LExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 10:44:02  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?ﺿYm4%AԹU:#Lzr75Ȥzp$`l} NN~fD|w9c#D{D#ߒ)o֌ (_|q'=yC郬_RSϭy/(;w:24V7(4W?)l= LYXvZwIͭ RgoI]&c+w*&V83{BגH$5Zke;BTnMjkШs/ѝڊ~ 7#G5faup9~jTPc!yPwsvfΏȲ }/CdП \kk_-vO֬c7;(h:ڰU?${))\z5˸_gΑ/}V I2gou4qfu8}&ՖqЃP I%?>èz ov~nNRkg;Zt sbukJ^Eptcaou\ GsCΎ 1ƳAo+.Se;`q圑ڈFEgL*e- >d5 ynёGrˬ5OFկ_K3uK?pJ@^P/即gvk{oQkmasƐ:f5:C$΄'mװCv7hF㸏 ݭ)3ּ'I!ͬ˜ mpfFݲі78w~WsẐMeEĊ5gǩ-l#]*o5lAk~پ1MK]nG{7?8#􌃷w}[>qasiC\ͨZie7@ []_ p,\k:.bӰv):~ѹI8Xd[8Tme<WUOq~oc,t0v+rmz5q#nDZgO&d'SwI;- {CĜ0v-??ۉ e[mGR4+gw1H\POq~=l}eu Վ-d$NA.:j냬8!!Ƅ E8iy6ڛqx0k%:=Vds=7{<2LW.SVUnƋm{^$KkVTXH#&=M%hN: վ]j{C32=F~jպ0ho" k?ʟkFE0Hq9tR$xYI 4iэe` 'kbfaDP.?V+]e2vuҢr!qiNN$'v0CN6t -:c~mu c۫wz\6߭6#Any;["g[ֺYZvG;\MvcBŠ!>rQ!Q? v@1[Ԏ$o3c\<΃'kiMNЍC8?&7 ȍHӏnH = 2VʝY1M?ܞDOϹ%1%MGldۻb;-sPs$D{w~j*-"h%I_4nE_pq<a%%ŰY3_˩k5ѐtcyrD] iM\Ú?qt?Gy$V柤?_ZV[tIq=3[ԉswr~l<ߞ:\w뾳v}qȤGKq,&g%k(X>jn9}VC>D6$8G>I"\G=5aX9@7&N\26<_ܦh &vcclbUZlZ1 ]6h}v]{vorJ[ X4?:cneTj D40erVT0Kـ8:v7FN̠Z5)l/kOG?]"hX^~ l q!ߚAqr)?kU v4Ii#?}Kj:J2:=Y`MwrQNQ%>%}+mkY 0OR>D|>䟺YD2 8#orHHֆ9Yer#3X4ԟ,IU5wGܐ4AG)9 LkCϩʑ,%cMOtG\mN=jX]ca.s:$&׳>浿> ҾT/~=B)w/S3Һ}x띭83QTq:{ߺ>UD]fg|ptj{1kCT~ѬP7Ο~̭ikɏG\IMWC F3w'"g{[Qܒ~vSmaߦ;8 QYkÎm}R@ksLuwps I#]Gsjik[]ߚ.y9l&>U,4Q_7?ӉvcoE[eAyDmUV([$~gal'C|FD_db݋r=q>DC}ؒhh2t?ͮliY!E,jjCC6@?I!%MkH1t >zUzLknU͖^?ʃTk ?WJ~$k#߽eU"|FYDk#iUx=J )~5G>zl H->6ޓ˱V*m3w$q ) `@Hh6KWS#{!2FߦOյ7L ΣD^l#k)(Abp =Z?wUsiaboάeCݷOgDgAŠ>ƟH@Ps渇0Oy_Rr5W*]4RW?ͰKHoI &=S5i4?rf l"|F)˃t,iэW/T0,?jJrw#dM%htG2ޗiL}ߘ+I ?TOKj`pXAZ9R+fַ&?9jߴ%&Dhgſ~e~!ճN?9յ> ?How쵿@;9ַՆya;McpݻVoѱtni7Gk2֭N30!c cgmIOTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTVersant-180_PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM_ update_maart2018_v3-2 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM .q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?ﺿYm4%AԹU:#Lzr75Ȥzp$`l} NN~fD|w9c#D{D#ߒ)o֌ (_|q'=yC郬_RSϭy/(;w:24V7(4W?)l= LYXvZwIͭ RgoI]&c+w*&V83{BגH$5Zke;BTnMjkШs/ѝڊ~ 7#G5faup9~jTPc!yPwsvfΏȲ }/CdП \kk_-vO֬c7;(h:ڰU?${))\z5˸_gΑ/}V I2gou4qfu8}&ՖqЃP I%?>èz ov~nNRkg;Zt sbukJ^Eptcaou\ GsCΎ 1ƳAo+.Se;`q圑ڈFEgL*e- >d5 ynёGrˬ5OFկ_K3uK?pJ@^P/即gvk{oQkmasƐ:f5:C$΄'mװCv7hF㸏 ݭ)3ּ'I!ͬ˜ mpfFݲі78w~WsẐMeEĊ5gǩ-l#]*o5lAk~پ1MK]nG{7?8#􌃷w}[>qasiC\ͨZie7@ []_ p,\k:.bӰv):~ѹI8Xd[8Tme<WUOq~oc,t0v+rmz5q#nDZgO&d'SwI;- {CĜ0v-??ۉ e[mGR4+gw1H\POq~=l}eu Վ-d$NA.:j냬8!!Ƅ E8iy6ڛqx0k%:=Vds=7{<2LW.SVUnƋm{^$KkVTXH#&=M%hN: վ]j{C32=F~jպ0ho" k?ʟkFE0Hq9tR$xYI 4iэe` 'kbfaDP.?V+]e2vuҢr!qiNN$'v0CN6t -:c~mu c۫wz\6߭6#Any;["g[ֺYZvG;\MvcBŠ!>rQ!Q? v@1[Ԏ$o3c\<΃'kiMNЍC8?&7 ȍHӏnH = 2VʝY1M?ܞDOϹ%1%MGldۻb;-sPs$D{w~j*-"h%I_4nE_pq<a%%ŰY3_˩k5ѐtcyrD] iM\Ú?qt?Gy$V柤?_ZV[tIq=3[ԉswr~l<ߞ:\w뾳v}qȤGKq,&g%k(X>jn9}VC>D6$8G>I"\G=5aX9@7&N\26<_ܦh &vcclbUZlZ1 ]6h}v]{vorJ[ X4?:cneTj D40erVT0Kـ8:v7FN̠Z5)l/kOG?]"hX^~ l q!ߚAqr)?kU v4Ii#?}Kj:J2:=Y`MwrQNQ%>%}+mkY 0OR>D|>䟺YD2 8#orHHֆ9Yer#3X4ԟ,IU5wGܐ4AG)9 LkCϩʑ,%cMOtG\mN=jX]ca.s:$&׳>浿> ҾT/~=B)w/S3Һ}x띭83QTq:{ߺ>UD]fg|ptj{1kCT~ѬP7Ο~̭ikɏG\IMWC F3w'"g{[Qܒ~vSmaߦ;8 QYkÎm}R@ksLuwps I#]Gsjik[]ߚ.y9l&>U,4Q_7?ӉvcoE[eAyDmUV([$~gal'C|FD_db݋r=q>DC}ؒhh2t?ͮliY!E,jjCC6@?I!%MkH1t >zUzLknU͖^?ʃTk ?WJ~$k#߽eU"|FYDk#iUx=J )~5G>zl H->6ޓ˱V*m3w$q ) `@Hh6KWS#{!2FߦOյ7L ΣD^l#k)(Abp =Z?wUsiaboάeCݷOgDgAŠ>ƟH@Ps渇0Oy_Rr5W*]4RW?ͰKHoI &=S5i4?rf l"|F)˃t,iэW/T0,?jJrw#dM%htG2ޗiL}ߘ+I ?TOKj`pXAZ9R+fַ&?9jߴ%&Dhgſ~e~!ճN?9յ> ?How쵿@;9ַՆya;McpݻVoѱtni7Gk2֭N30!c cgmIOTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$\m|6TaGߋʮ\66t?>,LXCKT\m|5AQhB󐪊5~#k>Gߎ?qoqkV'E~yMm Gk5@#,ap~8kT_Xoq\('7ڟ덯5NcEk}eV6uWrwߦ+*"*.XJC]j57 ?LETq=vQq_ ]o '$ѧa\m|6E0@kYV+v ow>iT&66O$c {k/\T2 Q_]j-?xX c\M,#SCpLjUaPEwED|~q#y˸Q;덯ZOVT\m|595FCm\b~]E˃0b?6x#U|DUn[XHs4)nZՏK]d4d8~b_ \|\ACb\v3?덯B>yMqj?6cP$lco_ A_{H~+5cľYf(+\UWjE6mVUPT$.)yT;F P fDO2acyc3?6 3[Cb~_(gn^Gk{C㌓*q%-ʏȐ _ tWb1x.cO7jm~H^v z#kJ($v.ߖQ|B덧Q/hHO7mX$T3T?69 } nG~}1־JcC;)T\m|6r$0Q`*r?-!NJm|7C6"ፋW\1=_׍mEC]X-a~;iz 4ʛcN{(nW?iP*SnX*_hDt^3ЄŃ|$La/Nee?K䓳 X,$2Wp<4Xnd|߈٘n;`/`#^΂Aqfz5ʪ?ՍC0٣V"j*ůr4eӁ\??6$j$ȧm9-P\m|5Sa-01EXJgYe4d޻ctDmrM~`hS*"*.?6~c&\V6JE>~YƦv_ Y5nbGߗ*&['ÈkLhq] %jpVB GN<㝛ۈ\&{I|Aqak?W(jgT4@ow,|8/L\,|%ߵTgcqPMē7w~q^s~[E#k]HOFa\m։P1FJrIهۍ/2W#?6xF?/"goh˖ߗq?6 ~]D«p?6GP x_Dv}oh:sE}_ +Zox|5& YF _GY\rZGj?6cV_H[apT\m|76p#Qq5Zz~ZBz7Vp6A_ ox\/pG,m|$"y)OFSC>#jF `B;W^73<G%ڔo 䈹qf_~" Ӟ5Pg 6ՙA_%ql^2xm|5Ꞧ m{V659 K`* GqǬ;>[<4P*`g 8XᡎdJxoX_ rlk~\FDe_ xԪhV'&2˨%GՂdӇӗ7嚨䓳{qxkc,?0N<5we ӂG=~{(j 8_s_4Anۍn{ ywj}C#oq7SOx\mp#k6x܎AQrXuW;*ݪv.?+Sւz&lj|% o1'0 OG"; ^<4y#sQqxmso[c;nk]_ ژ:ߏk7V;~#kkW#iΥO*!`xm~4#0 25;덯ud ʺ. b?6خw;덯~kB9_m|6ǟ˘QpHQqxm~= &E3q?6{^ێkw=O׍a_Ħ;~"_ *دNjO8whgoq}c#ilV?xdՍTqH--kPh #5iy~$͊\~T,&ck(nj8H:01!ep#jDa6>5S5lj|%;}mp)]YW_7.۹8 jW_U <->L~[BwSQqΨ8~{cYC-OՍap?/K#G\/٧Gk Q5ck.*>x?-?؏덯=L8?^Dw<5^nF~ȯǷcq;#k?>z[.\m|6|XNq_ +LKU}oqxj^>GMnQqjm}ƹM`Gqܨ8~]Fv_ zߖS疿Q6X`_ ~E>yKwhӰb?6HVoq~jЭ7hCp>#kwQ_p?6VƟ˘NQq D_sJvL?~-q'J|5 DOj"nL}p 3T(*2_"u ?6(}{덯v}&?X>[X|5 5GOqZ,{W(mū 6gun"_ S 2^Bv3b?6~<~\Bw덯L?gTpOuJ,?<@y:iO덯nޕ4SG|Gk.ob_p#jkɨfk7|5V?˷̿7|0>?6m0߅Gߖq _ۍߏ?T1A5ck9rT =(X$x_ jk\8/nq;#hWS_ ƽfjjP1H/_ c^2طXKOLuq.vQq:^ 9-$a^A8k_R~<>OMx_ dz=okj猷.!w\Fd$)RܖuPG-K!ڗD05u~X" ؏ ZhVN&?."pT\m|5OLv +qU-_Սڼ~$?+bmTXK?N0;W7cc;k᪮Xr +U_?65+So;SQqaToo5ck᩾<+w[Gۍ走2>4kS_Qp9".3+O?G-&Vx2z/*5gGՍ:v_~"_ EQC{W-^H~W xj[a@WLYFSk \}Xkwv;U V6Q=8UуŮO}_ xHW0`?6cZ?>JO5Mv#QqcՃ0?덯oqgoq'Y[|?_ IiWӚ_AU,?_ Nj/q?6[WnV6&p7xӰb)'S@1v_ M.'cNE^6+-?.~ Q5ck쿲9g%SESݒ%̒۷h̦cWx˫xV$K%Ee ?RՇ|%RM Y,V/{hqk+&umGTmBE߀#{/k=L?j Gmm-Vq֍MFZ0~\!cQqJPWMjǸ0Tb=XK H~YѮV:RQ~S(?_ W'쨯49C5~#k5f; */hoO׍r6'&^/q#yQ;|joZˋiv7,Ս>,C@~V"o덯gN#7 K7[r_ O@~Y _ MhSoYۍML>Wy .ީn6 Atgc+)*?G5FDgoXi֙ޛcГe?덯\0/=j{(->oQ_sʳc-\m|5/M$N>ck}?Yu\oH,T٫T2!P$H;_7$Ȇ)?{[؏e MR8WYh}xF Gf>G\.qAO[kEjbG덯"B\6rGa;WQpZkZr|>~{(s7 r؏덯5؊b\hnYO_ daq~X"n'f?6}}o tjp_ Pl7+qojmJߌo˥Wqxk ȼ7YIc_ \\(A)88 k6cdouNiAPXO|hSipn,Nkr~[g$<5RO!CZ<k᪛T˨\m|5#8mp#i:WpQ5ckmUr ojo^>+\M.}cj^ UӲux<5UZ_3S(m C`-mKA5cijD~81h+X=@GK|$5ƹp,;!Sc_XfOU~߆צ)@7WS0b? O%(i O:)&akh ?덯ҍT*. ?m|6K]/fa\m|6Vp9"<{~VFe ?6بV'?ٺo5cľO:1ɥYIz&.c@H_|ADV>"ViLb͊6*ثb͊6*ث*6*ثb͊6*ثb?y%;DK懾`Wɔc> EF6 8eȑB*TabOMJv>X(*zT6^ 9J.t=G7i08XtaB)=1 yLg UVTKbs#b7)Q ?OpFJ{ॴPb8]HXqM-I uj:ѻF[펣Ŋj}2aJfoiNU=RUF\}rQJ6*"%Wn㐯s*V+(tt? ख;qwg[)~j>3ӳ eY,%6t|F&pMj= G OC)WF"CS)E? 1Jҟt폒#*~ k/*_ߪj Ut2Szv?Qz 38\, ^CbsbQ#{ )5G9/]VIȍ0ڲ`Zw55?:r}=xێT%N[7_Pm/8MqY5F#m)?WV#UYABA&ԣwdǽj;qe`crPhO~[y!- VkqQN3/_Yc+ӊ{c߿V l7ۨs<1U(hϧ/oø@(EG)!>잇DI>4 I)=)CهLS#gS,k׏bUp07*Xr*; 5d=LJt*WgqUܧ۩pdFu=-dٷ\UM±늒Y|F*VlEphFE(m̶0']qN&%qFPEw8z,J<<{"> $|O$ zUy.p)źb̂q͊+M8Ȯ^3F]%vhqTU},Qˣ RǤxCKm6\Dۜ(V}鎎^;Gq~-P?2}vq,a늵 3nFbfp;{sP{_UuP?+Clz7l+Ju= KCR7GT˗i"}b !64RDZ݀'쿺8N4DTzrP T1cV:b|=19~-.@OPx`V1qP⏸8F5֘֍nR%8݈1/^/iJE/nƓk&ߒ}fc_ár]⮚ l1hO(HzKoԹPT:Ppy&{nR{f׻1? -ZrVQ )8h}ץ{$ء 1M#+Ģ(\ lhq,jj!?Pf\W>$\Um{' R#F6{e~WtwKf;ߧDGqR_^Ƿӂv?T1~oGQ1UAOp{8#?VK?S8xd¿G ۾(F CiScIv'Y,d .=p%:P ױ:58P Ҭ7;bl!Z[}q8/vg z6kabݎ,b?]7 h#V'fT~i=ejU*j}nWm@ÑK* z5We~blM7x [Pdq~Etѹ!mN_Lm֘QI1WdCT=WbW͕wB7u8\ZlU{dǪqJ=9%๩N,:†5^?T:>׾*W  |:UQe]۶ (v 6᎒"B({?1(o0`yaY~(ت!ddߪ]%BŖPq q Z3v=*8l4?^Ў1$e_Ƕ*+m)F튢O/L}X{r *? Y:lZfnjxMv#Q1|=258!1 ڝlUiGH=%<)rx\tPGs ,miF+R޵;?8PCs!9R_qUT>c\Uy>c*;͊}ǎ'IU|?(T*6lU& U~Ͼ)Xb0JJ U;c&w튪 Ȯ_ $/Ľ3='Ɲ[&р#9Ec zKj:0هŒU&-t#f5(ۣտZ\C?bEq\H-Tr: db{ Fj<{FWWFJkJfqGYwfvquֆuQc޽AG!CcNzho*TIGN*fOzv8HA&* 6x*QG6oMIfGěQTU@5딓}b{Fѧ+jW8/"ԧO'ۺJ偬߿iʰ6q„eO ĸ1GOn | Y?߁ZhH߆)٨# rC;f%=ohv>=UP|{=3용*r(|z\ UMÏoH=|눔|1U`* )gl*"2})1U9?ၚ bmZbD~Uk Z( -,iP IdVZ4wcǎ u!p8H8:i_W>$xrKX'~M1UDmZ={ªPl݈V l6C(n;0 _ yp=]> EFZ%5LE qUe0 R>cӼ&d`9N~TىSԷ>TQ18}9Td⩈pv` qx.㊡5 %9Fko0ĜT~8²K/㊴J9㋟Q%qU-%>*'~6zbnmM`tWT/,; QA.QVUmV7~8Q˹_ HS<\(Қ# cIÍ~̅~+t„PwH~ڛ’)5lh)l=צ]q(vVիV2Gbp%IW_,1UR7?hOzu 6==&OB -IC#eHRN6ټsE*?48U"e0J\4g}%BH"+Qk$x|I%KݍI۪(\CV1Jn˺ o߽q-VUV9lwYU|p dzxcш5kE$H]h6*ЁUb,t;H۔]⪢_i6olEV8JWp<ȌP~hw_«l*汚6**&v#^?OR늸6Rdb=\ -Ix{So,j1lk[[AZT~ P(j~q~FmȦ)_UU^#&̉Kidl;U^y#{$!żF [6}(Co$n? pV'=p*ګ|GLrHӡZhov9nv?Xb k^ ?{-5GхCxc+9 OpNVE+gp}CU7'[\sbS?Nk΃lU.m2a,C'P<JGp|q2ZUw:ۦm/P,n6'8ԫ>W3 ~rCSZ<1%ThHS`~e@xlqUDNcꇭ^*m8 ?튩<$+]}Ubo?\$ƃю9] T 2Fjo ~%\Fko2]-®{fQiOn*[%{h[Kae֟Q:+~x_-.˸=pI(;-⦂+mKK>#b0WOz`Mu<qCCP,q#˷] jp3XR5WqUquCIAm튫Â#f=EtSűTmp䩥)U*7f]vlUٱWf]vlUٱWg*6*ثb͊6*ثbo'$ۏ VjF ]Db<J%æȦv (E!cr3ўiLe|F)C̪MGS{׮P;| pB8wP#B^[u[4 +it&?Ƣp^7+NWVjě[q•mit2?_EK`e LrǼr3_+t5CѼ?l+N3((iZ*va)"#wRc-1UHf8?/g\P ߯| W W윩 2(ts1߱K1B"9|- KQ(?ob{PGqYy;>8>_42n,afR/Aώ)\mX?!$S._4<04Z_ژUx>1,L,DlSqXɽcK'F*U}>i0~qܦnRSZ}%[n;$ *IJbNpqJ6>qxg*~%n 5 B:CS#]-U.s:cRg䛎"PŽhݎZA*p(z#xR1ubQb>ێ{BHuD,ChO;\PVYG$ n4cgq㋘'^bn't|=$⪎?m>+=u ,!:>$;so| 4a#f\Hj1}إl{̲ 4֞# uAq_m(I[mj>dTnC⪐OSP}udZ v hH~PUr\ $tӧqezmpA΋ptĕ3N;xΫ cp2Km81YaĽ|1U8g>"|=qJc8lOpPnz15xujcWB$iѱ'tXUss?u`UN~>UyfT(|p3 6?F2m_Ǧ( wznۊV2=pN l _24J-1'BP?V7)p[QQu╬6{0߼㊺;>IXq㊪uapT$&oqክ ~A>8.;oP[G_ PV. S$l]j>$8St;%VIi °ހcpm[[qhKx,sRCp2K p:qg)^+?' Oq*H(9G=bPѾ^C4j@+_19#IASDZĥPī⪈i G6AW9&ᝤ)$MIC)mK"gZzdPq:qKnu++VY꯳ )11Qna儐0!6IG~xU(DTt86PhmpRmB{@m]f8A.1щ 49სl7I|7]*Tn*1Vcat$aBcAJoҘߒXPqo`p⣨*dd5;wzcO 7_?TJP⫾%nl cRuq?ٿiVH7F%,TRTqm93/[eD/X"LZYjlx6-CL9W /Q/% {q<7/Q&=khÉ銺MG݁4Fl1eqo|UiĻu8KRl11W+oh.OتEW"L<P̯Pqh7bX k_'Nm?2hUHhmǥ:} ӬR:)^}?V5HY[tR߸WTbATL{4&?'*eVq{b>N_gcqUo|F<SbWf|&xb5eoNثM"ɿLr7uKLo.n<1U)"'T7MU5%v9J>l/\Op~X &xzW~\(E) !=<04a(qUhH\ohT…mx.l0%FKp~\%}ǸP"^y!۾*fq\H>U9FhqTC_b؎'8)KѶll/!QñT5m{uժ) R`TԚS+2SV1B=$zR1 }XGoUVnџOCw2BaBb0=㊫Me13ت6*P7ĸ~evኪo2J{*j1C[CSahvmǎ*-bpjUp* hq UZn7L/M hDᘶ|U zZWsتO21'^#r!o AFhXuUTzĆܞ'wU]UItb[B{cW)C>#Y$8"9A݁(y" ݯr7إ.Lfmd -1ȿlPl=+kc[U?`8Ssa:x8_qaB ~[Fb l{bhbj/cy/U98(JHTcWǸU7=uZюYdYAR(P]v>?k=7 G㊭^8BGS*&JF)m\Tlب qU2̻7OkG_(m^cU7* ͊V~e+qƃQz⮭w]7>A˭GR4Ql^F*?8ܐHQU 2q ۚA)?N*FTsn82ZJJRAKۏ hu=J0늡 J-- *>%F*MŨ7-,K麉=ⶅHwc̽w#=J}oQ[mkavqR-$ow⩌W;_˫1U#CznyyͿ6*n4 N#`Tt34I![ f_bK%~sEu]koAh=㡪O~xėj1"xCby߿ӉJqUz|H~'01^_a 6C\^?Ǥ5߁+dd"tdv>xd 1UP|^ؐ@Е>#UbC255(>Ob{VgO۝ضTe5{0U} Ib>]5T[F6%J)(Ph|pGfh(Ux=$$?㊫+4co1Z=xUp 'Ć)_sU}x%~]eY:q]fe \$7\Rh^3Uޝʼ{ľ!|- @Wp*?u6+%I pmx cU>$W0+Ĕlw_ |*C& 0-lJ29=p2@Ik$Gb|K$|;e߆* iMħx8xZ LX-=b'~!C1UPOᏦn1Uhv9\]UJۧv?wۊeI>.잘 y-Av# gxqU8y/vQPk"r<;b-FUuVUoQU,o^;~ E*%_,P0~!Jc}TK]`9O|'d7--9/"G0 zHn|Uc]}8*+R} J[eqQx~uTQ䇽G!-r_Wcż15䛡 KmcT^ԏRP½N*j}[rbCqqQ0yuS*qJc1]۾ClW㊐0%DrbF]P+ Z$oO*Y:nN(VF%o0}IՇ]U xoVgO|.5FP@׺;0ԴbOC`h[.oOӍdlUQ$ejaB>  "z# "a<\%b%65qIJD*j6F?f/>VoQ CuP NUC9>ԯV25? cAN*'zaU 1t4o PM${I/ U[@j~0JP j1xUYGANje㊸Ɵ~=Hp!5Bco)N+J{,Dz<{aMΖ~( Wpq n2D0%::BLlJP6* *0lW Qu8-־= so^>ۊdtڜ%=D^O7䟻-B@۞JISZ;W)r\&'2^x(|{VЯr$`VhS煗ZiQ:+:l cc0K0?k "զ+m<+(ukmh7h)`G/Ƈx@#Xso H* QNG4b F U?u튈+ rS2VipPjqV!%5cn튭Zc$UF*Ƭlܷ!z⫚E#f+7ث2uC(b\WN-mu$-*|]Et'Ee=MN zMqT6NfQ}~*,Ax])4߇qU`{~ ?8"s55Q* `0sрzb5 mu N'moy)ezWo e<$ WqL? C\ډEWajhp%-+Cű%~4b7CᎊQM~UlК珒[~T-}lmU$U+4?*%x&7 SJԩ ]ՇQK uh޿T[KD (-V1Bvj=hz A=kSb'ZtWd؅u* !rǷ%k㑢jC@xXPR%kRnKǡ 9dzՌ_ fUzz]n{ i7OiaYWCbE;Db:HUWwpO隊Ӹ=VOc゙_zUf~X |U#^qUʇ*H P1?S>صAL9D~ yo^܄u4ه`JQ\t8BJ6ZFGcZoSg}BATjM׸U"9f|qQJ hG _xUSIW0EuqJ q^ᅭ:+u6]q\Vh*POOhhy&ø 3mž_-C?/;`g6oׅWI6t<P,h̝b>=1Uz02ހo{[4Wq׶\}ǎ#nmam#ʆn[aM+;֌Zx7,i* 9-R qM݁i(Kt,S $<{{aBy@ ﱭ}x* rrIbG1M4ЃA =[{7j Rlر/1J~;YUl Q>x/w^RVYGټrk"qaUpNI>$>|lW"Ū*W $.^Gz4#?Rjsj"lUܘ7J8 ZKv^#85`J\*j uG4b3FޜP&E,0/_l(P5& PabLxkmv%PS۔;a׮YOQZlیU$M>HnAKl|?϶#QSXǨ4oUG8}QIAw_nV+*.dWߡVh;qW \T8O l)v#(_6;~6=XJ}{dߧW/!}Ϧ`A=V0 W{e\؉F7ik|0 %J 4gR;%ܥkRvWH+ 4tCCFzv?rɮ߇: Uy(M<*|J{bl[h{bl{l=1VxɱqA<1Uo7_M<Wpz$>8B~9\8wˎӘmaJmی][|CX ~Сv늯۪c!хGbĕ"=*X?]Œ@(6T^2w1FaJ߮*A}|{M7+bF"[iUVPFjZ ( v;"ȿMwk_Yċ۞Kw1iN^x7N 7m1bSCj xi %]\sSf*o֠UsƇ0~ARWp!ɣu?*'ٿ^-?H8ٶMmS[R6j{6"G!C=\l~hlG$8<8ǪcibK<[g6O|=.hePqVrwCP&W~#Q|(LbSyïX[sCb (s6ǃTa[]=sKvaG:|> ,7chQ;*c㎎`*HOPh|GLl֫"%1BYZc߱|Jy/Q%cqaF0lw1] 6ρ(7֥7LF[vM=b\$$bo…`@,Pnd+ZobǸ*eh7%d_UoěVxXv{UUkO*,:S$/?Y ; ?ƇR8x ABv ]|q-~*bҞqhhH(xX`Uu*N*ExxOoqT2M`|KhGo8P2JԂ=}*^#&bx7u\UxuQrXcߨƼEqVIJm>omEvq1V>Z=ӧ:+- !e#P3@b4FT1WE5) }S"p> uaUucO~m-qUAX~تx~,LU~$Wzv|iSxb$cJU$1CuѺ㣹ϿqZxk~TƇ튬))po*iCF_%\}*Z`{Əp(;>9$Zb=ձSknDRwU.T|J?_$!Toኣ蓨(A:9CZ]c4eM:PYJJO.pt, ON'DZTGnb7 VN֣e+q{GxU_[AUqG«@\x ZavqP ?8>QM~݊½>_)CTPQ*lRçLiтvmxeF++YC|I"8P:D6 R5 bӿ45Fء* @rR.ݾMpRIYnL'u/4b g?ZZ{V[}E}2vm O:l{K88P~KeA[ V#._qU6@RCv>#Su1(~h>$n*$t9i7;HkL>Uh[ ,%vaU?WInNݱUPѾt7~㊬6-rOoVH(|qWz@kTv-+ g\ =!1xN*(6/ x`Y-x"(^Pjf­Y7^*}U~-oEt8^.-O߁@7ۨ"EsC7qT9>cFCrZׄIpiPW?kA67 t?="K ߐ}8un ƿh` lo wl uX)W10~`T$La]d=Uw`j<<03ت"9RaNEv?0F=-e :iObO>zlY$wq1]<^8܏oa~s=ݿv: G1BkX[Xk+}}ټy;p©G읆)6(YȮ߉)]mIlۏ|UIj68ւPgׄ|8qh|F !\t0*sd+_aUU`=&!UdǶ(_<2 )htxfho削liW6>!øTH(h7$;> ֧MAOCw6^fv#?u''Տո폣 #B)8vΡ#Yr _lU%$qIh?_WIC4#Opz2 ׾5dޟdGVT,m.>ADh?B%jN-.qqJz)T9R+jO_Xף7o+0>T6Fe KcB /Be(؜j:ĆU̴mm?߂\Uzrۍp%<]wJ_qV Hjˠ%|GEWq /|R|'lސnaCM8z{tUVuf_`t8g{0<;⫗䷏c%ZdhQLQe/*%st[Ex/Froez7b%rntчPGڪy/ο',?*MG|U|&AC1ܬ8RѢ WñǼU׾X>Ǧ"WaBM)?E##ed`r@i2=Tx$|QCþ*P/ma -褛_fqmQ㊫pi/8ɨ qO|Z;f\R̻ʒۖbmL QpFX®)pTo;۫vI8aZCIoN_߁V,WĚ7AQ.UY#}߆"\ Ut$mq}].j~-VOU ӊ{'+Sq]j:+ 0*mAE ? 2SY6Tۍ2Ix(S͸, e䇚uFY?'Z+ {bFGxˀd5" (Frz._WW M?8FFm}A*? =2KO~YdYFFv?9DjiWG|qT;MGm#Wp_ #(96]jľeA،Uhbo~]F*# mONSD |Uf.^q\8yljG0J .JH#&P]+φ`) U\49f5GU_N,-Uo|UkD{n0J\:o^CTZ~^9oqUߨvS[8/|6B?kY]ؚۿu_/bW:[ +֑6zJ9kW_mndE9dzOħUkpu\2ab뷱Yyub(r*hU ~! 7w }(5XEܰ=qH 0*ǎ)6,+PI#_qhqv2>8FjKdR1Vd}tp)}l7\݅X2}(J*+HmH7;mT5=N9.:K$ѦooIɧ ԄG?h}Z10M[d|-uU֪{3/tS6H9pKxO XcL6!c#E=O…`K⍪>VJ V#`KTzK0&tCtg+8ɶlUٱWf]vlUٱWf]v*6*ثb͊6*ثbOkT?m /&hӓ9,w"*1zLꍼm)rsP;FIpqKn pzJqT+Mibxl7|qhG8zǸ\h~/׊\zG2 ~ mcP^*Y\`eU튨7(ڣ QN%Bu#\j7i6*Y 3۞1}{l}S`KZn'SAgCHBuLSd`F޸"w QehI#1P@⽏lPJcC֘ƌ7:V I7HkĝlURy UM 06l 蘿qk_FBq9O6Po?t>ާ O>x$lGO ! en-tqPhHH?F*o)ڹQ]㊮ !F<i? FX_Iv¥b _ׅ o Tu>=% ul%l R@O%ЏbJtC1M41J ?#etз ;`pZ&Q3C1~AQ-5߯B(cRE'}…ZvMWF~D0Y/_q"H~[R"*1Uh1~PVG\zISVH0ܯ!bPjNvTbW rxi|p*[zM؟ TsN* !DZ]I<aUhF'ˍ=Gi?9Vx5rM׶d}c[z?odۉT7=>e m 3C X4cLmrIvabRA0aN'ol rO! % )56~ I%IZ1kK7&)ݭ NwCc|EZ^p,ѷ!oPSPTgև(I=RWc-JJ]fT'^.G|tG֋U+#f_Fmcp^q/⮣~$zטm0#;xxaGm' ~8XYWݧ802?c*HyW7b?8t=G/nP!]_WlUM߯XTn; STi>qG=F*SR:0ZAƆ1 z|UClƼ<*rMTS[Un)_lVkuhw•(n녓B{)S- Ix+~ă)|RٱrVp`{7H6GC.;k1>;D/r]taLx`xu98|Ui-&.Z &-CWGN\*^|tW-Z'ě6_b;CUŒY~%%U϶Cc" И!fX>6*N:`y"$Cb̀vn2Kxthv ~Z*8&)#x70*H&:9m?qp@gcq bh4UăvR)x mN*$AkDGZV)8Lf UTHwS~G߯S7M ixG%뙣 \R>>+ZUPJV)R튬1$_9r(7b6ܯH4;xWVr;e'XM-_ך[zQqW$|6X讹2 +eĆ>\([6W)_%lVP[<@z{8~PVu%>?h|], .8|HjRR;6(t qc '/pS Rtr~*1JSaLJњ>DZ«09 Ud|/U%cެԫl8\(Eq @~# x"*I۶'<֟xW-@5.H_q㊶T^Dr^8/Fբ׆Y ?HO|Uo Pr^8 qU* ?Qb Ѵf=}\x?h9h8#sE>wS TP8B-|re^*Jlw\jsT6*чUYqChTxcJ=~%WIzlISd㳊Wp*&/1ΞFqJ_ -׳n;8śہ("Hn?gD1ܓ (uS~a2>1*0W2H(7|qUH>aB>8rl>5#ةݾ R݈=bN:~(aQ# )+'O cD(~! 6'bٶ>8Uŕx'|x8mMvYj+֝QXhk2يV}?Ϧ*/?-Gu銴|>=VGӇU?WOVb[UhowF)B6qUF(ч\W: E;pqf JOj4{~'IɹFdT17SlU0hJm FPj@aB7q~mMsWh>:vsv{T9"5>xqBS߯eyhǭ{w~ > d <1qsOQ_U~Qh‡*;>? 4`8xPG)x WoqҘUqF/Rٓ>!W:xUH=z}LUzHrJ * d%[PSX_;8TWVG=6p;GOqVQӾxv"Z/UAQ,\P R~CZ(\Y_7<9Q|Kz aN:b񛟄n;T/.}G?r!OfCz4'[5Ɲ>cҀn#j.߱q4C*%IA~ҏG?ԟ ? I0|-;ybدEB8Q\G|URXQ^r= I-#nLV=7֬~m]bBϬ `#U2;FN)&+ mS\UB=KD+5XG_OPys׿©;v{~U~Ud)JSzm1ר*de4}6䘦*=U? Y~qJc4?lM]4?Th]־ %n@prLf3O1UPAda*%w12 W8qE V4qJN*޽#v# 7Rvڄ/ "?&7zTw })"+C㊡~5pZŋЊ(qTph hǸ5Cr$]$Ƕ9eu`HMu>8vm 0h|"U?z~!ክdkѼq&хURp%'lEd#fJ;|K;b4֔5=1_K>C?ef-:>ztJAIF0*Xk MO=[LuUcJ8\ISP >1hfQ/C֝1U~a(:$uC킇T;O%[tJT|&J}ULH>o2JSޔ>#*o9oA뉬Q…V|jkUqL6qQnKPdП& *Y<\Tcv튁߾X6h{ 2!i->AĞѐrتzC]A4'#Uo%$A^UR9H5c<&q?[hcOOVن*S)H6D vST0ڄaU˧lPҒFRQaTBPHE<1ݲ*[a&R: ~p%-],Ѭ\UDH遥Q⨘ڿF1%xC/%},0)CGot8VuW4aHञq-,"8]|{`JۆB|\LFqۡfT\b, UYY_nq .B6y/|UYfY>=2UOUS/Kdt51V+mZ{b٠8G، `JH9 %qI2on_?[ET_TǗp,p#bu_q+q܆ڻxBXCnzUzt\2 Ctc㜏*@n[FcRkB$ XQCba"jm* ءi\cF ,~t#v*;xb뷱wSL(Un>LTAUD`  _v$l|^ݱvh*XwSe$]%*c*=I?*a#TxXۉL qE"`| .m8*2HLbXV6{c+>5v]h&ኹ-,#*7s<[)"Iv"6+o)da iPJ;: yzr>v6U[քۨU=֞|T̻„]AlO aBcv|0g_W‡.;}X9*J{#[nܐEP펎pw }V"E=*;;qJB}\T>ƻbt|C›H n6.."QA#P~gՊ|P;buoPkeZZkKb+(qB /\56aLPn_gKdFUpcbZ?6,w_G/]`ehguߨȾC\U P@岇do▐<}+-ҟ6q⪂: yG#O%UNH87 cV#q w|ߺQ~ߏNJ 09nQu'' L!YE*FrJ#aB"2))SUz2?*7IW͊6*ثb͊6*ثb*6*ثb͊6*ثb_JIp|z&1΃s 82-XǸ'1'^DPr!~qJ:HC ̅vqaaUk:e):aK`cW |Օ պUTᅥGeof]MYOq+8iE*wP l؁lzDmKm˦+GqB+{fn튪\[%ʝ}:GY@?b2HzZEp,p2T(DsopK#oiP⢔T Bn A8}Ǿ)AO O_q\ CHh?>$wND dYEW|UMYn ee<8H+LpIlá\ÉUApHkIKnhĮ-C[mNU`~yt#X8;QQr5N'N' / @0I@6=*WdoDG)SL$m ,v=2$fZoKp%CڵL$MrQK}rr]{ Ptړ ͊ZxII4m xi~=jl{ Gh~*Mz;U`iKc❼1B!9wc}n-;UwUxTJXJN?ip*n2M b/C;7f?oDȂMc547F:KZ'8^ݰq5[|qqxbGEǡ8רpf2@xQ6ʻTxc xxaU/nWTG3[q4g}8xH9 "]uq+uT38=+j/Q :ٻxnI&6W=z*𐚎N[d304' ^0v07* {R4$I>$[fMdeb$6O gv5azg}b!qlYdŸRQHzUZbd"Aǣ`W;T>;.mJ.+<$:W+enSf1}lp ?L KvO´; lGC`_6AZqUn?zJѩ|Cp4} OC 02RĦu8!qUW*.ѻlzUrH;811B~BqXn<:t?ہ*Sׯ^\pPpҥ pJw)lbO^ǺToYjoOou@uqB:ZNK5NƓH.VQ"SB> Sc-BG/\ ug CbQѶ8֏^\OӱˊpGVK nd=S cAwF? *O KѻUL$hbY>![(vO==\Ӝ +ubU}h hO1SԄk6>kFhǷlX%6N U~dٻ ~i@Òfxn:4S*w•NX"1UEcb( M<*\P<تT)5[*Q.Ǯ, 7*/C팒*$ٷQK*On-iNJ_aWwF~fW[R%IJM߾zǵ;b6El>4u !K%! %-Oʯf9Gբ?$>?챗6 W8*_% 4 ƄӨT=^k_ѱUn;TmBSuwZaCqI-Ĕd*f(x6!FoU[{c׋xx ANJ7czt|2#p@EW;"*HT{=IO V $;0VhU8cbq"MqhE=pIhfGLduOCx&^5df b&GP2)ZxbG'nǮێԪxn+ 1D5^UŅRThzv['j>Ar|-ɊI 仧4t;bUG㊯ώ]!Oh*l8N=J`Y_8*N6"0Y [AI%6팡mЌUuGT紝T~q)cCTFv8iq;_ wUOUi7*@w_ Uc(cZFlJ@4s<_c *0G0 T<[f䆣T.N- v\SVI+ROU.d h?iU刬 =Qb5Q5 _>'ig:r,f~"T4O$?kq㊶`I~E0aD޽͵;1zv>XK)]b`S 'OoOzbI (}JJu2W)Ù|1e}U&L*GTz~d}ae [4mlv4*^^mcj\|FǾ<5MVqlroG1vaYJª~->qKuzxb9׮*imtx`Uw4=MEUOV** Uרbc >c&ƥqҠSh\.xlUNP*J :c]C0…H;o]tU@۩sqho:⫑#`Vx>D,&fgqO[e8>UIhF،U1UD7\ уOqUp1xnTQOqU-i@ۍT+FA9eA߾)pb|MqUL|WR[t8N[X_`Ԓ;X [j+>تSmI=zJKO$o I7q06*c1}[ڕ\u8=EUe&CYܷ٬ (?cRf>aT]0Rm);0&e>A5bTXt? eq%ɠ*kjn`DO.=fjs?4u Wk2;fnNjES > $+<1ܓQRb6"^ ۯCWp%LGlʔh;x**Pf#7폧UBt4Ƭlw\уfXI]@qV!~W2z? 7M7_|IZ31UHUὡl8٬qA3U1Ba[V? ,'_LmcW+)j9.(lMF͉Wob|H݊r *(.J @GQvSתqp%HҜd擔'VrQjkG.[NqX PDC'V)?U)e}%. RӋR=v?,۫|QO݁Z[_AZ`Ya+t„]OMG1d5ߨ4tn<1M}8fC $ :xU^9վ9G/#(mE7^, *?dЍVII h*~hpqU! GNbs7X*Cs$#9f!0\7HjP6EyQnqpXG,E@PJvo֣nuǭ!xbQvoݚ7*^[mh3\R$c_lcy њ?j;j.V}>qUZ)6ŀV<4o K(tњɷ6-ʧӥ< ,'Sb%[]?d =ļ#aTeN)vp(CClOqWrͿ ?)n?^#qyþh5FH?/S {UxCcI?o8t"_cVqTcặ 50#a=x_|PYRp"9,N| &94=qT;Ov M╵сqݾ0+ /<;z{F$_TVfO9/(VP>G|*)Z*cQB5ޘa:~8Y*њ~P*Ëbܔ\SaUn*\JHRةlH'f銪V_,b,nyDn-|6AeU-$ ,i0YA;URFaUa]+hlL#1IqU_QdlUkGQ`ҟQxnX (}`W}]{:PvUlL6\s` C)0^9C3Es,$qEGIS7*^Q UX)80W(u<5?W?FVKnjuF*Lh=6RO |Gc<cI~*ԙ}=_/olKvUC3ɪ銮qoz_2Rn.-OFCMlBq3XA"6a)Zד[?ć cKVUGUm`JӪ}ZGl1QTqB`d c>3SPs]뎚^f́e}QJWcn:W>q/.72EA`!CTaiaUcǮ)[Jn7kqW&7["f)~Xm9fVuaKEyRD0eʕ?eU}Uj1ч2pu-ި3GS[]0*?S7„ll\qm~8߳ޣ\aC~Z 4;C┩?FzzI JWNa<(z$0B."9A{a"1SŶab0o? P_#LOğkJ X)?|1dTcZ0^Ǐ;cc:8_ݾ iGߊCW$-T>*! wj^)M}Xq{ CMnL z7q, 0|?Un^e.V$Gcsjx/Jޝdž*41,qT +Bx@1 "LU^9i8 Hz8 7ogԌxaU%'^ Uzekf*ޠPxT\l ֠ŽN_F*c+I G/Sў=v8W]ԩl xu_l|qU>-#CH9!qUe"a3Il =yg(DwaF" 8UWg]T$SӮ 0qnK4OJQG =Hw^f)BCrзsf6ki>8s<6xbQ  뉚PQ>4]ǎ* Ϧ}VP݂j7GP&z24g<|U\:8t=dž\A#sWNQ;`pZ&aB aRSu690%aj74sx?N⮒܁/NcB9F~+in 5-;jlLoCtaT $= :6bI[гښcܯ\|p7F, OٟNFn MkQ}>R3LRq\/ڌ0h÷LtǫVoN,+F$~8wS|0,cmǎ*aC,J4f3^ʷe|qIJVQVsCq:x▦ߒuLeqlzP7~%a Ջ5Exo텊e 0,5usJxڅՉ?PݎH&0(`+^ PMQ˵Dqjkbh%=j9Cӯo hfh|Q;R咇ӔP=|'„J ~ |7v;Y-%:vX6nن_{iz7#..ѥҗWL K,Exw'ȓHAt5T6d<<{8IX<, t8Xe^:^z…~4acU m sfT 6#+Jp2@2Xox6lUͺjHPѶ?\^K/|8N[*uCFDن'l(l7F: Idv8P)# /BI0&Z-㎞!˝x?0%˵ƟˎvCXqU(%JJm%rMV#'Z qT5ŕ7Z|;L Ch04ЌPz9!مQ)!^d%P+.ݔ?ğ͊TVj-T6wGqWO}yğ7qɿ5ٿ?'bM',bۚb1U1&\Q"^UU\OqUAbȲ W:2=QfQ>[dvVWNhG0yz8}>*'cnjnomvĽ ۩ UPU=7K8&*6']P½s'v kB;XTE+^%ecن*5M8<-ñqJA *+N2 э0|ǎ%_ „OeHqUʽ*;[U8 ↔8 ؋DҤ~#UY^3CPqU՚3#\B\^9lUI+2&TCQw)аGՊr;~|rS~8LjqZ+hhOÂ/v~bM0oM7mѠ_RuF+K]B~o$F1U~ 7JHVUU%Fj0-hj6?"ic(~d?)C(hˍ ]?Qd­h׶(D({8t;qgszbJ x2!u_x?VMfQUS+Ɲ? UcB. ~qV*rzxrٺb_G5l~ءJSEqUM1>8x$l7YzC`KEA6> KDW#_m~R4ǶcqbDLzo}+ӊ-U+Jz.eT׷&Aj6P tZ5THq"w] 80n%YwUI=bDx(þ*]~UK:#PxWqNT܅O8\qFxQ WfĽ6x#^_b֗|2|U)lFx eao?aT5j?+ݎ-OaQOԗ^A^PY6P2-:IO~"Ӯux-$'U]c`ʢrfxOs~C^N45?տ\HIL(wQv.SsZjDZ«m ;|UV Gr[n[oaUH0fRuØuu+1*XSMӁ.a$Hkɺ_8n#5 qE"u(OX'oC)bqZf!dZ!E>$T+l|rNͱZxiqWSʨ;R«h w++8Z1Mj<;bх㉆zbk޿G; OI>qF 0qJģ([]PZo_bWUBU;6UHaMG|DqIEN\lM1՗?UrM?C+l? Z#T5:$Ëpv1T4Axb*%#uS ?⪮Mp|7Dm4t( C 4dp*jJ8cxqx(8гXQ-_æ)C;:M7M*%(xCG[ Hy.$<}8޸pi7?q,O1UqGŃ 1UIu%x0+i2Z bR }ˮWG+ޞp@w)NnK¨ _lY.]zTX{`Y>!+ٲQᙬ(9n>&}HvaQUaA%qPݐ_b,M R+Q qVWlrSpi튴T(lu=nJlo|UMUCCpI7CC=TxM'm UY& WqB|G㉘=aUQ"q2oW'+auC -zCQx8ׂ!1?| C\Z,2;Ĕ>#)K尚 +u\ց!S`9)x(L!> $+ >c I+Ǹx^>8s#7ԟbIzPqJBGHiN[0ZK>iz퍼F*{znK`lUݑH+q&bLxʊ~/hC \_ct|8Um߫Ue۾4Zգ$v=?*[qGˎqOcl ԖS_q:H(v'c6)B<tW S){?ܢuӊW=Ox cXaGH•J$_u/1cHmIXRٺ\0m3 ? T=_ Ui!j- ЮNjxb]m0% v8"7 *P%>;R>JŴWIt0G`? CAeud7!&KG\Vjbc~ce7„'{t|CVYU̓q;[hm'MVY>`s{⪢E\ ~Ul<:ScQከסYb$mUoj0,e=0Bʲ 5 qJDSk}T6)V'Zbp؋+<0UnAAlэG|;bZNvߐsZ:G )UeV}١֧⮒nj 큕7/L>]7IWr̊ V?"X~8}47E+C}CAL Y`HDQ%;:4?z}>!Q~q?C(q@V0$d⨤W=+?v*W$xg"}(n{oY;b -U ur|-چ $ /pp w?k m"9C/?G[8rr'VFhF?ݱn6 ɗFǤ+%8H5ϒmE4285R3dVAvlUٱWf]vlUٱWf]*6*ثb͊6*ثb7YB5\4=@;T>-*V ^i }4ӿ:8ʸ东q*E(~{ ўx;2})C@P^p@F^c8 TQqU%"5S"eP7|:4}׶*Q ٻi"vGPIiQJlzbdJ:k<;2xl A8CVV4Z hm{d׭^NQ%\J́(H8'OIJ7Pz[r.UW׶*ݞw:+4OUKyÍ*> Űov8iqJ|~MY#& |g#īU7 !U=`܆b*q> Wu#'V]ʴޕ FޝZ_㊹{~WUJl_ mr'z+9A~7+4 SoWCpJ$O^^" rB{t?߲z UPDsAp%M -J>ۃW ,84Hp%*tV8e\NHRX5jB;Y"O^2ҕr=g|qbK2Afc㥁eZ n;]jG*Upey-~4pՋt=G*p8Ix/^TIh kN͗PiӗĻ?ICZᑼdPZQm&k cuf>$v+(l|]d^iB=)K6p%Ř]EErPn0%<{U|(w)C 0F<\PQXt ЧQ1B1>) HaU9btNgmQѿf() BTe<;_V@8}8sM?@Iث *90 F6L50nj)h‡)n]4* VŒʊ\8bJ:t\$\Y&?fN*Wm5\U|7G'|?*xK^8\|/qUE !$lvaPPndoRh8cűU6Rq"Zn(W~^z}_UԪ*\RE%bRDGĻaUXq}۬ن*Ep/\ctaip0 K)KIWB~h?# }XMWxkTxUud{N(\m^ ԏø-k MqW2|G#]6?b3v?rAه0!b:m22opU\0ˊF=;*F>/⣋q> .9xf)PqrN$?Gl*҂Jׁ>p!N}.cZ؏\Emiѣ5]{Uq'\Z  *3[oM(AQ)*\f |ibu_qm/^#R82X" $%/m7u[ ܵ䐛E:LkaG׺΁B1W+q_Ƭ Us"9/[qUSQ=0«WS3~U~*uAm[J|Colnh~$[(8UU7&C8Ч~HWrG9eލ~dګ{bxb%7CRؗ,㊸ǵGOmZwwL&Ut: E+!M BxRKqpCJp!CuM6]*E|0\7ҸY%:c)G!;6qg~#[RFQ;L4K (߫ ld<pM𝏆 Ձ<{imF OzI"y/b7\ F#WLA?̘H (e50LJ-B{ Ԉ*xA/xWm'*-}ҟ,,xP~HQTMJ(W5S۾pN+B!@9#x(wيնlnY cUFHmzF[CO\}T,WOcT|k_|](Ÿ)h|"7V'h*:xxb"تI*3uYFVFUh}abbFQAb68L6{ULw(>cŽ27SWmruUܻ6%1W}ؼ7R Pqjcֿ\\:C7Z8$ոk\ rIѽ(FF H?{xs@8I i!?xe8Jg/ Q-IG8~URj|2}:fxUy A!O]U3:]1V~fZP$ f?ho]jv=|rG UV9\UknU (\1!إQd^@ۮSW¾.+mO%bU9mZV%o5>7*ڽ)ZIl$?p4=HXH;e r ~UWF(%dC_͎!%b4 n1q6*-wb-?<1B_4S}>!w[sl8!Y&{PnQU{B[~OcG?/Ȝ]9pݴ'-M߃O3ż1Jri$Y>*ш2|C'<qsҝ%Bn9ǶVj )KoYnGd({ݿ^;>e;[٤ݛっEX[|qDlE}`g@.3FD+$+WT=f(*'xc bVRMij}0H D&YkSU 6@iчQtnOkJV颭[J}!sm%Q?NE^EvnC1Y+8UT܇Lnf\KqB)'*GQblRJ?00N[BV6a$4gmVV\o|,(qUdn1/uW+Z8o\WcOT$ǘ_z1+rx<+c$Tu;z_cn?鉼 6>>-b [dž*$;M|Q,;aU {Vj8qBT;xv2Txتbߚ`J$( ?8H*?bTxbf;%?zbWZ|[ʴaц V'i(vV/cj%6="-"^@=4a+ ⫥1aQMG~>2UW8ezK^ V*$Wq"7Fba׹=pkx…xg#cFB~UgTV`.@?PZ~XCٍ@RP$``U5%OhF(>])o4d,~m5#vQۿ߅i*wH~ qT4 $(3jh7KYU? "5b] ޲|2J>& U!!mj1USrn7ªݑ޾؃+&>q7/qUc|'8JG]T^ݸvPsTB:ɬ"F!2؃$~"E>>c [«UUd:_8A'눷x(8!zU4=9cbtCCp,t?wӊ)s 0ª銬}^\QqJ ["Mqj, wCŶ8Uj#g>#Q86Qk:F0ƈx?r(#l\<\Aцզ*)Ӕ 銶RNءfEy*2YSt4 G'4>S${0ƍcTG{ԁt1UXp9٭\(W}MQZ~UI i}}K& xxPQ?z# 9>koI;%q8ҵ]s9![(Lb)ɡJ/QFB/CQ](}!sF #jJt}b=o-'a`Aڸ?${`G}1`8트FT }2H)_0c\ȧC2%l+p!#!}34`Gc*0xo 75lUlw7\! n+͸n:`U&oc ,JG]LjZ1Zl|1E=lGĦa'*Es$_d_I.JIx8Z 7' !t#q)xZ@mhWo cݰ=)CIj zߎ9i1U-۷qnE$ư_nJg@ӂռHizAJZ/s?ȓo9Wk tdbXC18_-aF´=7ot5+~qV#zef$CCክYۧUՖA%g~׊\t<SxxT %UJHTx N:J>qJ]?kuz Ӏe? U~#b4 zPU u 1@)o~1UIOvJĬ:P T$#aw/nFܲQ:_ge-/LK8+I&Lثb͊6*ثb͊6**6*ثb͊6*ثb_?]P!5rL4&T 5|hrtOQoB d#z⮯7^آ#SM׸*n_Mn-^ =P Ku4&qQγ t=031B8>;-&#QeUƷ%pm!nk)xT\w 8B? A֟?WS_ǫTq&,o3!lFot8!sMun}6FpMrc)~l2BsV~e-qYu<}Ƕ(E\щb)w~!&-;U6#lQ~PuFk,CPht;bUH6^إI40VS_|UQĒdn@9r?l GTجug?RN@=}5;nإ [=V.:Rњa?SҚѾoV`+"^Gn(?, m.cǺ#ȋZz (V؊~>،S?d8r6#t*i&Į-K`x2<[b:aU6EQN9.02Jm jɽ\UQ0=ʧ>X)^n,kRFӠ'ab#%&*C)S0s_`JXjcօNqUT08eNMᏠj>XU`-N8 Vr;xzaS i`(hFشSnKp%Bh'{UBXC6]5IC rz&QJB)aB4*ОDZOJH͹%k½;ƴ`|-튪G!?YyCǎ&b;xcmuW]:FFW^ OqJ Ցc<=B8^:88% S/;xJOq& mC<[U7>V*y)۶%$\${T` >U%㔳o^*EO;`A01e+[5p%dХ#t[3aѼi~ ̟QǏ|Uq5팞ޛPos`VZqTZ7Dy (Dźx`]ePL;Qb4nPCTn *$ߡ0%k; <R78W[Fd%M*KrE6Pp$i^*۠o0jʳ& sJlaCd%.seML,M qm}T=HGpza/ĺQGj  %후oue\xozunP[W,Oz C4$ز>n<1U9k_ՊOʴuWF߲v#p;~*Y --UPzb 0fCPDbU;i4? ~8)Drإ ,>#y/^ `~? C)x\P5Oq= ri/po1ߍ*M<1U kx8kbnDpL2}^GCb)>f@z6{bt?? P#R(REHzq_c"Ieܟb;؋cGlz8=N8R6bk;* g?ϸ 5w;IUQe͉@i1hg>)Q/dv*cߪU 0|KjtoJMF3t5(TAFC|kqUXd1=>96Z(y/Oc_>rM_ؤp%lwݼ0% =ob;Pt^|F&+_8$oN50LwMwě d]G+q'`iCP|U=HSl89,fnWj mJf*{{2}i*նs8_^|/Ӟ^z0(LF;,:؏ (FK7pEV`xx CߧcSb /q4mqH6V RT_U؍^(Qevo׊1'u̲4m)sFUqt!`UR5*dy!RTqb2HX SQPd!֍)sv~#l7 |NtX{68䘪R6bkӯ*>ቫm*TS~[1X5>^#U-= iП-DZIJDxGc*9/ħICb{xTJAG让I"mv#㈽O=dž*Kx}f…t |1:&n*& N?F#Zvq8&e*#~=}*S~Jh#\ W~!_|Rٍc}ש S |zn|-dlإ=|8~>Pm ӊe5vW+ztĚ!jljcgy17ozR/ǣ-(%ݷxW )'„ڠ>_q܆$8ە;xfxJqbIUqoRQK<#.IX}ޜ¾-OۄfH|KڝF**wO|*\rOE)AyEf o0Nb]Y^E`yJz"w R~ԝPė:#p?~!Kn<8Ӷ G 6`T3W1N^,=4wO" >) 81U9mB4A|*c~&|*ȭl~FSHE* ScFNq.rQUb#l=zFEq^b! N*BN l6zNdضZz:d1gKٟm.%eOˀ 8L4s:TUJ$cu U} <*١ߡH7Upr忾R>8n[|P U` tqB Up#ʬUE,vwۯݏ.SUiP qx 0AJ!fXCF]3s5Nي[)KJ>ǸT}{9oվ5ai>?p+F*W  d 5_Պ[e އǶ*(߼PfQ@w7nK P{ec3ż1ވq#\UvOQM8P9Ƕ-5]?Mto1هӂR(oWC_Ps5pz@튢%5FF'Fu5Ӷ?NJW !n<1V?1…Q/.E !_`YmmqB&9|{m\*+K`դ Pfq13FwbZ|;Y$WM*x1FsF$`+]g4Ow+|KXkMq#YW<>8: lqJ[JI~$4l b*|p*~xw( QӔFTR* 1qUYJzymn(DrGb2Pⱟ~5>8OEw`UF[27]  5֡-aCъp0d H3C݅ S,ªAl<×|UsQN懱xb\w*N?-*`\U?27ğ xUĞ8ACWf_>J~Jl*ߦ)ޠo 6 $dͣ58QTzse?.v}9⸪Y]Xl_?_,FM:UTĒշ튩H ߦߗۨ։ wixW߾{wP>[aTJN?9aĦb,+sCFOኯS] oi2.!*ZoO9~MLb͊6*ثb͊6*ث*6*ثb͊6*ثbZ28"dKn>ivbڠ :5墢b n"%:ukهW,UVǸn2}EpR MNgDR+A%HRjGC.xn;z.%?1UZ[v>?ۉ\Z8B% 1%WpÐ^id6ū)`UΤc,Pd# Y q?c1Ln6詡4܁G#/~늴EF?/ ، B̞$uۛ~_u´;`n%OzP,w<6/Z]T| <֪W0D-҇ ɌST ;H:*/ޘ:=w%$P$mJ3l{Hj{⪿f{#l(Ft%\oC/!Zn:UNHi^ FW^'t=0% ѷ%c8[dUx],P6، c$*@7 ;e#~(]nSo#K1JW ׌"bP߻c4k({P<[?N1&Q{̡+۱(vBu еW9fR0GKgIYGI+Zu:U "5Cb3ەbM-J :B,05@{Uhz഑dJ֠3Fco|VbW6Q hj۶" 0$u@߷c|(D+POqݟg*>~đ& *ѬQnz`JխN<s\UPQF$**ԋq.7هC  Fd) )c◀ni6ݎӸ8ۗ_ᕵ!hF)eS nS'f\ K4"%'u%X 0b2}GFSªq}1Bqtn$w„@`⧩I^7q،Rt4e͵Wu Y>S[pۮ͂ |Q#  u5BhOЇF* ˿znU=F}c vPkc㊷R8Lءp?1'(^ǭ1&B6;*[ᏆvJ`ςm-*Tru(}VЏP=+aVĦ=qbA Xsq^'vUzQBUEqUR?/u?qȥFS Q0U+q4bYT<'oV[Aր{UB@G?oopkU7&\:lwՐmctmצhLU^|p*OQlp`qIb»툫~GT"8z\Ua%z 1d>%~*ԯ$ټ;enO(C1V0LN~pt8FHHb1J!]dzaU5~:b~%BFsj '(iQL)ZEwOY?aSnxUr@jvuj8O냖.ލtqd5{Pƭt?؍ͧ10pe~02^Y,(}Z4{۶Km-r]b2HG$)ָak, p&si#XWO*˴ٗEҿs(d_ѓ\ Gu=1uupsT3>š>tpov rњlqUUG8 {׮9!<-JU Ҿ!%aAc 5MS|-C:xv TnQۈlJHlnUV9 * lǦxU=> +$RRU4tWjdXu)mE}AS|'o|+zxx䘦u̱s'Uzub-HIn`U 9Gh$%Zq?cc}[duq_m)Q'oTodn;Ur]FZhnWzLw^ w#er64Tl U zxb|1cϡLiR1UkHt|ycPܶmS*WaM|>8^AW8"iz`hf[.T*u/=?kqbh߽sP㼏Ԁ;#);tWFEA~"qaVV+?F&=K~$ ӟ"!t?F'dnuXQu1uUġɳ BKVu…TdeټqoU8n7_G~u>ˊᓮ5#fj>qT9BdZn.bOWߊ ʯ6=Ě.U6ЇV68ءz0oeaU)Nٽ"tqW C-PoҞrkUlAbAH : 2,V@ *G{QE*GouPiIwOeC0 tub[$F„`bA߅JSqW8 {T|*ɓڞ#Gexb :Ǿ;* Uo6Rv*BL>,txRP j`my{VڝJ,ugkw5҅6 :ٱj+<Z$&K:+Tվ_ƃ|1dxx &xT$4?v) T^/|qU/j|F(UWeٜwu­-˱?zckA~4Sq=qU6P jC9kV?lPzb+unJ|,|zaB*+`Jpn,8„P<~*"S`U9#m؟uwz9>Co)4LGHZ_LdsžD<zVxuCk:ߡQ'.WiG^m4lxiCr?P`:l߆R_([*cxՖNqB6=3\rl£\؋@{UYg ؂v銪VQx%CbIdمF&dx(6Ir$NCoCjbJ<\R7crWcU"O_VU)1&VUEeUM}|-\&dcDE[~wxx! iWeѼF)h"xS?|*؇ҧ1 TLy8ޞU`3 6?qV> (G7N$qQ\[* 7SS x~caFީStUrO s"n7\UIW`5$o>$B p Qg?fa1P T%>8G=Q5iL)(GlV7w\cj< 7\UH8PĤqUX(j [ (G%H8>,h>fW2pߨ|'銩|5>b)_~1JH|N+P$NJQQzTY x17lFm=nTzCҵzw½xp7 0„`cq#b,ljƊ_~8U"U)aa| Pn$5cbZ]RA $CD)u|AdI cCaA5UPgpз)VIn|,§84?34f특dPĮ9845Cŏ݊V`>vA\z 0lSƐG^* z{vƘ~C)ψ& ت :6QRW,lۜL|[~UxP7uhAA⭋.OB>x:\xo_kV:t LMS\L܍=1W+h-&O}FLۓwqzO{f12丫bemfVحoQ $E 7!Sb2E7Q݅ ]KJe6GHjvyJR-hb1[XS 7s Rh>ィ|CV8+&l FCS%ݹ@0qUh/SӺ@}Q7K{LU-olk7bko\i3[qQk\VVz2êdV؎'#5Q*;Y}6CV1Sኪ;8p9/ bjU& *ݻUcGMc`7(w-TIwU z<[H*-?]IC2ٲKB*[ G8m1%er4fm "X+xUۤh 2bzx7違qP(B+p;fp\xOM">mPᓮ".^AU))}Ht-zzG0|кBA. (7Q2BE ӕwWA쾮}H8$?iSL> r?' S} %!#qKKb +~sk (ẟbyl~EGqTcӦ##OQHq}ROHCU ؎eE䧮HN4n7Cp!!-V0<})jGŘzuJ` kp*XKO*:P£n.7*yGdp;0@=IVE!SIl+A:ިRu 79Z0b&V*33aҟ)CCV5qQV_잍ከ(a|q9R+?|3ĘRG*O R,,zwYZնVWKaqWC9MQLEVIg'pY_@> CtI?d.%R+g%w#fobI}kAT_q 1,ĵz1TLj#(6?/| _l(Dz}tE(*yV0BJ%o)CF#UN',[ߡ⪑ ; IWF/N@I 1V0cgx~݈U-o#=Tfo\*澤]GlhMWuW[γ=ӌSMaUr펞y⪐\<W}N(~&huP aurFϊbG*1P3t8ũSEbkkhqn툃隍׸…V1@Sb~ه|r0ڇńVڀ bOH%ep2JkJo~w⢵al@X|wfkG„0 I͊\ g &]b(av>b5>`k${R G"dP2VQž@ I׺H4_fҢn•i_1zN~xN`z{`pYTA "v? $m$̬T}'s";w*ʮ80 TU%#=^X䵧& "Ǥ 2ӯLkrAq @u?