ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:20 16:34:11  "*(2xHH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T#Ṙ6%]b?^ hZi\!}i9oO oHwk QSۤsֺՙo-gѡ~s|%·U~-wYNzY[|iZR\+Yhe'U&aWB3U$6bnSpȟ7hu@`&_v#lQI=K=kss\|YT8:ř/d%l|%\O[<@d6k~n[x-`? Z\A[e=)_ԖnJOh5,p{U:KeO. {c_dO#pT3DpG5_M'eHYk?*dO51rP!=Q;H\"A<6 CLW*3'ͳwţ=Ֆ ?4( x|csOO~[~o͉ÃǼ9H#TI-薁 v;SK7%((11x88v(A?궗Ka(jރSm&7qsgbs?޲C-'+G8.{?û-5nsþ?Z=drd;U(ae͐!Ŷ9oWk}l*kw2A6qq?JI52d3t ɰ5$?7U* uWoNչ^Ob .dg NSűLLa ќĆ%>1_5EFP8Ŧk 6\u:nu.p 2>G٬4<]Sq6m6K.&h$Ϸ-˗ɗk\202*_uCKYIZG멝?d'v?x]cѣDkںm&n.=t?U7xG#^R\ %\-d5GEt`m`'q󧻛>.:\KA'p1WUNKrױ u?eݒJl jK;>A&`kw 685sh<|CX7bg$s;ܡ!yh_;etcD9?uߺԚߴ!s#?zư$o#8|]I?|[ Ks9n\$~#=Opk5U6ո E`G&>N0Rj|YVH&o'"cCZr0iɨZրPٷocAµMC%V5 N>Us7pl=vU,%#O{Un&1閝 1Ugw1 gˣR8#=p։.DUpr!AZDZ.g5z ]u: ƑcvT1ct2xE,ztnrx2ēG~]fȝp'E%D}$ĺA;OkH}'ju|b){g+>>A&]WeJ s_c nOmkFI_9o1~ƸG@TztmյAO)+vYhhc?KKcO~]ZI2[SY2N8e-^V%tg?S4hwq4i~ċ,H_Al5׏?z-b}7g<7B7~<bi~ߣ o-?,ۘh|wìeYժÎOoUXrXc&#i o>^ﶡZ{7t"~+x8mϮY=S98uͥUVf+an5pؘ6=}?=P?Y&0uT㵒CZΩXZAS=3m🥲czWmGmGh~r,~|͂4k1R{ҽ%ӪJzmNѿtȆʺK$?5~>i=LJ4&ɬ;k?0Aӿ5s;XAgZ|@#bnK,k}s_"N_P`om?v '? .i2It2d6܋^e7+2+ChqI |ns9gy?A$=ڏiP) _C]RhĽV5`AG}gBAo1#SŲ湭&dh\@-dcb& ++e<:= FFudf AF2 ,۝4c9-'bO@˴M2Gw%aYqy̹`tM']ƿ%HIZu`PF2q1Kyގ3Ee{-hoF ם?b{ZdzF:@q?i6˔  L]ez;H]H:`vdb,4cͮC,#-G18qӡՏ~^ .b7o1l?<jks:!廟7BVLʹZG-skymfpj13Kp'R='.? $)6xyZ=ѿ)L%Ίߨݾ %Jkέޓ-'S/mm<~/BI*Uq֋?rG)iǹiߡ79w%Jlrmʳ$cY^׆7k?=!i{6R-/ %^+IDKaf;Qp#HߧpKkgI?K>/EI.q3{H*~l'f>ugLkoni} ?D $V_es`AzOmE\ h8 __{"[笧51o"{e]'w%J8yNc\׏DWz,Y[Cݟ[?$*Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXT EXP550/PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM[ update_maart2018-19 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM qx Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T#Ṙ6%]b?^ hZi\!}i9oO oHwk QSۤsֺՙo-gѡ~s|%·U~-wYNzY[|iZR\+Yhe'U&aWB3U$6bnSpȟ7hu@`&_v#lQI=K=kss\|YT8:ř/d%l|%\O[<@d6k~n[x-`? Z\A[e=)_ԖnJOh5,p{U:KeO. {c_dO#pT3DpG5_M'eHYk?*dO51rP!=Q;H\"A<6 CLW*3'ͳwţ=Ֆ ?4( x|csOO~[~o͉ÃǼ9H#TI-薁 v;SK7%((11x88v(A?궗Ka(jރSm&7qsgbs?޲C-'+G8.{?û-5nsþ?Z=drd;U(ae͐!Ŷ9oWk}l*kw2A6qq?JI52d3t ɰ5$?7U* uWoNչ^Ob .dg NSűLLa ќĆ%>1_5EFP8Ŧk 6\u:nu.p 2>G٬4<]Sq6m6K.&h$Ϸ-˗ɗk\202*_uCKYIZG멝?d'v?x]cѣDkںm&n.=t?U7xG#^R\ %\-d5GEt`m`'q󧻛>.:\KA'p1WUNKrױ u?eݒJl jK;>A&`kw 685sh<|CX7bg$s;ܡ!yh_;etcD9?uߺԚߴ!s#?zư$o#8|]I?|[ Ks9n\$~#=Opk5U6ո E`G&>N0Rj|YVH&o'"cCZr0iɨZրPٷocAµMC%V5 N>Us7pl=vU,%#O{Un&1閝 1Ugw1 gˣR8#=p։.DUpr!AZDZ.g5z ]u: ƑcvT1ct2xE,ztnrx2ēG~]fȝp'E%D}$ĺA;OkH}'ju|b){g+>>A&]WeJ s_c nOmkFI_9o1~ƸG@TztmյAO)+vYhhc?KKcO~]ZI2[SY2N8e-^V%tg?S4hwq4i~ċ,H_Al5׏?z-b}7g<7B7~<bi~ߣ o-?,ۘh|wìeYժÎOoUXrXc&#i o>^ﶡZ{7t"~+x8mϮY=S98uͥUVf+an5pؘ6=}?=P?Y&0uT㵒CZΩXZAS=3m🥲czWmGmGh~r,~|͂4k1R{ҽ%ӪJzmNѿtȆʺK$?5~>i=LJ4&ɬ;k?0Aӿ5s;XAgZ|@#bnK,k}s_"N_P`om?v '? .i2It2d6܋^e7+2+ChqI |ns9gy?A$=ڏiP) _C]RhĽV5`AG}gBAo1#SŲ湭&dh\@-dcb& ++e<:= FFudf AF2 ,۝4c9-'bO@˴M2Gw%aYqy̹`tM']ƿ%HIZu`PF2q1Kyގ3Ee{-hoF ם?b{ZdzF:@q?i6˔  L]ez;H]H:`vdb,4cͮC,#-G18qӡՏ~^ .b7o1l?<jks:!廟7BVLʹZG-skymfpj13Kp'R='.? $)6xyZ=ѿ)L%Ίߨݾ %Jkέޓ-'S/mm<~/BI*Uq֋?rG)iǹiߡ79w%Jlrmʳ$cY^׆7k?=!i{6R-/ %^+IDKaf;Qp#HߧpKkgI?K>/EI.q3{H*~l'f>ugLkoni} ?D $V_es`AzOmE\ h8 __{"[笧51o"{e]'w%J8yNc\׏DWz,Y[Cݟ[?$*Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$XԒT=^8$%@nC WQcNQ^ڴ@T=R~^Q1KZ24$Ӎ#F*C}g4h;r5IP1[!oڦ߯:<ݏӍ/ (=TZ_i #0J^[C_iP9qOC]yԏYdU&oZbcI8_xM)RTJk*Qh{?N4-~?k~[j`LU'Q5w*ǯ喦^??FG upݪ-垨;OiƗ0?5JرpRx %8# ??F4HBO֢ D?^Y =L|G\<(Qo1[Ntqo#4T]v%G_}HCqs(b48_1[3c,~Xj?FG {aoUEyB~L-GG4ǹہ%bF?8xQjQH*5<|{4rG o~f l*~U8:_ʽV0,+yvh*}u5Xa #Qlɷ]+APi|h9}_CxSPhC?oVC~rT^1.O2[??+CP.>eC[S^<сx PWT#ُъ4E4pGbʲNP*+p9Q@?8Wj?F^$MW xr~yCix c+UECCixW픅` ?^acPПGhƗeSŕ?,5B+#4cK-4!]RhƗoִ%Gj1@(i1^/AqOTڻFe%:OM^Z|.}HUH%c@vKSSD0`iQq_G(Ӎ/ KCq7F8@orƥGnGi¼.]nݷLHy |9#XzxPnqO ^./#4^ա>?v0yP&iKW~o +?#4K17J姐oߣEixZ}EcbuBiƑ¦*+F#cR&ݏэ/ kPVZhZixV-ϰ?1ZR_61p?"8)xQt忈gF p'TBly1(#4-1k_-F/Rcӛ_LW52eK*b5/n rÊmַc"w*:T s!#4pZVǏ]H4=0 y+SNqj/1*}ʷԿ/#4`T7J5~CZj `SF y_GižaBEEiZӏ 8V 1 P~ZjGC`^rYqV?qU]nqu?8=ی?ZӍ/ anr徤z4_GiƗ@:ʴԿ#4cK³Co*Shэ-5#\iԃܳS!DWd 粊T1KVDb1Jq'F4%Q@0ǟMLߑCG P ׫EixZv}E7yCS=/#4I_~\kܢc48Z_ARaaڇxVm!rZjuhc4cKWm# c~[Ki+[*QhӇ<w|.բ?N G ʶԻ4Gq[v ІcenHf4u8`OPG$ ,1i)xwc YkuiƗK1\Wvэ/ [n?-#(Ӎ/ M7u  #x`"ȏa.%d-n+0RUj!3T7 NR+5ssugW?4pPjN+&HoџGi¼*?v=<|Ɯݏӏ }AVGߕZܖ忔SV,=xWT[&-[q^׭/PKm t=_!߶?N4qd_?GiƗBMj(\{S? ݖl1^]r(Y^ǑG.^U9^XF9*G B|'Qc4U%F/gaݱ1c|e(=K͖Zrw4p'kܓO<+©F.?BM?N OCIW1F_Ӎ/muh[qh5$##qԢEOEbǑGOZ/k_ oiH* dixT%H=)~\jhhLUX8ǭA #QQʱi%z갓CU> |9 /Tk](~Cq*mFȪ,=i(su<\:qv1$O; `!<%}-6g^5>\q7KLFU,|c~_)Q5[`Wc4G kp5>C}H~_GiDžx\5@p~^j+OGiDž<*BjQaP#MPѕэwօc4I^5xH?-#Ѣ?Ӎ#Oу̿ڑӇx\)_ʵV)xZ[?QԇV8vu?8_v4~\jG?N^PZ1?/UMۑ2妧Ghx ѯ[pZpλw厨z4'1+?vЇƯ妤M9Bc4`^WcGhKV2Z!e dix cV>c4 D֐#K)(*IOV/#v o{ךBJV꽚xW]|hz0?7U4'q^kZЇ1\jI*v}s/֢/#4Is0Pupd@:vc¸y =+zQYcq3y8ixJb"/UΥJf?N4rSEi<+f?zb?N4%WݛUV0/#4puxf,~]'D>li<-b! ڑG X 7?'/1c4^Xh%$kK(ӊ5/Σ'xц&i^47ާzgiƗY`>ߟ!ᒘPcŇ^J>|I\#no$ƸFbWYՀcJ Phk0Huo-Qz_GiKK̖ӗ?1.55qUMvݼ~L_ИӍ'Xjq6S*Q"=8U>7Ch#4K]Zhy-/5Wqihjx\yBcc4K[]VT@u1Ǒq\5(@ QAf?N4Uy2Ӎ/ FlixTWEh{ZnLtX85wOӔڃthӇxW> c\j_qO Yn嶦7??N<(Xl9W_.#ُӍ/ Ӱt!f?f8 cZ ̿txӂk됧W?,O8b=*R D>lF4* "ɽ??UECB~Li<%OGlS'RSF1BаRmEWmfo}H ?N+\Ҍ>/ޠ*4sU\wJ->ixKGYPI>ȯ' !h;5S* g%>4e0 iu*c%cܘc4HU̖l)d?"ixQ"c~]H~#iƗ&Iǯ徢۫~L46!CGWe'1GGč^3UWc4* P㉟AOhq*TJ C妤#4cHCK"I'?i?,H&*{1qtdI˝Dhq+f5>_یoIzӁ+V7/ъ8i<YnхW|Q<~e?Ӎ/ Xڂ/PvW1~d88[dUj~X] xi8x j/P宦CD~LWMuriO:ixU W_An/#4p}V4ʶԻ4DxWO`}ʴȪMc4 ~c.!1WÑqpbd8JV? _X895$Mʵ>C5/88TƷa΢j/#4KB;7?S]j**Z/#4I- l}#q!+6?N4*Pn?!'Π8Tdc??+*TПGiƓTFn&ߖ/#4HUMz/jњ%>i<_dUAaLTViƗ]V4q_!_(?N*|+CLyԇxӊ?Ұهj/#4-R!\Wz^Q71]O|zy _ۊʸԻ4Gqp nu4_GiK»?}ؙ ?N ^ADEEOO˝EW?N4'֡NߖޱiƗ˭۷>.6YmտcKP׾fhftȡ.>oʝbҧ"GƘҘk=:hJmLw88Q\ցцLu gShӂ va딿mc4cI- r=c/#4HXeqQG=L#0b\UCixV|]ڇ|j:[T^d[W^GڃTn8TUidՎW4?GhƓV(Vj?F4+,g@fn#4bUܬV^Git~i1cچ ;tO7Pl1pKlEP3|gT#ُӆjКVZi#4`_"h,5APGhƗj>`SPɧ(1+ϘmPa ??FS>g?oUPП/ уʱ?#4cK¼yaW1Ъx00'[V I{cʃʵ/#4Pb0[sʵ/#4wr[j]!8ix[:1D^1>Ob8tMqXD!xȣ)䷭U\vd^iJJ{52uxȐ}ޢVfS¶IVUHGXn?طq%=l[hO}e2^'M #0+*(ƠtaȔRh킣hAqBkzŇCڟGoJ 'ӛQ~Y/.`KlX x،`_ݹv=D:xJƳlQbnWBmV~ vWRwcz}lP&R8-_v/#J'Kg:h?gx1Jou=W uja-NS.; +oU㖯ƀ{*F$n;k7]-B9?ؘWSV2Fz8Kʪv'Ӏ$<u?gA+!uT_-6 )j_N"cN)Dޥ hcJW$>UrѪi :q\- "4bfy)5GK?S=WTEJL~ȁ xQ6b'vў-dY^F@pW W4f@O}0m^~5=A큞*? _5XwUVh:UCɱ،U@rߨ? oQ)8UqjJ BzzvE 1MG,c'l߯%R;Uh˭=֤G%N-5HH5OK=W"t 5dH((ZSO pчِoɑJI dm(;_?XE1 HlHyL6e;2"؛FQh**L1]FqU[Ʃ8Vv']Qv7 …OQ02Lo~E ^I8v?J"KSΕ_% UBEwIGs:>\?/lcSv#A:Mu[2\pٺv>UZ O׺7Ĥ~ゕ ͐q`YG޸X5]*6 5_ PA1U(AW2\}?\-TS=>/ Z}0-ŜFC GXJJc})qA[qE~G_ק*߱=)FT;ch˷ǾHO|p:q\Náem.}Ncm|*m9_V:`Js𞪝x2%!/mBIKAcIT4QO ]N%23.[G VEܳ}{rV9[VGo?Wpqgl6{a'|pA%n/؏_0`$wz ]A'/w (?|%J$汬Y2Z ? ϡ|Cvאީ1h2_9ZjG~JKe}#xOOݑ)L9֍W*\AB{&@x|K1c)0Ym`zqj%;{aR .9n+Ѣ"> _aB9[$Ar=V9aF4T[zs~"a'\Vur ֠|1d|-Uk:XT2㧈Fi!drЕnQ7ZL%]8\vJR ikQ_\UiQeIX4f&! mhҁuO {Rޢ}dd_?.,P[~(Lh$Z0;'YYGɆB=yӺˋPvaUZ!m_Qʲ TS1XS`Rf~nqUr|GL Ѽ=E@txC UEhOl%"0㊠匩I:^9)߶T4/øqhf-Ͱ}O WL)Ѱ [SćG%gۃfDZLsrZ\c 䆇f ׀'_*jZIm.TqM.Tz:j bK'jUۤx_t1?'hܕ5>)t?zyMj:2Ge?ټ_n- eq-(֣q'I@^B io1c? Js_ SʵaN*q$Cc4-hdHxH\نXҴeߦYć ꘾ EW,'tSZOٓae} Wn?Tt8)U]֦ߨw\POOc$#4bV޹~_UVpEȌRcrzccVP,]'>ˍn%$A)ˍ˚:݂A?Og [W2nG$?RA*Vwlxi\bKD~jzb!1U)#V= IAFcjH(>l~g.Kf] z_) xI4H6TCFT?d'9ACnlRqצWĦq-qbkx`J஢m=SBb7Rjqhe0 qoȀ૎:As'*~=')ECvX_a}J?dJ u,>%qV#TIuu{"ۮAã% "#};=iu x*}7iX$s&ʡ&ا _Z"%~덢NW HaQSn>NH 7v8^ 0) ߸?<]QOq(1VƠqN5n=Kԧ {yI~߁QRO| %ſQ؎Ẏ}Co?ߊXrF &~?E A%j.Rj ,v]OLUB$tq @?[ Q!:\ޣz$'uC u (j_13e;*cKĊ4?~ T1U?x*$-1XU? :p?gC pµR8 \` )Z'Z{AOՁW?1}B2fAwrJ;! b2@z4^;zu U9eFZJzC%t1, FIR;TҽG*_~?ace o>xyt,$o WN(6)qXñU4g]GLR:};f5x7WqE7 'I>CQ %#Iy1d%O({:kA*@0,Wإiq`k!G~jҍGFIb4o!S-mn鷡!?\}+Ԭ('Ayn-p'NjɲVԬuJ"N?։5Es )"Qer~!􎘫ju6ac*j*ۧӏ+RVάCbDæQک\ 7QӾ4T?ߨkomȐ?_jPk,.t՛PѻfE*{f1XՖ@g?Ͼ*OcNRӕkbmxQj"6BFXwCx81[xMpPCvT-i&F-w' 2}\a?N _5&< -n"G񚚏qrLS1N8j|U BKCXT> 4q Uh#t?p4*P ?O|Dw$t= + H |Xr$P#]ɴKjn 9EQuĎHo7޴]qE58LJ(=DJQ"h(M`[@"v*k8j6t…ep c,J{ ?gcr5j~#~m+#hM*$]Ǿ"ol (A_q[?49B|Q5}[>|Z;J -~(ocATK \cゕ Txcl%늩-7q$5{цԅu+PcG4? aE)Hvd5aTaU27~'(LJUDqQ QQW+R?A\폥r-B0Ikm?6z ͷַWPx )^l ;= l Ou_j21H^źx7ՁT䵎:$P gN/\>XwZm뉣-isO2qi1n`ubq[<7oqGgQ?`*C$k BB]1 ꆪ|YEAT8i x6h`J6e8"T48/ueޟ.m[X%=*F~^NEF4x6Z񎦪|W7_C^?o:55S UyA@'lriaB‚$~>9GUiWlhq># j;U~%lzF~8M v<ȍ8">ľSO#cZWZ*>oCjQP*q73Ym 'w_+G\}C&(hP5;h| TRjm*1XgW9zlqUdcVTtK6R75 d>ǦR!f68.Q /ۍ*]{[|_fQż&'.6SZ^8nWIO%55W<iNO/G/ضiQU!XAYj\dc$~Xw\|Z|3-F<Ч&DZֺN~݌|b0SFSV~8?椩8P0vmNave8Ud+gnTfR"*G&|-hP*U%^Oߏ\R+"یAE)OC6}E6>+j\[J~ƈn8N UOZ6-eSb#AqZ{jt>؉Dĩ;USE,$9zpLwK'ۮ(C=G;T?DFxt  WG+.{f*㣸#*ԖL7}m tⅩNر9F*"i`?{i$%OlUpUEU5ŁY=XW_%*'{:}Gm,jzu> 'JWŔz} ٭=>ɨ8_gZ{ {U6b?F;MG)Z lE+~8ҫm}kpǎ*]Ņrx)?V-?@&[}SH^7qSfC^778J=&&A뚼?o֎'P:0bp-+~Hhr[?NDUJ8HQJ6D!TexEvY2 "K~=6{69hۣ Vdvw#B,(S ;p?AaJ[Rm/9YMǶ)XzRԦ1Ƈc鸭? vWWهݍuWFkw<"etVI 'R;aCZUUf WAT{lrHR(#nm1/bTGtsIEߎ)t3P(cnxUL9U%އ_ M [=8c Glk~yY7 Kgf꽞QG~8 P7ͶQT ))ǤEE3}=I>$ģ Ezp5\a~mXNg_lroqU},hd֟HaF)['\5L=EaC(:>[ch,d=C݅ZbWg}*1VUbֵRTiUN,8߯ c#1UvlUٱWf]*6*ثbΫpō2A,k_~7C2D\YڂMϧQb&\~8BUU'#~ě`T!_dg\cͺUq6}9n86Y R;vpT7̞«ڟi_@]YIk'mW\,`Kg0 ag{eTݐ[= U{rFM1B"Y6'uxr665ҟkq$*E-~hnE֦w\TmTxb&#P`6ՊQg|s04C(j2K FheƟN%U =)z|z71U8a4`x>ClzxaW+_J~̽HRm63c4G[^&CFb7^JP,փ`hva8=zU&_:`b$k TISPރBC鉓CǨQ!ybGCQ¨Y'cb[W_' b/SdoG0gت{fQB_7coG㏼}\\}DZЄ=?G!}]`Aw9+Jo%hw_{#xxcJKYFRDz?$+% t>ˎF<-2B;_g6a/gh4q QdTdIjЎ&sqaN57ڵ,;`-~$~#V<r_^XWToL n_cz)N9,2䂵1n2x0#ſU<1DM :_ Z8BG1W|Q7qO#B"ZoN9'ׁV4qwa2Vn],Icgr1ٗ}Oc^ӧSC_ҩkeFe F4n8U9Q{RPN??T?F^zኵq~Un퍩')'ANv  cM8sd>/NJR>?w,ʟE$%ՍKrJ[1 J#(P اŸ=}*qiTQCfVЎWEt@Aqh o|[2^G, m'&JӸҮ} ز£3Hh-.ZjP?#Iũ~svP7OpQ&S%v__?V }-"'9!a#$mUAc(z`UgqYޤ({N!̲4fonFnXa1jyhö67j/t*`Iǧ6Tj޵u%-GQ0*tXuVԘ]U[5 >#ŸѬmg|c~\KBx }EI UdË~B~<>)4T >X&ILFH k xQ)+QP=qf_F{H>䔚˒Zt dhIP.HHg&;hf/o#US2|pBH7Srbȥ-c9 pbxۏi" kT=eB~%[®/VCN+M߁… rPP6?¨5rA^P銪!`FP4?7 J[݆0+Bj*)ҿ]qB bqD8)QW=hzEt~:X`T= $]ԃc󴢓&;k[.,Gr>Pn_ hآXuSa2X/#Jj\W-?x8ACIJSb1P7M¨eby4nWWK~ޟ~4|تx*9Ê?߁(9-JџƿxZyƃo(+j= PL(|F0} PSp~۱!'SІݗN.%$faW`dٷS ֈ,;b9%-] I :UJߒ%GA̒Ĥ j{pP,-mF:1[ce'01WⳔ#r?g RQZcʹuOC*61kXG8)`I$ KsR8"#Jr caJƲ  U.4&8TsqF&bBN? LA8~dg>?7]}ht;(70+aM!16pkUR$*>/xF*$JZ=?#}7pRAJ%h%^u[LYj-_c}%eOzn~"ϖ QMY:B7~<0n7ȡoZ#6*2C{K|'ñ3XULj34% So{b-)6tnIټ\0^ l R߅\cݍh!R;8*ި#x |-0+.C8oTxIaFpBL|K7(3BQ~%8-:`WǷoda5F3+)\0틤~ڽ6gakW]C)i#jp?.P3xLiQ'xqկ8G%JLԂX}Dn<2)D$܎2c$[fªMi$?d2َ*Tn1Wsv%~P?~ c*Cv( 7g#qӶ-Ip-!2Dz}Pus0?)*wT~(CmNK:{b#,Nqpڬ{Bm?(l~!zJWu?? ` OQWӗCh]crH^MoƖp(ژ .0*jÒbq7 +@_h~NQu?v h<[5lw 5Q02?݈:N<\{y!2c^q0#8KvMP$1&,; W=f by}_׎ {Pٲ+CK#&qoB*A#t;x%q ?c(~:qBm'Kٿ^!xIQGl줕D"Y ϩog }C.2icfOUHneKra?i; }at'/Nຢ| 1fxzi*@ J\w)-9uai-)=`HC$1:-G[!Иn(MbJuE&?h-dB? Is 8 3l;ֹ m9 <Ń5'C}ʗG< oKpN-b3F9/|Q\ڷ 4v徠1Ha!2UOu8a U걏?\$Z1m$Ub ԓBK}Gbl*?FJS/HMӅy+v_n~4|>֝ V@bnDZQ"1:J?Ta͸R{UCGՖ]=*ң҂w6HQ_"hǏ-jtj<09nUnzZݱ)Mh]ψ#j\6'ew_[ wSŶVKl-@7iW_ <]Ց~,tiy%Lj i (3|ⲭPtOG떷( `a7_xb{N:81?ےk^}wCy]#1]k~ =Ҟݱ4qTijm U9POfHTM/UXX %|A6]-W{LoTzWO%)Щ̛y-^?- OMCJ [uju?G, s 1^WaИx$Yur?C$@S?ۆ;,;)ZUNq?Q*}Pj7\NQQ]zUNx 5;r |_p8 S>^&'- e, >H+J$[LqnWq)UNƇcr_%d Px\A!$2ѿwc[f[%hZ[}0.6"?%xUgJ}<{JhML})(n1A7* ڣ$(Bṿ;FClUwրO.t8#IT8Fs@|]|P=V&~ʅ.l+)>N[r,ǧD9_i7?& %B~[9M&R攞?OE!^ݟӛǢJ8Y>b jѽV,#qi$g 2%ʚ7qTGȏ>},UV~!2vlRٷv8lPЕTbm>JOM0>8=wZ6&5WmIۏ|VxQ># OUD0/Q(R5CCvqPUOUq 79^]0Z⾭vW!GI>цԅ?<aS V+5CA4g~Y*tڽ1r:^(Y%˦,kpR7=jH88ANDWkC2)WG][8Usr%RM PUPPj~8!@|2n>_|U>81&kK ƠrpT2ˏ#,Kcmiq=Yb-Ejcd#ׁQ_+SHFWncUc7!^\Q /mI6qJ ꆿ,[ثK#!\IZWlqUh4=LMK/C_T*+J{8ciau ;:B] *";}> J c}*n0!? ߮9'>No; '1y X醘l!gqzq]: W%VgMScnͱҷ2xt.brGٺƸUZ)){6+ %=4SAw1?mYZ *XlT_H"wՈ)Diz\P;0/`ïqJ[pzؼO]!熛؜,+k-EsŻ xV<k1B%n-&W*ݑ:Nec Zc0[UCQeB ^¨)8˕T'(j'ٿXJc EMrM0)єCsS.7dNIJn,I Վ;$/~c$10YkGEC/>͂A=,?f*}*(Cz~q#xw_q18U| UbunxXf%}E w_؟aP„x(JbhԯC0J[eG?{8B$UIcx )-4$-i Q|io?6߈3KCşVSK:݀; hX[r>ooP,9ȼ_ ?5T/#ouăo|;`J-:K:Ud+<1JqCJo($ SG17=%iҾ?2nbD$ٻUn Tmӱպtn*B+;רģxUGӨ=H -t;-|U4"mr`ێP^"C% sYѽ;(Ȝ~c !NB[ʦ+ݣ?`B$wáQӨªPҽQ 0%mڣjltlcഭ"(+ vmH.SU  ͅSN1eޕ.jLҴ>lq!&xԏd?xW"5hϧr; >|q%g>glBS>B, lFpz!?3-pW(p?'qI5-+:[ŤK>VIBG}-zwZQeJ SBofnTH1wu'.9L'nAY==E_ř+IX+vW68qm2(=9Cc *{Gڴ] wn8[SA'q2F|! HKFI#Y7pJuo";l{ ΒGc$𪌐cjw~ye麞]#ˋOJ0 )O x-)Ѐ7YHޭ\*_UTj\o32t=ULVEQb)"+1OO$cnkY?j.hmen2-8X^/ rN?aęC >T?e5َ*71*dPsfIڈ)rH [V '?k!{2cS'p?kCunP+JqI"+ 8bxbK[v;]=FقpZ=#ʼnap0b5JT?(Xbx 1C튯Gոh$-l?#bژҠ珒Q$l(UA>;Ḥs>prA ,|_ 5DMdO_6T<\q~报T zt>*[![oqMO8M@3[{U>cJ>b<;HFEsz}Q^?叉:*4Q֍D]{PM zs׏fg7擅Q`-t>-ޟ sDjNq+P7]4Eo}1\4'_QZ$⩿IM)K6LJn6 6&dه]S tۥz>_u YCHs?, k{=zU[E8N֑m&:ÛyaIH&;\.k![<Y $7^U8%ۨ;b"ȢE 8O˥wNUj%s/N`GQr ?"Bm i?eĊq>WFHqVT<jHRuE`'M F7Cw! S#? رhTqxu$d_xbI=~m~ |aI7*cǵ )[,$#ρ"}!2}qS۶Y޲WoqŚd`:>M4nG*~pޚ"V7#E„Ma,?᰽xv07Sm}N>9+S:m/F)6qU:޵8Pf=epɷqMMlW dUs7k6UM=6?(Eџo!_#Gpƕ*Kb~- ; ܊<:?%Σ9'qsY~G PW#Ă@pI 6>*uGj~CpX|{0&ZR؁QVlP\kF!UVhe9dV8UMx=YC1W ׷s`j=+oZex}\ 3!#UnPǧ݃V+-棣 7ޕKb}M8-wj~Lu_̿hmie!XR}W`4ܚR4i/ѿ*ޙC-_qhx꧶*9*qq1^A|C G?d2U4ˉW]^%Obva>!UW3IK,9wm%}A (R;QЩ Az ?:u?"}\#YpҪEq%]%/ iCWK]pJS >G=.$GےUC9LJڣAw$B|K(qUMf<|zI-?<`Ѿ*.e?b4o<^aغUNiPd|>8B8Ud8)}b ;רaMq*9Dx7pz,mr_?V9_j"~_usB/>ќiQ*L;Ph|;h;K%#Zau6Ut0W^Rf@c!e0qcCK{` RbEsa-}>Ly&0']$ſ8Cs o Mo u*dlqtdt;UWg8_x…C}u T8Uoc|-4Ư늯Y^#B?"˳F+*?u%RV$oxlP5,dUv?ʣwpۏBޥiFc84//Tkv+hgIeP[;|Nߎ4-«cѼ?q -GڌlmP,aH $V[(W IaN݄-%Z{7O՛Ǿ*Jcq(0F4<%b_wPSK0\|GL+dը뷈 txVIk5P֟k[k,E=&_r>MH,~17en4t m>)k>s@X * X%,`RIjmpyCC܏0dz}Ev1&(y mH?~Q̲ 1@ WGtT(i-:G6{mKu8X~Ɵ6O{]fQy܌IRV8%A#VUqh .6>m(mD{at/ qB>+xeMǎ4Mc q@@=>Rv_"?ldy%coc[[aI)"W$b pI%ٸ8?-!0%diSZ9M$08{Wo؍*ғJqڋǦDrnq,oaUwlpDw Aͧ4ux CV~5ꧡlim{oN}Ƹ-hmeXo' /;z1zbW|Я6X FHR*\R`}M>Q3 1Ļ`J\7DUJKvQӒ,P[+}xtUD*79f0w_YJ,>6 mOlFW J0ɗ.F/JQkCM;ow!L A(;KG&vݏON57BpVT+!1`]z|kBFS$c = m%(DW1M7"AIF8݅TxBHi ~؜@rCOq E"Gu TxַFj~/&ŇȥXHp^'-fWd8)M??~%> Li6֞3adX6L㺆POA7CrSvEmtޫxdk(Z~/2N"u;^ێ@ɈOn9L2BV]kzJ[=A6\|maTWtNSBe?Aƕrc?ScC{7LsF$…@i*cO%(b7{uw[m<}wQlq1|-I eXo}+Jr[C.fLwɱ¨g-qm@?F$qTx;Li.6',IMWf˨m8mVt XZGc}zUR)#F!H<#Չpc̮hQӦ*< V'q .