ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:20 16:34:27  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T-USvǒEw9,v=n?c}obl#c]k]=Kkhxc[QɗHK+ȡ>7[mm.:%bmcݵ:F clÏKy2Nqǯ̠wIr> Hf~;_qs^5VM_?GXp~hĆI$BQ{ƗZ qs}KNO{l}xw,wS$~~5Isc^אv߯ܕ=a{ƛ nC h?c,cla i\'NF%uY[MZL|}}w~ڎm{Z͛Y+SդdV̱ϭgNqoi)Tq:=֌gXӐA>ߥPKKB A\LŽ 1I鱼{Z,< ѳi!$_+'}9FQ\@cBn_٪=ӿv4Kӭ]*'v|#V4"oR_0?Ά[iݧ5k?>g/Ilw?s=ݶ 9b?ҶƴmwVpn%`c=4ubKin?欞loPq+ZD{5>[߄O'liZ׍5.|3 9F[KgpW˘vZ?;c֚nnN9zdkܻŤ{9C!y]Ʀkamenvk5yϬVj6Goa"}4%ѷֳ/t "nM45! Z]e{IC:ɝ,s6ͯgUߟ#I 5Ԗ?Qo;=C qFk}=膇%m0a{F?}>wu{=;{+kx9?}UC*~(Gj7"ͻH`x?sV5 ՚}'ƾZoR6?@+QԞ@O?֯gNkџe6mc` &u|}'1viU+ېIs{@ȭ#A@U96eOjkuI0y_Xa7ncص[,P dܼw9c%kL^7H}ꈭ_k$c=t+79uI"T I%9Cjuuhw#Q\8ikZkƮQh[!Nr"x wp&l%=T}[!i781YIf2:k]΀} O\J뢺Ǵ"yҜ:[˿zT,ϯNGq=48©ėc}`z|Cc̏Jm~2)s]^FMۣ{?$OjW V|];n$oq/gfu VeaZdis=Xo꽝C4cX6Ƹ Eu̮a5\z> ,k4\Wʽk$uNO<;}| տT2Cxm k棷꟎>3i+_1׵% ȉԟr!O |1kJ#~d7ZU'ƥ|r{/[K  99>{]b*U^nUӲ.uxXqD4{nԳ5s?[FR C}ͮ~shHXP|ǡ~4rI'{nLoӧHVY7@ -o+ٵ}+KĨ0uqkL=0<ޮ5j`2^4;scvvQ:P n3nʫ5nOmwZu<O2b[.n{,;lqi}v ;v̮)z*ukf{ˬ;9-?G4zKh+ȡnkl9Y³k6W^O=P{+g~/G}Ik~ϰz4۹G6_'DA{ m OBGPI$$I)TI%)r_?Q]?e~Uc!4[ ,/W:n Ɨ&K*vo?|ۈ$h׸KN߽r=7?r鹴}Kw YyƖ_aAn-Ў[ǥ{_S'QR[+7|ȹ]].۾{m~;Cl}7oU]kwԺ8X׆hoMnvF~P˺kcȨ+k7[mmz)Sgcf9NEk\Y-kHS"֒^8˞?z6M# 46=-[HҺ1Eg#iX; 61oNShz1qkqIe-q~kYHO[y]WK]]6m\M}O]HΪ~[Vw<.u-zGttNuO{myܝI$ФI%)$IJI$STI%)$IO uӺ [;SJ|سGp$ ~u]3 ֿwҪmm u|"}mn=F64͍o[]/ ^.2 /,@űhg/BpPD~Zu'RUqgdZݠph[:~J~a{y%Ӷ7"he- nTE I$RI$I%)$IOTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$VPhotoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXT EXP550/PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMY update_maart2018-2 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T-USvǒEw9,v=n?c}obl#c]k]=Kkhxc[QɗHK+ȡ>7[mm.:%bmcݵ:F clÏKy2Nqǯ̠wIr> Hf~;_qs^5VM_?GXp~hĆI$BQ{ƗZ qs}KNO{l}xw,wS$~~5Isc^אv߯ܕ=a{ƛ nC h?c,cla i\'NF%uY[MZL|}}w~ڎm{Z͛Y+SդdV̱ϭgNqoi)Tq:=֌gXӐA>ߥPKKB A\LŽ 1I鱼{Z,< ѳi!$_+'}9FQ\@cBn_٪=ӿv4Kӭ]*'v|#V4"oR_0?Ά[iݧ5k?>g/Ilw?s=ݶ 9b?ҶƴmwVpn%`c=4ubKin?欞loPq+ZD{5>[߄O'liZ׍5.|3 9F[KgpW˘vZ?;c֚nnN9zdkܻŤ{9C!y]Ʀkamenvk5yϬVj6Goa"}4%ѷֳ/t "nM45! Z]e{IC:ɝ,s6ͯgUߟ#I 5Ԗ?Qo;=C qFk}=膇%m0a{F?}>wu{=;{+kx9?}UC*~(Gj7"ͻH`x?sV5 ՚}'ƾZoR6?@+QԞ@O?֯gNkџe6mc` &u|}'1viU+ېIs{@ȭ#A@U96eOjkuI0y_Xa7ncص[,P dܼw9c%kL^7H}ꈭ_k$c=t+79uI"T I%9Cjuuhw#Q\8ikZkƮQh[!Nr"x wp&l%=T}[!i781YIf2:k]΀} O\J뢺Ǵ"yҜ:[˿zT,ϯNGq=48©ėc}`z|Cc̏Jm~2)s]^FMۣ{?$OjW V|];n$oq/gfu VeaZdis=Xo꽝C4cX6Ƹ Eu̮a5\z> ,k4\Wʽk$uNO<;}| տT2Cxm k棷꟎>3i+_1׵% ȉԟr!O |1kJ#~d7ZU'ƥ|r{/[K  99>{]b*U^nUӲ.uxXqD4{nԳ5s?[FR C}ͮ~shHXP|ǡ~4rI'{nLoӧHVY7@ -o+ٵ}+KĨ0uqkL=0<ޮ5j`2^4;scvvQ:P n3nʫ5nOmwZu<O2b[.n{,;lqi}v ;v̮)z*ukf{ˬ;9-?G4zKh+ȡnkl9Y³k6W^O=P{+g~/G}Ik~ϰz4۹G6_'DA{ m OBGPI$$I)TI%)r_?Q]?e~Uc!4[ ,/W:n Ɨ&K*vo?|ۈ$h׸KN߽r=7?r鹴}Kw YyƖ_aAn-Ў[ǥ{_S'QR[+7|ȹ]].۾{m~;Cl}7oU]kwԺ8X׆hoMnvF~P˺kcȨ+k7[mmz)Sgcf9NEk\Y-kHS"֒^8˞?z6M# 46=-[HҺ1Eg#iX; 61oNShz1qkqIe-q~kYHO[y]WK]]6m\M}O]HΪ~[Vw<.u-zGttNuO{myܝI$ФI%)$IJI$STI%)$IO uӺ [;SJ|سGp$ ~u]3 ֿwҪmm u|"}mn=F64͍o[]/ ^.2 /,@űhg/BpPD~Zu'RUqgdZݠph[:~J~a{y%Ӷ7"he- nTE I$RI$I%)$IOTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$A 4$bh+Q ߕQI҇-bz8;M=\҃' )Ai~ ippp$zL qRpIx*6< ʑkv7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbKBD]6&[)r;/@(MrPu)PRgGakIugP KDe|23V"Q ns aG]¨I(ҹ<xCxHz\!97>IܹˣL@E`zUٱWf]v^*ܰъC4OmDri{(*FJ3[c56ƀ0;e鴖aN82KU_"vldHFb6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊tk!6SG}FɢXR02䁺~g:iRRNCS*[I$Yϝ˒Ԝ B/]vlUٱWb?v M*f \x]tN8GdtGv&ty~G^c!͓RøclL MZS[EJ5LeС勎 &)jMjJ]; C ]s)_`Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/v@xfQcMY}c7KTd]<ºT>OsL:ؓߠ9癦bjN/—ezb\nG9*f"1F1b.ہH{cKȱ1wxSKyZ-1*A톂FA;+^צi 7br D#Q䰸 AiipppY8ʧݰؑm]/Sy (d!#d< r#|Y)Z9`wDF,f6(„d A͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*+K9_dY&+uƓ$cӰLZ '%ILc[5chw,փ~Xں-G\m6T#kknL]\mѠ=P}ڻ7=ъE ! 3 Iˁ q^8_,_GCe*I]ډу+kYW!Fǀ# bnvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]u8@vM4)-H16XBW(Yd5:m z(3!'K9wr.v5',DE)7I.*4QSV2݀yHU`GkmGW\lz|( 4Z(p|:$4v8h&dUaZ4hޥ*N'7zGpz ^ NB']vz^K5L$BK#LTنItE/"@eq/MDǾEɢu9eZ mDȦVп+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*QcfLDIbi}|t%\*?.^:|hr-Tb[GӖ'O)c.{9/w R?(\ df˽x0T>Kjm_\;34e:/(Dhk6?/BƊ-zذmr*2܇zr5p,:ae%&rr^nHi`:!k@W;8߫SC]\a&ʥ!OC;gAnX&lBGum'k'. ESG-gի0'Guo˕N֛vƗ,V FY|U1*ú['`UY4LڭݏLIlCHy^ue3#V#3A7IuԆIQijFCAaޜEġl0e_. Ož'dln 1!Pnh Z[ 0 Y)pJDRw8mm -\0F22 Yh/k8쿫%aW,!9W c{. Wq8l\W( ڂ,QSOƛ3֧mKX+A+)+՘Ҙ\@ŖUk =aU5B[YZ`vfx 6(E]*Zo2J:w$9^(o9bo%1Ëwhe\|miަ7+M陼"«}Jd{XaF=Wd@\Mlz}k1!T\f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]oimauR\YҰ!iMdws>G9z)řqg PT `yc$D;m:W'˓p <뿆D2汥l5NLmJkOe5cay$!I¤l'i<. O* ;-bhr~X#R3ӳ4Ka~dH+y൱> {]⡣]<3:"1O:ҙ !E8߬0EPWq39aYPnu$t,1]V1 1,C丂TXE?NMG$0 |{K})_Z\E?TOᇄ/o)<}D8<>d=k4~cb`Bk vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]kyr(W'2n6g`XFa_UNS3IK.a;g8^]fI4I PeFp#P6"A|Os{@\Nugjbn*TnpRiBY+ZS l'(;S.JSza p2PSNKi(á才\ B7a)Txثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊=0һ7R~<% v.]C ^Ut+O /Σ >ԟpƂuqQPh#vk|x{jt6?ԸMf0۩CDS1/ڏ fk +m DQce]LZ> e7j}ثT2?zb_E1Wez`u1 ܿz+T9g$өrC,"n rHf$E BVezTQGUw,@y&ۮ8kZˣ 7v4סuvX\R゚ G6L;b].XFkb\N<y®9\W Z#ۉժS,2qLPu\RwhhN)Xq~ͦQ8sE-s i;?b~:H=IM:ŕ .=CM!lU~)q+1 v'ʀu╤ImZc'ƖgLiĂ9oq¾ǦH[ OG/5' cu V>4w-ԋD#{Wc@'^[d~E2`,N27M ֻ6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,b'lًMlVS&`uqTի ea%NH23{BZZS\[9S e g@$7Y!gXS\6X᳏"䞙 PL5#ύuk'մy}ùr4+$<$P)Kb͊6*ثb͊6*ثb͊6*ثW`+T{ C ?i|FDi'"+j8ocx0 }{˥#j:6B],!;t8Z^%hQCU<`zg5EJ[Ouİ٧Ź;ߣ Mr~){&"O$"W-J>jq@V7&`WPepc `Ve'*71Wr\Vskc늗pt+ x^%_pвzIxxix]&!D h&V?vZv,]ˣ)uqE^+VFibI[.(൶ׁA)usz@{W"]\1uszK#0+W/'w,WM=awYUm]v:{b;;5,C^ث]ZF+xCGW ͤ3C Zq n[,c7tGQk@vb[7Z9hM;aha S0MKe0XA2TW(M787K1꽎k dծYz+8h㖮i$x`NiP]l{co^ FfSee%mN4V&J$B16Ǥdxc\S-Lˢ>$qV] Ԇ\g.; s W7A\ZmXEƖPxㄒvbOR`VyLR5]UC\on~Xޭ1?HiAwn 2k6l$|k| ߺ9esdj\UgOMB$s2SLHk,]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]DeQzHn9v d[З9RD*q(p彔[m#))ըU&Oizoe&Wkdwn!K1N^"q<*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWaVheOOza%mG'Չ&$WSB6YM1K^)!^Y3*h"ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*xRpi)SNŗKf<<+]tI cA4Y41L~4Jh NLvIʠ`WWKrzLUٻVcqCc s-W/^N5\ o\銺D^ث/(68UC~WWù®Y vdªOp^DwR̮犊e)9PTv%PNTBgR)K:w2SRBy \؃•J&ʻ,EM_[[\x Հ9Cs_GJgq4Y15e>:#J#G$PaFaU0XVc+HBK)勭ZFG*FI` 62j]8;tۮKJa}Ƒ"#, xQQ_}&ռot#,rZڊ*+ȍmwaD+NMPdSY͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vynԐH ;6@4ƃ'vSD%˿+L4UiX(ʧ* M QOJי&&;96\n|Ռ)'UR+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWev`p+O^=$1CQ-.Plan *<{bNVGLyJh1?!db͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbǤl('冒DzdHǠ~S冂h;.DvZŗH~p۱Uz mزSW|V1?F6Xw~6;Vֽ*쿋*^Uo+Tˮu2$dJ\w#Cy\|qjUT8*|UALRM:bVv6/c]L+UF*sl:J{b⮮_ҵ\U˧p%v*sP X+]bcxk.N*?*Z_E1WW0Wc*sW(k5{b]1[[>x$1R6(˦Qբ)IPvqؤ5M:b٫Lˮ*]{ U_LUԮ'+MA+j8ն [0I-hmQߡNBA;+LV3aЙ,aM:-$FmqFOMaMvo*ɧT}2Ceiqe<&},YMx`Jb(˱U q\J+zHsD}'Y[1[<.x2P]@% -lح,z]ge5We2M`B8߉+ a)U dup+De*POcfPxe;q*;Ӟl-qONlCk=6U-٥˅w1DGe*H=R 7}HU+e|z`꫹TuEAV n$ѩF=T9ѿeRABLLUKSv;#^3XWގIT9nҷQ^r֤+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU'OkIUW\[^!sV#X ȜЦa 끮FWr@ҪFN@1q~$5J4S\.ȵvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbǢ?- ;'n#%ž`ؼ]ݾ4NF1*}sRa1q@aSb{U]]:.֝FLHr,]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v9Ti]ErTbң zW0R(h‡1c0!ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v PNC(vt/)n$[B^@FI#Rq|d܆?dTrܴiI!cflUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWemR[ghA 2P9o  H 0Ë7l,v^8YiQ\+;r@2c wu^Hhi_X6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊IIRiaʝ],}d]NPP {,勬}cmrˠ\Uq/a]Le9nqV]nJ+]v–ޙvīquq®[O+Zn=XVݚ~*bp>~|XL=*# /nث{ucaCb1-eSu*,{vfO\U WU1VSV_QLg0)qZ-,:bCߦN+۱ؠe Rx+}lmƔa\|w; msT=2@ oJ Ef(ynG)W\eɲָ4F9-\EpGVM;u "\05Q.qJҞ6tWSi|H8v'h |rGAz`Vk 7cߧ|4WcP*6#|V\xe]R>P8kԑARxqG1˶եq?)OSŸ pqJ lȨÈZC؃DA+Ѓ)kW劻TFُDIhz_1fN~*25mW8CI Yh}F1أ1# ?;EZn<ҁlptbM5ր0j;҈wn|F)Stk*ZZdpj A4.~56%pap}\v;+P_ ZxVJ5ӱB:A].϶Sqm%[rPR$MCG)\]mRh6'k_F:ec,`)ѼD]JȑN9`Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*g6>|0> [{6${mk"F >8˒J OL/43Ƭ=@Tj 7ZŢ<}kBp[wæ-NıWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]:4evQe5D1%%z4o d5NA-Pj&ϩWpqn)mcTaM Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX]R{b(v}p(9c=0L|5L]2? $olMZ*n[DP)"<vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeU 8RFZv7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*z!cE8@vg#dYq A9+ٮUk6Q j]Zb]\Pjp!|Uc1V鉁+y(0!@3cJpquqT qJ`Bm9ogc1C ]|0%٫OI q銻0Wcj▲Mn]p}p+8~PI:b|U;b k](vl*nv_^aWf7.^*ء٩]\*w\|qWeæ(.P쾽i0챶v]{a*0 ֡T"z$+*ppAFZl-04s v}-6EpTrGqǧiČ<^PI<qBڽ[kXUd٩]^8EJmu+7[Ƨh q` c؎ lhnB0mq7V3=ȥS(ȊA)u1*QB;`Cn8e,RW^ 1Qjx-|#}xx]G5#UNq=w-}#*|U*%{ P,PFV;ZZ%u;:RWɼz)}iN6Qc,/q]APl{aVM\mȿRs:bF1km BI.8=1CQ>&5XS GcZ9 )l P$ |3f&*,*^ﲎvs8_J07*Oˁ%~(0m۲ٹudLOEv3/QQ'qUv=7L iv]ȨyCۍyzR챾z]e]Z;/%iurp\)v:-fWFLT*cIfdcY FBXlb~CG5&dRڄfn<.*ԮhU;ϣQZ9YaK/c>6)Dݚoz>/:@<ة0 0QJpQ(qfOEl<,[,);lSJTUXes5[I?~4G@6Lsu4o*`{kLPqcٿheC!.GK fG k> |' [+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWbDd4Nq),݆Z]1A`SL|0\zޕ ft%~ynX(\8RS®cL!(`Y+4TCWf]/vV*UٱWf*UٱWf]vlUٱWe͊/lU`.*찪{TTWe]㊻#'vf*7+]]®|1v_B6=*LUT8bLUٱWf]6*ثb!`*Ǡ\p5@"Qrb6 Jbt+C臺zvvLPm sZa(r6)^MI| Vel}lPpN#`'!:;"tV.Q<!..+P½#niz˓H.wlZ=cN.IRzc}p-83Q7@  FZzd}8)p`:Mjů ;.ĴשխGnymׯ9^=X#JY$=`1+Y%3YQN΅MPcqWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* ;bK-WùS$xļGs K]NJc%"sn5&Ė:{qlqFrͱYl0k56鉗I *;W,'q.a劻,![q8TZ:Xz;V ANU?Feu®}14(5}-*d6v?\*,]N*]{e]= ]]\T;0߮k­|Uقqvjv]LhCY`xem(v],tR[1~=4Tav;:Ro{`괸o*~o@yu\F rǸ\*"dhOp1Ji*hv#Uwl*a5-e劒ޣkq/GBbp4•\;1ppڵZeهO|Sn&%aWc­W.Zv?n.-ܠwCebs?Li^-wq7A}I-\H;T3_!~"& Z٩d<2dc`Ha2L(KWb̽zxǖxKKepma ]/WbP 9.Ni]1r Ǟ27U]+.p{%G$;U.][b i]`WS+e.ʩ>x5Oeٿ)vX]\Uazj9lFBxIX[٦xP)-6O5v+ʛlٓJT?<µLEޢtLIU浐6 dN9ԫAFD \'l#nlQbBcIx7?r$mppC"E8W4f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWcB vِ8'$a*,h0+D+Đ-zr?Ifvܬbz 6G@2_u|\R5<{6 bBp6Nj;ح/é6z]bvI]zjUǴVӰ;z (bGO:v+N:yieNح;/ce}Pxb쿩+NƛliiFxbi쯩KNmliiߪQN- ZvWIe6ƖӦ4vPAi^w´좬)ӱһ(CpR,u@Zl7]WcܞUك]ָV*hqWeLUٹw]q)6*O(vj/s,pw®fSE0+ $z]HхmF&rrWG*D$e|1ImYh`O_@ReF z%zt+` dR@s^"jkHhrk \ąb]\M WbZ֝gO٦%6$,SN1}Qlm]ȱ6M"3Pb0ipv;)Tڻ0(7jFEQcl]WWblM;/|vSDUؙAkXB-]%:%&ZQq? ڍ*fT=pMtX;dkdmku<&רW2[LĿ,(> H36"S">eY2UAɍؑi֝q&؝=%ِ={ 0(C\[w u&45mW mLmv[BK1|lm.LjP%v<@jec'>ӥ;,1J0>aalqLClbd•KNk7OޢzNj'w{%ĻԯLL$6M}‹,]@Ub6u"z&2L8W) ?u)?"2fH61M4Tx`M7<4Z*2귪~6Vﺌ|4щN?mlkuQ2 ASeLy" L; VAX [_b/¾=p+A{BWǮRbH*3K$ny&H Lr]Ie"@qVȧkՔ~X=.Ras f}] lG%p# gJ!ؑk3M2v&8O?YXDhGӓZv%͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊8@XiioO,˗'`rv 2dߎf|0S`MN%# +,lPp5Y>~E#և,Ɏ S>,9msS$tS;p4(Ko@,igGlƔHZ]lsQ$ Jӯ|Tʓ>rP$~SN?e`VSu3Wl MN|+N2 U8([u]/m*n`[o/lT'*0']|U_ lUt\UM*mWW7\(.Lܷl,LOk0K|b][vWMb]Wer6ݱ[v_.fbS,>+qWeCY`PL݅7>x劗r>*r:HpPSf*fv8U5ҟ*}=k*, 0-$^ urj]C]ƕ~KWWbv®*F%m_ɂ3;YE}w9Lp>Jn7PWcչmdfʷ-mƽs UQc$x˸CQ#)I\z JcvBBQc[,u rAe x1!"]-"Qd G"oZ OFW] @k0o(T[_{NC*o8D|䤽D^2va21!2ZnsP气0 Fi@8V *0&Eثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثba]:^aBN|ɕ-&!Lq'=V.l|;4wuKZq@ze`k$ȜpʭR9|Xom@BE6BVwؗKnI(cŘIšv(4U-Oa)bRӱd i".PaB-&fe1,f>x{MtgJa.fQRT A&4gc ct9@Pk Lu4+LKڬDObxQE܆14iphWp^1/шA|cX誝N>=V*JP8ӳ 4k: NbOd4v)x]kTavZAqO  QAh",Zv1\`cE0ƖǮi-!ऀ5ӸT$vfG^Sբ܏+)B{Uq嶤?pn ޥ%%Ý>?<-%z{uÁhTPR(EI$o٦ J٣D?Mr {r1l;eÆ#ښL|=!K:dX[y=Wb%wŢ\)v E 1d짘/|`YnYQn˂jpm 2vY`v"2%OvCvv]G =p)!aM;E.cEwDJ\q.n 6mMN(v,8vK(l- Zܟl -f',V+nddZOq0A!@]K\nz㐦it"`kH(gu$`rM@ɖ)7\B_LS> zmEտoH/傭JA^209[o1dic],qC+C`WcpqWf2Yu1Ecի,K8ZߎQn5=b1Zpm\mh`aP["W%MQzn;wѴvÀ^k|7!@%Q\Џ^ @}a傶k0#\Vߘ V Rϵq<TZ'A5 :k =å{Ś9GW+W={.Λ D[v`)\߮*ǧLo,(lKXD{|[u2v1[hf1T UA +u*Cei.]k콾]2vbZne==WSa*o*kx5ݩCn ).^7 $cƕ{JqJJ+ڧƕܚ*ڮMMMwȎvb@zjpU5={%bm$\W~91 I}S$Fڠ65[Dzu#̌x?A]7MsN"\E UؤWHs3Iу|o1!a]|)v`χwLsD k1CvW.?FSf)]fXe{b]CXCWc,/(k(ث(qLR:p(Oy>\GLxP(Pw\MW zM.2ۛP 94#c׶qZRƍl *wݚCIU8) eÝuOQRH9v wl$+Ol}*pk]⭊S/M]&y6;nfF< .bkr[ $9ɵKr$]-1h:dLJp ԩvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vqWaIrQe5Ͷ0q4U٧+mXMw^]C|>Y_!}Uk6z1*XjꈼEG7վx&8|Y; faHS%I>\. dOoH:V{4ZenVGGaiʼn鎥@Kg,,RmViBjOӍ" A१z况눊x] gHpޠ,{ dTZhƽ9$E88_TqP 6 ~4k!:3}Ӫz9Šu&dbG]+wʭ+QJah]U*Q㏒I:Ɵ@ Ќ~jxB(OBqbppSҸKWUaMӈaҙU[⯅0 zjbkvV8|BoBYtqq̱Yߘ>$tǍ4}_c:4rs j釈-5`@2 DžpkJopEgaxZ7 jMnDžr6Zdp9Iغo㑴:MsFXo^G^LiCQd;ׂ݃`իBm᭶mSx1U_~F4obmw . OKi$.7S@!vr:4*h| x jlw{K.8*"A;'P%Tm%Z;ajI}iq檋j9YPDZɌsG QPzsm-2Y׮p{;3I#4b<T CEe<0EM%G Il}V,8dka%0-I$TL lC)0r w\ŸJE3P;WweG+$B/v5>ХlzZdTO]Qor:Zr:G ty%Z2PVYXnXZxǣo׈~-Բ0eC&E;ڝg[sfmzָjؐ츣VV}|CΟ$ 1S|6uŋWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثHSQRz zC.N8n^AZkErJ1V Aȩa!VO̘LJ{s/#t[=I4>dK SǿS_%@4+|IV遧^@D@0:+|L{d-{נ=ĐZ+\Vڄ|'JףwL|ݖU,FTʑO6ߴc;R^ĔYhJCS| Eƚ 6k .떨[!Kb4X.==┌mmI'LPȃe:bx/1MR*p7TƾmkN +s}o_[ƕޠ4)o7bC-f'e1۲vKkV|2٣ uWW1S )鎘\!Ӷ :6n]\# 0ZWW18څ7[ʯ6ʡv®cY{U ;]LY$hwxYG]d=| w6j|߶o(uf銻qхik84KiHqCE¥k,WcJG)Wjѿ$_ TW'ueDO*ڵp wV8 q޸Փؐ;`KLj e E ^₰eبp`hH 6xNSB>!ckcR-d %0^S#ZȤmZ kM_%jVZ5  )plG1 zbUpnCfs76l#K LЏ$9%JPwTR­ZPF'.k_X: ^k=jKdp: B XVXz~j; 쿫WqE;WeJqv,#z4-."cr Fdb,fpaR*οMQ#%QEQ!PX4$\Zhc7_UXR ]2D=P?ج*=Y8;\pXeRG38TLPn<{ !-Id#|Wcoњ øtq bWbyn3a$,+qM]w8z1d(OB1CU;S wUcʋfhS7rhrɌ%O-o=_oD V񸫳b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbǤe -X{o&¹(ArWom`NS)6)fc-կ7鏿q|9V YpD_œᴻӫ扻1.r}SdwS@j)̓Fk`@d Va3lX|k5Xn$xKZWӑ?قړ OϦzKUE$`s1;7(e{ y0/R74+fo֬FLbaNf?<#YizFFĩWY:Rp~ƞ:n[;?k?QϦr@Mi+КPZbXF V=(+B7R #l%`<_;WeͬQ# 8G=͡"OA ? + 񊛜\Ev8{eT|`?LxA>!FN*IP>yM;>b5]TV[J2왆Q~J{7<Ņ >=6-s+݊c(dAdĊmrc-qM0]eގ@x#"v # MD~쐝ة:ji0FKe7J7;` vZXoN|unY mև'+n)[_ wG]rPLլ`| dSNˍL\R,l[؞e.onVX-;e# ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*^<rq앨UHmc Xש9o\4*sN-'+0/QwZdW[4v[&SahyaVh/N9p/3 K*No΅Ixfg% @1jjz PSz`LHMwޘҷ>=awGW$0o ě] !M OQYx2RPS,fly b<2AhPDBר¹F-f<."΋_L2j)Y r3iKd`/%b~ʍ-hJq*e!Ӧ;1*8m[sN~1LGe-؎#R2K ĺSY~9CT24W1r$v`BuIaKxsZXWS"4S Z=C68'#ԮǨ⭜xFE q)cø^C֗\V |l{3#EpZ>Ǡrgk)6<7h_Ê^bgFZ&ƘaU(8z Bӹjᖉkoz[8|1 Odb2]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUA\]:~=٠SLBi/\i[aZ[ -1?gVI=KFN!wu9w[^v[7Q;!,5rZdFg^7ndoOS]"W2W`M x]-PwE#?"ˆ^[ E