$b[cl|8wpLQ/ W~x8 -PT/ߋ;LQuk qĪPY@n=VJhq6yGUP\,4A%W LgbR*Nׁ[?AqP, ]J9N{3^ixv8&+ËK.HXU>VcBFC߸^|Q'cbIjoG hhJJ(GPqT @xے`m{ (nzDB\R܀ױT)#q*x*U1x6)c*›LzUe~=?l~-݌h:*8k+4PG|U;{bsCG튩=#v.Ud=J,0;#Bk+YGI?v*)y`4{%;S8&@En&FUV~"5UN!J` MbBq ( 0T=> YHXׯ/\{^P׺يTen7 D`7Hh;(Ww~,i>1;{>o|+jڬl}XA K扐`u,gcI.IGX.(xU=p!l!1٤;ת⫢hIv`>/փUY%`kaF%şj)hAƝ׸TV}3q|iz(Dzj?'p%Ś1ZDE9H1U6WShw}UXOh+*H?(F U߲}KnI>ޓWҗeЪ>}J5+I77.ؐI*(cA}7ob)dzbH4^(p%l0bQ f)hJ|~&(WfqGUՖ]ተ^Wd|J~cߩ߾*@>ݲ;-k XU9E|>P߳;\?~"ѲlF+,lZ ^)P6m*GuB@,AUxRrCu@*mo^ޠQC(T~˭fK7ҟN+JPzkn? GdO ."ܘR„ 0d=5Ըᒿ>/xy I6$aT!GbUi!`3DN䍰%qx !& Q 1'>ǯ 3-Olcxv R|e&lURr\_L 6~)l C<$xc V#lHm^'lPzv|kF;7«BJzϡU~بã%w5[WqYG/9BoؓJ(wUGxWL-úK irWnB=Uܐ78X~/tnӝAo89f' Oӊ @?濻U=P~G(;(:|qB,I_$QFٶ;~uVOcC&F1wqBo!VԝlkSFU4Be:,3NH b 4r@oR45~8*ؖ XL)h%J9)qT8s |bexߊU8WO.Z?{a'>(s* x6(dO=qU>-iFMWl gJǎ0^P[0;b=(FQ |F)vmRB>ШM,9f*S4Fc)-ۜ,U*+2;Q0ZtCRG4B9bW w/u">J8V[pR{Tu]4cYC B!&#!Ү=cMĞӔg8QLbLӨWJw\Q(Ck$Gi-H*wAtɳn1V[u㜩wZ4?~d u酲<[ p@h=! cF[\UyR7V9^&Xѫ055q]J kG0dt#<P_Q z+Smr8OeCl@qB唎iCnwdWDW5SFUqUfٱenC<1UPV[2#"2%d0rv^qI"~%wW4Q( =>L7)CKe%!+?$$,pGOhԶ{tQ)t>#(Dt"FQGT(Emj7*1QAQvɴT^8{ % q(~/j뉽&CT\GpW8r[鿅1PQ T[mxVXf=( x"o$ʚtU6'je=Pn.5qU7w829l#nت[|/dk{Gdc4Vc5 {RJ~PhGAvB6QȭׯIXqUW(j6튩OlX:Kl#T[)aޟ:U >Ǹ= S1@%OcKhIhoRbc`)UٻwqP8C9.FٽU"G0@piTHk]ZO|hj}\[)PPWh0<[3'?N$_wAUx!# ɱ[,NiT\a)2F~zb ЌAub/b+l{[h7+8>PN0|F*j F0 |K}QD_*$ 1E욏T捶!=SOhUH^KwK佈hRG;r[IսbYuGwCCm||M4x!&8)*MpTs* *Kc÷݊T-^7*kkI6?.*׶nXCWĦ+J20_~hU>1N|KڸUuUt?w75FKto⪉)~!!6* ābxSa]8|'Mm1U2J8\2|2V55*) ߯R3GGlh&3Q*~![$s hgt<غaZW[f)~chTw%\5hQHNfO5SZɭ'a >Ǧ,q`񊊰>Ձ(Z~׷| xUMSp$x?ۦ(DE} F~Ad6m݅UUtc*P8POY[IVKa>KeA7Yn*uvlUٱWf]vlUٱWf]*6*ثb͊6*ثb_'b;xK<肛ScoK =;ӧ U)bmxg,麷cC`[AU5bjBIhzˀPNbu*h`yIxAM ~$؎zFtlU|rc>U=(T}~Dži'nKQqIcc-ky 1Ve_|0b$TPp&9:]l* 6+[ QE;On-ƽ}RH;S¹- oM=Bd 5o#)1U a:^McS]۾) ˊTU |0*IiHK!os.t<>x-ҘAShtl?Ċ8<PpR 7q a68"2>x`Jv`78b*i⫢8}>8NCG^'LZ)QqJے}#4{׸­BzjnNRi.@2ʹB)?ד\UH^\#}H=euGEq;h>l>UcjYYՏ&8K?w'튪]Z~n{U ݈)IካI5V (Wxr M(;  ن)B̆-c%G*E-vo;qk9c(;՘؟=V F*ivNmmpUbԌQa$FwStS7Cb}%H*U|R;C!vUgJ2c@Jn?8IC>8i;{:6{ +,ǵ{{,Su^/ktCUJeq 8%!Cxaoo ˾U&''pFH|c?S,_93AT;TC#{SSBVr1C^6HDgJa<[t5G ~ZN upq AMByq=*7=9)+lŸKƑٽh"j62HLQˈ{U> $*VgZC b:u4_ kԹ_^}ٓl ]i9_ۄwL }a%#~DZӵ8#6#ZuUP>Cmv8R O;bcTvU"1hn<ϡ t=H>?ۊT*c5>ch wO~< kusfi"9Ǻb(sDci튺NQB0•aB2yh[abVW;a(ǿc nlx0ȝqJ;7ڵxQJ>B+ aګj76 =BOmN;$A$\R䕐`73C PYFzCDxqWI?r8ei|Ks=]yCԋ`~pnM0+$eWß?`mqq?QהdxaU(tŠLoM(S\c+ h`«vF><02B0R⏯* Nn ZA]צ(% K1U'/q`dJNqVdžۏB2Q*&1G.Fa% GT}*T8aCF*ѕus2 jC+( د.b)Q*P9u\WƲPt*~DZ$) Oև\-Vkv/xjټ0JNSױGe;6?ۃ}'`p%+Yc ?lU~XPZ,O4=Q,@o(FrёTa[F֟ QpTWsN œ⏧ ۘQ(hxvghM$=z8U^"MrgcCU5ARzB[M pZ+Ef45[doUcU<$)A0kqG;㊪FTh{`y"G߅orR!`?q;j;U UDܟ+OF=د C-rzȯ:}εu8PC@T1 *VW]Ƿ\U;bWfT^u](N|1U2-e5aɵz,3AcTr }N ZzCYO8"řDf%u-Rhd 6Su_|*d>/ĔE)kFۊDk8~?, d%lU\oba71-}b,mF9!*.N;Wp<|[{Ut^}:5b mGt1UEpu"$9WV~XF] UY\0̭kphث@*WCsFrCC,SCU=V[xXܚ7oXxwQ`JR@b?Θ"Ec^qײ"f~ո(Uާ+v;qpr6=1 MMRWlUQI7W(iej$f]ɋf WE($у:xv8P6585:}تv?~.87늨ѓqhn7[n䝇bwqpQ*Sc1U ;6*#)Xb*=ܼgd <>%IEΡ8JH? xbNL*v_(UEP|1W{79%#uኵ$]q!%?* #^éۚ*U~Ĭj(D#(o+UR@ǎYƇjRB8J=hIFw`&tu^+2Y=GA~:l.t =qT9FSҝ1'c0=džQbo!S iU#bFٕA(\XĹv/]80ָ8o*}u}aUx|-buqܕ{VPj<2$>RQFbIoxSQh)_ ifcd֝*6M^Ë|{@b5`{vnlo_W^8䦸?݉AمU@.]68䗏] & c0Òo>V V7F=$o4eŀYE#b?FxwĥUb97˷x$=TwVp|dlGӂKk햐?RujZ%č{ȮWSܩye4nܖ Oq%_HN¤nhLU Ml5Q-# VPܤNjl oB,,TksPnAk|\I ]-Solga`?UO%>UR;? D?~Ut"#~G̵UFhqj{blhx(x)-K߾*wq!⪫:_ems>.T|=|1T;AǨ{>l~1WQEGƞnEkЍUp$Sm%u6Pf[c<@vq+}tW/v=O8TUJ~efߠ⭂TlirKUU(Ž*(F7^^Wz"#]˱%6nߘGIFHw%O%UPËpF Se.5 FW<n?6/(Wÿ݁*[gjrڲo01[C_׀^ L욏 UTo/ &c`U)-jCW7N)v2ICXp+R-WRM[UoqGxU|w .x+1UQ)]1'Xr# !_|sO>Tqtքb ?GqOcڍҬ7\(ҿT8QI@ !;|@}aB,:Z |w%~xM;:U&IRਮ=>زȒ*Q5) [b=)?z}#ꗖUki=x=kO_~XJ%?xEXkQ\IA@O J<&SFހ[+ޟH^Ǧ*nwq7qU&پ}tw /*oJK:5#CdAQn6yV]_Ⅸ}b-_cSg1HIlP2G6b\F^?VU}Ƙ L{,igNhAb0q'ؒzbk8:'u{MZ)+ ei||_C>pp% |C@aI1W/!`i3*׌xbvElp%N9~ 'R0AYq\ثb͊6*ثb͊6**6*ثb͊6*ثb_> ?L4&^3(hz"ޖ*:{ U]]mO`JUqwmlGg_oհB$֣P5J#{A5aTK-He/T}bS6O qLRkv7qBKӾ+A:4cK!_~6ѺV1"u0k>5T2N /)k6/kv7߯]ږS$huŮ6O H}aB9>2pG]"y&9e~#Z%SiR>x QcpqUIE/(>\Xޠc'4`+=Z\u8QIz[O[  SۉGL2R-:|0%.edjB6#J -V{⨨L6@e'oc o0u/&!߫?oY/=2%N!uq=Y.*ez'q,j' „ƤFS_׊\ц tu1Bؤצ :n߆!*ׯ$^5jT1U87 ׶#"5]qUt~BO?/bIax*A:Uն=xhb "1q):wSqźPW-Q^G]@б >bIr_:pnװjMW$޸Ge[Ol(D݋KPޙn(Wpj&R|C^#n܁Ox<ׯqo,u'6>Vmo=On턌mbkf?)Rfuua(hvȥ-`a<ma_ZSW_DxWª*1Wݟ9^*-%CU)߃VztRgc1\$u<[g0@$ w2O!D(}iaP0z wF܁v0uݙ͋Sӗq0n;aUG|puqCPwMF6kn=G*7<؎&ኢ 7 ZJ*\UՅ{`9|=qB27,%]x p½p%4M\bƽqV_hă(D,-{'nJiuqB6P m\UcFGĸ^w\ ':2:Mӳw u܍;{O#@ÒUHQP5?C\,S;[uQp3:(Ǐ Hhz E[øUYy EkF*iT%O'þS/MF+0^* S27!*N-n71UD81q Ra޵S2bnc. ğ}(I$b;|*E~1QªeOJX:~Ukz7/_$xOQb5X ֞dWc8a(yb Gn1UO ;)K3`z/l QهįpULVe.A^<\lzj0<~XP,:WIL uhY#F(UoV+kž(z4mU=Ǐ7 >(CZg݂=h)CqaCp%0[z/lPB"|$0 _ 7(z;V*96$5͐zIȈWxqTl+تs4'sO|A#5;8ɷ5o qo*_N6=|Ay튪8{Ć|U̼~+<\`U"RXrm zزHHVКi=ǎCK+t L 8PCpP¦V4mױ,Q2`Qʳz7,Dhw\RgiOM=%1/'r@%<ñTV]TJ+;0kB-.12 (Va=cVSǹqE:*OjTOl%Zክ~5JC|R P8qQT] q~B?WT?~ 06UT$UD+i'uDК(FG2L9&Z]OBqBz &7sձWf kA@oYI|6w_]Ȍiއ5Y0Dxu"#A1%tmHJJ.8{aqq+@C-4Ylg`;d_SI"GQ،3P̲u5khՏz\~?Nԡ@SP ;&5#i;ul+ЏfvͨiԒdYĻXO4NK` \ lk$KE?"eL hZ#$%ՔdWXTeSGtYd$,Bas^[HG{҆VisHYj~%i-ՄrrTUOˮ"T-划]S$eˉw:։VALre1䇞9aF=CM~e wxJ=O`E?^_5s EB *ُĿKs⯱}B Qw#qXeg؜|`w[ "+j~̸7VY-C?-S4uKR %<1VIT6}URtTh1V\]NIE {WfV|{Ud%⫢t4ت>)$d|KIKc%rSCV,183pLJWPƜ!|_ $V1i}§7P)0pGe ,K=IZ{&ZEl(V;n[_/GQJ$͛?hqK"8VYM7#cPUxmJ*'N9mJ*6?pvc̒U։%;|½*'n*[`8džh3I7\,cGڏl Oٓ|SVnƝ>*Qp+jp1H(%„G4}0%OqV<[ 3@HO rP@3[xqn?Jh4|]QPn=)8-/th[ׄw?VוсP?Xł^-?.{s*p& r2KdE`%;`J&mxЂ(Ep^? ߦnQ%mQF&G6?(^%x>ƞ>X#|FDAЃ0j ϸC\i-xl7Ԏe%h n:*rڟ?5T_a²lÃ*yqv N #Y]Q$_x…zZ)$0޴ (y-Wo: 'U%obG*<-d1W]1WI b3ټ{Ubc_|;P]P7lUOuS_{%n6=LU|W%OZ%d1B:;aŇߔH*#DqA81S}aBPpB\I#P[jDi.m0H8U[$J.+7Cm51V(1U\H|_ǭU6 D~ytqT<`m?ϮD|PѶ>8UuSw>X]h?x8PnNW}JҘK\R`B\T$ l]]%U@j;b-s[{)r5f? Wp ?hhB*Ú]bGk| %2Q#@FqSZ#e+p> CJP⪡ec(l =|R +2CKfx>KPfZ2 x8/5kZ+V;b_ncHSHK ?MU ~U`4pI݉.>ءV9SS[>lWՠqCㅯjjH[ƠmBkCO1MOh+av"K1Au$n0S `U#XizT.|m2^,7;͊6*ثb͊6*ثb*6*ثb͊6*ثbg#L4i# ۷Lmx;-b;0튴<0\ i)BQZO? mZ'18&Vis$ƀhxMk>8y?>_A/-\*tܗbzR\žFbB.;| Pn#)#A/* imB?^x8BœZx13p;*NZC;+O_5gQqT=fFjv=F*%r1?-Sנ[KZ02V/sNeP8$Gk*b%"(i6>/;w?2tE1- l@!w_ UY!C労 :8|~k׸ZFYฦPBcoזS~1W-B>2NUċlz*Xu8*jqUFZL{U& BE0+Fa orw#{ K,^7VbOc&qU{kbֽ SJhb6Ħt?(U~t mp( }`}뺜A$ MP,aڣlu('SnO鎈z[(REA rwkJWƪo=1M v="AZasMR_Hmǫ hb]hi*6?*JSz| +C/1Fm%: 0Qq$~UtN,]X\i:Wrgz}S  EcmZݽ9pH11䘦_c/@ʂ8pTS;dO6+mB U~%=_NQ3L J5 ='q4'[5aU}h>́4ޝ3R\$IoPՉ.1U/zUQ] 0|1BQڛ8C!߷FZt0*OP>/$)t9Tf>덊bqC⫤h<1 |J6ŠU'=pƕ+47chh}Skf ܀zJU=cUo~v?zI^*# B=;Uq70Q_|/؎Cz̽(Wd@?r^Qn;SN*Ò8A B>)v>#l0!:%)ݚMۼG{k&4 wt8,(c!j@ٔp%ޞ}qE#moCX~f혀>{)H{.;A W+nh|7K[ĸ=p&3[4'`E~O PqF3 ʋ&_7)IPt@!Q&'o8ՔR0#7fp~QqWvlZ)q*2:hʞQت?'ߊG(m׾)S?O،cўqeW,V^ӪbL=pYe L*Jh{دĽ1S=qz[bⶥiixhk mM g})MV Ҵ Ƴ%Ćr5 Qe&:ڻo^HËSVV}MRAe]ŅiƵykޝb 4d8wߥ{hԬxX]Zdp1M˒nah@x]̶l V,(@Q\~Kw#[2aSu躹G9GvAׄd.Ղ [ʌEOPA%nڿ!ZZ3N.+ p\`dS1HZHM f$u'{W5Y`+xL .4N@ġ2<0DZq}((* W*hE IoQU=S`J L^nKx *8%zaBy ZnǷ䂦wPI[qぞ6lUScrr 늹צkcTp%{caV ` wCIjp%/Ķcߋ ۸8m JS#ăuhLM|=Kg،P%&_ SG\R^;q NweGCV/bpJ8@{P@%NhyGwcN1ՏkIeƦ!$uUl~ĥHK1AڤOrV]A l/SNbӀ}ר,V (k2HS,toFSTxӧn効6r7U+w~!Ż+ ӧpr}8DqTCU-0`KzwWqώ*d'8O *jxu&2STᛧb1N)0ߊw=~Q'!= @P 5\nsO^ș"TXҵFG1;mX?-ۮ)R z.Ve}68ƕNhn#M([, 'ĸ`8d+Q*H]01l7OŹ 5qP=ִ$;JhMARNCXb;AI Q  їbYcA|c@ocQx/H>b _w1wS ]A$BHC%;tW#'u=7|WyD~IkUw\P#Cb{}ߵ|m=2ք*]xkpɳ1Vmc a->݊za*F?V *MG# v5۷TfE|{hI%w%.T߈[|{ A_44|*%pmcjn)6_Nu:Z{0*XMޘiڍ[cqO~U1}[VQ0]Q »7 @|KqB͎W fZ1B2A)ZLDjTlz,‡*Dk!«Y=<:ɊV:|7ĝqB%#gU uf1.bs#fKi> M 0(rmo튪YEQz6riZvtVmԯJo۶jxAwĎHo")h2EPr|cc1}Ud_+Ol YJ튉8ĸc0;*i70"JDV> !չ֛TlpR[6Vm='u?pAշ<ۯӁTa1N7QƎ)&[|2 lR`Q )ZgtDWi043(hWqRj>čjqBd1%xUP}ѪK;.$Phg($(ۃTLlvhvJqB`F82j8]-{PICG߈»=0HW4p*҄nEplWlYEWǿߋ$,њ1Ȥ8 $T_NQ^SoR=G?TdH`0%@n:h>T${LfBq)-zn*žҠͺ⫞6x UT##TbvTL %>1I~{ < ï{~GTKb؇uXt?q2[NU 1߉).㈰*h‡U=UEn}L`C[dfQa l*HWu<oMF*C`F+!1B-.AH1>F=æT잝DcS@ap IvhldKtg&;1>X}0o2VCuTM A~ lnd5} Ukd<;:bOZ|ǥ;ثO7|QFrCṠRM%'[+G#w4ѱK`c ` *7Gf'* \ }OՊT$ĩ[5Ij#e[*LɴG\ K%~k[uZY>5"$8Y>((L|AG?B!dd2e|qb|2{c,k*Wr9bۉ3 /㊴cRvOo Zњu8B{u;#Pih*U%B(qUXH DMSOaۏ2)C#Ld PU|w~ Hnء\Tn16mV*[ £p;p`JKOLqAVV]:n!%)>qTB\$Mu{㋉U߅* /?F%=r =l xw›.HO!{cIJ6u1S iQ\Z);eZ{ S1 %!F=?huŗC Y4o*h\يGɠkv P;)xŢR UhO$Oo PIlgq]R> >(;0%JXOpmߧt=F+i}凭qn`Ҫ$=02@$AA|!cmsnhqaTtR\F9 7UY>늡Y8vټ/eWa)b !CM w9W0%<1CPcTo:u탡إ $ 6#qJ8p(R4T? nDÒ-]YVa»ZcxX#otn -t+V$ It;|tӐo8K!C Ϧu{sPL}*VY44o V)Ltj3ኬ/Sq &Z|qJ $f(qB&7Ke+޵^\֔nK UAn:~#Z^ ca@z_џFz07駩 ?:^[ѝD7_هF{nu0‚??.pfG_b$00Pѷ_3k$ՑtG5ۣa|{b!cŶn1J#Q<>XbGUUywCcb63{*m㛏~q;{xp$N(;3w,'& ӡ4rx`KR>9ƽ|1C G5e I⫞?y84dOC* 8u&=_ .>>4 2ʑ+p{bVfzþ`Lpft)N C z aP|?ʧ. I\1?WAh^"w0ۙ;9dv#n'TRU]J`:qg$VR;k"E6Y4|42Ј*#$V`7B =Iy]r"o٭YadiT(^1jb>R'.&>"@j0z \0[Dտ>~2DcTֿou'7W$obB#7Cx*܈)M"HMGi'e+ZӾieKrt?2DZM7p=\]i75-as ݙ H ЧIN}d=4sl-Vq2\V%aAVZ[{Ha&\?0yIԊkӒ mvG\'",g_ &a\/Ubb=6r*HLH R'o&rr,KdEQb:}W#wU,j=>&֟%r}+w^.dWS\#-9S60P)v8Wr9|M:팳X lҿ[`YGP:ͦqppqNL|`%5ZS`XIU $S!/{ +W V gBWf+1e@# lAq+E>cЗڄ6U$Zm##"PR[O}I/>"d2ޒX=p)bQ`/ݗn-. 75o6,B呣_~HHxTDs:cScٱHخR=*"ZH8#.MoR&&K?;8ţùSЏF)V#ZU;2ql\t.u?/ ,ء䐏IV%z\ a Wg <|2X-#qQWj(o?mﱈ;y1.EZ@>屃_ʙE)l\o Ju}#,QlN*$~#4 MqEbQ{uA3IoQE N~-Q>~%ޝZS?*f Ȏ|2 Z> E*-qbESS96wČM䢣W&?<f;\U $ݾ*2uVOe'8X4db:p綃Q"?cjk(JoJ?o,x p[MB; O1J0>]gVRFk؄mVI*jGhZy P$+(PSBS劗R8=8Ƈq?<1UQ:K?- vqUޝ-L*qVxMqJ4[6aB(:IQ^j>x?v*{Ƥ^늶7ls@qUh'э?qU1F*4j0Zh麟ܹ UL:l}[\_c w,IUSCdlیz?,Uax2d=UӃ5b/GM:z0-lyWgWԤw'a8ʩT_py ByI_늢J8H(i(}7s!_q$ݎ<;rxbDtolLsq^d PTS%7^zd/_0f&ŨF^clT|CPMñlj*Q.?eTۺ~pHpEb;lG~MeQ}8Zq&(TYB(OnF4UUwĊSuPH02|2/Á[łRPkJX췈vVɽ9)ĩ৿PqU=FRI⭼}ǿӎ}M0*+va%1t8MF.RdxNƫ޽1LP&[]*KѺ)W"fc®m᭞Ux5$VIIXa6?쿘bͧp97?TXO)Nݾ2Z;͸&ɷ_N(U vH_U@̆q~n[kDWcbcT+lT(TNX5Z/\U5zgۦ$' k]UGh‚l|7+\Utcz׃% xq+I9Um Uъ-B) >غL$4ከ<- %-R{b݊qp{b8*RKZ8Z+U4>* ^$mR_⭲CLzn1ELUIW mQexzb3[+|'Ua]uӠ„}aSd̝78PY9o;cSzDT`.*h`I {s >\ AI +#*~WJ!F*ĻJ>8^?L7긪7|MYw +Gj1TJNCI|.*~$5V+SKِ|U)l9Bj} PE6d=PQ sX$_ZTT#I?iz}+dܣoQAOBBkZo8Y.aO%{U_Gx@y,k|@":8zONUV+b<vit[M_w$XUqBC6GyWQqP`;? om>-cԞ=Vߦ5m_^RUW?|'#Xj}8|kwyE_ Ujm]OMoՊbA\0\PP=GߏxRQCI38xTD:K_=@8#<5F%-Swó|cIUƓ}B9]6}8U_V8tolrM╬aa-mP W F) ҸF;:?lYoQ%P݈F&tIO_%AG.b]fɊO}l.0q \PAٷnE$P@®P>ݱV]zYr[0Mdž*܃lq5bŷ^\lUE/,U#_i&`Utz8玎HIZ֑Dx)7qo Ug4? r/~xU7t#mĿp*114lF[sч1Bs<>75>B!nx(~ 3aB!eaggs̄?%‰] *$s.236*ثb͊6*ثb͊?*6*ثb͊6*ثbg@G$ n>h=P1ΈGߑrk(wvۡZęv8qQc>φ5Q&f/ӈQq)i'IzҖnh@u_pIޕ8P (M*qe~'T+𞣦='1zl|1U6߾)d+Fcq5OՁ -o׃PJ 1ݻcexv87*děc%1BϨ>1u|qJm~ ƒ8 <>gʸ+Uy)U,UQ>x}`9gV6xZwK ַ)upz=-EqP# mJ{o)OI&bb_C{X"N~%$7d [`Jkpza(f S tXWjUwS J=9zd0Re_;vil7!>䇟#ٻ(EG1O^*in늷D*)yEf⨨&(|@Ct„z9& CuqU Ïl$)p9P焟E#Dx_׊Kr\H9 F*F(h~`C7 N6*Nbhy&u).tlU\Eካsx HzB%'(|f0튯Q|qhf 1JS 1xT ݢ8ta` 2Nq^%ox6 Q"{ulPp>82*"TxIcqJm)HfQiNEd4*9D,j7Fu#˨ٿ{  ۯO eڧodbT?_;oQ6挘 UqnUhݭ[ nmZ3U ,i8`G$?{ M$T= :6*: ңE3ql BOm?͂ iz 2b%]57L^~ |5a|Ї=?he94F8U(f^o U#N1,>~8T8.'65Q7PG;hjQVqn5M+s^p%aCŸaOq;)؎W^?|2HG)<jS(T5P.֟VM|Zo*G0nܣ>P'n]f[* >;`d##FjM|KG{"c8lݎSOኢPn|qk{튩lzt mn#~r=9}̧YTgGڇ_lU̶?bqgWlUPAbwVl# Gakzx`%[**iS=Ep-,SsOI8 QxboV&T8$c@OM*O\MZtUy|KǸxaCO8 | 0D7?/\ShY6b?wl*}DU.I8m*؍ 9t8m}N)N* ħxn"8M RZAI/ǃқ1rMĔ>3J*w9X$3 jXgtԨaCVEzVR@2W64w8?wqLFڻUY0ƎWrM}8WSECc8ʥ+1y9sȌ0;I*Žܼ*n;MJQzOV?Gbvi18m>UNjZtn*UhJRB {pc@N/k_ST_᷎'w*R9 ;lrbfz c%FQMF[Nh8avb$z#۴l2H ;p]:$SԑN6aE`n7 "12(xψXL3!PZ9 W4[e4Waa |io$\d$$N)m[HCĆ,y5Hn웈te#>ea-8JpDmuK3%xlkeUE(kATX7qӼUI$([.Cu$&)5VvyNZ*rٲ<^څaL)W)G5WrI\1ɹ`}Y6j-)w׋{lE{ )+^ IcI }צhL&xp@ m5]lO9X6 7QVRd殴AdAa}(0.W S fJp-շ}UwDZFָ%ȻAB<fs>Mfң*i- G# ٴ۾6qժ[|9 WphQZ v>'-G`?Zz\4WozaS)8Cr +~|хte$M9|jd3)ےGńϪKk L|Hdd{5hr +T8AT2^;d$2i5=M|SF MLe'ٔ pj?VǨ[ILg|nZ\z[81Ӑrc_ ! Z ڧ?Rvᒵ[~ù1UaYE\@6> >[9Xw JVÜ}ƸlsR6 _x,B/ly(,Bqo{92N¸teD {~`E+ëIn=WrK1'l+htjIp}E5o,QbFcu]U~v*Zb&Zc`Je4;J!|Gqxw⫒BFj6ocVS= `ObOoO0Qg+dBq"_⭣cW}FO:Ǯn |Ud2\%q:=*H3Q-C6+іH85Zuq+ө㊵ȍIJuv=GPZ޽znht?LuULR/narV+<ѹ[Sq)!(|+R@v}هlJk݊}xjUXop\ GٱT4p<*I:qC˺|/T&~/B1UBSp{J(B1ibiCUb;E 㖸Rkqbק_ ¨y.*!%م*CE&4/*doѱ4UCFE&? ݿEC^hR u;LQF6?r=4rZ9 8abȭ!Mn"7FR?v-n1Kl†թyUh϶RVhqٱ)taCª%wS_ׁgޣcTT7{Q9FM_l(D qAvcI6S AOPwo #^7VRY?+G>Ⱦ'Ռ^찪=m%FLN/ u]*+T|e EG[m!*z<;SQ8;xb_f-x凩xE~Df-؟Z)F+laVCbë:0WXSlr]$U&ኯ$aWz} +Rc0O'|UgAGVSp*b 7L|/ߊP[cnَ)Oq͸J45 ~}>ۊEO؋_TP8ź8Up(Gmbijw=FO*<{bmb%7TRAhQqU|&H GOc@ :bO#U a6L` 0 FS~ H<{vT0)BKl$'#%z1Uc<}%u̬`+|[qN*-ƚ+[cª4?w~8UV/,㊩4m~.M1V ~>W{M,wbEqIG1m#cFK6?v(WQCH]W 2 7QR[~\vRY6tʼmO늢CG"նl1=4tk࿵JS,WE<_~yI7eQi S\Pu?O*m>Ƿߊ;?ϦmCQqW]P|*r#OnتO }׈6lUƩ11UBGLUg"ƕeh<;f*0~9\&q\EE~b)UֿG|}p 2o⭕= 6bA*j>cD:\\aSZǁUx=/]k+{nC낒DP(g5~1~(=z\\eEu$[^{H`xR,mz\Shn-+f. nB̻mf1QԚ8CmU]ze J}UN犨ENS+`VԳ}]XU#uɆj@YlUcD˺d~W%fN#:SVQ$lMC>jK~[?#Bgb/%BJ? ULxuh~]~ n]>o9|nRq<Wd{v*\ l$O6qӦr̓]vlUٱWf]vlUٱWg*6*ثb͊6*ثb_҃} ?Ę n>hML0R"%.BvaM*n(dslF(u}3LOiv}~8} cڟqTWqpc>ԉw|s?~ƿ?RiE-?v7?ɅSt? wc$^sN$ׄ QA45`)itс(EbfufD'&V%ن(Dãd\u®բ<5_ IBH?^*fu<1WJ+=*r*18]uk^  {n[A*.uݜWQ4.a+tY#a"jvCX'V(LBrTu]MLjG{Kl(y'݉0hϸ銪+hb1U?*ѵFPu튶qnW9UQL$_)CC:cx :\WQONQpk QXtNcU=0+„U*b:N*1|v8)'C]׸0PCIXЕ8]Z\R堨?F?kld5<}U{k0?#DoPrSTLDT?m(j=qN$xb~]i^\{y뿎6 ?•dc"p* #o ,e lp&ʖ]qM[MW5zoӱ9s^>)CM# '^Cb d*G[gz0Mw&t'%ͦdD 6'Tcw{zaB*悝WB !0lUl,‰tlPkcBM~qUI8'Vv ~>٤8曏Պ9II:!TF+y/LPࡇ(qJx<1CC8Uz$ߡ^8OVIʚ>8|u"$n<0JIPm0]!_mVd1{,n`J[YlRS8[q @kp6[C@;Ʋhh *-uVn,h~XRwLm }D+1J(>ぐ6z Pr50 1I ֻnr (v/qتq+ap<aBѶ;]ٲ5FͅuAA=1 D08B~0*Qר8> ~ 74]SkTP\vIc#jfNQI$8ke=;Z6{Tb{⬂u#q~(1BVA\ ~R$ctŨ${ UH1u=[y|/8p!q@ܓ \/$Jp:qBd$ٿ f"kRз%ʲ   ŷ=~ @kk?!4xQ>ovzm*)A߱WIM B<^8؍_B" ߨb*6=(Enؼ.c R,bJ:)a$_ v8dC Üma :t퍆r tbxyTZN]Q)ĚbM-4c|1e3ةFnYYeM}&F WKUU;+r j6wM]ߕܪ+m$ƷjzZP,NlMce^f&ҬEވ7Z'rxYDġ - y)Dք-hnoFq!:WdeGɪaN㒩x;xVf{J:P7=񾌅avf<=q0 @#i|`c^8w)~w?,hLm5xmXG-E FZ UަN"{xyoKPx]AK0r5%}Q_+TfݥJ-k&COJW!$6q"9_0SvFiGgW,O.Ԧ1ǀ)٪jd{U[ rQ4"OL$jhi]Kq[|'pRXc C,8KLmVAr0UU$5)㦿ҸHF@ޟ&fHm-NHR/rE|Ħ ڔ$\4$+с;-Qվ9GTŤ,( aN2^@Mj~ag[?j~Ґ61+9XbGOH_uQLZ;UqȪo'l4 2 M5Uf,#哶!t\nS$wѼ+፨1h^QEn81SſY-u9G1T>\ \U`Z71|K wqXlUp x]ڿq«y7?kB ed#*)k$,ګjq1 ezU&F[?<(nd3?