ۡHªjBF|x)W%x=EQtGJ9~Ac$*ZP%qU&+S­λ7ĤFhu=A9/-VSiWB NXȬ)^KqT%># uqq`+ l6NQPp,7ddv=0RZXPx~#kV'<$OC트JS)aŨviH86Ր( hb-|PI lo\bڪAÎPlN.A!|9MoO3)wt\mOl6%jM>'BT rl = .*nG!«cD;h=|J*;g>BOL ^9EF>)JzBɢG0HV[ofJ6ΟH"bOё!m qm sglXA-~n.vUcѿL}"U >ZGG(!/ՕyG xβhj)sCF$`dP 2Ƅ:}tMad[0M]|U$aMDZ_lUAi>#{B\c^a^Į&1U.~A8T{Ru?FbbՕz z`\`G4n0RUO.ź---${)A1 i6+mT #p%^oN9m ˭ 4{ {n>ZW_0%{k;(ؒ}ڒٯhCJvfWg 7D}ROj!w.gC7#ɉz%LRUUcĬ:C FTE;. V4lH 1܇ 4ֽL TSs0c\J>JWXU8^18F6Rhw=q(&?qKLvqUE<єW$|BW,5zo4*i^~T}>+pY^Tˢ1UvlUٱWf]*6*ثbΣt躍xvH6Ǔǰ(}R G/au@qW31=Glz~Z$;CęH4=^D+92Jc[t? $C }ПR#PEMn`}F̌:lzxeť@iz#*?VxNGII,Bi*2|+]7;ĶoBYwF@ĽISbU&h8^&*sq;v`$ڄ?P0Qw>ǐb:w҅q^ҿ9_g~]^_GcSO`) P$iAVIf$|1Fx-r|;eoBqJHH_E!A)j_@OK*02o J4{$l^`IS}QI4_*: UkHpxG8#q*3×ïXT'!QRi C.Hyiɠ~ۯJAtGvn0~CDv=Gl T=R:(#W(An~>dzxfG_=}]ow*?7VO 4]ygzӐ :3MJZA1TG %NjtYGQθkV<6ʇX&nHƘ.5={6?l"nj{BHԆq0J*6|(@ji3KqJ:_#倖w(||p%0hRen,KSƐVIN )Gz ԋǭ0<<,RZTD( w W l߯*ԨNي<}uCx`~)z{XbVFS\jTR- `6?LPpt=X{?=RR˭6;=e>J*}l^H۟R?{֐vMVQ$ʍF9J/? (FOl$!im%J9hGlR۟JUO~`FG>#d*2r/k7u*|0*bfZ9QP„kFAJe beONؐb8\ƲN6Ke|#Z7чla1*=nxݴg1JłL_YEG_ׁB>ՐPqTQ)"T*{$*a*ĸԅ?`Uu?dS>%TUlySb;MI_me_pR5.s9A|IAyz8 %SJ9&O_~dng*E05c5!6֬8ep_!TT}ĤJ/݊U}*t(9n?*1!2*,/,]%^„4w2+[%bIǸ2rd8 p<̻;(ECvM;C`1J!x'Ţ ѶQ0%7YBmC^WQϿ*bf0{D犸4c0*l*?_U)b?քTx  ǡšx%&6?NC\:PTF?ӦLpT&xC2r\.ӥ<7S4乢};ZpRyڍucՇK*5q? SZ2'j5q@&7qU.-7M}h9},Fa9bV|_wC_|UޡOAM.b/f }|FsG{'$] OCAӸĈ=z`J#4A5#iCgIzx )B[P)?·7SabeX؁o~$; XӧƾcXҾErWCj{UC،X4sn~҇0_MPV㽢AAc u ?-FGHtt<]~Vս)zlj892{={qdZ21\LJhó  o b@i(bWUy!4m z`j+|,: xd2\X\O8)>9'o4 *c<[ö TgmRLT0og?^To-ۏqo8}Ld%ZtvŊHpR ^#P@+R:wqUOT59u=7M;ҡb6C”?v_"6qV`kk |AU cOֻk$+C|Tx:#aN)ESVS>+\n~!8J ӹ8IW?l+i= e;`N+\VVцIqj_/A~~ UFJYjd`~adoQ2)'rx1VGlpm78mJ]sb⥪O*У>톭 Q[Z1? ^?䯾FCꪴzM7GeKwꀐK<oI_kw3]- {C8X"x4A:}8gCT5xc$r25Nu[e:z} Wb}8;aUX[v0Q0CUIlSuQ znZ޲ |6bjۨxэ,<~ > B[(O!qfTQay-ޱpFCV-)톴8MF\ksQQٲVp+P^!!Z.YS_@~XX3OWt/5ƍ {oȥenxC׍MT[ e{vT+ *mE dCѐ > nIꆇèِLh' ÐCGrBKT} R6n=JQ( HYdTZ#zux{2_Ly.$0R[]FXՊZ/ fА߳\h#\H0LIzL7\UsK2td* []/-*]G{NwE3|_\;6XՄ-",u%okrz.P8~S@qeNy P*>'-dNV(t 2Q5z {^= p ? PWi:{P2>fݳ'{;e->'boÖ'$;cH%Z҉8뉴TP6  x⸦)tTQ=ؾ'MW _o-5bMeƦ2T .OkqBXAcoq QYO~ؙk^qQ+m%: }q?i*ߨh<uqJ|o3Ԏ>mZhN9EGƐq;U n)U$J)"ݾTI]U"U M{8Z*<$ k qZF Jgm (C㌂72$&n=M@UN?q`, '_AyK/RӅmqTjM5cgfsP&WHK=v$&(bQ=j6IQwaUS%QpE;zcg *2> 3I:u­,Gbf9# UY^o%«Zk]P߫|2|UFM<u|UvO>֪)^\QMXţf}bD9'N+ZPlOĚ0waC}Br)&09~TToxb\Ej8X10},rp+^10oqBǷ#qb9^Q765q2g*F_}lXmUn>Dx}⨁vit鳊|5r hOq7h*MŵiR1uxMoJM:wMtP/?*# \ϵqGhRhPǀu8mTWflUz8=F5 @iwF~ɦ[2[coЄ{5?5w iف2(CO#5x4>Uŝ7j?lr22_nbZ2'٭<Jr|F.ib\or,pxƔn1QaVTpB-oe>lU }[].cR;0Ǩ)pM'K+ErA|_/-%V*L=p-!;!_?'OVrHMa՘Qiz'5ܰ=&t&y@Ũ{ximN[|^ WIzk Rl4^\>"m(wԨzl= /Q7V_1;ͽ}kj=E*>&UFi~{TВj#C#uFHJ}A:}Q],1m؋AQҫ(hIS{"ISg)T7'Gr?e:ⅲ@X|b uMcASgIG|?~ JcxOZ}#OGҪ&₾+gQ"X.6c|#%jz4;$r6JXO*>Uޟfl~|L6"/URTev݊AK2fOaBmOce'• W>; Aq|XJƉqC꯸pOE_cCrOF-ck0l`_u?&Ƨji2-?ȶaӥh7\ =f@\uS*-Fz0$xUUh}98k_1Q?i=H5QlAVxS牼*8nKMWV'8{`BREnm i*rFc~Q~=@(5k(UP$Q"y#?^Cf%\7rZv%!='OQ*x=s4 '(r]I|b- ]Ko ) }%wuTrGn:\CIUٍ>x#uٽ8Jqo |UUeW_WfVqOݏF#=e rW {V?Fġa G1Op!Ǩ+*}~9Q1oAT5 KfZ 0MsmpzLm{ʀӡG\zߠF? pn[.{iSg3:ؔs[Itra(-7aR%[t,SBg]+0W1Vj'#fiGb:l67jX,7r4ǺLa~ڲ_0B$^;2mW_8v4TI?yu="Q<;8߯rv9̂hc^هCBc׉x҈XVc1![[2`6'i$1U3zYGj,]Ov . SG^HJ&FbPdKgӓm ^؍v8Cq튩co|ovRGW7ٻ6&7*/ obY`khH<{voƕjNpp\Ra}cdD 7li[f  2`)PHBL :?'GRYtnMimC:p7n`hA?[%vĦ̳Ƴ۰d"j?ǯJFITTц1A]G|Pҩe, +d$ =q7rW<>XPUR6of%Z?_%r`ONٌО'uUy-vn~]z=;& FmT*QoY _!sEO'u4lT.Y=/%?5&j6e=mԫQ(EA%|3GtdJz7@VFR{YR[>+o_%&)NaRtF^o|{bH~pzL1b}Hè;h+Q>q,47=Q!(+>ϳv8Dj>H\Sq~qUya'(`cJi)*<{fPG>(,rU@G>]d:*YjehC6ڄO|q!Uخ֩}0)h2!nZ+`U]Y ޢ9zH$4#IQnQ*cչlxQT) rBAUOJEx;e%FKdI~SDh &HxMaFAqe<0$!Lej|-0R*>&56SĊSF6BkY$xBַ O YY7T1!RTnT4Z[2c^;vz\cvj߾4Щ|!WLPr;?c$;j$4w  (G߂ŭګ|:PJ-T ݇8㺞نaר6bGqlmZ[f -(z8p9n?kjk~!=?̌7\5PO O N;:V5W_ʣf_(‡8ACL]EUq'uV鳎C-eqUQԭE%tnJ |W{Uc)A2dJo?{а­2+n6>8ARJ.9/>X^[8 G(GuƱh_! ᇚ`j4=4=ېcO *L~cb})VJtA (߮@Klh+_JP$n#)mcڤ}fܛ{NʿbC-.gˊQ6Qmٙk鷳rMOL'N6?A$̿ *? Ul|}?ոhŷ8t*;t#ʴg^rӯ Zc悻7^ǾFC7`n-TYvaPzmC/_T ΝO?DQT?IylP%B9!1^F*bdOO*ַl0ê[O|iQHj*<09x~((I 1H.R H45iFɣ$*EA/l2moU?_ Kih ť8AID@O5}Xxkl"KKh\1Z+41ɳ 2uwli0{efOl0qFxoZ#U<smXaMK'J0mWI6?;)lЁ8w%KծW19`WCx!UbxOl <-xE$`Ўcz`W(lWi =uc*IBչ#mc GJ)8r &94*684ObE^.;ھ~/mVIĿqe>?,P|;7/? p~c PV]P>%f_\n3=£ѐ\+QUټF?-4;|Fz1TS=X"9UT$9Wr]q&~<=rJ+J~T>FUW)P)ק8OSOkEh)1U47c:PJ?q(=}| qA{U ?Ͼ*e(cd<[op)Cb‹Bro`)m]͸G[$H>$6a_ׂTۮ߫}zAFOĚ׼[{aBޑA0ݱH'Un@?}V<$R?m?]>̃K4ro_PVĄԓmxWz2 ?VZ XP#t?0r^QՅ \~2ܲ |6K`o އǴI(xw[;jGOr)L`V Ű3Bџ⨱*H;qUj;`I֟Pm_cMwBAmiu2G GF]‡UpL$ou8%aV_qU؏o4eAی*)čĂ;tov QիCqBOqCthSxɗ Ğ`ym *=p $,xRWqTIPmEq,0%B{b%?ۂU{lVN `$O~ȭW4|KF0KoNy?6w(J['_'z:Zi\q?>#SXG};MhOrK/UNoqV;k;( VѐܺFhOQ):܊W~?H峊नKh˼mO1_OnQoTP~ GՕ sWmȫIu$ I %aMRhdm˒jV"#_ϾBk4`T5ʞʉcWeiה'7V\Ut+kZN ׃`;'EDz>}=hx Kv1!O +ZH(-ET\U{8Tl_N~'>OJde>ӛ(,-Xت=y"F$I$6 jju'Ĝ-\x̠=wPHvA^ W1%{ggonEA`1(Ñ%)V(qu9=9LEnNV@tiQB)M ,E7QUn|i q,"1z<08 2oM:ɏ9iǟ/򽼢J,H0R3g(}Ls $}>_Mkѻ 6*}ӒZH+u‹OĻ96I_?V#͟+!^KX.ˆVzWݿ#)u,CsW>#cT| 6IbO*,Jh=\Wp*+2H辵zю~Ypq-",R `-`!=?HJЛ5?`H~^2vo8*LzS:IGn L&Kp@$/[.Ig )h+_Ocfuc#w- -mOF%5 JPVY#/(Qha`8?LOOik_f.8K># XMm_q1)C!!:Mmf7u;a\UwUU!\Jm1I4ڸ;}襑ycA~^j7zkF4+QU?(^3Tx bG3͸7)lUM A=ej?~VYm[Gu"d }C`fWTvYw.2E|))Vt ~'Ļ#rxmq{LUiT|\uTx {#QcV۶Ue;)!)b\_dzG4$古buZeToU1˪OX?lPv#q%~*aV~|hPCt0?l5 tmؗfa*jy%ޟ'$B&X!U!hFOf:*%d17}#TI일t5xPHtUiU9a]f1*H{8U|s_{H*6>تE#a* &=>e)­M%M%8R0RC\2C[X ܇\V-_c?^'zezElTr+oBkOqkZQ ~, t_n濆 [k`iB>i]_JPH7>ª$z}ڤ~8Π {bbNX M)ixٔT>PӅqpx2=Eq G_.R8Й,٠z}(~G67Y7Clin-+ThՁ.,H:mXfel`:=pƚ)ZTx6ڰ'OX<T|W'NT 5cJ.ۧ+0m FՅ(JG)=F̛*{d}WLޠGFF*n }2{<;تj]Nϰ؞.w6qo{'XƒSmqrCwv(͌7;uUdUIIQ1caU5Ppcq|Cp* S* LFkEo(|OªޚT OJ";qFq1/FO !KN**6?Gq*̏j\Sn?"rrOĔ?L*x_]>b #j<(FM Ra&)*{wx/N}!V%)l|'&J\|B/鉷bn/nt5\6SS]rĬXmZ6\cy-CqXhwW;?g#IB{hvHGF#&uy GFx'mnx5z:Qsu/G1z/j5ݟj/?e$~2-‡ x窇AČ%~#⪦U#{cY?« 7}*Si2M[L GA=U/7 zCZ OǬ:dS>زLqQxZ=Oxi*mV=8Vi˥}V#WjWr>fBbx jOсW=}9;aVt1 :mqUE~Xʕ4" [n㨧r(|F5.qz"qBTcB 읽Sқǐq># ij<Ӹo^+ڤ{yZTxbAم4(Q Ɵ#jrδd ;\qJ⿯T} f#S &uhnqAIuO'KfdOqi*S71m$ki/_[7Y.lSEuo?zDoIm*eæqg>YQKFzX:]̀IY$XXpv,:'pި1:9LXQصNGGW ٷp-Qmze4+ӧQtt?8;{tslq4 pWՑ(4.3I^&]W mѾx KnL7;0V^~4)4c8gAX17ªLGI6 clUohۊʲu1?ۂ*$? L&= Vmxj?c8e= \.#! V\#1䛰]پdzGPp$O$#/uهlU_Sb7Y-OW Kq%ft?CױsZ+1y>&(X(~xet# %N%r*i 'nè@-Q5oNtoV^"(3Z>/i4b߱ؐp~ړVp? ?ై_=B)'ħH?\ [-OGuĞ JqUHimX+'MAªAmFTL٭<;UR=0P fv?MKBOUV =*>>ؓA:UQ?*q22_ \V?J2r}=.=BzVlMQyF|l W2%qzӨW)XU"]'K*BT#I@e%X 44C2f/6ZW*t#8AB3O PPuaFVWդUph{!Ui0BH>8Pt 5Cx %juSzY[[o"CIz첸>R,~=?%jd1lzW"'u`~$58"At9'fG2n?mOg_/ -4MoF'O\w w R?OuƖV}T<[Ǐw^ءr/ :W0۩[h9Q6q#PhBclrPѶqʤ$45Hƍ*K(1]dhM:DN*kڇu نQWhh$?iٶc߱?R40$O}ZC*iGa݆%4a\ uMÚ1ټ>G[kUދ/R)ht$^7IO FWUfc'X8tIfI1en? c}pNB>%{?†rٔ?ۊ9-v>8{`G$1fP8AK&W&b1(7JWȪ'RӨǞKw8c%Gm* nO?r3Uaj\kRnvԍrNqe9 m u]Icx)+=lhOU=% PKN+|1k[w@=$*ˈxux∯ X=G-+$OYaĎ,zl(C4R۞hyHN`/pqW'V*;V4 tq7!48R7߈$`TKl9) $l8 дCSeW덪WcAr0ųG1V8­VNPܲSB~lA*jp* HϾŢ䴐rCgŋDx KD׃O_RyL7.VoDŽ-[Հ)H~Y ]H5G̍Ś9;b{A^3,~'zU$g{*?Vm4'8>%IEÌVW] AxAS'|[fPa㌔qݷ#4W"MهPq҆x(^>/=4N߱IUW`)(?h{BKZLU CH{$ [nXT,CŅ1@yo4{f`i}:2b<$S|>X]yT0S;t%*Zx6ue\k+n|MƖmʝcR.<2}b3Bhu/l6 2Itx1aѿFfož/ld/ī~UaŐ}E1(b 8R*PcĮ^d,,̼z~3c0iO U^X_F#mcWl|7OتRQZo&uB{g]qPxJxBo<lP,6!AUoⶲYZuwǮߎ"O%=A. Q<~RhyU9H4|F h۝pn>̽ )vCv;(,*}L]=;<ԛ5 )2ɉ]ٽqa$ zv >sq0SrhV*(xm⧦)rB_84ا `Qz6(xgW?"x9q(h~%0JSweuqp0VlMV6Ī:l Q \%&Ni]4T_tO.l5H bT ,0R*J9x4I%{s=EKl Ԗ)80J? 3k)]|G\*e4<u;4l >8ҫ$Ox=_G UTp&,LpD>K JE7_3!YfYT0F*@kkߚ3O jQ 4=?JhGA1'N,zW9}X~/:kLd!Nx4ObcO J:'O8!*<{,U(kNF"`aDjVKaĝwRr})_Emﰪ7t@X,XZ]EF?m0ZUەL B:nJy.IUqż5 8lXJG\;@ߊ,ARܑĀ~Q._Q`r6fS=b }g_;WȒBsuizUNJTxۉ1HۡzE)J~:T7+MSFC# TtOTf ~!F+b#u{tPsY44?C~*(xʱY6#|Ae&ݰlV\ $iZ?ǨQI taȲAoX=qEVa׸MvS~i*Bܭ;T v}VWx*{N6=I_n;6tBLQj\|_=#]0Z2i"킒 0-5U}+~pJ8ii_?5;]?OhFm:|&|g_Ԝ{Ee{Ψc"(ܟ8-5hP)GOl֜}^s&ryv>M\FwIl庎ku%"tL PGȒ"S& "PJv2UrkCeCPѵj*FHڛ\qMI$dT26BDBԠIrccaÐ6 $)F0qi=2xJ> :<2z]'j?{VFnzJvSfzot"kHN㪿eYEMxIWQx_7QuW|Lqi৸> ąEKgoz9t>+uHe =bs#JL J*{SCVERO S «r9%Ş3 Rʳ $#ՑMojt'3qGű(tC;2? /XiVb j@?}ZQmmdJEp5䣤Ky*j0S+pj?&F&'liwƒ~#p=ѿ )\aه H[)P٤86 HTl;xZA2<[>8N5嵉e|FbRCҍ4"ٹ/j0θr|Y6RHwz|a|2H^!9{YOx9Tb/m8ҡZߣP{c'q;쟥N\RcZ'V^ҝ,oՊBh|6?-/ڽ4N9F:Uz.1x⪊{l.6a{ʤ]$TeZ?b[%:ढ!ex5sGpRzoz%P~~zOѿ My`zd~?iYquuT_YSR#?\, pUZ D=ĸohBtC2R?썏J0*}ݔU?*do윰D4]6Xu9$vocMOw8m{b>J *%4!g*H6x0%B[vQPI~*#wmI㳊xtمG*#x=Y$? ND1˔*w'ٷ$#_cHDE~xmGq ^Ҫ5PA̭lPW*7኶3 HY.a '1G4qo? Wê0Kd{%r #<1 Cԫ$HHDu=0:{b9u#LUUdqh|Rn7M~xI'>#-nx}Jֵ`9!1BqxUqtf>mW}V0nhѶp߾fڴb p⬿}ceh˜m\Z+Џ|iTJ2wq%A‣'cw dm4L7]­·„j O+݀yc )jw]>%~ء=?sT7QQ)[~ rⱶ*\G˷Pp*CƩIlUqݔq(EFߎ89wHZт*pL7ǰ&q4Z<':20fކ&N쑿\I;Gyܖ˳?eNTȠJb?cĴuhUB`$Օ~, >=HRl2h_6_k%jT)F qhx#5Wx\qYFO{cJ}ҦO-8(p"Un\$ 5q\+?58IUWUdeѪ>{*CتP?N(.Qء=(or홬O:*$P{1"Fh Wk_o%}U3rۧ,_bی+jR4Rl~lxW`U𹖦SlqeQ튪)p#دCRK^͉2JH?qBK7Jǵ?~)XlwbOÿLmq[_Vҟd<LQY[UI'Zg'xvƴRD*w)W<3*a_ ;|n2GC00=qQp>bj?wڝƕ>޽?HfO ~Y/o_ ?x-_jx7ğb+DN~ w:\͔4gqckJ:b 0bYMoQnj>6W4_) m1Vԓqʨ1U'l=Wl])75ٷªžc@H8Ulr܊q5(}*hyllUHm"nv@wFhcl6;CG_/֚/([x?(M8)Vn>%ISB}xV\UQJ6iƂByLBBcCQpP8AȦէC#8|5F UX}xt9MoK⭬=~O.UB5~z,+ߤWt{e 0Gkx#'Q1U1 |9\|&ءWCW啠U{!-Yu4X+}SϷ`BڀvwFqM1JY}9T:! i?o5],m<OZ!O6}1?`5KF7-LO'se=9Jvo\"AiVUA, bi5S?Yvʩ)XtlI1ɏ[^;V6iqGݤsDh1O IPQQ&]6ЃB=UwT -Gn1sOj~,McpuS0䉊EhH{v bn?ecب_ %sJw|~xI|3$|'b1W4`k/IP^=qh Jn醕b];4SWEW4@<GԶ4WD怞ؽЗtiªLB:1^?vT p7q>X^/j|{^ # 2ztB4#ns//uNMhǯq U_Nr6B~*~zR(|-ڔ5달E 䇿*x97%eY$ڎ9!qT,|E%eG'ud9#}Qjz l&uȐ*ZPIC_ĥG8 )Uӕ>>jeGlO_W! !6#-7<P/T!o8h#Oe|?ihu?N*$?؟ <0*:||~rIZ]낑8} CE+v9GEmqX+n:IM)6EgDRaW _.jоK%,C4ᇥj%=t?dRB:?Ƈhvw{ؾ{g~8MW&љB=C|/6rs~qq;p8xV >(کKJ>9R]lV;`U+%cZl|8 S>q4.:7Յ [)ܩ|0ApscЎ#&qboX\|>#T?5(…IJm"{Z)HV1M2Ȑ-ͲtksUV Y {}?cR-Bb&ϸ")?ݫR|Fc a;{\%~KrC5UGF)~imx,8;0[q;۱Ą ohv>Wі-;W%j)OԚ7NJG4qT@eƇQ$QG~;؋BCqQܤټXn\^9Z =!H x䐆b#x͜WKFVɀMOpovPqML:zW Tv;|Qҷ24cvo[buƟwF=gy-ۄaRK z a a4t忾 HVGIxcի)V8*Ͼ_A1?`Wuq⿫4sh6V>+ „'OG鑱v#71䆍q>9+U>U )rNcVj7=G&x_YE;93տEfPIPr2V$̍ qTԐhsq )_͓fi =US`([qi ؑ q7>;|zՇz |C.}?pX'(૎7݅ ͵S%MTԘ*ۃYRNaBAUS6xz0 k51 p%&I>"+oaO| B`G˞ޣb,Uk`[b)*bq&*f}ؼ:(`T8&ը8!Mc0%$_8($<E ৸qK'FO\Aen0 qƆ߆*?"2j\VRAZrAUB6?~CKA0oV_y0پ|iYRғO?SAX}aԅ~K6\q%ӱ䘢izsNSAT|Rv/8"+TxJ4o?dqD4ofE'/<(ݷp%.}UC HǒJ!\T6~ڠҤ{V'kta& KpwƬ$u4?G*^+ xwfp*>«Fɥ-mljNXiO [Pa崀 o]9Q[Eu? V$[ΛI1+xTti=Jucv+o L*wir|=l3LaXQۨ {E_A*Zh̄:q%_[XA5W'BYT gHbhw)^8ٽPֽ7a 1+H2Ks*znK sX;@}QI_.CzL㖶'7vm1=.T2,kQ19?kOq2-͵8eY?i*?CbrY$a^-Aj{‹^ qkW`Eh<qTd/F ݏo,LЃsOU=pk%]**9= Dll =EC/n#«uߚx$;zJ)P ~bIGRZV~twf>~q G\U\x8qޘ PWgc/?fSCdLPG`ޠL#q5`oլ٭ O9w[?&G[Yί=eiP%XudTZa"x\,It] *> jQH!z]wq*vj4?#JMH%O0ZL =H] xۦ w8cڑqʯ># ^=u?lptr&!VUKEKįJ UÍۮU) {mI?d9bm6 B1COmSqѾ8UOBj{t9>Qzb.~ ~^>=jL9ȿ/+5Q-7k(~!޽擂`=&vmXR4{Wnp=Om 9"_*-̛8M6T֒D*z0MjpNHaXC*tT0K4qLmmxۑ>9eU[ɣ;m7wTL|OqFdVIGÿ(xMĘ(>Y{eoW|'+ԧ\Uޟ.~9Jp,h}9U }ew]Vvm89_Zzm1+[H?cʿRM_BH'o7t48UYD z`F*`}{K\@Ԩu;~ b➫.jȭѿ.A*n?(۰`BZхʇbPi6v;(H{FW|uHB%zw->89׋"?[Iބ\JF'C<56/OS }ο6֍Fh?ޘMø8'dfZ 2Qo݃Sym-#䭊cmA2YK 佻 QE0PkٶrA11V)|?.. E87JNq0QQ~„ +5lKў#Tǀ늪RZ|M)ߣ|l|SdYGd51G9Eq ui̛HF)uTᖄ{-l)^}-#SQXۦ6),"Ven~*") ~UK 0e%G~"8) Q6xmccWO>ϊ04D?vM<UQ˳Ҿ=03IgRbmQGtP9~q>#[j |'PJylYmȡ<;Vv;/e"r⨄#U|F/AO+J9(~X7H~ɡɡ =RM5IF?&5~zME`7DT`T\s޴K;Rv=zNFJN[`E:bΧnء $~Z)O&ЗPCr.Qdq?s;?'ه!IXِl`$>'\tOO-֑ GJ}XH*oh"|xBr;~nHn 2.*@u d8U揨6'5(6J (k1[\VcQ$_גUxqR[f-j˺ gy\JXVbh+퉨=m1^ޜHw6aU 480cT\AQu F*o WclM${zL~4^ 1J$~m:b4m ;c׭z|zU}3}ut0S=)^a_qm0N1JN!\itm}@]njq{vXqaP{bm*4lTʳ욍o_duim?ee$'#oN ̧jn]'jv;2RX7$fkg9&߷ +\aVIC4S.@~q;CsI`o)GU4Elr2mo8XAC}|9+A3s 5O3 \`A`d́rVf?V Y4q89* (RCSUapv ֿ-B;aZC7;x<RSAw;߸aPQ[ñ\AxNKj EAڸ%}lk$'|JHU{xUx%K/wG~j#j6z,sR|6?{$Gs~VHLtT8/у 2 M?ENM\[#، WkGO)$5]ӸrhZ{?aWqK wh|OWx_p*qWb^' ኪI+~w,щ<PIMGNԡñ+G%U~;UVHVe=bw|-9,%눺lxw?q(T2*FqЎcክ2?6nu |CqOP:sC^Fn8&U/?~G9@,e2 dKr:f_cHX1"Z4fEԲ}|;wx8ՒANU'[vTxB0U{(9cQCQ\%xL8)%U" Ÿ n- Ĕsqe>%=vHKWݘt?? cҠ.ak?bc~>+Bhwl]= 9f0~(э*ŝwc߶9$- cU©FF^-\P0ҡx-U)-uIDߎAq wmJ QG!T'mC<S k4qaUu'] V^ױ1 Shy&uOhإWvy'J>V?}aRqB i;W^a k_ RJRivn26Y%Q ^Ce}[R++Wc1W ^/AQ ,hI:iLts<'8ROk  eqG6(Gtq&ШiսhzRb5| >=;͸Aag[_B@cuD& To՚-?3OX!F'mqT4JksztpRHGۛv8P\{'7MKj]2Q?&gU|qlp 5SB9E}aF%$,:n<XB{`r~VhROS??Յ mz#ءP7 3ZP?.h:ǷqT\7m _n%Đ^)1݂&]|{TےS=*x=1ԁHUIܠoOw I(O$$Ӯmm[vC/׏9"uQJPhY'bz+$|4BMj)֟_R_89%U cM'*H?u?͕$,JJB~>~>*f J8%h ۤq޸";Bm5d<:{.h i+#A8;b ҷ{Ph،V+?䞘PX10F>~Y  _d*~ kQʒ/GBWG/هC]^+B{F;2WcဥjaȁЉ~xQ 6xRH? =i/AB{K^| 5SZu;!䤫x;5Lr(t" zM?k#UɕrU?RW}Ӛ(G ǨN"di#(erLUw'K^(w~ ='qF퀥i*zb= Irѽ@+ѡSKr0qIאe? ‡ߦBeWap,m`@lv]\WӟbnQ{E@dHevkEH[%\I6M:Cц 1cl$RU aQ0@7?gc՘}OC)Gizݽ[0/Ʋ ۵=L4g/R+w`xjN|A]Z{u >+7Ir٤ٗ UԤEވhcTZ.+:O?*? HlptNBݯtBPRV~@(JH6RHڟIC bbǦ*[(p;҄br d[ UZ'8t_F| w!%m?vC<2A6Knb<\]CUl%Ecn0 ]R-=F6}St86+Ğt#4 &GhPF'tI]ؽ=x3smП\kJo.-Q}RmTMK(xn#U;L\Bxm նm8AR+Cti?϶Bۏ8.5M' E#XGCx|R S׎ط_+U 1UemRe=}?qn˷*;>`v.;}r^)e)Un(; XN >> ֍+pZWJאt xOie%Z(imڷz?îQ7g8) -;mZ+4oOlr"h!sCXæ5e^S퍪joG}TnlPh8g(>Oc%Qe3WZ=EE|ję V _AM (%k{8ttaE%`0ۦ&FE}oZF)iOhXoMZuS1Wpwt:ثvC}8|;U:T8ڪr)^1VMI7=؎w4SPOV"9F7;Y:tI],kc}m-5wG*umV'8v] u_mR9>c 6<~}2lV4aʞq7#IT Nli ᔟ>1e9ׁB8_ţ`(lUBK%4o~~*qaUI#ه14!ir\q2>N>,\\[˴bz87 {;\G /%גDSZ˒Y%`8<D|Q45 ~F%WMP~-m_rvQħca >Xգ?e~x,)(严rĎkrՕ}V}{f!*Yh}!5 `Uju1U>?~(Q">wcV،+m&AFQC1UT5(aW: 7}_?AYag>#lTN:6miAOTEҾ8T]Л盛']4>9luCǾ`d0z'_,Rh`K_?OcZ$_ Ur$}zxڷݨIPk늮bwǪZRb+?θm x#qxFQMXT`M4oV?NM:m?ʡY/m12KkXAZ]!q?A f]]ISX&f$ٷAl7pڦ0j׿QqsmءRK{{ {J4)``Av\~?"ٝGU?XUYo#dOWߨ­5OD?⡒axTnh <;ߎ MNѸB~! \G GQ*+O f6p]RѾ} 95O{lG~fh\ 늴 ݿd8#E$)ZcdU(DG Q)*4"d;E,7Q?A˧ҟ,.aG #ZI䄃=m{aE"Hpvjp;|E=H6"+b2)Z)Cg ߏx~) u؀?q>7xT|w;Gбn]5=|qT[~r]""Il*{@O1ҽ.'c|-b`K컊qȑƁ;8]ZR0hjߦXv8߹obZ3+ӧjڽz|a)N†!EqT=#Kh鍭(5 Q_aQ 4hP?I,-%5*з&Suҽ.ažL ;7 ^J vjNdJiʞ .(rHb[$ Fj>D1rg߱=Q+Q-T> 6Ĉ{ *a~x>Ǭž B[#bq${6+j ?fPi~In7#7v8;{OĢ\UZ9X܃=0?PuƼN7u}os|אhdqqVb͊6**6*ثbΩlM3RzJw#o-Ƽ)<& A*+dTNP=^$nW5؝I_:NU~ i!`⫕LZNgssxeڣ+kcjĊ *ν+A UbPbٷQfIJj1p)ԧ'juZ_!IJ.lKO ep?a {bP~xH/UOΝie+IywKbJdSyZDG(Mv=Ȫ-p5;ճU,o_Eqia|p! 6Ǎƭc;}ز^f_s)b임`y >^=I%(?~J):(z{v$#ཽj):x!PM$\`d5 ~ău?.[ڀIdո#aFWjF Wt?{uq}} T0wh{8QN1 /犫Jh><܎U©]f4w5ď(I[D3cb;W+3f'zc!'