P:_W65銨qQZ+ήnq<0$=35)\57OfPcH]j/lZcxIiS|xpεJߎ?jwƑJXӥcnEN$Q) NpzWZEGG܌4eQM+ɗ88UtZH*bfm ،%fɩƖ[O[1,}AGC:u_Oj*xI1UU6 #\i6]}H^;`\.FWqo9F>xm[k䌷NRLLXpzwivLVŦ % 66>Q\JU +F+J.g}t* K«ZG|\iu ϭӾ"өژQJ2^ ]`ETb3Dp!Z9 ( Mp1!PL1O' "AO(8=M僓0Rx䑩J1!)9K2w䝻dX'{ZRPePM.~fJ F9$w?|i+(DDbZD$: Tʝ\RSU=(S]i_ *AA~ -N;oM #~níp*)1ڼ~ʛl|ޤ&>$H 2\H;p~#L k\ w勪)!Pq\3p.{ؔа[yfBBMf:~C7%\GTpǽjkpCAr7PT?؟鈟*^ >_H <8['odWL>|2Q7`k΍/t5xexOqviZ8ԝ+ X + 8;usGe)&aY Pd._ DijXb-hj]~$%??p ͨܧ1($l㡶 +t m3%C,b?6XGd+'vZLdZ޸M؛GMϿ, -Y;& ɼ? l18"Mmblmcۦ@KZ}pR9ijdjv=p΢xˇ^`0  w?ٕ 001REz#i5}@kw-&ӶQ@%OӇ-s7\sjɱpbC8bMm a!iA-;-[p+L.)$zKx0҇`ȦY;Z80S$V+L&\wY2>c ^KpN1bkq4ƾsڌ^<|Vbo֥QIHkÛ=R9EWv f'ަ֎jMrgnĂW2@@yqA=r̩S hw*Tu\bbLzEh>ɍSQk3F5JNS<=/S\aaWvۢ,G6 V,|/J1||G)@n݂OU3*w^2!xf녗,~?n%B\@vp:sllRŒ4 dHWa4COMXoGqHM?s >l!+Qh5iŎ,_ޏ aj SjrZ:)ihimW$WfMPUaU3vAq)tj*Kk2oJSO?4X*]¸[}嶔@0D{dr\I冺$r]+(DѾYZN5@08wS!5KҤ9l;%~҃bmH_Jl;ܤgr!1d 2ES6[ve/x n] 6QlBBúRg_Llj[#V.8*ҝm<›kL3YA߉ڧ1N-z'iFmFG|'GPd%l}f] FEXn \zm-+IvW:nEzmZS7"WS,;ָF<^+p,xe06Px@<K#tĥJ|,\MAUW- ^DW-(OO R\_0!O\-7Q' ACGITg FECUQV-(S7;պc|mZ\<4늷\}GNqWW(ָkQ– `v8c.:X cKJM j0Pr/:w+#8=K(Vp-5\kS m+צ qIuq&%8R?9X(5N_p.O^ȥqЬ>j˧?*?+ob~4ָ$JqWbB: \ F㋊wú-k>8,I}--U?ܱ@||6bv'OK~C[,lӪ w[ SY^sffLZY}2r a5^n0裋xKekHc|d K%`in֛TB^ҹ\6Hvo._P W*7`*13%['þ)v6X>kn0!;zg;Fv9cs#&P߫@Z80*Ƒ [B(vXK]Lr| u3*3r+C%)k$~vG@+I[qfK,&6Rۭ3 vC<`}ፖ-h@ctowCq5w[rBF0RK9-&Źz!@;z;*x,ks}~x5=ժ̼\)ߓ6mv`SJUV䲮 ZMa*%uQM~\4Xbi8Uq6śO&{~8t)Qi= **=A[jM{Dx>_N6;'ait(݀id˜j˭q~X0@k5;f6vmY=VPA)jv-nB9f+ꀊS%JHK@: 4 Ğii6hH(lH=J/Zar0RMMWSbTmTTV4&[b:।d7`G' E"Rk2w8i 60w֏SYtOS, Oz$bioũ+7A6AGʅku9 Y %Y:aЌlL팷R-yc }geTv k þYioِiBl0m%T ،z $,_ d#哶U@ǿ^jwM+ro F#U* 4ӮiU}8^jܐ j> eV D7 ħv?INH6 ;$" 02pO>DxASі6؀s}b#DžN7U?F(5kؽ~ )a=T r}jg%|: <,kVhmƪe367(47# SMh1 Uw$vOZaMC˜ch\$L,T4\4O`+Z}^`Be5+A:dɚ$v.f=M6&($avQcl{.{ǭGpFTdRIj'L. Z#~jy{G:k40fm<2-5Cd)'1UpZM*r )Ҙ(i*^m Nx\.ANkԜaKV /s¤#+AG1/ѱQ"OlAmF;e ߧZ_#|%fa!$֫wgZӓvr2jpEB԰cCsBIQw2ul r̗P$ A10,Lq8iiTo%Lj6C`Ľe d(6;ӯSL 3.9d$PE/Lv'y$CWƴñm ţ LJ8qcydQEMxd=1aKT(wwNJ:A ĄjHH Ɏ=vR=pݫN'"{i"\hX; SXJޙPk ,)y W`59剋+v.5_b¶]Lq=*~44)86W.N:)Vߎ.*:-ۋZHjvXy&\RaE:؛ {#+2Wh"݈[;m=OaS<pCb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊8@vKlQorrfqHM{XquNQmW!E;v†4t;؎!(3Kn̳(ȽHY?p3|dv~NT"aZWfW6%42IBhS,uNENPԮr>RdnƇ'd@BytK`F GFqӘY+?m9٢&8J.p2֓_+aJ2G2T7M{˶HX(w?:;m.$ }PZ" r^ԓv)cd=N ~<)= 섁/n#pnk)w%lA17c={WWTv*8R\8Ɔ"+='H}Vrk%0,0UIs8ꓷO㊵̛V+`.؝&Q ק\U'ؚzqUB3*e[˧}V阵ƕfN0+xp *t]"WcY|1VE:m]Ǿ*)1Wfv-`VkDZi]!aC&.6)ijP]$U̵`RYO8q=Hh'\w%)8y|K kƕ5_ tĪCC 6#?Ť-Xg7Q0T%1H*æK+UC~2Tt#6O1AlFWitqpZO:dXrLe5FP;WKd]356낐\½~)Y\pTaqc[d$+L)%iW,BYM)i$ܞ'۾)LĊurf0(u2߮)qb+Tl6Wb(GQ㗉(EQߏlnt}} ڂ2zxu5tI`UɎXħ)>iG*7,MK+^j#2IO3U*9IN3Ûc钻JoLDꍹ}%8&ٚ{ Sʚ7N1|IFU/v)3).ZG@PvjF2F(] )-SJ &W WeVXf].ʭzcjKR{jv4W0N#!غm2c!!aV{ ]Z9 rˈ7+w}~A,&ЊZ|Xc7iЃx8*ګӸJ6 q2q|Z,ҹAzEuzpe{ȳA\pVGcY+vWLO_~UWolZ 84[j~ϔaOHz2F]l}Lb֮,z5.d֣^&bGaCx>GS"MPdZn3vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]l vIbF2-8eͳj2HX@(VB8 KIB{Q-451,NL@UN$:w 66 Z0iie &nA P~G!~a nbNc=A&n{~NB'`7]{Yu}GӑX'%1zSϥQI4Hk\5ЙG)-eI.hҩ\7O (& yMR΂S"}dINj&=Jk85nゕ1qOlwpRoHW?4 +E=`F*qoj!nڴcliU2ƽ+nG(O#,i(OLUXNq*+;|aN67Lgn80E2W-q2AWU0w|)KmZcV8.*b2rҬ2oQTDSwz8Lގ1\o?  ׮("C5٭gld ᴢc12lhja^uFQaAϪrI 0*;~EqTR@;c< #s4ą1D}M9[Jmpxd¨IuiH;2<Ё{& iZ&s+LUI1b- oL -nǵM=;YSGW)lGq\i ˫mElװƕbjmОkb:d PVHrFGCP}x27%$殼X=M.(~޲gi2C`.8#b(CEA@i䮠8!EI{H7ϛSۮ>UA]|.<{1t#uŕ/2Px:ҵ;+rHN"7eXt"H-m+SZGgڃ-,^kUd[;#}&OtH}-xA[~`VI?TȞY,N?xQQfM`Z]Q'V~#򶡤 ؛o 9n<$rdO ڇ5Ǯ۷PG`:038 ip=co0n!u@vdae!\U.O~a$޹~A@=Fcd ċ`A!q~9@mq$]DZLq37ؕQ_!H^brON-:e}" 0KSKb71rraM5i\\h o*j"mKG91 ]O|C.iR7.hC˫ʽ [EAqU@eZ1dqk@yh_Ցe >mAᵯs-{a1d Yu I>ʅyj;cdPIɽ/FJ 8SܣL)@mj:cT~*bE0\ڵΏ#l5Apƕ4b9Gؚ/42# CB,iw0p\+*)(SR( p}L;W IKǥi;2e)2V$_J7r>h|-7wcQեD7B۟J%5MzVŠRE&˰&d>*UTE>,]FPbf(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊hx%iɝ8뒗6}ZD)VqkZr^;~'V WW;F1]]/RE+B!Yuڍ9:+HĹ/L8̥<{`r5A5a@G$95AR'őL :oMیN+H9`'-5 Q=B2;O#q*M>A"Z|v߾9,d=^aiz$tYpAz*.2\fNøkn)cmc7[j|NM$plH\(nb&U&m}mx%i.›iW{ecu\R}#7C JC-XII*jj\ĸx CPGB1C`x%H+P88ii&>8 bw> %]R@HI;aVW*K5Óޕ{Tl%Z+\ܝ{v8wI,VA2 ֝zcJRpJJP1N&x"m?`*q6RG\SmX=OZxT;|VTQ#jxV֒F1) ;4 \Sc営v\X$` ;;dcA?Xݻc$[{ccFϯI?$:#}Ja.!shɼ~`q~Nz6!**)/@sa @ ZN8C3)-A oaKu`8qWeAC;I^y|]1K8~ nOߊ]lULqE;J`ؤ;1>p-e\t(v3BJ3#qcJ3"Ņv*{dҶ^:de!E4~MqL=PFrG$ڤh(y + jd*P0a冣=Q(={?fjVMtQኩikMXS7]_\H§~ګ_غ?9 hگKr%CwRWH?#"qGf@$IӆDQwˡEWOXi|8Ҽk4mB?K1$͒]{OlU`+r߉QQ1>yj yKRBۡ>c(Q1cZǎ*ӿaw+=a.ȕ[n0!T'|m> sa %]Q1%JeU8) E:ds;wfbv'_ 2Wʦ(T/޽2#t=1)[R%v=1TDSTuCUxB}:mUD:TTRR[0*kmĆ-+nbC`BXة0%$L 끵-(\Z>N<-Z\aT3#HC`cii2-TݚFxmAoݭO#t&$S myfj.[w -CD)+N2u{ *]ytOb*WfcE V l(eTlIF,. LDFZX#ۮ  no ?vH-l5cڤ1 OOy 5f0)N\n~1Ӗ+aUX5mсb~FF%B-R$iRG,ECzbfx.V9UiМLA'cIV)"ʩ@h< |ͨ&$;/\š>..y'B|2HrH`Ӹ8?y[&MjV]ƚZMNi TU'ۓf@1_VI$[ ͹+1QH K5k!b#uY:S *&k҃aZo,=TWߡ/ڧ ^ЫR]R/H YFb,՞6, *R+`h(HZ55 )AƶP֤|5c' M)F9)4am+R*z`=%m-4Ȣȟ+46B~cP|-Λ@m7ۯ)S0t^asF`>si/t-CMBd$5є*Lw\\U,pF*g9 _O5Ҩ|S,ʂEym 5O M@G\}?W{+qoPJtWd uj0Mxal1ry)Tq{`"Q=2'~hsQrmy#㐉1K'⻬G'V^Ăv=̨0f({ҔzL NEq_ _d%>=8Dk8?{%m#SM&Auˡi8D {XdS8~Q\FC h22Y q)m #ޚ cƋ;~FxYRji{ SKN,1<1dxA͜1ov-3sG/HoB@u߰s<%k{bƎZxI=TXc@$8#˜V\A]@麮ĹpnCV$;^;f|d$,&ڮaCإu]kS؅lcJ˧ߊ-ʦ,]]bƴ{lGŽ]C]\e{4qV0%؄SfDPVŭn&wJxP\1v+  û}aXT{0 +I5;aR Ѓ6ZW43Ŷ{,OSW,{blTUU5]NHhTTG$#Txx푏2إ휶97U4s3wIwA+0'9M՞&Xr퇇86@#*A> jWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWbe`m [Caf@rEXP;e68G\rEV!]i1/闖Ї~254 hUҕSkMf ef&FY^xNGYTr֧qJ'b5` 2 2r>iv@v#&X U=9 lIBW` }w҂g,J$< j#qm #*`ErqFB+N{ƗcU4PRpVUxƌ 'SeLY*?~QC፪:"RXסkB%ۮ_p½IƆVhZ0 `U  v\8æ6OhiB>,P!Q=$kE(Bm8TÒx`Sl vVLbozxehv8]om\*|+sDGndPm<ƭS|ŽV*ToU+ t>U.r$V:%GYߥa_lj$2*w8ٽc)Oc"04POι^*_n #Jظ1J6qO|5J$%I:*oSRӛqUi*+}#B! aJD46p\mZ7l10OsZkq.w1Z#^Wd|qVbzeအQI@8eC YHo©^q4+[UvڿYoptժ+Eԝ劤R1q*2% 59$w:;Ӧ4#sϾS81D tRizD sJxmRyU0A 5}'H~|e)N EQӶ?}VDu'iI*w5끋:D lOVD?)7QHoE:dKUZ$^-4UGPvɀS:/1@9'(n_Qid N珑6jk6槷LHh'|Uu> hͧ"Bm8!F}SAjָNпb>#(B:x媓$EOO=dmTSR )FoT lZU=;(' !H̪tHZG$:+XrOJȪ5f*Fð[`z %0G5%^^m@>cWm$*侗n5@!!FyF mImi:LLXӨvJhÑ;cdA:|3CFS UcZm/Da ̬EXҽFq6)4QHaNpt,|mR ѨڎAzd鐒?EuΞÃ[%ΘO5Nvb%Kp] O/uor2D7K:1LLZVÔy=,ud YѩZM |LՅϪ)fu"'ƿ~q(LViͣP=Pv9|WA_wVgyn@I 6Fr) iHql s/1&[b:d < p>cllIPэGJb-6VM?ik7I|ZLR:tZ54(!\e1.mC#+m.Z&=%1a8ɼ4x%7\a0)՟=%9 5/ؽESPXRS-gNmGr\E~{2 Ƥ9d}Z-}:e$(ޯr\8^ugēO' >pr5ԥ rBiK涾F`2`B֥ѫ8 AYT dX!+{wPC i1xM ҂iҺ^CǜHA69$L2,T;|)# $"E*&Zn€⧽r14 ty&[g6ĵo+Cy]Ff+h}'[~WN囍9J~$uh/Wf[Ft7e%l19O%Jq;1oS [}Xݾ XMRx js5i+6NKɡCEcY/K1I܎6e~`uy;z08ya[܀܏.utjAupa-ڝr+q]B~WbzaCYe(6xbwZ OY؃ͼYmEL<ڮc M0 bqSNR*@oUtHPhX 6}s6ڥf T2?f<vNў,/L/4=)րo#1%Epk!\ZbI9ܞF `cC|V\DJSZicj[[1E1TЀvRMՁDB 8k 5foT?])YÎ#$}bN/mtmJ*4LmQPG#*]>#F.K!e_=¨ Z;B *|1qNW6qLJ7*{`6ԇ/w.ͅwEwqs]*Я*\Z+zP]Űq:{aKQO8vJUqE{ऴW/c*WcJӦ:2ShD.]?-gq*JRQS\Od [K ªm >$56 l`vY"bҪ+zH"h1xbxCc1hv3x q˷"eZ81)hahIҘRk\cUz$5'G0qN'P -re&_T n;▫pEI㊫OW 04[ v9",y7O )h1?S$W /n}SnVP1׹`VP鳲4j{dq: vz{˾,9s BzኬNk"@(ɸe>8"%GchR C^ŗaC"8v:׸z "A@P1CLMhGݒJЄ lc{bd*|r>+=2Z#Ez`(cu[@6­F \gMԒ8*L?@9|K_"hJw,wUhoJ1f_UEnCyt#=sg?'c2Y,6e4SHsKjp!]"2 / xp-t"[o풥k/( Ğ05ŋ߶+N]|1K®j`We`K Bܲ>|)v9M8cHy. WlP6ԞOQ*0w pI$q\+N#1lv{Bf-߮)rǷQz| bq G|US2PEd]▤eS@ԏ|pVH|*#S޿F_.6}?m o£.cjюSeU9;Ԏ٪i$1Q\UoZ cF1TB\*OlaT[Y?,D.4zT`_L@W-\r'0.%V-w #^ GS]@oD8gPM-Im-'s?N*ؚ2jI A5>: bM_ *.>4؂r*mN*ҵGW\5;!]Z[ SWYI]={UXHIۄ`\$r$%3ӹ.N#AaB@J&ˎ!+.@It b蔣 %"ӾT]Pݻ؃-2)LbS`ze I;HVuCNu mB@2/u/jxZ"xfјlj:mՀX.UkB?%A1z)aMKMpUо<2O6cymY"R>C%@WcBN͹I dS9xԌQ2G.=U ݻ^`t%xn~y}  zjhH]RMfטڂIV@8[jV% w޻wJv)7<cHLE9UOsWJ`{>RxǍ2bd2ecO\o~8G}}obcq64. [m\8p~ei t_߯dG2AjxS%BD\SH< rD&/y~vAᆃӸ_PY $wZcGq8E2+ĸz/B 5ΔVduR,mg  tV5A1'[p,] r,cr.xf@3%Rν5"MA]̨m%,rط_ėW A!GY7^*Yl{:}Y[GM_L #"RزLp1KEp|72F Ar=qPTtŀoJ$c% \Cˠ\rPnp٣Rz((6Aؔz\. L5 Nv04evYg~+ߑ%=C7`7a5*SfaO. >P$_ ҫg_`(04\ :8d7ӆqyf%l)}eƢEsRA&-*#Cmf*ۡ8T e2*ᄷKf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6  +k h{写aLa9Z6sDhhpǘ R>FǪ ؛~81zQ6Cqle0UJcWc)8qͷ|(hbE`U_ZLV~ _:xZyPm3W,~^1rZOo/R'38=X4ed3R@b6ّc0<,=8JxdFA˧j8{Z6]%Q# Aji%0z(Gr[rp\:bڮ`]KuuSD,XaQ+jD~&=:4,c]rQi]ʡ~GԴ[[W\ *8nۇS(J %Yl=?J3<$ƍD\1O6̝ӤO|j>b^Y.^P ~iҒ"qTbAj+1 .&^躁OL4ӾR e$ڦ4nإau1qLkH0+`f7czXPv3ra~5Qk(lc# S 0=qO|*PտxHZI[zfyenjb(]L|R8L6î),]itdo#&PbMVqJ\@ءFj 1B_vq㊕'*+Dhf|i+`7"$J|Ut;nzJ87*r HŔVhnI851@O=ZrHeHPGq S2)iw&Ïݽ[+T8:#iRw!.BFȅzaJlLFp!"A4L|.-wW&c-^VJ\i4[Ǡm‘]]_}icqzQNʒ.RPlOO-ʝ-]8⌿-{%q!Ա[o1?eNIčebk!!Zzf7ʸ*)&+CBi遍,e- c@N R^_~\w5yGBAz`CTl Vpc\#bj^w_F?tH ¶Xxԯa#9;`Vv֫po^BۿCp>8̅.-r֎:{xbxgS.^`x,'Ҝ%XOFGl .(IF뛽E>.3Q{iP9l{{C9c*7ͤAirjFv6HIZ5hrc<2WVգڵ_ cK`{!8Uxb6`[L_1y*]>4vo\v_) W0\rc*W C%1We0+T95: s ZJe\2Zd0Hy|J=?S2(;@^$nGL-dCc+Hj׶%Wr %-|!P?cS|I(>mZC` k˖з5o21dL*{95}2h{G}fM rk0xTvR㣳b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*9Iɲ.b'+,ԉi-X|) cP;P"Pbpq˨c\JV.LsLKtżj)mf$61v4᝞yLl2o-=2nvݗxS8yrJX­2iHnG,S(KP@h}EN M*z K^ [P1ȴHDgxkfcVs\PtJ}nXR?JPzpPP?&^lW ؊؄ U2n|0* ZV:Z<*$J-  :v%6*cTd/eUv YAV T:l1BjŸ|Eӎ E%Q^rd8\ҹJh2U$^LOjUBn2r•e A_WQRGAaK:V _*`xfqjb@bZ=|3WJ«XLD73 )Vn]_UIe4f (SIeUtOY⫖RjSf3 Lc c[F(Qg=p|4jJcHk@UX R R=8 <! ?gq•6c^'* T14>F!*^]\NW{ ?h`^үQLo0*7q1UUԙo_ n)UϩА|)FJbe8i*rf)z1r%zHN*V6v ^{8 FCهMb~qT,w :`T*_qZ;,%Gp cMrvMrJՄJK `i->4xK~X:+X^ kl~XHU<^?d ϭYZW=8 ˈA(:uӔ|Ĝ(kP࿌A>7Rko7.Ġ&vTڇN*@·eHLǛ;e~Xcib^}y,$ '1ȧCyb~)A8' H:#Hߒ;Z#E%Q!rC'_oH5a^k|P|jHQ|M' ,9$N!UI?Njbž)WFN*ڣzeLUdXĊ0xT"ѷ?V,o?Wv9."ˉ2^c3;K7\(2iX]=Ց( 4-_N5AS"[p_&QyI*9j c晢`brAsPiy8ӏL;gԣє'Lxi!{s?Eu%2=JIhr7Jas㦂+|:nL4]RJdx0X޷Z5 NL!{4Y[k-8KBu?X˛$ʋDv?NA ?(:`P_ot(`A2Y?V@*D4Bb249UL "Bڡaj`Sx\3N^BK0P)CqsU?\aK FUz^4|,2QQvP~yf$B}Fb=$az]?°O=~ܚ|M6xj?NJZS^ GCLb﫠>\y#̭-aĝ͆<򽩡"|PR!~?^OJ'Cƒ.Q#AI8Ljť܇'cֽ[.F|U;G`v]ݼ9ij7P:ۇ'`Ȣ*Uv#ad17ӾZhLZfXw,y`PjH9}^5 z9L@K6-Ҹ6ǢL6nLUc +EaVdU;těI #`W\m)2ű1JӶ_&u4>ثq_;l4z)O~#E<`J"?~=mXm7h*]'޸koKgц$BL|';TW j1G7ƽ<<0bOv&Ě>I[p#ߊ2UZoQ p.0R)Wc\JV0N&kPqCxI-ϮXbw$.î*{QpǚǨ8M;cQ+mrxq'%~ڇ4^76ծscxPF\~Pg۶*fSǩUBk]10w]ȌJv \p^ǡ.96־TR`H)+ql v8|F*?DžفpZ`EC*jb1AUW ?s%*DrçGl2Sx& 0KW!Rv=s9 HkS)retu+b~4}2Rbd̬pǘi W-A|0L,+x]QFaF|9  VUWf#U٩].{WeWeҘܰInSli W, S]2~5;0QeGPqd~Iv?(k*0^`4$vZ[_8 B[\ʹ `;ַ>#!([e a0v7slñy9(6nmxR Mwxc~G)[7',dmQhq\nlz<1 /$mvZiVp|$.j>5=23vZ6;Q{g76E;Yp2[Ը]NCT"Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]+=+Ǔd]*Lԅ+>&e n,fV@1enXQ2|6x^5ݛ,̤yɖi%]@6l>=~ckK۲-X2pQS&o'c5-þiɚ@J*ՐdQ8]bWrur; xrpY}PXScj-Yaz N* dI;Aw8$=q `1Uzk0V(yRT)~j\F{ciU^~;REؔMp+ڸM(1A\n3(ZJLYMiTmKV4l*_R^pc\(Z£z`T4g݉|*4§皘BO-%j^S5|0r-w?FPu8^>##%>HUUx偊f~Z↌isSs5M=_LF6R[㚞8|ju8Q덥zbB5)A1 QFBNٔd#qL}w *[>|2sFNl1UKp*|܎)\"jF`c@s8d8ڮKH^ l<6I ;ԊcThMMNU{ Pğ뚤aW,a^Fe|BW ;<0!oA'W0W.pw=Aw0*Pҙ+UVXab-+5,}U6Tf6c+(DG85)ZUQ-xWAUDCO|)"7-2(Xj\{\ڃlU olp&e ,WsqĕZEZ@% >'UZ@_WKViYM >V8Kn.}V2IW$t.Tp9;2v /xJ^H%hZ{Ylq2qVj%.+ Ӿ T=n9n(n[*15޿MNicL)TȃoS B*S+`_60 ӭ* lJNRl88Jmvč09vbɉw$ dJG_CO›xam̓Zn+6Q@0 *9I{ۊ4tcخ،vhG]@ Zwշ ct꼫!x!_&B+mdW%OhI?<=jUc41S ,b[ܚ)r9bI܎iUIdW q$nYi`1Ucri]y%JXQZ&C!bLREUagaRr c^2Uԭ܏$QR!!4h|v8o\'1@2EQt@7n̡)gV3[1pCzfÃT71|ɞߋDM~8ʠZX½f%RvP {I_:nDPw>5iT-ԱZ'orJQ J;A𹺴b@ wVAc5;zv]?XOt1W(=#0%g S)e^JWl?[3G1Me>oW=ǶWK"PHv6eo/j @Hȣ}wGk(E=x]\dJ$sY6?,&FňوyǑʃ0"$J[(޸CoLJ#vUѣ~mI@ra&dK7t~es{J4Ku4œQa冽wl e,kLҵI ]j?[o7FGߓw OU4&vufja:s 2/%^MWHMwj?]GQ%v1\$5--;Nb.#jzDw oV1%j"62XI/$W* $sk}|&)pՈ#n-] R(z(DS.;ȢVei)#ZAH(v0|% (w-)l;m `E Q#3W 6ރ,XTPOHRB)F?,,BM}q5-4Ÿ*7Q lY&U݁9nB|1O >Ƞ!5w.|;cJTDS|E1 Xwbܑq4;UI^.:,\Xicj ^O$I W|&CCN7*ZAS cHhl`ijbT/lUi൩>UM[*8ЗpDom)Iqx6|"y5p<4`Yka'`1=S+O-b%§ %bLĞ%&9&+Om]녒cI7]x`ESt23f+N2C[꣐85>e/5c C}-83xL žU0 P]E;q@k$*!; <0J J=H?vcLN~ rUY 8X .`&#wk8w-|h7z!Pf ^Y5\U"p+EU XRMVv]-nc"`p9B3\[OS+1zgLE|*o p!˔5*5)TaJO7z e}`7ZUJgGm)<[.ֻAq4_h}=F6$x7=N(;)OÀFOEG*ɈR0P|kFS.WĀ(kW `PzaBlsAB%+"E1V'튭6S 1JCg|AM*e8Kޣr#|R1ث%"xmSr…آF8?cZ*U1@╇5&QLN ֽ1Vݫ]+waB02 b;n $Vv'8L4hp Pi4MDaAWa-v"8 Lah"i*jv=0 _D ֠x☀y-87}n11?ّvc0*@"j <3q[gı|2]~Lb&, W *0h9olVWp$占ZR!ACssL lQ;3wUL`ҽiWS9m\!c?ţD8ov›Zĩ8u;xiUrإzj6d1Ji'c^ F0zR() #}*k2JFrL% QI\A㎚۟Q EZU|Uӯq^78ōW|7~ϱh&΀$7"ץ:+Uc\M\t=2c*ĤdצcfC0ųn;%Տdط^KS].:fa]׮T,p!nX*q=)v7.Ɗ%v*V3?fTؤR G_ U-c35!GFؔKl}㊴qXnx9dx. 26&2, A!0 xT**q9ڽ~y,>k2:lw-ϩ"Z&*z!>Z: V럅vV*xaR74k\XŅADnSLk@f}:TC1I?̭/"~c-@NX&&CdS >㐒)V#Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUgx/d]e*- nH*3Z Ink0]oJ.!FQ \cz"㓿˟ICI]UCZ|[H'1P 2WZekpsd~(dx:֞Db@@<*۰L)]ZeZaV6(m$p-|)Z;Pts12Ȯ WޔEy զM.+S1COkbOMUHWu#0$eAXb,g;ڻ2VSZe`7UO9OXS!M1НYxmN$>5nU A*bE1U!H+ƕy'v5&(:1VUH3CZMaU3z⫾Tt9FJVڝ7`\Qٹ{ُaE|rW\qSOSL*Hoc*{=V|<2*eޣUWjc@#^J5 fUEx+,"mQBi'wQvB~MhmQ0NFe8ܓ넛U#T$D5 N㯶EUCmޣVq;ENڮW z0[-~8:9 6&KxTB$g~4ɪƢ7),_; BP\½8}RႤni0=ż%+N TMZ^`W|+Ɂh;rZg:fX iڟB$ W~ZzJ3ؐJ@XGz1F;)Q-H zͺ2J&-$]Wouco!'bmw?<қZ_1'OӗZ`xy+aE nTޘNn-&wb3^򶟮>HCHV+L"c =RSuqVU`.LAȥ3z7CZ ;7\)eS="\1pt Jo?w"NJj^Qj=hk [CL1Whj)mEYVx+` I-v$T粚 #6$ָx 5K&YDA9ּgvL`tX?RI= %^S.?ukg]1ix͆y"zuS/ђ]0_$O 9xvfU͍IguVܩ |f$Mn,\lCXCZS1^}?AƜq@'ά*kgaFQM,)S}Z:-Kpnp&چV"+0JPdI'lZRC{2JI;㗆V5=H(U]Ap(Wv$Xuޫ$#v'aKXwmmf>4 5B*tQMIJ7q]QFNU$s8OOJI[w4 JՔC[HKμZz:iQPH 9-ƻP[yd(1VS>y؉H;+7e!IUj}KX'^F t-e 5{u Ԏ&vلFS r ͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثM̳OߒM]Y-@ 6=HmAy/eEApgs9x1!ƅhlEdTP%ϏTdUˌm]rj\%OBF^\VJ=0|6[S=0t!g>#\p?Pܥ=Uu}$O@;M&[^䒮2V'bS[n]Nv[mv7?^(obS o=J+$Χ>z+ |U#r3?C-[gW]5ӆ(I푳ɘ+1Wr{dambR@ h{{dG'uJ_#jv9T8Ua' VƸ&)҆ĥI1C;ȱgqÊGHb6'ӣ?. ;q6ө\SP6̴|m\m+lMsvG BOFuwvV~0 V^.OhFh!.ۑ|)l\) 1AL V Jm5n:wKc7*}ثWqZUk*FT5'!zh>X;lUcѫ׶) E=idW- &=qVA(yf ZMY>*c=M4N2yhNj2M_^ت8חvSߖfφ7є@&.7@-\|{oqzވ6EcO<7 ^()'58cZX B/.2#@pv&lqF#W\l EnXa&xON6R: P4<pIb~w^b هP;,=DYvDUdz8$l}Qv̅5=BB01 pq&;$ci`yBw=q꒙ ]iŠz-RҔY=p &@܎ˌg.k 'BVEv\%D0j>Vqe7V=iڗ*%,]A 6# ǎ#mS}pl#ߋT+WnZo|PZqQ`3 A > UhPM8Yq2$t*_Q+xnA%PY]+7 @*z!`DzTnBOǡ:ǎ:Kt ٽ6rs L8]Xz2sCD?'O Oz2C=܎ٛҟHTnjV9WWq\2F &,#]Z*$˿(MCI mRh1*e4=R(鑤q;l51Z^d 'NץG]6.=p2O@+- E/dvǘ% nh7ܡ :DQ3r:dRF?(0A$*8f|\|TS*UV )09M"}`k3q*ؐ4Qs*01&OEUB:0*ԕS]O\=Ƅ mZZ ;q%V\=ZiLmUᚘ ~98*A3\F W:f"-[O}pcxJ׸a/|U6I+qUjsp8ڮI526m''jF r@+|qW*ril;WAX*jl*~^D(55 0ܖ!ħo|vJW~x*ta-A8%ta_? A=3EoƧ}6jާإh+aB ^ LŅ({ʭN^UxbO:`#K t SS*1v#*]@wZNP Z ()U1 5${mHR|Q(F'YZm0J-S݊*HS-Eks tTXj:fQ*X}߅WUA|WѐHlƇLRr]QU й$0 \ATg#AULQpZ2ʶa\iEOC k!n58ց#jRѩAV H}&Y]iAp§8axUZKU-N()PvI FI)mޡ#|+(Z M\ ',}m >xujP反 0`0HYᅗq_`2K.