|1V+@S'q5ƚ>*[+;Mh{& `y)ö1 ?goN*n^9]UA|rd}U)Mv8t)> 0*D)COlmxQ@=/F5Y-t=~UIo#NPЏMoH0H†Ĥl|eH;qUƄS(~hqQTL{xbRAHA*x8q:_…u|#" qUTq&!U>2)^H)_ՊxlwESqኬC#db[`b>QYd|-Tʴ}w\QI ULv\KB}إc)]6E6⫑ĔqU}ק,QUTYhw㘍pcߨ ңþ*H޴9jc72kdUCppy/ $2{JM.-KBRjEU]KS6~Ali2Ӽ̿UCmu/nx]&c N#~)ZT#N*0za7qvŁ *%Hv*˺*~qHeF*%.o_bMz~ gqd ;b%q`ׯ+1Slkp*s¿g8 ,=mŒQFي<CI&8"+sB(ْj-n4oU<[_I?b>|~R0*lq8䞛6(~ႄzqjc d /*Ho]RMfNKlTo1WchWU `MJr?Ͽl2&f=d┙#Fչeρ.m$n2/?N*X^({2W J{ib*Hx#XgFQFXUx2(W6[{⪏n<1MqULUEUGlib^(~ ov- Re: ոwiMH10e8_beHBS4p~#Q߷хmt.0) / F |qBk"8#S>Ԕ}8Udž1B5\\T7M(1*8~Oc\T>/CcqUWcYScNw8q8IAWr|rҜ[hG"Z c=2W 8,MMSak% z,7_ Ux I~UJUmi(تǯlMڍUQde61B4Xn\\͋v8I C$p*3Ğ߿_׊  U|q{}K'*TEҸߧ4d5^~9~EV{ÊKJl:xኮ`s xUŘ 8#3>d{ZTߜg -="o[xEz8=]GL*6~V7F*U-{W!a5 KQS4nCT *M~3O=*ړZC U#+6]T^y?hYhHq u?,FHJupqUH FaSZenđV >cT }-E*hb¥N>dӎ[wO?)4OnXQ\Vc:<W8Tʘgv߸+7j~ibw㷎G_?U mcdq=;R>G1S*UQ " 6=*Ѣ?bPT*+Ckf;rLS*o=3hym8 >ۡǩ61UU-~N)P طHŘT;6QSrl vW.?qUvESCpXS =^>.rcFl O*S/l]*zp}GaBio/#F?t {Uպq U:2W [q1U#+O_| ,E~ 7*`{3ź k/*G\a^W:  65|`*=%q~eI(ZBQ'߈MaUqӁ`B%`:(wP ey%oG#D|FxQjh^34mО\ K/AGAo U|NGpۺWn:]+( #3T"[qgM52 H7=(DPTo|b1]S\Vߪo튩l^7 lv)$aǫNSCfB8ت1H ^Tu2pCmX=F n*9A-C}PS֟r#nqOBex WtGal(e^]Txx>0XqG!=z`{ u_ኡf aNݎ+4aqc[]|2Ri%/"j'XoP^G{8Sd[FV)1Ddٻ"C,TSllR$]C8Mv*~O|Vp*X g4㊫uq- !IF8[G 5]P"'lXN95p~- ,w QkR6(\l3Uкpi١/ymˊvd B~^+w#aY KONPaO).GR#FF8G"ԧ->tk,U?vO2"f21apDׯt21 MeEqj~pF&!i.I7@pzeZЃi=9M7AqiךD+IrGQr"MbMF.L vUK*zPWԵV5*@ : `-HYYe5F OsiX(i!3,tQ_x|*h=GkՕcJx 2ۋQkt/w[!cv%xrTڇ\(l>osE5@y#ߨMґIR;-'NGi'WxW_rlMxzW+:iIMMn3 ,:0UezM/ī@iȐA t$lD9TG!cvky>$'i lqMI&՘l=3xRqexZ&+QN VS9I1q j(X9dUx#g OR݄ߤRa4ń]Հepm֞H58x\sXn>8٭qXcO9#*䑷%Dc\/WP_vbw+NρϵrMVS WTjw7ޜd%ʐUݭ2j p0 +2|-S=ܶzr9'zkh#?5;y Ta2PCqB+% 1cQS岎^B6Ġd x֟;&ָ 9 p(p58,TBE?S55Aٙ|L'`hͬn%?/K>"/L1.\'d颊M{ m >8>JW,֕Q~GSv 9\clDr Xitv1FUEWħDQ]S*qM xG?Y mOUzmc uJ`,W=69!)*;SZUFrq \ -UMC386M"=p\v7,y{;1y+# `F1UhaڽqbD05~;qUQ"غ27~#J@ WS~:]z nŒZl Cb؎1uTj^0>m rP=<桎KJsAЏo3ؐ7PwFXbw6_YO80ӸPb ֟oq،(Lվ (5: d=dž5)(md (57eA?\nyl|FC^>bW助$ _|J7Ul|?Ğ…E8;qUZTmfJ)cQď?1U>%znO=*ڷq|\lRV:bF*PC14]45v8UzWfA A?<{>voa?}*&c$=qU Bw╂q޻8`n|qqu^؛WubD6ϊZInb; PӠtn?uՕIokva^ h8etR=*بIU$nRn1NRU׳~KZVI**cDţcV [Td Y0*#~8Yv3/@ي\V{b!$f1URqEuӣbf7qo*%$⪫&ڛ_ *Kˎ_* z=0ZL@V߸9ov\} cY[ٱURD7S$ozDj3ګ +N[SG/lU&r*Rxcbh3Uh=UDq%cVN=SVxU /VKlPᵞȼꧧ߂_Q޲㣯_evVRMZ{MMGT/2t1Bo AH%waUNTdx+GO\##x_*U7ÁJ ?(TNs,oP׾_MG\RH؝<wob1Cjn 1'ޝ⪫(SM5WO L(?ݝlU}iw"#|RdhqU5E =^[t$6,M*cb~FHԚJ8URP{)(*[F;fR|?8^TjAA#FLPfH6ލ6x1:*ЊlrBH=*ߪ~̢ƚv:UM=A`̀-~هt_W"'?ۡĉD}H`JzN"_Fc8n<1T[ivaxMF…7\AhrLU^)_IY1@}N*e~(]鞪vhbO=>+x%NKaOa|]=T#GCuSdWe<69[\iĿThE#%uS]i8t9$#mZ" B1d鎎_"9pR E| BkMcTW<$UFQqU=W$,;V`U|^'C*+|ǨTm@N>پT^;JKpF8UZ+#m(E cV(:xUk)SS⭚>+z|#c*-*QPUl AKjPK\t](2SJv$d"[=4jP]+TĒEm¨c7GpOcK4QqU1F(\ A\TxLDIICQZc(JGUozbICQTXP]|q*S׷ƞ u8UZW5v;\cCfVa_s{Qq늭d+Tw\NlLWC g1_ SE?*~1}e>,^USۮSGQ튶FǮ$ק_qB]46~w^4@;vS %HiJqU2^Co«P~hpp*ݚ]J>#b>X-eQC?JRxa&}ħ)PtUu%@lk<4J6t1B6)n{b^y&ۯB|,( ?;\UkBS<(J#YV8wCXYb( trV8 F*kZ,>fpkMfŏq d!FTVS_2qPՆ#ʟ tZK-qZ})??AQ+*IwFx`U[6zRAĩ SYE#<R-VO=qUB/Oq*|*3(x1=qW* G#5r҄ڪy$fnQw&bBa J01f\(W(u48N)igb+VV4DlMcp%D|Uow=`~Bvq5Ś f6=\d}j|qT;%=dž? ('`0%Bt_wY9F@ORMyϦȇpP\ OL7_ׅQ1_l 45D=6a&̊.1BOA?!FXng`( 1!@?ª篁]x ۱ qޘI;0銬t-{S(ߺT Fheъv{}Tzz*I1+`nK:W7aZ?bN\Udб'ҿ{>\4 AOq.: U[*.GT=Gq:c~5t8(D vc)?⨘E:R T'⏨4l:Vd PSx-wl$beBD'=9$#u]=lUN[uk p9&;dY%|Hqr,:xbJw=<+_([ŅEz s~xlr71<02cס qUJT,}Pڽ{N=9 )ѻp%-Xkkp)RǾ(F\4ht URN['x8SCFxTS쿇D@#PIyT^v *#רFhab8|־P."IDNbUw]~,$ñOc( 1>T}(OlU=AC lj=*u(hG֟cE~w$?b7 ?dRtjDS0AORH'Ru4vv_pKUGow'|U2!OJ5> SIC} EO$هQ`A6["@5c{,㷎RsTUCNU&5nCWvo\*]m^H L[/z*@m9hucƬ8]VqGwrnyUcj4;eUwJ 7=Ǐcs*vl ~%p~/!ğJXCqqj UGSIǣ,Y"{J=9wl)Z4Gԋ\%tCF {+Ԕ|?H]"9~(E *.)~R_ ~?/ X+q C^8& W{z?qn\2پnt4MЎEjqރ_eHz ^P eEc5SG:(D lV9CZЎhGSb!}5N(~=VØ Gğ mfAC#ឣ-x&(`ᆟH؎PVUz7 kQ$ BL9dz f?$3}GaTL=D;`Ź1 1!lU?u\$•Un#}ߕWv Q$85]/> Fd<=U}Z>*^<~WXݗ4SMDv#0L)+Nc4Cn/XP$QS5mdq\m(mʚc %+QݚLgt܏{UrCwYM ~8aUu/PPӿ*+{x\^(7 :vl\APPq9+F;x1,*MHV;W" W6!zoYI[DEHHZGc\n,VnJEcqImuvr65 ! 7 i&c)dO-(*DZ`۽9g@d?XRPB$a~&p|2cr'fYkO/(m#٥ZC ?MIj ]EHL7"滍58֌iLV"~YIMqPL$t w8xh2ڊ27n>_PAvJ=Q8;eQ?]ĊshHd-ElATCU1XJԟ +Z+*aZ` FŖWju9t-WWxn'9%O|;̌ot5tPKچCUxw˨b 7 g֣ސ##)2:ٌ:[`W۸ ${j؁h-JKՍG;18Mye?Lw?GL6p`bOL9b\p~koe#DOƸIbٕ R!R蠍_>*UU4ӦJىR-$'JB25T; dUMjqk"=< g!i6v 蜲.Ά`uڴhWA&q{ ,־zK P|<qڟ6[9KDz f*?bijyaK_/39BFI*"c R0Y 6rAw biYK+@jr|L@HEIӰ+ 0$#Z jt00 !-TЀ{a@҉2EEGl^3)Cʔ j&kbx3^mNbYĬk޾Qy!C=OQۊ U協uA",`=)ӌ(`^ QSݹ|po~G*a*G/u={qiGc e[pv"zNQ L˧=Uۦqの"?KbJI*T\Qf))pShQCxP _JHx1=+Th$Qx6URu~BN;l!QۿъY(~3C:b%?ip?m58 ;n"~8UYX0Ou4=1UB$\Q*¥>%5^ U|r޻:ҵ4 kUi{c~8kӨFf8(pB:|Ҟ#l1c(nisبJh RI *Vb/ݱJE|:t­R ن1U3T8BWLP\m$Sb~}9ul RАrWq@ƨwc R QF;Zz>:۾!"P{ª#{t~8˱0uСU>ҫ;Lmnפ}U%G;[~p)}oqhJ7kfpp7 @d<5r*#)k&x4O%1]8%.x*/lv8.;qP )A˷)R;tя?vXTqU|_6*o9Lsq኶Dr-@8ǎ%,!(Tb7lH.*Lr8'Mn@1eN>3wt9D4"O -nPaVs z1Ud1 6<3#LU);7l61CxU $6#e{UPȦk`MEUwq*4gb lZ+7{ R[)ٷyhX&}\`ޙ=c?alNL4-AK*kKCxWe 1H6S1;#,-7Mqa1(mK)w#.F*n-e~8F*t@~~8Gs+xxшȥO!5~Mq&U~ w(G U5CCrb6lqU)l+% S\LCQ+ 6 ~-V4nlP8m ~B4}⫽A&g&Q$hP*Iw%vqUWM`kCBO|UiBqZRҡ{eVtTх}`rML)ꭃ&?ΣoKRӦЙ -̝z`U+>}knUps팒7ě{aUݔ\x/-oءYd )ۧb&2gqካ9u8Pp=B}0*֍x{ <**mSKtգ/*'_td7 J|bRZ(⪱]y,[ )0Py.`£ |3 qA]7]a+L*~6@0?~*ƇmJfF:.>cNtT^6{ٺ{`JZn0fOZȎi^,{x'OZKh8M}ޣ n#ZP?MpqJu½Fl71t4?4ažY4:~ش:? UJk Y7b9[p) ׭51T=ޞSveن G~ol B0؁*?4CQUXUk„xX߂(jc>!}|q(_+|,8鎎}6?۶)[$5?ŁYO|qU/3U`kx[WVn1U@RA[$7OPCT;cL5[~E +Hev2G«Oؤ/sFF U4=#*<1Uk{{6;>8ҴW4a=m&0ZhBˊᓦц>bFűUX7;{A.={늨Onn>' P'_pDs`JNBC6 &PtGOp/4L2gc?|,ФrNn?ܕ&v`⑹/C\=H햲\UkBzcxUdD&p%(|(E@J"z?V*Lex֯'ć'~ >6 mn q!:tBfSA ~)^FO~z{{b{_8C|KۨFC.SZzNO/p Qƻ~#V9Z$H=7{Vy.Jqmu#:RP=LlecþC:[3bYEF1U=4O߉[T)z`yjz P^CqVnLMT*`|CM_8ƟJ;"R>A_Y=1*[-_⸪wO΍܉P6#:,{{bE/pÔmb`ĻH?BOpjªKlvqbwS'ՐM*ҸW*JM>PopU[(Fחĸ, i+dEu ͼR[&c'N8p\3 ;J x fTƝF8]mlH{T=0ަg4oW~증8(e쟼`YӄA0%-{0ҧTqUc#m:2m~%nK$ѴGmǎ(UGtᛟ*qǘßfG*% RqU-91!5&*k8vt :b\i튢?hxw$ޫ qo0Cኺ^j8>)MS:Le&bUpUǨ8aopӚQRY4CSz`[sqaK0l/2PD:qUW [CqA䦏*U`UPu䢌:UD1<\>͈(\U'&I^H-QᘹsF† ۶'W (a6w $BMuTR@}ҽr͊- *![{00Q$&$&zfۃb%_C7,R郡(y"#Y3vFz3p,U{`.On}+#9WO8GoOv6Nu{dק„Aaa'#AǾ*N;Ϗx'Ҹ5GP;2)qPD`<֤xb/KoѱGߨFE<μ[s \nOc_MdWc폤aMţD[(n'NՌDCslT.y>B~げZ n(…JSO|4}Ta (튮ǚ}ت[/5`J#q=<;b.ٻ(VV)z ;⪄Pr]?=9>`JOX"~;8 1/Gӹ]Ag%d (4)RQBc[GGl$b*; Nmu'.\RH]bAOnH닼?0ױ̃: ӵ*At},?7O*.% ׮R7%:n,6W4]WBI尦䞔M0Q1Tzj zw)X5ܺr4Q+p-=u@PNdx9DN<&2J/6#É,,^gi5i @/]8)%kbRBD/%RU3kXH;`5+nsl%o'KfJ."ݳNYG3S)b65Ŕqokmޭm>I!W,4jrK%Z /eA= to7l.;`h1̛HZWrF4hצr544dwiQ0-;Y"`ȍS,JA$dwTeFOfb3ƝpHo ,q`YCvap]Q#Bh}\#rXˈmVEK}t,)D͔AC[,|4)Jc$6yE 7utc@<nЗ=;Mi0=vrļ@a|[CIi~95 a1![/ pP'Ӯ-kA&QXe0eȫ^1(dcW8ZU\Ȣ͢Ʒo%仡'GSs?F]X9'by3^uXCF-ygum7ހ) ,Ge'6uwn)"~V%܈ 6>Zjm/cANFIȭLys[#ȡ+-t% VSp:04W1GiOnO%aF}+#h8+˸4# 4'zSNݜak2 utVH_pr4"H6Niu/6DHE4 6 a$'t;;Zinș" [GALw" Tњj`&B`z 5MBg2zҙmaADZtI"orI-#9oud6$v)MxK@3\@80%9tS16"/ԎۣxtٰF/2j eՙv4RKc{N-.t4jw,xwkIr|OOW 9[L ;ajfv`q92p)OO_=P0;LrNr{.t%EE|At$>"TˊicHkxeK+'rSpAz!&N*WF?^$'m);!Ɵyp;[nϫ `"(k+Xǫgv)"v5{xcANxǒ(i}Uq l]=jQ+5rW`+a"3!Rd,ៈi %NIdH0x@ۚ +@Z{L+jvگ%daF$U- -|KTVA#2JN V׉ þUcbh8AnTqj:S߶(c*#Fn 4^b\mXԏaW0'oW:Sێ}8[o"c+ u6 Z`Gh6(jn16C+qE튩އc6lw E*7JVai:#-O{vhh\Vru=ءuLxRQF(QbB"Sb-G>8iO? UKSMp+Ol+q=X>8I\l{*9_uxC ,v;vbuuaN~[6Sx銕7U0|1BmG#f銴:`)aከO\S*1呗*m UTx69X?m;MTZFA-4llS~S#5#¢+WS6>AUaUTSF]!qUXRګToi* OPEGӂnT^a2Yޔu|'Ƕ*swIn1W/6)S)So7Ǒ]Z :Ě:TY)q7M(_oJѐ~r[kmoUn02CO%\xK }*ԯLXņ?F*8ۧlUM㧎9n0튭Y8>Y xU/x|Tr>8c ኪdĹ~1C[ u5lk-(rFሃ$f?QocmO巠Qo$Nn^E%|T?~*seΝlG!DNE!sG=jG>ky-QOp`ÿXvhNU#z`y!]Ǐ|PzDFi|qTLrh|;b^^*?7NKkhSvm)X^8%HoiqT;;:1'Ƕ*mǒw>ثF h|1aS/*?8{*K. Pّmte;|'…pk2_ي:`2M 0|K'Prn0RHW~ Cj͋]*8)En*@:}|<~!㊩3)'vT哯LSf?(D:,{t­])Y),̿ CZЫ߆*N=)Qu>c[#Xr^y,"CB6# [c迁*ՠ70@|$ e*|{!o4WI <QQ@68P3.ݼ12)uի~%7{Uţ7]cWS!h5b.OWNPRpmG;xUŃ}p!8e(zxUa݉~i|KYH*bu;e +J A$Wƨ<1UOc`+/⭉|/xlYX85TJs צ*HzF6MDaPhSw t-H!I;.vƄ MG*QF~.Yt5ĩ$IV?w.7P+|Y!f+bmoq hT|U@CŽ#O'o[Bi ?N2: n#RV?^esFj 1u!9 $]FPF?j68.y튯b8|w>?LUMl+W~=be(훛G})&b5: $ ċ C^33to%ꦣUz](|}ۊMPW#.͹d틤bgc+nk3&́em&; n~*}]\WlVFkDn=`Ȯ#nBKno MGlUkT^/);m {cs]yoC#ż{`9А.RHh&Z 'FI 7I0p1TcvNZP]fGRMBp%M lou_qT<8F#G| bƝ}UFU~P UZ=Scgjh(wSVኬe|k/>Up5O^4ӊ#V-[\cmU-v#S+<$ L%H9p5S?izI;'+k1j:*KQFPn*~^ nP1'Ļ001ኬ ꍶqzUr:r/wTxUhqe\ M CNpqTD3.b>5G*d;:]]Ѷa!+4߭7G|ůl4_-8(iJksܧ__Bd|6#)]ƣ8\UmxKĖLUPEۮ-/7xU8ZQN…_TV1vx7C^:04OlUX27Y=T$v`bG=JF._p߮*Qfb u특~;TGhGhO'N"YDu=0%Mu:(0zoB(}H |0>0w'6 P9 Z L[UXNHĀQ^p%Qp%/Vv?cBU# |< %]xIO( B;0lb{G(wpa4uc'P7U|>x3;?}Lў@C튯u>O5^> 8W{*w­pT;awm L& #xdPtpTRE;ۊPb<#xCTI9|'Ⅶ^l}0:1͊XUX+q_QB8N=4k9 V.{ustukZ?&bһ >A?m~.1OqBSNCqLM{b2CߊTn-.,_:H [g!c%-{GͷTĿydEGV6]p,^=b%z)o?>0ɠ9CTWlRSMhƾ? ԑ7Oh':U ;eb`R$>8(Ae; hUA@m [VF6`[p%sh$Ѓw3Rֽ'.UdP> b-:P6C 8X%Z6~~Xq\,RȦpRT1b8إ,%>%ŭnZɉM|p*u<%]ՇPUQ\U7Tuqi{N:?g‚>P_zS1nUM4aAሲoxe(]Pvn\Ã(Yh4WkRA=F*Ʒ#c*#TXN]IqT 큮-(DE9Oza%婷[7Bܻ=xl~qJs5QZg;Uqj,׿| Akn؛]A4u(*0Ny`@֝\Z=FNbEp#xeqme_lCTrfa>cgyOz]Ĭw`1G[(V.cTOp`a3TR؆hH8*cJIIT \&I=Ob<l10X|8T֘Qݻ&v>HȮ$l銩T PCA4-!TCAƩk{\\[ *iL@]@㆖ZƩ;Oh۸\i j+? -8b ېmQy+bps`J9ƹA 3 x%X֞8Pipb\/=P}CA$[L:b3Bs^v9(2Z [^p}̈́3q,W0b@4AxnBԤk _Tp0ݡPy:Ke#@kO 90vVQQS/di zqA_| vh;`[MV 6F5i JM嬷ĒTGA43U$ ј;LsP̰V n0)VCP7F!W-,%oxD|-z]~W ^ſo "t%R)Pav[0˵H5`ݔSok(QQP푑#p1UkCҝxMCff%xt2D7ݣؒiJ;Y3 w= @zCs%FcNN핬4'77qH"P \Vd"ǣS|me9%ԍ0%촆GJWte?.2y:Ri3B[}un~hK̈xT %CY@ d^ImU=v$N8#+C\-2hWw p̾^k{XԔ` QZ U cbznlapԂuXcŻ!%IVap[F[[WlWGW|]GU~Uhҩ Rv$&"[/P0NkiH@j<+&cmkr8gJWPzlz,m:0^U'=Wa S:~w\ R*=~G%;oY(}JHY8kId ?'"AV52բ3{ȫEܬ/)O"x l"F >ciԑI {[ymX[ѓ+"_F؅:q@!Ɂnoi%m BfqلQaO\sh"XUF 79ie$?d9_$%KE;8cD ڪ`*]L01avU;JCZS C`y‹kG]lE)関"@f$̛a"\ƕ>.옢nW+-`-LRX5TՔ8IZw+ JHNV*09퀕=쮮0rH wN%dV0E$@Hx!\{Mupn5g㒆88K%V! xfTd%)̥X yT2~atqƜ8bG F%M<|=<`i.EB΀Nb3Ǡ\j2> ҵ o2Hd'!eYX3 uG^_1Po29}B|N o5BqO BFT#$j@yh-t|xW"3ĐVahAPwCu8r K_Պ7_1 /P[1XXG!TB0NcaxI)a$+|&PWPbk?( Ċvz#q?~o ѫ˪ءV)hvo׍Y7&e iѼ1t݅T>ޒwSþXxw.}fV\VuUH,Ǯjn:c/qU1Nʟ=;qUTcJ}tV)eU0q3!O/쟣(wCǏxKhG RAQ㊷69c_b0;5U~xi0߁wWR?iNݾ޶D21!ݾw tn#W9dda-Ɇ,;:te5W:Wa(kbS(WcuQo "Fb)}ؠc'ĝTCIp{n2|j{;S>튁wF/=3 *&5F߸銮Wq6]qUE1y!*XTec`K84  ~3GuWK QF!a1T+#wƽ;mnK+E*I~$n0*+) y YJ6 *Z!qBhOnz!0*+v{`I!)ӧO `~%>ت.AM ,u9-<=P Rba#;"{6,l`Gu0% ΘDZ󏠝>5I!n(Gc ^9I;eӸ8R;ԯN*]e-Fqmw;7bbJ >ől~׆Rd#/Z6Ƙ7A;Uy_k(qSOcW(jw+10 UD58DƯI.b4)& %*V抻ӯߌݱUu9G~R~۱0v oO|lHP[N' 1|vox⪡ |3pt\o7ŸP/TøV8Ft?qT5LaX"?eXeݷ%,nx'_Y-Pè=qVEhPS+?N1ߒqUHB*<0, xB29O ?_U\|;k qh9_{#lqa Ò POWYQ%;)r'j:x*TR,ٱU "1Òѫ htqU*wV$o660Kb4Iz 6^مU RSCv7l P?OGpZ'aOc$㊪-OJ[6R>*%TKI*=Dg}7G $T&){0848QH^j:;LPYyFo ꆘUw"va\M^F)vlR'q 6T4elZa_Wu 8Z]Ƕj2_oY6*=ߘ)h]=bw;U;{u 1Vո>f|qVTPY:Uh, Ge)w^(F=gf =F+|Rd~U L]{0.Coqw~P[۾Y PxJ۾b(k:nإU'd۝%W:8ݤcPrڼ[Tui_lѴ]w!$I>Yx)m}9tF CvS G}9?W$M-5oF##PCxƀC\_g>8W@'=0*-^cT5OvZTQZNWlqV޻nq2IUEU<7|OĸkU\0Ÿ0;pNT͹}!تnY 恔U10 m/uUONlov~5x5Ūlҕ>8H$s|F2[@O%'}|o*1jU :#ln@gtbՠ<cfRZSESױ*mQk&+GtWf-:`A.|v#9IFf]vlUٱWf]vlUٱWg*6*ثb͊6*ثbGM4\4='a5WooB;-*Ғ)ژNWc{Yٻbv@CoZ+b؏9n6'*Ns+u;bdmᄋScqኬ$ˡ`.#h.+w`u/X}a$6UOB;䜍:KrBo،,GՓRp3DVGӉ5EEt5:u!&_|R`bjx?^!6"88O%hn>c1TBo|Mӱ+SPn <|]tz/;IuDp۬g[n1Bܠ=O}L~ĝp*٠G'q 0܀SP0%3QIv?cኪFbEmr>;G0۷O"b/ۡS}kAQV)k F00[Kcq~ 8<=%ۏ##TWfPi*7^dhZvq1'lP K'FVn[7 Q⫦yO;FqMnKCOMP}%EQ 'oЏl lhG%#b;(E,W:PzKՋt=G*v.v>8C LUtzGIp%I&wrՅ Lyq|0J+fӘ[ߐѓH‡xBvq;p+qq#^d*h~*񴩪 PC'4$ѹ.{f"zURpc،]:*E/MO{\v$<$؏\mLc[V%s+QU= ?Xo\~J )N6K7ۚ|Esj} 2쎣9Il$7*fn+a<0xb;aB1n7CHJS/Cܯǿ(ptĚ*-.*^Go 4Ev; URJjşG݃Wt#P7>X,WΗsЏKbkyt,{U?j?][$0F(L쮖DWOB;=Mt8mk0'ӓg0Zc[iP,«G$w;PFl q=c8rQʔDZ:3VSTeˬu;[yUD62O=1)dgr:,>Xc:zZR2vb}tcm-G5=^mVF* 'uPBRI']t VH98ms_:o/?c^e"Z !kntK`6m8yyjɯ-%PL;Cm24V &9vD V>l^#}RY.efOvM5QYDnVJ/!j%3٥wVGa.\JH7 ,R PLD@uH`Q9E:DhJ@r; i"rVq[{H^fRB S9]Z_p8YWvHcVBDn,\[q?_l^ͤ@ÇJ(`{< juN9)}3BU%ڻr}0xZ'*{dlGOqNP) 0DpSg(Jzm7UBhh+;&3_m7v#'n%Tæ$itzk\q"[} vkXdIvv^}lTEFxi^`[y+;dm+ۦ1<E" P(턚]#(C!+ Ȯ*=\J,~^Q ,EPJj:l'~_zVW;&խZoҿk+b `Gl=NM6큯C =MĆ׋Ҧ p&Z٩b*2ʦQR]'@(>8EJ8uɡ>lU~^H*:uH5j8e iAPsU{&< T#ΟNTw-yEQQCoZaJL 3`0<8ʊ ژ$pjFYۛr8]^\%0%d)w8b. Ɠ,jRډҸ_U}Z* px[l|p.r Z6"UCfxJ+Nz`I ! g$2L$?, TBg T\\-,ASۨlI_hxʟ ྨꇟDԡ)ⵎA DH=12$38Pp&iڑq$2;l3>׆c @Y\sBٔ$Wiه.%#ȩ*h+S[jzdEIW:RIxЖ x+dP<s8Bǐ*q9l4I"E* Äu WњH= SM-:m`mSA6wWq '8g߭K!ZKM}# 1vPf%W8 U,^R*}dޟ#y)]񂭃,5Y4ւ[z2hNL m1d6.Tt?Ӌhp-^܎@·.BH"j3cknefr+ڵJB1S4,ЁL"&Ĕ * E#P*nrM[[` 1Qˀ53p2n!UU*dc{6F.ٲݫLոԝH["l5C2k+鍴[r ^%&|p %N vbb҃L/ТGh%R(~xr9W]^?]tӷ("_Oh8mu).lᶊӽ&'=ʄot|0uIPfF)1W5.2*:"%.t $D7%M 1ޙl%WI;4݆$$KhE^^3F)!|lnj9(ƫf$ECl؃@QRW|'}G/ nmtsw(\GrW覢B|޸c+d&qSH.5yWv+yaٓ5%i*8r@G \(Q22eY4+D'lwȆ Je<sr߁_"Ѓ-$k9QGt4ʬo֧($wC];!q˧`)O'M'D;X[ld:(1$2%==`":V$&SsMcIEV>-u^&M0񞍧-AA} \ދ{`=X -(D@>8ug XՅcj]0K皭B8IчlU=Axe!(2–9&PjFplw0j@:RK2QXTfգIه p9Usca1QG@;UÒ߸Č Ejc7b;wZg97Va~C۶P%7߷l*ƛucXb,c*(krl@ӕ;WQ5W+Uq܏C`U0W`ta/dw8fܩ7]?eʏ ?+C[?_ L4E,gx쏲wV?8U45wO0J~*lWmGV2+{6 ڱJXwwSȄnuţlJV}i]i}Akv mW%qTǧ'1K r7Ǹ]BEw?]l8WڇOqBΝqC U,EF\5 PۡxvͿDqUz|2ʊ+ $!(ثk'\U^smѼ1T$DnR57;{\URm1T~=:4u+%[rɿA3tQ (Pt;i6݅\}1JP. ;c㊻ 3zuU f}هq-?AC`"F\U m-+W U^)Pտ|z:0هPM{""v;nKƥՈ#GPE:2(qNUڽbA5? xF{PjS0DH1Lq8/ &B?N!SOLP@cF $ï|4@wkUq#[ d%); hYm@JU&8' G0ªh62ZSU?1폨ن(E&#w9_kLƴ aCbC|-bیwJ6UNb cYC ln6> }*tƸW4? bhZ0ƹtUmcf㊭t}\xro1W+ 1V~8czUk(>1lUR.UcV^sc[lPh*8+•N*}?qN4 ?v*?.g㳊aW?SjU#xUQee%đ} [$ /MqNX>jw]Uݑo8[# IӸ8coN9/|J d>i] 6܊ۚ Z5.L/Á9$&v ߐ(FG(?`j٪UsZt-(74{Wz2*ګtEvМU-B*,ʒnb2DhRB˻K:N~G=1UCWd#D~A«جpVټF*(Џ?0`Bwt)[9!¨W牙 82⫂r 90*{(Xq|r (G#\]Z[~(rumdZd8SlU> 1 8*jI,FGP\/0wXQI7+ UOnPPNl'@-GVխ pw?eWJR餭sJ4GL ViZJw??HIwv` ` dªЧR1ol]8.M A_iڊrMGRz9$Ŋy0/,8m4Λuie޷)(N)B"Hw5aG.|,y dd6*ثb͊6*ثb͊?*6*ثb͊6*ثbOs'$ n>h]E 'w܈[a[Ъv=ᎂ^C48٣*y)?Tx6@?MKJJP}*cjW~`rcx utVzdQOh;byL*z/A(Gኵ*%G#B[u?\UNHRe:0׃ +VAٰ<v(U?v(Evkŏ^pP 2G8f<;n(]ܓ|9v?dX$X^=O͊d'ç*NIehhv]Tn{\s-F1VPaF;{U{z q<1U}_ƌݘbRT ='r7\U1׿UkToI^?$߿jyv8zOlOWcb[b0%BX>ud< V 8I;姦|-/xjuaSU? $uqBc:cW %VANتfjY(ۣ`UDw\%l߁P J~#1)*qUx?e8}ƇU3OAGP0ial TlG|(LaepE~ j6,) oBi>U0>/Ii׷|UIir9 ㍭*[4$8FC8:bê;Ua+SVқQ<c%qnH0d<\w%JH)%5 緃ت)eM7ӻ>̘MqnUj# )xVЏlVG#̧bKvK'ŠL`*~/џNQcpE\V7hEh1JUPÛ[ŜJRGx`Ǩo B p*;f#>7̜f6C|,-1Q*I}p&suvPN0C915~_q- TALv䍕v?P.ieuXn|2=ilVS]!)