!ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 09:42:30  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TĀ$t 5sSo-:$Odɥ$͍߼VuS^WAݡ ۷1zr^jh[׺DGwv>3=}+{ {H$=V6oS#{=V@7KCX٣~M_i}-iG]=EkeAGÈFM-{ EcCO谿^=6afVY-[)+kvѣ7\(5~28q s[%Fħ~,n>(hdMy=I$I$$I)I$JRI$I$T-nJ2t3G _uDnv/\1/s>Vwno=6l#vߍ564m`ٹ.oQ6&YoկA-s:^͙WhOgރ~^^MSqkqOgR_uYOˎSO[<\8k=w'ыEƹiq#Y gZh n,ͨ5;}un]%5b?m⭒R4H> qc^ec_Pʯ/EɭwM!Gf[aVtE/ofzNkuL%wC9lV;XF%Z[_cQ]š3uj2k@]xm59&S~Ƹ:Cjojjz|nى4q6ݟڿut_ %RQ*I$BI$I%)$IOU2\w=#ٻ2VWJeM-d]L. kڿIjlN<>O rYqьm408˙PmJZfk=:lr*~>euѠGTZ6ehLIJS&ͭjkr/k?Qgm5{ռUǧmqMz=A[t6ܛ61nCpi/moT)eϰZCӮq *wR5niqnfpoEOM~q`9}--R7OqҌs<C[=O V:z-.f=jc=ygJ뎣՜FϰAX̞1'p]L2H٧*ҹhg~,غᵖ-gҺ}+XϱYjcctaszEճRUN&5ըZ1OZ\!VY_]}#u5>eKm]kdbꬤN7{c?kK\g[$Y{( /kmVi[&ߜ2NE?1I$RI%)$IOU}wxu+m+Euc}Kկ%LWJ14mX;&E1 o:87Cݏ7Z6ߣIbI9.fN>5V`ȮOW9euC+qv8ö.ٻ*~Y,h97')쪰s _}+]ퟤ%&Iԯȵ2\Enǵջi5PژM?uG_{NkNvz>t$w2\+?f{kn̗rHj:0-Bu>Ќw ;5ڝSq2->P:9:e85\bc)T?H9 7$fn;.k nnFg"O`5e嵸9Kluֿ݉ԩ'#n-y[>u#ԴtSk=GZl}gٯcZ[Ӭĩg1יG"Nu5 #*!|K*b'eI%-e4WE2m'k >s/~U?2>ΚFe22>љOz*ɳ?*hu 7:uo{սN6報:~bk$`*r%I$+_TI%)$IO;-6Ck9{5߳g:s31z}ͤ<\/Wno{e5Ws ];'"e㙩ZG1VP7[GMEze@}6S ;cR:^GRȪU~zWnկCY?Z}]mv~F|0,ps[m6v&E}/RW~/Q[~uĻ 465V.U];w3]66/ |c`knP1ZQ1c33&  I?A16)P4z\XQ杳ٵ (ͥkXnF\Gn8-qom{%V{ZW1# n߹{=gLnN Zm$̛;uƜFb,6{/k߱ A}l$K_k̋sOO΢Uȱ;.9m{F)H{kH6wmjnH&ZWSZ.-;=~61_\G72YV}mo6ʉsŹ 3Kӻ=G+#P|HM.#hWU3q>qq0Vf_ݒv5er5юXmP9{Hy.ޕ(_T[K=U>㡶Shoژ^#RPwEߒE!ƣ{xg!1nYE.m_ֱղIN(/Y QMV `lkW= 45:cNNCc6]eu1ߙ[K5x}[UetV7T3g%Ondz𯱸^m% I9TI%)$IJI$RI$I%>mޫՙQs7 7{={E붖˟$o[^J}O_έr>Ð,ɵnC[,HkWmt~쾟g[e7m Sj,k7;ֳܣ9#^-mSZ8 `^_Md8ÿVmf ֝I{uKrң WK[Elk@m_Nj,}\:mmη̭k-&@wZWX1{!i&D^>=_TU~DxQZrձ՜z0ŕv=}y6_b >}U®}2h-9m2Q>Ԙf8n c宰߳=vLz+ǫ+vloF r kp րIakkuqwͭI"Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$lPhotoshop 3.08BIMZ%G8BIM%}Ǿ pvN8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTVersant-180_PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM[ update_maart2018_v2 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TĀ$t 5sSo-:$Odɥ$͍߼VuS^WAݡ ۷1zr^jh[׺DGwv>3=}+{ {H$=V6oS#{=V@7KCX٣~M_i}-iG]=EkeAGÈFM-{ EcCO谿^=6afVY-[)+kvѣ7\(5~28q s[%Fħ~,n>(hdMy=I$I$$I)I$JRI$I$T-nJ2t3G _uDnv/\1/s>Vwno=6l#vߍ564m`ٹ.oQ6&YoկA-s:^͙WhOgރ~^^MSqkqOgR_uYOˎSO[<\8k=w'ыEƹiq#Y gZh n,ͨ5;}un]%5b?m⭒R4H> qc^ec_Pʯ/EɭwM!Gf[aVtE/ofzNkuL%wC9lV;XF%Z[_cQ]š3uj2k@]xm59&S~Ƹ:Cjojjz|nى4q6ݟڿut_ %RQ*I$BI$I%)$IOU2\w=#ٻ2VWJeM-d]L. kڿIjlN<>O rYqьm408˙PmJZfk=:lr*~>euѠGTZ6ehLIJS&ͭjkr/k?Qgm5{ռUǧmqMz=A[t6ܛ61nCpi/moT)eϰZCӮq *wR5niqnfpoEOM~q`9}--R7OqҌs<C[=O V:z-.f=jc=ygJ뎣՜FϰAX̞1'p]L2H٧*ҹhg~,غᵖ-gҺ}+XϱYjcctaszEճRUN&5ըZ1OZ\!VY_]}#u5>eKm]kdbꬤN7{c?kK\g[$Y{( /kmVi[&ߜ2NE?1I$RI%)$IOU}wxu+m+Euc}Kկ%LWJ14mX;&E1 o:87Cݏ7Z6ߣIbI9.fN>5V`ȮOW9euC+qv8ö.ٻ*~Y,h97')쪰s _}+]ퟤ%&Iԯȵ2\Enǵջi5PژM?uG_{NkNvz>t$w2\+?f{kn̗rHj:0-Bu>Ќw ;5ڝSq2->P:9:e85\bc)T?H9 7$fn;.k nnFg"O`5e嵸9Kluֿ݉ԩ'#n-y[>u#ԴtSk=GZl}gٯcZ[Ӭĩg1יG"Nu5 #*!|K*b'eI%-e4WE2m'k >s/~U?2>ΚFe22>љOz*ɳ?*hu 7:uo{սN6報:~bk$`*r%I$+_TI%)$IO;-6Ck9{5߳g:s31z}ͤ<\/Wno{e5Ws ];'"e㙩ZG1VP7[GMEze@}6S ;cR:^GRȪU~zWnկCY?Z}]mv~F|0,ps[m6v&E}/RW~/Q[~uĻ 465V.U];w3]66/ |c`knP1ZQ1c33&  I?A16)P4z\XQ杳ٵ (ͥkXnF\Gn8-qom{%V{ZW1# n߹{=gLnN Zm$̛;uƜFb,6{/k߱ A}l$K_k̋sOO΢Uȱ;.9m{F)H{kH6wmjnH&ZWSZ.-;=~61_\G72YV}mo6ʉsŹ 3Kӻ=G+#P|HM.#hWU3q>qq0Vf_ݒv5er5юXmP9{Hy.ޕ(_T[K=U>㡶Shoژ^#RPwEߒE!ƣ{xg!1nYE.m_ֱղIN(/Y QMV `lkW= 45:cNNCc6]eu1ߙ[K5x}[UetV7T3g%Ondz𯱸^m% I9TI%)$IJI$RI$I%>mޫՙQs7 7{={E붖˟$o[^J}O_έr>Ð,ɵnC[,HkWmt~쾟g[e7m Sj,k7;ֳܣ9#^-mSZ8 `^_Md8ÿVmf ֝I{uKrң WK[Elk@m_Nj,}\:mmη̭k-&@wZWX1{!i&D^>=_TU~DxQZrձ՜z0ŕv=}y6_b >}U®}2h-9m2Q>Ԙf8n c宰߳=vLz+ǫ+vloF r kp րIakkuqwͭI"Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$?7Z,$wM2niZvg~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb] Up8SNi n'br ZgUD ˚fOHy0: .CЬ>59 =2Gŏ{dtYFc;RmpPs$cK%kaYD AVM$ )OXwy!uDg42snjצ奺 Hԥw9WGG4vlGRMB~SW)3#5&2Э: P~XG}$+@ˡMˢ8,%UH YꨚW.%N%TOMѭ-ZWO92y.8l\g2u8'* -i?vUw ԁ[ac4eݚ9 ~,*h4'zBvT_ 4 r=GHR+*Uރ)5k#C(5)\ٓ |i}1bWrEw۪ ~p[IC-c࢟כ Ώ_ _]m#\mq\tL6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊I('`eri/SL60Qݐ9rᤜpyc5dNʏRs̊|s&EϏf_2W# FZR94>818U{[5M6/n!v̮7 $6sdĭF70B*j1䑕B9TSGą 3a GO,!NQ:w?r ^pƹ1 r9wt {pRvS@|Wlr.M4"!];a+ D6*ثb͊6*ثb͊6*ثb͊6*챊JG^O\ )kԏ i^@*$ ,In9=Iqh!~!$ۮ[VMIE$* $eͻ.8;74W%C̦f*rjA0KSeP>a")tJq_f&Dw%czqӮJ h( z9eP% )iHtfd>2 }$1*\w!3bE OnQsToDR)iO0flMt#nJR\I_"h9 j(ki6+\=OZ|e.N:W"`(m/K+zh>A'=͜ȣp~y-41PYL;nc! :)zpk۲UjEjErEK2ʛ'ᅈ:|zldS# (V&JPo?a HP}}!粏QdWBz`8V=|3 $KdvJSǧ]:Z\mh,߯{̀&71G_cĻ;K$>y< 8?afd.48ٝ7`iō?jn) Kď%X qEP+LIf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊.WeLU٩X銻51WWYݞ0F}Dm)",4~A>~⃑ôh; \r|v¥#oA_.q|0Nt(XTnOUP$6v*X֛$nP NVæڠBxمt[Qn,wͭ8"-|iGrlڧ\'2Z̷ icbp`.At 'l2oG49d+KML5{ҙƘE!B-2Ws=H[t"~WY9#U0vBڭ̢O7M B"v<\eʃ4y?0HSs? Q Ja@٤$VY̷AHR3q GuIsS֟&RB*Ɂ 5vAgv\5!jyˊ14H쁛M"0=ɔ=Tv̽/2뵼:R#ߩ+&`GjM9Ӭ_B#NIB7$?o5^Iwzl"9lSx`09?_̹)Yd1֭{-<>Df:@B^kZum3MVT9/כ8E)hsp V̙P?]/( 7>Eh2ϥiF^BH(i\xR}Ğ{ \nYTFŇb:S.W{r΁^lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]DIM[.!SG~xd1Jr$ZckZX^^]%Q,.l424#q'OʳV?d3w MlciG5(NxZڴK@8]y'PҨg=rdOO(sT"RtCOD r9E {ב4)I{ {;F zT> ҹ0!S:=AbTc$,!ɦ!Qȓan,pzP&&'x%j\ jM[51W`/F햴ܓde!ˑ $c#צI@.n'DB; #gV.vOآCMn3$d],T%HRZQ$FyD\3(]^HPރ9&+-ԃq+I Ɩ;vtG;(Y5WoʷʓDΙ(<ތ7ZZ0?54^G.h vQZl`MUEk9Pm԰޵7:g--:Kry;7^[QI$- i*?8yYђ@:.b}-La@&¿/fSsqS2*ܕ* ?dU+FW|?͆~.Y6oȼ@UgD caR!&XyRdeQJ?9S%)A@{pՕD6vSMt|s] P!$~!ƛBU%<÷C~daZ)/dh-`!Ajvƹ]vVC2l&f]l:CoaCO ߼s3͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWf*2ܺh1l3#Ak8PX|mvꢤeG =#j3B̧q.Ő/w<6|妯hCz uhuy7OF崐p$^‡/Ã(rRN-bv>8ZBf=-āѮ"x0p[gV$ªjT)N.TeGdLsFǡ_kWY>"'h| NP£l񓻷8TĜțfR1lld}!CM@J|!WP7l\ӵ̽[5͸: )F"PL)SȧM F d IG91{aNXW{O,EE ϷݚٸzLpZIJ`o+5"vߎc~ W*(Iο<d>{xCnkp(p7 15r*cKjGa14cA%Ҟo>X28s:wor!ž+ ,MZzM3 d[U* ҹE(*:?d #PI+I%Oy¼5+CnF&=7)ЯJ PP}{&NʔZ SX(O.^Cޚ@ݶ?\7K3*̡L-?fc`i$R Ssg/:F 9TkُdcK[TJPoˋ"CPkJZer2<j8s,z1@<ܔ(>Y,Õvk[*PHuUhHR>;#$27ɑG* ?jHrT^;0ʂ^$}'K"el !/@P@yw2~ʧaB71>GX=$To|?U gGO:N2g ȠnEHɕ6l=v#]ݽ* |~日 (-NBz=\3%pۨ5>`?$R+z>mSRcIĦio 꾤ŹBK-mw#/17NK]W HC"R\QIjks K)&Xy_Jd F$8|4WlҬחJfͼjO|aQGTZʛw/nEAܽ߭+.)~fCs7zK"ZQ%qn&×HWӠOϻfZ J%kDVSH~ZaSmC#INuٖ#(e*U#m/MLc$ k5RtJ,gqBxֽ'*m(zͅMB~+/JٟG1؝9+G5{g?%fSD+Z~G6zqP=74t޽; $sfU胵:">GnOLzhFum-J MSw$w7&$ĵ = ?e !(]4@m(5I*IڟipAĢ4WcZJ1 #V-yzB?2/] HGAx?Hպd-.#3ՕGs.F٤#HDcsi6Tpq*qݤp@`s D)+@TE^ɚ &2 +c0Y 6_k9f3%oYf;RiOfCˀ_~_?k*'`PUxNF~^nrMj֟ޔ<sw5rdPGQQdh~"\ɇX'˕-h1uó^oQ#P5-JP~9208I@'ey)ؤ0u6U0Zu^M(J c峏TَP8ZZqsU΁نV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbN`V6DnD4 =p:˗Vc/!0y$uy-h{LJCn'&'hyeAV4m(Z3eRGC3܇)4RObT ‘ob5lE1xFw@JMH4#=Ηv} ESJ9x.1B1_mw!?OMa^;ፏ Km2K)M} DqS [m-Hliӏ]1gtB8kS$vPMU@FVtDִo'>(8#cbبZSܹoMM@#$ihf޵܃OvfBqx{ v crʑt:kiC=Xɷ՘q{/Wg; st'jwpA\e#8ϣZJ|rti187=+O(B|OYw%?Vk2kO 졡ƠohKj aƼPrJdYn#l)b֘kB*Qq5&OԑXґS hVr(PHϔH"U > 8p0iRHW\$9!H7 6%iZGe$x  ?QR#r4*OAZSzjM۶o{I)-ʣF& pׅA _eYϥ.@,h[އo9=rw$2=kqj#ۀi)'Ov+[C鰪xݘP'ft$X ?7-@\ÏQVI=ARƹg$oo&Lz;EխYy3t&mP9GmT}@:2JGQS;vp4悢Ir[jbvZ BE?cp)I55I_"Z,qZ7'bO@TM 6굓KjSƴ9"Dq͕n հU(Y<Հn;,{C;f>C-P:Ԣn-yX7]"8Iߵ mE3#tyB~;˙>d}iGX?._! b(~T>s]aU؄,EsiXhF? ?#iN$ bSA+ѨǏoI2"kl)&+&>$nJlXq@} 1'b $|yt@n4D& Un&ޟ6$cdMۂVx.@NC&7.۞ƕGŜSKRnG*)NFSY(}ɧ{K 0ur((VvתՇi;|RpeH j:od %v PRS1;$ 1ZM 'N<(*9Ƹ8'~lXnªTSbmHuI|i9,Z5Z}{o3i+햋KW} v}DہƣZLԚF6Aj*ttJkһo|L۴u)/HiSң}9OF ]:)Lӈ=)sy7u?R}1hT^;B+^,#)vQB_ЊJx|?d:# țzsS>nZ ,6Rw VOE}>e7.d7a5*U:}>Po(g΂`+Z-w45! m BVZW⧿Y^]A ֠Ɵ~t8^iGwxX'Sۖ]X%uBG84FN<Ԋb^>x;%ѷ YV7fv.^ 2?Ų8eYUhTRv_#nF}Y8}N%2ʼPLގ@ coTgpkLL JAi?)3Y*kֿJ0]"ؚңoړk3=XKr`sҝ-j @n?=2 Ap UP)4?k- Q8V*6rT-߶vXJ$Q:SB cӺظYy: $EG:[ጊғfWaZeF窓ɇc=vc >C@~q7=jF5l~cܙ/m$sҊ}Yޓ].*#=I ]=2A&jP|CuKҼMjh7ιzaKŘ|OSoN9 , X|5V_O\G3Ȣۧ .2<%8*5wYJy)Em}$nuj ܶr*^ˑbs{A͐JHR*lO|y+ 2A9vA :𩢝%0sNNvK,vi8{D4;ϩo|v\ LVM'unif]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ULU٩51WW51Wf*ꌰ [$kIM E:/V>yeSDJ<Ä@c65ǀLߣ.?/)w#pXpdp\Fd`mDVNӁZ.4 bYe&@'y;lOMS1Q_btk@cVL~2M"91~vq|Xr(I}m0X+N)xmN_UΜגEzbM?c D2R;T$Fj˸Q/#,l+4u+K$.aWsMҟ0gw84*v'#~L ]VwGM7$ xW#vֲ\# 3o8e,j:9ˆ9Tm_gs_3^IG/ qlAjo\ u[!Sz/[Im$ГdG3AZ1n;|Lqd3]LJ({2pGk47"z_l"JIc6#^T%TKYz@-jI`b(~iq2R m_ "vTc40/MsJ5ח/i3ݼZWR+ȂA P[%SR Ol?l aCVSJK֠0_py%{AE7bښ*ɏY2hK1oLN@pZ] 0NnHiZu uZ2ᏡM٘c,˘LgdJ?gag J˶6R=i.!/N4U IQ5*dֿҬ)KХi^tt|O'oZ2Ol;<Z ݃Ac#G;~jhOO+r !cmLnBo|f->ez'~f跙:o$mrbjlk!RZI#m3l945EAU!y,~@○tSDNBz5j<ɿّk܌C̭hV0U*˥y7wo'ej6ZU@4߷?j,e%1 S:Y#TG Zn8%|'֢w&׮Ǘؙ߳ JXz=m^y~?; ~=ML K ) @q"egf\e"(l*Ï/"@WQ_jD,wAAkS5g%uK8!ӡ6o` z;>=N[bm{<|?hӵ~~}Y]WשmY!|[;T,h:|ԑAܯrrCK(`S@VQ"zR6jXpR(:;T@2^[h9+((hI4uONIqBhGACI9㙙cR9A5fd kӎ),,cjl3ʑ"$UIq4/@6 g7#P;8+ݿ0ێ:IEK! D2ȕbw~+]ډO=1R74Y;$V>[ 9TrP z*~q+lHA+U1a*rl9<-Z<RLvxO_RXJ ב GrQC3x 4y@r͘d(Ab~i#&/+K+93"1h Z@3~X}rX0Τsc⧮":>Os~[=E8/.fpĂ<![\XaXԚ*|̅p84Pb_IɆ0yF=@?99'?89,ҴS_[f/&c!]!,Okl34 8(OkU՟PȌVO"@2e) z5?WM5 x?r9s~CQDr}2K8luOlvq 94cֿ.ɝCS62T%?1H+PMz?la֛U(a_68<&J̪ջ+?%[ bT'ZVVIPv8qYoQS9!vyĝú25#?؞X\ „ 2#pFfm߳^( CTߔ_yuvEcOI'c-euQ;-a5J TDNok7&HbA_$xui1S#ݼ@)ù4y|"tѹ7#JC^-@3;t=嚉|= kTFE/ BU,?bI첲E~OO2-u4W$!+AorCnBPP>?F@C۝9(G*#nI O ~U>SOQ_`R rduC!#$QFIUG|}_[BgX+NN۟StƬF)~4>JRf?$o7и[TsD;C/fB6'k鶟Ddv&^A@  lM87 XM{rYXBB*6#sG1e$p$P}MX~?xP+27}8Ǜu)Z|fw`܈HxIkˣTJҕF_9^;_jW #z vʇj!r|Gw *NC[vl*qTsr!F坏GAD"bjENViS&?K:aP;m_( T xbW:(1fNd92R| MfyxNxL/O'z;Ti]_y}E}HMM^JOP΄wֿO,_CtSا4i ̀?C&bRXY+R>ȡ$_pi:|%Evx-k8}Yr7UӷonS~YrVV$ӍA:}ջ"R~% NDmN#jKdhފ*y7kJ|judeZ4&<}Ml@UXS`(,߶Iǣ%y ?o:䁰w˵+J![2.7)P1RQ#zRj@R˦$ IkzxUl֝$ $20di 5z4eJer5C?,&_'9޲(^C, smԟZkj"oAZDYj!#P*}75-,C-6&Κ" 6ln/xR?e"NQ*ɽYk#""K*CQ/GOiuMKwr+ېm I˻\0%Q(;p*Gm؁75vm8mm0^ё6&,[G.@*jHŀ ~\.nv;J:*X*jZ6b]nMP8:?qYYJ ҭUؙېuL3"lwHERK4#eQNK^R#Gj%VB$5PޟJXnpXrôzgԜ*¢? u;T%n5'5'H,`kȰAZS:m<卹)ֿZ?1KN)%8r=?gzhTAIf[Ol!y`Cp=?fNjG ;|•54CnmRHS ha&S0ε]oi*j$fӭ좬q*e|I241Iarք|u Y2u"$)Z91ڀ}+=ML1,~ 2"3I{fhpdoyR]"~<L?rN(MNSGɠޟti Uѩ*߲٩9w.򒥍m1؞15 VAٖL!Uڨ# f3H2z Y)ejFp c=v(6ysMT#""j:5YDR: ^FSb P%bڛ OWFŐ\2잻?r3߫krȿ9/KeFq򫺊t>oG&ltqc؆Nk1+"j5N %<\"Kۑ5פA^J-VbOs!##+5HvCV:e#vW<&TԸԖ_@om#yc, H#43vn:PֆrKZFp*]3u52)Bdd#z*<0%oe;,j)%KN4vFF,uao?NAX]zn?"~(\,{u(ștbvpY_;:μv:V4UR[(+ ,j/=W$ qnjdn/֧|z ZFCԲB}6ζ X^Mꅏ?:7Y"6H",?טSq,)=@Gv_,J4 $_p}+ bD"O',2 >SL%wsy:j(ovHUVPvs4-d1UIV'b?O#7AAN@dk5fW }^52T#u]$a6 P-#Tr}έRO{tTLhZ[q- ;,xnH~dOӨ;/Q##Tr?AfrZ߮nCq(HO|iV&FjAѝL =J _KnZm{L]Nr? % Z8l5"<ǽ6*eLEA2Q^lPVCX wfJ}/13lKRInJrNffQs@6E_NOQe⬗d~1);OOt(JЁWSl$_Y@׭c п>NA1+qoISZv;nXOs!K4)4ʜ(4$6goТY@T>Q"I^(RK!&I^Ho#esUcQ,e6@j;~~*#'$vh?YLfjI [|y-*iJi1Š5vg#&3䪌5 7s?l?L299ܮtJ_QM;mUꪃr ?~Z23{7^!J4Eo}Ot( MU81J OΗuwF?i&BnG٢{N! q;xXRh H2&J,ySUB>&ve _Zd}iFXՉڂdW Rܟ+79ʊ"@~}D?g91^*~rM땐%m̔ *iÇLμAQzn Z-ī$M(j+ *'qT΅٤Bd'zoq d>f}_7ys)Z|1 {Y`( QsEw^ حxt%B(P$N>/S|?:h?;-_;~_ +%!w*LoE]nۏ*j>7,n[\{7f4ϒ<tmO_q+-<_ $oZfr=)nSc52]_C5|`Fz6- +#U"F2ogŚMժxj<쐦ōz}'?M,#UbHb~&Hk$:l?Åߙ#|5upO$^CF}nY&j Ҕ tM|XѨΉ1Gl|*MVx׏\` wW奴s llv95NBv@j4f2Tu='O!."4Ҡ$U$P}di?5٠\աS.ڢ,|Y'h=~-stBF[4Jԧ]s~k#1}%=k'W1 8'հ'epbo.nSd@1wR& jraXij[{J9դXۣIl⤗BHd̨}@}N6ĢbViYE[64Ę6Zzu˦9PSKCtoKON<л'"y!{?&k:HUsYj}Hё>1]9?\Qdar~V"9 z5)rJօ2p.:6jSL2+5䣷.np3Ͻ6X@V+V%'U#r:iGWjJw#:nTARۊ|^R{ݨKP N-4l5P@ j1(p5Q֍eRk^9g)xp`E[jЦ*AlZa89ߗ}U-9RöWU;J=H=XiSN:H}xo { __5CwzR7V<\zP)4GdADKHE7JH jR EъSAƜ+L&v_nOj)[8wp(MٽΞe<lU۫L0F(n[3p_txvZ8`c,Tx죑Veד&yz*:?CK@4`hA71 ED1@f Ӧ m/HԨ%Hj9*3!2Sq0M*K&E2eܠHփ?9et6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG`4ŔE[#R6]-m$ɯUxy l$ue4$y/G[yI1Ӊ"p?MʆpW;|uJ z(j+je؝7F0 r ˕)H's;5vIpɺwmzUġ3|/GS7k Pw hX|* SVK!ce/Hd^*wd* q%G'aO(({zE@:͹EĒN~'sn4zN"!@qol#zij, ZQz-0$ ?=%*cp,R0F')GX-ItfHUh?VH&.c))ƥi|ԫwM2Ri[7sSKu+=Jm%BwBPgjO S@sK5v# |+^IƎ쎏KS̍%)\MUق'U׆jy/QN9mD}2ю4mn._gqR}1njH5iO'!(lOóf^<)Ɲ*V=FSb> ;փ)) #v|ml^4b4B)oO!O6j yKrtut~q d5+ohs6d)*@2Lm9qJRgo\r`,+FE*GsyUP OdaawsFcޔ'\*ϩG|A^ag`W·lGdTjC_g'KBL {I6QL-&-Vq_L)NY*Ƶ҄SeiтEa3q-ҋΟZz&zs@ΥXq8f:$Yʏ( r<#E@t{8ⷄ2Uő=>8 8Tp\\'Ÿ<~1(/JIHۮ?^ŭ$h"ru'"5MxE$շ2"FIƝ4Bp':a1qz^s/AR2kFjS8Lc,xC"Or.>, ;lݾ~&ѩ*N=\fʿRc>Ksa^]rCT*(6ժ>/ʃkKI0M}#q!hV;4oZq[9gfa^.Z*wجṆ-9Vf7Al[ An}2Ys9Ok&!ˀPn6A[5qofs% tyק"ZZU9Cn#49 ȽZv 0Q̐$-Jo˦ dw)4 &|묦FawB+aF 1rX)%IKv bd'䕆,}Y8p$#jGĺ-Q~R$ T.f}a},MFT͛ PT.ESh=Dgg+ w5> aPO$wBqXѝѕT8 PJMdeͶ`Xi[H)j$x:yb!Nd SQ_XF <#Q62\6Q%bjuwELZP GYz@-U~W%N*@RZ"f_/ 6d cm ГC?i>M>t wPYJUj" =(0Jzw_B(vvtH}y1N3 -#|kjXHoB]:<G&ΆHHaej|1-COoiNǯx uX+Yq##Bޣqef +15Eȟ$ʌ[2sːX|17)vŔl4~_F7+DgTm|95o@rO1S}!5H}9~|ёN˂;: fᨬoZl9!t @ٗ2jeZ_C#3t˥֣=)?}Ed<@?˛rqJ9&v \ 4cYЄ>dޔ} ,SNqGٟ%j[ۏ>;Gw7%}#)>K-].Mq\ vA:n\!#q@P[`y&GA5Eh+y~cؠ5Wį Ft RvZ@c85ۥŸ?wp=&YG"w&^LM!Z~#ڌ;D5qi6c0ɫbI^ UE'<6<M?*#,,m!.qjݷ^J3Vh[J#$TV6r[A3+qɞig0z~?;D1h@q#eDH-&߰"~ØŒY(GU]? 3.%FXS,}uf_x䴕v۠O%*:~ )` 0٦J--w C-iT6h ZInN-hTH Ɣ/~?i2"?~eXB RY 1~S T/:%o4m_D;@lM:|S E-Ў$q!ȧOVsBM:j?Omґ1j@M idpx3mx\#@D|4InBr?7ORME$phAi"Wz;7:7F80 g[DM K `Hҽ(>ܫzMC;\ lv;a%apGRBƷ"VV4? 