|u4U4ܤt=2CuKo09N0f hW[t2Đp} V5Ia0JIIT{+G ߭k]qv=*T ~U4=Z[3/ GQ^Zz lJQSW5ѫ UXncȀのo~qy~PcOS !ЍGzz `)MŷBJ 5,G>'ƘRW̲KRƽ.// SCǒ$'򅮿JOc:r218>k Nޤ-m?4hxҟ;/8\icyVg1̵vepp' JUc5=29c=)MV0rt>nFR/z vhV `5Ez`C#*3R1Lz7)2Cph_|FIk~ V$eD2,^ӔIgr]$j6_yjj{H?Ze%S<u='d/4v={z,t8˂Z'H(޴Ypr\* '`\Xj2Z.+2ZۧҹKi lJbockȷSCui~c nC>pte嶑|a 8&[leeALd3+'v8_-۳>§'a;"ǜRD-ɬ< ISEVZi%ݎ/%S<VDMTvȡʗAonp4`y,i adq#-ԣ})8Ī7+RcIqdBԢJ5;?"̠_׾/ecZ L b\ټI.mEO"f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbOu0wn=͑=JC 6J%ٱ9࢑N,W-OCW P92bg Whi,C4ۊx:0`k :p)>iO1 CU9.H"ѭ#nڀn|23`d:1w7l%|ɹOA1G*KJ' Ӽ[^(?| %cԞ`<__rJUbmCy^WeWzUg;(1W񅫹Vv?sLUz;j:5TZ9|~U=˙xȎx~!fЗūK%5#l 3+x:*dAJtv[ډmMcd@ʀ֛7IQT4$qJ;.ꜱ+s_:X^N>#kCfN,uŪk}ػ{]ִ;,*®7ckzwUٽ+tߵ1vfxP\UGqZ2Mc\\qA,Wui " (_[mkan0L8PAژ)9$+ ⁃up1i| hҹ ݱǒOӊ-A{T3z)^=WE5'&*iig 2Ҵ8V$>8uޘVjܛ#NNUFкkmZ[N7pw7ZqVⵌҿ<*8[FcZBG*q؎|VqnWiQTezl6 \#m]\p)kSqJӍ6iLpI@1vb:&aK|dzy9GKgnLA>[acHHW6`'_Jզ/o25C$tsMIܲh*I;W dM^&HedADeuҧw)!r3X.'?L/|LG_,f3IDWp|NKv/_UelqWfe 7%%W6=ifUv|rkR;-PT^9KW!]O|Jf;6%t4)[M,]:0R}KKqȐG[T3HtO>8}-ۃ-V1uPfDQb4NZv9k{><&QeXT.Uσo_ל*S%0@="oLTNQ=YInak=6WOQ[?4 t8j*)CJ\tWƸ1U![*K2mK/rcƬ8ym% Ly e%OB6 d'2Swu5)If{s.p&=dz7F\ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثW`=a\vtm:`-ƕϛ}쁝 䒕'VQr^kӾLJ!2-}p| o֧Y]ZaCK~({TfF.mw26 x,9O1 B9m|2,X_\IDŽTe#F7,l£0nl@\Rjc :b9kdrbPߗ5 a4`S/Fxw.}3kb7Y?X2珌GM|xaZT#?N9n#PN r',^(><E{}s*Ju<Aqx mā*;~8#|vj) 8HkN8r%H4 XS#䱻e҇NQ0x֮15upJhwS\^*u#₃/$ϓd; }cZ)X|@"Pjܗ=$]~ywN0\/@0V%|LH#fxۗJn*s T EZT9FC ҅>)v;xf7D~i+}dZ$}-M3&N4h_Hci64/I*uG;ʎC*emy WjdSjk 98k :ɭw'ݹzv_2H +L-|rtщem\W~m~Q$fWNSC!5FG7[kB '\&M>W`|o˭w \MgAIwX:F=,gQ%߹o0VX0uO%yߑT}GǘZ|RE4.?jv KJG_ܝ?欱z/-|?Tb?_Ł\E03}x>b=u;3x><;^OR}1 Mr3Uv=>Uj떿?z=vc{jG?Gar?^ Q/X_돏?^{IBҴG_޼AN┏Sj+\D?ٮ( O~%lO̿%GH+ȺTql޲|hW]$ڙJZ'f' kjo_a5FK)$IOqZ0^ ɺVq6=d_!Əzd^X|6|c~nN/G1 h %4 ۚ |hUO/7{8sv(CSLkje I>,{׌5 T#{I9na'į= ?44{-aQS"F>,GU CNCAk)Iڻphه`FHK Y-@'-""+j=N?,c]@Ex­]*X^Lo+ /:uzNz7u \m`&uE9˾ 8€cӻAVIgw0}X퇌wEc! Ɠ38;i'p Q-b wO:Xd+E9w7D KmO^&sWzX&q*I)G/+(9-7[: X[.q0xn*q*H4x=ΝtDIƂ≫@ u+9-N_˭F>\CP)tc+P6ï_4?V ;qm#^@qS,:RH w53/ *c-VH҆r7ģ([=9:m:4nE-"OOI- ޣ]\9X5Z'0.z-rLV}jʱfաF*G읱TeE8޸fP{`9Os)宩$A3&hjrno˝JQAR=<kPP\Gm~uʗW|i\ˈYyVy)O,z|=v4Lj~I+4/qx`tbYZB )itj?6l%yTr~ ZGHfZ\,;w!m#tٯS  F:T{@,F5 ucTVч6U֮5Sz}+MEN^a,ޱ~^]A-Gg6hV}54_m{= PuܸHEHPO'V![+KoS2h=1Pڏ奵ҟFߊ㎹oܖʟM!>BÖ'"M3_*9qx(=K4.[Vneӵ?c͖c1j7>oQN>DxQ_a41>#|D˴ٮ69L'a { _x54?AM'G]NH`x 61=}6N! 'Wbd+WeeI"ȏB^DO݀Ζc~' ]8Ӯ Ld:l]BcvM@uO%YFxз!ܞ`tDq@Sn[h "SK[ST 5?1lI(?1"%i\f) B+|VFZg2 xbp 9Vo_ BIæ^Odђؒ*ūOluLUz#r )58t2+ is42@F dY#ԌĻX0!d3F);W. Yה-Ø4QcyGWcɤgqHJԀ0Z#T0t٬{hko+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb#`hF=/m",'mx=v;JA/WPzn@Ɋ"9``>#\+WѾg$91]9Snz`;]z$52AioQ%R g^KOw-SŦE^sK'@,zLf)"/":-tQ`voi^?a{5',ThC^9­OقuiZfQr:9\i=c2vb'0^[t~U}m7};З>8t1Ⱥ~! [lt # xl o+}É=\pmMq *l5]I#ɵhEzWr} ܬgjXskõkƥa#-KSF؎ިVz;.vjeӶ*–M*f]vX8ҴsbP/\UaJ`Vrc؅]LjM*+zDm w*mW Z)I^@qy#Wb1T&BێUr^q-p@*یoZCTzn)mSĄn_ S K*E{u­^??77mlLt:@|1rSШË/qEtmF*UZcW]y1kmLm\'@TY̱Ws\S7e4*Vĸ [OfkL kR>lb}t! A ml6QP߯ f!NQqiƵR[4Cݏcb'FI_Z }0N8\xe*rpRmրE><\$" .xQAx9LhFTpE DHDP\ooTEO;$|\F tՖ$l:`8Aޙng 2ǥ>x}@Jĸ̰z=TeFJ?,|eZM^;V0GO-G Jŋ/ {]4p]2QМW'&1!M0TDaqI{|Hգ*z#DJe7 Rڒ_p2c4Ӟ_ \Eס8F?Uj U <&$dwbb@ aH^ .- 4F;W+Oęd#cW `v*0+XTҪ2MgrA*@`I';7]XY6zcFXs^N=P3(f })nfsR@޽n􉏪?W@)cğ`9NOCKUpC!FF<++O>^W钻 Z־':m6A8~n2Uآo`)h`郭+xHLm:jr/ӎ 1A vbeGS!}P>x Rj CWf68SlT=Ǟ§` E]GDDDlb.z!Vs;\ 6ĜzolQCEkn>SNqJ=QY!qdߡT'Q,8HkҞ98H4u~8t=2ԡM~XVOlUx´wW9}iTW쟣$bG pmN2#,5ټ0M*_^ 垡}g:GͳaX_ (nk(YʜtFlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v^*4{XtLʙ%]3JmJ7,%d%!ZvS{`&U#3ȣl, iv3W !]:etAN.mg4;Fq'$oVpŨ: ,`Ţ1|qXЃU=\pxdY$Nm١ib5$jbj.g.w jO{qp]k\|{EM)K]l qKtiͥ6{Zei]6ŷxǍ.oLql{*2w_/U_K?W~Of6׽8>[[<!\mz6!\I7?}Zd~ lj/%xH>|?%[c 'rW}v޸zI_&1T|7v'r}aI^N[~Ky`3N ױ9Sw2⢺fǗu+BrrO΃#Iv'Aɮ^sL&N8b ػ}xhm) {bWr;1H:ek튝JSJ70M qr T<;OΝlAv8 jJj[0x~BR㷆(5;8ӏyi\FqFW >hFGͪ28#(QE#O\c| ]؊[q u\k>' 0'@i8Ғ0D$c¾]21Ӑdp ί,lJGVKJ8Y&rZmc$!m~T@X82IYK`,{EWY"V.P)#Wh7a\.7?N8S Gێ _ˀףSO }^/>kplMDcPwGߎ<,.Xo,oSoݏ Oyz-5H@޾XY&iAX㾿nkX~ƈmDKD8zBY\Fݭ`zrζ?|cG|\|S}kՠzYPhj惧 ͢r<ž:3!?.yOG'Im鈀_˄XY.CG\>AӅDF?߇1+ڿ%Bhmm  6 8@;Ufq?Vxmo \ 2O^P%l.ã[??Hx hU]ɛ)PմqzC WYz 88S4E8 _8x|㼩'F?uQchK"˴7'z?x{iPu?9E>58<&'_EK/J}?ybTb6ý/7W R1PLS0JPzTZ\/K(w8hԍÏo A=2l>5uFI \]Y~\%RVC <|+'FU^6TcR;o%yxxdD)1,2c=9j/#GB'}r"UoceQM@6#[VtY܃ZVdN[x C'@LD(72rףod-T+ABt0Tz PWHsA2wma+cy/E":vw7ݑ3FcCm's]Ij{aQU41ɶ#WM|RSGYX3riwl]߮>tG>JDBE7ϩ)<$#{^x`Ӡ5[@2)O[5?ҬloQ;SBH)$2($]TZ*+6%Yoþ{+˦CTuǀw0bCyg~ b0ʀue)MN;U 7z;ɽ#CJdEY>%'d~i ~hHR~lSUPVW!@kCJH“m.$HT-ͤS F\@#7^K; gFwgJe ~>&ن;>20qsaLnq( M!`J2%`oc~b݂z+~xՅ)䴡y I6PU$RtZabd OJ^h@ ZIyx$kn)4af^<4O2 m),m+{:Z[%AoD pSWsM!Qƀ 8x؍ȱ F\=<j&taC̑dbX pWrMMlyRmģ얋FHpy+ k%]BbqZF>/:G|8c7&)˛NG`zCjOQ%U-'ymAN38if cmdЭ@,w#J L,-O1|K*9~31+q1> L_k+&,]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊Z]k #FAN"=|2rl -./4)FA- Gі$4zz GEujG0K&;%kv;R/ NgeϫNYjO϶C+׹~Nj;| @QFSa- f_ W ]xR㏠QSl'Ml LJl1Ug 8m et]vavzS#L9NXDt3BJTug2 ȉZ$ۑincqѪ}޽ qw]_IyâĔYb; B,bj:-;(+K8,QsmuaCRiƐkGŐ~":,`3?مĤJN@0Bm@@Y1YFc۶*.FlXor(+cK}V1M6|܅Œ>%ħ8.}I_ -yx8|&֕V;CT9e#>إ~UbxiAB1E,kak;[.ңacj⫖(hbuqU=n`[ň;p/# oƙ~5:6OB;{(gg)aƠڣ"GFY 6~,Zsm7JHȑ9;?1A @PS#ntFRZmI 54: WxЏ WK i aQNC#*qWz{q ޿z r#5ĎVԗfc#r0O@Na鏏;vǽ5-_xz~_ýޠEW+޼yf-铃c}]FZ7|0b=w~~{p['|0x_ýby[R;z]szdG޹|O3><{w>W{B =7DnW|0b=솪 ;w:+jcw4]AOGl>0OuSچ^>0_Gki1~G/tcQxc{:u?kOl՗+:: L{rj9)S'/it栵4\hI~s~`bՅi4{cIzJ>{ޖYXjT⿢-%>/`Zo}HiFHdGz>z#~bxrqo/|3r~g͡[R"rޜtI%鉝֟(2e#?ZCO)%7JDdRv^hVi1aR`i<՗Zk;̬ Hmʲªp71|cޥܢRVfԨ; XĠm@7Sޏ]TƮ~0 TԌ\v]@'#z|Ū;J/MǗ?tY RzUHfZҤ GsHd(: )'ݏhHko]f]:# Y|rj'( t#~`/5NaWetP>X/ źoMJqHz(wc^!A.&f"{|#bb/N% j$ξad;(ȴ+A^#~ը#NU4sCSpd{0K#bYBN?z?4릵5-?V5+Gd|Rz&:jq?.+Y}c)SAjߚu3W6͒Ԙ|_Y4'Wo/;iFUԖ榼kHXaTꤠ5uQqQ?75nWf>_dbuPW#'ri nm毘Fs_+2Ws]+gq : ~1%5uM~~'L5$M枾*;-ّb3-?!?2C4؁kB7RT&Rc!W^OW)d~S#cS.mMspҴ NEHI2ޞi_rBdzcQ\#)D>nտ4J6*<|0ռh+DK-G9cpUi <ޕ{~y~Ѐ=|sޝYyRݚy޿.xFg)տu36?C2)_$xP`e/zct!.dЌ|Bè\nƟ!F7(Oz=/\=%vF({9~H_ vQRDWCk|Q $aPN鏈OUzjS\+I ]v,|ͨ[*9&>g˖b]~/=󞬅}I\66Ȟk+s%Ly|bwi:څs)ކu_.f-$*2QͿ6'PcՋy7!-ISAJ*E4 i;u7vI\<vW!+Z`9@꿙K^*$H]t4~cͭ;QdԐܷ!(S^7u>kյVvZ~rӣR> >8c5֗c? %1T#0Aԏ}+éf_\8ZΜԠ@cޗycf?|}!4h;kZ \QBWݓޓ]q. 7oN`zS5KtNeAVtP+꿙yR6vOoPE><{QDzndnKrEF*^\2"uuգP+:J ( /+GkPzSُ,eer[9 j}gP;?OGNl#ӌ)-qC!3G8 q%1*A\J+a"󴣧LiV,xN&9%^XT6Tn-" r P7H]&%_܆ĄT@(6᫖c:`MB.ጩHN`",7 zxw/f 狍{0S>r!PG\-VTǡr&."_?rk6>wy F9`z1KˮGtmǶN&ΓqnҪ7n} i۩Xe:V1!B\1ڙ$(7|J['͇vag4-v;3LpidAeBdqa@+]Pruj"@X/9=E|v#x'qX{! Ol 1}zxW*qdfj*Dq}{dH@aߙhFnn@+ټ F&^8UeWL*ڷ~ن851SܝӮ;zcj4"Q\!\q$y!2[*bޟ; +AשTuMF&3`)M4fHZcidrMBFؔ$mC`EC I֟hUq琏7_,(O-DѼk#@Vn!m^CA=6@n!,f 9 E0" Kf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*RFJFi]ڣrPB{Ckm脞 ţJ3"9Z$^‚N)/%TvL4H y0o8]Dn{U6Adtߩ";,%3'K]2C݋Xڡxd.1G*TqqHԍCto3vߦzA#DbFPL rvS9ߧ-R9>% zfB=f9!GKtEۮP l{EM>cnJ`be‹X/MφƸfn1ɷMVGۜP{@ C =lY סVD)i65 FNN&&@-s<_ W41ȴ|ه%=|FNwٲRŧrlZրfFi 2Q4 ǫKDb*cKDebӾp(w*J7ݰuh̠%@ޝT;j$#(XžM!hO P7ha!8PSXͺ4/LVJ?3Ozb4Q\Y9ɽ{bpH9Tsu! ψ_Â⊁J|q)x? Pwȹ3T.TnFFQ-ߖNAɉUE03v5 v[Ġ)] 1ChǨ2.@ءClm<26'`F1 \T`Jߕd րx&Elm8_PЀh{[PZT8EaA&%CrEmBapzSait>i2B(E0 &Uvu$n%B.-FzT %4ixض301}ALixaxyF@=|0ǣb^%u8\Ӣ 8uT:?8NRAQT2MMyEiqwǪZe(n (I>%[£A:cPrÀqK`vfq|EzᘼR8~#}  x5O^FJ`x`{ \/j0Wu!ؤETpiQ^ ;dc}UX?PTu 7 T*j阽~!|ɼ]MwXm qrjæ!]Uӧ|JEzJKYN")\=qVŐv9wPX|'$"Ooi2%iV7C;.3\%BGK+Xm|BCT'OQV}cx\z2f4 GY"!0ra/h~~Wb|qV8B 36WFOn-O~m[glI!) y/MKIjsQU=_K?TCEoRecqh5̊bcŸdBAB~,24;SB'vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vZ5v]#GJM^m$)hrO[,/-@92jd>Na`QXUL~=0S v)9*Cחa>Pӊ=[J;|ܧR}þt]Ғ\Xğ?!*pL*2P*vt%ip19o=WAbtSsnfȵ匿 1`S\z[Y#y{ӫO}),ssO[$^Jm;)ɁfsUT1N(rFޮ??->7ՠܿs4_Ϲbg<(c>igܯyJv`)'V~GSϹ8`W̦F,F> ϹgOx2_}%mo=QWK—s}D[?~|91VbC2n*Er q˸KXOV:} K>bC$fb^i} :|*/4*^.c6p(>xdF^h[)9(x\5&6 XR;v49yyéiM#0V#/6ěYky`ӾD's$qɝUǦT&+A2_E1 Ƭ:n+I (>5yђb12׈'%Wl/jTO_ԦSU7VЂ#GUNJC3NJGo(ǎ]>,Uzq`9%.K,R8bEH8x]_$mOa$ė|tF5|{;5*a`㗚+~eRxF=1p$ʚYR#3,$ ŗ|^GkL)yėyTK[#늟!b'刜OQGݳ,U;䄤]R pŗ|lGѐ0I,vH>C2A˩)'ƟytX(&'&4TT)LR;sKOJE,A#!lL|iX8χMT1*1Q>nt$ǕS/5%Ѵ~6ė}SGӓoJ:Kǟ|~Xo (A\.s=d.x1=$XylgQ)9PF*aZ`9$,4Xbe:`%SOd2!0x,yPh"|&L>$ (}Nj17a/4*Qbz*ė]F4q Rc,(l#)1K~Qˈ H6/4Mѣ;{`I-@H'h@䀟Fh<6RGJulA|5hxקL_ɳ:gm!V 6߶>h&@\kU}X7yee4#"L&$Q]}VC0CI`2}p֭ "zPҬve暙n]fQe1ۍh(XȘKx'T ⓯tOq!͏AX'ar~|ѣҎdRp?̌7}=_5i j>pLc^i-xZtĞ˯\PgM;ee+ci (WGQE1tBKm!=u :|F>?->ƺAZӖ|F?rZ}XpFxa%iܙhu-oҕ ]Oܶ:DLIp0, JWVjlgܑrL h|ztǵ [8Z}͟ n"*ԡhz}ؽt;t`t(k̭%'q=/)VR%9h#.X8,t-:#E 43NCGٕSqDE26#IQ4,7Ɇv+R\Bi6of }rc4=1U9t DT#RipQzW\AaϨ+u=8f($oZ{(Zvm `&l7ƖQfn ;~ޓI;xQW2B}`m Tzŗ .RU H~J5FBI?ZQ7,u,ݪU5,A\ffH9&I/FD=&),JgxWlW7:D<&;qB}Zd4rA)D^P>'RJ\&'-9DRgkөqHo=BWzٮ=>9٬,`xl|>vsS *ApI;tEJadG zS *RJ1o g\row^PּMSLL&RF2MAJZ狒kC]go0`<)&"PWcfmzt8qJ: ~&xsyY/n'mR6:]1/,L FdX&^uNB\7eɎE|jvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*r&-]T#Zr\I脻R9]5T4 cFGHR;}1m'Cʘ8lk$e5W UTUcPhFx XƒD9#v1[3 7ZbcV̅O& Fʱ8#l4K,lr޵kq4B@ģrqR1L+M/TYDYS+\TnO߅ZjdHnb:"*S6ةv4 bsd!rU_13j%6=03j9'nح._l R*q0cmZ:VڿA]\4*p\I#bPTTJUpŁh1bDS Sn[#C\K5SM邛ap/6vPQc }2xnE(@]sv<[#r=]Ya=O|H|C[Jo F [wwamlGgBzWbP1 .#R)_HƟ zS =jnl <5,z{Pwupztz;P֐ŅދպO|DOE Ⱦq]mm)70 Uz[)o(h;HT ևg+Z1GWJfQMbR-Q0h㯉*IПLP GE*Ew>8BwX*?銮S\0 {aC`tR Rl7'.$ݫ2c]XZw 0*>/J$2Fci$4.Q æ,r"u&'C֙,?m*67693KC8 [q;P쵧| q"8jZqGu؎ٛ!(o9ٛqvA[)2(Ɲ69%w\*]]xvZ6##e];=)vX?S^@A?,y6S^U_?3^Go*~H.i4y-%OwMO?/ZJu@yr%iu>s-=y/ l~[j (SVO$徨zp{O`J%k~[(YcgʼiՇ) [O?v伨-ʼF5cc`Mʎܰ_jݣ_!|f?hMܚ+OC/Cfo[ 1_?{V7u2Ϙ,dr-M`=;"-~.OrYxd';O׋ vӴ+Mkfz̚{?VUyǝf̊z_G#SS~/߃;OM)S~dAIKp-QҎ~ϺJZm/Jx?/?柒섺?,SũͩD<| w}Am\ 6>> &N,qQx2Z kI>q q3?o?Il\}|-CtwPc=Ƞatՠw~GE,[P6?)م>x<&Ot5P_Yߑ8wصBvq0W~}QR=Jҽ_fɌZ7*$=r̝}|܊ /%⩠=q폿$0y}ylA)1"߀=bU强C lU%Zw(9/B>GӞ(IUI,(ې`@Io./Dc3v~}8r5jB*Ow=cOr"py}ry.Xs~0ʋapn%>85|/<-?ll#N2vMqbz7!hJ9}>{'wXtߐw؎,[^{R`n<.{\!b8iNR]$4L&A%>bB\}!HLBuSCM2{p+?柒iC[J#LNJ_,*\Nܗ14kZq]ꣀfjR ͪC | @_6[Ɲ2h;mE+ǭϲxI##KHՙupM]! ?Ujy 9;,Vţ8>0C8 eZS4ӯ^ v 4oR-BQA NROŏeQm4BD@#]qfU*Kv)#?Vz წ51$㑤])]Y[Tm$=S'sқ:P7.5Aȵ!Z}J8' M2 &퐦%yyi#9BA nyB(#֔ n+іHL#Tl:eP6&N !4uiz A Bg Tw̄v> @ۦ8bbP8@F#j0*.IޔJћ\eIw>^|}o\j<1Wm zkQաb\ @ʴ`!O4hv?~adhoGɄN)I&lo(") Jl5KcoLUEtV+5ȑf+8}x~6Zw g~dZ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ܢݖc#w[3&$RT$Pkۘ"q7-ضj 5+߱d9~70bov~Cz51*:` -pVy9q^_$wti#YMYwG'㉼Tdoǒ+fI)選4˚XWrIo 4ث\إblUzvVoZt* j銡n~K_v8-y7L[SSx0%%Ǿ\|9k Hq5=,Db5z;2{ZF+Rh 뀶ĂwhdHq=H9؉xp8.~ mZx|Y"CT1126\Oq7x~'kj~,tL6=A@w=2%_-M[_0* $)ŜMJ8ŁÝԏ`Ϣ̠$}5¡ 8  '}i%[2䙈u߱/&$Qr9@{ :gr.z}AFw$x&hAO$]lc(ψ3q:֠xdGS޴ w6p3c†Nn(ewZ$aL1Sű[[ۭN#2?jPkn&2 Ѿǎdʢ?Zs;8~J=zw*s$J&:Ix1 +˷*jJξ+|y>[{ˣ6+Cps-s5ɐv#\:J8B~'3Ë_楼*+):]F(NǏc#4|P8(vU$N)\HOz,3W:C6¹ٛ;;-|ze "\գ܇N&Q KxPlڂ۲0HӨraaPi\e-]-Q)'_TUn>).倫tF4e\B(uX/ءJh}٩88qf6tzјQՠqS$ xۦ[5v=@E5L/#Ts=Fj+4U0u]_rLrG2M֋h;109Fzjb"v(^TdڸMv}&i30\_\U)QRqVpS2!+9ҵ ׿|qꑗ@q>9x+`,9,2a1D2 `lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]4=OR5XVi;abߦM]va1d85c&ىRnj?÷kk.َΞ8z`r6?~7lwm&O4 ;S:["(2sm/5`iT<*lȲb>h-Jԍ3)x|ucR!wCIVnOJ[7V hI~ YM 6ƒǕޛ>)ǸB?vk'rAb;N=Rap/?oοXy=;r?onKTbf?:yi1/A;#.??1_r·?̿<~kI[I?x;o/+ګO)bCnh4 SĞ1ޥ+CnOo(l~%x(OVoM /x GߒQˈ.zN"\  _[149qO.]&<#_^2OǏ/^!NOJG|E/:p]ߘZt4+Ξ ac~`=Mt>M^r󘿜fǟ.j*΅x?`Ƴ qb /Ǎgq8&XOE[C8s|VXZ#./Ny31w=2wq/E?"/^Y~ot b\n믦vȝN/EuFn?N@ʎ|P͚[1Cn#oҧL(f w_>d??Qѯ:zo1.b|CC4k7 >e?-z5h-}ZS3ic?Cv?oRi=\z7}}7@ٮm,iWo)3;MG?,hm+MeVk"罹|l}Z oMh,>lѻ[;5tPޫ5Ǎ.||}Z 5[k΢7(-_6v㆕xo)٢VkGݯ#>>O6hg>v7K/)q~o)t|WeukPGpxX= "RcpA#mLc]t|QAR=wCű.3Wu;-JTOl)3 ;?N\}P^M--Gpxh4`Њ\[&o]lyDmְ?'p|ǡXR7r>.>}]ˈ._ O8߃Gz^?3t34rA?X̝ؒn%?'ߏ.lJGU_.+SC~9cʗc?wІG9K>wlhmѤ?5v8iE04i6#M T}'%Z[ͱ["dԏé¹Vr2 O2(Pא ォs " a0 R")N[Ђ)`[A28-6i_Ixuр"u¿ZV.W@5ew4Pj|zInza֙~!T^JIy\\ZIgH#8U6$mȶjEJE)ezuuȬ ee&V8~r*J" E|hN$դpX_򎂑WU{"#̟9Fo 좔uvKӦ^ K }I> )Cc;A¥qAN2*ڢ8QN,o \{xfe +l3<-5jG&)Wazc19[zdmQfhh;V䩊O*)ڄN"NGKPĤRZ# E)L!~Dz`+6,2$$2 QDN{NJlwJ}qlr-8Kn2!;f>[ XQR9k`Oh~c1yĥoZj.艷X]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*6V.ȳM&F\P}(Pg8 48-]S O{YC0 ].vH$nJ˸ڌw ԩ?1Oא֧\K.`~U&y/0.FGSF}TI8.JS]67n%n#۸۶qY1/VIsa1a{Ox >cs kL!`wDcv`li7ŭ0!fl1n\9ڝ24HMGT}ӉQ[b6l{fN͋M\]*fx)"DW' LZ^¤KCtS u\&.Ҵ[Ux6%-Rko0*:*?Myl74G1TD-5Q;v *AM▆5&jaW^ )|Vn1W\qaMw,+zd?u0Wsx[~2ȷXԊTXmLw'u 6گez{bĝ@;}9Ys!>&ZVtWXhQJ떞ث+)XQ|ULV(R SN8&tJz`!ܟG\)\Xn\tMjw6 l< *\\e?m7aCuTE0`!cdjjlO|-*}=دZv1Q˰{I.)*w qm7X|O=h12P*vd\t)rȵI;tf&JG~X۟{ i >6ݦ7?|ʓ ʳ#YEE," Q~\'Z]ie8 .ApvX?eʯZ fzV}1wt*ϸ.O+zq ?!d|UtWʲ؏F6WV}Xf<*ϸ-o({\?2̇/򴻃Č>+K7p~]e,#?ez'V]b=r~O򴻖ʱ#aq@yZ]Y8<+˹df+ +{`M/#WX4ߖz\ {(WC|~ Jƻ +:O$$_u8;~ʎBʫe<$c=1*{`w%_W /ނIҞW)k\cKNiv{EC/Ia4?2Ǩg{=ܿXv^IXqR?ZkMvB宭 LFKy2'ެIq-bq` '垳H9fa$7冴➚Sq$⢀H2U/=i]m*[{a2#֔C=$򫵶ߘ8?*[}%Zyw#WOWW/&C]D\e|w2V,5hƻ8$Tv/#,.z q/8f:2VNq.4,\ADyKV\aGPpx2_<^%q=UDC p 2_L^mmTl! Ɍ2_L]>SJyx͏>/5t+q"xN'Szt >SUIGiȚ_)8]OcaiȚW?W2^ {OePtri?$97{)w2T5zΫqAܿʘ:;[~צ ]Z/ŇO sL]bEmT|w/.D~_냥}e܏L]b<7{7޿U#k=@uiV\xapx_<]b]띭[5Ar)l~^kxiN|/.^V?HUl?V> xcϹw ?Tǥz`ܟ,]y[ }]|+ˏzbp̩]M]l NEj};Gz|yeTt޸|w2QZ=r=eܿX׏pW?Qq||/.}_pM1w^4Weasl^%566՘/"W^aOD⟯-Sd~L?IVx f2QFuG1=$; CM4+øF \-/&^'rh 4=~?Q_kM)$nC$$=)lYqDʝ[>-%YqrVjK__Tտ#Ld*e?[~%b.ZOƙ+?-%XrԺz}e7:ab=SPH{Lirw#%bܪ?+/Ycr ??GZU}iidNUm*/Sӧ|zH=Oly!bi:c{ {3;sJ}s8[r?0r|1?T~㩹]8gz?sQO^FEz89lrəj)t*(>֘Wܷ͐T %^o(}d;d6?&.fiH2'L{d5k~Lܷ\T1bEWiһasܨ?& SN?ۀS}?8NRIC W\RʃՄV]}9Vv"hmdi\M* IR_]Qlp s*O9y-"ܻUVsD!Ab2)ZΠڅ^5]jN/X$kv=c%TW4]U1RhƞP$fS)qA"X@#xc0Cʯ $͂ 'nt7 8C߶BҭkQ M0%5XwޛbX`Rr ǵVR$t1&_Hflݱ zbٙO?IG*b+›Ț&Fqd4;{P)Օ'}%=9AIl ݑ[f#]M6Ix[b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*9+c[ d#})(w# ҟrJ}B֌]nj8"Ԍ*%ن+cv悤v|F\`MzqC&GQKC?*qXؠ9.+NY0pˉ*Zs'#m h3,4®-** {bAH Up&5mKޚRq|baU( qP}PqX-C@+_ w aVQۯ9z +N)O(b01D|n4e.kty_$r@o mLze1UPǽkyfhdLG8x#@7jtF"VO[`ȶτKC HFPu''n#X ()u[*xU?|03mT-/b0 !hA?f;ajan8\14)C lV8lۛE{ !OB;di uv!Oq5EKu1:A^# bpzܵF+D;${L108#Űi!{RBIad#X9Ama/ ~%wDbHV=ܑ߈R~!ɺL4bA[zRmd' fOXe]vL|SlBBp:|fbZb\(56*&$^w B`7 W"bCfqB..%kmv>d&bvJ(x,;WqT$JeH^=0jb1NzRk‡13kg®۰`b=)evTNQ혘,?U`߭sv82jvژݕ"={eY 2F]$Џ֫FHBP/[s-zʇ*ɏ]\Ni 4;M zk֛b`urC9j*=vYn)v5H8*㌇Y៯ǾnU-Z| Z9OB7M7xS+/Y MG8P r_1FkOl*b88}ftf,L$WI@)=,m T[˿( UթX|U_ˠ^E^ͷ3<&Za-~, HXӪe dq_G:^!