ȱWe 91EiL [Oʠp,Im vW9VkBNHhӋ8ZWX+h pzWQYwji_\h rn&pE K,f}&X(H"6HzPw%C)F/U'$qt2*TklU2HC(ODI[-ogk ت= ڂ]ulHv/ lmcA=Lcv9 EP{`525uaSx8TE4yu.~ 0֞Jpvj#f 咎͞ӕ#fA~&M4`~L%^W]F<#0u#?/ḷFuc2b, e &2j؟6,QFw9.NJ/]b<<cQPa`VǔK+mo'Ve"> Nɕ[P]MwIG R/SN q8JZ/S^M+Sؑq˪n+28r  ڛ&){7ˊ]FyDfiJNG"Ȯv?,hq_d%#m$r#u fDROcmp-)9r=E8ꅳEM䈑E6˟motL?ol[1 OR& * #+;B{{!a`ME6ґx+*4nܸt#sfOrXz2|!ƍ˶ YxLDY%#uBi~v毢hZH\6_,|NCuՂؼ X>*j R#ۨm/Zp;cՖ䮡^&eQP0&?ipKeA<;T^F:q22AՉ2CG47z8u$eq5F[a)Xрlet0B@$b(*1/*Mw s(8Z y~.8[LmNoL<@n "^A8bȝlAL3$Vh}mKmԸá5_]t,!g֝p9<|AJ6ʰO-;$wsGREJ6)NV!-8G,Yd@6s^˜n~pjT5il5m\߭s>؈\ȥd-{i3ޔ])Ƈ2m ݺp!Hpˊ9ۣӷA׮ Yۍ{`CZb"Jn8jO\ (ȍCLI;{S&wI^D(SM.HOP`Ju5zrCv݀NpLh;ycEjPa82$H^ڊza)jm +J0etf`@eQ䀶@Xj$m0+x;y,XmI׎Z؋شwh@dL1eAn ֵ;}E'`.Ʉrzd,%k1򃂧mϾEKurSf"z; TbBan&pOD5 d )Im$w]}"P&J Slo\C C)ͽ?2> wutZ kgi4$u{Ȥ̀&d8ET8/݂^E,\q "LBU-:k7o@Qʦ8G,G݇0y$B9v |r|m2m$52G%6'%[5;:elUke n*?)\= ?W݌uz}r0SF5\N)v=sf~#wꦇDߎ*3"W@Ӟ|$⚴0>Wc^<5hZk~ ;0~“7WS#aq4?EYX|RHQ]~‡ C`Ԟ/1J%v>/ZxVq>X栧U1U Aqo銭WƉِ}'+k/CS,Hj1W hN>URq7…Eq߱W?q>إc|V'١STdUmSч\'|'i-9!丫(qCy)1!fޟǮ*GD7[ مWbD+o Sݞio*-:ox>87z`gv?zb4MǦD>uك!*}{(x)A=)?~YqTךHF?Qk^8[spqTm 0biޭUZ| xAoq\;]j|" ǁQ_ Uߏf@hzn1UU_-g#c\ЃRy![Ȯ b*~(F46W Cn~7x؀1|1UӊEpɱ*%0JK㊡^.|C\$-:{vh;V o+Poت(eaqWVf#1NXPA;juƴ>"Ԏ&U5RkqB%qGx"I(ت j1Y68MG݅($4>H>7qUYiCxu$ϖ["G*reLN8&.Kjy.rSU=n0%F+-v8E8GB攌$R a "}w"TPUR@₄+c(>c7z[fuUY(Ѽ{"?  d I~J^:L QQ9i'?Fت^5_, Vħ>PQ020Юoq W!\ >+KOW* \𑃡Q ]?*I.~i1V3Tqo|G\UDn8Ct4p?xĤHyGxwLc<{bfOٙka8_pb@<_C⪭O(|G|Z;fٱU-u|0J^+ƬjASUXwqUh!+W7+_v# &~?S}쿼:+Ov遃qQdN6$qGXgMq%`EyW5Y9$B6 VXib3k#nGˀqpf%vClUq;iQ|' =@8qVqMqg8UСtsC7VupUD?p%yckz'_tj|C[.~|y?4̟dBzwj񈛸OLlukY. vg&ɸ6*ثb͊6*ثb͊?*6*ثb͊6*ثb_I0|К=0΁2z}9-Cv<ǿVFb}AC UMCQNerF*N{8uzzuPE1U~XCb%9lUbj:wDqB˸e銑_*D@?.\ Q㌑8n:wr0qǿc}(>t@}h8\.?z?g742֗B,'֗B7?,QN)^A*cz`Jai*3DEwKMVPÐ`T3DA߱>^8qK۸FPB*9)at8 $ٰz? n()6#|AbDS GJ0،QHan)Ruɧ==r)]Ϗ Pzl<<1X&Ob)"d?}ap.)lVEc~}9G8[>K; b#Jn#x^ٛs䍺jbIoT<%Oil80`~]CC\~ Lk-?P7윤!=qU ue*h|Un=ӟOG*UHV'Cb @<;{b2S_8=ׯ| SR8V TZREδ]ǏUN?t(Dt8+JױVj1_qUY7Mq n ,E%هl@ ěc2k/PV̌nq0OO Fg…): 6w&Rk!`um+p;DZ(pn;j|, <<0⼨j||rPUC׋;_lCt=X ]h: Ud$£pzHqQ}2K&jJSMڞ@?V(F[NU-Rw'6.Z67`:Ir~Rsu6l/>G$>. P1ђ0k-~qSpΘi#7mkU߯|UipMqNn"AQXAC c㎉o]73qnC8Ak‡=pi'щ:W|~xU_.&ܺ۸UQiК׾͊OQ˖+a&r^5{}`zP^q͉X[~G*( *EIbEFኩ߳QxB$q0% ,t4LUIQH)Sx>8,V. T9|QuW߉z*}} otUmX6 _ }8ޫaB$>. 2ehmJ(o64-T{*Um([$ f*!|KUX|?hu1U|1qVdXWV~}% h9,qixTS iMZcNZM Ne@ s~wi(H`{oLz8csg 7%hGn(k+8n[4uZ0a_,; z%rT'`{w\dRhnP?G/NiX+T7WHQH6@+LjZB;HoLFem-%%?Q]VdT@LI]s:u+ R0j\l0{"$VBKR9p;6f'#?HYlꌚ@F.ג:.̲#&یPG[E3s SNӷӁeAq Pzbi[yIHqNǺGv'vAiu(Y>S',HaKikep@) >,'P}vH73R<@GEh=F9N[g M=Yr鬑OC3E4-<|n' $+e&HUB5D-$56<0&RF%Js=cSr222ɻzwQrw$gcҀe0zd F#e*fvU'[ 9bTl$qrebAܕ;:5a( 瀊` #F;@!EbXsڜO+c %H#l[Y r$אZ3ʂFy4"Dܰ©l\TZFDXKprD ]ǧޙ1!ՊDyRlB-M+&RQa7^NXU-Sʔc21aZ-x㎓( fe24#K$!zh׈ hGfu 3ehtH]@i,!]|FK"+1 j[+AgKbWAR/Ҡdx:E~)-V+7h` AQEA?6"a֕$k&%Sݸ;d☻>V?/m!&?Q^ZavhZ}^Qp n2 f;1a 2YDlWdNKJN ڒjcjPe`{c㴆Y2Ņ:*YI"<^ EO0b#]dJz5ӆ޲)#G\݊[MH ;YmXe;%1hVzO۔Q1‡b&[`^eEuZѭn48):dH/+b1)-#,CH6`d[F]C#@ct;}5]בݩ`Ӷ,;[Մ$ZŊ zT8M>1T(+ʀt8 9'HRFĀM) h-|7mqn!M5lcَy{K"Z%D߶ XyK䏽rLxl`v FHe=}D 3Hc5 7 .J/!(I덳㭛u$+#],WA@njc3h04h 뉋^ ɺdF~Eb ɌTfd`8x_rm2@'>\d0ۮkX0:EHbWn1v>UA!]qep':xcZ:n1U(=v>)S^gc1U@kZ{{әDG>X˽m:#l}嘮\iڦ3׆Bu׏a2v?V>v?bUP QI4늴IAU;)ZW}&+M{0%BH`dc߱PG/Ad{wVʎB`VپYxL* b \dCF?*6&l(UYӁxn銫cIU_qU)ۧ) ?uXVt柎*$?Œe|'| P_~YpI}cjo;`UY6{^bo)TO⭿4qCb8J~/3IJ Cv`iaKQ1LuOlFQIrV(|(T+oZjwN۩CFG/A"W!>8:e2 d_X#„^hCvaAWxn5 V(\?O,7qUm7CS)[Ǹ0w~91lF(uOT? R;@2⭚6(O~ٸpffj1B_cf^q1W;q=G1U|wl|Cǿ݊lq^*ⱐAV(i&*˱:A_QTЁ-P!XM$OlJ~⪴Wua@gocjkxB^qN߁Ċ2 ?P[fNZJ:?*p½qUBb( 1J{okU#Ķ¨h7S7pm"ՇCчW1\iU?&{[:я ;sYu 銫_Gl(LwaP7fSiGeO8O?C5st[]̐0$2|Cutt={bܲPU>إF{UzQ dxPd2>=㋔mǎ; pZkզ&(1UwMLJ݀.4t1Gf x[Oӊʲ 8x aՂc*h㏿l&CQ"d޵P[$(J3ң)o~U%? vWH~/mPy`(9!{Yq ՊPx! v803\PKoQC Ǿ*#dr_ ~&2+; KduΒn68-'j,$ PXb ~UuW.HcoOHaUO-b=ѿ\se$l|?:bLn~?m݁ĎkqQF 1ଛwY&:wy鷿lE8UTOQGbd߿늪<Lq*wq㊭?^؁~ {銶 ?p4{P(D$c䃽G*%ۡ0h}#फ़wت+B|šdb8uv,n»F9 D UE#y+&{,3zޠ=qBeF=(e$«2^=LUz{S\7>F0;V՛~❱3 *ڪ AU1CF플P U^B(xUeOkpWIyõO/n3h5¿$ނh`5[E}2?7up,{zCQ ql{\;lGC1Upz۰MUH|'vqu8_QiJ91JLAV1lD1 GCiz.E6a⮍z+^:|:wVЏjGzNq;Bu}L&x=?´mV}F_\q;[ ȆdQs 6]\0.#ol0(z BM :w@?P eX{w}LOnk|db 4!;TTR8t; U|-Ӹ22 lǸbP˱ڟ(YjǿC4$D7IV|R*lO^br~UaF P^&9C⨇A S &`JAi }Fq+Gzb7Q>`jѕH<¨ea~ U[FAX3?;`Ux>]ǁ(gG7(IuGu)l֒Joliyo|A:qNԢORĎz-㓍ݏE:Wt=UKá -B,RAQ[QS*lJZw >%v/I7ħP=f-_Պ78UFpj1WLԁp>3( p%)4 ISyQPmFTo좿$2nPel>J`WckH=d Ve4)[+KRLnLTW5^pRw^B?JǿEE2&ԣ9^<|ҳ0J2zj2qi"N>Aj V`M6W$Dsg* da[ciE*<Ѯ*ҠSm§cb֣E+ōNLERXXXQ; % !;% 5rEßU½_M{cVؓ!mL|LvVvPA1 SR ڹI1Ln.-B`QzU!`$"jc<"9,F!x+YԠ2ȚXm i*"ck; Y]LjHd[LIqvonddRGLxpg 8)j2X j,]qmEԢ8SӮ hぽ<ۨ퓄lZDlY@Ks$r'y  wS,H؎ݠF~bm6*r9 P̪kaO$#!S/9g /JrJ4iF׎4":1AaPUބ`J1w-KDCЌ 2$ߵrV+Uc9I4PFKxJP@?0OZMK54R| p"m)O,rxzPZխj;Ď+\$@w$P9}$x}Ezb'cV,)LAdn0*ίp+']Zqգ0ҫ*"FG\Pq=FlxVq݊MT)XGуqOn ->%v)P,Wmc^ M A]|;c"{Z>ZJqn )kBT|;*ggi`⨨dwX]PINqU[+&V3żL BK (Kb'/Bm3udxثJǜF7Wz%zt=T58MH"Q۸hZx1z Шƞ=іP-UiUz{>1K^31B)O5_UÜ{08 qCWx`fq[e\Wqa:HS}kӘC)?տ挹[/nvVSo?]k 8l¿<(M|Jhr?CLUR ;Uw}?jCۿ\U*:xb8)[F_uq_bxtFx+U8ݏM*lwTU ]PFUW&OqU6`9j;Q_P19Fj1Jp6B<{U8Sb,9/1Ueu TsS_aVÁt2HVOfURRu2 gC/R$zآO=ݎ,ժZ q;e0OV;Q*xua1U#!O>0;n}'VMo4Ȯǯ7i$^-a?AfKV t?o -:c WaM p~i0(5⌼O}_ݎg8HvUw]UqŪ"5D{pY.^~! o4ZaE&vZAJ;aB(qph|qheR>ue})cp\W6qO~CKb+c4JWn򸏳JW 8w#Df)*7`P"9Ojw IvaCQֿ,Uu{}@GĆUY qHnٱU9ApRm l«*qE3Gby#(}ӈc 'ZVP֌~« 7c'1]'8:rLG xj|qJʕٷP }.+Mg$;H#XlZcJ#l*ڱE mª+F{,v}sDt48H#k+3,քяdY)iY"cx]*dlQ':aB 4 T\Ho~w E;eq B;U$mJ {?߁\jv$צ*ؕY>Ш…^!S(6 F>l?-Lޣ) :P⍸T%MT߼fJ$[]4'cJv+n-u^‡RItm[m{cfqCۮ*VxL8~~k^m 7p)wPYUmHٺ`Um]LXL)SU 0ĭFhqU+& EGNV^.6?F=.0*׷)' +Su1U5rAħ*Ykb\6smUV$^-hx/ =q*w]V"7C鲕Ӈ?h1M%zm;u5zbxh.ۏQNqzW|*8_ m^BۃU]8"c~C}뎆ZY"q˙?izwo={lonتJ~ Ab\y-n뎒0Nwĕ(Vu]҇NثH/=)Vl{UdWǾ8mQt\Pa􌤣|c[zF UD>~jҘ'-FtLlkF?kdf)}~Woaclk& \RNǦ ~8,o~c Щ oc*N:qo oUF-c* S<%BWv;o3FkR` OT &ꧾ%}Rd 0?o {ZlK-{8_{Wz#Ej t=j„I?FTq׸WvnIM*6epw*%PBSBJWǧWh6q*t=G*7lĘ5銶@n6D_ AWmXH(qTqGpc<=F*oPq?izcF WcL nUG 햦bFn8a_-NpVJ!=fvsٿ_K 8Wp>(6h=QZQ] #JO ,|'x\P^'qnP6:)8lz`JbB0X 7CB:]c~>4c9rXq'|}[%,$1(PҩfW2QZ4/Ż`BP(Gr fO8b֝8wd3 ;8 .O  ol~YN$&Z~{4k_S%B>튪CTVC U|K*K/h~Z?!uʕw㊷Ol܆6:z9/F)qq=U\?Ľp)M5 qUulr_m 9/LTaC)Q O0p#cM«vdB$;bTtlG|1K;M1CSר$(tWZܴmz >ت̡t0; 'B pz7om F'Nͅ r8Lg^B(xH|UAINnLux)=T3m BOlyGש,>A "֟G*W~84쑱ªr;R1Q:1Ǩ튢;caP;w0%wiѼ{b~%?#.({隞0f/(ƲM\U#M@-WM6lp!5 # $SOl& Qx Y$*yb60_|0a p%,-仁^_]|Qbe]dx\ a5=)goHFizܓÄx{l7&#ŪV3b^-,k"nG!CC` x„Vg7;`JHJ MSfx8[b6f)S?x\ӭ?* ׯƮۍ|P;c.a1^hۄ{<"4a( 4_ .:d ʠ(UQ1d2ۡw6`I~#"aB>㌆Ib炒F~$3Ʋ}1,C׸BfRplp-:r گAJR9Lz7'冲^oĠwr6Ձ)LZt$csƫ #zjOsF[ua VE{~-eW`B^im]hԏ o,Y 7vO쯐 U֘ _@+|ÑMCL_^P>AS_9" yJZA픖c'+.j@>|=pAMQafC 63_v"TJ۾i7 *c 4v˨d;h +0k=h7^٫)ҭ bR@1/ =.)(ft[-eJ)0yu+k<XRA&̱w ?KuGK/hc }6`G*IC = hՠzZ)#r:ĂQ3E--9ƣD+lnDobyT{a$!rߦ<{!+j2klQ&c D3p@ƙcѝ?&N1 Mt9[Q;:eLiхI=`eti_ ~DR6;c Beު1m!7[~2>H[',{ SR}nK7jw_'eRqzfҚYjG~5ɑ6]t1}u=:9 1&u2 =7?PƓwwJ `I>C2҄P0*Ɂ%{PIcnsByVwxSIcÉUCV#Q_S{Y({y]##RA)"`*b0u #d6 ui$j.<&׷W!w2dJVT[uDPZu㲴Y0UԚiҡ$kGlc)(^©bvU>S IފNVQ*z-2?o?8S$58%2EӵV~=01 rDlqD巙9f&c̓ɎWw&4~ xSF%vhsxjI # ) e^i־#bWG#~߄s"9S8I|2GvDڰ5׭%AA3pG< Ğ z"[5l OOM>"f}JجsYQj<]q6>}9Gd4A팂it]YL1H-+JǘmX1ՁɨD0 )Jaqǽ4lP(AܑAFHW0O Kh=>%[d4U^3FhNB75Fa7ՠdt$Moq-Dr酺=Dq чQ.A냎Ҙx>ӭϕG\y;;W u&Ɗƌ⧉"6V]EyBGՆe0dœN [t(d@U"7Md %mE T#gp8c-y$h6l+$np>3$J.1㇅ʐP(YBJjHmĐf;x,1Q˒%3Cud*MH|K^j+-|AJk77p@E޾ΉWZ8dI-hb7HݽkcV\7DYj^ PH7r*~5Ld7lܜڣ&|@푻[v H"o`kX!mABoJ \M1k,ZE; Dpefu ,Ż`6rdik]?I[c$(Kș[&t|t)O݂$^:PTjGGrU2734n\zx"qkEUڝiBNMl!#>rFMTtin.~$ ofP;bs!XWWoF;6NMks Z)"Fb'm\>g76zqs;+eRTLڜe74._~?%b^^jJ#)A.CWi$Н>:ucm&.! Q@ET6G)',j}=$ xq7R-=J8ݜazEޞ8'HTaG% 8H`Tuj}6EIR+kڼIplVC|sa(Xعa™-ȗlNER76wY?GR; h(,$M"~ #M8J3*ԣDkcqIU<[&[<)g|`ch8Cv71qa.}7ɔ)ZH O eDSFL!SGi;F~&l͆V)Jk Jnv;+HHSO፩B\F(9"o׮[ǻ>3gK Zw#LӤ*Ol )$xquH= U2IϱZ-QĮA%<~6]WcQ^lkHʛLq@(G˸&n`33Wu{"nTrw{ xNPjoɉ^ n8ee?N9MNFR";7(_ *WuW$~LJWW.%V~ˊ⶷TGm[u?N T5Ŧ4dSG_%qjb~1ݍ,[҉:td洐UrLY DDC/Lpjb?0qUC҇RP ت0LS2w߮IaVq(| 0GC;ר8fIzb*68&9P'm8TqT6ĥn2 %O(퀧#1B2p1n0uP_~̛(i'\0@WPDCmƽm %_O>U*v%NoIcU=LU{(qr?qPANA1}8aw^銮Iy8[J7oAx "|*VH5; km_Յ{To,r,4K]DRq{$[SۍzlF|'c bQ!b1"qB)æ*?<\Uq0;* >~.ɓn<{qWlOl+fT'fSrWLaZPaBkE*ƌ?v*^x>TdIЯK>#*)T؞#)R7({ *ˌl8w,xIP8CGo(p|0CC8Kb?H8N~&c7, ^ت3xh*I8یRС䦄w*S>o)mID#b1J瀙lV?wSeezKil:L=9<Clдg $|M/0VU57ݶ'CW'4]v=F$UI;wCr#uS$0G(gSqT1 0eG1UOJ)$;h7ЌUDpOV+;`[7te? )o&VXi q_1+i0ª =t xUL;VC3V .+A1T+5*8S-:}q c?AVP$v# 6ͱPٲ Ÿ:J*Nߦ!$HC:btPĜ??0U0>'+#cSUdK⭗Vه1xwP׸Uz`JqaNVՓwSpPOn&x&CobxsqLԑ|gA_0 AWFIdfA$,CMU2ucu\]&YfUx `ѱyn|UmJ7T; b n*BUnQd ­7\*%Y7ACSehSc})p{}=3saP>Q;!b4*o`UUqzBŌ1qY˦WpiYz>T ?hc5PJqO-$oCPz`|kU8b1SF}:{"-m)*;lw.*Gg h‡^ƘclJ*<14Fm0*-VA>c1J=ϩpTY>͎R6?~*;j~*I?\PTLCAUTQiTo|UÑKrc.pz.eO(oќ$&Wf]vlUٱWf]vlU*6*ثb͊6*ثb_5\4&_LP'JC | IÃ7Rt074h{bDTqO iGC^F?Ut0*$eM>kMpqU'cwǡǯ** wN)XGll{b'bjǡ*0~Rq׾)R~@]e^@ӮS( qB6aX ߾*1zشNUá*R(u;n/|H?݀~AAo vO kSX2j݃a$u1dWoZ>#J!8zBq';0PUo C mK*7 *DXۥ{bt-QlUT?gu%b;*;tnUۆt&@ZQCx>^+08V0ª|qs?فUQ׈G݅(WhkLaCqU=A0lݏ˒5mV# o}1B>ܩnP_;[/Op%&Cd>A5{x8b>㯆BM`{ʛيNNeKq\Ug(}p5::iB:v8_WPJNTVٻUIWA{Oe;1J[_ݞ,7uYmBzPi&f?T„XQ|aJױ1J$GBmN)ypi*'c$-WiШ4XikyO_ԛ+edn VKzʒ3. J~85/MŠ|,4. 41kA882mL/dhFI풳Ͱ'=JD/}@cj]m^- xut1#~4ȫ]MKQЍz t['gH֭GSqjL+OԢ&sA#raAi ).j^<1et~TݹcV!#e2 )`*8J)"R-{q%2ܼxh' h7ve"w\*zAz at5 ?dZ++Wك'olIjĊC&k)\;YVjC9 (I$Qߖ hHem+?'aa;nLm\r#1H{)"$Q*5{j1<̞FlP)u}FE"R~C (~"oP)ޟabwZSJ#T\A\V3S0BX{̪9pRA, žtB6"„(;AZWMuOEX | ѫB 0'llVX`g7l6W {"Cu =x"c>S ӆw ڿdc*()e0׺MuF5Hne3K.u|_hYSn}~QZt Oi<+Kp7\{u nR8#c,LpP$0 Z!=s0݌` NXJO]Tm)cXe+XdWr22͛p>LE1VFKv u[kKx X[9(ߨbMy Y1R[2~9+ >LB6(P;<{5QOR{d[dajYtٶ3yltx1WCW5'M~U/4ބ4۝wSR-i!N:ѡgaE}ԟ}IW 0Hͺ1pFO]KY&č̯@1z =n(éEoD|4}];7T2ټDmzrS:brpKG [O EP~8'bӝ~3\Kc;) b׌-K$~93"ׯ6FʹQP4(ĴtՀ<+i_X*ڇтQ $8WpѴu!L=[inY6爋@h]:9bn=7RIrP{S A(zdRRU-ۓR1QUwsYmg;d8O5S K-)~HX] ެIiJYY5.w''ba8[BI|Dv4ޙ6iv_򹑊D^crB$[V#>9#ܞ5 ;JWpx[mAw*\ұ=^dϢˬMkQP {`6($"5/<˱TWk#T<z3ZZ6R'%+.5HtD.Qvj@MPܨ)ؓFMrh ~fe$ND4SQ6K҃ VL +:7?ja65{7a8`( \VQ2{lOɲcwL],RىUYkb>n$wK],7Քnp9m M?  U=-F{ZkXkU pvbV)e9}hLLL4_JN⠀@rQA-VG1 jS{7iQjn}gͮrޔ}nOp Hnfh V`Lw 7 qb/:ɉ(W6QyQU4팀[ATN` n8[bw#|K3~OL7C+61*㒐\;伥jTc!APaT M;VVfa- 2cfʔz ~e2ەpBID= ĸ⽫%#v$ Gӂ8u8#FxIK_ˑ TPwkVZ+#mBT6Z9nF=1ݏ*zu؜ "*R( ,%'s%c@ a\SF!gl {JM6q[-g$q-N,Z'lizM=AO\iT0erb⒨&kSPCRccJ6U'&2p~fqF RHX_@ƳZBXW=K mj6`L%qA;قAclJc+'qt}]a)ksAMNA2Ȧ3yE[`b]i$Abzbc%G!֛dL9SLViA품m6 nHF*܀4$Ir8qQ I[gPyu~2)Z̐C4 zZI!;ST6`A>S&u{tJX?)1:tDh(S ?KFeQ+ #zWrbA-"I۵1Ӥr8Rd4$) G  ADOzcPס,[F02H4o|s)Cjrt jaf,܊r*D&AqCW1[D* fAِ np| @83?Ƶ;{ ۪l2<8{5hLӳdۏ$!1Ŕy!4mGpFLE u x8١q(:S,[e'=9i0O@sxp}wa-U[(4[sFmpj 6Ru]㘕=46v)ܺ732PvsVaNUGU.EO8?,UEPNGf5Է;Wё:!f2i5%Zl Iz9y7"YPl}F0SLlr 呕|Jw6܀OMB 6e@3+m+P0 kDZ+6?U4mgv9%rO1KS#k2 {`T i& MΗ'/RY>-< ևׄ~ҏ^ ~A# {@~G8Pœg?T@=>Q%*>qVGC?G|UM\r8h\P>j(ی %C|2NQ<;b xǾ>o UAす |.*1B$8aNqCUpσc8)BICČ[f(jThn<1KlR_*}Iub RO\MzaBNq÷p޵V'|{Ǭ`J>aNZy!8#BWOZ{umD% t[ ;b,Sªn|w)m-4(ox0˳ k;{լ,VP)^iݯ8GGMp$ ⩤W1 "|A41V`0'9(O!--ql5_V0㘷)->(GX%?_hcQxc 6XASѕt•z z^ *ڌ69C|LUct0Tw? Rx]~$(PqVs 9.8~Ucۃ *$2$q =P|Lq?qUARv Ҹ4m/cNhت)dW܎V<SbvqghL sBtdٿAjjb)QcPF [<' k +SNȏ銫ZJlj:Mq ̯b;Enxتb>ШƫG *➚**Кo~8q݂"|C}ojDwi)Lxá nKd>I{U2&`1KQI$&O .;Ɠ+k?¹m3U[OC)#?|L*aIA}L.5?)Sd KbBSU%O鋎2 JQğ<[VQ>.I](g_Վ1W*/#֏wĚ?Ev…UmLA H*C_y'\myl F]N;9`5#qVV8_튩<4;ux`J5? Xzn7ߊцO݊e/?U 赼ñi 2 k~76`BZ3@E1B8s~?a0 "q\UU!ČrQGkMjEW|Z%nm~1U܁@}Xa U£YՅ:`U&F<Xze4j>#\re[[n,q}ክr ph} hO|HMbu(& T 1AVߎ3u5vWVjxUex G<F*q` #cCWTO!| 9}\A­#ġJb+%mUk펖ې▣DUWe*wmuHxOF)Kxp=Λ_w+qE"muu$G&0qQ1E&q\~kI-X &U FU\mCIjFŕ2uc)|f( 0Pך*َ)hE,t+ W9e$;]N,p{ZL^+8$>8%d j6>تFWǙ6<{b| LoOWzPC\|1 LjUy u4Q{c*\d|>Ъx+F++ZC!f)Azb\I:{PHNy:\6]\C EE]q<ثb͊6*ثb͊6**6*ثb͊6*ثbo~7i n>h^N"q΀ U\ 2q^i^gOF*}ƿN*?ܿdF JJu\[ 튩l1Qv8ELFV#(s-zt=b~㍑<1U8ʝx⫨)NlUN3qOW|%F8ËtXmiS8ס1Xgh5%]|0%F{T rkRu 5yc=+QOt&7'єə'uĽ >1d$ #؎Jei8amr)ngiEwSp% |Cc#ԠALRHQ# |PN*UhӾdGB:UIq_0ÃwN UPzDh;blw^UN(7A+2q?,q⪍G2lGQc% q1̵(Y|qU@ 1;}ո'잘%ӗĻ0raCj~txLU>>8԰-iJYGKTsnNDS_[Rh[.~1ч/x AF\EDjڝFhR:wP// Fu*FQSr_?UݵC j~uVj/v8)/8xxbXhӗc Ttш7\NxDQQF* OG ;u5`،O]O *׸PО8FHAf: . pq$v;c*:T=(~-ǎ(yZ9h(c'q)cFp*Ϧ0OCߙ/, &c1oVK@ޮOvG_LimKꈃƽAfo8M͐/ۋQbb~䤣rul(M$B z6:xE=*U_߶"Ԭ㐡ӊ=.8GSx췇cqH`BuBp{ ˦X榄nN_ }=;*) ~-!šeZ,W .I)iB{ 1 ҹDrhWz14Wn! điLj$bB)Z}%SPcF9bHوރzPVW?|`K_U ?Qҧ ڼLH76 K|8d{Ap(HMv;*4B;aQӄh?>8Ei i#!Cԑ"VIU>X[ǖ.M>T=Hk1z'FzEB啳(U`T5oFzĴ@G`lkn$ N1LQCNAko%ڽ"ނ@ %[y X: |8S&fxR/Oy7 #5_D&M/yxnqa c[usxau8J|B;8GŘ2)cXkزHz֟wl;Auՠ3iZ;o^+0@>#,’+[KiMx.GNIӄ-(z0-iͪ\P?욏cofF{#'$hM~pz'Z>xi2!WɭZ$4m#&#l#sh$-ڀ}8]QC6`Wm1scźW\CAJHwm#apl|0sISᅐ䮂s@ -X:a wmqS\.PXV=q[uI 0+^PC $dOlل[E&cN'&:sȲHэXݸK3K)e^(v 1홮Zۍ8P@Z eN֯w/qa[^07A*9kkWw8`O>G-~Tys8L?E}r"f ҫ\1[ z2WӥvӄwNnW}~vl/`0κ ڵ(+jU:dr-iՄ#4=rf6jAa5ǭ]KU^j$Ā:L6a 4E|q$d(n?cѐv+.$? ,81֭,6n~jᮬָ|Z[ޤa*\4Z`w.DӮE&Ph*ҫY.&6 I<$2W`_;d(O%h<= wÎw0Ԑ>1ڇ*2HrhqKɄV$rS e4`>GT)w7% |?NlxiUxP@ xa"zwRW+B]Gf0Rz,MO[@ "BϚ _ƟXē<^| yL_W:N١Ga2I'SāpWa|3Gxe7-^8KiqHjJ%{.f=ƜZ%FMfUcP+f yv!HO*J"݆s4/AL)zfา1O8nf|lZkFѼ`# %mr݃)u6XᏉvM M1iKHӑ*~U#'s4sVI<}>+(c@OcE(%FBYؓ aΈD;׶!ݻ <66߉ma 9IDWVR{};3PH;t|Xom"iZ$ 8 rozfTzj- @= ud֬ gce s@ޞ3g0nn\ H<Ϟc13z`kkNgi7F˖WFC}PĚS{qFA;vb(.lVm%>z!kC% n(:S%EٴSr@WOAO$Q/R;NO[9E>mH؉%QQ_l=BldZuaƵ ?ə[lOF/ Sj +ķr0;[_>z&1(Q_l`f#i-+W6 -(~X1I[1 :;fˆz5M(W+veY4vbU$4+“k-P^-ZF~Q bzż?7Ӡ@zݼ$e`e8߮(5Qj7ֲQPPw'%ğ#U#O;10[&U#榃 "խh#k>;FsQhIĚ[Td=n05&@wdM6DS9Y*pI @6#3y o HXq5$vsJ&##t.}u>\)n$M>Y8s!e:ޢ'ö ]^ &,om&F >rzn+T،wit9+Ql&R-O$c^d =7p/%›;km~x7Ɇľ)4 Oa5a½6O 7XQNl{2|aB7FیU%+Ua&9j0%IEqPUhMSoTGÐlƇUwcٶ튩bA<;UsF?ۊPhA'$+*E9mo Bjኣce;)@o>'cF7`zU $tn5O|UZSڍ=Xbj_qJ[0+=qUƴ:c߿㊭>v&GZTWScX<.QĎٌhPUWe? 9m8ӡ8LU^;6aǰb<^\S:銵$A6X5EB]/qMz{z/˧S-z:+M[4Ax*O,J&kF>0|U hnUq|U"Y 1Y`ƫS' W2fX~8 0#ϷlUooe3OQF#u ᷱĞ;LR2~bOQ~RǮ* Ep>U8NXUc& x.Uj0DwKr68@72voI#Vjf#K늫(?iN!-#Ucg$_K'‡KmV*dwہ\WfGp{╯nir 6^6vHEb<%Ŭ0؏FdxAv̿j͈\4gqŊlS PGLLPO e:`U_> ?gߍtWGpcZ(w?.xC}%e 8J1ݒöQC~8bUoAſ m\W[o=\XW|\(!1}>=tw_?".)M*O8\w[W }4\t869u >P*~Hz0*˷l'<[b3$"9Ǘ }8QlH 5Ou{!lI_]VdcP[_q&ޝmbPv;U'ˣw><[`)T**)"x\Ry^ Ol 6z(\–\}2̻8?