45'ɿe b5j8׉;+8)&'b=+S7/3d4閠 ~Y6Ӛn % #HW~?rK`Yr^w.KQIa` Kb_Y{;=N"XF#E#;(վ)?ᲁ{ Vr$z#?X%_vrt?_f֍vj,5&ͫ(?ъ-ru@? *0h%FH,dgaZ*+]Ni~*Qu{y1 QUXY?5pc 5;pe2$rpyJɐ/Y!Em'4 Dxݙ4b}94e+#÷.[n5#t2ym_,+Ū84<6=W*v R01<#Shu^a^ fRsVbJ[r J6lRVs*֔5&_oaM)Ji?44K*"UUG<2 nV]VGi(ሡ@z1_sI@uU :5TucJ|@X%o՝IX-"uE!*E~Όq},Z!#q\;E>;I]F2B}vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbz[q$O1lzcaVKv (<3쳞=l5խ؆^j漉Ro}]Bޒ&F'Zȶ]~b@h3.d2TcNKZsPs(AWyz8:\p)!#:zXGgZP9mf(RKlXMh!ĂM #J ڑ?MC)PWD0z` 4Ȋpp*էTreasu:iŹaA^s#n2?Ku*Pl߆I%4t_&"X'! P0sW-4dVk?eS*>R ]D%(&RUB/?_S$ }W]1ǯu4P/6mcf)g%]VoqBJ?g7:xNWu.͙27 XWmEi,FYu5ueE7 C @.D٥ɓA!YE>ꧣ#Z=BGM7()jT Mzz{qelX z\n:f.?(rXE!J}=I2ZxcJ $ 8?K~_TZ)RV4$G˛hdjMV h90c[3q]$(CaQ @إDaQos3 qS̎*HԧM0m¨d4`O?͌D#mO*++ѹO&U^/`o>T##ÀzpfޖOE_g1PFsJڽ8si@֐xmӽBC7UʇnΝ%hQě!Cr/˚w߄^È!+^(0v'?MrLPG'+Z+6n/ ,bRv*N~&b| }Z6ſ3LM"0 d.9GbN?֋p Ơ;~lgUT6^qEWOoˠ3~Ԯ}Ge(y!t~XHK,!?vW]ckƅ8s jRGjs[YÊ+*|jl 6]&3c3;{:A+8ܴk"Q^UsS d2I)tJU oCgwY4%^% wdHfn3'3_|bt.2M^WmE}LZu(|?sBoFz]Ajy|@;EQ -?㚍!jVÏUzmMme)B"+|`[tMsP$ԒI hl(+O?ԝߊ?k8ꨍXګesݷ!2iw'8B"U )?U9ana;+ K&B Zps3Irʂk!5o9h3PJ牧# lY^͝iVUʃHMGOrhDPI$oTX\o[ۙ~L猉A^Hَe[r7TF8>k+o4Hזc8JNW2(ZTĢ#ZoֻYHtj¨y_5Z˿Ƣ߲<0aNKȹQ,HICՖO_cjp*+Zl(V.6ܙ8iy)=2JXI.W _N-X`AD;0'W؞X,p9Wv;V#o:F ?{wDsZ>I:Vw 98!C㒯 J,"? x-9e:Bƒ;%Z܍"%@,A>?枑wp-QFYYn_˚#7(kq"+$vpڠӀi_W+wk|~`mv[}>Y9e@= ػlѤ3I=(Ny2"Y AV#q"d9;M ߖwbz +HlM9j{3uiBIF9>ol?@|\AT2\QwIxPʕ>F%P(kJ1ifUם#ǟ*1uJwOm+GY GJֆ5[m]`WוݼGjbyqrPS7εpT˼jXuo[h)%,|~v>陦M)Oڐ/¦s/dym5E%EOQOV/E~*)0GW_dc4fUmf-('VUjgAަ_ˎX V0iZ?'٬m7HHH&HMN<r U*WcaNXH+Z=P"3U M{5)eyަqڹn!e2hڝzRc,q iJȲu -:"y?֡whXR7;B?T?h?P{k'orH)V`*MMff(H`~7i2ʤ"ݷ,|ت Uh>~rʈDohI,iЂFvSEv6a?֜OB;qK_# QUn}.FD(`N䊎O1x†I.v Q(BJr>X yF: 9`}KYi +8 St5"vh I7eݛ{ij~#@c_ȵJf%0]AЁl)2h?X֛S}GRf$L:=1l'<Ҹ:V JoجUvo?ȓRQO\aSK6V6ԉt oЊ@Vsf^ߦ ՎqG?nvιlqu7;pc<QK~j=GU@GQDf5o[ޔ]ٻOorT?_U>#FYT]Ő<)Q Ȋh)SU_쳇ZjIΈ<ԓPZX1ڻrHQ^W kZVr2 I (kFKTR9i,j8Ap#fG2DԡR>?_5ظc[#?Y+PyTWhlh=h$|,y||*D1<ڢgw!kwr(UYu4IR؏n{zbNOMq]φ_L,92ף2%Ct8.bg_5ggh 4S~ VWSTytq[*)*ܗ)/k˹y4^"bT"@ŸGxp$ӑuSvmjW>g@7t ۀ$ g0H*BBJrױ0ɼ[V^Yȷ?˔ Bk!ZpXol4sq aWgvZgVAH*:iiX:#ZrhCG ؆Ne8$FU`gDfA75&D4^]Aݘ]GENCNǾLyimT>iI! X~̻YM]R@D(Q'9Zc__'9g\\2r'aZSp?k7vySku( S /.?Ej`2؛{ɿ瓌eS:m KDItM`|[7_f.B>U#4e1бU~?;;s1v@y!RhmerBh?ر.2S=jCN_7(SdV.FϨc|u=d# f@z1W~1σWb7sL* :m*c>Y?܄v$_`xjO闐 b"` GǙZ$UݿW";^jAw>E4f;"CS?dt^͜0KhX}#s[h y,QSu&>9##%b)USuZe9a*`]c5tήn.xl~p1xm @=_IV|LI;-C8lBW`~`0MͣKlw'pniM~uRO1R~~V3%Բ$6tC܇4&\QVn?k*ћ ^'Hαgӂ5]MYv%_zRS$AsVB(EUB}?쟇79\ #3^'b78dZIjZty\uޒ2kv4Wa?v c@U 7B0AC)+">T$1U1 G'滉-Iw NO&6;;/@I'n'ԌIQm#t"YRm5$W~e^1ufrz%N>o,*H jXAOi<2D\r7=i".x`@T5vfFtQ%n C/QGp 3NѧAAe¤(z$@uvsk[ZFV;6#bV8dATǶ3qIqh=F,O'5'7N=.eIT%ͧR4HypaCEPr٭&*mTG&>A~@4eha6tgs%vuli|ыx6V wj|A~.NZ53Y"Sx} v 0;$c]ه[Jn%0 I Ju|_鼙@?e' ?2uHiS£xBE-zLއB2;wʫ=.4c( EP SL=%ֺ-"N Dhʲ|)>/^v|9_ѹ3+/Nj(9\k|.g((9 e7>b" So@*?obm}B "fF=gA>3?'ApM,kr4#|ʧP8dQldr7d#m;\@s("U&Pת7.jlxIn. ;1,O~̋W1r?\ll *X#cNGifiܗiEb n7 NsBCCkH929 7I#r%%7I/t=)rugo |9Qܝ)@mcv@GG+ʂZaIਤޢ/?ja-4 @+ xbgn+"R!هTf-&ޣ 7 ˘PxQGYB,^ "1 otR=?D7M+i:Y9jQq#,)ˉS3d gσPW?:ozxPvv*A&%V  xc9oe {Rsm`R푰IgE]FU zǡrPQr"fZ֝X6`ѱH5w4rRX% pI/m\N>>$*йݺӑ_8?N5Hdq{oLId1?QfH.Y@s5d_kR+lTGV]+M$_6OS>(Z (e,v;l(:-֢X2ݺgIbiȲ.}Q(]\y2*#1A-YOo_JG!;0sWgGP@?6Sqy^NlcP;:U|s-W/5U(~ŕ\ 5hD* *9^P-UPn%~ϦǺ$pe;$3:7' ?}ֿ{ak tE)ժ$ 8=뜑 FIkAs\jJiN%lGS) ƌ_BrY"F_hCV7sjM53GB+NC!QnE8xƃX^XGlW;\jOS 4龯}B JӡǘrPPօ9 TgWc>(at~,H$ d`+ߏǎ8\P'O9 G,A=$WkdreT.3 o!扫E)EKkZr5k#u?\q@yhj4 Jp?D WXT>ydb#z47<Y]! 9oe0ȿ ? 5?[lJJV;N[!erK*Ӗ=.+Ojū7%XbN\@BHU=:o8'֓;(H#[:7yvj:}WKpُч~Nܜ2Rʲ7HwBQlG4y$D0$H ?mWVhI4?E4?N?c& F+Rh!?҇} S>FE+H>5+~ x{^ DxCS~ʉtz r sȞ́($My7!>"ɇ唊$trۂqVe5UFĤJ\ZUiAoJ%f\-jR%FVӜOPaZ}/y*C#Víuy21k E+˺>g7#xjEM;5jG_c$0#>"DW?zBPHC]yhX *h,v>ܞYlfr$U3tgg"<>EѪ3Ҡ6g=+%Rӯ|ac5$cQՔ{ei!& x~mWx?Hm­d6 io,A}FB%)x?o#,DohF\:21$ @VeVrjDFqP4Ӓzmp#^ jq< .Y}!"*C^YF^7e\Ntt@܀jmBƖIHY$ъu˵Czvm~ )=P*`InQwhh: ՁޟC/D_g>$b_n}~E05gxG>mk6άH*w9xEx!u9Fxž[4^$P,lespd,})@5~'D|{l>2kNaY4d@h1?=gL^9xE gG*9Kѹ';ucn1$ZzlnEFMR@XxSuYE=7 VnYmRPGR_u?2k QޯBi$x#AsE^aB7cM+9OW7p|q@yJ)J>Qi (ֲ ŏTaxIX|.I6b5KS;WVQB($oIqJޒ1dfT;;SV'/WCPH~-ú3*~nu2Pm_*U +y9Ư%lr0%xӡ4M.+m$0Ć5iG?o!)1&'zu~r~Q}1Sz94j/?\RN&+T^zxWzam R'oY٧:Ð&4 '?arMB hăQg2 *Q[6ZOG֜Z R:jO@ٞ`:_FїsӮ عod6:иYrY N~O "Dc`э+2&H@(\o'M"N ?ħ岞6 ze9xτАi=+,Z*_.r e"JV?Ο [䄠?}5`R[Dw<@O)vW H$,+@,O_s VcB{t?+czun@z@' G=>.q0`6: 5-T.'#|#2*Z"Q˳V< && Ӣbsx5?j*.hM!^+rUv){?X%UD¤HTxۯĹW5"efj4t/^2,KWoڗY>LT0S;&sOLNJx3<ͦicMt _cэO߅>]c&Z 6n=IvoL}k@Hj):e0-}Yfᐔ+8!)4Ҕ@FN'LBm= UJƜ79)*F4h>UP챥Ezӛ '5RceARKTfs_$W K)YVo}HZrktIm5m&j~4~[#C 炠YҍV'p>RcUW-&9Z#ǦMldd1q]>,}A8sf`TCٿk,)q!jbEiߦv-)6QpV0Iza y$ R& яa_%DA[ȿS1s6 g2H&kxXT#oOǘ'p'%Hs1hk\⡇ L"Z|ZҠ=rtŢ>p^#MZ"hZx&9^m\Z; Alkר4YyѱfSPB(֜%űQxY Uh\Ï}ʸUQU ~&,o1UKoU!?VeɨPV ilZ՝[ %ŢY[SS52uk!<,<)\70M$M%ãJ\8A~[1_9)B^YmOXt7O/VO7:Gå[0y1_ԏVL=)= pLEzaޜV21 J_9=["F+Iױp)ذ6x6IJK Zi" C8l@)rtXylQNcL x,@`ƣͯ'kk  Ёm53=7-զsε%*$nq|#OhHegeiaICuE&puB#<\Uf|dmYʩyrf r$"[( q7Iߥm!AQ_@;|_baqU-C_Wo+;ִg1^B by/PC ?[j}EO&.^U4Rۍ:Wq M}H˚S%( 2QQAKb1E:R;Lai\T daJ ۏOOU&x R܊pd_lʎ.K"Ui6h7*pw|M$To9K,g z >SH|ceH9NsgtzJyt1K01۵qMh{BJRIG]V\sd,BCK*oB8%zԎslMuV9k_Ƈ#;[}{.$0Enf7pF)rTWp^?#-\+V қg\9+WRn{!=EIde-#ms?WF;p~2hAF6̗I#愓f<;yф= ?$a4m#+ɓ@ʫB),3{v?*esĒcqZ%s\ %k),zܛ:UܔSʙ[)4`̴nɆ+l1쒾o1QϚ~9ZoF(pzq#; $rQ(nJ~?AIbNQNRê4eH_܎?,,!]{6&6%ЖpA/'MҥjO%'Y3PKc: [<_4vKӕ:XmG$,1rWӻP~bDs#;Iu4~PZ6ZW4rSː\cSFM~X4+gcGO\$BфuJf<3e`ԁVNMraO hКvy 2HB56JҵKӨ{r8ח.Q|nv ZJTКΩ0tAVE"Ofh9ބ 8VGI> 1,#AB9^R9Ē򩓄dvaEup璊rCS69F(=X&DVM}{eaTb`$fC5(E*9l@\M{i"uw(hDh}AI"d TNLAmN&&OG׶Sh?F.H{.D5=:XhŌ *ՕPR怞/)-I+O,% @ggMf4ZnNruVؼ.<$dTgcDN_>b @#d{L|kA~>I8(v_YϞG K xKW[zI%Ru$>ujjMŁP|JN`q$ifҪXC\ա'iM^m9Mtш:0㰿%Ǔ}˓dw\yƬ[^]F qY{u X.\8)\&c҇;nIMET_w4doAiJNB AˍёjN*Gȁ ,+0!-tzؙ#^FjQ~8I;IŋEݸ/|g_k*տFsqz^{S;ga@Ic!}]4&5gw9voҏRb_!:՜:;EB>/?pzh<;.)Ue@v75j@A xjD1 k=ϊ6 [ IgOMI"ngUqjh-Xi'Njǭ~HVI=- رs(<6Y#P} z#LE H|XY:Hsv@kJ%@Z#~x MfI7 4cfv"ީrF/GD*ޜ 64 ]?k3lWl"1;)yI^̗P~!ہ["/>x٠<ޚ)n#W02;oN 9'hy)4?gjnY1ާ nHȯ 2*X4`1Bzf>p7"j[aWAZmF9wij#N$\h])Q9,hf/%ܶ=ScLb;9JPѡs VwJ5IeWV݀zg llCy& :ʲӈԘ&\BbŘ~AJ>H@*-FpYPS]ۋ-{XP ٫iO[5d%%$J0Y`]NeiCٿ: QO `D Ůyckbm]o|'.fSڰocӯ|Xym|BSWr|?4xJHSS/6(F$Q$?I+!nye?1ɨXvۺ9MڴR+桽Θ /-{ԃQ09-n`kOswo$9 '!EC\hYH%RjaA<6k"2=:~a#v<߈_\\ +?"W]I69ǐyQM"TՈk GԟMkG}0wF"í)rR2evq,'C^RWs̿޻C ! +_6VPٟf?E6dV'% MŸW$/ۍk$l-ŅiF=EfLWKrP"/d7)@:|BvҍֵeluIs4A.֌EyQҔ΂%u )ۗ?7lL\/BۯgikLE%!K1!OrVsG3:E㔥+d''F+oLLC,&6vNY9:3jE,Q}͎[U '0vV"sIa(П7a֦#;Lèۻ(HƮ$6it%s-HDxxv<</Mj ӡ#`[ mX(.v߹1Kn颐`m8OiU?|c> s/Gk" jz{RRcvzZjGPEV^$R(A< iW'$!Df+юWZFs125*v4focl'o5)#QQǪ2I9M s?ꦕ"!ԁTQwy^Kך>j]U}?fOrqʉ6F˫镕R4zs$m~7Π<0,T֝_T EOpknOr ee'5cګ^UsRF,S?&8* 39_Iv~h!wIsZ :sYqJfkR[~w=0#Fͭ9gd_Z պPEFE^=5ڇ TnR9Z~!bcNνƭ0b~J>O)j-#܉:mFPA PY0%QjR{zuoav/x&]+2AN ?'yq5GUf7> q ]rUEl> ¹;MSbD=hr,ͱ#%FP;lx3ы(-^S#OV> ?i!3's)Is+R)?7dd}+K!К+E?*i _؀hϷ?.W3,L7/3[mjIzo5Ơ=1?Ts;R^oX ۪*JZ?S1@qjRەw><ʐdXfǗ.inݰI,c@|EJ1~Kvor-AJoyW$!v*ݲ5TQR %v?Fs4S7&J~&c.O" ?ٌV1'*n:W4smijER 6[wb[渊N!@J5ߪ a8BKWI{H{hJO!a@Dvip3/ NSw޵z٨]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊:ʏJaQOcUFƁ~sCj$EZ~F,'V.(t.?6'?Ðy%9zS&7~'bX'f.t*SEXWٻdxԓ%9##9JQ zƼqxR`U;/*j(k`VwkGdf &ٗ>-U\P95\Ϳ*)J\PVKru;K Z ڐGߴ\ﴦk!"KG#G.J 5HiTx2ׁC떣%$AĘ TcpZ?M\JQܫU(cSȎ1EF2b[";r%!iZ??9uڸش~(z+hÜBЋ{"sr9ShơF|>XO =;Qy9}sU(zL|XEq[f,Z5,VIB~џna(+潫2}jqB0&͞l^\=A0N(աGC٢w ~6nAAL`H@ liB ( :]$cA= cAFh.dsy#٩2!6hA?޾/|T9%ʬJ4] ^^i70MU|HxML4h$K- 8ʣi0ez}Ǜ̈́؊[!c\#(D*NWY}T>cK*}zxF?aO,20d\F$zǛ+|\_/[Q\Z3ƞ>;mV W+rTglpfPRXFA_@H|?k9˝@>4\nP9?Ǐ!>y6k)Wgٽ$S~>iʰKI%7xҊ?}l\+RӍGnn>PM(¢o݇Ai$Êҽqg 儰X5wSmZg+L}Js)|WnxTxfUg0K xl^c< S+1~$՗6>Je`9o[:<΅䧶m VDpZuQM=K.Ħe+ATo|p{ڏ~??qEQ,K B|JMq!PЎZ!d19¦={Uldh(296ZV#H þyyN9v9_ cZw;n- n3Wj#蒀ިt@O*0)z;r8Pm3~m!drj$bTr N:UVTW1Sdv_#*,7JjҢ On7MT<ϨSES´ÿFě`Fc$luAstgzK+ ,jmJr$Jw-QTȻ Ɍ̏ONAYxW-2$[ A2rj~5?eF$# ٸ&yȍ?vpUVgJ ̓:O$#ƻ;Q،[پcT;`p}Vq9Px>|QƊk?a>9JKY$%z`hez$TNDjd@L`TfOvӤrqCh@ VnGW+ g[4=e7^6Z,:2ە7ڹ\[4LM7 ε|koYtwA+B,_*_O'xbuHzTǑ3z58yw2KO69״[:P%O"iGs3E*Y&[i ]IDtJx;:;,Eռ?1n5!jQxkAcn\ܙ?/U$^5=cg y!ޥk t);7"ߙ͡~S$m"7~W, ɿwg]VԔ'tn9"(arCJsp9xLTsi$J&_GLw(*qŠ2nЃl)Xy?G+'f wm(WUi[@8O$$xXʧΚ]d>@*ym˜R1ԮC0LkOM:c>;1)0E38*v=L*W|8ٜ !$އjy6bANu-7;ЅU%h叨);k5zPRHš bR/UoFܾ/W8vI 05:_y㌎їoWT{ޢdC"ȃJ}^s̤y&2{}h0ꇩ' KY?ti2oQ+-4ga}8QdG[n\s2_ۤAsҁP~\K7qy~0[L$_MFɔZ?nc*"*xDw-r~rk.Kd1幂*`76p^ۚq =e:Hoh_m n?ЌCzH_avraחyCȔqٺn)2}$9cR[2A c@+):Hf%Z\?a|J N+CyWʹ22jF7-^Oſe$5Pu#$J͆US]_㙚̗ Py+C/fmrBH(OqGCa-EMntcuIeRV!qDܓl]r VF0ughP)ZӖxSt{yIc@e'uU 5- "V$ Wx[0*K$[i_YE_z|BskBhO3}52ȘٯS_ɨ4Ngjam+F.VxŶ%zUOiՔFnMKhn #%APvz6TK[$aE\~#M~?_㓀v.0K޳prWg/r{vJ.(Tq'91[Ibits +zP{o =H+tk$JԆ'}1SM[,nG$W]#.L<5PݱKvmBTz=qaAi=\wxo{Mo+PVɧb:dXZF~s#FUHecT #JQ2~+4}xBJ̥URVه.68ɔ~R[=G; (aI ̙};x]snU #/fW2tq[Koa2"6|; OQ7d mꣲ8(3OEn(Kֽ)\rp ({}$y)?96tFq!N :FHոZk ֢e\&FM*EfK,l1vGjwW-W//drVwPuzV2Y}LDpFKOAs2|UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊yF'nk;oN~+6Q bm'ri[q`Cn82@qL:`lðGXDGkZl' A+y.k5~~Rt[2`s )S})4wrۧĝ+ߚ Y,,d) d@[aMׯ.s_=)H;qś&yWԜZDl Ӊ?Ngd3aW\!=5hi:HĵQޠ}VAzQ$ OA4ۯG_ r~7ee_[)#HZEQ(?&⶷/̠҇QO\4&IU.Ӷ7Y`\O l aǮov矑ܧK,-zZr4"]s!К޴ߵɅԞ+n}[k"vvVDJ9 :lckBWEG\jUܶ⬌~e4咥}UUgF=o̭!:h̦BE: ,& P@ͥL+Pqqof'BB 1lB\KHv( bQıgIiz7 ۣ4xV&r%MCppJ+FU =NըUMp>pI7雸tN; >Zl3 /Sg;qR &.] *yQLg.zr-%ReY!CoKqTz_ST#anu,Vhx8;2/hI"*P +~YԭM쥁V:)xcm.7`oL65&UXNO% Vi~.Osycӈn2O[#,![&0>ʮ`s%LIXfS$0|_k va\UcvVTo2:ؼ"ރ_f`'|>0΋ b0򠃻~OڣfIQfnGxB35xiJ/dݚ9S' s(n.yJ^BSeCr_ r, %VT'L>nCD"BiA1*e5`) ʝ[adl=F^LhAE̦!CLuv$;R+㱮J,ZJr u42u 7lﱝA%#LH(o$=f/l [,`l7rm%"Q*> ?OwKn$d@ ;g-hq[{ظҧ+omFTUޭ$-PUJmC:+4a Go9Pz( 9Kr9 JT,l#;&0eDWr{p[J$Doܓ2fd$)+gRIk9OG׍Gr~ieptOlݥ&M S̒NQ$oNזQEz"p>c3јRt7tAj(U`>!`L***aZd~=l6_aP"*AsZg/ǭMȲ;5oͮe  $PV>GJߖ_\ Z1 5hklI!VNkZ3^d#_g4`Qwa̤+d&+U4"lv4c l>56j MGv 'B3rVvg /Nw=s˚xª)*샐ߐQA@_^E$WrW<1f_ }DL€Ұ WpJտy#w ]ԽX'uUXֳJ)$oip^C"ֻ~XcE(d[K5TIŴ(MH-ڞ?.r>2ů;E@ay)]EstO+` 5'ӥcef?3a5%jѹ1u=6a,M Rg<٘x}Gs E&a###(m6\B㌤OuQ_aׇ?g(6FޖM¦52;'G5P&ϱEG×ՍQ.JVp(s;:bFޛ?iZ[qlWQ9UbhOVY{|K]&PV"IQ5Ÿ4.t`+B+pC~_ڜd=2eZagl`mStciTPNw24ψ+m=^*lLZO?g%zFV0  7}:(Ig~mɥK(Bd W?97ɎC3~$x-CavdvZȊ(ݧ/~cㅱ_Uzayaf#Ȓ @jyoH7/rDmrL/R6w q{Mz;!i:28fS"d b.zYuѷ+kE%d p؆RK%J'HUZGC#|OTo$}_^< XɈU|wP B&Iy7Е _~] ՁO=g I8':ˁ%GOOZo5R aAUofB}%v!3nD5Mj<="3=(#3n XIKBUjxi-AJz~9>wpT7Tׯ uHZ!PNj!|$Gt(;H>ӑ<@L?<% ~Oz:ŔI}ˊ.Dբ2qRHZրqɫzMʟ *vbb]r:]W0!I%~שEIj%<^C?WX,՞6VFY6>YB7ܩ9g5 7;NȫM,}bU9 m/ǵ_RkAw#iFCS?ɚ9 q(!PA%b44eESd5`)@SyUrT5m@?3jjM+zfEM\^ե$FQSr3=G/a>]p ~G!ce2!(G^l"?rʜsTF]ձxld> 4b@.aA;NB H& 9T"DJm6 Ⱥ}yWYrBT3ti]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ŭE=9X#e';HڄeB-R+՟V[4@\$f*M 1۫lO*Nh oևlC#i'MUI/SJtJ:w?͓dk~ V64S|LO5.~@WW~(F.27 **9RoM*A={u9X^Em6:p7$rdvW@s<8@1% r;TW, !wv% e)v,OMi ǔ*XT_4`'ҕHޭRO2V>5 'jƇaOMCrbE?x~΂F>;ZP]"-/SU@q :@ksZ[5U7zGv}XiLDC~a})+djӋmO˖]SUEGg0,1: nk_LS\׃&2Kplm6)29uΓ%EiMjܾ?ݶiībi,YRU "w S-miLxD4J~\$Y$X*1^⡔n8k96! 4oOul zw;->.CUEhïu?3.[Z"dn?dx4b0Ah.bj;$ VrJ--П$5ø.ot0w9gqX$o^zIQժd +:rtNY(l/ʼA kqpg0~4/8 A;V POlbw&LQj ;|Ye=4 3]#>YVuVZ¼W-9lBz#WSXEPī%n#puAXgC-+!?-Ċ΍pr#V0t&ԉ7FaE]G`=C rX )-*~_g0nR\r`h^u?kSASBqgL)< J5?Ik*kc6/Bٱ0ԅآh%R Oo\qL$bٴy4R.<fHfUwu']IyğPs^jpr O$ 3*i?øE׋ [J%v8sFNkoHn[ɲr֎p_@$Y$o\Χ@syNF"6i$>6?n,mTe%Q:wq,iPq7)mɽtBٴjoV RY7OJCMR CZ 4~c=B+pHdT)O⼳m.U);InG PBAp"\)8)mBPڹllBz3ԊqI'\y,dK|_sW/zv4`;0|u53fD*J,IŅD<(;6ij^p{չ*Nu8P$""PRw ݺȕƞSncmshcs@9(j{o@U))j .U?R1;*$@VMjFq=[JW'JQN\1(I8Y+#n<) <@1eZ0]! TR=ŪH|2OD8@VxzzeE1k^\S$Sv-'zW~I$@[B( U_o(뿩UIʠg ?0P*?deq5BbA`t|7q0;ΞюIȪZCgkYe/F4c{vk9̢\  ї?ho_v,/ R6 in[*ܶD-9]GV^pRNp%TS@x|\O`q_ip}D8J_zrbB>km;τoSor[\I U|?9}_zLJF ħR_Yf)+:OnR΋%gVa[5Fj?mZQ/!_Ji ypx *+Ub9 Ǿq;D㓒P-: o=[i-;;fKG=GdET,Jܐv+WJa؝Gf'9솥G+G 0 ]Rو]L܁WrYߵ?o>rD#d#crʡ^%C\?yC_W.[%|NG##9'qh]*I,h;<ߊͦW tѴK%F e^~p8Ә$%Th61(Չ;ߒ<E)+ gh([SD59?꿳Pxmw6 s:Ƌj.G+Ex@aބ-,ɘ_:oVVJm0'FflX.n]M6Yկ z5e?ъB,޼MFcqF@`j?ߓn]G) Rܸ9읅(5dt9ͣ& {JպW7:>A{rBGJNE'o ۪;NM*_?FB^;ZT;f)#F)lTC]c&MvӓI4V=P;MV{W&+% R6 5N-BQaRԮ|骻+Y@RXx+WHR*(PrZȌE*GiQJS6Fr& uP*ΝszMrS`KiQ9'qe:JC_Vf|V2?#\}χ9zSJ0jMZ>#%J`bbesO4zo\):oN}~YlX*;*` 3(8 .vmi5R\IbnVvv:H_[A#py8r$B4&Ɔ0wE<׺xm9_B%ė#9)L1O$+89(]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊%^Pnx Ie4-/Aβ갩jſ)ճAIIE C ;;`[TMI˴y:-a&^PО?v#y$hZ 5G~J߳:T,7Slo9:U_Ni? .ͷ$ڇc0YQ$ *ydNʽc(hĖ4:_ N-}hz;'()DUi#3c=Vc,mz#slZ.^/Ym+zLfűY#fGb>`BU`Hn-OyOpDȵ%dFҠ^_?ʹPM@7^ SFi)(h 9}>ÍvG9.+Xn z| Lxj@W BA_|_4l\NdM*mE}n9 'iO)bSp/@ӌ3$L r&?h#1T0;q< 8Qc/FӌvNY|$~!t(rQ8e:7, quuCIC"e iŗV^e)R 4kųPylȥ_ߣSǾtOFvxB+6 kWk$ %~œ##pP-IPT+Ҳ9sB ہ#m.#?WQ $dӅ79?ݞ+Tm.+N bo`0ӋfFg'T6Lt#]fx eeAQu#Y b%AjHx1I98dn\PQZ7 Vao.m| _\i0osq~KS8wtk$h6NΗM!(_4HMrujry2vNM\s YvSJ0_2Ɖ֕SW5`\Ч8ke3FIvec[rY\ďļHe@)RT'&QyQR)'jk (p\O9A !k[k$qP>xo.HUhބ=xf8ȌfDxϟg;/Ib> ԑ.?BZQ$Ҿ -br::l뱳N3 gf6W*:#"5@ I.?e!6Iឱ'8~/ŕg2.]