{D2Sq2)R hk5ŌU2w e 'N%Zsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Y%*—`ĜBg?W݉8י-i])kZz6mn;\ ^m qF'5ŐK*}VǶ j8$u1oZ}8/Î|NuZqbDOr8Єu?KuqO_*= Οyo E_@b3KmB= :%jOMOWr$\9_~kGAN_Տ>9Gf?5#S_-f%CͳSIs\?25 =3^`# waW欣0`T; cIc%CߘڊH@ ?\2uBDk_?+mAH?1O?Pi?03^<>r;0?PwH:·w?>9_y:n>qޅkJy[+#S]Cڿ>9GT;ʠ #؏T;_u O[a}EzdGT;?:G\rQ^nW|p/Go>:%Gaʿxo 'Jylg^q5)_<{&?*Fr"~cwKTN9bbrCRޣ/DptP2?7{ -Mڱ&qC{aג?+ } q=):,ie;Mr?G?Fߕs 4;{we4{}hw1Fz~nԐmͼrߏ#˼+/E6,DcR$O-?P;}/|`/D[0[s_F("f! MlW՜W)QԂ3B? -އc\z3'gwjy8pj,'+n`p y~cs8?5$Ot6Cqa_?Gdϼ!˕D1?M??2y+Λ&#ncV_%tޞ?1%eX89y|_ "+'\zRE%_׏ Ob+'TI?(VE)ɦ 5IO?+VVKQa +K'?Q,8?5J䨿[cW)VUˤeF<c梏䬭΍+YƒGcQ_伿?94(V^˕1G^_/mǤq9E^__E ?ə{{I% ڕrCSLܼ~m7n?ۍb̭֐)F8?3LʷW 83%oW>?bo~U$]+KJ~5c1SE:؂_?梿['uy~tr~Ql>~xOդ v~cz *ڶeu~y̿޺Go1v%sޗ#Ai }?6{Puw̦GcvARF^^ty2H=ZaCVQdžK^IG=Ke7KC9sk0eg(ۿDr??:Y?Wy/G}eo~g?^9( dr#>IGw,9'9w+'m۹2_=Ghr^-ϏcU?95 A3ָ?4{;O5?D?z >T{5hby\G݃G~pj]⋯~h'&=dڒAb6cܿ=J68?1jgR 떱1r_=G{sncXZ1ϒ#ǽt Q~?+n`O4{Gѡۂ 䘎?7u4}8zuvytK1QDi_>Xa^p$02?)K{{^*Fl+, 75fbPXϓon4O-I!$PiPė3KuO_Oe[$z:`@jc|ݜb"(tE<) 楾"|N4YU=넥S_M+_M(Z~!Z*JJǶ5" ⪅)YǠ'|aJ•x)jFSE^تx5' m `T:mE1'iwO%TڟN<0R.,)'+eJw6508WAxgEr`A_VE"hQ`0, i,MDjlDw"MܯEqHbƙF;Q!i!*spc?5" rO1-O(FXƔ&ƴ*|1̂9Yqȝ[I|Hfsc JG˞_w^܏׉],沰< ڧ~y1 Zޤm`(|zH[K+GZmF+ $|+n틯ر+NSZ -/#>mJ{N(Tw :)%*qB5 +J|Oa䐡-z S!›LOl!Q')-ZJJ-Q7sݻ I-kUjէP;`T\qWU•Ǒ`bRwq2:`p\@LQhភnQH`{!.4"341/QܞřxEcF+SW@UKWrE2qDU* j bSPv#)1 Hux]l(nkBOey. JsQ邝ؖqoŪMqJN劵kMe ~[PE?R8ױfbL(o3!هޝ+v8(k/})v)Ӯ6+mO5rPP}X$5) x߳c]†}ר ;P1qY"J**mh8{mo'~thҖMP0kU 7L/ ycCz+j5 - Pz|a\q ,em#ę6t>1Dr#%hmإ= xdK ᕫKƔrV!&FQARh ڸZTq *Oֵh1EV0Zt:l^VA'8w PraQT|E- qPہNX'ѕqj)REixbr<iCCF~x:T@p](]pJY/ʕ=jr\Me,:(T{pC1)Ǯ*:Gnj6njs~6V=%3C-Col:#-B>Ң}d~O`MŠ+4RLx^ >TѶ#*N3;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊%G 'dz&d7]bofIyohád- ?s/PJ䪛֭5'XP$:U' ޠظV)hַ 3n#cCv8yhq2$&^ ra<Ũ>#1y1efTĹ˽Z+&l0~xE/y>i}4Z+ da拲?gX>@@G4]}|?4V+O~?%RGݏZ+G||wOpy墷UޑZG>f'/堸^i''<4~V+O֎vsnǃ_G1Uv<+妓sepbzqo#k_ V-ʴG>m;Q~-򭴀6F9WGyZ:H߃拱d44WʼOT?G7yh~\*k4yN~h[?:CXǛ.x~iVʷ?櫯gƒvG,y~< H?Q8Uu\_򭴳8ds5vUpZg\*G"Vh48|p?/8OzV+L?/gDq=Pߕa?5˰{P?+4ε sڟE('0> Ozӎy &z#9cP~G؊MY_6E?e&;䵛tv}0߯2W )a=6 +R(zVnP|o$_~MÑ_Ǐ7ۍ64WS?ҢzdxJ?)%18xo ~PV)cѿ $'FPJOr1'%3{_?O7[S?׽~'mGTR)&e'+Ulw Lܿ71떾l}NKM\=qo!?'%5Qr7[$_DŽRX!Bw)7Z~@_˽ ߐF$\oq{@^uT\pmvW0T5* Oa<#c`?.?9鼱<E?+D\WuZ9@ pO䊛~EF:j{f[ukTCA7AF~Khz?Czy#~Dˑα`%殟یП/ǂL' C^1`?6/8BO}\RpO׏8a`݁ms7cy!Gy* ~/0? e1ޭ**›Io91D>)1{%I0nޟOQ6T˿7'HޟɎ8 Oz$;S/Mgt_cT~G}khz~HK9Z9=A޼~Jr`mcP_R(TJ{jRTO4}˙R+sOŅ+ h99/}=M̤i˨Q@َxr*Xv2,=VkQcGYMG3_4\_kM裢_e5ς,+?M8{Oэb'CG/Oqc+ӌ\n{޿C.+_4{`T|sҋ_)UsC]O4#_*sBi_o#/doKL4EiKRcj@yԚJ4SWZ;"yvpPM!Gi`: o_?&|xz<) c#r[a_\o  /oW~9oNީǁǐ4UZGdgIYNbʵXƲv9&)|kO˦2UoL ؚcRj~t2JZ]Qz1P{Tc 2TNTޣP Gvufv?? ^FKh녕 1#:ё^BlkC^) '?~XarjEb-m8б4 ti/5¶ӮJI)O B~!w2tcD.ݯ9psJ$ 5-> &jzHP}nGR+-;qr\!PrkzJ)퍓Kizj^p }&Œ.=[28^7~|,#^"#(f"V: dk;Zεtnn[n7@q?<;s&4(ݐ$Z@Kng2Q/oYc@}ArVݚ E[(-SYN#UCdY.76*>JukHL(uH,eC5@$ W[br$S$NٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*6PN[EZmM";uƒ1TNP; 늨I(: m]T '\)N▐Qܫ>O$-V;{d`v )VhU,H qKqG d\a.Q|D)L%JuE Up4 XP/ߥ7.9 M+KGFzR='nV#۾uęO-o\ r^p0ޝU2wo^,R+a7E6=xx8|X*7rNǿlUsASb OB[CVk! /MȦ w$튴N]*)c#[3r? ] ,"96ٻᦽsr4F>MXqcR?V--RJ^9?r-p?*~*3'8O^Az>DwUc[#[UqլQN)ZqPZ;3GTVb0\_Jދ>;W@ѵ QЃ+A0*8:bVo"F9|-WzHw{6ł ZcT@&ap ڔFm!ox[~ぺ׫c.Ҏ7prQ&#N8kWߠd: pw;kOlV8sG LEVb6ᔲz&?ٰԦ"ej7<aAZTx7#8h5H /eҐN(pO†s|3*Xio-Mv[F$M[]|#ͮ_cVP0\l(iw ;uĴ8ץNx., N U\ .!B8qu)  ,mZB|rT2 w8]7K\-bD)k&Mq n mlbHJmqdkM~:P) y=2;Cyj5M\pmz$oE*hhx%9rUB TӨ}U]ʧg&F`jHDd']Z`{ΐ_Ė[@+l÷g 5qDSc\߫~U``V9-|VMk_{%y|X2L:gWyG[(훫eko|*ޣR!11 n3c,CDbF,x[]:W.WQժ`lp+U+s>a;8%e`œq>,(=ZbH֘ w[C"BS9PGOq^L1NҴyglBUj }|P|'%&EVjO:vaٍTSg /%CKKp99U=B3$WQ<}q^RJS`ژ~b8Ak6M7tqe VTEߣV |R[a>|=BR{bj{ 5;9|9) ǘXUopkC 0N-fױ.">g]qj)(܁墥kd@ -YE#1ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثU#nH23 9:<·|2/\Ⱦ&؛I5=d3i62h%4$2Y--%~]`}J+.wk y&[8d{~4w+M ͖>{3AuZ꯱7?NdTFҭX~fJOW?ux?1$;yW'Q4;?Ǎ#Q&u?Fo6ﱇ?GZ=_Uƶg_Gfo8\YY5W*Ɵ/!OqGd~c)?o^8RoV.Ӛ 3' 5̚o̍X,ynpq椦:lOr|u'U$ߚ©Fl)G#rP_Y"?bo9$%&ˊ? YI ߝZ4"n+#Y&ֻ#ݔS=9}&͔L_ج'jvo !(M]P#6)[#l"R$F#60Fa ܿW:0z;c;gzr ͼA8违 6{El8tC x6긠EO#o&DCQALQOёo Ԁ?c,Ą}R5J@^E+PuДPYM?朦e6J>h[C;14'Be0|tw7+& LU|1w!_r I?08q~~ "w4\9ݿ qGm?`|w8A!??۔|ks'd~xw4W{&q4[{o(Bܺ?ȋmfx2yC(krd\LS`⏛/Ύ?_u6NOcD? ]g=LigOl}(TqRo14R-1sMm&#q4寔)2;/r? l'ۏa?=W*d |v WKO ~ 47?Q kOr)=]9-cߑ?v~p(]JZ5lO}> gZz bVZR}j?qr6;]?vk1IJ2[5G)t!Z'HPYk_~!ܿ熶eY;O~LƲEz~w묢5cG?ܗGA7c–?7%?]?<VZ,I rK '*c_I~쉕1::3,9Gs0#౤ۃQ9kzSuGQ;W[*8\;3-p2?%!!;9)CW{%Lk_;T$)EΡU0 拃PoE L9dU15 oooch|1 ܷcw 'm*7-T? lh.\.)\!ۦ&l +Vjhv̈:W9wWR.[|pQT$]agj(2xbF6*t;7zv&7ژo{cjmjOӏР8qT3ܙA$⋍*F*|{t!vSFqnڣa)MhF6[ LJbjz5p\@maWq_(TRcM#H!|QNV) w,Cua\*rа_VQ]SLq Riv=08RS&W $%qmEB:%cڣl)Ez9zȔ :bR$Q<O|;&I͇~by$#}c6%*s޵d',>h `ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*rս3 hҹo ri2E '}Za9|[$6[%Z!y?EO>8-ˑ/LC8i5 GƧ\rԆ:rqߛ"'~h`ȼҋ(\g$o| t;o[jI=@.$ԻO!)oQ#(0vɲDS=*o JiLto8IMv qAnoXg Pzk<t"c4NMG|)BrTXp#SqTXEN%mJC\ stY:`BQqIU2bS)-i=qCY@F*1t`؃ ē([`r0=09㈬VOO|*1Ujn(-S zu3u('SQ\V_K|zaAk(a`nz8h(8 h;1Uj{__;+zRi(Oثu2x2R=;Weqߧ Jɣ0?CҸɣaP7pR?Ek&U-L*|L;]mJ_ׁ[8b#W@ژPcp+Dʆ,#gL;=)!oMޝr%"OC}SZ8ш6_[0d Hbxʒt n|qM+GTT|QZ ޝ2iߑ17 zR c`y_<=FUڌP1ca8} I^!7?|FZ7i;*8>R˴l N4=󑞇%rU>ĭFd\&b+aڙ1['qÐ+V8 fIGUP6CmO Qnۭ0Z3'!N+;4h`ŷ'w΅-'-'>I "bg/6$~1p2/>$ş|#OxoLG>$]siV(}Wq9%46&X@|0xO> 9~/F28""rK4IYᙂx`fƟylywNm$c Lf+_h`闰=>,ϼykLxvA>)]ϼZӎ*+)QU"Z#)H>2˧irzrH@q'Tvù؜&2S3ԩ.tdI'dH%cLu+dzk=@ˢe>$OAiͱ/|G>$~<$yoMnE*) dY>x#[I{Rn`С;[퐼yXmÕ"xdxIyAip1>7AF_0"6ˠ> ey ^N];⊎GN-eIk2wPy J4({Lr_l:Z Wl`P?E?1=^4P_&hIR|mi1M?O>4ZN'*S4~vhY|[z8/G禵`Yͬ릂 7ޘfiI_/ד=ALwg ? *Eo`14A (ʾ뻵{U`0~jj5[q"`fPKu)Ԏ?75F\iB$cbFPҤ<P(޸l5AY$*?7Qs)?%~\~)dŇ^5Lɗ 0F4Q3Rr_?4AHG_Տr%Pu7ĭ%O z|Y$|?z{VsP1%ɇ'垞6 /L*m.Iw;\?(OE-G_oaɏ*M,GwK'URIC+6Lg[ޤEW)bQ~c!/2yG$ȝDEP$i2wf ?W rLg/]bNIOF'|#W>?3Y7`p}KdZc-NAc-~jO^CR__^?}1$B AXߪG=IM>YMn%y/ʸ\t_W\7$(M?-,@햍L(OGbn-r13S?-<;7E;ErxNIP:MȖBN#_|e?$9-,1nCY%+*I_#ɍduEaɦbH6H\Y.|~]}#cźdW̮iTLx $M,BSsH?Z0i9M[Gi4;l5N&rmg${=$p}sAxǐ.IuGY;`/ʒ^_C2A+o|4ʉcATZGx$iZTbƴ\rj`y^)yɤh=A qBN9qKLm@vqKx$jhD e܌Ar.t$BҟCWSp 0'$E֕o'%h= ڽZc#ޞ '1c$ =%Te> }@jzL.QPTnֻ+ϸC!Sq ۮ08Oܺ6hA3v P<<04Xqq jsֵ7V<Q61HJt#˜t"X ``PTo^ u\kVUt)8m\erJjWq50L!Q)/#AEm)% XP][z(֘^[5*UJ2ń׼t( T4Ӑ%P3kJvU^ZG&kDһ($J@2% $@}V*=Į?7#%kM=lrtb,6ǃLR([nyU$aUޚ$}j>p|jj%N'$ 8bWcyW$ہ4|zlj)߈vڙRNN\ N㎝)1NZr|jq (}8Z/|Q9&)tT̴LՅ1ǮEV >Ul HGKtIOmn&Z+(z%q=گȣVrQ &/Sv~Ab͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊9A܁IΡ좍rUK/%]cE.Ei}T6cilxSm=-Ɏ݇HMRI2Vǖ=Z>0[ar lmPݘeC!ZYc$ˮ 5&reN]EcQ9' 3h8:o) 1 xZSmrĭ_Z`I #vw's[ᓿUTp#8WT\***3S®Ɗv* ^i-۾,dh4M1h nZv9><E9GZROtĕcҹ駔H> %mؖ *~c.o72v)+΀}ƹ8MS x&7Fu^vho0>PV؊Tœ؁P킒{7 v+8Q:AZqQzb5,H=Gn 3z#v(iӏĸ,GTZ} C_:RӨb+˯NS1QQ_ f;ۦ8f"Wt7Li-ˍ@885ۨ 1)Jx▎Ez׋`ZP>6S@1cɦf>&lF9XZH)Q~Tԝ1Dv>d-FKOQT+6#l8|o¨Ѿ-*v4V})be*,P:UUO㊴qt=f]|P`k⪨)~1! b$mlM:j={,`)߫"E F m֤S$,7$\/|_z4yT|=F4[nm>'ۚJ-J鷿ȯ |-fNhh+z`|K8 FH2eF~$OVC\E r俅h.@h12GT$,Lw>9&7X+ѻS"{ہO60uq|nxR^X=jv#1J2l[Z/`]^8+'zy &8JH}3A3͏F,j፪qObl _r{kH U hJ*0lb|QĤWlTm>8ZJO?OmNG PPy0GST;}i%ߏW[Z2Bзm]4;quh]jTx~i:Ǧ2!Iօc=.cEFƄP S}*JrSZw #zl-W\H*(rqAM-_^ss_dXc(u RÄ[Rثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊x(a;%>LX&!>Jh)\E-=rES~eZ>ZsktWc7b!ܑ/C}<3܎-Jy}pm^2Srzxq 51 "y}ǹ޵ܳjޠpx>_b<(vۓ9Ïph\2_>؟=ʉwtw ^~'B#svfw8_GA@C>؞6[y .cFV *Mv'QpJtr Rhr6r3_3^in'`z1ł3μ];P3³H\MM4?0n3#&>F?\̗zoS`?VJXDcnq~lrH|bp$t|&!`wbc;c8O.۬9bKGlœFdxe\MT|Y3_.uKvA)x01y>$:=0r7ˎ$Z&_̰G,#|*  6kX8qn Lt[/[/.# \9$ ӿ<6?2SvHO;8KAE ZKqc,ymVKUUaZl2"e! ;gkeZ1MǗ#doVh!o#O7+1eW0ޯнQ_Kh{Ii1i]A=Ocp?ʙяO?az#OZ%ta邵̻WUXPP׾# qKɭ&t$g\E5ބ_y6_W?:5y .*?N4k]Qt'MQR=[ci͋' tǽt{֟-!q/яoͫz'G?F-2U/4IӺi@kM0Ht^i7o!]*y UHߦ ox3ܰHljI`y iW>d4U֕,@ BHsO2#EɏgwJ}+v"=~mʿ8j'?jk7P?xb4o1}bh@tt4ɚ? uyWg H82uuv%-~e-k4 >H A}ACK-#"O Pxɢܒ+GُGbA7V5m Gˠ爔Tp^]<#d~ =u+La2AsSN)& 1d{T"?-lǞt=ŅZח"k:-G]4\~J_CIB]q]V2P,b_RM)LTi-qa䘼 \MDB7*k˖FO洦?ӟ/;~M :nN7VO'O};}=޿N)Կnc:tLLZ-L&dFHJe=?&Nu4rǹE>c7w u#\<2CM;ŀ|ݫ \H7Vg ҇-!4CQeSEYS>CPV O-H>x>n`AqOyH.Mk_Wv ]60 I4[8g)VƛDI6#O'@x1.U.$#L"W# Nelct:`pߗ>T|ڥY!;g6v{&2;Xiagi:e OgyT`;0Ơ,QNM$%ѭOz>n-b$xU:7nDRĵksX"9|SUw{Z\kp#5SG#>ɽ(k6cTq<:8o=+ʿn+W'vyhSiO'.rF?{"=$2boph_*l8}"%x|(2gEYèeaB* z1F3MFŇPFO0-S]K_B8-MkS׿1L.XػƣaGż:4 h瑗9Ô4>F!PNAcZr߆ 2;GnRc\y \yVp#l FWvyz)Z1z|=re`J u5e6瘇/ D2,tw쟵{soFr ǣojo)kUy I-<ߩ~+-Ô4^NxO^i]c\y[iRUHzoqoCw.(Q^wh6vVOHiHOy2+/vtI#R?fkȨ>1Y7MtZ6 /7bQĸΒG~PZ_8&o/cI?染-蚬ŭ6S"1JVO,ēYѩ[b/diG yOWrmA+oCO,_'k>"]?jV+Ooa-zm$*{k2Ɠ j)Qlܩ1ve{5j?/_$_1Lܢ%nïߙfYxd3p0<%Mln6?&s…$|RRNxRi`qWLko%`0^j2 G#MLB޼>9ݕ\UQT4`UZ/*y+SQ%j1L)50jɰ\pV9=dmTM2銭$a^헿\i Ҟx5zfZuXU;vP;ae؎)bbT\!MNa j>+Bύ vǖHuBb8/|Souc v鄅E*ҭx{S#.}aF[E5X|JT oL^-؟+lK僧$aN:Wī)qAS5#\BMӁ)^b~BQ!Ӑ55tCb|Mr+\bSU+8F*)# MrJ4j־ҘL_ӅW$ɕh7%Eq u#~S]H `wQ͑…eo霆Rqdb.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊TFkuvt,kh._#{otRVwR"3s6svmsoah5Hc~(.>,•)>4 `e}Db70zपE'%n_+ZI<*TdX2bbB:W"y(hbp|wƷ"m-:+kJ˖\omSTm$Gߊ=p ®v78vU{xR`CH43 'ɣt~vq[Q+"ug3Ay ,.lU*wa*6\ _+Nt-QI+*?kdCƏW!һ @q:<@ڞ$\E:$"mu1} B~n*D9Xrxr g7cEq9v4Z=I7M%M)A P,5|@Mϱ—yj H cyWbɺci+] ƞ8\iwCxz W+3VQoQ]^}Zj?-%S,V_\Aw=;+jؔM!brp QC 8T S|K 0qJ,nTjXf$A_o #p 4ۭpi1˱T:Wۮ$qJ7f_kH[O6HgNsX&6E>%}?l1g"wZqb|r4^a0}w~Rr Jb}WcXw8pȧo,u]ml !~XLNu#q߮*C\ j?J r =im -&TSnqBbZ}R:3Px^8JێbLRX!qmMV _;|@>Y3+Cpz \F}ޘS'%)FNqi,ֻ mE-J5v> ZAԿ@,~r2\4c/ LJ@pi)&ƵQ;1Sx wEnᘭTY\Y +PS CC^œx >QnU=aZmqXW5=:+XoLP7Ů) y|8mOQY7؋[=F'%m1n%5,[~3J堂|\&&a=A$GP|?,W݋.D0*4ǵ(6RkV$6>+ J6 Rv>­08\(B֦$*ycUuۨZb̄=gj #U04SCfWdLN߾bx*͔zgA]1)ccM똺FH9--Tth5,(PCcǏ3fj}**7de!E-`nԁ4 Bzc?(o:g@Wauq+oZa8+WWg5/9N D3=sKC-\qzR6 LZO dM阺c$hش?KģqBlUvLi}">SN5a)ƫ%/Y-*s1#X qu^, zblPe9aޣl9$Ӯ-cdQg1Z]dL j;cK{Ҭ6h]GU?>eWé*&O{?Ī1 j?(oSy8B~Xل;=GߚQejɊ?(>#VOL0,LwaҤ?VF5@ 2TdUu~IMфYȎ+U#-ΙC&Z}I zCVvqqf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW`)u4;$6i#EE44×h[:c5''Ћ@s7Of.E 㝚,)իN:|3LaQp1;&Uo0Yi *\HalN}3/I4AZ)t `a|ù?JN}EI/$;BN_Rƛ%+Jo/?k9}|y1l^yzӉv;1xV_2q;0iUۦcFr6r5/:KUMӛׇra]8қnI͹@]~/ҴHSO6_/\>;Pܿ ZP2ZX@>拴;C" sk~>kb'sꚤڌrK1<39Џo K qE :2{aE;0e`hGCM[DTS΅u`Kqc;u# Fgq[ hv–sCoߵv]tp=QMOљԄ`h1:r6Ũ @S{Rd?fmF_@im1r[pܲ.艤ۈ+o#x>y䦹@Wl*bo\,+o+@2ˋ4^Y* F>ꜝI$A'(ɨ>ٻ>iXr _CPUAFR) 2Im?9\f")~WɤR $5s-e:ly.d  WGjRz8I`^JvfOYKSxhߑG"J9'#'~PY-6:Y!;#gy]/F?5ͥibTsğj|Yg˷.%0[Z֫WmeAL݋yMjIem1j˵kqq+N<VSC}`<ǿ0[gL7uRD<3o#qܚ|#xƿzFImby7\yW{AПJ(yؿ/t]"Tqd,dl~^;m/Q`"OBL# އؐ8Y펦4:*wk:^_[]*~Ͷ8: /[%-uhUDHsO'ԧ%5~)i|B8NIGS1}ēY/IG¼pI3_M}+\Nܝ~Y`"(> `c\Jj aK\ܣr$_6U c#Cn[7D$+͙? 9xi/a5#Mj8@n53_:GޚBF|  d3o`VLRq\"FƳf֥mV9/2urO>*IzƟjjݒ-BJżT5%aRGrO:pBc眺^H|jWE}~h'U.t'LՙSJYq~><"&/"󗙴{1m4ԋ 1P97m:6 wxC)hh]"PU)QC7m)%a߮9d+^'E8–Ckɯ\\.0@+si/Ø@|o%Nk0usƏӣOyfѴƕydK 'dG  +<6JlSjɳ7_68Uf` K/a֢E[ 1/bA?WLMGm!SxbVR͓׷ ~oJߐLU#fdNنzEtȔ;Ucuw"i4~9~ p5$Ă;yz|V7q˧["~΃X6oō59p`9c/_Z=s6?6 ?qԞf!qVr|\͏e_\d #SۖXsՍG+ǹ|\i9mPPnW\v51W|Lht@hGȞT}61U10+y"A?Zt6ݶ<1?_*6끧}j~BPIi=H+9!mN9oMqV^ ءcߥ9EF?gl. TRJ.)G~snT]3dUx$Wn3mU*O\8P;J*5k]ǎfU|,>!)_ǁP:SFv5|els+JK15fZىEYm^]IK y=:8B|PW]xTmɻdIJiTqoW rT$U2*zbΞBw )SW&D ]PcX$D_ծŔqZe)Ss!=v#/M\+nD+elb$ z|R>$\×я^1Sj0ubVƕ~^菪>94R!|)`)Ap ɶ(IܜUxZD=mw;5i8WcOðZWc_#za`Fʘ7ph<'Fzq@vBŌ;q;׍`*&Du52y(oͱΌ@̧qZ ֠-<-+3H*߶IiX ,ԭ">tuv,/r<֯m/i]ǁ)homJRC19 T -k!GJLMA? UxlrܘvcSÙ0*cRqK; IV!IS雮(K#îf\cԒȪfb7e)홚)yCakv ^7eo:գ>|1J'f=pOz 7\qZoM]\W(vS 槶b gZ-CgԨIfdsũqlm WV)otRaˌq*8 AZN[PuCK7bI;KboU`ݺ&qKU4!j*37*g)ا%VrEEw'gJ*श)^9UqHn:UlJy]Zithfg?ں{a dגXx55S<3)jDYX.+GO24%5*Ci7?a䍋 Bj6 ocH[ Nç*B߁G&A=0$(ƣ¸R~bTmU,r銐ڝ! ZD׾+"xӦLՍԐ9W}9"Yzx k8֩4h~9T]_"/4a|7b/٧J|=ȴ,hךoTƻhl,| w WU uAc8-Z ׬zr_qNW]u}(}aY| w,] 5_,H0eܿ ~tu{YGriLpў%JɚM5qzOyw>h_{|.D OO!{- @퓩=L8ŝ 7@\gY{Bܸ֩Z6KSN{Wz,=Zlqިu(Gʔȿ4Ǖ3ދN9l~ȼ2uNu7"5T/r`X!0czӅ(FM-9< wd\<"Iw%ۜs>q{nX!f6J7QFQEMrua}&a$Ze2bɐ\y0gi?fy-+PV[0&v"Zb6htiIݍ9* \_XIe+[(w8{kfF: )+Ωy l ~( œHx.3qKh?B{\/E7PaFYE<#cJx`~rHpMpLƞv4`F~d!SA~Z_~Zz )P9[und7X!G2*qv4=.VFH95;GhFߏB #\m_{(t~\cpZ:@'*Fl|twn!A~ʠ"~\qpGhǹކʿ)Ӈz7WFԯŰ2#-\Pُ>mghjVʕF[k$2E6hߛ&~;͸O_* FA )L 2x)%a0zO5r>ǦX2za|m=AZLE$:q1;3.5O'w+򭓵}۔ |Y6La7ߢ.wۂoNJi<,Aa זm.s1OTg"Z)d߄˟Qi2=T۠xd8rn[к}.s WE5kZKvÐ wɏ#IQW32`)p0( )Ci)iCD2 5*1(u&j_2s ;C95ܜrOV?-=<Wɲu<2c~[ۥϬT v9"cnMl`h0~viWXp@lu؃r"`5(D)t6FʶrA8 ̵]#(9A.f13qJyZH*B|w}9>ެ=~񇍏kUQQŕ"es;{1k;)ѷV4tToNvyT[odF?W`՝3Zv26~kŦwm$rNG~YõS[5L9;X_ouEX 6JiqE'W3)1-_˝F;u%\V*BG,;wۓliSK@iҹ J˭OPe"Z= >ګrP+a7$||ǦG:+-kO + tΕm(2+@ 4/&r&YKan4;7?>㍜j14hH=>ys(=EI-ķpyG]d$" bM qu9!lSycN6yWJԌ*ݪB3j9ך"oVhJIІ'iLZܢ+KNC_ vpu=:*79W'ߚt+n{|Y\9v?#,a ucF~jzy?JLPF`&30q1OO6]vdeW)Ăz_\(& I&D)/8]i\3Ղ_jK63$:fuyli4Q0ot4Fqju߾DJNXRz[I@?r=ʹ')S:Z$(KPqx熃qj6662Jߙn$u b~5iENAOo8+SKr÷Lٽal/ #Jddi4ca+M4bzJ*~{{/ŝ|l8'i![6Y~V^N>'si[v`7nc?- JTvFI'Ozm*{cn֞ɖ<DxsDA7{'?ՅV#wHҞ؆o5 ~8wSLl%ᄎWLiē̿Fwn?&m%=~X}4H~Gy4F@<EIBKG; -7&ZI>uWg@0q鄕R@r{UgUSQNu^IVN0w>>U1p5Ȫ?kB שLq!*]zb64O5J-6c1bulmIRHQSI,@ȊCM);b0Hfbv S,TTa@~ˊǶ_L%E-Na&9cl\hHU#EwǮ!r޹ i\j2|WVE8i)P 4GSNpNǮ5ڂ -D<0TW.c4!\vh^yMGLVIK߾nJSoVĥj0}bFl1FӀDyO>8AƿJҩq'9 īM{uwP|=qv5(P  NܩxK5T|L%}~3}{u ?Sݛ*}a;,KUqvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث}qn7FK6"i;n6d2aj+J1>{ w10qba1­*׾ ȴ{bX^" oDߗXF:>-2^ A 1%N-AS+&v]1®Ə]{Wb%<֎N 60un]̣~e`ֵq;|WT~F`Y!@V@, њҕű}peEI=,%ާ('|A0;~1 Q\`yx : LD H:"xUy "A@B\2ZbZ}зjXc[Ŕb7?q䆪{$&,4Equ z`g )* OnȨJ]wz-ʠe"PO/ CˆR&~8Z~iS׵{ZzqE8; mؼԎ/u:X] "Wi\Uj>T\zЩ=ZȄ*rG^ }F*xl+{dj ?I؊ɵNC.@?,Xr˷%j)̘ۅr8s䭩Ft:cnúZld jGZ%Cdkp; ^[P.OJRsi=K^} H5M<8ƟgMiby2 iZRgw^h]L]PuY [bbUܲ8!( sB`KvLjƾ@>iVv+hޛ|]iNؔ ~uU;%M8avq R6*@|V9#fG !'Sۉ߾]DdmFBpyw-Q2?ǶyZI*YlܜirGl䮥IȧN1ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊خh2qvinZA}U˽yGy"ü EUɵiCeKRC ]Z*؃1S#y4v'}V]r;9#hb(-*CNʷUbHO]v! Ƀ~ÍxOai1tUMo*\OV?(_[x06O g134P'YtW+\;'1Pśo*] \l/"?31fw X}bjkr;-?R q (&WV򬡖}BA@jz=Hywo̝4G<7 ?FbȇCG:k֙U4̷5&ߗ(z/F$.7濜keVλw丧j?nRj6~N?n+$Wl()f<浒 4OO"# 2㶑$-?_՘Zcwe 8yzҝПfȥ+3S'ZIup}r?yB̷ih ާ31x`OD9˅7G~H? Vb?W ~=` J{=Kg(#/ftmF?F4?pps24~SrM'ހ(KazΛ ԒrS/.?1iPo]"T;kkErsF~ey|w44N0Z  &^SNloȹ7zq#.kӲcsr*= my6iL$B?z/=gPAxT_/=5Τ7rH»ZjvI"xlKs0AǛVOm&0֣]{i̥A˴Ki9$יtF[1g:J0$!6뜲O뜲cQu<; GI^dh(BCrWP]?yf?6ǐ{ŀG?V4)+#u~)PtKɼ}.sTmw =f K@GY..4|vָiǼc1ukb?ñS'HAs":&62B976\V?ꖺ_-%u#m"պTc--?vWpt? "gi7V~}%ߗ3\HV*rov7@9ߛIy±+#ֹuIS`:y9Xct?/Yh}_OaBjB>5o z%~@kGeAgUz H}+ZReqظM̿IHځCUgBrd,y[ yއpQ$6݄~gNc܅ET0. 㐄;}R)|eygyG$l,r 4ޚ\ h@p??