(G*5F~OхW3#;U̡a aṮ]׾-7^?ٖaF(qWzF`WaC1 )](m7|aW,:<3rd[][|`n|UnF]i |Kc^OMmg#c'Uy$cG:cT],WeZnb+/^G ʤ0^^W\Q][ 1ߨ~x0&ċ M*+2bCadg(s )*;8ƭGA&.xQT8:u;~ NI>Ҋ+7on}TcŰ4Eh)æ(U ?e8kj}Gp?{B PqB).?qʎWF}"YW c!ı=)PD@z`+oF?lRz!0֠mEƑizx 8PIid>U]g17AU<dž*6\Q| Wr<kq1KTVrHxbOq!SaO*10|{bx|86X5۩Ĥ[zFY+'ب>s0MGT^%;C1юb]?+ !]:b}o|"N7.e0$MUM}휫&Wf]vlUٱWf]vlU*6*ثb͊6*ثbwLҕIL4*s7obG9 RS O? ҵnǎ9ZķNq/?x44?)TvĤPUHݣvbJ 8h: PiQҞ8ſ*7ǎ)[,۶(h|Hw dlqY Um [\k(mw•-*'>.kW6Î% 437\ gmh0qC#~TՁVJG,~t2OCN"N ^&Iv튯H7{(=*鏆SfqJx{b \ TsVZ\+]?/-(GnG#Z] ,(F)PUp=|)31#(cmQ\E뷏ʚ.CԌ­-&?Pʵ15dGnN6ٺRԚ. s'Sclr^հ6=*muQ[pz܆0Mc0c@78Us-zu=*hGL BL[~~p%w{^iѻU5zXMQG| lNtNbM]0Cğb5Cካe :(w„} hS7qa'\⽱U 'E:Z9+t J>88hT ws^-튴}$~Ӎ'tUv*^T{cb^X C| ;uĤMiU0CF퉺_W5;ez}w[>nC[V*j>&0 v8x]w3DlU ߠnB:U$irXrV09Rz~82OCBO݅6XaBmkz(Ne*j>„``‡uV abddh[hOVAl.- 7=Iț1UJvO:6$Ȭ*<1UnLvlE86*ٹ95j1ݎ(_lQ(jMYQb5)KL?)6@QdIአw1)^Ǩ=X䓩Q_׈짯ӁS,;R2P'{gF0{ ?vI JrTTi[gG5;{W"J&Ԧ8N??b 8!]W`v)]ac<7wn}|Hp>1:b%PFT.Ul„ %MWQ.)+REK:.7?a|nT&Ak\RX*$(pD6Z„Z8{EMcPq/k)P+K0->U!nk۾-_M2*H[ Ux0(U=$taPn_iS۩~]AE#N!fRƔÛ 8%76D%WjaO6:T;RNrNEQ(qhg&~ K%:О.;T4M9)!h~,Rj s3qWG26؏!TT)mܡEw{KR>$f,HAe$Q$l+K1@V*KJjHlX,dbt@"I_$1Sb)bmq cĎ{D o; ڒ}0TH朸2 U{I):m YRWaE՘(jOtXβ}<E@MZa&Ujmǵ0Z.H4Rxl('Db?) ߓ)ʉޑ#hE+z^`7>" }hآ1$S E"mdx{IZbH)OhN Xm.[3!.Z7fCq#Er(~%=O2rgit0QKљ:ҿF#vG{@5J2;e % /q ]o.ۙt,d];%RO =V%*UkSm,7V*cjnhv(աv .DhW2n(߸#M.yF7!|rxE-Q*c_ۏT##dA*}fu߆:\BpYXX CRO>_^6Uea,#2Rڭ1 wFb~/nXPcHRm>\rPh1$F$Jj#! ˞*ݓ$ލ<(4((X0MLPUG_Awcذ~Ȯ6Vl0#uZ]ηy l 8ƅVIH5iQڣ,ZafZcipf+WY=!E@>?<"` yGrQaJ՞Ϫ9+G%g*ch&u&n儑ZvSEwߦ)g+oz£6\H+^Y S^FZ6;y`WL[oJ1+ovƧ xBՙy-/Mmc*'MseHj=d.!pbq@ udl2 VsP(jkU0i~92a Q;E2X^_iչ?ӒDQ\7LK yN H[Ad[)R(mudr S$Qv5Q_אdsm&^_mbZ3qޞ%ykXb<%O VݭrˤvG:δۈZc)#c~ymG%QMEk-pN_ b1l­ K9%7_ 1+VF YYK/?Mӑ݉h*}'mۿё!@ Ybphk.cšY$҄nOT߳&p!\tdd+[26ƾ#.lb9L |ULn5`'#"i3ĭ_ f9ŜM+Zx}!.7? )r@\q&exb90o,'f΍S!ko=dَ8"OL=9jד[; WGxRWr`L_ICy>`[/x$, z_ 5B]3kA&yvo*B0#.^l`3r.PB@NR),w BzةAqkY'GSM5m۶f$@R97QxH@13ZC( xWF˺bGdJ)ZIin5rOB`ƹ :>X `&EN8)l qhYq/Vx+$v&8mQ#pHMya~} *L=rmKD}@ "nB7IGoJpqZe%;$,ƀbjyfDTb=%fڵQjFq 6ӟRNA*+#+a=^E'XV1u E*0b> w=ɧ\}i^"6#".C@*hW3ؤ(y-*q鈽"QA<+xtxI+T{mi7i3)JSi[S:u*߮&qS b8x`.#VbTWnEG^{m"D#6m<"R9 /fR#*8|NM(+4N6e4ڹ]i+̪=2ȖQ彋I6*(~xD#. +BA8 M[tTdD)Q)n: u>V~>33 yrnh/\w'*MiVc0F%'V,ÿJIt/Ev9` 1&z\cixqf`,h{#\+׉=J Z" OmEɩMBX Ģl] (|pL1 =rWlByHC*MUE~dzIhUc@Xv1Fp%H?40$v>B2;J>㉆8^TN_aCxhd{{MFhqU.G+JAC_ޢإCdRGf*GVS^Ǧ9\SZ2J~K<ď*$̣5jjTj1d5 ]𸠡7]*zS Y qT@*7mqqJ͔sT!{ zS? >Kڟ^_zsjn:aZFi7C{00#1]8PU yFh|1J'޸?~, ݙW⭤*Wf UU+M%qU+~c/(wzDZ@+ {oثF2~9dS߫ZlkvoqBHNHn7?>]UE?xW1ddqU\>z`p Rb(IʐNcĮH`6PnW9W;UvC]e }⨅W~jU@4ێc=4 ~Ilۦ*ͺ-G8T nlOS{+HyGkW[͊)yk?hPA;-*OۀF 8Ƕ*ֵ+`P̔+ǾiYYp*)Fœw^TeJ-ٻk@br>D|=%_lƒ銶 ]nؙVW{7)ñ1U9-}8V]Q5Z\ Z-I UB7U x8_銨$CE7ڮ^ioNC(WcX~0qF\ƻ Ykኩ'*;|S+߿cNX~kpR pbwlR Zu^|UHZ1\74e=Wp{xP G؎h9&TY?e Lbi\gvYEj(ن/##mCUnæk*>eN+ƸAbB^v}a.Di\(M0IUqJ^pua)z(1~ C2{fsTlN lqa ߸juCe}8=4>-جm_zX|??x`e? WJPѺfdX[g{xudn#1%>ʿX>t%" rA-fF*n? nLA4]qFA2ji(7%2cVVőX(hL(Mn#>=P*7W`\VxeC8PvC(V/Ul:mTԅ麞٨$;0\ Ov#G(T lan:uWVpL3 'SC>|O_bҎŢI֍>́TV"տLj(*'Zo9­ Ѻd(y'^*[z8䗙 *8\T|KЊdžY  ZQj~aOd&nj];0u+u =F-]%©M:{`3ž (Gh Q-nAA_.~=׸ OIY܅F>Rb{![^p*1+^/LR }:[>8Iq?h 9tʆ_N>U%IaB2,S-bT,Mhw0+#Q$,|mNbRc<J=)~&x%~ t#cPx_z"qmcՄч|RUL7JL/V-o+Eoo|q&~-«I|r˂+wV*wy.XcȲBC@WruqUxq1UZ uȡHw팑h(Gjt]0}?S*|KMt 4nQJP[0G%Ǵ6Jōi_잣 K7>qK?!&gO8:UֽAÈ.Rx>ҎR;y4 0ݙRCmL(L,EMkLfp0V1pDvlUEWʒ1Ka^']W =;n1O5mTD>=VT|1U<{E<{xn*}ڝSǷ!߷*H+nr[P6=„RJOKvap*ͨ;ң+; Ǐ'44犫E6[m r{*uHG|)j71a\(uTbNnvV_Yɣ?=Φ)F@PL@BU'ӮrBM0Ukl՟B6$wBFR-3h$oH,jI>y/VV!^Ȓ D `]r楖Hz!A -k[3}+3| 6#ĒiRG>}o$W'(iU xSFӀVѮ"HI\R 6&[%Jj}kQؚ2qI' ܢj|K{A2_ΏzVhه  cf%!R)]1>Zy-Bd#[zjRIi=̲,5-@8,`qf7faTx1޵egDܗe? uEDZ`r݀G!JT5I#??,Fv|zW-C>]|%@v'Jz h#~96# WOu%{ **-7 N`;+k)qQ1r+e!&VԭѩBp2@8ݎꗣNKt/@| cK ea),:ijT*;vmJQ.}fȘħZ~sEě[=[KpF8ķ iy`OH~/d%+$4 v†GL\D 7K$ﺵ9P".+hՂXѕS@_59#* 58vkCKlZ)JcdV0Rq8w4h%Hr Y2_|>ZH$d)j,~[ڤR6 G%|)8M|@Oq; PP lOcHQ@ǾLroڙ1ɕ;YY-H&jpLؙB @@!NW67`Jnxf%k RDKPG|El-Ҍ7pc~%YLwN@/*DBHZ?5xжN_|vjL rSgQӔO݃D0zMh**>/ѡ묠QC+ٙDYufj)W4b ? C0cir_mė%HO2=M%b3hϣSĵxd$hwUjMYqR]2H,p]|tA6q#{SFM74 v-xWm&H1QAedjS#3)^dX!76О$t]TfVV "f4Q)s*aF N-IfP^\_6ʶ8a{v?$M%m41ۈ68N#ʂ~9Z-i_l<2$Ui zӶ'5]eE:S%qw $Uuʷ,FG^ҍqndRu,mY1QGeI֒h(xA^l l7n1qnePZF\)p>ЗP WdqEpj\k㕙w;$Kȡ)\ؘ7cC3 8~ŌU#n@,@VӦm h?cb|=4$@Id JooR.'Wa RqL&V&i\dApuv3qycoV I۲ ya\R-IA/ zw{ӳ*Jtu"BYp&aJH@O卋RCEGZms^`dw757w%:wz3 !\&үW~g)LWD4\ ~%ٶ1ۏ&3M%8=k<y)8MC2dݺ&{E!n_&$L> W`(  v-sfL vfL]S5۰)fW95Sg%-D5F-▗ZF!B}tY) sB t4\Ee.){WRҰj6'j`?p4$^%F`vcOle8nsAOn5HXT ~YY\/ x}y | ~8a>->v,A>R-Sjv[  e$ԑ~Q^Z݄۴nG/ck\AWSE )C ,lC$m`[A,x1;ĚW[T:+pB02I-1oP ʿ v?2> >0ަSz?[b!EO;SjSaSNc1U~G5zU G*ɭ$ټ;v|0*ҤokBMXUr\jA4cnBHnvoDbüG~8[b7O b (~CM(V-p]5ꭾ M5 @Ve2.`oo|?O ;Ƹ.7zf%8V[N`O0%5F7kX` )Av„?=Q^/W+oȤ*@U>78Ylñ$qS %!$ϡPYUh%<g8Թ 5f8b%Id5K{FB;IjlU|wl> lCЏ *;bbLbBq^2u«8R:bn0^%I܊;Pr[j| F?p*EceVg7_aUQ%O %;)dv8JϺvM8[+8")T,֡ v2[Hg~C_\;~a}ՔxtŠM,wGn|)g"D͍,PWrҍm ,5ޝq+}=A늩Qzt8 \;|*/|u3GQ*6W+{W)؞ݎ7ԦqEU5&h^n12G)&˱U$'ǽIch^,hobR/S${qK=v8#&G(T(~_[ǽj1q CWӯ*)_*2x*+qUt*%?Ʒ+^!}\5>0+~Qὒ!EF(mZ` |?dPKa>J y7vlUٱWf]vlUٱWf]*6*ثb͊6*ثbG딽ėm ~>T~$o! lPwVʹ6%># 1L8JGl @ ҄81 ׯqV9v pv#C4m[oaCP/A\P4}U,At8Q"\UrxlU; =0H"QCϊrw1UzwoZ q-?U}D-qtqUߨ=F*-d`NǮ(s,!|1JhQG^CQnהn(؏(-Bn*?mkH6N.mx_췏 Zѵcz #uFQk& oMiR: дFx;RilV5*G~s]χ*p<wsӨyx-ӶVӵp)Y0P0%XKZ9?Ο|r l(MeIr؎LMG=Fm_ w޸*nib0Ew=*5;H%ن(tn'*JuƺmQ*^S ?w!R/HM3I&f*qӪ :0% 4mrO{c^ܦ[K=1&ZKUyh!1URQ:)<78ԉ^#Es5aJ?k9&)˯1+M* ٺbfzw^(G˾*ke,娦|VЊ=:I$gCNK~8>*qU|]%~(ZQ5bWPlUCu|U\*~!n/qUivѢ51UdH)Ǹz~Pz־9`q@qqTH8T6S:thݎT%'R߸Ë[ON]`dYIdh7^끮YW:4&pb'`/ 4% 1F>}qV~I&(@Un8*)Cm{bib+4UNoՈ1|Ub:|q4ső I+ N ,s>إSӒѣj{qB!&W?kuثO.|p3v)m0.v~/sG<4>?+ hF L\7rΘPCap^S1Axتuٶ=xڂ*;U#AƌIO>xs_~X#UMHN$qFwl 0EA̍ Tt[VBEr$Tlc;늷* :l9\CH{xxerjd4vZv}ڣU}4 zsfYmi*T܏ՅLeEGc6qC_7Hז60k aզP!Ja鵶 pG{<ҘpHǹe݆] 4=rLvr"0v"MJ~ۮ nD2 e5?d=V<zJ,.Z(OL`)č؇m"Z2z@a>dZ=\E@4FVRL #V,M? Sa o\FҊ YL# w w44#j|7X%ƤmTE"/7qƠ*`fj{lUQH DmQ(Mh0gn⸌pN2DCkqJf_ O2vEFP#&L{mI&5.Eh~Y Tx`zlHA'Oƴ,RǛ$*f8Ro2L֦)"6pð?p\'ѿ&OsT@J4+}S[[!jj\uU2Eɝ75F,G]q2"I$Z16~܎opuV@؞ Ml&ڑW67OqH5dlw(wM;0)$щ+zz ĭ﬚ q>% B\z5UT# 8V 丩)l7)J6ɦ@)|r}ā*i,-~~7wCc0P %eeo➩SnG|=֞ʳtx۱ʦ;J7338%6!7.~V5';lA@ ʚI0.™ [\uXEb!!d~Kˡ0Jdn+-ul&`9piH2[Y, (㧎[pXqN,Q^0*ӗ*v|50[0t3 U ~]&4A`}d4lE(G| `ښn2H eͳ6]Tth$7x4"qD. =gg "[BXq[27Hn#tmcƃ5+Beiք>2%|D&"UK2\Z@dcKm<@;ڹV@IcZ`kĆ(e6?dܦ&+^Fd+)ArXG $à6Cs"BË7?:*{bPm<~3}ѓ3v YpG{c[t/({&ʶRiG77.el1A Gor) q 7ݱ6Ojἷ+E"Q6,Z=2*n9+MN],VnJ%{2|2qRWų u"GYh@k4<ʝQـ]9t+շd h4\`+dHOC"P֛inޥfiTp>dXg.Mng"Xq {A\ؒ眛l mW&L"%mS|ךlm~0b"9j[ИVCg ]9DDp ydXBqm04 c*A6k0d6ejZ|O3Aiy V#>9=>*kH,k&AczRH$2Qnb%j2,8~id3V @ Hں{@W7j60"-ֽ2W0GnD*0OQ~+7x9b8\+]tݖ3VޅG!NTZdÓ"  4ZBNF'pOs nv)eM"9F ӰT҈ w'|ZEq}GQE[OJlc0U JOI_q"2hV\vI-TI&EYFr6߶,S$kZLF٢@fLt6e& n{GH=DPdȶ@W1,W#=0HYِ L7 -9F(LST46[Ԓj@IM]^TAh~j ;(YY/(u='fN'?Nԅ{ۺ=ܨa]I;Z5ˢ?Pwm3vюhBڥ% RnNIkulTUk^Q[_P1;db7Nή9P\8ԓBOiK-POo @.J#Wlt*v6Fީ߂'alfى<2\T'b**< 923}ekt,>**.V ϫ ta& IRvݔ!#l8guq {0DžMUwtRY0*aNiT N\mcFG{DP wld)+]{Wпh`({ђdbV_qCQ )wSTxT.Ҏ> w8);|:L[ OS²nU<\mቚ*_ { KOшHx JU3z}\£f1Kf4}`6qU2+Rij)YT2͸suqJZSY ksoX_Oq4OQ ꍳ`r?>#O|Qv?cWUԏf0~VO!_XxlE~{`TD2hsAr|*mP`՚͊Z~$($?gQ?QϏG n|1U7#VT^[„T7O`N}Q&B~4٩$H$;hMbX}*0\`=0%BK}EG YQI>(V>!HLUo?RG?zUJh̵_F*)4C*,<6{qUt;:+HqBVva1#;t?p_1"zjqUe6?$Z|@qKR[TV @w\~щ>%T/-iV\w1J |XeIuĊW*uRzu8qHʭlU̿d'?T|&Ulj1U&zpiFu xA>r ~!Oq8^ ǒuxm9X6kZee=.JmJۇߧń l}Jj7 ]l e J‡Wzdn`o1ŀ<R.).O|V잟F՗vXz\43[JL(LpǸGbLۃC e ZhU( Yt^Ӧ]nͷ P7UM=OnG7 w? ]OKx.*r:(\;l|5«zW∟bv0)R6Q!]\UM[i#$E^3U~9F6MqzbhP#_ѓ4j/Iq 'i]?9MLsb͊6*ثb͊6*ث*6*ثb͊6*ثb?Tz\5 EzW'v"ނ6J׆}ࡷORRVqژzw̸ܧ%۵c\EqcV^'c2(Veb_NM*ST%%h~sqBWUp;jªaP?}Ti~!C~Rm۾)JNLuk1V4mC SQ@cΝqhw*ҭEGQ1n5zb u1x޿ }tw튶Wc!CDzbN C>X yd`1GO[m2M:PWWVk:zdRD<]74rC|(FpdRІ\ R*({aK p$*Gc4P:pdR>,tO/NSu.Ŀdl"tª"kGC)dj44*)A8! o^Ux\w1=zUNhbUqJfS@MF~. 6>%w)'h[<|1UB3-ǁQPܹPã`+NJ*(!e}gpF&)Wc`屡l50UDNPAzB*1Jz82g7Úl&߱:`JI_`icVxaB* yXѿd8zvoካF62.'hZ5r_FzJHP;|D4#V RU%{a 0J:7ᵦgH. h 3_ ۡ8X-=ccتצ;1-M݊*0*lr銵a\UR9 T|*QkT Zn35$Nj7\b9SUΡ4jR W]q=շ[)v?m6 cb@y.*Z8q|1VJP\(qhH(wTdRHu=uk{DrnC)%ݓDh6#7E F+H?Q #=FH$rLShXQCnHZhOߋإHw\J6en'cC P~PSENSBO\Ut2T-ֻU!R7bDrx)K`W1Yt?/x8B8Dv ٷVeWOI0:e?FC<0x?5P01Zqԥ>1Z•0Dt|xG߅VrxLIӱn*O$HUEivoo*v=51\seYf\<`[EMmU)ŕo#}fŽ+_/kI!"Hpçӊ)[L֖r)=|W5Ta(*BVj`EoI/:_`Ti9GN ko\P_,E]vO|RiݾX=>'cR_蔨SQ ި؛=Sî* v'.9c^J8mCQتmGlۅtU.y7 >ߏ0_Gx A0T3+/KZ3:m(;IKx8zxjB)~t"JIƗ Zo8V I)zu8?Ta>XsP*NoaEPFJ%pPnx.O#0; eL$VĢ 6HN,6q D5$d$dRhb1=N Хi YcS&<.a[ST̤-@1=%2*4gE>rqBc: %k{tt~> CR\o|A2O|ż;W[_߅ Fh2(hDcQ6wYXQmq[̋gEcx敆R7kX m'Gƿxk[QY&5琏7 Y'fZ7fE6;SHEuFS|naslÇ$"iG S!Wzq⍔Eƭ58rFhǡ9/ѵ5T0~}5%S{?[m4z~>&6Z1Ge;АQѕlc5[6 }uF'q'Rr5?ִ='ٔu>I] 5#{i'Q)\J2 |\ y 7 ${WaҙTӚoezSUX1mQDіȐ{???jU&ެ¢t5n,0Omp9QC/ ه/]qZ!\9\ o !w|JAPdzh4ᖆ]&.EƊJ{rDZԂ$.E@Lun-uf4 Nbv F CqghnqJG} (rv1=SMk빧X7 e\Gc3HŔ Zdx%FIL:N^\ʎ#$9;o[kxeZVdABFzчbz7"YeUn?"r?wb8㒷'2Eumɭ1mC%7i@R-gg s+ɤ^qO#u ILtwe= `NI:dUPV#Ĵci҇ {2#r :û9T.x !ئ a{6h@Mk\$k$m/)H Ic#B 5Z m\ H,j<.WGsMZmPYL]/%Ƀa;,Yҭѐ$3& 5-|S!^K>@)QSr7eaUF[y>8' /}A <^$V4cn٤O+E'8[oa܌W8o1tTGHVIc-iV92jN]+̱Ϋ W;kZfU@]w!Dc[C15>8R;S(J8W4JIc |sqn򕉔! R*U=ON9]D %\ӾN[6Km w;ej6UD*K16R3Z,=Uvŝ@I*zm#f\É*~lY@bi]B+XnX輻dkp`eEʖCi`{cn7Wlo.P{X7V`UD (qGrO٠&3rr%-oJ 5&\+^Kx-Spv)˱{IaWjz_,cI|#rea2 9\pzU)_@"k .YL6ޞ#JX/iZ|}>!- ֑' ؝|מgc~ѡ&F zNk퍴ԚY,cSDŘ*˱Ai ylI !ĩq›IEPkvm4U*=FVԊ%:LshJHEVo:W9KSw=^o#MS[$ N'A0CZ D@KH5~[r=o\6]7VGڃvcɔ{'H-#rhhV8.s4P!=y+S)#vh;3i+QV2LL+Y%G,k퉑j qi H7rI#ؗ>[oK14̼>g&E"82}$Ws^Fxz<23e\2vmp8eo5pbv݁m:ej z8Lm5"_P MM;@X4eGAeЕ1Zo$3iq(' (+-چ;»{W'698BcGeGmY=87FeT4\qRzbn  V}qUxւq]rq78HvW9O:w"k(E+EA*늩hqqኯ=6>8AZh|:bՏa_||s4a~RHtPwS`U?v xCO{bKUNl$WO~b"Ř,aX[V@=]w 2e^OpQ*@I|Q^d|2[„JaU./ųت2TɳK-W>1Ej_oTJlTACFt3UTኹ|[IZ?l 𤣠#Grc(9-? ː (_GswBSniCnl.oR@~Do I^햪PXl}C1UJ1uznUPN2x*1WqG] VB[-e8F[Fpv^kb=iCcW+nf]# WV =q<1U|sqS&h}8vW1ީ]S[郺qPwlqiP̡*1K#Ěݝ(A0;8$ǎ|p*}P5L*ٍtc~%VrS jܕ45; Ya\UN8)▽@vaCV6T =&;bK4>;V i\t*}&ODBb tw )S{^(*>! A p]gxAz7qB} sQ;U:{Ğ27_iW'_צ5ԍTaVq1#*LY.?ShE*7)gt#tR Aҧ#|يL75͊6*ثb͊6*ثb*6*ثb͊6*ثbOq&ۏPAս~42-8eLH%\7">.OcၒMڽU?(`bc ‚{PeknS8y DM{wUUwN H+DOl*78#0 QuS`\]Ź|FRVӊ>َZRwqV];HCb&o|<yCf0qC>1ޯ)[W:b0pT>Ep%Ox: tL#ayßC^@U,@ 2O.jZtqóڌWЬ}ڇo] Y{: L GP Wǯ/|qUV|0E؊`JſC㤈{1ULNv>8„rIhc>wpr8"ЍQwNez7ǯ|1U/Cbx`J_uhasum)]%HaB6HX, "XaTdl<o_ݞKg۶(^?x6cm`J rፅ/ݷ\U|RU{ Uc(fR܏Յ[,JggwU>LuJ 0DrVzT;n2vCUٻ*x0r2 W xb<_*ql%b0Gҿ3|'g=)+.Lppݲ0AVdKAׁ[Y>!feV*ۮ,Thr9nF*?q2?Uz57NA>JXz*+ >'87L*Ty9mSi&:~4q>vL)^T}Ӿ0s1BFۮ<늭Sb`nKbڎO|L1J ۏB9BaʿkK Rk<Dx߉^R|}ZҮ8!U=MoSU[1M`8rGlF*a{`I~$)]xJ_7+H87z}w*@C7c\slo6IDC=ح٤GI| vf3T.bƁTFZl)lbJX V ӿ+~!PNW+(Ft-A۾(Uxߋ[]m*7;l{bpuT_n>,~*7`I} -7#n61Udv'|M_L*` NS!CwRO\rH GS~67hJ}\ AjzrޅӞ=㖛a.gv}5AF7]nj掔)y)"ܭkS қ fxC lrS%6;PNw8ӊTJ|=߈22qUZS?^EZ6*Ǐ0D2q5R #c 1U:86⟻q#G5$;1+iWIzU]F4< f<,! KJ5֙rJLA5 mŬ$A'ȵFnpj Q}V@p7^v"TR$Vڸ{% |J:cVP4䲅rt)xHff? {NDcw/!vNWT%\6քH6ؔ3-%~`x=q {7=х _mr4utc}  `$Q?joԧ,"~,M)QWR4 $*mP$x;‹ܔIȌD"Ҥ| t cCQ%[ 3,ўD&%0vnVTQ7a7MmrHe)}pGd (Ǒ;uV@B'z{it>Zu;c)_m kȥ0β/U`v984v퇚_YOSש{㌲\}wc G%^rgbjSt錱Hqed0JvYtUVO_ ƛnS*cjcúi; E 6*?BV<~ FL/4,bFos[= @WHԅŬ-A] =~XJMc Ws\K}VpoJ *8ۉ%q_)ރ9+b&VRTa"ϤH$.Tt|Kčv--`Xciҿ~JmtLwCFA;8rU҃ 5 23Sz,Y`Hj0yk+hE;`c++>SSЀ2DEҵDZڵ땘n(9O aDfЧ|C290{aʥB:{e B"7Ќݰœ86/-n la|EscZ$*D|'[ȥ}p-Hĺ^ h߰ }#X${x{S iWnྊ P;V9q#!#B]->˘^ E2BAc; j7f;[7 EdepMF@ޣj:5ʼnܾv;=G]>vR V]؜dTFj7 =z|kOjH@] 4\\i18zX#AnD`\+J>2:a-:}긐wT:R*TV}8XY:_$&=h׉8 XJ-z7 kke$eB PnjzW 4=q (;m=Dujx/坄Ha\!Q)&0!oO4 Uy ݪ.MIICR&p\)&EZ. 0TjyܜqrHǩFCRy/C|(C#Ț2iҴ8m9[Yy1\'3p.+קΕ@>B>(ӈZxb1[\|Dۮ2c'r8fo^"si ãGrse (znڣ= kw~J`=RiPr>'ȁ\ohA;`KTQ ~lʭ{B9 KiHAO\ȨYdId* ytyh~Gr}͝nW2>i{ ݂K!]'F&729j1xmo"{ha*wp\5~o%~)`y9%62j-/Y'T]cHFi&nr+l'#2'cn {Xf֑3!Ha&VNCS/ >îXd%nn1ևlۅImd%FzFnDGq AUu#\!(Bx.V!i pE55|Os3+(+һ*nā3׾sl1 odz5aexĆSjK} `Tx#k,GXR7GȎ#AzMf"&[g 0xOJ)"Z_VedR,7푕XQwv֐`HZKfY z-5ԥGƤ·_b1AlR꒲F9+bܪH9-m2I3)պ\y PĄГ oeoL$B9) Z (;)\NT:RK)Lpe m "#t"P'ų`9d v BZW6WW e2U754 qJr3(~倂=[ĂEvn&ݦuI^GbEl\Ep jUcҹW `bCXSԀX_ x˷iHj{dG50bj1F"hFO~2(36\{ /Neu4 ^"QXɻ0E8S%l\0TFoT|122'ok!z_TOMJ`R%mNIm"PȤ&cnm65bV0uq}{D(K?g! 0M 0 DіHBbiSCp˵p_KS2PǪ(kh±$|U;=8Jfh {"og3H%\BOZ@ E|Ai[r4$w\W"L` "1;ch+[<%՘AVhؚ wZښwǽ-ˑj &`î>v+;xv-|)SJc i0d`2!H`6>'#h%'#-=VOcӤބ;K'3_iZxJ呕34wV('|Z9~b\I N7"7 [օnSL eJY;'&Z֑=Bzd3tZTM5=&MR.,|/dJ͇z60=|w>(L]bDĢK ?BK'J!@=X"f1iq2$,OJkA`۱XVxB}ݭvfen)rɶ$F5maN9[T.(=TN676rR@ٺY}4[>7ES$M> rPzB˺K;,\/%qJbh_նoM}#ͥ0֐N0oPm^cQGchv8OqVS/wLMqW~CKW-fmn<\RJ>9k*|i _>+6lmĚhpڪ,(M?(4vm*e~φ*-1i~QnzKHp*քTx5}+ ┶}oZո?Xbr+(-Z䞿FHwGXf˅S`UbCp(e`;Dխ0"mY>N*kfLUi SW#r18P@7CǷ\ٶGw*ĥШ7b@i픕+qUlk[UR6=q0|@tyGZ­WZW櫀tVq g|s͊6*ثb͊6*ثb*6*ثb͊6*ثbGǤk n>h{ t$ ?g"ޗ0\C*sfqV\>OÈfMI= Mi2zj*{`ASvqlU[niĊ\*@w'8OI>! Ywp*bLc…`~5'8C QUuiJ1C| w*| nZb<%bo0*_8{)Mݿ-r9c%̎(K.IO#flzJCt=qB^\w\z<<` zRd+X? C젃bGqabe6ڝ1B%I_ Q')J!>!7N*8R׸F[P{ BO A#hoP`u1cgOn|hOl COiGgu8P 6ƃh~l*yI!_| " }?p%Cqz m qUm:[_RT`:{UMmOT $Q;,SʡGp{L0T(i\]_^ 6ǧVA5Rp+nCmv#ZW陣 CY Ɔ'ߊuN?F)Zw}8WMBsvm.)Z0!TF\*$*}Y"+}UtFŇU~!4& U_ lrkVEe~BNR Fh'UuY᝭C"Ǔz2.ӊ]>#O`JFKw:cH!.S(EK@{桇[e?kJT%:{WzS*SnA>2S*u0WgcXRA4;bU 4bx⤘ѥr4H[eH&׽kwr Nb̲ :C}څ ҈9~$jbuA) $̱mJĉÁSvF%hx`i%tQ$O;i䓘jwRirӮi$uQEv^"X! gza]G`J+dj`w*ƣle4W{`IS4FC1$R L]Lr(؁e>$3JvS:F%0LHx Thc/BV_JnaeBʺmJYC06Z8줡၍ wtt<"oZHi]־#!0~EW0;r2 r %Fam |$|EN6O !i6Dv&[ה׊ۮG/oW~ 䣍J 7XWJ +r8+bEqIT(hAܓHA:Jw0H)/2R0p\ʼn;|-whG#* FPHM^ku`S6, =2w[k՚X E 72)ms&X,w}S,Y^a)?1H ; \\NdEJhr w< px$~q1ӖI1b@t$3G_l r+{+^dgoJ +JfRM|SU-$bQ:Wr *@ፖӕcy WM/r F[Gapmlosm,rA1w\(8@j:j4=][v!¦9)lGtA4m#PH i!`Y ✪0A\irȁLz*xuWFEЎ[bWd٫ZS)Qcex$17E) [ϫ8yEJxZXmmiPr#nl !<zv4`"l3BB1uF!Z+Pa# 'ӵ.) )8Y>m{`#Fl'\O$+u [eN `Hȝ1$$gvOǯB\ѬŲ*"2Q,DSt+}JQ$TS@+O+v"n;xc($pkÖFFɜTޛjmڋ#ý=P=P0j֘Vos/dl2ⰉS峺܆׎M[O$[ ^T%ݵ* qMČܷ|F-#ۧL6CiͶ ćki}gY(9;ٲ$/R()JXl|;#?X[T)o(9"Y +$(j}CmnDl9µ gxU:AxV$^?H[$#[T5$Fe 2wir.