~?ZE!6`'pLR @y3&2f6Zk:|s~h[]Zj31jKˋfA1(;TabѼrD|+x$moSV UV쑽Ge {7tPhgP2i߹Q=e^O+HWXn2JKh)nҳJ>#CN<i$[0E{`D?ˊۯ/H-T-Q4bcԭ,A&?e6?Yr5hExaT 8XWRe`cqo":`Lw=BSJ]ͮe;~($~9׼`RY~Suiw KhxUHaEJ ß@y*Wp%Wf; Q()e|m$%w&$bXl_\0d4s"FJ#ܰ߯k 'Jub]2hS!xCo_L+k:RJSxU(*)_?٥؛l$wSȈ\j|}f[u i'QD~!NeX4z._Maq ,KNQa]_Ф]FXXڼ!)~%9ǝMC@[r` -GN_fZ;9WpdP/ᒿA 552= POWg5.A*  %J`7qi di&>+Uoh X_9G5}h(,@nfE+:]VGbhHC7%LlEc&5N<^$) w׿/}&8c,!s @qz &E\;5#z-KR/lFS1W|hk#J\4j'/os7R +;xֵ$j,Ӑ$tKQ,kRʟ\r3p3r ^2ag̝ TjaME5\6J]R^ILʪ 7ᵚberV+ !.ґ ?OKlq 4 7oH"Q^26Ygj(>9tj: [(X2-*FîOld7 HtSw9C|iDAhn @ƥdjY.Uև~ghBWF}e,$x#r+0KdҒpj75Q\x+顑 >hwoW"'R.>HZq?8J0:%= GM~Y Y8Ȅ5#'[鏥&WNA*M{\ H=J%@bN~=?Ir -Jԏv_20$X9C1Pe7ahuj54޾7ZmuRw{8Ƞ t+`q'֕Y07 >0543V(MV%rAb < F +\oh#PNF޿.Γ%?,HQJ{~s?[SUs?'Mμ)(ğ ֧9Xb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊&?SƄ@+sAjQNNuM<Ŝ#E"JT/.BeO|gYVrf,WԪ^9-$D:=ThzlܑC-;둯(ΰj W!z͞XkˆMꀛvAuUC=zѾҮh'xG BtwSv9X(T@e,cҴQ_mvq;͎]4YP{r9-#fvQ6Vȴsy'C*+_TO5@’MAWBH/[96BL 72DO& ?\xB3)Gݓ"C$r2皟 ~R6-ǔ̗#d Yhar+p궈xDr:~ë24Y]VcJR ?朂][R.6H"O~*Al<( "i$qWOk9Уn2;ev jCU@@I3zp}|$Su<*Ҟ+.( le7('#dLPCI"MI$,!1v$MmAd Ȓ*ܨY9Ij(dbrûM* ^'vL$qI>@}%&@B;WizƟNjuHSǧ"+RCMWj}3vR<~&t2n9 V,KP} y |_h+6!g HvXkk ?6O岱e $|_ 6)AN>|1Fй+ң"s!F?_bca*im2A ?Fta-UX29&OD!xxrDbZP*MOK}1ad5FAҴBhGuhĕҝ:LFyBwsF)k 4wKkr4#QubKr6 ?k_6juC )1#rRi/v1%W$!ݫ?8909j!w;21OO*dEL[nëɾr %j9y.CM~҃mr0$M3VnC1TB~ZFYWP ;s\[Rܡ5JႀG**?o."})C9|m4v[x ,9>%9vQ5V֕aߘطim!FŮ#gR.[ȡ*Q?_@܁6̝Q) MAblԤh՗L~WN'7DnJv@kc * bHғrh!K);r6sABsRMuNƛkq5j ZWc|ilyJ)}S_aא,jB ^\XUV VAa@ c€T!_q/=ŜѺQw<o:lYXM5>o/W+` _kq\OD'UJ֕: ʈR՞gaE([RA9;,J6SNݿ %&׌iO'cV?᰷϶O62U #QHn?|O1._DoP~%J)r.Y5?._f6jj:~׶sY Y\݉ﳩos]3hI:O^?YƧa$w?K%ۡ$)z(GAmn¢+|ky"+- ں\XI {yU awlYYPP6p @vRއ:_Ht2Y nSXJ?+HL,. R+@*?f7~&BH%e%|Y;ޘ.J+_k 5z-/ҕj%縒6NJnXX 0&p,^Yw怵RP w&hixXB@po`#oǡ~?A8pK\:*I}fGnYQp"sN*βR<))Ό.J86;Su/˭B t)p[hz,zsIkyMbyǵ#WwTrFk`C#WE$ wreY2)|-BZ(>.5$YxU-}Ik OKA]8AC$:trjk'WsARWw_i҃9ė(b(W6 :8ZBZz սGQ"O"ynpROpw΁]um$Ss 젞oj5M+!hWZ,I~H2myl|iKi9d!>*)l8s4%c $/]<)[GWG8m:X 9ZY:QE6o,̑QZpi1sƆhDzT1ԑJwrig 2軀N7-JY> :nH @r,E*H8ȱRF@:9^*jW1J4u7<l;4q!7=+  F̪PUޣOOF*h@5ABW?*M*~zpb{(;\EE;v|Ծy!9$U@~ 4mPjH~YɑU Ba3x]s톚,viH @W2X,qFj9u+fYf'y.^kR -د\3fRCwaC˂'*|R`8V b޲#vr)FN>\lXU +Z?cFII!SjzʫvĪQv$gߔ3$d8 CPt*k:XvO%'jX$fb6QV;~oNG&لE ƀouѐ"cd?._ ,_79%lg>+Ep?RK-  z`l?17hWZuӮm?RsQQɿ^.g8qL~OJXGsH$?d嚭Lwo1MIUY.))(4E@70% @lv䢔uGy\έFJ#~Pͣ/DHX=֛}[fT:T-a0mKm1HVU=ol]qt֪k|]V ٧ڠ>.UlJ4i!J#IHMpY) RxJ1mL Ԛe֟<΋czdu;:(Zpw_=:a_Y`{N6+5z0F~sQ+g) -#ÎhYzqE\ 7ɾc+۠I+V9$hbZ94 |~hh0n d$opQTFV @ZnJ??˴d.-^CEGxAMy"m'uRjwr&YT%tYH~;[ӝ%; K*AUo]wجjFVBak y9e S^Nq(_YF5BĿi o_'*;o&^FHq'W H4_08׉ޞyrNXp X7ȾxUŜjoS,~ ƛ'}s:8E2ޔtRnTM~.?hc 9q @4oCHVIMC%Ln<<#{yoBk-*+]RHMJA]jdg, Pj/H}4#ԜX!TO .LHʿLC-.ҥ-RԴ b4z~5ybq W__TYJK_7=z07ŒWf7i9rn9?dZUŹ ߳\G#:=ף7 D`G / &idDŇ T.+4ȜM4ōõys]b~*`ڣ:DFaFcdh*I'doؐ`ni']^'ؒH{~|0vѤoٺ$v| 4)̢5a%T9n?hKxW nZjj|^ЪGY].ō7ْH _QTѥziSȩŗx8"-(F#o#1|!\HU$x)G_vGc\ t+LCW|_gA@{*LXk5Y myBoYد*H7Ú2ry8TRn.99*5Q*MuQ"8j K[vH tcջ,J4z} _rU߾FEQ2CQJmAR!^z6X4֧c~@ IdÃW*d5CDe#Vjgb`"fx85[!ߛ6} ޢWpO͇gʉ:TwfyFV{mo$^!G:VzsiwhҚMC@] o:DRuF;>4Wti$< ih6p7l;x7$lL,/bPmr@ ^$o [ݶfRJm~l;>{u4Pv۽GѐqJvolpN]Um$//]HTdJd ng1J%!M@${fȊ)Ƥ 4OƪsVdAC~o8-[ַh20 pABY2%QAAJk^l.چ"z|POT0\.s4wJwZQZtm"9K; '.+~W/?q iM5|ƒU,HH~mY)t0LHaVWVZצq[=+P{hsGD&Un~[Em%D3q)QC}Џ;}/כܺ"U`{PGU^Q2gQ_宪ZaT5)Le饽 5dK2ḡQC:8^gn9?`S+[sI3|-@Iރq8"2; Q<[ .q%)jsa7X809>Z|>/7)T)i&zaOAj( i4^敚9PI1v6*N3~cEy,Q#I&b7rsk'kd rH%}m]y6UFu?.αYBoU v'0uzzl`DO- GB65̿"+_֭RCHE J #5bH}^[*7Q&U& lN rzR6s veҥhk}s^&0Gqs՛uUp۸ֵ8-cRST'fjSeRxQ-ʌ1o)Qw) C٦a_OV;1 P=?#qSR mWzbisaɾ$nFa%>@iR)(aq_9ym~F$~*=E ^mxk2DVPt <Z0 S*Fלz HGh=Voe ]FnC~VKtq"(=odOT^p Vg?!#2!_Iy)W`M? ?򳊞VpT4*vl`lsKiF?yn~-y)ʭ'Pn@1; 3b' ֧aZn;[$z`VˏO5)w##42rp"Ssp~r'{@@V2MWNבHMTohGOk$ 7͓J l&׆HT`jK=#׭ΓℑR)&{m<e<0l2\On v~hd7CKM6RJ6CO IDljX p%Zj gıy6T'͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊&@bXlvs‚Ԕ\B; 5ΩQQA=Qdjerr8Y{"7atgQr(R@%?6<05 M'rY@>,>PFƣW[_U0Aчb6P(E4bjLfO@#Eqe,Iaw8@dEѶ;St< mQq1*mb au30܂mߵYqB,%J7Q bh!u6YS#v_ |16^NĚHh]aWXF0FĔQїɖHUU\~OpL&cm"VE#BBY+4EJЩxUia-2M7TN)1א#ѿͦ <|~ف(53yZ}LGUV wk!6ۑ]YVfeyAz|_fx&%"4ի~%ڤҿnJ (Cn-f4ǗY5kEOO,2}"[:U)o7F_\q߳!+h8@xѤ`_گN~q-M^? kMK طK(OS*{h(jyw~>"G#բ"z4`O(zhG6c偘#O:Fk@ftaBZ)d5TTۗc+sRGݍU:´Xȡ=B\%fstTd}}22*f0 iӗOL=N74xġPqʣX䅊Ycq1ӎ6 ׷Y"x+S,~t9FNxS"urMo~żJ $\ۊvZYXBhPPQAi B'#u73rs'NxS,\51д VLT#zҿ3rk(-+^W~3p\3%>LK-J&zʣw;{>\ A_V#ի]u9b"2b~צ[.%JXЃݩ5,(/dY+`ǦJY5a_iKU2:)y+Jߪ+Shd5qNMkRj@O#VH£q729+P4֬iu;$!}?FjaȾ N܂3Sig!~?;ЕDIKn 1ޭQ6ZDfnu,Pj'O?O_1,:=E6 U?q]@X"$Ƨri^^g ~:o'BSrO ;SmpXja:_Bc#tdd6.NQRZ&SܫG^A WS2cN꘧YI$~L`jYJ  @F[X6w" FgFMhRU[*|P(*Xmo̙2TInENù|诅I)J| zɆP YzPu i&*{\eӭHܝ___g9ܾw6 @ҥ'mzM(V$FFmѳNl/D#Շ@|J.+E;\qT V'+5Z*ccj|R]547b@ 7ӝ C)sFA@9/MR6(vC\]T 1_~!-F؂*_ǮCSr"rdVٔ*ez⹧gl@@ߌsFDžĈ=DO>->^ .6Rq~3èCtMu&6)FtAL:_Zy+{`V6oAן.KHRMeg4m朼+P4.G'm>"#7#W?<.MG^=",Y@E[9ty Mbc4)%jzNoI-n0..ݏ 9 ?g+!}VhMZԴks)_NuO"u?5~Gd1^JTSEkBPC 0ݟ,L9p+CV_|~~+乸tI<ӮEMŹ)!TҢ~t2$Mn] !z#TUTx\<,X@pe_RTo,{23"H|>,A+z~Ѯf#WC?[,`9r;2}`zcdSP}8 qi^Mr ?cqkvH=y&.*~c~a7}"iWٚ5g"& Ir?O1p dʋV |DsDE> m% 4@3[MYeRx~*y3r\h30t^2P9 >#\"[i%+ҀfFRrQ9^pLjFnGg.2IG ^SZ7h>BɒDR_kU4Ҹw^JhHޝIfhsRO.ZEQ!gNVb@YXs|VNr#uU\w?w$%Q'.+2z$z_v'/1(%2exp ؤV|c ~"~&$V/?N]V#y(gl>+!,:ٴ$@%/Tغ ʔ$nsS-K5 GZV2.UsGOZ~vRD:/$Z3֔}9OcYbA#i1t]FUOƭSݜb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊$z4! kO{ˆg_࿼9O&5!IU"aIuJ=eŅI:Wf<䚆KH Hb(H+7g8JkM)Qƻk$CZlIIvPQMa"*c*Oؐ(p&ʠFIJOnglV3 &_SFyc45Mv߳볼[G7#~K`0֦r;hj*~.qʡJĶGv?<^U݄w-BRI@E'WsGIˊ60 SosLg'-Ҵ7q0U5 +o&9x\!6bY*0(I_f9۸ H?ua.{;C>,qP6mȯF@wS]G*|d' ԏ(Wq~gQ֦ږ1DM5}>˗,vqJM[+1ޞ6˹aF,)drS W)2<ܴa@i"VR҄<_? d&vgMWYJ9ߞ[[aBIY~ҳ/gpߛ <G5 }?cysU:>g}c£>.Ct%Pݷ*G A'%Ib#rJblL졬M[#seKC?Vnn%?7Xd\ f> Ӊ#Tɰnrzt܍+Hˠ,oŴ2DCS~D{ּ\Piuq|$rL H Qr&')ߎI=FT2O4 Н>XW#Sq7[qlhLvo~lh']#,(Il\8NTټ]vV9!`cO("Fiߗ/w([OOG.m%)\uH S_ YM*Ud%w֤^qr_rP@$U"HV_8X>NܾHl/v,J  7_ywL^;Wav>)eźa e{;W}ELM[4w5ItV"hH?㭮$H=#ryW'OF`*pGцverI7[1rF.0;>?vr9k `)!2:'ugG RGV5?<$OyJ\>t̳&FʣȨ*;Wd-E+^!M Jq?ECs3Pj=ydL=u/:0^٬ɌǮnjKuF*v.7fpܹTnQnY%Tq£9}l("#FY̟RNnGJ oZ#Ő;dٗ`7Q^ ziZ-A S'VFmR#_nLvE3UHAl?ŚHoZd6~8BMG*۫pLw*9ٹ3he3'%PSp@S'~9ba, Hr6y2Ibxb)޿S]7lFF$O9K {3=IOT oBb RAm)tqSg -# E4hP*/ ~Ƙm*Ƥ9,&(f9U ykܦ4`(uM08h NFGhS':΁,Z$R -M[c$D Uk[ƅLkD^ Q׼Unl ok{| MvzW6 F9 @er b<7Tz1>*͖jc:Pc4 (ir?jGNM t!qqsգUv4iwng9;ލH[dQc֟<ou!I(~AM9`V4@NB7i,Mp z'wgKcnSG y/H#mOY eTn9EMhqֺuk7,!;dHArMOjΒ(?kΣjq r,2s軐VP*ƪ@cS!>q/Ԭ!? \~]?Mjr(RRlmDܛ:zKtΚx^.#dsRMw.@H OZغ+r dm72c 0ηU^03F囃|\4n~[F଎)nHNs(oJAh=Q>"֘:t|~^IY*i׍>?SbP1!Gr]d^Wn}$ N,V:-Zomgan;nH~Ū}6I&#\sO<|YE%0Pюϙ=f[MU/sF4C URkG-Jx:rS΍K#6v4O`jƂMR6mY D8+Wj_"ȭm;Pk*6ol F>4_8 ̚Ҵב1v\=LB+N>m>֔.&""֞ɰOa~ڜe>y\- 8ʌP3'-(j6fr;XR߭=Q G̳, @8w%!vkƘ?OdN.@jVAjB$?:K{`9UNʽrzXJZ spG)9Z2+􎹟{O\U^%|ɱMFGtTO˹hfJZrq3Web:(ⵡoO )듙#כEWnxm.k.!AQʞli)ЅbCNKC͘R 9rr5Qg<ЄR8;4 )6¥a1ߔ\[f;, AtāѤ+[pbʣ )#owl$N^HR~ͿcnЇn.diJnzQɮ:A~,|@9N9&78=> ^2ASZ2sJjB4}9=m׊=c>q2!wS )T{4o1l)4thґ2D26*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊$ZyA h&m_Y`L-зs49 zJCf^p?d`L2 u W'Iaqq*9^OOOa{72@+ oΘ tTgc hŠPmG巇捆z#FuKAUtu/I%~-on 0>k!䡪W$S|\Ã(S*TWcreXn*Z&(6o>Ks>57L?oj j?d 3q;#卶,"@Hii\鿖NWV>Dmw_^'JOYh9P#f;Ix hzӘ<.c^9y?ܹeIJR+ۡo|h)0v5 `S3lbwDEX6cwSΙ [Z%TMCF_.j8!ynLҸp\Z(ޘR(Fvnq3$WkY\OB8 Vit'L{gm:`@S{?42En8wWտer.39NJ=9(-R?ވG;rp~] #a5ym_Us)Sz}+v;B 9kX67<?uq돎e "IGk!( Qe˽(1`GjmE0uhe@=+Lf6O:D$0yK퐵;;mgZ0m32 !GՔS;KԕZhSYF# 5_W5 aDBֿr?-FWb)5zlw6|A:?oCjC xltuj]yv$֟tY #̭7fdRHC(.H{18f9mb IÀpDoƼZV_q]>{)! 'cQ~rWHSy J :Ȇ}V~Y/}i A*|?T..HPzj{2 ni/ݚjS(kSZm'sE#YQP@ruK>kXpQ$VJni_bs_0ne9ti_ qH54CnۊwR~!>(9+֙lHoD selHY3Ё^fF+,~/i5}-2U,wW4ۦ+[Ti_bҽz`Jd+Z=VVJ?a6;cv|5+>DHDލ#q*)NK9]}7Z"A5~y/#VB꾳/oŘWvfVZS 3+4")F6}0 XcڨcѮ,*39?ڜ̭,M[Ɏ)%( ~Tbpw6#y,$ҫ*g|{Uj]hG+˴ T.*@.#Z4 );bpH5Foˡ8jko[ho*kO=FheܧAsZ9SͨjGϒ@ M9pZ  )S:1E1 Ool깽&TRRj]<&kfo% 9J>$^eR.ǒ?*KH,b󎋑mІ .&_ei!̺VN-OZWc?$X9"rКuį-{gUѬ;xN&i㉛4maf2XrBU6L> JӉ?_X^IVF 4J*wZׯVݪpiO.?_ίi$s^()O=G6yDZ+aJu߿Ͽ˚%X1N_w\S;|~Oha{ȱ#g㎸Cn뒋~1D4uw?-.Q&KZ֣ K_O0ZC ;? 7kEcv}vP9IOsWSj0^-I؂HmE3% orr"Qs+$a6twBf˝4k%L:9uI ~_ˇ_[+B#GJ#Cr4Dyf;;<#RU%Y2(?S槙o mGY$֟<梩yqmOT :t=71Pt‹{YD;3"hnjȶTugV!l(QPq59#JRyz؏e^OK@RHSi: Aj˯.休aJa\" G*G@3[IKKHċŜ%`'` R2B!GAgm| ο>R 7SwZqJ}/dW@hQIt˗|y @j: q I(AMCk\W \5:xb\Fӑ $~]2 }L!ONF(܂ƒGƶ~,Uw( r8wyBf/Toqo򲢪`ThGqMGG-Y\GːR>%#\c567cĮv-PS`:s;jq#T?M(Y!R D{UYW2ofyoJ2ǰ':x.iڔ,b)&U5>5܆l͡zi|DBU59Og9mƘ9S_1R8Z @n~tآz';m nf~31.iB_9VT4ҥr o$ qJc0?ɓq_0om✒T*[wxj /(*+ٶъ9uR:ZDaiׁ!nԷC~(P6g:֛cdFfIz~EE}H+y$ʒ 'qL@8:ފZITRΦ>~iս>(oNgd%y!4P6u@%,=!p)ǾcoShb%dɒCz֟ʆMSFܣݨ y…:CNTޛ7 ?o1UYROOTD=65M5wnİV9,UyW3rZXBRWzi4n^eکToCLcPwb)hӐQ.v? WE P(9|Jx.>o\^QVL"Jc1 !of%/b߷Z->/k\^H⸹G~'gd vs8xm%M6_Ts AN_+`jN.XD8 UVgV&dsRNC.tCwII$ w:ݤgAB?hN?i8eOA 5"Rlj"ƿ?gz޷싲(zcϣ;Cn^L>D\_J];klO&[2c^C5+O (G].:ǩ w7s4ԖHP3 0a}oN6 Hw&kDwu>LjĴ2RGMg,/sn-z{7KuFUk{5˝+ ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊%\7"ʈ$s+>_LFSDrE~1CSA;u"i3YG?x fa聴(1%R:2E3iN9 pVhX]gr# d'Ҁ߳8I$4oBz҇: &;4SIp3QGö%iY}E#!3H-ߋ` ,TrZ(VʹVd@բW4r5vةI꺍qZv}ȏD:#Vi.gf&wQͲ? ^Z0( |x?,jMŴRY1Z>DlwCwûrCJTjAs;0m! e\Vc&C"M.'!#Ě\XK#EƑ(FIKɭ~t$jwM6N>t1Ҥr~^9F}D&vEʄNǮG$3'Dx]&ZkARؐ =)6\M'ԩr*:ԟPF^ =XS8_SѤ^ʠWo^ eh6ߴib$)OٸmCUqc iqP̠Va㍿L\˩ >Ԟ[l{3\&s#rKP| &&N9-~Y+yḕA(sU]mh NG41ۯZP[*ȡɳ%RjAĻ REɞ'֭OT+?oRŅBSnVysnȨ># <(Sr(d"3H-ٍj$}3@w; ;hx)ۉsZ WB dOǥ8͆nKb>\Ŀrm"TR߶v&xg)]jCPP&n tyeNmW_6t}N69-yvsXJ[~%lwi"LР pĝ Qޡ?eT.YcQ?̻׵6K7nNp5E5ҏ::mB˾n:И%rwX DNU@ "ڧ6竿(%1 dN_꧐8do ʄ=O“i(OCČZbUfM`7QT"H.Cm+F$[(=ߊ_TFPQ'[CJ&E6b^_قF@u'7HVG,G0[֯:)%doo*V!~Aia7?^@ Hhǣw՟Y R,f̢7qAVS5Ԭ)rC;4sLV6On^.Ow,yꑷqҙ'6jl6K{ xF&e<"\їo_2˚3$I#m -[E*}jlx6sO̵I(D6,Im[\h{5T 4(iFf",T|T̙MGՙ7\[zDܶ"ghS >4#u?͏K#("*@bJ'#Đ0ZPiR*F?cCNK}1\HVtފ_s  "/ $~}?[V?I;i8ܘUْ\PqP4$`7:WNTV-cvr⢐ZQSD>oW% ,Psj|ۧ-L2ؾrdt(j ,ڒZ0mOV%:}=}6uqP^ |`%Ӣp $5;<|,ν+N^:P3R% NO'% )`#!'/ې̩WGOm_iK%(ǏN>i PGx?`$ ҴTOr5|N[% W1O#q>Uf{SќieK.R ޴9r/7I)%|F8LHz6vD࢔_-bJ%iR}UF!![i.R}Y*nw@r-~*>sH5 G) vQZXNupuu$+5FV?t1%&O!'wwvBx*Gzoۅ3Yt oxx( *כS8F!@"ey7E?NJ[l\`; ~ߵ0Z$ +R>ԇ1oe;sdpd+Nq}I˷+/ʇt8͇ʹesVJ7?NXF:qRCjd}^@۩F3\H[;(FkDwҎb}1T߹i}XդûfMO42j@Gst+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊'GT`m=>ҡnvB^cZE#E01ޔ8V-c‹5 tv-.>v8c^.v_[4Yy< ;DM~>K-$J>ݟ cWrS8|p n>`.I7OinI xHV> 4 ÒEsmҿ 46Kyh쟶~lW_Tn#ed_@߲ȯPf OT5ޔme_Fl锩Q9PJf: mi`.Y%I>c8O2}'sUV,ݏCۨ[qѱ$/>d ,њz"tbƬ1|?ct.0sUXEH3Fp&9Zid2WuMP$nۃg3qwpj~L #7؅DmSI? Ί $LUٿ欆/.6zJf1BO Fw*ǨyZn}dx (>ƒVT=<Mfnzzm[p7gPH-UR49%i@~ ^P\4gLA ~?[_usҊ ǧbţZXTv~|ULtg kV$9F 0~sctRΝuo*F+2q_`i?/vs6Jm'-4qHOBFxbe$Jn[Uy/>-o 84ą&1P+ZFq<!Rv_g*[X9vGV,d[f :Ʃ "E +\aݦ݉JM*L;?g.'Uj)-Zljt?rM+2*UH=kg>q5TPjse]fVqݪ66?R AN$cd{c-tyg"Eށ$ga?/A[2Rwz4Dg] )G^-qUbb8]΃6 2mKdOVCLD^W,NJ_|e;٭q_I\:OH,KSMs gMn'o(C\IC1r<~_N$ |u+6O_YM(Tֻa/[yjƒ|˭XHbXQizaHv8'Q Y#6A?jg^Jh/V(&U@0Ho7(=~oؓOdvpG3ECp?viO9X5b^F=G~=iU&`jnvnl(ڳT֕ e~7?W!zη$M[F*?䟋i/% W @~vq,!#? БZϖ@?)LȥSS[DSd~ACpSELliU"2qiZQUH:єR{fw96ž$F4vx=ِЪOc; ?!+H{γxlQ}@}%ZpokԟWw+JPߵ^]`~aΧF<6ZcY?q\ŁµR~&w78an)9MvPeRvt,q+]gY֟xJt˛(:0 _%:< OLUe7my!ew$QӺ 2B2*QWI~첑ɴ)ytv;.@?3yl]byRoeOuPGiYr#aNI.e,ޤ͙f+፺UUш4酜C`gjV<«qg4 zXE%4WW 0EbJSY3 gvF.$%,SzzD^̀9Zu~syꚴ WFա=îtzSp")4|,6n>gچrܣiQٕY]#<2F*]4hЪXeUGYz)TGQZ|"f5W_QRH(kUB O1UF1m~?.6undıQX ,-9'j5FJxUB9>,O:(Y!-kܜ +yܳ'̫oM5%)TnND+ R^!)^[q?y+?Ŝz@dP ]VX8.5i4l8ƀ!eXs)!lS*9J &;=;z0ŴVr+Vq*[LI9Xր}.u.iIGN: F3lK!Y?u!zW[%sm Zxf&NFvJ|K";} eHɍ$}'j+h2@ee"OQlk<y $=k*by.9?thĂB&mu_ 6nՇ%`jM;twHDA* 7,CW40\bHғJ+S tYLe#MeKG7Bśqζ.O c)D-}ɔ7E٣9Fz}.cZv|8e]5@!SӒ~ r,V,K/BhѰ#K6FZt*,94UNP?e`g1ZTS,H'waVr )e FB`|0tCG*ԧ]r%Z;|0Dn$Pufir0B䇽Ӆs=)\64uZ(pEx2 fb˽r%2'uaR_eƒH|:G#1ٿ'fJ +)_d 6f0Աq?LYʔ `~6#Ҭ@%cCXj˓SMQw737*ea6napd*Y+;~bqL*c-GסQA9B nL-lfPTBx_oY4oi~p"uiZq  bYce6kdwtAqG:#`mD xOAr7*T>ұxg&Eɪ̦bkJ~98P#@5醟7L.@6*Z 6st|КrMh)Z΂]ޥd4cuf~?v\q9Bc+rn7pfFM mѿݫOÕ,cjN,GŸ;ܤz ֧ĠQ_X})KHkOk9KQ:twn1Ryq`E=\OrGAX2)~}Oy5VY(O&њxJU 4 '4~?lN+o鰐6mnR["Ά=nI qiO V.[n ƹ,~neTFT |]3B%zqb9'@)nl~?ܻFE@-1/`8}q>ME}H#(́} Tz+SV-Fu^8|9|k_Brݼbۥ?QH\C|KE;=)<.Q&HR'c33‘qN2H)!EݴV$WsYR^LEJM 7LtE p PpCƸy,IG?W/>Y7zܚSZ>G/~d^|ntڳ:j Gʇ$D MҏǕ*{fvizXi<8Z&HBKSA!ðO_~iIݥV&?u*@GUr*ħIDoXzJ4(zSÑxH#<愘ȣn /\C.]3[bœE@q >yl@ ߛOb yذ`~dX!Gl~Z14 $YtP(<%|@+&(d9*rQڜr1/ tdž>D߻уǓQZy9[@N-kV)a d(^"6?ia{˦;֝{b.4 JO"k}O\k4j)eރHOpZ'bzKr lzcsӘg!Jԟf!A*I'MHHXWO&ˑZCed!]002U~( CU5ROGg4!'nL^Ɲ3yn=?o`i ѵPmTFƤא. ȪU==տg6ʵ4< V@"4]u+Z: jm\#(5*@JH2ۖRUXAU XW͊#CvAS@V1Ib;t?ߍ9L5{T'Cn'<vW^ڴJG2+@vl:A^~6kƥEiZo^g72'(i󝈮n-^1ĪTUOOlKUtΥWtvrSzUQQƟΔz]FSr)֙N9#ItEEAߡON7Wb1@95N*7U֏S.ҡElolOIs\d=E*Au>M8'@Tb:R͝H܊jPڙW6-ä fPTԀ"[u?sn9|yisr.^0 Bxw\cn,o_Cx )R(^-l~qnF*#;1Aj˭)aNG8Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,bJjR]Y*4?XʑHؓ5:Yz6K"WP  6%ytG_[(ҋ."X) #_)$ hƧMFgf wh7x[ӓq$ᕢ,?e'sU]_wX?A51pjL۳۽ ƅ&~d##_.UYQR?