ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 10:44:03  "*(2lHH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJU˨k-DP?9շuF ֹxcdsEszeGW.i*8YP#zV.t{\x蹪k4hq]>++<\γ*=s.ƵT8 ;K|#՟);6sp})Z?3?5O;6@:swYSkk 0i=DjW5ω4TX qwEg FLI&I$JTI%)$IJUKܷi-Ű$G )U/Ϣ;ssLύޡY3`qdY/}sKvI滝;66]M~=2H7 ޑqͿmؑH ik`;X斒4ʾ_e.Zvw6;sd1ߥ{}78[f>q!?'f. /cZYlxsٻi] z `{+wYmvn+SmԶ4-͏~bޭ{ ^ghnkGwG-PZt 8hieT:ժYCϢG%w`ב{V^ix>u"+5A~myoήݯu\p$g]n~ H"l"IRI$TI%)$IJU:}>k QYI_D<&=;Rab偖36OsE6EY_O*(U1ne-sk7C/;w6{?//gMXx&w{eT>{^[Àf r{'L§2e:)d5U~ꫠW?օnEVՏjx!Ɠ-z6~8y{nEUȏBR[_(-ǫ#wӺZtѿ☝D[(ҟEf;}Gײ0Dv1 >{?OG^ETkF=]˖Z0:E4쵞[vc3垧'~цZqa-kwnͿu[Uw2[;h{'{n[Us2s(hcc6VO.IzGv8ooxk,kkkKeO?\'?hu$>IӮ7F~Z-hd6==LMٲ v繌X=5t jgN5k]+)!q.s7=;ϫ2;m&Ik3fE|Q"I$I$JT>V_PWc_ms;uhW{`kZ:*%̳3kh$ @΢lCbL{KJzՍ«m]5is+,dE٥Ŧ-0toEMٹc)O JDX#AcoG8Y1gQM/dEܷygmmq\3ԿYezٹ(oIv*}] $hceeZ\K!MB]Z  r^NJ=1c̜\<ʮ88pyZr Oz=Os}7}T,u!nOzyTVKGX֍kANmlu6ܜÛn%hk|mus"F[Z -qC{nǚvz׺~C1;ee<Ko[n+a 8pj^~kn& V VzxoaTxiVS89O֍Kka B:T5}rvFKQ=K /5شˋ Z3o^׾ZfDTnygPmigНq;^+?jdE ߖS)2lƯTJDkOw\6fY1ܙBs@wف6wis+uM۞m'k)8b?>C{\?H"-wOj˽bd5.Z1#kmw6U_n(-Ht}7Wo{ٽ4]Z jK̵4j0Wa΢x[ߺcSeZ]sXᨭgѰTCFg7_t9) ]oUآAɱZ~ `6ݿbA-hkI/4|L߬O#U= 5[o-sC95޶c[smVdh.O66fGThĽ4 9o ?-Ju0 hx[_^2cb2p DwLrEykwm\FP _i2ƾ9kAW݆ynBp ?vE~7fam - nَZ1 }`=4Z*h\C7CKdJg,_[[]Ju΋ʮZ*8{1\ɻ1=KAau,jrjsf۝Am>ht1[Yv3m2Ez>8 s";Y lGpGҷe=؇Mj:1u$-lENYY/L`󮡾X Z\2RxYMyo@oZ ~>7mryѽQ?窯g)hpk̙dZ߽_Sֱr2Hap dXvoZ3n֊MV7ݽNnCiF# Y)e~ v_"?ޮHgU[/7 kGiWL{ZX#sroK7~֖:GSc[cn;1cKZo?X>t:o˦mw]V<uպ91c ?HK oN3 a, 7ʚw.YuHSkZ9nx.sͷ'36[+m"{3E/I5.v} ޟnHu*u\(sw- ^ۿ6:c1t6?a~PnSċ Ը{G9/qa8q5z9ODUׁH@=}!S6Z捤]wncVv9t5$m/{]fݭ [Zܒ瓠 %!m_ ?T:˝*vѫ6ob.Ncinc ^^7sU^ ^ۭuX Fiޏ.Yz>5;EklvS؝Z\q# Տ_>$Oՙfof4us/db)5> W[ZYSwOUeM6(ca[Hq=ALE~U6?v3O][ϪYH0>?YDPiȎ?bÈ[{Em"~u30`euWY>}#sgoN+i>g15S_.sqp?rf HraĀ]uZ)wp}E"lc>\WT֏n%$r憒ZF쪯YN=@떵Ť9`}OwS6qGc l+u{_1leSoPgIMcMZUc-k\ 5&O=c㷮;Cw:HKVv^#Ar w]T}8E[}ʄΖhr?Y縏?YP>׍52g59Aطحķ`Z9]ARwGDĀ>xs4=k4?HҺGDzsVz|oqqv8qTM~ ?7@͒oofqkj/?m_1.X{HoKg_WHW;N"ɖswJ­RW{5nt|zQƛFyh^>PgH;{Kޯt rڋw4ĵ\a'Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTVersant-180_PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM_ update_maart2018_v3-1 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM ql Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJU˨k-DP?9շuF ֹxcdsEszeGW.i*8YP#zV.t{\x蹪k4hq]>++<\γ*=s.ƵT8 ;K|#՟);6sp})Z?3?5O;6@:swYSkk 0i=DjW5ω4TX qwEg FLI&I$JTI%)$IJUKܷi-Ű$G )U/Ϣ;ssLύޡY3`qdY/}sKvI滝;66]M~=2H7 ޑqͿmؑH ik`;X斒4ʾ_e.Zvw6;sd1ߥ{}78[f>q!?'f. /cZYlxsٻi] z `{+wYmvn+SmԶ4-͏~bޭ{ ^ghnkGwG-PZt 8hieT:ժYCϢG%w`ב{V^ix>u"+5A~myoήݯu\p$g]n~ H"l"IRI$TI%)$IJU:}>k QYI_D<&=;Rab偖36OsE6EY_O*(U1ne-sk7C/;w6{?//gMXx&w{eT>{^[Àf r{'L§2e:)d5U~ꫠW?օnEVՏjx!Ɠ-z6~8y{nEUȏBR[_(-ǫ#wӺZtѿ☝D[(ҟEf;}Gײ0Dv1 >{?OG^ETkF=]˖Z0:E4쵞[vc3垧'~цZqa-kwnͿu[Uw2[;h{'{n[Us2s(hcc6VO.IzGv8ooxk,kkkKeO?\'?hu$>IӮ7F~Z-hd6==LMٲ v繌X=5t jgN5k]+)!q.s7=;ϫ2;m&Ik3fE|Q"I$I$JT>V_PWc_ms;uhW{`kZ:*%̳3kh$ @΢lCbL{KJzՍ«m]5is+,dE٥Ŧ-0toEMٹc)O JDX#AcoG8Y1gQM/dEܷygmmq\3ԿYezٹ(oIv*}] $hceeZ\K!MB]Z  r^NJ=1c̜\<ʮ88pyZr Oz=Os}7}T,u!nOzyTVKGX֍kANmlu6ܜÛn%hk|mus"F[Z -qC{nǚvz׺~C1;ee<Ko[n+a 8pj^~kn& V VzxoaTxiVS89O֍Kka B:T5}rvFKQ=K /5شˋ Z3o^׾ZfDTnygPmigНq;^+?jdE ߖS)2lƯTJDkOw\6fY1ܙBs@wف6wis+uM۞m'k)8b?>C{\?H"-wOj˽bd5.Z1#kmw6U_n(-Ht}7Wo{ٽ4]Z jK̵4j0Wa΢x[ߺcSeZ]sXᨭgѰTCFg7_t9) ]oUآAɱZ~ `6ݿbA-hkI/4|L߬O#U= 5[o-sC95޶c[smVdh.O66fGThĽ4 9o ?-Ju0 hx[_^2cb2p DwLrEykwm\FP _i2ƾ9kAW݆ynBp ?vE~7fam - nَZ1 }`=4Z*h\C7CKdJg,_[[]Ju΋ʮZ*8{1\ɻ1=KAau,jrjsf۝Am>ht1[Yv3m2Ez>8 s";Y lGpGҷe=؇Mj:1u$-lENYY/L`󮡾X Z\2RxYMyo@oZ ~>7mryѽQ?窯g)hpk̙dZ߽_Sֱr2Hap dXvoZ3n֊MV7ݽNnCiF# Y)e~ v_"?ޮHgU[/7 kGiWL{ZX#sroK7~֖:GSc[cn;1cKZo?X>t:o˦mw]V<uպ91c ?HK oN3 a, 7ʚw.YuHSkZ9nx.sͷ'36[+m"{3E/I5.v} ޟnHu*u\(sw- ^ۿ6:c1t6?a~PnSċ Ը{G9/qa8q5z9ODUׁH@=}!S6Z捤]wncVv9t5$m/{]fݭ [Zܒ瓠 %!m_ ?T:˝*vѫ6ob.Ncinc ^^7sU^ ^ۭuX Fiޏ.Yz>5;EklvS؝Z\q# Տ_>$Oՙfof4us/db)5> W[ZYSwOUeM6(ca[Hq=ALE~U6?v3O][ϪYH0>?YDPiȎ?bÈ[{Em"~u30`euWY>}#sgoN+i>g15S_.sqp?rf HraĀ]uZ)wp}E"lc>\WT֏n%$r憒ZF쪯YN=@떵Ť9`}OwS6qGc l+u{_1leSoPgIMcMZUc-k\ 5&O=c㷮;Cw:HKVv^#Ar w]T}8E[}ʄΖhr?Y縏?YP>׍52g59Aطحķ`Z9]ARwGDĀ>xs4=k4?HҺGDzsVz|oqqv8qTM~ ?7@͒oofqkj/?m_1.X{HoKg_WHW;N"ɖswJ­RW{5nt|zQƛFyh^>PgH;{Kޯt rڋw4ĵ\a'Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$' ]Q}N67.?Oq%N6P}? urq.oah?N6?N6?N6Sah7ԧ} voO쯩OS' Eپ?N6}Nl-f8Z.9oq]sah7&} vooTah7&F6}Rooaiپ77q쯪Ml-fq֋}RookET8vWfF6]#}ZvXN6S'Zus}NomiRޟmi8ӳ}Nomiپ7N6S'Zvoo;7&F6T8ӳ}N+N8-i)oq TfsxoH%?aZ+L:Nf/rh%ģL\~}? ֊C/uOr9k]1ѕr@q/_^1:E Q6k21'WLn؟鍅+D^%o郈'꧈D^%o釈/ w#Ǽ 1pc/1ݩ@?Z+ 1ObqkEAoq]78Z._l/ w!#Oq]Ql-cKaUB=LAxKEFSiKALxp`zM&*v x3q,ȶpq5 cTo%: _ՏZ*T`0*zt{ѹZ U?|T/7qomiٽ ?㍭;7'kNI8ӳ}^OokNy?㍭;7V6W[8ӳ}^Ooaiپ'7qW[8Zvomiپ'qW8Zvol-;7V6ބq֝+}Zvomiٽ ?㍭;ɳ6cpb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*4t"el36Of#7!7,Uٹ犻7,U\W ܱVbƖ*; %e1VW* V U Up]PNh.'1UN]1WeU@id5GuF]RG'^AlɰRV;[<V.bP}}!Fvv؅wrS|BaF!&EQp;LUT|Z_o90|Av*+ȥD enES:`w1Ut9^ثN? d%*'bknj \]\eqVu[ZNY-WJh [?#CuZ]{p%P' oJdnDUbhr|FL(Jup{}]SU#KTlmߪ QG`BSp8qVp8N՟lLQYt]0+UaWcqKBRi88y]8yXbcHoNo]8beWus`Cxӊ(Kٲ(leRnvc8UU٫(.N*쬒]1WeWcN*MXV~3* "v•~XbGvc]N'C`WeU.Wh厸X.! Sn"a SXL''koߏ0wŕ:"JS*a*v ALRZT8S=-fQAMt&Zp!L.@+(ZPw(!VJN,=rMi\7)e ͘+ l-?rTl1 !U)IZN 8ۣ`bWG%S$pjp6ܦ *obD~ȧ\T!}+9Vtv^`!_`5JONEX&T +`$GW$&g 4{-uUk: )L\ "ؒq M&wA_4KcAGDZBI G© )h"c}UpL"R1e-j~$!n܄#2@uiZJ|FXwC!I@1( +VHUd 4~XN4a[9ghc ­r=)*C #- _&|J$;+vQ8RMWe]8vV.)v[ vhV ݱ0_%DS m?*̼)'"0ě%iv2UcvlUٱWemm٩ٱ"f]+%jup+Svl 6͆ٱKdٰ+\_qi-`ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*3٥_-rq1\*3s]Lxtu3s]LX*cKS_nq1^Y5[Lծ)v9qV늴qv8bzzdP1a}8h%\ ,bGL*B~rTOdU UaC_Jx/҇qQjr%)LB>!4Ȫ)1V*1>G%5 qI WY`9o(N!1 ))WL\ zjʿNO G|hȡ~MeƜU69FPϾ*JNہ+MR ҿ?#uc UNY ̭S%r)-ŋFc2AKƠ`P+`y}*6/| FFpѧ? BU4G (=p*oU})~,RG1Rń-_b)1} Y.7j 22 9 FNSe Po/#ny31NI k{ /j~HED(xxJaJÂ5ʘr M+*#^" 2n.ڲL(WQ>]BqJ]V)I-4{I$ʼ"<Kv>4y%+1Y?2h(y]/Or$6u<2 PxdK4"Ƒ]Lihbm .F59\eF pL1U𫱧vQ])vZp!R졊\RU}R NY"+jR~^IS,z_ *SqnHDL˾+'I+ q A>p?SL LRxd z\ +,6sTF?) OG\K7>oua L ߐ,3+[4dUpHG6 ?<7ShLprr…:@ UarXF06…!ڛsSX pj~x[?*㏮n*~rQACNMvTU&Q@8RizZGŊi-g'2/YhM]Gl>dp+7o09%XٛpPW j[>->DlW1WeUGv4RWf;Cmن1We}7TDl z$WZ6ȿ1ݏ\!cs0®9ٱWeWe"eaK!gvP8R켊vlUY+Wf.͈CIv;vP8)]9t.ݛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*19^NL3W)xG/*8p]vn2Sn0;4_k$`qUpZ8*;v=2]?6HR>.KGF*se꓏dX 0%2m(hvV|]aZ78ɡN.{`)EQ\=:d [Z%0r(D"kl*ShQmS g^{7q VƼB fASt8uӑ*۾8)Xz f>~2\qYxv3-*^bcqUU|)lz@>x&uUBPk|S%;cNEW a֔?q ^#2JC Fp+ELjHVqXWjSlO8 =<!/_siU@`#uqSo(H]—f'++o(WcN*죊2e ]zb0`WeP# yDb-ٰ+yXC(vV)vV;6*i.8bf]vlUg$죅]' +Z6.iZ`JӕoU_ o]p KG銴1]]LU*=0%T _|U vw2;vʡ^b\.R%e61~*p*qXA+_cbNʕX - zoW@ָdi.ZTH! 1"*_Z*T@ǀq hVB1e`Uq b|pU!_W6z4?75P\咠zt'm)OlTl8Ryq4%Kl~˗K:`kޙxȧl+ Xآ1 +Z'c 1U-A 681'U:c \e9(ݯL鍦EW biCraX?FaPњlq p*.]3 F#b"3LG`UN_<̵-Ā(_\u;bV8ӑV)@ȥ\"8cLUXb)*cNqWcN*c][8m0182VvQ]qWcI#vQ­UXC*죊+ qWeUXWf]rA]WfI]Ҹ%J]@go( UǦ>CRN*.7 -F)Z71WeWc)v!S{kc/cO؜,VYܼV*0R2}%S(_MDxaKD;bqBW."]QScL_u1[x`KX*dB&48 V_+%[< qu83@}8o}Z?v=u{!‹XloǮsݫɵL_0N:(-:dgF;DJ1JuȪcLxSIG|R b6Vm\I t tҘ5Xe\6p#j'PJdwoVGb'>_P}F"cd`8Vt0r,Y]\L 2iQ$ NCKn@K#_1ĘCWebƜ cbƜ(ve] [ ]\U]QȀ:)vInK_6ȩR?)POpzs3}~0940]6*ٰ*i.́ˮ)vjf]p+$́]WfH+늻(UOz Svn͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*y $YIe%O t;k$0:C ąO#'%9`EmqsrfVr[hF]Xw6U&-}gũhLtUD=w)˂ bp@r+/!>q+0 O b6*4$+)ѫDXCK_ W(eE0_F!\qp2I[Z8Z88beZ8ኻ ?o"%-UxbI_.Rzxr.;rk{!/ 3Kib,1,ۊ`)~<pLcQ)6UU[[u[?M2JCakb.{}#,m)CNHF,EVP bN]*1Jq+Ϧ]649†LR/C^pn5@k+Jl& 87xk`?&1arGblFA2J1qu Te[VćVc\[[؍ޱ0-tvM6NX4We`C ]'v7;-qWcؘ.8}:?R$}QdK4ަsK*ƹ]VJi9'-\H],`*Ux *-]Lm]vlvlUٰ+aWf8B] ]v^;*B]WaFr5M_56*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*>,-fۥX}ˑ&Qa3Zȃ+|YuFOSc*&5% ^#e t,i^yOAO2uJڞMM8՚nr*~0'Bm| J;d]:fO JC0"W"N=qU&7[*E(h seq98zO^pnS@ݯb JdPC'MJ횘Y Ӈ:|9!XήO~0 Jo0ژ}8!L em[㊯叅~5Ul?#rp%R#1r Un8#n1U(^0 cWWF7a-g 8Uӊ+o(Cbf*(LU0+[;m]8v4KCb8CvV*UXCS GKaWf®͊: KK}KZb/\*qWcFv6$;p%!*n;,b]zWn70M *DE-T/|-^߶@Byܩ'S 9?1*;aND$Ư sж.Qk:iI,,N2P\?E㕤(.8AdN,`Pӿ EX WW' 53JkmW+Ji]GQVQ+:9{JLS,{r4);F40vQ,T H;ǏkmyٯBHT_Iڕ(ي,ZWn_l A! pT`fz0h>82T퇖 !.>1SgǠ[*AZ,.+KKV0O*?J4 :YF?<(NZ=WnhqWWH\  H96L ACOtў#.4@HHOJ7?2S]`wSMˆʮ3,$oM$ 䐍Y+2Jqjlb,\quFUm cj`{x֣We8v#;QNDc +v4UȄ;rIvV(v9qWc ,)v=()GsW%* ?e?YEz߼IBkn6\U(4pJn~xәګLU0 J. ?!*rz`D;xdMT Z ɢek?y^YRgfOFM]vyJ]1_|ZnO+K8a)|q@m GFUԁaFG+ENawᇁM{`GT¿0S[Fi+Yr<;db8zbc޿Nk*;UW-&%.jI '֛f;4%rd6j[ !}xZr)Ga|rza243|+us\kčOт)ޫA«{NkPxEUر0ZUGv4WcXcvV*P`E3C<,M?!($$=#9r)/lYD?,G SߑbIH%ђWeWeUٱWf])]vly Uن%]vX8vVWf8٫ͅ.͊UQz SvݛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*_ΰkv=(9Q XNd̶sa,(HfٔjMR?#?. [,*)F%@!< +"AGO镝$Egވ CkXi>(ƿdLNmS\ֽk_:."_O/L16Ϙ+;>rk/K_ i>"A5F1jr͕d_ I>?~DB52ȏɧ$`~@?`ՄLW㊃i:l K_, .yDG*Kg),'4K$&n fL2G*0k-h偊]1KG1V(1Up*9< ur,UbW/SB<̉ 1W?O^ SdTZ OG̀6CRӻ˓æ4j~B.Rs^YـT7."lI?qUPǦ*{eג1=o+=(.\U=" |~HWAAm#AtAJY\0$8bG\3:aBR*N8i 7KS)@kb'|%VZڹwJX5+#dڗ2w Qҩ؋b=6ě"cd%AJߔءU1H1U;q6UA1KUȐf+JqqV\c`^8aW$˒V1Vv0zaCu5Uن*z⭜UW| Zq^bk €W?$gĢ4Oi#DIMI|(Lc#0M\Y1ةs"rR܉AOFB+lR$ xV |BW`1(Er%0/ $( KY+-!)F1Ǎ^)k^ZǁkqV(2bRvG>x  扆W)l(10\(YJd+U % NN=3QXk>XddrZӅ#CkazhdXI^|DdF3 (]9%vV*xN|Vݕ. R8#lno;W?'ODH ;twuoXr6vȱOq&$]va]͊(Wf 2P]\ vXhvl6*UٱWf] *@K Ux۲bcWjXثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*SI_r2<ݒjCe;('v&9/] %o8,\!aF;ڍ 1>xaa-Xb/K>#U1{6facǙpӇScGL~v==_/Ӓhw,>G[qVXz`N?/z1n&ڹO=ͯeoj[ۏ:d1Dr򮘦3O_׈My-&ydn&dl0ZoF?P?VG,-[c+G1WeR1VXZ8U6L0ҵ`w<*|La.s!?j;#=z TTl8iZivøG3$+ jI~Sd-ZIEr%)mAd"O\ \Mh^$Pv֜6y>Ʈ^Wc.@FXpBjw݂]XӮ#FēEKv AAȡ\p*ӎX-c[*ebqCDc«g銶#qp~>U.hǹ KV AQˌڸ,aVCb)ꌘd5'أU8q&1&"#lBlĿϮ7݁ L ~VSEU0-1WW1J<2)^E0*ؙ\Up8\JSaBlL I 16UO27+$ԛ'Lm jd놖˜*)+  ].*&8V=1W ¥xM(⭌i]+.͊+ ]p;6(vV*ثKS (aWc*kb *m) :Wc;)vf®(vlUاE؉‡e v*vi- YvUa!D t r,'8LH>gĮul8,҂4EpS"{Ss3Wr9cHlՑyHJw ~.,9&I0L`1AȔNHd,Rd58Uk HqAiF$:䘅5rIYs̎ 胲~!ɉM4H *Q۾#H'lUn*<1KX+VD߮*Z۟V² e )6!6LP wVvxJ)#b'a֒rB}ˁ*G/6*i8$6A"^YsE[t8Jrh Å]N*iȕv0C 0늻0!NwCRPt.ƶ(vH4EajR/N))IuCi+(XlXɫSvX®vc6v]r4eW&eCR6vUpW;(2vX8)]b@*q ckK]: 7` ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*I&Qʛ] *݆*frr]8};08Nbؤli$J6KrqvX]1KG1V*LUrVZ͊6)u2듊l:R5Ֆ1o&ߴ^$|R-ӮP2 ->F(=d0+ͷӌqUb5ěXV|K$:b6*2&ژ?ہQSlLUq:^O֮/\ V=a{/U8W1 * T_cȱ*f`~ۍ UBrL*r-W`e+߯-# 8:b#Q\UT1rA)^j *EQU)0ӒK0}TdXչÑq]&{x)|Q1DDa\`|C⯱*o~O 0UXLUGLn)lk.*8.*I Se!TM\$WVɦjy2 '!Z+@ c` aRͬrU! Zƹ®F«lUp7;b͊8RثaWe`Webf]銻6* eaWfl(v2 k˗;;pb_a.İvlRu1WfbbZ)QsU vjB>ĥ ?8HG>Ȫ687\Q*MM$T='3[P5-G6]Di#x\hP`J8dlb4YRCPYˎl=i*M6F풤5G|,W9ƓI+@Ȟ'+$+rl9x=6P}XZשȫXcp1V 0LgF\sC~ 2e@d=Y-"|[fb~,QJ*tYd0 Rͅ.]8ؔ$/#Z~> 2صLY94*cN*쬍ؑ!Uن*T`bcACv;vV*YW'h>H=F2ǯcǘ-Aoo4Kq//2G&ͅ]\U٫*UٱWf]6*\;50ڻ(vjծva18WaNWjXثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*)&Qmצv7vl*죊*WvPvl(vU)]/C]M+Il+(㩁-W51WW/vXYt]NG,tʦNko/va] e_Y}c_nOģEp%(ũO|Q8ra~C. X\~c )U݆$÷Q7r> vIJLڕHȔ"yw4Eҿ|QkY8md)ny`PƵ]Pr$%NIy_ E00SSo*+Y 0 FO!ie*+1;Ix+qi!}# .mb-kqGS>?7WouR?͍>j>?@ix,1^ixmbK6|Kı$3"׬|I fAڿv./H#&X\uSf ^U)l2>djOxڧڷ- 13TW _RZܧdXmV_ ­|1&DĘbbR P.41ˊ!SqHI!T:#Us//vQ]UzMMqE8c•qVձY.(^"\7R;t >$֭[z{+~&"d4+dX`KGX銸`i/lUv4N*vQ®]pWe]eUGvlUXW$UM*i2*CG158b(1v3P܁CIv'v^)vXC\qE+OL2PdRpmǒW&N {`T5.KwbOߕTe/@]rjqf*>Y }|-R|F JRQqv?p 8bVY/S9n)L!+kEJs  s vl ףbߓ8d?ʒثEqVUa6bS\&qP<Yh&ܓP>hD p#vU'΢汊 d;]nzʀeӍ.'""CW10LiKY 2K|QfXZp[.mv]K]2Jv{DbmZQ|qWz8ӂ!? юkZT &(Yq VN(.QWU }9{(dp+y"^1 $~9~x8f^*Uӊb2d]]\[rh_nvQ8؛d+\)vX]\Ph58!Ь,I/ID#&u9D=)yc'xIR ثb]cj®1]ڻ/|UٱWf**ثb͊08WaVx?9lkvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*)&Q쑟 We®ƜUTLU٫50U8QNWcYALspF,oi[lUeU6vXU27 P9b8Bp*:m2 ےYģ{}!4żqJ9c :W/e OU;/-)ۯ| SHl ( fu_ - H4D)2m[EGLh~O *_G&=1O8z(?Gc@4Aŷx]7sO8-Kh`g%?e@LEڧ[tĚWo8*찣v8. eNLiicZvX;/ZvUKS"UcW]Ո0ZAkx_Oe Ȁ=1V0$*(A nMfoj$Lb>GۧX`s ??^ATPaVKثI"Txf~Vf8 a_I "7oVo^ZQ(l[vQ!Ӆ]I]*c*`]6*졑vqXۏL4C{>T4*o‡fWf'*UXb˯l®́]]\ /G(6vUpb͊6vlUUx?9tkvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*)&QGvj8bʮ;U{Wev8+J]+K~B)FH=5~&>m8M Z3lgGJ# ^9MMpR$БGO~J/uQuC`\.cnxaI\XPF8F݁q*ʏ#x T ǃ9acwOJd,݉~IAK[~! "Bml{ &Ȫ&| d Ua π8UN_? DeWf®͊/)*:cIi)u3`b*qH+Ԗ8M_G e0*!]Yak1V #!wJp aʤ)ȫUǪKGhkqQUv&qVWe`WeP(vQ®'6(vQ]\UXWvj JRkb,v &L k ;G?_F qCxӅ]>LqCU٫]ˊ]m\by`J4 S-@6k"SAr=0g$eh]ePpΜTuGL)S*3~W ^F0Z-":A)81()?CJs㗕K<-Pxd{rsbܫɀ "|MOŰu'Y`ثd [&Umq.GbYP{  |NHk+IG +D%Kl%MЌ,:!W򩖨f)!M~]nGY*a$hdqH\ ᢁp ! x.JN&&LUuq."ߺ?pюR*$ `ZŐLUkUQ{aKGlZ B 4|ViCO lkǍO%%p UQRߊv(elg~XT\Re1CxӅ]L 9'¹8Q\W|1—cqWe'$ƜUÊ˓c*~YW׈%u[x I#֑SW#1Nqb͊6*ثaKb͊6*]*vV*ثb͊6*ثb́͊ o-&vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*)7dm\ 쳁]5+zb=1WeS 0]*wSv(0+b역g!Bw*+/f?