abPo[bgwG.C;ff ׯ?gg,ibJB_rxtޠOܜP AS…WekHOp%Rp>q2 ҸzDx Bࢿ'9c}4X;1F*㸅HRLcerO_W(֝}bxT}T xq7~ç* <~&^'|@V4b:'- $8Ms.`^>lz^Coio?s%aHXi [ii<'DTT©:z]P9OLUƉ6(#*@p;xL1Kq@woċI"fT'WH1AEu(1>$ )ʕڿUpO똰_EO>9v_^s =eWieN%HZd'_J _ە|BHl?o7cs|Ƚ>d7nثb*6*ثҲsoq'd=iQAZlNsuN"71Uh2f­3EbJ⑯(0Zȋ>k+ۢQrq._~pWcvUOHb?ILj|UEB_:Mq*! Oߊߍ `=gACd> [kۿ4'Lgv?~J %<%y׊.!$!oH*68bbE{]9l?hOSbL" X+7\ x8pUUơG8)=NѕWŲªm1}WLc p=>[ej>Gu)p$L Dǩ ^ٍ:9`*r:CO\R:@[XFU/LypH$s58ʳ{jGl労[O$'afBjWAm|pԽJL܂fQ|RD4* 7qZUi)=N*є/m~X3nh>yS~Uʜ|6݂Ƕ Pwi[T=?SMRb5@MQK ;[FվDj34ׂ/_,NByJğsTDkE)~Udi>#bm1n#l'A&_(=Ktb"']=aZ 4[/xPef2We+ǮQ}-dbQ\m ܟCc3nƘ֙Mr)ZmZ/>cAФV*,IQ6]cMXm(lcp >'3`UI'HeiYodl(AtOEAV5Tդdc}o`M*w?@џ?F B)P>}sT~)kE}WOxVo+o2v55@o.NTXƖ)^۔.lNmC+ *_LEgvR^W5QWA[+ṣ<с@=Ͼ)MavUbm)n["n:낐^yA}נKq{ pRzR LQaJWKz‹B|1UJtU&ǹƖU5Y!Q{*vjYaƙ}tm_ai*~-*[l*Xƕc]t e+>إkLw8QkZ { k=M\GZ뿹,lǝ#ڼf!ĜUfTQ({|#n;x7V4mǢsP[ 3[cڻo.N\0_4\QxO,y37}dqdZ=j*Op $Pd1Ǿh2lmݚbGN<q–`y$1^NF;Pu'Z N R0eqŶY+b8~:b UCTq' jۀ]M)ݭ.5xNSAfz06lfAaDE7IBݰ5 0$?%wV$c~%!P*lBi1-NlԎiitsRiJoޙP*rkAQ+Q?RwqWQQbvq?<4bmo}YmHﷆ7ޤ@DInbbK' ' *MOLR&Mvˀ L]XDfuH\}w;j0TO-vkGsѝYZ5!foL9= h/7@MSJM(SriL-V^oQtݭhG-x[dS^{v1Jaɪh1b[ąʗ5)آ^T $" vIh-7 &H&Mј}S0nbB2li%H^C@8S+XSe4M)dv-"-y e,ծk6N( !}6R(iAowL1Tb(*KȔM\m5&pr,a6B! .عHe4jc%5jѴ"0># 6zbkd֭)\\xEbz▅К,N(#ƴuJ3lWdUiMGs${R\#2:Oҩ'\)"'A2"T:gY܀ȒO醶iS׷\ˇCى2c6qddƼʉVaO>wۭ}Y d aJb.vNĻӔTR#YX W}TW7ѧ$aCQ8JPRX[=b1KE%rXPr&`-F3QOl)åH]M"Z#P|pmմFDJVM}ĞSJ;Sփ6$RO )}KF44vdB (Vj] *7 |[0ݴ$EebAVJ]Ӎ7KT4Vc y?dv\,[a9+ 6U oRÓPaձ;wc SG(~V<*wb PFU=OQتQgv%5R 6l욵/5.)^{ c;TSUx5J:27%-#)]U{1Kn&Q k|nQHN7˄k~(HH1&lJV<́nNT)*6ow+z'I>,&%H.!\~6uLV_Jiꑱg@{7lyHQ"̿ u\@$ޙ,TU|~+SJN#R+$mڠsdZ}R`½Jiq耥U {G+dkĜxiuzQ Ɵfb>;3Kgܒ䥰WND19XUQ{P"=sdԘo |M䪜 QP~=xQcBSޑh_%еN%#ޣFKCHmG;S'g<_lV b@{J>*tk5 dgq-Cw-?{-,h@xaZ-ddO N&I!6'yz_i*Ȏm!:bOr0]ׂCu/n_chuoTib{H25f<@Dڐݮ~/a{28v%rc) BU?y*p"+Z@CGLExQ|-߮YN0]\';bfik|_P ބ|UQfG5N5TS88続2F`zי%X @nVx҄SRzqw*Ȉ!Ey[#8|`1A.HN TkRwd@x0ePc 9vopI8 H[,6C.&khqn-r u(-fBBB8&2b@S;a6KF#F1Q%fݹ/$EhVbZej( 'KUBˎåw_6v'%If5 q,)fcMcN }(24e^ 89PW'xHx_.qJ-s#1d8XM_ ,!rܛ8A#YDǝ5U )XZ*Qc`!E~)pndppji8`GӉ>#)STVcu'o$dG'iE* rG ƽx4 W@'8VV'rڂO#FG6> UҀv  *ܱ)ڸ)n-%D*'PhVrc%n! ()S+- oP;S]ZM4y ؞kiB(jXX͜ѻq1(鹧S dԵ/^DQ?l.Ha0zaT z#} H]ʰFLaNDM z}!k  iSfXpA:~pF$0%/ŷn )@Tcئ¾vZ9roxk،(i U R5!4Y7WeA4ve# li")`e?}$jW&hz _(Td: خBI \^FPnG8(dMz usnJ#ĐI"oQ*K+:jWzrB[nAxRߋ[z2ѿ:i|vA ei3qH8=ڻ`{[!iEH钕jH8~d1${EQqiJ)ܜ&QְI5wnT3̧mX W W[Ӧ9nLGjzįOb0/Rg$lRyWRT> ̝>jZW00ᤴ\._eን9{s)l[ i)Q*84# ʆ" ,_ā8تN -d@VcYS4jLpPzU#ɷE,fOa rmذ#8y!ܷM'eȒLV"1Y/lhZUFpTU`Bw?NqDf<ߩ yuGe_?#}ibME<vQ6w.jM}1@RZ7Ƙj/(>%Jcl2\덪)q4ǪӮ(QӮ;-LUr[Ȟ Uw9`wZg0ߧpDPoesTxeWu)v62+M@~VO} >Ǒ'W\Ui횝;⮭kQJ p=96 +JS=m;^a|!bV<_lVQBP$^!PAfP2JLPu+ rx٭c$$P| 1Uh4Vk,_ m7˓~Rxf ^U q*IJJh?d}8!2o!ç}JV56`zcHXe5^8rؕD,aU>%+{cxh%FG{B=sWw}ez]L~L9<)k '5B:䕭_gŭQPuckB $Obh~p֗7aԄ4$Ԝ)L";` :-" }ҬŸoTl$$;eEN(R!϶c_}|zi$Wp*4~UǪ7xBY?zʢX][i v(ŀ(ی'lUQ-T[#F:@nqUr.⧡r7cO~y'!B@fz,ƵbKz%88 F0`0Q6;oO.srwk.8oJ=6dI¾# ~ueታQ|[/KVq/[s}B|+XV<|.BM M*K_>sQG mTGMUtF|[ƹ1P$c:䂕6?g@[SXOoaբ{lc:npZJ#(w=0Үi+|~t} 4sc"ϓ쏖A3v͊6**6*ثҒ0f>gO* 7gA3\BC`\ӊbk+j~Za,zlcKU"̞XF\RvD] ڄ}QK'AAvQW}^F:8d~XZN,@+3.#}HhoHX?Ÿv$oWŷ?ʢWDOrW#yf{vJyT>=#`UX]3*oAeyٖ d1Z=-6wj^XBzUcLae0YZ\1 / Uק_s+6#z`B[ߦ0UR3M1 UEf?ہ *>"6mbIN)^l1WUA^,#7\U#~=q5_46I:l=ܩlmT"۵Oʩ8 WE2,[.{l1HyOd w}}/zC\>ʻU)o0Mx};/Kݷ? *ѦIqGo,4![S+xcnq7e1,FىqUuEdc9xb1_s=y'J}V=a(uoqdio)~im L`rP5Zs??F0H[⪆NiV=ۏh"&÷elE/_gz,¬j|3O $5j[fSHU(eX"g@;c4Na],XNs)ɽ%DQpdEXozl$.WN2C Aw;&{:;l؍0$ͮUF)-R>ݜTmSZ낑kVE,@뀔QAW̕0\2'^+ޱ-bVyLҁS1(ƼHfsaf[HN b-wZvDEԖ|a Ŷ;eI;]5 Q|^Sp+Ȏ)]iJ*pѥi%` K}.$*L$*D! +%E(;Z]I# ]dez"Ipj;1XȪ\TP i[O$y8Y 憞8niN;Cv5WAȔfM>᝽+%MZ"jxv;K~ N~#n84V:W9"@KW jHilw)+# G\6J[YZe |54I*} ~MRi\6wjR"phʳ.ĭ:t]TeޜB(<z&0! |MҜSbRC#W!@Cv~vodM]ǣG#\:-@@{xS[asUy lHޞܒ[\)uvEfyF7PǫEՁP n2ǯӞU~Qv\N^|P=.HY 2B>yRis)jV1FֆnboD B~W^HyB(7X!^^yJ}#${ԕYA*~Tls&C*i؎%P B?8&HYUH q= $ ,/ eFA62 $+ε4degnB Ҵoar =[e`epRSw$ 4 XCv+JԊ +bԎ@;dBE+ʹaW$3v#L{؀p_jF ,Y,5dI7Vt͚7hU*Z P/,PCewfrdM Pv6XM*NԐ,47jcY:")W"d|&VVʅMF嚝DfKo+D=>U5Mq˓Oo n[# D+b)^wF- 9ŕdv#|qǖ2VcMipku*I_LPCՅsA!boʙ+%*%*)J1^r RJחlQCV#|$*PGN$ZRFR!U*OPq/1o\ײ^;}M?,BV`ō'I(V(CQ-B$hٮbl!w5eGP1څ֡`XZJ [سy4Zوp0%%RImF1mQVNQ) ڹdMahJHOAIhҁc #~'6Ą3A/yApЪ<‘%4[# Q:D@6U¡Fޛ,D@ 跬ZKFsZ+{ m4 J8P.p$(9*1"Q$+]}KdXX*Ёن UP."lS2^OCFI_J O4|p4Mđcds'Ӡ?F j#%*Ga1[)D锡ޠ߮.rI#fʌR$QP(60[2}@>Uz}ťZzhF9Zm.f/Oچ :w?Yi**L .