דVX+^gGS;؅+-R@Mqa>~?k4n靥˜|"QVOn3Z$i7<\鿥^/{6??H+P* GnCٷ:Pe;\-Wҍ5(*}5 #۵?^t#4`3y@ebPyhP8$:(,a̗i .T|LW(ż1O]ci=ʕ h@'nM_RUAݹm[sV $rh?r'_ffQĝN{R;M-N=R2[8;llvuQF81>_+=mPM-4v -$%YB;ZQLeu:ZCa))?9݊[,0^ENx ^ ׫U/v\+ZQcn'O᭜lhOR=ce,%WAʧn Ed*ҕg3;)^([nw8[߿K3xwgϪ3Xogfjf#1LuFX @j@>̧LZ&j*G\M^2]Xl&s  G"GO_~$R~8esth]m k4F$.Kr? QE٠9?9߉Kگ/nЪUi}'"E,owrh|[) LF_z( r[L\()(,  ^ꤷT1QZu=GMe#N?Ռ<$ PBIr1f_R ZHݰ;ύbt# h}a_ab7*~۬; ,MP% @o?r c.M' ~ *M:OỶIs5+$էBI:8?'20Na3j=]#p5'sAyAXaR9ծ-0rŔCOظdKJJTqSVٿֈ6-a11W"#JWW_FGaӐIO՘T2pO#m/*2es# +ST,@=r7zۮF OM+[6aQtZ.?S0@YnSF"VZ#(C"}9t䅁}G`9T:~e*7u1Q.Z}A3cJ x)eDSN_ 7̝@юzޤV=NEd20%Y(\/MxӸK&Q>5SF峯),l}؍JTS#"?2F *$589C\Ekɥ^U$+0ohzmZ%(@8X3Vje:?e[LR_Li!? zo3] wzNIF*4de 4vrk=320BA~|NǢZ)93Kr8\qđ#O`?'7,?N[\+tk5 y&/%|fC5$TR"i6霦Iםw::H&\k!>/{2DDQח5v8>PI}Q_kA"i]œ0zp䊫BkoH2**1@ڇ\q}_4O'H F{w8#i-X*R[h|K6IȊig/RNM!AfDSSs -Ɵ<.u4ߖpg$~Q])v xEPØ#AJW%I[e2U2;[Թkt̎,Mjq X*$]jp}J, {@` +' B?lr9-Y SQ_͜,Şq$5nc.(gFԷIRvj|#T,7ymRErR38.IYjH_ݦ&lw;F1D؃j~Ae5v ve5#dK"9*mo`5IL2}Eڀ*AAAuv]"G@v93Uo  Ŗ* ӏfM )8? ۮٽCwinm B9P}'y4do*o8ISΔd7˃'˘m|QLGvGa쎂`x6>Nm(Sh)J[i#bQr ?kļz|f@ʮ🆋P)}Vfe9%v Vcsk!UX*iSo|XEP7+'rkѝ7Q޻׎/}IH5~vƐgV*i]-`zP?<`OCV ݗ\_~\֊fy:Oh?isM \QH56*DКyNHڬNN # rJt5@krQ~TAUK )b'j6Eރy@3,!RT1`x%$͆FCW&TX"܊SysT:n.+q4n,~.4\gi M9Q]G띢+E/VowǙ 46qdUw $7`#b\DփvZ۪E5`sk EY%T_бs/A*%k#c24(w$9T"U 0;FxT־^P;M-- ,mŢ`yS[@0`0k7 3#],n `GVwZ#sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vh"r`4cV=靻KXF8osD޺"LD@a-?̫1ĒR;ٝWKf+*AqAk*[(i]0jv2ӘWrF %$|!y?hp9gۿa,v"6PuWÙZmn]jFiՌ>*lz[2҃fK~iʈUAH7F6@k:tFgn`\|jrz,0 ~RfiP:uWe;kWa LIS/!bn/Ho|f~*?zl?Xrؓ*TT6 FՇ%%G%>lب_F/ɭ>T$P8t57QScfGZ1$oVth`3TEZvo͚D5$}MuC~dž Rl3+˰7+1J0R >.I~q>H@`"45z9%W„P~/?7yxmF0Y^4rT;b#QsRGBDbdj3yXIU<2_5Sa Ce[Z6ۋ+}~d.j UVg!"(|%,h >g-bU5^5%N]r.TL5g[xd"|w!\W2@e{|VGo7@ÿŃ),ݯ9U 86lyQ[ b_̽,j798拂!a+fU3=6FXGZ1#5P U8`y_$qϫ!fw_U o55NZW1ue}>"0w  _ٟlA)Pwd@6<TT.국)3oTC䟨xז|4NT?ώ\6s Q Rp]c*4?QTժ%H}o:IdDvYJ‡d/ %P܎U穸Rr^DV4(44_t1 gj҇|އ ɭp; E~RКu?ipElԝ5k%)Fť 1tj6?h.BI~\v E<;[rv" KzlI`s@7.\S 9NӐ"+#6ι+ЇaZq\TgDVxٔ+eT<6~wzAU*T+'1ET_tYVo5cYܖZ$l˷TRxj=gc!h7dZW}4r E*h~"YTz+~Y+QZr26#o#9-B;PT9=z~G3h֙Ӽy͢[CCL4s|_k5zJMc3 5v6rN.ry"=p(c_]7)# "P9'ӭUySj KΡvMgpEDyTʊd`:ʾY#uòaFc)!~?{,vp* 7_nl4~x@h~_k&93Z}R47β.ʕo=Q ; 4&HLVsLcQl"V,o_S(w)RF"˷÷٧/PpR &ߋ푖۪aȩ/~/f 2*UJ%V?r0%uRᙅg(Ԥk+l}z5P gr^z/+C<[?.K9鹨k獹 sD-gRy=71\ЛtMXG?V i-cʲ)rnIV9ns&vOH#kW7::'2P*+_o>URut:q ogeK&>^~f!{/2wHϫ%¿ ^E"q_&V^MD2]U#9C2S:?%CR9,4mDD)jӧ9yrŸ-%۠q)V ha5W#U΋5uc.Jq2ZRk-mc̑"뗁*UZYylYNbbPSx}˗s"_zAU%^7 ɽo,$nHKDt!θQ5n#H9ߧ_e~GsOF9Wv*z5M aEhޘhxNݍ^ݺ!؇aP;p]`T ]Vrm5ͽ)kg'ͼ.n#'J)@V:+8#O2kW F˲(Ku ^يӵ+γ˟Vw+?Fow*UT- )7cbg VƟk^X$vmXr=[?U#8UE>#ebA۲8C2fJ/P}lqkn)(n9[$@JPרdd)^1KhvsmpaBtÌuI QhoGHD+C8S6LbFOTO3"$yw%9q 54?VZ_<ٍH.Arۨ!8}3ypEWؒ?gEC;M=JPׯӓD1Ejŀ--£i~]K8z$~ \Q0,zDĜ~\m&J 6ﱮѤ-^?HL?k~{H9RurN Sc7GcdXH+fʷ 1ɨvG_s_q)~XK#vy=wW 4|@@1^\e/$.ʤQZsG8hBI,s,V3Jw%:V~lEd#2{/.:Ikk'/OBֈA94睗Eu[ɦ`O,`X $ӓ3ZTu5-aq:ڤf̹Imڤ 7tcoq*C0E ;5z'g0uq]ފ[$U6 GuQU+&R5)-zPG@Tr|ٮ3$k/;}%pe6{* ElPU1#-QP߳ލ ܍XI<$Qv,Y#"ITqP: A($ p{{dJdsRj6M%6 ^i(K|_x;5" Ōơ 4_11Ad$7*ouHD}? 0a]PQHžѩ."g^6)I0:uiA,hB"EmjA~H%ABB\kZܔOL:#E?ONn..~ʓP@Ӑp|ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*?lRMzbAʲ}EF#fsAN٭Z)H֥iP1n_ @GzY${Syy476g RgAٴ4TP4J@ZkC"6j&˾BL($~'xymH)Zz~+c)h1V֟$yRP Fyxͦ?/77*LFdXGԜ8ȎlP_YVYpė7M)!]|32әEZ1Q$d~3~9?IׂTW'gۋU3<|j )t&_r\ ,is*lvDPH^>c$2+ەSoݍDNJT?eI쳔#%A/]uM@=y1GeY ƭbGY|c琧wE"nyTrA4r#oY!TR1PH!ҧ_Vjr V0PCp,i@j"=k>/ٓo'f,'}!pJ_.GzzCq''*8WGG308ڜ1TӇ9{0Yf#5|Noyʤ76>cyd q8$1ҭR݇ &0Q#KC iaSDUBo4edދ G1xe޺1pβF8A+EZrqA<@Xֆh;Ȍ),l&O0K9H[%ԑQ_l$M֊p~Qo×i /B@rnkܺg%զhbHԁt)8+~if#5=4u?&N'm=ש=8d2YWrIΆ"#tLO6 XC8\Fι‘Y2 P0n9cr3#q?x.C)TA05RX xӷ?IM_:nŒ}ۦ)n&5C&T#~̿`,Ihn3][{c'AVEO9zuV%fH0䕾zls 4+ rkNTtd2CrAEiś?N%,ޠ,;bHaPEr};W\Iieuqh4aPU5䧚(KJyd 8^g%-%{LL,j/يzuDk ?/axv~ŵW*K E|>6D9ev0Mlo2SsA+ܥIPI}#Џ(zI"|K{zr|_Ԡ5T"FS?kӰ\jm#Гw,>-gXmAyYR>`Έry6O t[4uFo2=cT*>Q7%j"MNJ9%hGժ5K g*AJp\(r@}*riWk鍖?oKo퇒URHwm?ejMqR@Sc|K8b6Mٖ+Z] 42x2)# ;j#_dR:*F"OJdG/Up?nYz<3te>#2=N*@O0f\8 K9< FO5=Gӛ$}54u>ޔ"xNU;0 JHsڸu\YV TZ'V9A^ iSDZ|k5?!ڡS}Cj?|X2 @9S_>+Y$6gN f& Q S @Wn]1 :|Bh0xfru螀aՍ:EgE=F9ƈkunI%Z >RXv_t"X${;S])DpAnԑ~⿽ ֬cIo'!h7FqeeD FϿ쁄G&pxr}j<_Fj"сZRg9,# Ҟf}N&Dv\~C zG@*+iݗW٩sp=#Ԃ ˊ;VIn9UYN[0F?n 20ON-SJ)(`3LEXWvz2Q v \k\ȺbFzi+ ˴Q|^cMT Tֵsr1Mn7JzGPUH4埩䬌!m8VQ>e5GC)PhzxgLyZy[&ҍw%*t)B)|glDC14])r_[~?ޫ c/cN@`-EHJ9?ODWNwaծr$bOb=Zl_( Bc-^hm}ۚ7 ε 7f*7(Qh ߹ۥtcO,38ՑW'5Z 0\r~?YJ+Ě#˜3ͳsY9U^Rjws dzy>'P)VM\ݫ:$SPk:4Ȝ>о (젧( yVsMcF' !ukv g~TFrmd; &R^\A L_s 4uHlLF78(Yy >/jVu_ >sVqz^,wc"/7ew^L`:o2ך GAA֕Hl\6P2)ߐ?;[e IF9GOy͟KUW栟ʜ!gi_U{qlKPHc-U!j7T1ɩ0CIU:Aևx9'֚ڀQO%P>c n[H!/***cV$ *AoHxMCn$(a eҺI_NG٦z\H<0w`]!FtXH5)TP鷆[OĨԩېl%HHʙ5H8 RYťs #_ @ro2ؤ,90ÚNTm6u$͹wG98Z) ` O>7a㪫Fkđ^LmBh0\j^ UЂ>{ٗl~WKcߍTzזbq V~(Zե:ZCrYccOU(W4kH.[)SA*ji)_e6+\G .qq)ِSWg}><.դ7zMrT2'OåÍd}9('|~m⣣Wa+;ߝ{W&JS$I`x/4SqJA !ш`>W!`Mo\hڤ VU)|^GH UW2?g8Vţ%?h95rX%is:0S]l3sul6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Z+-̊JD:kf6ivd,5 3i:2S+En49}1P xwSO958+cps{pvB3|6{y:s@sOyz(hb{EpjHIJP#G/K f1> d_3+**q\|8t2\;i$':f xC˙HƂ5 Y8(lCg%6+$sesm12Ӹn9P#؆"rΈIN3IV2~8fТT#V#3?X 4 Z貱7@O3*N+JF*cٔ{a/=0II)֪FY Qt؃8|@tupz1 Ćm&*I3XA)"9^\$ٿk'b ȅIܰ~.f|I=ZJM}/=j0}17*Os!FI|,(o>$̺v$ B܁=9WߎgǦ^se:ѣa@PmBd5mf,Hyf)(Y {Im.w!3'QPG 9}@;,梦J  2gqB*FD6SR$lmsX1DXc$$\Ҁ.h\DUkI|'Vd~q[d*%r:dsҨz򑿓qXkxF$`Jϭʼn'ʧ}d$18ёrI,P7΂RsN:dᤆGUBܻ^WN~h>@(REfڌ?ӚZ?ptgrBH:6emK(?.߻1? r4`hP D$,jJJcJo p5S `MOۮr.@`Vڽ΍& R2n4+_ D-TGrVj=mA/&%+QC4\Itx(Uzj~Mݲ^$4D)4lXX~$۱Yz_ yKKCKP${z̧ӑTϣNim!m9y"B"TlGYƴHޛLwjΚ<^*}0c7S4 H;C`}.F enD`A+F$HYyRC?#Ѿv~vIW/WAh?;bTf03***;:k O%!7 \f?+-bxx+P >#~rT=)G; Lz1gU3Fpf_R*cmS>z?&x@OQa͵=$2O_zj~ym gߙʤt0B$b[p܇بeY[wU@ E?jgg[֫#$4hAοY$̺o$Jݛe?_sj ݔ>K͸J::aOj`ꪵT$d{n0IU5?,g0\AO.(F<D\:Th\71[@=dPY-V8 cٺF?Udne+XS/5c+#Ʉ.c@[:rF7n5XĒq9}dIvKXހ.+v)6Zt?ˎcQ6ݥXa5n":WlC'2HH5~|YHh(99~\k4 dbBRAOrR˒yUA;kSL^`J`3vtzGay6( @ҧoӓP` |㒪FpH?nY] \oOE:PD V^K%j ?g jU:X"v%4j}9ѿ/}/ӌ$"&QSכ/nT{H} m y(w?%)QYIN߻j&(I 7X#xc_NǍ^3.+O I䦤2R5q21M~G]v֟G:'PoOl$Mp(xSd!S~^eo()9v"Du᝾nlGn'Ym9o\wK5d¿G˶%b#HUkrsO$f?Ɇ~_RNJT|DݟGZuL􊠳(D$;'?ݐ L;Џlk곲F^MÛ7 LR}TJMIppugS3y>ɣ[I˘)D* }6?TG^ JqZI;_re%B+ԧF}aL?Z?L4'v#Z2'RҖ H O@cjߤVOћ1SO.2m:.Fj=Tl[xB fx6W #&[gWs<`QOK!-npہn].hQ|Jѩǎܹ~c]uºLgA$em껞B>#:Je]MRAU ;)`byG$ǩ1feVVR..DwA X:)5htΚWlX߃1 F~\Ӏ/khYB:r$7* ID#j?i2xVKh\UF)ߵBu\-*΅Z@~>\9Lg19?%+]SP<g-bx)':͞j_:/( ~E=@(X|G|a%a+"PUqfخ>dgb!T"SB洘qp_kkf +CPɿۯG\ 6Z>~C_->>9/fJ9rs4-ƿdS.dgdx,U.YnppJ"\}9 -lހd>/rYUX=kG"v"\i8CZʳK4MH^X흋V.I. "w'YW,'(PSʴJٛVE!&%l@ٖb@ _?/b[m%9j_m_͕DM⹮f^,86^_ )$\FƦ'oOl̞̋Wi~\59b#AjĿ~;۹MZq&@,Krmmj0!_%ds YLeǷЎ߇ËIb݃rZz (O+ɽCe& ~$q5 $T_X5#& t^ Y*̳"H6āF~{8H-`xC=:caJ @mX6U#ЍI',4xQ[6n,䙰tL+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vt}9ny”q:=f O79V."@EJ4_: InTTT}6i2v1d)J2jF*kPE pM;!xt['HWOD깫ɹzy%X"B1\SWl$^dK0!=iG|_6X)"TKJ15]H=).13z(ta__%m8Ê}eر( 7kosDRo0TGYQ0#&Y()m0p޽BTۗٛ-25 *wi"I#,)(@ze[HiAs*d,4KN++6`kwvAQ#Hmjwś۱ YR2~z27?_vdU+ǛZC`k*R%w  rsJC)-kETV-c@v,vaNF@k %[3eeu_~nc>R1Ei6}uGe۩=7]] )GNnݳ>rvrQߦIxzD R~:ο.jp,ܝYይQT]BWڴ<nƇzȷ¹ڡbіf(1ּx?Ln^<6$?h,ow$/+'BɑpMzq/~;@j~?VY[ 풼[܇F,%Φvכ <6JvŠJ/bZi~8ĊݛlQhY9SʿQ8VPi*^I}/K'iHTi8'ɋHudT2 (Wu>g-ĆfW쑹CNmr7q gvDP|~.YuzӲiH/'tjWv(=6#SHP]e_Ř.JH񪍺~r[IZn8-xxCg5b>R>6pZxRխkQxE䌰&<¤[9t 9-@fV7?lV'j}V8/I]^:mxog) GA2SoE)풿J8+DҎ@1R*OC֟bvHӱJZFPɆq.x]n-eYPmO̷1N bICBPi=Ģ$Ȼ"ٔW}|)FW(U[d7z!-Wm슜GGir3@Snzj:PкޛeD6FE;3Zmn _1}?d5f,[B#ed2ǂ?+:xYZ%" ȁP' |8Yk3S^LWbT,2rQ18?.15D& Xԁ˾usɑZ);ѿ.XK?S+M#Yҗ_0[+JdE9ZVٙi)mQ|2ѫ^2 ,ΛTx~.2*F8ʠ rZЃOW9!SFb0)B?9uySo܆NH$ۯÙ\%N?/lR>39~}AoôbvkDI#-=u@Se yWs5Jpb~\cH*o]WDmʱ}ZrZmqh!>%CR[ѩ~eS_V"9Ɣj*,R~dfmF? rͷgA:5T!A}C nλqSA oψ Ƈu}J.iVG<#IPP+_ZD/f ?:2Rypjv(ZF(1.MJ4Jo^r0#VW^HRH$㛝): XZ+^ rL%~pXIZv2 p {S$Գ1F kAߧ9⇘':n DjcǑ?͚mLnz-?5xdy@8yk~ՎPDܤ?e6b_RƗBi0ק1]6. KHQ#* ojSH$guHG[8\LeCE  OYC*LL?n{8s;#ҕs 29!$S2v:|u QW燰M³wzQ7:|\\1޿' 5 ەaˡ]2@;V]WtfFzrd  ңaTR#Έ$}}I-*JQO"Yur kֶԡg‹wU1q.VU%+ ǯMȦ8PBlq?AVA%v!zTq(m$`$m#GZ4Aj޿kF9u %AY ߤ rw!ugÂF>J%x*h(z&_=uo }~Y; )7,ՌPq114io$oAӫxtK880-Yڍ{1 Y[ YT"F_/V8]?HPI .dv_=~?ٜv_V%Zq{nntԓ5چ;vQ8%XGJQG l\ɧE28% K?̭ubjǦѺ#"9"Os4UI6E*>T9]^=LeuYy oEDTr^_f OA Hh5jHqKHFZR M/*U! E V8Zh/v/R&> <;QŸaY̑gfBƔ$s3Dv"}>%Hʅ+>ّ'=m:8A)leElM|]":?-Zhs`kҍ=fpnIC΅(5b>y1ۇZ5 MyP}Ŵ0݁'coLKsF܊rػl6ecyYOnۀNxS[> vkl6㵮٣MI wF ??qd߹u梺|T=fYPZ7 ABOڹ!^E]&X ;#I?oW y#,y 67ܯEd Tv_Y;Qne Ey1[?,Z)>JXD)Rh Gn(z8?*ORX0`j>0_s;H+s֝:GȥN?D ` h7li4K!;`bl~[mo-$a Ҟғ-I5 }чLA]8̴lj_0ofsTVfڿf0tVS2@4[ c?ISje-` *ku6 $HxbZ]e)VP݉^tdБr=AΛy7O' ԝy2EUT'.bZ\\K̲/Zڕ':$qz@d>jڿ٥hnd1}7Pq1D*=B>%b|Y7[#GsOV>,F!Qy:؝8]dvDB#,$r~&&zv-Ow΋>QN\*Gib6ĩrw`8UDbRI~[´D|TtZ45?Vo#1^ ]#3Q([" (lhIkk^D~yn{ :஄c1J[b8>2LEJViF=@Fz.IJӁV}(5)B?r[A&"I#5J;7? ̍|&E )'$b̖*S ÿ'U !{eZga4PFHT"!ӧukïƪ<IaĺL/6QwIzRTM(xuqIli4wWJ&u@~$Y[en'%)Šd.+~@D5(%G!^ (?hI95H|pzu}g֜9Dൡ-1k Ņ(ץ{H7ia^V 4_cOQ̂G9cLgɣ\P"^(3y5SV;O1eQT 2EG!E3+ !+A9/[֑Za7,I\ӈחdVkq?]֔YAf,ݍ%ٛyř@4iqQ$79g#0 A-ؼ3zif?\Y.UhсxQu9Ϳ5lb+v` 4͞Du:6Xfvۦ;RtY2$?n'7%=AHRk0V7H.&]k+0O;Sr Z' #Դ\<[xQ < YQcf+`T<:7 jE.'o@4)̂+ӭETR_SB6n_(?bPTWcӿ˜:}gXNT:\[D{`e7Q%  kF^,);h}[$ OIdu%& \r3MV?_䰏\AyEONK6\K?2mdi~ ?Ҕ}x,=@$Fmχ # _C,3(5Nt!$\ kR" -[:eGO)kǮwm*N` }g<~suC>GVZo_p$t(O^[(ؿ_Jb/"z?èyI"; t#SQ?#1ص˒U6 MwV&qgd9,"yM:}1}#ƒaıju #iQN_\QrtgtV`zԭcq3Q4$nz*ܿ4s6/]% $h PV5OpTQ7k#ƣ-KqsZ?ok _F 22jhfB}4鵜=[Fnl2ES'JGk74G!Jlﴦu&+F/54^a6Xe^wW!imћR6Ef]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*鿕2E;Ɵa t} &P@jp$ uVa/Mޣ<#CD@Ks/QG?Yw-!QcΠK?~UHpҐv6SݙW5?賵*|[t)nIm6U<9geG(;\!FI+D@2wolq[ R~#DWnĖQ-OM@/-1сSƻ}I-4X.t,֎i>&DcLxY&d҆ Yd^N`參vF I$kuUJnSrDHcy!-O^㧙@j!ehfTwTQCQN)6x޿ }󧁷@ '`T#u' Քs#(v ~7^ PXMŏ^wV&7a`-5^HzE(mR?nPJ*X62H!@k֪r"DǩU,$r݄O9g!Z*?k6:ky:xw>EF@TCzrp5`O(N4/+fO乭[gc_ ~[!NEY9Oⵣƹl״'!MAm $F5F$qX^%k8g5Q;9v!\Ըlcv1?u )Fd#yt3GO~'V\|.Hfwinceuou;=}K<+7pM>|SfS؍^iTI7v"~c]0e,N_TIhםc$|J4ͨ.8omV%s-SCڹx(i aX^Ҿ|\Lgk$!Ay7?o˂奺сhђ9LtA\%FP>πnc. _Q('SS)/|y8:1>Ơ((aT-J7yGZΧ5:LQK6(.3|?wqQcwfN@OF*pKq %R9/P}[է/ >*k3}EhB!N*/Z*:)zW7k?D֭RW?%2%aԠ4r}ޜMmE!EPOyC/5Ƣ&[$H+@+l%ʡՅ6inGhwVOLzt?6nYtZh8 z9etDLۀA~ b p30EbHαhd[8mF2W5נ"›E9tõW䅣y՚sR_,q9b @ ~B$BJGPdC+#4xR00o+ҧHebӅNT5[mi[QZHr@_9mvajLn=%epeyR@: -*Uùf,NHBHWzڧ˔ 9#.D&t2 \i$?6Ҧ))QޔoNS>'4 [3@҅-tRA/Y*o@>J٦#{-/HJH,JVþ ,Z)HcQ>?mz?QPd ~ok@lB?o,1vhoRV$p9*,!eؖKjƥEȷ5H c=lO>'ԾV"JםNp5`DSLJ#٥”W&X -b6j󈚬qL߳|9^Jǡ.YPP0Wk+9@7WySu^HD[MҫdW1aPzHyZoC&qXmjگ vy/~;}\^ɕ%o]Zkb9GJ/NG2s)e ~JU+_NO]v?u͞7C~)R hO"e=igU'և6¤X !%(i\cC\.=靇7K`D20ŨRzqro#Szeq 5qQN bV/I؎pԔGܔ_~U7!fTĘ?g5BF,Ȣ'%Զ?9VMa0 g5s(܅vjٳ;e\7n~& Z%^6n 9DSǣMcZGZ܂~%n˚,HR GV?dC¶co -4?t(T^L8QdnlM*?|v%J*~V6wZ=Q {q+;1 ccƐ6W_Tr\?H(˷eduHT۫6>?+d]kpj$ӬԎ#/?hOq;q3 G"\KS3u#w#HvoWPUXjhWo-<]6PǏh?Y=KSZTw,.88 rnA7TJ;Ҳ+!'M*X%TN@n^U4է4?Gv 3Wvz`ӗZV"LM עُOlUՌ@hM7;ltGS]n)T iF´_h. l *2Q/䥜2=wM[0^*j;A?:ҚwYjlwٓ>u )[x1#}-9Pb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vv!ZX#uyrlit''`f=z65Y>ܷ#_]vaRLmڑ)AO'Eԕأ,R"5xv%qH(^;E,*ޛ\T.ELj'ُ'_O7j._~&zΠ!:ێQD r2w&%R " Mʖjs:iI[~GV3/=pHKFlMi<"9+vڶ-`t4NXoBz56\Hr=&^6Ԍ1ܣF"n[OL'?]$p/2;PP6+|8/;`v ȣ ds%nMy퀡37IB)٣r?朰ăH$/+ُn's":9NB6t/.M<ӴQCNѿ,[{S1gD V&?vWe0 I{t⥀{#zeb"=y6k>5 ce~L}ٔ)\ DZWZVu\& h+*3T7DVq j:H(Ggutĥ+o AgvZZ|ۗ"y' JRcȨ.a9Կ+m1d<{|}>]vR-U}Ŝ r_&_4"]F7)E FMoWw"wQ}U/ G~$)\䯊ݶ$ p}V?NNֿ ?YF]c6/&~R~6& *AdsuR,%F , @Ÿd\M(\}d/vkl#/>@Tx4F}hEX%<7\j2pFpAN 6?$t~4Ԇ5J֮!99g?z6`UZ+Ӡ8PI(CI4_?\ڜ_4' 0]w, =x[ߘ4 \QaD VS9Tb XI7B`GNgOaH T_zf[oj_Êse>,b՘o HEZq2 Ǘs]#Y$>5@5ߖ/o#NܼpU'?LLXYHsekƼK 2ʓ_ſg, .oh424Gt8w-6ROcQ:J;ݶ>>ZJpP_UM6%DWU,*\՝ƔǵK]K+87L^4o2-HqX _-X#ɱ|YefgVU !e-9-d*R  żKh ~C !D~SFLWP;I{;0q3]jG; "]_UVCSz|Yx ̕N Z8|aҟĝ[1#QJG?ipV/D3|bިdW)7K8 oH߲kz%=(W c()ȼU'wͮ[Z,ܤc5f,O M[&ijG0QO 5WbYeZԺIJIUJ(@޵޻#rsVAB~t~'8ū2{)CW5S5QY\RFXG4-j>I<1o(k9?cY`Z|龀Ǭ_l<\ H> M w k-@yFH;PTΉ<[pn'? eZ/4/OݚՐzN7?4V1Lní?M*zpOO$* iO "sJ8+\~lO `]I$4o͎@5tv*8uZ:)Okcj`Knm.xJc@˾}8-]BA=YVcS Nu_&]./^4E(?5:KQ~/P1%H_\%ITR>rfAj%ƌi*O49Z5$zzvc9>.J|4^H)Ȁ*0,B+aDsA9_ 5ei~k>~p23,ElvM3j NxP6LB&`?Ft"ZOP֔ 3Sz:sI5)d7x i5*b ,ی?>`'m܀1FZeԀW_'梈ep>-{'*AZrnAlO'J}5. Kc_Hx~?Y*f6&`|Y5щ;ք7Aɜhߴi\+|hTFJyGz|Gߓ,Ò?fAkj]\jȪ߽,%~47JQb' N%pg45Ǘ_/,P mPkd´ E$sQW6%~lJ $iM qwŏ㺷 /Oo=΂cS(~?}9ɩB0(:װ/}͸>D,QL~[!# 9Φ;9ŭ4v-ޠ]E<{>LI<9/$Kt1/T#u';s,FGx;bКOӛ|Y`;{gXK 3_sݔwUyw'ޔ]SZg2=#9r5ۚT^`]^TȴR3wCj3FǶ2AO;-c+C55`K d@BO9EC4JobqP^Ji}V$4QfdF<Կ">T#}eaևچbN(u$S߇А,G+I~ e q?/Y`X5GFluQ1QV Zm׎F3]+>F<_iuUz\'ғf7$mWzӥ<6h'x& _PjGk2L~%4#M뼄Jʨ-S~OG fBUى&6}!=&WPPi8Ǘ}akU])h TP휚x\=}Nn} 7:yt){?YL #ԬJ=޿g iϥ&7c vHmd9.%&:}s@(;ÚO==E d1T iE_g^x;E?dR+6 Eۨޭ\3D'Ӫ֎Isǩ㛈ar~=hd螉Rnd߿,U[sAjZ4tZzASVHwCkWr> {p?`7gW!oGU*=7[)ن _޵O\~kȃKPޒܰ_iI rw55|6w F[ZHc@~Gi\m(F oh+,fqpI->&W|YQG*VC>.+o5!>)+~7Ox-Xa@W.cćc΂^K'2.b\9+޾:݃`y5TfjeY~e.mQJ–Δ"wjwIVg>|_)-~'Sa)ꜰ!$fw$=q@  *Gmv!Vܢԅv[;CjMGƴXgZ˶ a3)6k/c#V>1ݖWLH jJԊڡ\*×.7*O.