>*EM]CւlOn存 R:@ M4i>ѿ39.S]D5[Qj9 ҸN\87Iw]cl*OSk\'wph9E(G!VOK9-F^CLT^fIԃ1-'JwKy 鱧~RNˮ07 0F2KRFJj!HmLftƑm)LFe~*uato$L{;B̦ XJ'^nXI&*0bˎz0WfD-lFc6%0=Y4ŒzؔR*MCdP+d@U">tnO؃hF7O*YU{W|h')QI iND䦣i|$s8T#$U&޸:NYޯя,ę}J[2W 5FOӄi4% EOi#6Qp}N 9!>j\i6 1$׶ZhlkHjhBUm;$cQz02AUGтl&G %c UUj:mkcfS,Sj2VUD#:aVO3[8Hkg<Y*M6\j" -@`by]a` 7?FB#~[$遹.p-ѕdkacl֐'v?GĹ@kQ1mOȍЪ$fC= >ǁBBA>BwCNtB#ѧJGze ǠL$*oo-ʰTX(PpPصRXLBme)z`dy:|G lKkր*ICS^^b7v 汎E,w  [iCdwKv 4 ,ڌ7 <_m"b%>,T*츃 zqD 5-bwpF5Tbz8? {kH'ZGO0)Am%j8$TZ+YKr+ɽ&7̛Y4d*50Kni1K|@ĒX۰t]<0۴EvamH61&)1aCQa6wW.Xfqd`6XN֧78#x *#e o H(wkkYXq+7Rr/51uM7Yxt|+$ 6| ;GxFqOY̭ WǕȝ!ƽ2۰ly0CH fMN\h+hւ0ay*$QV^c/U234+y› , ꑀvi㉬#z X+2;+\!DNws}pQ ("s3nnp AQ1{9N%H1'lv`Gs߷|<֢Bx\1:vM>Yc-tވU])ǁ*#01b-a-,䁰nZZs Ybl.5탵-LH5 ?W[ݠ)ĻrEx΃,)p>'w2k/D6U$%F^+{ І.+v:h)]}KOVp҂"dJʝ87Q\4[tOwnhПqp% -d')k) hPN(8+H36\IRs` 3mM:j%hZaS"`4E#G5 ErQ9HY$H+Oo{"!r19T)8 jwP7y|2`1CZj{;IVܻXҿdaF$ c`GlZ-2+&јC}8gGJ|@(]$"./2[Q}RUNv<`RKzS_|܂kكhyޜ+eeT7?N\j:B ScY1*8wM)_mX7;ml TYl؇Uy,zfpGPfլDl@ x ĩ sc cICGqJCbUW?[FCXG5nUpuccU3FĈ(8(~Pj_0኶ϵ_WUV]mdž**zx ѫ|#cz |%nG!: KIx kNrȑ3?jMCG7c ~݅ MB9}^Q W_xR9vh-W#$:ª8j*94>ܑ,0`Cl7 R{gS T銩kQ߾X[PqCU{!#x#aUH7o{ /45li1p+7„X*mTm`?A銹 ~9!Q"P0qHIvtx#^p0%I%ѕ>ъ7ĘVnzS ң_RHq~FUn1U܊_c+pɺЏ @ 4r@,u\ܐQ߆(|UMW鋬x;BP*)Uqh-4f=ݥ 4ۘ l/ԼW4UuaU,8qO▙ |Ga،SntAw١8e?x*%>ǵ1U -=8XCS+U]--«ŽkZ~jKh PKkR4-f[ۧ%q+ISjyO_U }5|5aD쇍(Gc S=j~Q\lr@pufDbTxՁz02A_ UQn$oLH X{zlU6e}^_ (pᘩwyL.>Js<͊6*ثb͊6*ثb*6*ثb͊6*ثb? ~%[qP: '9ԨoBu4L?,[6)JB kኮ0nEւu.Qe7jc$2\*pOOcZ(h}ݎ)X[(?mqW)#cV(VA$F W9.5uo^(~銀rlUHޟ(ٺ6Jn:~9eA5㊴=5[OQ]+S?F* (h7c%<[ q[u8"ĽF+FVn=~v8pb2HኮVCW"k#&oԏop*֍dǦbЩV)XkG(H;6R߶`OoWS>؛[aB\t ׵{UmW"(zd3l]04m7 ԣ1N4'rҿTk=Ti P0ŔpqU7^ƍC O._{ ԍU„u۱2mסC:wFLU/ W ױ#!_0muƌ6R{\ Ko"kFղ[yU?X*nPY> ]"S'fV0iw»jԑF$&VӁJn0" (F_ Z9Jl~%?X~corU޻J ގ†()O* ^\Q`ybG?(D71CC?{⪱{׶6)Mhva,5CM%0Phe0%Bn=ݎQ6*mr P z(a4 VXuX\ P:7%=& CCU!#{m.NbE|78{U zqq*a^;ǎ*5xvFA\»RDqb)|jJGp>Z>)rqC# 7݊Ѻn: NXtUb7^Ԑ\CzoTnUr8chϮ7o ] (zإADkxh{WYkiOU>JOpju#WP}4gѕ6 +@`v8[#E')o)^H*k(;7LRLccJgWT )xHYG%r)i]V{ $6 QSakj뒒ۥŪa#{GU`U1HSDžDG,ME(0e~&>W6(m7 Q@+׾T9YNzoo ejrm7ԩay$r,U(- OIo'1H(nQhw:=Y8+AXd1&ᱤD6ED@HcɫҸ8'G6 0+ZѱGAܫ «3*BO{bŵ{ {+U}} 0U;o+R%[=针 QCC,/m fIKO_r@[A$6{a"'L,~5"6lwjĖW>Qȴ@ze`K>wQ7*YڞpԵbP҇6Rqq U@0pvnkNo^;YaUznOl1e- %HyuUWc0v6 9{oee8 TWFbA& +Le+t'cnlc rخfu8_m#on DdC#fFbhGl_YaiH*I'v WXNFFrrmjhTdD֋YGʏ4P\|l7]uRGQVRb*r@4.ptaSo| 6H.`}8aqF*M~{S u18.%vGnmѶSZٖRt1f^J8v-e{S(v)1bCVΝ>"P;hI@+%T(@@Tz5!Ijn2\7դ-Ѱ^ o6ZSXhjEY:bmŧ. 0&E$On&IdKܮ7,T_(&ua:iJPSǾ1*[֞`(~!^߰~O:3,P5FXcDy~ >,jm#Rw?L7ۂb۞SqJ߀+4LIضH4ROl,TmޟfPÚ!#/I2%x# =KE$HBW8Vz4rmbp[ëg}Ք.CLҳS>9",9io%ii .-YV׿@d]\:|" \aa7 NH4@Ѥ(ji]d!dm{d- ( lR/F˚>mS14}Xi,RjՏ_2!@ѩ5~ rV(i$%iZ|x6jbM3]y*L})NW_Dڦ>(62}^7*Vjtc+Fb{eLM+j*&pF|iŇ54|eLJ#D3OY YA>`-Z:hfUiOa}zrA:-h0! t4pQF\L(4=ZPj ޗNhA톗VȲ4X-NRa8MTcvGp!CSC;] `"x e(2 r,ٗ{-=3͹D(%҈փ`0KAmqRx (ѲS?~iUe&%* un 70%0[# 8lqTOT~X7-l#Ch|NE6[$Z5cLFA{p3_0g!@+ڃ|ϳݐc  AfqlǕI`:ucYI(QZT\Fԡ{]As&rC?+]r8 ?L{я\ ۺ+ޱX^[AZё@?P= vd H5ޤ}H 2T81 ,bջ/+rWRKJa4Z8윑GUV`Bvmb<*OJtƻFJrR074qM#HY.)Վ<l$0[GԵ]#8с5|2`5 !BkRDUKq^ i'VލW1c'- cTũR0 vgH Vγ1P.%č !4LUn2k֔]oRV;ZeqkXO>đ{ew+$ӳ__ҍkS#}ؼZ(Tӷ@XV-Z+AP7=r٦;+ -f`vPrulڒ퍵Y ?Ht5R1)t $\1;VRwee 9*ƒ\,4-qlIma $]W[5dC)2^p]̲۞@xbg[0!`9ɶۇUu Do궷f (:T$00dJEkL,5l\p9nVǾHȚvMmA ,+_B0M1'\ɩ>k0š^15,=Ec]p#ͱ<^FDfRM--1f,Tڹ9]l.*F%Y^klTfhe}2ڦCv$׶ V.Vn 1~YWTL4XM>m7ʱe(un:+H5('HDR0;67=|WZ6Ɖ z@xkmEÍ_\#Q~3]\0  E-#۬j^r= Fۉl^[ģՌl 5SGʂKh`PIܖ=ydj(VBʕQ^<hdg&:@Jl0S ۦT.#d=V Ajqi/S+4eNI3KxHb$-wɁ\Ӑb?^E{qsuޫ $JlBk}F*7nN;;lVO[ Jdx-ɩᏔ}qD$w2N'plbQEmD8ii&ʪ=?\leY%'&a4xʶ?y|L1`Knh|aͫbM;dZv 2i~k- ^Fnĭ2H;wȆGgbH]*MwiKn2rFJ60߶!qjPt>rcPsT7ojxڇ,PیROi,̈BeRI4[H4N "Wc}@1<“i|GQ@_| ݰ$wՇU n)|?,D` ./seIH3„e`k==_}|LAc7Ȍz4~xie] 4#.R GRE f٨'oIȨ7LΌ [&,?c" B AI;gj/l @m 1{bW|sV#6֊Cx*eޅGqqeF* 2W(p_~5>\UzPoLbK኶YI)iqA!^~*ѫ!rBTmB{U}9:W j+:۟R1ձ;QS/ VHxׄն?ۀ":1n}zKf? CoUX[CC9]Ѿ Q>λ'IE$BO#oNHj[7|F9fI>R|ILJ'Ğ=(rǜg@p%ƚ}ZEAq>C7O 7)3C$QU… :r|\RvaC$'`U'M*2@{lUAtڜ#>-%Ic㖪T<׌X11c*MA'1BJ0*Gfv?vS ma_SC0)\=x⪜4>_Pr|1U7q&J(I ({e*{ǾJj;ҟmӚHal6ªyMԱ_Fj#C Wn.+QPGzqU:z0j]JO_`J^WZuMzџ[PlqSqVVO6V„I#uSQЊz=0*(NQQH bݲ{⶧%N.+sPx)CIlr\Y)(FQNHyF~H~(%Q u C} &dlEGߊ*CCQZ5V }i{O&&9Wf]vlUٱWf]vlU*6*ثb͊6*ثbG'b?%[qC O<=r.Bc~u*>1U @m=8[sC,Fn[hĈhGC]=wHbU[aq\-)Ӻ6)K-'{I_/ˁ^U|[D :b"oኩ+ӷ_|SNο*'amJNv8 QL Տb>Պn 1T8٣ۗqA|1US}+N1`: ]%*?V*hqQCXcjk^;{c/Yyuن+^ UKgcqVWcR{`B,=ӥʍO4)Es'"6n}1dJ$0GƫՊmōAqMIqJ$R( Wz]~8LVvz97S}"51 vOKF⨻g x'`|T]</ *5*ۣfCOR0\Rۂ(AYjO >ʬ=HwezaLUj{Uf;D (W?hJPncqoo ublUv1bC-77(7 8iaR;Y&[+,ԧ?43U90E*~U}ZxZW=jwªŽ6XU7k LR]c =F(\*ScUQމC!* Ÿ^|-YEPL&zؙ7UOP9 v#p1_M zCbPq+ UYVqU0Z1^ GčAx)~f=o%*>WAOp G iO (L\(2+# {*=dž2x|cC'÷\J 7NU'Yv85VqTLa>E'?튭"{f!(ۯcG׶}v۸8P\ .Pa<=(Gqx}#cv[TnͽMY0$MPC+J+IvqѼq}֠ˁ(CؑPrfz =@W1]G–W^CfuŠIٱ\[fF+< v(~GFT5`ܖIP‰(Lr {b D8Rw ܁ߡ1xe~)Q.ǚuªJU^`*⬛9UZ\w늴zrB7?| :7S;iZ>o1^$$ A^ۍ<19q>2@ppN@Ƽ`ւ!zWLbQUC g0pnbnK elOR#1#U>z(XDyzcT5Ւ\& U>e_t)Y2@~˝t8Mv}7[kcf(j0׮1\Uδcj<1U'H78t7\J4؎U#o^"QTٻ*'9Ҙ!+= "[-@=k5R `zT\C-蠍PIѐ_/-sKцƻƬR@rdpZcϚ9 {rHA >";5ҚבJ1;zcV-rX줸jL d: c+i!s-ק߀ k II-%ٖ 89tjvܴǾǮU +|%v˄c":*zB(6X`7iG*5s69 7Bixů,8M6wȋ,8zŷɩQ$ʙ!DYBcޘ/mPZOPOۗoQ74bAnTҴ5VmMHR#mBm(Ӵg| _;cOW{6V:NZPHK |[7|Jx$';!{ϪmBU))Y LmJ`HEU(iS_7˺ܖ? d"qpѬ v6k>HMh on.\gaqoIլ\AWE,læf_@ˀ qKOCϻHyZ]'Mi.v䌤$9,RVY?>OCOFB}' ) #Kkȋ6= .ݤPy{"#_I)]rC7;pKQ+,!;6L:Eդx>,i*K/Ab2Z$0"X;w¹;WഥvuE鏚qlS# .$З-oEm",nM놿& rf ` 4[LuʪF`u_"yMG"3YuאJ#l1n!,_eA Uj& ͕jj>XZ|*ԖP{vV/Sc4{˵9j>i$9W*2Q廩لV졈,eI%i¤n2J(yߗ|Ɩ3KYX!u$'wi,DbNC}"wIip!,oO|t`Ur0{y Wjtq<ۀЋ@w5OT ђj1 y6߯YGsp8Ѱ# 0k#!0ï_)-`Z/u>aVf#wEl?w'"6-Kxjz{d*i`e,҉+[Y,[zq<i=uV8W⬦//C-nM'>U>ˑ-"@k"ȡA],d$D'4ķ+PySq"aB8/y;7bW}aY?~nMU"0=6{G.Wr_ m/Ke1K eTb淭Fkj1:M;u(8F-c4_$vn[ArR)N@8SS;,M`_T!v́"'1Q'WQ@ѐV ߰fPfOzb vHR]@'B׽<0S˦N/ԑэ[h 2Zݷ)EC #wwꨙ#2yirPfڋD`_VupM.Ly/Hxe ڿ̸'Q,Pywis\D+VQ}DYk6KxP71ʇ߮@HtiNW v'B3S}[+w'C;+ǻE˄QDJ jf(Be4&:k v UPM\wn$Nh%er<ñ{A$j,) ^ J8酟`լ^ÛHp~ƛ2bYģ4PABm$᭐cRzP EHF 7.{avtpvM4Ik8| (nQݠG|h яSjdNŌ l$0S[}j$bhza@5a[FdB +?Teٵ {Վi@aT!`V݆է\[ I2v,ώ8]~ gVBeM/\S7JG5sCMdTB9rc+?(_4/i+{(^N#~9x ю>ɣ=(^Rcg~;YDj^}vTy%,4'ULJq>PBc<ҴUxH8YjvIAinW~| |C߱($N$D^>O(~Ɠ;MB [}ItϷ*麟F*Tt=Z>RWr6ac}Blm㊷OіQ$u\ӯLHɺUPL-ec\Tn1_S <; ߶6(wLaZ5~С'ON߉7? v>-H;_nہ\R ܪ(¸RLc[u8͌I3CbA ÊPhhvĥUG*}2{*8ַ'\UpCYvm^*׮YUz v?eHCmApTWI(P[<{o$_d<1Us"L(ž7{ua޿P XsSڕ/437iA-畔?;$_ckHo0! z/d(h,Sc-T!7!qJHkC1h;|-p*(s}żqU$v<[Dr5U~{,s拸Yq 'u( &&Wf]vlUٱWf]vlU*6*ثb͊6*ثb/7"'p|nW'\!đN*=1DntSC㊬G=G1$ru$~:Ub9FPzblnP+㊡䄃7_w>xNM[<8/?v#`?*~KC P7~/+S]PYyTlaN՘9FidRu7֣T֏i|C V;J-5sDnO7Rh,H5_L28`+SOኹmpb!_8$BAQL$,!1\U$(y0*ߡv1U|DZH]T⪑`#A*{qJTh{ SȊCA(هክ|@RA<>PPhTQ9xO]Gp? ETl|qCPP; Aא \* ۱?O *z Je}%w5 :+Zf;.7vc>8$Qaxj/Z  ;S9@GCAߡ$ͳbIu˖bq+HǍTOuƸڣWxxa;TqPCqt8}0[\'ክ2|]`~%qJ[F=hwk l~ߨV|Jxv:V]^@nPF}[qVc11WJ^hiOo.|-هJR;MG'nT8mlEPS ]U!:<[sTe*11 sƛޞU^ 5!t |X=׿)@u'8~{: 1upqD6qt­9<|0n߸ŠM9Cp+F„I#lZxai?AyK8 x-v8F#zT3"pfF P ,, EݎV Tj8q}"1U`Y9DjEF(Ȕmxeu.銮[f9Oj?\ A)J<1Y[ ' -p*ZŌաo dr oO.PI c۪*C-ƒ UEOJ6c[IHٷQi78ڝ 71IO\UkNC윧XU~C>9mWثBUչtaWިrzҸbdž* 8P«+d,4s#fkL"LD(g U4=b fK 8/uPĂW .QZJwWjw V5/`4L,i$d7=iͱ2`Nծ\BL)6Eyl55pd'#FU#78/+^x풔鑕.3*4W#WZO bot܃tbWf?^,6I}`Iĕq"^9s+CZllLvMwXCڕ#]!B0-SQS N" ^?-Rkx pbC)r%dB*өds6N}hlDؔjVm*oQ@17`Qkƞ+8ZSy&ѿ*te3VV=V(q\CARmp8~~d'&5u8VjA hp i޹.a XTĈp-mo=뇆3T<[Gή69PxIl vbHEOVȈX R#lrqx=OݍR%wo1IXLNNV˜zkȈj+8^LvV1x.CNؑgk Qjئfm&nQ7BiXz HRx ra;)Fs ͱ诎H6R-zb7J9(Dw6Mvţm0X c@y ^ "Ev\Dkqt[e[z22Pwq̂v¯Ej\'[T/mW؁KdGaӵ0`r(O1TW)g_Ď}Ab8O]E1Q-^*<0~}im{4q#n IC,4{$DT9=+Eshv52 dK j>v;)+# A$7k2qhݙW$9S8]אI V Dm/mmOc%F{8GrC1+0<-VbEoĚpz4A=,{pg`_7^j0H*P3,l|r5$(U[Ol@&A1ٴ8Oܼt0]T*Z Cwjy ƢaWV\YXAi?tva#RM]+)&Gg*jEx_f~;oV4p6ⷀ)ičd2BIvr/B+xHa_#Q o aQ5x I5=z'vEU [˖oURAcQ2rnܐ>2]{}Rn0EŌI,nIhE%EN~8ۺM1njڥ5=I,SEwhnf/O HfZ)}VprpRr5!ޛNqZ Aiom'S_VDloI3w;.V!bzW& @R5c INC$]HhTb|OPNT~Vc2J mn Hǯ!k!ju@vKۑ+*Ť lRej:uݔ 04.È|$O&m#F}8SXvyǮJ@Jt_xa"h)o7>8I$aCjIqHʌ|? 5R'dAIF M)ϯ#V@ޢ:sSY3Y2:F6-aV< knd5Vm@_$pTq"zy 7l+Qk1$fj/\2ݙZImV?+P\q; Ȓe=+ lXl%c݀= q2FAt6[8ct8"rMQ*|ZcJafLZЭ: 3 1Ч[P Ou5 8&E{Ky1PkRS٘jڄW3k"ne$6 0K%@x*rk-s¦9oO 4)fJ5VqDd, v"0 ,cAr aƙ憊 FTc`IcE!w$=.fr)|-ݜqدPZF*6Ec_a-u\ 2FwPtɍFatRF &j- ^ߠۏoC#m‡M$}8e? (r~lv K,ǑN&}j RwpkMFQ@xI26[(~4JW\K7X o lDwW"8&$vʀ-fdl2Ap̩S,!J\h7VVO,3I_LwQ%[!*[ue;Y;S-"T .mR Rw'!cDiRT l"ԀELRa i(.U(A-fF8G]@#w E`5T`eMfkA+|tb6^N %de`E+c#ы=ܓ^|yq!E<:dlԿFCVf;.SW{-+S_ M.ROXI (]-m+oNo.*քq N<\A5ڂ H4a܏#ĚO\b"VP >RjlO\;l\FO&@llbv] \F oNj|*T6PIⱩ$rc+#g6Oy}]:h3-rz"D;-]իއ[w6Ný'@HdVUMM~YT6Kd4mwW'9<',bƾڇl\b۟d{C\ӿcw#x2]|F(\ǧݖIk1VsU[G29gie.W߮\s2lw_| Ԑ+`$=}T+DZxJkj68w4;lcd;mft«D{M Ux>8E}**!那`ªk8 F75 ڿqqUh}c1UA7;71U)5\X7aMΞѝ+( ŐTFЃL(Dd>%>8i6E1Y|1U>8"' > Qx>b:Aا2voO=0bY,M:)\ڳm,T<'׉_cZZ fxa<;TIwCqB>_{J_hoH +TV;CUKe4<?Z|{:,qUSqY!4obIEG'pz`MW"Lyu$ ǂ4>XA_*=0 4]xbMFjnL bM|kBGć6QRMbA qUǎP/_M(VIcD*T-WuZk+q0%$ _CIl*Kpثr6&8UThۜFvTe_N`Ndn:0،UW:qwo^hrۏZ꧊F6GY7:$}W-? #>tf:~1\P68N[sJ#uY͗fx"(4lG.|V2Aoќ&&Wf]vlUٱWf]vlU*6*ثb͊6*ثbG\4=AOC_>r))\sn#HjaUM\X_~*E ;-^BY)ù=w ,~N6}KyA{…֯w5?qkp[i:@VCI_imWUD!~G taUop%C#2Fx4?xP?|k(kGR~nqܹV-IPPeKr_tRN;}DT}BFCczSx{яdt=qJlY@،*ĝxKvUTN9_g1Bf0mN۟Ŀh`x%(dm9Ђ`&paFP STm^7LU]>'Ľ*Cqo1Mt Ez7c ^x;\D§gbO(ObfuR9vqV63xa5Fj?„]x:֕CSbnAٿhL S=rzT+:'y* 7NG'w $\4z#t=)C$ËeHqCqTe0XUOgE}?wS.IɳJӧo QN V?ePEu%Q0-}*2 ds:C cܔ=> |;׾\Ð늂#nd)Vԍ$c17CaJȯ׎X~#hI}׊) *:`UM;7N N;vWG/vlRU~cGj…0|< 严cvB]qU"+Ӷ~늫:㥄:c rU+J*T}#%`o1HnZ&U;ULn+\=za~܊i/J>knǺ͸M_銀UNR'<[d@1Udnb?«R>SSj otƕSqxY6=p*crn(;~^إ*I>Q.O \+{nmԎfؐt6TӵeATXP|G5J(6ě|X~z|Q)\/x.XWjPSRx\KZШo1ȷ [HxR;-k^S~ߴƶk"²#8a I+Wso>֓L7ĴMV6^)#O=v=6%ljQ=A$*#tm- z&>skW2p 6TR mL!#t 8~T>UkԳ$3mcFـS[wӕ(?^І1fyo aq'uA#ziJ 1"ZқRAk%!(h h70{|W_.LUk#F#읈9#mvG6T0wRbTXpe, e[:2 @55f JARkLhG0r\7}]A E<2'ҞAJZGp4y,Ì ;'tCƌj00xPXIPEZwE:KgCר#*O= ޞԧ1W`-0Q\dPUO}- ٿD`$`#xmF4\%m8eX k$d;Ğkoݠ1@)SORАq].7pa;o_#?&Rʲ+FLE(} A65մqzX ShGL I!(LredѤHZAMKQ$[ ",nsn/ooikTOXh"ksnb:rO BDph񀴧_%@VAJ; o\f$DQRh" $mB⮣ӥk [THni;n*;`4 IZefGR4]LV4.뱫}9ZOŖȻzȵ@k^dhH+CD欭tK>>E!ZN)#Y <dfuÝ YID3*7B|%B$C8 f]Xg2+~{d#'dݫ= HzEyZZ 4\…&p/ĞTكHj麒+E#c=E*zeK_&7[H]Xd!W~/|;'Nodkr]*ѭwQ OUBiɩ0-xDibOTn i*"PpgD>.,: c\ .Z҇2eV7?d Jd܆F*(D bDo\uč2ʆ֝gmPLGr#ViG9G&!-[Xr=ouݙ0ڐ}Q A\[FA 1_Mbufa@{usgvg:3v#"Z'm.$GЁlc )`]Z 4Y/5596PM볹_JZ+xZԬ$wkrF]n9rntTfl%=288$d`iA Sg-*>.";df'mbEOi!z>kCqo" \2V88{wiT 1Cm$]tYFnF~M{+ |NN^H\!W}7T.7-۱wjum>nfE'tz|I۴I" 'l-T@zZ]GvȎf=}{$V2\2ݫ in┥: pj;opm%Z~xD2BΦ;T'&/I@ :L^>eЄv+vGJfOL)/ak(.C /Cƹm ;-ZFۨLlhYzI!@$+Ru`iMeܞn\m!\5_% @o4fȠ0=Dkzhbp*;瀢[E" i7l8bG*\|($3-5GLZ5wK&,՛5  (SMYrkdǕ蔙ioF"Tm ؖRvlj2+$$oMZq׶LV7.o xn_ҍ՗zPep4Jј F`K5]JQݷWżqmɑ>d܀}B2IgF*oLW N)QQH*(3A]ZI𨑣j|,6wùs0h,W!9aB+EHnaIzcL-jݢxz K[H}/x.L Ͷwp*54ex5 ?#+Ҕai8 㺲߻hܓ^kHV /I]҅ЦVb7Y< ~n^So/[rZ `mԒr<$6Rymsj-` r{yseJ> lM>kzB  1iiT bAYW;|;N6'RY;a~NZL "ǁ9-qXGޟ'lH)a M2YydQXImGpbRIlzJʰ!Ha^-PF7[-("\&.$F+nBcQ˶Y&mS%3Mom`< 6F&;Ek+NDean65E5y2/%qAAI vU>j|)p[Pis/_@Z L >JCMZ\lZAZؘ!-=GLcщJMF.t˲8,Fdz UM r *x*x=3pڣcǴ{U PĴF1/!ƀ)Wt8r,h%# `k=q7Ŀ(^5 `NǾ*xvU>Rc*:ݱd~_Bv:BUꁇ {01ei\)ۃ6q ԷV;5bcP)Z BMf{}b;/z<:ʧu*#1;)\߸«TcT<[\ibE# 3l|FXREƓHC b"^ 0^_g8'#W)}`U݆V+=qrP7lǏ:27iICZ\WaGNsȜ(L`KD8j*Cˊ{^+*JSgrGAM_>4KGGhWcUy6ݫ ֬'.kPQ/0(o6|KqB(Hf;"֨J*Ҍ*8Eqmn*1U;W0*Ԑo 4\\8aR*w^q2l0Yt&FSYPw L_aV?gcOv+cbOMpb6qV,|;.[sr;Uf]chU}VM͎䒊Ua+1Uާ?rÑt҃v9L1Ck!LDњLUTHm[1u9l}VV]I \U)zlqtYzPR=G4O bCtƒkC_ QQ8m|ў]K='R2k’2P(z~ǔ_I»ҲGG׍K=v숚ҍp2\2 (F%7CCCTBǶ㖕:ײz0%K;~3+Sq[qLثb͊6*ثb͊6**6*ثb͊6*ثb?W*?%[qPn*>y;V(hNEÖ,M޾qzU<'TemԼܟw? !k:cHE尥 tq۫oA'=KTuMuS_;)C߸}*F? n.oF:F**k`Kۿlu( m'mb> 68ESO_:qUw=jENbZ=21V(r<קq\GCt=}W)5ZO^؟:|Cb1BR0ߺث9V<,$:x[TncFU=GipSS1A 4FKw7w!5.G$K%&)1*1HB7N͊]'jHyb ikIqAk{j b*iq V)CȻѻ{c78 \@[qF0wS  &|zx m;bzKTfԆ_㊴~ĠoUU{#~[7ħlCGŒD݊ȏ_ێA.:xZ&Wb7X_,(|Gc6ԴҒ#\ul-SእDSf]8a>t©zr##oT@hz⤃B{*`h;vVxs/!cq ]|h5B;aV#>*zUPUC4U*_]b3[^SPQ㠸0qU@%fpo]_׊PO>8c)ZFq­|19/Cp}_/'laR\)n-:Rc"tCQP+)*݀2>Rya}=̰x QQE&+ B1<>?V*u.?NhB2L{:xv,'qt8(2ģlïuh4< n9 'ԏ# /8-U=܉cž^ q\f1Sx{Csq8NQ&3z4.8J7y.z U &[g, U5CUvtcj9OA ;ЌB'z8OqU@%ʈjxsuTrGo(-fzqGyZيIK7h !?hxՊ>TG.(GZOqlې䛎 h{bGQET5~-pbO>$KOE\T}ت@‡ qPSqFI[ :DwU qjq)**{╱%?k*)ݪӁ \W #RfQl $K ԃ#pbGQ K槡m_S֧pYEaϏ1gS~qqM׳w…d+( dpv8z9'bu|pou{t#޿}׊<_:z6v8a`ʇO'BA?YBvR$_$8rM钎6A1FP{U(? *o6UdtXU`fӿq38\8Pb<:S,AC2݊t#hj6o U6@}O|)S}=rS`+ ayD=>kYxV1&"Q1Yؙ!=\P:{%)M=>d@d&G8X j[8.F5<6-m6%n߈rl-7 U Ɣ̔/y倲u= -aiV#$m4։aEsj w-ە잸ZZ8-*)!6NJ҃ P0#D "P EQhT@&Ȋ m֌C昚-\fvm+]+H(Xa$`b=5ʱdݬw4˾H0C^)Al+I4HZuH6M"S孃[JnoEAR>Z!ci9W+tLl]:`lY2{2B@"^z|(֑osԎ%*J𾶍E̞_FHxPV6R[<@s*=N=S~XReGզ2M&1-9;qn,:>ԧԧuRTuk\[3ٹ!rڭӖvON(F{eѢU VHGv@"sǺ뉾&tǒ*4ˎ-TcUjПՅ ͵+T24˒R+8yݮE$t q,HI5;wjRhR_w2"܆ZMD2Bm$'NYUa*3wzee#aƕHےܭV\XF ,dh0&ʯ샹ٌ,ͻqmF[+l1 `-N0(W Ƨ|n4l q9 xP8 ܤ* 9P|,I/%jO@+_XP@2QNݖBpN8id{I" SE&{AU$wL}lDhWFV*NW,!~w$5Coq2G7J$pV$e r$6ʁԩ`eGz. qP'j"mN v閪BRTaIdUAzb$SW!:艐QҲHC_qXBwk n 崞HO|TASN`76E2Z9q:dd!k^H#5_JhJV/Mx$a,QnFęBZ8U#&del)0(VeEE\b:둏+,%,G0=$bwS!z TSaMO4P Td0xqFj^jӣ3-O YvWf"?MyMi҇ ˈ. [M`{"e{-c@O<4M#TW u8dmBL"] ?P2viEd&nSo3;dnA~_gF{c)!0{0ֱ'V5ޝ8#vw6q$ICZoi mڒ-$xVfvWne$zn*91lwʾҴ=kŹq_s]; Ly*Q>8kl.-ļ^ll!Xh)$ZL I/oXgar.p=GcÁuƊ(RNN\CkDiב3f_Ϗ~8z#՜>Y1C$2z'+ 1PESH)UzKKR3A3a@*w|ӥ"0huAbMB[@Ҹe4=zSϫw:yy(ӑ*pZ!U ђ53ʈ#وvlX[kcA=9=̖-Fτl&V3Q/+=|jz1n)#E}BEnPNⴧH`$4Ĕ(2Pxhw8DW<ߎdG .:~r΢'TMu fXvHF?fOs#0"+#P~SmRi\B$]&,e }C-+4!  #A),a3ף`5QN|DKT4zxHgi կ>j2n80)۴[1  uofP1'c+R&"u?Pͧ Ili?+[9CN+a-*8xmg!bN:4zVzDyw|zU֕?6Z}NxˣZ2j1vmFBGOyh әZLG.E.?}l(n{*BaSپA, AsHJo8SG91el*ݔ:_V嗌|wn帡M dP,2Yxv oYБZz% oD$$l929GJq M eT8B <,u׾1W`ӽe,WqBwۮHŨ 29Rq|a4 =@*7$o4Ht8VqkE8`!ס|9I '&?/|g\NޚA-a6j` ^">jR*z2 *c;6p 6,qbA>$GTXC]CZb0Ott a"YNdAg5ͬz{- P{#{n6+vY RHG{!+{xFڧ Ic#pdbAQ!4ת$S_ٛՑO8$xekՃGCrdjxd6\6񴁔@փeq2iC#1 N@\|Ks;uUMAQ=m%ݨ]_%g(nVnBzj@ 7p]g[wYC;7%Tq9$>/L6i+ux.u,ٓM3ԟN.'a) ńK$ǩAmjp>wԌʻ0LL cvq=~-'$W.pe*k|H 7vru6"K O XY0ԓ#=v\J{ㆠV]>XnaUS|F4 _,r 9NǍtT 1p w2C~E!hP'[S`d%=6.