-R8#Zc R[ 2#K"cFjRGQ90lifqq(zFHj+vHDI>)wSۭrsX)1Z7Q$Z?ώ +xAs푌x?J9-Kn1r) h)Aʼn4Te7`LotDnTq\JBZ{90Y@3AE ,0E7h?/U( )bڹ )WKZae5) TcRfQ  Yj<(Uv] Z alyY1"NoScifxsemS)dL[.A*Mm+)YEI.f^Fʷ 'hŸXQVMD)Tol㸭C maJ's4jZyXҕY!aT5vqkh;:JVo5VP)w;oe% 8;F7@tB܉-U5qiK*@CF(pKmvYu7gClJ@a&'u'tJ2BpвaڛE9sb~]EO=F_'P)@2'ɐ DK[PX5.'t (?eʨ i"RN5!w+/8*XVR={Z*P h=r_$T /*uڜȊdy"l6´;J(1i ۧlxkE+فw (0]mNy j zxCS# s?օ RO`p Rց[lFHp}yS÷ѓR((6jIʔ+.C*E đ $Pk gON(aUʕZlʞP(Rwv J;;ŒOpvSjOpEOW <6EU]78EU,{}:ejGM r*[bi`Uoz0n6Th K1~ghU7}M Irb6]$,xiV33{./aPs)z0/1콿?ʦ.`J7}-}Hj`ZLm-Ģ81 K,bcn 411zl160s}Lw!V4 UNʯ*p皘e{Vvf?~~[6.ŲmQ~ׯ݅-6`7ƿZcA=SX*vE/^V TPZԒ:}Of+9 ZWQ[420qp_qUUC0:/E$ x}Gux=UUZ|=?9@rW3{b@ª-)m_nƖ.)TؾoNJ7q "K}|Nj1%ZJ/MsaXMٺM1VTT%6z[Bw8Q¸0IaۦYjcj䆸I UDQsze|ZWˡ=p)i4 ru훗х[ e :e W5o:PF*A(C<žnt5=8D_p*.=: f&YAS']IUVv\!&.HBMXM늬j<:UMXbs0ҩPksviVx o%Ik߮Y_(XF~^k,>,pZL # —z)~*$.(.,Pɶ`balpc6cO*_~R=qmWt|+{ux4ArXr> nUDҬh<\PW 鉗a퍦 |M{㖤Pl1U>ى s}c@.kwUBo +sUn>~cn)DƟ l6d|m'b!Zc#iqdR87m+w8U7qST/_ĞZ8Wڝ#&%aP_a\X& BTHAg (48<=J<OT^?qm#r?!qv}l?iv?ðžIn=qB%æbUz ⫔;> i$u>TU 9t_w$>'v=[t4}w8`H *}'oaၒ+G 1,eU&+\P˖iփ [x^^|M~)~iSSBW-ܛol!A~w}aJ9o>RN-(-R2HmlQ?ݧ~;cYϓ̋^ۤ]vlU*6*ثOn;zvG/lCTWU> GGu)2#kH;H۰ʩ>".ۓ//|iW4(cJ}8\UH$gaU/j!\ j;ō9N㑵Adܷf3xdnOйm݊y6STbvq)/&b (0Ңm;Sc QqTcH+cTO`+[їJbr$s v\A18w犺jW VN?*nࣷኬ2/ak-&p*mw_j +]=­]$q`B5 cΘiV4.[^RlCHY~.([ʻT1 W"m/bU)=6iv#ct -M-AVTrc\igҨ#cKb=:xT>ѩ›ZI%4cq{{cPĚ m(O[ӏ Dءiv]p!@^WcCrmFd]`8[~mUHR/OSͻBtP1t17(z*(19AJ/ E'QineOƕs2nG(Wmw`߮;:U/\;eU«%ݷƃZV;`*qT;|cA5[ +ڛ2؅FFsD>'k]TEG!K$MIWKxaEO̐[ۨݷ8^3}djZ[۶bUzqV9$ 3)$,C]ܓaĠ~LU)g?㉛(]lU7}O8׉l ESQrpzDN؛8JOV _;Z2cchS!j|WK(߮P=Uiz〡s }i2z"x]y)>ifqEl'eTC;W[[d=Bo~ʒ]48BY?S+ZZt©ZĚRw'DnWFQzu+.Xږ>c"j~X=}qd?aBknHASQqU2?znEaW,jӑݺ?jZ;1يnۜUMCƵ肃*G`+Vbl8T|=0ҭSpU[*$O@3shbæ`-SoDŽ8^nwsXF=qJNɶ\8T<$qʽvݤ-=t`]ƵaR4vl?|c$I)+y<p6.81%4Xu7R#4H]e^ӏՕ(DUTՀkRv@`U,CL4.O.;!`(UAX8&)[iV^[ ;;PbxCTM;B"aBkG %z9CW)%>"LhA+q1tAlcv$v"UrՅ:bdDZ >XD9b2B-L9rWF@:+iе$` k~KN>\ - FFXuaEA%`K/ρYy=)X7#dJȜiJtXr@ zv{ RM>,tVdymZM2-/NϢYz6JtsGޔg1I{F؍rc'%t2U՛X Wa DHQS\w+Rάh~߽pogeGlOO(VAH!~|Yq,w+--9u=0VԿ6w+.W1%l`w8PUٔd }UInUjiHU|77^$TWVq'3Gz;/JCD"{cdԵ(l5-]3R\|K!GvV [CABzAU"X1_ TI.K2LJތ(~"Fi4Y(2!0T{( Wvϝ3fIJdFn✡1+|"KFG%ZH㸒% JAj9=60cd]DDUVr"<ˏZF:Fq܄2Pb;nwNX$H_U a@x;JamƠt&w@J ?v?L-Q@ڊ~@܈"ݨitQKX3 niw6H/@]-̻lUQO>D")NqjJWIڸӏO*ӒJ!*+ʢ큅ü>2~''`?Q)UTԭ6@ܞ?~"b~D?#Kȱi˹q_"K9"'Յ-x1C}RUr5t< 0t@}APOl#vA8^<8xazG+W)l2;ʛ:{aI`y FrG$@| mDQC/,ڍwv+Q9@-`˷ Zx/^p5+BarNPvC!)Xeռgٳ]l5pnuzӮLJ:=TWz~"]Z8E žak⒀I,w9T=v"֕4l$)GܼRsU]c uk9d*#+T HK*&( 2H,c榄ZTA6BTڃQދ ?vЯ>dV= \ȕ΍)/\/Q8|GÂ1#)BYG[tXg%=U-7 npbN,[\! Rvg.!0lG\ .FAQR¶ v,IZӖtG|Pҵ6rWl>b). O¹(1 |i 2aM-*(Rvߍjג߯UXn|R|+se. æ4ᑴ%wm]1T*eWlVVj7H&n+I i4W4zuBk$4m톐IE EA)nμ \շo|4dqZ(f#‡cƚN^(hֽ|U!; \*tޝ1lUQB&?*wL'5k0|8C9l0+k?lV({n2~*ŗBzTE`eX3{echwr [m1灐VT O^m"Lp(|GY${aU߮U18næ]<1UXJb:u! \'L v.z'19M)}mLe{*\~q,m&PW,DF}J3 "? KsN4T po*7~9$ZIC 1*؄T4lg.| }x ~-)n߮Y+Z^zw'OHSfG(8 AZ$9:teGMLW4v\˅- t'sUU6▉ `bVHbUYy]=U}PZu[0֡喯LU)EjD zTƤ[Yw]__ <S{fwnD1!6B%BvQ)[5of=*x/`:mK=b3e'}Pu*[iol*&\SJ&|[>"Ue>w?@|Q;I$m/ݽ&mxDX =*\^+b~Xy./a C>OՏ6ԟGl_-h} D֐nAw>Crp5~Ƭe[|Ir+?]}$e>NQbOhq6 mcO_7Fnt6ܭ)}n4)4QA㍥."帧 ݁yO )^&ݼ{eƐfX\c,#?lԧ–vኴdŸk5P~8Ss_՗=*Olp/0)*frc}x )_t<ƅ$q1{kg@6ܱ4a䄿Qc@*(c3o#FEqeuWЃr??DH\rKJe @:c1??̋S쏖A3v͊6**6*ث7V#Y6{O*݂~۩I^UN~*Jws}ክ񼫵rJe!-AK@W?o1>#\und#R1OJ!v5B} MMX⩊)ES5q*Z˜\ZoU>-,§aXV%=*e _Ȋ@_.S.;o=*2)do›*e칫 p ?nylG9UO\T/^}0ҵq0a/ OBqUS0NҴga pAZec{bǮ_Jת: *:oC^L!V)ӮQp1(mbfcZRz`J/S5=q*r:*T_`1JPXdƒ!q'@_Z2+h>xYElmW p>>foaTOVh;tR%w?NBNb{WLfqIUޚ^ܞ>EbR\Msؑ}y"=0R\ ToaUO^Iez0Z)r_'$1@"`(K~ >W7\/+j2\׮( v{]guUf=r(T[%]Bh:F+*`}r+}/5>i \*|N>|*eN{ kJjąؓ]1p MjqDaE伦. [vǕSLP$g"7*}qojh*(90+}_srsvJBz=r±߷iv[4jX-"OR%?I?F pN JM\^V0~1cB) ?cT-]%~`inCV% 6dvEX$ғ|*X}&d*Eс*Z7PG,#7k:'Nv %m)0ꜶW~!Y$?rۦ*Ns䒪,zl0+ s}w8X5cLN)T[Y+-Uⴊ>gRzmoNk=:}߇\kN*-=\47ǤU4QbPKRāB{KC۠p[-jrvrPYTb~({S zq]q6+rć=rWLN$Dc? ȖNH. p`>VV-#5MFr\p`,UV|0(Ѱ2Ij ߉z 62LCHG3^Er jr:auȣs\Ub0F҄Ct#;Bxf$D[ޙ2up4-" enX q4T |QO4`]% ICPz‹\PyKlt)lI"d -Dd؜P-ƫN*)ҹBɻ-DkǧBelȿCBo8 uRPF$䰤Zl68`-#ldXJٔ8j.2$V#}. -um/Y#CCd7FSJ{e[4;BOWG7$1VC5 4 {(\˦4*k5"-6)"SwBs䣶\Hyi=b(yGCr`{*\JvAXoa λ09Ўgs VRPVIl1B4܊~mo8E}`'Wfk>4cMrR 3> FJ鬭uF ##P ($\POҽ24mR*Yl o`pm9evm 1Z&l˹'21庎,0 HW_N)^'"A[SUZ>|#[&voI 6?