^yͯcp2(aJy3d[2$DXd9k&myPH!Ws1>LR7<8 G:Mk<\Sʏ$vx@xwaZZXڇm,X:q?}߯,@6?ՈZJgO嘼x/{q>s:d=ד6խN.?1WzF7]MO#bqA <__J4JSˎ/el~,F"m<$Ϛ_vʂ\Y9c{ 1vɼw6 ?NST670;V\1Ϳ67zvz~Wju=_JH#.,)&_77x4бkI%kL.s똞>Ԯ>75(idv[U"?%?nIT?eؚVGm&t~L6/Ϲ m 6ͫ`mVYtgolh/漚wT1 v h'^J[%9pfXGsTWĜwR۩f۹=-ݩVArʶ~Dr:Z"S\RUɁߝ$;Ih >/&%V/έfÄ5b3yfHE/ :oYq]J8.(^~gWr6 lN=v0))ZjMY݈B)C+.#`y퍐o\*o'otۮ9Cn0f+\UWsj;ƽ0)a~˓ cHI9elPIC*5pBXl@ȜO!r-nՉ6Rm|u>A]<n0*Q,PbXr*!׮)uHr0!+| Xh[{AF8hn:l /ŷS5rA[H H}8 UI,m8R* +cҝ{buh k^ج#*e Sn>L5юr2IPu*~q Jab}GU0^!}^R5=~xzUӎ4/-a J#^bе 2(;%Ng2UD@A!)֞H aCtɫ.-}G R|1ԥܪ?4Q@2+q? GvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb#Fb:a35EC,=MDy`W6RzbĬ8 ( )X_^)VS\‡[s]ƘnȕTckrjܛ&~G S/]ZƓv3\]늭>;[=0k<cO*<@㖇'6۶-m+)qSqPpmEr}hmc^3#+^CY׌C> ҉$ݒv;;eqχc'zl5n8;{54l PN-m,`$NzɮXtr 6$q={a gYixn"L%cn]djOB$q+A$S, mZ)ڝlq~B1n)k(kᅂ5z`{[B=q@**xEʍ6Pe仑pe)$u_{:FVB%8Q 3*8bMzWCTqܺ"zdiM}띷ghԾ9A7ȜN)'qB@3ԺE+t;wのӐ;VM?xu2$}קr$n QۍbUŀ%T' yv>1 jУ2d鹯nN9; lWmʛb.y{Ֆ$:sY;aUx!j<)q<d6«w7<<2)Lt˂nS‰ӓgccv ztnb2/#Rzˢ7#N6!4^<릋[R1DY-ŧ ӻI}X7^#KBlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]z .Ň̈m?slXMFvo0q oI-[fҝn,<|5 ddQ޸\xEፅ-"Kv®H'̑ q;#/]5Hi|?gSǬgԅ:ܤ|rDƛQMv2xwtV$VEEC)a'n%^;rRD+4FݰX`uZ? ܫ|N#r^?6;|w+˖Y1c濟SL6;W1 a1MSՌRԺDH28K3!DdèaЁry靓Kwc(1uY8%n&5O%ּn5[e5\7 LjPI;gOxfZf,F^9T /$tdqmL~ʲdW=kD]^d O.3M zCz\q)#dxWEnc":m4a>΀&&;kDa_|_D߻0tߢ'v#k̩#?iO CJx絿/mpaOuEY}^BhHT s>uHX3N(9%^ӢϪ -p+v¿Mט>Dl˿"d~\S3ѾX[@uJ) sBjxd7NlK:tIpR8z[F/γ9!#Y a3%9x7&7u۩֎XPa~jA?,ʴο5\r?%)]!B`sޥ'`?~i{9/l-۶t)Ӫ6?5]9 HSja!2=FtHw23O}}+6rrҵE;guA'R6wOiljfzDpa_3A Vxċd`wM UxG%W{PUOzC:zS8Eg^fG'հ| MӮ\Ubv!NO$ <%%aysLKuPr EnӚCs֬_GH牘#睗a4p!EmRQct qe:K Տyqn+?Xc!:#Řda~N3ibQ>խ>4s9>0A88sZ2 Xz  #6 8Vk{=zzfcCpY7 wɲW&Lׇ/,d2^M<|x=k(wO\'$>Gՠ?aqu_ݖ%/ar(|c1ujv~H5|,0{tԭu2Yc%_Zl0 ~i`16dzdGz3q7밿UszS2J|OR4M;c#ȫ}A z^sH"BĞ}9*j1v=q}"ȯUzuCI|Nkk!t6%.#k|ǜKqQRȿͲnvrf?h ؘP>9vz'0quf%置/EJdˆ)g2DHPOlX\"]J"eR@;u |s]Y/?mH6(΂2J~6?ag %4A,ǐd6lw&TOVr p~k} NuKbq?Ac^Z[;q٬ǟF=;=ODiEN;pn&Z;~ [xEXcU7ΗZ#J~WG?*?0Wo7Fi /moMVڿϾrpA$~+:6( 4h~Hz#%u+;'ΏX|Vbt! q ld3%MGkHdXZsV8;DU aח ,^eZ_ά+ԖxLXP!c4quǓMMlf튻r®)PVҘzWWZl![}AGGQ*7ㅡJണ+\ǭw8 CJ…6*W\ -Z58QNL; h8 [XzHnwCZ['";շᔷq\ o偐TY@0#_sbB7:d{ X(ɴQR0&oZ:տJI8Zd[ŒXc}ݰZaW08PebZ&7 F1daCb$|HUw%W$C C\YMO|rz#d_Ww@jK(cP0Sb 1N8UFy2[Q숱Nu 9t8Cp$"ȕTj0Fo "W1\VNn=-ܰQxg_jp w^t#S9EtèPEH;(j>=+lv5-=Fv Hѩʔk ?rn<{g`v=1hx_6 )C֟FE"`j끉yTŊ|8maTBF=%0J}"H00KL/E#cQݺ/# zS&lG{aU q)b '6"' fziŶʐH;dq^dӾ)jz8!-ǒP6?g.e ^x~o~ou:嚉eTێXXn qWl{/W"x$*%_a=Vx-H|?dJYm|<%4⪱P)dBp=E0tJ`-ñv͉jA\ x{釢 Gj"sd*@X9Rj]Tf]bu#Jt#23u5'*DŽ-¶4Ǫ94NXZmJ`KGl(j|{`WW.l j8'! W/޻Bbb[0+xZ^N|$(Xhp'Y4hzġ.UҘ9#ccbywqXW|$t59R؜;3 NӆNKNQmFn]AZScjq)TTFnΘQAh+񥫸\f0m~\0_{{GV%[3jk0 Ta996ܪGfPlY%J M F{TTqnWWoYjZhȇ UqLMg;\t~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWcT!]#[u(/ Ǒ(^Iǿr@%&)/܈s@ c_-yFm0l PJ/c/v RJF؁UJ6)Jy4ZtQ)emO,CBT?xljHȝ(G{ϓOM~|؝^q%>!ozMbNRN)6 Xہc:?4U6H00GlG4PfXW ғ&;?70'#c!Չpju}6-z9KYG(d`0\[:|r592S;4GꧦFcSF\#'4Zd_dO T;f)z8oIVo%@vZS!Ƴ>);~sNh5m#7#<=_|cAqG•%cUx%*>᜜;tb Ra$lU/bXU) (A^I/Sf&L:xS݋i-We751_u9D0/!F{IV)cnNyX(⦁G 0V,|:Jh0K 񯏉헷#u˄1i1pC6<Һv"/HU }j['xEHt"G0hP,voGzɾmDJW1j-S͏N"xYj(O|/nIJf'$ Ga-0j@HmFSNWǯ_*ʁ 394r !&Ѳ ބc=f\C?!giL ׾sfszN* q1??^Ug3k| cq-J$:|NN|]?atc9/'Җ'捁1m25G \Sgb`(8OǬy 9V" '6GytRdͧ/}7wO(G)t1NB2,d~Q9v' ieAn֤[ue1|z<^ma=$y>A(1 J&u#gO#E2QțG2Ix!u, f,`1tRr HZNe q*`WbNJB+ViIKtO/]yc=2/= rNHԟ:XNJt8AyiS?^g⁄@=lgJ)֭hs~=#ݻ៕[AA}&=`՝ =^_he7r'KX߯6>?X M&]j|^U=>Two^g-M][ ~ ThI~lj_b}b=5ȭ[Jɳ! mωaZ]IY:aa+SZ]L?yWf?VA۶aƛK/*FG'7GxJbNyi7KjFN.)6/OP4]A~c? cj97f23Uٗ>hq.YN@#ҤQ}Q^'69GD}=:(L(օƩ?A,9}(k7tb}.o^ݸƭ&!QA:%oPi:<_MIippyߑoʽ YϿVG͗نP e|ϥy1o'z6Feh pϰcBaxE3%Pkq%FNGjr ,6-v~r\ce*l$QJHӠ!kkX[4áWr%xoC寗[4ۮj|}ݘn\2&z0j4Ј3S:^wLA2ȴe$fq/`z9sϚ`;~VyV1ѮٽgZXw*7wBS֑pV̿)F/޽?7qT>pmpfY8?/ùdj8n$}_ÿL?s/LyTaOA߭1Xb:GE!ܢ|ɪr> 7l# ; L6wcPv-ˆM_P'!߹8%y}{m/]LNW APj9L֩ukZvX"m[SJ([ X|G=Bc`B~loS\)VP@SLmi kN/Tcʸf nU+|wqA(A1@c\VJPw'(WE%4\VQ! rad&&bJPlj~l ҷjm6jz6H5rQ iQ\Ѷ%[@IobU;僶*E?4䐽k=rtqU8CGB\$G۾+!Y2KoL|[.E 7wr~JS^"e4Sci1X)^lOl$dizb}Y)%hK`HH_ \*,f64;J)q:q!J0@# mf(} DO$vE'ua e\JNr]QYyu,^Hi0^Kw2--ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*?+n\ L2Q=ERqiylg*ZexSH0-㫅 s~Uk4sK/F(UhWq8;cNvb;U߾*S{t]Wv`7"8v*h;h퍏f#V|8aCCl RѫU?FN-9GV.]q_>1WSsPw|o,4FwScjhDymՆm4 'mA:ɺB$v˹e9-T;׷a=c&plI)oޘ{U)GL.D$bl5\ /iR_Yz )\G"+;5q9l~!LY4 ~NTdK~9t-tY\2_clw/-023wNJubwo\VjdIg ̉xƒLIt=@p)1|0aF>$Ha $,%>|pjwm,eJibɰwņ y=MחCڹ;n$2ƸǷ8-GM6~ZO6h6-r%中P~KEFQ(:Ŭ*QY>Pl-VȠ') TOSx*):El(-< SkSi-UFH…6,qaAҝ0)#xa~kUĺN;׿ ̲povwtW9/½aAҞz0!^wX6_\1B%FR5bISHl퍈`M>XU*0ASBֽN3J\whGW-6j?ī PoB;lc[lNP/KN&NbKe}pVbx@;fНB]0٪HJbcw>UQ?XbF0l5N)R2uKx]n&? ,b8 AٹMF)ZP1Ebiܲp!6x(ZNe*u6ߋ&0v] tPC*k/QwZ#,,V ==jt8(K3)sKFC*)SwTVS68l~^ϔ)ȣ|oqzd6ޑ㋬lC_vnEbmiH5;nh^50lJ T/|V?1ǡR=;@;X'%40*ƾ(~kqZ MDг}ɭg=GLCvԪf0tZ>%^}+2#A D |۬l5bX'OttqPw+bݼ!e^۬c}ԍZ66&6<9f6pS!0i9ÎKy[Rثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثX>E!=yߤix 5V4!դZpMsMz(C03gh#E'+f@syxǶ2.&%_1Vq74H^z~-/Q%*HcAg='Δ¿Y|?BG6 BKaviӎM0̂)?):w{2y 7E"POfG^ߕ6ҍp SH0%?(iWQ$sK8 _"]O_CUD)[1&,T $%d|1-B?2X4-!%>ۚ}n%'%oLd@+ aui- \ba9IFt8ob\P]劻 4-]RP7f_c)/ &" {U sw&xbar8MʎmҸYpmUxm}={ˈHg܌Mi!VC]9=p ʾg]V3{8;V25LrY~QLm Iŕ{`Jw,imw_h5HT ͆Ok2J1hǝŒäkݘ6LS͎=%SVdC='sumL}Ż9F8z:#™N*g>Y.|y' Ho˿^k\2\Glad |C,5mN.K˖`?.:}Lki׿|DzaO ^ Fcås蛖,ʋ[ZVr<fSE<ǖ\R0Y9p;'T\P:'!cKVB)_P,?o_'1g ܪ½Zv3%اQX~A^ $]h+o#ꥫ7f0(XZ}grq'3vd ]u83Ex?dzG/8euule@ޘ>^O? 1jͤ *ğV_3G mqD.LC4KJ;DY[y)T*TJ!|N>NLozo%ΒC3Kk BJݹLb^_0ŮpܣPpWZ2 ]Noޯd͉:6:[ $ћ|=r yz|$4{uPx7wJq#^Hj~eM {qK_4ktO!]dßtO4EGXtNrb7moxydSQŃ'II|iYִUn.߉k2:F21PDMZJҋM-k│߯5;;|] ğTd}tKQUPtx/y9@p暭/j1q_/O~>.eD?잊Er}}{+I 3#2ˡk֚ݲ8xouq, سLk銴w7އsc1}l=;V1. G!6+^I(SGԝVqB-cAD;V' 61Iwv1+! #ƬwdЫ8 50s늲3  L=~xU}kF|P9cҝbzVr{ VJ*|+b1ȔS_G'c~튡]}'VݲL~=}*ӎQi-L\2UXV=iJ CwcWR2Q7` rop]wE"_b ʿNN1N6NUM>}pb «)oR oeHM04=r-ӭpisTbVWq1Uq&`A^1?62kq07;bJE >F)Q*  J-lM-q\R1X!O':[Ӂ#5gj ;-Z(qet, }#,(&-4\؆!b74ؒ؜)#J6"jKBb:=&d*0;|`Fx;H9`Sy ?0n[ŧy`K#b@>54~Blrhw# 8wZa/5PR;?:q&E >CKU4p+GWp: +G J  B\_,C((`n$m\X!y8bɼmraCT@hxdz?LgjndGf\6+p<|p VqkBˉΪEy $p%Z䒢pd( TJ*X[tKy]l@bLOp7)Fc?1A՗}Y~p|1m?uٹ ҢF& "$_񐏵.Vͤ;bCLm0Q@*z` lőn#qRu~& 6,w/Cq^2C{}?-w3X0[ B}̳$~oھ(SrtCm:Gif[x]&|Ųח1<|US!Џ g?=|FVzŧ^4:R Xj2kɚ't̟~_n`ZG@z.NeS!zfk\1?/eOjy ℱeZ/[k ,luQGy]J$9\ڸ?[-4BܰP)3s<84*?9B"* XMّ+GI^&gfROc?w/#ǒf+8泷v?f%e̫{1Ŭ#хd=X}U;w9S.TvU<[^4Q;9u1"ү4hh7eͬ7!&UXnG'Z:5"KWoej5.> q58]?0,ѤFSI69Ni#H5+F L^٦lz+XVK,#l@&}jo铻O/Oq|rǔ _ 7ZednX?AZFZHw?{ҿqdnniO.y/Sy#wG{F}D ο^t;[KUTvq+jI-EZT|mx"S~c:9DđB=0xߗXs7o钿)yZ[{7̌:\C,o̿K -\0pVłB,sަ<$̏Br2 Sc_^_j}jqkȍA;ƿY(7MaǕ|ya3҅/>n6\o244N1de)N.n?s~uPtp6?go%Ph| >`\?_xOKh8^\S J=M;f㑑t9ˋ1g9! È:0Ȑd?z!>ܛp^Od,ev;䡛n!Qψx^N?<gEUU`U9y 7? ~rzE?ܿV/ko}o*L"A1D巙u*LX=I%cڿq̎gAymjjoHa! k~Y _pvzcEimo//k;L6 @ דR$%e5Z3F aAQO G/kSO$x f&XyLs'=:nvqӊmOCs;.ũǥr 9R@7r&+v$FJt\M+96~h4?drS'yH/J(^T5ۭC)0h2/17V!1co鑟UK-N@5$)?\GesМ<0q5dԙ8RwrjVSX@x>\#Zp4yF=ve(Qx 4%5I/8¶Z$U՘ l&_kdߵ7|٧pA:Bȼ̂ZVSl1`n?S_g0~b~u׹1Ŋ4ly|^pY[FC*#ƒ.$쥔byV5̲# 0,Hį[Q\{sHǃQ~_>Y'c/t5^jd%'Q1qcﮨ-65FO?iHԿzn7Ճ)ZizBq51ү4~gjbQӾ,1S`>'a5~i#jc.}9QIJq &a(gWP ǒtO>O,F$濙FGgGpA՞"┷(XaZL`Hb{rj8&)/zWEHba_O/᫇HY;q,kzu>xM!xur7a$nEgB;GEm?2?4>@4l:TҔ`I;iFsMURك~lN󕇗V_뇂~l?͟+YwPk#񎪿eɾیU'Zt8ކ[&URH>?8խ?/~Ğuq$,}.5 z6p$%XQMNAgt8Ȼ<`+*o Ijfbؖ\i Hy~8+ss[1~*m)X.J)Ӿ` >X `a5ڸ~{c Pʽzxȕ[̝ o*풴%iROLȀ$Ӯ_хT,M2[Ȁé4WHVփ0pVJ:ep**C%=TILx8*AߦW ~oL(mZZ`q{PnFKJrO-N2Hh#zhyj9ǚ۷)wRԁlk" f#*r;t\C KfVcQ4*}n:3cS4"$zqpv۶:6W_')kAlFJRˬUX dƞ%q9)>9_$/qɗ(x~Ցj-ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث 9;2fl)"cˮc ,­x=CX7kfJ~7ZlUzbb'vf=WfW5w7J: x;Rom)len7˦Yn kn⫱Ž#]Lh5ToIu+,nU3BYEˌN4]\N$d H/ˏ?<^ ]^F)5_ &F ,yh=\y b̡Jxc-i=8:iXpw_TJ!fwQ-~H-Zv?͘a관㙁~r8Tl|.) I涘DD;7[u$ 1 DcJ02=*ی J4?(4y W 2o*BTh:Hn'pxA$9~'ErpapuZQڕK_<{`bTy8N,XhcœlޕᖿhI[7R1-9G#`zW%{4x@K9`KG 4큙X[!J4Q"rZMAĞY.|EAS˨q$U06a;`b9Қp2dh*#Z|U8PS`V6.RqjScָ.R\@jA?Cq܌C 펎nC}$ɩ"vX]sh-^H=ed(OJ~~,./&V>1!V&cBU,XLCPOӊ pOHRi1dgZc-l*Vp*G H rzps EmnJҵFieBv|s8e%S%'o(F™=.C J+኱^@X) I]L^^،~eTPjNl1kM]#8 lU+`d, AO/šOge K2|e6Ќ敩1T)я wc\N5[HnOL N-L{(])h+u1 i㘘V#mAh]InC@{G2ǖ2i?NKS0>*Z*7#7+ PlWe트.KC!ThpHV (s%~W+bOhN~9%AIWe2kCQr 9zpq*Go*lIk\݊7zRr~xö@nce^v*F|zLNT q ^-URHKCF_z"&'-$ht`8 colS cC7c0f㷶TBxӯ|/ԬF>d%i*j5/K7 9Fz &=e4A 6A~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v ^M YY tn$R>!BXcc>IKpŻlr_z#,:V6"Hl ,A%Xd͹F2EK5+۾Ƶcn8n0R'AGA;@[AÐt/(?Pc.L82-k"O? w|19GG~-24Y44M$PQP;N1ܟdd_I*|;{K%w,wpQGw-$&% (c \Oҁadw"%a-fNm!JC@kHO"*i1e%Cfbs\=QRAc)c>-iGfN&A<(S* /E~Ïr7Krǹ7>MGHÏro'yh/I"s'yRzItS$0ŁL@y#Go8:kg]?f];1U\so9<;sr#ACA?q>'{ʪo0G7#i*42+鷆r=G_?k~TKڝ~Ɩ=qnC̸~Uhl~p|C~^,?3%gzc~^,㬜y!xnolcwkO/z]^S{ 8?+)BʛіiӖX id+oJS<rd%6_3vOJ0/(Ҙ֟+3r V=8䮗LǾ?oEcKg(k:`wM#"Z?ɭ80>xC~N>ihLٶ*kԒ?=$ |jQ[Ow$7^ ?VQsHlM䞜?__XqkiN\侞y@$\)?tZ_ɫ\LGLi=(_K/zqט|jm[ry|ʕӆyw k0ʹ[.gI>هӗG͏eһ?NmE?(  :8d;ƕʢY_Nl)?zM(~L?QN`|)/RIv!ZMpHOjMK1>;}Jߎ(47yXᏩ=0N 5VORZLۮ#Cz6z2ү(o?8SGz?;?$ma4^-نG^S3swȝ4[hS?5 h1X(ZZAf51m_hE?>ݷ?LGoN+ret_)5ud9#LuD^N<RF'[W&=&/0NaRF„LGrw/Ƃ6> Bb}\~^#amN`@Q_'yw/В=X#>{6<зʜx#r&cOJc 4wZpGxIߢtEk.]}x%S^%%IPi 9idnC-N[-A>nu"1__}_[J5GK?EOKֿF\AZojLDN>&\3H9sJ.>I&KcoZ(J>IzIryDZkq_u$x$37Ax~['t$󦊛h}faa"dK]71}ͼ0e\T>x19G~#?'<Пweqc?VA+̆ OʣxG?e ;d}F.QV8?1&j?]%בS_ƭW3"ΖZx0~j,eBåx.R0=?5s ,|1M_ Ǘ|13a48QH5Mbns}nÏNr`@1q\1(E/J fȡTs[ƛJe^Rє4]oUp9UWX5XJ&;``9pڅ9 QLr-BbziTXr\XjW>9]\Uq!Zlz働*•;l3u&Fu޸B+QL^9[ū0 M)r%[A.Ii(ڹ(HwlQaY{i=<12k ukPSuˮj r2L\)A\PT[zcTSZS)O#Z%3o,!3S8r0i0P:c%p(M@,p;S-I*>61WNV,Ola Ҟ8 ZU\GĤ4HF6,+"䊖S)1|y{?N)f[J)9FՎ0{BK(Wtk#|, vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث˲.49`8*Uw8k/ f|*2"r_W)iS\!i(k(ovY8o+b ^6CD`$AKen^"uOc.̤v­{`d"b!oa: _p5~J={`-d$mm1q(MGh`#m'rdR Ol.[ T6;p U&},)֛`P&O4Ze' 06,[9W r_p,FpeU}XֆEkF,ovrjSaQ!>HmEFEq68U \LT=pKKrpŁX'q w8Wn8O˹IJo;n7lw8"LfFjr'1Cqj:$BH8? O:>H}dt>8IFOO+9GɆy+O`rD/˒1<_$5M/pEP {d$F>#a@:Q5p%7 R$0:Lۯra PP8_w׷OqT""nXdju *6^(i_.gO|X9+PWޙU[Z瑚eK(_Ss/Ml~miA [9ei7W"~ Uen+!Wr~G襥I5LacI W5 (zT3qCh u')q5~.55cVI[bM rLJpq^:n!P/Ȍ)R,O6lʬ:xr_4Oӊb;1 b!-;"ӡ͍!o,KN YxJ:a7qЃrr)vobۆ~90*[*vvUȀn&TD vWz}ƌ߾.a9T=z֍h+K>mX:H*0f? N,UP> :ߕv;| MQWSxH({'9Fgd:(#rܭvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf], d >\ϗ'C_c_/%S)~Od{F>L|+gI_+<_g4*JZy%yڏ|8W"*:cHSe*#{52Sڝ+Oű?o ,N,~qxg 7D;@/c!G[UK6_! VcG IeЅ5yE?8:M*?xF=yRQUzZ%?)8O'e4[#ק.~GB^Zjsd8D\kտf`?9Hck_Z]M]lgKNWu]MsetG15=g&fkUĜu3G~.ϝrׯ}UW5Gkk1?G̗?r)0(N>xr8fiNܢZnnoa1ޗ#w;r޵Z}i{m3z$xw?sipn4;I-pRmւK2e ]_=t=S ]ˇ8jJֿ٘@;]!z]LOszJ65x=SY-;]MG/_|._ՇZ F9B4#Ր_5Gzӑfl l|CH7YI$~m#ߑOzF?ggbHD u fxz?.;آaH?V߭W3`bѵVtآm<͠j=?cKq>͐GX|mo鉙m$H&Sy}ZLiCLg-K|ܦ}%W=Gƛ@w>_+xEFm/ߍrH17-:z>"zH_ E'宿(}#78݃#vrHlN:?&b~gy"),@cGPt^ߓ:Ҡ/1[j6I$@Ոb5c2}y'^?%R7-5[ua,[IjJ85|no"We'n# q7(T0fZ?>m~&El|wc}_ŭ/jdmx=[ʃ˒6ը늌b:tǫoL)P:?3I1CMvqEp08;e(Sa+͊W 週뀰nb A)4sZ}P{N!zaW(r0+^S;eҘk7APqUwz~6rP79gV(ۏ ! cZCha/}LQq*}qE!!ރ d9p&2AV<⦕훮*q',Pd$*rP|,]ƻSce݁؂NESUL(C Sky0f)90w6%*P^ՠĪ&?N^B2 }J䐏aZt"?S.iucKRܚIf:pC7ڽȩf[$g3Gxd'L 5c8K[< ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثM?n'AdT9#͒0Lg"N)n4qC ZrO|Um04CQ?"YD5̦ Tl*]­銺li\P5ڮ01CxyhH4-2İz9s#@>'6UB+\-MXVȧlBqF;S|Pt״M(:RrsFz HMj'F6}qIuڽ+G5cFÕCc.[4F q]ӋVW/AAԮ5Ҁ#ML׸l'RQ'NZ r)T[d>EIjb aE' @l],F6ĸT7 >,SnAYZ>#$e1 !nUFi;Ҏfl#Ԁ mʉq4A61Eߠ,=pz39#ߒq'd&s0M)ᛈzV܌-u\F t#a]h(^eIŀ8>]--C(5ߡYU ӧ|#>j bhhqHGϨ B>/ /Pzb #E,U G+q*0ݫ~&%ޕ7qu|24;dn !eu*vj&;`9w-? TTF+Hpa\Jd%8$PE{eeKR[|3B<:`B^5Ej ~^StF~%W^A=4[b!vQ$+E_}Ap1U)m\wiTO?2*r]]VE+1T"?*1R%WK_xqU]qGdr@^ppˑ~,6[kz$2GM kꫤF Kֲ_ "\m\} 7ˏ|&c"ySB#6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbvL,wf,W7C-P~#̾'o-v@Nl1J ? Y#7@EEXu2 \ Ebn=~xAZ$ၝGF%'"C)O]t8y/[kK3 {q1OBYGawW=0H]Lj"~C^{˺Lm?@5+yȘËczHE xqcQ?߇#sG˺MxuGq Gi]y/揖tukG EgOGnБf-x$GլFr}Vǀ/}6]j ǹO kHi`!ܸCHe~{ߗ _v;Az6O_:| ~ xB^g@&T9 _ùio4'^#ù֖iG7}_GEsz_C||{__J?z?݇8Qhw;Uɯ8k`_ùii;z݇!VO埗_'q_ xWZ?,v~9O0pm,q|~70xa?s˵NWOᏆxw6.<{80k~ 'wtul#_͏+?,oK#sm- *W/<|,h#v,X~ù} -Ter65ξa #BR)iݎ3zݯ'r,5 IvߏGD~MS|;rJXH cjr~R{[AOFprkG- oׯ?<>{@~ݿVs¼ҢGo+O$"Eu4|\.\xVi1+ ~xx|h@h6qeva1[F@kqnu GEסSuv/|t( 1EblX\}{^A= wA/b?IoOd)|hIٯ#; k44{Կfyz}v=7 ?xKGZ\t #)4{_.o锾^RsjypKo閾\0S'ǗACVr×iz]o4/G1~f)?Ϳ_r<,Nnpl'o ݷP>ý|fW/3v{/ߎ=ȳ=÷zj=e.\4 \ ]~r.IKeWяE/+?/n OvG7Y,7'fR=9h=uplE:J)f=]qG; ƿ/<7Bh$j?<4 Y ,5ͼF7(#aQ;6+k!_qmv _ͅ^V}VCOCgGsg֍?X"ႂ?7[4?gەNSb6ߞlNbmccO`Gm|}rMHVMzeUWbglU:|Uk#|U`; 僌,"Ǩ$!;, )X "c&DJLCN ˮdUg z˥qCEh6LUil╔ x.mW7-]_*GB+ӶUi 6M*Ahi\+ӆc"ňhx4j¢VP$t88ۚmrL!Z*i1y8@8q-Fri{WPʋ`PSnkWMD<7$m_S[D k=*hp1)L*Ӂ,c)V\)Jר)Qg@:0UjpGuďZJ<6m*ZƮyPpڦ6Q\z2+rjA$#`Z n_#,+&cHG^@>A̗ dkg8TƦ;+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbFv%(~0q Xة8P6b|vp\ 8bNi|mv8<+2^q\,V哷vaNUؼi}F*#p$SSTQlP is ,Sk*q!4S,1Š25:5?l!Ǧniفh;u]~c8cL(qɷC{m&zO=I%bֳOό}iSS5:eaSvҼ&9t& !ՌѢ=Mah%P+ٓ:I6[p?+-Q>9YrG%03y=;W޿A2qWaNȒy{®9CñP048̃kp?Mr)+ʜFTQQ@1+Ӂ{p;bS7N.>Ha@+Eim^`2!TUgwZ ń`n'WnGl&z2ڗ58["}d\pǶP7?C˨W/%p]{xuy7Ƚҽ$އr,'1*80aK-b@ 拏+o\f#H"[ǟ!UӧXԲ[0[x:rVX8,h:-7 wm q7IHޞ|%1o-\VU6ޝ9QL8Y<|MFAD!$ }V]*r-pRF<%UqJx8nBV#қ␵tzŒEX08aJ.#\ (!e$lƣnvr֨q)T=q ?g}`K;ڻ4⎿k}G䦔\ 2J P+E-J4ut$vѨ|jp AjRAqxmѹCQZQNe7qoL ns%[ `I*h۞!J6pr)?v(Tudʩ ٰ~1߯].SmOJzu F;t>?6%0Q sHcv.Qcĥxý2T wG dҺNjZ?@*FF[!|QԠ-sԸ)j::gj`ZA9U%~Џ Y:<Zx#u uq+r*QJo­mdOQЌ};D BhcˉGLiq[~L*eö8{U2w;⭃3PiZ\l{Ї2>/ay%g:bm 7 geTLA/UVrOAbq>sަ9-jjN4KAaegcj!GHs R}hp4ƭ@7Y! D3׮&Pfs i^L[>?* aG42L?Z5|!߯+\6Q qWE{'d`Uu V~mB ?Y[㆐y%NmCLS6qJ}%ŽunUt*u9r }gcj}G`ꀉ"T[me/$'Δ&0K\`Y;F.q<% {Ր4{~n R}Ї;wh>0_ǽ/a?m֨d}FaޏIzUlg~??KWYN584lqݏ濚GY'Ƶ}c ý?Q?ڭ}B?د,z5%ߦu ٖ+@'׵v lqӠ2#/2{0kI$l c_-f5'iV?˙ u݄w'PyZ.9~c?l[QSw8fqߣCGkyZ=OMl c_Gh^]N|>&/ݓOOzf⹞6_?k`9vUa-t6%!濙=7k 3G,kCOzvE>=G~G:_%Ə͞-l(-u=G+d#R{po1a9Y~h_:k`s[~h>yPm~었=5sߣ-kiSAh< xWKBIMvRx?MK`<9fASwqһeV'VU1]\rY\_`{͟*/u 3bgMv=jfDcMvDAԟ}n.n?6Pt~|O5rZ?8dؠ~Yo0>n+͎T vр<i.4O6h݃_;53f~|_5sG[q5{Q1Ӣ݄gAId活 vɱ>7_T֜lݏF_j-{eI)ݑz_kbU8bA+_4~o_j> W(['tp}zn fxýV?5acA,;ﵰ5V=qUfڡa8}'<{Ckm*OciFDjz7,[ \VjW쏻-{؝\7UUㅙTS u1_GuZWҟ##qrCCK?{.m Os}]jrw[y)J؝\;w5vN25lC={y+Wmztڴ?Z5䏘xa6'_cyY;ޣlSr)\;~ &C_qo8?7ՉA*WqRc?4T? Pvڴ8MFˍNqN)&:P~Vj%<+r(P+uP~_cuv(PeWn3lIߦOG<7厫qoqQvjz(PqDA_ێ;~ƶl?r?rHc܏ܽ*/X+;4`r;_ܬ?)nYң}:~p' F@뼒;GsRI V`/$Eo?5w(OULFx܏ܽ?