>ʲ:wQ1/}aצq8 hGs=TN@;ƐL"iX֬OSSd ;5H!;eT~+ҪE|+v U8hNѐRnf3bI0bFe_*?Šӄ$\CV :'6aGPRԀiɘؓ[pGg S4%/+?\$Kn 5IVK+UˉʀfvYNhE"ȨӇ\^ȊS5\"Rz6IJcu:dO9uW(P!lCzg5 <ׂ(#S_-_ 7|BӃ0Mk6nEL2h!ߙ\jYnVwNeoAiB:RO/EDG4S6JUR?H$c~Q4rIBd,F#nX w{yE?~^^tZBƪ?pڇ!=9+֧Z@쪂%>%c{ڸ 4@RD\M3aHAQZZnhP|܁V#B1ηA;؀EseܳO9"C# V51 xH*5~ݎNKm% ) ~ ln$*7mJԖM!+2?6%Oܨ7 Gnu3YZ#}ir:!R?p{DTbv$;. j6.Fn] Ep Q2TM~섏?B0CM;4ڌ[A/bSФZr#т9@]ԚķZdv\*qٻuD?Uz"@;ǚڄw?' )S,TxOqF',3pM܎]?wgKPK4ޚq/sՍ [HnR6.MT#l\ڷ8l!`x+*S0~,epDHrTO|-b )AI<ׯYD+C Nd*S ڣ/j4;}-%у;CH?,REhfˎ w+H7I< $츌JVdiӓ_U-Y\ՕdEmQ=Q1QD]}P&~ #gj; /McE-UehQ!޿eɨKTV34 )~ܿVgrqG MD's?hӰ<>=E: J3ڝk]CZfG#td$-AΕ]%SIJ$N$59JVehumHbx|#W0lwf\w~'fsSspB#4ҟCGd!U,mS دVh[@ȏCFΝ\"JUn ~O?k4qA٥@řTOa;TrYM,RTG++0Ш=X޿%bba(*}\~p\ɐ1S28 i׾D4nx_rGu=W_Z%;vE!~MLj4Qs~]j4֖Gh}7!"aosYEf i3^\2$@9b9VW-'Qe?ibPbH\&Nqy%Jv7퉝BL$9`YWnE`'f_1dH-6 pi+#yX*ZTXpbcFHr}59\.V@wF~yDlr"jP+׽A΋itvGlZVjbͻғ(K&4S;#/ч+N;"ZQZ np@i~i˞@[HhOkצb3d !#3&_76w*xӏo/!ы*~P%#8 Ie75.'nlr+fo咀*M ]s7W(ZI/7&+#>)8';;:@F̲D X &["cPxiWҟ` ч5^HD@#M1n|y漛峁djcTPNǭ 4Fv:M%ijT9LZVrQ=>5,cc9q!=O]%a &܊}G{QwqyH??d%{YEO?$ ҤTCVV_ oʧq5#үi]XfZ?k8ԠG_QdiJd鏩87׾t~ K ? |<#)GKCi+LR$@D)Lł@JE~-$; G7* `M(C`=)1D TቼLc0 90#U܌y__ +o/9Navz#eΥv~:|6 ͬ,RH+,2?ǫx+f01+9e+(}mIgxCڎ*\Ҵ&&BUrFl҇<.UJ'͎=UT݃paZ0O,Q 2_qA /;&CsZEM 2|O>}t7V=;5sL20#A#TEThߏ\H7ڧ. 7@.%J.X_C _ "⨭OqظtrnNKVk24C]VHI%w:msJLǐpNݩ㛠]))1q XҫB`N%kA=ϫՃJYVrrKٚ+F*2h9QvSk-e?^!ej79x]Uc V_ZuQ[ždWޝvHGĎoTg(6B O/l Ip^eJ#}R'6D۽3L(&>1 ^-zK=>晇64RWxV]3{8_ Ӛ-2.ı泛zV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,bΧ^$ H>ejszKu.)"%I7ѱo)knH7ub(t\%s%yD8Fp 0 S\To[ :lݚ7Bv"٥W}깩!Q25,afKgf iK)TlW.,Ӆ/VRKTߵyr,nO_6:.49>ež*{VZC J,ٓ7lʞ;q#K KX2C#ڿ~¬ق 呍 B>o~ǻe+7ˊ V1>o˗  B(<ιINnxfV].2=>_0DQ@`~[6q\JOSCukmvR%J7y7wI#+:'p~l5(Sj2UVU\ϯ/6(}wh*Jmul|th&v~hN/5*\zJUQd#~mT#!Z`QyPScg;UåzQq.TuK&e= [Q!T,%?~?/  "(LQmmƨh߃@4 jB_H_l߯TFC$Kma_ⷸM$բv1ʴ@g=-qu?J>ɤTQjG\K).*PG}S:tuLO%:|^@_SNzϼ`K=+05ARKx~TiJwGȐ HifEsV_SKpW~3Oqkf ޔ#ޗS_sVU/JxPU. 2nX[޹WĺcOq㙝@\6Gi#B*{onktt_9qFI+Pw R2Ulנ4$yqn5f|KsJ[10Ei^f/ARCDM;ZIzU L! pʂ!?[m2 .b2fcTs)j0M$sLY>>R9.(zL>HˆU@o!^m]Ѿ&};#$[bL;ƢU2\)(j#*KMCy)XoQS?/K9Ȏ;T$b0x$Tڏ|YҐ\L $Uwz$(yZzVmV?Ox6z%֟ 伪 _-ZFuIX&"G1' i4Z) M)QL3>hyE5h>>WtuH"@zuuz;.k&gV>*<_l:C.J+1&86ڄ&Y=nvͧ L'2Gu{;'$@xCac}͈v3RvQEE8W]lWoZ>M*>Zq'5ߏs25qɂ9^hV9JcyJKHpMo?9_{c7HC⫷HkA([;Ep@쌰Œw ;-h# -fh': COկݑk1r tj$%XW+߅>%3yB*vBkǑU-|sw:PSp6sZ҅NCzd2sh)QX=.E- W^D*u$;gHIeVdriF%k$nvI$(R+@)5Zy'"4U5f'[u#k#÷.% FbS rwhZ:, $a[@~F?\j_'R.(qC Zj,RX1:)<$BAtɷUo]^amn ~akacm$%є!(MGY%E,3kaթ+/R9؁h$ԨQ71pUJ{qG">I!DN[hc6NR{9&;fd(誠T>b& aaHЫ1ny yVE Q:C!e`ck(.Gd ~/ 5 ._%֭1d'E/Ĺs . ughxQqX!^)DŽ 9`W|Z+:Jk(X-Q8$A^.ŕ%zUc3wޕżlDΟ#/-d{Naq['"u*1n8s[$5 $R=idq. Hq%tS\QoA1ӻ]JQW`xϏ8C%=~/HY6\34CeFV|z~eh5;„ؕ_n!sN`5E5|-XAL-#t'%_.56枧hj>cj%Qv.vՋ>ubQ#zIZQ.h&&*DnGPjC)h*e$~Jx<楠gZ5CUW 2i,:6!_̍'5J*'ű5R@(:7cdȸ8w#d$rAE~S7Śm`; ׸0unt촟JIE/a %HmwD3-ŴCFsN|[\P*>=ҏKI:\3 #`T );=C7H0%J좧Ý=$eb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊-EH [v+oO4-x#IAb̼E(F7OHX_M%?Pg9#tdKd_ڇr>9;oF^QZu21L :Gl@F;>×Gk\H.ܒ R1//#КCZO W, Iѩ?-I .=>fnDAAY,!jv;u9| >xo *ŹF53'.W5YY!)FрcԽsʤq5/7 1eAqۿTw C+GQ_Ych䍣~OBߵehcp̤GV [TpRPcm:V@ߏY-Y")Jl@sgMEAءMǓ֍ӛDT7a 98GwGq}o7!; \E*Jxd{*.;OL#Х~cn0*ԭ@Qr],lԑQ٣/^?<ѐ@{I$rVW#?kF˭s\3ZGo~]Z6!2PTÚ =CnITXN%WFfQv*$i9a>Hh&-hGݨ;rh[DuSf?Ȋ۰\'4-VܝlLO 2#[M5cev 욁&GI-'hǑWzCE(O_ %x+P{ޭUxk$Q!.fBjwCNλ %R&^K)?esF]HYaG:? bz&#6q~IU@YI 0攗]ո rJX!C@&*q6*@ ip8GZ |^t9<{M-"T}Ջ;!:ݣx=ddW44WԗoX#C:rFG,'2A(dSDzC}YApHn2jr#bvm+"_hLFn+&J6^E7b0!Cvͨ.mRގ2ԅY n!8U!bADblr[~F8:QǛSdʧy&6]g%}@glk'So}9}I.^ ! +Z廯ѩq6 }&B[t椳Qֵ`S$o-YԱ`P,"u\ͤF#EI *'N-7@5Qs̺Q s…ZM;0ͮ>/?A2 ԥzˉMAA,7 6s'P=-#D~>XB T" dsD+㿹FK7,׷Mm4SSq_zd=,溜dGl"Y)MOrp`HSz銦yzѮnCNdʂV(!ZZ aIZ8Fi@1i$Fhx6)kˡ7Ucٽ7HT ON dsDQ"h8,שuJdԚZ5*JtxY;"$ێYS2Td p |a6N2JvVN0^9(kX ^#cB*2:w{6G/ Cpv9'$cdX) ן,O/K!Hrtm5#% 4`Ao {7͟dKьI,>ye,l5ȭ{"ze2OɳqB[>#?.p^a-QditS{ٵ/L*"ƣpNsI(}ɦy"e 3EY#ouUĒojT +aɵ"? 7gYb1n[YO>Y Ϸ:Bef W͎ՂurDi.=@h@0ˮbEW̌ҺYT6{?Ntl%F_ZOBf`2^fOKo6J45=mG$JpxrrȐme*nH:7*κrhV7 H "c^*5#UR(kzBF@iHCĂmRGzgjP:H=颸n]q8!;῔fiؘp2rcsBj7S-yz~ \4R; :؄X ]يWm>n.aXciym˗,8ޗ=GBJGÆURH|EWKׂJkGHmbB8CNG>?G9ȭLvR[&fQzPd_Y*;Gr18Lc%e@c6|+Eį<ЛךQt 7gnw?H-y=M7::n>퓽xgOH$Pg o|yn޽ ] *~ f\v@"zE_S?Y'* ާTRń@+:8j~kLdPq V|'os͹%2Z@_EyDQ.wLt קuYu@^\:uͧ'UHjx8yPSS?v~Y*Kq;@E~n"WFaj#b1c:d6x((U4b$V"2pP2KT~vxUM4"H&hy<7ߒ Aq}9S$c|e$;veӵDvꟲnntfyր{#@zPںriȊ([:oM2dVRq?yԋ/KBA-=+ neus/0(Z$ Y̿_M ˑ4ىūDQPԥb")^ @К'e[>kU _̽WQL>!]֔:YcI*c^@vqʈ^LhFu0=lc<~*=8yg?Կ6eV8OPkZK]Y͇'7on9M?♭.>.dBx6\0 r٘Po_u@o5sl~&qhcvy;N)XT)g\ 2FD|sn*r*ݟcU")M,*~"pUy۰((\9GEl;ҰRDj1Kvcֿ9V'B};U1͐BC++H&*-_n#]I.8Ε/7Y:?BD4v`wo9q2(M;gA2+ yjS9WBiONp6 hhwΨAhBkXӏ&o2LqeCѓA&sqw$&Yf hWșUB!GW'BMjnm!GP5V\+(/@72ЩaPJ rӠi8܇i"'Ur8}o_0}xsqD)'v>,6"JHc?ˊ\FDǥ%#bY)MAJރ̃k&dIG+Fea 弿d:>Y~|_uߥ~eYqڂ ?֙ɯC" S|FhJ8=&oE-^@eg=wh-#JT{=r;9ZsRSCą|)PUsru >#%jkI;cQ*l7?C8P!Wyj|-A*/C7ŏ[=xvqGpZM0.?c_'EKmSQO26 զQ$tuU_YTyp*ƄuPy0謭8uwhr<~-fAUS}4@oAN\J `j5̀kR ؎~B[mC㓉D) 7|*csčUFV`깽x'ڂe(h0)XbM?sOz0}RBD(Oϳ7A YTq4k Cj l>Ԛnqe>֨bHߦug$n~ MF!/e'rdLoN$WFlKQVUY +dwkGur1) X8#uͰ&Ч&֩B u.%'kdБi1$NfoN I| I"ĥȬB>tTRh}aKUn Uƀ^q,Z`Mbj̧ YtDz )ȑ`F:~rO޿vN4{XEs׸†1Hg44pJ?i^+j/s48uop+ +kSƔ|Or,Z3e}JB(Z~d7,'q)KJIWqo9Gar\+a40@"3dꘊJukʿ:N 뒲eT=*q> [XQZ K:XzaڼPE-"Ww߂zmdHOBЭ:<ġ =PjЃS"E(Ӿ] 3wvscqJ bI~4)ZVjS( `i1?^#4ޘ(C!nqs|HZ4j 29m+B\nzk spC_Nŷc}vDA]-gU3U."(!C\L4AH#laz5DRQi !bBMx-w9p'tO/q E/t)*&r{dע &3- l9 )X&llIߖq[Ͳ¯XڵJ}4}BqNr<,wMA^vER:dIt8[zP7,P I R;~8gDR~OKfgE!ψ. X4L&4BE:dH bwt.kU$=@52%]ѦʀV-<-LV%fZ{cOyLXz  R{vPM.aIIKrvud-  *8ӠO9dC1SK Ŀq]?r!X^۰d)AZ+ #\W je•oN]љ$n㒼pVvZk ĈeX+G|'1q;=]ƣ+Ym)+`Z(ZyW%loz427Wie-FXH<`|-*;zL>  %R {Odٟ?QkUt3Tb*|,[Ncn>Ζ8.K VM3RRaTU(hk%iɾ-mw|D,Xv>k$MZȶުp@O7=~Wu;ӔsGe$e.*TW;S~ %f` skJ$m_&2 FP0 kOor9*˘#h5FhrsЎȅۏwAXN+zȋDbr=ԩjiP/Fe?gcU&\\4TT+ CgTCT4J|͚P+wqM-#Vn{|=[2L9} bd#~_ $eOQXg;~c[u{&)VIWBҿelEsUwHWMimۈj=M:1tbLYQ#zΓu[Y. T|\?0Xe.NOc>aB 4hS!=x.ݝ xpMOgc ʆ`E!V ~m7IA_w4c`CiQC?iQn ^!YD\GȂxݰ)++Rf@jȩuΟbLGe'j;W#m_2},GSWŨ+->,8mĖ,hޒdώcaճ&({#$RFP ^-Xb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ _64B|yznij =z͹g=^cI.*[QyO1ǦmK BܑOzW uj.*3[!XMԏH*@9Ż_lٍE'rA#n_"1 ئ y QŨ? SS>QDry ?k@uZM3iGq\ +t$/+)ىPېH/s_;޲n5cA&x'xS(F!w!ѫ_͚RԌHI^MI]Gp1(䱹NO~:6+…q4,w6D?2a## (/٩dG[\ʥNUc#Bdb#R9uÚ64 [;&$wѽ!-hPSe_"7U15]`ILa`$R?~=Ap(AX r Vw pmugy2֕%C`=r(h 3>j(Y[n΂8}9ñ@IV~27{ 6ܹ`bcY(K7v]yoȝI'1hG֠O\$UUS7=ܔNX -0o]) _6x :ӋYh! Tsއ*&:|O'%Yc5`3YI}\ BсQ.:U# }, Du:qRA3„W#7bAdf3y $$ZU^c%xE# vN#+i&+" pԈ[T"F~S-ጶ/p  3B?g'&UY"|@O8,WW6P@@s}3Բ65UcNbT`6U=lIE*@j+JNc:5 8BQu7 zH{gh)2PyЯlj%ɍdjw*ӯ/DA&d+j>w Я5 PA q-~$j`WW<+?q n$7΍`?{_urgDbQI-F9o5v L XOr1+n£睒(mdAÔTev)wcqD}D;(ءd;C[ |<;_Kq3@}I#Tp4-Iq̓>P \$_d<مR)|UM%܂nRKGrI ,n*Z|\+ˎg?ՍgϝFnYָz{˛Huqn`1Zv4BcWePAVB4ɕZ?e8XvzSP߷-bO5dI^bхZe)^+y32 rXP$ixlŐSKFj,m`*[EO_舎Q;(U?*U@>gyA6BJT%Bw =Ia@riOGj}1@{QA_w9Qˈv.cjH}(D+A:}sebHx[5mNb|R= G"-f˳eVQ2ac^POAҠWG)C4:+u ،(ZT, q(~Yݥ0ȃ}?1-N;cJ7!iiFPWQ0|hAبdH F#DH+ֹ>c_@1E'5߭?˱%CJ?c(h+_|k).00߸ w ңj28m]PIPy"w?N"Gf& X$ T_1gr8YNOVT;R߶H+dJ+A|R%~LF|'H _Eqc#SA*Vؑv[PH#'Nt&T tV|!KA 972E|fE4ԯQv`i; 4W Fj{ xM"Fs~s zh<98  :> U!#}k̇&]d梁3j=uF;k$DB{~4thUIЁZw' 9}RZ]ޝN5, lT*M#M{~ӑ=f@u`"w,[4z윰yJV" $%_,NԍfzVvi(6Y:K$և:}'| lL*[SJ2 0+UP2?NCu0$ԋT^+BI`&WA h1H_z?pGLS2MLW!W.S#o CVqĴ5\J.Bn0O dNcJnHJ|THGlc M~6Ti~lw_ kR \bMI>*8oT#VuxŨy W 0d/\c)Qm#9Iʹ"2Sha]du> odՒWZG]J'H$ eJin!t((h qH(7 }5 XQI&E;c2EB'+-i0;`)x-? FG~nAJ JİGt$:J AƔW-1bP_JRiNIA\Plg0*ZTy!2L 2PPU;ptqônUzx?w" jj{+-F$SX#f>V#,}s%? `F=XVT5'b?s2+mWkyXI=|U~^=Ɏy%ݠ:Ӱ|47SIКЌO42hiTPmQV:So< 4%Hpk׽qdU5Lq(0>!m}$10eLd3!!|V4jU1l^'?K)EW=;~LIH52\1NբS}W{ѓd` ܱj9.mɔCƆ$Z@MgnGZ:71blUXb͊6*ثb͊6*ثb͊6*ثWf N*ᅯn4;dY og= o)^߰;TT5^\x‰Ngcy9V q {U}CO׃xT[=IFi7VfTD4)(p%0!V+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ڵjӝ~OK)]WjufUe&GiJs:=R1 HcZ-w_f U $7X>h΅%^"SmJMH})<,~/?gx 7JߕeȀq_"ܢ\Ɓ ^C!űLf}_M? (U}kOOҵRsv/3 f:NTxc"S*IR~zas٢@"=4F. _3 U]WWUe`jВ:vfI'1G^Q}vsz|J>&QG9zr7&R!eU †C*)>}a7tT&?2(B$䴓ᛃcXB(kJONs=0ܤG!uBOG:g.pJ~rF$w*IVh֍U_(RIƋTSKf?SF"UQ^+`]6iU*X,GƟ"N(Zcn185-!4dVOQWM.8BҿdWqwOkP:&)5|TܧSTVzed]OZ.2WF*-eRp){0g{v- Ȍ86#:OXg0ᑭ ЈaۓC|WH~9c+jː>Ck "1O~"O^_ÆvpEs^(7=Kf+k#xv4PhmfrsMX x^5'%2]+0e//H٧5^?/KԒ,-OU~Fև gEwC nBBtOCH)@*~WpF] Q+QA _(JUI4WH IG8n,F[9Kڵ(Ehvٱ*we 42LHǩ[yFP'%\kG]FЯ=ۓGی+{ڳU˕U9ܑӏqx :|QyeGc0EV]ePw܌5ew/ 9}E+k/602<fʙ׬+H/*q&OLNu@Oԑ =Xת5Ri0̈×7gˡq[n9I>_l\D̦@R>*H!CG)j ?ReXCz ?kݳ ek"D$  O9[S 7R ^W 籶L*+NWͼv.F%v:ϑnKig֋ x< 7]l(q r䰞չ](ԬY U? 2e_?ufuTVnoZN7J+E?b_K7k)qVuRkI[. w@^JC^ 3/>. \N6-5d< CӦyB6@ushM$ u?Taܙh^F PHTn~] 0Ό!cS?frY]ƌ졨,= MlKOhӴ~'TһPuV%QojWd;jhE0zr pP8TlfogO֣lySsSbzKGl)׳fQ M铮 ᝢy^n6!VQݿl0rws)\!gyGMR<0$62MsXw2Dd?7HQ-ԯ.y)UPM%r?gpʛ ^ٽjpQb$<ԥr%kgefP.0h$rj~~,{*4ОnVL;U!( uR#؊qZbr%iT* y1#djl`e~U)wI]'v$l":̱CG响TזEIيR6 (wbT) 15+ ?@FAEF_.ժq;"їȅ&UMh?q$`/%HZj !6钩ð؞S|][>=J R⼆P: +HeN(OS(*v?v)Ƥ"o:F%e,?ӣ" ' baA?rqh #mz67''ZO$N_k)bڰW@ZIJSJZ6CR{ƒDQ V-ڀ&9_bU?) *,N)U}|eC$) _ yB"H@' ,Q?.ۇT}J,jBiWE¡GlG,JN Bǯ߮<*О#o,耿p9SϾD굩TSd G)V;`iK/VE&:yEԮCɜF‡mg /l-8rZٍ֟4]I<H;7ET ʉmҌa^_\f7F'}0K3L^? ۍiˀ~,# |-Dn*uCo򳍳9W?w WJ$D~Y T P6Qs)V" U{gG1QZP`œU ?RIzR^gaPzhO=Hk.-~ J0ܩjydH?s y `bI@xc洷7" R8zR[/?eBF2 wR~5'c_QOp 9I-Jjj; ?AZ(yˁMf[ id*uyyO;BG윛C%-"pѡ\J'xOoe+5's.0V1z*@) %cC Hd#Դ@em3K$, ̧,R5yLR\=TrTmGZ {&9#aVفuIbM+Sƻ,WZ#YwNt~&ǾŸyG:[*G:nOX̚}C߆]`;aJ%h#AǑ^vO"%֓ 4|H._sEI1J,WۖVD>0>,ɹ2ѷicq_ɘrqpG2*F~~g[c{ivS1$l92}8?NB|+9< fH*Gtu 9ch5{xFxn[4uk5RwJtS&Kb_ >N'nO4.gju5j3y-+Q833c8&zֵQbjUiSu#D"f<+x4BsYwe`$ڂEN[U֙"kYA'՟N_+f7`~QZoT͸& m2US&|,~/ 3 *~^3yYN%ȄfM.(: ¦[0mޛ`*YٚY>H,UZql5lhMGʼw;wu7.tF>PlO٠N%.V EC˩7TAg<<$nPH!fq n?Xd_tSzOS`hc`84"H~:8?Smd"ݔ*Q;s_[KXB.xjĻ- HOPZV>%YX 9wTKen3!wO v<6+GΟ[տ;*57sfWwVovGXUcW &ٯ(Bb/R'?2'rݧYGaW?3E0UJC-OAmQE3Wu 3rAƠ$ sMvt& R8vlQ:UQ`ұ:_$6s9%_bIEW7RO~]>+# #Dd7, Ĕ2ѿ:quR>ZQf() 2\T:T,%W@mu?ONWLvL# )v,ہ 8ኣcbZCV?FOy>˦N( ԙH1e#aCJ,P3I"úڕPPSFEBx}J) >O(,×] uUz;ٔj~71=Lp} )o$<5hhb9>p{LjS7nv䩓oI?J( ؕzmJt U?]8mJa_Gr*NDb{Y4EUn : j(T䠒X2:֤+cpBe`2Ƥ6o«l O  `w v!NQq91vo:`22|sΪ>*xP<`|lҝKT)GT m3u'bbA˫+T-@ǦAS?5VA#/,Pԟ¸1hp@Cr(HY8tbZ,+^B)fYmZUҝfS1&|*^^*| +{3\Ib\JV!`$XBJR]~(Y8j~!VC&fV^5{aG:bJOzGuz'`o*D!^AQٗFnSa QF˪QvN@}WɆ%\?CN'$(d*Epoa0u< Ĭ”잾#|yI۳>JS-FIu*~񅖒zǡ#Vp^ܢ+mKJUW'fI^4}Xb"DH ۖ( I (*9*(~#+<;҈$xcZLm'`;9#cW9T7ԆɇeO\c~e%M5!uSZ{c/jKˀ#VWcr&~B߀#~17-]"i< z@zӶwcј ڧ Q5'Yo\CmU1EPDla/nxQ5:M֠(#PČLk;p5,q7% -ܞסz+/p-zzƧnuBa J OQg#BLN"IC%FVNXFF/Jﵰ뇾S3ڹ[pNDIR1@ZA,iT *ܞ@]zdE+OQhXQY Ӿz_,Dh/WY/qfcӷ.DP1XT>ir6F$?3Z^SUe*$A&zeZwq]q%n:}`(mےC#Rڛ A>f0ZF̂ud#qtrcn=hR^젓LJebF<7JL%GFw`wN0k "oAJP ]7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ t LW:C\1'PѰ=(s4NjiZ/y:=DU #_=ƫ'6nhTѳ#IʞoSq6F >]0wR_}V5W\vF_ceH[H21#&o7#OJrymܳ_vWh(EReEi BPK7.@$vs9'3jބQ)ѳlH4'"H-GJ10$NA];ZoJ7jr"TT}#p#$ ͔Wwz͒e1ZCs9-6N!KWjT::>IẳJ 5VcFŗl498=N{y#e't>? {ja$ ~%g@#YXRn4psYqGE,\|sAM ]@Y L%5 Slǫ$Bt(OF&;9-r$ 5^2yJ7 - Rm?55c:CV 6eTnrl@n>9 A/`#ntieV6Pȩ9;L>A ajCq]_sfX -(5vw>?e ZchĀёT)H6 ]W&7-n6EتH,(k`ŀ](E+9JMPSwɛ#QU<ǽ}'U8qz?v`M* ,A#I#c4,oX+J;F5+:O/ཇ$n*,>?gfC>(uQFƱx*TSr#MHÀܶڣ$aQk^\Jgb\* B:g9KH(ۑ%olRfEPmP ?_~>9__,4lRA_.aPVJ7y*NyQ#XPcQ'zӾ Qw!]>o_ontR]6J;ZآL QOz}FcC$RP+ă%s3aܿBHt`DGA9ܝ1ސ.e'Z5cg4#_9Q-]}avS< ` 7^S?ĭ& -f3˕M>5'J䏍u6gn[?ղg"Br]J=n|d#O8e)PFk3{CF(݆AU!U?_x2_kF0@f?gNcPԊ%> Xz7]fGiإVl@rHnLt䏘j@jhzfOR;%V8/Ċ3H(lc&BKEZnpU}l_c8mn |RkYĎaw5ۧNIž\xGqFçH,&D/H;{2jc`A'E6 &fk;p'jb!iH5tT}6J҃nf̮GR'4>:(۠)vmBMN9e V"+4y!'ya,\2@J{\=O?GxNbFv6W@\9+7xBO&AB A?gbo8$x'H@@٠^a I<((OOle/5<|2.QY4Q VO6.,|-TyAq_hbY29Tn;Rcr D#+P+1_/%YAcPZ6ԏ'ʃ+d*^`I|żUf E}J=JBEK1y=jƧTj jfR))8Nn> @SXyzhkK99H + (DHx!A`d ~Bdyip%kC&o^(}q빪)䂄̟|`AH*Ѫ@P>BQ Zfc E@-Rw/s!hMkF#=E^ulP"a#^|B?.\Y'UcJv膷Q u kSj#+ .#d6tJa/$Vc F[biqXԥԎaURQvZ֨(jJbrѵ ¹\>/*J 9ZӾ@'"[Ɇ.Mv;ouf)HCt0-7=]vq߱-S$΅euɢL3PG%W?س'$y)BX7rԪ)%h6|@BP8 (zf`Wa#5G\,q5K9^ %9Irgh 1PTaϕ읈P>@ +a+( ܲ5y0ߍ@ w o!ÀxS>8-纹iH$zG|l qކ`%{bqTQP=Ėڌ헗ȕ՘H#]OErG1CݠVH1-|/1ૹ\!d/Vnk]oDG=T) z`r-XoPz"v* |h+~Y rHQ;h)ڌ?K4uq"ã7'7g7_pk{13Y 0sF5YH=p)-29 07=rDOF޽{advnּMI9VH8 09!FX岚^Fn"1X A Q_[ӽ18d/v*rge/j~D 0U?O f5P1¥,q3UI R1榤 0IǤ.;lB/] <bUՆֿrjB^Wi\hf•pRGE(^hE1nJ]M;iaQj;bx(ȟTÐY%(r" 5)dzUOWW#$uQ叶tUR"( 2ؤȓӕ-pZ 䐯 SJc,`y- *{TB#ZTїr7؊2(<67򤡣!AZLU=eH) =Wj̰1Tn~,+ɡm/duUob2H i )PK`n@8ƹ\H, +kSjȝl!eh®<10߾36>ӵ2E乘JbyrJ<ƀrNk"=j(M!b 5I#Z5@LA#ņ/)ȧm1 CIwpd$ա o!^yJlr+՘Y!@ae Ƥa^W"2C -~AH̥ʊf@O\QJbwq wUqƾ$ncB|;du2%!qц*О|fAQKAJ]H1h Gsxˣ d) ,V&\ƔuoQcBxJ3s"ՒGjU;[mN,F !6 ym%PGᬰBny+ҙ )T4Eຢ&?Ne0S(C)hO9dzCG Ƽ@~ TbSP ~4OoY Eщd95*&sb{h h; 89=h㕾('MgȯaM42Q4m$5UAQrUW 6>#ߊrz P`+Ԛu>rV;N#j=)n4RIdQʵ:\!2e*HQ^U%=8NXtMOe_c̖-[F>! F 1 Zv[#ɳFP ݝ묊҂8s,MkWȵs(Yz.ܛU<# c!lachp@c} S‹QrJNƹyIuIF9IK"/T?m68N 좄dᎇz-8vb)e*խDZxa,e[Jٞ pF}(J*pH|I R=u~ ڇ"O?g B̆]D$ېـ_+]j7߶!to@58 IFmEEI, һT~-BN QɷLmW5!J3FS+l $찮%qۣ Kpʷ+i)Bhm*2 v,>ׇ|,X2lN*?