@n{q&V$Uᄭ[:`T]Y(KeC$tc#4s3#܏Ou´B8[Fܼ{|X69J;_`Pmr82h:pq(րӮը {շŦM{ WeM4v'*.fXuǚљ:lVT2ƒ@m#dSJXe%cQW-6F T=S 8?f6jdP 0+QEU2+mSX;]OP;>Bk idRGӭpF6> JTY $!H ;P vߝw_%WUN4 @/6(ޣB vCU{qm27'b?۶$(jr(naM`Yn xw4KiV$`k^i~vTM62ARjm!,2^EwZJu 8I ٤AAڝy&Z򳲐(MOz[#+FzxșVr,P$w$ Z`{'My8%]'l.ؔBy?iQ .iBzTlvHeqOQrO$ZkM + z--P({,`5EݏO ')Z.+\/,E}x=UԄaڸd:Q "zqcgfSO7Mrb p9Pmg{v) q`8xHܲQ cSe?%ǒZo#C(#@ F5Yk cLUi#@ ȁ+zGXE;|ڎ^P6|ڗ;=E4}=%gb $!#B8NX&xm7 wu%Cq`K I9Vc&rʊx'{[UU1H f{`E0 |^Lj~>h`)eﰯ@܄y+SSӶ:vNai#H$em2%ؽʔ^)Gd[:RXt`1Y)-Oeu,~6iAj-v dCnt4I3קS^Lp "U7 sAh۷ T #e*VAn"!TFӆj$(SM mYA$)@oy7$mJGm $Z2- 9$ $1?X UQ|dJVQ<(Pf K M>덢fQKt$z ӖCsK EC^$bHU+ƹ1WiDRԯkdܘ8ai2A4 U`<+n⦊sㆶVO"*iM>{d{E64-ϫvlwQiՔn|( ΂Foa]^ٔKmBYwĨ*6)E!Xo^Z hr6mMmp iJ~g!J,dF0N2+ u$ӾR2BYZm `WFCZҷ_'$6[ZY7?lߢ7JJls-ܹ! ~6M$#87Ng%IIZB;׎'[YoԥrcT A~QMso ZڤƂH U8NFs qv?z8r#ۍzA% VD}6JۖͶ/]5#@ܺbMI;M;1Dhkޞ?Ƕ2;QTֵ}H] @+Sq=BY[j ]*ז$3 աNqJ1!K)Cż2cpkcB ?)2ҧ I2!.J?=JBzm A[=\71i'37 6&(+5"lG%=>=lfQ50_j\l:ww@E)nNdQ)|nreۥQ+贽Ed."QJ9lr|M=kNh!xLMOP0A@h} %^lj#4_Zzd)J~^Lrr*AڧlN s4@ʲ%9*E=8U/{u FB1 @7qCUH=\5aūJ47s"jlX;n[i{ns1AKo hANiWRrPa˾%R1ёZO,$_&Nֿ~b_҄vImoIOҋҥ{8P:X$r=Tu]0h1sǐexe/ZLt([S~q*zƟXI2[upܷBPHrw([ɕiAiѲO&{r^"܋_<%kȍx@>9(l evƩhZѼ}n%ʂ }mދ.bwHL>2+C bE:SK7TaE؋Gs%Ej{WҴ 8O?lR#*0OWw$|^ʸ[$ 8-V*|'}SA‚74-3l**+Zth=M2 4eM 풝RJdH| *̼b|P*[iU_ؗr?K7:L^5w gVs@k %t+pb,-Qi w;{ci]J|#l=P_-Tu8BR>]1p1Apa7 1VƳG퍠zUP֓U-o\U MzadJk7_„QaܿH~}\hH4$#l ]I0[QǷ.y5|0i {blvj7z}eMFp-ޜW)4WG +cTOæUOn(Ew9E*0=++Nh<16;d@osJuƠUuBХCƕq:O ;/|U銶&XA=e֘+UN*jui *}VƖjS(\yG 8vlU[0yODAz.,(\*xo?oN?CZOV' mmcxơWSb;fQ m+7s|+}6biI=6UUv2C8UqOMhlwpb7_zT Uǰnq9;[7tȪw_7 uGQ_7I9+8ibt}HlLXX+3~@4Næ9#'KS\lzP4sPxbH>( 24Ud\;Tb*1Z-_Sosbׄi+xwSm#\vő*:PaBi(zձ1UCwlL[d(lv죦46㊯US2 *vR߆"x ~*FEgI;_$J Ħ'9% 0mASրa}O[Kd)I>  -Gm+Lz?~04<Q[Jzҽ64z}q %j>Xй# uoǶ4=STy>lźiXJ¢ iZ;boƬ~i*@ {w큊i.Q:ULD_ 3WJoxU/z%JФp*p 槇_*> K[aIݺcی>X '(Qf.xorS\[vR:xJ}3PCE= \ \*VĦPh8m囷RT\­ Iw^'BTv@2bV)Z^܊‚?'_}CЪSǠzkc^+ $)ThGAJqO.k~>0tZc$8g# a+.>x-UP[bIN61sCjJ*)Ze*s+|~*%w}WU@A%l?U@Hn݀73#ӊ`aVakw^`-]=Sk>i`1UA̝ o!bpbZ{\PCm˹p' =`awʢWW'O--_}*U_qjb&ҸvE0Zixr4(T{'ãL4E=\RRK9Y@kTT}Z{H,S#PNaB VѤ-SBrɩ*b,D}i_甖"#n%J7)N(^\VY>p cރ^>'.>x Ɩ'UX _| mzrTCv|P"Byƙpس|RFH evUPZ<eP^We3m/ o\mkW _u *R\▘;x pS&V! 6 u${u86-!yRiBG;YtE$ Fqf؜ !eªrkmL %!w >'c>8 i❆{2.ң͑؅1l(hˉrY1jQ9zB߳޸!$;w=0 'e bԞ&C<iZwTB>hX#U7i\CߋZi=Bƌ;Qژ[r>dYq=MʁǮV BF4i%EA"6`yFX}8l#^FCxcal1zWpzצ xI# CóZ`AQqq'`6DPdJ|wA^6W BBj:SJ>lO/ib&QsF,CQ{ qlbsEmЯJRz$w\^ B"?k䕲%'yJǍ%PoF6HĭItNQ vcVIeVX^%Tn{yX1҇JؖwQElM]-XګPE2VXjv4U`$,h: E^+M\ 8ar; UHsž*wŴWFFTutx^4IEyU}5apskۦE(ૈ ŝ4 6ĒH2,\T$kNG:;oե5~;`G n\<9`MFpM0#A̕)8"FO6$њmS[O>iЎ*!G)D5'ĖD mϾE /N3Eq$bm};'9-n+l-ʛ~ĔK1+ڹ5W#hIOs+),.1RN±RK]PT+rWPWz$s%hxdxl!EgOL#/M6Il1.~Q @N5@(|c~MYqiɣn ,V &-JiTѥH+ -@m,rre4#FM,%#J""¿*#Dcr*PſfiI##nO.hQPs"ZpB|A4 ̮vA`&e!eoC(?($oPF@@`qESolm +[}6]KNām:+j0XiQ$7dB1-!>ۯq58%vM2,IYˬZ\jc^*V "3Qa֘X$bUi|B֦I#Qj˷ae}'ZkSr-|*CKﭢIJn%Y84b#'EmVԄGG+Mx;@h[xS~W+i(2xAȏ;q™CCZ>;ނm9z`lT}Ƕ]gP F4Y$WKc z{*HdYȓL`ޢpʀP_pFs%xXm!UuWDʥ’}L~X/+Q]kqIin%x)į&B\PG^0tKk0%hn8װR(-C|pqْ& `l6 OҴXI@DIӥ7>ؾc#)1t56W)uLiǕ x$64w z|X !lc,xӨsq;K^#ODRc KGJj--xSY%4RNOX6K9Hu@#(b'ørQjrE#kQAT1qB I5ђ*Q=~_CSRi%O?rS$)4u% !ieqq|Z O"?~fI]}Gom׻w2![`xi> ?1K 5%G!r!ADԯG@Na=H¦vY#yڷ wbXdNϰS@nم!EV>5'#r mČ@6SD̂!p QoR0c.]ڣdނ6qW- -x7d֔Zg!#n T!j=HKx(O.(@ \JaEq-i~r؃ B|Y rEui͂"06W"H:6n9nY'7ÑETe|;²C*NȬI?/vdݷ@Rx#%PҟND1D4KŒ -g2'z vb_]@=~/Z3:T'>>9"-vL(> | # hUzemkESj7bV3$Ȝ?iFQ+2N26Q1+}EweQAE۷|h/l}`$3PN*-$|Q 6P[ِ eL=A_7_ߋ[2JƸVֲM[H( BkApT/q?94loCB˰'1\/cU됗yJ?FyJsbo+X-dT}IG><<#,<\$貢7zuK"A,MG_ I\-P,zZ LJE](.R6-f[$;{'URiL0lVOViFV֛3]ؒJv;bWw(9/S*K",Z*CG I8,boGN(7%f뷶QCJaV2h?!oX銯TQ׮Qjj~/፥U! RUcIpSEۮ1=pn7ƑkL}^ѦSSyz(ܟ0w?Wr:aB{x Zv3' R۶7vU>,nˌy ip*@'e^ȚMbǶ679)\(9gʱKHi8 pze$I6⮫7M.zbK*ώ]h6bvG\4lw8 XtcyxThq09EVW+s\hufnqWPW.͹ >(bڧ-튶H_|Zզ?nAqYiͲ$bC~?h|~gվUYj?v OV;8aUNyLp*ɹ>ݿV].XOO S|U9t(⫖|ӯUOzM*!m(UpVVVwv*E}izlKo&bxL+k ]1‹ dW* m8ҶX 4A=qW{. .:%{!