~=M?HCeh *b.j=Ps@OP8|ZwyYUkU?^=rْ2`֭*8_ȞJ\&J"aFs?%4 aM*qUh1vx㕥1ǣ4qZaU?|U%f9\ Rܟd䗈+ D'Ĝa釞P@Ro6?T~5ӃL,5:f v(Aj<[ b]b* )UH#Pُ+ ޟ@!L}I=NY4PVuͶ.q8V-w*i]vlUٰٰ!ٱWf]vlUٱWf]vlRUٱWff]vlUٱWf]Z_n9cf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*)7dM 1We(C6CWc)v;*Pbǎ]u9Krnj u3]hk,UchL 9`W05J\uW{f"AhaFNX9!& s-fpé?pRUI~sPUm@1daۣ$u|#7+%b{v6$a@0+\;]gG;,0+Kb͊6*챊/vlPإxb]bRœ ˮvlUٱWe Ux늻6*p, ]vjb͊]6#nJ0vP~LHCR'm< \)C>!5aا 6x#áûknb- Z HY%P7jE+k6\UD\dS θo([(7v®ƜRz)XP/>yqmAW 1CT;6D(O'eE!ٷ?xB./C | kQ.e?hu Ɯ*Qv\ v0qCإx)v8`W`18)Jpk 1 5p<I!j( {zF9z6o\T-kSBOD/4] B 3tŤ Bety0RȲRn\Ud1K3L J)M./GYɉbbrI]JCдXTQ <2 DAbY[ 8o(~~X+) L~ CJZ,ɋVIcuzZ"c#J rd#NʼnRr8iA?R}]n* "H4D'rd8$1VvUnF,VyBn_QZh<9ɡ<9g,lj{aWPU'2QR " YKdp͜PSpg\)(ڸCKd.?rqbSW5N-' JBٍd>`KYbi a8U,֞7 $d`#ث;p8qWebǦeHwхv4Ï'$z~Q;~ivh )p0yFvKApp' U`Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثUr5M&ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*)7dmʮv^(vXGv6P8W;..Q*q銸Mr࣎1!xX•/*챊#,RjգrRV;#J yCj?xwQ 2Sy櫙#`bm=dBC+L|zmSMRY's, `g'쏧 ko]@:bf]6*ثWf銻6*vlUن*1We]1,%c "UنvlUcvX]6*p] f8-.́]v^)vlUٱWf]LUX$$01SDWnek+h sQ+P68l4q0T(/BSy~ 6,[o4D:"+Ļ'g?q1^&ʼn/eo#KԽǨS;"̮z'ㆂmh4OqG?)8\-TuUEplTp,FA Sr {iؽk]x`*F> ĄXHur)-HexG ́]p qWe7®Wf|0һN죊(M1WeW 6J$]>]w48w(v90ؤ PVv(MvX˦)v^(vX]ÁpUJ(Bݚ0XaBLՕ}\dj U[KMk95+Z\P] jB51U])*½s['DV?$'C*N)qV↱: NN8b']La8U}}-EJ 5v5v4KlUCv( cdv?*n%]I,1eN$gXTAʪI&rIvj\RPثb͊6*ثb͊6*ثb͊6*ثb͊*Rf]z_ÓT݀r͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* 7a[s*pf#*F\U*.Ǯv,-b%vI!Mw~GCݗdwJq]k&fP~c 4._@9K*W[ߍwGݖ->UqC-f_Lhoo\s[BVeߵ q%ZmR=&ir6aIi[wiZGU_^9. Aw?݅,d~]}j|:d`J- s @>&?~*7KMI˦v]1KbLUٱWf]1We8 UXWeUxWc*]1Hv;N1WeJ6vl*챑We]v8b CeXxٱWf]6*vX]6*ثb˦+NLm]] ]LvX.#; ؕU鋰N,Q\U. M29tɪ↫Ƙ qUU8l(*.«C*UXG ]͊;WeW*UG 6* We Uـ!جB\p+)*r TaWbP4a RLRHc!xP챋'c)v9z8cj>*u5YQJԏvPT\oNS" h-WSZl2LBհlO*;՚Pw`1B/Nx 㹮8-LBnA~ eRea%!w&Tj6de^cԓ(v,VNN*$Ġ.'H]Qd^a`O]+jQSNQ%>Q^0HӜ1O8)Jk o'OSXJ4>g֞iʩ٥. 1;Aqd$P5T[KrO,6 EQd`)\- bX)ma_ Dlw|q[Z@4JXDv?disjx !S<]xs|$=s*8xpvE$j"ߦqCv%ӊ81Wb؟|)vX]튻+ޒ_Ig bZEPq| m|PPثWvjfv^;6*U٫66*ث늻*b*RvlvlUWx?9l0vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*)7d]WfQ*]V®f]1Wbm)v8Cvm0p1%?H# w|F3! o|< ?Q*ppq1~^7zYGG Dbmbv O/~b/c˛W@0-]Seb&{ᛠ+nĈnpٱWe vlUٱWf]vlUxb\Uى]6*ثb]ӱʄ%i u탉qdw1-vsLgʦ F VH;͒V#d塂{!'K©苻~HP;%ثpUlWdw/_-rDA M6 q i$qcnc;S`Nb]]lU@`vH4s}CT(˨X$荢lxf(vX銻6*ثbZeeWvlUٱWf*ثb'vjKvbqC.&@[`7`b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*)&Q?2 k+ˊ+vUqCvVvZU] p+˸*-hzd70p\FSPbʠ]LUٱKb͊.SvV*ثb͊6*ثWf]6*ثbˡ]XPA^v8@%ؠU+K̴AZv7l f.qCr\V0(vP+ɏWc+E; c?UaTQmboeެiG3oSCc0ڿUoWc djj]+v^*ث Uxb͊,bvX]befe»*K;>`]Z)Pxx4K8!hZN? I *$ĪxW\/İyX*죊v®Ɠ]*UDMw8ن6*ثWfl)vRH1v mHZq.)v(ts}ثJ)bZnqK8P챁].إؤXMq}TŴ`{e*SoZāRj`.IJ0 -[-)Y. @RX|;D)ANՔ^ex%Bi`z @tzp那dp3rmݍ{p3(q,JKjLnߩl%c^ⅸv8Bzx W&&=M(6UANUN"dR2]r,`>#%Aⷮ~tsa;h5WOphL]>U9&F> Q5)^$vZK_3kK_qLWd)zᷪ9.lj_X[GjuV=F@E0\!mao_8Blʹ Ԥ.zb>$R?~jU|ث1KG&Z8hŗc$&ֿg)l O|]KS sA d:_ΟO(9ҐĜd*tǃccIWc]":sO.R-VHe4Uӊ*kv=c0ث&%eښi&䩜/I0Ťo"q` Lb]]cvc(٫]늻*N;L];5pb͊]v_(vV)vlUٱCV o-T݀r͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* &Q?9@ ɫvY#;(8Wf®ǮثD늻qWeS|*z˦*v4UX*ثbLUcvlvP]5qWf]vX]HKb]mbv*Aidip26r$?+G3KmLnݍ[`%mٹa ej c+Hv]qdpeRr`;}9+WbUc-]IN/R¸ qv8Hq&]+#&c̼]6ѿ%OIbRYțQ0\K*aWf*]銻0F0\Uٰ+vU0iȥ؅®h>}W`U;FO) w`@ LXNcbOJ`9AW …e1BMo]qCv4CvV*;LUXb +vjbe6;*2ab}Y5lUX"|k+_⫱Prv0hv*X®ͅ.ێcB|HhZU/\/jO?6Q+VY+xWlaT';`P傯T5VRztoavz:Y|@U6)Z&"Ġf~&/BO$^lmxm>~q.fC"y1F\Dks1x/HDʙ3l*Z1qUnFByd04Ī釶| \2,N@*/vUOe':.j%?P$co<դ-y6zk ndYoAY+P2F>Juշ\"81-92,-E8p͊C#˅kb%S8r@dEauaLZ HK;7Z 1E h`UjGQv=61KG@k6L1)e 20}7G&[2I>},C!ȵ']6)vY͊, )vjt]=qWf늻+ ]͊vlRءٱWeRPث R- 3v;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* &Q?9XmvQ](v^6(vU1WcNvVv]+]PqWb0`We"pا*I+8p4ۦWcHvc]ٱWe Uu]pWe UxLRQ-ٽ+N\-:WWeWc ]v0ɒ2~LjLKp]J+v\deCbc]vZi]C.#Vnv ̵ m)v'%#4',Ie9EIVP.B;7 +(vU0T}ڻ0r0Qe\ Y%+NV1V(EJZ 6ha|MOjxhnR0+;#.bf](v_O@q66;~#C";iv!s ȑ;*Q~Uخ*2 R4CdV/8ؤ-9T–dJp1 q I*Fv4Pi 8XٱCWe+vjb®pv^P !, -0%][p*p18ᕊ Wbg8e.l㰫Ycvl)vZ |2u(CN~,TadYʊ N5r*\\peگX AؔͭV";#H+t?lJ R+rcTY4F>-*Stŧn-R:q@=hc>i9ܕ;,d2C O)eiHr4:ie`b8Th4q) [1gݲC NߵnO$xb;bx> ^e4!O߄e;D2ՉC$ ی.}D%8E^$#i9ȖA x~u#"z2 i*0*c(*LA W҉$9@/?NkM7\3 b[QB(c\We]9%v4Ƒ]`*}v0dP`WcO\Uл*>L ,$?t?be37"RO'ni|1ȵxх]6*ٰٱWf]vlPإٱWf͊6*]vV)vlUـ$;T)qWavWiMb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* &Q?mv6%v]1Wc]C]Sv^*p]SMWe0]v NM8 -銻m/@ĭ?kaXTd8Y[4f͊5+*](vjbe$oKSնi!aU1eN;d-]bWL\R-lueW$f+n~};+vlن$!xUxW^(vjY;64챂.TbeAjȒ` w%*0퇅6NE׹c&N˩9c v-P]imv]1K]L λ}9v6@Wf +dأMD.ljA]9QZ;_oZ*9?,QNob\⮦Pc]`w84pEGאj|@̔ª9|(v#;򢎀aWe>v>m[)5 .AaJrLT%&*ǀLx Upx8\U VqV6\PL(]튻+vc(We]vl]l(v:MDZ8Wb1op*S͊;.nvP])vlU ]%M|uE([j}䊡c’իx16S1Eȅ|g匐6R>x 4v#fp#tm58n~1[ Z! Wr*|HlXFO'lW~ݾNZ_Go+Vg}=%1_2 dycqOZN)Ɵ~kO ˼{Ǧ z{am z|v>DGC$:␶W 3ɽN!E_0|SBJ:,HoZRȆE5@~xL$ol8Ӆ[2, #熪2)A1TJV\QN-sLQv $V /$oi퓏4MrU?Rq4/ UٖޘъqKGS⩾>>#0֕L) [MPUzpʤWœWŀsX|k U5 |KbI +\m \0XÊ1 Ԥ+?KD.ja8ӊrJi]8v+J~,i]R~v3vhzG(p6bdwU'[X8O-Ioo#MUqWeWf]+aKbf]vX]vUqKC)vlU٫vc];5qKCˊ]ڷ_An9cf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* yT졅]S]}We`CJWf]*QEqWbh+Mhw—`vY8Wcv;ir kq ӱ2ztǬbvX5Ș"e]"i Y-) SN QN,*MB4n߫$bUَ*UٱWe?^*h8x1K1Wc#ӱG?., qKdȆNŖJS?#+ ~8R+wcHtc`IE0%P`W' vĉ®šb c`dᷕ۔؅#+q6?.RR+(CDli-rĤ Fp늢#8Qq 2uኺL 8*.; 8(vV*Uَ*UٱWf] ]l(.Ǣ!| k(*bţp*];&8o(`Wv.bu.8:n0$)ɆV]rj#֙vR<.' q떹+(|iIɔ;v#0SVK>8dET!sإp"T=)/?\/HO`T >dsԧ>/ܣ*|ۯl+I9}*h TUCW/-eop޴ɱB.AD,';E r%Cjofo՝C(l!yio!(~"ďՑ U0X|/i?,d;)EPSV9EUih 2?G'h($r{)9L, UٺP}lRP.ثX"׈BBU.\,JCl Mܜ,?+%{ ~l (/&ČT4rS6!q$*ƜUpbZnAXIt_k"l8R쬉C5v4Ʊ]]&b-®\Rybw]Lխ K7H;F߫ qy<ǫvD+q4Up2Df͊]1Cbf͊6*ثb͊+6*]va6*ثbf]5qWc1KVr4,`ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* yV1We| bcqWeW 6*챊*Q 1WbU؛8.3*Uحe*Z8M2l$lUԮ*a{bb1݊2֬+nѪ? @DG+_#!I7v"e\*n*|CqK 1bb.LPN)v<(v4!.*zFkiزp%ؠ.XG?쵌 RpJ`;1vIGb,x'?Gl]*{aWfbf2 1!#u8'bW`7Qv+L ®˦vg ]$〫r!]L*a@\B* bu|,u.N *|QaFcX}B;yV8 ,2Iv25h0lm!@A11%_#׮MZuէIc!!bS=E+T5w1ArqU1ejDŀ0\1b㊺ҘĝqU,pYpؙ‡eb8Gvb1WebLUٱWeU٩%dVwXWkv+_pI,CcW]3TnNjRۦ' $NE(b+X@`,u-Uh#ojGO?,h9x>Bo@Wec$:aWW&me,bp@8(vͲ<ۮle*#RQZbVt>/$^S"Ĩil hecqUQx7 %HFɵla9$* WcN*cḅ*P]—cv[bƌ*{0C#`l$u?&ZUS&UٱWfmuf—f]vlUٱWeW/;+vlUXWeWv^)vc/v7vl p8U]?9d0vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* 7a+nv^;/*챊1ƝCWfv^v9k] U (bdJ\U؄zl{}WE>h֚݇t V+5}pA\tI#-k\0?㊻_I 7b$S;+vX4]qKW0+b:+ns|)cd8nX]M%~1+nr [vnQxVݔ}Q0%7!ـ8b7W\ZR򟀚)=U8-2 ?u$ Rqżt{c_b]N(oZ˦vlUCB1)haTKQEC$|W%W§lD qţZbQ}9h!ri*zM#)IeF=/&VsVqʿ16'߃u7Rf`T 斓UG`Kvޠ DN2j!|*z) ȥx8t;}:I:7*q+ge4ɖ* *G ٢yU9j W_ɓI :dn^e!$]/E(a~!Q֣b|NݰV |@@\僐R#\PJ XtU69jv´Ah J~ Oi2bS}(,?k\*nثYL{T 8*82VQ}IR9&+V.S6ȩ¯6,4T$ҖWOș*s} !d9 Q\!\i\NW\*SU'lUpO1I"%X{ɵNv7]re]'v0cf,\Uo0MjS,A >iN ;ami—fp!٘(b]UٱWf]vlUXxٱWf]6*\ ثWvV*ثbK폖];6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* yT8]*ivU1Wev(lUت]'\ ^▎ [L܆*eÚ t7"}50#7*ژ7ZWbEi;vX8\UكRwXd;HUEb˱.9VdNb|2;v`WbƟ-+^oar.mQԍccr&&[lTqcceHDV\A(Tbk(Uc (lb2.*8.*b,Iv0CS;51Web͊6*ثK$]-E7(iϊc)]0+ RP-qWc p*ث\U"!Vl0RT8m rJc` #™a`uȥ[+q.HgB F5끯64튫Z3 u rh;f:GpX}5e4n: 'aE/q&*dĭ&=O݊ENmPp#fFxbgt`6JmEbN0R(Pev. PLPbDZ­S*!Sv| ش:턕 p:=2 T# yіSA朐ۈ<ͫ W%P#nP"~DaNPkK"˸pP<(umZJւ?8$m!G*1Bb!L*M>> )3IU/N$`nvZozˏj8->D?`qXL%AT'mC~E wx?p0ѓs2rJk1S)p쓐d\UeUc\1p0UOߖǓ\aI~&rJ]N6v2͊60 늻)C$sz>^c di>=]R;FfERq]/vlUٱWf]vlUٱWf.be͊+vV*ٱWevV*ثb͊6*/, Sv;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*DeS_r24GT\x!Zv:YHUpp%'u2Sg89(WePA,?dP!$~o]eثW;6*ثWebb͊6vVvX8bZbf8b]\U}p+ 6(vX.f]+]D®*j0+;؍VUXTҸ٩\Ut͊..Wb1d;K 0+bԝ:C!(&URC:Jlr!6oo.} ĂV5PFpڵ1\ UQ} P4⮦XdX4E2q-2dڀQ5,iנl Ֆ3$$Scƨ|Lv1OX$:DRk 1WfvbR-bn2Xyz|"eԣ]7)VF)o4q^r: P]vO1*rᴒE䢠{N2,NqL(l0=1`KgZ1S8.b&%?UQUmZ*\Y5 `{ⶰ#uks/Z2MP1Auz6 ̱damA;~Z-~؟8ĦtlpRj( -ASROXKy+ ) 4& NU}VBbc\qN*=,~)(k}# l t)ȱ(vU".#qoJ()(Y8U2 ~7'!$9 RbLioǶ(ne./"1A+6+WcNv1WcqC˗;.).8XRݟKːv؃SV'?ڿ+"p *UٱKbf]6*UٱWf]/v7vl ثb͊,һtHvV*ثbK폖[evlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*3/d'ɜ9G)nP4 B:4v(zgjuic#ThI`64kvSO}W*~Kn"t q3"7, $te4.,lj2?ff\#B>BMTq2U-K&v:-bbbWfG*j *RK"ePA (O4Q?o06vC.WvQ®Uؽj2sָԃ.p!ӊL ®]vlUٱWeUَva]٩]b.͊/;6)vlU٫6*]LUt͊)vjWv9M0xˏU_0ޣlUؘٱWeUXaWfqWb®+.Uʟlv?~Uت\:nm튦0VZ, !u#`2kp, !ƭR-z1"cak5ylw[z@o CB>RbeRi]QF RQ$} SJ&pw Щ1&ȐmU>* 8bf.6*4(pęqV&\Up8.]H(v6b͊vlUو졷ߖUw[]=*)?q?hcaWbLp!( Pbb͊ B0%ka!4 _M]c)U^1G[T'? 3_V潗"U>xpvP2!1bjp)\uqIh Jշ$݊Q@ɫp V4ir2bSo ';$XiYʒlR9i\U*l 'C 1m̌U $,.Ło|`EdrK#.Tn+Z%!=ܐz>j jr>@B[k ʣ,-J`, )=HXi*j8팽6g㋶8CxKLMGe= R>p YRJsJ*V9cӲL4$4ֽh/z=?"<ޢ׎I2͸Nvێd[Q62l-aQ!Pp"lU늻mdDebͅ]O Pذ%)LUtƲxb.؉aKUXٱWcqWf]vlUٱWeͅ]6*U٫]ͅ]bf8b͊/v]qWfe ]v`p+H *T`WcfNv*+Kj;IoaqWe͊6*إqWb1We*xm]Y|p!Oĸ\*T=r*z bf卫WS\*fqWfc,K;(mcKD­60n{`TY-)Ӕѷ-2nEVLY1UF4S;(ƶ)v4U n1V$][bdaC]vlPR̈́+ȱv SaJ1VWelUdqJ< lX˓ ]6-8KYWf#1J;E wfO *VP<7—4*Jb2ӦBJ/E-h*! 4.f )B90KNld=򲀌n"lH4Ʒ+J PP&c.7t_|,J?  _$+TrG|Ԏd9*ly~Inc$8;|LO6>.L6o3[L,OMYTq!+pKՁ.ko9e0ts_rgi&w=td⨲ը| i{t#fnj*i?̞C2Dw d{dwTΜ=IxtX[$8[L,U:>عbXb]LUؼ(??bʋv `K`qWe]ews`Gzv'*—`f$`CeWvV*ث Uxv^vlU٩]b*`Wf®]vV*ءc. ث/vlUن*]WǪW 'W ^,W`F`b.F(vV*Ut]vlRp]\ Uٰv9MqK銻/va-v늻NdževbqWfv=H—c]0]]S!.VY=d(F/F䃲XTn%&EU%6dUxaCbDӊqKxӊpM*bV&W e‡cʦ*ث$ج`2hh- Ldi d18UoEKQ>(] S7bf8`Wc]F1KG) E2Ԡn q=M<9"Tf(!%v.1 XehR9" rl~܅A?Ķ@_p9<~'kK'ⱍiA߯V[r1b#7x/+`~xzL m[i2lB&iUC*%4?D_$<GŵfNH -qq6SN>xSMLQXgbaȖh{T('8!@VY-,bTIP0*s{bag_Vy%V@|ko0 UآǶV1KG$::~9Yda-|-elPt‚qk^L`2W7gɡ;=`6{f# Y<Ŷ${b8MX|@|N{ ݊2i٧e.}Q3;' JN)v06ƜUÒWeWc(ve]1Wc,WcF(v_׉gj7r0Tc0Tq<\ZBan$A\((UxUX`Wf]]vlUٱWf]vlUٱWf]vj.͊(͊ >Yd 0vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*3/d'ɜ9΁n[~f# e-71"-ab?LLCe}b^{*qK)kQLjQz(68݈ǚ@ "Ŋ)b]\Pi]v*_ġq Y;E]P`V?p%Wh }FHdv0!؟IRMlPE8ؙWf]b]1We͊]*ثb͊6(vl*إٰ!c ]]vV*Ut] U`aWb*0KG0zUpU Ʈv?v& +;51Wf.;\)vlU]*책]UR챾*qWeUkٱWe ]v^*R8UUq)3GtD|Hq߮ɘ%U8pPQ[ƜUU1Wc7aa0[bl1CaC+vS_vIKx= RĆ(o\U ӊ R>X~LU~& X.8-C:R) nv8mlm/Kc(2UhP{Qd$1p1Hհ ǜ}>u@2H#2)l«&µŊ['ۦ^9;|?0%$ :`*X<>hɩI >+%Nҭ//# E:R+xunn*ہZƑXz{Cdpf~} WxVd"٭a tvpnr,$YYӒBuw銻)M<2*ʵ®(Z8 UnHIʋ0ݟlZP9I !kQ=q[]InB) @Ԗ=8T2:PS+&ā<0۱١' عVbu Ę\S"Uo2q $\ ',-j !ӈKWcN*n(vc)@Wc,1CC>-Vxn<]/8R#5c01]vVvlUٰ+aWeE;+vlRثbf.͊6*vQ]ٱWf8UٱWf]v^vj?l|5,`ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*3/d'ɜ9H\rSJ6%V7GzFuj݋dPh,N6=lJ.Ɲ) M&+7]?\PUCv*ݏ®] YF,LUv#F}vA`V e f#!O&ثR]H=zư\Ubʦ(v^*ثSv`1K`Wev]1Wf*m0`We]*U٩,`We 1UٰR**]m`NPoW؃VI*ң/>&28av4LUـ]]6c].%vX]/7LUن(v]+];bc)v8`bp]*z ]vX. UU1Kd$Z|1 -6hlfq3WaWeUӊeUӊ[*4U؛ Uav&qWc†bʦ;EZB Mr *Nҹq!.8Z ʿ1쟖%>⫗ƶ Kb Zʦ(v9F*Q,pLC6% ¥@ɀ¦ )ė*F2Vn*@U%3lpM]U+aV'VVv܌1,eT5)t_'. Jy$TdǼqY0QA'@cTH]mLR?6gbOr%T/5E0%v9wZţ^GQj5ż(VN_3H[9pޔ"zx>$#;f~U:]a%ײz2?k^ q*jaVԍGV'# vûؓ,r>GDr$2CZLAbTރQL*-2 }h7kńBj2ZWe;SvZNծhƝ0hA'JӒ[!% u~g|YdI .,A0CHP!z{אXpd KGj䈍 *mWWl*2m?\*a&~-rT`l!]U+v0cN*ءـ]\Y;(WfZm1c|S'oQGr:qb͊/vV** ثb͊6*ثb͊6*ث-ٰWfb͊6*ثbC폖[;;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*3/d'ɜ93 $6r2N.$S:alabU@ amks=Wqp;QM$~=:Uؾ)v"qC*UpK\CKdCZ81KX1CYWB: QAݨ~aTW`:CRMAv%"RAib˦*]銻-Fv:aWe1]/vjbLUt]av^vc+vlUxb]ۓ\]48Uz~.*qdƌ0 SȆb!J*c*u1WeSvX.͊,bW0aWe]b.;*u1We\ccvX]KS 0.njUSLR.4pH yVHg ̜-p%xK.;(R죊ƜR0a1V&n*1V200UbcUjq0 *_|UPLUإVKp;⪙O8va.]LT;Ah)Zaj8 ppl)JVUl A"1ZZ,Js`D%S. 欌%S<٫aR!Xx;+.PRثb͊18aWf]aWf]vlUٺAv?l|k&Mb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*4/d'ɜ93ڵ9lr܌*0^OUYT eLH_b] H,kj2{ԛ!+G\dcCv.\bc*v,*ኻ. v ,)hb}}D) E}s0*ic $."¸D`Web **0+ثS$͊/vc]ƕٰ+b .U٩51We͊6*bLUxbDhqWa& x)?H$wU'<{Iv[;5qCb\Ux٫/vXˁ] 6v^*ث)vc)v<U`b1C ]0+*p]KRv8bb]! ^Llu0)8Es_!F(Rci[͊Fo+oqWebDbɼiPbbb=V38nn ŦH&"Pf v ٺ`lP†V.ʦ*Q)v(5biE(I/xi$\U+U.+J4fb1*0$m|4%58kJ[IUtI6:-ڸk 1Kn 9#.b@2KaUS1>k9YB.((%CWf7l^3.vX0%ŁVeQLPN.F EF ɋAAG}=Nf}M#7E28p!3Xbح5qM;5qWeb]]]LvV)vlU٫6(vVvlUٰ+aWf]WeWe P`Ncf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*4t"el36OZF RHjPp*@5` *RqmBY>9*/9's+~у!N*Cj i]SU5+X1VU{ב) dVYVeNJ $o4 pdCN҅g#utd|8 BÐ2 Nv[\D|i F)hb2 E5&peÓIW^m.Ɯ!]9%vU0*h$6*\)v<]͊]g>a ?͸Q>in*&YX+aM;+v^6 Uc.qWebˮ(vV)vc]ٱWf®͊6*͊,`[.2%, 1vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*4t"el'&pt΁C٨b)Mm.JЊnUJ458MxWmD K?>CdVEO_Mzl+l$ܒE@SI䘪cXs]8UCvc*Ɋ]뀥6< h.[Z'.js 3)Evc:KUؑL `WeaWeWf*챊,aWfc /vlUٱWf]LUxWevc6*ثb͊0],bS)v L)ZؖV_CQ^]_Z:qWeS;*ن*],aWeWe]vlUن*p8آPPdPv*1Wf*qWc*p].)k,R]ثXPv3zRzBq+$ÚmSTbS qWcN(]F*죊F)v0C1*&]8aӊQ, M|9%Sp1 ]n&9 C…ؓ⥼f(v`0]0آ To8&JR2eWf`S%VAIJaR᧎FJWrqt^+JjqkCH[qi֧ B]*`9hRW%f§&n' WͶH"%0(9~r~ewG[i[uɞccu>'Z oLT]  (@<Ƭq=] #2hW 9^I ZӳS4ɼ_di`4ӑɾ+?)pfKGݞRT`A=Q@ȲK~xV[E(ScSnyxoˢkʋ/&~\ɀ逫c0c9+KX4 Pf\R 2!NcE?,[tRN.?,PPh~ <ԷEg8?G?