-b:m"4>ۏ!uץ:HSrX;B0HdIV?2=TrbwcZh2\r"vjB\Lxh^3 TV[]ή&F5>^ 4ws 02tY] I,E}W4_MGɽ躌<&@p*b@r5 eJG(h ڸIkv/? Lǭ>ojT^ï/*+aa (6ޣt` VK$8Ug-֘-^T+ҴjW"GVz/ H Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊iR6^[1`nweTXs,A߱!F4 &LτWcQ>D)nmI# anxњ+SF,NEi:, Ȣ9VW76jc!O?KBD3)E#<&ved#fz *nxdY]rม$Ml32@O6Np$x6V#| JqA"K;3=1 $qs/sÓ)m,SOWᇐh 8O3X!u(Z 0)bDŜҊQ+S Zc/O*NiG#P޲(q_ſ|H e_LCdE{w zw$Vr;D=J"wRDE ma5DЀ9cKHHN\fQU۷l1IJmS?2UԯSSOιm4h ehG]srOh捌>ƍGJm47aif7<$ԩ]D]TX]/S_vCFTdYi̒@̌["t٧trY6@(OGs۸.EiGc\^v)Źti#8CوA[ЃY=|*<+9t]=ƜZ6<B@鵱%0N|zC8S3jE?!Nfȅ>! st[TrPi5XJ GBe43JBN &_/HZޫ%!Y~?Ts^]eR]a|S I/oӞA&fKԪt`x̫n\G Iiͫ DFGۛwcFNQZEߏw+8YFQva$Tɋ PUo|f9i%R5u,+)?Ú>fPSŔOҎE%C7ڬm&I6j(Pt>59 rX-n(?cehSquF}0"W7#y]צnΝ(,D3CN*~!Q,$WQbz 1,yzhɖ2r"T!qE**Yreʝ#Yonyz4ҰڄD,ɜߟ.ڭ$TÊpDSMFKV;хԼ, ~C1-) CÃcSWGؼR*Ɠ\@8PV?jo*S(|rS`>rM8XXf,gبy)/}N?iswkS2_V %UA|xGkk<# ᔎocQ̉McjoXgUfr;%ː#t )@4mKB>}(qTnKNj !^47§7S>UC%g>rZ#Q>%eŠE >8-'oܜY ~ y99ҝ?ᗎr:[BaL48?QhDLHz7NPc ,K-OjQs)+Vm~/Mj'c-\[swһT !w$ې0 2.TU;8_,Ŕ5;%Ed=VjA)Z}o8&HTQ-љ@v{e{$_Mc]=@Fr^=3K. Y \%Ja |%gxy@$~<| j"+.Áb*ylQΫC@6/_)h,Nl'W.AcM̀ )vUlF)I/߿fI|5_%mj(w;o(iXkf:G:Pa7efb*zS/ERW%(dMJb4ǚrR.MNO +Ku+_LkFzӏ\z5[/8?Nnz|`Dbh6h;1VfpOG-{b҅Q~ A_|QHxKt oollVg4 `+RiIF*9so:ƫ4O rd~\'V*F17|kA!i5`=6`I<؄CZTux&j# g^zaB ݚH28?MyS牬e֝>i*K:j+ ]|{TRkԕHNC֟s\`v@DlYh#/Ո\+0h*hR=)Z{O&!ԫSLn 7UQ/+Z(ťb@}e4c}4$-=;2ǚ6[Cm̜Il {Tk|0@XsVr0 1;Zժ% ?^_Ma! H LW܂H>; Js"*ޛl6sKGdeɚIwAƭH5}*d[+sӁmD`r] :|'.N'h-fUXLOQ ]_M=OTJeť du!Ӡ5?A;Cɇ^$Hկ2X72X²IVzo7LHv_"Ur}K|Ad5%AyhU%AVɂHU5N1&hʩ\M=2Vˉ|7':vu8,(}`[BܬnZYLdSd/95H*Gķ^+g՗[SSƅgnq?^!o,⪕#!lZt'>[cWHrUņjExhKR<{`r6:Hbk %~+[ᆦ7nAO]Ww?EpqU# P(T9 lVL11ۚWlY 9>*$׵S6h6F`ƒNC+iw5JON@NVuWofk41(zJ"q?Ny s!J҅y/jdv‡'L)}Ax\E#UŅ>{$Ҋ>'`㺚/=q @H>/v1Fj1$tIkg@#_yrFT;m|Rmck s`K+S-D•aZ:jAL<Sn8ƫPY_5!،7 J-y*Ip@I:DI|O)!=̉P^Xu= dTBОGң"v 9ߝm-Gpʷ-54 ҕ`t-'[Z;WbGw x#K2z*C- E{yqŌg5}区Wj1Zv9.찿QzmV <&GfCy})Y wfw#|BHL/$?wjlwgg2DW0Xy(և$3 Qk|Cp!~ Q B.">ft6fOl͕S!h b>U.'94 #nV4`7+tQWw5',(%)I|B55CJ >wDBK6ڌ*y?e)6ESӞDe c$]2шROF37V_;[ _PNPF DYW4c'uA$9(;bkQ}dPO?ՅnԟRZS?kRW&9 $/l#k+= ;aJqwn20 sr=0+N;4"s-B?ճ-[n( |Yi mcW4=v?y`uM?lHEA_C8G2UO_Օ6 ԹZ;b81gBc,*%2tSkҤW O:aUaI=oX=+dy0(SFFƹ-pI~ aFWmhW~F"j˽~gApV4߿ eVdu.W1Z0\*貧'2iC34Hѹqej^evJWb\pb +lmB:내Kep9( !y dH/%ET po+vC+DUBƀ~yJ+ ؎@LU|bd(ҿ$?a5pAɐ7\ tKJ0@7ߔѻ8[[+!1?z?*6S+ofl6? r=!8-itΓ&Ą *)Q.[(O6ƻOdڔIfF}vvB#Џ"CtP0oNq坢2@Z?v5?o_HQ'ꓺc1bORgD|?N\qAjnOV-V"I|2r@XU euf;r#0ę$$|D7BNô9/qN*+;Wo JaUF֪Wm_;˪i$pP <%gS;.0-۱>$и"mw."CbO s3Jӓ#cqVvh$9Tfv3gtreK=I+z!q=~kQT\0%ɇȆ~,YnVvi :ũ_RX#֏G˯ OnZx/AҀг|k_̂mOBj ܪ?uh#8M (Y@#/uA S}l8m]kei]Hyλa5M:nxfI ;;.5V.'m(I-$XIH?$JK<[vcBN-_YyIlB=SI(kKrQ$H R$'7zUJ(jNm/d K5##Rk͎02тѰ.Xۖ@@)kpG 9qlG6잕  $HG"J54R260?/᚝LFQ~vc 6ۛIW lzb?7/Kuj>q+%TR57z:@k Rgg0]k_崑%䠄Yv7hbE}wZ#lZ#[T׊/UF@K%IO&ټkO |ݪ6$YR~_F.L҆xcm4̓|lO&훈gr dS?2vG[Ƨ^W2@ČJ(SPqb0:br<1U Y9 CƥOa[7?,D!l>x4 ^djVd7T9>ni crF0PyWaQ2HaAF M5I1U*jC)jČl +JH #H{~|w)~e "9J|B:VfF#4{mkrQZnJNp J8h;ҝr%(nD96i!t 2e]ۑjhE)@6ؐȧ b fsp*9 asIř+ݼqWBPVuONEU G*83snwVL/#M# #|]ކQP4g,xy}4%-zC58mO1*>Tt^Ol}l dRVzӭNt-=C4rv*A瓂XN#%@MvW4 MT~xO6WVzSz) ݾB#u›H$(HLNI5}U,^ < 7g` IPg60] nWSV v0WE4|EQ6dLz1#h>Mzu I#!V2!l€v9-i鐐dlZPI~N§ ~f~'bQ+nя酐*+˾%Q/~uaQ&?Xw*?F<'ؑOq 0J2 i]V>5$zR ~]~y@!r$Ux2UnAG݀;?t"ո#92FKjTᒏ%}\=/3au ,]{[V4T <:UA5e}62: /OLUŽ(}GDc6TN̺- x۽>.!e܆2,+2!FJF(q H ˇ@rQ)!z",o;)oN![}0@Ƒr?,?j>DSq#RJ(:䐬)OPjz liFaXߑݴrM<3Cs* ? FD5C/S@}X#(T3Ī95TE5LB Vo@c#-+gZ94! ~EkF?n|{Vre];lpU_zy~`P|,\td>weH RFtK)?rw\ 2uH|MH*KPw! UY"K12ƁNT0HSWfН6 @ FHEGWb9ܰ4HY' P*Χ@·vI?Sqg?0م~\FsK +0E)BXpJ[2кs`j 'o GGa,$XeźʿW#RO+:HjO)%\'ʢ N6JB zh" T=C*Ju𾔔/)19[>E3ַjxMHˁ LawJѲŇC߅SIֻqA}">nZ0֨ic )޽҇~oWf w5ڭOxo26jz֕E5; %[L T!li0%6*Oq'.,:O Y.Pγi7]-X憛I( 1 ,HIq?F+p,7O;~G|XUPz֛d>+rvģ nNNC)L0&-\Y'M$jMzn|<29k)q^l\&=@$|d噞C 7İ8\ޣS YRv5F+mHd^C6Ԓ<25G}ubv=r5L:_UVQ?$C_l!wR,hg iK?!h`DUcoʿc?QRWNd ȊGJmԚ~44RLՈԊWju#2mȃ4ՈS9.C{#9b!+乧97zwlxJn˸=pl)Hf`$r$o?%rFrl7*QKѤC0Ԭ8q[sL&UtӘaQP.DL1W_Y,3Ҡ8rStSf#P}yiD+n@ S05 vq[!qB*Fצg% gSy )4=X2|JS5? tˏ1fGxh$ _oYv/i%Wۙ PG9T}RHh82CN` s8[jU԰oVIh<< V|^%ykjYdPLmq;_o4 ーܛrWEXo1Al*/JE8ssU$h|O.朊N В@uGIz!ߩ_Y2+%]O #R\OiMX{4(%y#?`*roqd^o2'.; IJdTdZҟ*16(`zr쓶F3IVЕYIaNdHD遗QJw0r3 nPZк]muRyzT#\;1T>Cy^rVU$5rbPǩ$BE%^|V8HܝjTf: v$oOWP M_yS A=Zr@BҾNWHrV}[G6=2rQ#`?hԟmb ! dqUۮ59eU<[NmItcFe(h7=pu†>;HB_xʫWr$ݲ]9-Ù".n,~’@AZ~x:)ئ|HL*Ul*96~%Ka%!=ɎLTFnʊ֤|?ɨKI$n {ؤ&w\X(e 3bV6hZSRǪ#,IU\}!^x*o"RI [ȖYFܹ(:`0pc*h~)[%SŸF AHeC_JhA~(Ka~|#⇽;s ,@!X(%D4eRc VVVVbԆ6׊]YUnd[G̜e2xr,~]F-quldՁ:!Q_ǨE%jx>*MG +ъNrL(Pz㭋`ێGLi5FT3#KJ?k9󢋛ƑN5@J* Շ>Q~QG4̪8S R#d֐7Uɧo)n+kSm5fu*@++n9r.8[ тpbbD7jG̯PTQQyIГ6 %XWd.I:+q5b;Rң ulή* :slSP'"YDnέm /0ȬT}>Io ~#/4Kw7S]}.Wi ˘%ҽFå}㐗4wG|:@xOU?VE55(A~v΁pYR+I u4Kt!Uc9(,SYbQ %뿾Jy0]*7.x$Qwt }J`~dZdtx(*-Evۡdd%2m~-ڧraր7 WʉLY9`E >= Z 6IKY1%QbXAtC@PP5Tt=I5*Ǫ2mƻwpO^`lvS?NFЏmEyIsYA;:P9 :fHv߉'L}@Z$ˣ5@$85>)R+'|9$ځHǬVǛ V4@-]4`B*m6&Ga$2wG>O;m{}X"hYJxed$SOyYqD'vhPw-z^dNW&@a;Q]8=JĊGF;|$Mmo3iO'˜> jѷۡӃGh(ZHHxp?:!6fqrCl"@MgZ_̖|M?vE<:<'-<ʸ-5R*=tJ14W } bXKIAR#7#/M^J@v;XzmAVY=%o=[dUJholv(҂j𯐽vInWv ŕXS3mG?vibڮ`S1A(IGFp0~ys7yQW_金b%svhR~o 3p fǰ_ A_oi94+@&#\poQT:}!W6+͠#锔agtg)A;Ւ/,No-C7T4$ "/1i tbN6?X$ҿ0rqĢ`FըpVd.(~^nAʻI8fJu;q4MHj0~x,Vldii"B16$?N6#sjcYGJ {{`;uMLԹaˈuL vD.׼C[5U0%7ZݧqF|#d[6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vu/˿21Wڵs Ylz<)F`'֓1΃md2 y ?4rk!a .ܹ vz!󞒺E춱ƕl.$xJug/Ft=x4Lg?ݑ.?[5ؤ!m𺑳lزRI7$7(Ϸ-!~.?~+'L i*VE_A> }̽kLL#D8|rVܳcV,c=qLhETuM(Vƹӿ.iI-DE%D&ڄ2C]Qdt"8u4$t y [[ ʊCEeZ~zp#:.bJUnr%s]d LcIz?g>D~b?͒W[NA>¯4 $L# xR(}Op_ÄN^E24~,@n*?~^$XN9SI ,gH&e=3IA?OxVwEiE*hFn%~Bi=,Qs enm$F%LJG0`(HC:MJ|!\l@}LpVmJ5 ӧ@u+U?hs.]m#DmN]~dFY8a͗.LQjEiS׿sjsp f<'T+n1'^xJEl}$6Tz rXPl6eZӝGͧ˷c ͚thT抁UGdM;{c(8#-x?xIM\VIri[͂4:By­t^mm?١-YrY23洢o!>lOScC Vl- +k`C^l8$l,T)$QhyW5#V6Jgg<15wژk{nG2ЎT :֟h0_[Zהz<"$msV7q!vV*4,$8rnG*zgJ򶎚\*)^,>.͚NK/A(%Hgnl =ËB%Hʼ@%2w"Q@ ҕȟ*M@v4Vl0˩jO mn_72T l18m!TvNH(4}8)0 -I}3|y`l"JB8'bQ/vNF=rldD'  t<~F'#\R8b7;;RHh@fe36S5N "Q1o$dNhR-l6ߏ;G!/EK+X^, s[gwBM,H夡p+~zȥAb {:rPck6ԯlV8 ({u\,M?ht5kR6w "k'#$K-v%)ǮsDܧ 8vt)T |]f4 czhzUDiZU o|/4nӯVY(Ƶ_?^?Eje8|Q\_CN~oqo=hJ>=;*5FH#JPדJf8$uZ52)’ ΜH;YPwZmLD\<(gUVG HHV|5#Z I!gR@1,"xW9|ÕZ+,FiY)i(yK$̠0}8i2ZMǷO-Sz`߯qڪZ*/"GmOBij(M0 Rr=Y ?p%IOZ*g՗hr(?BW$ptdFoH~$iR5G%?z5"J84L_fSo md3W2&[B&՗8Bg^D*' J/&oUHr#h`(.e2FFrT.\Wl!KX)E]Ɋ=): SA_2An[X!V˓ӏ`T*V n#jZhڃΟU.j94DS>Uwz Cc0[#ɜdzSZ|5XlRA%JH2 MVct$~&c29 zN*QG w*GV6*rkxeW%rPaUewx:n+g6M7g_g@o]ްQAR5yI+qT:IV_fѱ AC"TQbڤ,MfidnrW1S[P︳r Ƈ9U\LV{ +`Mh? $hGB87тe d_0LA =5~",d+ɍ[`)ح+J6+ߦIPߛvF ; SN*GӶ*$:C!ӥFD5I璄Q\OpGlK;{TW*-)c(\kQZdTpbu ly1ʍHV$x떪rt vڻ~"0DG_u8QԌ[9T>OC/ r?$FoUGVAO ɓb%LU ZHn`b@,;3K[Y+$Z5,Sl_4 ]v؎q-PbmE!`Y=T| "9Y['%%܆" ; -1@Hܖv;t2BT "Y1,яC9 ڜUޟ첲˫1j%~3DJal,}A ~1bXi"^{aĪH ҙp``j1Vn!\B^AK*?*0`?찧0qAɺ͕˛)rM\WEץ2 $#挝+cT5'<aCv;H#k֌8rbG,~{" r@-3)ly͡uP$\MYOnLב4=@?w,\U Y @8Ihb~in1kduγM q[\;/Ry_\R4'Le YEJ#!jM7 OLV|$]"H俆@Fwm?r`Tw{ :kHK uj:rVO E*5 ˥( S+#$#2ƛOZ0#OdS+\*т)(Fn#3Hc"LO8]R#u8ǚZ_:$S4% CJn /זE]13\$RX؎h|2aBJ_~_b>?k,,>2h<>i>)Iznmr<^<}^4o }SloRiBH4abB91RGe=޼:P{۝PjT?or}յgdoP}ɸ2>A-QO™M"#@j|>!Q3OѾq@*}w{t>,\nkdmن7哥)#ӱ.B1V)wQs+0u Z:S[30JS"f5E%Jce,sYNN -=zֽ27/3@&9!Ew.cLlǨ;I?Ol!|wOMOyc)|Ce[&^UҺh|OնV͑׈>͆Z./RmΤn rL&a*z~=0=OnZxj}Aq¿-9?悛y;g=ǯ3O˛QCF|,*+6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*1*',Λ6O=,.+(\"eKqlR!0xUZH#)r(OCჳ=A&6H( NtKg ;-zb:/lRDO(!yLTOg Y 9EF=6f_qjdl_24܂JQCs<|KYf uбhP*$tۦ߳9Uf#FN Ɛ73FBv͹}*vۧK?..k2ՒjB r+v-P۵K]&XokR,ru#jW %ʟfx;4V#67+Ņ욄u#Qef^Ɂ䋵Hߺ&V'32q~6)_KpOdN|JC} k| Ʃ 3MJם#uEl`xŰEpn2ߴ>5\;wQdtvW CX}"Q"%v p:EK*RY]GLd6o Kd#8Hin_k+J@+(T?cmYX2D*lc>^4; +g/*m`9-cu)Hqag.:CWv#`=$ -Îxg~ΑiY#Gju9L"FK|zou8mj#U'[X%W 䆧G.#D_XH!0ҕ? 1g9q􇛙S2E}"޻U$mOO9Nip&:u!QzW^ɄuFT!3uAD˘2_$P\;5hl¿ν}^B,ԤP/ʋ+u1Vr}~_ IEUU?oIF_:ii,$zI"OYxXO~{MX׀)<+]eNWK6R^MW Wlp/qHbs6RȱH<(uWm$gCT!TR$U}0} Tcf'qi"YYfsG(,?a")滲v݋ٍ-**cOȗmmLA9;2|e~ei._-! ʔ"yltp9b}3#9ohG!5k5w8#A B4cQ**ڬ@ex vTb`jO~(ӕ])WzT~\LF(-S¶GVID f RIr\K1>ո\b:+<4Cx~/ LxeY).JJ>&o xedrVו*|2qWې!kwC`d9n'iqkq|B1Ơmt)& I|鼂e-^#kHQ>e +^)Nu? +J\ J76b􋚂 u1iM  Q %dh)@WOukz{6؇ h>C l]F'E0)LnG(Z'…Cn7ȱ21UMׯx| oEXƃ.kxbVYU[tj;wmČ{J)OuJuC^3-xȆ%8r3@Fޠ?ژu[҄2o!+,ír@ucLdrh#i#B:˾+T;F$GZ143꓀ E;mDң\I~.<Ѽk@v+NB5Yo~,A9A+nJG 2%,)tg Fj*҇FI`⟭HЫZ'P Bم䪒z廫;UKGĚ8QT a6> !*mv!UOSK qsC0atd޵RֵU8  ~LOEy[~xɕ`>H+x Umf==VHa3NѨ>K !*^R#,b`Fr(Aj@r6`B&x&<ʴrj'Ϯ#] Gug-acBW 8 RõU$W8(s|'jn@T4#cS5TInÊABE?kh 7ddSDCPg2^_Ns3>.#oRb!/B"^@APT# ZXڦM@0N_ I$-B PȖBJ9K+j04"3O&ʊ@ݖyu ڰ~UXWku*dyQH ڣm:Ž~lh֠ <1'4tTƝF/'zQil)1yD%(ZJI%^4N`ecCN50b% IPIx.B *jshkf66׈g䗎Ef~҇.QaF =0;{光Hs3-~ R۪ k`BUix^=Nx#_oVgpRTPwjm1 ʵ E KeQ~b ג&l>#$"MTucBAS/d^DhגW_司'SFBlţvo]ƒP Y}-A"#T9J7Yã4cG_'\s#b#a8C61 7\[^#řeF q%WE$"ǿ26ʬTTS:Ks@C^ NsFMA_C +Yƕ%kӪSZ}Ri>zEygbBk]`H$P*9;`g=2߶BT䐬NõigH5qWZ#2yBKnKȫbk;tS*K[N8B#jIA锖l5*mʑ[ 1PhXDv+&)w- V xd؎I{5-qisc~R ]I$Zo}|0ՅWζz\dwC\>xE&Dm-u({!ANhkb<%؞GoGi+]#sq6H~"0& [5RG]&(-3 E~ǯsF 66m AǷ ψĝmRJV5?\r!S`Xood趥%y(܊ב;#x$ROA\ŒwY]1t]WrBb;(71W:7n QZǓAb>c2Sg(P> UOڥ2iH9r$ bZge AO2ۭJ?݊TUM.]Ha'J#KV4/_mU/7@n* =*ԃ#H8MB6q20k X|h7p.cq]#'Cq4ܹ)2)5bԂ(M%"4clJlX+d =ܽ:-Xט`X&/sa~4 +oH*Ҙ$Q8[t"naiS# yo,]4l7:CST5S,eN⿬gN.g'$T(&;\XȿWeXM + I CIܰ1Tȁ P{8ke*UBDvE'~cԷ7ej}ȼ)1,"9oYgm>;qGZ }O+`c# /t$R.ުW~YaWzo"~Ytzo,'ޟdq*aZ{*fq??o#yH G/@uedy>EXOa_ѮZ-L2?|Fimٰ2RUA#Ɉ < F<ؑڣ>< SI &= F=P nEi7d]DhlĴ[h,yz}qJSIK.yn;nq(ܮ凒9 ƛi Ke߯dYN?Eu5s[{oוϛIe'`V*6wRr=׌ JI,<?Ci ;~X:[[(6ڕejнIy ?7?`jb(dXvLJ~m⍗EkqCE|^@7V<#0JV((Jb H),"xHHFnZWONLo(jTx.DvJi$)9uf^z 5 pH;䀭ɥU4޴O%dInan+CF4}|4-F7=/lgԕZI"4&fJ^MNqɦiO#c_>i(u- \qHrR9>ޛ'6j =)%7,0z_ XxY n ZrCr[(d<+c ;+i&N2)@>^g1._/*P |/q޼ ˏŝ#qZB$K3P֮zGJ8$r'1 zt*C)~:&]ۛ~ऎoCjC8S&iN TQޣ$lZxW&ݜLRt#+# 2R;EPҀsD [b]sH{)ȇ=Y]3LˬJJFFb!^8S~8#cϷ݉dԏa'A!쐱q 6(-jo|N#INd 4j)z$2C݊W ҥqq(a*ZCȯGtD^$Tq ?k9tl+w PxJd2f yЊdFK$|@3C׮Jn`TX̫^c K20易H&17(F+|Z8UNLCBQfSmnVɧ&ȳvor$RI!_\U5 ],0E"4V~ D~ JL!6m'*X 5:,cͱ#^T)R(m=K#e'; COY(TҊ•HYC҂?A;1Sm̱.km"㊚6;d Ly6V>CsZGɶǒK< Tt; rO<!^^䁶l~߿$yJZ7(8|GI$>ocLu 0r q@oC\:4Beg~]eMH8AA_S I%?<@Lsb9$~jeH$3ƈ+rLyx0]Zu6錹C*䕩"cU-;+XU5dze[2 PI< YmPhUA| !uVLWaδ1[wC+ID- 3Q;{Jb fQA~~;IBGnc+ m%tP6m!"Ģ4إOLŐQM8B\^J֧ۆTYn-K (*E65FEjһ ␌b=Z~uJ$|jg=w)*̮^$jH=@#d) FcCï 15'@iө刌P@jaiX9,1㈰Q-jE*OӍ{Pk@<>+Y4eJIj4-EiMV"(2%!L}ev? Y8X^*@=" ȩ5bꤹ`9teC)`s҇̈FjaHBC4:$kVG]ħ7rO.Ys;di^ufYI\ Xƽ>imTٓ]RJ~5Ɇ01o{!o_ƒOQk A+P;v8`OQN̢J}r)#^͞P,>L-#>.ԧ㓍{4"a õ[ F H=v-$jOVN9Y$"@?2@BY}Č*$a]%bNM"_[ ? 3)Ž4VVU5PWc\VKG*+W%2(AFbratc#*=0G6Z~ mv>nDk̢i\ng9Y|?jYw+I9xY({f:QIN;H|[99Sz%S"}Ym!Щxg9H9==`{/#O!?M?Qz (%ڄ_C&93M-k[,2C֧-ƭ+QJDALn#P@FBۓŎ]'g4rwG\ ɦ /G e;}9!SJ|ewlfm:.+ oTc&DI#Ǘ}Ĥ?~5,`hC zO';(1 41 CO2*l@ 6IǕcy"=ղ<EVb(dIV5)#́)}>12s 0j?VYAwRrߜ{؊upыTl]ϸ+Z{#"`I\zݛpkfN6آr[$Vr߬QRK i s*}݁en65rpA$ 1&9 K)E@:6M$gb̿#nxn,4|mga\j71H*rxIDmL 7H̢ MqB9a 9TJ7.`ݑyꑟZ9ǘ:O߂|29[[TNlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*|H0Dbh) 7MZ*O!vp;t l?Y 'zxHfiZ5|AO˧:LeIHTVj*32 Z넣z3nGO&&'gyv^v/ˣ(ygsB%deo\-ZD-Ncs`U +[rw˕"cd} hs?w.KcS[xs6JqAA>[4ڡW< фL֘2s0x(;Ia>:.CkO.KsU9;lxy%2<,%^J@?Qe!,*?aWdd7ٚ ~{S@+O j7RU:fDE?Ev_s3!!n6LR/IP=7>[^CjOi\`r* TPWa}Bh uv+ƹDH[^0[Pk@'Z@;<"dN@rnx4v; 14Ik-J> I~KOgj2UT&P9o ?dZn ; 4caRvlV*INţsT^ {I.>)S"-y]gf8qJ&$*X ?$0j?n쳤yiW:86 ƞHG)H[ǥ#MNx}i%aY L˖`MdYj~Ge=b* 5^qu'!t-jZ0; /攊[G^l>:cs3CԺMqM4:oӰd)WFj@ֹu"Aȵ 0szPZ%яW=B~A>͆+CP4#ɤRɕOO,NQSQM*z@$T {be朅0%FĆ_O˒"H' T|~!!0 72gF}֪vC}iWn!Xnj2[>aWer1ca_§tPӒA]Hc $!H-o8V; )T&%=B˸_سĒ֥ ,p(b#+lyZFޝ5s Q*O]AUmTh0l16E$*ǹ^܅rG+eCQO#xeX޽4PirpQw#bra'i[ïN,ع38Qr(T SyKd86,xd_P\/sDL.|1p=;IK N'±TC\y@w I*kǪɎ4jƩk&PGBG 0 ڪzM+aMD?+|, <$myB(SCC0*}IJW!$7n>d9;![( DP6?C(#Z og?N%% Y2}X*J-jNIAΙ{&;eE,Yr ҀؤA%7c_Qhp:LVY=Fvn{\Xb w[g2g{[E}rgNhG#Re4#卤18dP|6FmeJdҶ8F Ҟ厜UCV!hޥ8ֈIIQ@|*w 䂍Vf=+)MXx钪ǖ}-O!ȡbO/II!ޮC5C·I@vJ X}bG;[~=a,PohQ(q8EE~BT& ~@]#{H@?ఖ]JXVC9ȪZ3,|K%wՁN>tNfXT`?VKDu$0&r>G+a4&ǑKїc/g:ҿ,EOsTіAѕΏL Yxz|oSҽ,O޴.ESqJ|CUI@==$U'Wr2qd6IYi &o#zKyK%6H|"pC*>}2ׯz2a ~{(BjVюwɍ:S-!٢݉»ޣ '"}瓪kN-.1ں?+Nu bfO r9q&]Na%9jVvfyM1N8;8i_q*bPdO݇7!0,6?;!M{֟O,Z2UC5>9`Jn.@j<תg$jҼr;O3r!}ܳ2[ H2s^A  \i5;W\)t#VO&J"BlPEC j(H>G#jb?㏊+mrMvNHbk^lfU ź{xƪ;\kiXV[Ys:SԒ)Z^g䋅_VM2)rc_Ḏ3E3BU1',@,GRX U JNTB4~53}^Ռmq&Ҙ*3W_ŲLfy@TCP,d|?jHp0ÖH,FB7zcx.LnXET+GLmxޘաNY̻R s,-CףL kٹS6\ y9ӋeO&)eB!֔a4̕sJ)kFj%9Old4e/d8kF`Ec‡'L9JПNeU`߶F[%E[z%4t NrR?ClÓT:/tlm R|_kG0}=Rd0F t$u*O*~̕Wߗ/-dE9T")1pH[;Ɨ *r?h>6zTR c7B>?C2u3 U>>?|9liO& Ө=C.a"J@qlëE#] MW#+#j~0KFKhxНBMRC8zՈ{λ vD ca҈”G&EÓV~aj7t ebѸ0$1 #_ 9f4.Wbv#v?俺ؐ<`8R͹vtoroO".d(ĩ VmWֵvpڄ`ŋMYAo~M霟Sd<ҹ2V'na uVYhQGAD{;5P*kZ+a&ӕC@: v-lfa#IWmE4f])Ɣ<|\w2~Kfc#}2.g"r1FLTgiX$,"A9e4#zxf;o*:R^:Wy(O%1"涓p?B/5U G>&*O=E>.ˀ)-mB!_u " _ڌv MտØ$ Hޠ|j?V>#?5|VW icfsLzz[@1?