_\6 \Wr~_>~4(x{Sc$It•{[x,/i'c ,boUcsWc*_+j,[ 9TWm)K!hnۜ*|)39rCNi;TഅEJ:+˧L 't[[pRp-yB Qd$M0#NGmωON[O0P:V#a U#->$w?\ S| po&8-{bMωm, 41jahxe\Up' UeS+ASTu;qQJ+7:%Vz0mՉKt|?:}BQtg?iv?NRE㓤ZoD8Bl? T ۓQr_b?G5WO ~׉fb݆(X(7•B~ow9Tqoז#'v5XiZk ~`8UAܿ/*SިYni˔w?+] >f&¿}9\l *ߦ?ƔGsqUho A/W28R/F79$qcNNI1˦,ө1T$]߮-ȨQ!!XӀ W#dET#LiI 4ڄ`c%~Lſ]н⫹1PSfGaAW<&?݊ sᆻce=s<*m}q'nQQ',O])UD ٔxdJn|0/6.X}݆(r#rk J{~? Ԍō݁*A~a[? Ip' 1 o Qs㊬yOlE%V'v_lQ .~n;UV1H-ǠȒڔ}$}QR~~t. 8|娐=_1.K95=I5&QDDPFaVɯ{o[_Xet} 4sc"쏖A3v[͊6**6*ث+pfO_??0oUmZo?.' =UO i ؒO]~mZiZqmX_*}Ww2xbmif+kcDZ{ W;|NplB4".8ULw5u)o*隵[WrJo|i|UzMqU@2jn˥0ZEwv͈Wm;VQcPVƖ6]㕰늯Z01ݲݍp*]1(Mbږ4nTQ}SΝ0K\k*v_\I_q$cKWLz-mc5krp*R,&Tn~\X~Sjm֣xP,11ޞȿ(o(+޵otҚ,|I%5,CP -C)6nPSGr)J&og ][pqq28>(9QkWNj4$P "…%ƙ]l0Zmkv'QO'-X"53#QOpj}L}8LS6VОs4( fpJgڔ@b'|QjvOb0I.s6UD(p*c.˿a{ M"#b7s.ON#U=?3}A̩9|G| ИZ :`SDna \xˠ`{O፭un3'i+տlX/;HFݓ13_D~[ƕ>a?, -HjēwS[]68ӍB/b&Fl+hNT-b<18c|Z;jEfT۹늬*Яw$th0IAշHhHe64}*j[yPGT1_*~]#OsE痿q?a G  #,FN1VS}KHF 9eiPuP[׊v;+Em^5?~]@ծ${XcFhwlml27/SaU6ɿϮoV4-OYzK,j6qQA; o06-UQ`` nvT pu9$)z( ;(!ض*mASd19RTmXrK^s4Ҳ727j;[X#F[.EiP/6!;nJy [ ʿ<(X4Ux@ 8Q/bP1zi$h"0N(^B[)yh:נ)sKwP尕k Xz֏ib**`BiJa j~ZhaDI/#v 5)|fz)L g5ll$Kŏ)Am .ؼpm7wIJ'Ab3zedBԀSI~LRQAKbqBWHQr$xM;ڒI*E602L$=ɶdxO)N)䵈|dSǓR2h>uWr7T ŏ?5m R@c^70?|AĝGefVgV*)D&>O|kTG,ʭU~7ܶѨ;}آT {6(@-Ҝ#'ynRJV3< iZҾ3Ӓ?V1mֻbԽDn Ci .A[^$.*64Mr ++w;Ɲ#qJ(@鿶7j ĥ頀i_KzV#Z)) ȣ~R9@}ʚvRզt۱푶q W[8)x&ƫ2ay=6j.Md 1=- `*ʽM'e$W :DÔA E+X)}YYUے~xm " YG>m"chE(+|C[р 8 윘q2@7ZSVrFǖ5r` b 12(Z,l `hOҋ\y2&iKr.)@0 q6Tu vGXnϋJ"Pt˞F7ܢePV(s8967K/9k֕0K[͚LYpQV}sURi9"b-:+S mqdug~̄iec㑬ӗded&ԌdHL ?YE@n0p֫1ܜ,XrsL3AQdm 2\G.{J?5žK) kgoYJ`U2[HnpO(ϧ ,´ȖJu2DrzWkeNg4YI䏵RV^*dn>"2^POKGscPԜ/iRv;:4Z,g)ȋZOŎ(/fiʹ= an`bߐ؏rBv 3w<0jıM AJ'Tf.ܛfSq%J~>=u2ƜWP5RƕpկV,h7ڕBQ^n}7هû/VQ9]Pر䀾;f5oI|1ml3⢽2,)(Yo!TWǾheq˛R/uNTۮ& Bn` +Ɂ\k)OApD*$ZȔ.\Fǘ䆕s㈉erP퀅E!jDpxl:ʄH\"ͽkZ*1޵)T~$ޔZ7MB+1 -VY#Zd"HNd" hzWI2-փdO-Q8hCh7'!h}R J%l/SH14jZ` mqQȀMhh ZuX2HѴJ "ޭCd1)=XE95(icBYaEGl|eUXʯ@(FB#Hrܝ];)*=9 +WK"%Fony+U",Ҿ{@P`ԍF0T1[ՍJC?3ݬCrgW F!Ṹ]JFYh#[ f3fw0EekONNU%l&ۊJ6U{X$}}p$kĨ Se;umA*wxs4nN[XJҘgޒqJȽ1Eh%փٓsWwvQ T퇋/j$cY 9eA8-)߿/8d<\e%b Qm̊^0iJ$,T%0x>ym iDp+C킬4 faUJJ7,h3kWW(5>*d(Bi"!ܷC؞ˀi%@W F^ֻӦ<=z֧5CQuKR-3qM FЋӢBV˩ۭ~}FT-tz5PE ژcf]BP\oJtBP̶/5H8C*Rk]}RT (6M*i#ac! mZ :I!Ö9`#I%9o~,#-W`T*;"%dqcTsm3N1뀤2 ^J<dɤKY)n%O lr\-aDp mOleߺ6 e貖+/D,w{㳾[]$0ꊞKu;-< JmFխJ#$ҧoc;(4AVn\Eh^>Μ#Òq2rj^`|kma[4qG~rQ$ѫH)0%r 78"(Y%K!r8Jo`-4 эw˥fy*<ҐDgi]β܁6D>5nHK Cu NS4;  AsN XM+Owgs"+Jʶd68ߩ';5ARwl<2_U(YDRH"<ޡJ]VA;rWGfLAg+(0oeaY}b'&3)'2E N\Y2H@enGeAmBFP 5: Đ#QCJҽ1 `VWM!d$QIp]T&7#t)B@lyw)p; ¡4=1;ֺBzc-[օhxo$Gw-RO_$Rv2Hpˑ!  ֦?,u bk eDwFYz/OZ8NBOsH4]j0$C KWbeUV1QAROVgK4F?"K1G&ka8~dhQGZ֤ {,n+Jf#~er6,uژ3GhvH;{#~i^MZP\=RSk4Q"؊immnbV_ucZtՆ:6E,Erd)hg*y|t ֤|_9:qi`D#ēzOݕT2%t /$ Byw CO)D.G@M!AUӮd/\ m`nM!54S!ޒnӔPnqer$Kx{WpkU(E=DgHlU5/͹ ԓJ Ypyhܦ2CCD7hϼ˰q, >Ƅp";uolJƢT+i ,Yn8YhG"\p{.ʨI+fJ jpKD+NUӵ7VhKՔ=aN$]H_)TfK>G=N;[_ZQU=3;fBR5Θ¼w8P |:`J(^LaªWa˦5q1br*D 3PZmj:eq*ߩMθ61獭/NsQC6\i6$U_gQFCPnyGVfݱ.AzaD,kIlî4UxFn M'ʕGN@^S2O8u j; %8j.]V-S? UPRz:esdf튵t Z[a+zbDN?Űb\# 6U UEˠ@Ul6laU,.X\2;\i>'(NU(Ϡc9oIa3kd~]s 0!>}Np+/WVיEa [cI«( QY>f{ '6*l:ztevت,x ڔckj5/X،/(s[ NɰR/Mω 7)zڃ|mQUFjQk0b0Y< U M_8-B;j4OUD챒]<Â/%V6W&Y(h넡[ϲ츛JNҴvʛ2Nl@VU>/LP*I M1r:l1WCn>#OL UEAo,Uʅ fwl*  up~6;tT *ǘb<~ώ4`UD| \ҁg HC&\NUu"1J,ی)Z#qm6Mob7s\r@$m&,UR6^|k7ʙ1ۯ)lBSw8-m.}as M &Oy@R~gMEq-*(tĒ2*Uy>6,%LP/+HxY'VA;#{? 8퀠酊~#n.MXI_ۍ`Nh0*_[70: m- a(mm>&h78Ws+v*R?v20:6Vv SKMo~aEs{-8ǔ TLxh?7W?>3PnƧ V/rNz/`TD6`|M3S%_-<1U=éP]Ss\ N*jo  `EBm+RGOp 4ucBxW9O&]bK$n(F=1-߮@H~{ccjli?I0*{~swƕEOLmpGצ%`]' | ( ۮ!mAK|))("kH4)c€7xaUrݲ]^qn86|0M-c*[We4G M*Eld?Kx⨎"/vǢnA,z`sU%$r('` h#?'v lwNw'1G5Sܼ @Q@Bl ԌjcElB&`WO*`>ᚡwqV9>ö4})TT ?:??՚N9gG t]v*6*ث"ۢЏݳIDCTP,+PI~HF+ݰ-}vR@locA!G^b]i튯O˦Q5+S+8AF Nw4O"=[X]WG…##mWl;4h⭎MUOaLP}-ƾ)ۈNUSA'0*: W2l!;ceiQ`w8xI_ϲo_V*`>y>JkvQ b/rLxĥ*Y;1N u A7?pR!rmlr?G4N4Dn(ʼnM~H]DhV1*7e~Xcy s7.}ƒ.thk +PH#q#[AV#m289%'?' NЃJo,Ӑ5SЌr[4).> k !G֒]mf2 -SV4oqUMZ6tƕPh<2-⭩TTlZi{58C#m:Zf24${X놕.qet[UbN(CrhcGªBF+s ;F0+z{f*h %O]W*uY^ J$SGWzv+sUSweGlkK^*-\aoUBWP5") -)))f;x~W?aK4# w VY MgS߻$>h*&Cqݏ7?兕&Y^.{+*?284hb2qU0\U-1U 8ہdf* !oݖ}j lOl*P֗(g"4쏿PZ3?