* qAj}:ܟϞJ_-==.U$u${/[q]?=w.ʈNŸ6~s/ w)<$11h>%ܿFYal:`릸~UYrH͇ߖvG/'Z§"uG禹?+g9~CA?,9~z 0~rmg[Ҝc}]) uG2IVg 5D (]S&΋)64K]DVRƭ^3݂WBA=a +AWa+.a[j*16Qp`kTU^ PTR:1U9î8ab7(,nz}g|Uh*R=b ۚf8rXxWl`֔l| A^xcJCBN(a>; WH)5G\5YTk]6nR 7ETPxo]`B{ NLUaolIY%.v4 &ĥáŔqS`C?#eTq%5酐E9G"jdU1jigjbR5"` ~+ e!؜KwKp1*qT4Ĉޘ0M)K%J%( F ^v1[Z8w8C ie'jrjcKLS!_tby3].Vop[Bc"Xb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbE-{r[n$R*Va%]pqk7]<1Wb^ ݐ\ FYbpZV:mwFY#۹95A.h>xP\W C *ɋ%bV͹ԯՎ[lJ8kڝr!\[2whq)vL-h߫ޟ>f&bvʼnpj{fz7)p["ib b]ѹY]2!4`LxO..c2FHݩQ]!ζ_s@h F8z liҁa@"^m)7\XvZ35x@*~CׂL &q퍥QSjo V[t C~9tpjb +*zdk[lRBϕקC Df1_ƗU>j{aM1녢,:w=bk՘lwpcm&F8je ܮ` W淙\Y 7#c텈Z01ЌS]ZL #IC%r1A* 9)uv]F-k-mcQy[}etc{{/,Rwdkq_Xp#n\@]LWmi>ǩ XpJ&n;rt?6d4bf7iz}lh(9 *q\%Y ?^Yec-1j,SH=2a#큒=^N* z%I 5 ŒoQ S4>8U; ゠>lY) 1JLwEGӍ%^-?ݲJ4{:v>L&aG%|p2ZʝP4߉:;,UX HZ NAP{,\!~%F,- j)`cVOS)גۊTQc,þ,'1Nǭ05Zƃ;NB8.0*b2|}kRP؜TSQRW6bdM4T|/u*F|qmSrťS8$ ܜY*ǧ{ UE? R! >[)_p{vōmED/{j#^3"9flxM+Āq.B >DZ d2[E2|2Tֈp3D9qJ6>OJȫN=hiA&߇J, L]qD~?Y!hA;gǷoZq fTld`v#q=)9qg~6^ Q3V?[a\;{qd%XqTqh0]pYv5)Zy!;=w)RJΝQ*6"\=;Kǁ 1RzmL**8Ci0TrXU~-[ƛgڟ%JrAN>;挪 6we|:1LrdV- 4f_Tf6Tmin6ż)ಎPlc/1To 8xbm*R;lc)ACQQ6{ c &M)A~P翆HsV ~opwbB(áR̲}]]+o|}'O_|kMFa:}Pjjy /N+N!!Wi Ql*,żF<8&:|dwߜvd1Sd$(ӏ!E>,]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUؽQqHvJs}ub?9^q{iS&/V0w12^3(TQX͈jlYύ9~z8j IazP_郋I|ѓM/#=N1G{0>u5z#o6@;=H61<6D|~Cͱl=zW3W?=O=o=)ݣ?A#S%޿ybn#70~RH: /O>\`Fk;2ˑ)>ZwIe1>zӂH5$ y֚ Pק"f/&C47 lyJgxXo];変`y',)^M~*k *^1).yOzE3W}xIO=MDoZ(Ñxizf^!}IǥRxut)g%]0|)N"H ֽVƤ Jz^vy ?Hՠ\o5pK͍Jpx~J "Oݡ ^\r4j^iᗚǻ9 5 Txz˸\jb:\QLek,s.@DT@1O pt/58V4n!wNJ0pH,|)#cwr|)tq_^r([`Ҁx1p r+OJRJ-Q`w/ ]F̚ZREJSQ㏅.}KGr ŷ]^}| '6zMWzW$1K"F)O]~r?O9H^ ]ON"3!q"SH`qf4=C+&F䏿%O?ܪ|㤮޲1Uu#x V}š$ִ5Ƴr>#O>;zDt-p~W}->S'rG$:oYB1L͟>iaSO'i1:< ! .z\+3F's&CZ.*SsK'r~gji%:'>G"?3vv1F"_ok3d47榘Ei&ALZ5 Dۏ r_?䱿5tE%#)\?! b?bO\YZ'˼)浜>{ G'K._ͫ8)0%.CA.} BD=Lp}"=N">"rl?qx۽>cǛ#nc{M"?qnP p@{ܟjM 4%vN=nmAՆ51Owۯ_ٌ3 _Ox\rxr뉛SAiOŠ42OI{)jf&4A?㽿Z1Oe?yd;>=?斠}``{`GM651jz׏f0|/掣/E˽9~J>lgsgjW'l;O ;>#,{ #E4~F+WCVLs%w z) y#GPe((fjk?ƛ~J Gqq3p8$h?Ap!ܣzQ(c>H6J3S+_tB=j!w3<;R_7d\8M1Tc~?+!܄Zz}eY7']"3FMC!,mLLZe1U9һ1tT=8mCQ#*iF׶&AQ*;X\:k*(}N;T•Zaƕ͊Tf8,Z"USXLJ ^޸RS1p\ !#UN'5(7+ն;+d:TT׮@Qcb &S-}J=ly4Ŋj9╭A00įMƟNXޯ#J_l*hwU M{@ellFM@ Kܓ|N]`dnf~LB1NԜS[eBHǗ ` Deԃ\^)_T=̞Ɏ('s퀥Z@ ?hՉlQH;iJ ԊkZ"PQ';-/:-xY7 z_ dp,3yū0Qг&Q&q/d=!ȸ1vV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊%Z=r㸶m UIk5]ъ/vTh:bj=i\BJ)_ ,Z OGSԌ,O,LQ /LzboM $W(n)\Xn3N-YlmM-":dlH RlQ8%;pD-qKQ,@>pi Pv"tǪ;`Vo+ iZN#qc^g]'IY+ӧ70"lG\&ź ONT W`-we9V@b,AP E)aiԼl HUߨY†/KI ]kR ^"ņָ FƂqiӃ)TZ;ŨzSEȉk\:6r78iFŨy ׵[Qrչ F41@ xFlm+Fq~;RzlOǫ==0)Z42GS#ndXJ;@ti3IQ`/Q\]nJR;6KJZ}0v 9`c"/D*wZ _,N>ir;ؒIn wǕɓadCqL-il6Ǹu!8Tcw%ĸq=r-]$3+lZJ=QkDȼ=!le\:F `a${rBQ>P( f)QC۱1^k+DW)4&ze"1d|!+qGOQv7F͘EKgSjWo PZ\F jw6"bxbT~׉JB Xk%ɒqVj+x\h5W1H-vǶV!"clj\z TFGλeP@oDէu81l )5,vU5ESJRl1xq%˒ u'kCѲ 'uQ;!ɸ؇KdZH7P!m+e6\4P;!%OӶ0`)[AE#r\j}{N"R`c@r7y2T1R>8;L +R/^0qStqcjF`~z}8*;X<ĸiFڇo~#(-ʤ]kxlYQm~xS;DuZg hm{qD=/T[ _|_hatŪQ6"Wl sLd^$֝G#B%>/2CۧM$/NCUpvPq;sQ?żR{uohc~K\W|H7S hZ_4E$5<J\1%p=Fn/%Ä Á+AYaƝOc킊&$P`w `U8=~XJF5ĤN&_ [k6?v*puktrQq\F 6N(ܱ)q\MpDTe>ĢޝpHY9EH+a\'6l皲IJBm4Vo\t?~*!rs$+dSlȄj )BA7UQ`RFʧ*ҷ~A LR0=eY\٤єadv߶c'2>YUMiR Gu++Vz{X56WcVif 63\oǡ{e<dREnJ0 ]'XԢm\6ێ| f0b#?"\^A$uĵ3N>ُVxCf'",o9R!&1б}d97W/{)_ہc5b%eO, OpOn{{hIcKO|o5LRK汭Hj0O8\MeOa2jv@n]K Ҥ-z@j[ւݨ=+99GqZteC`8I_˓qw?n@CWy?56/n_mraQc͏qc㾭lK&惢$6HQV3їq,Ƣ߇P')m3]f]A}H-+ڎy:(KiMFj2'ij)[aLF2:LEz mJa$nDi80/r^?E:O-1o_0.N@G8`.ee|2I?5A=kpʾ^d1Ufo;'7p+?lim/俑G~Co85?5-7κݢ/KkߗݒF*R~Kyaٍ>hdEx "͹PvHv&NWMt֏&ky$T ^$$rŖ>Y!s 24#R7W"O<*P}_G]UWqQ#NQvCB?GUWqOwNr zFp!IڽA_Ʒk;9xuWn0H${׃!P6_Lc#w?!bNqv4G2:-%!1J7s+_yq#˕;F2h&©{~3`:>zA- wʉGK>o=#q%cG;ͱԔ'?vNQ>Ouo7Z0:~xWDX?dN-7Q^[:TǷMΦw$ӎ_c+Ec8?V5Fߴiޟ+}JA_p]d_C_U=_)kܟV?ړ&z6>&GhmOLOz~Tl/kXq>=6#؏3b IX+Lim="I4/Ϙ5m7R*j@q' PC|'zcU$C^kVv I()=@1=Uh}rM}jzbI!P|aJwWf|C}QV=r-9d0*7UzdQ\mW(Z`CXR^َiw|2NJlT *jIXk:cB+˰9uaA_\!TvޘrHW"B?gR5(miybzcxeddO]Ƹ<džRhgzR'75ĦLa) d}*1lc  c?<$zc>x8/$ PT;x% mTu +0Рⅼi7'GŒ^g/qNe'dcQrBf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ tkJn'dr^)kbZ9|.P=`v9ph\qj,l}* 0(QN?:]С؃b'^X.O$kO:*6 1J.|bC^szLxڥޢxx6}0q&GP6Ѻmo~+ Mީ%@;)@8iվ-9#mڧqjWǶUMBsQø9"9xz'M["~SNro%]L0u7I"4N갌 6E:̄gهpy9c&4~l/ߡR:2ddbl8fjJ@z w5XD\ErTc=@찭0ZX_P;2cNt%km{KI爎&o^K }Rp8RFF8? }8eM[ZjCfW+)^IJlbh)N9y6pKµdA.]t`r:,-B(O1n"F[Z1k\V\bhWp8KDYi ynlQ=:g̥ͩQN#mѭ04wzȖg<`gkf|Cb~[ '\i%N=Ůo.}F[ڙ>9ԵFhW2@w!p5/Mcby$ ͼf8z>TjUj{mXm@dlW`>Jv)kCrwbihAzMx^F60ݣz96\M{زǏZ2m6.qJ<G=vZ#kP~)(Fd=V\E`^ V',d+ Hw+pB2l%.Fe`qџ߫hqa! c1DZ 5a*\.h9/:j##E4&5W$Jmi%MF«\$T X)QV`5 ЊahC+UsIFޕ ~]s (4?#rvŧ,lRGUڽrA A刴"P7+8A`l/ϐZ00WYp)@TdRV\r'y 7$̜d>`=3xc<n6B7b(VO̭>O %z-'GΏ0zySW?Vke,F#IZ & %=l9DLUcQGVaӂw=u)Sb|?Vq8]P:l]T'kg')qSUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]l!])j"~G2 y&.ky!eEZ{>f ecUm~oaYWz`GW 1rw"Ȳbv81bX9W[2Kb> hv,b߃=M%@>g _ FCtSm^vY}'7Kܿs-c=F><<}7 6o{aĻJniԀ01F}|׏7jCa.!.#/Ͻ$;yQR>1tsG2_zLwyR!_-#:?K{T:-*6;|𖜸 ?E^Ӌ' ]4?k9n~磐>C(cX-) cE}VOs3D{fRjaW244]&m{6@@c9S[)kp̦'EXSgUXP^NcX2孔1/6h̵U,׵|2\r&TV ,+2sc0Yޖd8ס͆=o~<O<𷙯X)c(N 0^I]b?&~E7eLdU+H̭>DjN8fk^mcr(hV+F?y;t#6icGeG=|j#+[+C 1ߢ ' N~J]o pp#|։zO3*{!Y;}`|ƶ+,#Y>Fy5~C/1tc XY?71ޟclyY.:TG+XEUnI׵r_h.O=OL|1Ɨz)v72I)Z`޿yP>):||y!ֿZĤo폍.CIME< ql|iw;ڋlfT0x#M/Z %#0x?W-Τ7 (]6x?ZS;1c$H8|Rzb:+Ũ M6"V!ÇGw،^6%%_#WM/Q?R?lz'#d&3c2}sUy=k]Aך}f0+E=XMvQw_ rCYVRk-Eǎ=ʿ}RM=E=Ȅ. ZI_ ;)/6 Q@)+K_V"]˯Y ,AJocw?Ĭe\9F nhÁo}GW : e~2/L +a]Lp~ءmiO| IBazw텬$EmmZn_)ur--r+y%mn)T JNx#Dst' 5ޘWw[/f QQ x늏7,`\Gr1C`!zsF\[zdk׾(k튻ƻ8RV|\`NX)!V2HmnF)tS|8V9!PZ| É )tF)Z\q%dz^Q[ MlP&TbJEAciP+. .e5۠%)n0䕮0JiJd6"s65ZZzHHHX^[,4=-"7 ` vqf>뒥v04Ec | oLDOJ27z90A' dMhߘN~!;H ~Œt(cev9ŋL;߶( c5JRMs"CZu# *Wr~,VD,obXW+ڛJ⾻O;WE,10n #U6$P_&TcS^/ttءvS$Ð_v>ْ9:M@U;lsdUTjX"aF4*ў?JVǖ9>%542! y zdᗒWbDWe]a > LFslpK:1`lR}*rU0|'~U\oV#.{bw 0D U=Z-,TuiUkLI^H*A̯QQ&$,+xUqMflFSpCޖR(*O+ԓf9aEPh}.H}Q㒮K/Jq)Wqp*uS'+8+]V61 \Ҫ`[{֢SEUj)vJYw\d k]Я ǟ6QceB7tg3KT|æ(Q&l>xbnT GV=OjLI]UPVIQ\ -E*v<,ѐĊ&9a^E½2A1AeqF)>x&z\cɟD%\v8k7cDžTKnm; Gm!ۏǘ?юcaQ _HVƏ?G 4Zk"u:~! vzFblԎRUj9VqIɈn;P[wN/lst9.6.{-B}rOZ\BU^ZpӦV i/ȚRB&'/4kN sN2|qd5C٥/j_L'SL7]XCƼo$xH(ȼ^Q{G*1!iւ?I\FgNjX›e |>Zվۀxw q26C_2kO-P~05ƷK(}9Qc#2~@EmMbe le3`N>dq# bJ ;lk  MK-/?!2#E"RyΡJSM$e?-Rž#1W}6I:kWqOO$o8CC՘ELF*8\&kωv/TÏ.yp%FW$vї0ؿ~kx#!@噑]Z`-ۙW'99#!-+dbRh'$щ.amH\IjtPgK[RC)Sb:oIb׷ѐ UOT<([\H)S#MNS9ݏfPr@Nhu1H#{oE(;RĞ-M'|@96y.yoތQ+^Jwa_[+ʱҧ_d~@8[zrCo+YB}$-lg|7+k cus*ENz.9}Yw:T|r` -Q HIST[-~?Jq}7QWn^'#9sgJ^oO׈%;hM04ďNb&tu2#/1}PiS /^׊v9qf Ҧ e~*[dURqlSם]nA࿩Nt.SWПd:٭hgF*~c+oXe5 RE >\LlkdvO*40ܘɯ1¯1tHgi1oʫ/2Z~icWrJf싏 Sc vj*aOT.:/1'e^+~J(!Z͗LvUF!F2UT8B)QNRg_ʸ/Tvj_,am_~:|xq\?$|Ь\WgO".Ͽ3Qy]}i?)f^a _p@K(h*.o_M5coxBZ ˟c=d4 DShw*/?i?6v /aa?+l<+xw;U8 j=ʍ?{f:񩇁|/_"h#'Ɲ^s5 ^v!> {<'zB>7CPyWD-018SǹTh*-ZJ%˧h} ]~9 #WїmQG8[TeWdtsBZ^}+g^N ^(u73[\vG¼QwBNzv8W.>nW>`Z}68΀Fm/|9|zi|H CӠ^]+33?{i4;?^=n 1? |xwo?.Z-4.tQǽg_/ Rw-4>]}m?5to|w׈X?50H[;/.N(pjO͍*6?\;~ G"64`+C_rϕRf*CHa#s/g;\Pu1jOm)!{6z['%E1{qe;11y+YyzF7/~G z!?,48eecP`U(2x~i W A {U)Xq"P'lU+| ѩw/)iZTb|m{dP W|rCEG|[Upr놕aMz6zfMzukT ҵ ø) J+Z7acLUz%r P"mLW49t*0\%FT5鷎%OK*;a #zAd;Zz{NSAA&6bJ*p1FN8 |ƴBvˑCؠ7ߧ\Q,ƃp(ݑψ U(\kS!-Ƈ%em=-i@ k䤈HǰWl'$$̧9&')fś &^a2mr-]ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊[Z=t|2@Z@dM|w!OOɗG "8Ö$q 4N*4Í;Ip=2i>IVIfFZ>DՊ )ُS,lG9q($+H8'AVU9&.ت2#s[¸. GjȰC| lXl huwi{QF˙4C;mLTc`YT;ǐ4l4AXF%NSq;с<ن;S ?$4W{X^pJ iN V'b7D[dr'& z`-&qq)q۷fM/ Pog|tG@vܚKD᭠Px䚊/(zs[v%7ʞCiŜ{6 zWLR} d{lrCY淾#{c+T;t!k $N&VA 6oBNZq0!+]>¥.6?*@U&@Y QC8ֲ~ ieNp7F*(zɦ//_^)޸cqf<V 2<6Uoo )Z) Tc.\U|G . Qa QQd'}nq)l95n{lI0u4;WrI%и# >샷VP/;*œ)mDc}qҹ_,$á 8"^ !V2T#łarIbMG ASvwE ö+CN9TwD1%Ab f5yW[?ŌZ玞Տj0o7?V)l|'E!0:yeÂI2 F,y)I Z۱|:~sVs큐rrؠZMb K(_wĹq4iɒ+UMŪBN\B&)%O^N*U& ۷Z ZV?p( ˠQt]M#(L5lpūq|.Gf;/zHB4nWqГW"oa~:NHhA?8 <01Py:N˹bRp:΂sܥyw UԎcfIFQ1Uf[ARv#0CLe!(W#\(z<2PԋC t߱DǴUJ㇪QjZbqVe#w2DU{ OUxlMcJMqU-8xJeV+uǂGO[JC[ 1 aJ(C\[a\m~07=3%J`zf KjPܼ~$vڌqLuى$o炊 c .5ڙv XB#WzwR-FPB4ȕBLr8geQG((.gm;\|GA# !LXTi)WMg›Q/~*!aUsct#nX|;jzc\@V8BATrA3ES~sZGp=D~2i ZئK-0Oq6AF&#AK強Esqs8ha,{#9i- NYʚsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊nN*hA\!.XY[t4vcgdgPՄn7c0cowH[K|5^ƒs KXd|᥄ dqHyE;lXjc14$Wry[P?,p|xjޠZW-Qda5QQKԣɷr)Gݓ{`ԏ(zW x쏻%3?o5olaOчg=LQ ۞ݒg5eq!i-qG%tS\+˽񾮽n\}٭!gxMObjI7_fE>Q5}^od.<3nOfז ?IqCnL^r3 g l`VEob |z٥+oՇ<#](EZi0?Ƞ뙡O4-69 TR-~7d;94\|*9 W0-zR^:]<.R>]u?, m5*iNO9<`Z ]BǨ P7ZZ|Q;0z4a[Ĵyx ǎM=5:N|_eO](z?啑~|y cE&~?9#@;0#幊?B+XR 3O[J2Aˎê(`W+v1w$!ZdUDDwbxEzP4}Ym-PeB+ϭ${Q@g%z籶k[ x0kɄ5O#qڊQV!d+DZn $^ jcd7g͟?ZUR'9wf7 8㺒p}04;puHyaw]sw&G*QkWn6պ혢&R+()}RF~]o-== QM\es6=2_kfj>>֧ɝmkTD[ZyTo˟WQ:F}-j ^\oWOȁLsٯL\ty &g98'~]**ܟhJ>߳_t^V'1vG@fg4Xⷰ8x_قtgP$-uS #krq$? \h}yGmQ`+4ټX_H~YyX4,ÎFleWl~[E5W&Q"C/IPUI!j1/~.:>yv:d!fSgY7 e/Iy&6YZPi@!Tle1"*/,}^3;Yٷ~>PE;Hr W$ JM*Gd:/N`7Gc=3kqi{!۔Qv/^9/֞hJby$%'~|MY_"hn{dF[$[5v1۫ȤͺD!(Ů^dG9>O>XjV4SɿuHm n1I-N~cH۬`&_^ia-:sq\Bxrvހep.NSo i%=C)YG~/b^p:œ3DH~YDcIb^}Vg(@{p9fǓ}TMq 0L Y>:^}UA{qV OyCi=[<vVߦ.ZgO!$'-] 6,$Q*xE,h790 ,ƀnNv.iTgXw\wN|/2.]$4O7!LgE.$ˡ>5?_Ձj2lZg5:!tL =$&l5~^h\W4NeaRkKEG>M0 ZwhlTm~t)t+[2ȤFT&QVV iWV_w9.2nkO.8ynϧ:_L~o.ohS~rK瘎ZۊLݗ |i޿ʸh#~LI?nywTe~?7&ǘqtWeӠan]c?vW@c#/ޤߚcp}bُXKLf~eަ15;KқD`GޤG/M{5ϷG,i4\_4;Fpr:޷G7[vǍ6t6_;Okӓc"3'U/wvܟOqPO^8G濥n?M>fߥ}-?>>0_kuU??^XAG݀9-QNvlkA>#4GPʇN\T$ -\N=:9CڧҚ+cd3qrӠ-|hNPo z?9dί'ĶĹz?;Ǖuwyk010nwO(k[IOQ0~nw/uzOz`;{Xm7Lj`wq{Ar_k$ѡޣcnNl(Ayރ._A)fޘ?;Q?-5*Ȁ{1%/|ק垮 xefŏ{*=MnQ:{Y\hO_Ԉȝ|{Dw+_)KrQ/Vkbmb˹#l?GEkyzָmqG򏒴_Ozlzc%PZ?+.J9z(aViCp =F?Lәl-MG~HK+ zR|sۏ# *<ؠ#$3+)2SWnXªL*6E .~$*)7&Ŗ1U"HAʹ*V0*Ut\Z dUoJW15­*wnNSF4W1(i+a75<2(SsObZu=v9­}PR˹uʦ6ߧQ®]S,(ZzĎkZa*k:JTIx׮j~X,^O+B*;bjv%.1J6HzbqE.Z'*ӡܚiT"== 5>Q'u<((YKr%홶p-XnqJ*HjD_TzSCPPbT2[O3HR ΘŘd[ZOaQqUC;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbZ{\$ xM.'$^=!al|cqKjvZWbP}I4OLU08EB$Mim3Hy6Bq_ WS#V SZ &Pt2T1/lPJv<. -/ )QZә©&B1V5Zw6U}M#txӠŔڝ<0T]=~FOC`Ca;.%B _BTm 2ĀO/.})$5'#{yld]L5U;;u.Ǩ7=Aq*٪cɦS2M-'t-x%#s<8vAˈgЄ$2fУyvx7aĬnSn8ncb6o (R}A<ˈqŤe}j 'J)^?Ȳ]G#%GcQA7DWh@cȠETec߮6v4 bb데(v.oOi AО'"[~~&H' o!EPvv\cLXUkq#c`n } svŰ~#~,k~2Tt;o`Sk-Fj9OlX(Qס=&l7`f$}'$P|C@A<4=~y6 fb;+'uG|*Nx8IAQ(zҋ#r2 ܿb+ v•嫆VBNt`j4unTF5iUDq@(9il #qb̢YH;K\P}[CbV[H)b*;S+!nAZ|>?* c@ӿ>m\$?F^@r(A+Q!q@.+pM[s_+Q-lG^N\饱_X*FSQҝhKA.Y%pP⾨ޛdؔDTy:Z]:@ qqmɲ_`$ 5@KXT I/ uf\8 J"n=e5دLGƮLzv**du?\J$& zoL+nu)N.0׾oB^'ppHXyM,NGl KX_ g%RO`K'=RLrf@Fٕ3c9Sʿ[Jc*5RUx{0+Dl{ @+C=AZKPܡ4r]Up3Xާ$.Я$?*>8S6ĜOMSLJ +t8IHӀ2ki' 2p֞u9t9ʽ%?dW9TYWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]8R젥U/x A ||E5Kel~aՌr׆ܝMVQ'+oxPgASZgM9Sf?N#ksa^7%_ 1ʵovаkQQSYiMty8UFHPIG_KIɱ~ {ɉ͸d%\}(kQϹY|8~c71$^h=d_}TyLՎ \cFKc͏ [sm_l KsR6{ ޜsq\/,m?O}8ǽkGep߫2`I89 Qҭ-ZI+,z2I~''u~19.14@mLN/(1?-+Y94V߫ 1 YM|mG:.ZxEsyv ,!Pf))fDz<̚,]^%jڙμjҁڃæ~%ydmDŽkO´PA%{ɈLL'L?O]rds_;شZ?x4p!N6H!^4#p}Y[l*6u)khیY3U,r<wKr)EA5\PhE~l>NwC&EMs+c3H[~_iQ#2 5vOy0 yp܏?藀v[sZ yCSiw ZN ųz-$aoRQZ뗔kwe4Fi6AiN`K4,+ a[׌8?̮3({AY 7G1IOҟO;xa|'N6G(:gӦ4j}vr('e}]VSIr՗A 7+V:7tc*6j0fy&xǘimjNp]OkGmyOkO,@#UVM8: seBඳ1BW{*cuV~_l`&pqcw FMgDmsG \e^4"^hv$EpiYwb]s [iŗ|YS^>T_|2',R$ʽC&öb.,ʸOquޜ'zdY|Ich@;e^}_}m4m%pvTQ"g3ގ9xt1W#/'ptTX|9T%Iz[i 2B^٨:7/5IKq>n v1y'z~50Կ }gJ"ꃭx@៚s-KG'u=pO͟>-McF4 2;cϸŸtN4[|L>| I`>*vea'W;kA 0O+:?k0'OiF}a ;4evSj:94?1t4Y _1~J}/VVj{M^ɍ)3+q)9-+B:lj\?#5JJ~kӱ8Fl!5?ZhROn3zOR1 O͝4"_Z^'sjXaG*N?oVŨ0ɿ囤v|'˽k~l} 1r' wO=7(-޽8>91=M=mnn3}hxzGfikT#w_'y7~d'"eXms];rxҧiφX4#{cJ?z#eDqWǽGj~g_:~*~yi.Kn5^"8J[Bzc&+ƴ(R$xU )]«JR1@dP2~CU6\z҇|PdVz=`h)u9`*0f$vUܞF U5v_ )uP^h: |1*[lpȡKIw]i[ȏbM;&l)wNY 0SQrPox{e+ ^Fos(@ڴ p!er+ g|^Xژɀ9t=wY)MAt>yP SQV$b|"7 r<{rw8N6R:؜Pelhw8܁EeNOVj;@>ZUe8jݶS](n٘FOC[W8b]%$b(1fzmmC mdAEG*JlR,ƟO%acUUt=kӮ!q;! zF$nqKSJ`'0MST7$VVWKa9/NǵpؠFE0,q選eFk_*]PA51{l|N,Zƺb;Wo,'`WT`B{h S#|\y4~XM/Y Gz&#QK'>Tx.j0ח$߷ 4=&cE0_Ze@oM#'щswHSZwV7t ~rx?*YFޛvP$|C ]ޟ ?u‹Vڝ=AJ^k*;l90L/Bq]`*`W 7d¹[Z( t#amtRICOLΡZ c$T҇®S{G׌}:)]¹*1{{\T;lW⨔ IQpҷh>T<+V7Zd|${ rp~%? F8<Ӯ끒7Z\ir7J Z;Gш~?ۉZ74އ™ll*\.!{h%+O9N$T'alR^$Cu6+p*waI+:u.ka&L,OrnJ|8Ѱq@ %V$bv(:6H A9_f=\'q' 7́uWaZ1ۿ" qR7ȼƌhu[q1њliB26B=c܌,Qq(Nf C}_£8.Q'10bTF1.B>;w:i !VqY8 mL2W-ѱ[i?;G^Tt̖\]qf B[`PvPg5>;An# 'qByӵ{xaUu邢4 bN+86JPƐてQ\xa~\ao|T%swƵz,'NDŽ-5Z$UJa\eڐvaQ\'d yp=O:)t^Tr(T-\c~+p`fS#8}fA=.}V5Shi}o|mnb^'}1)u؝/.;4ヴs$K5DjQ{.25r8h(s0?JcjOe Ī<~/cY{am*1$5|;`9hZ#֦l:z%.?fU^>HZw2[}ramg(X3[/ r%BĆ Mq 6Wȷ/`EH#/rEo."qvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUؼ=V9IQby@5m_--4 K ţ½\pZ񻼐L~|(nh"F6)7_*zmPMΉV5_ d e͉v GA#,Te gsQ,eG9?,'ᝇ Y|ҿQ#\Y|J {&] ,?:Q|l}S^U m\ qy ]b8隄22.\<1pN#e6E&;9z%Iǰ\q5_Kc=$ E+r>9yN:\o? >q_(=.M36<ܐ5V~,.x/1#RfV;rqU\S?C{Lo!2̈́NE?֣5.r1`rV@c"$4ɭiu m혡O%d2Eߦfϻ`/y] ao2EHQp|Xf:ɺ=:^nP:cC7Np/HvZ "8c/LX5s,Z^#˅ jhߋ<auu%܍!ci3?hz㴚<1e?g=f<.ݮ =pf j%c}/z~O1zI8~ȴ4aB6m H=k&OdhQlKYcJ|w3QLfP~eF2#yGN7ShӉЁؼwH>v?Lc/j wzk߽*d2] t r]O (qE$h>`6lyFþuM'wIUOurɣt#>fBď*@ѯ0G#3GYe]ʣ>zC3ˆ(/_kb)T܅ ʱRen]ݍ~^ٲ8E=$ (=>`^1ơT{ AO|3WLBk{?SL{ uk:ثMUZ?O0%8ޠa-I\5ƅܦr2!^sz>($}Yh+>)agu] Vgo̖u^9'eM Dav2fKFcRa0&^Q'y ɜJ]y9=@}X2B9 o~Y-"{4jHHELGt{5uisBwGG"5]>y/ '~#*1EqXk?<|zP-j6x:rXH9qF1!:Լg LẺt9;r4ZcR>6ɲE?$LLq$|"m`/>]F _"h#Wᖯw?-%t` +㐎c/Ip"-mn=FݗJØqDruIIW߇gSԵClaP |!ܪ^~/N~>[W߃RiJ w7/VAs-36v%)4ߢb7_e~7~KƏw⽨2 ~J?$~MWm ?o陵XO}F?$/[z5XY )SǥG u{n$;?)zh,4uo_ܹ|7yN4v~ٹCל6sSWrl\W%<Y.| _qY2ٹ{变Sc_yDpU!? }$ytVc|{'U?/>fmX$fY gY'h>5|f:1#O\~d=mqo3ٟ?vLv>_/<2*Wf&caHF2%'e7Z_vLLQTQOӧ34Om/<Ah+Lky dbLu 䪿wP9鉟4VɎƟxHUX@zTLL?gD#s2QvCEY'ʀM9]D>,?ȇ8zi?qȟOUq⧕Sě[c#9FC q{GcǛIu8#^l@O+X{cG?iG͌_QQwo_׍>k鏿4%Փ vk>\L^ъ|Ca%@]G3ҡɎ:^`4kƟ4O#^j3ISS4('J17?$b>vKL_*Zo1]S/r< O=~̕l@,]S~rO~giڌei5&&<)'|eŒMzt[lӥDƝ2WӉ*oA=N`UN@vǨqT<~ʞSFAg]"iZpҮ9 ֹjvIRX5)ðʭv9*UlN9Z15ZU4>,pNe#HZT +iW/l4*<'[ [w_Li 2 iHґ~=85pR1i aCQ")WSRjF]iUl;~) l8T;(~)S:e M g2Ƕ1 TW+,[cR2*8=A+!