>?eh*Wo<7d[Qқ_"aa 4 `¡Lk)SQU aOx|q!ZzUcOB1V?U8݉`:8#qmJV*#fh J#Kmdh6(.GEqDO፥NH⌸!br 1bnnb̎F(^qf=hHh…x(xI1MN05⫝BЂ+c-nw>q'+J^[--z$LGn|yV)QGOӸQDR#hK5y)?Up>GQP6 ñZ~ d9UxLPFqY)\@vZ7M6)^KN%D߼ѿ^DF3H~pyqǎ UJWth:?Շbs˥{_u`q%jj#q?MZ%6n 5&dROݯ]=/ŊK w$?cyZE^݊=Ct%Dxemq ˺9^%o[RBprqiyGi$5]Qp, lc %BqeÒB؊ q'cU jюJL J^7ٺӱdi!Z9-x-Lg2)u6h Q;Uul{1MO+pH= pqR6YLcQEzTiᱏiyF}HaJNEeg;S?lkךQ C VUx˺f)ق֚Oﭏ.uCp$4~\c#CaB%o;8Ӗz~ ho_`K_9+T3Ik F7܏Į-lF1UkkMG\$OߠQJPt8˺PpųoQn:Ӹxb}+;cRRWJS+d[B<30e5х:W20LR猁Wrb# =M BQ$Oq{ R$MJA[1;ze(bz=&rVho#-lDօOU>uN)#ݘa) D?űQ꿻n\T:cJB7~?q%Tr_qb&eQIrM?hu8%6bW L xuo(?Ͼ(RhO?.8{W¨c ;wSS_)Wdb=%,tb4R#_=G$0؎`TDrI۸p mjTҝkiZپ}<Ɠh[;mNk}T2[mCi@_SFmv<(^[? "Y Mvl dy%$4lR'ѱ*wƫCd*t~RJWOs4aL*LѰ'fStoNkRणcYӭʊ4}* : F [U&ɲcq0dWMQٞp5I"OZt9K,mڒ!qO\ T,2Z %=RQG)ݠ) Xb58E8Pֵ$(M63So(mEƬ;`'U:5*V ЕQ]< TzT( %.zөY9G2k/%0m)N9*YGFiҽɱ3%E%H˜lğ;JK0te8T"!Mx)ѐ'Oc 9na-Ńr~qsO.-_JKy`JkFzx9FxۋxU ,mQX8EEDzo]69-NQB9/B r7+Hc6 M>FcpN&ĝpn9R!> `!?oTL'iU4ӵ*nã˝!]%hMu 6:H`EO|r\O[%0)I6=p,m R>E7hYVAYf 5XȐ~8HuHBo7YU>mgxWs{`۩kd\l %~X:k3/эYTZvqQ).>#f}>pY\S`(Òo)@A5bcPgotxX{+48;10S%NK*c+lb!x/`aFk q0}4o^qj{uh !VKGiNqXa M (_hF[>#-XV<cIfG7# R_lmCoငך}ʆqbwivy\SiC&ЫaiEt]?2mB=HJ̾)\6U$*ޕkW;qd-Y 4aZ}%HM&n2_cW;cĊ*$TP=qBdWUb=2{UUd k8rtdSF,@>(إeb{"lb ,cu6ThE@=*n)mhBfS-+ <=XuMXӡG,tpڬu-BÕیie?k8}QO݁[۠ێYYZ RGe?qb!Aq잠?vRz;~R"A./AOC*ַIbj׸`nT02Qq=(bD3cuG}eriXzvrpN}cŲ\t? } =Lm?l|IgO*h*A[ "j: 1E#&G \%[e)o$Щ8ڪ\P}).eV=9b&c<8:8ʛ0)]0MF6N_hoO Uhq_Z]ab*\(* )4w(~?aV?au4\Qԑ6aQWpI7SCQ&ت!j|bW߈Qhu Ufvj|Pѓ⫹$hPTl|Q_.f0G enYOU;*2]?<"O>ƟR>W_(=vƕade 6ZF*wuh%>#J8w\V M b )Sٷg-$Ej'56AI[io,"KJkzmgF2U9%SbDj? sS7©v 6o #8>8"fX@aiPDJmx1ȥ5ͿP$AYOm/Y[oY[|F nqtpj;aT3XGO1gJ4{8h>pR-S?qĕ<#wRXcp'l~i)OHf*?G,5?qҬ7/J 2⿆L&7$xSqKm~BO4cqUD;*h%RUbq$Sn`o;OcJ{>{dz+vqUl?>IlABㄒETxc:ㄑk[aBlr6#j0IṛcT1)49*r}-S㊭Iyl7ƘB,߅iMW5~I@vF4R@N*G~3_DxHH*W6sruŞxMn# })CEe5RƟG%?ȿbQYiomui дk?~5daⅿS-|Cc *T&UJ嬮:{4(sG?p*.!U) CK|w:e* 1歹(tb iѸl| IQ\UC97J0?I>#aHb1q1R%kۨVT~>܏FlUN֊|F^r0nD|@8[P'ö0*|Z]͆+x|@*SQ.>1UlF~l~CaUTb\ !,xN>412Jj=ucZv?%PxnE=iXPq F؀V3OQO‡iSӜ,W_5ܛJHf/m)5%yGG?rW 5Dx8o7 Th%7X>?0E~5n8acT $?(cIw%OaP; HF+j+쭷p#2IåWR! =8K}aBHiڝV0RBzҟI^&3@bF|Uqp >xHj=LhCo7yS]|אhd*6*ثb*6*ثbΓ8֪FFHإ:&(+BzQ]ݟ^MFbѾ;v=LWZ}#&Ź"+Fjz㙁Cw",Ǩ?xXUdz~z|UIjc;tW0:=(\XKC^o bI5=~x<?)V`d^ĎxUi]Dec igE$fX)7UOc(+SQPΥmZAWEOW2s*"Q") AGOks_b7Cv.m Ji?Ͱ:vqTi_ ("%50T\i ~UXvj(NUy Uц(@-nI_Vj69JYTŃ A c0$rǸVu¨B o'Ljv FVJk֬Ï8fN|~4|F%G-ѷce. I5aKoGGA,?_/LKʥ6aL_qNqa%ETw~G|hn+ ~=&4'$RCzOsqyG`W8H)Q.T;>cQ/me^-R@cٻ* &-1

8ԟ74bNrҽ{'=G'V__"Sֲn?ۇq~KxXNp(z7Ua F[A!їfB(Z} GѓUz}ֻOqTHLWg;Pږh:~X"0R!d=zCk '|#>&xzSvn~JKs7mh'će{㏞j擏5;;ᓉV_}-?\h x~]Dk'QQNgۚ=+ g2vfQ q5IlmQ9|i5o  v1 U:xBh poߊP^?QG;GvlT[uiqwJU O ;7V i*7+ {!乪cF.'cҽ놖Ir9E@ȪOudY1֡Q"zs@_0Iې uܿ~ݠ JU0ZCDhzxU\6G.@z~BpIcϾ ښ {㒞Ǹi6HMdt錡+q8S`.1JŸt0;ூI{ɒ^Vktq/b|%1eG^dbУt`jإq?ӊSIbsCO;hGqȡbؘcݎYqNSkqJNՉh~}|;Uh/@=R;T7=Gc i/ZpѪ?+xO *[ߤ߻nip\=M+;IB|PN4VG8P*xu‹>XUAث[l~xj6(~ɡ0(q:B^PW%JtW]rѹHGiidioibG+RHԁ0qSQ 'CҍѶ`?[cE%li픤Մqc8mPRY4_%<\v8Œλn>X)(mI`[yg5D^XŨ@W]EfQǚb!ɽDiNο.5[:é'!\nƍbK/cb[E]=㔍dJ{p~*nĘ/<)DsBwDsaT$~8gT )EI UcS{u\P|_am↎6d1UQo'Eo'u7?CEGpG8S_kR'$Lx~h:`vczEr)W08F W䮼X Y}[b_M(%=#2Eqt ,aU%uvԈS_J>\c "S[57?͍\֒5$;L(|?aT۵V$7ޠ":)? g*q[ÁTQ/3~8-*s}S1n6># e~*<ńe_UC[*|q(GwS*\)F-lUƿJY8!V3N+>0f >x#GCi `!B_-{Ub!q'l,ls,ͷ6knwbAC4eM)OlxxJHn:ⶭ CC-$9#[LPaPʲ|ULB;j3URW ? 7| =GGc]%j& -$y ]? Sn }SJlcClv8UBoeaFZ6+mbq~~8˘Tb}PF+UbFC̵SU(s|{QeV4? •)-/o8٢GlU{4~O?JeMPpњ*魒Q8>+(J nH㏹WGx:JMH?ߴ?د@/D*~ F=e?$j [or\`.l.א+##rBx?v5ܩ7Q]/4`Td y&w⨔(5lV;;8{ai =3B7WhMw…S1)c ) WJPS-'ZKʊrcqJ` *>2;vn5+_dK!7o…j+(?4rjԶ/"؂P-/ ᐉ#$7Kuf2Opg֢pQY0nsK͠zvG?rX-1% Q !u()'}e?P? %hV^{YBFpkCX"Z)Q-p_c$67P CT?Gl=j\QdI6qL+HylxO3lVԞ&'Zqh鍡 < 45b0T*wKdd[!-(&P }%O$>Td=}v|5~)MH.JF x ˆV9$GEABnF,-[s4FDS@)ڸA^fc=#YF*ɻ Q?SfKq/jޛS?GM-X'3Ƣ$;ka>I ^H(=K+r0{jC(|FY%mQឣ<#i@mC?-n[ A%Yaq>^C97e:j [4 mhu8? ”)*}H<7wlL٩:KR%iOm;9}a|:E& 8#$QM+&?V 4pR4o`G5{cJH'Km@SWtT,_7j,4> -QXVN-ou,&jbG5$|Z6UOc٤fb QG0'4oS#B&B6 #{O)ҝGۊs 6WTbJ[9jRś>,P%Xxo`y-xn<%o 6`> ˳R+Q-b|6Qo] ?e)?pZ5=Z~/ׂ (}~IraL< UѺ)pPՒzwԎ#T~K63ipSO4gK+G/ٰ)nBj1t7C hl!Sde_R2|Sq*~Vs;xa eMPX2oW$2 TčɓfJ౿m?Pi G+$Cnm k鈽D%fzvیgAv*0"+0؊ oSeU$'*/*T żdz`uY" nVm?mc ];%#oo8AE!eyc~;D~/X֚V|rC~Hkmec`FqbnmmIUIUҘX =P]ꆇg4m kQ64X磊d>* L+wCxT1(bz|_銩NnnP[fl -1U<; =`vnUH[kq%1M-1*qZPu|NJ4E~%?\'8ꑳ ~8FfǮ4MTxi+:+q> q ?`mfhѼTo\cB*#4Ҧz~ GDT1~LaPke{8+aVͼl{lqNI&\ HvvlJ[0Ixuf';E |C=pqdԩ̿~6$0o[)S3}8BR媎5dRԯ\M>銫a5G6Ynbۉ4n0 VD}e/o#HQI< pRZdaeG|F6^Qw q:\_Yll(Pk~?QTت?̹f4 TȣzH?ᱭ.GV77qCoV So0==el«~Iq 6j*F6STO~=>^I˔&0PZdMOd?k3I6i ݠ>Ĵe!.*q|iњ V5bL8-O ˳ 4؟ܒO$fAĞܯě|J\+2P|01CMju%ثJX=Z.Cl*Ĕ>S{ c\+nÉ01rUO!1VQЎ'BGx+}(P T Oc{A+*#(鳏5$ 9eSip7J6Ƈim"Sf1i/nvo-5ܛBCeVӦ!?OY1?//lZV1,? )ȟ8 ֧*]Ds\;_"KPL94`h߁UO}c|N.>cSE,m66v/d u5qrʩߧ˧݉ 2O/m-#HTKI_pͦfyc1UvlUٱWf]*6*ثbΧp=O}2A<3}9xK '3Q*4MB6}hߖǮ!-~l̻+J{Zu|qUvot4 @=8K.}VVI'B, ^Oћ#E#88 U C)a2HM"n Bb(y./lnSdiAC_Ez\٤CaM!lulZ 0{0O hCdUx %䂞#?^#%؏ QCͅ ` 8T$_wYqۖn[t#e;)5_G.1ҕdw\(^OO-"XWSSo|Y% ($<>%!ߚu;{WSC-ufqh:nP}etU-EȴZIHK#Ț48i͸+r<"F\_9+Bd1I08Q&P~5'5AXSN-B"3:hyQt?)p|'퉖.((%=37!ũSmě:UsdbپG[E}!jzWlto|3/%نS۷S޸.`:_NQ30Jt~$̟~ڛa+zo\~{-In/ڍQGLOzoTPqH;I S[:u*HОwF.vHdLVD%fQjRMqd5_%J8\Ug ټ|P̞ 7^FRj]c 8IױTشm-b&6c.*r?Ahw]F7_NAudJzfll#8)2)a'` JI5/Xk$ V4$r…GObzՌU8VI}AZnL}qJ߰CcC6Jn9)䃷$Y?![\ 7,⫺4m|-E֝~яAbϷ %=%JKPַ<v:cJ%܎?,U[P~ӛa]IV;1J$Ha6-曏T& r4}>?h PAF@EvD>i2 ֻn@V U{WKk&/1+匷 KЭu>ԏJ#kz`0DmZmGkG]ҺqNRYaF%Oƛ)qbCaU#PvvѷC4㿎BiyIvo5fxm:ₕz#ɿ)Y- 16Jn1B0;u]5_:wkrNz}?dy2Kx׳ی[_,ZԡS>e|b:_tx‰R.$'ܯqx.R7u=hsaVh J++K%Uh~$ETl|{BRq v?桔h dO TdPqR!5J9(8orhODZت(pU7=X&)Ԏ2إ -3d<ۨ[Kr-cU_(Z4_cuƼ|r*;z0%d I0҆OTřǪLoVٸ?etBm_N8m•#ZO Q0!r8tnҡn[bA?FCG (# 4[N`CIFC҉"} G[DsSo)BIaq`Lq3u0.;xǚ9*Yq\UM;|zL1^AUQqᒻBXX==&#pj?V=oQU낒M-/Oe#cYLz9^UNXMLJV8F>Yu# L":&%O srbNv|1=0RBsWU#}JIP"B$<[4}/ P<$WH"$(U Cx)s&;dvzSO;nlƃxWgo=wS )45/H ID8b~ ˺Te (a!?9}Oƾ=*b~;Mª93 S\w>8e0%dsDs5NwU/]1g$*$WeZg\w24{ MA=|p .BE7<3PpqP~񊀓[DGrɱx}+S~S+AIpo_G[MY)??*2lh䏴?L6h5È/겶11?~"n#ZZuMIXd#=H*iS*7L[mPMO}m"ۨ]\,V{X(WP, '1&J kq0%UxIv'~S0;mzb9X=T3fj<V絎a|PUi[oF[ढy)棭:;a\}OZcm+"OrXޯ$:}VHORxځt+ in6Z@+2}>-_U BW_8BydiAAj[w:ؔksh_܉X@DgV3uZه]~ƻ2Y( M?2u X;bVn+E 4xèOT5UL]J(}|4+( *2w'I ;ˊ(\nV zn;UJ{O'(0IGC7B+JmW(î.him(+71} 0iǒЂ|NAƔaPrF}C׳'Cu17_IPfd~aG;GlBKeo7Я&_)*tkb|{H(w ~8Y  ?4A]ڥA"/c2MiU??ʾV+/׮J"x4!5NkˢZp0|qj漻{q=Mix[e_ gt1d2Yw+}v}?VQ i|׀5mQFqڝ1;yUh) ti%R(?:ڸ4B+*{6 eQTa^9PHRr*> aj .jqb J֒?Uc?E@۔rl;a4H3@5So)y6US.wXÑ !0˒nkQ̄6x:Z X\/^v4 G`ƨڨ5>آ۾쁵"1y) &ƙ.l@-((6|DDg? |-L8ņqi8GN(/ؚM80u5F['z%@O|lLP]nr|ȆQv;FPjSoVaz?g!ef2zŊjZ]K=Hzf"0Xr- 9qY>pZa5H>+}7ցD0-&5{.jEsȦšԩȘJK.{opOG+ed[q3鿏l6soO[߽ Z'L^?q?Mm$myF [H6T$(4i!æ(j9UKq]lp% 0 ? 'ݼL*-M0u znm*tkߎtAe_% :~SqBQMCO_+xՁ :}+G$F#A#aUƑڧ_q¹6a4dSQ7ĕ3UFU}*m5%ob_!/XkMǁY\oׁ*qʉ)J2t4;SKgaT 6' M3Ub0S%MbvSi"p?!ه$Ft<% R)BnE b"cPo$bjۏs-E…%r;qFjvcI\XKo1BIʢlUү_cOq-ziZPqǒUa }}!m %#]?& ^ J!.%~+峎TKfF5~NH ǎ% NPMv0?$g_xnplv`yJ끕7^YϭHm;>Z:lqs[9'2A _lz{\%peqU;0VX!lO` Voܮeh#8Q0'hZz2HYCa+^cCqgPѪmMG4CWaObNJkR>4Ī~!ݗ읲clUr>G&aBU)Wuy oDN*Ojo<\P } UZ3h_p?lpF&»0c)7J8(|GO0$УoCOV!~U cc{cJӚe:EpoI@~p%*ųVBRT&y~鄫8mUYHHڵokٗ=xPH=ABMG޸MoZF} x>%*r\Ho kr!8~T5Ή?'᝶ ?p%,Ӧw]Ndw6ohr#(^=)~*Of zU7h%%}4H)#!-pj`yl_Qs̏#&/qKm*\\&)Mٯmn#6evu 16#o"ʞ|$>{bkB>jS%_~&,I^;i+Jӵ>G U ;*ҍiT?8e⭬oC t5 9w+FUu>#dIٶ4qW_  axO?m7}b7iW+7_PIzas*կs}:b9mkA>MTg#I $!`r$nPKP[nI ӌ'on3ğ{4?'Aʢcէp?ȏ5dmp$֓[5=>¨[{-+_n/=UPw17'⪩sMSb_GjO_*vu Fy*7–LI+PaduF4os ءY'8niR o2([Ifs~3lou!ZC\iI|9F(As@jw'%Ђ<)V3A FEߗ4p:b֞f0[BBmX'C$r}2H|F*QF=*TuM ꆣ\*ٶ>#tCUtfa2ߴ9j2e=zTL)X!4Tb!U O-62#Nr47tMF*6q9k9]F*ۃ~!ר|Rִ?  'bCIv8MKׄ6?CilL220n9*[vDR {#4}Y_,IZ]bּ/\a|}92HerCOFⱒ-(\M*>{6&ȣpx%e1mO TZr9m+C6eK6X0< ffyW1UvlUٱWf]*6*ثbΟytHjFdlR-fP'&@_|펾K ^PKGXBQQ\Wo^ Ԏcފ6vJړ5& nTώ-Ec@=?P\<yOUv?Xp#ecJw޴I,G)؟7-'Kp0i soC; Oqmt"qu=iV'!tZ!MD$Z7_|࡯lU+CtT 6ه|,bUg~cqky<\Q2+`9Fj<1f&VC]O ,<~퀄tntے(`Ha?RxFP 0?^>{dԀ6 J41'w1CQ#fGpc5´HjٺvƕSU]8v;XHtބ+|J>c`Afx)Un?V>9Jц܁C㊺EWsT,WgDR؄<ڞsp}~G^RK.S׮AUl(l%oq-mU%m7ѩ*h&?v Lnԩ'q*USe "9@CK x7*lb1{)?(80P"A6VרX)F)VI9]Z*[%}fňI׸T'N`TP% F Ϧ F=7M14{ (lH/ 7ǂ$ǎBSt|1~Y UY~*-Ǻt=pR*, ?C>AH,1dtCGGKCQ#qTR#J,aSG\/S[¤,ƾ ;J䤃+gma!JI>W'Wo&,lؤJkQ^DNA(]>Œϩw Qz6--"_i$ͧqr˸O߼>6)%cu )VXྌKqw'!KV(۶4 ;(Exi}R+/9\?QVe~qJ n…~$OB( {bN/ -MunQc=[;qJBY:/v<',K'OJ24[DM  ÚS|mxcBc0RjL* єj_t?8Zt;fY[*RBv=Q$z on;0 O?`J3d;9>qSWn0{ӧ~c/ꤣĴdhNBZ [[M!Zx7#o#tu Mo+*ڍ~s 8X |O~%qmEefFTSb:[GoKwpvcQ 8nP<}!SFxd ,!`hÿx`BJ[q9 ~7Ga mTZH[cj{GWcPbu#lbq"A0, k,㷡׶*F*n^5P Tfq8qQ*ҟ.G\Z'ҸQE:` w C=B]Mbd/o_l )E"/%!F*ף (CrQe{l>8VOć̲xOx/<<2'$7#_ lBqU䇋vqQI8)E_A9Jr\еh ?)zcWm ڬ&qcBw/ă2{{dAJ'Mևu˱8yuOR%‘z}f ~x߬4*;w/t7[U;)eo_w]V1Xt+iDdqC]imS߳pV/QL)+ Ǩjȭ5&VV2I{ $؍H%V9 (J2 R`>8O"H~%/1Uni(-Z;U -.}1lϦ*+» %oU˸8G]$1t<:Y:u,MI NتCWهBIO#u xT'Hrrک*} d5i|@\ $9dV? ݎ*H1]?nnHJ?Jt/cQ$gzt\2o~X?'g#T'(\Zo"|ߋzl5(~]ضbi7V#>i`zTBFڽ<,f銡f|*o P+EoIwUw~ F)["7ِmˢfE[t<`y`?>Q6*vCeeC+V w_$d~n>%dlj{>Xbft>#qq[^[D?QqDb7!T5&?ri? JKG8 !mJIŶ!yWџRUq <2z7*6؂ W$"w o>yiAPk"\K|8kAQӒ4X궺ৌê ujrSIm2Jmq*B6E+AM{c׭pNh? 8S&(e?:}o*d?I6}8]To9\|7MPщ2~ڲJN?z0S%hsOn:vbª<|Coo$[ъOuN?mN!C9JwX#vWsA*26﬋Țĭ]=@@@6##=QAEYj/#n QI~ %uI+Q\Hh* CcQhAOh-:\q}RTK<{Mӱ}{6Pn=ğa 1WO=(K ʒ>8(uZU^"cDGpm Epcjqg ^RJw¨H(|c<0+~'[`i-UMöEv鴟xHJl‡Q\ y)ӮdI+M I)9` ֕#Ero*Q sc:# 2{R y]?Cq'5#ɉ1!qk0,:هc1kcT㍱QEVobB/z y[ .l%D\6PT'e|kgTݿ϶k:Qyo5_j߰6ֹ3,lRKgUU֤һ@yꎦM>#BGYeDzz,d|ْC|#[-,܆G#rSsFӘبWp|1=>ܴuf;@ ,7_#JW-4lO L`Ws4OFJjHH(Fz#{~8Y~ŧ< 1V䡸kAca Lj 12҆m@zJXIs xGpqn*58E5 @dN(7aXH#rF Gvxm*GJ`KrIPm۩P<m(%%$s+t땪} Ú0aR0bD\|:(P5jpz5ݼBBت4+g!ʹ0*~|:'Ż|qU+$~8[v`7j9RBޢQZ㇓84O!QN"Jd rmjбfSǷ"$9,'bO2zYKn0Ap+ P \[0rcJMu'W6>8(Wܚ1ݤ)EޜLjRMǿOafۯ1cU"y7ߴ9/㊪+/E4oؗq?x>Cr=dTn-=Oj|GQVf=ޕp~j&40tva`Z &#Iإ͹Zm J>GVedZȡ=RV1:[+#?'Vܑ|7 'a 3Qp)@?9%D'0LW2ǿ)T$9*:lBP3iě|`T; [(Y^U=|@-T8V2H8ʠ!&'gv(@jⅫr0ۯKrў/jP GA~z)dxĸ"J1+IOp-߱\]fScqBVJT⼈v[ qن(S2UQ~\m2#+6qL6C_Zlr0w\%w_o kC~ӕ=3>㊫ZWxqU=q*P{Q]f_/Q5 ‡v-p(A?ضgaJw[^ݏ߁%//냒m1TqI> %zmFN rQm@c,>|voCk{[>ތd=KBxZ?O+^/-Jl꿴>h~,I[!Te n6+}Q;!GLx SbAcx|'+ˇj0s'CQcFRݸ47G1 {$CQpZ5roJ>e yC2o=x)!NcycI▦]!qT3:K( ‡ [H+~8!/1B\aCîT?P&|'Q.H^Ǿ7Oq8Oj6ɗ]c,;qB۔+WCkŸ/CO jUu<Ƿi`l YzMMc]Rڅ֘%RYSWIQ"20m+}2[Z $?NXç +F?ЧW'wQgf(+i2ǁ zh~f۝Kt?\cDj:bdo ~-.jv5x[ j:8Lq1UU&U ?R~Ğ0I|c\M l4ɨ=e2'Cx`Vbq}dNQ&~5ŖBkqPB>eGhqByc*~1u#zf^'~U6 wCc?~8VLt% ,6߃dU^?m-:x'}H?w_Q$a0RJ>dG.7VR-Z#~ gQzmtѷUlЎHh>{q q_%+G$AcQK%ec2}U'ggG_š܂~!]Z;Ye#~ˏ-bޠ_2ܿ[ϣ9Dy muU2'#ATr {[kQIYuʟܞKIa1T([sCU^c<tMZIe(Irn@줟\WĞȓX!WR S<'jQcӸѿZFQHyCi$rt?w„ =b۠+m SO_?ƕ}V~#`dpo#pP\L'[`B$}iKnj`9~Px퍽r> ]q.~mWlE+$n<\(iNT't}pvتe܍We1QAUʼ~{ʡCm_+%rO7dqUnl+.-< &Gbr8wġA%68&+"ZFlj_#I͔3yP|_"QuW|w حMay=xT*ӤTt5H֡܆v?v#">UYf= D•_PF$~Ш« Qxl'MoQ>uP~С]R87\gF{b"ƘdT0mQwh~Uz\ eloUTH48Gj05#be86*9fuCPXFcż1E xPb7•{j?v*,7㚦?pݪ{u8MQ*Z b?w_ m 0"e౨KN3"84k~FK~PHwFz} L` ;JRv8OG5xV PBZCzRTÏƸ٨߮J0~h4ѱCr$*w3Ǽ̛R[HEG\LWр>q+c.;%쏖#vlUٱWg*6*ثbΩq,m:dlXEGb2K,d ㅒ)Ez\n$4o`KBQN؍vǷQ!. !z+䷊\ 7C^Z4dيjtI?ySКJ*kv ApMzbh(qGuنBrj8=yAtb~^,܂R?=8vasioOLw'N2T17S*gSG 7?[$&٪q?',1-wlr T1QG!ZvZ ([m:i(<~Mt#G5PWB䍱S8anntaO<({$v,̿a|a)WOw],?xqM«ܻ8Ĩ$*-h,U4*<[ ` 4" ߾tקQ#oBw?e`)Lk_ISGq F|p*oQhEH0aY鳞L^)KKv`jMZ*}6KVSP©oOчFJ=EP р\Qz8S|AZSrUۥ{lAС%UѽA6nq႕V99lE YJaQQJW ^'F#$m_ DE*J*vo NHQ\UZ9LG}Gp2to %|]h;|UD0**G -p M :&9QDD_G%PA4ſum(+UW*$z-o i"W(& ECOTx0Ѻv9%[\r^!Nm28qn߇ck!Jۄ~>;KQ⋱ĐmD:5lIx*A?=S(gjcn'(Xb/%:Ȯ*6#I3Ě4}HDO?؃ٿd. =?eJ[s4$bբo˗2<&T;K+Oc?'0"A݊eh[xy!J. v~DZL-Jd'XUz~Boǡ߸9%Z@hà"n$/Q'LPbŅF *%P*(m7̗$c㑴%4.Fԗe) !!A@<_i -րBAXBe,Iu-#ʟ`GFB:9Vo@Ʒ֌7* W4wR ^!''ϧ5Z/?ߋϖ)$mjC} {VB&_u_?ذeqp9J =JbSc# =(r뺜 Ӗ볎 ph{bNcۮ#ɔ8Wmţ´6cHQdr4cN疮vqc$ xz˳/'Ӻᘂ x0[V3_8 >`QRaNS'/8%!4=1TZ2*)^ţPZ#: bx%+a wOg1 {dTf9Fb/()-r잣_fh 4|JjrH(~!,x%)_3Q[R 6o׈JZWIYprhۄ⭽J9wNP#C?mT\srl 8UM[T`B΂ñJT+vaF?W8늨4&&}rx%8+aAчr6ٻ(B1Ũ="G[ݬi` l7~Gx7_Wha}0\OQU5ATCak2M`!m%t$w& ߉^Oz槺d% miaD?fP?vU,-;C!Kv'D>7Vֿ_> [/"z?{U%l!SaKkǺL{ z$x\ ۮ. 7ć1X…uC!1v…Q2L=ʱ% ;W|3$2pɇR4-HXoJoOtde2ObVHq/"`;6XHQ% ꐬ! %1lJ<ģ`$&jG*eHЩr>_(&6ከ5Ct=(ۡ$,ǎ-̖ۮ>AB\i zS׀t^ 47e㿾G076*vkz[ID{+@§q% $-ڪzq9RGCM=}ܿvTuShL{0`KICx)B>„! w1i+p0;EQ#B\N*;V~tuw?م B AWx{*+yYqk :{#3QԝzkI'+-LYEi_6/\TF޸Pk  WNI/6olYe#`BKe=?WSS,;~Mj:>#mk)[~p(j;wb1kq#xb>T%%QO|Qsߊ7lm=jܣ?j;Ub^)P+Ÿ=ukT$#t୺ R]¤v88m rNㄕSaBo8T|K0%Om$<$8~H5 $Ns4FCJ\+;+'q-5Z A1:xvӜMQ"3qhL C o+F)OU;`?08g~OOӃAIwydA?VQR[cFXDz|GQkG1,rFT-&AYxobqRh?VP(i4Rr3.R+3JLL.{{(P 3[9Xebw.MxdeZ)VeHg֘#LeG (= g=qO\nN_dϧ!4((b*+˻W<)Fg ֟mssb z[D!'MjQ h&ַR̛Z:@L"qA䩥dVoB9"XU4tGa˒"XUj2ذ<[$vl͢$1 dɘs#iz`+"01,A5ʴ*JȭQݩ# ؊aβ̠Twˁl0H'cvLYى4]Yk3ƵMV Abl" &N@ָ.i)QY dbaj" Mʶ(ӈz Y!Gj&Mk1ڕifH`yZcPz/WXu8<$;lJqRà^$*Ƅ)Ia!U t=1;Lj9.Սv0n 6N(~*hu `H팸1IcmH'9eYi t9t2aO$FOنmC s'$a)V+:XvgqOidM-V A1X(|:^ O&^M8aБ_ t/pe,}9U5RqF#4iml4- -/kmZݾWq˴PXwSi5qu”lwp\3NO+;1[E~1gp(+4ooWM z׍qbM 2䍎K.[G{zUI.'=s 1)0Q#ʃP[u9 M]::l_!]PrKNWkn4`䝝wnm֭O^s} V0GH!xc;UPuN`>ۈaپQOq}_cѬ# <[m/z r0zbB:5BG+#LQn?bMfT~xaSS)qb3/ƒZ9Ijn6е.6nq::>ZWDnuWeAWFZ$qWKƠr>p#rJl h?&k%_bm ~(7;l*9P_IzCaU]q8ɼFF.U@>.#~CMd+P~1uF"Rhg4M%<-k/GO,6B??b$QHfo?ݱ `iRl7rTO1ZtcHacB:*?fؑqѨqUeBwb>ɧVȡب>1FTFy.&zt%ڹCpxͷZF{mcHYl'4:rQG\A]e#/Cb6>j*e>xoJOmm HVc1096q06Ϳo+cP}\ m ؜i6i |f u4w+OV br|B=*SqC1v==U4mlZ+Z{{^[x |#.+=@$?a.$Si?tAowl+O:H̛0ci}D$VO䇗N~ Ɠ(F5~e jR'`6{CI¨ F8" f@i > )tJ ^hOЗ˦<P>Q_ @q1)mU \ h{_Cop(G!(/Nj m*ۈ)Dlei"=?P#o}q?lR۫]/&O4dr.6!rpM#\wC'FWaB.7Ѹ«x:}|(;:8IG;&1#7Tc0ƼLG߅U#_&P jC]rYw]X!`>҄jGh|LY$ yqKhy}9>ÒrϴL?aq#Z3[$?8R ??|m+wniqwEh#n, xXm:Q{w Y~(G?AE,G݉UU+3QŗZ.=7S Uwt<_>\4}OqQǬCVZQPzm.´>>TJiFٿ*T6>+4Hd>F(XҺs=5d?F*F)6 Q4mccVBv1A"O(,qhHM~ՁW߾*li3~*؏l8⭓^+1JҠQe*}1E}kuۮ5`6]B7]iB1.tE)N53cSx,,:H2V_~Uފ5\P\P|_~Oő{UIE;w,(R^T !p'+49So-{bd֝!o⦘tql%^(eT~8 ܬ\"_`7h%{`M#~\ضYko&?dsUM qCe4r[z# A i'Zlk8M߯"EWf]vlU*6*ثbΛz̺mGOQI.q=h2a ex)ųZ?