#Eq:"}#$+ E@Eƹ4 |0v[ pdH!pȅrG-i(Pi]'WeKp!jqE;+vXœqWc1C )q8{zGqou[F>m˚Yy?'27 lUٱWf]vV)vlP]6vX]fٱWebeaCb͊6*ثWfv]p1!Y&N͍!QcA2͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*4t"el36OXqlAUw5'lHU Mt9;*j.Z?d[^ `W`bbM8c*1K\8qdRPw q (Jؿ_Z31^w½*2f.|UF*E]`Wcp+SvVv]p+b *책]*bevV(vlUٱWf]bf*ءٱKbf]b.8:`N–+Z㪟n* $*cJ.`;FvVvU0+q®+Wc*vI]6*vc]1KUP v]1We7U٩/v^0D-c]v(5U/*ûI ߦ`";#ŎR;(*ibƑqWeS;(Kx®[bdba 8e([-6 jRP`jaU``Vg*኏[0 zb ؠLPadr)v,ZqD94p\|R1jPS 93{*E_p%[Dd:c%Pm^nFJC.3*fRdY%.˾E+l;-nP~I䉳QRkG`W o[ǡZ8*qzKKY{TJB6$cC\!l S%S=~|mc2 F>lUG\Uu2† *}KlH$(a銻޻We7LWcI]vZ8\Rϊ+v-i*'׀vyjӨ|UrLz@Bc/+;/vV;6N͊6*ث\UٱWebf]qCaWf]vlUCvlUٱWf8R/>e Rv6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*4t"el|ÛM'bK]FSpz1.62ĴpQY :`pqCv$ء1Webb?t7%. ]c`V,i)h+%kt%9jݯ J,$-HlKc,;U\ i*\UXU 책]0ث)vP]qWebf]vlUٱWeRbͶ*Uc;6)v^*졊1]`зL)hႧG6Lxl'+`Y'vnbv`1WevQ]*]/v:%vj]bevX].cnnj v8bc—eJ`Wf] 챊LR,+v=qCX]\ M-*~yumrp~cSj8Ɲlm1UDb8xӊqCLR#lc \M*Ęb(oqW V AŊlVU\@Pj1WZ'ݰC} `s\(]RUٱWc`CGQǠq˓% >Kx 2)7<|p6QlH1 j UNU*r2J5$brF+)Y1§fl}u]lxAAQ5$o00ZV%y^W?%yf!z{?Vo*ƹa*s`K`W]AqJÏOlXҠ? Y؂=pWj/9 Ģ-8 uªo啭>8 %k#Ň\rUl"m蝹 ~݉bG= Yv9\abTFUp_rR_$fAڧ =rlY#*Z'*kJ7Á.=+y,ߦTRML! >dڝ7Y"_fJoϸW;dYc4qH'ȖABc`JR11<(]Fث%Oy.QD-iWƜUTӶB]8Pa®QN0;ٛvV*3od_ׂL ['`mvW4~-a6C˜]J#6*ثb]AٱCٰ+bvV.ͅCaWfٱWf]6vlUx]LA[vl!.,-Rv1vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*5t"el36O#4˅3bLK{vN uU K;N,(v0ʦ(v,ܧ*h1KdLZ8N=qdJIж!T~'Ֆ̸ rV y`bVio~gG$3)̓ˑ,#;a@s1A)Eltȿ EoN03Li Y4, JÍBƌ*c wn*dK\ڕ7LUÒKWc(v6-)pR|j))D*N2} psxY) dy/maٱWf]vlUٱWcSv7vlPUٱWf]*vV(vl)vlvlRUٰ+f.͈͊Wav/vɱvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*5t"el36O7)a^ › U0>H.`?+X v8v&ءUٱWbߨaCӮB2)q-YqJӏ\)h<1 kOLQ$\Q}T~+VfN.Mr]' k+1WbD(Hcă)cv83 *bˮ*1WcI]LRUٱCRbLUt]LUن*UٱC0Svjb˦*1C.š8|Cqp$GׁUUVT Q]늻+v8 beCb R0v;*إSWc]vX.v;51WeS;.t\qEXclUUnlU0+*0q"H*)q0j[+0nb#\i`0 Qcb L*6 E*q0.8Z)ɊZ1\RrC |*~u«"˦;50|qWUXN,F*qь)Z Y&AHIĪ622.iU)XƀiRpe#P @Nh0JLB[tEF!yEC(@N[' K%i%g=2{g2&g,^w)?297K G\ 1㊻Aqo)Yد+PĨncE2B-&T>L?Sy8M͇ı76HKWh|!~F =O_{ HAF80*8 Qs"S4_q/ XDw>~9T)+g![ˏh*p+ClUl q] |L}ȖA v~+)J8#!ծ~3ǓTj{?̍[*/9%- 'ac2)FG#diC>*Rq!r[qWaVԷ#ŀÛ *EÓ`88B]8B%vQƁ(.˓fY;0َ;+vH| z.(d)qWf]vlUٱWf]vYZR;6*RPPإX*죅]6!CaWf\*ثn+ŃC폖]v6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*5tbel'&pt΁N Y%lA LűBB@ -RhO+}eX-/_z'OE/HPQ@ȲBVo\Uzc &OH|M~ᓋ\b`8%ӒWcN*Pb٤C.cp`CIJc5 OAjb9K5a{H(*qb)vlP]+6(f];+]vl ]KB6*](vV6;1%٩*Bf1vV۳b` G폖]L$ bثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*5tbel'&pt΄qG-L{RpraL|bIv\G|j_\0Uؤ}F*[l*LPŜ?oԸUK\MW`A+`KDcձV܊b%c+^VN9W]Av"V#~63T4#e*8VUؙٜ\UA|qC51K銻6;.ኻ2Jp.vlUXSva/vV*쳊51Wf*b˦(vX\ u1C.(.)v- @RЮIZ,qBoC`We*\\Ucv8b ꘥8ݖآv8 Ut]*wLUٲIvX.Sv9VX.#8EbWH*8Ŋ-$ ;Ɩ1MeNj|i LتABƗ tJ=L~>Hi⯶ dʙ4)l9«WS S/ +UTcH Nu^ E~>x d~rӨFrp>ġ}P/\pDKV)jR !/Gc8$s8k+d󑏋ז1F cPo\2Sf3ei {?e-ݜ2Dce->mB8ud Pg#" 8˾)Pc)TďS/SD<'+ŸȪ>-bkH93oan+҃u2?Fkbbk뀪:ц2B_N2 )E(CBYp-X򼙿ʧݖ1dz1H8T3#dɥO!qUK'.\ U |?N-sUɰ_FI]8UG:C0K] v3M??br m5dI§lŊe6)vlUٱWf].͊]eWebf͊]/;1]L*ث* * J]ٰC, ;e]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*5tbel'&pΆZ;(\U?|b9&%p,CC 0늻LSn^LPHzb9PH&A*7zR]g?*\ɣ'*F~фTq`Xh( GQxo}HiE; = ̢ЭbPi\*s*MV >ٸ 51Wc]1WcJ챊])18Wev`1Wf8b˦*U٩ cknLv:`bLUٱWfv-.8c 텒p\K(*np\\zPb[ US_ U\ *®.N(va*p.SH+@1KP);)ǁ];/)vXC]4WU(Wh,R<!ykm41e+L[XKol4m M>;إ_-(Zg-+Z Um1B\@@)cv2\W1W p#WaǻHK+n}"mrw^L}Ւ5dbS3_r\\z* B:0(H|H~<< g$1p/PO1 f/?peQp"|p_SZvZHцq 8P{`F%ccoi.`& xLj߾84'0+w8x׶*9w\F-RFu'*%@n@ø֙R P6„9Ǜ\--O7OO+.,C+^1"(U?ȳ 'Q 6u9$7vFx(TG|_LUT$Lӊ.ͅ.Y;qWcv^(vGma$I( bI)FfKXb͊6*ثb͊6%]];6)vlPU٫6*UٱWfp!Y$6;6 [v]1Cf—` C폖[;dػ6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*5tbel'&p·Lr$s`1]t{5rl]}>b ,]'\R{ĸbaf11Wc}xbPdH0tC".[-UW8.D|?p,8.r6˾f+`Rj]GV]p!وV'vWqWf4JSva]1KثLUx-F*b/+nS;50!|qKS .|qWevn8`|ZcQ&بSc#aWa<ջ݄VժNjȪ$Nv$ѨI®˦*찇,1WfǪ T—b CAvv ;=3Gɖ=(7 mQ_s\)s׌QE qV\cWqLJ]LZ[g!b?HU HәCN K[K9Ԍ|?9+A=咖c: )ou+]@HY;2ppKZcz\FFR:'ŒM#KԭDF嚧[GzkG{<ϣ`&`~&"ݣy"I*K Ո}_'# Rk5^*H7Q}[=ZM9б{jJƥ 5euLY>êH`QSQe}KFx|xd՞ oS6[?d 7<3ʛ|dRT{-`tt۶XY NV*Y{Q"lp`HKV$"S=ME-v*"V-Jic^Z혭2)T;jFiګq/L!3mZb |'9e)L_pNzo7Io }iMI@prqyT%C 'c S" Nrb8Jӊ*7mE8+Z>'"Y+ pxՑ +#?HxCe0t~Y7ӣQV^98b_VSYq〵cdd)ϗdT{em̆.[*pvr p*{)T1J~* L׍y[9q`U@1QSvRq a|+NItRl }ȅKgIrG ~TʭIˋ+`Oj"R:| *ҜI]JXld[X~W-ᖆLÅ];NM p+;(b.)v[b Ppĩ8 [~gN4 ȟǖG!2Wf]6*ثb͊X ]vlPbeG6vlUT]\ 죊0ٱKW"qP졒., 1vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*6tbel'&pΎ%A3o .e8Ir"zbFo)CKېA\.cUجK /vb1Wf0+T#|Rͥ* 1JӊR, 2pAh,cF1;xUٙ@]C"*pfWcqWe*WeRpvYCv9W/(evX٩]]v_Ue] ]ኻpV╌pARvQ.! 6 dDxdr42)Fb7#n8ql bv(1늻H@][1MX+E$WXvZ(b,V *( Ɛɏ[s+LLjm6( iTaU'4d `CeZcǮ*A~5?FVe5 ~ga\mtoՑ3TdzAI曗W+3M+o72Ht21-wzUK=iB?'1"7Ǐ˚+ze7_)Yɍx);-Irb7>9T+[͊#KԎ-]aCnqv8)Z=KUjb). `io-Shؼ0HHv= XԻ7$0|vmO[c6M+ | V?F)]# (-Bמ䗧&PM;^{VgX2)"z*#Ly1ƫjarG_R3_#LK%\2Օר[h&pO4H,Zf#F YsXe'L89ÅdqC"RO|[ӄ "WyGe%]z pMWe!iӅ.We`Cv.1Cv[b̢8yJ]B >YnJ_QfbF(LlUٱWf]qCxXٱCbf]vlUٱCaWe`PثaWf]vQ1Av^edن` C폖]'`Lb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*6tael'&p΃5J3-ITVWp[$ P0Rķ'= 2,]$P ej_^$;F*VN]$eu_\JXE*}*\U⮮e<1Iur81銺Z~# W%q,z%W$N'mpAVj5N@ɡw 0%lU)1Zk_f…ط +UztC k< t+Me/ۉI>W TwdeIG-FaHp Rk-ЎGlYF)ZquqBw&V>ka 0fԀq)uՁ¸F(񯋨q*rP c 8հV2m),}aV؝rSCrm(YdN~#8*IU8 pa~7g3}ebQr? E2†P1T`V4V®8<]qUbJӒj=Ry m=)Kf@k/b?mQ悫a~?XWY9a,lv;`W([TY]\M7 w9;7'2 J鉜v5WcNcI]' +eb\R];ԙw`0Ai톞x2a#Ul, KI?9)XŋHvYmG+v^(vV)v^(vV)vlUٱCWebeS.ˮ)vV*Uٰ+*쬊 /e .8;+ j?l|k&Mb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*6tel'&p·: rԁ n@* .c3|;QavhԌm7dW a`‡cӮ(v+'L v'L*ثbR10+ A+N.8 Ua !IZN* -+HV|N+!fe]2C]LUx0v; /v<-qK01v< vjb͊, U|1We—cJp\Uap]\pLRxrŊ\z*qꘫLjJ*(𪋾 U!EA#^تP` /'bX!ևym7گSdxCqRæ*p]* HqWbv,#—b*ž*UilcSG1*/&*$eaV˦*r銵\]\+ #x,2AqJb2QӾF/Vd 8?LnN)_LcSLI8v'ȜU။.\U>ZOI[G6LLYoP?IV]J6zi 6i*7H^WޤU)p?}+˽3 AԈZeUV5bě7,/=їJ1Wu-N8ABlj[/ԧu6m dq]7(i?Reh}.?S[B7 _I &`╸\PZ'z%0yUxzա4- h'Dtq[ 7Ӛy z[pY{ٛ`\Udc$Kx!leCkQE5pOpCg.QW& ~f1H5>k*\^Iq:0!$^7Ghߢ=uȕx*[ct\\ ^\R[$^.<*ƙk$~nSLm\! 70rsMd 0qrf>8ڦA*b-Fؤ-CCcQ`&*[)pĴaRٸK.S$)`wDžĪ6q`d og \1+J^jr~QP7P"[JDm.#iZ e}0I]q/k%RX7IDG_O >?.xh'6,$Z}4y4ٽ)Zʪk}0qZn\p<7'8]"&cW*(+N*! H&!J邢h%I ޸i-F=ZF 'aYbsSB>9/0ꆬ27Ay|| V9NvoR ETǨZgiI1Z/NPG%fą)L4p?2r,q܌ Mz0*cǑWtǨ)-^1ZS%jxeUq9$8A0 42QAc@Z'H&>#f?L6Ld8\*fa JUaWcX.dه\ ;+1WePUe茷:P}Q{($=Xs(_jeX䧥ECƃ FHUxٱG7f.;51[vV)vlUٱCb͊])Cvc]WfUٱWfvV*PxXY;1; [v;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*8*p[!>Lli'w\C1iS:a]ă /Ml]d_i1%i*5`EG9`K9`Nv%\X®͊, *pƒZ12HqQRkYV qd\R,Z`* N21e0A¹#$4\v3 *`bLL)v< C1Wcȡ`bq.ኻ/qWc0p]㊺a1WW¸x;"Z8%1WW#­WV▹b*=c ţ !MDžTd|]"Qi)⏈ICJ %>BJ~H!b^RYX5b m̋v(2JUXv.W|b9$X-WHN*l'HUx#{a *r64.ItV51WW, R8+5_ f d2&(b?XDݕ?\/S0GY~) #}m(X~)TT+?s|XYu}b@* @Ȗy"bD(~R]ّYH+?F}%|qӛ-T#̗.{c-' EtOiUzF?dYqqWA'zqWy~S)~VCaR\yn)`Bk2/Iaƚڲ)~/r>sH|$Pk(tS!K)_dkZ,3#G|I4倹`KNi %Up:rS(\$*w-Z%Fh܅n??Ur2H6]z-R-"GWt4Ӧ qnG?bpe).2c!I!_Ҝߏ\WEiHю?NO\&_c9H,M@FFm.>9H.fU^"or1禖&#J(4%''Ga߈?/mbӧ4y'u,!t-'Ee4D9{.n@gO*'RGoוwi%T%ϓ (-  oFr` J]˷цvz 2p)}픲|J*Gy}HH>W0:2_g3"p 9G&Eom'ɑ\4x6 G|&a$m׷ϯ>ug))-NUM۾@miuНy.×m -*lui#tSb1a=U%#?@'ӞR[N,kwȑ'Mߜ($lIp;0+銻*0aWb*xLv8&v<&*참Rwi]./+N8&*1V1KXBM8RRqUAZ,l + 1168ǻ4p'TbWs-[iitTc UA`ǫ`wץQxQl}NPקcj氌gco G/,ѥuFo7q=۩OE? 8@[y2R5˃ZBWZ?_r+yxܮdyM_æXIf""j-c_`R_+vonӰ}}u0A<5xRvM¿p/YkcH_;C{$XO~|>F8!G}_aO5-TGяO,4-?޻&\_zݼ`mSv\k*X)v+op:jr@JhRUh^J}F1[AnנṾ#=qW(b,tlfe5BvV}>E1Rؤ-*ʏ}e`V>6jwF&A ]3hrTYAOJ~?kS+qfh<ξ`H'j9&~dap-[I뢏ٍ.Mep( ?k3__K}1Me~*JDYKzM_ˉq1aY~*}ݵkRRKQ'KX[hfc:xH>)ׅHh JQ&]EFPUY`VHd(rTr$.; P%1bs4|˹.|bDu,~ U&R~8\֫5hU'9w}.$1*+":%\'oR9 %չ lGe;[wXAY[s@IaUfPʙPĽak$1␡}[fQIqQ1Yf( }=๕au [IX^cbji4]z )Q|:|Qn&MG7|I4/p8V*v%v a{HlDUyUFƫ_cAnXQ>y=y=@bJa9z"k8 L>Nv^hHޝ' b%4-bs's} Ȩè2cNdv`}DE/Cd&c6*vV6*ثb͊]v^*UٱAvlRP]\R(vlf—f]*٫@v^(vU1KW ]CPcrlvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*7tel'&pN0%ˀ%$d刧er8,+ƸP)h}Oŧ@8o 0ZK  v HHfHqn ?#Ƽ+ >,H?qqO ^ 1ƥى;m.bʠ[q Ƶ+JGk}T^۫`|U w8MbԒ}UFci?^R}퐿7fT98 /;qOé/1GbR!PHbʩ]v<.*QS H+PxL)v8.uqqVW,G#(v=bZ(aK\iivbLwŖB8᤬3-=T' cӏ<*&ph'AaB]}8aKĒ^ѥN^ j~傿m}?! Ko}q)۠q![Z<]UOK}9,q׹{8u@)>̴7T>+"ٍ>g rI!rykS\GQ1l>UN)$Di\Z6SJy)ӫ9k"٤c@K#!#UC#@/Uا<0آ;Gn2חAS+Y \#‹ΣߊIUcj|O4Dkpܐ>8x:D.?*jxDHG'm=kʔv+0~kL+{ZAnM/)E#v$\ (»}9%VQ@[ dTnt-Po{ 92bgc|[j<uX?\ Gq)ľ8mL Xygmu4\7e bRu9%.!&ͺu+ـ{3PO1鍟In\O+pߜ;i/ ~?k uS鳛ç3ܷ9ǻijS2]1DpЃ"švQU.UD`Wf^NU٩qWT`+^vab R--C#,_G#\\zFFВIQ|̖(],'FIJeQoE倦`=6 G>kdFG-FW$/[iE ZaeE?7<2$vټk<5o&_~4maE%?wpO<.nHJ- ݍ"DjFQgV!WkrRFy(H.dFN$rʇJknyd~7w RdىDeM=g8'b'gXy.5"ou~'ӔQzQ44?\Ύ2*,ƀ*e/[/9#ki%8ԖgNN .6gO9$B -]\n9O ?zVkƐi_U@9En+G=>[#cݽ<\T?,B/l*{vr&d2(GNk`V]Lʯ!qbd.aX_:`%|s'eIIʬ=놓 OW-܏p*Etr7A|6xAQ-fhOģ;8>WV"g$ vyx_$6w4V\ k[$0J8?l$t |ҧ(M!cqt([^T& ~o\oFI31)ŠZU_bc_F0Fፌ7wG Y(([d[XA/t&Xo5sw`WQEgplmI*?C# @eO0o[jO/L #b50;X[z;Ȳ-3TSv$$RrP :+FX5*rli AY>#sMM9\29NVyEŦڧp2M-d͊UXҝqBls!V O*G|hih pyژXm]\NJ:a'ɍyZC xup6˃PbV W9 7gaS S iV )"YEy% -/5ȲGE*RA[˨atF kǶ,i*qE$n)Fn}D~Jh9c Fxo m6rpHzɩO#)~JA#ah8q* S܏~G ,L"y 6o zP/o\.NbR@T2%`:bͼIL)bfBzE;MpZ*Pd]E(v( p!تbp8쮘]E1WfqWe Wc( +]\c]ߎV3'BQ/}6($hKRՄsȫ#WW4DoڛYZ*M SU?Mڵ5C;|Kҟ<)^q*F7\_Gm )?/Wl7ec$'Ur-Nwz.q$ 4璦1>=Y\$}94l7$ 4 y;XRʬ@*e?r\&k&;iKh<>'Uf_S0'0үEɧN 33sr1LW yM{USm[Jx F\nid+XǂnuПk Lȹe=C.f6nET O"OR?SZep1'T4E#OHYpheaMI *z`ռ[thŅ 5(?Zg[W.7.#tJSl4ʜJf OLU˨hCz㢌*e*@n Z 43q)T䯽X­OȐIGXo} ) m/_OiSAF1q丈&|/P֔>K#T ynt' Y2Tx/RܸƊ+@r W1)ŎQxBY~A}  .>~&5 !0"j~JGiE3D*?הlJ!znw;x J@yx\韗d%"O*9o`Y+g鱒,%2iHF~k'?bLzbEϲ 2w_9EyG=}̽Z1T?_37,,35=F^ sf|jE~x-'"9,1S敿eN"ǀw4jvR_\D~ Ib0Dr(8byߤ?@f?!yc%}u"5FSagqa ˜$Sٔt هQBO/ Ayk]-g1c{6\>ҼHi$+2xTpѬGkcZ1ُg>7?&K).b9(6A[ƫ*xmb2ZH! OG[C;R7RG`w:u[>(xaJ9Ä36i#ET+hy=bU+=05ʛ~y'Ɋckqv­$S2XOO\*0e1Yw< ʋpgKR00-Hȥ2 b|@AxӃNAj1UتhRn b Hኪ+p;]=Y_!n–Pp&QMqV@\ULDw®_A*qER;bT0!n/ B*\31+(Z7UQuTIW[ZG,$+u4@I'zHHL;S18-oЃm۸;)W mL(la'[t_"|$9& Gv0eRnK;(NM.͊튻;_}qp \KfA6 NK &Y1WeaWff+6*ء PRثb͊6*Uٰٰ+*UٱWfE5qWe(.8aK-&;e]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*2ql37\qcS0W 1%w!Iޤ.0p] rOJ)v<9KLue qPFK4F;xè$)AKGWhg ɨ~Zq1Z[,a X_/ߦXJyt仅cp\TC0ⓚS@$nO"粑؞>$ 1i <l^/ޘh"˿F$^;5«5+c)* \C[,(~xf6 'Rq$੦E0d#—e'6;W Tc#]$xR Z(hS,v-rܞKK[SKF@:z9; iVwZsLhIxPW"@H0X #(F4ԷGG刔VIc#Sc`1@?voԧWGO!'ralk܆(_Zt=C1 #-$ۊ%U,~4H ;Ȫ?BA<ĥB"*֬^KَF4y&8*Mz8xS||SHF[v%4^j z`J"uqU&~M*a[㚤Ӳq,T`CuM A4+LR>tcH( $>aaϛx/K5'oH(TGn(2JB([F:z}Tf#"M$'"9]v#x2V#CzI-횆Xw4?Cq? /)q.6;oi8aSQ,lvHfr%9BȀƃq-ʎwぐ? dzf_DG`7?V>d?p "y r181 -I *?}&|6¯7k+ ӚIOe|r?OŎ\yf1IC%OɽL@҉q-~Mή2u2S'SP^m_W®Go1j$|We]fY6veLv)kd;+SZؠ]OU\{UhbҘWf*Ak!-y) / |MϋqQQ7 l-5';uɿ*33QK%)h^oZPhZ Qfٽ?[^Sma]M+Dc.,NBi%zCN"C, k&)4m>Ҳ`Rhܨrˢ ΩgR[u_a8Ka)pM<a]SYSv$nFdQb"2eU  m''_˞&H`"@䴼Xz1*|\N\Wl.8j* RG. +=B˹9sތ\"8`/XۢFLiAD%÷P~glt}:=r*ދ^c=!d+QpF{sOhсd'c MV[Ym\BHx64?,05 D^ ,[O׮oKV8n~_ [47[%beȩ#m$^$.+Ai"+i:jTTҧ,~_r\Uܻ=Z%pć|~aoS>U֏r^&4b??k[4d&-yOnJ)ц#oh'zTѬLG"k}(I~7ҟ䉭fLjܿJ*yY2.Bfc); Uiklǩ]q6u3}i KN9^k$%hS|pY}COJ{awíͷPn}Ŀi!&;/!^`"KՏzx1 &El:fN1,pnۓsPkRX~Ni?;,W9ȽܷNe̎zjrDې"&oeeb H(TP*bAA=p2W1BQ:qJ9&=z{b#r2\p12I'U&X`?qc-?Bcq.?/r/&ޙaG#L<˽1#U_\@~ })Mi cGL4U=(OȏĀX%r] lqP=G/ 4<>Tݹ[,f}qߧ,d^L$z XL/"l/an(&?~|fc#ح>}r# YIC /ڡ_~3LA_718!30]5@3r' A2ũ)Eue˯*ПRri(ԉA9Q P.!F $ *` L&R͛SC^CɁ`K[ȓbcgKF0:3.Z oEfe 'S+)KV qVPzcN+jlV5 ړX2=x?p@4”PS[e'V.%ZǂK`VTn»`%TnX"~*@"t8O01!Hk j04Zp~xxc֢^KGTzTE2q,)0KLCL+\Dp7)vQjbrĮ:c54 vxG yG!َ*iIvQؐ5v< m]]WeP#=^yH2D/N?k&XPͅ]6*aKSf—eSv^v7vlUٱWeRUٰٰ+Pb]۳b0 50mٱW` G폖]MrvɱvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*.#~'ɜ9$K^C{x44М@b*x.U=0!آն Oх.š(I4ZcA\hAݹHE=cdByAAW#x)  )X̀5hG- ۍ~F?{d@kD}O$ڪۢ3v^f^W)qp?dak(/qU*0W*.3rV}i\[TVcȳ'G; j2@j~QW;"4O v qWb[ Z,0l{l* mk{ V۽~ WƬ0/'7  J݂4+B߫qV(*|`#1mʃˡ>9I/9maIn,,Ѵ.a() ])opFB?LwZNn=8]SӾSjiQ {;$|LncܑXzTHMy xSp׫?+ذ pY-ȵ=WjcG`^WUf >HJUKxGFʖ=ϭ<|?lZ)%M˵Xٿ3(}-2Di 4Fڼ9˟ޔ(jWB* W^uuj ۄf{lmɺS+Ziso>/ "').2x`bjzT8"cF9;[d*Eb$q5˚CtrĻ¼F)Tc64emقa[vK|sedyq$,H}Aزde.2ȎC5)(h8@rVe$Vt[).$o|Ϸ/LW?ܵr~8{ū^)_{ #JOXu0SP!Pk3~rvɉq)cLt]'HѸ L(%Pd&cUYW%yڴ~hmS%|<=0d̊$xlc%ꂗZ3"u-dϹN]S H#l\Q@v|bkI*=:EW@OQQ1C-Ԃ(]6c)B,Fj8ޣqLc([t!@o(N՛hn+VcN|]7.si/9Lhx)^ xߓEsXڞ378݂"w4剌ץSu f0?.'x ~?+AO}ܯpLj/JOLȌV@_'*țO%i'Zg5E/g2ȫԩfn%[N 5ʒ<\q>$n3 {qXDz{lқ|6B|=b `;߫$|ehS3q߫JRΔZ|@ʬۆʜ,'aȣl,{i]>LL4 ^i,Gb}JDr ޟ,(GuC>J Cv m@UcbB*1۳={l? 2x׶nH/r?P$O6'f>8cSWyKnO\$**0̃2]LiQ۸WYM<+Q0"KrCK8@0RMyRO 1X.