(M1 V=@e#~11")nq ϶C^ȷo 7U@uƪsjتbA-zTDbSbzBf*qҙXɸ]9Kx"@#WɾT[BqlhA|qrc`e#&o|44 qҁ~9:;Ӕ~>&+rB0-Fp tlH5N\F,╄bVo)Q9tUi@S_VC\S,Jzu&Ů+ mHY X0-B:"y7bZr|_NA=Uov¸xad)8tEU>P1/ߧ,e9#7]qlV mR nj`Ji1ӯ #sӦ,8E/.8 ;W;F}O$ZZ\rO(oCԜ,*/$FMz`J/ KzCȠiӠ;,^s傯"u1B˹_-Cř(8_Uwê1v)PvND"v҇(*E o}kbh1BŒ/w`wCMqWA` J*Mi^*A))5:V'"r%jT8媕ڃ&b  mQ \;צN06Z:Q )ٶar:?ω|-Z{1J׹ 9.LCZtΗr+Yd c~akbqf+n'J0 x0KKr 7yK *2\҇@;ȁW}TJN1ր0ڸjkSZU9ŏ֘-4, 8$U#F߆IUqw96&4*lpBS8[E^-Zfi~Uqv*8bb'8+F4ݥO0_ Q79|y8e樃 7F*;qˊ6LhS&mTSn_hsQxcU~XNѿ!^ĕKg& 7&f9]wt-xbxHS]GuqmVʲ/T>+l,9f1x7zcڿهqwan6g_SUdzf⫄|*;{/\Up[t|\5M{}IJ;e䧒+D`wy9hlk#G9]QLe u8$jDUie[u.-l#xP|呫2LA2aHvq%jCZ_E LiCW3ݜ sAjkihíFvZ9䆫$ [<ϪY +OHeѿf:t~cF1nzrNZ;J}"/̫?Fx1FZ;Tax 0P)1o*~haD'Rlqe"zqx5ۆES>Xte9`(y"?Ko~Ln9`}鰈O}݌58~~=VºyFo+%إc?A/=SSκ;Ot5ѸChsU-?bu(5 ás܋rkl+ } UчaECE5I=KXW?!T92 <=E=̘%9|/T7NUYW= 8YBbGsoF9,n*70/*lm_Gxҽ^dCU'(`~->y`SMR k2gIҮmLV֙`Bxi)As;[.5DtTxaºLz7F>#k{WGHNC.!IAw uuDp x暍r< :.-+iui< 7(̤ҙZD0 BI_IZ㹪p+Tʕ;` RFI=ُOY3b|HI⻛0X c)9PO>OԽ}J5)gR;Wg4׋ +,hޘ@Qtyt[ψ]+Hfs@@okvIM\f"\؏W <룍>)ac'?iq3/˟2~-YUBIp{K&=2sZF{DjIĿ#6z8$pe2y懔,Ni_[\F@M(ȥ]fM>l R|G˻O?ygH?ĒZS~_jzH"F v?k6sWMNeFibmΌm}f;F QCY6h һf&`Sl`j`VZ;Bx 8V\Ls>iBeauf98d*[0xgX40C8*ylKUI24䝛g{?YC'To.A-fKzNOP#1%܌2iƉgOʇKfVܣE,smy:A1J"B"YҬ澸n1… {\ؠWQq\bE/5RzzחfSJTVǧm9O@P/*=&oW]WL+,q/ΙTGg/3}nB>s4+ql̅OdU0Ȟ?,DHQQK^Q9"IR=7ˀАu|x? . *C㼰M!_lEk3йZLq=W1z,H[a;7$f㊸r sY\MROu=H&'K6 /)&wqYͯwdGhoaC]po|SaS1t[ ?؍;ww .WO9A'0w旗S?N[hwuc#G7~FDE4o X^0~}}c\̸,bqяيs X Rr|(?_VacȞ$xaI#0P}-c)Cѭf?J IAc rl,3(v;<@g/dȞڏqG9 n}I2on='([/$\A[4COpۏJ+KKxn_08y^ׯXpG'羱DpAͯ_~|^2UiQ~g`}Tt|l.f=,˶=P(2cEvU&=9מ%7z}&y,~mֽajK_ND;+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbI늻,4H $~,3Dp)T !T{ ֻ*Ƙ訫VdO4~l~R JآudbĹ~ol*vZ4qe8iSHGRFء˱!p%VVMڸ16۶(\lU{(v?S ݪU;a y"1{l[,z`^d TvR Cp|NBձ~<‘E `hzd[Ɣ 6^Օ_8)Jo\Pr}Kx*rX^nxrC>dP|Onk%`VW=d 161C*.lM͂G1dL)U3 7~n17nd:W TY\0' Uc8A,Q 1H\p̆;x\q  ㇑ u\,u"<R]|QY[ݰ9k x2׈K*H# `=㓏ÁOU7w'eX!ܰU F❎ECVEː]x!s ]`;u*Ƶ|YHGۯYP&­<|1T_F lU+wPiV2 c(:TxDg.h%N:7PGg=p67gN4 ajA^^XWo|V7jO?RvUp4K 4F%hݩ\oG{k(+=}vĤyFy: FQ\drħb0(yCW_Ճ Kc< ^5j DZˠ\L_M $4K!1DSPz|2IY(:|l=Z\0MpKWꠠ\2\D=}'E _ w'b}qsģm}[lvv9Lw/_:rŤԨ9FL;$)bܣ GL2qc*RBf&Ū[W}LVy~F 9#5y(^nXTlzaH["[:m%nC6L $IUu|0*+* 8Ih'lUrV7Vţ?1P`*3U0dlQg64x^&ŪΏrBm಴6aUSO׉ey"$)W2/Q9#I.=Kov8]l*B+?pmߦ~?*(L| kD 4UI,{7XRQU˶ .S(fm_~|x⨮a)\U*9Qjq ¨`>?YSb$ 6)£} {eF*fQvaQzC!znpra !f %omLz./ ՜| S^ Lbz|9l|khf5 gfH ֘X] eiH Ur& lEw@}5b)Pfbddz\䤩 q"\iĶ80ǁNXg$zTΓvMa_ ~Ad@F_G Ȝ!vO$$$dm9 v65j v~XJ VO#"p;Xw)7̇\cg pڰ= 'FG^$2ި:?&o4 嘧CU"S#_4WV"EzW"Oy~:?N_nXe#NU>rM.\i+!/ҙ !Ϟ3"ߙe[}\ Gȭǒ56F$QV}Xo7醾O>)Āj21CN|єhh6҇rdƣy5PFjLXi݇*P vQԖEfL˄-,{¤uʚ]:`kMq%pռ{y؂+C@|Ӣ^\jLH10 rDF^>ns+ E7Š_Ȧ=<٤gT򕙊$^,F,ɔKD3"n8ik/&iL3zsO3! 5)O}.6D`T \-E8_BJKӴ(e*dK;$Nϗ4_듿˭6{HfQU[Iɖ# 6:OrI ^5pZ*G&L Q(N?בO͗E:`u1pmOT;zMo]**va.I ȓOe-+$ B=F>?k CAm&ِhw7-G;;D(w#l -Nh9z^s AT΁Bzxf6YJC{9g4EuUe5zWq)jo+۹nt9j3B3ˊЃAFN{[ݒS('懖5̐yWkkR>-N!~\=>x }L?Ϻ-j"n>Uŗ)gj1; 28lf,hI?NtQHDx|N?ʸz׌j)XG;S̱`VKK[)ndvY/>5*Z"O.L)$+Cʤֈ?쿳+'O{qOëD>ln_\?*;7 ~gfMp~RKT~OHcyRLOlgQLӯ/r2{q)zI q;6_mL'+EQ%$G@i[3N/4,Et#ƋP~JMZmkK~lr ^]RL اۍ27|?.ટbܣ!~O'_c>*BޕTx(Kd&;5)lAQ 0 GE~J-oa̎0\ʖ&;Lg"ڙWɽ:2LGmͼqQP~Oi5ykFCH^h'u>fNKcU(c,Gb{ןʍzFgx@/^h*4ZmW*(:6w]em?İ_G9m7S;kžהN1GU_ 6Sܟ뛖!=N7TkrG>N*46e1:/΄Eze |L9t4PV?#%I^;!c ^Kˆg T(+O$^L9IY5!8@v,N(I;;MZ7":i1^)Hjnlh`<>M1CKynJuU/F#( ZǾ_LU Vh;*mANr$&ѕ/WW6*mE:+{ZV^o? UqZ 9WEʮ*ٺP/, Ub~UD(|xiAeڧ~)CFo(0$Q0!C-VnƜʮlQZ Udl{& W| Eiq3.ABLk\V+b@ ȔK_S&5Z,u=ŀ},dy&D>JP~Sқ ePn'}YBؑ¨)No|pS322f^\)HG4!' ֟YҰT5 (7QmtÉ4*`'^,A"ck#pJ*؇|Bﷆv4;2:a"FP4bXv.@971ſO*\t9M[D~y<鱌=ƘC) qmEjXA+צErN‚r[>hGSW`GObچl!*[ 5agF&8F(sewx i4NK@{ Tc;S鏎ަź\=j` f6l[JeGe \v?,q"fr*ŗ99[ՌEN49qk\ 7N$u ՔMQcM~K6 !22<|1Kl݉cFkZv8<řPN)q8vhϿ2L|zJjnu6$8moFS'ݏSㅲ8akCb`|*\pXNE p$WeoC]bj▎H+N-eJQ]+-AJ&#sFU0"0L*-}m50n?VE xCL!W"t«2$-H>>eMi.Ǐ{_Q튻tCD;Q㧾CݰD"J}؄o2!֢UkYUpv'7N^8Tq=/E>.z"wdSқl獟olxd CAuzx#8p*74:r^pU=-IC4kՅL׈=PKNDvʷف;P(]v !_l}n Q0|$oTG]Y6B2LG*] U٩6vl*qWeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊Kt`wIqΏ+6I UGŸMw`nu8?f":ډ*f8Q*[{8ǽSv4ɖ”*ɍ Z4>kq¢)HHoN>ռ=qm"uj~<Xsno.?$є*q٬+S^Fqa0C-3DyS4ܟmZOgc=1yQN _zBŦ]!榝%V(c-GடMLޓxdB~eߎF~FO~g_,$5IDGlʟxTl~obX6Q8b?.z{ŃW2F1.L]q±q+bL>2IL\qCeL 7RDgBh~v/t?.ڇ}1{i7FK%N (@ ŷ_pwT Ze !``Y\Y '],8(>-_Hkquڡ c< F׬d2ĮiHϻE?!{3fBEiPC2qaH`F$!2ɖ_FGiHG~e#Ƹ|#G3GehvbS"d#,u lDG&\9I&T^ӪBV`^#+q5&h!>'v։J$SЕ%8 $Oa^匏/p 71ˎ\-/Hdmꍿ A8"cG/ /$I蓗7RZfP@c2#Bi6頩LX0r(HY{z0q䱭FRqeV־PIs}d2>4y;`+1sB18zI^o*%`:lx2wI0aS`F_%G#&t2z#S!edQ%ϔ䀱M2<8 {^Pnf_O)BEA$we%lWkTG79]-HFּ(?tea6$rIh<1sԚߒ'/(vH?(ǩ'&'r~K/dY7=7ʭ2~<{9;gh#aqQ#5O,:O=t"*YCY ^>oco61'Y{gξVDtE?vLfT2dy~ M /+q'?/rKqHu?FW6=qOz,o.?@$vnn|v}1F=:'3/r{ G'U&eZIZt27=2Kʡ+gH\hw8j U7*SG%h~p8G w\kLF)J94?R~ʣx~8r)JxZ:,ق@>뎣xcȯL?6]~-O1 #"}ro`:ȧ"}?Etr=l??|7  G{Gfae޽_ ORTj?r#˼)?Aj۫rrȝj#soFC/s]P;1?%G={^M<;oT[Nۜ'Q\=̿zcQTqe;wD>l#"uǹ?-Ȩ/\Vb+Qaeqjp z ֿ?Z?8uEOq3]ܗ"ƠE.oKɐw{Z0?1.?hH8II&ָ$@G,^M~mkQz 8sd^kfיy,?NHgzFr&cg9K >4~Opnm{S\Nh)R5o]솖 CQ%4i&${`{}Z?'zls^ÖjĿ`{1Gwg2Cx{q-?H5^ud@I>b_bƼtJ/Q<-G0r"?&kZNkA>)r.L֔E$`=yl_Ap)+u301\tg蠰ڸ AқdrHхvU,QN *ݍHߵ1&~gn#ɾ.vZF׶XU0c +T$!ZZ[V)cW z`Z.һ}]plzo if]]rB. 㛦*$¨gQޤpB^FIqVEfdaM,#w?#0[D-}#: -zZVM!h+-m_"c>C .'yI 'ymkj{a>JoT>߫96!헞msݕ(t !vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثK2#t:迯v(]08_V< ]2HZN-0瑵Xw;5U EaTɦ(&q޸kb2t=02^\oƸq$ţ߮*Z5|qWc|Uvare(]*o61y(v4x.#;V<9>.AcTڦ=$5ڌ\ ѼB&#,>#py_G`}h\{bEҦAnt{>aIQ`oI$lF_ɺS5{IuU;rS\@׿ͳCz05~, lćm-\ZkF"ԴpE<Tn+rbTev=:ևh݋ESۮ+Kr8Bь@jm\ #R4W5$Txx6&UFlSN1K @z{ b:wVl]80;C0+H!NA\:SGi'#salEj0!?N.-ڇ}d1;`*'Os*UpƆ))q#ޞ=d-ztqWp7]h>x&1AbBNXIR}dҰmb~l/nhjEKTv*I: (WS:v1MT/zHQpH8Dۦ!-)" _* |5z|fr,3X'֡6#%jP/=Z,_`YҟNݰSpDƻVǭ|fƹ菋zx㽭;gkuֽ=#078- O_՛glz_?%{W)0$m큹w\zn"؎ICmEWiu.0xP1s1cN{zgs[Ql9h[ߵb=0"\O5Qjɫ1}$ruCzafQG,^(|O='BY|)Q@'o|*NŀȎ ol e-\XZ#^<+,V&<̛5P_XSà̘Lѩ&Jo}F{ Q?4( 6P{ %[}_ARAޟ~HsJԩJm1$cJ&|19;=  $SS y%ױiϱXjĄ̇̄E5^\7¾DVv\$b^H끠<u+R*8#u~uS0Dc_3Dƥp$A;gU{!dbhQi%{2S?q(%J8{ozS ֹcvZ?bҸB؝j:=\L ]bYN4xu† +-צ*/aRk| 6&8KҸ΀ '| ^M'."l88)5|s?C3(jR|3bpH_Z*ҵ2%Uѱ%EFvgadC8bH( ڙZHQi!_q{wj?kd6OE ?=-)UaVҍ]>lZe8y O_S6%wb.V)qR({ A~B8Њ|%):$;D OGї]qUA, X]/uQA;;YAMjB#ET'sq/XU'&CS59oT'I oT}kNWLjk`Skuȧ-[F'Mr}ʓ!br&+aWeUٱWe+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUز5 ]6ta3^=VNCTxg_m ؖh{m͹^ cA+qG \XϘ1 N$Ԡ1iRNcBJpG5l;OۈDP)''$ݰ?Js_˱ЃdiGn'+Gvxc~[htWl{U?~<(TM;|?8yn?<(Soʋ/ٖOm?4|!w 1E\gd}8OgW8`K/?'n̫4r#܌rK sWje10[1D 1<~Z) <b_?i:!Xb1[?RoeN{0.jlbX2RZSn~.jmr,|!.]m;Z]>=f-S?6[CBm/߇ZBSLߤG~kK7:cm_&6A˹ 7%=+N֛ry\>->Xө[vu?ZOOqQ? V?"ccg/46kW_$kAlh]i|܃|YO-6@Mm70V}k8%ܨ<&jOI[} -i8eܫ'=F0l| w,o$k4xS#lGPOj"˞z=>1Q߉čgZ K}hnT48m一O.L^C֩O[)"No1ţ1Y%h~a?w/ȧrS&j! O1jC yPO2s9(̖#Oo̟?3KepZkߙ  rϙ)sK+JT@\el'U)uk##iI%C#N1fg݂h~Hy1SgҭcŸMxܬ_ٍ>go%E?k!ȋ_34YcWrFHz?cV}ؘ$f~مi_cO{}iݑi6KzB!l_+ NJ +q1q/eST-uƟ7C# LO+1itqAXn]g@5P7J\kyN@S/yLo?gB?#BZ{;G_ _q[?،f/h QFce7A?v$cM~Lw_u+e ~k1ި? ,\|>|)DUxٮe.3]1ۂS( c2p䢽 s7޿NY/Ʌt3OOLL"U>E=YӍ>nhK#qm!^ڣf>mD< ;Do3ne /~|z6AcH䖃MĔ[^,_R_9c~< ʙ;q3[d+3ޞ+Uo {#>a?`eh+/OƧ`$8J^ ~WyuOʞ=\#y GV_Q֯Tr*V~6+ǹzA]Ŝ?#u;?QT_%C<*6vzI'qܹKHє03z~2qn|7Uݟ+'pǵ? ;O -G- M[}gd6O[q3 >aѣqoy]|v^8->pcu˖taG}n^YƑǽllo#audG7_;p _V6%~UjP+V#94=IQĉ!kusSOŰ4lGŒikQzeSMN~) ?V(OYPOp,4|*GD8 `)K} 0`|0LG緎D^SL0')e+ 1|P0B59ɵreLac$X;͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*r#A +Ic?OL2v. &LU&_ |UتJ8|?U|BYg$txz[t† +Ab}N5M>xdbmVaSpz*r`xL]~ثCZ\qbw5i'⸥qŃ|51UCxbiLPw] 7'.:{a Y9[Xހpb3tyo ,Hśωh6J9Wղ<؁5).O'KYIWex/UE뱙-1ɟ0 8wF/2v.Sn?R6:1bA CҧuDpeOO[Vǹ&tR,6vucJ ۹d"m\5^CFh ŅWzP܌# ȡ\cxdCجQ$Ҵ2A L^h׈q *hەĕx;5`eŁR"T(~LPQ#^GpkS}f!!(SL!N# xd% Qc(H7UآAqVF*ZS~:[3oA WLآbnP턩Z,9Y>,zb^L*Qo''a}l\TUs 6hj?Śԡ*w/l*Vv8h{8UB?t' 0K/1|}e zbO+kot;Gb Mp3Pt\L߿PB "IŒWBwT`yRwlUV6ҥvWSBRzYk mBX%S@ޝ\ȁ(_Px):*<ݦ'Q(y'<=H>\Jys>8[kHߩqzfw6XqOck<3KOڿN/j܅ p"AB8Kyo\!Y|J@d<w[+8 ~=,dž TvV_$WsqEx=114#m_P^8Iw8YUzaw5ҕN_n7ի#Gn:MM|HPaПqzKen^+ء5"w6sqĕNQGłrX}[o Zlѭw"y-!L1U@(aZv]dwƕS}?#Iԩ̈Ș E# kNghP+Tꊍ30%fLUV᩠lj͌~U_ UqaUNBDz`Smc(&zdя銩 @{whU%q2_\L1BqDV> ہS\DJ( 煌;9‘Kd<'2tޅx_pSQlmBQ$HT+ ^2%(j}cN R ONG\)YJS{;m!e* 1Q7w6.iBCj;V$\ې* 9ĨW -v4' JHH7$ס貞 ;t iE?xUU*zaro*:u˥8o|{xm)n(I7"{ePM)y'lF$y'~USl6J|y>VӉ1gKjH32+"aC* vQPثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊AK3D7gT[OSƟ+֟ފݷ'6?:dL~WN߲6 Ò{)1J(r[l' ;,pmF \LĊu:-m"j߶ARCt4ɰJk>$d7Ǵ;]sXNcg-C]ǔS}1+ =\zӵ SP(ik(_"'ƣ5Rde36lc\`dOt;Fu ƢJ~ckIZOʃcvͿ`_:}CuO[!䭐"wS@9,M\MlFP~>O +΋[!dqH~Of1mj=`y<~ +$jaii(hj;`ˆ~d+澖ǣlam"O)ہ~x^?1vm|x'>;ۈ?N4++D??} xsop1_]>b=v`o!ǽzkx.zNaxKǽk~kxuo/D2\ǏzlytvQ_~~# ýZ]Vqn?17ӕ?/#ti|wCr~ltKFrAS?#Y/濗HַǶw+w'旗j%D#, f酗^ 4?Eݹ ‡3vE+oDST)3!to銮vw ;e&ވ?5;ח[ 4_] LJz~] !'?/?eG2Q9ޫkr7&GiǷ"h0r4zWA=bnJSj!޾ŕ~s_]vG栵;7"8Ze)&aK~l/`=4;~m5ܿbl#PS؏\l#QX>ZӘW̸lw梵?tqc2ఏL~i;o\qrL= ޘ,#qS4KyOo>G@iaI݉4Ic_JSc`Go Y!2?݃Ǎ6?6R8=0XSo(eh=e?vGGr9R,y8ܦrf09c:~wM #O33'F݇xKO%6J8y27ݐ9WM|n!A9?oX4F߆K|zEc^o5*Wleߓol"x9>Rxx-72\l8TO@0_Fwl*N}?י:jcǗl:{xLky.Ъ?\ bZ9LK~iyA4/vp~j]?_k*=f?KGޢ2wLi!5./ ɩh- dްa7oѬ_I>쯍Kw J-fiZ|7u>9kD8GqXw$ܛ1ӭk=Z6v9iei13_Il{{͏4ڳKɲ2^${؝Pr_Yӑl (>,{l9pUm9?67_#?99tYs,hѵf;C7qꢛ{[ե;!8^+aޮ<;1SaJ:w!n,Ϸ# C[$祻}mJ):w>e0~j^k}71WY؈\L;dƺ 5d֏G!9#B[UA|Ji:ؖ?1*Y5hOwI۶GA6?*_ ދb@w/W=q{䨟W}LOq5Ԍr4"< \6'sQ̓FD1 ۾LUu$k*W,$J0()Wj`E4Ti\ULw2U~”ڠ9$h5^U-zfW68m wx~YFE~Gn;IIM>UtǤoqZ~^ *Jx#L[/h3 |ۭBJt0[T}F1!hDefhE*c?zxΟ~6Aq6ۭzƟ4޿^0{1?25cO?^5򭵶q><7]Gaƣߚgκrv?N65QWt?Ma%WO&}LnOϟ,Esch*&h iFSĹ?&!P`EV~muU#fnď#vdeT~JAWo_d1%np-D{O/MߋNiK1TƸyqZ"?-O$f1|˘F7l"/]&'p3yQ#y 4Z_肕^"5BCWiQ}*v?é9#ZimQFI$E"c@dzTU-Ul0Dt ZLPjb{B2 L7|rIk0':tL!mlKPoI")BLåӍv3&cotQ~G3!@I0Ő 7EbKvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*EZ]q ATv+\qU4-O *U}𡣂-2*F96Uzd;u@@n=,F!AM%q(;ⅇ'mUثtž wIo m}qUF˕v\U]ثG.8ژWcvM=ő^qf? qB7A]סAx6ntթNs`d!z Kéœev?Lqx'pra ]EY#$7qɁu+z1БԩDۭɏb~hj*.M$RG')^Ixgk`Y+VF8$jh[9<ҡH`p&NaNF6'J"@`4ȟ=e !Jѳ]onCl=2l$Z&;bڏCZ>Aɱ*,ˊ,}TqlX_GBQ[q Uf 9.$u~+=>R5Ȗ\~," F֣QXFGc e"q6[ppa |KNTk2q]bR Qn8>>]p,cLT:{V` šu9&Ax8 Z]Em|4Ȱ\C *vG2 }L@CT ۩Œo7?@]|F*I ]_]?5L\ o_PEzSZ8da,it$xu僓hi)pM{xUW*^#''ҌtRx>9!NE i\Gޝ1AVM+RqKG|\ P`;brFi0 )URNT*〳Y&[ 9@H9~,gևʧh5S U]Oa>fB` @ ɷS i׏l)t'qyl4oZ}\_zl&cZW);}P6po HHX}Cq޽ŬrRg}8W6ڲtJ`zJ\ U;`c ďu遒yε%xS4jT8IJU0E⣶%P5wǠbyЕc֞87YEE؈jT7SJ?:b!F7-EJe$ԟ XpvilV)LX;=EEzȾK1joP5@'#* u;|v* `p$oł%K^'={>*?ĕ[Oõp4!6=e(G8:[u8d2iDߥ!b7Uab%64ꊏ = J%d Ue0syF%~i"*)$Uj{p<:!|G߾T zUi#Zq߶GVosLBѪ uYq'PHS&F9 x,x(Ai9CK,1쭤9.`qH7 TsQHɪ2H"xKQ*:l|sEڿK7?V%c6 MA=sˀFJ|x1eNĤ!?k|LZ'7Ex2Ae'4Saj91]^.: SCT4~,w8Jsvc!5;Um2eUXWf‡eUٱWeUXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثhpiE=7lqɟcꣶQ|v2H.C>,AH}iѬHjdX#케^~B20KpoV8 sH|ʓM`F|5GaKKK"_0@@Y PEi,1Δ8GE'.5YʘM㔝)\ihOBπE F@A_E=rcYLtD'v21ËtT.ƛpw1e9]7NWӉf.:>]%jz+mHui:B<6'+1ޠJJСA9^~jL;55ZaZtPAԓn/捗~G.{`@5f |6q~l6=˛?fr>k$=/rN?/ݛ&K^>қ\#Z;CdAt LYjី1h)\jy'(ZGrC/嶡AT=s}]Hkbܠ.ߕN#>F7VdN5?s!q(xw~yKgǹ{#yc1|<{F(=;u!_sܻU$c;䆶=?#w ْ3zG"#M,H{c$tk"F=9?-5,Ei/Ǫ(ǹu垠d(=KS M1,GW؞ Si՛G_ZяqBZ䏫T=Wž a.Jɫ)DtJ,u(̯O݂ū /{o{ͽOQ_]BukCWF=ʋs~3\BX٨]h(Rr"PٙPO* VGFC'hK`Q;~\R sC015˴˓i #;GkYNV{@w'Hw+M_vе&=w߮W;{Hw}x,ԕ3/Zw(TlV^WփsMetW6ֹ!r]tE}dlrkr)4R*((mN@kLw9)Eq-{$*y9*-ZamqPGu޸???%Mpwe Lʉr y#P.?LM ϞT=?K\|>{{ʀX۷Ï[qLܟ3ܫ*@jGZw;@/򔻜\ܯ܏9w6){˘@ǹrh~U w??riKU*n7ՔkLJKVAj;:/wRA-@뤿\cl/֤kAֹ1 *MG)`^hSo?ә`KMrnM=T~\pîWՔ|~rl;R?M1e*0~niNDR:1dq=wrwO})XVQ߇`usm.F8[?7Q?/ύyc*0xH44cuN{cNP1x11+]\X LCȌ;<L;-|\>6N*',Mս7eH.N*0i[lI? C%V-#o[5vIO+}h ۷u7? {NO/_ bjzϘ4 G? a{>a{KY?@FS8gLQG_y;|<ˇhh@N?,|,|,U_"=(l?GgGd_'t>Dcc+U>|r48Gw. &U|ېL"R4EKo+O8% RcZ 1?L?;6H}+_<?2/2w-ʷq%|ľ'#I2mJ1?^?Hv1bpNl% $1Ö24~WCSe_&^V{fc׫8Fi#tr3Vf c 3^n>P V(x4d޿_?]gI|+PT|\c~kޟw|S?v&ߛOɎ=O{kpkc?6罱z 7cv-w'v'q6vl?࿳&;8wA+~qnK;#ع Jp'ǽ?p=s鉿cI~B=;ˇ<ރ1~ Dq}%Oz5%>ٔ?41\uVƜPrSq߮8W o.=1*eW>U5@]_jb3qWR?`)MN`{`V^ Fe=_*mZg$,bcͲ+- Ɔ®8582aZ Jk\)SዠiP|R%a9G \2b 96`c_cè YŶNhTrӳUY(rV6kL(.9)S,UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*8krΌ; : ]6¡-U (.8@2A <z `YZr)U鋯^#,ǀ1V{b cl1V+o[&%ז ThbbLr9ԓ,.>ab8UP{↳NF*BAŨ: \ F=`L*o|*|v]/d6;zt :Ӹ 減<0+J1.r-$Rิq$(Mq' *IŮ&z;oSZ{ЫPLe|{ RhAZw%N0SrN k.E@1V`+8AS$ѓ?hy+Qa1%@zqri%b-i `Qđ܏p tLJ/RS|rAjuW1X}:~agᡐpk%}Z+jCЫ V//&ϸCY r. Nĭ29i2BYnMVA; 놜Eҋ7U\V>&ޝk _̇݅Zq4T*jzHݜV$|0lPiLJk`POsąoa^v#B]ivESɾys?OFBGj8)ٝIPt&,ݕ4evjbؒz`Oo5ġc HS " p]t.ǫS]&|pȾBZ|]Qp4rZWqج|YtiE{Ol (kNo)|RKa6, v=| N*V犭_ :m5L02ɬ ʙ*ijaKJqzfSJ2|4ɳo-c#;r1`~xqLuZG8 qGTg: ?B qHgZc銴Rg {aVS_~9 _|or BM9 rrҩ(#Q96Z]$_ҕXazm9,܃apruۥFqda˘v$)qmpQz<*Pz(pB*w'1J~Mأ+UN8 8b%}d[2GÍR@#lY[.qTK o6R6xxxeV+fe\~5%$` 6<[|JmkI$ 'S H= eBH,Xۧ16FߍxOo+\8ͨJJ07!-h_P@QI),v# 5)*fM E:V3#;pŅAmC+䗉*؅Ű-oM$V 8֣,~g}FdBӒBZd8776$M|+k  X4"58oc%@=pP_Cc$Rכ1fӣ(Jw'C^Fo5'Mbv+ -:ס,W@)DR|1 @My5X898@.x)so֣1D"Sڸ|,OUм}xGG]~3 d%8ˑ[}:}= 7b> Y[B_?]p{)SԑeٳO Kn,ud$ MbٺH3ZJ.zױ˨@$_(:Yqk1O.객S nӕ9QCUMbo-]B9Ⱦ8X=N]zQ)m@,іDܼR]_mePFCa>tԕ ^JP'0HJ>?o]?ި||?d)vYYf2F;@w!3Q"t``{<`>ŨO'v.HuO>o[U򿳮Q%a{ԛ:Ө4r Aٌm' =QOU[_fum˅rէ^ȭ?4USfpvQ"F]-{0Fn#.kٶ]kAО=A@fiOoks?9+uO rh{4Dw67lWѡc@wd4o#aWv`˳2YJ%Ә~U'49nSJ=棳C̡',.`HA;}[fiZe_k:[ZH5f čȯL<;kHƋZSy8wߚruDwgo٘ u"'zN#?zؑΣ7ִ?~?ɧ?ɣp؝z@Y83I6O}d?!޵6. >7,޳V =]R;0w?W}MoЦ~@u,fDum4[u0>G/?r_cGPȕ(A2@TBk榤EQ홮)1>n?:K6 BGgKVvwO8]j&4?i28u}ld!O~ddPztW|rpCOXPScF~F)Olcj(+H[o蠑Kn#'ZoM[5Q7F1޵ڔdc~O%(Xubk= xqsC햷$w?)>Si7Cȝs/C02t}8zu"Wȝ;\}OiS-zqHhw! _;&4=Ro4]| 1ߨᖚ X 㧅N^ͭY,!>@3v=?9G seG$ ;ÏrD>q<ޚ}̵ٍme;z|GAxCqXZV' 3ᠼ!v1ώ4Na\(oX'%Ih3PvǫSi-p2zR! $ LQIvrWMr}GѶDrH_GA'#Q`{)B^ NLC/4`C"LV튬;cW$1KxƞWS(02puD+Z 6L*NʥU5qWcI'LPT cmh zMpRZ#1®~*O…*p|sֻaB`Ф`JqhvZsW®Z1VCU@A8ٗh∼VjJ㘑߮pƒ{aCvUpjbW4j[NJ\Ui(qVo-f逫­eZ,KYOY3;mJcҼFb㽰ZpkЌUjQ8¹T\2,#m)Ps dL]\h+.rM j ԩW ®T2dӴHztJR3Z [O$vt[皽oLx ]g"OvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*:v(ŇL.C8coAAhѭM:T$Irແ mh+͎N!Z8*}hI[+LP+_dSmw# PixQ$Y+abI]Ovn89T68Rs6*e_*-8r=b5=?baøa; 79@{尐˄qTT^~/|8eGJH7\O2[ mL2T_JԌ'!xh u}Q{SpNÞ/9ƿ<Ex㖟hSb]!uaIܑ@iI۷ȱXq+x)iPzd-T{p zS;Hx`Vd/,/ԡq Wj+e}ª)GQҽ:81V(w1N\iCb娡=pi! %GPzcяUѱ'-햔N(*30Dt}ZTݺ{ۗi_!+1#(w?aH]铁l6-S*){`lP-d%8UMFhUc|WzRbc`[ % |0*LJES*Dvߦ6B4~F؆; wfņ?VoE\QfxmBQnmd[u*vV#np:Sd(|^&ؖAnX" d;{`,lZ )@Ů\Гݱ+p;궗EPO %~ 33%zdIT+=b`AcW$J*; M!