~Ryu|qUHfRBwS㕄$)X -w8%ND8 cc3T-?qڕͣ13ۀ&k'XSm@z:#A `+Z~ҟqٗ,bC*pm4iMV xwpd1 ܁A;W_OEŋ(K9KV$A8m,#5,^ƛ<0g2NCFsW C@pkwk ?Ib6XN)ч8D^é>Z2̧dhV4lF^)(|] $DO8P9ăAGNN TTrЀcXŪ(^G-R- ]qP@mGzjmB+F_C:[ȥ]ě [4y"rFXUd-LCajHcߝTvw%o>ANBX`&I[PU%qUef~xyI}4]";6v>rM #k3XVvh;C}#ȍ4R0?e-&PMk<7FGV_n*~Յ IPŒ:1U#1|@r_ wfO|HzzK˯\ R/OLcW[$.`y:0Ȫ23sAqw~xnGJ?1ņCnP~~-_:`JTn(|t8Uٷ#5znEiӿ&TUU\>v{K#9Fz=|*tQ0dIGqb<=|Aǚ-÷Ua+WfjHDq*TwCLVSJ}X8|k #uƫS|(^ǷߏCCQQj({n=Y%N4^\ܗQb~mD{|0*Y{88qk/5Lg?oBqAЎ0Nxϫ*&Ee$LZ+źrU!A^=JT\f½p<*FMWU2r1EN6U6J#x:$ TB3Gm.-Z!U¨{Ř? yv'`V4r 8p*R%P츪%.R|ZHRaUB#<_| Î>GTU$>;|¯{r":08T9!@d?i +?ُ#)a䳬i v?a8żl+:A+ص8IfF?.>9+$\ZuS,qZ* Kv RMgAX_ -ZĞG| d >d)%{Uzr}3e(@\<\P :c&K.=zRmp$;l'7MsNfR@ߧ­Hjs{e}cKnI>{1Fttqw|qh[ Pр3=AZi-F){Taч6P] bDnh[+=:=>M7cYA$=Q hCEB'F1ʿfDه̿,k*- 4܏p])B% IBΛ)_JWfx4& n$Ѻ @C <ob48ǔ? KVvF5>*Wm@%F*w\[ñ؎Pbw[)ThRl(|+ e1BHLUWjŒbڨ=*>1Z,#fU ,̠S Z-Rڏ)WZ ^2uN$Z| < YqKC*2ۘW޲0VǨBMY(TeI@?~r$ѥbl=}'3F7zHrNtf?gUZ3_b}}L$xO~&)+#ol4<շ|M)lUK$i(eOqX4k<֩Rc>{` 2F4G٪6#8%>%89% s5$I1E^{^ 4lSE Yr?Vr!Pw?:'g\'ˑ[eICA!>=msk1f /*|L(*iZXpT-h?8ڕ9a(פ/*ר oIyZH54)jf48Ge l\>Ƙ俌ҹUʎr62 ڎtBXZokȑ=d~d ֲ!OJ/sd5.Ov )@kRV>nap7L%4BXRYakvPqWr 0G$>奼xBGAf[ٲc79+ILsD^ ./)O[>C5}>~をMbFo"B,SGN#UGcFchXǎúCmi؟~t1>#bE7R;V-T<)7a+H[]tDi=K*0ر3Hwvu5He>uGDi2;Mt?(8_"U ~1DC`Wxv8uq0+mB~*wSU]ϨPPCK؟ TQH"? pZiB'__i%ƩPSG9?VVنvӯb;0cMQO~# "B~y4_f1WpQmnj>*Z{aF$teN*8큥+D~U(VRO(dQ)pϸ0Pok_ >\%W^cUIxj2x{ m?XA'S02o*^YG>ta JH5OJ\ =o(} I} d2uSQ%VEz2Q?Sx㊢+qOd풻Kb> j|M*;Q*e$  ;溸9 ;w=" d7z`+vXHC_SEg@T|RV&$~JN‡"N Aх+unL -;[BZN ATKq$EHkF$uڤSbsU&N|qa ҅A#I,T]i۩-?uLJcOzm.ȡ2%mQ(2,Wt>1? 8LW 2REӃdG5 xw̨߳Uq鏊nE(K(~%N)*ĭ1Z[z{f(lU+EN>;낕W^qG-1ciW#6HoQZIJ/nd'%cm9}aw 7S}HNK~5X#^ '=`8R4qCUo7BT~Oվ吭Z˱)zSƕMBF!<`R S?HTn?:1hXU U-rT+[I_lPrMmL>1E1JSAdI?U ޸DWnoBʭI_12C v+_0<ۍ4LWl6mǎ"vEUw|P\ *֬qޗt8UgzH1rPԖq=Bݤlodî(bY; ,ԏq.+ƥ~Ҏ"{#^oaQPxRAopƖ=u^iKz~/k%rZ:x$ :7M_?`"}3 i֣1UGCO"2`W[(|zjq~s*YlTm>(AIv8B6 nTC; O:ls"7gm.8ܗq01.`WR:oWP~\Uc1DR?)>?)Qh`5W쟠Cfb.+Ǧ*CC㹫u?1}qCnoq8)S#/_`UƪJ$aViؑ#SOmX:J<'"7؏$>a{wSPwAƒ%8*cAen8+c8IKΈ`읢> l[U.li G8kY 4pW L-oT4.u1洊_># \Ha9_#_lԐ2$bn-pRO`u8& H 78M Ll$_}x?@}dű ;gnӱ…Av.=\(8:\ X#>KFwں2x xUzAp*^ ^ Dm}1RHq9\њ1ivqщG_뀪 GV`r(>QGjw+SB;.?Nh$AiVYRO7b"c>US 6|uQن!%ӣm`oS % -yqv>*i kthݻ>ؓZ6]nHxW-OjCDizbxU-n~5x(&qS6F+r_UM~Xb]Sf~xCqj} OmӎYYv&m>}0R]7Slqh*WH(kX.3X\-̜Oy;kvJﹺ~,YU=X,dTPPkJVjf'fA_=hYw!A8q lK=qv8cx1Et,-c2Ux @>QiuՑX7Fp{Y>.߯"`^11 U~lUٱWf]*6*ثbΝy_Ѵdo Ht9(>$`狫TT#AчsVO^ w_pk&zrJې}hi2GtRUw_eZ}YH9GYvNOBiǫ^yNr%k,"[ՅDžz#%NwX%d8>tV\BaoVcgkѻBU 6؍ 5FdUeU= Ǥdy!M_|t8˳VrR<hd`c4n9%M4U.T4}; m#+?kñ˨ 60U<\wB 3E3iVFF*e<,iF?5ئe;aV0߿$Z~ 'aٻ$ 8mĀ,6O0$ejC، ,Ff0E0ܯGU=Cn5_SQxf*0+Pkx|}X27uD&AR"~׷u9[ՍICOl6TU1\ n+bpN$=GS@h70j_O┽#m1WzTa%T?hn>¨(M'BZfQ۱ڌ/#Q)b (m&fUCCJHM=i`H5ȓ JdԅOd ?\y[.;0X]PżYsf1UYٸF ͢4<1T_ï $Pnq F2@hJ8-FUa_Oir$*mV7vd,?e_4x߰J:=@2 4t䇨CÍn&J%HzlB7ĻE9)peC#AF\Ĵ"?; XmKt";ֵ.wON;v8v8Z9=C7u9R)Y-:u1p+؟P==TGo P4:H AG1cC /.Ğ-|0!Y&,g.P#_I~}x߱t9A v1JTɧ4Yz{s_ooG4T wv lq;(S)mVOdY&]7#TbFAÊEXE!DFBT-<[QT?q漐V^ Gf;"o6'%۫Rcȷy&76@ 8`Eu4CxqJw)N|UOxqn6xѱQơhMBf{' Ө>Y%B{czlIC9J?+ЎI%n2 UҺnGb-oy% $oXի+|6Qo0"yTSXDۂ:*4=1JR,|17JBx~Wfkln֌0q~1X]qJo~#VèŠRuh_z‡YdY6}*/CCU[|7nB?Yi+G"t½xb0dŊ}q# R[_Վ10`x6Pzu#~>L5'yaOWQW½KHYkQņp9ҵ8V_' ἸCNMgyGm^' Ac lE:SS3'|q)(q6v;xبUFCv=\v"`U"M2jWkb3M!h򫲪/ON=XVH`.?dğyw˨mڸC~ݱxn`~DaT-Ų 0WB"ׯ!!)Ci wͿc_XhCt9 QH=Z D]6`Fn6=UĽ?Vz_㿎YB:`!Vk>|]Y4Q?g&p*﬇ف>~gHaBEo5^Bwu{|ӌ튪?Պ *\vS<}87!TxbxY>&w% (6{>[N[!NQoJW >͑Bm/7Ou+vѯ"aCQI%&T2؛ip `nѷ/`JI`e+Vj'o dr)d+%w(OT0 B1@t XgǮ0N2mW#^Q<0bȒ'DЊxaU{{7_ .0?4aOLU13*| F*kF.v j#w 008&+Pޝm1Pi˸~|nl6>S7w1l>lp%R+> TѾUYX586)Ss{eKqredkrPw'nv "(tuS8R]vކpف&.պ{`DXZpdaZ:2MujVBA#0$Ka dQ_q9Nbku-w340YqdGz\ђIc2iJ.Mb--ÿL1-\Hqj({dJc=WiN4Wbojh ^hv|h o4JRXnaJzQ|qy0K8]d%Ɍ$MV=(qOIE +Ǜn8)+Q_c~O*Ƅȝi3w[æ_ZBV%} [y# DN*?o|$*ݿƫuDYht%uXG&l m1«uTbrZ U࿖٫ n4f⋡Bqg> :PQ%i19/ y/|dzJ1AiG7ȲiДL9m'}`M9ʏVC`Kur(hv'||R*ƤwwKlUw…ĕ¨xEj k6$E& ;]Gt=:dwx#pjC[ s[E'*6j+OlxοXNa db37 (EY7`c%Hq3nr`$do{Us1I:6?ێUWክy$^烊* 8?3q:唅QLbWcU Ӛ# *اՖQ؅R7ni2qY!;1*2Cr6 l^)?PxپVPUȕh؏P ׸ⰻvޝ\P3J%, $y>Ğ- |bdwVRp6pq/ln"5j1xR"kIfQCa>L.m`ǰػOTŧрRmN2z#e=NLy]FR6^.[iiH6͹'ؓʣ7oN4<4]+u_qNQ@2$q8amldFYW%n8Lj qp ߉,!yW"p ׶1UmsqrGzЌĵn=9:W*{qP$H2CRONF@\RA PF6ϺXJSeNDsu'=pV`ǨD*l'xkrqqҔҞؓm GᒺI}!nJF<6~f%fSP@a_[$0Q^XO%c#J"fN B|'+T5*|O\4n-R7 ;|=[bNt @Xj>{p`@\A^)K !CɎyFu,F»HAủ+Ʀ9M>(pEj*8 wHs蚞ُ9dR@O*V`Sҝk1=ջv^x^; )"3];]hۯ}ڦ>dm0Mo0SmNhƕ|aov&?opF>%qYH;LH덪(˼鈋R>+fN*ndZ{.z(GqW 5!H! RG45#`E%c5coqF*Mubքҿi}*G.;G>)Dl坣;pc,dT`n87$&7];*Q4G8(؛0IJ玝1~8-l=U270lkW[jiN_A&xPCN>c$9d O,q=HmS }hWӘQ0Hf֓$& ~(؏RKa@ub)tȐ|JL]|0|S,8_4ҊP7yI~qt|C#¶M0McTm8G/ ª悅~ ;Ng"n Phb2qU%oN4dK㊏R>wZQoFc_a8m-ǽ*#?~*>>o*7x ~v8ׁ$ߧ eӨA})!)(At8ʢy=O)Im r!c9/޸}6qªsp*~B>!201 [8 L;{㡐sQیLB+8UyfViWV%x[TI7GiFPlr}]G{B OPoxuUE^cǡ ? Og8UZTqE}E$Om {vX +7\p] 'cR$ڛ< `^v 7_!eFi=Bm 4 zM߸ 7ѼLh`Sz櫻 0?p/!F_G97Q\>~d1}Oq4GYF.-ݏݍw0wz~;_׊V}L<[93­ pw8 &w8mV3I61vmm6j2çhm|F9.hMjH仏+~Phk\SSWDxDwUV96pABtS`W#_6~UD&~8קm!6ٯ7| l0m|F&aW|-ኪ Wf_l.i[Wo(}*<рޝkeG}YC\~!|Cl Wx Hnld[Y1}+*kil.%*M-INZn01ӗ$o.Iiq7iL6+x`s šUĖbof(%΄DJc 7?dqT[IMH3IejnH!'CbR1;t7b_O/[Y5uRth}߆ WG5{/5FM=cIXf%^cKն# %L(غȓDWzs~M[sV*vc4qF?&HT\_*0*!e,AX RK6a_ qUQM Y-#`诹lTWl*eo634KI݉e:UUpA}Y A+l&9|Qu$ b'$>j,?ިehTx*7MF޽T Y%;lTOx+r&W0n5)uwkM-pyOirI*GE)Η[iz"0ivoJ.Uf_CuKjGe{y^?!1 ;H\TwJqX|с8Qvm~xQb1ciM֣<C,6fq`J(ZVXr#-xS0:ɱd㻊{Vl͊߮*$On܊ҥOIxX=qPLۡ6MZļ{aV'NlrS 5vF,/58E6:b1Ӯa!O41[U5=#_]G,Pх(mU_t<<9=wi㊭5,On~UT\~{*Аet_!AǡS-u=}zuªM 2k >!x6Ƚ>#Sl*gWL pU8yGG[͊6*ث*6*ثbΣv]u c?X?䝁]YQ 0b<1c`U"GnN-z(BlkFeLb * V;#pa<VD,5t=zlmˊk n+ =2/ ?-JHh$(؏P^qood^HJY1ΛlȒ3)l2N 30Eqbcol qh_QhWE4,UZkPu׷.~{Be,w,UsŸe"cnA=~XB$V5]c" 7'e^Np~Qq_J"|GR?Ct}׳x|NdcuadVy*uaָ9~Q>yjU%^${\zهк:ܗu=GhۿQQk*ɨ9H G_UA ՂCEz E!n*Ԩ&qV iEPb;bOaJT,;xmӻ T-ӛzvXoaO7_9ZbaFqiOW +zT{e5Hrŭ.Ϳ̸8*VA*~Ŏ8LvFeO„uͫ _h81$)EPOu4[d CCwq)W8qP8& (kNsSJ!'wao"ɲ% YJ}6mCqUnf1V#>>QjzwX``~I(7FP}B*>/BӸęxWG}6MϮUIu~}S)T/"+__`yNeޘz{ư{v$*|m߸uYA®Fn/Qe$R= ]b$|@rPn[zP6??cHT/@b&/.W)U&֞G=eH(=*qlGlUyGK!*E]Yd퍪ɲ,Ed5MA…hY(%hjxy~CC`(o >({8UдG_6Ӿ4*J*73J  5bJ(}_ⶂko")Ia_6=@`n:}?milR-˕JvC=Yj0֋8$f#}^< dYq㛟)\c }Vg6cR *CPGߊU()Z'(7rHShw<:c;U`Gk)Mip)nUkCc lp%R7i湑7~"`A? {UA+Ŷ* ø=8˳ `u hԯc|Djd,YO]ޖ1FSчO(mJP"F@xp{쟜Cw |S`]J;9ڇ쟗i(k=8ebZ<[V_F,9=e0X&hW0fk+ WL{:*(8P-Ēc긄A:b=Jnp|J;xbW\˷hqB۫4b>.Gq_ v8m ƒq|~oaB ÔDP8%|}?j…T'5C^(hbKU<Vn.8*}ͩ] 6jOu=Pa#D1 (Cx|(Afw 7u;@I>VPO,TUOՋ>6'a[[MRADY&.>4Fw= UՑ]zcz5VR>*n1xh;O݅Ptj@;8emHpIo?8:l_[6^oRwbBy^zʂ=cQdђ5x!9bC+'SlwMTxDż0Lq۝34zb-y%r4|!Ag (:JT[BjPcgCN`{gHn8eu=NO2 s]s5_ѡR)A6aul >c_j9,cjSmU&cfM1;w~,7+$1QLP卉+ԓ_l m y2DmhIH2(&=c+Iz,X"z|EAV] R ECS|F(޹*6mnI]<0#ȅDm&sݴW?QzJcRϜg.?߮-/YbVH,Vsz1Lhd29ROJko]t']jSaaSwz,ۧ.UĂ jr?0i%ʗ+*qp NVz2Qeَu=jgEkW5ІARhGVf"F @\OA 2ō^QMosaL }Q@@37ed?B`R C'[18O\|NMPf}#ysQEKZJ >&<jv9QmbE/ }h?mvalc! 1^kfzw'/QOZ#h|FGXJ5lc[9-1[VK7(*dzm_VU8X#ҿX}xFK ]?g{Uoх*$'!Z;Be 8- y @’ qJY=C[sFǛ%0*$o;u^jxnwSGZ'>(;(k((v' Iħ_d"PS+OcVpo~ V8ͮYcf sBxH?q VTZUYϟjF!ǒn50/uȉOI7wpJ73K<(P@%U1]2Ga9uk6qˇ-|hֻr}H+oY! O4* nx!N˧hآ1>T$r8hn O w$TWc٬""Ug|oRbJAi!F(,+ŖDž{ubEL@VcA˽UWDO2;/1T; uA1(\{⡣yE(H<0UmeZҧ EG2[1Ze\^bȹ@@H*RU!EޣǮ+hViHn{{䁲tƵQ1Ytb6|M#!;4.2[T6+' @@KgZԑAZu,~&lF0TXC+VA7BڢvP4pX=x0uX.)] RPu=ˎV\Gj84:,{bFԃLވF|7˫>HAJXphlWrlRf.KMu fPhRqo)" zQJ$Bul$o@Lnƻ}n!A~FșSYn%rwх$9 "6zBù\Dd27/pzc!*_z<<+Q]X<<1hFF|r`qP8Y} Iz%A mcZ{s b{7Mԑpv䣐Ó%U?hR)p>X%0e*֏N4.1t͎Kv&,JU LR{Mb8NޑV$&:䉰jӨ=pH2X~8R[jO"ԦaGc JfIF= 4C#J a"xftqB+Sר>%8>;^2)o\-.)O?p.)Q5~]qBX /c5c}⸨X#u4CſVh_}J%co~NjM0*)hu?qGrchY5ɱj0Lw H}27j`#GG&q5`S'F?>8wO9fSѱU{PT|QIUI (/J(Cy/[s +}y Ç}V49Q|*ji´ Q`%Zo ҿ4`TO>T/M<Pj&כZ{z䴲X"Ǚ#iZP TcT;x_(lq FiD!U'ǡzvS-8&8C*F%J()SФQrSXqٽa_%=Y~MhJl£f"`[Wk w rF $*-?EzQ~l,zKd;tƖlQF$i.^=F[qƵSٿkI#=Y7#sW7c}+f*}8U£q>!p+d/Zq>`[JmTQ=?Θƈo*WZxm^Qe|b'4> *la I`qr**7Bd:)Wz8=.laS9䆧GGTYdO9eH.Y;LA4*$+_Q.dMnF {v?FV|3߯m*˂Դ-N֍\go67=oM.{k]F%OMgn,3IV?6u 5@\ :}Qء1ɼOu ba-`{Up¿-c W#C62QqWz@ j!R_cWM<1BAa ֎E-mV#(4F*x;⪬UF8\2m Ud&lZ9C})FHvq_) At%qWxS>i22H8/ބ0[ ~R< JVUF4`涎o7/eV8林ۊd?p$f# k6ξ*ڌ4># :R#tn^>"Qi۾B9/х$QS4qLn{X]8/E=1I!I"S)j9Wba$_0WQ>(4`c?xƐ,b*xIߣ NU4?v%S4sREe>V;S MvbHهb;Cqyߔu7ƕ2J8;B#JKqPvhlpwn> {. )UKcGT{o4q' %I1T+I4|q[t4ƕh+Qr'jU7'^j>xxShG-/zP9 )FDn~#mLIZB\&BV GS~=!͗&;"\y[m62R!ryᇒ-ko"Q׾H7hPUOj\.:6P?9KIgwlkcp]oo bGJVr,su֕W]h^sO$9a{v2m0䴘As~'bf>5:TSSzfU+} NCo*#>#xoIc?v(pi&*1J$RK$ >]G,SamJbOxGTFm/T;$t{5 !qFR$[T V߈,Co=6wo,gdoxh{݊K}3^1UA: bP7(/Wzh9tn}W4إoTW5^SSzbWz« j7mA%:XcV<{QTe~膞,Kt4ZZȽV,I~C)쏐qUٱWf]v*6*ثbέnQL6EyB^F% ?`dfy}~V)kNzx`{#қxbL2-HI?c.{{yќpzCP0GQZ ^87Zz%$ppR+m]GU|'`RU_H=Ć3B6,m_֒$hN+@?OI8]$ӌzhVQm>Kw>QPCc' 9eRa+UDv|}ik )Olu$_xna? c_㄄(jDw@*7v>+pmƟ춐nc?會$WMojfnK}p Sn nBm-O= "aFG\j}r}Jn_֐wPn 54BY=ZQi_6Q]Dui[O!?F_ۑ2Ǿ'slFm  |$~TKbޤ{|<Қ cfΗ+;P6? :0>xR؀>3OCţx<~bW6@v=Wqp*%Ѷ=m톶w⼐~ǛQ9/ G;vaOo=[2~?i҇[-/*𝄽ǴS . ~mfGt! ?q+䣀t#WUJ]y.LxRX倲lzZ*dRLWo Wpi]@VJZb|;$0HxY5 Т@|+ <)UOҸBVoJh~ʟ|Vf2Ot0mfF5rhky&߆_uO[57@6 sw*~^ 6yGa?'u3}\Z=#voŘQiG".⻷o34U=@RUO *71c4;ؙgoJSob҇|r\BTUwE}{xUEѓi7QYClݻQhJI=}FIUcvaLFj: z(;cbvUu+qo|;*PCŻi-QN(j;|'Nз("v[D  Z IQL)A]rT\V9LkVm¿hI~느v?beO hةٸZئxb'SFxQ 1UU7cxʝnqUEpqBvlmW_8Ȳo[B#GRc0ªOuCW ui $E>ƼD}9վ۵GQ5c@YZbuϦ*ScUv[:eH-{bO0Zd[߾+kvU;[>+ّv[gzq^-bwRZLzOG??gu{=^>dXۄlzU=d>Y|{aTUΘH>?qs,Fm)iH e)q6cC+DoS-r(x8j\}.Pxn;%9.&(xox7w0|Miſ)_``$n<|>x2'.PsY8~qedza 0\sTQwa)npAe84 UZc Z>8xj4#?q*SDh oc*$_F^OZ6hn;H"ῗ1vĸP)keWsO*r4#s+wMl*"Wi!ҽ9#?V(Qd!$P+{VO/4xaC`V69 xUi%x`cbT!|A 9o!?iHN'`x 1Q _[<؎wHt?[&P'ټ1\ T$ 8ټp%rK$&mH{sCEum+JRWq.5 xb+¥(>1-§˜)M|4f&B QQC&\i4 &FP&2Q!C]7O9! X/I* Ou)q<b[Hq[?{p@ۓ?欰`Z6a*<PקcZ(%CFFnw *W:֝|Q[qCcj>8Z}CM~6Ejm=|OX=2Jq'xyP{VXU!هQc24%4%}dž J";h+n0ڬdaRuEF r#oL=Ħ\T}8و+FmBKzPG\[t8/%_hѾ . `"&mnvoT0\i5kݦIdnGa\< GI 2Mq}…^'MGlz nj?Gl!IOQubM%}+->%pS$Hx"+8 -j%=* Uyaӿ|/hfac⩒K !bq`(}*-0H`P0PB6J|.?b ULW<B+}x{GϨ¶h@a?Ͼݣ߆E6[^Gq5v7`gz`J-'ߧe~UlNţ~(=by~?qZwF 0TJ =Ǿ%`25\ K\/lsԆ+eB>b0-Fr}`9b:Nlϧg['V_\c`JyTF69D:l]@Z|;uƑ/nxiG%ıq$t Epݰޱx`{ezmncئD#]?v )".0o"* NT%_ʌ eg@1eD^^6NkU PM?M0%Vi?vI *DT* SbDZ32W)JZ"".%$'V=il;#A b+r,xR٬v޿v[A)*J8VƗ1(25In1k W##v#?4HR-X75BvƭHq]4HH㈺"\" CTq>mSن>U!7Ąf?Ta کIlrcN9p=AǔmAGXnYv'8障.7:%7M )UimUq٪+a&9a'&h T!">G5ԲY]P.8qo>#vlfG/_`i5Oca&=ld *-5{ L+sETWsI+| h `-J`wڝLn(+$t_odlTvr vaCW% m'[@B5Ve`:1.|*%nb_r=6"j5݈ڿ<"C`[%bu?&,ڵ҈:*Tb:GHKd igMT2ȃL%>8t鍂X6jE6{mn;v[J;#ʀbj&4qX(hkŬ\og) t|YQ=&JЂ{zJCCSJ'S*ij`|:| !%z&ՠrSBGze qkTD` +[#Nb% Pz$VB$j)f%  WzQ wN pUi6W282TGsڣ I&xN8aQ6cPZo/F06 )F xc s L^8>k_qn ҄cCjQ$( LLdd2AFQZPL<$ٰF/|Cd) B{lŵ|kp4.Aa85(./p*W>=>%`S o߸=pO;vxaJ-uqu2&-}\66x6FccJh8*>(gWxZqj{8Q/J2j82vDW R+OU)PW Kr:27h@g$jQd=QG݃EH?|w.?66lz9OG,I1տb~`{Q~Y#fG \[+Ntx#,J⦫[q# * `ugPG٬5`~cT 0?/ Y`T[4}w[Zר#0OnU68%?_o$Xx|(4zñQtӍpTbm ڧUx704nw-v=-4CH¿ەF}{rb-~'Zfd#lu;'0CItهcTE="wU^oՉ2ETa1(jHOaU2{75Kn/QQ"oVa\ix)o4 VoC!{8zoVeh/e'xO.nK56B*ЌֽUnWO&2k y)1A ڼc?dfxBh?"<}2$%]g^>641Un 0=.;6S{n|XwXUDkA1F)\$UYA$L1\UP#L*E)(4V8>0>tǐr(|W)r)o}c[f^ ~$cZUO ZZ=+^8D>iAbtmxB]r$r1CI4_mn˺i6 cLl`JPz00@Oli+^07Oj.폧4Mq;W}au̿kąne;נ%m#SO4=(]n[T~1J#5 b_8J9|CKid<j6p6Gԧ5U ?Ko5O>mV7kֻ,bhHlT]m *hr(x4q$ Q㘇M?\''ts`x郒,VE;Ҟj7s7_,Moq ڬў|߈pO$?4$qqP{ ̃d?C%t~^kiBh657Ŀ_k^'m%TwZ$>oǎ'6ֈ~ɡ?z}X書=\)>P?b~RKVe55ޕb\7xqU['Sq qcJbeL)U Sߍxպ8rHEoJ:Z9O–fYNExS3D-9SNP늪VwؕqfSǚYګ!"|Hè>RbHWCOQKxzPZw6#z\_}2TϮ*\YH8% `qTeȏx8o JهlRy&zS3[7 ~t8؟O9ćQU1 vܥb1۱ĥ9j7*KOYhчMoO7.hW8>OI\+N߈ꍼg G)"2&߬S6"C}\H[-AӘzrZv#|GG VjC)Od_d:ٺv#SBߡ4|]YJO`TW5~J[Vz[Wcasqw*ifN 1.8rIō[XX ~>> rlǸr,hçP-.z\XUSJtI!{_^#NhX4l4 ޡ$cmՅ>xk,QjOoL8&AP+\ ki/&YGhFԡJa7XoÌ%=Wj -ҭO.X=،ĝ'%qg~%8q#v~pA<1JPZ[;+R+Y(7ćU[eObПR 7bQ:=L9&BrCP:SCS1/~?b6zasI \4-˦Ukv Z Yև~ n? Kgh¤8.eKͦ<&=[ßU'_nd>;Pec_O+\=FޜcqLXHh۸?e4 $/~}/0!&hw?ӱ• v8Ҹ_u=1NjٻdRyEIP}|p*L$ˍ~XUd<'aZ޾P8[HԚC1!g&\T>*8ӧP<'qQU#_ѿWۏSRn2 x5?ox Oq/^ИAȲV"f3XuSZ+)ޯV__+][ހaotħ2X}1ym VU1 |Jp?n(Qf=G &3-T\& Iq>퀡`%4qO.)֨ *BDnu? 8׎rKm7#N1&w;ՑVWٿ^e`>!UG^q#~EG=v&AG*Dq}D!]հ*FZ&l[,OHs %kGV{EF<?o\.;7lN ~,''_?[\Ѷ>82,*Kn|qUUzuZ}jW;ҟ8o|«}O)V^'_ (Cdn`?/ e~xb*qBhYMJ)>'Np+6=cFAj⨥E{mII|,;JKr[J"+ |o%Pæ*':cVFFٿ[)c\|2N],xyZ 4oC8J'q}DZ@A$j("v[ N~Q;T`?Sa *Ϧjܷe8V bҺʥCqN ⫵~0<^x+۞q- ;;78 OoOYi -Cb;`d[ݔҷq8@ɴہц6&꽰MD*O$IW?0&QI*;b>pPM1~*cCaT0vс#V"ن"dCH>bI"7^!428XQb2N߿3 LL bScdJISJ~ /B{8?($v9$)H5Nǣ}7_ D7K W`J5{})$݇Or<ҭi\}ZdœIGu%n?N#eM ֩҃;S>RՇp;d_+\`RH?l Z0?xי(\$S^%nXHڣ0 ?luQ݆VRفnch7%zܓ;Jjx8/^m'5*P!j!Oq1&<%UrM@=@$+ ZYom\HVh&; m o'jhmEs0RW<2H`[Ϳe_ʹ Y7`<pҞ*`Knr[mM:B:4 pVב?]CoՉz0k5B$SORU?2m4ֈu+^~`CitM*?(W잹%N < Z hqCM(zcj{r~$94<_5T$cKsQ{hEbjwGʐcTVI-[?[Rv=`M^n;ĂdW, qJ#%w6&)Е\FN$CżzCCS*)mFua>V~u㞉p>"Jw+U M5 4C4r-O B[$ ~)ÌܚL#W޹W#~(2u`\T):M.e^*]}[O&XF ִ#+ %#yҔS+;f@ݭq3Z1pݎP5+^mj'-^Q&)DIAޔBi,Oz-7>@{efTCu&K Q]xz{R$ *Wb;ot9v=JMUdn@v1 #_ /4Ju CYPt0ځ [IXked9.(ycRHX:CLrcwDT|c˯^*`J#XN~jN|mh:`iەSn "apzuV%۸NX,D5JactTѤz(:<_Q)NQ+ZA[jsքu5<8Or1=G֗ԑwWl1\{ٶᨔUd2IQ/0LrzlSGl34>~R{FsïZJ' :yZ!0ދH_V590SxC&uI]F2oT}9Y͕nrSp|mz}jo qe#B6mE?5Hl}3mfvj:;C_ח/@@^[VlGb2 9)*0 {eh ^8̐A]\7\86eܸ5;%wZMF{Ԣ%$55>+ i08[!.HiH)ЃeߡM3X. :+ʞġ $H`n'7CyzQЎ#LKʈ\}ZSSmWcVȁX5m%{QOFC}kTm| bW*rvuV'UG{渲ͶL)|ֲyB܁hAJ-N-D v5Ğ6L-fƭ:V D,WmV8QBt= ? -*1ZE@zK@"iEb tfVj` k n',A cǽT Y9V7Eu+/(\e6SnEFv=+N *A;Y¥3mӦi XW^5F@Kv8Y<16>Qy!4p#t=,JȟelDJ:@rfBQT&HٞNzmu[.u,;\Nb&?28ĕ.T!7+"@Id%Gv=:`.7 Nێ@4 R lF &첨fE 1I ֣h_tT3^/;n+L *Oȍ|Fu7M0]YZhZ1FDkz.#R=ڽ͚r!B)OfF6i\wPPMaDj`7%VSOp0l:FI3JSLum"kBd!m$c>&_Q~ۘX>coL(!-0@a keg o2>Mz* ZVR%ri_f\ʫ[[TqOG0Aۉ`"5dt#xyD%rဢS\-w@FŰ] ~Ѱ*`KnmH`VI~r-Uc v/TP֩3@w鏱_F^ڗJMo JI^i>$5c<bvQE<U^T[jID@B>91q{9fVr+#TvotZ!ttX#lU!tF)֟FDjo㣲[ߠ'{ek"|iI%WS"Ü;DJ@A.MXy QaU 9!͌2 rwx(Bkݯ?fnƀ6[NBWi pHz Zo!It[/L6ȭ_PTˆ{_K%#Eu `oM!Gx!mG!ON]/l+T4aR]rd]+#iaC{r?M Jn? ˶(nm26 +k;5Fk+%~{K`j68&6i+&kxE) vh(Cz=&;xGDQuꛈZܟMտ׌8)!~-lؿCT,a/ybsB=G 6q\V@e.uM5aI'‹MMZģ+4䖕^۝)j>!