/]P0Fq̂:3"JpRM\Oٚ9ߋFYO7h.1!Pvq\UܕQ@IUo^GRi!2/bMmqc#8Rhz__g)fBQ] +*SH]MTT͞ uZ\:6ҟ؂H;{RZ{>C3B2# pf f$aa!rD™"8O" "_(ܳQ-oKO pŎە؃kR$v\69M1Rh*Z%)J1%G|;%DȃE ߞO= NEhG kό.6 |ޗ&??ި>&S¸ce쐩RH֟Z}?Sb WBQ=ʒ5kͼqd tETMӘQ1v&NeAoe<:Kw'Ph<$P_RPO4G橥5me,1! N\ ܩxTTru $1$n'0S:UW~6f߶#yOJ{o gӅ)ʾ'3L+OM'El|OY0n 62UIf܇bGи5: x;^~hhƣ,`}!)E@2(p`P*.Jҙ!X5K0_uJ"ӑ}ljA]oL&{w'OO.$jdz3((Zc mgyO6IGƿ*לJ i<3"-a1@hcqdP lM=wC$MHJ+_a­sXPYT+#UВ=m;гPPT(HϴI8aW`y\G#4 uz6lȶT4ҵ^9՞_z0%++z>ĀnTj)E+$NH xFrU2łL4,c v'}Xt'`~dS["xc<}5A47lB_h]ZdY6*6s C#9'`f"6= SZC$tٱE%M eAQ2Ð~?3@A…J;L$Z~.@i@m^ & ڂSPzJukDVGReZ RK C~򽂝siv3$.L\eEW@k QXЗG }P+lI~͖c&OKK7R~o~6;7ښ19]REnVyA ə'jw?M!4E|hpJdAd:tuݔӵIGE~;+h{G&`H.BM(7#v  8937ʺ+ ׮M>O!.haleM^rK-J]bZh@EnGQJSހa*[NAH 7ljA%%+@}&!JMNqͶkIʣnTSl2#ٮ7$eԑfH(刹]F8$_ G@YƠ}<8^xSSڇhUr`QSȷ0~*؜L4Sm>.q"^_amY[+"Ut2ڒ\zU"#\Ib&ഈw58"HR^V(*9r& A6ռS?-V-CBBu|ǹ[M{Vq J~&#//`W#75b4|>n^  G&yʮJz,ޭh& J`>`p JTo&/+QOR* M]dd2-v&kd7WQJFQSd c9I,ݍ?ᰖA G6ߵ~&j;_5iaRJf``P,6"'\KWs2cɭDeY6>ЯLYTڠ]ʒ-6Qt  Tm֛sI *hvZA¿/JIڣSa883oRT$x9ۖ!ʤL@^6Q8Gbf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ir?eqgk]Wɇ%5$7"_S`k(ћ0;C,w 8{gLBZ6FK?|*zo/99!>bÍ/iմ I.G0oeoݧ4,&:LfBbkҵeo/P!Gf~L>ܣn'3BKxS#Z.<|E'`L6uٳD{rA$P3yWK{M:WR.7'5^vLyG%{}IP ޣ2H-=NaN?gkv+0A'!9 `H~ĭG<Ĩ :xY.-5$nd2 H J95 P9{]w=+49T u!|BXv#+na M*|+rhTqU-8?g4sr?L Hm!Uv,r*йwF<=P!`WrB?J _>!=Jʜ U rQ]M^/,~u-[syڔΡ嘖]5a=% DHC5I})%+t\܉H6X :>fS^L EW0-\\(WޜnIGrʥ1|ͤ b[2;΂=R .w!ҕ3a kwm&cQZTg7 V!scq;Ro+!ZQ^n+N-zs7w/ұ&}ݦMȭ(GI ˓"tYjɯah0-Fzs?Lݖxr=k0/L@;^\в؟~S; %HUхc?o) 8p[s{<ϪސrILЊ6vz:LxӍΫhjQHv\{f]޻Ґd^dTɽAp~2ާ ?j|&m KU$즃5a-Zo%I߿/xѓbg qQM`mjL\o4K¯g<JĈ$acuy|8ЂVQٺ~Gh@#0h|r14=3, `ow6Ԃk9$Č_ζAԩ0Y!) BLJ6۪i3":c}  J9`"RGJ_ y+4j;LlPq<B}2 ݐyP|@m p4hҟȱerz( xyyX  +ү2#WPǮJ}7`´5SGÁ~HӐ۩3:Ct vl(V[wW#jv]tZӶEZ}6iI`V2ѓDQUn%mQ>,Uy HʱxJVȦ`)]v }+u<]zYYm չ[z911PWl),IGhI4Ŋ1@@>xdKգ^1VD Ei1 7yR 1Xп GJ8^M mDzĀo"vmYVKY(?m9/ 9z=>ٞHߴ2-֩{oX'2Q#b>J 'S z|&LbqC쁸&BvJv=\mqTȐƗARTrn@7lݘpyES`'RT| /b/SB[䯨|ʷc1_>EtJGQJ} DrH*Uђbyhw2Qwn: jcvĬn]. e?ix*ejPʰЩ q?Ƒ|Z SD7ǻ };a N;#z A5<unrv_ve[׎TV928#uo0B}ʎ'-D,~]1:Y#y#kC@C噙,*?owNk!ig{*VU俊LKP,y9MˋqߔcVCS_ۖYU? )fRw-lY$|5AOBEnHF@Hά{&%;1U^,KWJ)W2 )-R ljLV.m {PM5S[3+%NT` Y}c@ZAyY|i#Jq-RA4bn|@Zm2's%$+l1ȀE +C2 ]m;`Lw.zY|!0[q`G߳,ϞQCZv~׶J$F5*oU*^QȋNq5z~F:MOMSӘ33`E?`,OtAfؤl*dxrɐt#a]]q{|XYƟ3 nk<"$q~OQy z?Pq- P1bƸ&EؓN찪A#q`?-5{BW(~%밯ᐒ"#fUt9 ,ΌmX}If93JބdGZل$w8&t]Y{XJn<6fF(o4&x֌Ҽ-m^8 aE8]Njm؂+""$S􌨖L`~[HN# u,Iҕ}=2lc-#@L#Ͳ%T_F f5f&jTeǛT&TxT$v1)5'BWZFsTR *tzb1TRk=s& M|hH˛raz+;W@k/':rصDQcJj|6I޴Poĭ7**ņjRP[ lO|++6mr\ֵe˫#+A?xby/P9ߦNR2#, $D-%+t⸍~D5rȖAV y*h#ۨk$% < 9|1ar>'5EZ˼f@sҶ TxFC^dUSd޼)ZCIP=~^T+S@><?;[L+RSۡ1Z&OſBxsSnѹSe(j5# AA=?X4_U\P0+zeE!drdad`O&'樸]s_bEN0M|[LUy u B1)+$@KD }5?5ȁ7!qʋ;d~Nd~RfA+dM+\?' e$VldGV=[R9pS_:#U؎Q?4l7j\N5̚t2!P~9?IKN~L$t:N:d͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊4 frX~I|E\E Hs(I>Tk¡! :EJQhxۚ3&rhH=#_H6va?)ՅGr~Y4qV](%eq=FeQJ|^=󚻞AJ:f tufљ {2r1ˉ$ɥAuQ[MyF+4?잊1I6!K7W}˃c9-,jI:r?b֕1ٷGeh+II$g-_8$ "|yʿ _u.jǸ~7")$Z{akt R\!()ӓ}rx\ uD@ʟ/Ε->OyU4cvhGR+r@HIe66zA hj~jxL–~\Crنh?oh0JX)P(9Ld!4&7 M(Z:)HI^Rf1?k:H N%Vn**+Ac ZW,y7bc1v\Aߦ@ *f߮uo6f 1&%g5z w;8s#l* $j@PHX4 13(JGP*ZkjeX@Ǜ~ JD<*g82J}]' x#I I (>Eg[(ɿi䄸Y+ʬjw?s5j {H"%-^CW-,*.$L3Ս)MS#z4&Q1M쒨/4Tot\3ΟpX̔ pT ~9kԒx㢩Zix~o1j&ƽ*|OC-GZ˫N) QrC^10]_:iYJ 5!Oդ5/i L>AEmW9䈑"}Too??\%z qaxSWF% )T2Ơm0-qJ>O7?r, 7)6 Ӧt#rmJ/Ϋ囥:Xfqƀ~gf~Q$܋g'sV_|9jbBebOe< "E~|QŤ#HZT. fUaNj{sb%Xؒ܏se^{Y& *ֽl۳r 1bE^zĸY(m]Vb2}]#oq0$5O⽾< ly6+Vz۔#z|LsVy~8v(H v컕~ާn8*O p^ ¤FdX8QO׶Lyw!{e8N($~SEmkOq-\(/`=)O0p(_הT_o4?K?'m_<$?BHXݶ|i :kuگVח6%؜Z&~f䝋}A6#! i@0n*XSh-ц/zq܅aF#rsTÐMbqQFoWQ6Qe̦e0F ’a$Šk^R|_ɑ=N>N̔Z uFg~#Lemk)?Pqd_|1p<^+ _B~y +Tt4rS:DXTE !+N1؟=PÖԯcqJxVmLtN یJCOuU#}"ꅛejHNHmU? 䫀Ib'7Z} @zǘPArZ{חkv傓A׳$%T ɸwCre;V`,JaGPxQbqPjp!NPA{yN 4Giٔ 78(u0$Rb|FH5?Tt=@ouJ-cXe:IoHn FZ$`B7ЭoB\+{!fDe(H4*iyKP*xT1bz#4)E$$S%AѶllۖE=*$*~컆Xfouxd' -BHBӒ4Ȟh-~YѴ[Iu S.L7q! OJ|Op:A$ױm5@cQҔ`t(GUP!PPTTw!Xq!`7UQ64y$uȨgvCOՒ/˴ mتZWs\LQ@E#‡L QIĐ%`F?:/Ӳo҆ۓU(EwfTzr2 ܄ǁ`ICᐟ79Wp3a1!;r~ ;#(8:2({lޝcp~CD[|XS%C*>q%͗F?y JOfI+t%X~ȋKBRKuܨH-Ӊ# Bo}%yF܄kpUhH~`>R Uh PTu!ꆟVy6lH,lذkIKJ #2FJl<ɘ.,? 5IF9_k~N>ܰ!X-jR\hsHOsCᓊV т{P;_YbF>G#&س_-\4qKT?0i:|n"(r ;7z1#ɮ}yîLlTڽ2[9jevŭ7UnN#qHJ5I'EdF&y,3qQOq9Q.[eap1 8Y'-ECT˜$ |U hME6IТ*G^õ2,^dn ԩ޸%UK  JGfeBB_\Qބ{4kG%u*vg X$Ǜ;iÇA_+Fޞ,&{olPUOw5Ν hj qq$^Ib z8yUzW.T-.6vyP~xEOSkӜ#G vjq-enӐ@rTБ$&WAlՅId9= %މqKJO, n\'-f7rrzLivHRo\0L#VsJ㌸F0%[:+HYeZTvcM?H"'gYަ曏lڀnSɚH?tzW3f}'|~*P( lh :-I;SaC& f7 ^T$0V-1 @XGXǚгT 0ۿ\N?&}e]Yz+4m]v2Q`M]̈́1?4߆籠&xA$^}r赥H@ 0_;J}2RG #yFjQC?- ߓMZ{SgV5|r}Y!GzO!XZ J4e@TUwjWɀ5zWN H;# RF_uɄGbhF7b*{RxՏ*)ZA/:KثW"y_,K[<儥om\O.sEgFJNY0]JcCJO\f&`+ebB/,GVq#|PBY U[<89 df+rkR|Jʊi}H5yTF{e\B);4&F au:MDZjʵ ::-j8P c纜72m_f eʖ$|1ث}M"hjn7`d%ҀUU;5>aOkW ;ҟ ":TypR+f m$uo$tևoyԀOCi/TG.TT}hWbjlk&`6ր*<6yNđ^F[Z9mH+^Ƨ"NLSO2~?iɀAmm ū_ $+S(थ(=h@2SD y[4QS|BF,N)4*WL`"b@#ySf w Hn>LarX|-cfA%WZAx\+uhNğq/&eT`G>uڴo J4[KJvmU3Ezu"A+VAʏ6ѤS]q Q̃2]ǛLGљB66DbR2AA>92 r_^ RX!wHȠ.7EYRI4ڔVqA $!ӨGɵ1W&[JwuJe$Cw26>}@U&i?q_ (Ff]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊WIȀHzT` Y/Kb% 5;YMss nG V=Jg5";d$Dz8 covZkA-9`6MzG1F@GSW\~lבnAI~췾E4Cklfd [n"Q_s'D7.^Y٘^o+(4=3oN04fKxAۭ+MH y&NiEZ7|gts;Ge*$~T%ƥj\Zr ܿo**J+=M=b-Ʋze~JnmX }-V=hTM>mM#u`jGz`G~z~W6HuPvvzAa" `j Ftv<$c,(<|0&&RW[xп@1ٜFߠ [U)a@%g#9 /CTvb]VWBJZSCo4 ĴcVZS?o:VI]:-_r@#sO-+Wjv HUyf*/QWY2T-$*Ehzq]gYn 3ũCZ|9ʤQR0ZLFK;}ڿ q%Kƥ31T=D&+'' ^"vI9SZ@W6Z?y]P&P} 65͓̪ȎxE3*-'4& ,=s+ґiV+;Jue2G+=`p&o6 * _|)ܳ%Бlv|,['9v gCM0/Jnuo.QP*vS_5{J5àƤmAqXZ+^wg3SJ(J,QxF_g%_+/e4O'kgrnJr[p<m4BeuZ3M8 f_%=aqʊ.P&/lO:+]#8ދĪa>"~kaU2rTӹQM*+A zl $R?:͎l ? Cj>vTYoы)w$useSϧlR)!Y:ue_ owtV.UT3 HЅr-UBKH⇒?c ;],vPI$kᅌJӑ#!jf>CㅁTCqf;3Jy:n>Jӏ݇Sy[4P׶F. $jwRQ9p ʣ }KN<%HVz8|搵8RZg# .ZN&`(]vZmNYW>3E?R?#9ݟ P{K|`v;$ CYH9V\Vq^Ƶ!%j:e80v& E;z R#TTAR{IFu\)hrQ0Nȗ } E(?ವI ۱&Bzj=a(]A ոzӑ-vXXiZvǒ"S,;-H!܍%n_cJON)Ht)׳dkψfKJ|U ,(G ?9Nk{*TWƛ6 S 8dy.m2){ JiҹP7ג$3F+HPhp g "*A#K?HՄ!C9@çmщ1 HZB0v"-#>7ai$yGFyVKɢdz O+\)WV@+ԩ?zdBh"bʸYTrQ'M\[kW4-ݍ0nB#}27Zo|rR}VOYU*~gfRD#j(;h*3 oȓfI6h*C` /eX=* ꆽrգlΒuE: V#`AW_wcg fH,PPi-zm*fbyݤ"RF|G1+ZVOMv|8^p@ZP,xOyU5~VCx5+(sH>$ )^+YcP=2rej 4 6',`g*xȴrU]B=E+zov;}(Wm. z&e0tssį@Z9PXGdz)2K|Pw+rcsfR!i{@*/ˢ!cw3[Vʚng8QFh+W$RB"i)cPSϖ(5Rkץ26JWV$U+@+Rwr%uӕ)i>yo-6syf8⾐*Ђ~US_NV&q ,\e33Ti+nb6/E%Gco$xJ懜{+Sy֤)R6?!MgXJXwn :mix1MONkm o $=HQ5mW" #Ȧ4cGq85Hۏli+a~<)kG4U$ ң2 i #=QT:pA ø%x6OÐ('~]XZ*I 4<Ѩ"s*Eqf4W To(0JЭ̩pc& ĭ%]N*\^7 ݐ%~tDy]1Owv/xrh;Ѳ6^14#u>ʼn+~6>4Yҭ p)Dz#'#w Y\V~qHxџ_*Y s~[h$JPdoӮ6ۜS .]|?*H uWR࡯_64,Ͷ5,}7d93B2mV0*>,#6a~f8z\3R?L1,TJxhn$fU8Y"Zju1gD#Ur3(?}PYdeq+ī!ε/Q=H#ɾ #`@'rx:R܂䮿l/MoRQATp@5ɂkG0b&Q_rAE|Tծ`J0s akc>* j]]h}X?PVW$2ۗ;m|p)ǭ9_sk"H}н6r,6g:1mCJm uPV`~ّ0F#bBr6lz{1xF̧d6'r0YPtn@~ qɞL$C" _:\҇4<Z`d{U:,W@>*|i0־6lW/,E=lj5jWԍwK0weKc^ߗH+e\# x6KHڴU mf[[h,`rvREM:2) 8~)=ʦHF1y4Kߑ&QEFLsLZo,|,Tz G5pN+VH ;2D O$j/T\K<(Ȗ=RrjX0 0c5n$z}q4v->OLHB RK|*A߯Cƚ& YMIATPF_wL(?Z@*JTSPVAZ~5éo !R`wʙS6ޣ*֏%.- a_ԵoU~㕖A7T-~g#n6dYkF,ZCJo%QxЏג}) 5J iK'|Y'\%ќ Fzt2a.lIb^"Ub͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊%V}B ,p.nI-.0In-6#; 5"f; ydi_usQ=OAh㲆/2,JB;dŽKsO:SfTV<7t^jʞd`K2s/FkNӃqf n~U lܺ*z*H˔JU/GRr1 Wbkf1+NJ\mݨG6!dw*G3"ăq~f1fV&}r jZ.'o >b`%4ۘB21v" -I(i*2aܨQ!g;I.(u<H(d_ǫ1ǢvTw @[vd*UV`+Ȁk?;ح.XjLJ AΆ$VT^JNM?<~,\~hl3$VrʋHnt)יybܾdO"C2/}N د޼q~3\y8Ńpd x;|X.H,hҵSj1XLQ4S4jb Tx9VK;W*DR}1?ֽsY:rGA }-ԞIʧ8+5Vy=%T?|]-}.fb@i =R 4: Fzcڭv|h 4l跓 o%^@M}dkn]KfB*#w a4@Mf̭(RtQ(g^lͳYiu&Aw897cxVڭ-Vs+= ŬzKO_s^-mljen?lQ{&E{Ń%x>LtFB٪pgWƦ)eV, `{_eJjkJKC_m/2Si1Z~G߂f1 P~[PйӮp00uSȩH0Al޽m)_nI n=NdlWs/9-Wzd)\vR~X`= k0i)Nj)M[#>q گVy gJ?-uH >(<-۵·(SBdɦq22aXf`) .rJ;vŋd6RzoVrI~ Ĭuz/@1ۯ .\A9 ORy]Er_qfʚ|'.kWC|($PJ5lQ^2ubM/ 4X÷"H4?.rRP* v( QY+cUxd*I5Rkp)챮#L16?#դxuĢ-SxTd@7+LP>$aJ :t`rR9Vi+jbĥ4`Ӯ ;Vo\R!*A!x: b6V$C zDTnLmg~[?@Fޟo-uYK/Nd~"swTUBk2U1Cc#~W.\՝n TЏ!n+CJrJ&ZTi̸v(oQ^ q;F58H@ "RI+Q ,v!TJ-S_ (WRH$ I=r߯2O$t܂v̐N9kZ$(1GBB~8UPz%jj(iea7mLRA~9鱝z!Ev I9$`bz7RzwKChB$wܗIa+bn ;5tnһҧ, …_'7I-D\<+ԧ?re"1n9ءB(I$n)qVW zJ}T1ޅYJq ԞAE*R zҜ‡b DDSt"YKI+b8 $.YГ'isǭ눩 Fkh T)gOpr`B Weɘ_]BK !֠ݏ ) X d:rz &Q֠ʳ<@‚~@܉JK1va~Vi$FfY:k ~Sz+| ' Zob|fWx`m!dݫZTނJ7ѕaB Fcn!49(#?+dFgkIMp3UVj6WR>ҙz8j8:֔qHPGNO%FZ 6>#!neS!Cq;/X~Z yy Zz4-?9p(n~yE@[ܜ ~ o*eQzl++H [̓W| Iu\I6 ` o*Xyx۞0-p-b|C' 6FَJR {V퐔RveugIN1?urrRț*US4x|%p-/zVɕHRƥ0)SQEN f&aFGz8DI'GshM\zDFVA)MK@$?>I'D`1*Uc楄U%HT+͆h^I S2S^;dL Ȣ܊EU.=+YjG|1Mp/nzҹ[q?e`vd = ZeBY@ZLQ+pE!ǩ韉7ϙ->=k$-g*@Vm)rauc1 gh~?,. [gB=$Ī=rLDZ]ޤNJ sмQ#WjP/V2QTP$+-24z@UvrP1BHGb$z 4W*XTשTS&ά˒9vu ڴHեW) yBJdoL(Hʇ&Xbj}Uj+SUڼAF'ڇ+s+XS(SUN:̏{`) N=*O\U-}4zP &% ujswzcD؟Ն^DoFezmT?|'1mW&L&R*_o2) >7PX ac"%IhGdCs5VP(T1CO|uq$V# 7^4?lT- E D=E|l3c ?ֿ 6[䒡k_s&Kx]|`PAj҄b.r/$?C VA4VȖA7wBFEY<nan'% V|̸bhYv?Ol-ם.2L&[pLA5ZV;keY͚TlPvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊:WU1MsO \k2svl=$̫R;e*"rulGeKDï$ocWԀ㪖4%s'S쟉NHzMT]>$~]7)ͥά($;,?Yμ4ژf(|j=ٰÆ/;7$ۖȹ@>*֣e(S$~GM@/y)[!vZAjrR^=iLDgeݑHrO4=)uiT|.zv,$D,܇+f X_g%[2Z@ݏ' |du!x 4ZÃ͜Ii5Itɵ->)p<¿Ĭ_s_ޗJugh ђ`+)بiHz ; W`oNF]̈jlA*: rc7݉hdgs *FҬ̓ 6u/ܝyMZtS0i:^i:DQor^_V,]D[1KB trqTr'pnsSG Vq i=\k^;,A/$oMpK ?<|_c6#c6܋4_X>I/AC/,,ɥ\(QY39,r>m#I (jfêg0t#zgQӭ3~>eH!O߇^[b,㗒AM[ΝΛYp9;)n{JFYc,y+\?'*MWzy >`tVC"$3 1CI[*Sn^y/ Eʡ'nm+rě[Y(H a$3Eߑ`u5ud9>3R _NGix|I)IA)Jf0*EkSco 0KH 5fCvy|^kX=Iq"č)m) Vz8"dC*FO?,VwUAsɔ_]a4{\Xl梣 [x꿺 H46?.jsP~7ߖめQ$6orA[x?Xz'j\PtcG\1$SK+5%J$NDS6j3ѽyG j}ټnmEA;`SqI/:2#QQOiL[*GuH#I'&XX'(nOW 0D(r|xi^)BXǩ9 moL|bBi  zQv,|9Yk$l*-Q ~3KͼZr3Pi>ym}I-%R P=@Ѳ#ʜJE{fgW6v)o%b}&%D4#_%iR4=iLqH Ƌ 5F%f$t-({#ߘˤ$ \r`/KVPf24nW9yn>6?oo3ty:BD4nI#㝞@BFǛG%Ϟ{dA_B=6?2c3[q3'ߵ &B l@^0oF>(ŭ̷ʭ/Rh[0<|JH06 n z)z  _y[bUĥSht| S8f cP #U5ݢ+< g2H\[n3wRUTL2VQA1IMqbz0& FmKMH\Fx`Ŗ PzUR)ΆAnЎN؝Hn#I!d1{6(r zadKnU~ˎ;t% M>rI]n$eY(+ ~L‚Cb~_@|2JGr-+a"iX= @ABqkaAA FG(CXݶE9O }+6'@*Bzn)Prʒ:ȧ%]uU( T31Sjvބl=dDedH(WmBIDEn=1NxFBi i%>y04+i[J\YƥUQn1)24%[˖ONX7,gQF>Ȗ>Pj o^@=vqDMӐKMF*Wn}~k2dR豖=>]p[2}4?*m^k8^B& TzF ^~tn>UTzA1rwI|'>r+WZ|;?jBHgj{S"U.a 8ƕ u5cef #B(5j .2_޹49A٠p(Q?ya'݌@yyGF<[2c/X}ƣ$ZZ #.䢞l1XDF8jm|lK _E*L)YH ۇ..4dFuљkƴګ E$ >m<Ӹېcj`ɾ|XJ9!Q v޵ڔɊE@LFSӭk%\<ц +} "£KY}MC">bG8ZJ4>6&#ɡn zQ+}D^~Ñ9ia ^66PȲ(22xehq̿?ʙN vdycSAPAs"dIf2 iѱbVPzBjLZ񳣗SEu$XUQMAQ x )\eGb)1=p#؃ʍ̧0~#C2;Wڇ$9 KY""Iv%Wje㒱hw wn$l)Uy!-S:5w\Rd"/[r,BMљPAOYn#r [焲'M)^@ GH\8}yňɻ!iD2Sb;bb1,JSp߳W hT\L$I!5E`FV ݋)ٖa$o_b27 5ܳĎiY* Z|uGFH8u45l qXoW SgL5|h+ڔd~b% ) }`O Ŏt\ĩ\!yVB6oUz.=ڭ_Ԑ[P6 EXHd BP&eL"'KEV-o qlZQ wCOB̨zri-mL/_(R Q%OF]lBC @Xȧ(ۑ%$T*oJ<=}=:V@ c;(DrQ8wTx.5ⅫDh}鑑o蕫M[΄I#Ȣܔ {.2X*"j<{Z٩ z`Pxee)Us#>=)YjayCdC\ODqH sд 6-?;01'C:%i^7\*? zhȰFpaIUdPx&ؗ Y+ƟH_Dz\"%gF*(*d4qci|2;4cU*<Ƕ͖#|'U.[= :JuG=,@5_燪G&/+y5*F f\3p\9HvٔZ"aD;+]bP E\{x:M%zDSzn_EMڧP|YI棒3˦D#vrҿZLTgNJΈŊ!+P$-$^J==>*̸j!@)[8Biq#Aw=NJhC-v1E PΡj IJ,"zguOf9$q7Fzo^FVvgmper =X@Aڤ5, l+fXDdʫb9Ж&(rqaps@ PUb~փhUnnM+]0 5@Sds@&zW(4_5-GM<"AroB2һdi]BB 6=@vn]RG("ɓ*P2"Xl!E>x_4<2eQzQSskVsbYc (U͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊;WcR$j[Zq;M@%=f ?woszܰQP681gQFsL(Qm`!!_^cr8A&X$ۓЫk#ٻ\!KDQ DUPp$r+FT'c_^§Y^yTƄ%TSJ':#tX覾0ԍH9R Iۚ=/_Ŗvf%L+BOI4 eS~([@әl)S9!WZM( .JEj*M0i2eu'd~waI/ϭtE`=V9=C`µY2P1Yvix;ҕK@VFf,$?Ka^@PZŽp"[RD ~_+#'_>ŘH`i=OKNrkT+ OΟ~ta^ q OeVr4UbEpmeCz-(˸$-g9雑kH F}Z| F^& 7"98#U<(Xx;!'a? DndcY%yz/,N.cQrg ¼ (;g/"" _O7;_ޑHB1jSi;ql+q5IU>Q0Y>ь2II ݾKB54Ƶ뇼1g$: kNskm.MJ|yX:miS"քS55Zn8vD^B!5iWI͒D!/ ȝ@_ ?ov`v٩ߏx-Zc`#4 N?U,+|7XN$=Z ?}5H$(8 ƈ'g;WMd- ܎/DDIïl8'^Yb8 Ҙ瓯["GFv/~\]ބRm~/$ ʲƫQ/-䎑rxb GfعzkFR9c#H`1 \IbA2k_?M8URNՑڴPE)Fo%E(q% .k/rAc.J \wr.ᧆr+NA ]j]O`"N! Gg_ҵ'rsn,[arW$fF*DwZ??vh't%[+t~ $k0J0kSe32T#׌db~!OXSw%VM> ?2"sQ~ɧj?s0/kRg盌 *i (c,Gu4o\J{7 j% }A/xߠ8r.Gj s4Pļ}g m44JZ UXF:AY4d:1 Yƕ?gm~]䊱4 tsoR[mєLޞEb@%#TP㝽bgQbNQδ7-.ѯ&s,Hi.fjЏ_,zNծXBLz|٤SY쾦UJƾtIʛHc/CNbpCU~%?coQ ȅME׎qbi 'QڢNtq0S5Z]BT(UPGY"~; 2q ߪƇ}8zB@7429wii^-t3 PHpg0'~& 1AkzVÐ&Rv倱cpI'7jA>lb+Jn0KtL Jl ^4U(I+&7Eh $h @h? k4A!#цRy2Rzz=AQ4$LOW`+ئdNI/Z Zi8IB]"?эz`Y@#Ta,鏫D+qXXN L1Lmb[=w ׮s͞=U˃|X:2̬"|#Kk)"2|zDA0|A*BrBi}XAeM4=FCqRiPolZ!ɍ@-8)b\z8~Pp&L~2fiUj9;qgva=m`HpPS#w!&fR 6cl|ʣ޸<_idJ޹$uRzЫ 0톾TxX;̈́'ecI|[ dحO,q`1Z0jcY"hM]M%k87SC>=+1|W#/S(["إ%2OZA>%ʤ[ލop 0Zkᎀ,d 5fU7(PR0DzRq۟zH+hm}x}0M)Ɔd`Аw/(#3/ װߟQbxZ3ȴV=Ldw^*im1}IЩJGTE|ML0 ԫ{'3QsJdbk5CՃb8(B{S-V< X 9T+2pՅ^5ȔܲztF j( |U~(һ"jU 5yzos^wz)V v|  X@U?~JÀ7wG$̳Ԇ?OӒBJp,RfvO`9q"F8͈l/E@Ct @āĪ9D'2 ҥ{.~a%0_9צHM#IN7aHN!m z Bjs,E#zȽt@Z8BIRDh*V$ۆ )C kⅼ* i_ձc:!=7;{dJ lCo(OZRQSMn$ 6>=' AZ~ƶey"OR*:~ρĴ( [TvS+%c@'[&q' VdG yHH{RDJHv-yVIˇ OA ba EǦHC|v4VP# >:eL& SV{vpx"Z\f"w-MRP+FZ\F'ZԱЏzmI&@D5떉l+i?