~B+P)O(_};$Rw4_SSB?fkۑCPʎ>$֥0TqId`5LHf Py<7$ZVجJw¶?*)Nq[Q7UIXuF CbsָQYs\7IXy P cU'L*jWe~U. z_!Z;a}HC]A)M('81U|"Gˡɉ;@0$" P1Ṵҏ#iPH}&|im: E*g}Kip 5Zp)pp{e FXW`s8KC]wƁ*pc$C+/d?7o$9)=b>JN|)M2J`WeaWf]vlUGf]vlU ثbf.͊1Cbf.8챊 b늻/vV6(v~ea'`Lf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*0+~/O8svI帕zr[L};_ c~We۰DsE 4vrَmrJ4W1h~ICLSɈf3r[lGQH2qSN|EjOՄz.rj% E*q`i k1醕؛!l 6ҸSnƳ® ^)uqlUثM#DIӒlSdi`v2.UQm'UOȌmMO}x-[-kM3~k?l!NYx XvM[q_dRJ{ pCCwݎ@( ,5yN)?,WY<*Ƃ,Inxr !7$ko&X[>4O2\7|#`N0; ձҲiEjs7V8ڪh@>I$njD8(LtšvUN(f|qZvbIӳP]:V;0#Nv_/Vmc NG2 E.82HqbiTuEwC1@Exn8b6zuՉfdG.o#܄1]VLL*8 >[p\$q?wԓoWFRDT "$7 p?Mc[JYE(\_?cWlzC?;I2b43#)~F#W K(L*RgiNGHj.6"j<' #h7zZ TryP TWq_`~'9 Ha&*'mtY'Wcbcr?VoO/)zAdNF~? 1V%UPI87͘Wu(lDžb]'#`qD q'AK]&ـ]ʘi.Uk1C(v8ثإٚ>n)]v>8U-L yCV2+dOiZ.C->+^,EŖy6󤴹=2EXGt,8AT1;<}Cj !2־r’ Ve?*oな@KtUAfe#N!J+K}OUST^BF`imSIx2 pܸOmV:ȋ"Grh}8~/X Nķ )ǐ2m"VG3ߋl* W ӫ$!ŲAhwwQiuv_q @kIuZQKh`|0ڕ럯Nԭ 11wÄ &dF?Lq7=9iDe50D:sSJӑ٨H%؞~sQ9H$kql8 Q2rܢ-Ko+[BF#]vrV OJ`۫>?e%ghQ6Spy#A6MaI6 ,/cd d"̟atAd gJlFNҠ@1#)>8 3GJq Jm a&KOOLj{Slk,(ORcF3D$t?~>5xX2_$Kg5V^."?hBˉ2`E(X;щYkA2BE+v#>Ern/87N#Iu2o\EplDL>˟r[$N#B\QG)v'0. Ğ*{we `?~1Ȳpoln]iN1CX{*ȽN K]qQq(^ S¦'QKLHX9iI,2 m.ȉVuo Fm̠4b O%7i?:;(\!„]-T*,;6)vb0!XRءوcpٰ+CKbٱCWfGv^f+N—fv^.͊+ ]5>Yn>Mrv6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*1goO8svJ0.C#M UB1 E شj2Jp:)ZEqe 8Opq*ҴwœZnUrt 8gz~8+Ʃ :e}aHn}!9Ei[Bp+S 5RZ!8RN*WS Z:aWf^-].1ZnbAb7Lޡ4fTes=Vs]vUqWefӲbʘU[j5O|UN;{Wf2 U%0[ !V&RI1Ɉx펇 7O" obbKY%?!kz/ړ#^achKčŘ}\S"sve(k@B_؈tF)d(gV<;lS-]J8I8o2+?}V]`ebR[Y#@TU1,1ϧ;/Rromk6PK5:rh'X'QLqIskZC6뱏U?֏,~맄_})ҭ50.%IqQ/Q? 5rME(RTnN9}#(8Y)DyOA#ɤLXejI$R0fcxc: *쵥hz`XZ ߄c@h'y=GNlZ.X ,oi D(5qY33Y*?P"Go s ^(ؐy[A,q//IKuw+ĊT_x@"?/%P?4b=˙[__Z `#l}W"8|/Y. (e4m8[wWZ(~')RD/ofCEQ,rzNoLy6}!~p{"pq6Lca]zAiyAŒ,*mqCvc.*xBC%# ]^PgOoꍺ~,dCDF[󢱣"Cu/nRg;),Ľwc.sQ6,7^lq"녱;F]f?:bAhqu옏9H019B>SC-뉽?F6r0+l,bm\UٹӦث~[Xq*V5LZyf61CKϖPdGsKݺdRTLb#X էF?N떅II%!OU#2$`xT¯ VhvIOS `OU6))c)ZyORjoZ4J k8DtJܥif$WBB"П+ H{MWZQXa«JbM)FO:d#K!"z#J#AfۈPSHc_.X@?Lїzf[(D,Rx91+PmZ[u"795WƗ\UǬ-S)LPfYH[ XSn EnhZ%B<\0g#F\d%'(k6{Tj~רﵳ˜ߎ_`H~ąOb2Ko1UOӏXd%vJna R195.U9H-#yfn1 bE(6*]Ӵ~sKJEz`Ŭ]¹\qJ\ޯ-.Q/Uekщlo3C*,r1%0l#r:e#`8?Sj /O>VzW'Cv 9q@_G.Y86i0Byziv5d &KV._*yQrA #-p;=JpFBÒ&%aA 6 h*8:Q]8YL dJEC`)lerv>$LD*c Pm0%1We]r@ن%]v0Uٰ+[T%Df8R?<0m^/_Tdže-?Pm :cu["Ԋ#Sؚd?"dG[ATCs4cM7cl?W<?fYXT+r)pr\yMj@] @^21GXuPcuD( UxSj+B|[r0O1-9j)fI%>RM!tad;wHlVةb c'ʰT[*k&ۦm\ P5[XUavX' *'c`f9ZA̮Հ|0O4@81^M֘ƌزoUƳ**QlUٹ7lUE*x-59H(G؀G4=K_H?mc;p @}S"Psh?x@v?>T/O-⬽woy5xß ?IYo[۩'rE!Y,.}\dHXL,y3]0 fi_l*pjv.šx(ةPiQ>׉0Y6> k O5/C0: 8eW62 ,HSqĐ?i_~j5ⱊN!JˋFÈy.i QҘ@î5Mؓm .qxx>an#gY3GҴ* 9]6K۟_F݉?&u</="Usp?kFc)+j#o0?aR KpjP3D>6OV2ɉ aF<2+^ fO7¿+cbTtK- 2zc5*)q+I 6q@v"ie+4('i\ k"D5H e j᥿ 'u4AJA+:f`{prކ gg%F*4edZll"u+k'(HA0,k%C(!~Oln4~nC|ArO' 6Ad H^ RdS" h=z`w$Tlg Wr6zqx)8B'!理]քF*c.v2\qWcHӱY;.;,(v'L .?,[}cQqg.?k4 :gqik tLpDzHQ0%vjWf#vlUT*ثvV*զ]qWf®͊*Xb͍51KP*ثWf]vlٱWf],rlvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*I&p;e Džmgge[,c1bӦ 2v4u酋51dv,H%izd1&v0*쪜U٪qWevX®g_N(jӸPFFN.N We+%HF\hv9bf*죷\Qn]|*ޡ]J*fI)\\U,*ù1Wcw\&7+(v9v MyAi~Sawڒ?;-I^i2ڋa_^qp}_X:!b'إhajFhקG5Vk=Iڤl *EZkX헄c'rO3~`:צEUXc0Sbzi~xRQP Po,)vQz`CJbͩ,k dO >F@$ b:"}<<܈KB:;04ϔגfDG !Xʟg ;}!H: R#|%r`;}Mz3<\~?3JL.οD?,;IImBף#1"9zMmnL$r, R.skLck).EVOtGofMR\ "1H $# S ]pc}:@.ń4SkXi.XYlq>>c$p hF0'fLGQ TO+N韓W-8HjA(dAB1h 0~+8g 5ƨjIJKk<6,s1..3>"|+@lc]%jh=Up8T^-*q u%;1-&,-]\{\IeA*0?Ϯ |o]~W',gRc=P %.9BW2%Hi:)N.?d?jw'rZh_}G^cǙPK|bǾ;N}CEALPLh%)AQ 5WF Cʯp1KUٙ*)g;+UF$?h7Hǭ=AqxqrOOauLx+B(PC/dBxY}C*m2MJ`2ku,dsnik?e riNNu+u"KlA%??2H9H|ok7ħH?ռPtA๷;/jRk!WE'Fc4§ B:p#m(_ bc@zUfJu\R0TAwzJ[!?'>3x!\?±}]ԷՕmчoONǒ4r~;2>nQ_L3ӞD?EB*@_*%Dnpn=>5̑ZM+nXᮧi:𾙤#x` >4.D s>SJO.$O.uV<-G5@`?jh4C4AAJiFnDgziNOݟL$Rrƣ_|6t$A]R2o\qJ!llZSVۏe,xkw6W *S j[-I0)4Bn5ܱ/)m>|2e^hvi{Hg*rL~M0]|]x*xp H(v81.dž#knqo9+O`k%vEA>جwIJOl.d=ErXp S뜻.3[<0 <;W͢$?zGz]$q ,pE; 2WS5 ^ 7+ k^@A.93F[~l_EQT!Gf1_N`\0;0lg/C0i.qȠ'c1‡c8.ǁNWvPjo,{bƊ6*|LF*Xy)tċƇv;^W`y/mVX"wH瓖'Ēr|D!m<1=90!Os歏B(y- ЁHw;DgSFA7S2`ګW3Kw!Si|—cyP®.NvQ5]e qWbewһ s{'Pp7n ; {vx$1N߫+ %U z0 4HTZ1Wc*Q#8qh}">RPh*r͑2be[/K@ zBrj|5]Э{VIOuܧ#~ղP~c?H$micKFhnd2۷qG_Y.մYiNeQ>LǀD ($[Y]N[wfXپ_?ehsbsv9/?~8M1lQkKk&~?lum~_\yN춍70^g QͿpHmVojQ#ZݛsUR?v+'Zb4Bg:IRInSB&0CKWT:ÜO%ha~Hh(qЊ=wE6v! S$ZfI|2f ݘ_C˗$>fO) [˓Po8c % mQӕ7%,φ_ 2&LUEIaD[8l &,IȤUWĚ۩8 &-wV邠)Ҩjn#?430ܶ^3N,Cr44>qco!pz?3>&4ol"t‰$@m7U$`NkWTXH46}",%B-Oٖ3a]1ɠ¿1#)aAW4;TNZ[T}VM0˷S1y G#pG_P VU^86;{=:`h!`҂2.RMK TiU瓕o,FJ$ Mj; #5 .t"JThJa =F8m* aCP0b#.ˡث#5X0 |qWbt!cZV^\j9xW|xO1P$ ;n[p#ZnٵO]ukĮ#HF㒆6{.21$w8P)Y"( }@{Es?1$hR~_a1VUWf@ڬvƇ?ȉ8^I͇Z=~ku:/Cޠoy.hѫ\ 8oO_\dy_?rȶȐD$oRӯ& [%Ae/à_ld\qO*n=iB?K=,7.`qKY| VdRʄxu,"1un]xӮ,E/zl# ƻD2@|Ex˹Yvp?rwՓrHonվp")GbNI=O6 H ,4߹fZ2XI'Qq&5:]"S27Erhv|r)c81/*vtR}_}-Ar#fN$Kk}^jwL*bnۯ6[9i Ѯܘdr-Z $H×+]֑Lt~pI!S'nË!aqp|*?pP{STP%FYR^ij ew­ v9\TmpdQP*^'ŷGߙSoRI8㝫pYX\|_,yQpmbᲁO Scg"h V6ǐL)764;7=I&1i#dVq/լgau6bbv$ lܲ]Q($7_lvڄZ|?q:jZ~2I,3VO_p[#1/c2}?碾 wTYF4 2~I2$p? ,jĴ/`}{G/wOR):Z?ಱS;/}*jÛy4qN?drKG08#\nGksbXHd`#Kyq^n7-=N9^E:`KDS@1M\܃lC7\ۮS!A!lc["cv&ء@t®]LU|k+(vS&*=ݴyF͗ wSFt 7+(vn8*ث+ ].]bT(ebͅ]vU1Web́]vlP죅]vlUٰvl*`Wf®͊ >Yl `ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Hbר8 (iE2T!FS!Aք?~?j%*?l!mwq oPo[qa PCKXh!O_ac'$pVpvBP8fsV$s\6l4i]b͊6vX].R+v47{a;,)r[;K]xRһrmJ KV#dqI-`5%D}OMQ]L‡c+\U]m'uv"EpR u3<3rqy)C@u^Fߨ'^ygeę)^5#b~pOLhCOX4 .@?SW@9(ȹ5ԭ$F_ㅗPa0?Db5>uS5ddo!*3%6 bQ.br5h9/S(%T~exOܺ45SLؤW}YI7%oooS|_jE7+eR *Uj )[`uDq+pr"חar!xiO̼r[^t}bG{84o#HH7(c5+"][4|bBkɁnh/d 7j_ \5wy\E I`*6cqrj! Q# {o*#cz\I8򷎌z$nx5X6'$] ȫWvW:aM;/4+N ]+e=DM7FOrBe 3G=9FauG 3_dS#CzYck70UǨ"G,G@EF#H7D?+RionDIpkk-5_p7?39K|@y eK^KA C+Rr*4$2$J:؃ܗEjܸ}oclC$*wT4od,p2nS"9uzZ|<]EH=ޝ+"(Y;I$HO'?Cx08Ukgՠep=5N_9 %pxRK v4GŅSM׈h2F$aGsOp5I•\{1Wf`W)v -,Q$S &td?F?nOs@c홂3nv (q b(B;6xQ[X]\sR7|g0b>.$4WSU mއEk'K8_-Ο%8eTnḠǤ,tIVΠJlO7;Dܤ-0}'#7(C 喑I>?B?_S' 2EG!0 [%xIPO$,UbcD1ܓ8Bӊs儥Dx2%Cuʢ(b7r1+q (´Dgw}LxU/M~OmV-ء#p:P? q?ޱ;ucڄCPW>*ip;9w"w .Ba8̮8`8mioh+W "5lo(H[ȤF[&]G/Կi?oiOי$_d%U^nBW}^>}2%,LE [Rv"\EݼC-|\pqtM5y'kA"9ɣqρW`,58_g,㭋DݥZmPwlZ|YFk*ܡt]݂o^!0䥢ysE㼖cMH+W? ,fM#"ALc%.n ezLzYS6⧩i`r l8Li\O'9_! KyФ^uщOU)M݋|p+6P(Jzbf#n6!MR5:tpq;5TGcW] 5r-Z/\UbJbS)- Lrw튵{v ;XO06)r -z~˄6"nRgCj`Zj2mQf%Hf9v/X2qOW+â_MIe|@#\*O,#LǢMmGYǩۥ7_#De痁]614{ID`&s/Cm'͞cub ^tqfVY3yPꀈb?ш&q=}i&e37%("dtwpL2- Ǯ**v;"3;dximؽuP;}&kyPCn*#f)_$5)ȏc,j16Acc1!ާz즡?< ]x/L(r(# 'p|`~`0[j<6Ec+ ?wn'!SnzEЩYَJc pWe0һ=Pҏm=S._Tz1#'1MqWf)WvQLUҴicxʦ*hWeS*RbG ];6*죊1]8aCb͊6[WfRH` G폖]L$ `ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*I7dMękbpRٲJثWeb͊5pbvlUٰ+WeQƙaC]b A],bVF-WM(F@0Lz]z[ q\Zec5rx!HmI끮iEƩ+ԓJR,UEWebvbqWeWv<-|@+[vpI&=$vcm3rOyoƔ& Q"?  Y;S I(Ե2I!"8vr?*ܯN# dSc_XM~Y!cL~)jr.w/m+<>6~*OJ+HY{$ֵ& Hn H3xW˟0mΪKu4-;nO#/zsRk) ӲۭY ?e?eR5b/-XZqE?$ֿ֩u"b sy7?9,zki|#O+ Y#[82ߕR=(|F`{J7~ԟ#~+E:zjor((O]yԴ4oMӢ%UWI/qX#SM_mo\]ZT| }^,߷3m9 f,ǩ=NJFPv[ib U؋/F٩\cA]˶(v4Ux .$d괵6iaB٪e2 AE! PSdIl5(ЩU*&ymר]k~DqUW1w _VBݎ?.E=c2dX !7K6$|M 0;<ȱm }j.h+ˣtu)\v \LV2fO4f_Yw#[<[n[DKq`qBߺ߼ |mZhO+ᓉ1xKCw<$x"O S_R5#e>T'g=2O0C-3KVIgDjl-( ŏ?N12-Y-Px!K9'$>&]gjbY qZySWqXw2H88;D~N?Qdr)u&/)笝_%ï/miezVG@>M/7߄8Ž &&9L7g?$>OӮd3\#I;M vHYW\ >e 5&'+S5TkɎ9EJ:+k|LDUKQ8ɱ{c* %yGAn9W&&G?PkmV ^+>ԕ'ks\ -mGHڣ@_ ]OIk)> nȕ֨1`r8m~8kW0+ a]x`?9N`n=潦:ݟx?ҷLU]Q%n _ IN2üsGɼ FKS1H{oOd(sEM86_S)inP۱ivQ8a캟Pp4]E3Fkz6hv8G67p>_S%VO"*{`o(Mob3Pj_QMH<,.Y|*-P?Η]ŵƣ\}sR?O^HŚi nbrL˚8B6  PF bk7p #xPdWsFb[n+:`ܼ+?G @#87M)]%2 Q\9İ3Hf5$>'J tW 1WeqWe#v81]{튗`[inCn{(jH#W$PM,)>rݙCNF>d'&brN_B"|egAe Z⧺19#8I.pAɤBj%I#=)Ҿ%MUQL?;=Zwj&#Sf^Kd\$tyzV4+"*Pr?N"5@kB}aŔ+|HrGnPL۲5NSqɌb?매Sk}(6mc{}U[s %xn\T{?<z4W/_0eNJ8[ .g<ũr>{1\F?e`eH;nIC~N ›aBpGcR˿|ݶȘ٤{wU,@k~/KNS,?&æZ UQ͉;l{[T?ݚөTJq`sa{?hhս?~QT P+Z9 :wƐvMIm_@x+Z=Ɩ֑`(rI|U{SKn/ZhVA+bPq{ծ$ЫI-:൧W-tj fz j&Cԋ}F'+JeGM!5KK."X/`W\FLxdB?c r sQ2RX݅N'lU+E pfvv+/vQzt"0׃QA,L浔7Q,)ٕH^3RQO88QruNROwpWPхncqKfUG_}"@)[aCblh#tcž&.@įiVڻy4$I ?um!x#dp(fDžFLPqWcx]+])]e튻WcqWf銻6vQٱ@vV).qCKbLPm]Wf]vP ءQcÓ\2.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*I7dMƶ*n(vQ]vQ$*ثUDWe(;+\Vݍ3c}v)۳s㊻0\QlٱM:M1lV G')h\NUa*=1TP0R-aŒ5߯ -iQ~A+y9阺/@01pV=q;bJizBz ܏@Z0ZWRJXSqKWeQN*Ut]l 1v'ihגqh?_ɝڔ҈#d :Hcwazoط_5_ ]]Jl,8sO1)޲PAvq_jGmR}!p||>2_u%ʵm3"EgZUͲ+N)It.CFdv-pY$STkRk}b4&Yk[W[ĠFh ǵDy~UoEjBG~?f5o7쐐)%"I$VO h\l7" @!Ϸ88|2N []y[C;5@jG|S5Oߌ dI{a՟.lŏ{?Ru I z'\v?ؽ@BjXU#Om="jMQ͕-뱘6W't2[ $QwӰ??k tzvbqb:jOѿa՘dqP1[o/pS(+/7%_#R8^F®z]+WC:P쪮*NGv&\M;C+NC;}  93 c_N&`m4-u8uDS\gb}F'6P|y?͏SB7,Aӄ"s񜗌FL:.O麞8LɋK tl fZg}=z4ML"D01B cYRĤc#g=I$7͕PDQB⣠70sM/Ͳ4PcǦLH_<eMR2B Og@}-gKNF5>H~hۼlbJ=GV藫K|q9?iqO'?jJ]@Ey 57_&XşT?_X嗇0qOnGB11WN"`wW;b VOC탮u:h(`ԞfLp+@DG38\U;)jka_ 4O2 Sq,(H Eo^EӚkj4tzaR rpY`7zQ)mW_P_r'IJEtu7Q-ū+YEnJۡr?FKG@6Ki>֟Ay?8QhY8IJWlFBVZޤ4zWV쩅'%$P a8 -]WWfe8;8v*5jdIA5ͪ_MmfQ$7+rt2pkÜ~ yhnWHg?CC$*?f2 ʆcus~dd<+zj#K76i.2kǗOjDp+'k ?O'ޒMq,OɟoU>:ܻu@zE =6iAuY8ěM;?UWb ]/*05CǖQ [Rp%p\"9؈я#'`ѪR?B~}8v{r+6dॾNXD@HBj@ AT z!fk]]6*P.#bKn(Zȭ~_ONX(%iI2??1+kqFr^q*⤊u0l'\`QJ2E,ÆōHuG.Er?DKSO|U$x+İγp,mӌѩc+1bju|Ry'DUBx^H_E $m$[[5엡9#/øK%~oY(. z qS`_-x,?j\@2iEcJW]*iR|R>-;u~x[vҘO/ 1Z}9x[$og rl17[v(3]1`gM/[o#xVX;-G؋I_DŸ_Eegu>#IrMYE"qvgi=G!r6ͅ]X)]Li]\r4eq]Wv0+nƲ.;(UT].́]+vlUٱWf8GvlRPٱ@vlR/O>Yl95,`ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*I7dÊ+;(a]Xav4̣—cME>c=w=1WeU(vXfiشzs:"=$Ui Z2غi#J1=,?!lXD~+Es ӈKKJֹfxWz~^ޝ3 6ɏ|V@\I—V~8m)l:dXF_Pl0Wg ٱWfQ\Uu*].b7C&$)X4qGʖv%>MizK$ZP9nh)\:k<QFb* >s9|JH[" XRQ!A(Ĝ~Ҭˇ+科OG^ɿx6X!v/#s3+>sZls̷_ +ƿDՔKK|͢j3C{G2U][q O.cu6qc-%e:EVWݎ<}O4_)ʳu-/O^'ƟiWOдAUah3S|_tSյ& 卜{J_ݧ]Vph۫0ɗ_̡ Mt%`c1HWmmϨdi w%,Nԟ|6'ȁT* vIWeq K <jԍ!I8m$GXSTD (:`~qKy®v9&eh0)!e؅e#Z\i jHIV,NkLIXsJ;&IbFP;_q_DNR3|8=@$*؇eFDy;)n[[$/ uM݈s[EW>Ttة<8W(hG^"|\;W4GXO?̍LDmY`iLCavQ`v|*C1~x!>Ub*`uqSVan"B5msy ?Pc4~]Ra?-lӮ{ ?q7}h×(<9#%!H lb|'fU'vn$bC+v]qWeZ۱HiUcńnFTXڧL4Ҙ?tՌO1il|bEGެJƹ>87/:LYc<Wfw|I~Ɣ̹-09%bqZU vKuKo.a;x}gSeVyRU"eC"u4M?mUa";U[kh_Wb6g~/G7: G Z_ZzѴ7 F9L1Ƿ’ʿn_yȉW21h>ztqvĬ`yxǷU6ge]²PrUm=s<&7΅ 1jVo_[q$}bH{;Vo^@I<_P|z՚E-ƅ@Rw841)5 ,O*?nw7W!oU?V98'EŒxR??53P V\1mre2],0ŴSr? vت|"aG6II1Wo0D*v&p/d}Xbxc VUQd0W1#ڹDǦ_j*3Z\*9Q@y`R>+oհ7YD@TI ~.&"e&cp \6lp6MfܟD \O};HjmM[ʮv5Ev:3t9T\$㩐n—f*vV*ث<*BF +p+1[v41WcH´i]R-]ebf]vlUٱC`Wf®͊,I,`ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*8KcWy{di݉za[v7sm,D [F8-.*kح:"-% U@0Jh}J0 6$L0ҵ,ц6<*/J|4/i-qZc\D(l'N3jߦz7[pg=NVUN6ɣE$,LobnqPN A(+b Ƈ+%'ZkP?pRm[r^>q-\;}U%[Jvژא/E-r!;i|-<[b>ㄷkx&^Fh!Bϧw;m>q'?}[o >9PٺW䚟d8[눲0 Y|p%\0SvlUu]STJt3\ZW5<>wjWvyć;\?{) R *qVo .ns~aNP4!!>8%mio??ȃ|NJAͨE2:v>OmWI6@ei["Gb#o=G"ZW?oCrcx״k%Q|=? Un*+VNNXaDdxWk|@X84)niao:Ē:}Katk=@¿>iWpo$2;488!EU'FkshN! o\(vQt®S8U|N)vQp6j} M;/kN ^8A C|QZ+mrcs#as"5\kZr,q|a+%9ϗ[tLzaPR{ +kv Ĝ!΢A_Z}7dIT$tu`|+ ~QO˹8ikŦC+,(_e''!/N SM2)/SyV#B~7?('ˣaSI*U[;"eo~^MM[2j\W(GJlc?/y߿",(ӧyg>q/6_ Wpܥ0Ch?Զo7D[[mOFc5.iVpE?~'dwf!==.uF ;5Ļο9 ?IV>  2e5)8SZvQl*p WeW b:w )ȱG;࡬KFC'pDV%qz P(\$yԬ(@+Ezv/6da'Rdt7i;֫za"iYm}ی=QLp:`:NU ]h٧! mx1j'mO,,wf5bO-2*8vWWy,Џ3,S!EQ_owqe6T%yRWO.2ځ>Z!z-QLgq'8\֜G\azuEc`<1KUlzN)o2)4#uoP}-r*eQF1hP{ W6 Dȩgvef [ΗVY6YG#+?9Y)̃cnKo-ȠKrA]#Owoʈ}Qޓɯ$>##8wdvCЀ-R-ЙO|C aO$0IV%VeG>"ܳNrQY]Gl.o.L~BÊ|SOYXs֙\?ݶ_zrڧz 3qQ޼yzuK$2$[uސA/2iA2jSp12ILLRUUىqqC\g9?cý<2Hv>/Q,L5?f`rgVaaCר'k'#čc?3[| ia@Eƺ6PVt#'Qvoj_\n%9~{&.;*ثr#lUE)vQzC0]-آN+NwƲxr  GVĞGk)= xƺ|1y RY##'23¿g&I[ӻ-b$ʅv;N?9|_m^Y?5R]d(xzFDdq|?qchz!p8Ul.dVďK dZeIeN^Wd9EB""`00h}jƋeG~۸(? +k["3LX)E bO(ՍSpvZ} wq\2,'mʅ7XǼc )9IJ{DV{2?}|=U!9ijXX=[&Jٹxbf!O\HK킓nD4ᦪ-PVGX[fƸSg?nIPv6,[c[v^)C 'F_`M>VI I(8iiۨOGq>\,TRWb+0!MiOS#* QA'K}Su !?욘Wt6W0Ձ;֢`SXç#Iw{`㋀µd(%cqSH6G)4њt_~\ {}m?Q4g9T}Y1Iխ$`xrA62ͣQ#Kn3!+wK,t RJ0p"_WGxxX<,XYrb*۟6["،wgYG/=?vuXZ^cH|)᧕٧QKyxW37l$xY_J̾]5%Ђ4]ڟ'ŰfWmZ5W8rb;9 -yW)Jn$TpjLM/-A)jZԳ&odecbmm=*<@Qe?Ͱ 1lUq'r: (v&K1L* .sTwgr6ciM;-MثLs$:n)y0DwMvvO,!Ch\/AtnK0ھ}=\?qQF_mOa23d qEiӒ2~1F1G݇:~X.u;#/ǧ^B?ڼ(dR{ekKahtg# Ɏ?L1sg)F.O 6jRIJG/eG01bW،| _zdxXxd5SL4ThP췉1FFd cqJ̀wW(J8I]lyB0p!NXVQGijeb5VXMXc&Kerw:^>6Jz9NtMoF͢ħ囔S+Ǒ5jv`fk$Zڈ.w?8_Mib?3Oh+O,jUbydᅗm0^8qO1`ɭ}F`Pʰo\;ſ9}gueKɷ F8drFKmG.M)aN_mxy}Fxa?W7WzaZߵ+|Fg3/j_O %6P{_>&<{pf|X;*#%Ӏ7Y̛ɇˌ'k ޒ<?1TMcq76Jǩ'7 )֛0iwSEFJq[9Q|X?]v%z!V^8 Th8xOZEu X( ?_,zAEԐ ?lx|2^ɲ=ɫżV̖pzߪ\9<<ΛB!BtM-o)yl׎#&q6#Vӭ#_s+q .