-!FՍNdRȨч"v#¨_">=.OR+}c}K8ҩKSNCTᗁ|%|'=qZVm |(_MCVWGd xy&To8QTlP@?uY7#oVQ_b:E!x9n1UVۯjA eh/WoVl 8w &8m9_|G\|~cpL=oU6b|;V Oq~ TTzOT|[\Xz*ѐ#6JHA&1$`#Sڜiiw/#&<+::2n>0nњ'?aضi=d9vy{cTt 1xJ\01 #fVhOcn)XSb=Y{V+oLӑVԃ"0E65xuH '2Faުr? #⫤f?, PHa5ӒC  Il\xoT%QKx/>}GZ'wp9 iUESV{bO߅ ZSSvCIiP@F/$kCd욏Sۉ b!PIGoQKsޏLRS7႓jzE| S`}owŏӂyGIz\Ŗ{8na>E45^ۯlqŽ8U6`5Ij6*oq Ǝ:'_ BAce4>l#݇!1 ^}T7}C~)QUmcjKTm lp[f nhh#tƖ7v!u Z}v))Vɱ? 6JXZ/o'rJՑ~5{?W'fOz)ͶӣCWO47(JFVLehj>,pTQ_82G߀d⌓O lW/}^\Z毆Τ  #%ҦR#|hRqQy-Rqq6o@UY}V=Jn?c^ IfrZ0dB)^pqKuj創Ɲ|W`J_2|/\L$\UT0Pdch5֐|_qIb{t*K{G=qqRTXۈ&&n6k{dP[{[0>dfiQ)y܊ӯ݃tIɚc=ȒJu6EeK[d77oƿOjT8G~IAu IMQS|pσl@!__c*7l-Ng]K:0<^l="9> 7EI YY"FKRE#\ V0qz8Ul:^M;6W,G8~UZ9]eA#[1QZu ]!Dc'.+ȹf>+moe%tm%ӽA*C-4檭jP4CdO8hٸ΍ {8nmsstǂ2{umׯ›T;|mfW]qx:7Êꦠb*CG&U l^Cqc >b8yWf]v*6*ثbΩo!KoH6Ŏk 8~O| 2IC-v8'Bu?1'fVWO-_tӮ) ;'}%[슎3!!mDv>,RXCWpz4 kF !hȯnpIWb>.-*ݭSv,l.Mhס sZ|Xn C2WzҾ?T:gakz.)dt'29[ JM@qQg^-%FdM~X lCdRY~E)-wUf:{ؼ$cxbHb$88gy$)4^c=}0k|r=h֕?9oƕscqq wJ֣#p|04qu2j,}9_|L7#9V){~ir0aA}TP2𑺑O!!=׸=V\[J!dãWIshVlRxY TYjY>.y+^ T!# яlqE-`a=@oa.ҢIz%-[)_^KϿނP*nÉG*dh}8ƎI c^u xhޢ Lg )GlV'7IQǨ-Oݡ.>߳ږRffTIj 쩣lè`H)ddOɿ欁ഗEԂB=H_G` [r({nq[p+GC?qB9\Ҏ6C9S*5qOVa4~P($=.7_UqU&x mJx F޽pEڟI=1!.lZGE1*̃vOcNM!$̿xMBAaч8U0[栂 Cgԍ(D?~!m<X(Rgh:9o?dkƵ+H܈^٦%3HDaz}qӱ$GHv.:/V (xڰ 81@l>&*Q_fWIWҔm`VXNNaA^/qOG'Hn쨓ҏlŘ!UF B;ݢs?߉WݣLU86fbzc0T儏SaTn[Fxr0;RH*G^Ƕ+oBo/2Ȯ뷈8Q_FJ Q)cT<[STJէqʩ*.|_$"ko:'HV\F@@GLY"auo3qQ]@=9'l.4u"hҸNOWxL3_E -辰Ep񍿛!IDZPl5hTY~zWUFoKWqK[Qׯ݆O/DFq \w\u84=G2<$bH\sOOCF~ 'YG'Ăaj- L^ꇧlGzb|cf{ἎnTR>LUt8潈umM(Dj:xa.f{|r=TƸUJXFžn1Gq5bFt=t?jֽ\U.E8J>UIyxpD3Pַn8h%\FWN(k 4C$ due]?l}Aڈ.?ao.6RaOl(1Z܏%U2mQxvT8r_mujj?.eOzm =Gwl|Tp) Ep%=Albۮ>HěīP Ėq=wKV ȠOPp5_p*G$F)G[ܤ0<\vqpp*"D-(PxA5ʚCc;WA5> K5/ w^ +;H>6˚C>JZi~-1qfЯp*.ͳxXoTLoT'`|$4ze墪viŞTZ4Sm9$$qI{35:EGc =TVY֞=>]JiE#X8M+ȍ a;Q{}@ {| 4Rݥp} [/'<?l.թ N^RNvЩVSAdP}<lb!o. SxNcx|J{a)B>##P[ԯ28܇$*mgn=9miVƺ vlN'REM5ߦ ;{x`jʈ_`v8sQ88K.99OA+4*>xh80+4F4؂09F%UA2-|5_#})%|E /Rz9&uU $;O]qH؏xPM; "N|1 ZZ+2Hם>,Wmw)ϓb0pOTk<=ĽcRumܱخ-f@<-e*xcU"v8,!{`PEC)IQv#7g*sQnڼ풫Z[lz - 0zn:~9aE \ENaY RQZ|MsV[/MlnMVCF98[,o-R=-Ο1oE=#m!$C$夒?IFԏV,$]EI86I0,qo14aq(!"b$wAjW|ZoYY(#nt1>wvHZW" + ~"1W菁P|y[VŬGC0ZMյu(Hx Y8~W¸,B)-wsg,odT&`aPA aU Ѐove1-X1 |M_O6=jGk|!5K>f6+٩}kP9UɀFnRTێk|tUi^bTmIA#zw#~ausW:(׾(IOt#ۓ.KIN@PRXᇋe Ǡ0cMω"En7rP^¨feQ֣,ddy((kYV=:.4=awɝ#t9xS %]e=>Y!*^Đ@{vE,3nf,O+83k!T2F9 /W |$7K\D?hhܺdF"|0VZiwWsCFl?FVsz-tLV]VmBk@>Ѯ_JP]tslv{{m%(|>xI.'2ώH;tprumMo/\ #PS>?6}*b8Ӻ> $4=վEG0qJ㾰8*mƘbHN!ԊRln=@>+wĖpW%lW<IpyEG\`]PȔ⩋z`cMuqJD1noՅTfxDСǼMQ}zSMXx_?28Nm ;bo2J=MqvaQ ,|nOъVM#1CuiTUNC⭗lTWlx\V%~)؏\RH?7r{*.,AlX )!~Xa^PQIOmFZ)5 Ž(G_ o| ݗ߮(Yx$a)UԚ?G\N6չH#Sjk(VׂIH~Dm7iziz{rԏ)$odYyhU'ҘxH|VOh$JdQk/mbh&Ɵl}#58pC] CU Iۧp%p:wƈAUDn>M WOksތ=K z8@Oх ;/N'HwZUy18 MD5mPГ }!_t5xEGxǬ6낕MFv' hp%gzrE7^C|MqVO7P,no!eCaP߬c+JǸ7|$?" 6,waOq}ŒCoj$A\wjoS;WP8 VA3]: PҎU#=UFZWӺQ(S+J&Ϡ}>F|i7,o4u=%;?'6EʄrVu㝴ÿz8?Gbϰ딬QO!嬣Ƙ|PccLM*+&E\v=UoN$ȏpU]CO{~q>baޣ\VOW%╆oᷱƘȏ>_0\Q[܃uah'48 wC l:E~XR7Y8J K^7Ϯ K =RKD=ʷYXl<֚'u7uITG'öRScZ\(b޺>Pl^7mT$Ԋ$8ӯ=-qDCxv Ld}t|`q\wwQi"U۾ 4kAOcma~7Aʖ:r6ȩz KhOg2&k_!T`?'F782t1EJ֧z?n 7_,NJnU5~`:\}$֦֡  {I%&dQjj~,iZ18AfZ ƈ@>lSqO()m-ړCߍkRT>یUz v1!-X|J@>im@LToeraˁ+觧}|sӧS_\h| ic1߮WGğ\m[ v =㨒هr`MU?Hi, Sh+6AX&x؄K[IJ`Gq٨ //q^aDbXyWf]v*6*ثbΗypa%ڿH6&֭vF|2^G_'e5A *ehm}1&^" \|@?"6 uVڊC)0sUOu0';Kufe_([<Ҹ)C^S?P8Z|y% $f8lH?],Q'*Ӿ\jZA_L I:Z_|ECO(ȲceG#zrHjhTtbu^́T׃}#;UG{ֿN([_EX/zr_劦Esټ~x\*BY2=l3nqVۻU s߽|~x-K-}b)a璟%:V; Sۀ#MMYۉ@9W bYOWՍ"WMBq,H{5Lba(m6IVlbHݎ*%4? >StxT$IGC{eI;:Hٍ< kzi)E(q=F%T&y8/_ jXzUZ$v8%05 ;[gr\ئ2B-z0 uſir2 H.ˍ6oS}+,O͂B]z ):fSebRE^͈bIi{jFh ~*Ʈ|pdT+{`(4~*0\RMaT)%ش? u+/tҠ⩅Jr0i(hQƕ0+ J0jJKk'^'F3T*qVԢ*qKn|0$;TlS!{/c &r>PʼLn9۟P28)RkWgYoNh'jj>ta+D)vL@Fzuxewu=G![f|Q)I'n `Kx%i/[+Rx.U{oZ;on'$4ݠ>`'I; $:4MvQȳ)*F V)U }1cWi^QJġB f>xK&WT%k?XSj C*W0xBć!f^/P^vԏl/h$킓i/|qH}+Ud=\TfXpۋx?O'~,EGp[$ ZCz C]OKDqcG/7(h 12;R\E>>*#1X B)]f|qnQ'2=M:W"%R<1V‡'h:׮:Qq9 J{xeil|{ suxw!%*w(B HeF6KPjM<{U 29I#Eɸ?qƒY.>qh%!Gk֌b@wSqhIj֕^?eԡ%K`"(쓏}Ge?Ļ\-ۯCQJ2)_2'-.Hbz$?*0%(}7#(Uרǯ4=j|pکGS\t؎di^[͗^?-#1Eo68u5C=T4FW#=qu"ab;"<fB"V4+qxK/|R9|'qu3Q`T@eawHR1M;W ێkWDS[i8Bt$}]?i`ua SM7ZW K 8X[i梯qTdpnNJkNb\nJ 8;岬cp+Gi%:ˍN${ZĿ$%7| ٿsd7"0*>k:;I8Cm6-ͯ#>1۫q*<|?$%ЎBEٺ@B\RO$N F#"J9Dwq:8b낭.[bUB?TkE:Ȅ5##Dl)˃xU HWsO+ ͜@UHdW^%>՘q w\PIЀ8g?V1a# Y#P,Ŷ}Sq4-ĻUYgYcキ2}UsnVҿS:P+I\ 4(T8,$~w{wp7 G8ԗbOCdHÎbOZ_ρT٬Ao;t#$免jh!hU2H*wٰ+TK0UC'BUp0b5x>"!+G;䶡鿆TDwx^3T ~2 cF\b 3<:2n@2J`R§b0VV↪{-i*ec$D y?j.)6V 1#z u˰ipŌFv"@w0ޢ즙z\'D-MFyKNMx- J۟g Md-iޘVQF$aEۂ:Bn0]seiVP$_dJ<KV0ncxȃz/Yzt*:{bOױ딃N@@$GlHtlj;2|dU82TDLebLʉ^2|ݔBv3M f+i\2; CM+qį&JYZW!%R@Mċzd9mA-[R`NF AL׷r2;ݙ$MNRZIE#jT e]VL[e˛!zrUPnSB(GlƜɬAqdmJzL Ab 5 @KP bېH?Ac%5i*n*n$[T8Sb,^YWlc*ز;dk(Kc;a"!lZyGC'f;Nw8Eu^:\cfZ*N9Q$H=EjH*!їjd葾N dZb&ooOlb$]g!vဋeo(n$w]A?㍳s@h'䆐1qjačRh߫+,<mzL¦#~X!~Zi!]WP5qdq%Ji퐏;X"|{W)3`ұpzQB|F h\6cN /ƾ4uɖŠ,xµL 'ܷRTaN;#e0b&3Z׮=^ O&B";%m)MzZ(7& >D dbCdJ% ~(7Y_YLPqO'+صoMDDTms[]AZU;pA+q+}NK1('uF)me  <6P 9F7EV6I$PָxhQu5 /Tx/@e\жqmi VGR; [[W!sRwpG ׮ lA^Mo-dwJ56#˛)FͲH}# ,-eaЃ1fD#b'-Y_Yޠ献؋j5GcV%ERVͪWT?\TaQL#ӓ@6+uNFeNkʻCmѪ7d+च# j⪇1(6/a{kot d3;)z]X$UÕ*)j q(98*9aV?UII_pPO?t9\c;l\qvaކ0*2 Ë$G.)VR8"QFaRM$RᅞWቪo))>G'p}هҴL-<쟓vp(?R~x֊k?v[rUT˧ vliS(u)!t ti"-M-x^v(xiߨaTjч!h)VK =p${iR療"qCOڨ>A5lVֵTq?m :U#?N*Ԩ<2"F'rPo `i)”ehvN [#hW'|U5dzW=Ju14ɩ=Bʸ4ox@G>*f(io^K5WhË} =v2}ǂ{aBW15^I?wv#ZoR؏1.? *ZYzon;86U⅀#vV:Uaហv#q< PJdU#8H855eOTvan]̭* 4M!1>+);7X)Pk5X5/d ١oNu*|6!'A5RI >2GT7NU-*Wh\~_&v+=^56>#W 0Ʊ Upx=4#uSaUEÁ4JJ[ujWZ+g𪌶Q ~1˰;Ew-4]PYOcISuW?VACEcm:8^ oe]?q´Z|P1?LkVHŏ(|{ᴯ^i G#a`.Y u w[L ^9`LjZ!zn嬪~ɡZhBY FKj>lUHMl_i[3Sq*164cZGW#nFW^>NnFh~8%Eu?Olo(RӾ.J+{6hG"n> :zH%QS.㧿©߈GOcAЌz\Un\)=)UqR Ě1M0R$rx})U@ЌoXw_(Nl!i#cl}TV譺q(S']jVJG?~%kKdo-Iv#mBFz<1lk+jZAI=6~R[Wⅾ^)68J|F)2-1ZPpix[^.pk6 (i*O(x`U5,q7)VKc6Ŭ_PSz?薣N>q=_P7){x4RWywD[Rn\Mz?_L)&C9h [u;K ?r=O邖CK\>!yү'OI*S&wdyGM&[G8 d+qhE=aS`F^L~)_`v>!$"xf?aB6B9v\ipRZ ^#CC/[`Tm2X~rO8D *F1۩q-ݾv#J";]Gpa<\n,qpg$q^(@0d=kzZxOJuĪi(- 1H_Zl$7ZǙ_p1Z QUu,LkɆ%i6Qm@PO)ro:I lHߖCceW݇Ŕ‡7]F"7SVĵZ>CLaR>5n9M8JcT;bSE5mU{mȧe# }iCCcDOm $J7Œ:8BKSbԎmѷTI-FQP0-IcsT4>.W㌊?HŖ6ӊJ8Vۨţjt;ctC]vq '_#w̪ўp-p?=1fIģta Grm4f0:lx&~&|m6O0Om05;>l /#'6 3mo6+ӨCoɊ#F!Vq|GO O!q x 0u>Dv?v*(w~ZK4=~!xba`cqZB`傑BHx|c]GNǼmxRdxiy@PⅲXG$+ pR\+*{W$=r}ƕ|wC G0R^8'U U/;b7:aUCaLR\C8y>X*lUٱWf]*6*ثbαl#H9WT ļ'dP0,->e'$9eSn-Z۱cC"E+kKRU@7Q%lJks2N <0lԑyjQH./ъA~jqJU4@wF)oŐ׸ANP{{g+O$.%/#1؃J=XEWy%-3l}LF9[M|7'Cf( Rl7?/?!Jh}/żCumz? ۸C#Bcg_Q7F pyrV1_U'0Gsqg_PrSGT8*?(UѿwI=D'>̓tho !}awiXlU+-_ƛ:$銭Z/pYHÕ9&.j{741긔VzdU^o;Bx5AOf«nq@$0xk#%V5=RTŗo J(71~WȂVYl6W1"VOxB:,͒%]&Թo+Wy?a[Mc'*FCF)Tj>fpWf=BQuh$5]t8⏿ > ~4?OՊk4夿pRۏ>9d!$HݎJЃth%QDkQbE(=,zJbiqc.> ee+F@b߼¤_=' "H>!u`01u?`GL ~Ͷ%Rzx,~Ufxf~ؙB}%THcU$  Tݎ(P#S)9%rߪ#2cC*@|{Ǿ@ qBxS4U^喬TЏ̫&vr02u B|EO# z%w{v[2؎.; mu@l}چ‰1ݣ?aRXÞ:@7_}̿%͋Dܗq2+K՝w1;WBۻ?_NL>~WN*oZh˘IyHVI8TLkhk0rJ#)z\ lACh22h?d,3=GQ>φ*W]C+6kcnA_qk!.- QO]SY}9G3!!qb{s>2eP>:q)-nǣuOz7M1+u„͈m|U&_VRf0⩾X<_cIx(VnbO˦Td9G6cb5Yf<~w[< 2KèeRqJPbimO&? çӁ䌥Cq>-t \U_ٞ5um%hmxVWVIEDZY;݅VU?w|C,ׯ~׃)vu9n^.nޕҕn~xI hn,X:5,oWuٿh`J[Rm{M07^I~ \qa҇87*VG?DZy #]vVKc%?`KDH=(E-nӄ l4OItܿeGF? 6a(b}+:nY.2rܞ/GŠjHP|BqЍ07_UN_ 2«xq#Ƙ)&:чcR 6*;)_fCaBWCz8ފ?iT|C20]H.G!&o!ˆ!@ّzclS 301)2d_nK1M&_  U>%ƕ &|; ;۾!Tފ~:!{e:Ǻ0Ţp ȡBd(y}Lt<(+b3'čoEpe"*XbO 0W)C\T 1j!ԘA[ RD",q]/^@x QԉދI tysonuRNlM6B%xDh(I AzH!|"Xur w W.+TiLxA f6o # I IMO(|q_om/;fd;ebnkrO *+Hٸ+lFI@6j:;.6 79梧j|Kn-1TbӋwŅE;=P 6-cHȀb;G*2SCܹ#RsS"h6@;-'5b7G>NuaFg7vvMO\`^G(*kߧS%iBn'ZӒ5 z$Tȕpq xrCՕK"B>x<$ܠ,߼`)xśE.HWtC>KkKCN~Nic9 R2J^,b7,8r\QsWY22b2\jKrir3Ş64$hdX|奐n$E,*UQOa y[v2_X[/vĤRW N:IɉERk;][^=vvR@\?e[9c4瑔EXk%OC;G" *}qٴDN@J^FB) @&mr5dRч\y^68JԑҘvD.]ڪw +{6ZqsBzQ1٬+ԝ$ (;0e4,ZIOE1 Lrc0DCNO++b{ቦ@؝sĀτ)*0 +ސCD5"w] $0 $ ;BZӶNLT}2l㳘_4lP+am!R(w L@q}?-F:צGru@LJUP#wr +i8Zashƴߦ%m|.Ķ5tÆ6ޟ4[ف ]mz,gvK2f*fHlHmPtĚeQo({` W훓Ģ[v"K#;,٨̃J Mq e/c*WW]I կ%ېr+|@ڃK7>#/2aukk銸8]1'>Yk6W9F;b+pEG/x`{'1h%TYyQ"1P;R Q?v:|JDVUNg9M)06JnG_ ^FKT/ِVCY%L5eq(kO|bPLEc̞x: PbBX+퍆ԍG` <+cgs2YAM9Kq`FAݔ; S ֏ Ĉ;`kT u9e=iIJƂKI-kdu&=Mgf_H|V;@zErmKd=Ĝ ӹ8%DM؎)^X,6jW@gt]QM#ƾ8_pWa+"O|NXLV9;We3tTLB9IK䂭ľ$mľT(nToi?(DZ"ᾘ-\ cUCb^ h~d+F%?{77+t>)Ff\$ގC`y O*㐠<n$\U O;^+Q qg*zrx} BFO4%:t2'VK+y!ɒtUNUeMk5u7lUm5[[ qqqƘkTzo!4x 8Sqq%ozp90(/ҭX,Z3m)m=v"=|w>Kt-ZC~8mw&*UƠP\xݣQTG P;'?CPSyTã.,շO0ҪA%$O и?1TrDXo34/UIGLRъ|[V=g nR{TaD=v>#(QkyWe[/N[Q^+#mKQ{aVۋ]!Iel*ʿkq5'@q>G%OIчGȔ0ꍈl+R6PQ7bokh|0# w? 29kuê;Jn3\І7g}O{ 8?x;llyd jzvS?p2[5.'p ;[/P,}w5X v># )?ANJ⅍ź e㊴+? R}nF> +t, Z ʝ\ >|Lɮ)w2koՌh# bon(^WZHSQث8ٶ>+تٺՐxU4F4 Q!\u52)hA6>rDa\R$I_x h7|(XU>ƿN&UjE%f'mxJSOeRj  R?\E{F YN>$8AsTOjW%aF} -j>c~8UbM,{L%mK׷Qey5۷ :i2,ߨ6̸6;k~$Y>}bAMuNkM}5/ G⛟Kk[Jz E'?X xFIf!PzbMVIy}0t1J0;|Fث~ao(rQ01R<ޤٗt;{bAr>x[q^T9!–WO9fu4aqE,hQSC$:BYc6UhxU"QpڹJ4m 5S$w]+jvF*{C>hm&x<$09 RN>OiqUq' xͷZ0BA%P٤c *>7*$Im{hהg憴Z)3+F7ޕn-|D/9'%KxO p#`et[Tq 6\Wr5N~)19AП[V") |0Lz7Fhw)k75ξJK`V7d֔/uQdMB4GG#jl2?Ry1籗r Q+B<^CV=kbY,6($i6牴Jzb)mLh :|CWV܎'ۦ_$mQ^ò>#+x RMO9bCc'* >1P'^,%?<6NՁ`J)eGnj7]mbCGjפz(hޫ*14}{aU 3ts7\UECm<!bMlɺmwIU[oqGx2J+! {OLCʲ)xȏ+0=qۯU=ՊAy<WèT"j7ZmAчYf !WM5;\7ڧ2͢eLE?V$t1TK@$;|ϾFY?G e|W7/D[@7턪)1 ~]b: B`#j0ScхkE9'Q$MeJUn?uOq02A_[W\TAwO }ۖo9itq_(Sp~\o<%GCW/Gԯc❣$5NHKm2 >2HS*J= vdz`Ji 8N]R7ViCv)bJ۶(B5ȴ` wvQB.dzn,W:wJK6u|:VYEW`?Tx6&v5&[FjYG+~ RX |i׏IȲAXj#KPsRO?abکקKu|\)Wuc{R  s8„.њx;OԖz$ O/\feWbCvs#ѻC'qKs#j9;WYWaS;7s@Hh w(;\UX2ϏF\n\d:p-SOV=ҔE=1Џ]P9ܖ%jv ~?˄W_Wf1d::E!.Gd> B`PKᆖ܇)R*˷uڝ*],u4VquٻVPQ$M+J8Ĕw;xBb/7_㊔ܯlCB vqE~Cc_qAv?ho-M` G\h@>w7|qHV<5AOQb}>Ou=Gb<Ȑ1VS{tc_P)y=^t?fcɓOx>$7M5;|%8Uv;*Cö57ݏ\Aon 5wai*3AA߆ ge؎* 6N ã -l<|>xP*w#GFfbUA:,T H; ѣ9áPӱ2Jh );NU {88R+^X{\P,:-Cݿylei#ȟKKR3qҿ0m!mYrcwh?x„lsڠ68w2˽R۔};M1U8.'Ƞ?N*MUmdž(PxGv>9lUcw+VVF{P0RWH >:[(SqFm Mdw2$$9dfTIٻdi+Øدƨ1 ƕyqr(OqTZ4? ;<Є%yF0p[B)S>4?7ޔ;tx\?f~2Mޜ*JXd8u/.k#(vB2k8o5<_m=*i߼zaTTxwPd<{7[hv#(/YM7;6 ֟VQTA =",RiF&$p|>RJ="A#VmbGۯ*$ KQAIV䧋~!qUrjpJOTK1B'ca'cю:EwYE@3Mg4lp)ծkvJC*MAZ+Gщr-{O RKkDp-Ԟʒ}f=*ZRh> ^S0$I{)oRm;\/mB<L9Ҵd^M#}kK71ޕk^NȌV-F6o %w]eF]blHjڜVM1ԧfn Oocjh|4ʟhXMJ{msM ˾R 7 eR?Y6PBZf{b^qYsR>T| =\jPרRY?NJKrLGnqgxگU|7 N;&8GSww:gA0 N rW4OYq&'?/7z(=q&G ;D8Ɵi_K|Gb{`sy /_ HJŭY 9 -P(>6m ]9$6 <|;1TqQĚ`"X( 2&l o7"tOVPf;H`P\s{~'(gLZl 7L2ejN'v+SlFn3(v#2)L|r ~$p ֔a*ieŰH+*=ciIg"+:EkcMza!6dté$}9J}(yH>#l\GAP#Vikeg8'l n'0;Z[7ƾUI6@o햱5S+OWcC-g#PJVЃpCcj7Amz1f Z *HCN5`Tg{59ONR/Î6aˮ _I˺ItGL7ЎA IW.Mڏ o&9 *scB;]\Sxct~:˒Q6ڸsI+`"dB"IvS]u5`! |tZ?%> AKU$j<*#wbOب-tK8"l~!T&mopBȯCqTI  ?irpq]q1B2;0ĊUWn(>YU };aMT lqGO 6[T EFZQh=${nXVM<S- xrNfN(SC|r!'aV4tGKW_&ie8Gt!W&5(>!pI|q&/,;Py^ Q1\G/AŠ%HzC"Evm(1:6u;b#:cZ>cphG0lEF*7pwƪ3vlH9~}8^2m(>mfݚpBɺ`Bn媔<傒dRAtz8U⍊bmIdኢ"R*?mUY ݗo­h6<LJfgĚ N6qe_3]etv?~Xނ#q`'jzY݆,q 8*}FƨwbHGYdCF x^U>Y}ˏC2@UZۿta6q\-l﷠o֔?IZ55HLihM߁ (d+kOVYcSp:Iæ1;~#T[885\*G&#늶ѲQ wªMצf Bա>e,ڼO銶HپՆI'Oeзc~ׁ뉼H۝*!_cĽ'u;}UD˳9E}Oq"/@k{b1vSJ˞#I1*Xvi*%`$=.Gsɗ&%5ǘ0DƟ[=ԓ?#|~HlěOmbF?~ZC~Mj{uT*mҹ^=~+V߽_kO+KHlF6?k}0QnԐq>8 xQJ22£b }cA'o Z3Cq6 Rhj /ۀM'kG5oGĄ Q5qPhMc$c9G˸켗0c@U\ lQUaG8{saLmqzn5ԣ%n LzN$'v8sw|mS'o~+dR+ j3 T]R_(,<,Y!UqAö*צ T<0; ޛcBe\RښtƲ犯Vסc=0:पzxeنثFæeoJ}gN*4oWi3,7LU\rNaTJ_"CV_dPWw 8R]gq -8wnH8|Ud'7ɺ][}8^:llVCHPLSce df`J)MX[Zv;ϳ~8mZ1gݖh~~~ ,;{t+2R4pVAU?Hd]Yo/m 4e#[ОKm>a=7??Y>G4W{jis.h~/\sm|8nI+Ө0$Q%#w*Tߎo \):pRF[6TRG(p?pTJ"(Gv>?㊨IfMV]Y"ه!t;x•n(~$wH…>2ElHS0&<0% xh?Tيke|4a).Qb)lC{8*6*ثb*6*ثbέmfϘEnwQA /V'lls_P6\y2\ZllA$#SD֒&:*Id Co1yi HCH-Mf\ڴ4h%=XPbXz~.fh7?(?搬 o% JA?*9R;m]5-i<1+P}׿4jSӌ#5kOx҄}+%ӊd~QtHvnv>*i|_ 79/_ג!Pb<쎣 ўC J6DYR~.(lz('G O8-%$u=$xu$+eQݏIBX#qFa-SF5|hUw-o~P- "u_ع\T?kq8v*ew,NUQP>,$ 9%!)=! e0-~ ]nNBK O 7zOa7i0vӗfՁYV*G1WN9?vFtC|(۩ R_%!/C吔m$,5#W9>r@n{᎛ +NSLs5~Ob`l7(:7x7.C4T}1^ُĞ 3~,XZpߧ8P<\}Yaٻ R(Xd7=«A e>B@S;7qSQG8nroTRAUVX(O0P*K(r+maTJw`_ Z[_?ЫeV C| DRU?ece_IUq5!>ӱbnC(gǸ,=OݽU .?78o 1 !2??,Rv*ans8uB\~MDjh!ݛQ&  46~8_uW݁-sd?;cd«ی׳[c%4'2$% wo#? Oo \㋍dA7[|q0K׸!1@;Uc͡?Jbi0-uWxTв412J#( }hbOfR~!׾h0|N"-?8zb{Rf:{PeW!dXt==%%MQV<\uhsPl{Gnb!T\` vpjL[KۘU*Q%R!Rb5177?cX>_ t>AR~ ݩMT)KF'?l;:|?'\ B]/Id/ӋZTH[[p ׹(n֤4z N&KjyDIQ?擊߯8A:\~cQQ$#i~Mx :* J7YE)x䐥4o?O1(9H;Kv &z\6(^تq~E3T;`QP}kƹ)\l Nga)sX($Ktq"g.m Int^MD۝X@MqsJָQq[Em.+=55;l`~p*D擏(HHF= /V$~2ܕ3V 6LtoNJWUIj0epMQ.r1 ۍ`c-;]s׈2Ơț0ڕX_?%G&).[Stj:HvV>~LY]3CSnupqNb(70u<f1uMadvSbiuʇ8*T|eúNpUۅ{.{NJms@=ˣ>_qr"i40HfW?Px%F^2I,G~e;UmI^KZm-`n"ӉpzvF?b?lN@7vJt~2"m:"?5A3Oc|8_m-u"e$|TZk1!~x_rUm+͢Y5U;7(( RAbG;+_Ko9'Q"iपQy/ƞ?٠Fojw43A)\ggfI"y0soIVqnbXUO^FTKde ]3S!"B+^ Z'3OWV: %ktV^^8֐ +q޷"]@.X3*TT$g~o1Ɗ*hhz)AKͫ&bM n d; DNfCzy Sv"z›me5 78hsIz ǔMaݯQ@hzw1l D@"c^iUɎMԜ"D̆27ƴje{䚊4I@$i̯Tm_@0Hg>J/WQO|y3~[ rgr?r=BEg_.I<.Y썷EN.{fye>m2F}a7r-bǨ 4( 91+h9]VUBz2opS  2\Z57۶"4'hq[Um\P8Oc6k62֤m`hT**2bvE+TȢ=ء߽r)nL1vIЎAh B܁+zM#yLslvVB%hA4 `)=\ yq!r(~{c0m%HTH; 5!viCC=uv=r(ǬӷϦQq)^BS,MH̊!# ޝ^>c1'}>6mjcE1#tw7LTH`fi>҇Ӏva0j?k& holr_DCx{EiQL9 \;c kFe+ճr߫$T R,j06پМ ^ZUGL^2W b81Ȇ6W1*p=C%7j!iN-J*+'5Ĵ@U~GjTzSl^j܌}قC;Tp%#sJdo  NV&Fiǰ|H$R `}^}'V|=2i8dF`(|@S 錎e_x !]ۯXQ~!kTr/nxHmnو*%hNYY?H};m9 2Ӧ)6);}QkLBT -v\RQɱKKlhSW?v8S2'%8!:xU4Et1iibKU`I#sQ6nH߽(8"N9C+mpwwo1 "S m ˁ/`il EC$>+2DmU;}6*CGrz`4 Nm:u^CIWʺҥ}HȚ/M\AV2Au'86$WFOSdre?"\Ah[ Wb6)ק\Q_Em0eYv68@0qAy\\=&UE ǶU|wղSl(h Mޫ^$,8<X=ڎ;F^c ѣ5O1 =4flWblJ.6+q?n v{6l.q:A={0ޜsn:lqT_cT'NS TLqɱ*ɱy!MWS[o$+ivG:bjs=9?AQ m >ir޴UooJ>œGnPZBKO-]2ď]_9+4r n.:\ Bd&VnFE+#)+7{LiWO8˷6?vx+ኩmƸWkbѳXWgd_J8C_׊ P)⪫\U&#nxj-w*~[b z(f[z}+0RI3§歵~Е`JN| k%vqa@Wҝ5FPx1h}8&9T4,7C_c[,폤ez`oq@j1[{M>釚PܯrDa_jQ-6a푪^iad9cRi XrdIPZNe1MOrTB)'2дdL, G=! :Оe 鴂o68Ə|*Ԗ=Q5V݆#(&Үw8[l^ݗ|q@pr6|Uw%&>9@dJ$2uƺa4+} zVۉE{,I(}E8 G?*GQU?3V' w_F{6kr,MF4aVDf)#v!\aHoiex8[}iካ }o̮0~;௺[SjT{&hE)(}-(Iq?v*x6oNǯєP^+}q>d<=.TqTmj&Bh~7-hE>4?m8覚!Oc)T-m?ވ՜toe2p'r5Igu?OWO[2e1mޣ۹ۓoK60ȇޟ|6fGOFcW waJ^B_nv%EoJ )\"m& iC6W$čM*X 8NKbj1pu*HOYXMhwB'X*ظ<$pIY^AFj G]vlUٱWg*6*ثbΧriu7Ȇ;kE=Vr* g1Lj+J6\o%Tgɨe?̟OdHd 煤\Zڊ_[#4RZ0 y#n:0̹ m*wqj(xȇ#㈭KK6v\Z?p!