%i {ۤC O\UU\*OZȯL@}OsRH sSW#hs{b;ͺ#~Uo5=˷}+>#x xت]˪'M,"iOUǛ4Ўo&=6N4GxeS]̑E}b銶7~8 UV:PVrṴ4qN#U&fڴc3t{ohXJո ŰIXWx }%ph>~8*mꊇDywzM3~"N *>Hm#PGJz)[ }'(8ҾtN\tZ}Yj)qZQNm hZ_>X"rDrqh ^m2TO\ !^Qk2 H`il#+z*C"fX|ql8֘?u@ZO[f)5qi‰p 798ش%,.ezR7u+fJȍ)8)-YHhL)*鎞""ڽ5D>8M=P0:L1z{?ժvabN,m1;M^wFR~65+ěRw׾8&nƗlӦv4w@ļ}Aڝ~y$-$vXԁ}E=ӑܲ\E{!jO#JFO!"xT|rH+s.ӐT>#6X}cbCg%'-1$!^tTׯqPŇ WH];8ӆ؛s 낭eFN+U)- Pȵ_Zj8(LӀ2au8TGHrI 'X e¯4ݴբcH6y\ L uyȪU'r+HȠꈯŀTwhRf_|pLws2ƽXIR SP;ch#.:|EYJ/{P>yz0ڽSZE-Z*mX'Ջ0t;*Mlo"TtST%CtRmia"|NeD;o "\TmoCk* rVS/! KB =H6oz FS- GƴiA% =xi+1$aJ՘N^L)@*bRƋ' 0g@*@! $UG/Wm-T\ERۡLFBЧ5Us^Jf8ٹTd+@YP?-2@5Y)i YB`{I)[*f˼u%ʃƟOÏ iH ($Ë2R ?"6,O ʹ9bHTo޿kY\CvM>B09qb >Yʪpjh> er'+M-JpP[ x"1#Ho+DC>>3?V L'~hRnߔRG*zV"+E[<S5+ȼ" 6>-Y8VH ed/BnqI;@loUX50-Ɇ3ntO@`fS 7)]TN|:-]28`H5!9$CEԊv?N-mom4@ Zx* L-RKujRM؎8QT?h/S8s![M@KHG2(Ī -d"H,$'Z`{ª }BJM\p _$"r}M)b3YsPSrix `%SS~)m_NLJٝAaN>5y}k&HZ]5EV$D ԟc=MJ2s]Mm6f)ڴܴayq ('nK$⼁_W'0T)yI(1;nSh)99,aK5@ghNopQJ&D`1 P7"z`ۨnvǐ?p\ؠmg0$V%}BI;4]{f.0R^OIXT!$LMeE  -RevP6ŦԚDH$ӯd!!ӑiKTa :!jzL6TA۰~]*ёA|2%-^ *ZŴ7'P($ Q"]XZcK T|Q%I'X巿E2Y=.;ێ ?jV0\0h/txVg H;G#0kdNo亀ĔEk޵˽fSl(Mz"۶ 'cčks.niNCyK붸ROA覕`{)uUhMwrF(U.%P|@HnXh Кv` ٽNs$f!JOqAl]$bǨ#6|hF&U@U?ZΖn#@zul-&8HoxƣjAL䢹,tQxe_4 TfA~#'";LVJiɑV_x-8xećhɯڥ>ׇJkBYBO6<=VE)܎7˷m9k0J;"A/wbXl=+˾.8xĤ3K#c6rhONA͗+}DsTuiBGXxw!.Bد Im-.d %AMIdTj6@@b(S~V+3"O*)}h"rBPE`4Q-ۻ`xq߮1:Lr%L8^ ZJPtNjhZ oPJ?`}F^7UTO\ Sa/^s|'rJxĸlj9H=8QOj{z13ey]a)GmMΜ?$M6fݶ_~n-(XO\nænz<;ZAݾX w9j§Rscpn[/sO ;9N* 鍫K+vJ˹ҭ$i犭˧j鿿eV1Vv6ߩO3r6WyW_˦*a9\[h:qWo3r'v1*˭:J_gbҝ2K* ULG낅E\l*-`y_azSݒ8F'8i[LUoRrfS2 TSRw&9tq<WՄO6@*W#V,??{{ >'.|; UˁUevqӘ{ ⅯQǻnpLO›5qU @RgaWHl@2T'8.*56j|qKwxn4hUQ>5TaBLcK]662;r?.U9aGgcދ ^ULcszf |MUHa]0rr銵_^ Fr4T>J5Hϥz"_ʿcVOQ]>nwp3;ܚ)Lc $ҋ1l!AZ`B+` G!])|qBm1E_s*u{W/ڃZnH{mi ew=? R+clˎU'`UlxSxUAls3Ajp)I۰5kSp*-æn?~Uޡ? )l*;n_EG >[exiU<#[bn築5o Jx*VZTn"ࣩ8XmZ;byPRǹ;F?K45QְX!X51-jL!!C]%Czg>ԯ@9 K\g@Iɒlw)Gxml6Z ^=Ϯ` l` ˤc~V+Kz)Os Sm\8֓sBp;/|eKRAqE/ݱ܂}8y~ћs/,@SzaU=\@튴þ4պEU;~컟q;ՍNJe6\u<~PΟg=2ž=*\xv:FpWiI`d'@EиcEЖ^ g} 7)h}i4y.O8zn.ѯC-NS/隤B.U; Ui=V[_RMՏ[r}^`;cI]?F87pZ_?棜;cYϓ̋쏖A3v͊6**6*ثSVi;#6{O*yAB?nJN)OsTo^~Sإ5 L~[bG`\PU+め,P9Ȥqlܷ4o.b03mZmā…~#d=*T0cUe>|6*qh&!ߎ)Skc !HR@f,zcJ>+=߅[0 QF*~“rbLl=M1Cq]λ~ ]Gbk~_*ݏ4< j\Wza>~W튷}g,)ohI?,xUo?&r)>(5MTh;&qJF,i+̶H+nW29S~- 񙇆jTmZoe cKH=pR.['u'|BhX*J!Tv\O gw8bgSc%>-[[jyloS㊯4AU38; -UdTq_KקlJN DWWpYTڥ6X6;l2JCV0h U`Pfz(jߢ:n5둵]P 7?*zZokzcJKE_U1iWXm𪄷 ~犬[TcHC=֊9|H78vK/S~ܝl0!ޔ0᥶[h3p*g8ڳuTG%wSai鍭*-?k\U`T*ƃ0a[ZH_8E8<:off$0Rۋc,ۢ|OOA_kv_ 'dyCso4Ru{뽭bcivls^"Pv<,TGkG1 p,#;䒚[ih}yI늢 lUʞŒ)e ZP1EmT -:b+4@XtU_n8ڠ)V| 7_+U~)9|(X;YFI®Uf+O4ʣ~>1;تZn~#LU{:? }6}Fo~SտJsU\RnrbZcWªm ^+jOt *p*L>qW}d}Erʻ&rMyY{aUx?*|q< M: 5T|𫸻\r@eT~'7U%?c<Soo#ƕA?ϠǬ$P{=Z'lIJ}W~ w?~8}3kKR~Ovݿq)/\+D\iQPi1+;NvKCۣw=D[T][3&>N;zB4D(xlh:aF۶0VX+ms <|(nAD?lDȾa9Nb,Eӑg*}O|w|Giv6zc! t^wMHH,_8rI >N|.>1t?:ڕFyHSZe['e)p‘Jʂ(tmDR܈hh/+s5d[ZָGA+E+Nb۶K+Y( 2h~%o2l[o!zE` [i{qK@Q>8 -Εl{qs |I'bbWz)Ty~l?v E )M.&[ᢕ6`y*:*vKj8Zb)G+;hfV~sB)p|&[C*)WLZ[VdH/jV DmŘT MTPMLoU8m+ASZ94އ畓ܐd' ^#R#1f*kCX#SPzK0h;3mHI8sv)rqP:\Yu^A]v*I؟6]#2Q]A<0Im6R}0kBi_pqb咼TO CHWTi9{4iwVLe#5r+a !v fT|Y ;',@n۹\Չ1S1g9x iƄmd]A Ύ:T HAj'#ɮ">";cEý168틫䳂\i4EE1=;'M5Q0hF8{9,M:}8TWU(Hܒ{Džh z{e%v^c¤4/PH^oR*ꚤm7@W# ]M= (In=B4a"eiI,U Ge$dʀ2kHt@O30 UҼ'eӢ8K9% ƈI kqU5 ""#ɿg珅n l% iE $ L#]*Gpѣf>$#%bH6 ~-J*x$QX* k?wj}:HKu<#͏RbeԔ V $C==w?A4r VVZ#KqH2h+uSU"7ENǵi1J #f$e܏r6/C5Wm&<=`'[XL ;vzp[):^esaTnEkx\YGay/ՙJHZer-6B&yn`A"J)ogug2*o2tUx'7QL)WUjymإRvڂ iQmւy.J1݉ .R$Fÿ?ڑbP<a?IV7^#épWxr;h0J*(KhϨBM7W=y1X{_PϤB(\(EZbim =A tGpJllnBC QF,!y8hlj+"QK!=Ƞ͵qۮGĜD)T7t[/]QN*96@IREn*v.-yMOJ: Oq6lppA<|SnUiM/vW$/^6PRg, TX=@…cZ@6p-/H ýzf U*8s;u&߮?(Q2>8ᰠV1>_,P(| Tf=0+d 4 u O_U?I+*Le's*q U`U'|*|; U|1WS%ml2ɧLUli'*T}<*٘]k ,!'mi!T`9N=U-X3IvAd ;aX4;oXAO%G"PPm-NQLi$*ʡ>4 +Pz .fSN WՄU{„O] ܚaTYdoFV ).kVIp:&> K|k8w8U!'1iU?U)-]fW-:VF"隀{Jbq$U@,qJ2GOцƖ"b$dU RJH{49;ŕznpMa]'&$LV~cGj/7q썪QI{][QrPmn5\zpQo ֻyǡ ۛeqo6J*M?i~٣0mB JX}yS VreZ"~bNQQFnX*ܷ;,Ug_SS B9f,1ڿ,RJkoOT;ە[cׯ*/ ]"^? } Tw* xw[jփ1xRh>1⪉ li0**8i,hWo׊Gn[vmFkП `5`XkcRդ%,й4OO zH18)SJo"/_֔t,6_A:ПaTFf5 zi鑴Һ X oSj1HԃT!B!e4pjs1o7݅RY{ ]{O=1XA+…Fvzc~z)&vQu78ڶ!efjmMSǹ?;.