#hu1إp^[|8 U?v?Q*(.B +N1ۤۼsWR~jP?$47^Ea=XPl( jW&i6ƛiyP@W.udi߿TtvȞ(vc9!S>B NI . beY;,]6OlRgA!ÒKUٱWf'vlPb͊1v])ӭyi}G/rg?/.#/x0kiSSZ_OhhSfcȹ0C %n)Ðv>&ˎ[.͌7)aTg C,O<;5#$FjOW5Q1D d<#x\x u,RW C6'b3'*>+"Fb\M b늻ܰ*iF(|OO6%ו%mp%٪p銻0Vz8dbSṈ; Oa [&pǠYrikHWeᇄ7$cHuYr}_"=ʥ,P]_% FQM@=Vq @WneWZ[m\ ];t>9n9m.% X7PH*mI#mM)\dĹ\U|ӳzu xp*®́. 08ى. /vjbv`;CDס4ecG"pXPŽ"9׉vtȖBA1f$-;/WfIv)?>{`G oG$HkBw>*?N<-u.{p?>'M7Zj8uqB1MGz܂i_ 4m*ƧR'_,>  5?vkFcIg0Qr8y|rT#;cE`.WJ}\ܷ]mW$dEF=)-5ZzM\,x#w _G~g7eLJ{CRzGIq~x٨/_GQ2V`8=Ŭ~X+n(g!W.xЃcJ↵k˅`K{Ӯi¸.*D99 =0jv?!G6hC~;?|_SqO !?YX6*jKwpnSx`D_`cL:\WbM( Ut]vazTW*r1Wb*pÝaVv[Ɵ_p\ Q*2Wb*P|/.?M%n_N+_qNI 'k{OꖶԂWQ;%~%0#DŽsYD]:];[8y1=I9oLwIb E/#UQԓ&YV%/! $ns_AV H<d7G7e1F8\b0H§<>q;k|kx7G."9X3+}tkQo;ùL[K^a]f)vm\P㊻)EMqWcvQ%^I',@b'XRUO#sz/ ?% x9/;);~en~#XG'`i%i XIm]1We *We]S]IG vSuAɈ᝵v)f5Q5.;JlުV&#|V}nNlO ,TEJ8]"ڇS 7J@_Q@>CWաa_='M8Cx1R< 2VYC [P[5fu M>xA-=J(H/ޫr-NVK ņdd*DYWc["M BQ9fț;HzvyȨ >J5Ry*ث]6DQS LVIN ~|f`.6Q(clM$w*"7Owڶ`FW"[{pdeSБp$oU%G$)I+G +1u1oU$7eq |$rjϽ?׊}G;|oU8-4„,C׮ӲWejiv]q |r5\v+ :Z22p+uķWeSu%Ox|AH< xX\G\Fmo.늻KwhSҿeOn/ F ۔/."cG_Qr<#"SKi"N9>O͛$'*>qb7nA#/ժQik>Wյ)2?dlmuċUH5c.LF17̭q!K*|:r4ڽCpݷF<[i6qI(ǩ?`.U2늻5qvUqWfivZSQ Hb3C kylzA <"G#n, ?ݰ߀\DsƷm_C` w2e Sj#!4aUk’a+>y$cOহb)WЀdHsh?yeg-G /ZV//邵4XIJWnCY#_Mo'=(]3ʗ,\"P{kOVWΖ7(Žc+ 7{1tL(j%[)rL' c rUGnIlz;T <;%? FB $2^_ /R?Uc ~t O9 +`LzMzW nݏ{0R12cԝ)^.)vPjlqb+:e]E9ԭi6^R{Lj:Va\Bɧ.OE9Fkǖ G+v=pk—fc]y-\I*A،D-^5;3Yt'pa+<[cIڸ&4*쮸\Uح՟4?\ِ-8Ԯ]P~>8I4QM`CB+cj yGԯXmk/K(.r~ȿGWgҦtqXxBQ0JtNA9H*hve?뀺`T`&e(v^vV)vU0Kb͐<죈 WF*c Ubiƕb͊6*m]]ڏ, rv6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*4ĉJr cejw(Xۃ4|]$J-O5pT{wA1M#C'6u d`<./M*.n~~xH/%r6qK /u2­e*LRX< RZ'T'Y-UaFj}4qSI*X +kSJPx@ܐ1SBip>?֓&M pJ?O|BKNIGAӍ}M T$fy "~W| ]y( z"" " ~|1żjI%= |r mb+WZ4I;~9F(bG|)cXbe`Wf*v`0E] ®W`M6[XדaI?`;#5V 5OQݏdZwm֨d '?" b88ZLbe氷k 7DohN\fI+;z[ ,^IVãҘRIf=wlz혎[GFnG|nhQ+Y~HOI?WQ/Qq2ރXhSIw#K߬;i6?aL?KnS c F~A>ʟۧg͐fyt)vQ8X]qWf늻E)v4 ]';6*ثbvjWPo,RLU`*ij-ICU48*+n^Ni/1.R)5m8ۈ_G'&'7)*>thw,{8ď<>O#xZjx0?qqW2)_s#Kخ9d-xIu })ոFѷBIۚLQO6 #+.X1;Y#At4Xl0 8G ai!?.P35Ձ/i&ZxOӒ G/fu;M#WV,lܮBe>,F[x~ ίak/qr)}&2?9dORqUXxJRaqO#OC_׼[&&-A>'?䮿_(1/Ck[|DW5IX9]_nK$靨eg*SVUu?`F)Dfp٫] ]صP [=(VZWr>9 F۲֕pX[|qg(=xay$$ϭjPgR5/ 8N.)/N KīL+$Ƥ'-cnHAe9`s⺸31OQ7Q*oHG QQ=# :/b#L^a$]zuq_O): xwݗ&qB4c<>5darbx~E Q%iU6vV6˦*Exdm]~IN.X4q-?V&Sg!*v2_eǨ#L+®ZblUXm.6Zl&BR64 sw,D; ^8F]UvlULUXWvnx Uآ(ö,LZ#eFe<$r.>cb]Zr#|TL7>X۲815ٴ-=r_ Y1qC\,o@?(_T?zW(ŧz?gǥK/l"}YPB̤5`j'ė\/DK H!ˉ$oPbn}Q.Č1b̰ڠ(f6c\ LaǷN\emY[{pz{zq.Z!_Q8d q#ksgvx_Ve%`m'Bt!<{߉n/"PG+w&.VLDloَbǫ\U3MԚNT2Fz2)[rQ ?/etԅVԗ1Xgէ%X}_q=po0nR죾;nЎx\*^aA-M94m *We$+ wT_Sx/ՖcYY4^[m+/K_}i-Ìh{ȘbKXUF *ye}rwfw8)O4U)~r/?iOkb(|2&צb{b̵>pN͎ebe*i.͂챉 쬉*F(v6p#+ xp@\4ڄ퀅vVvlU]ˡɮNcf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*q?,%ȷ5.ف]LP0+ rW WY-d~pfU^bdE *2'1%O_IZec~xb~x)VY} ccՉ}ez|+^xz6 R_ZN+LUa˸ 9?LS,?[b̟ߏ *7Ѩڬฮ(@yҁmdvbJYe5w_$)QcmGrB,SH'zX?gN#曏zcjt,ݘ'"6T(]+(v-qpXyq.l+$.(&9k :V;woqO+Jn$?˻K%XZo,G+.bqX ^lWRl,xO)EY\OXq9(Y gqO}I#g- #!ҟGʟ7e[7n"P7EJO\'㖳) abaeUإ\H'ڐI- ,q41D}( P0#Z"ҿGsQq4_ƙ淃4<_\.((>8Èӏq) ZcL3yV`޳ɿ\Gy~w/O I8R=w˄P$`{1ഝ&_݂cu1? NH`._yhMV>Ad_݇O-8c(7aVIÉf4tػ<= m1WʿJ!bJ&<._a}09ǨƕدUPP 2-@JspȋW^~_SbƩ7SXHU$|:&@I# *()Qkٹzd0):d9c0vJӛ{# F/_%aޡm*䔿)T B?|+$vb3gŒP/:h:b˷L}+٠.q!dX!C}B)=5%.uT5T(WqK-1oqq"y PQu VkfHaBÌGo LeZJj=rq ݍ_ȳuF2GE\׽~}qv/HAqWf8t.v]8.&clRi8ykKq4 &4wedl 쾘ًxbeb˦*Uu]v]@.7]F*UٱWe8Xx[LUA$$G%ZPGË_7j,TD,I^\ ]%Sx* լ.O)[%[G9`?ߊGy-@!'LCSW%A2AljDc3a>.{]vޟ_cJ֮T1ppW2ǽz1 Ԅ//mF[#i8cyJ]-?y0'*TCCQ)uփ3aA/JSWq?apa ;LǰHENgbe6E DThmS5}IvI~|oɷ6҄-d;qenʥGW ~8vxY}ou?w_%l`ԭbߓ?eXհ}%-M(ySⴧ%uҌ?e0LzvjV8c$.>K*,,% Ri5(~?%`85+&Q=`d&`G,M&I$DMXbVA_.m03-'#p7'B$ahgmjC#)n}|kt]E0w<>_覈=m;0 [uҥzԏ(q= L i?rJqw ıXOH3jm l'јJN4TgɋSy|QS[5ܛ4@ʩqWf{˨]\R~ii6ES-JՕIYQjF׈#h y`36*>muPC PqXdùzk'gnA醭Dlغg̱ױ5?+%kK&{W$c7#7Bcez= 'i\@XȓZn$iXvDDlT F\PƇv7^Y+׮)v*2W"ALe.n256EiФ*Z9(ɭ<͏9W|a˪D B[ d0\XRiOM^x[ej"YXg8,"h:]H]B#R呫>kL RAm>uN.⻌MC~b?ip9>8UWe#uCٹ*݆孮{9GPfT-2L jpԡˏu&k[$(td=\bwN8d=3OM\/>Xٍb-nP0NXNB"<^[3 A(HOƚdQBzo]5Y[ءشlU)JPv=2_B52=Z0-$/s+$x?F^ڣmea^DNیC!ۦq+pF{j- O(o"-0GV0n͊*٩vol+.# cH]#;F*0TƕJZr$v^vj_l|rkXٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*q?,%b^v9#f4PO X[)[Za>ۨo+^zq ^ƼծN{Ŀb1_}F7?i[~k'qwnN]08Tqv8b8k/rZ'k_ݯk~6~~XhVϰZO&0,ݾ7#V($w/8b\?Aa$(q}E@ n5"[N<_t9;$DK iO T~^Շg)?pFMCQq5R:[T[YB_s CӾĀ?їCfo)LQNĪAF *?0_Y`l9EˤǓu2S~b+U'nQ`s;G8gy`'sIs̍I:Y;7rJW;Lq%IhDmRRYmDeآe31<?I;s"yHڝ߱pຕ>:(ye[GÈ/I'-yjXV?i\2آ =OJ8RCo,aLU@b UùvY.˥1WcI]E ZG!Th d#*z%:W8 H󓺏"9q5pnRh/1XRRh_[v|~%ҿ/o-FM<'d$o\[bqn'?׊cbìZ}fr\kMmSITo#:qU>(qp QwkSYB{i}*&Y#:΢}[H}F4)vhM4gY/ eROr-RJe]?㨰ؼcHA}LAJ.Qn2o A ]ceCZUA +.o>4;!gFMsO@8 I>$ GQ,qU٫]6*ثȌ*I=lIj@8k>7QXrir#=>ZQzM6fĪh^1)._cW'4!M.K.~| S#9ވ@=xV.]Ke'9?=,*5@LGDQ~ۖY}kfKCg?6Rk2\F:scI $w.:znLM>޿c+0쟨-Ϳ_O ? 2rh^ ?_d-5!wc;,aD,`ߋ "in4~@sC޿5#d9f4~!t_Ja@SQH&:v [*>|K ڢH+MqZN8.k Vx81CUShaKZ *u?,o*O et?Z?)qp@2($;"Emĭ-%~~XgolZ:뿎S4vJn%JJ4EPkwr[*ә҃_`0Z2O9D)ŸAР6x`l)œ 0L>+N'&UޘU+!0;B%^MTV;_7Lχc8\ciRÈV(,3|bt&ER\#}au8Htar[ZvxE!˗>laf="?vrq'58}}& n8۩dhW_N_<1z8cUAtfII4Ufs뇸i^Xy>ʃo~Ö' 6#vvIsi dn' M¤l"#&Q;abL U؛ CP1Ku—b2Eb;|PnDSCKuX6?_Ro =eqFEdv<ڞddEv& C_ cֻPQw® .=6.U';Ǖ.#t-tB M_3 ?tg6X?Wxr/^m0lhc_| XI S]#AC( bvP].TbqޘԦثS*kƁ\ \YqK#;I?S#4Fi_F0$m/#&kleq®˦*o#d5ZWi3(MV^WH;&iqzq.NVbmK_(R҉_Se&sThdomӮcdyg89eg=8%PxU]e+**r`-JT b͊, Uى]S%)vR;0Jf++S*egS4@rI'?|r$P!ࣔ ߲6Jm\٢c]=Nbx5k$),z Y˃~,~ȍ_ވG T4(X/q7_&{gQր ?G__XfA?g)fom?iyz|"2aQRNƟ&??pU>Q$3XY$=&O;Bg)O"w%yӔ#w\ Eu(C'AO`dYAN@ŰϦNЉˍʐA5JzF+,Ǔ_g\ v`$6,CWemؤ2۞p#x xF%F_4@=pzuW#,AF'Ŗ ek6G*bkf?D_Y0OZeƇ. '{㇗dr;F .N-?Gv/?# m&!gF0#gnn\2F{ AҘvlP캌Y;6*ā[myzi.ƔGlG>MV<|M$vic.+x{+Kfda07K>,D%9?-4y1+11GiSʑH}l5C~Kjw3"yB W#7GiGKˉWIWJo@6["NcI6!G qrGMnثTU*_,Uى.\UgvVvlvl*R)DJSB>GY$k"qNnZWVg{HoQ>"Zxy%O)a: mn<;HXD .-ߑ֋PpY*I3DZqbo*7dҍl+|]-F+[}J,뼋V"G_bqKGKBwh?_mkeCbDZݛn.votEU+lGR 8MvɅDep#S=blq*L`Wf 1K)c "dVZ6Ɠav=AC:AW`/xRB8O{W% "FCn?ԂRE"p7a}.Hsm#vsf}M /Ռ;zm=H m2Tq|?x&1 =Am3G#$[ mmpWcu3ЂG|#^^bT=^YWekk,Ai/8r~/@>ʝyK*7tk{4'p܉@Kq㉌~bi/޹GmON>|?O\20bf"Y4d`}%9YUXPJuِq?H?dRE$>X-i,|PkPEj+V@kJඈ* vbeW9,#24Cn2K3-̄'K[Ixd_OԖ8_gӕ7$Kη>K6ͨb?|6DQ1 BSi"!cmإr fdثWe.vlUXٺXCȫư]acq*dWeWan.\L]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*?,%9W6*rPrZq8awWe?v 9?W\٤եs Rw ߳XEr\4O%4[$hltn/iV n=.ZpÞ;=aVPK|%;Eɕ0˚}Ե#PjA')#nlY-?iNC$*H LD#ed/>`u&Y/8C%J4lդN<1ֶ}Rإ LG4G)&_̺No;pvAEQ˪=.s+22@rZe\+LL T80ZqUإxG bm0*8Ut >)~k{hn] &H䅠]Rc3 +=@;Q'JHKV@{Q?$VH/ՙ onFArԌ&ǿ*/O߰h>}|[>c/V=HJ6‡c bW]FČCWXdLOv"Xu| ZLY@ذ;.t(qQx|_8RECrG_V%$dž2?^9\Q+m4X=xG94Y@EIF?8L>Z``HndS}3G'a SIՕ9G_jKy+pWVp"P?%wV/'u5^MKO^dg_yCv0aP:Oto{1l9[pX:M-㔻cpب\)v=|!\p@3{/" 5;.u)e5qPy>"sn1r)+"h1WcFN̋A\vZĥQ|Uٟa, .;C]U>ثT4] 6|ԄvA#"Rֵ!sJ cGߊXh-`@tmӍF4=ǯ\Hy,柳LL® \P8]+ |R+@%nɻtUOX7wrdZ #+&anPY$jSj*U`bfqWfsM*h8Wc$qWc!OLU*vi/(%1H4Wd $A]^0s)ROAƩKa\]J4E}+IcۖUIDY^F:Ͳ6r?\VO;TyoTO'dcG r6.L5-LzdRVGn#a^ IS0ݶf9|<g\˨T^'pM%8q{@Yuߏ?l^?'Rq.- c_a΢LZ MvKE7G_j?T-ۗ'4~J|I Qn$C >AS oYe\ Y8`x+ʛ2}ypJ|;;HTP8z؀Y 61OǕҗw +S|0G;yYHI"$uV$riblyɚe^RRs&NHo<3l[SO.y}AI4[۱Gp Pj}V킑𒞠-㗏SQ4xcn-|2^ Eq֘1v]|qWfv]qvcC]^Pbo]žR/s_z!뻋=$%t=+J6RhOO6`^-\9q#4o9:N?_)<㉰joV;-6g1)ۥH]aͧu ,)ܳo4=?:읫;g/膹`t8#ӗk#_>mÇy?VԞ(KP.>)w?ao5W{I9UTG.j$\};O,ܾ&ro[7LRٱWejUٱC]*owqV@X(f?3B!55>?:YPChMoO#/?͓,7P?&:9EĠ`‡s#G :Oq' 0L07d?#HR,u&ɑǎy [GuC*7y3;h$ +~)_8 HN+Kurx;5i]늻.Uنfmx+NeͤK&eԏ_`٪ue 8ӝC-j+؎y6Muc׸J+ <ȸ/Kڸ?Ξ <:z=șG3aݕ&\ny|+W2OG|җ G9#mn⺌M US½[FЯ[i@J77d2v6ܭ6Sqd?xX6Du=.MݧG|`hS≵6=d*%Jz7FbE8*h[!pC2WCHإlfX)$Qc$lR gGQZq|<ܿ6HMzUةnCߒ#-؛2R \'err^E]~ B(; ƴj䏒{HC%w I]]_J-"??'o #}\u_^!A;׶J@fL!TS`aq9Sf]1Av=p-$}n,VH* 2AN֔]j0ܮPѷΜ# sm_BJa'?o`1W'y(j^4=H$C~nҾn4oygKҿEUpW7~Z?8٣l ]"9^d)FMON-<=M #n;[0])%Xvc*ٱWfīVeUDbƜ1*fL-;(i]CWa^ekMb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*?,%"a];, 91F G' XrDQb Տ^vU1*`!!y'pM^4!H-j +ӷˏ_LÎ V`5\I&cF  ~M.Oc͢3p֤x29}WB ZKx`hQ&⡢gy4q7{״Atnn6 SdN1ˈpOKa㕉A%:GEo'O7N:rq)wᢱ -ky}XmGM&ǭIoe#o(2 Q)Dg?o' ,!h8zJ9@8?dG>c⚲:aKռg7L#(zY۟}j^=92RŹ?fW],E~<7>` RȒ)fB JjaWef8U[}[knc`B\2Gy_0D*egP }.ߵTnXUZzt5_ݕFW`IlKYn{Z' ׉PIݾiy&#r B>ox!1UiaɅ*r)?2j1`2^_lW[o&S&N $&7]<&'2yLfG /%vCA /éb=JP pDۣ1!ah:h܂1"> AU Y N&Cl*Y(qWfE®a*M˔bqC>ثʑ*r)bu; a#BݝVh.*;~ԏ?5/"rཱིLpeZ(uqDNKjZ7_l,Ըª>Yc̹A\ɲ\To}0hrL1Wev50vbvh;L v7urQbH%\߹p v?TRAxuhhjJy+ALnOu9%vs˒k2AR[ɰuh~/.'.?-nTrUsY-,l;r ZjoFeY14v`5%]yoC1[FqQR)>1 rBRxc& M[)2vTdk`?Hq Nu R~zk&E@7☗IUzSOO_dLH,tӛ3~lO}WgS~_ښwoo)'a+QwQ!'$'&ޕb$,l~'It'j*ߧGRT_rCwaĶ̟f)dqM/֫'SЍO q_z_,L` ̎OV8?"#XNd#ӕK/R'򘺽j+s;%4ᦉn*'z* mW$ȁv0۳Z,L f +qUotM>3,тIO;#g !Lc2F?.k-1FqUU^^`mV_wqL#f~D]O2NW<-+gQ0VwX?S;P ybwH@ħ@s(rX)FηՃ2(1F?8 @ﴅ4 mF_L1+yO~b 2K(U}9J?e4l3)RE_692X`zc2J Uu‡f.bֲ829TMy2GxC8g&8F4>n#2cy&sX#&"󮝦]&'$8Ǐ˨4jmϟuYɤ=GnG!-l/KGtO2KvWfj㌟ۈ̧f$ga},!S9ّG,iiGVSч}-|o*RTq_5>_z_đ;UCslvSDW2}3S/''==~X?YEY4?W<;~NN-W}~ĤZj* 棷at-3IwBVS-$o~DC!R'H|{K!g`ta' zK[gPeNTI;l4(nVj|aMEn[9rǀ=p.V*hAlUzdHKKKgn1Cԝ-7@OlC席]~yoٓY>4x+cL%ϩUҤm7KI߻~U[ E )8 y <$OB;*֖R =Wk_oF@US2JxfS$(˭g84e?pMpS|xl(v_,)v9[pFlqVmV^n6tH\t?o[H5S5Mf}UWԲaE"ӏ͘i]}2@םe8Z#x7_+&;+A+݃RKY(~ .|?;2=4lq1UetMf{\$P½E{`:䒈\U٫]CPhGJv¤[aYfvJ6Pԁ%#"0# (Wr>J6Y_Oi9X;#|NQs-̍#9fe̽,Q*#f1]'c޸.ǪaǖnȟM9G-ΓWVe}ȍV ^^%hY F/ybF-cF;]GM*_M$#ӓ\V %ߚkI2L>~a7Cr4,x̞˧,% 526/WLKHuh;m/[?oGҋᇉȦV:bRj`Sc'|]([7f]6vjbLU]K0vQ!9v4U0+Wf5J+?/ELvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*?,%*zC+G&?~$Ž*d2#v-RO4.dg@F.IwĿ^A(Ǔy6Gx?#D|g㬵ۙN&d$05Rj~/qHJtBGsqx\Dܾˏ4m"ą~!=BW|rn ~f[B#.TdО>~'Mp1f X<Lobe^1ԏEYt{~P3/EaJ4IE撩^<j7J*z8OQ7?ŔÓ ;<~CW5Mi˛ݸTDN1ƪR*f"SL*71Fe^pBqt U#o0:/c-YZ|Uo|^/!RCıU(z+k)Wa D`7}h@HН% @Q#LR??eMyE~陷n'b:n&rzTbwHgl(`(]NINm.6chu1NBAGRۺ`{^#E.z5(:r5ۑ?ҿ2<#|ԯ(BRTef:Vyol1mRaޑi#/b9?r5e//54kRUЊWMS~UMVzkoxWoRz{P7i0J<y_({m_T[-ۃ=F"2_I{`S X?Y 8K30cN㯿ĖLLKi_/uo™3+Ǒ?X 7x5+od%kL%uh-M*7da,IȈ9{rw][HT8=<x/O=њD}l)\(~N2s#+$]!U`Kx\*Q\14"ó, o,Ԛa瓴߯j1 |mtuO9#ǿN0|)f^| CX2f7N1WcxE1-1 X6#LmOK$UPv/Hq,fw 9nKL&ܺdpQ—58PLh 4o2-84+'[.@;z0y=)Y4^@{q_`Dc8hn0GIO%%Y:u#t|ɚIHPMxsXpU_oM.b,{Z6$UC%"rG+ {`T^rvN -:`Wf=1KIz↫O; -7f#[HZ]H~ʧ҉S#4=NI>[ywN]No2H}®nt<)k"}̘?N*kN\un0iu5SZ*[5"a.Ō_RzӴdwlx=chKhتֵ4yt_qj<1Tߛ{1~QE% ~ y -vfO!-ul⯥y{Wd[ʾ83fm:g|Gkg'6֥ZbWn)VMB^eVIOm=+?pA5XUfn{3OˋcyrDOkkT Q~ʁE hù+R\R Y!ՀddA/SdLUـ]銻(UفjaK`Wf]np(H p`zd^ءy1A`%PVaͨfgh8=7m~$=iڿ5+&l"y-0hv-.#Xg'9s;_L9 PgA/'R} EKf-Rx 2$4IL2׳^%57RO,nR(ɸLN?شPZ'!?N6(^٨-GYRɕܣr9ATu_Ӹ^&H ?盅En`[psI?FAX):U'6YsuQџ&%JUN\6W$® ]E+DЕaЌPVPz42𒺏2+)Tl& 15/Im}?$G6NAj L%UaɕyrYDbfFõJnP*D,QKØ,o1iy?RE?~*#X;`ɬݦht,J(<^en^/~ww[\r'c.>%Wic-367.ޫa0gcy.%*dD᤻*i]UفĻHKu5 ᄠ&(q! j"=A4I>G_&}xc%|p)ThA،͌ł7er],5#k7Q$Sԍ*ăċC]ىU6e⫬z>mGva@kSƑV0G(F/o AVN_JIs۰ƋƠW.~bD'\$L^qO?qp\V G3Y~x/%,(8>Z]I~FdpƖʍ|B$NH;+q!xbl\D>$SW?kR\AADl~5_«ntKR-{ٯl{SƮdwOgȝث eo𳯧*Y~ov8y^K[ $DlU˚l-lUٱWfB%Hvl 책.q*좸v` +v9SUupC+j#BIc-hBjqm$QS 0ZכZh,ёjIv9fLv|,K4] g;!O`N'V&/C 51_cW쿧b]>[_* KlGg)h,dqkY8q}b2BrK[E~Y!|94-JU셚#||qq㌁._WekZephގq i!?]E۰οV_ &U#?M/OGEu"}AQ})8"y/bwV׷Do o܏&Ʒ+\_ֹwOyKun5j-T(XGmI}{nDuI"e):> Q=?|?$K (XM iO}[#s/eDo; NaF޿Wy:_ @&GyG#AwvddRV_~\3ܝ>',eJEPcg<%d#L'!n=5WQ6(GpC2&N6%h6$ 94!d8`d5T[AƖݍu d '`Kx(v ".ˡ銻,l.΍o+qS?fEx!ȧo(5PW>9e"^C\:nش~0. JbZKDᭅK"FL4wB^Op~;Тl9n@s@hVS5ȕÝ\I=#r0ho1v4]:W .TuףYld-BҮւwW([0t29d>Xyn[Fqɩ ǁ4WS Oƌ6eJ[y:p:#SϺ[]SyEoh-MԔMK9K&>rˏ̍*@VP@^0|jj?0)?Txxk+;X:8!'wI,lQaE\U1eh ?NtN8-YoΆorvɇLGvyr\BƊҭk#"hZ Ykk)Ɵ6IJk8E&SҔo,5 ׊Qy;Zw`ӹs"Pߵž߲BexE%VCP#@.A aè_UO6/ŗu2Z9-~j)ݿm\p5غn94hg;p8^`ygv)#qE$?8hr>Ik"g/՗ m/MiѪĿ% YxcI2F[]A-HK [`[+^7o,lDX(I+lUu]\*R -ՅwRA1R.2CXT%^Ԯɞ0x4*?7 ݧGtOЖ[XcD(b3Suc~0- ;5W*,R5g`֤QA,i`R^?_?dsXd(RHq8Cאt,d[ܧVzbsOvvOF>ObItۼorqr#ךk B$ l:WW~?+2Ef' 8(J]pZ66 4oiCxinʏ?g.O.)b&x85J`=WLMиX̍'w#9c2_xEʧer gvbk-Y47 Y)*{tb~] xiP$=9qw/#iGNoR 8Om Çfzl(8zrE ksoCK@diCv\2,.ȦֺH=pRӭ /Қz:߉O\q8^iu̶V'_!3\C`jFHh0B*j%4vAej uo>vAثR,*Weױ®;b]vlU`Wc^NV`C6I]E.DŽp xG쌉=?ت,th[`6>ckj7Eс4󼨼W;WW Q57Q=*¹>xģ=HV8cq`=A> $*0?q1sDZr+-4UfBǃ#uNX؄/1CU9a,##ђTQ1K& vW,ee]7,F  ] LJ2켊]vV*ثB*UXٻv4+(Uav4­[\rLvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*q?,%71iZ#01KIbS8ŊV,`5!ilQ# a!-8xUi80ӎ*r銵*7\zc|#1UͳzA$aU* 1.3XA>&늩Y8$ Qb7QUXcX⫆-b*9VCjMf0|(1_7i+ԑZLpa}rVYiF܀}}O3_@M 7 nQL4U)-*i4q =(>ԽMqx} x HouRVJAvYH1dUe;wE;%K.#YGJ}A@G1sIZbhl;"!Y֏Pv5xL"ㄏe?__&pK4ÜGu RF] xvܲ2Ĝ.@4A;&Ļf݇7e=:"'mjK>G$}޿Qܒ$y/Kk+{SR7( ,ݻ+)2NS1Ɓ(vSu.