$v2PO4?獌>)$[~tBLa?c{bJ=2|; jOJr>-UQ\dmVd@S䍕9%GC2{c᚟ `sj^ݰ;@IwQѻ_q3Y#$ue=i,_XhwSAcJP:ݏ~8hwCaHWfVxwZ^ r%ȯ75q,˺M"$[A?W P\6/p{xLP߻fB}XR>̽01}*QBY:+<_㊭UITmRaO$!o9'lN. /^ѸuC4 hAdʗIPj|0)BJ 5AژlũLxOٻ1j!ICnPP4~+G\%R#%Y}\V#"Yj׾Jп1=1%hXzءs%]|F WF)BĽ_ 7Ղ**7^gYO~br Rt8 pzw(Jӱ튤*]U%Ջp{\PIC nIX^>f+Ă|qKk qAQԃx=08bq3ѻF1\׋x\UUA_>= |4.%"nQߨKgWzuH]o\eP+Ѓ[ Ct Aч__pS;]. &O!dcVC?e\BŪ ?qR'LR<\JInWˁJp:UJ+Cl~P0|16UP‡ęh /N UUx8ؘD~`Cro.`T=q@ߦDT~/'x b(tԯ~=47ӥ|b]>%^"BUy~~X~8SH1d1ݏB[f@JR柞i $ Jh:5.dq(GQ)tVDq= j zH:o$-l6xXQyu`v#6( Ye@~d ?g)͊]iFN8q1UdddoT{PnqWb0h@\'[ޛ1&ZCqU P]L*qj+c!8_~5 { UbAnHi}$&i7TC3Z0Z=׸=q"0WqLrTv6E &#єrC-z?~~L>˧-Kh J:l6񸷺%?feF# 4o䘧:UsZw?ڋZ&a.?t@fx31rh `TeՌG֍2]<ءs$+c'Y~8`!*Tc18ɤsnçx-U& LQE7YqrdޝA8UEd1+҇6p͚g`hź"?uQS|2*8I eޘ>d$-╱_.W#" @A\(]5e&:q;K >ءBxQCC6)ĂpqSc &WpmL0t Ѓli^jE9;g\fJKϥoSC0OʿsFZ2A„9EYbnHɢ\mUB$v=öks(x_c?(m>JZ' dɲ@muBhW{?R9cSc))ZNdUAqU߆J7(-]ޘ5@Pb_PP"0W ^Jr}Z[3U# e$sEwa0xO5cv8{xC$(eG3M8+?O6dZD%y=iSM7!zSDv'e3V1@ьZ;R(ʋ#-kbli"IQZ2I9(ibFY [va8$e=hU!;R=Y/rDŽRj)[(7űBq^& c}{oX0f)3"'U_Iv%G.41?~:;0:xƤ%k$ TsX2Yq`Q;}-tKA()l8`-r5-2K‹:2(cUkpP&pbvP7US"MS\E!++Y㴜 X_!Enq%ҖC6ᇂW=?x՘m8cʠ0qxZynr0`W)Xt!'쪗@2 HVRc4㢄xޘM)\}T/~}oeurG1H)M'qI?[CF_>܅+[jGV_X4 G=AJ:FKfЃSk0)Ǿ8HA]y[$DROa Boe%p~k^==hȇC-F=-d!Ǯ%=>!/;z?P,|19&bk7 ː hLuqwdk1([Qd6Zk2fbi҃"YXTfWřY% ɗ.hpT| hOoHժk2;<3"E%G|p!cGLݺ;GbN91Ȫ|SO¨g޽=c3|r hQ[I 9NPf+\5h>C`w9lҊ@jj)kKekrjPq#i6n*2ԎHۢ*P)XxYkS XŒ)#YrrTjިOq$TditX7!(醩9ؒp|nc*7p%r3|p,*/ME>1۾<Ȕ 68P !uq$,88Ac#[`{~" xxaH5^9v%"[F 6~Sa$1d~ @&pf] 17VW A߶.svb3ۭ٘0[FmHp(9\e#d2h`VIU9%m,&X}5tAF閘!?KJ\e$$NzɺEr*щymn( $duL VRH#ԁLV5;p5 +ĚZQ e凛O^J~|MSbj1 &I*'4@:J,:WOBJFENM "wf`/BDP:4F )&B]FƓx 2VViNT1QJ=3P@0nH&:Yz滸U8j*+ԙ)J`;`:T7|{nIUjv!smO PIo0hTS zE\jSUBȦ6 `upѲZqZt6:eȑHr{4˅i SFdsB@01'wR\nvca \R̚#e{ ]&֞*JT85=Xڣߓi3(C'搕l4wN@2zuA}@8+E8E D@P6e"cΈaH|SYnwl.xv.,苵E(Z =<9T A^-H*q$UjQS"EK/0f_ 2W3]^yoj[-FD [ b:#Z5Pa 瑽$ɥ[-4SAzW51+DR`M= ek81`[ެd8 EEt̴M.cgöJ^KӀ5f\́`v$S"drL5ۉARH#]O@xvX׀ A!QOJx۶pPd_|&C.ai8]hHHp/eB'lmhd<;{dȔia|[ƞH,y6VPcK}ƯHF6"5)G$n0p5 7ӈp6Gq Rۂ2DPdgJ1.@.Q" C)x2{6C`RFh@T-A׮$\KU$Bȍ_mL\=~JWz,y5VS_j2N5/1{]?շ7jm\ "ZmIA`Q(| gշiam~3l7(v@H FSCY*$9lvٿ1w]6Q{: Ant7FM9HV<[TX;$2m`׋HNۏ 5ixx|pD 5L'|Qq0PfBPhGOX?߆E~[OXGWxRsHxFN*[u&f*;_ᯎ ~y9oh'OqZEOGc'yG⨨gM>_m1_׍,m1}LJ,?j>+hW=p0v"_rTZl^Vy;Nڰu+<]KF r MAw㍏2OX.{#cBqjGUSЮpHHoci X݀&Hh7I1~e&uQɹUXqFW#}9[@\iP|R+iRbx$PbhS` qw^0*2n] t$s&"F9\ rc2b1DP䭋M'~!;f$o&Ojڿ, H~ l?ױ]x*0) .x Xzs ) Dg:<;ctw*v;6sY:Ac-y$F"H~X9%7I'cj|'_}8jP1(ƈ48PݺNyr20{үo/9~`y4Őr@TRkRDx\-b'nPR<0էZ:7Qߑ-djqf9iS奄4+}Q<8P~\j ӡO2w 5aDG*A4jF/ iF?O*d?+4C/߉ \OT"}xȪ Spy)Ib|K [-naCVǺQс l}zl앥Mdv;+JvUqouqi-u jWaһ0Uŋ}zCڏGuA/P5Aꛭ?ɑlvumH#1AhyO@ۃ.j{}$;IT즕eU`=ߊ)JWqU=p}⬻u8Бj+[Q9/GӾ)qeN¶l6{edN*cgSs۰>xQv>P?hraĄ~M&'4Uğb:uX"m^$Sof8'w-$ǒQUFٶ'qIۯ݆d|YA߸Po۱woI B{k7ƈ+Fw2(*V z߆8zl1Ukb*~uS {iW$ ]wS`Uģl م*хj2iQif {|*xS;0j仩ĞWcCURVetXY$r 8W(dь~(Uw\y#A_q `I~ɡ8\?}=G2b tƕ%*wL Y*Yl٭1Qk9gJߩk"\F77ĮtmG2 j+M+Xk_ȀlpPV;,I 揖6+}C튴ba>!+mFhj}0ڪ4}U*~o|1Xins]|78?>CWf]vlU*6*ثbΥr?]F߼mlcq;d @H5ӎf)q1'Qԇ)2$.3z2p1O&G;cXEvq~&%<hCWMXt?Jj*Wӝ6t=A+@rwM4t~߿|BQۨĤgb>:_ȼ?Ab%x; m MMGqt4][![w„#'hu- #I7uO y%wVX[а?;Q\ĸ;vӽ`DejV =֮>9C WpNԩ:}qYb d=/Vv5@^j:xHw_0Ò;4RO <<Ǹ*ak9zF ^d6n|q!GS|2 0ƟHP70ݺ7qe䛯u_+pF}0nQH:㎊SPVO̵@SQ8Uj>ٻ'<):ѷ?Ukkoooo[g'䁵N>pES1bwhPGQu zw7R@`rikcf?geor>^ٸ+;́)ΛA=<]XP#Ą0' )ax%5bd4>%|{b@D:q(i"(y!ŽJ|2L OpCQSihbqY G!QV60&{'1 <4hFXk JIRY_>㌔qrHn7-w8z6 PڞG)*>l]ø?< A{0?&'܇mFqIB:TkZjj wC>)Ju-HC]Q,ؿSZq];/P6 E94$PƟkoƎ7S{2[ Mg{4;0-ϸ6IkF┢ɡ4+x|JLb;}#[-UeTwyHejŇCgd=16K  ܍Una(~${ Z fن@*6#8Ʋa 4rl֪{Ϻ`J8s?Jv##9$ f8Fr$$#d@J0hfK(IK5 J'qmƋ p*J+}LT(u;Y*#i|Sfb0#<Ċ5 >W[u=/qyA4>S7^)T % zHc,%!֔=9!(K۾/pㄔīWcbԮ͸xP}o:9M=9WMqQYEO5aU$<;?IWf!QAva1=JWc3#>iΟ T\i:ўK÷.JZ$өGFGF߶? V~(MDs!$cqPN5C|2}*}ٝY>uuCĹ4G{ VA^rCtc}2=Dh|0+b^"9d %[$@ `!go|i E$xf6 K}w_M7UPN'B%ZV-mLP6le(iLUu dH$WI-4n" 4|ta'`4jt7 Bg pC!;8a Nɋ~2VӈoS؏p+ed8,ɽM1Cc՚3M;jڸJ9 {rEټGLimN4Zxwr۝i"b7BͧH;=6,Miҭqc. GӊZT -բ7\U ˳ 7> CYqf"N*>JD W*slv810? FV#6HVR 5rа]ǎUdqC?4!P"|YYK\>ڏioԙ49 EABz:pZ*CEWBH zSIS#z $a]ܲ'(q.?fkD\% cad8@r>gBGњ2."u xuXV;7ݚ H'*hǮU"jsܪ5w*s@eZrIR:Q]zQ1(w_qymh;(K֖^SUe${#r>R}%Lpw-UaegɈ+1* jWq8nJ8{0v\5=ZImIDZ햒f+]Am*|G\\D!YF#"xo@̴ j8ˏT-%+Jw#en%҂preEڦm(,:+.qV-JTaK6OZXBFn!IݨΒX\t55fScTY&|Jj7d,O-9mS`ly8;V zq 2Ptr҃~琑ah=b=5)m~9B"tNuR#y2>8OWF2lo>@ >؜ jT -C%ƎYRĥJWP]&Qin-&I\^dNu 

TݨH&(/pW- 4Uվ@Wrі:@tz҇[*K+d9j$7Սjzm[BE 7HW``IЊnAŹ1'%{Y.vgȞق?GKl\`XhbSF^lDbPo. nMe=tᣊ!+SOۻȀ+HkUbVu;>ytrtbb ^A5[d04$$,]QqmfXVfсgQ)H$ff-6LjO ^DgqA;˘&oX6P]_ajslkť(6˚ڢ=r$Sjj|'b64:UF^<\t;P@#jxk7 )\A" u6EĊ#l!roX.pZXj#(Vj$=` ZerUFRS@ϒO 0CVJGwsPi <ڕv+wQJoב! CqwK8&B6D:cJYa Ґ@":o&BL,E,uZ ҢT!o&^Ě#1k`ʴ+5Zǃi2`ih:lI}A)\q&{岬rD)_z`l'p3˚SGv^ۉ'F(qKSGqN4UvW ʔKTFVwj\qaFj&#(8n'& l-Ka Pz ^)" wH R"JU&]|w,@T @߯4dEdn*\`pQHH>ȧKbb*ԚbI 2IhI @߮6Q.Ƅ%w l R>2ڹ]w4AKBx=x^5R(^-`%c<;{ oXwc ʳiA\]]JXӁH,Sp`~L O Xj_[?Xr ZȄBL銋Z6v~v k=%*#/7X#!tJX>ɠrCm7S,zND%V;$lT"19?N)4 !RJع)èSQJPk^p7>؃щh@-hh =rPՊ3ⁿ:P*5: '7ޝ1F(4tT4˶`s )hc)EL EW7їNFH q .<_s''BcᢲD"+Tx׾JؑJt(vi < =1)>m^Alcㄚ Bň-SㅯhI$TuʈUVeWf>$(#&eCv-¸0oďvfbG7Mk],328؊BYGV B%u|MӢR\ 惖vH*x~O:d=QaĮ1cF, ى.Nd%MMY鴘+̤w<~~m22|1`@.GN9ލQ98viזզIy1}bP * ^,*|qȇ5;P`hѨ*F;|$-,WL ӐYwijո8̵nxVWc%"$|ZBq;[JLfc ´=it-̎kzcFOJ8}Z̷QH|Tہ lc޽-oefOM++ ^FVM?XbEn ;JFi\S!oWQ̏G'rH9g XKJmdjqFV 1P ax0c[$J@~y"7^-IQ W(!£ 2g9 a{)1K[Gs-up}<3c8é^EZ ΘdqChq9x.`C[^@c+06Wd9Ӽ 'L*Q ?֔,Jf? 08W)\I(pJM`_҅okH&؎}2Kho D䴞ľ}8v| Ud1n=FA5Hz=rK{Y`wp*24xbdEV{b޼f8Jsج*1UtdqCٿV+)m*7u+*># %ȿg* qゕH( *MdWBG,ƍM([ȇĞlTx6̍zcUy}Zv!s=6x*䕖o L[4{qکI>|&O҇`UDZl8:LO<\Si,6j k*zPC# ȯLUES4w2|8Ug9b̂Kv omॷK]!I]ZF Ἄ9aKisC[OeF[ZkՈrY?/\ =DxN!z\RƸ>D-m:8Pź~3/J6^UJ?Wq?e`>*Ǫ|#Vh<G,!LRݲU3m,Msа)⚍ѺO166?ےZ-ZہɅD#P;xaVB95KO>l*(Gb0BjTb3 ȪۣxDRjzn F&֒GDv2H^ON㏎f>aU9#UN0({]$8״'^cj*ޯ@)>VIE{z~8m Mw>e=>TH\VToॵ1BP҈6>,.r^2gS}pڶ>,<6?8XmchTC4]G!) dap 1B]{{Pb:*mN()xRm yފ\ 'Yx8*hQc{iޢؗ|kϖ7[0&A ^qmu 5zU3DcI0]q{sdYSxIN ڐ`y'.8>7REhlmZTq?_K'17F|ǚL-uORI vSU8V~-?pg2{bneUŻ<*۲mW}:? 㧩|,Uثb͊?*6*ثbΡvv;L Hu4_e9*xX BOwq~늵$\yjt8)UPQUe^8Pxh>̠z/(e+jս;֣d^Y{ ^pq it2Q=GKV(qQ`V? }or]ؖ[:bc8QN/Q~(]3l25!n\Pr'/ W! \rj#,CQxj(Ɣ{r"2F]cOcUf'Mb*-ױŐrxlzLVH-:1UemF_= *]ONTeEzV4u_!6YnMd'_%6j\( [,}|2HZ=.[WbqTқw-(ɱZ/D~)Yu0sArs*0>}F>kpG=0F!Ƙ)ss1Cźv8Ͱq~5{v8@5C svF6Vwe!rOSQ~f9ƻ~4aCFt>?o(/[U@Rxgv_ҟ^ C_pp(}17ĞU|n%<_g+ {cJ4%<\t#+@*_9ooׂU|QG)Bl$eYִ\*hZO~0,mLJc)tZʗ+F=Tj]#e^J:01o--v7,>aT;w… 2( J|jqTP`AJx Vf޽|iR_Mx9VTg4a%IX0IY7g Po|Hd:~p@?L(B|$xTqhEAM@0$*]uqwY8ϾEPrqJN;0t7[ 3柈nmA<ø(;P p'q$oׂ%:]ӱ!\8c S} *=A+F؟1$b| gnƕ\'x|gğLr }Ms1JE!$Dz#VͽX?*&AWt1b^|QR9쟰# o7)]dAW?`c%X#=F()*0emS=~6ӏ)8AOʟ`ߏFPBq$w1lV"m~b tZu2u8rCǷo*U)_SPǏFMcUG,\B69&EM=JmJ[e34mhH|GU@  o'C)#])]==8Hn> N? >4$n劺p 9ӆ_zȃ }Is lȊC+o\:8#"h5/ 3.h_Lߔ[7P;90U>6'1#Q4ithAz}c 9!qJ^UNAK7ⅆ~#A:#5##6\&L+jq֑] miNm47}i (9FjWCt%<$d[P{6)GGxɳﹰ%)@6H)/bP8`TzlЁm*ЏFV؂j$}BӟTnM[i29z3bwW]:?$mq N&|/NC6[ZTKnYܐ$wC IraɒG}kh"RAw,q+F;{•i /ŶǗq*?erB;^k6q$R>!Yi>j˨!F@j)Bi&fcaץ0h,1s9R>ws5ހVF|DT]f0dPϩ?(hA9.sF;`Ο]2" #l 떓bp٥rE@GT=N5HYC3iA<*ju7 듶R89;7[26_ueSCq1;bj(tq0wN!*T 7mr"Fk!'J cZ/1P#K.C5>#(I`[Ѩ=J]J*,1QD8A n"@,i6GpBQ9dQB1n=6F6XV-|7U%+0jzed͐RP9(,>x7Nd-rD[@>&NNEtQE(1#,Ҫi\ y+|MaVQOv ҝtzU"VtjBHCl%c*uQA#({YHp澙FK>^ Pdi6*^}}F,#tH ִe Iɒwl|`3Іֻ!)dOoSOc']寫Ϩ]Cnz 4bծh!frl*咦]\ʡjIEF.زp A|G';RW:{@DŽlj&0ژF*#K(DŽZ#KW>, і?$"ܘ;*b@ lIҕb R,U vসSY(JMA^v#jwl0gm:<*7l- ^Kl~8r@) AD9fK)◨R<Ѿ*k^P̝Cfh)jB@¹oV7eY#5֕)=GZ`G@եge&^Fv%>"-R{aa E!'QQQvw1-9Z;ar֭:*/6;l0f |e 98wc"$(%E-bn:;% >Ɲ6Cp`,C],ni2&A#,E 2K^`MZZTҾþ Om* ߑ2G%n^' {` &i?l[]QBnjF|=h&R{dDLG]P7r[ f tۦ$w5ݍ#j|Tln+ڑ$,C T{}9\cL{@H"y(~W nlsR+7ZO߶TlGLXMVyU`6)XJlwIo ݡN" B {᰼=lXv㎚$gՒ}W,jT EƟj€;6 wi,#vʦ![_&mۊV4t #|2%Q#ٞ ^U8cs>eSsZtc.]\MClA2۶ckZQm0#|["yʆX#ىR^$'oTKJxlg1-82)RI'cXBebV#8e $g$|n] "UE9_zJ-O!ґIcH C*ivX#Ng,VF!F"Wl >KY5da^rev\2נʽ jH;sRmq8- ޘF1/Eǩe;4p4AZ 3W]U Xo\7Y'ҢaԤy 0KXöXAUz|Gȥ0-z_0Sz!ܼd0=z tȑMN:@h?kb i`xH>#ޙxJ%Gt:qn- o*%X0!_|D놠#Sۍ(Ҫ0XOuXlvl mG*/D?VOxǰ銬̿.6 -i鿈m Ců_F{YOQaTdWlkǡQoaV$v~やHi 6+c^e [KփP|> -]koTtj㒷7kJw=t@Ӌ0%Xt YXT]|,? l@Zo;%W'@6{Jx#Tƃ^#q\qoCu<9*bY_AR nDCC%7ך*-=,{sFrV)47\M KoujƸ) }Ɯ7'LH%o1Z܏q(~ #`JǶSO ,ۍr?<%CoձCZ킩 vHJX8ciD5F ֠RQQ7 ­Xn7b4Ru[l>5I#%P 0(߆;SuU1Ŧy/߉g{cJ̴'Ǧa?i-idP㣧 &$:(q8AU&$V#)M< T~2C^Ǧn,>ɮ]+I|'zN%[z}#JΦF*yFwJKqA0_JD*~8YZ_.[3|k7f_egv?$} "mMKSӏd?XAfGWzeůx#qFIYZ@XuSF9=FH!,kN]*(T3oZ9mV{y/N+2lUޛ'ct;b*lm]1 =*Y*f#ӈISn^: 丢z7qݔidKr'BdrS qJz%v9i!L2ih$xQTREKMbo >mG{o7AIn+w`%e_(REGV6?vZ;P8DŽu0ک#~1{`W$*GRƇ(#2#QXdCXOh)!i #E|::34o !›AM9_յ&oʏ6<Kc>RqٚO@<}?m$Vd;2C6VԠmN'ۧ݀&cZùU%x-ʊ7<<4JDƬwXd/4\ZHZD?njtd1.M5mߐݲHY$7SIǫ'q)/S߷a<+CIj iU1Pd)=F~}<hSI7SSuƐWLV93Li*3|N-&p*Y ߷n[?hwkJr=,;綍>N,.Q?E!MB#jĥuu|GU }V7l nOq +?䞸U<㊩iч6ءau5;- J HSa݂Ʀ\qQ ncI `;᯼M6Vn+عuKC/Y Ǝ{aԪx:Vj[9S(Eꆟ, SXG!0!iD=rĕ;qU:Px@ >IR{c )*ڳ.N7+qJP7A­pmZCƔ>X后b;6o.ltkCG`U@~jw=VU`U<]7iWӘ:|(in cJkV0F0&[WZvQZS,L7?-,?>CWf]vlU*6*ثbΙ~t^}2a)6z)WߧX6ǰ~ "&2xZqc>_g)C!~Rd^k'HQVd<ׯ:)«[9E'+?̀ԯ,LV'p+7sMX5nbJ¿ZDZ]&2FO2OΡF܏1*Sƀl9i.XK]vUDZlzjP80>%Сwɢb|z86BhES %S2LD]Ÿ+&=+2@;;H;bW&>o0-xᲽ@n`*T'olT;$E+E""NHi/݅UbGCᎎMaU9ߕ6qetrtdفP-4@_mOq!4,Ŷq#4m.H-؃7XL[b=URpMTGA_1VPo,wL(L?8IClTf2CJj"=q>ክu->8žĻ*(oʿ1Ml7^b'HrגnQ! 2Ë/o ]aS(.xIąmp}c *f"7FND uzYA䬽T\YczaUz<j~G[>GɱY = O8FI'ٿ^05\b@I(zI"K֎7cXUlsޜ\iy@jzg eTtNPexCqzrC_b?,h?Fj?v#b)Rl^!wqBq= o O{6cUD۴W\t=WmNdF\to니(C5ĉJx?=Uu04㋝zMCI0>QCFS!f;oPQW a0^.~d_ /,tabj PEI?#ato> m-B:H%xȽwŒUp;wbp$-#X~p!iqхZed}LmV "֔_YFњŲeUKxLℎ_?͒Yңч\vj-耑1doNXs*v$I.3jA"8u,z c.)flԃڣnly 2 %lD粓+잴8\.֭吖Ɠc!ǰ-OJZ7^AkqXt@zn?8_Z.3fS$4{+Ԅ"E0WdO5k4;)bb(=Mf9Scc-K4Zӡ De5W̰Jᄆ-¼n8¸  /d@H{S;T<RK/1m6trfnM-kUb_u9_H)0dy{[9.2Y'%1ez7qUn_gq1xA[ܥ~xͺ mr6dڌyU1m*HZ3UGca";.c,'@H9rꪷ!b7S}J곲rA8$eؒ*S(bRA.f] 02y(Z e$#3uqHdw23$rMFEZjX u6!Nۊ8m4,HaB4$͸1f w)qs@ %W ˆv WGZBfBPD 䂖m 1,h9qU {cnHG'"0DH(6%ԁXwBN7ɑfBζn*lj>ٍpQzdcj:vxAHǗky6` RQ ";`-Rqln; fV,2}-3'˶qGFd M+Yյ-7Jm;^츈Hz&S3-y6ON2g  ]#n[ΔbpIvb'_HQH ؎q3Ȅ=F@cU,:xP^"3ոAP]\eAlq@?xӓYJĕ4aJm2 FFUA hfqHi&ñ>8m<ƩLR Ԝ")N4>ę(_[P%z6 d@k-X,Ӷ%l?Wcd-2U; [[Ȓ{"3kXFrJc U%{"cܱb"YA1z.U92zzvؐ2F W zt@ɍן4]-PzJ2MbB J(`‡'ERA+S8^dVpmAlXA]OI\ Rb=1A+Nx((6ƖPsJ3!ƘZ_>J_HeޘdRU~BRZxew\teimYhTW'T n)|JhiwQhq1~i;_Pw@eJִ JV-vŠVy RM0R=+\t@FݬNAghE]H"ڒxᩦ2̛w?U}9*| _ZQ/fI6nnȚ pҝpUgnP`h[X;兒BK{9.L>ISlDI"S゙ULh×LZejSQ QHA!^Dv"ܨ-vڹk1ssmA߾; WRwF.pre4Xr8L1bĢuqZBP܍+D4Xs4jY#*@+ w-r-H#HO!+ؤ-w$Z-mͶУĻꑓ"'vȐ(0]hFA^xщcY QqB%Jǡ(؈lw$1nr^KC7"qA匳ؤ٦*"-Iћb}ZigQ`dzb& +ܺ{fI7QldiHgZ9 c.=ặKPGQ_l_G! 7۷lTvi ǚY#^FuU~A:%&\w=?Crf j,b8`Y}?P":ȑFd-Ǧ#1कxCeCՐqL)$]pȷRKI$fw !CW˒)a5LBi^!̀H8Cl>X22 Ö%gZfm+s_x < 4{ME$㥳Hdv-InE)?tu"{VA㏞Z׌L2TdEM9>T汚wMd>\y oڹw76<\$+v p,(ir@=)v$o_6mT9x#sJb4 ۨbvkh㸊5ȍȓm¥G\Y#a@FJ@$$ĭcvŮ/ᲞKacu%I%8\J]F)S=i}BLB:sJnYw'¿ǯ&1e>.jмzBC7)AZ27S 3mPqy:O jcĦc&\I7M4f:;U/J6WVYkGQB0 Er NzzIm0fZv50đ!*ح^=9P.`ZJ2LI4ܹj ɲܾ1T؏1bh:I=医~eS@L6UYOZ3~Yl\5T]|K탆ܸNm5 )5:br+-Z9a;Ё,Ɯ$!N* 1۾-wuDX'V-lG)V0$T#/%XJg9Ceb-n'#n{_f(=q32[č〕3YQJNLXGbG$] !5|,hk{WEi `-5= iowe@VH ~X*y8zw@/[cᐥ۰ZH x~)@O7*v;N{8 [j2CQ۾ki_}Tz]|.xu'o϶IU$`)׷ 5r_IA}Wrl0m{sIkvO*Iw?(iU㊶&_ 9Z3X|Ahߡ!oݵ~)Ph R&.cOJE6TK9%k:CevƧoq.+v׿,fbZPIԠ]OW6kE]3=MGToTUOSPp[i";N~+IW (eGrh~‡=a^یmӿmsx5-P/o,bi|1FsIXSő5FZUkteBLHi 6H*mol$Ɠjbx:Ok0YM$h8D>I n4˛uTI.MevcAoс$0HYG?qV5r1V)Nj<1J!gI>,c?WIn9\# #b:7!cmJCt%UV{tQö,/iF#C@ZX:6ReRi"o/I6Ɩ]nq? ։_>d[)%ko tM)Qt5bmIvoWZa#u;{hM+}7UP~>qPZqj:8C:bf=SaIop-di?>xu" Y-CB?uR"d=Jn+CKvJ ..b Oi[Ky`+2W1𨦿,V=tla>>x& @]{u:撟]`I7 dՏ|1Mmm5`?zMj+ULU>zbu=8Tgd¿/>̃cH+Ӧ*E'q>h*]\ێ '6HMCR%G(Gg Ѫ0I,{\U$~L#B`U`"u U}~OQ틉u|FJkgI \o╋o$#Go}_|R׮-=4#op))>׈tS=qSؤ-87銴X~c=s=ҵ8ҷ鈲?q(q~fXV_Yh@jxqoS9{oHŲGpmM'P5VCU2ZHq'- 18ЮȂ~kF_n+W,_cƧò{UQEd10%V -d1rzp]$ݚu8GAd#ˋ;Z]"Ni7'|C*Z~кF?b_cqB2wzXp;kiOP|'Y>wxqT'۔D>5V >#c@ ?x֎=#coJƈrnZѲ}s늹iƑ}p*|w1[d\=[B6=V? W?4>JREl?HZ bqCnYv1# qS,M¾ڸY{ DFOׅTW=0 6>Ur>CJRWwlPi8)U|t G1Br7xPe-tTЌi"~SkG7cM[fa<҄ (Qh=XXS I5~H~L'~kNXbCQC+SņFhHCqnX<ɓ?X9-*ynp7A &oAŇ^S`vcfչ.{L {exkBi"//OՒ! zj) p۱Ȑ:J7p{O,,K*N4F{↭WzWF(8)Q0\+o; }#Qr" qW@# #R}]S~+HON؇x`t=0J||8pqT1BUb^jC׺7T z3\v*+%)u~1Ў /Ļ waw)7A$LrSo|91`iOSNDVdZ֛R?\Yen#" %m@*{,𭅅Jn`T 8 qv~%j;7ZتYjXb4ُ}* 9*>VY(x̽pck:}~lIJ;v8-W+`~a>S TOWSZ1M/Vjz U-GH ;:U.Y-ozc03Gq׳aTRqon; B oӷ`^h~~ڔ5Ap!ʤ++&W0Gotw)"':TO MŐy :v=WOl ׿Ӄ!:HTG EP% дG$=Z?Jvcƻ7M~, 8R7ST&.EaU˶,PRFxx[v4Tw :^ؽZw+Щh$w2BVY~ 6~?_\ZkaֈVQH{{I{:'݋OxdoZS qQQ9c@٢~'m[>]va0j\qGFyT(R ʯc@n?)ȼn-Ӧ ,O*=>)^NaF<ѿIl#Փ` 9) bC1;P£C*BH7ӊ OR?QApWoxbzww vu۟zxH?iq䔆K lX nb+[؅͑e[r@(-UgV!ө"үm0Mx[Զ$ӷB$'J.gY˷ӂ:~==FܿgO܉$X4D?b<\ EAaŽ+o||2|-?y$  qmN0&;kwSv |,:0”@*xIpJ\d[r4fhc1VbK8=㔑nW…7 wJp}B*cҝJjYgw5eOEyr Nv -^Ԩ;?]Mot ay }}dՅDH(Ck9p~5:liUPS~.ɠV% %ho|7"ᯒzneUAbiYW q(F$K+P>*ׄSmMjmxH+AE 4M ]33?،nSKe&t1zN1Ib05 c 7hu[3JbhWu]]>'wdI=ۇ}^e*bMec*UTNF!'זRFpmFpL,9P573#/9nl[Yozx`DRLrNɊGhA7P|qc<^[l QQVo-cGu7G#P;v'fV趖"G Phh|1 6{ƎvX+N2V$6NFqNO5EH> R=Z$ 3]%փ؎"M#6HBTmujdv[i{*3`+:N*i~Cu$2zTwGS([5xdw|idE2!`)SԜ q*g85T%ZBB #d;њgiEG:hZ4"y1]yM4r q5^F48b9ݫ/dFEuӘc2(68>j4{4;䀢n̵_M<++cN5ܞdodEn705h# NIMesPs@ƫe3^JևZVV '8z05ś'S TWMzxlȲsp2ZT~ KJb#*mm TeV.լȗjK.]XFq֙M@Ҡ`*kӮz/' Oj{?\B6U_P4preepvr y  kPql 0ギ@7NeEF&0^mTڰiTTz?F@ d rT}E  ,Wݫ鐳mW'(1v׈*>.HYفR"H]N%>^erͰD {Z01AbIH~ҒvbAjx*eAثQҸxEbi8guah$z,yj}DCPw>x+Z=_zA؛,7Q1޵l3*˨۹QCB[}$qnHW B;?&E);ڔ"BNq[;4 ]tLxP]XZĒ^Ӵ-zt대ωZA@w=)m*cf`ҡ nq)FN|@5hv:n4GG^Le:t Ċݿ\(梌z 8׸8*k7q/!3Pq#o)]%SEӎ0Pe%+RMJ=Ƿ6aR١S؍uqUq(O߆\<'glmV\Gr)2ٗi!4q鿎K1Xϭ'[_Z\CGȜ&ҝCA_ׄǵ oAi{/K ZCK.bz8,Jk258삋cKYCٯ\,RO^2\7dBa5Txpڦ_slN+\,iRX9 0tWAMd|[b$6dR6EF8 )6йRhb`Ul Vah@u?OQ)-IG5@h?PMhj8욏Urx8[+v>xE${_q VxQk$mIlhOS{SJ*qt }CMnvT2ɳ \*h^M>]4SLA~ B:2Ċ>qU@O]n6xeQR[lrH4{krvTn OKSo!1?b:-dF;|VR@J#*W}(+5lH۞ۏ|i*x+t>#eʊk&tF uck B OM?:y&i_﹎I;bOaXm[E vO~[%ޔxƘoH^.:fٰ%0~%4ct8MP{epe+#]|F. ٨G9 ٣(|Ceq؟šA B{v {oC ViӹYOjv 8$ Hٿ[6fn `ĘVq|V? }cą|:Dޢ|h~\pJHE+ưܯm"_Պ,}(nVT( U]^ }i#??AZE2QA7#hX>ѿ^S}֐?-c7՛MaUPZ='qLM_?϶!