ߎ]oZ%IZ0/W5? c8Bh3'UkĞU.gjҨ~EWEz'˺1q]Bπ;`CZR?`%O pރ-h4AbOp*q Bړ>Xfc*" qpǸ=E'?Uc=b{G#(X'7)]:RVb슑s$;.Qci\,~)(oiW >x^ǘҴV`}H=p%*WX p!T/<ûo1U|XVв^1AP/HCcc 8WfEwcgw5Z? +AʋEqmmd?I'=Z"T*|q*cF"?T^`cB$?b5)\y6>i;`U@ZVq>ءFK\*km@:b>&ݿp>0*Q1 뉵6QAi[⑫.[8{"Wj[1UUOl![]“KFUepRǏ|r9%R@XO|4$CCMv~Ӛs=!}mi .sHz(ekO֧JiIlB[흱G[XG|iSETJ^0)TX8NT6ae:\nE?E c>'=8ol;x~ZZv "#U=kq*uTG֫XV7#=w: LUEٺpR oח_U+c٫Olw®ۧGVY$U'ytL$JxR1FzG̚ ZHgGjv(9Xg~SPo)(Gor=`'Ki&"I"m_r;l'tYۄH=?aU)G&>Ц%"(.rKq"`qYPsʕ)\z.novv4 28vb)$6eY&km,`\XJ2+#$GTw8x7=|:|2C*T1nGNIVwaZӏoޑfO?r9p#G9Aj,~|GIv9j'Ny[B/lڱIn;+dpoPr]lp&D`n:q*8|G1IaW,ia1UYk, CaU=$,Taٕ^Ӷ.$%AiVI\lr{eqpX?8|TУT%-`R5F昄V&^P)?[tW>"_Y{]KR^<89!YOOrj p!G9O{,Uk&Aꧧl+,@'~YU;4nMi}۲Ӊح-Ln?"+pʴPq%@*PIIUM,D x -4ؠT4^ nf&w|FL[ʏB;ٸ8Y _|&& IXx.}x%g&[=TA>.iiVrZF)Md"j}HB)Rp<^c)K Z~C4ΦwNK4'H6S! 킙U RVFV┢Os@o^AI,Lz8 ĭ[hنޝt3@h{ k~҂8Jk2%=G4Je *za˦庙UQCқAĻ$+BwSDخpx=4 ѣI*Qx.ӕYEsO&({Ҹ B`wyK;GEuݤvLCPPWe?,l<-=WJw\/G0+Mv~[S¸eon/B|C146TOS#q  :7D QޯH%OYiy.&Sk`"5⬃%8Ԏ]4,7Zͬ 02*% lido@ǣeR;T`VF^?i)ɍZKOs$݀Ӑ3 `-ZoOՉ*Rf)ҙwCA+su,HXX[[eD0SP:Q{!tҠTilozEMUbD$0})$!dR{7M*FXߎhaJ8VwƄZK,we(yF2VNm 9hJR2zo!5ܑL bhJ"mE#:HLK%jxnU!Ld2Tb9GHJt= +T7ZZ f?Q dR1x3O TT) Nazt X񭥹9Yww)ZHQ")i^?8&8S4dgP`۴\q1}PFvD+F{k2 zKH%խf!wif[&w5U^pHTVYRn\p-;}6Bice$J6'Y>Qi O]<֬əjY ,]V| ģd4VAL&v6*HJ"yPN*WIhŇ\Ze,* Mp㪂[$XJBOs[ F)ۨ?>>*AOڮDW;UKaCщdS"$KIt(B<\Z+,\yQOýp rz̹%!ze:TSL2IF#!<?l{seR_0G ,WEM2<5T=@ǀXuƛ}%! ԁ #d5 " +C5fBuȈEak|'*ᕭnf1^, ٥vfɣP.>*Hc"ì/ْ&:퀭n"HVi LYIoTxԆWa? DxSs9BM{`Ghߋĝ{na(nG;} dr| ?No™0hn/}xbQ?`Uej$Ն)!.w ֔+ms㏂Wu%:ߧфU& 7#lz]#*^dAlV+ҵ톲3$'#}D UzzzKȒVG=_}+[0a ?`tŔB'j5֭>nV N6H)(=*?Osf ?V{eĕ`:6֞PS[[jYbQED|vnzrƾ梵?\@:2*)J"[iKZШ*@5=ܓi]S;Dެ>Ż HvyeK~ulq0 WcȊA4 Vdz)ʛ nVOWrWF$}OuђyR#ʼnGzJGVGoPhfˏ $V'=vpX{GM@Gl1)DtcSf[%dzV3Ϣ0Q Ѹ63=If…Qq +'`=CT9߉=6tHJK(-*RQ4H !5 n+g +B@ e #=-eyN&Ǵ_T-ӠdT"@w8t?6"'\ "qEeXLjR4ilvԑP;w Xai_ԙ0zU?g Ɩxz#m͑iyRMӯ&nx}8l OU&7_('Z68]iƟ-+^$n F`w)w'cP>d ֨\GD~A1&`bȑf+U@Wj;c/`gc }?#\ ]@QPiM> )Y!$V$НDX"K]" ,w52r[ælL G{K QZlP+(<0WM&"}@-TQFS7bX_mU4v{}@5mc4H;G^C,o<hC.޸|ԔKx41bV,pmq@XR+]-4p-Sl%ethh!@h@پ0^7Y`݇e# l=ͤM(W"RV#y⮿*PL58#P@V#iE/"$7HPO77͑EܭRʤЂh$OReVoF:oS Ft<(>FBDscjO0T? T,N"❾O6M6= 7`7Y#PU+^DrcJ]$r%Pv4fJ~eĭ$Is{W6!ų|=Q'E 7orWܝdoERG,J)P!;ߵ md>: ڟ$76 8JVl=(H=XQ!,\aq⋵;42T:a--;S:(LHXt j1K;lf1*,x5[D}G (M.-=4%w?IPM7f)5 }u­G Ժc,=Ow;`T`~?r*TߧL4E4m }q{ S0Zl)mw uVzlB~'4xDeӧ\GAV?OU0!P7a+:v'WJe冕dpcZPbrcjC㷰%rG A'\Ue+qV}>{m,?Y`,Nb+?qt%|MA$cSpTl6WkG[ŕU0:J4ʸNN*g FRrd+ ;?([w}~ʍUq?GՁ|g a1ısQvKHV5>k( \+kb2viV9a퀩^a\Uibv\P^](ҹ@up%Yjx톖)sX..UiO4n1UPks-:aKEup!k7l 6S2 Lh[,Sh;o]yDҶ'aZ` *c"bF@MO==Od^@FU\MtyGsI ?stPdh λ.*ס}'GjƗgp?iz| t>h?,T^`soP.'۶42g+` -w$x/qkbM%>?َQ]Aj5 |N HTп/P~Iƒߎk+N}8J]ۍ]=CodX~-8৩͊H28ԟהn?Os!5Uv\۱s *٢/9|{ LW8x⶷Ú\\ޟI銭cdSmHhy>1Ȁ*I O,B[st} 4}sc"4#LݺVb͊?*6*ث7IDETPbi-!a_7n%d~9|I_Yw9|>Uiw/Aj1$fO\Upe^}9`nq-~C,:BM<~x9 *?aOmsH-cV繧7cSR$-liGA\Va2Ңڪ>v_lƫoSƘP;(b3*`>B^~yDӽ0 O˩=q@iGUr} w}}U4],}ƕ-P;R2W6æwz2`^WEy j}qngycO 0# 7RONmEF?Î[Cw}*ڍ8C1UM},jMU{= );!bo ',G]Sk;-V|l|R0ZݷƐO\Uz>.*ҝM?i-[1/X_347>>8XaJ౮rxOqN{ p@:3#6㧉A*Ǯ| 8*!k M`!nnwhx\ā1IhT| o@Us nwDbP Q`'ءBK / v-Lŕz4bwl=1F; ^ UoEݿ!\|)._8gեv,vC/SqA4Ǧi ('a޹gfx3)VcqamodoF-ݿğ7mRm`>yݻܷ{'큞rS;䐘Ab#_M@UQ10&/\+KTUfY:}-M}mAVY/Kv'1@vNT;L_\,Nw(ƙ(>xUp1%L&m-F(c:q%gƵ UX%]1.ETBG-2, {&ǬJw‹P{d#ΛX!cw9[|J>,p*^xwcV=xb27sOn(Q3"ݖX8&@o U㴧Pi`UxO3;ȥ_U7:oUv([Ӯǒ+/-ם'J\21Wjp(&HrVLߎ*6*L eVO5ui7JWrMP;Jtď/P=4f =DKW+^ F-Ō\qe6c.'XŨB.-ےƴSޚ6ZR.N qj~Iɿ%mNd}51qI ڽevEnàsJP|n%n\,´n"{`#oҵ& xaemCC]ပᦉNjm8Ԯ.hx hFp7xh8e-۲"B S׶ kOa۠ɂR%=X0 nZ3؃^ثB@#)+Ҹ+LAfYV`H5=/挼UiLmܐ\;4K7vCP1jOڛkpV /BhG/^ ڿI\q_UzY[T; RwXF0ҝ b/BBk!HK ۑ -wT~8zV}:D̲՘li QUqi@V{ⅈ^;NT|+2 9˸Voҟ{`V|U1TC+ H2u@|Vhن|0V~XZ#C/҄[8d(٪| ml8:e#=QeO5?d=[<(I5ñPTjĻ՗@8 [%= "*+eO6$hz Z\2TؖGXZ R";y LG؀n8) I+9!! xbجr4|tFð"MSWr.`S+UA޸Zĭ6ɡ-"fU^`Yۺ0 "WDңoCl ]O3*$C10rQ*Q; R\0=d prI%EcF# &ݍ{(1cbJE6 (;}pK=0v-N@>'~K㗦Tڹ;d+o/,2RȜ}reit^FLJRB8XT6۔|C_*2dUZ! z`/.ЄS_+3H`e=H .?v 4qDFjp 7'QJ~8z*JHڣ|Ί>Xv)1|jъ'zolfQSҿ<5f}&:F=H8]n`&Ԏ=v5$#uMɑ+"ƽplZw'n'jv[Rk]`5 o|jj[+G/0FqH([ PŁfխ(GLP FA` @v8")哉z|~sb)NVhH:b'a@kpAI(v\mi; v1i,k#> c\APV7u j(cQ^^ĒH?j@TUFf껀=q;FCr&jZlr Kp,I Yd$UrϤHTǞ{ J D4tW}) -$ O%"Js_bzpGjK!dkBʗAlFC, +q!