ǑuRz3AucDq4KJOyKOՅg[}\S氙};Et=@!Lㄺ qO͎Gg-2iDw^?LH<P[rġاM-_ f:n~57Z"/@[K Oo쮜1晕91 ֳ;Ѐ 7dV\~֌0 .ۈs;ͺ]ncяO_|84'v#YN![~Z-s)O!2S; UrV)-CR7opB_C;Id7DFQx?խ 1/yP~:7dfN?jᜳ^d,7::#}/A(o/e!C]Z*VHRCFG'hh"qt>h>K!]u9aC$!_܌O7at]C+[{2}0?ts?Ӈ*ZߟDf4,ajşd'GZ-br-)CdkrxmeZEn!\:)cxZ3>+f0-1)oF*ث*\U+FfI*>!HXBjZt:-mrby|Ք`'a⧍x~ ф`]'rj>-7&%,w$'6U(eR1JیUفhvc' *k`C劻,=0ڻtZ?Ej&ٓ zedNO(K?aaFa.;[\Ў̿;?ahwnTBʼnfkZp_j/l"gm煴*0,QGY w𲀔T_Ʃ-5f!V76qF%bӽ:ānd\)eՊ0IriTЂq^-e |2Kr폱~$cTbTMSmڰ_Uw]\nl6E.͊+vc+vc50cH®ʦVyX(*(?_];d;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*??pQ~[s #{aWcN(:uqTWqP1U q8GU '*qԦ*qʥDs跓n$P~8i-&mq!!obFXEn"ۗ# 'Ň͂cKKzO_+$$a,S{p[)9 of(: lIEsP_^d&F/Db%\BxHzc{~F #^HU}$$ÈEʡz2)VÊOD_2INVQ'4ǒUo8d#d5RA֙mb+kfȘ n=5m_ 1s5p̎_{{rSj6@mlx^r\Uى]1v;v-}dcOw~i&jzsoآ)vXZ]owʐ_]8،]%C]MrN˙:xqKI<\?8wHW!: { ]Uآ ^ !ٳHN//cY`%Ves*j(+փdT]~-?.O}~^~4ȟ-MhzfiGq8bH>o2vPb.I]4dfUjا,4ĂP4j!mO}90[MU$@ ı%Ș~^KE%i//m^)D`ykX.UZٙ* qO!8 949 >4MҁRYur#(pJ?A -er"/tQ[=Dwqo\Pc>(V9{iltRzNYV%nI̻_ d}n-Ym+Bʈ[snk?y |?ogI; ]#;#.ʔPPqC ?Cyp:l͠>+z.1ۗsykq-s6Ո?kA1& A s(t=C zAP\3`&^ARW6d+7R_\'u)u+6)VF<;&X@QxaJ'EpDž(v8)\JKN=K{dj~~fM{8=>Y"pyPjbU5fؚ<Ű6KcݜFC~ra"׻GUJu>-A~ۏM* =D/W4m>:8|vm+Vw? ['ɉ\̗ZrPpC_\p5ƭ+(H?+9%`=Q^oҮ)ph;=I>^vaV.2NEu =qJqCHv!Ė)vEت ,0%smio6a8l]l1Sjae췒zt,S2c1`Sd[K|i] )C.ǃVu`R))kEl▅ס~8+9/i4<^R]RMO F PjXUD_[+uǶ%.To?L/q`3mo[$S+rƜUU]vb0؜T]I;a .GvڃsKӮJmBJ?1P9͖uuOUL4vCX5?r+9R+(578ܟ~h]\.ߧ`OcRWx•q8v-a% s'G~|9~ǒ N_!2d8R$bCD ĆұbNJרrbf,V;uN=%TMcN*XHIbB.Gjk_qf~dS#NͼT.)vfaC&$䌊>8-.ǨǚgR.lFy#qo ڏ'8+Iᐯ6j5dSTC>K56k/S<@u_60_NT hEǣ l ,@QY/-)pz;cN˜ǻaWaJ;Qћ> >&2Q8z M1K?0%f·ye#_Z~YmfS]Ov,wmJ]*A늻ƃv2ى]vb+?8R7#A"];-wŌ;hlj|I?w+λrzqw53BCoH?V$G-u+*kZp<r4/_e$Qn'gpKu*+|;mc58Xwvܭ4рF\&J+̟K)m!s'+ k ţZC 9 (B1x@7vIRDzx親{d*v E.+y~MzmVR?e2χvŤZԿ^#_ cYP]q;anAi\Uܝi32cPr?E2N~(7/^M+'e{m @Zl'YE‡fr)v7| mM^8egbʲH=h~ˣ\,l=55IfY{(#\e#V\ vP&er] P>;`Kˮ,>)v;(v>9d4ap.# RQ*$G3%Cn0َx;bc 1Erz(bkb}4{'ҹh~#Q名&MD83S*Ƣ sL&gY#0ͼy?T?}8D};5t`kֈa#++'Tߏ-9Õ'~?bB O?ퟧ 4?'ڙ-,Uw/ DuRE?p~ZD XY@Lg$uƼUi~55 J)QF?a.E0m j|U/Nn#䔄);$nD(RUI-OkVv7J[{q+zUR0 Y?_rW$rO/WW,7/_]{-ݹo"BƵEK6`1K}r~\7 w>:??'~i6"jzo+x#q#n #ݲK~/G=}6*kiNuӡeEMU Gįi˫fNݓ 5͆2̽PFh e w2)S5ҷ{)u3bץ'\sNJWK_9?1fQ\Uٙp\qW`7POTЎep)Cj6 TӨ.Z܉m[}/zF _IunRk(̿8ʿ`rm l]qWeʦ)vV*aWcH]L)vVF\+ '__Mrv;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*?,&emWlU]1Wccj$0U l au{oj9\J%VrQ$Â1t Ƈ$x 8[2,~K!>ㆣNOSݤ+ [dxޏb䨯ܰXEwiE.ǜ>KusN<+2M6䷎3 bF;WJ%cvőXN8 UmrZjaWekVGiOx^N]~uUXŲĎ0VUv-D?_ׄsa.H=hO9ոَH#-4ȁ2,dPqWfv-3PS׽;Fo+&e6*v6bAs?WKɦ#U}L ԻE‡cث'jb;Myp!vwf%rQFNlI?Lrd4,XK^^ Rޞf> =R奩T|f_-pg&]!."PӴi~6 F㲺ߊ&z&ӇC\_Ǽ, KO1W&_W> ~Qq *3_플d#/hc21w,^cM'Oyf #9.e9-rd\} YW .š|(%k4@Bv59Դ{aO 3{q:[7ߟ2sH]jڮbd\XHEyuA9-^NbnpXik@PEژז/R#)*{qn?f{KuH/c:uÎR~I,4p2)~H:LP{+CP)+F_9g9wrIs)6k-զx S >LN`Bnk~.8%73=vP:y[U|HX ]:Hq.?$j/*>*iWsQzKnV>m4tk(8`G{-7KyxaqΚi)yFm坫V@T!нQHQ%1=b4<N[[tˋrj?`r8YF4/m~+Ö<\Hiaȿd3_,Gjn4Gc04 md}ZA,(vM-tD7Is͆LS>='P-ET|#0ώVxFb>Mw9qWb/"o~qE401Z oil0;L vP0*jv.$n"v$cJbaוy꿹a~㈔GvB#/ծ۹˗y?X%.#eÌc ȖdhetEJ˨Lbb>%yXꗔO:OT,Hh,vQ+uo˅ZѿIݬoRGՙ6QBxM\G̺יvHT ;rZ<>0Oͯo1  ;11Tu$kuY#j]QRO@S>[AjfqݿD+.LEt9:-"?jEZAl<#ޜ8r.QFt?j_OĿk9H9ZvjCWv]p%U^𣛰Dzl0%}j8yHhO4?I},|*Lwֲ ?VƁԇص|pwY}o p;: $m*C&% ,? PiqWeQ|UكJ+HxxTqoi `<_qzqf[ M@|FS2!C72;Wv`v( kZv,0v_`Z{R3X¨#ėN9˦Cg/q?W K}LFs& 6yb`$6J,?_p^VJ*bc"mu[99l՘K8>&S-\+$R€ BSS%T<*#sNA'H''ϩ̺cXY?o+}X%.zK͜Y`~Rw+~I,E2hҒ݉u7R>|!D0a_NVB-:S$\*k"?8"AFОᏡr=czcVy_U[ #(hqYx5n˛ .3C^| \a{¿fQȑ>䄟/ʤ lj?bt>{[eaqz3D층\פ6[+4$fݿػEoiޛq1Ge/p?)$D' cj%fUCpoRY;w"B¹]R+Qܚ`Ч_B?pv+Rߊ9fﮃ51㇀q4RulTxN4j6slڃ\4.6d|*R?O2#(~KS h20/t\'= /W:$b:<;EOlbuTX_x1_`ZcʝV* 'f'&' MJ5ĕ 7Ӭ:Oit~%bϖV cTGN/]wuv8狡`O.5  o%H,78 ?֊^-dG1/y,o{zԬ# @ ~sA9LMGV.n!mrI>'$:+}2]4~\˰c*?'޺ILfRxշ*]ш7)Fl^% %=ҿ_g zߓ $%Ԁc'<ޥ.3S+6ZGzm ua#/e5k4*8@:7F*cLll1|-u|mOR(MG-^5 =c#iyWFmj-C┎{}_ WFBYIIs hlKU@ k *(vXَ*bf0]]]1 uNMLL+ ~Ϥ-ݳve"HMONQS##+~ 06Θm'?Tپ9a.=e&!e|ێ2[q'&Rn*cd>nVD}~?&7>LOX^ɽ6]04<#AkeJKƟ|8g.ALPWah\x(e ҺHaΡvmfJHn_MC(8jrqzFLb %*]UjJFn1VM.} M:\F9SԻ҂O^TC)TvJt6&J~_) KՁW/ҹ.%E{jPBr1{4Ն/j1\Mc;IC~~,"^vױ&~qL[9*>+=IAIM %:]=*)n%n+Ihj"$Y<1'V4]B+{2'yprC0EqwS *ث]*]KhwZw`^@m`gS_ݱ ,6)O5#otmf5+u|\jƸqw,=]kK2ZS cxĊ?N?FuY$/~pMJʍBaZ oY z"%iKn iCofC 6B;4kgRm)=B"̀{<J&sBS2bd D84g@i|*߂.b6odccjٙ=(6!\}Ffo9 Y!B@O|M@4IōláunP3Έ y`Z6S~)<&܌;XOʶxn-xJ "!nKվ|FbL1S2& M`/ӕR\2& AKfvX'| y"Hpsd7K0?p5hn=6#0y,'_\ղᣗReä?I*`,ڃ:1OgD5/`{"Lͥ z.זYMw,-]tOe7g.K0jvR2)|nl iZ2RHn~/9V<6b):$7Յ*Lm3vVvlUٱCbeS LR)]#!M J\cf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*3ĖK9*TT}G5;Vt1x$rg6}s<ose<:U&ƕ?]p0Չcr&D)Xt\[Jqhǁqex,' N< Ui t*`DvE4Q?s 68_j ;{҃'R~i]UPo"o e y#mZm-*&IIMt#n/уx -p#8( -_$1R\apV2QCdK?S~c~C#1*[ɿ΋zelS %ٱ;']r\֝M;6(c[vVˮvV(Oې(W \e+gMGlL,aWe*e!4aC3AFv=qCv<.)v=@]"VP%kW"PZ ]p@JccTh83|KTUp z]&x(E~\tF܆ȑmE1olNGn/0e;z]>u$?PrrB6m.SSӰ~q*;ӑv̪`%چ[X^bTqx{rm zqŬÊoڵqqg/1`G 'l1kԨ72(Pb٠O|4ѴWڅUN~,ȼOS#̟qDuC. 8#mrI4S,RmNk1}dcn2-",/V*ŌpNFkFZZ)Zr?~ߵWWM2#񺴱C, xܠAO Ȟ9/IKŅZ K[:FE_:2KΗ59i"j3H=̑~lc׼u]y;`{/쏻.6*1δM&;Kz@${g۟ MT ҏWֈpt Clji}mzohS+P9%S;ab{91L"($0>8XkUy(*_?y73OOp)|\|5ȓ%zPb=·p|?Θ>%?oݔzp;vY Jqlu-m vWi4"ObvTOvod}<ͿjQg3 5ofu] U.p$/GK˸%cf܅& _%jjrFX'GUe]yY*}kKfD~LyG7 ?5xO6 MKܒHУȾ=FܵӠ`X^ ~UI_ pYh:=kh Xm?T0ŒjzaiNeeܨ[*<1c-ۊn2MhT,I1̜q2;8zLp)ǐdFSObKǯ٦ѪsÅNMr9>Z>1K&Դ%5Vr 2zźNȁ5~ϾcD,=xEU!\Vh1î?u9.e+bu=K( >I2}1~6d4Ƚm?b6:l $򝫢$2q5zd:#h ?tgf\f/S F1/Yz.n"9݂g/+QԱKo"k7 ̞Q y~(<&@s!,Vn+%T> r:h1i݅ͷ*kT;&*倒ypBC[6ykj"h#AvͱDolv<vV*vlP0Ӆ]p%IzEnf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*0pQ2է, U$qbI1KX*UV0Z'Ce,e݂B[jҤP{PDv3e[;u%Hx GWG_Ɨu3ԛkF8޸/c,^1qv1:׮TWnX2–MP!*S ]8nl4>Y\v%K|z7z H~%یo 7ővnU(o8^;OFWqMNɗbǣAJSOjcY1(bGhX9Lj?θcL46EbJ}<-Zje`#l|B0]*wSH+2jVC̊8Q^f? Fc$/…zD'6M֢gӒ[-Ss~\r {/00?umKYcfx_Y6i;}cvw+{hSFVN{|},Ou=41Y_/k{BfT㸷e5Ҽ<nB_f:&?b_Rhe}kFce͏oQ:䠬+ƴq\*,~йc_Q7T)|\p 4hZZvW)vU+;Ⱦà+A}0T]"r4d,ӯ׉gz`gZ^#ڹ,^3RkOӓˎwg4\=6 4:dtсSvA't$%ָ%kͪ y*8AZu2~6Gw$uL\Jx=$:wUT\f0 uݥ>2>_Kiܾo3F?7 KQrE T%Tp.ĩݷ9$-]/#y/%#9W__򲙉$Ro5 k_/YXTWh':D:xrOQQ2ЏL<bb^j jcx܄,'[\4HЏ &/Đ6Ӡ,R a%Əw5# u=>(}[ͧ/u`k@T俯 LDIqF~\8_+{u-Mխ䋂ɒ@5hTR yȵ3 yߴ%W{ͶI6$rR9H:FL_M2qd\K80??/.r2\ ; \U*]RgIc("*j8j?IVҔeO>/eC'N> KrY1^Biy\EثU8¸-.#l(.Y)(vb%vQlPi8hI*AuwdaPvky O ~̴7rOm~,mOqEl &Y/!m$H$n_ʧ#t2HGb^o5·:+1q,S!`Mro_+hQcmOL)QƑ 8aY_WoYƆ8$R Tw]8G/YbٶSss%wtn]AcV x6=|-?/ql ̌(8Ȉ mo7嶣rT&w CK9sQ7GTyBM־t9H4r^99d0MRc߼88nMa<0\$Y"]7`-ZD%FI>%zpz'-Q[ERMG?.`"wmñ#sSdzmkA4Ub~/yйT OQ?sB#z/2E[!\v1Q|vrO;=B#YC`'X-@[Er&R;ʼnbOp @Ɔv<6)v*]lQd elvU1Wf]L*bF*#?_"'anIb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*0pQ 2 rKG >`Lt;]5XF'Jn$g4m>xP§[DF i?vok_fcM6qh+,O|J*2h Ue!m2–beJDWla&D=)Gr~;i~Wa% Ep1RڶQ$\kf7*Yu8,QȒՐb?ZXy^?5}yntYH9Z*_5\3O.(Gn9#kD/>Yt3\Hay"E?d_M*j?~2do;Ȼj"|qHP TƘз1՟{;&3|Ҥ:cPd njcjx_ՕJ0I Ã)^%vQ| 죆n~md_cB:Zw>]‚ث®'lP +aK1$CUL*zUآ*"b)J!mX,HZ+zbe6fK)I?|9n86 ~)7qjIFWzWOng GaL1(/Ni$2ɻ9$Z[✛E;By^ފ ^ECZ3H9Ps{/@BԎݲALKa艚Ah:8d"_9 wޕ%so/}h}+S$'e] ODI/PwKl:/)YYIy 0,eF;+J+'9E_9 D R d*`+XejĞw—cVCT%OHJ"\q$Zu 8c|_ƢCc]fnǐpKShu1{jm[rوdg8Q?cМs┼JWާ/Z. 8-.8/*PF:d]\k銻)1WbDo]LUT®ʦv6ak) *]\b]1C5qWef1Weq_]]ac}jlpZ/ov -]$۲;v4BWf;*UazH?5?˽RQ__̀!w `$O__v{Y^ vxةsWW B+0#I!*~Gri`hs$yR#.( >e( Y'c>e%{NbG~wPKdoZA!8oV\e[?wd#l5.͊+v^*챁]vX]F*xPtǚF͉. W"elUصR FV ' nXԻ7$7lZ|OMKƪ=͏|] 1G:+ʣn r)AL1e qΉB>#%|K'y0Swk'nH8h%^im}_ L}'ZXOYH Z'pCl7)hr1L@v?Q"X yoѧe\n ![H!ըIi.@cHd0)pM7JUr||I>M6-2Y~ץ\ eNcy5fѷbJP}?Tѓmh'A5@E:H7,SиeƑƮMw8YƮ*Z J?MpvI< :[`jck?4e>/?12N\lG)1|Tj/3G!V5?Q[$/cXC`?j)nmglb? "Y"y6wO/ǥ(Q&|*NȓQ󤶬Ti %Wԥ]iƧlO9FJS,N*1';\w*ךI%?sGrO]0B'=C@y]rfxj8n)87hF󞧦-"և&֕mr]!3ԪftQ PÓq)̚\Õܔ  GDe" HGCWX9 f6dV %5B >sg`m:zZ+C_kyoeeT8pK'KAoZv( ])8غ5v4 1Web#vU1Wf]Z9dZ-ɰvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*3X[lyOD6ד և2JlNjOirGy!mV;W0n.=pZ#\*4Qu9 [L30?7 |_ÊF%$ {j%y Qꂳ^*l'fe/y䋻k_M>ҊaTz~(;Au_+$7GHbqZbU"Wf6`WW51Vjяo(Ӈ.jxKU.ӧ\PڶM %nXLja"rpۗDIjΧz:m:hNq4b:4?C(ܺTқuj]5U#Qv;eSXc??ҷ<<W ʿ Îr?(i>_%VX䙘gϫl l2_G~I~h^{Kb !ȿ=?OO>-CQ̀XoQ#WvG!#tsHǜiqϘh 5kt)}n=Y }CVp$6Ngu bMߑxi7-եLxP1a`Wr (L,icA&Rh+RQ?'- X"b,R48~9.‡f'Hva*].yt®xf)LVݎQbǪaVT^GaW$ Renld& ʓ%.8}.]I g t$wH57v!ϓlC^@k2\v8a 2& Bz{ h -*~\. ՉhtۊBկ/e c(ge<Њ8Nw$ƑL>4 UT+WlU#5P|0o+PXᆳ`уFoUz]O8!~Cdȕ g;Hꂿ3~8[*J7-FPp`C|Uي~WcpWUqC, L ti Ў4Āy; ,|ݨRR;?,EY9W$6^_W̑S>ĭu KFV )]_"0cUȴXN~YJxz)/\r\o2A,UGCz:azWm_kW9]E'53fl `Ouwad>ah.`' ?rdB\kyO52c+v^)vlU`WcؔĦ؄;O~.J0v'̍;[+[C(Fࢤ9LZ.>97A[~(~KgA 9`B;eCd»p ͊?ȖomK[j#3(f h~\:qÓV{ʫjC5XTFc˞O,-%IE _첑78)s,N[!m-[`:EC*8 *ǰ2ݽY~\pzss0]3&7VAN (f'rN4*n(vlUj7cc#ޘi4wO4f]&dB%.=c%9 G+H$Pfn'WYrM?!nKa?_r*y?c%2g}-&k10GI? lKg[kG_H<k",̪␷s(h@QT/SDYQC+/ qY3 c%w`l [Ii#}7IAO^{C uF2B4׌mr@ӧ1:+Sd #ATMq[ A6**? K4doчrt.JoLUؓu]8 \$z¿15KJ䖦qFBVW3(D0E!] ; V,Q6R /L4^)AHYNzB[%h!=#n2 @U1rb n?7PSžMe+pu؆\r_Z~ ҌSCxe|K zTs<GҞ1zeFv& 6]V.UT6ثWf*aWaNN-rvd;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*2/YGO',]z5^L)ӯː-+.ΖW3R悧~K?%Y/QȮ$ϓxXw?5dk}./LUf?:WLiS4$gJsY$`kEq6ps2Q, aAk&$EX#SwXb$: dqdɔ#TVhRJC$9t,# rݍ5HC$_r4 }Ad>]Gi7uy h•7\%ROs˘\wp>j+R鑵Df­ثYGW", s)b5+IK\GuPMtc 5f4ő7Ȕ);/&be yur5~]Z n!Q-)284g uC,]y Q$S,S>U, u?%Uu^ړA"߉# y.U}S]Zdr{ a"iO6-x2`O{J5nO]3Pf&eJrF*bLUO+oWcġCee]፡ާvX銻5~6v- cĝ"+'cy]B OAK.Қ m5L1`ÄJG61͓! FH ѫ 4 ǔm#ʌ%{T-1ց-R"VȾ,D6k`j J6%FH?I8c-x2G$m-oG 蚁hc/([Eb-' Vq#cFsC濡t_,u5OR?jZٴw+x7 ?\r>8b{~h跟jF|ji֟d8NFBKֆj3-(;t.znw*ŬNQJ(–;bE*r%X ㏻j!C 1WcWci2+c+)v.Kw]PRm]1C]L)vb)(oK21C;UDb2c2aKVX/=JGV9uҟo!-odmyP҈%-uJͿp,@إZ,uE"xsO/U.HJhi=A>z~̩@axUÊP CA|ȼ7zǤeCl&%7|i)F0=ԃ̈́De`rWe]qK} }Wc e|^ru'nؔupH"; U]G_'lΐs)(2shVpۆuJ_ʏfD ;ZbNzo~`dkG'ٗ*MvՊ;/?OpDօ@PM3GJ]Nrbx>9 DŽ]gt.(с@bWf͊|C]`:uiهK$8YhU0Gɖ6o搀>GÏ3eĆ]}?1?)@csA4 ZVORB=e]\12];FT-`~YU{m~nP]LRș+ѩDSB];HV뇅]d_|iNSv1;cj`rKlw6.7x5$}Y D„}$  Wx틤&kA>J|ՠh֮IO/3=[E<ws9l?w-3Y6vGSA^`+s]pCb6(Ļ.CAAp{ۦ)k0Q Y!Me}i<%uWp?/l5DzcCIPZh,ts;E(^Ʃdl#rzf4@ Qjz ĩ?$tR[; yɦ2dd݅`cܳk[@yDSٸbEn|YhrQfśer-р ^RaZD'Z(OG]$)?Ke6D/Lg,4iƒڡn1U[Gn{DUl [I'KB65 ^$Hckч\*öZAZ悹w_CiY*ؼk(H%ZWP߫+-9DAَ"Y*wŕĊ+t[2F[GY=s Q]|:H%_ ̘Ha+"iWChM ?0DP>seS<2=yVQmuJl4֗=cW,!%^~\WFs隷)??]'Or[_Đ:΋H<%?ic *s@&Y/.%ߎzU ^ɟ`m[zf]lRqWci\U1C(ـ"˦*1Wf#lUhE8ń 6*WS.L |)͂nia mGӒ !R՚3"`?Kr.*߳n8W ,ivs$VNK''_oy[Sw+x}ENB͟Mʩļ^Ht&Hn)FYmpm ~Qҝ߿Yl2ζhbPV~wǬ _oFQ4z%-W%⯷Q2Es֧n_OX[M]{׹$t[I]v\ ~|[,o1\TqHۡ??ԅcǦI&KmMuBeNgXou;̑חȊݶ/ɯ2Q`2|wȶlx: _.kIZ r+ rQ&l)VTFC+ AkU8y%v&ؑzqC)i8iL :6 H4s *|<ؒCeoȿK6JCi}QVph4rYbI牑<+"(" 0CE`NsrN^k -ʒW+;+vlUCvj* ث !]v[.iR#vتþDVݖhAn,kv10c9-KS´MNT" uGN!فޘR4!yUol-s@M+L;ULzX (rV?7d G3r'՞pJ)_?REԵ!_qF>1U'#,[8ؚjY6zRBǀ8RnXUE!A$`v4fɘ~Xآw%\K/+#eƴ]*WfqAث銻Jb튻M0I>݊6̌[|~qd|ҭ&` 6w`QVxiXCAx-cՎ :0V^_7x]Apeݫ.֑Wf;c/-VQI#%X "(v9HrF*;DdYS|Uy %d4wGH~LLWgՔB~So/S;J :w9+Tሻ tߊ໿/>;@y8JnYQkMjtTX$qcQtΓVFX?gS5fL.Y4Y/}.`6<-Z3Lv{O"_TPjMxJT;KB;5\Dp=OO|4a[_dꘓ{,-Ϧ"db(ɻly/eL#vQuI_rȵW`ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*2/YGO' ޤq0GQ8b݇wnU! B/R4@=wLiLf'ǐ7G ),8@>xc/2}Woc%ѧ ]dAX f{kɵ-$g r\Y{ Ĉ _xz%!vA8x;! Vo*MAw||A_Xpu.U.&fqH]ԓԝ9#ͺ1_ n("(U@ *kRF!<ـ .w¨sNI6 &/9^HAZ .zhFoa *j}N J'Q{[>X)QS ҳ}\%I Tj>,8+%)8w?iGLҬPY.~x <$G`uUVVC?&ؿYf? Q=47KSGO_Ų6@n?'u3ekK'~>i-cTfv*↎S*[mWeb͊,u.))l%]:Zv=]*KPŋ,3wK?B k]>'du 4ڶTRl)LF%%VNdFdxsCDw1ZEieZIZqlh}ܾ4&A#VSUkWi̎G̥gQ$*|`mmOLԈ "X ܳ$* vS煾b;_ʽ71W8"S&2%mcZUcxb3:)o=N$ӱ裮CG*UxYp8}ɦ*[qQN2w\&qWW'AcqWe1Wc{bE*)Zɮ78-Zmn,1 _ńyj&p?nw~8^@ 9l50];EqWbsYJcz2l,%-ݤWq$ 헝ZԔP:承ضU(\mJ * &-IL$rI^ i27OepU;؃['Dd$,2/QRK+**(|(p\RNL(v"qWcCؙwCI[ŭC:ʼl:,82LgE~KI^QGCC!"SP£1B}j1W`3P{ ;%m*W,ѷCd]!DGuLQU; ZH'Uo£9XbLUـJһ, UJǬU4+̿X8X$ؒs >QhYv[zYk)2cg8NCceo:lMJk?>#Lx?jk# G-S@Z]IOH":7rE=<_&8?đ3PC;sįD* (hU_!0I_+F?[[U]hHڂ)q$O*.@僡 OrµW9|4lQҒe2 j*1 ق+-_4]CReSX^/R?gf88әõN{XceFx%`i5O WBy$bFe촟c Ǐtq>%jIa<2h8=ԛGƑr9W?>}7;y OU9m%x_9`;N(?.Y[YcU [b2Sr-rnBu$Xt(vf](v9F)upf\2{8Yz{cWb/ dN'6OcM%I?`G7?\%Ӈ+;3wc&5V/;uQVr][Nxcq_1|Z9Lb"?d|9apʎR㏐TmkϚ]YXI\jc/^oG#>H}(x7^E%_Pty؝)kǞݱ%5Z`+zPɁl&v-9;D4P6 HBOa,* )2e][ hӤ c M E,#fCE7ŅYS mIdCJimf}ۃCd7N12٭z^ϗ)Kyn”(ن˒8 jO' ȦY.fAev27ٯ,QRNSn&/o RAQDBV@?֓Rx6 ::UW,Oˎb<L$dȴ}o+lR@BQZEnMj/F er;D"8o>30_e3mlrH<(L@jbvb1Wd/k&ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*2/`,ͧ铐2-$bQF*WlP,XʘUe+7(1̷`mi>*bF)IbYgxm-#~XxŲ;kj{OŢ?r?}@tԜ1%Zf-9 NS}%Ĥ9>E+TڹqH9y,2Q=W%߯nXZ S"3>wJ,YL>xdֶ^_LjJBY?#`6zVV7_Y61Y-F5V?8*2.4/=vs幝nPLG'G^\_ d cSvBQo˪SͿA5.[V/ i o)9?"Ŀ78ۜ؉xclR_lTqŊ7lfhu㊻*ב.Ƕ)pblJKv{WxZ↱+.U6jJ`CGv efAC\=NVͮy/ߙ8~\xA^9e1 Э仸7nT.Y$dG$nԣy(e[.ڣ|RcrqFLsh#w[992E~B%>8.m*HWe Wc2vPRNNc]\ʵT®o[`b8-w­c[v6qCylv$:DZ\rKY@`Wc]0!aWb1KX~6z'q%!