-qHuC <'ۨ"tor}1Oq•ށ#pw倄R d,*=rBK1 8"H*UlcOa*$/})&1aWKl6>!nAG1B d+t5Ɩm":bO`DW!4aa!'lz\uj- >,;)Q.`U9}ߎcpڬj=H&c\N8nJMqlUVaHn1UE1P`Bv^|aɮ4qЊcC2 ^T7Ocv…6Nզ9e犬hHQi0"G˾?f#ZC#Ǧ*Ws(0R'}*j*tUO=ѩBo銵=1+…OUVya*=U'aGqB]9\ZJH}5#q Tlo|ޡk|%%?`I´%r)tW8)j;_Ɠ$b9.UpMty742Q*6*ثb*6*ثbαi"=F0+XaNIe۩qfn|2 mTzL&Z<3D5:i]pN~bR>x*Z#_cJqW |)3qtG~C2VӚ>·QKr*|QJemkYu+zM%ךRˀ'U* bJސ/5ݎ:7CaT)Ljw}ȥ18~0\-t=7P7f޴C/Z T* R?eƕAhoׯ>Zkg?ӵHWIPqK *U=BH9B;HdP KIRŅ4,l{PսԐJm[eRfL=GCٴmJK_W؞Po gQӒt1CGTdR1y՗c仡UK?kqnPU48Itos{BJ@T_<%J|2_:)?}F5]qT, Jգ_XsAU?qFQ>x1!*G?DXGG0 M[爬ۡȐw%Q֪j6#HCӨ=XqTqQǿL ~pqB[wl޴T:fɐn#$!Z2X}۷'o$T^BAJ||(C;KSM=Gʸ%dT.[vM5?b<#Lm$vڴf9W)(%'V*?W#iBCq6}G㋢fZ0"ۮǺ׉ ECcEFw<5FXS ' =껏 RKuO#~b\Id. JB-J.z- Ow5ZIRm0Z G(\Fٻ2AYa.>Uq;QFdi+`~/h(ۯ JrrM2KQ1%a *1T1,^ (U=?A@_i9boNu?%s惷/ָQ}-E#oNجENاo`h/%oN`JIQq_V"GyFy/,v{F(2ükڸvߏqʚ'|-[щt0RfZ\M"@ݕS!oh'ACӰxRW{)Df82;ѿdRI5nsN Pb7-6zרcmN+ee%ViB!c]ɝťarls$sh`肔7ZŸ!XH )"p%;Vws*tuB;VIRxhʈ!y(iw]%>5l{呐 $xEH05͠Yu ݲjFT(Ejt8P 8o @B:[BjhH.,,iL*~k,NĿF*g{`t>dZ*:lƾN$To FAM+|JT]c\a!=ee"vLJjb2$t? Yzplѐ:АwC\<6B(6b(Cb#Z|\p ^<`Ս0c_4ҋ-.V8SjL[-'vXWeCQ'`gGsN-1|iY\EC@M5)o|wMqE[E/+`ao} ăMj\@ ͤd JWL!XINA@#JAJgmlK+9qM:Ak+ :6@]F'܉i{U40)Vٷz{2@AOs.IhB$M uDK֣-$iF[!^Fep6#%t%$~x{5%נUVf$6bw+3@:/Ō`g- eM%Z3Yr\N߸7!!`u$+ FĐ~x{5kN=)6# + 텬CT%>tƧ!}Ɍz(Bi@1(hר (Rb 9OAP 4p4~5 +ܪEG]g{b1= C y3YdIҢ|1Kb'~¤;t (Q^FȲ~ Bc("8[h"T6/LD;!f2m[&z*bCJ{X&qĒbڸR,@H x e/ #J7'(;"%. !݈yqXwʹq2u{-+7tȓH}rVQRgijh7Jx($uQj"L}[@?ȃLAndͷN+8Tb[$1`kh$IHpމIh_L(\V޻HGZb1{سq`v6$WDTqr# nF\d@wIQR` $R qӃZ+I@w1X%w"Ch〪ZH\8(]f&ۛF|=<#R܅,⡻`[yx9m Ki=тA8I?g ,%aĊʪq'P0OAՇ\pŨxN9G"1V6]1{HV)Iù r(\zv fù44N4d$/S- ncڛ6J[Q憵nW2V\Q\Q0S"yIVR7ތ:L)ct.FJރYlԼq!F?g+6 ߡ0T32" -dMdjW omeh Ƹ՟ Y]!|<$UYy ˧3ңzw䫹(aa9GvȂHȱ>'-̈1TmzQ!`Wb0-dCTA+5fhuas'T ŧSP_&0S5^Ⱥܕ@ AҘxe2 =pB'8@;{}1*eއYN2wo9~- fU`ިpvUi/EֆOg+`QV7J2N2KˋY0-6f׾i-VI0-ʲ>3L@i⡲:v]`-EsrD;\X` UZI"]n=ȅBtpN 7oSE ^/N}*<)M3,xʿ+tң87o'&(4OJa\B=Gѐ,h0GT@;FG{o$ƪjA0(ON{P5ʦDF!`$d%~ z r[ז ң٣lLM@2M=QLP˄vj2ie@[aHJM_/.'w3GoFGll 1)fv`)@&&$q8(d]Lm)O|0,3e(X!q%nS}0J\1^4Noā RyV,KZ½,Rށ–;d*EpXSS'9V;8ٔ&x(U^>p)B2bb{ bvuI-c`Z$UúdY*e`4r=1af܈8~Y:a,>8ʊd Hc`9(2@46Ep%V lnk`1< p5ߝY~lȧf{`1DP.+>%M^Eأ\jKoN2 ^ ©-V9!OT* fއDɰ; y%Z=Lnrj›j}C@q8zccv9@dR[y-`FƟ,KlHbxH"ŚNT¢+ Mbn> \ilFS-~7!_|[sX&HnE%:&+_oE >,_ta @Vh67•C.vŢs>`UKF鬻{uU/QAq9J+:UTjĊ0rV؟MrݚmT-Qf#ՎcFټ„0kqU<˂-~}H0Rm.t;-G} dz}vG8diW?q6HZDvkgQч .ZseX}.{cnqNmnw=ucJomn2 §lIW%r %r@yEǬm`U"IGFWx7 M&X,U %߿/˰;¨Ifvx8bqNB[`F*)_Qb9>?a0\ @inu+vl KEUONŒe} *½P=i tzt=߉I7"q(.UCr~1'QT{S?vaWq*Bկ쑿s4<*]m{u??A*I!H(q(ra1BF6$fǦ'd##i|`IշIn}A}{V+QJhqȖc!hz zO#\iL_q&)5Z3&Y%^z8bpZҴ~cX[9?~,J ?ʇ08p}UoN+o IG=JB_sppI:T`U^=+d5pU}w#h8I N 9|+ZIAhtZ ό*צUh9f£)ZrgO\vQ>CWf]vlU*6*ثbΥqʍ0?5u6+p0Oo ,vB?|FT? nmPxȸD(hz~©RP*~8}8B޽:v+C-Z,t+`W~UQ( ~.؛-{,Bmx^nK2=@AYGr$jj6_o +dC#_܀`Wo"6ʕy ='lW[1CčU=>RuLAC=>zcID2NN:R~{a'E? xBU<^@~vFB+zvhNUnSvE{!Q6 :i""I5ʼnSAvB0JKh¨9m!Q٥N[_W[-h`b -Pb) v~Ҟ<~xsf$ HS$Jާb i|He.?l[FLScÌGWtsb!߄OnG[]Ij>qmV\/}  ^ت&~srm'UE?lT-~4Jb˭w>r(ZTAP~1QMtl%Tל?g.SQ8=Gqd„`\~@; 8kpA]F*ݎ.G +#?M ,~U;2x8V4'%>hO : \[$Ú}*Uw_ՊTfI Bj*nn0n!^=@W#1*:F4~WH7;n7_ՁT_xncIq[;K~rf0,xě'ǕR9 7ORb{+_8q4`Щ\wc??{IG ;q3Өh pB2*=@mb(yGY2햤6f\c  *<1Φ9T1Im#X! i6RLQjH$([5C6; i_L5^R#]x`38N-̤(CFQOl`:]@VQ HBF*B?^ ҧTZD3YYMqf' s0x7[ie$UL-ox M~q[X&56K4l8=pdp[T;MX% q8\#1z\ٗϣJ.AFmP5p|2S!mk b%S_<*j҇@vVLvD'Sױ#vKm٥ !iۺjqVjsmѕT ¾?5G5 0\XR@\}9qWvO 7@G6ˎQ%FF9(XkӸASr (b峘"ޘ2)iէ$)g[$tw!+u/bkF$$P3->OȦsK."^QP!ٱH!7CM664@w榕ټ1+wR?,5љEh6I(#4?3\N'.z|Jm=mnx}*en_:""QZ֮* ':6ZQՂ[ b Vq(+z%BH9յ)n&qJR]ٱANU6m`F# ,m=NrE2 .IU$]mtEbdZP04amjr]Hq71ֽGN CA(0|pB#(PEdSB+#}v*x8FQy;ቚ;[IZ;2`XpW$/VԪHܣ;cX#<PC{d#4ۏXV+M;`M*i"t;r^L )V$d>׷5*r6,etw~-n#g!a$0sIO7Z\4E$FrN ZEVO2=A+QdcbQr%nHJr7|B5jq^-vz>!Zole}*pu[E9-ޣz{e4/t'Uցz0#HH7bN>{!A$$ӲV.[M%D^ P栐-ڿe TuݢfX27lVUS\x@ >XNLheJ 8?:[^L)޽^je0ߟeJ67b%FVBMp<đvQ/]Hq]ۡY,0RjC\dwjl5E>ª~Y9X\G'~` }>T>8o[d ~,[ ţw둻nVz)><_W q}.-B K& Z7ORqAuzӷN`r+f;$Ji-ֶ0U+-}e}_B+Li!t`y)eذⲪۂ0Rkh=˯ka w[#|%xG ٙ=)anmȍ4/銙~+ (}JC]XgQ•?g.$Dshu5;U`rSBq΋I `p4A3܂vٮbQ*5 ܮ5ȁJIvT_ ,;`N@D^ŷ^צ&nz.;dXv.iXLXqn|əJ24s.A.-L%}_GU#MAv D+bOZ 9NOS֓_yCNs$*Hݶj0]/(zٲêb5q2~_3Kl9uv*цs8s,3A\Y (pMu"~xUu]J40$5٨8R n~x?|npL7( }J L## ӊHv8P'79G¨{a5B]|;rKuSoaՔ~Q o-e!^B>SBx[K_y:2)NH[{w'Pᣧ _I3Hڵ-SޮvE)U[ [I_ v!xu&Q5i(Y6k=TOOG݂Rc_55OQ\1QѾ*d?{1x$x hqMtRL?lP :[CO_0JjUjom1!QenA3CRَ9~!Ybeon0ҹ.6m$Ѳ{bD_ Jus'sS6—se؟JqUҪ|Lj<(iS+wŖUBKR$;c+3v+VvގCǾQbޏ\U?AqU8k("-8JvaC%H.Cx.I ݫcE ˏT0\k@ƕr 0@J̭gAҟU_~o1 R)>Qx* Q1MF*?*qN*Sz}#U#m<ٺOKLURT^V}CIz#1ه vW%}9?:TM;SZ2z!ؿ¹OL%wDK!Sm9~U[KZ 7ZHІCcűJE.PUJx)?8u"DUR2x1?_oT\o K&xƸJܶ˻-O[ۦAO>5=e`T9 ff ]{L TaE8=}cUH}"2vbDr}4Qz7bQ~GVow(X>?/61BO/ edaMeii$&hƾٸ#l`ZT[{pRoQ_KGLO  M-n"OVV_CQӦ$~ゐI ?Oԡc+#Y볊6ooM4hSbrbbb?j*'j(m뿈DžW;VxЪx,W:«ߘr\ uflo(w>;V=mWV=צP~| +d8POAWc-"7QlaR:5WjV?)1L5V;z0lT(Zvփua2͂RݝYO~Tr:m?vpF1RJ5E\Uo>F/iv$)O*Pqn+_2#} 1!B PQWS bJ+qT% FHiA 0;qT{[G/-BU4>%_A\sFRqb13DA(o'B({~*ybC4_I(jsMn#.5m|9- nqJyxO=xF 扭6{c-hxd)Ec4-#"T^.+Vq>?46n>ZQێ4#nUj1V.81Ѳ6DۺBw글bqFy1v?źöǏۡa.s~)\g^qۋX3T 8BT^lBxJliK 8h4dDaR)C <0)O SF;vlACLg3[&nn@*G.h~xSrNCvA틊I~(S[E؞I=05O7COU`Jme;¥v?rLSBWNPt;wXcJWV:ͧICs]u_ȑlm)!T=_Gq^%TbW@5~Xi;I mVy'ژ*Ta.X}Hagn9cs~lo;6k3Ph?UoqȃR~ }݀PT27ی#[^q!{5qB>^# U;Yӣv=YQcO Rc(A`}`V01TrPq%nb=ĽS5Oݸ,1rCTTncǣbEoqBh/TxxJX7LJmOR\jˇƂ{lvHP*h؄AU뀄Zž쨮ECt_ _qcBot /_2/nXճZ8c ^/V9!!lDaXPbwI!`UdeqN˦)Y"faW{b2E~U]%N9#UTF7.7W\ hGS.ñǣuF0?q>r&28l\T`Uxlhs O+BhWWc⫄[qAaQԩkM/v`¸[V_Q?y{A$f;0x5ah]~i8IvqF?"5lY+! nM|`Ux<~R8#xBH({Muª,hi'SX_ C\ IOmCM`[S2 9'p$A^8Ԃ7)0%M 7Aцvoׁ\֥}c>a[Z *)8k/ҁcqh}9{H3s\ف5Cai?Uf2/Wv 4MOpJ R©ǸmRHs^>'…K.)}mN_{d"Bw"e T5\Q$hM7P$i(j)~-a/;,i-C=zW;ǾU FջxՕ`juiT/tOē/&HX)9Շ)PḸ~[( +-s\r>YcG?l3h{KQY >ǮǮ n= K]mq*V/Ob{7YG럭pɓ[Z5dkPt"|N{"A w!G%m#L%=5u4$%i8+)tc;37{Wf} {CT\iSgX_NpMWƝ?N+*@i_n/riQ377#>2Fv:RTVKf %~_ӝRy\~Gb(/ 0j7M?hXU~' mx'NQR{uY@=,VT*{ؙR~QYEw;-:oDAўt'ȩ?ed-Ү.F~*+5~n!͍\:sRAt7۶yk#%SB>&TU? rpr/2<LplCj a"H\Ãv,WM@ VrHǫt"ͩ_U†K62(Wj>4fkU,9OCӚP8-pMrؒ0RiYiSdQ vA_1;h_]A-oO 3EJ8U8oin>$@6e6R9 'c-YcscfB2G *h mv嗋ѫC8Qn;v ; r׶ PX ↳, *nեr6G&gl nzvŤF. Z1j$ItbUz~kW(7P~lqEhp K.=qHUgZ啀-5n]mjJ@tĖ8.D{\@)Ĩ'+ BS%' 1F6q_L&WOLڃSVM7,nKђ2zvBȓiۼ.h'P|N<Q[*D";Ҙ"#x 790{p1% 㧹ixd#Y GZ|gzk9ީ#aMLqGH u X,> >|BxͯjT஭}x\dI dQ~)P۱[)&eMy .Hu'b@Vc0U@pSR 4L'zbQH Ě.șF}{Y"1PfGPCCNO*:dcFբI}jVduȓ\K vDVh;|tsM}0_N?p j<62H8m\N( 擴;R6q#&AdK%JxK+tӮyΣU,e%6KQ j7LROa$jClkq,É?ocon渋p҃"OEt:Oь'Ct+wq=E\qi=Xg,[$SII8Out8KңuL%Cq QZc7v Pa6@A(ܣv4qao|piOl XrрƄ /)U>;I)GQ#-2 6Q4 aCXe A^ lH"U;Ԥ6Jr1 y/1Ȁ\wmxGT7 ymГ$\57Hbe_t= 9hA<a[*!篶Y%`설3'iݤsX0n;ۨu s>8\ @EHq3+"݌O{Qh N1d%Y5b,5sFCFJoѢ[cpHcJLFAlX[FMمu,Hbw>8א FĚ{ᾡ"5ֻqE@O̜*휀#dXWx(O iLj&c0-`w\@@2~O[8}[2޴LLr.p"@I8iԢQIXg"O=i% J<758c> ۓqn(Fj>XK-V`RuZQ]^DlDM٠heJՈˌA;0.hH#Fp14D`B|=̤-ܑzb2YMrȖ+dhXDeKª|Ze;/-Ԏ(&~x~ dQEj#MZɕIO]p$H đ9 wc5Ħ2 CC`9TYnѢFyQAqK BHhLe~;xLz,Kޢ%iЂ=4߸9)l.7%#%M2f12ÈfޟFU9QN1j.cZhq'[TN҄f$d@ݨ}Bx .TNm/rI&P⤃XP LPuYA٦ OzvV$n"G*P!7ji-  RĎʥ\ܘd1\F \2'+RO\YC3RS6:>`06fKcz:oO&X9b?6˓Os(L9ֹ [cT=z{4T}qxM>?qB{ aǃu(@مU\Ic9z*X +x[i`;Cw ޜ~7ኮ!/F> [K>;yվ(NîY&q>Z[9"ۏV` T$|R牣|5<xmWMmȌ slx6Ɛ3Q< {_wƒiZ y-PI\ "P!ZdpiuƙirK_NMh1FO]qح"0E;,JL:%US٣„8T Qʵٴ׀Gl*Azp7CIGQc5&+bmJKh`j'(dI@Jj 6ў=<h}Ԭgj1HB־ƻVS¨)?1V$}`yUbe3BF,O >8ގ'cb# U0Hq9d6|j6͊*\ZQIbmy.JwV\Q$ بKGGc# 4 ;b~%51'SqaԤSI!ȥAsƆVኯ)$@ sOcJ&?R,~5/+lwRڪw V6gq/ru<_X"U5?K t[A]~WیoYla>MTBɨjZSO(`+ !O~Yjz2Cq4en„CuH؍G•t4>jn>\Uq;(*wS`V̟obq/3Ujxe63?-C트FW!鍪)QqZce}*F?o4c5bӔА|(m78\mIhG&xn)Vs/9f=TxअE2TGLT On0SJԅCq, h;)j>E*+"1J%.9li:FAUI*UU;;'MwVF?3j6> et&wX^ߡVJP|w|} KÊ}8UJvQ6VS0IO-4/XO-2)G=>ZފCz{V=1H7S~fݩ*>  ew(e_ ! ~XG(_-cTQ^٨Op3<`KbC$tWqʹe2.8Ξhy:1%%G, \}P?Ͼ*U_~\kxaB3QQ0, ~T`!6T'ѽH"`J>-\R':x ֣%/ KH$]fI6;T+Iب9OjPw Gӈ!>8mQ r ^2MXoc[hm+`$q[OU8jt?zUXOג:Dl<nxV+48WCŒ},6O^G +0z5>c'4`Tx[Pv u]Ƕ<6oN@?$G!C֕nklⅹ *q؏ ~U_Ct6ʭwOP6OKoLj* |ҋ)=zqJ,=r$-6r"o ISQ7{BZYq0}*aצ­~Y}aVL:|C› Gr=#! eזckO'Oc[;ـ_k)-$1V}?iQvq&^E;1UU7lrM/94mVAQ9R ۣqo hx*$::xaCnJBǶ&-h>~8z_޿n:p%vlUٱWg*6*ثbΧrC& dy1xA{Y%/Ir7AVS^3BOɻW^gq|U N(#O0~djZJn)oȒ6a\T|_?7`U" |WۖV*ܓfq?ʭ (lC=叅 Do V$X! %Ȳ?jr@dڠt Q$SFd)2zvve=T8ڨd*6_ dS4ف(wI?/oL(D ǡ?@z0QV\O.wbA{bK8LPzXq<[p{[A uV+EiN4P+)M !{)ֽJ; IVMt>8Jvd. v;Y.*t)x-8.¡/%:Sq˚JvΏ{I~?1$}OmV}~B?)"̵(@ڱ(ۏ~YvqኣQ%!0xxJ2 G!Dµ|=PvS>ˊzdW 9ćV)'#B\~J~!z J),EMv?x'-BT|,qaCźW £p{⩆7CPèQɡjO5d7 @ۭ? izT;ؐݘq0\IG(Sr$$1 "Z2 d{5ğmҝȥk)y1Lo|Ol6Q%9/QR#(n9Lrf)╳Ex^n4U hM"5_ ZËv8ͺ8, taD4dКD*n>R[˳v>8)(ބ*j>jq'3a5\($=F W> v=W7^F',%Ov=E TAEv8q0[Yd<v>͆]$x'#nJ簒TPaXT~G D@nW_avOjjrBHdVIr(vl]2JwLCW\|' jO K00&{7qWE6+ c ;P~!O=c/8*qG5Vx*Jqv=*8?CX7ЦHbeSC Jw\Y:q|,PP7ut5]E*L"}2VaCKSUvEdԔj4mH!(!PE&9첚0|?9YZSRAJ}Izo 72qBb#p{tR'cU<{>ئ+6Z[G鈰 7PW<=Re6{`.}'KsQ]db)pqU!B|b !QpYn &HJHi*O 8[pLW'wp{:qBTc#O7SYjr|&.lb(@=[ 8jaJxo27J4Y tL}?o?|÷~{y!~ZhqT[A\mъ)ldnx Z/Hq/RdžHRes4WFK#vrk &= gjZV,7\qn{4DM66`Hުzp2^ԨrA6R_&귗<)4SAN dƼf]N/GZ5b7;+Yuj3)O%{Ni=7ZA_dON}m#rލ5m%a"dsCnl?Gq_$N|qv[PAL4`Ő|-O~okB`pKv77n8rwj|ma t#$-7KumV)/=Qv>8)#RQլ!צVcE B5OJ5]@3슅%Qҧ,Yd`N-.Q\G|S|z:%RX}FUY#|Bd^ /C4s"ȝm]jSTR؅Êz4Γ4#!uz;2.yJKKP5@AFᇛCҹWґ%sL yMp"w)\&WE*GㅓJAֽ1-'6ABc.hrq({Ws˄Em7"TaP{-)K|r`)'n,Z|@LAЎ3&_900iMmz/\ 5}JdK"/Uw4eF؍F[!cT4+B1D&E~|~[~E޸ؓlvoyʦkփ/&TavKYjdvn=pF4bBQ"@*rb7R5PD-' GCM2'amDYsnHffG1aٔlUY]߅Mj<)c Q'U=#+d$1c,x|04b(TV`k2 |Sz|mHJ1647 05ZV4۪H)ƘH7^m0 Ҹ4̯7)pXRH}1͘SKdF@kG£\_~C,~dN97܇wex ӽsGzYh˒x3+iyl!JVZP>ek6=v1lJe#6=p*EX֞xrTڔs1/UCHpƒ*YWGe`,xoY`5Y!R@0BYF(׾;o'F9`<-)p'*dQϦeZ!PP8K ~а5 ɠ(kG5I$Q qĴ!j¿,c ,,(:t9[)!ER\m+[w^[Lؤ. +fL/őr'HX9IW.i 쌭Rڹ0oX S) RR1;(`M;T˨W6>hbFtw[' P@|i)9rݰ@Cd:M"33p]#uPژ\}?I kF`FUU0 $@J%ۄs#om$^["k|]_Y a%[NUA0`M@QI"# RZx "8T lo7%%jwq(2A'h,PSҤ [-+ܜn#aWrqA#UffrR;$wQcbo5@H<钺A$n'? JͬME-iq7@;*YKw917Vi v8$f5 =OC 'I 2?$C\ -v 14>9B +1J(TSmxJslUETr$a(Iݷ$ ݩ~3۔j&6 {fvHwI!J%{yn\4@E֝N55ID_H ^mBu-˯\nH95ڭhR(XtƾYvU>;SFF}L:nLm 3 lh)% 0=\}5I5%6\IdDpl+00)!Rû *~̑|<2D"l5ĴCo/i>Y.')n?LM]ߨSLWasji bǥqf/u6INԦ+_9-'1& `i4ƶ_V7deئWxZ%+SU E#dVeے6s Cۏmefi6ߦ)G[OnNhV1YpwʎP prBHuŖZ0T8Pۍ,F+:C(SB`W)TkG3j-%X|]/_4{ a?um {o[+ߏ_KѰ =@z7GNC`N ^?r5IA6r~c"rDDM V41{kK|$_0[dS$ )=K"=m95cvK` zP$RS_(&7Jnb#y!miN].9h`_%$'z)N/z}i}3Ĭw[e?* “')I늮hֽsї1kKu$Czc㜩h|=*@aN+$4aűBYmb<ӿbZ?q%r|-F 9a)x7o(rz#|P8ndC2HQi6ܱSAZ0 Kh}MXх$|'iDInK]d /OBF?϶'5zFkk~400_nʵfVS8[te4#l9W҂+ib~XbzTce}8"~R>V)I@Q* pL}&]q+pŐwOAٺ{⫸c}5~ tٷN*1JPҮk+fb8XCqhcB;WsW8o_0 c=Wq׾*s-^ ,;~|g0q,^JOn{7ޔH>=qJ >{U`7UH{ lD7E;~8Z!?R9۟ (R[snݗ*Ҿ(ߺ,Ј_Mz?Y;|F)VU5eE~qVh$Z!;má=zↄ9\h .(Ħ/R(XF<"LwaCoeU?xs,7ס-cgp c+WrS7-&c%kiq}^8'҆Tҗ.`&5 qB;N5COR~QJI&37\/q^Hfifþ{3T{RY#3%̑|/=>6X2N,a~Sz(4ߎ4Ĭu߁GC*Qt# RQC}`IVBFIoTx4$(vh|F-+AC Kq~*6>ت<\JKJn7^+}oc301UtE?g'Epz)[B{E']6D=6{UIV'F%A !؁J$\>cM$[F }c7$P%Ѝ4n)aǾ4IUOLmzbV3CzV_j;0鉹?fPcEp1%u;O‚]@iWoH 'Tcw<:(+Yi(_~!-k@|8+HwhO{ĮBN@eA? ZI{/c􏳂hH}S:-$(.O0d1=7/dw 9CHS1;}یiURnsz/5MG}7م(qBɺ}qZ&F1+|U%OCf22\U?fCYF]Hڻx*Ab|FU@?*NB7𸡠΅b|hO|Y6#Օ?PP68O5V8~x pR.էJEaZTx㘃mTa8ksI*WYj<pGm|ו2$#b]vlU*6*ثbν[M vd2= on&}y UD?߱7i1`(A$ ikjC?gW]Th5br>'/kTy~Fh߆T*`v1u? e9uqWOuFCqqBeQげV!_O_| B6ܻxcHSOn(!P233G%~]$P$q-_J?eƕlŨUqte?"DI#;"wZė#R[yW@?ƫfqBDOĸR>U"$NI~ǫ:({їtokڏN_4M v#5Gz(J6aae0dMzYj!XDơ~8jta&^&ZC*ȼ0*O<-q}-!+v>n@v>kuowm]?v߲v¨!F)By+({x i K&XZG'z7Kzb2Y~>xTqo*-YT:n8Y O?&Tr*IzXwV>O;V uJ`dx=}\ЀGCqa~"kt.Nu3cVq4`{ gzwY2 F%< O$o9 m:2NXx|p iQJqaz E ;{: Ȫ&6[1+?QH'u!(+kPOnF JuiT%0p쑀/a~ILQA ^$Y\r^~톕yh%oQk[<8یl IoĝL6I?i?˺I#ձdױ"v$r^Ң4g4֪Cc\PH8c VYپiW4C/~8!cxBTYG(1t+(u\*r$ƪz?0 jo(qPw›8~ݿJЙZ^˹n)TlHJQ+EoAkuxx xQ$;*߼`WNøbim3O؝ͿG6*oS!3F1ٱn-_ua`YUCTQՁLz=>I7\uź4x敚0 W'O.zZ~suµwهQTЪ%"E*OunamS߶ of;U4jGOq}/6:I*G~#d%'q/NVloPD CYPcZ2>%;g@¿(t22wx?,r>A^%mة'eQ^Kbow9ZOOO|R>q:#$xEDgP|JF)-@wpz+ol$z >u3#Tq\%6cCrӧ݁Va^[%P7 ?qv7cwnD%]EvVmJ\R5?P]߁PnW/*?qCn6oׅ PQ$1^[ᆕ][Ϻv8(~;U>)H?QmTR.b5t#(c?ǨIĪ~*ҿPr8]$G##)t\,eӍAM}# Ool܀onDi^|%MNJS 5M_ (S~8u*Ֆtj~RRXoՖ&(G-*65,>- H66ky!߶'"2|IcHUUzqk{~\Z>!O>PIJIwMg{cMӱ>`x0;wtHoVuHBNه|dVmMh ٍ<`J/i7PiN* v7IJ BҮ7}O<Êm;ޠA)_lDBI[Oeƞc4*) R "-J#$ =^IiC J$RSNY%f&n^ʧ  ̷q$Sv$GMyn /f; 8-$]&sm]>wE?sRCK/i)Ꮋ&)ª`,ZFkpPMY8K(Q[I Nݪ1PI.3ADv6Q^߳i$Z[sI~wZ]z&0]25:e$SO[OP-UV,1ƳzQlG[_ZcUJ{,R8,2f[LHbw4/s8:nλӛDGYmGa4ؖkdvb%Ր-Cm\n%5*$Axi{9]Z5]NT!k> 7{u:kdf^>ÿA+‡P{F$|zA3 mO >SSmvr$Pc[}MuőR-]jq 6]lDZDQ٘Rj;t+*7!+~6=A\BI+sSNvi V\D'"h:`93@JA$AIj $sz|2 [H[D+E>b5C)|\B -*nk`xӨhZj04/Jnu |G8Uv 4&ygmYL 8@'X/4hI*OL$QNɘRᤡfC'qTSJ伎7 텧Z+a s2:c1c\yfHwؼ jTϫĩ€Wz a(b֚xu^r u;tX*-} "VؤXb8CLD%14gD49 $FaČMkUZ3EUSo:q.?rBEru.z)ŭ5vsMqnTiFj|mVOL{Gp<"lgg#$ <Ϫ9VLS[X 1w ~PUd8S&5$9#Vd\ёqA}` s ـƀlDcq8.%,}&hq~ң )'G1oεG @;7@⢝^A ā͌g޺6̲v^[dWF@5fXpPc{SE5{Ep̩łw) L@upԏoYv0HY J!e*|2)G #~@`9oڜ?<6O([Ўt?< j ў,GFQj'Q|(!HV,n.[> .D/DGzX?QG+gHWӴ7$`X_ >?;X-ԋ ď?JSʹ\". }@;3;S}*ШW Һ6.r|T7a[T%-:t4aЭA*2#$mu=q$ 5l/}1TS+mHY MioijS28c]ܗG53lxSDs+! Wq^f!E[v]E ߠ_Y/ASl9lL|WG ''۰TJ]T dl||Sl:gjnX唞8Qї1݆r$&F[Up(Tl; {5&nBi% E-JqW%# tq-Qj Ũޒ5 àq/B+ 2^!cm5iF&u8RH^4^ G1Pr *k_1$V=E{afC nUQRI!Br tY%؝L$5~my7>x7Q:-m z!kTxY`}H3Zӱ )14G4CUVLDCĂױE%B xc{Z?1j!%p!Tr &7NyDO%%a{^Jz5 )c`8w)^ l Zv਽LE#R[(טAbHZ5 .aڙp=Y etr}Ny* ާ1@cLX[ۦ KĉW IRG =#k]YP|q(f5-S8ǹmH⴯_iMtݏ 1X r]q, Jy'ڄhI#&(ސ(R)-NYZ?<!/s *j*OW1BQ*V҇721"4Y*c=G\<-o8֏*Hx+uIDoT iȌuP\ZbOц&&QA@ an%-r͇TY:W-axڭP:HN)J? +0S:ޝn}v.H7)d5[ M]& E3~cJV\ sfbEzy92%9m"SEpMI$26ݧ*AycW"kv̫>|۫?͏b# :M !O2k~q0$6sc EObJiCzn2&vkBaQqxN%b`)uӣ`UJRZ45 _cʂ(z} YMScmy:o$ȉ8c܎]}?|96Ky~bg'cmoR[Jh‡E=VuĤ9CT8Wq_Ղd?F O>Q0mn7}Rx_J5xr_8 Eqǿ8$-e֟COD=!Jx$G˖c;GZ؏8̑:(w,6o~,,9M>x~I WB5$N: =;mk3P{$ƽ1Dp~JmcFPAjD|224`o>82)ğg?H9m}L Ox 9eų6<|WDZ)4s hA=27SW:E[ 6,hYEcnKቼoBw+A,~߱U=$|^FU9 z:Ug) ~#U7jA?q}5mlq<|2n=r)Wzk.o:  xI:9۩kS BvQd:aBhR(#b1O>fӮPH;-"l~P5y8K؏]bYs纟]l'dئڣf*3!=r"<0*ѿ'818~ǵF+mV)SM>Y{ث^Weq';R5Cc/<{b?L6|iZ_1 W1 W1D  }4?)\[^\r2s%o(GO[n4TZЯM_!9.)|Y~*WqdcK1=U94qTn!)