> [Ƀ|׬dUk1;9qFD'Au8ȮyQHGl%-RBE2qr֊8ǾkGH]aiuVaJ|ي[,6In&3z/L{IYdrߏ A)Vuԗh6pEZs!>>5 ƴ^0TU5UHcJTS#oUȨ'Q7ɐL[|/7@L DomC<PWhWBE ;d(* Zb-$#`'R""`ri9*ŘsH;#HTJo_n?ZuFS_o̜`tT~FP¬ zGJYKs;}aU=v=qcoufnX;HHx/qI>$V_Zd4p*M7a١c‡q*%Eln5ۛXz'j~HʷO%-qc4۴A/TWo;[gdlzIJB^Ic @F͎P"(uWc~hIݠ,:0޻xa<ă_n" RvM4$nrUhS:^O|=4.ۛEՈ-Q1EܣAU?^1=p^ U#C&}beD*"n-.ڻsӧQ>`VN ZiU6||1E2W1Wn,SL1VZ:aVNa&~Ur[9G|2^Ҭ2zx<{G5+p{ iUޱo)W 4ɳSMz.W Lk}8lGc -~cAQ@}1WEHsonBP0\ G֓5\FYZCY NEZP8$ m(T^+VvG~ҷzl1 e|_p*$)_cUOAg*>8}%J[1}Pc~o4ZE9l 9JHŐIBMxvI?xI7btTR(Aa`P=ω2TTyI_.'BGw8-W\i {V'sSTy N… _xcz~'(kJ􈟱z!}OYaH~&^'si}2NxF*G^Ȕ(\Ab১rnqon)4?mCSzB? y9I>퓦HK(,е@:ǹċe=V@~\@P|N;m+Kߊn'|Mz`ZWH?qBGͿ ij U~&ϦsΏaf>Nö?2/AO>Yۤo6*ث*6*ثs%b?D4K?=}QC6JEQL3tkR\*@P:V[O(獫b!ެ}cKҨ7ʭv_.|ɩ SJҿG%G\)iߧmUTPjI'R)* mZ QkLoX THZdcթXUnj7c[ |(3sV2#ޘAc2?f=J_*WE#,&(J˦*zu|ʽIjEnh=DZt |[a/dT[{h2?T+:Q! c)X" UIpܮK~L\Ԃōpk "U_ʡ=Nһew=rQGmiWd ፥i>Y\!w|nZ3):|NW!|m[?>q/v UXn2GӍ*f[f@`c@{ckjm9n0*X4Z 7 +O5:ooz)'vE'CjqZZ}V~.o6/[ Hv;ѭ;ɅLTgWn#O So'e.MZ\ƘKu4JF*7>'*z톕VeY||UD *"Gc|U\KɶQⴹm_UV0>6銪#m6l, ="b_jgU MvhnrS*)m܉"UTxĜ+V#(pג*M*Tm-dwn)16b~(buq JE:c `Px}UIfI1'ߊEOaO_a-߲sE0+lj;3Ӯ<(C<۞/bzr7}\{`Ujn^.OL*!a}6ip0Z 3'J͆=X~PUk_=cc*t4C>:=aP|N[Q{#ۧߋ=/47 #R0ewKn"O9}7+Jcq/"_F[}:b*.LXs"[¨,aqȪG,~C^Aql=(WrqU .iAgrN6|) ;J׬g,P ZK7xbO8#z`ELȪZtgIkW;SOMkTC毆*~?*<7'o6v?foKt'sW8 ﷰ*qV:ƕ 0ⱷC' E0~A$mdӑ%lμtX]drorйb69h3Ҋ⃧\JI!kCHy|Gi nW5OBrABV{1z#r:dj3n~ڙ3!nj e2`t(} (j@'lN!Hѣw,4( 0(XXj XɁZxҪ~C-QH̯V;aAm`DEw_=)(pvmKf5A PFf$Jձ!e/bG\imR%p+=VvqRJ]ē/l kU@w qj;}8JxTRNX9$QU1m丐zy"l|?Us>eo B^5࢛4TbBRIsb?YFl6漺@ vmVJv?F5YהJ,;$ CF(\7ROɲZt-UiN\^E?,N'Ten]ĊV"Td 偭 UhC)'Er[wSԴ>쫇B`fA@3KjlOӞa*L짡/ꪈכH5F= KNORyRhJN UUes^ë8"O7ru9S?lci]w J$jzWA:pERu2tj į.JMiQ,po?"ȓˇmR? yԭSlmWĞ]8EW\7# +Hn P#%)$dObZ-haqwe&OT6$3U;T-Y ` new@M7=ڤ6FhX4ȉwPmR,DŽWSl XgHH~

GP܆IPfdU^AT<@o+lNeڥͱ桫P|*:~Nhϫ8-ILlXң"@RsDÌ&Nj[2=2Ƶm-dPAԏyfyd3T 됫^jڽq.!j qڌ[ڪ$]8+J:|MrG#ic*J16 ՉHoaUr8uS| qq`rd^OC4F؝B2k:w(NلMeQZbEy*͹^[xE4r:tok$zӊ{ &4ji gE#A>]Ovc[B Qպ*[OTCna- aD違Z+Zd;bdAhw L߻(r CCsnHn#%2 #^i^^- Q҇)DU/!({$stYpL v1+e}(yQ JD$QA?`KUcGn\7ɝҩeuGSS`>$v eF )]꿬` ,NQH\wOP C}6sUR 00$ Sc[eu Akp-,]#c8:I!\}~!sfWS-+gn =Mr2J,t+؀?g9tYCۿV-!c1;h&:S<)b&$TpcmULjHB28X?n,qWsLUׯn`ƕwNf>gZaQWL*=}s]ƻ4[U]jWV銴[|xb^x7LUE00UũV[ۼ۹=0*PES0ŏ 0.Ӊ;a^+ݎ}J銢BxWzl;':X]XBwZiU6lp|U&fnf5«N7}U@zsLVg^m ωVUx#12SП_x`aEP^K`kxy!9|OWvmS},ni~,{⴪W\Xڔ|Y*U3Aolv2V{zª3?q@lPa.wxEɰ(8Ag"uKpx7cvi Ѹ,SԦя_ b,z=RTtnƵ䴢QFXڴLUx GGsnmԯX&sㄪi7}џs?lpJaRT+p(\lMm -|UQUc .U=3Pa:&ƥⶸ3weO|Bc^f 3yH_*h%qJ*NZi$7>f mؿ1ڵV=5ip,-z֒gf=:b,SYRzeQ"ƊE- h'(;m4u?F-X-OQE(4ĥv$[ k*iIH_,簧bAB _}frv)n8GݶsF9ii>m-kJ~"-cJܗI☥tª$wjh( ωe'~؄WQIo g mϾU\_Ov늯Uqa㕻bm\zC^1JT?k*?$wa/3JnaV}q2ŷc1UuAN6yW}ƼUXy}إEe+J?i\Z+RPH~_ H~ȩ=0.f:(F'UqTm[V S׾ ڎ+бGCDD ?o$V5'rpMPQG1NJUE~Н j5=V=W$_pqb9faJ刱m'ߑ%Q n,e=9O rLjw 7c4}@KNyCj~vJp~]Z,Xs=faD©I>ޠQOB_3u­R<&*BKI ^/4^R#/_j~*HO-WS 81B4^;rq"dB1o1??EA&n#yWf]*6*ثҒVi;#6{O*lG盷R*} vW/|_278iƩ ͹<U<3p_V)OmU$߮WM>m[I'Tfܜ Ml *fO*@|s⭙ E)/*&0a`UHkqW#$'efvAƕocӮءOmӦ)n\wm,摩?FQmlַ  iŽÀ|b{y{O<|m-ppO9Ҩ>u~ L·p/p4fcV%S-%,$Aa_&Bv&]- )U歱$Ͻ*ЇZ~9\tZ]p|w=viTH~ɲ*|ƚYzt<(D1UDdzȥ-cIgiQ}\ %i uj͛5z0ۙBgo\f6Do!򲃞`Uۙ1UND6E4؄#PbMkP֤x`UV'e츭8wsOOo/l1J_>~R"|n~1.!u-B1n')zlϩD +M fagDp NOL*Sw}x⴮|iš^woi_f=b'<}d' &Q}XU|N4,IҀcҀaT9^GoaQ^T,ۓLRɷ&L'Hi *-XʳbeS]͏Z|F*$aVhqXrބ8-:UM3u9Fh8DSb>_=srU~Uޛ  bx8גwUcl='l"_X/SҪx/`0ZҢh1U:X0Ҭ{f^ï\PeћUbwjz[Ws&;b\(o&= ,|+o?]߂NeebgP ¡kߩȝҊ]1r7`V뒵LRc^+2 t8U#^cD6.S5a1Ze LUMe;TU'f;OaNSvQs.!Ss‡,A-V=sW]ƛi_s1Sڡd=pSe$R{丈rN81;aEr;vHg+OTߑQ\R*Ƨ+`E(`9%y)dm좜՜0nA eR)@4`[x7PC֗<7qYd$$ +hbnT5\<27h4.X 1R3HkQ%ə~]ƸNX84]Nl[,9xQ~#I 3E0NjK iqS$ʼnROa7^8T,jM>dאV'$>+'S`t"6ZǾHJK^/PS' pCP(NWRUϏktӣ %L;SI/".Yjn"%m Nǚ@p+GL?Z[|iݺo#s1b?#R CFG8MY:VWjR$+\gdQ^N?VҨV{` ڃ׻byE|Gb*3VcQWŪve#eT h`eC6ڝ~ԼT0>J[·*ҽcsthЊoa܂qTwRMѫփv⍽@R(܌ej&aP;C"pkp}5T"c8:`k%F*JkZqoCq} mشaʩ 4AE@RJF[]-Y; m4 +3=2tZI O#1]갍;Wa\h[UU",LDnrRqM4|)oppRxT ǀln'': KMxQ*]UpXCN_7K.6 uԳ?ƆpWUm7=?DHTON8רzeleYvUZ!q0IgviE#t8Qv&"<%*=Q48#wF#SB<=12ui-r=6 d&l;qhb!acֻ QĄ($`Klz @MA5ܜ%HuK9>ȥ6I\R0 oQ-N:%։"T/m6GQ% ( :fHM8@& opcБ5^]lFᙉ 7pEGpe Ei(ߵV7 *G`hji2or8)p$ޠi$lS:'zc+\ƑaeQ=0KC/e$3H-Baq1XXCSc팆mW0n5>0<@X״dr;ޯVxG^#TGY40VZU&㷑܏T71~qRJ{#[nM(/qjxq_ ǩnU2 !jeQƆCԧ;[({!S7'qwj9c ˖$һBFT]zޘTӭpHZw =k\eZfcRRnq"axe\i\7+]`ZN f=h🚐=0y*YO7E1U YjOlUJ*jR8@O@cU7we$wѢcvcQA 6đ =A3EZ?XSLOC»9=I ν80˃'M?8sr*Ӵdׯӑc aԊtWSSu:Ud-mEѺGL(TG?"