ٹ6SSNǬT׾X&aU{sDݟ溍qc)Nv<ֹ = zaf+gD q?$oxQw_7^Vl"e Tr.6F~y'օ󇲝n9sVL·ZO(/ 5CK0ǐS=#([}HC8Q_Q%ʁ{DC#J}I GAqԤ(Ed#gh#.L=Ƥ4(aSfe^_0FOї?,x;ȑ.;:?.~ȡvSYle$@ƍ@ye !ˉ:=2䠭?dYTOa>˶Đ1F8Ǔ\G Cu-hjN-bVvv#ƾ2dӜ}*lw2snB/Wi6̓-1@;0R2ƖǦէ| k2^TǣHk0]ǔ .4$Ԛ䢭tLQU!i7PQh6ʓ0@Qq.8|*SlRQŮPwjĭ_m2'6U YϬ\Z)OMr,^YPL_WǤښ\_?=_'jڄė2CZxx-)xE'Vm=?<ƸE|q®4UTʦvQZ=J5~PҦzuוC+<݀n/ѲJlzm^e:\FhkNJ&NxVdh찦I|fPū[o'//:-%hYٔjȉ;358c5qWar_ Y;UB>̢a~++( We5]B*bț`WbǵqWbȔ +)wSv>;9g?k]"wL;rшZ.j c@?d Lro2+k/+պt,9  ·$SޜCǐY%:-$, uwfmE\ų[]c2nvM&w@|ʎXT&ދzyJY N2(ejzo"u*8^PlmܯM~3,2rACfv`EL*To]IvtT}.=(jG5d5?jji7[|> 6ŋc:^Yzz^KHޟ_6g^VpV5_%"3[٢>Z%"%CϺHl.[d ?oJQ/|2$S4KN@ب(s-CϾ{+VAU|=El:|iF~nEUӏmX,Q]U+ԟQ%R;i鲼,Qz%o;Z.$Æ4=j?陲Gtf~@߹B.ȭ/&'Y0*1Y~8+t9`ȎGeڟ*v#3{Q ~$m`n;ZT_YE n=CPo`'2 >-dZHkeHGrΟn27ՃnUƍ{4vø9zRlxT_'ٸzݏ_ax`bI;r6a9JA,rN;nA8k~gc¶Ǩ\b' )-z 6cLKHy-`T|yH*]2c'{, /-i+Vt ֒]~gOS+7?I l?/#ʐ =T(QLOQ\Jk R6v1#ry\Y%6j/xGC7<$Wfި5 ?M"һſ?& @$Pg5wKAJ2NԔˢ߫% =-Ȭ1$HDܞ}hՌ'Ŀ.ͅZu]9L@5q3D}?r"AS#ͺfx\#^owe"T G\UUصԓ0qNb41)–\Q cLUqD Z'qbb)Mmp(GLзKOXc4[qeb뫋)'?c쿉f}[̌KVCr`>iͨO~S|([F gPzE N !NEl0AŒr vSWbgvjdJ, R2%W\NO)W Xh9$_T,kYO|y+h-eZ94mHwyy-RG)B1pu-LiĴh"75k)6e)Ey̍鯨pPgSQ4Q<~ Vg$?33ͶFIL.Hذ~ȦG4tN'<(GHcQ:jLZ73IysV,}PdO2F"\ &_@.4~US"m|`t1*/Jzt}]~~=4+O>BV0X~X_'@N {}DmH%I'E m 'YGdS˧kbe%eF>-pxXUuW?,;MMRMr&5j 8 ~ITNs=EWS]]r9$J&p['j;(}˔4M`N ,=z?FY-[wvcQڑMOjڤm^*@]NG)ͨEwBYz)'e|HIO7حf#.^Ktˉ ԻԼW<@y??=yI)UH7Qeuk4OuU 4'gBFdin!30}Ηhx!Œ,v(㳹괙٠"?"ba, D>%g /$Ilyfk'Vij8oDP_Qe;KEd6:>D!O|N< 桦i^s;hWFLI_&YH) SQvJEi=zdDޫ 9Gi/oX}CŞ'qczUMy7/+aIH?ԩ?K/ (">ax)k0zѭsp+̬N/XF'?#dd2CsSR5"@a]Ly틞"D ??"Zוu-}KȸO !o 2l+5P̲5+ǣSǃQ4ҘlV8Z|D"Q_Հf:}iO2${iCq6n2vaC)^8M bUmp\q@! ›[\J<Θ6C0%BI0fn,~lvYIg9{إR*,d ~ʊfw!N6m44Iw%Ӆ:ls!sGGB23SZf3YlIe!Pb4,; Pa8RUن;A%waCjOHɤʋ]եs)W:@Oqs/}eb:acaO ;@Z/E0g%_zRS',ytF^+ei$էZ.avHp*ikR#N } Jɧ)^RHqݿb.M%Qylt;FLʊ6\"(LQji]/i*#ie0[3j:IwlRR|䜿s6rb\IoP.}(ts {s9KxR/'L,zZsaˏ'Xl.Jz ֨:da2f1*Tk-E0DVB0!p׮pJNMƸژ8`f*6HQbs KUW~22VՒS5F?Br4b0L]U|`7IvaX0SvPtpĀwӆOJ3I?W%AƆX>`:TW"Dp B8vV%]AElR:%SepL#).!a8,;Gs/Bkq5Jޙi,ZW.#m#"uP|)N؅i"jnI[n?/Tԫj_r #]Fr݄-:ղF*(CD?)fj=K#W[W-m/_W\NdIe#l(b$b|Ib??F7?8U9};buPb :r7x\=N(O~Ҙ̸ ?lDC0]ew.eOilB8ZȲq{q鞾ƅ Rľ<]n\2]9h4b +9,B̯xr؋%gcI92GQk^n R~DU uẖ g3OfH2<ѾH{Hn$yQ]"I"Cbo|ʺ$KM6ilfàhN m7r w_%CWsY$7lOaOZ: o*͂C7i5YtI Q^LHYd}ǕUMiwW68A|'5sNvm!؇6YZP+g)LI,0aClUÿ\*a]t*3Qrqd`99; }+ؚ# oJt #OؚE?[m2ї"V7l70aƸE= -QY8D 6ze'UNjk2|U `K~YƯpβav?O.Q.n&~c:y!] 9R iGDZco'rPq;hz=Χ/,-򩸺5_K 7Miilܼ$#rrF)$F6΢M ֳ|R0J}ytd9w‡cvY®0+A_J409ԑ걋Z2vM==VQ8E"|jx10+M~ј b;sLyHI¡P=vjbPa`V R2(%ՠPF페}uTV?Fk@wȸro!D$`HPGl|M^xx)Ċ"mP@ާ dl!F\Vjwlq|eXN]4ڕ|Pίw@Ϳ¤̜ď]N<̢wȼI+VfU 'e5ZAӶԪ( F\giuh薝I'RQ n&8Fl6eh7Kt7q`]n?KpR M$66?y W~KO m P7iW=ׄu?._0۬m%OZݧM?KOyzdGi}%?ć]*PWO 8PBI{d/mDЖ . (q!/d2 sH;MߜI{RneV%syiNa}b 4cL]ƍS&TeWȟ,`pT5m̓ĀEEWnBT `(Oy3#1iAqm[74cԕ;S!jcqU<>UG 09U&E_tSĦ/,[ƾ #entϯ}F+AgޟrEWJq1Gdaɣ&1HdHECc*/s^1N*OL*R (vPDo]# )`C8ZTS v–>vmS=&2."HrQi$A+\>g=Ǧ:F}'|1޻ j8p1*@u9np.*wUq_*8atNNAJJqù8UÒ\5aJx#JnO;IH;xU#I%.F*F1ԏ|d/~JFx]&a@gzwpzGfgqH1ҵC a5olWK@m:` 0>ޒLjZܕTmP) #aF P\(Gm2k?(a4V_ Pcu㘠#[JT2Hu+qSt&|^&Ebm@EI0i?PE#Ay~boJWzRr0}_zb9;Z1M P3|\c`CqC6Ì$wzM\c9y`ZLv򬶫,+*e[w*,2.G>`K?Pa\h&CV.Yg" ׵KOrK$v4~љ`9hq3(4N?E)\Uh͉BǢMfM5ҍK>\r=ɹ[w pA2Yr q2?Hg:K6 ~BhBf㇅|,Œ^sܟ㜗]V{6Gi6]0t^#~\N9SK'LI>&?c쯌ߥSWkaЬלNѯni|՝nW U^_ejY8^{_`|HEywYS?xû'/ ntAO?WJc~M>#ї?Rn/u̼*M ߳7d:`B0v'9A={W*:ṱ3 eɛ! nD0|IrQyJ /\!`i\:rqwychlyK ?Xi#fM J7j8H|drq5sR9}=dc,"I)$OEJHbQ+˜>!CAQ݁ivPٽ;.UR:!bpn.#<9dshӛ2'!§E]A vO| r1)> ŸC =,~{[L2\?G%Xגv?oב}exYcKV؃r)';F? cb$^QP7ۅ܃ǀa--dj* vUw0ļԥ 2"ȭV/'2O5զ۲9pn )>DK`0%zwm-fKXyM+)ZpD!fחqK_Dq@r"4{[ HEjK''-R7DpxW#Y8e3l_[5?ǫ#̩wKXWiSX^2yYC&r*R veqNЏLJ_)H?OL$-εgjf $H-/_\,l?eq;Z1n?84JzZ ؘgW ͠c[[GdkeXG[D=kvfx>)zXj3k87V@[ZܣWysӼ(H#2LA-4˛;mQwj}WO* Qҝ9.t.%J%C֞7CrF\% za r!>:̤M N5­5RdvIJ7Ofy,GOET B†26m Aa]sQTC.Ƹ(Gʦ60@s*KT)-PaO7ȚU1cp|cty~+2>#ȯ6Czc{ei蕔QۑSl]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*3/`,lg' ޡ\*8‚LBA8-iBe;k`\*+8 )+>l.Rp l Gv"ôKӇqw?kW{Z٬*jAZ8yHejR[b@ ܪ5+n I_\yP፽%=8$p+L4fAѧc!-o92SIi#m@U޵vKhXaV!Ө7H/9Tؓ`V}vhJjAyMo"imN1ȕ. c?0žZO枋34  Ҝ'X[W֍xi2zǔK-R030~]ogJ|Ljr,` YE~2’l: *qm[=0с],by)J!;RiF\ªj޼?<٪gccI)+>i*xTu5V>?8_mVQDVRaG5${pv6_/#mSXϜn+t}*]627:µ·pTmܟH';=6  ྫ[ᶄnePMtidX9iWC1s+9m,|V9e~3twp}ʟB !:dxo2̿ǐ( f%ɹYOই?!_fhzuۍ9DJ)))/E-i#o+lJ2 3)[ WbƑv8eo.85-* 򞬃x\e[ c  XkSM$cLȖ0 r,Gv 7~9au{`LQʧF%W.2 :I,%$aOQ GX?Ky')kuk?Q?|Y_:N^ٶ_q-1-gzvI]HdMնŹ -$?M<7,N/AVEfm;g;^s>#AN&/Dl[mCfP@7 7yya| LBQK}5sNH1+ԏHdNT}+TcT{wKFOoͿr|]1JGLM9t,؃;aLUUٓc vf RS Ml7~[tc,GflG?ꤤ7/jzPUBls 'i"!@Xrr-9tI(qe> نZ$X}+f VzfkUT~lax6f#tFDwI.n.$AbW/\&O`+/5517E<>oC ң]Т fg+L]y',jUջ]",?ݰK.96Mc&,uY)PCS:6)!$-C=9IbE&U^%nP6+ĻfzJó!]eXvXƸ -w9aHj$?[["=T7a]s.ɏfxYTC eU>#!KE7dc~GLgсޤs[μ4GlusS=%LVZ6 7L@vn*bl床̢ϜlbJơ7gSBx%^[xHEO"F~>,Pxr%GHR`wu ]JK"); ƒ/NVGcr j}4%G͜pUU|Qg?9?d?J +rr-v!Ģ݇wuX)?Y(cdv,[|;/2 3d4R2!=.7lK' OfѱW2(g8]'x,8G)imd_ܱ%ySL!odHM<8}<_RdGdŴfט~?+ Z+?NkMڞ8].J푺PtCj/+ǥ|89GZvmlcZ|(g.HY%7K+n ž'BܗN '-܁Esΰ4)R@?"zܟ=p VqsI'`_[/m_Gnٹ%jLdkxce0ck{b2/q676Gȍ.5ftQpRFnF9=7݉ ]3ܦmAңX܄uoZdM_>nq YXR~?Ŷ ?/ ŋ#T7o<а#ve!N,(or"0w$?)S7cRdejxN=BW* oYFDr~?еCL\(~(Thi'd\'ŬIu(#@_F`<~OM+VNb.D=H'?y?\fDeNA 9x! z0lؑ}<>)1hXԨo8scWg kueI;rCFȦJRMIP9cQAV|HTlѤT}FBi;3OT^\b2N*ث\U8N[0&ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*7OCJ]ە'ly\EmM;qVc@>廔壁a_l }bn1Y4Ocxds!% ­i._DI/K -TG€/cL oLV-®NM@>xݎX73mSOl@"ES?N6S{ȣڻ᭗c+CֶK[1J UXpOㅬZdR450Џ{~jn)mO:imƣK&"6R,n̚ΠŸO0a|ўS#z 6CFC g3O : uVlZP]fbpʓM46/ &Y#2-lfXc<6Y郘l y>O@T͸Ǧc\y#i_VÖdS?S&c@)fn!v}8j!򑼷~Hjc( r@¸R]\ۆOC"ĆD[! LvҸ!T} m_Hc_jOY9#gc YYZc}*:qc Fn ", u{C)pH4'yJgn`k1KpHpWH~?#NB9 Cb jyfq.<-rI~rQ@BsqD_v 2=,Cf |&*6/zQVȵH_3HͭeCXW'28܋ex׾7QH<ZY4f>ƿ1~?_/6;iTcnn_3@nbQ_VDL8sẇnQEcl*lY|! $;bjze3(ĕ"NN"э#U3-Q.>̎O>uj?u#PvGr1"QO7'-pUε=Ɖ=!PReVH-pbiQӼcqnD/oSg'j~y KĔ˜U `Sm[nR{x=MhoL]vʤb*# r~eEAa%~P[pm-KB\Ey1o9]lUGNS#x?nY~HT.K%7GHz){#Nd<^cYȵ2kj4r˷0ɫN~[n թXxFkՅnW t=dyeƟ/s>94Zp+N?Q:8DU޲ y`/yn#` #SgS[[)=Le_ ?m\23Q*8ULUTE1CYፄo[8† -L* lǜgq1̌&q_rN3ql2}/V=qjU'i_V :rٿɉy`AjߖUz_*4_ÆIޓ T'ءr'_\Hf_.x*~^Ů|I6JHy =rSޅO[G[kVUoΫOE[e8~/Q~ ſ9ȶF}̻K,I mF -Qz;oO9r3&0(GO`V>m^M1# {`d=1BMGJBصqJb%ej2Q@3b-qROl?Ol0z"Z<_!~c!:/%R #ƭ?=GscU[2_//i^l4]ua؟ ,_$=Ǫ,i$~n*`C$#n)D$dĴ[&~q}~nnaTu}rs*[{ms_NӏY{sp24ҞN'9uے@KxX:1&*,VCƏ/8(Bv#5lSjq ;KdwFt.>j)ё_fPx=/MO ;>c΍'~(Oِ [5y1gwkz=v=p*s`y ]u?Q<oIZ^;D3o'N<@_\}$&c}l,l:VB pDhp  eB[BG//i^!@Zx_n3a!l̖\Ր|J~'_Gf &3q~zK<I?"2F$[̂6͸ A'^/_b/ǵ ~Kkςu?_/+1k8(e4d~y15'clOn񆾛%w"~)8 Wٙ=D.^Y/-d2U˭2XeYdX=1$ :We]AvR zyH}dLU٢8$ӵm#rL_ bEgUqN"K=Zhd8ge]Q7u$I-:kh zdԅF~Y f+7?@^V{0ʃ. !? A7{qa0⦣js-O8su}( s:vP5oWwu-EB{1C,9շO8'X6 ZA4 /:w͚~ZLMh?e~cuǐ2*ꚦd-C8??g#ӒrALy®xh݊KUGC ZZ[*hq6۾ƛ \2iC_jP/)(?H]L8F\`;O4-W)TǏŇ\peYq3̈ZiХ>'"pR^4>9vNn&=aSK:8T%9͠F ,%QID sPi;,ٿ/ 6bf)[U2ۍ*m?<,- I} jїq[ G ̲&@bؼO_rUsqLgLK00aȸr'Hbn\ o'BawtZ}Dܣ%OL.H00h]N&+%?~,>ՌC-Jjcop\_z[8}W52! snJ"bN٘DzEy˻{FBwQS&1!ǁ~/77__q&=(\zdihvrkAOe"tzy#TUt = C`%Yb'uNg/6Xqwh9m涶ۗ8"Sgi乔;)"F +d;X$j(tTf|bfv`1WdcB?`6d;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*0n$XIWG@9I( %-%mѢF(Zمd +~GMs$HxS˱$`K|Tb2˾қΑ# ,$Ɗa\ ojuxPK3h鶛G'Ǵbëo*[CTS& O?KYukpP1?5a651ՁN|H{U?Dr>0_ Oyw%8Ǘ!h4.VdYp؁3SDKƴeH3W @V9QF 1*kȒCn#;QEKcyBQp'Xwk+9A7~)7en)́5 &;0}V2Ҕ\Pys۩!y=\8d6MՍ~EG!ŞUXaQ́߉{`2E\62(_aI;#j{\0ϙ?2t#!YnDIY4|ccGNS|C qKioyKF`Ri.ٕ) f8aG?Vi@;&sۻVuGJ2ʲ3Pz,(br'j\ Zi4q xH!\QAգj}<ե5EIAۊV n$2ynxZkPkф{z豪uQݲCv/{oOwBIhiy|r@Ec}?釜Jn }Y?c%&yGAdN'f|%%-Kufo_t,-c@WcNI-LU@`v8*] p8VC'tl(hb oJjW``wbwd(NZ; l.#I2!I8}Y`?sR}GӅW(v =0vRc;0.#p) ڸhT] 6UQ{75e_z7LF!]̴lJ3AP1FS=p4T41Rm5(|2Cy|ޢ G 2+2c1S"hbShHe)ȊrG^ 5*E5W{br5=0k*1}c JUrE/f\+r;0C󮴺]%;Pъ<\VPd[NF _"?@G2fi狽.5\EӜ[|_$-;;YƪjJI[Z+3PA9жGF\O'h*m%g\roEyܱ ~d"IJ#/Ǚg1 ѐzVXXyi+vz#e?}Cg>'xrţԭhqU?am7,[Iֿ_r%c!H-FЇ_oyQWomC/Kjh8w $SiNi8x׊Iu'96QGL}حaz=OiR%{=3Ğ# 1Z>.@+J %}q Gl ڊdL_U!_f9΃3c)h'|g۱iݿk嚜F.p?VO-»zdM7|/q=^ l Y"n kw:Ϧnh kO`Ow+̈́׏$˾VDd ,jGrE*9eLUU3C''@v4佘q0>NKDxOfZ6d6d=Tt s2bɣq9<.u{f? -eO^A >%EjzbEUb`|Yy;E.ɗ&m5r? *A4c˙X=V/n%ho1 $5EoyZㅜ؏9(ešKbqys"˨N!?Cđ㒆W6΂gЙR92ep̉,8u=M&-5~,ĺ=avr$q7OQIAGoc ח4q*e` DOBkBI;O.3rtl6/m/j`ddD^VZ+;ީ+$tL{-{yeן^븸^B}XGbiKiX^@AE sIfH[9ѹnDt~2m d?m2V/LvQ+za*7s X~5|Tyb qWcP]Z#Dki1)?lr?qg@<E0ڹSE+bDRtxGP[܁ArwPcz,CDc>ᴹ?/7/%ɼwܱ(ȹK]_,j]G\!cqne[oo\ϥfCh5O/[m6Ao If ?g/{j EQS;n12i0eg@鿖Z=V3s0"Q֑z(XL!`fLK8u^&ʓյ$L%Y;UG8a ~p NSrQYսR(rmʼ\ة5#,jeVSע x`X咉$%z=tRS|Ŏ]Z8cY8rƯ"vDZè.i-eoY F+n]VO_P @`*va[[ú3CXZ\&U aVmWU8ۓLZޙ?\"x5r,3g Rbw`E/UL3^C2-ƘbּlrD U"؜&6.FI0+:PuHnKNne J}-~ߗ$帕gUN#L2 &R7s+0"$# @ϾN&bdt 7Ir/wȮZ0?~kf7sbl3M"_ 0Iz{|`Rvgf]F*bȿ?ބS 3la6Mb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*9Kay%^l+Lƨ),lj4*ᕧe'o%T&ZF $aaW??`ܱ k@?8ui"3cWҰ"d?XmoZA#!9fXu{i)H#6W4{`rcJG-k9,{-<.09sxi1IE'&@ :cWTMN;#Lȥk/\†gE*5jqi4@8n--sֲz2 qH-Ú/n눙kiS|oH IJK5bn?Sʥ>B=gMum#R|KpڠE=OV??sw;ɘ6=yWD)]O5R.쟓j$$~%\%ƒyeQH/C^'?Y,"q>/4)8F,I~BQcSl;wid YBmZ=@19;HPcO5A/Z]2<}SFyg^9ӭTT\&|s'ܵ<*q\% k )?uMJհ@U @k$2 d(B[V~e3BR|ѳȥXN+#|do_@KO,(>(|G*&?@OEW7 VYHjJCX>/ ɺ< ,Yz6o{54;h*|J R &4 2TkQmJ9/L׺ũB$n0'9h`6*.|a[Ϡ^E w3",-#)zeŌ̭?qDp)VU pA?N&aE.;3y&nZ,4֟"ٿӒ1| =ԟF_rS^kGߜruܷӚ>T%R}H[ȸX0^x} h5[|8a@EOBS~*1Z풕fT?Z2ǑqhdQ AmuM]b~9f=0i78ៗ _Ïoxt]ש?S9+k혴aW:3\Uƴ+\AMBb=L cEubߐvX֥[v^?͓׾VOMzze:%jN:--O7bRovժƮ Y9TK{iCȪr+&AWWlRi^f~Li"+QcۯLMZ]\MMRT V]pΑlv?QX#TyM\NGŰMV T2ABo1ڂe(OrVkh(Gb£(8_Sq9?MXں%`Wg~?4[J*hR?w cN[i_jn ok;5YB5P˙:UwB9e!XUC~ja%~Gys.L|5zqO~/yyyiw{y5c֓?y"|MU-l\#C~Я m&OUţҕvGȬ,-œ i4;+ ]L 4Γ奝R$1ٖW,?@q01䆱WcŠaWcjĔvGm6yCy#:O`69 pq8d޸B\pbZB[e5W:@ZAr^_*Xx֖JU?M%a.,iҐKc @[2UzM1_-CG|WVX#qc3ZR (v5E4ɡdQCL$V39a䡄m#4qq9\?2?5LV;扗Ԇ%fYr6ȧ t?OR]0+m*b>yXGqȒ;G_磻LJ?70tt';"VR2\DEo֗-,Uj|(~$n|>!WH>`-/Ba&- OĎ7_}uvxvwas#IǘE^o@]BEyFި\(,=]*}B?lco 78!d51XY mZvwa!PQXŸۚ ˒x-ބ / 1(+H?)01\wz^`hFYl{*z%t%^Ѱ?a 侲Iօl! l&*,Kˋ/L] SG/OJW9OF:1GOt-Vt>I 5-9]R΃ij 7DضQ\}b~ƏJ\$f.Wa]1Wcx튻.V,bbvPt.SmğOG)r:CtWfl(v&WN0®́K\*lTJmtIKEFy@p}8F)QWSI/=sx+\W M>ĎcOvzsԏ剢d\N+NSV6 $ FZď%b)3NꜘWpO#ptZTzW)q:UGP m|q+ m..w{X,]n>˗ƟçSՏj?db$Ե[M*vPzkj`E5ma7rW0+{;a6s^"Ҝ*E)2V)#U,ZY+n (nPߏ ؐ(&Ï['yUٚ!$MtyC͐{0 !.tw}Hq䎼0TxPRJ@b6ƒ i9xe;rGJ4dr >p)3F";<qE#6Za)ytS"YRgaxb`k[1s+Bѵ%1"q>x:^9|KTi&i~0JSI"[$Q$J 6^'K\ 4`r0b \$(==v%cC,G6X_HrX*l<ȣ?e,7]+ȷބS&0-`ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*9} ef˓(Ce\K^ JsuO'ğ޸(-3:/LR-'5U?/$xYpYE.b2K`%M@M\cQVӯѐ]kĸ3T$ď_Q)ܖ՗ ]4ąDZy%vX&'is$E#e"KuIذ**S+}tk1 Wݚwzq>ȼr\ _7M,mbGV>m*U&z |(?O5 y{3 V%)/O}/z4w$zcɯRR T(?|XdU?C#LMM*// SgK13_̈́MlUp90@~~?T(6`2 4fbjI;f?i(3iض("ޛ#wp« ;#9!LYY6@=*-@nN?D4H&ᅖG|QиR4IO:ĮdīDvӖ %~&bOL Hz3bx]FZIbߋ4X4l,irI>l UwCMTv?NuGd_[b $w6WBSӚԥn%~PC") ;6$f]=:ˋ$W+qZ71Y"@Mٸ;'cymezy.dLcIBZH>,c? R_4C?4VۄlN'tiaz,6swF_.DG3]@4>2&yd"\+X\7) 2GʐKoAɠc5zw1o呐&d&2J`*j3 ['y>u?Mm5Ǵᴍc8X&~c]s+qBmƛfa8z:eR8!ĝ.SՋbES1S\`JY(0:8)>5{E򅘷yD|(:l7j_1i>[-QI# Ҥ =^z3L{lSG8Mq"" tmD7lDhEQ #iKtP Vmف 4 {Sq.8Jp/}La5CcfsyFFuaX2G]>!{$w(;2uWqVE$9GGp'SF#ȹƸ \m6r*a`QCa8SEW$L)]qW^&sV8bRቖ덖$[*ӂoݚI!O8nׄ(*FsAkck[A`Ab;5X25(u*wGI?g⏏V%j$,ds)\jR+JZE~k *vT¦4#|U偊hөϺޚ--m%hSҤQVpwܼD֟So`v}E |+u'ؽ >Akd#?IJ%s< rHqÕ8oT&0 ޸ͪ90Bm!u逪Zkv-.։vɂU/(4G`BøQQ-r#)A}{<?5C5RVsC-74g>~#MqLK}2{ z `Y'D&[،@9pR5p<!FZdsb>'7k&͸ѯ'_`Uq!W֛^CoX1y0(ufY&?h0TVsCVl6ȳ$ehH1 ?_M.%e(&տuEbpI){,%猀#J#S@PIH. e8d߻W2N !O pTFN,到J>); P !еsƣ |1,{^ccvgJW1 n|MRS9k_8(9;1WK4݉ff5$ى>-Sk)!tƸǛ8r}8sRx>L8ƹo+]!KrKpXY0HĔܡErmbb2ʅ;TXmdҠR҅f<͕:޵̲߯elH `M.Ĥz ыTY%DyTQ;lA6/f@=d$qt"/Q<1'<=Ar2 4SXJ[;E"d$j^L<17?vBF7kTPUaST8#˺HB^0őWfQlA/RqqaaL賊Pxg}ApW֎ ~5 1G?™#}ަ;mn-9-t/cdOǚV)[7Ms6+6sm.[_M!Y7gs9˖t%f>̙myEqjX'#P'&I^hfyHѷ2BD4\w]ĒGGPG+Ʃd~̨DKcO_I~?~-sqWM! . 1(b?اL0CN.L3|O='Mܲ\_zHܛMO[}FPxs8E=3 ^^!m.NO)?, $@f8x2hC<6 R(+h0A)喇4lü.d ##v"5ݬ E#N$xZ԰NVğ/ӳyH/.j MӚ!:# |8:Վg+"Udq1HC4GM&סR[gC iǺ2?=.\'+njl2RAQӹJk77`I<_\b*6j2O*7#qřGO65^QwYT701e?;}!KQTu?B/ϣO\I]+LɎP5 M\u1%L$j^W \#w,pUX-B|4EpVV$*b &* lM[ W.2&Dj˾N)eĂr".)iyOuyRvSEz* f\:EտF!%}-f&q,_/!Cs>9N–H2PRܚ?̍˃qin31o#$WovK-gHbmR}9Ev#1dQ}?E/OJv A#+]%PzCWs9&I?#u;u9m^F1z,K*0 ܨsһ@r\k uq6ZbژqiIW ̑j#OExeޠWIj1׏9uWxwdZ''̉Hp:\ǯ5xG7 aD Yv r+b!1aQX0XbYu\RQMEqCX{P4Y@5npY-HBGC+'Ğr  Hf4df&㉮,夻du321dgL? OD҅I,2$22A2^\GpK/*V2أ%ei3f6aBrS#*21n(q)o ->L*rnSB n'љ&,*hw8SBjvvא<7@A,Tm_֠$y!hO>fTl,(h1<_ 2 3חBkʵٸ_k< ©yg![{YH_0%}8»K?1DfGC[jYkyV`e2~8JTMm'c#qL?Vo\ QRr \?\k# %krH,mS/#[>>ujNW\Y c x[2[WRZI]I9k )14^ơQG`2;v${ br@S E3?#$WGlu#Li+`iDw&Bj4q q5k8{&Q)K8_*MoQ]BkDQ_W\r9'.ÏU?=_ \1XMY;O?g6z/?O|g)-ASLr%sL ZO]\aBR)+viߢaG‚Oφ?