$Ϧ3T$2 )犕"(*ǛMN*cM"q>#VbDZڢ\y(6a%E3-/(F,6 fUb"B[>:T*OKvLd1jP͐YUeDcNv[ey)Q7rΖfJSjYxy֦9Ѩܱ4GH3*9e^ jbz8; %U[.B,[_5ƙTٷ]-v}O$}*JN~!TS_SO2a*T#rEY{׈E٤P:Hҥ(rD ;JO_WvBzSlSwc\}BkڅSkzng?zlz=41 5iIpڎn dBk ;2'va_qɌMqhv4jdCP?2,cymv5xK8~6b7UMT^7k[5܂(W7ЋL)^Ei<$\I(-)#fV=NO|IU'w9(7vތfuCOIQ'];|\>pps#AH2ëh!%߁}ϟLyĩY WD !umO;PhEpU'`5cz8IY %ن3\}V>oøΈ:g0lΫُKM\jNƛIP!NIg;T7ADrEZZ~WW-n"=NYԁeBJw) |?" ŸY)&CrEq}oSq& }3_6݂QĬV7Ck 6TO?`r9,*zslA(D,vytmc)Џ_ Mnc 'QQ+bc` Ҋxpگ`Huɏ3zNeQVWØϥlPQ9b?k:L0. h"B$EV*5;`ϭ)sόʫHztZr8\??]b 2֩({:D)1 ~>\9~H_:%3ZªiǯO.c* tRbkROm9CsH7-fr %]lx G_liqtǩ7e7zժEFۍwXnsU`tq$nF2K4rL钄[z}E_/+[ޝK 7.T'2!fOI* Wg24׳DiE޽4=ŷd HqAYI)jQOy>hg=4NZ ZPh{`xM4j@I(+/gFK"#J Ɵ#ZT I C)ui)5)3.R )թUiH_n#!t`{gF)^н[(z $(܌5ꂊy u]Am |èJn-.Ʉt IQ-uV4ST?NI:/ZT}9Ow;_aV"〥G26Z +GF)pkY$t*IkZK<v5? 9TGԌ7]~Yd6UVB@ڙ9ׇIfa+A̖ᒴ;WVdwms9 78Z?QQWemJFΨH?oL|q C ^J[ S-#:;qG쾩}VEٗ5̲.ݛbP#;<'r?!RQCbpt:>fp@QN9bZrUh,S[ ź^8iF*!(Y P7yF)#BĦAĻS~匁wjNXIJq<Oļ#^vCtBPQ@;dT 7G ,q])`Q؏MUTS:%C^HȀ!ϵܸ cBzlI*qI \G^ CoxI#n%/i:,2('3'Caoq ྡྷwr4ȶk JSuV y` (A%`R;}#47E(܅{50ȓSƄS丨~@Qndy8nnu(xѷ;>.!Th@ĶRĜ(Ӱ\2Ae#jG}C ,LMO$l MqY$E4rP7*So& SZ)׷^:G+UJz|0KR0(;S`~@*4ʻQӶNem(z_y.bJ%6W~ȧx S~1?yQ?o΁gZӾ baRwnɪz媔ZʍBT;Y;|%( +BO BJ|KWBxZQ\\)-F"Yklѭ a Ԑ*>G$pڴ>lL\Ȕű:`X}I^ ~i @OW1ß{sHĄ]ru  e'!7<X3}FXC}-Hಶgdym HJmU̺R , ;FjU@I~t qE,I>SQ G*|-d1FsWSҿ z|z-dbT &<`N T4g|EV#wEZP7CubE$T@vzYZLn:R]@VzQYq3*<_WŒRq)[}J6H2 $@0;b9؝{'zNߘn}=A5d.cCZN QX֣nV,cDVUjjN*qbT]ko/9.l(k1jq>%pn{tH=DMr^6=8&7fM]5HH'-W6PtZR}ukϱsA <ƵyQ*FhPE֢Ȇy;8 @T ON%Bo4ˏV ƣf`>m%GTB9=24 dd}|):rN@<_cį y= ~2?FK@P y`.xFXju=աR'!ecy a%B(Ԡű,|J/2$v핥F0bRTjoyK ӮM&~T(%j¡Q܏z|C>-I^wh9j|)Z^J|YlV">rskq R7o;Dbwۦ_&:% M;|b.J&g-NDA \ [1ۨ͵y}yE'jM.i٠= G ͫ,`Tq~F轼pD֫A܆s+TjqToһέYej)߈U<kPLE'F2O5)W`?d3ۅ~WG*NA\ߑʘrXX0 A*#܍ХA %QeҸrc'ɞ F6CyT'Ȁᗫvi\*+~$޲u%Ma}j"SQ &qEcC|JjP72hPW XD29= @tQjq]`ד:$r,¤ӻvwKi$V֑:4u$ԧZ}`O4)k +se w-O敕ZoR͝ALZ͙'2 ҕS&;W!$ TSG6 wp"kb?V9"chrŊ1*yZTѿ]rt<\z)zr^KCsp U2B2 _F/2]Hʋm2]\e!f^:佞h)2"6j/>eO5EOr 0D$|=1J=(ֵ ۙ7""Y9eTZP)e1=~$a~=y-?a&{!Z o9y&e~dv,S *KRS ~C%,xM fB@ȕZm? jKdTUBPe,|6gQtr}HOOr! &d7pGKHv^Xm0O6tb*!n?ȱD K1keC^S35s)?VYFsxHeUlݜy= % ߉8 i b0QM[L<aߓ _c$ͮc'z|9%SNdPd+^E(sNૌƀmvgBmlo%7P=Mx`LPmX; +RobE}+` .޴"֞w䥥p#9$oesOi!tD *ԑPƣ5]ʀ|+SRkr![!/Z XHJeV(MZ5O FVɘ?.1ç3!d{ɼISvOY=^wy!_ݹzod\d|@ |'!&Ib͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbÏ)[}cSzpӧ+j%NJaBƕڔt9ZcG"2S?k ÿJ\Q6>"GEW1-C m6MEэݭ+44*M*?+:M!X}\q?9xPWƘV "MP򉛈LoԟJ"ΦE!Fs8 XVwɮ*@Y x\!yɿAKOU[5M;$VzȐN9v΃-fY]  E7(%%1ޞ^s9HR%PJyK+9cIFѲfzU2iSo<Ȩc_Pʭ~o,_#6QF},w0H1Xv.&a&F<}=:89ׯ  ?YOAckD9HanE!djhR97Oʨ_͘5G?NR2y7VkA aUBܠF<\3ŀW+'?ƦS+r7k"hC++~n7WZ|;l#3^8 :$z-%c-~}CȕrǦ֣@JSAxOBj7(ww9,֢ c+%t4x<8{J _OѽE<^-^a1 ?UًEZJw_wY#\PqPLNz+ !DLA#䮼IO\#mi6Ky-W =I <Щ.G6d3:gh(@1Ɇ\+(fo9xZ6ߍn:SwDi! ȩ53?^9Rva48xxoğY+3EmTuUg9 g(5 9u\I^d׎dMytj(CPWz˛y)+BPoO rIFxX$7?NatL~jZdQ{s Ǩ mgXFQq-ۇdkc%@9 |8=;a.rHn42@ZXP}LznC*y~0lJۥ }d2pi9e~\;rVwe]ya6'%wo7Z)^7I$Q-;HV-W4eRhz]zXczRYA2v [)%4?^IsQ/"E]Z?\&veU䆡;)t]/%yW$"fc^[lKfH ^\O˟S)5n& Nc0u;of@yp+ҕfh7c~bEd%sEAyё'#PN EbS]77pCfHSFd HFQJ+TSδOć>{8Re8=Bw6b2N40H!- A|ro_UyOG謫I<!iN%'`PmK\QEoVd$UgJ3(އ&X!4qUvރ!.#z7 ?HWI+>;cMz`*dDDݖz_϶R(řR˓Լ5UR?' n0]sHֵ{"wMcBqdkDfWyS *9T~;dWMh׈VL 'RXG:;dTۗ%oɱ ngܡVQQjFXo9aFL3rWk%;P"XʃCWT~9&@Ef*?hTK|}kP_b5#q -Rb~pfJ?G+MZ q` M8҇剉 ,lRrAZx jT֣o[qPE;r g),bM/CِM~FFE(xT~c,Vm\ ILMsR Ɵ CpP즫_ \$Zj4_dBH \O' Ƞ`Y|o\:nm 5c^A:@C}x&'{yR{|>bm8%;^re CrЗ#uz_{bj8Ȯ5%h**}M9jlkMo((b:YacCi$~ת)b9/v}tHY*~5Mu Ң[̝iAO媔^J B\jwlcIpXo lF%?w@b95ԋ#¾7?dc++>QLKdyV:G0ȐQj6Kݲ=H8iUo&[代'Eqc1M&.WW*ezg e4kSO$ZJ^ut$yBUM6ۋ|9 |U lDN#yu?17M^"VւUe.**Lאb|AȶaQ0_zxP`912I5t]SY%䎪w,ͦ߯$J|=(yZ\BDBO@I_D֕=kઢA$0e*B*Fe9Ť[,mW6Ƚ·E>c%^F*:ݐ,eE7?14䕣**(?ߖXR҆;79j`uIzJedPUW#,\s,RM(H%tAi!d M 0d ՚".~UKK;},")Ōm*vWur@I$O:}UV +ִ|k//9:RD/.D ޽rЗ4# P4;w2ۛC@懧lK^Q~^KP{*b  w=: b"FwtwVgvU?Xl'D(.% :aذ_=@cI8q`}.ˆ)w`|NLR)UAbAS"7C) ^LvnSh.$^֨ێU{IbPպ!'ʄ5ʕ(I޴ȡFJe O'y[ce /Lc1Ԛd5tHnh LZ&lpaQUB zWF5{0Ͱ= ˆ"U5pC2*ȢLkj6`rxBBNAj5LX!- HO7;tяrw$)2ݑhU-TcJRrRY2O)T1Z I"vR6'1mzpIAD`-g5 +}$zrsՍ>/mL)JH9}n|%?,)ֿE?B2OS`*IkǦDs`ż!0!K|#A :XnVڙ.Metعj7'*Հ‡޹]r-!T'c,;ZW |صjmBrNށ԰f-"Nh>q͌WG7 3*kdX#C^\Z'Unh+b\bEӎ(WnG#&=/(y elS,ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbɧm$x혺T]fBOX'UW M-He})fLlEqfzQ+,ĈB( }k|33=!u8Ձ`[pv=H†0Bo]{C.\} |趋2Ij#}A?U-M$Srj:7ݜDR2 bh͔eǷNOo͔\9bStI)=?w|sYӽэ]!!{ugOZܣ- np܎+?o\ӎT!&PcaFANN#A r8~r|^ecmE%sH$BAgQ4o__AcW97aU '-|^lӥ/n$ ̮"_@O_~n~3WM'L6 4Ɋ SbC>j2=!"G54Pj.? #1먤Ï*'R}>_|YLj ȟE:z-(IbiϷF"h8Oz|{' 0$&H;#oMk39-9[;#4f9r?mp J9SfIMڧӆS[Ao/` ңPrۂXw$7泇?hOF=X-Za 7_6;.M%MV58I(P$J ~%+X@ c+B{78]\eU&=WS~O՛+M~I 9"So p]az@ήMڞ9 4ȥ Oj^i;?J8QL2P jW%sېx¶q}VҸ*H}_+:'}H$vEœ %4HPr~) RY X`Gʫ_NM W Y O/odJڵH?T}c; ig 0JVg,dje%&ҿFCn` mcc0E19j}u'`ჼrjI)JT#;9cYF{v*wV`BrLJ=I*Њ/^yXU8ksm,ORI'kࢬ8(¼}6y\b XFF O ?ns/PjerŽkl>u<ӭ=,bJNy"!d!l,05įn,3RZ—MLj?y8_kR۟$I&fߑE~.$2Dq N\n?k7^~VQĕ)/m U /erm4&h?`k|W|~g٪qaOkk6)lC O/<@I*k־5ȶ ^9' -K#nkŴ1o%RG2Ȳ}I\H0 94r/٧;=LATr?LSV].BznA#cHQr"c[dF ]-GLJߍ@jut΄?"\3OeO\~3Qi8űkInC%B78:H;:q-:/s\RB$#=g5+6 (+ ^M6gWXčt08#`΢%6FH>YfNOmv *Օhs+ dNOUPK'UYAjC|K|4,h}ϖ`fEՀ;_`h($^M˚|*<2Xf[i]Q[-JԣPa07"H(I<֣qC0Y)_n)ㄲChk)X5r[v\ %e+O42 ը+Jm"Ǫ+R^v<O!sVat.h>;֠\|q*G(w0֧a)V'#xb`#I^UTӿ,in]>vFu1K{iz،L'ਐG^_KOUՀ>WQ@aZu{z|¡DyPO95kZ15% J Įa$p4erk፲DL+U̬/z!n#NR3rc1&&=ֿN!Xso24~rW!HFi:#<.Z $doL}G*A7 qlk7{$>lZ+ol!0Mem@0(HP*w uC8_E 5~~/׭M!NLo65;@1ڥw#bafZkgW#zT\-$J>%&$;~OT= )#':${8YwÀSדIa^ѩ,Oݷ,K2u&k-T1btj'v_ uF҄66C$jjFsNF,"6x6 UVph Uefwو'[KA{AETWTb$Wϑ[n}G:f' spQHď+,4m/ׁ ,8ӥ@佉)$8V{dTzNJ :ڎ2jc р] M蠭~$@.{EώoQe j<)CF˄ $EGVCy|@;{W#JYGQh(BWKѭKv;|?IB'[eTو#o$6*i~2a$.3d_kH꼾 z>() iƇQ$hI 5aJAvQS$o풺bAWP{H9.*;bd # 4r`xU9֟szǓ厢 :dQ;ȥT1:!VWHV&.liMC,q)O ˺q VZb2ݙ7%qo980!"ã>4e)YGݐH]ԟ;7AY. J iorCE d}ć$~0~݁`+Ēvn<l~ œPĵz ©*OkKu޹p[K V((f?RÕ'mE bhE_re5ڢ $G`ӿ{洌8O6q=/QjM 9.êJlG6 /ΈecBRakROY"%-Ê8*yJSBR8RjI=7Zӄ#ں1[ZQ:㕅8끐i^.iM]p1y9~]rz?!ğ:H `'@,ε u4BNơi Po@)6u#3WoČ{2,Mw=2@B#e`-6(NGLٳg.WAu jaT딆lB'kBw2r' ӢYuQL0ơz}9"<-%@m-lcѫI 9(n(zM)֛fLb%F^@Ҡ ,d]քxw P`~@741P#fa>!"5WA#.uKƂN5^Tdy5|؋FQ?vz@BvϒbO4sq1{VNRTԅvd _pls/"X1%ϯɰ0h$m- VeT$5N[lte٩U~\m#H֤9T޾om94j?w-zjq-)ӯ%@VՉ׭)LWD; ݿ<1v/V&V\ƘD8ƵR:* <huDG#_zB#"B/~VnX_ WP6V>,?8QQ %|_<{$}Nv42.(0{R4]E $N˜Gܟ\7t+ \n%me![pNZ6rMs MN{|=Y|6o|U#\ۦ?Pہӡ<#?V ra'lgʿ#[6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb΃U!r$|Ө[՟K.ZD+J׿jzqhRx96vlz]*9`M6_L @`G5|Ojy6萚+'\1*I ;$)i&&j:vfvl/"l6?Y爈Kd;* 8t~?ظZer)'g'WRPvo ƛS.=G1&*t/KXkȫjR߅?X./E7ZgIPAɿ҈b'p>y_sNMsX3ܗf8 cF~faH~$qn*@QG爚moLȪ܅JS˰NV.(2=U$YM<(i+9Ge o7p.#dj{S3A}|0پ%6W_frƆ2_G"'1 j1DZHcP 8r(k9lܑΐ/:S5LnbG CVH1mbGtPOr[J!ZU>ߋ*idr}N#Cy^^332,P2G* $-6s;~=.ҐQ]Ejo**XȼcSU+?IRxE@SOY>U%Tt,˴{duѲ>͏T'9-P*8 H9n(@$-Z)g>G"fS;ŏ݈VW dܩ|nYXm8J~_9rd4U&5qc Ae,2SCE?9qQb7W?d9nԩɦ+٭~YfahUA;zҽsyNT;T &T+aNĊ`2ٕ5уF}͙z#r%S_.Kx|{pk'6(W \L=(0o~.,?RkRX{s"0pxAZVO,gރM x+Ŷ KPdA+P: ʿg)¬rR:o{WpX[N҇4v&asmm4vӐ~Dn_m"8y1Ғx<L$0I-9#>keo578E2G5!:30JD*H摣 #/$d\RXA,k88!-y/O4h#s569u1k1!foޟy7M%ڻ lWયSJ<ߤ;2ުʢ@(imZm*b F*j^f:f/\w~:8ӕo%\)w\qW0k؎Blp4`CqM-C&h(2wuFҕ;Mz%5J4xZ΀l1U'?v?dE(( #<`ŗ )‡RǒB$xW#vK&+ʜz퀱yqLrk+tki ?>2> `qh!>aH[?/MJ4@m_&Ƭj~ᖄ[QSF2mNeX +S$I#j햲\S뱭=!?X5$aəid'(Y(TToif6%@zӮEz=6*;!a$S`+BSuF$iCCO1CJS,)^ QPYRqNiB.3B#AF8/(4+FZ7C<xe~ DE,ȲGKu5Sʵ}i@wLA[VM>İt$n+lmНM"9c>qeKB~96nPe,> d+xSe}UD\5QC{p.nZ L%0[UԨ5 W#ePN4ฌUtS, ,ph+zvMJ%XFT "BUP!Q%, L9zr1l!F \ťXֲ,Bqh W5 9W|,@y+8nِ,6HaŖ3CSpA*zU(DVV N]1 VvW*"6RrwqW81ˉg{>*,'7n8j!So@w!Wn޾S$ߣN<4{H"Ou xwg[fnҴ#F6yj+"Bc-:dW# y#<$9]ǠrIJ\c#D0ŭKz& i >z4iס?.|%NJT WRx{ [U带+s? R [ C,+VhHQVvWw"OE0 kO<Y$I.Pz}㔘ᤜWJ W _R>W5p=h0H+Mg1#PBW-A r3@(6,l*;o 䑥# l F5/39 rc͝.Q{xl+m/Y橤K?FW+qqal v㒞 ,1*jl0a =j?M3ɖP^N$X/cHyBb+0j|[b%IbvóEV2*Ƣ81RM?VJmnduJRXTSwȞ=?R=VA(֯P5JS"NE䔸u Vᵵ[aC FUBȑ޽1aFKC{T3(=GA=VCm)P8MAN`9h&vnliB kr/D"72D O3b#Do=+ DP|Av-V%D<Ң#UnޔUXU? C_DֲC^$mH+A^FEI#2I kȍY%,v d ly=?Mz*:rI H@R|6##I%쀩f |Mrڻ6?!L͒4B|Xȧӷ݂LHAPCTF\r+6xC=`WɑeKIJ(DtP~M 0?-2C"(>Nğ YԑƶV`}Ztm[@̲^ogOVብ k7c~nZeeB~Q,u\Ļ>.G| ޔ,Kj)ڛảc7ro qR{Қ:\Y7N}YK[XiF?-y7UIJ\8@N)QEEO3_VEQ(hƤi0I׶^PP]r SjSK@NV(DZ4$UZV&z "QB#ƹ my*'kd`ѡ,Z'_y[2vp3h@iY$HnYAU S)ݏ:A4ca* ǦOݨ„C~6aZבߎ"چ̃X1R =qB}ݰS$ML>E5zyZkoZ\sMe-hw~:\mJ  \'IrWqɵCP)j~cхM\(b\wqQ^Fہ,WmCBiVصq3mR2)ڃ*W~Wa:耠Iv"n>Y?.)>*P9i0>?fiyRQ;QP|]\vswdX4泄sԄsF WrZ?m\1s3IC7Dpe *uAPN*Xt9 %g%x䅤SM_RFˎ@l3pVі"/;/ SStlQNߥ;$h~]%݄Q`'u+!RlәgW5)eDErxY}OAmER;ÿˑ?k+U!?YE\7ڷV>)*[SVI$p3L[eOu!klѡiE{<~lNKcD)'$0+h9V!:YIRDEy{>YͨGQ$ND;!Z Vbh_^2334\LD zlaYol~ hdx_y,* 'j;}sAK( (ٻNY{Q#ZݒƑaR?eGY$S$LnFc$PeQv:-r@ick\?$X Y!kOW۠je-h 5N b@0RZjSK*$fՍV\ 8&Gp/`].8ʡi ZDc8HՋ lfysl#-rGO5'KI#]w΅M31h^%GOM@R[5S%J|Ƞ jP|}k_M@#oM9}J~ŘWcoEB[ʲIxcJ0#>/܄e;PU5eߌuyAUCZiQ@A&\iȓHG!`OǗSi O_:XiPE~"@گa UUWf]!GFnā$9 /w k'$a-}mi H0ȜWv6rxQsG1 ߙbĸ1B݄YvSP+zr\dw/կ@Z*_~a(*d4+q(*3ҫ<ީ.:$65̊L%r}3P{HR"0cV05QqH/]*hRiG$LeJBg U9%,k\ع w(RST(eb#U4JZ~M'F\j6UkU^m⑤=AX2:T<̆̒,nA)qpHՈ$7/# @;v_)&^TjL҄ҝeY @.FEeW'aX0G(jȤ Q &NucpdVq-}뜟_SusO-MI  I櫪X)eژV.P _o|&CJxl6X<+}Uѷc j[SZoZg0O˦Эpa Xez8jTu2d;t,mCĕ}v/dc>0B@^ڿds:#!r6ybJgVp)ZȅꕴBz3lg.L=tij( lTBc3_DeК>V?dܵ(f\ZVu>-WlNRi1z`U[E!OƂOs2dRz`;IiԔF315iˏbG@É> 1;G@VJCj+s~ine?y}C-5~  W\Wzv;ˇ+!n]vD[-DAOK2v$)ɐ<58e'sR@T wK>O~HkLq@RdzaZ Tѐ2:zRuMK퇚! P}8u ޽{I|yiop~f Я!BߗUb[F#ц *Ď1zdBPTŦ )>CnDQ~!,j!O#( *ZX˾g921B027eɓE$wmj)E%&xzJ2,4''m?;y;.<2$R-tJGߒ?&_zk[ayCaQڦ0,_ QF<>׉m*F-q+@<$RRW `xa%kJr:a|6ƻ|:v3QoQ0kGmH&d1*zSv1O,I z%ɐ-$&N 䊟XEّK-A%W%})^XX\+Nǒ/ncӷ%ĚLJ죚dsһWC)M>x݋V k^ـa>c7DT@ }y Z8ce>=;wAUV̺GČ5{7j)́턍;1j6 *$ƕ <2؆$Yx.Iӊ VF?k+H'rPUU?9# P2;$qPҎq_ IQkCo$y*?V+̲nsilOo%cȁّyKػ|lTuڙh ^ƘLڛӒG)o$@;׿lkqVSA_"MyQZyR4:L:C3tQkͨv(>!NPf<1؞|`›O/WYqLRjE$9Vm#AZ̀"7-|_% n\JæbB n ~4$06/jA۶"~4.;zK_rݏŏ o,dAh@H ʅVAdKY_ u E¦ #jOp͢Q-72jmj};W<)*?4 ʪ}9]2e^ŶWۧ(!!;C 0emt|,O;&<*)؝_U{ȡ;M XiHYڙk3dJOXTtSt?,̦7Z(ߓW' 3P|\?X!VSC^r8W7ԏP_zdc8ڜd zݬ`rzSr}5JpzŤ&d xquٱԸ}6I 5 BEYYCɉ@Χ¼Gjm0 2#޻ -krZ>!Ev c#xՉCRHpQ0+!!JuVః)]F2ŔHg[_'K)A:{+FH咔-{v2>QW2SeN Aُp]&2 ?JLbLݽ8w AL^uJ]k#dIY+D4WȞA3͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbΡNH朥4v=/fAK5*ȣ}ևl[{ h #$u14Ij!m^5$(Lh]ZoizAI# &rɺ$P>'Oj7h%XP[_lJ5:|]#2F>+~ni,+ڎLHI?3!dԂum!?Y2.qScB2Ky~0%:<|t'ta hӡFz"Z_'pHHI4$ף&) z*m 9!]pĕk&JAU2,x%80ːSSƹPH8E uQ _fs^ە Nt\85;ҹ)Hl +B/,SsJQv Ox _A0_0=5E4"fpjJ< |1<+x,RRnrxVWa/D]}G@~Ш(5Nsh93CHLsr>>?g\~aCIf˱mNntӸ*id4ElxY&қƹ1b}hbL5ȴ^TT:۷@ѻcO'SdA0YA#= `kK-Άb6_,k_$UoNHt'5,-A EI5?㑏(N=;9~_\eҐ(0mSN ":^\ suz"k$ NVogxb;"? Y@~ԟq$ =w05/^D g),YXqaJ-_PKtY,Yc.\|^XD;V+WerZ|5/ vZPO_g!ȵ=ff<~nDn0i-#MA<@iTlc&S0isNu!93"f/\X5n nǩ΍XAI< ~є0w?w 2vr<핎B :#|_ثۈ%BH2x8 .'~9镺9ZTBTT*y)ukymDr$Te,v)xqM~'>[u^gdEe ֛gInԣӡ΅&ЀatboǓf|I=Y9a$VrHBe!؃?,ʿ{Wy=8@RpBZތķD\)R.;ewU.7 $dg+4{+4kЅbsF@LR')( 2"獥z$V:qel$Ο a8L Dy&˴;_Չ΃ӵ$dOf"2#yE)F!daQͫ<$9;?(O/OԯLe#qƟgگb!&NDL+8d ?P19¡/JGh-8iP2_Wn]OF鿜,dByD ~9jG?opvن DH%F@(qYggKv&&ąRjsh8FtfNAfi dUS_s;ӳieXUL/!@z|$2+}k~A{KrV@4$nU|~sGiRcfS<4īef!JjG]?kZ5OIՙ$ yJwpGuW]ҨtŃ:J Fۓ/?~+"B k'_X-f,g0㷅;>ݳ^Sq19,_,+-*#z#n?s]LY=3yjwC@ \At34JqhF ʠ|rir⊪9m0Sԍ /t*^IFj5?yW L"I$FN'rP4Gkb+M: B917¬Li̍E7&8(9PH߱r%3| @#~.I穹Y)b+HLL&>ZG+Rw] վ !:7=htWm a YKR}l V&@x>s (M[lKSzEhB]O:JfO ɋG+<؄*ީ9uȝVz` vBC'Cjc IUpwX,$z׮.ldQ_\DYF`}^C[ E5#JvV-8G&y)Ek/H֙idT$~%o+WޟM7č Qjc5wmi'e4$;8$/CE .8rES4ʦIO~\NKu;9 V>`ĴKH4vAOJ%W,M$V~)yƃE65 vb0͌WN)PjQ~z&T ҕF!pgUBȟ͙df`),ӉU^ U [ 4)ܣM*W r}:䳓]A0S07 |EPrGgEkT RdzbkuL;P63߹?(` eGs޹Bj1.D˸a2`Pvf;CmĚSq΀%z|%+$A3Q~`&K)`PWհF Ο: zb> Xɗ2tcNJaui~}i L{Wn ~cyO+K K r`Ջ7]cd"!kɪ;q}dk}Gڣb9|).VNj rTLfk12SIV.?&OPA,^xh"A#-RykĹҠ PŖRT5"̡0 H8ֽX42 }HHDJC^U"$̀.@ JFWRJ KWWV-ɗqiM@nSmY:y5q?vY2aGz+m.<:XT!$JȢ wxn2N2Y=v=#)6GBGNzPFIƥd>YTjrE7V$'n&j3TѾy07H։3,Rqr_@8HP>P,kkJoQB[_`v527S\N# ؈Pƾ_^rī}ҦƋ׿#+05#zxAAe?FƊ@)r.oFpdJ1;t\Еue!Z4EKwOZ(vt;C hTO[ ˂]]^*288rҪuft @4[)'EXfV'a[kXr2ү84zI< f(+Sı,OS1 E'nP8Z,` [0* )R^U(ulI#zg3=1T=BXtnO6#M]&}@OBFU;QX HۆBk\AS7eiB+AAE"~TYE7A/OmQiMnJ֝brDfSKh 5?mfTF igl΢HGф`(M;esg]@ >7s!ule+< ~ t?:h}7;aJx0ϯ^ jT\. a#EXJ!LӂyDu$d }L)*̣?H jD=l ^sH q]еviԈ( ~_,U;w_ P]RZ $NNcM)C,V"n#AQyBŹrZdWo$wRE reMDA,orM0dxowDn:6udVHiZl=4-/Hsc{/'t]-VK$ 0mqMߦ ?n2w.\ӑCO;*&!>p78c㐥unhYʜjLCo IoM@?#S Sq Oې7i+SVm9ҭ2A'noD*J:$B墭+ZrbPJ"T)ڡaI{C* )aL} +)YvhaIV'!*v5ðj|"ca&9tuI3%$YjOR(0GjR>wABsyvf Nq=x.Cr-ilUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*mBB<~}w=v5%7R+]":@E9QGYKtm<*zV˨x< 3KAk HeoY7E:PNivA n~^kFJ>~(rNKpezG^,nQN:^F?3oLJ$e'LxdFe OJ&pd4Rq~._YQ?BS!]`+T)|vǵF G,84_dx s%6:T&ek~eKyg],417?.y~ >\7FUBjE&n4@^ ďh+^N-Bɠ5nb5*En'6ئ%;,b65$oG͙;jqs,r0*aM; vܴOZij(5~0>ڊFPE) 6ibSyCrPlYA%GWgGd,%Y4 21o~/_ ~1<թ4 |p9QڄgNO''dԙu΃c,QHU+H2_6[*Iˈcz.+Al3P9?sSw<࿛cKSQKWj /ʿ,C lʍAF,|g ?V=W j/C+QGEvBՎ1sJ7z]HĒUV1o\eSqz}Wr ֍Fޞ4M6c|?ktϔ`D*$k]݉$y:2v^Apn)j(aZ< )N٨MIukqi̻5s\ ]91xR&(j# ZNU="1ܴ2{ h bzY8ʪLoȕCC;8wּ{`O;;G 9&ҨuO uZBE~?hZM}$p!CNOAĺ~Y\ҏg;i$^57C̤B0e?k:XM]Fp:gA14pjc4!eyԏY;a$z;VEY{[G rbA