}VB OG_mEp';UwW`/4ӵ-6i(~ě5?:Czj;$ 6[^(/B:Es Q60)veb}ĜQh`~{2{v M#ć߉x?mUqo琨8AM(c鐻f "(CaJ1v*cXT~?X>0xU ?r{8( ME~* qT\/OڞHlEH0Ɠ-Kbz3+M"Q ,sJ9xO!J٭ăA,XaW_K б?8%<+pO|1XRgx4,Q G}SAUF]0Go ,mKho'%?MDڴ:CheS/JK&<*#0XhDz(ޒr%0\ %I7PHKY64aUR|tYGW5> F(";QЄ laPM~) 0rbUiV}ƣcQ*|M )}[m+w^AdiG[͊6*ث*6*ثbΩpc5dlX0I^#d)E"4l{'1=Ӊ^V?oR)~l? `ʟmdǦ%FKh}Y>6nҕ~xq9"P`|JJH9ZHr]Wd TY!Rh@op HoH ]q~ܧW'FHDQ h;%%căғch7^hf|pX挲nFHD#fpah!fbɻj^4|;Ǐ,~Lh2?i{oJi%spk5;t/TlGU!4K=pI Inmt>#G5= ' .@+—[Vw#|B-O/1Z3 "bT=H>4ŽiDWOdU_/#`7Q0ҦXqp қN>9?APkqS^='qlQ#B_:8D$>8qYӜ[ႃㄛ7cLojLn.1h!sf}#Rp0$v8|0*&7Tz`gPVa>8\T(n ƨ'gp2|CS_eF# JӐ?[ݘ^x60%]>Î_oL0eNKF~m$&N.&aL=^;$*mg~ :}TdfVx9T'29e.w[5?8vR~oE WH0ꧨH >rJ) *I N J2+znn K|28 =Gغ;CHFӖ`x TuS5V[ Z&(7CBze^Jj]TPWc_]IzفHȐocqYM#xmL7h2dӤ[MH9% R{x<Aƺ£fds S@_oy!oѻ{&^ 0g+c Z ;cKVh<}džQSU؟ maGc,uGSO1J9'G xoU*dn;ER7o5CV,*Kr~ ( ءEf<؜"XLw?q5,h{0*\Gu=[_ 7R+3$$_kK`N9nIQ?rk($?ȿaVyaMvـt*xbS)*[݉cᑥKn,d}# B*h{0(. iN`OُB\Z(އUMiWoliU-52WT,6*qT`U`W Uq fDm'cYbNh}Ri⠞|(CTaBq6Q(<:)ȖJ[2`*~_("DxÿڃxbP$sx8;ц ="BTdlhQ^Nx$`R6#ua풵VKAPwC!+QOI ܃*JOZ8C| v5o—(xn:1 NqUD0#4'xLPff eC=% $E>OLT˽}8~qU ؋8ګCFj;MjǏq $=`i`U9lqxڍ!'R<;cwVtb⣱˷h0u?r4[y% oN`62/+-zcJ `ao#E߯(M#Pn2t;xbpqU9FyEh Uqኚt80 *7x$XaU3F8?će+ $ȲP>ن*LU1|Jz5CF؞UWF#_ׁyXUz:7c;ƹY!Ԥj+J'r7oHҠ1߀8@[Ei .Q=?/?_ F !6fl~醖lڌFOlt+(%]??8h8nyS?jդa ⾙OKc l[j>$C$ۨqyۙ7Rdٺ[Ml R0\]gGԣY݈^&O_r\\N1 ^fJk#Mi_PX=F LIYj&ZG;1)fVZ`ekqNt<; ^[J#ݓq1 I,\*Q+A55=%2 !44EJ(:=V9_6`ZlwJ$=+LeZңX6ئ:bI n/( ;-H;m6nLi(f[tw to Q629HģPw|0VV9bR8Hx |-P2P@0k-EzH^GTq!!Uu B#hW!1xB;Ө=rF^KD*>В7FӗH ZiK=yԚS×!q;d/f*O%NK&H5.K6}e=V/$hLd0BV"Q|ʢzĒqf\ Y(^-|&vP{1.ثERM镛)"wmƀhåGo4Uśe$}2[Ta׀2k量[zĝ^I 8UHE*e]XkL<\_F%>Rr)qq $gs <`($Ӭl-@REjN,nDd)ƙ 1Zie|'T Pz-[六ܬ+ 0 _ߦ&AY1@Ǯ3RA>D R3UI=;c!LMu[)wqyܬ?*uP)ƛ0e))S%02 cQ8J >9K~\QTE9Qdj=AITVm)킫v]z!TY.FpLJKڊ48y*+{Gڄ>_=~Gٜ%[&Z|YZ)_jHB}3 hۨ\:zPԡ3DxPkXc+!ҵjIRYQ(wj<1Sk+Ƙ${|ЂԔ-H-y">UNV7e ڽ) xY!1>~J:WB~5rOL (~4FWi^0=<7繠Sz`S}܉K N]5C?8]uJQ͐Yȴp(| F)+G}k׌{0`IV1Pw`fYV6>#,o9*,=H&se[qJ(v& ZMk\k= ӨN"GZ\؂\%Z˺T#4tYtmKN5- S.E-dYԁOB:-U!r N⟵ɮ!"H]Tl}-̡t뀄u^ FϮK/{D;+zS,zTqcZ~ljwV `+QR<-ˡ6P.#\jXA2Ȧ& Ymja> !C5׮=oO\W44EIz [H܃9  "%(p6l db7M%~H da0E2E+SCQ,#nlr{J"iBVf@x0j>ZC5OJe9D,!~%A5䷸FL+l h=D4Z׮i:d!Hm*+5 - ֵn n]. | tBO2&\e݉ڎ?, +k_7wAopeR \dB-O0jwEG)7Z#asa}_]}’~`RԄ~SbӠCV0l$iSN4F#vT -+ܐr5$I6SI )\{](!)0n)ɘEŸUUv64P1؈YH,$|a9XHʪ wKY~#⅒FdJւ2EuX1'y"AU2oyg0(+NĝtRj෈oM+ʣ$vM+Ĺc^MLMʭ$pn0P{S|v,m_ S,_&&GR9?A-S{ߵ<2DkQzHiqQ'eIZ+J aD#_N_<k{kr^uL*P6M`IZllE`F( oA6ꢌMN9+'bW&r}H1cWjbh;*?;7"gTZKpBH+r)Ff<=fLb@hw%b<}q ~ -)Xݮ:veEOI /E:9hH:S( vqsUIoNT]$4 t\=-ڧH5ȆWvCPm9uJIoR./lG $ybk'j/#1 (JXOsJJɬ"H녳X<]6n2\H+ŔTid]? U8*}`>̓caOPr_!6{8ڼ>nChAjOQ4[ڋToG_Ip4M:bTf8ko3x+n< M[iEĜ6JO.$oBWt4#=i=gqQqZ^-R_"d}n'ʎ |qQp鴂U]jB =Tև+)ޫƼ ?l4=p%U.A|:b@;T8ZFR߯T T4rUúOb7S%QyQm(%|zS$4 `$s M^BJɷo|ggca+Ȓ.#InSjib&2l0x+ hxct8~+NjrXPE'bpLT(]%fI,kחp{kgFDzK i2| {Ւ6sm$J nGUU2K t?̟NFPq[\oa9e$t¶${DƺM=RH &Ƒwk"8j@QlG-1U]ƙZZG@"Ѻ?qȪ*9v{n9k1l~6uaU+AqUfH/M8UhX~Z}1emǸW:1`YcqZq?iFC*lHqY,Z0dWK}*l0RpFj0kemZ,qRtihzџrn˺T]$wO+:Zs.h|LQf_!E3[K~С=&fUcM?JH8*߾=o=N6/G5LM 8B [74jƒ;#ؒF0qiTO[9>#EEq,C<ki|CVKȤęּ\Pf,-W,ѺwMȦ _\Y'(Hy-Gp4i.Ҡh0d$ݨ {C76H1ul2xWq}K^'{g= EpFPpT|(M#Pz xWrWٷ?qO6r|ULtYUzJ+#w#=8۩Jvl8ioƲ+jvo(OqպG'zՍ; H|Ká<+k}E;ter |UU GYZn?Z ;p#ƊuSCf(l֕aߏjW•2zg?+q,d|#͊6*ث*6*ثbΟvH*:z0ؤZjB#%D⍹ѲlYUT|'s_घ\)z+I䔺kV&koZ NXG~"\[,x%N$w( Qv$P!XoZ~`9$ :(# !3`@cVv5g?#~c:qïEUzrn a2ףdR^[Wt8ɒڣX hOF[ 9Hezl8RpBh%+VFx5i H/\%nY.ʗjdfio#ditGor7-¾\2,bĵw[0,h:eM )+DZ!u8$ba^QqJć* `KwVk7pH~= TPf2hREڝ_Qų a~f'j.w7u!3&J>{{rN4ݭ{ =%PE~˯C'u892 #$x9ᛇ۸wv01L(i@{89 敫ɧ ĘGFWm+IOa[M0~fBGqT1VbEl([@{r`fȥ7VK&?If銠&{cO݌S_*L80<1ٱJF`!0>,:~F3KO wɄ%vD|K=Q*n+:뀦Q)٠YiC߶&]|(Uhl^zPz{RӢ@U#u#N/ nq+A zORP=vj|-7;,¿eר= AqSD:?F y.:* M(Oou+IGxbA96v_f>1,fq&SMBr,tq߸dtǚa-Iqa8 " c=WaPUO^ Jn@4DQH l"uh؍YdP0ѿymWuaitCv%-,d0\h_DZ&+T&^W9O5%&KjP?u,¹ {ĔƪEG\BDY#…u& TKSF{6K$}} 6(B2<Fz ,&&\ta52Hz8)إhwWafq!1Nc4a`KklEvo9ȪW%!MGCxUSpzI΋!ĕ|Hj Ts%]\Un jv[u8"VGdG¶3sq_l0U ׯc?K'2ϤjzHz3ſXNI֍?Y!+=U -P;IC%QA ڔהdmq%OC!BO Ll :p*\T[9 n;xŧ#(tI(;D+). OcTOG'O mJf+uXXy%<\w2(wV,J* 4%YTļ<=ټ| iT=#-rJ.;LUGg[ }^y֞/ Kt1՛a#5`oR_ᵥy= n{oxXbx|a^)Mi^ `: m;w T8Pz'$T榌;_l*qŅG/#Td)E>lbw_ ",v#+cLHP? QVd)ܯ VR7cQ6Ā+ӧȥ\Z9aT:.(J>ҺKhMT፣0d4a)& scC!G4STПe9%!"ŦMD(g`3so{f ͇em+H1g-J@'osoyt؃ݰk$ ABk0]ؐ:< Z؞*G@}Mx>#uNK)1 a(0: ×*;do(# ; }#RPm" *)Jv*F׏B>YfR&ҙ3=I"lj+*}Uls,\FIP;i5X!hNDïLD\E7 V $cCeTv:v!~D?sI q-GQKe`Ϛ =2(&YIjsŔGg='jjl"d= =u%k?Fm::J.] xAO}xHcWN~^ @q]d G}9 B.9-*D?/' .HWՕxc^cz05SzIQ}P0]ڟT,O8UhVL$/f2(|qOG7S Ck)ʭIq^fOl?^LmJ[Q+Ť@X`[`:xq˄shFvs]ߎ0.hFDoL #~ey=;_AJ}6N.sC7:A=mYQt0Kedrj^˦au$G|0:1:T!{uE?[K30٩Ol aJ\ !AdMEg =܌4 X~%;h0bzm+BG-%FYt-Jം&r$A bѸAc2Y@j3~vq1ϐ%{|n+_q9^4qxmJFkЊ. B᳌Tvjo@kVV٫{Ӹ R%HjFqH3 jMsS. &[کQN&I0qd٪2cMMWV*=<@&%kv7c_ijGѶFNc.?T7D{8-^%bBB8$A pS*т4{nǗ *H=iJe0PH)&m #:؜lF(*2R@|ErDX}[}D ZzlU[4,6-V^Nܐhhz[#Ǣ("A"2 &P:FH+5ZC֔N yPR׵pjNИi#+Iٳ.[t>8޻VlaEcDn,d̨=cj*Z+85 FZ0Aw=!(Ǩ9-ty,2vRy(0M.M Qf2 !PlZ<)HOEKC{2 ;9Y C"N( HU.h{{׮ 4yX4G9~IĕB{4!; d,"1S- 3Cz]: w^푎~I+!f܅]Ւ@}KznD6Ҿ9eϊT.G ~=l% N7LĠ|~XDZe&Hiр+H@*k_BY+\ֱmofCe(ߢ6(+2+fU5߄Ȋ KR ʖ#!`hv>8M匄s];&%C /рW& 1Xq#cV,4afh8UKPHnemPV.a@q퐀vknaF'$dˑVP֔ʶzS`)Z;"F1Ҙ@HvNj]sjsJSyU]G>E<)1ݔd:^dP}CXwȘ[/ʱ>߇L,mnTUhWH6Ҧ ,~'oeoBn@|tSYz|6Hi9w9L2F*#7-ʨJmVTI׋˨]{2C1TՔxb,nPVZzVSnˍVfWqER8, im2}~)QVw3$Q^y+[<#.@Rza=s(? ;e YH\|2I U:rXk6YFID SN^Rjȝv_<~-H˰ѧI HZ0, MKs4-vri X hɀݯ]EK㍼}*5oPzhpl,>9('(jiP:lRHMjF=weUv"#4RvPܫ5 ANdr=Zhr",[04_ZvB[L)\t.닛kL<\<BDo疞C7"q6,#:큤FF9/pYJ̌XPF OF`{݁9Abw"oT8r )]yxΏ,vn1{>K0}1_-vZMoH9w(8A?ҹAl‡^WtJx*$Sr.o~Z4_oũ¾WG4F8#u5*/~ *;-%:vqmw,S[QZ/&?jC_4H ]AƤQw#O7$b MpԨ_YG?P7Mߠؗ%0j?m1G8EpY5#C‹$B[˜PȬQ"0u?0Ot0)6%~ H:>WdNNMȭ7]౤[AZQ86)ȡquF틉0Wu?8,!7l FcD`_l C=?^>quf~*9 Q߆{>wƕzJ**+ĸ;{vQ* /qerمt**xx|̕0R-jB7(|zx;Uި'q(Wn_cXf۸ n>1>QpZYʚL %T?*P$PE?Arn4vKk[&'^J&_G6覆`m';~ѐOYU[RKvEkcIС0hL {k zH3_2HW(w}"~Z?߮b \]:{*G@k@w_q~_.=wV8L\Ui(7*AsbxSV"I4#hUbu+"nEGU~Udv,>X@WQo銴ҷؔT{\^+NP96xoTy/e71$W\0|(v`&"y&AߪEҿ=Μ^]krbK$Z@o /Ow  ڿv\|.yI[q[y N_0sPLRxȐeޏpoF# K4&To<2IaRd9T|aJV44''ULZ3Ej{7O5_#PWgQ$f0ڪz1+ W2˺^ BEn1dKOH>#C5@qjC\Pw =bu?qUZC6 v}*]MRlp>x;̕ CK%눴 D-~S-nd V)C[jWtXq4p^34ƴ$nUV}8FFQ\1Ƞ< $m&VdN}bLzVt x9=ITQqX4`U9! {ǫPpIeaFxۜlUTU)U'S?fnJrz8)vJҴ MbqnC![5G)h|FY8*cmr0*9l|raVtQU$ʣ[ 'O*}Ŋ֭o'8Goq5b3||p&%N58&çQ_o6:ŒŸC{Tl? q)tHUZ-{b~ ƪ[l[==)x$#F^pDr2)BB>,tOtVFwk6Sqbʾ?P~8\U wnHn߲~xi'89*RipL>_rNaJoose!̓b:( ET?**:bXǸ[ 恠5*:Tn*zZމ> :PӌgԋltZ;]$+LZ 62)E>/pDS=^JЂWz#1 w^"YvnT\spN#؎U~]BM1Tf&VF ct~hebK'V׈ۦ[M-5.f 0%7GYE/=E 1T;U Wrzn9m Aep{⨴pIFy&`J.Oqh'Y|<1PV6f|VWlHPP*HkJ uf.鴽cQvwbDr|P $H$Q-Hvl$!M8/In|$wxܧC8fdK'{7RD]$Kڃ^ !Z?O&Z2*%;IP4d(4o'_Cud# *Y~e޴&Ca([wd|8Ua-Lx͵:HޣB0%JXQO^cC QCO OՍ(O mZRhJnpDwd6KԃR2_K]0mIO\u\U`i-aAU(BI|0*$" rن)CPb~J{p tqW1P|B?sMIF/^݈#Ex+mEBmG]~p#FgQ tAi~LR }{!TJ4w Jw C47)tRsGp/  ? vTM@*Q(k@IGN',D|Ϧ*Wb(n|(_*87>7ofu=Vz|.?/O|1BHy?áҶO HvlPRvnEmTxaKQCU8 WT CP*jT 'oЧ"ӿrNH9r;UtPZRI -K(p?wRƹX(IͶ.viɏ~}l<[N181&%v+ϡHYD8H8ܷa-d8&!8ơh ;]fxtd0VY=a`n}ol] ]H?, Jmr7jrĎ! Ֆ>ڥ0B=b)=,TmLմ}bTF1!ie-ZLih=UR8{aq!jr6j"s*A#aWB+DSBxt  ~8ڤSq'}NuOZ{izlDt9w\$PHŭ4hI?==BD!*ֵ}vH"~2=mMz#d5W덴Z5PCӕzta+j1ܰ(&om>U98lVPc#xLreilRFhTw # R S⮬j ^CrO^ؘ' O]%qt4FdcI8EF 9X w@EAqL+N/TKdz0O.4~UO~9Nve-#@5pD`kDa Qx.%HaP;b78qҽmMɼc@ML,TqYkYCFCFï%vQ[jy2)؅\F|VR "'QEKw#=ͩ[H}fa"OC,K,;l\dh][ 돎iO.uJxG6ZthN_ጺFW'RUF(iqj(Fڱx E؁MaΌr U*Qy#:mQ+Rk9dlg+OiMSҙbE͎c Hۡ*ֽ2DʹxH@ Ǯ=crVڇ&6kimeNZ $V ;9)HԞۦTE vvxKSBlxjzo\FV]iⴈMmQ_|,G#'}藕:K @c[Bѡ,X`X m-Ս{o',Ecq35N2Q]),lŸMl@[ 2 돞7HJcGbhA"M#H Ptl)!!A"TvDʻsmdא#l J se*<,*$z̦[ĮQHIf)סVO1u$!Քof!P܎v8(e aYȆ#dQ4Dᵣ-צ W;l2Q y1:v\(xg&JG iQ}Y Jtq!q*i$=E(E#1j]ܩ|EF:ܴeu dVJRleK_+ybƜd Mb!@J*$(Ehk*R*kᏺ^`ШA&1SBӗ3,Еc͂*bh=IjHM)]Ɂ+:WO$6Jң N6")W´ LQ!"xԏJq!jb(1־{+n0.^)jqx8yX1Ec d*aXy,b ݬL^폱$CO"7l%b7Dޔ,Mr`S v^k4=M IÖeKP*}{!㽎SD5NӯmiȔ#*]zk6KON.',5J1۪Gϋ>pju x|'b$nbT,b~Ѯw\~d VVQ63;ؖ6";D6=)0kƳj޹Q<䘤d+ؓ\va"m(%& B\_bq^5u`-@e~ضV .,$1sBXb"%kȑ99r@~`~)UduM1ضš'QȣoƴXBd/9 蛭ǨޜR7ޝp( +|F+ڲhmN]q4{H 8+Lgfpq* ,6 p;%BJJ _\1W )_`_]TjGL3yqb(VQk*(l"4D1?5 Kjq? @Ɗ6U 0l3Q#r@r.6E6i1<)ƨyql,jCu@M  kSF,^dF2t|)Jb &qPџƸ uSAZgt&hwյGuKq }/1^CDف(3jEJm>)75Nd CY!Cv@`)n14x;108~k(X䄰d;W b]f&Hڠbozfb,ek$bJbW#2)QO2R c©j|C/K׉4VnNNuYP2GGp:ԡ[T?V*w鐑b$AZ'.*A pӄPW$'1dSdfOlf|_J 4dw>"q#tP\J 1VAe2gƊnh# &{@̑{QZSFm`75NnY_X*Zfh; -g/A(>׾NHVH |ƋxW"K0ZO|n $$H݇'b|2rI AShs˸h~!QJ2-[ZpCWf}L´#\5A,dqOcJEmqI9&D4q)[\{J\ i5wCo.wlG,t W[DVs*Bh#(8Sa{jUGDW@L)S1)"p;HAݺKj7+^xH"}qڏ3a:h5d-)rJbR:,Gǧ\"u؍yK(t'}[3E{M1AɐFKi ;|C=$ze)t!Ҙ鵈 ڽ0=/`APYy^be39œXwX 'r+ЮƟV{i Sè˭7?4aNcG|ªoxǬǧIrG_ZK|>1ռȒja}).'mI1%T[a=OqMج]6F~ڽ&*_I6Ui#Q̍,[lˊȐy5UZ;mx늡q# HQ"=Hs$&tor?p?`JZŎ^_iZ{tz9H?MF"HOhND5G!_mPBOiCP>x>Ǧ T }qʭM1T2+|P,C2Ҹ咢0k[j~+^}xk B+X"lD%츨~쥕?ZmUN>&c톕Lbم@9d-ĸ9*`UxcE n4O~!mpU)LM_U`jz2u*I :fxR@MP p+Fc!cu?wLAI ON,%G/-%ס«^&QJpSIiwxa" 㒴Sji]Uܱp$CK4]z :zIKKB6pkFxaFz(r̟-G R[&qooPvjpf?Rl s,8P.OIj<Rl =! ֍I_c*ŜcҽT_xj#=NvD@4SPݶiwj=W oy}g񺋸.yn`%QHmV0L3# ~N+kC$+ϧRqR?xHC>p=q+GLi Î,I)!:!e=> Z׉ߊI7;E$"x5M.bkqTB\" Wp ۯ&_4LfgW<[1ݣ| > VKhV>#EaCF.. r#Z CszQp)o,;1'xWlU].eCLH…X~qUxqJG,=F+)N}>)(خ HprB!T"+;7p9lJ>-Hx[p<*w8Vѱj̿ b2$Q0{b|UpR&zI]cy.oՏzmZ{Rb(#q߁ >\ޚ7Mi]I*=wd24A_iz*te4a˾)Z\m 0.;O,.b%4dyISw:赸9A)7lM~- }}AXe?eVq@I=kY*T/7(f׈y.[󮠪: [$VѤytx^1Q2|X-Gߡ*ˇ9.k-80&쿲ܾ &p4蕸gn GŊ)Q1dTfP8n$8n`h@O45CU>_X_JPo Wj[h_ P߉;~8jcbp ኮ#'OJ#G]H 6؃o/Q\$(osWcH>O I0n>=}ؔlXn;K:aJhQN++[xc-LlcݘDlc挹"`-Jy(9*ejK ji_ m17&7Bgsl-{aShW~JO=è/ȥNnhxU+u5\Qh_P7`W.x *IM8Rqk~ dt=mnҊ8Of,LmW$Xe\vқ6qvbm*ݍn$!#Ցpu;1Ҧٿ(jHD 8}+%.TTu=.(J|c&ҹ,'k 7tW,,/l{bɱ8ڣ4J9EPeaB:`E:xTˈrCB:h_PH8UqqJڣoţc7UYq8ĢzP4rz6Yu-.YX+ocnZq2VK(  m5'#T*h+O6gnɐx`BhhjџE+DdٺWJ.hu|Kna|A#=rSs Q81W^vF?1Uv(7hne#vO ޝ,SJ,Q쒏O5ѣ~:Bm Swlѷ_&cO\i\NZ,05ɍ!eqqP{7 -P6F&ݡHb;TwN*H(pRPg*@ڇ"c+p&ȏ:H}U}`z8)8 =~9f*~dž(i.C~q=泊4RՍ#ۡKUè i}- ?oRC ܒRUaԌu`PGqgaӐlv5튉16 ٿ+#ɒ$*e&?ڏۇWn`hdG!esanq7qx)j:LE6W•o!(k(()qUW!kFqKqv*LA^8fO(VdY0"IA]qJXV)'+L 9 `]*g|X@ڄT~*$TĽ&?U8Ҫj, 1)k⸪<} 1dp R!Od81(1j7_{Z🴧6 VhҹO"+NiUֶT0Bazzٺ1%~0V. p-"XޘƱ$V58&?=dȭ%U|v8yP8+a \PCL`;1^Ij>`DB#N+5L31V}^O gop@S۩7q8x=D޿FTЋpW9:M錎`Oƈv8zSF/_Q˜7ȃÚtF+r5qIڟNH"O8L-4%cLf,A5aq(N oN%lв_zpqP=~rb"(r\b"Y K=%8 UcZ@+ rL$f"[7ڮIV܏Qx)ڛ}U( Q oDRwa .7>!$476J(9*1#HuS׮;S*.5xer4tXXחVB&^kX `U Jۑ!e7tP:l !P2΍dFD($`0-nNB[`. XmNb %qQZ%=QEȞ;5(i61M( 2`+܃aVjц7`+^NH^5eE~;w:B<14GU"8)~9:#8]ș #gO]5<ULJlnz.ŝfOLFIt<;=ua$NkO82 ^wǪH;"%%OGLU.-Ź'mRJFxg՝DfEoH"]-(Ey8=3\M)Eg#r{`W0֪2\lğoLZH2 !l̖mKD15ݮX:w`r wFTt`]5b钄 O0zt ; v^{IBRġ_qzyUڵϬEy)q$ w!$˭l! !VƋ݌I~5%#{ECn6Ḡv[J!24=eSZrnZTHv(&`F̲ 4&%kuŕԪ{mqge)\DŁ,dѼ2$Zj=(b$ Gz czX.%+fT TM(6!ǽ0uNVҁHrf@c(-*7=^geuv$p'ąz{̞ w6ymM xgqQx(Z ˧+ȓ+!d2]N[HNK$( جJ֡A@p },@HYօ=\B\4zo B9*׎W'îie-(@4;8P9BK\TeǪb%Dajze];æ1 adxli1:iޛ3#TC%۠QW&e>MpP7"XѳhGJҽ1׶'nM>b)Pq&Kj-Tsb"a@| #3=E(|rpe2,.ul{hӐd8.=v/B)PF1ʏ|5W\2>rv)=igwq`+'.GeT/MREbiM0\Zɉ2kl !% hz1k$DwWVngf! HW&h&kŏPpqD'v)9# $1[ko2JJZ|]Ȩb:dLP!YhǾvH·Gczcd=*9FVҍ}4SJAHJtw=8Onum^Y J瑻+ºHpZS$tX@Dd-p!>j}.w34@r: IJc4#݆Wp"Ĩ5V9'w@ᖢiOlԐOm4#%67PBx,Waole=҇l֛b"/H A? Т1FXRm$Ck3 z}hvzBF]< ʧvj K%ub^[A"\֟ EsO&+-ZeQ֜i@w 0)$F;RaJcVJ|'nZfJKEOñ868C]#"ar@\K%UTJȄ@†`G\HS@zPX[(,_Ďhntaj*JEDE%?KJ |vZyt:Vt3ys\lN%QR0\rIRF8V<_32|Q$7,Sk=p#9(KJbsy=<)-ɠ18#{W<>؏5O0c YZD({w呐IW#Vd@r4캕5滖&d>Y H60KcI~-H(OMr$ՍCQؒ9%{ƹDP^-}{ ֖ۈT3C?I+_MSRkmH*n}R.chAXIVSDB h05/3̵ ;bȰ;:Ȱll[Vŭ$hH& eez98w;$8PeiZtȓsJcCFjzPuE<kH88D H%(Xg0ky_PISƙ!ǔͶu40 "9e;e^e"vEּ{WSc\-?<0SpE(L8J7Qi7{ŸѓǏHW7RїZ33*[!u(OKZ4$w**vt=!1YTsjɻ+e-r3^(ЌYzChB0imK ̐j*E2M$5[Y %:I''WK h8rmU'W t[Br+_ m3<[4܉_2Rؔ#<2AIvv.:iI>:eŜS{tvʥB@zTk!=l4RzÓ2Ayu$7lIe\qd ՛K ոH})K]oˠf>dmR_ 葏lJ"N$#JJ+KLCʦf5i{Y6mǁ e<~^/݉!oU\Sҧ g1.>RTY(I1~y*NY` Z{fP5#$J(݈I|'=huBvURKuŕ{6h&[ZAt?pE+WUӏlD$Ua/U}U! L, ]|W/,%dMw;Bw n*ģѷZUj8ҁju~:muͷ+ PO,+ I7Cxcx2A2ɱpNT_7/v2,滭#CIA=ع1%}?56 )ZM5 ޤnw!HTdP|i=hw)n}/E tYcce4o*W[6ZXy/kos@N=^9~(SOtħ(¸m6kWl,H#xp9 H+0E-rOTzM 4q-Ǐi_w<l4Ԣs 8JDPi&tyU8]F;7R?o0dK`䛴]iƶR#G&_RF%jUF*洘EKiH3o!HF#@P+bB8ىӔLcQ\$YO_HBz2x[dr4UaLGF ${0=8dr?ĕC9qPckB\gI>F(A)"nPxӧ_HaqVw^#ST+tUbnl|F*67!k}~Un>\xqp+ lR[|'Ź?xƕK{^+VCfoN'bo<%0q)-Q _l}#TaWI M[ۡ1$?<%9ahB=LǦ)菴+w)QP+_?v$M?ga(7pBܲ6+ثt/m6ImMZ%IcmVa=8[2t\R&x13ɷ~ɿo= #F4&*y =~*0-)<J~#7 &S3tѳDyD?=dV?~[ث2cMlm1ZhNZ~#w742x G]vlUٱWg*6*ثbη[ K2vFH6Ǔi8Hם#xY0Ut~L[{i#ۑ?N*AETَ%«jm C7$dRk{NJ4\ AB1X)??*Kuj4dض#T_ڈ/\q Ln)MzأI xk S 䦒1_OLRЅe:o~8UsM/}xUD|-{|2ӯO UJ{z6a}3GzR |qpOz8P~d 1Oؑqhxz Ql7Xڕ s0OyD,{%B<.#h&ZO /ԋ~4RPS3vi1ʆn_ ن/Q~$nmO->Ԏf>8Qh~׎*wW[kpW'Ja*a0lL;{aT"=u=4\Q85cnDrԡ;W3#zrl 3B/vc EkV3U#Jw \/:սg0BYKf1J*:0m{tr3-\[O~킝8B] 钖|cR> ~^pG(z*zRc{O]q4C.?e7楐Pi) ^㍵1|2*yh% +@ԋBcrПf8dС$AAeT!tq<%Dw0*$6;eQl C5Q2HAٶ>8AE*EpWq剡5= YVJ*X֍wO 9@x=GQG*_efqZ=u^K B#cY֪w|rъn6d>ӫ(qWRKMQ]+aK}cWOZ>wZ@pH-op>$ipQFF23XH.O._eArѷ$kq";6YE t8)R -:w^!, C4=Kެ-C퀅ScCPhswSoX@2M7){Iգ:bHntA2>xĥ]{Vi*@~Ӟ9KP H/_f8e0Q q7#> m%fik Cfd]Tv8U4m(RqF 0Re@7^$۬tٱ AXs6~vIU7ۨWW<<0RĭKi\c_crl̂'Yh+W6.Qې=} 9kYJƘ_YGFѴ@ZcK0Tn#ԬՂq*zl[50xgkU# <BkY0m6'7-8Cg/ՋEvyD 6DŽH#t]@jn?,AA 7B0 )ЁIHgW4p<JXHZF]]XIy *Ѕ;6՚D0NNMU^8~ ?f^zmv $#fdL,`Z WO$i֑(n#X碁ESSk$ ^XvaQNlEo.nI=kƯ`|F[{0\4nH5&ֽ꒬#lg4DӠg$Ѽi gT'Ɲp$LU+ʻ3lJ$@͊2$%*LB7 qV xco:= , ɼ7Ar> ڃmYP`Rv#1HP}=dWm ,k{ihCC$W^8eXŲ֋yV}K8/fԭ;-`)րqhOVw wMJܞDaAr4"HNU[Ej0I r$ NFé$fm| M> 2y5:,;Jo6 <>8KD"ⶃm]'$VgzRuzR0:uVG,通cģF&s ^*8tSLj}MR@+\JF!y &3ZFE2N4v@ #4'|e$׋\0[#ŷTѦWTVZŸU"AR;8IJK0A8? uRu+;Rl#rA `jk@zad۔u t*{k(ؿ7k9 3oG#݄AFzG4SMEky$Ajˌ:ujzp0V ͉ll:! _T0Of56'lqs%dX"=׬QBtfۥQhVNE tkS_$0>-M>xaꥁ]~YPi4/KЪTO>"(E%" ZrQɉ0dz$Riy+JL,$ qn*I`{noynd$ThT.&QrJA aS>8BDk{iIrڴ\6Gn4펴0D:S}eҜ CuS{KYZc@Ew/M$r7{|6$C#x[Iuql˙)pjυ7e' KPHXtn 里lN둠97Fg Tv%oM;󜐱Њ4푌I;ݹ% ]#H=q(AcD t.×#KZ/8H9( 鐘c|vI$[8mj +Iî\e+"Q; t@;RJOBA}@ zNV}e[. .-\3Ŀ# "oXG(h(q5fB @Nۜ1Z-# .q\Wr8DݏuͧbAȕEc:-?Y=a u;Yhc,v߮_v7j:Ԛ)|(6ICHPل}V. ǯl QdOfVn$;rz{=a(QZpǹ+J~r폨<@ߙ_͟iFUGf`:L\>1efc\(KޙtWr)@ T~=YJFkl{a+kĒlSr\iWG\%O3T(OI@