$)\ci BƫWqðSٺҝ-rKu(Y6H9\ Š(֑`Y5~(Ɯ+rpd.N2vgϿ2+l2W|X9 #a %, 5;^J ԟ{t*hv9/rNXBkڹ `Ve-*WmR@EƸV35Ƕ51BTkT |F$# UȖ.]0wU dm&? H@nT!aSf6)Q|, imAicRvPjoܧ1A҇; |Al( 2цqR Uq,at@AR9 1BjVq SyDchMDt=AaR1ppӗ%XNOSCORJ:=#<:b I%l;vW1%>.IæH Z9J]jTM<_ (m|ʈ ׿jbztVf_Nm{h#i0!9kϲ~Yp0%&}Bwav+#kӶFrgnIW'| +m:rWБ$Tk/i`=BG{V7*Ѓ91C-:u;#)؃e6 Q :_e#>EHՙ1 ~^c锑p~cD+(r?"[$}?2#rØr15d#42ڧ"Ԥ"Ә Ol#>|5f[|Q@~g`=>zJ'%tÿq]LPT|V ~k qcs}sR^Ӕf3կǖ5T,j&qxQ; p~O꿙ާ;4zkwêœ!Hψy,$pBg p'aYx~UFC9ujcq9x%P]GO4\ ]p4qz_~i}93_} />'y>j-巙Ȟސct[a41N>ˊ#USCNS_7.3K ۀ'zx>BKiݯZ%^(/.[q|/h?8\{%ކzciFޘ{򤴶qis_r==y" W7x0Ċz#+Uo!LYT{ÿE҇Pzx|9 hw͏];z_7.oTd?5?3ycOȝ-?o2JvLvF1u{ G^~vf1EF;!CjǯncKqex8 ~H賀 zc+%?׈#ڼX͏= F/]GKX{t/KBa]ǷĿ]_p%aQǏʏ,V>&?G$| MԟK2?_zIy~.ZN7CvHG*O@G47OJq4cDt%W?ZNYq|ld'j 7=cp~[޷RK4oOڏrKydV+N8&i)ϋɟ,O)ssP؄?'~bwU/,ۛޢ`?_awK!AI6NWd?'% ?8P LjGNL/e1ǓrIjM7p_aqpZ,_jra#{Mo7zn࿝&&1t >(?%{?o[T~ZnPt_ݗR"b4t/%)՚xiHؿ^Iqoog?äWmA 5e5#GǦ?1KJx/՘ZDn N:GlҴn{'Օ-B6>6,?y9wmipypgk/E/L+j6+P?c;؏Ϗ`o+շ L7 ` 6sV*9M^?#_BME+HU ވ;TeYLH:MpI˳ pT;Sl*C^ƾ=p7ˮOr:U+M/!AWCSSbBq5=pbnm3 p".p"5X@*NK֘0q 4PNR3\iZAt oz; bL! lh i/liNDaeZ AFo-I Ba&.d q=jJFAvCp~`wTbNoP % 'a)%w1h\61KDQ\xbJYd%Rt8!]Iȱ*,V YMNI}b@-+U7[`0+t銸kZ #$HWa`Wbf8>t®We|KvUMqWeC)P+L*F7s\qN)leNUS\R ፥qVW 'M.?h\ 8pG, +Y[8Z_^إ~ HJ*@0SR,XK`mҴ8xS;@B682 ;cQ}N^E5Ɓr*.C? [ NdW?5=uaL4( yJ%7ܜ%IkEWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*7њLrelN*Tt )bc9п~Bާ p)IÙY[ŘR]p+GZ(o14v+ pc,1Ppp "qӕt 92FC䘷%[:Wvc+x↲Q⮭028K[ↆ";mJ`KB0uV/ Wq=jV+~B;lC I68Ŭڣy4n`vȸHl<1E;IF91e-k"6V2wm%M֕ l Sp=ΙTAȳ\`lcܝmSrcD\A.)o+pU̳sWc,o5 p;wH67z֘/n%o6$ $b=Ttx}T}TdEz║rz Uw\'| B(E1VSHWU9׵rHU ;׶E8 c4z0q\op(A4W8v\F@ yAZn27v!D/<||? (z%h* &olH1*KSZ5j*@ ۖ`~|dB 7~"()4o~,Jp]c]c]ʝ:TM:+1/THoZ`,[(G #~W8ݻBcUĀˋ6fǒF׉ҿmmZ GSTs^U0(l>[]GP|9A?z)˞K(GAFIu˦E6=,eaݱjOɾ{omQtR_=0T7F̨F>F]GۦIwFLINL|5T%[r7(E`~#@#ƶBH-pCqR: e)^_g’5,JeA'½9PMz5[̭6)@l ~/\,g81ӒӽrLjR7wё-~FOs:Ұߐ9I)cozy;Np w* 8df HHدGiP#K<i_lǒW \ RkPFZ}Z+Խ~ѡcc-`B#b5e,Np$[(ǖ=VNTWXZqU->~?s\BӉ"UYT;bs@/)Tl=VHdfݫ 5% .$y2=GGO1(&#>HVgF򧰮^`<2QOBхݰ)-pT?r|YyZp mqͪ|O و]qv4(vV*bƜUَ*n*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*zt8BC{e;'jM.hsP8rYa+Ү\Epn$4̨odQwd$v, XpLb%$ V_@ jjDMc$.*[{kM'Dq^i<"vn[~eZ?77pl"Sۣ^ ʔo8!< ݑO˟kG;C+H~0:o4o;8_2a~X%*޸պ>8$Y>(n0q>k QuVv X' /6o<%Y| H|s-g:Xuٸjf<Ͻ^ֺi a%>h0}n=e-/l?z!V_>js?Yq,XAO]'rZzՏ޿Ƶ鬊rpQo'z!e{f~vϽ Xf06̇Csǚm3}M:!?އeLޟkiRo{eONslR|u3@c\<7}IcAL'|,}>lb2Sqa'ޟczl.i8y>1}_IөƤ(Ñ,%Z_3jѱAs) yƧ2. >>kM}*"O ]#HW"m9 }>̺_^_cKNZo2j&9H?˽%b՛>&c'4,kض;ыd4Xm1/.PO76bƗy_Cs,BQK#I 5Fe~w_OV~53.>ƇWWoؼYj;Ų_)9tU>lwmxI.?44]Wq+fY%2i~5fGV̟xȂSo-jmq~ հ鿸SG^<7zO^Z/WObIei>B (kDZMqRSNkLlY|y&9U>'޼R_bgX#/#]?,u6ьo0؏ Oe܉3|bѩJn@ƻfM}O(J8 ^/lA?ࢿr ]\cy? 4SI*Qn1>c <)/ϘWC wV4,Pḵ֚X:cw˃I/,«NW& Ve\ =CG%hj)ZV-hC bx`cJfڔƓT="p+]!(rVXW2T 1pq"XPl18K@6)Zzp5]C0GjuȐ`\On43ƭ˱0ٟHC^PjHy A\!!^81osJz)AcH1QNj{WlFiṹiV(VbGm*9K8 2iurnp.0\iiALW1߶W+šqbf+MNj\0-zJ;bdrqBko(0l UiJu450}+I-+{2H^deU28G+qo/u3 u2,)v7\Ub85 0ca0 +yf`KW]L(J51;ƘmZ9C F>U_qWb eN #g;M1 PQܒG/zI` ~@WD"uMrR2I}'u)|Dv.ԧV~62owtn95d.(mզ˸ liEr熤8yS|Xo XS탫=šnj1("GGC ݃YoKXr5=`•`Bf# CX:t0)# Wf*k*qi-SϽ፠j0xx>Ul{_%RK`KG[犴q@zorI(q9fN_Gӊ"1ek;ڽ1bNuiTUᆞ2`j"+7wc|@唩,lٸ+\ƴU< h}9PCkATd~!M% ϋ` ޟGAF&Dw u%CJTBjb^ت` 8U^L#Q+B;al\ 9+&<2@), up%bRMס0% 7sJt#ńy-=ׄ{C\ ژvJy-728Zvکq}) SMkbcM ^!"OlP7 zvPی>&A8y)Ξ+1 (D7Ozd$t 6BvL[?kAz=  mc?L|48-I{otf1Il$cZB LvY:lpj?(2ˋ)qqĚ s F#[IF(pc暧qQB2v|=‚ 9@EI5'* x֗uh+ԭkϏd6\N:.~@DDlpB-Fݰ(3SbCZxd$-4\ 5;`薭}8_OY `[=]7Ne`1ȩ.XI%Z-$g"Ys7/gQ-FlWRM#ϒ&?OS5Ǣ`CP;Ik%+La[*|r7N6E殐iGc?×C?N4{S E}5#cNv?gcި<1?7c^<᣷[N}Osj~ in+LiN*&1+Jy(H5iI;"u$W('Bm[؀B.!#v|i>{-,,6]ɯ|rFt 0Ƃq\|S8]|ǹLygBS۪}¾{Ё={ >-|8G]V ÏphyKBf O+<pFGp򮂿@FﳾLaS@=m`?@/Wlܵ󸵃Al6 =͏(P2v y51Oy?@ a]|(-P}ZuݟĀ =sy_AEAn oE|8."qk{p{.Y=~xb4]0>%kz9&m7Dڃ.ȥ_ƙpEAl4$5o w]~B冻?Z:ߍ.P7kQ\ɡٶ˭r(4wpG%}vMM޹+Qk6{p?]|u 6mb|u>[.o#<+_Μ |>lWͽ>c0ү뇒8íxylW+[~^Np>`=S}ˡ^YHcޢߙ]L?Gcn/?,y~~/6joLu#1G!޵89O7$$1v]X5L+*[ڌUƧ*:ݗl`PQ&P:Sa\ XqYEA8o*UٔWS5v]Li]*U1Uw8X5Wevb6\2Fe0+`WeW].ZrcCCE$|RR~Uժfl l R)f%v(0+De$m7ơWt_S AS1C1+PxbLH#,d`+[Տݓj%QE&鍡paA]Dd9StR׋od/^Y"|_,Ȳ+A\,vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*i]M6Eof6Qڇv( 0ۑ1VQ5V>Xm)]F{ Zl[~ءnjW3 .* hnG%q!u|aWv;®ĮjR.|$NO\*]۶*R}&t8BթH®n;-Ǹ1k'zvҀǸ8a W4Ms/+([\jvAⴹa/9AlSJޖ=&Z)iK |.G@ض1+;@8bh9F6Eshs[@x˕J6?BX2qJlK jb< >١4O&Glm)u#8?k\5i6P@Gӊ9CF`o^?;eܗz*lБ%&9U~`VasÀRgiz$ %յv'+1͖n?ܟ cWlϫ*@8K0 vx;R+(wpp#Gpqm8"z46ՐTn8s\>+!츓TT%IT ma"ţTxVy>0BE* *q•ܶ;b bJ ߐ;k(+OPdBU힣 P$Fd>xR>y-8^[Ev;W;kqmk2% ۭY2(S㊴M0|1ziyRcS8l)]V)c1JX*AnKAAk`Ӌc[;o64MHiT2 lǁ.F61FIFmۮ 5'q| JaB-Aܝpd(qJ+"C M^U| (yfރ1[B(:SR'~P}0wprt #r{<ފ7H[ۉ$NK]<268U,/8|-S][s]5SkylMRr{⒨+ P *0KUT<[3H}+Cvpob I;㊪eFz\ƫcOT3r튮PXcteF @K/},15; RJ%cYy*@!Ӂc$"-BvZSQdt'" dz$u҃\q쑶> RGL`Jޙ 5Z8UppEbĎK_R;PHL !HqsZo<VF\$?*eރrp0hc FS(w ^ԡ7PTq钽ԣm&3*d.#en LU ̼o(MHΫHQ+cxQ{4prJvwhc5CiB._~Ԕ/&.̬UV?T_$l7뗥HqL WVKp!ӗ:Ss҃y8mSJ6 *)9sNx/uXp<:ڬ v;} l "Ɂ+2aɶe=Yۿ:]*ڠp!=z`*\0&'UeaΒDqSy5]ETT{f q)~lۉwJmFUe#- KAm狸(&):SŖ]GGXRX|q"g-&HD/.b+ٔNJ_ L7ڴ3Hue/ɷǿ21'c[ >k޹~ Ym.#^@#/Ι|<OPo˖SDrcɍ`=BߗwJh%C__pv,#ܢ~Z ?!Po"j+U!i7OQe)?@~G0f+jMEvr!0b=(MFU1DRXIl3,j0e;159j"zwUrڷ1,ACk^V H$Q2S̨C4BEK^Y9tuph;I Z1އ~O|(5yCZf Wƙ?2rS}aUPFQҹ@"yCCesW2hd 9tP( CITW0VGj(HhvGo;9jڑӛé_ņz->6#G_GDncoc=Ʈ?Qk-HpLjhe^~9;cý945 -e ol><{7w#8[P0xa9ZzRޕ;dh5aK65;`ޏF2!?#(i ><{r5\f'I1E(X%E{d19Lh:S$Vb9!ztJ+rm_j5O] 1'YR+ꥸ%ƅ' =ycU9bn ;֟-jI0IO)j1cY[!1 a޹| /ݗwk)VWl#SýP՟I0~j>Zlme4'{pNfȝT;|;m]e Ǒ5oql?z)Aw0Sb3ҔupO3޼yV'xEs{(;UިF9ac:'Fk՛`ӹXHȝlQ*TZ|wk`p-ʶN~7n ʼn8mJ?;(ǹX~ZZv=QV3Xu)OU*F;`cb:T˗JM#scu-;t=r\?j?r~V܂kCr_/%eb Pwg\?SL7Ո>fOZc{?T&l}_I~T(\p6j=Py2h&:制8 oC>]f^0[LR6k46 o#-es5me:E)l }u2[`p+>#}鋊R9Dw\&liipċW$=3[8a]֣4طL[\ CGi|iZ1p[$*\U5< XDe]IZ9*wWe[Ɲ*UvS z[ ]*㛦*wϮhI LU[b4\1rLUqhhkSE5]_n튻5p+W)o2vZ`kV R}()b|p`Vj)R;J1o/$cL j1kY-w(«ڸCP1qr%:`?Ŋ؆Hw 2ScL%0=7'$ҫZeW [Oy 9n_ L4E)uLq&=|swcnL<2))$|r-~#͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثvwH-s 1M>cvQ_*{%qVxZv†ūA;SV)]銭-/.4 ^1Wf4maĐz`I;* Bp銻0]ƜU^JWW35r,0!$w ;5qWebmߌB䦛ӰhIЌkf;Z]zD{զqa`۶Ei?MqcM)'zuv(JTS[Uš N' uOL^Fllp  ǩ;eIYJh S2 *2I>94KguhsQ~_·$ 0MvE+p\xu{(h̞nd\he;h$H vƔn|ynsCza7cNb \.DSAqnf=IW]`*,ruLZ$b*Z!`cw:e?*@|y!c?2M!DG[Pz>#Bc|8n B0z,NZ:d\zRNqC|+Vnp~4Ŗ*GN-^~? |1CTv6gw"Y!pwmє( 'Wj"^+Cl̇ E۶+bb T8mUے`HnEz`Zy2j6#MB9x?V\Yh{v"+xSFA<0*4BٞBW:ɐ&hqWEsBX^`"׎6HW#ܭ?'0iHQq(NْuY^;oU|Y֞2*xLu'zu]%ceZcl#!t/GJUqx = %ԴI'^6}l`8Mg>Z󽥅v*n@W ~xc'fAjWlzjvkPtڂ=~ac_>bѲɁM }tUF妃~nPNoiV :)A"2Ơw (WPkM>惢nG!Cg4}"N)i2w8yHd BA^4?PYi'ܶO;Go'JXwq6;!-&HL?)ivO "z-3U=R؄~S'rΑ2QF.FPtL2yLw¿1)8iw/2w/O9@UZUeFFVt ?)k _dRo8,vW/^}L=%yW|x2'O>d[2|_S'r~2w_)?WS8S/SF?q_oip}'eQy'y;Iۥ2<,,Lȕe<֖A2Po:Y,t;CߐϹ?ܻufVFr!{&6mHdCT'}3 hcYN%~̄ ^}N`gnd많Gs_kVUO_,\!w#9;&y YPܑVg_uSe7f_9 r)̽ URrG&~g鋲',LbtSd4Z:j^/J'4 pLU:W%9|[6»F}g|#C6oV>!A5nPxaO/lV}csn Uj;KEZe|ٌ_d|3rr%6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb|&OIo=a4{]AAL .Pjǯ(hpk-Zb`\ u̫QqƲv®JCxڣFq k P$q]`Cl*Qb5F)'2TWfu+Kp;[2?'''܇B69_zjۿ|(]\z.,8{ၩj_o,'coDTҞر2]C qڵT`GZd[VƇUpbgJHk; Ct)RKGgf+nź< f~Kb7ww>8%#݈"z|X^إO,$0UR<i.aOhԵ p* b>۞ȨQ疪L s6+q<CڝDTˎ$_ȼ|;vtOTc9bcd'pTQ]nT}&ma' |UH9~.w Bje `~ᒏ63VQZxu8A*XZҙXʓ*{S3z=ZEeOj6 8W]ቷWŻ RI=DrI qGuW8B࠮#l@ &u`v\v|r66 mN*<"(ӿ|+U(iLB[!\>Q;L#T T 2Ul@q V_L\FR; Ҳӗm+%KGF¼{eGԩ=juV+ S11caJU|Uq9M*W\늶~;צZ}M+cJ)B"Ɲ~aPAym;w!! Xȕ]x=uJWpwN揵~VŅŏq\%͉D]H>XkL#늓FJ@WiL^nGVNT-֐ElU|7;e ckZm, 1!bI9(g1y@aKlz݃_WN1›.$xڟ=)uǢPV'錘ROl1URB;o_(,$`Si\* (D elS>R9eh Te8VP죊(*i]pGv7vQ]qWeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثHU*԰ߨ0iڗIQ?w럴y6eb[qY_ 6纃To`C@vqR;U)1O֜2i5x]ą2Cbq}eK# >E{}7?<)xAl-_&vez/CMyZ?HX%Seq $޴_3?eHz>(42>(<'C1G_ٹqǚi?#x &Ou5*~NIPB2?Td.'lOze@Mg4 heZjw>JKTML>e׋GᔶSZ׷ zᏋFxTc>%HjF7?8'On?,E)OȝrrqSY/['&Q21?vKc|"!5I"Ɵ0[.M>Y\R|"䖷*\fX vVA1Qa4"Bيr~tʥ)N"/>~+c??2*CG _D}cs_N?Xxkժ_?9Ɨ_ZJ̖'9_6O$xR[*;G"L;_y'+Gyz_َ_2x^Xߑ`O2ĖvG/XRZ?#c+KmO#x ׹H_mvկdc<"!;_-n4b+-#u`m2ZO'|Y D#7\'(?t^e_vlOTo"5S#31C[^(~CkP|faFeU? 悝#tێaE|QC oUZ7ݑD|XxEP}H>|ێͿIcZzlLrvo%>)˛qYj4?(v?ȳ ǽf7e"e8?Ԇ'TZ71t}8R1/:u#^`/'+k$OG88x??N1ܿ*;]V|;Gda]㤛r_?7#rqqO]Wк(WƟ67 M[e6  H~J36M>k8b Mܿr6Nz v>/j_>l!*83bgsW\}OzRn'?术Me_,HUJ4ӟ朣拣y [?iE?q_4!zBhs9_k~C|?"4?7̗]?=ŵIObmY!x{ Lyt o3k9=;7 bO aeKiRh5`=As9ŖE1F4H+q.t j⫆WN;044e[;ofS_|n]v)lUkb2,a]Hp8§|Rƽ:`CuqǦqn(Sa}P8ȥa9$c\mUj W[ƚvĞRקL To](\]$)lczFVثxvaBiN͋C]TblckZ4\'o UǏV㊷RqWf-{|RViَ\2jZ+flUZAh㰡\|RyVY­e튻0 !)XzkLUwlQwVSצ6Dm*8T d12E< (7\}19`W N6s.s\&PG@^;0F?#̲mIePpߑpnDR7ջ: 嚺3\'2&yZJbZX;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb"`AvI,|e݊ETaAqG酋Y] qKk>8R/VZF9[Z#U늭&R&0+jqcBGծZZ8*<v`p`=ZJ;uȞl!žXv4‡f-ʕ튻[ 4\ü=p!H8Q0 GQm7LU}2#5bĀES3 F2)ĸ c$I7ڸdv7#شT-iIZEiAw S;!dd;pS-  :P+UQxbwm QUz hggpCErvⴥ;-o.\ȥY0=q%e#r\.WXDGh ^i\u)j AGCAx|O u5kb7[ HƊsȑl*\ $sUz4wn\Kxg."GumIo9 щ\™6M?aPTӉv.NOP/LRrFqrAۺ\zak۽rE[(:" l{|8TFې큑*{ %; !m%T၄0`+Oq$W.P|URƘlnU~2ؼ$WjxbiN?v@\joQ6Z^ %l2ƕjz B]+@|q( eP7p2jŦ;x⫔" p~,s(-QP+`iJ8Ssa!`t TbTwL6ӱؠ-i8Uڞ˟aR3śl+b5" 6JoaJm UW={b<%WoXN8/o!JaRik2GAǣd%m}5~96-X|XC8G5g(M&1gh"(~JpE8RToTk]•ĥTB6䘅ї?kW*zJ0*R+JYw%LR H=رԥ(  SAjPSxPlw1KQƕJws$$<)xMۅSOfSe9~zcA] G&ek4Qpϋ8R<VE<.{DZT  *8IR3BBl%HHxw=Z-4t̘u0pt\Ƈ4'M)8[㤋BGS VG7`(~%`ps\!T٦RrAkdM.,ᦗ-)Nv҂O÷N=iQԆ(l7P~MH=|1VǶ!jJ-pg}f. RM#);*_%|Y=;:ڄ. U%Z7v歡 I嗁i6W-8~IZ#,qV˧~Y}1Wf'\*O_ʧ_lU;*+bTT:5D1%U'l^?*3ǭ éȑXc.sGK%2|6u8k 4qɱ@+H?v>e{y_VF1*GT|xn)Q:_1sHE9P(}JN|0,ʃZD!ڸ#"~7)քo v?َ`V@OB)CHFxwzde.?žuNo#i{ur[T-0 M]Ie'6N:`#7LUT®{beUӅ8*i]qWeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثHW`y4mblA;wƈeYJoۘY&3dَ^MB\.)I#Ni{2%}'JNHuvTMS⁏GD;S E/xtA^+8I@+ ؠnvC!ɏj@\~_jHEYV..G_,jx$]8ƊJ2~.HL"EީfGYv2cܟPko_G2b5;drMo%K]?O,m>*?b+fH9?qto#a9 5߫)^~,9z72T'9@@Z1Ǐ,cЯ9To>YoSt9 (_vF' Qه㏖ 7d!W ?amըnG(yh :*шݟ?1(B!zw72GY>d z' 0V F,Ǹ  <ܰa2ǖkcw4󐐯['c? aW aM_cc5Cn6ٛ-'{<`l|?ߟCb=/<}1YOh#6忕?0,CL13 ? {@?UަO0Y/*_SmGC!'; +9Ql{m>X^C`Y_4q*O7]?߇d5|aܴD1Vv {pw#Z,#?,yMퟻۃ?\Y/rQ: >X.I97EZC3*G?vV7];'yoa\Xw]eb?߆?gj|U1wݬ,Nv2?˒j1Z!E_MᕝnoI޺?o8͍}ᐖ) gFp֦$NCq) Oʃi}q)0>m1s\Ppe dƓ#}+cGqMqUp2ZqAĖq ۥF%]ɫt;1Jeڸ8u ;KG3\lUvJ ]CŃW%'m֧lPĘӽ*lUb`C{U,LUG|)vVoJ|Uߞ.ħz!8in(劶ؠ'-f'v_"3O MKY]8|U]\w銺w]\sM8c8TnDS:[ _it @menAZ8_ VqW !4s xRPejmZ8o\1V2~,Y8.}XncirƴMNAC!bT]pTk%PmPt,lR0ɅXdJb,I4Xm\ heBSN,=e5r6Q eJ~Įu .\6U Z_ t{lpFvǰG':*FQ? jԭ*NZC8 ":T}84@_ Yz92FJZ +F3Z,C Zln5pp#⢩FGߊbkP煜p&3kXط 0*8ߧ݊qF :aBĻxRN)v3ѩLi!oꀥhU, ^]qM%I@oz $&lFةָcQMG5CWþEg/7\Ucߧ[}0!ـޘbaZ`jqL|pá0) DrMӭv o^߫#'/ڗFq"ިMG,^#) AU߮ySJoڸU\^$R5(748~R|JUXs b_9~BXSc(Y!SӧݔKK(54S!nP;oM*z&=p+Ayc i\*->&}r폎*48 w6Sb8 :E}@:nucGJ֠*rЂ>b#,ACtI xel2~|CJMdQK'q^ 'ĀͲř6ޔ,Re?fq97`I 0oCي_-c< sL! +-z=>=;W#jЖoAM*\l*TPLȃZe zd\DLd>(f7F;rAеbn PjA{u*v blܭG!/WB( _N]Py2Dȕ=}3 M <~jʇgc)#W+@DgÚQr869;yU)DcrsThJLq%d q_FLQ*i2t\q)ƛuM(ex*%ߓܐȥ?8򡖧j\@J_!B{%RwL>F>3ASՈ-qTObQ@~^0F]s'4uHj#O 4FVT|_N WǠHnM s~"+b2-Ȯ=vXxmw'_DԟBDHDoNx-Fce4$kE>'LuGSӿ\)-S_^(z{$> L*v-5:NN>yɵW.daжO%eMmUUӅ8UӊqWcN*죊+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]FiNYa9`Cow!FFCSם t[Շۑʇ7D?!s&Kly(kl鶽)ε=zF^5AqT5^ף U3E^koI RuHujӱ rNus*sX׺0l^ea_EK +مU vEq^Yj 4x*=Nm} q秾a'~dyXS}8940<a*{04zFO..榃5eoşd_"~f\ wSOF2c0.,+ GCj5Ө9`yh2Ǣ2/?ir}+i+di8rG)_!OLxAG=dtK8Z)_>ga2I OߏC_uSod+r> Y(ePo˽/V97>d;K/ؤߖafVa)dPLqĴAc~%;T䄛O`cz'ʂS'YsEdA,VfN1ڙ<7:pi> [bq_\HoSqÀ}p?ry(佛k<}(% K?^ߒVl\3zUPZ}LKFtF؛)Xt)>W`(p>,qJ4+?%8'ǡRfS^:8_ʓ^=Y;Pr OkO!>]8aH B?䤟jF&z _iJ~Gn.3oJdž+O-mʍt~#̴n t/:̕;K?VpsHڏFXZo\)+O-dܿ˥{8N蹿$,-6WZ}h5̇E+q)W~Jُ2SLjtlJ,fey:; q'1OO%tn%ƒ(z*l~Mؾq FS|??ʹ<\Ke,E%%zvaOO'7̀4iяá-$J*dZaOjXh\N?oy1?L+yeoᚧ"ʹ{ʕHIk;HT޸~KթiH|rCIS޵&uڲʩ=HK/zNh>?T1?(r~Q}JɷG5OX/^OTm{@≩\=ߒ;/{_4BsN?-~w/y_*@fda;̇i?-$pip0GwɳyY1܏yDf3O%܏}G\yE@ kCOÊ# #~kƗ;p{l[cQ^)$nLG|#}~noiʨq S=ދ(? (}w-G.p->Y |9Ia$?|}J4[1JyCiUDҔ!6½j{`)NadZƶ\17zdS pٻ i +((h88i+ȡa9M!xrA- r(ԞBUusNثG.' ND-'*$Wu˧qvWH&q@#1q۩-^ #*+qCqثuƃM)usT}5I]j78UٹW$CyGW`kƢ 8`)Z|78jw]lPC|+Dژ0*Fuq{+)nCslWWqZF#AROAG%cefMnk@z?a-|8E%-9P[Đ? .R0-E1MEm?~^y:^$$!<(_cD2x>`cTp(u`z6S6cĂC(12VzcݱVQRTfkF8-[FPn%h2ͩ#s$qchJ[:׮1cOm+MHv۽q%wlTkLiP0M1X) GW!׀fCAyFToΒ{2"}`;ӏk0SIQ뉃cO/iӲyF ̏S._P~c#kA3㴐V[yBy:> qk\SBa<ڋ&OO(tQ ZN0ZM32XZ V,@qZewnM*Q+NiHFF'fQ /]ԂǿŹ`zdd4"1sLE|~rzeK.$>5&0AWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*=Ҙ;4e; 'S-e昅q=rJ;v; /Vt,z䒟ۊF *n,zUUl slWq8Z)y` { V8쒵|UD~8>6v; D4"*`Wm>+I˟QH>wnHW T4)]ק֔+\A8 A9R\7"z..ć .UN4ᒆgыG , %{-vO=әg -؍t!aT_/V޻vF6)yZ້`k1 *5L7$P#h0+h5KIγofL#6x:\$4KZ}SGՒ_"+^/ @]JQ5# @݇&ӜҳN8jtNkyhX+{Q%,pAݏ0,-%>=>x:5wZ ~l@דLix6$JؐҸf_8Zġvl{`HOl!,75"m|O *8ׄ*0uNţzo֛WwȱXpRϦ6g1ڞ8kSq iv(6eL.p#)\,<:bۃ xldgJZ*~(Nof0'QUʁ7pTH+ӉJWj HjJ6P5]LR1߮8*n`CǴ'aZrzbv2CEP@~ӵ2ad'p?䩛faz۶*gi@?ۑ.F#,g'F zw9h!kX{bZJ`lz C'uQJW#\ 4?^ekcmT-Oob-7_#WoNsݶ2%]p˝{7!Ϳ×evW1#g cr65*v]$AiZ5 a {R6p+u/%]jF64>|ZYNXPG 3FȄHЯ88,( (djmJZf+Jo*ucRbc{šVm$-ӤtlI?z`TBQpd()W~``sCxc$GcJA%[ 35E74Ȥ80\@)AK.~_(P8,m W?kIMl*-|Maf&w_za2h@B\ʑ%|rPDb%90' yq=<8K>}f`NUS,T:?7\Ũ*?lOr˰Ӫ vs[s:7HX3켗ikrAn7`1W#Vkq|8 J0df~BF 6:WڡϟR#!2V %b{fڭDLZm"5<1Ww_qU1} UoLlOnd4*hIqܞ0ӦU;J*{Ȫv Q' U߀;'H!)vqu"U#tj2Ւ|ѡ{ _h=>Πc-pD)T5ʴV4),OB:ʝp4Yb5=鍯q K噆+Ѩ 捄 $gބbH*55ljdL~v(Fk?Xq{osNJׂ2Tm+EUa֕1du0[%?徑1%L^io@~XZΛ_Vko;((WxOR>[AYqIx̏G>c#MR˹+"MN:tǨKnO Պ-GMi,KodbP#qH4?>J'Q!vL)M&z4szCL!Q|ѩ_-b7;sM=PMÏ7r `9 H)Ԝj='alPSu&!^hX55d4#.0Hk:f/55}uFW|W$&bQ_z'.' Q鞄&c\?4UxG\dNĕm<ž扻" <G)N_ 9QxzV>r $&c(Zz5Ljq}fλa)*vg d{+`4EYT"YH"vV?5.+*$%So̝zɨfO?xח֚!3p8f}XMޟ]L;\|yMܦ|w!r uOv.κ~Mir^4VػԧGŚw4|ϫ0zf9\2˽1)7ٸYDeWXcU}~]#G Y9cK; ?/YuV=?f2B~DL)ե`ldr@ǎ^i*Y=:7LqQ/ߑG?b4aCpO/-O0%_^]֛o[^xI忣*'li,߉GT>L։,?49_l`p6}No.f>ԉ/}e/ݍ+eCrrg1:bGW.JV]˗'MOf+>Tiq\X4Ց Iiw&:?变bI,*jw9h`_ZDO]F1=ACoIiW.'*C#W00G+oCc1q xWe5+Kc]*A j9[КɄ}튶+t.9zbA fjt5)-v]\qWWk\UsSo(-78ڻ6Н퍭:|N*aS]\;bZ;;7𫫗| tXxj(TV"g-w#"dr}XS6<-ii6ǘ iLm6?W[2%\d*G#ڧe3`R;nB1NϱNއ %G]R[oȅ^*SllJ[ĥǸscCm+$~KwY[Ԉ0 &-ӿ2!@h ?*Mdo8xA7͆y"0q(ԙTk{nj^@OObʚj"NGmNOmmLnȣ)<`O|mJO]dHDQ7Σ$&"J݀T3.KArpFOiAdWʇڇ2 ȣƀL P?QE|0ȖݾT,Ι>Ճɚzoŏ͎J-"b{& iN6Pg_"*ZCKUמ(.; xwHO |Jk֮EqB)T`#ȓ; !jc1N0Ҷfd^ fF,V9ZC zb=-o^Z1ȕO-f!V auqWcbKԒ/Ӹ~qG'c!n]1ҵRTbialh%-.;H/Zm-ѕҥUE lJݿԜB^'J6y}9ϛn+%ZT/`3;rrm&?`bUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*~۝o+eѢi;Wl⫅k, ▲{c튻/犭N 1v`Ev®BA.<~iTL  }NX{UlPp|Bӳژ='0+N?|1qnOS W4#zav=&}~+ֽ1v0s]Vp Dᵤ#C¸oԑ}tD.S}!4ᕤ" _#ě-JغydarOki[[ˏTS,d{eLM,C WphVhrSwك''