$FJMs^H8L*p=p tªMJW}]+[C:B~F:Ȭ }ߒ*X*H*v1nRE8M]>9d;qqpw8HjR i*Bީ䴦à]SJM'wJFZȎS;ma[)wQRJa؄Ye!µ` ]. ig!Gݒw$N Gp!%\V)w1r (6_E))o.ͼq(!%w-uH(}p`zJ&xbPC~dᠩ^[wʽnw4S0EF/ӈD9kG>ofJ0ii }hՀ@G`[cFAM$\o.H,OʧԮ}9B@M`SJd*Ӻ>Ғr9r%WPR@آ%)!x gs^te\ }$4`ӎ.!)%slm=srjc܌g-y-*c؂q"Hƛea#x*@ RC16>z;Jbq mZ15zV^i>Ki ) RkާKIjH%tܖ1K$w#,+A!270+nG=^n"OZLb,yrc2ԨNѮȿڵ>ށE)6?b?j\koyvyJnmr5ҥE 7ñRwhP[#U|M~OUi%eO֢P@WB؀#tc#́ϱ8dLww.)qcᓜIRٮhr< 7i$@|;#@@T1 K˻h%>A6F0Zg=+W*hגܣV.dxjVEpM6C%l~ :΍ zeWF(.KqJuR:{c?oqSS8iQZl{fpYR"U5A=N> !~cVlU{(Ec(QyT 헲컶S*|OsqjJߨ#ckS,Nى|BOEĕ\JGSU=\vU*jze] Wd CR}rs9?h<\)muma.H/qUT)ceF*j~&?H 튶ƒyqJ20G 9k I6«$H>,>`/G|9 װvꄲSF=VcJu8O 8~Q?QKL_zFL3zIޔ(m#rQG}8JH (q"")$8A-X|;/㊪{a!}{ P䈑ɶ8jOg(X cQ">km%?go~v<Ф;ynhp24O!Kn{ᥴIp Z[߰:A-}U:nqBb) Dڇ k?  ÏlJkPu>d6**R3*x S8*\\L5zWv3*RZi̟ E$䈆ëE E(^]Cdf5f> qe;CX?y/Qr4J$ZT՛2D嘳ܓT( !HP a%l1JPkf ߊf۾V^pW0Rp|xP:BI_Ol*!?S7cM*"A1l6U&ݿ ;\4s?18*M%~s)$UęQQΘwcE{UDvm1v??vEA&n#yWf]*6*ثҲWѷ߸f~g¡XwnGmPPsfF.鍫B:}WoJU)eOƕjjj~y\lF_X_GєOo]^>0sn~"b73|M튴8|jW|7OlPw>'M:TBƗ'#VѢE42XAU3xUekX Ja훑8ڷs@ lp/&(pZi)H능3y;P>;;ea1R+̶ў9eTAƴ_šVӔ~oRp1v=6ǚ8vwðVv\pji|Ҵn)UE#RkwYSiQ_BNWA5OAw|G+Br mUkbilPef /=VG&9P\`,^ rOc.aY׋잣->HWFݘ OђTSUN_5l1WUNT|MF.;Ⅰe\uRvpEM߮n4낕VmWӦmV<,`NDdu4X }wTXHR[ \L2"7UYYdi중Px{d9a:V1j=~⣦D{.ʂ۾b )#~f< H 1e_7c} ͕;f @vaJK? wZ5d_RSN:qpJ* cjm5$X+PpҘ(N U#\uʁC)᭖+Y+1 _I zdrlљIqAEZ-\rmZkSB;x-N6pagTIRP{d ܔn-`djbEwU*DIhhŰj};j+툏z_튑[L_YsR**Nkm` ۭ6mu7 xO$PXR:`x`ăPpZ {c>"*'9u4Ƥ2$EK8BP8=qCe 1vYf*8GS %h\dۯ(`j#tf'jq'4ncP@GҮS(9chh>˚a,Vz\vjLcbi4 U,Rh앑VJߴ22*ybhcKԑHEHanhq&R2h_lycI'{ =x8I,{µ@܎^[PFE[޸Y!`* BaUz~>lJ.[ɪ+piU },$Je5 ;`0[P&QCd nN{"6ĊeĪn*OMv$xdV).7{F*q@rWQiAl "IvJQNҿh*(PZ˻\AKE\޲րҞ۰$[B)Km |d#Z;P^Ƕ[-k^FPb prZ8O da1^a;pna;*W m`*\;% wv& Fbƾ8x]̒KqFh9]m/ZB) jʃE0E&2(jrڰ-*v r̔/(&@瑙#ov\H"bxb*ٷ#--$n =iMfw[QW>v Z t-]8lKR\9Y8**W i79c$S8f l۵?\bሩQK\],H#q1:8?{⿤d6aیs܊+d!Ⲇ;x#oi4*iV M>$riqZo"2ToB>O[R>dCǎӐ?g 9a`Ȧv፥{$Wrp`=sh Ye3AZt˛YH\)>.O-,Q.Oulca~[HiASrwHh)Soa[FM>XUa~.'GACuU8,Y-QM 7 -BI^H4h?k9ϵVˋFxGweVW?[,hS X$ıޟ&wlZJEtE\"]lqADARێY&8DWf8D]AEHqBASa,ڌkLi5nA0PvPE+SO!AmĚ1Jփc^A)5¹Z?P59vLJ-YSQ(I? 78 MKjw~`ܔѽ(0WQED>T?NiĂG^N7VާmzA.MB_n4|P##EOJ-8Hȳۊ2MHo#^t(gӅOe|pyeYԴ 9s+_X%Tң_똚=J۱dɮA2Fu$9c5i S^f7#@K;\%UOGi7%I$~>y&9AU18*ӥ{lza$%@QQZƹA KEs$9@UoΊMAo 3bF9o*.bڕ"- ;Ԗe &mY>']~+TVqSJmE2ai۞\DRާqSҞ8bj3Qa߾]hJ`pW;\CM4'F!~ ^$":(0O1R:U ) x۷3V`ڝ)]MvHRg"E ZƬ81͸^ ڼR5cCJSecjI[˵(BeަhĮn8dpNYD:2 0 }qOVݕgן  TĬ. @X=6;|]w[#.vx̭€QO\NfRTASxKWib@ _ԍUueA%"CE`Iًz?,odrDYG@}@KewG?%A H|Vccq7k He!x]s]O zm-a=,)f*IS4O_]^l[/yzH=8~?wpJu 9~CkwlUxe^r^::tUN*q^b':eP1\TゕyFXP:*֔M];iZɰʩ>oN`IZ.c * >%X);`$[*p^u n$l_N1?qJmdcU3ܞ(1Wj7>8aZ^vQ]#*Ƙ@7c4+>-a*lcCW<߶9(|P4捰M UN,#iWX>h{ k˱%q:v!E)=E{731ªum\ zu0sUPɸqjj:oGV t8t"=)$@ K{q,qܭu!V~:SF'C~p+I-cq d Pl<: m%C4eǰ,I8(joMRz U ukr~8wON1T qsЈ5vĥ~Gb{ab4|:rwiZ$fa/sosSDp*&+@%=v XU(eT [M]lKuk5>R#I!hۋ1L>pmN֝7ƕVos๪[n-P|*'cjA;9L;l 8j:mI)U9*^M\/'}^!;.T/[u_Mks*搶ɰ!+$8"w~p*aW1#VM2ث/rVMъs?=CUDoF%3M>s_P:t=TU6Qov;9 +tO %msvaBҼon1UT^{waXþlFF9=O6FOMqJ8\i`:iTHOVoaWHrcUC_VO S*LNˎ OT7=FNµ=욟*OLrqU` WeGY?h~8Uo@^V;Rbƀ[+ X";^;wⶃPn`5v#rhB+ri ݏӍ]JkWMN}A!Į/U1Gm*'O㵐13\z b_*|pS4Qܚ"DSeroy'ߎ NeE8R1 *qφ1sAU|q}ڒ([߆9b]^u_T <~?(" $_gnJ68/G =>imd*>Gݱ((99>8E]V2t\kH^*i«ׄ? nߏb\*)To| %6( O^Z*o$yxsң{O_bL>{ [s ! Owo1`U'` \#.9; \ڬ@= k˕hA.%1i( wA!ʸiJtQdꫬS5̟jF} bšG$E4۶^_\,VRXUi1}rӍOqCzW?/sos!~Ɩ zJχqI58^W톐b [3'V d-(PgsRuW/v\ t X#_k9Gw0K'axd| HlUٱWg*6*ثs?O/lCvT?Kj'~oTvRà۟ m2W]qDa$4«GO*2{b+Cs Oj\@lpaL @;,}ePw\ @=­p* ebᕅ.QpRz}\@0Z?\u4 ]H_`J]f7 A'ՊSWF?lCF>M|.I}#Nz} .j~#s VҥƕSD=} ִ9L*׹?,M AL *֔}めW y]Ѡ$;{bTau\I/Zi6Wҝ~a%V S-bt|UIve, S֧+zcH)e- *ƙc0iTaR=r=jHs5?p UX+( M.X<~FlR•;bċ}|47ALxS Z@wsS|ULa_ 6!Iv |~$bW-ѶlM!58GC\ORCX*zU+uνɥ44,!=qBƸU80R~]wH^JiWeq%OȦ(۷Rqxt "¨1YZY{$c} }XCHGqA(u+ͭ[d= |o ˪_N |-4䴳3~T`f$;f|#6⭚3PlVuޕJKďjbGlUAaAqT4u/\"=F *qJރ1ѠV։ة9 >զ?;ZQUcz *k߆6o:tˠ\I=z{Ve' iضWX%v߮*S‹BrO0;홤Uo$\Ww49oqJ&8{MbcV}{t\J}jfuۦ1b}bPwB(]qiV.UanH&.(J%?\*fy:c4qU1f=|779$S1L_