@ ܒPM^|?\aUȬx_fMԎd3KC%WoԹFh-LD|&OB?P:Pi<~6콙~VLNJNZEPi52[{LlbYkYbBlSVG:dTVAʫQYn"O@O`; -`Uٕk]K']צI] \J=55X yAqKaK{[WrrNq 2sh`c+R^QOl1gor}C9Fv+LUحrmQSy5ebxGHpt++U_mSם^ICoIYjVܢ[񩧩+sjw 8A90I/!(vll,A7wu4{R:-"?/?,l~ʝ,=s\`7*%]r YmZȧE.SA_L #X;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*?qmRzqc;2c"k:䩘 iN> RlvBɭ'@$ j +|JX5~_NWHFtE? %-BV`P}2skžMX\(FOr=D!# {؆k: *&yaufCLO c+EQDG!j "+wrHH֪a˳S$ JhfVʻ&ӟ'?Kz.졈ߑj}-nIطdiVcӀ8s+ĸpISL@Ȕ U~dkf#dŦwijm2Ie,//Qc=μ*w#S2tgSּզ]B7^J29g؎dinNaHU b_%rۇw_5ԽsiEey|%[8ml(-E>< [m:\?ES~b$R^!Ѯޭ?x27KhdNa}ybM}yդ }E**Zrq_P{-.bpC_'3z ]ͨ*z9ꆥhNW(,߃[$P_'ckܵ_6Y\v]pKG\^E-ߒ6P]f]rvWtB",җQi+շO'nۅ`^r^C/sZc$*6E\10'l fxXdq,5?Mّcۆt$caw@ޤ,Qu$( bC![eb/I}dO,Ds;8`G/RK*zQirU 2R}Oj)Β,̿ql18?ئrNm>xRA!jU; Qx5Ď# wŒ)Du\Jp$OQou?Njߩd1Gu9Z%܆W۲>ʮJr;c??m"K|M8;* $m!.+M,Qh–ءSxbe8&B4bא!E t;Q\K\" ?;W:摧A:)y¹Zoj3KYo<0=zΨՎv\g+/u0DDttS [+r׌WMHx0)\ I+ۦ% wd,}t oԯHNdqy(XOdP6SK$"a8_>' ]BK9:4f7_lB.mVz8ێyXUR@pW/f2Ԃ4DdD*iҾ4_%/$&g54*{cmVKe BM"[,i.ę7,]{a v90)v,ODZ?kSm酰;qRiȨ_~pm-SDbw}(#32cp-\ky—b)QA,d}6Ј@lXR|M~_#_uZ\#(g2_OxV*@o~ f9FG}Ik`re ®8bcp]qҬZf/kN?ԏ1Eiqc*|3K;a5͐gXThVγ$-;(r_؍ς{~_ggOAQZOi񭼿 sC-@b:H~f>Aӆe^Y rh3Jnڟ qaE!ŏf[+ɓ̼ KFVX"0U0 jHeR%tʓ UheRȨ?0_mߟP06Ĉ*qUFMsJ<t;(cGSȕ4-TEAT cD'͒Orᯯg&K;ءQ23q#eĴ Ȧ\JOʛd 4$t9\U=1$I#*i%D"ko2#5'n^A,Is&.,TY(j6.Cޗ}]t*\Tr\J,3>>C$(;q' Hr-nTqcPmODᖠ‚mB^_QzlrVCmASLLe<, d݁ .le&Ǥ;k1Qj)"SZ";$Ѻ= }9: % Ò]_ׁrQ13Tx9DbnUR?'&0-`ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*3jAkZmQ#e"#Ϛ)e緛Pn 3͡?tP+!5"yqSJܸDHZ jbD ʅro4i$`"#JwoR2'ބյk$S 7' NJ/¼dAwɨG[!"HksuA=o.8Jl8v?",H#BF(T"u;PnuK$Ld.U+LEZʹ )m4ZҙDX4㆑ĸEaO7*ZO q)3ʟ(0[tX3r9p95 IuɹΛI!@QNmԘ?6&l߆iB01;yyeƣΓZKV#*!Ʈg_^Iтz.{pS1[ E% b ?,8[Fb`3&1 \v5=BCS4Lj*}Y\kn҂!?cž%鿶2jIߦ$ee!Z%$hȪW*d f\ _p+ՃP_ݝ~}B5g)fGT~um%m%xkޙi#6dVYT"Chp͖W\R#LQmՂ(m7 |۬\>_ OVvf*n$Kql6s5=G4 -pǂ=iG ,7žR r&M4JZdcpmn"PTNjp7f뉛N)"JiUl y>-e#J܋!a\`J KɍK.洦O-)`Aİ*+Bw5e&ycj(TB_k)$hۜdb%Ut=?g$zvм$ҽ?|mj&fbO/"!q!Msmu, қ|IXqxɦfŸ/?RҮtmbťF\B*6* ;̶+EvQ^{~n;H#^Pᰂtu3eQ]\* VCZhEFkD`u ~9!<"S̴*փsc݂o m!AsXJ˦*KYvgU\YY_d}ro\q̵†, lm()RqQ\q[ß2."\0:g8Po{R ϒ5`z$ !=Vac3|~@equ9e3TuSV;N< {;[NN̽ Ղ_\0{|!f.s$ezk]"Qbkrc Z̬PAh=pSNxp͵OEn@lp@LJ{61Cc5expD?n/7\ɿe%8m>?Alvqp ~+hkrĜ`Kxс]F9%qↆTczݓg|Y V3DE\n؏n#G *wYxӳ~ %3+<\GB턛#PVGˏ$y'|ctk#Hµ%_Ca g/;iDMٹ _( ^!גt?'L&$~b_nw$_mMN(;0'م1ñRvBk7 ;ٔ:fTLeܯÄw*7Ƞ+y"O#7r"X5ǥW~q5Kj2R+04q?<𝲔cTo 28ak PŅZ8`08Y.\׶*Ͷ[)g-ѻW.28j<=S^ s?K^S5#U:_Yuq_9-NkEc/G/l3wxzUQR!ؿ% AdbwYNF6r PA]Fj+K|;We@:v,6—cdUB]FIGlWfU]L%%].\ e ^K׏sxzp2~HU bvjw%զ;|pWnEݾL¹ǚS?&7 "#vr6:3oy'ًMȷroEE1Zv&G!®Pbv @F>0OKG XrOL/}>T9z]1=I8Fª[tenN?TnHSA$}'&W4ZkRv5߲ }z97 \ k_t`dYncV?gg3_nPQU8.=P-H5+FZ[E&OiEs|?N<2Cʚ;V77[F0??".x5=*#sLD;ݿ\X~W= =B/ =oK#s} Rf}E2|/{ZǣpDC17K' B:[_|p2\IsY1t (I; b V\i%(ى( u*pi ?ʛS{m6BG4FvlUDW ciW"L#s9e1G"J2$)t7fNSC ڑTwғ*4ALP.i% pp*f*GC!R>eu8FT,8eYzZZLP{`,\Qf.qMU*}ͩo8I7eaeZV&5# n e;6'fY L㟏M!;+҇\[ɕ麗(E1lL%>[whj2Q\ISHEEgKHaXiT@S00׮[+;32ԓ9 oK-O5{IL0_┤,B%-Gs2!Yc?8gb}f[Jz/#7>,5XK플d's|?9*m&`MdT~/ ܈{n; V+t`*jIevgDž;rvn#O%+.TDM =xk ȶ&yDבjLB8)l&\!Z͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*=:A$ o QPړvcE¹ޡe[G+ĕ OL?\:q\4Ȳ:v٪*5ȴbNO,`T7ĖJO5X0| _*:Υ_Hs=H^? B+Zz!1{I^Uק[[$G)85Ope, LPA#eVpW|o|VH傃\d[dET,}wR$Ces!̆~:E ե*W$:uK+nO&hLDq$@l_򷗔7Ԁ -G] 15ѼemӜ} y2xg857ŵxv_oUԧo+ZbƘ/2q I;/lC:T@lSbLM/\<%V15xJ8ܞnErb rjqzˆ62G"Cv #|- .{o!<ҿF@o 34+uc#??!-c֠{yFhd>??a<W jw+!S,xwgP^GwogTaaPRHp>i+#Ǧ?>{.tS{˾,*F_q=jPEm\ /]<0CAS  ݫ*ǡɱ GpC]>YNv bU="v8o׮ =12iw6mb:nq2lVD#r7ĎynwrȲTq[,~#=ʮ)^|J>]~ᷞ_ʊ@euu؜s̷Kt2}5b 6 EOdF.f\||(;clmcm&TDRimkM09_Vh6A'#eA~NUy+L)xP2ľ- 5Q-@ ]і%lx!,O|ʕ>*dԓs^ ~C9l-.eO:bs]"gɯ҂z,'8e(lx/zmNQj>Zn.-dFSe`@S83o,d|.t@5ޭ ZGQ*}9_s{_5BЂ AFnԊܠ==algs兕pv~V U1Q+|oJ/L)]u9 +Q6XğJq 6wT?k=QxȗXk7 #9[rFL0*1R\lUbNn# b/\>Lpq+u&"XtA978q 9 ˼?)l~[ n(ͅP׶RVFUV$U#r=d'f,KbB4bZ+ƭ@Mfo7ͣ^^E2Ve1dFo0v޾*O_;?1XDf^vI64ڭqD3:>Ӱ_TuZG( uT1C|ys^Gs̙]H(葭>͗S~Iۈ8w+}y5r\l\RWeң%Ja b*0v5$"bʦv]6w\eOeÕGݖC)OLj7\<֬eVҐ}D}eќe'[M<?͗n%P=w TvbBd뀛"\j KPWbj1CY45.8a 1㉊c+r&+mC$8Ҽw91ms"} {]oʚ~%6vp~VM5=nM-QfTs Q.o7|y^׉GeN[q']X[n?O՘O\#;V_;}f4uo|?O 5/#FVQjeC]-Ii"3ZI0]3[Ko#:ʇGᒿ!ZY1.eśa"4vS!4$եW(T3M d`) HaЎA#pDE+'Z ֢щ $j?&l!e3L0HO!o4yJ} J;?q]#N9hTWF$k-MFM]:| YUq*pS&덦u1CpS )/Hby3cXKiMB[zo N6kY$֛ EC y1~˚dzo.-mzIn(Jn&ͰTw F8-ՇZ-rBUɪx͞`)mb:bӱD.͈"?ߋH4fOe4z`z.:_}gţEl6-m$̱ݸә/q_G"r#`8$za+T]TqPXs',lAXĭ 72PLK_.1}<<|1IRTt\ "#<nO>FZn#C.w82Hh3 0-b$V8TD y81-^GVmlqJY`TșP-d$1(14gB|ƦޗLn.@Hxj8Qy!4-]>)?OG5#H+Rx6XbO3㌼;fR#Ljd,v"8EQ@?%˛ ufsuk^˽\rV#ͬ:\o&}DIL06LH KaɈw#2l >0O =|_-k9M/_dkg Sl<M=F8Mlu F@QK i=OBɾSKԕ`2]kSaoi<쑻WQ\LW\H|*T.fuc-sgTZ .&; F&r% 8'|&'nG+o4"0^#{ 퍚G֍~5] q?f$nX֋ujz̮-nZGd2k#4v@9OB:7IfiqKX G* 121rj5ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*D'tRAm_eʲcEyr2VȺ Q< W@i6cOzN54W.t湔!,0jEm@|A@6*(]bXv^J_釀'u)޼^(HM<2B"<+Ko.Թv]jPYl0U~wfĺKLBڌx̵<6mqZedcK!]K"6;4 ztƗL13W]({k2U |+VR:&eX|[ 昩9EYņf%je4hm`,rȗiU月-c%j{f-ݩ@^"k ƙxpqzBIJKlP#߶[7lD) 7ƚdi6 S#L#}'&1Q!Y&邭Mxkr<4&Ӧ0mqdT+TTo`}&L.d?[9)f5Z~!cm wcR"ArHFt[k")k-@ů's3mnwmY6 CP3|ݿ%2{LxRRr+k] bZ`,r!އ_eicK^R(!sJvd6l"ڠTAT+{$c;(5WlL-Pq__VYmJz--of2!U9Cp/deĴ_,if9.,5_4?1_-dGޞXY7 +X>(Ngɍ@8{'?=z߳81ȼ%q6GÁJC; K ¡t)4 H rcn_Pw&i!妌wCsk^]:Qf➔&Ij&J&n FŇlQc8UippTfu ZSQ\)Sl/2`EWq0#|W o0p Lx r®ˁw,KNqq@-#aᴛ 2Ҋݓ2_c Q^p<5.aQX0/yַbR_nzw T%BA͆"$IcAӵV5ݸ9OE[$^mDkO SQ$rY#Msb4Dj)4I_oh59|$5." mc!~^ d?9?yvU2M̩N6D+Ă⫉Wt…x튺;o0\Uو]Ɯ*zm *p$C*TaKg-+*R qpن*kbƍ*^3\!+[Xb7`B!n!YT}eQ!vcLc?V~<~'%VvqKhψf@¤?(o`Y! }AfEn-(v]qCX (xʾsԾ8Ov+Vg4bO*@#̾E~Уnc#six}QܴPNIHϦ  ^U3|Azm]Mp0dwȕaCu[vQ\PKuŬd`yHaܴ1NJ\w9tKo,Ĺ'n\06I2?!IώroUU{kV+3Sfr:]8@|QC8镹V~[DR3A67ą{ om0}*]CqWaJrIv"Ņ0و;+(fZu"n$hFRrd,j] rWDFk#X_g""gr9Yoh#cZ4UuqttsVGbmRc,Ɗ6DetU\LE7Ӵ"ݘnͅs4fL5qO+XVrd!̴WM5{A6U#vU0;NvSm7;,%pv=Tv+jH3Sjꟹ#Qk'u ΁^Am 2$\Z_+?]n,2q'O"0܎$;$QS㾫}瑯߃^jmw %ȍv^hwHuQj| M7Dbu&ROosBl w1֛B)uc+&ס#kRثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Ec2y>H篳LثS$#hnx:FQG3nFq8o$9#x<~LɌ@ S[bq'.MtCxDd,Zv(8YڛZ뉝el&ؑD Eq6ߦWt)Rh1|ND嚻"ܣAl dB{ l5|GoliߦDemTw5Mkp~W]+\ДEipL#rk6݅m] ?S!lL:oЏcFItq!uMĪ%1bjH wb/L-oέ6.VҪ? ya8ocX6cn~1O׊.s(-ǀmtFIL%w!@@ZW6Ph0:Wu19%,ޡ2U 4 GnKp¶@ˇ 'ĕ^yPD?L}YHߗI h9 ?qGqwr}~`XIu9*uSZ=F⍹#\Iߘz5- (A|(24ˍo' /\rNAr@Ғ;'RA{e:,1\eQyc#e>8UR@ǩGED  泟.~zkl/ݯGrOߖF/*|V*Ǹt>|н?2>,0zz[tom%ɎnJލJKZha%siqFA:ٌ~v'ѯ,nh"qU97WY fed^j.TdC?ch@Z{dxӱ9zQN%Xqv)'u21BqvIk%A<.y!̘#BNHO=󏒵WҴH02t\pɘFd['8W*/! Me!CP=LFrFo^GmZ3\!>Ҭ6ɎhZ1⫫›↉ʘRڶ&W\X5ZbLWW|U9lb+\iMVbZ#0XW1m\J89MF(v`KU˦8xMpřv+T4lBQrlB vl+hA#lRy_5^5ZHՇD|@k-9> FMg͌*rbòkQ%vhd߮H d `WY.j:JqV*pZPygͷA?-OQ+k::ǧ'e'߆I.y}#d_lɂ9?'CdK=b!g4%0\IqccQPVV *1 {uVcmwPJl`ƖؼjK1S@ ^syK_c77#%m??SiyG쎞󿙿I[vGoWsU^aThB=3ָ"@;J\<L ư® RC8Oԕv, i&oj r81ݲi\>Ul#ܜzTyn鉋 Li.F)'Z31'M5r$nߛD+9 [6Yxl(C6{{`pN45pWAsJ"rJI޼ 7kŠ$':sV+T˓b+탖؆.fv pC=pŨh>,X( ^yNt˥Vk2{ߵ{'w.ՎTǪOR;1! ޽iQ GA]UCnzTJUPێ?DwyҼϭpnVq1Wb)MHo兿t)҇$$Ab`4-g{ QP5ͼJ,j[~Xi@Uۋ+dl%FFCQ<|RfI]&AVgUY:d0]F6*֛?  ݈(I#(CMSH<EpDu d$IDKBe#%F s7gQW:|u"ӒGnFU vmxO|h@LcI!ʿJx4FuPwdQ5d|9_mލ1C-˵^CŠٹgYeVݗKfGv^qՠD]α8q@5o%Q<` ܳo/f{ܔ i3am'ˑ_Q+0m!;gBM>miOq# `_ˌ'_O{ ]\aCZ1 9">cQX{%!mOH~gˡIy E:9VxM #OkJl `aqO|8e)n<~NjqkeS\ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Fy&eLX[H Ss"Z5[lo^DK-6!9DŶqώ9 \ rB6*m[!W\Y!,& .m3W%+Fåp>"ر vɎq1F&$\o. g4t:bfc|0aĊKcK -*;~# z`HDQ0;msehؕ{ `K (r$7cL,,Ws!zw ?hcQ""5Q`9h5p -G|ˉqd(2h1i'qj6!A Ҿ~jtxej-lsяS{SZewlSFԯhCu&9.m@>fF\lzA*/h⊄w&7;mhٶޫ}5#($ՅVid%S1 b*:\l:͑E[2 %1oCп(uJ.w+ F.DOKDH $}5e)PJpˑzW(t;ܲP׌ߑkmR7B~!J>.BS[NS(~a~p=oRF ƌ2}aӗ+ s:qCG͇O&EK/(KlڥOI=3[L}rSA IM ?`"Oax[#g"ї[ pI{Eu%_r5uY[Tw TeLpfuJ?\ZX3#$P )_BU~E^,A[c%t \t#Zj)9ªt \m{5џIlr-3@INHUeyEG6C︥7r8Lw 2 銴⹦} Cq_RWbOU0d1bAT.1 '"bձ>4­/*JKu+[6U؃uYlR ro2mRxۮ8)6&Fo4u OQhImW WuO۴Wdbjr)^FYZb|PtńB9)0 au2NzWiO_˚贽 ЗVJE2r )5$PPvrγ1,7p[6m?)KMq.wJmOHj`ks,e_!"JSΰBҞ?v s4'XrCQVw+3崗/uPc&GqW?v9 ӣ&QO[/-sZ[zVu/>?g:$("P>sc t2K=N}bK gbz qN.%d2[Ӷ8Mvؑ<&:vȧ)(]q@.1lNW/xJmOPb-psX9v>RTm8Y.xv `;3?/+YES^qE*"Q`Ͷbe^=NCS7߶4e!#')L4KTvC{bC")_"M;֙n e$cSSm|˧$OP @t`O$]NBCR<-Z~硫b|4K'4KWkpޣ LL/)۹!z'+Op$o7LƵ$XE4#Mz'ZUxǨ_|i_&ᥥו)*41RS )g l+i8N\"Ej+qiMpF5BO#;+2(&kЊ;cMwMe77HbF#a6|Fq+N徍zɩ?[ ` wi LE1׉?qEBxJ#"n,z?8_yj8 2y@fA" Vԧ%ߘ|tWzcG/2^O6Y= X/4ALj7׉DOw7޻c5~"6)eX )#!|;햙-eeKPtOxb :?$?I|'a)ϧgzp_?΋ %1y(%X4|4-@a/d1ÖyDg1Gw__664 ''NQF;'vn1CJŭAn>U~/uĔ™z\Qi֟<&4|$a˕"NF?E]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*I[cMK[^CAKȺOÞg#Yfa[ _Jĕ |cض̃z,%Q-2k`'cjL2xlNXJH-{ESGfіc 8 }-co0:rb!M2h}ZLPJl:Ȣm2qeNDPw qnFpzf > k1Ɵk1`)gM؊{}vaf9ۼrV߿_Cq=G."##L I({`ǶZJ)޻aW2bYױ4# ,TZnf$}9tW_%{W]T (|9\xcK݅G~I  M^W!L@)7!+3q)!*eBĞ:FSeӁ@;cm\J{0ecvai_o1Olv>A_ հ1ޔCJ7Ɵ|7h|4#5l =)-zw-HN< JT?ɓ_d{CMbAಉPW^哸'"4dG =\ :)=̒(eEzW^_ +"3YHaFA.?[n /14F¡Ȍa`rh]]ӯLQM ) .1U@b(Z8+Ju1WeR2(\1lUpDf lk-\ wQC,$}Ȗ@[p R8a. q $7[#}Pjqd!7T(Y]aҌL*qtɆBL vs2,aZ.# *&0ZATfJA8Y6ڧE+LR졊]"ŬUFjUHe4a]|hz<~R&KҦT%sU"z%6xcu"GytWNmVi⇮?c9c<MSNo%y-_%$ݡY+rZ\x\~.?>\}3u Nfj3 Sٚ\gl_,P3Ja~[DGL z6TcJ< a\nOx7\Ato mp,'- ^RT{Oe- W1FJxXa: :t ~ __|8T\G*W\yR}juƟ1 ܩ?,CynHT05܆IU8 F(v C!.{dh]m*yċMMUDj!.47|GڭtG/hir4X䯽21זSZ0IУ4=c,rok\KkSKc }r1qjѯ 7%c\TNS,xɬrkvn5]lNE[!E®s>GBrI ^o}i(<ٍA#͝/ʿiKB܎,|dO"pa?M7Dlj Fu!__O&1sc(}!N[C<4\0UH|1UZ rQ|E':q2ƻUjUƒٌx1X@; dV11>XQ)߶?mO=z~7mʠ g,UB!z$/Dq4irS7(EOd-T;(=PdYqujƐ~xWB|UvƛM5 B%TV#l=cCrc lHb.&@dh3ZjL (^k!69ME:NN4_#J~"}@`?R7JaljrjS ] - Zڂ3P/y/5ݾ\>&Y I;]mrnCQȇdQOn'ʼnHO8UVfMKtv81܍vJIDDN5?u2ڎ@Bb?Rw>0sq O5ۏMUnvLhh}3iCKND֫>F{dm*n|Sa^+CJ+A?Sޤث l@16W%iUV^i)s|r<չ" }8q31l&aɣ&u)Yk-ݣ9SG wEGY-AqƊ+!m˺ִ-A`)JGKIu)^D(ЇupmQ=}s%]·-si9`R}U`E?^4ƒA|CG(>FN^LRM\[VlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*~J[cMK6Ƣ^y9H96̚uos;daRlLELz[\ĉÐa0ǥW;k2(nA?Fc%:$Lzplo0vpSHD%a/| Th)rH^%Q}؛[ׯH"!n<&Wޘ Z1O_ƃM\Ua wA~X) ;l=v;Rձ ep)pF, ڙrGZ( )S+-*z&PwHrLC֞t8"mD+u1!q1E=684J)l{sAQ)_^AFDVaWޛu^HCj7Syw$`(iTn61 Tf7AabfBDɕ4UX|1&]\lZ@7˧-"K*C2|gI!%QǥԨSE̎\ϥ,U='}Z$ڧwSC`ܔNw?JU4O8; &+>Xq?с)N`-Y.jZcS֦deaNݎWo &ĵ;OqW7ق@6"-SbAb{1 Z|f U“%8 ځLp ڛx9 Hi\x\Ro~ JK4@^(-nԚ\xzL )4t뗕J6*ZV#+>%"#ǫZ>8jI#¶lu+ၘeM mTer(4 c*l|%:a`؏0zWjukjOvADž"Jf3gNxSڡ}V nPw$d䌱.,d̦ae}KZFF[.Up$m.~FV%w[$?҄q:5 ܫ}8Cm9zޒZ"b?/o 2SڨVHO'~ +WrMjwǧ( ~OyA"0K$8Y\OTrD\#eo\/"1L0~dRV]LC b\R wMr+&>/5b\.W? wu%Mk6*ݽLKDg`ycTO;sKT#P61~`%@Lu],$? zMoh*?OX%|&'Y7<1hG^qfP`UA]VE%[LUUW"Us2L* z`FJ;0([Gde[E(jKOһ%ü)b ֿ_Eַ* |zaیm ^.Ĵ/Oi`|@q323QgIB@ffe>ql$2 iUه/&&$iut ErXA4aZ "aV,|k1 mፖZ.@l.fwv5逨v7"ɼ1Vd‚T (k3`WeU¸j7Ktj|WrquXg!r^]~hP'ǖlFZ$x>&s$xDa_@3 8I8w&l%Y!ٹXڪNC&~Y:cjJⶸ1\o2۽CN/<+n4ʭ2@-vq$4bA\uƂV$n6Pq!+㊽w4ޒ\Zpt])Ԝ˜E6@^ĘdY"81JJD ?v4^*$r,&iF Mil?ض1edcm.,nEV;ҼUo_MsىOژ 1:T^"&Z|\V-o3H~n~Tt4HZHx&Af%ET12JWf(+]^^BZEGCPi7z0WCI)wہ \ +F2M]қʶ9ڢ70Z@Uֽ1.DPU)1WiʚA!I= ׉bt=V1-?qJWCWqj k/ҽ?lV zbM/z~j1~|B~1zxc`m᤬2)@o-X5B]n~NI  6F`@ &T̵>.huHOEf9t\Oc=c)"uTƴi6 0-?ĞO EK7̑^g$*l+LaƁA*;oq͏zlٴ=)x zHZm@0YXZ@us`cMX|J4徭1R =%vQ5ۮ6P61qɉ"p]#!\V1 GQ˨dLU[eq nL|`O%PO^FO Z6N [+g삟"#R{XeߩoJ2 sVnK-! z2 **i}XD{ጌyP29 Xo^~#a2bE)Zq]"„)އޣ+yIpf;W,Z_S<<|q.8|+\^+'h>g1eW'(i1YqR HilP[Fb==1|$ ^Xr2|i2E8Nƴtajq]QOlA]bf:6$Px&e~ZĜW5)ǍR۾P0mES |r:bXO*M5Ǩ\()%͍cەkf\%k1@\QjdZG.%=S&@u dU<Mej,cDŐ*neR+Rdǃڛ.-mU[[Lg3%J!8iM8xkdM9Mɻlx XgTV' # -Cz,J{C^(XMs<6+H1w9aөQCQp|vE=@3LiT0o2t2W-)Z{Cofx 3V(sd8gGg(g!IM/#Ņ]AI`,?/PG0πKմ?Ν>C"["X&Z{̨dcLz> g?AU lD8RK7Dj큤>U =VbZk0;/`0!7&ǣbkc +]\GACJR! MJ2f VU`j9QILJM6=^iXgGF$j[Kw& w15_3oTo_pI45Q,2Po_WGl_tO3P?qw/O&O|P$0\#E ?qFB\g6% SP~G B8.qp0+mcWs-s UsGsb%VŬ,$uڸaƫAam|wʋ+G@$z;'n,/ԂmX?%Ae/_GXϠ7ـ͂?Xk^.&nWpK ZȋJOSAVFg܋I"CHX8b$j]9!zEU=JeΧ BF)\1oZ,SVT\*QF5U٫(v8b]iYZvS U/v-vR)QKCXIuq'Yoi\ƒHqmNT7B,kV Tr4?d}tDK*}o_W bb7JdO2զYZ5K#´mמyVC=& -2 huwE=/(Gy7RYAO/M&M-|neImnNWWO_1f?XwŚi[#;Ux[Cw^^/~VljKӘjV^ic)Gir` L֚:V8+ 4oodvlE+>q7+eu1N:O#5͐+gԱJ$SBbHnn:T7䕼i-ԳhϞ8c&rmi yO?˛:}+KM>їu?DNo)RֵYiZvۯ13j-'f;?OKcBs8\Z d!G#JŒ[cǫܙycMZ$Jj|K"|R=HLm&بa33Q'.V#ulye`JB#w~Ӥ*^V@2O 1b[ wI]8yf~$2}1VL0!Uʋ` 3=/ʒJ'5Bj~.N1'e47,Y}1Tawn_ ao/~jpP|U4POwDEh_Q-['MNIlMJUC?/|Rz-%(WRȡ?s=TG#-mZy&⾣v ś_ C5ۛ&',-PZE~SB%QG_LZi°ĨJ\8#3Hy֭=gX'뷳HU 1j69|=;8GTu^X +UF =qʊ0?%Jf$?~<-d.;ҹ}w1އlKw6Ui혩›uG|p=b[C~Vؤ-d+H9D =4e4c$׬6F&90UO8Ɨ퀤. y/0 \*Ċ&tHE6)Sp(Ȉ繎 vn i=R7z(|›n@ql͆i_n |"LE# Z Sd $F ~0P *KX^nF;Rqݚz4dYB|K2cJ]BpSç,νwH@26F4mq ]B{`ƀTF,Xk@>q^ڷF;eƕ;O*F:mLPEB0&wj/(׿ J۰>ArAZ`ᙜNT|lK]-%:m]ګ,DiQ6! 1HO ,)n}6ŗc"vˑ(jlzotjhxx~ANO鍕V3QM»,f ]8p$#q.딭_ c~m{z`~E1PiNƙ˖m%HE{olثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