@)&ʤQ"VRBLn*{tWX$[Sv(b1~umWIY +{^ym >pVzk٪ a3gENSOcnؘp̝*^6'eV4߮}{Ǧ+;t%`/Px?x#ZD@=wzl=IRv"#Ġ,*^-]}^ G=AɑZ-{L6j&LOE|9@hj sKT-,D&0)"jif*$(mC\hNnOaQ!5n7!S!I8Mk, oTZGaKiawěWbD"W7. Mqّ3Sl9HF;{c[ JԜ>֏lAfE"?k^,:pQENFғ[&푽t,#a^Hz߿QOxtYL2ZRW5=;xC-dp Ө8첽ףr$ƙw1Ā{w RIݴ^s\ qR#%X[V-ԱF6*ZMσ@'Iru$.1;Uq/5% ;N9S9EA w 0 #sMv=㶨MKwq;61ҕ)nb!6,V$f#sQy9.I! «]d 7bZdm+YvqVzqjn*A9(ƩQ6lWJ\SF a[[ H1U|skTI}vl]>ㅒ!ܰ~*n#3 ~|Uv7 (?k1\^~Ƕ+0إLCGHڞ*q%DkG'\@qFN-ұ~R{rŹ)RA(1Kq? IٱJԮ8_N(Z%#f!_oc8oӉoU/*~/qCjǒblUzN >|F)lþ5 w8\ٶ>#xx&!jl ,qΞW%7_ O\XvDuN}=㏱WcIXv8AgQAم=\ix{Uhڞ#vjTMWҸWߣ*+wS$ 'r}8)AKjњء_ ׁ*jnfYM=>u8M6XQGUxO(pL#u6Ɠ]INJ>S%Fj$H0G,ZTWw< ))ZN1l~ PI'nϫ+x bgSBi(˺CaJ mPWf(hM? RzuƨA~Rzq>=A!?5nMb~ϸYH\TaCf5;r1JpPѺ&~UIG>]nciT_0#Bk_{gCEn|;^PJTrĐN튴cIA^Z\(D??`JS.gcw_?5ϣh\mitٍ-A=T#&kG>ZT} ʜ1J0{eqQ1V!8xqC~g8城0+G% *7ThSPA'V^>Ur6q>e Xm0wccoV+aݰ!xWRFxUqon8F)ZyS늵Jf5W$B\M*ɡ˭wM^4;l}*GcR8P}cW+sቘ Â7[݉nu48WƖz\s0ش[_G'8[7h1'pH֬~#qXig[]~s z/IpZ)ߧ9MLsb͊6*ثb͊6*ث*6*ثb͊6*ثb? /$?Q.ۏU'׶EQUyܟME?h AOsei?kNވt~FZIpWeem5>?#滩CYQ vqI:sN8BFc >1Msz9/4V#7Ȳ `FUz_*ae& vzUzN#Xڜm0 Z0Cr5CG(xcqCUa?Q*d|c?;L<> (E77$'u=*Mtq€֝HJ(QjtqMJ rJ኶MяUOXQ5OՊO.u،Ur7۩o8k8DͺQء4SF?V ~i0%yizo+Rӣ>mmwSLԤG'C8eЛf4&bGn䇺Ho+H:lY$sVj;04 SU"N*A>ҫ@yQ1ȼO7tHP%\b8c/ćn^~;čǍn'U!>{{aճF$bA:ȼ{b[gU>=DR ٰ%H>!kUql$Ѱ)T:`JX[c1|J9!/)@jTjGƽGJJWqW㕂CWPw O H=hBFwՒb_GFYq5`+ilhAGC 6B>KP{wSPxw`yuTHIMUO\k$i\*Hh؆w6QׯJtbFS UpoL41 p |w+q PźEت e۶ e^¨hGNu)Ў1 憍$?LZ濻oJ݊EuT֧c~*!8vʱާ6X6)@+F?K0K)8H>G1d7^%w-J?V[qoCኡdnI'cU 8ٱ0xV*QNwǟ~$۾b˳u>f«Bzc`q}T!GoP4S݁Zb)B(2d~*hoO[lÿ*bW^cu? ~¨2ޟn6pbټqu=V˚Ҍ;cV{ « n-r{ &u;㑃~^%VH?{%qx<ՒTەH##+Z~%đeњڔD iQ`%b(K,h*z|4lmh#^G `'kPq3lҎɂI~0Kfo}**g\;bݞTGp[_FbZ]Vq%iN,c; U [ k!y,}#:`ȼ oQǾ4֯QA%(iJ\Lڔ2#z}(z.r;_"E2P0%79"[)-28wQKӢ.H-^@tSAmpPc+cb1y iJR]LF hiN2!2!\ ;Ӧ-vm1ʨJ"i FQjqG!R7ߖ^N,8m{SEoT7VW*P$Pً[+ƣ#%03@uĩrD _QA%gxT$^w(-=k- DJJPipmB*Nt."Lj5u~r7=ȘgBg4p;f}EG۶&ҶL 3.q{SqDw )~Ʒ-*A=hza-cR75@ګu4HnY-'"G&biO2/p3%i1H xj֜F=>ip$R(`SUg{录 n ֽ1HgAѣm(`|NFq%ԚW<77LmN"-[.̕Sp~4n *qF'r|Ha8;pޕ`XS`0+f4.*zɾM@qU  R 9AĚg*]\}kZqO+@~0TDcKV"ߋ{u(IiS՛$wH6S}2-"v\#6hGu q&+wGW*A[żF@P*8:Лe&XS~Y_{!.jr me E5;7b`:@VH$'Ѡ=M#jNx95{uG:g_J ߦ7DP:ruprcNzWFǥ0^T2 t]諸BzšImLEA{po0SB6A^SJvkrCZv݅0X0RP1?.Rˬ!uhjc AN:TM f8G#ȷjaD~eTNXe[I4=N i5K]ʆ' ydjO@*Ǯ-Ѭusʁ<,hf?er:ӚĞ ZHDM­gMo?=E QN,D;c{deKĪoNPj}-v[XDor"La\ wZCa9U8k$PwzlwRXSN,բpAkCݴ.l@z!t7)廌ĞOA^.P;ΒPnqKT-xF\Esq)c@ݏӑɅSed̚kNaPdQE`Vv4ËVJK2,>+\y@i puD^%MHCGjA2 D TSFXڣ$Ϛ\u-n*\06K=$<{3 vKs4Dq4+B;գ^صZ^&DA7ʎ5f%gd'^2H@(#zݰkzf F %녴BHE0[%2ar"cN*0L"Krk<ܤ ɢqpH*I dg E~YnXBԓ $S.`>Pހ|8 mF^Nl؜<*lJ1FK¯hX 4J\.$ 'q&ӻlOݖP\ֽ϶TEOIc(z t‹b"qf#'lI\ 54;up^^5$ `TV݅i7. Xcm i <Œ@=+aIH%ʰUqR6-v ܽpj@ B1bH%riȴiA@6g#^4"v0ݼeeaRvǶLm3{*d%jw gPj @ )aK+"_k鈋]Ѩkl{bҰC؏&zN_JJ"S%f5 ոF9,ԍ]38nAH •2GC_nD9^XSoՏ;H#&qU:b|?o+zANedn19"eR9{7lIHUq4?lb\hy 1x޻wSTdZm U`0!L&k:n1KFǞ2u(k s$@|W4 0CqOU 1ӨWp aH8Pׯ߈5 UYgew-H6VMi 2aZ_6?OT]œsj ~JGD|ZU!O;`x?dp~`aM%A:w*} Uªj0#.bم(N䀁n1@:hF[qcU#>gѮSNo3E[^pCYƲ]vlUٱWf]vlUٱWg*6*ثb͊6*ثbo孳ȉ$rL4w!&$NВ6.AHn! opcSˮ*lBDۏ2nl|F*>QCG.î 8߿LRz#.60M^곯7qc x7o@9^QZlC i6!Qk4aN">n$b%4`<=,ty齜Ok~.b3C၁z0܏׉Cªei^ TRE8H6Zu#ӈbO(U%NNFݽTTs (î:c۱/~CC:qh|JDy(U r0"uIhmo MOB N R]7C}w.'c?"' Akv;a|4LA!8Q:`tኯBܞ8E0CXPG0~:Jx^UUSlN@k˯|*Zpb6<Tm]ZdӨ0g=$?y/#`OhY${rgǸ(IEq"zJhG^جғo8nNiO{Gӭ),5bv?7iGo%oގbQWoj ̧{(D+pzs^ǎA6n=}B*#m_A|1BfL6#oq'OY ؎? 9,á>=B:̇|rvl(\quzPv&SOUଣZA e=^$tٱ mT䎛OlySۮ*5v8ѹٰu2]0!rˌp9nN-F# lPh|k 1{V*G6fu;2F +~1(늴hzbsU9k%J\RcPrtUd@~$॒;o_-r}rϾaMդ|_q:u(ųc`$OQZu7WYn[fOU0 =6\M>5(18Q"zBn=qQ7Eb{*9 Gu-W5>_(7B>,lNھ"+%d%cRExomr5È;đq%&IF`c+ө;TRQrCC>9LIhM;8:l5k$`ݵP}; ܶ0,sᕽѴqDA)#:]5)AH#F*eTܞ9 DlڔpoMVx]VTxx7sa4mJSgӠ!(?4 GWtfոplZ $Yͧ%34i#h`~`zn2l1FO  #9l/'YZۧ|HhZ*{f/hPt#ۖDZ˨t>d84%鄝T8_KhՈ=VEĪ:W_L8K2e;lU?rQ+ۈڣ =V }6KWW%xtu\cP8? (W6pcWX"TGحNIoDDYsrm0{B`[ʾ5d٬HU/Og"]P&re2IĦo,뇒_)ư$ueUp6}fP<|N@di4Oa|%^3.z-L?G,7Vzqi*nvFuk0˓;^5cҧ eAy.֜WF~ |G /dK.k-$f)a,fodQoXِ.%h8 ,t+!s:`zZ^ qOj< U|4PԷn@uAUbYGݖ@QQ-$`?-Rc&GYѤEMbNNYI[r8*7wxgɧ,ovi)6"pdNɸ2l('vJ >7JG,B0`=qQSk.TX^1m$o˄`rqwP'MNM«<\*̕b%H?epϬuȜ9 A-"FYaJu[(?## mupMӥ)r2<2w[O3/z}'ƹ"l6H͕c'pTz4+Џ ' (/{8g_MXw,&z!cSAdGTo[mnH=Cc%I }j!q}Z̎hr65Ԛeje^&w%)q oMKRgB!(u`)S\#\QD9tyԍ\wF@FE9]sc%x8"[# '-+ssPiȂӊ{ b #pamp~N2gvcҍw7cmm94 v~ 䑳$p5'Ȓ61]2X 4Q-ֺ" W5'|"ipȓdE=*?g#u.;K]LJ4lxixZ5LRT8 20KU(I^Tk|MiQe8X[pV +Hzm-1] v5UC/>W!fӺ`k{f,QAJovbVA1Al=c>7#TiT ϳaBt{%uTᎋӦ LMN>jp@QHJeb*}EX8-ZdSC\[ӏƛCmg=)b^M]#"d0w; rͦm3 TGMWskETܞژ"濆Õ0n;[*H1pP%*f lN(ه\lugM2"nZU&aBPbWdS)c* 0x@0wOH!lb@m`qd۶&\%$(ҡ2dwr;F9-dr]Sߦkou[֯SҞ9nڸ5`"bāX{W+ Q!(}U5\p,b7MxVOv8k1CF#"een~Ad努, R;[6ت׆:`*{s Yta)qUKTh<UTo}ñU mLj6،UWu8%[ ]q<_ «O#CBw*+&Ҋ_A*7Ľcņ0*ć_4+L /qmyvWv+/M}KF; RB=`ur̕n:혠o@{s*w0,oO8*;w;\bCU[W ;=R]6U %+N{|}u$!!?RCU02WٵEA[-#{PDF݀1J{F34[8J#az} U9 JKq&Ut%͓TaUPf(BbvqeFSQ튂;m)zثalG^oc8޸B UC7Tv8D+XڇI ך8FHն? ~qPhp*MTb|"Ї:UY$)O* *NB7.,f5_p+|1J$H*̽1e ‡q5~[…v^;0cݜ}=UCq@<7ۊTN58@+'Kኮbۋx/Th|l?x*)_fW4Zd]p]*)+^$)\̃***n1V>mOFbuSC J}*;?I*tV]&q_%O.SMY2n*qvlUٱWf]vlUٱWf]*6*ثb͊6*ثbw?HIF>I-u}AP*gROUjz!bDU=Ex #r2x}AZPU|p41fYbĝL})@ܣF7: Uw Sq7p: Y֏?;S(ݺ(N IT81$v $OT @QFjxd (>5\BTZW4 &H=U؏<*M6oJnW#k`U9q'UI$1y7L*_M~LU\8rz~-#1A(˖m~8Qi7E=F(Tc}تť*H?HUxPi*G{|xoei#(qW+;`rX "qHޣ~n"[wP74?{N#i]EUF6*zw+Z1V0N sSU=1V(z፵wL CҸ`[O:b(Qc  x*5=F!(-lo*u>~„H?&%smKOClxw (zR B~dž(VgI_cҹEG\$mf FW>)"v~VFW002S\P\jmj)(_/l=Z>h coBK i_Y1ld' 1WqSbcH/\Uux?V=0cbdR qKD}atp!r}^*7FfC[FqƱ?Sq\?G(Cz}CR& ^XC PTv̔=}  )Թ*7(wC kP_1䇮*Wøţ~BJFmpܭ~l I})jՇR'ht„n#>$a_)"uu t^`7Cnj>0%\N?k_$}`J ]b U.a.u?)7_leͰj6aUVmc2ħpoāaUB z- $czQB"@=z$kX|Tػl9W5=4bV?v?8EWQGlUlrm0a&}ክ*c?l&:aUQe{Ň~׆ ۞-v>Huc=Xcnc; W5SU•bcsG{I4#Vg#[dFXw )j)~[6uMnO^UhGC+ CE>]1*yNJIAlR)CS"!ĽpZE56m\RWoV!{V^µ;l\ =ENW4~Ͽlp=? "v>{taI {Fp2\~X haqYRxvj1UuH7 CU(qКI|qKr-Wf.Cz{u쎾ؙ?Θ |@:Gs`d]Kk7a0+ l$ߗXۡ?hMtN=M(S͹K|I׸VO a:{R,D#jǼ"M0?X';"SGٿeB7.( rO\DKs]UXe2/Xl}#zc+}u+d ]C(z]#IAʅ ۸ŐiR»x*~&}E~vЉh ߱”#,@H4~ʪEc^?wOݾDAmZ)݈_©."hGᷯ1msd~-nIƃ#F;wʏ'TtŠ?\@i-)ON94pe޸ )b@ (ېQ[eVY›(}pR:}d4[k1GC)^" X`àܘ,{]~ n p}aJhoLnb?*\N5Z%7C,xTV4߯M& dҭ(Џ|DbN}p OSl. sariEfe*!$ڞwh$xЎ>NF|j:'[O;Fv#l& 'ndaT=q q@T~n%b:t5&n7Q O ;15G+?Z Ey$~&()Z~6Niwkp4eW +m7ēi&qONfTӅHlvH+n`>:RLWby!$/,A`I[K펆̲yiFJx$ѵ%=>~|@D| ؎t@.}Tds6ogܽxve7'rR5{bX&Kv,"tJdH[ Cۆ 嶓N>KVo贸[41-5n1ȡ r 45 EH;EfeNȖBwS^$eU^F25 wfI܌٘Qu;SymHې`}LtA5uh*+)n+84?[y$75bR?G'oFV 7NY )z)+@S#".dw?KmMc`OJ{aբBu\sd*]G%A;4YaI[N2jQb|LեA+O\\%k q7:[<tBp=ktZ5Me|JӸ:~ Mq:]ȔT'BC^,*9ى(}|#1sSڹ+k3xۓӽ*pRU~joÎ[% Rޫ{hCu,Dj@Ae1M] 8qaJbg F`({ddK rJa4FB9}l17eAӮW.t#;Fǻp"i#Jƾ9'/:kaMo$wXHWm *>9m%Ezze<[ҝ1qW>1#'=6> ([.MJ8dSj\*Cu%TDSEO,nG_EӑyFmBYb^/E<}RQ Nx&Ó4lObkFuL/;M"H@=2&]eXw4U9'줶@QS# Oxw݌)dfKV1Xi/Gl\9Uԍtm($s#ҤR"zbF$u~|Ԇy+J$7 $,ȟֹ2\5]ö!qAh6Ep`)B$j%&(,4vܻ+-KTۏ#m[xҎuo/CX(1nVh$ %P ?Ud pmvv3[M NzSo[%ċUnAO+$-*w\ma262٦x+wqVk2 8prGjnS^zȃQ#% T sK/.biZ}8H \.8 UDCJ]φأğrSIӂ-+}}9mb*J=I )9%$Jje )O^\tdEv~-=f":rԌI惂v&:l[p ӸnEn7cM+S= =lxcMyn Ƨ;0{l~Q`qt+ h$u'qU|}{A-ԶhJmKw,CV{a#Q$JbImi^\Wq}N@l-oU^hXiODQD+BU"ZwM{#x-8 {fjI\-GCc_W)nȞlQ..D;n1J.4kMN8yJTPpII9v V)Z7Y^p k{X(S#sڅH0< K^끮u+kft+Za 96CruՍ~8GZ{d)KI >ϰNL (m6_ycjSJdI,NEl0.h=ط:+v8lWZ%2\!5l%k50Mv,X kO {$ 5 F_͝[maC mỶ{㱩5nKN.v"S|ca{W؜:o[{r# u#޸PbfySI}a.mݖGj]!X q'M?в*`o =f7czS޽Ng͛!b[ +eRSmgWbkT|7$_XjPS),@XZpZ#DL!PO|}ݡK۽y|GO'ьv١[ck~92ӮY((c1Ԁ•$ּo}4 dn(xE8ihmc|r3sRxr4I$ms\dl+O-³mS l`2!qhST'VMI6ӞÎE@jٔd۽rR'StP(0 rvOU{8/v\@ĭF[𘐒MUMiS㏆X;*c ԑ_<^1/;Nv f\N:cT]11niA"h/R@Kxp=8?Rӌp+SM^􇷺\) ՐZ=wn- ҟ~) x(QX"ᴚX%iZ5qn)' .SkqZ\~h[(q B{{p69@,S>beZ)g9cPZdsδ3yj kb Z_+W]j*ziݽ@U9^:(9lfl@jP,e|yl-U(O.ٲۧ n714>;TPPSo|i8a-i= ,^b&XW$aJҥ>YFj4&\ bi]@~ cLEwZxM⪫#GuO8vn =7CUNXkmTaxRx=b:`Vǥ][ZF= %tQۏ ?y`[y6~tQ^۵Hcê P']qnu8N^Fr;w—l7e_~*~EM(8_ 7x`VdǤpֈF8:tC a>*0t~Ux`z}ukZR7]*Уlv?3G ]2y.˴l*ĝ|20w*!]Tbo_PHq._Zh7OUK|17Z+N` qW~h|bEmaUoRjz6rєck˱ -aofW秂c>NkT6*ثb͊6*ثb͊?*6*ثb͊6*ثbgs&ۏTn(79aPrBQ4A;L߁P`~*!6$o{b%+O]aBܾ}j) [wLjDoP| ?)Wr:l(\x5尸NJ*+lMqoOݑLD0O!lt2[QژGs[*K48O^O[0`Icm~1T)Mx>:{K#/ 7+MRux۝_S_GnZoUW1OB _0ZhU~.^ኬ(C/D*wM،LzPO/~2={U|C-NǯVj:vͿU ~zH VX¨ kvpmB\\'t?XTlaLR4 GxT0PkOz P_-Us]qۡ++PYzsjIb_Ҙh\*Q0ѵa`r-znJ[1w!7f܇O&[ci 3R[QǧrG|G87Uإ)}-Ͱ/n~ҏ\,6 .*p(?tW)?*ڷ5l;`GmL$[1JN%Zj:=PqQRd)UqQ:Umo>hƨ|p4inj8(;ka4ͫ'Pͣ,VMW0 Bޠ{D})ڟb^uYjMzUXEP> 8Tlq'oo|Uf-z~8RWg{c.\<_\jd0be"#Nuh% aFpBn lh~fRٕ?C e*RViNK8u낒jZYf01Iuyz7o|mWژRON  U'p7w>F0l|1U'e(zIY4a~!k ~,Ui1>8R|;7(P8UቐT_?RP_י׷*bV5^pli-Ocb*FprϿӊVwq&^[7*Q6y MY[t8Uu ۳\RjR2~qW0Y 䇨=F JQbxO GB:,ڟV#tHLti/Ҹ'WBfh~8QqCt4a2پ%=pGRnCskcZ?V 쎇 )>nǨsثBJMmqQ\ˌoV?>0o늶'+G⇱mFXT'Qv8s(Qf*uن=XE~8q p{ \ 0*6nO0 r !7$g%m*Ů*O2 3{<"-0 hdĝUb2 _0B_]%[?&_)$zF^$#cad@rPGC/n"2L #)$jP=*Gz|8Z6`AR8#QkdPљ{9A!@j:bM6-RO^ $LXznBJ+#5@vz'!hxdCywvwn+4\YO G6DnSґQjcpG Byfq"(ٕ"w5ybnnm蠒z#|)jw"Kh{ʾuCJ%%149+b |jCAzIV5H_lIBKdcEWi掷-{p:Б" 4 Ydh_]7Mz4Ó)!W催ÝDj׏!ZJA^$v̊"em@!5$6rܗ Eh*oن@ٕoh/$D|#+dDn;nI8GnA#$( d X,@vv5f;bcZ}UpY|SOTvFI"2[%!B7$~ bmuԱrۧZ,?kdT*x-SfVqj7b?ɮBޚ1gVR6 KHfr+5p.O԰KZ֟NT6mvrQRB\Ų+xd.5WϦ@` %4Lt^ʦ)2_ustVEC;V̹!Mu(1裸rڵWW#zԓ0&&mBzx76V8}Ba,biy oFmUke$JvħZ Ho-M*PB:vk,Z3+$ ՇpDž詖 % l0䵓ƀYOݙ; KLP[P^DJzdA4Z )rI&rjWè?ub 5FیA^vLwoCqZ,LeTC5GoA @+Q\i^a:h{{HyO7{orp4M/IT< ̓/5ƍ9 5orCfQ懃FL#UjA]v[3Q0Cnh;ۓKiw>*ÉY259E m邼'^EJBӠ;`$(7<r8,"e.= ZnE fu;h~Xsn <ڪ:qNJ폶+>o=2\(-BŤܬkNuRQC %?g DZ?ūP|?h-K42OLMrE=V9c;H5'nxr6 =G}@ @ȵv$6aP[щN?Uk@u]@aRkJ+wNbB>8!ou:Kz $=$%K~2ouS[[WGV~UVչiؐ>)m{czRF0aN/Z+˫ZAC"HLJmD gq!ź\XC.|ABp#i(ră({y#87;6LϞaPF\ԵX-:ʣt &!oZ`+ayo%Z4Te<U JWshZ[jR ##ElӬD֘euD wb"ov#uo gj~o*㨥qpz vWH`B͉&"xT֕sH[K(=񚾏%5D|bcgYB89_kdܱ ;d7#wb(}@5`}RAi)tv}8ue\?0Uj XgiaJk/^ MslurPz-GeۑF|՟KD#B0E$H,/!]Xyv371Fes & HĊ uIr"$"8yZZX]ciL(vD\vcHя#ӻ`L Аe5`ܲTHlp<]C# Vf>˖ͣp=qEfXT{lT5jbmexG;IQ@~mia.?}aLe y(I9`iNy+Sm$^Fx}d/P.ώ/Ǐ0Iׂ!z%Y2ҟSաemژm㹌d^7ڵΓv$`A'¬'h2a%B Ʒ__] ZSk0ޙ*R _du+KhS5-ۏVO7"-*Lz;^N2YG5~}<1*N&,K:hV|Z( Bq,iژl^lxۋT_v%qfYVXS6ZFk(%p]YBE_-% ĴgF&H]|Kv׷p<ՠC cJ)P}IP+Kf$&&2G# d;~R{cKr؏Sqrs.C{| rXEՊs-Ė:qr` }4Tyh޷@1v?1-8DS_]8os{H @2&$XX=HVGd#rگY-z` Mw0Eh0n$yt#STE+h(_TDT$n}OUhG*SfV.Vj%Ul1-"iuhžĠ#S{Dn䣰c pAM=>ǒN%v,_qV8mǺf3H ȏE+8f6Ӯm5QKRА*Me iV障2Ynv2d6KtDP ;u8 P8צGB8)L ,rBpgm5]3-H x %_iv>08NkVk 4ؔHjJWI6[ LAeܐ}5i}%O0QŁAAP"ҧ)dkɚ0;逞HsQS~i%Ti^d`Ê$8[G@ya4!yӥ0 :+kUR(+9d BGZmzJ -@+JST$j4A0&=GgU{2R'vM<ߓau,fyԄ66tZLxڴ#Qhic uL( -\[u ؟雉yFbIp ;^=WB:}J"@fh"M'a]xv T$LYo r|5_0$Xm'$zZ0~akET& FӾfP)޸cev!i]6RI`(Ğ nwWou"=pGvIdcIKOm(-iNfP6g>ndGfBDiEKoO": Y+,_۶Y"l 4bĬ{5ІSЌ)qZq3! c70vVw\pbw=!a 891K@b/…Tu0Cczf/* p;UwDc(OlUہF|G\I1Vgf,w=jIi]cq(x7Un&+k_-jN+?)S qm5|'* 쨣KTdRUlx[ኩ 3#-eޒ|'\b俎6[`[]OC߶p*0!8?p 6>1B"ETb@?ߊj4aLjVM;E^?UC,7}{[׈=?ӣ^ `{Q0Kov{:}qT5o#v:R[ֿH*ztqj$~R)qa#{,Y ӏ>PJ˳oN*Ĭ 8|Ta;b O1U/׊\$?>A׿[8XL §džbi|r\#›͹7?l*ګ߱(k*h*$;Up%{3xTl K~8U#~# z}m?fDZ[ˮ(n7Λ)M銯s딳?إa 逪PZ!ٶVHUڜ*Xy H(ٱ4%wCCqUG`q^(|qT,GGZ%mT3FIlFEGq^`i"QOׅ w(|USu2Q=&)$ru 6zr)bu.Մ~?\,S[3.n`^pa}g$aP>.z }Ug7ǣv]V2{㸆Aƺx c4{\Q_qUt?A+Yv#)پ\t~en{Q}8t\ 'AQsd9/*gf 0!IJSf)pQ|~U16$>PqM9eVTTPz╍/^g]1p!oCLMОq+}#I)S…`Cn>zbZ~l6os1 1W.%5_O~(wY2n2evlUٱWf]vlUٱWf]*6*ثb͊6*ثboq1`-U 6ȹ HP0'B *>ħRm~# m4*Cb~cs Us|kkޢۮ m>_U7x(MB/g]J ~8dIEr6 }.4#u=(G/*(GQHU @xlo7)COH?``@u8l`dPbdbvC”GS_?\R;bZ  v8p^)]ޙQqnWr\e>*Ae>Ui^>_늮=1$rxUn)0cP U)N<~XdU{[ECzP$g c) lJW-֌nk"(#2kG*eؐ:ۃC&)AwţV\B:d‡r]* 8" : C[|VX|kbPPoIӨ8.)ip4};(D,u6A8y& F1 ~`T;iqQ&c㊨dI~Pkv+AP{吲 j w&z P9wٚþ] y!OoTsM1Uz+J(}B7,'LDCcM{Rƒf"ȄN#l^@Tzfd2lz0=)?(Efq;b棯|AM>=UV=qEv 6:QIXZ\stN |iU{sjUjHa4m9Q*d9vjxht=phnb\ ALV48ЃKaUw24cB6!ǺPنǾ6H}m$h[b*?u>UY.j5U[qOT*O<L | }*}-Ű-l㏯h0%A,fF4A.bᘂ_QNPsqn0%,<%Ê35v%FY5-! pKrsov3P(IIN7#-nE ]>B+8c$m?k8/&;?-p5UN@iő((w9c%]ϏD20nEaQ:w om1U۔|s S*9`'VN "~#-xJEkcC81)SB^i  0 nj7R=)(b d VҌ>㎽cnim/+ ÅA\j?V=cT*xfk _u#hujwSF?;啮؅h9SQc;tªăPPJXCUEpǃu80T4=|Q@⇯cW1CwlG|(^#t8" rNUʧn*:wU~1Cq];Ҡ-W ^&a4lUQf7 Z8ߥv=*<:ql7 RIC-O2ڎ.7 :hzQ`E+zϬWgQ_,Tu„:`Iن)C̆=pO J 07%; јMU0,>XOǎ4fbRZSq Gx͚6|qWH~%W>KEiO"V dobrv|Xioș9JOwzYqiOc-Ji96J0hJ孂zRs"dQp{sl-Ck(_e˸n$VU^$\.<2W8-?Q_ӟօQrٰj2-~S `WL,oWIr~BwRBҢ9lwr lR2%HJ0.q&-+= ʣ*/?\|2wNOx-%b?Wudb\ru5r>b*cV.{wQhdEd%ٔpR l _o+ٮ0YQp[UcA4$}Ij~JNe&ǣOQCı9-oMW_VU4 XU5n$sؽ7r xfo)ۃG uQLb5 4Q8(Y d dW޸< Q{U\C|LTM '1{/[F<ʞOÎw)B :EJJTkw$ !GQޣ!*J>Z4ZN+iC$% |,+֘?X0ܕ*߂,!" &\,w%L~m+ qUA>99擲~vr)Lc Fwhj2*AԌy`RBDQW\^QKy&ANM-BEPboRɅ8qؙJGƠ?EGm *0ʮt@G,&9E8R|8e 񩕅 M!|{{Q=u>[;k~Lmr! qC(p[6?J%H*}ed5J_9E<_NwQ.Թj^AWB•sqI,4'8\gg:UxwG ŅM+У 3t;ҾͷۏD՜9q_~&HÑaH7msn x;7Ep Z/!ct5ukiRPԆ5ʲꁊSɑl4i:g|#'yo"YGf4 JvvAQ5`naiXTQW K=2 졓,M8Oŏt*1ȏɡBOZ脍ϦMwonJHEpZQGk`8-eO֟'AM* 7MoR{[Zʌq `Vz2*:nu vcJS )nf(%= #{/D[XNΪ݋I{įM애Gtf=Af o#=HFܘ񚱥<:|f"îbWU$DL3AAeDӭ'{&?=lLiR SHl{tƜKx{tί ~j2RL jfўU0ZR2F%f)thZ z|V;`'\v[- R*}H+:zq~?k-W-tzVE]ϓd㲕Ԃ1ωba\ivFH@2!գ#Jّ%\|VeX__Ik /16jb%ȊuȚKxxOްW6;ԒvHOr"sSP66|vsZ IVez :.&x$c,-آ-#lz{I[֑ w')\t,,&jOo8TLA0!T:c%~ oDlV޹.al’PNX"EVjM0a+ڃծNޢ҄V%ьE9\z ( l[$Vxݭɹ{eⶈ9iC%.8e~W s)n6;ZAZZą~+&듌2/Դձ`r;{遶(ݢ?xE1B+Dʿ)j|ьh2@)T2#FjȆJe]P0THF,Y CkPA }]X)MkxZYu 7MetnI 0F C'C;㒙^d*t *I.䴙KʪoBHFQҘ%cY0v^+2?J:#~i}6u$2Z|m.Za9Vt@ $x5邠hkp EVSpfum*4f ;S/Q]KU-kP[,S,j#Eѩ AURVRsa E[&GM6NJgd'# ;Fkur!A=5aFNg^q o5zdmKm9$Uȍo--:I#I0#J'vWEp#cmq$-j=["mpEhm4Zܪ}9.Wьj2iQS{$WU&2x(n2M}4n!zي ];VA9Hf_R )JP[m +4`-MFYV+PPR N9D9lĆ%{2%8h iɦebTll #qziay+ig jC"dpGVCnMb+m&|5$5E4Kuzpl5z:(fm1@僛;Wzbh)0j#m쾰F-i]33u -bɥ>xl o[q%wvGP<_}e.SNw MφW cd# @21&"cthq.MP#Fֺ29kAs&ٍ-xztTT`INsݍ[DFi )xZoEOPvM"IRJvd85vLXfcNG +JXS\p5֏%LO{#n5#zɆvPӣ9`98mI!b6ۙN% LTaZzeu?OLi6ɣ] Cĕ??\mΝ5a=wN*aޱu?GP8UTM]C#*8P Uq*6͙Y[|-`CE |F?,( Uo bd ? 0 clH{?L&W8Q[l|qV2 Wi>%Ҡo  j<1V-ef▌Dt{eJ*1CI#)n<1TJʲ 64rT\MTxpJ7UA+Fv{bv8rN l}8UY6d}#*kFC#ǫ 䘪Pqű_´4&4j*J7w17⫄ቕd= m h)~jlq+)^hۯ|pM]ѺfAExL:H5bU؈oqC۽4<}=XOi$ǧqE&v\88Qq5]x\*ZS(')AO&0+UoaYC']ǎ(l~|q)lA(T:o('8솭V|qt=0*U߾:'OqUhK HW)Y>bIIq"$/UYe|'2LG]ǁib*nG_0Su5LJ!l|*6,Z6px>ڽ _n#n;b[u[Ƕ* (q銢V@G$/8O~P#QLw *X:o?VHتs4;SnTbTW3ۃKxQSqZ W[14}E5%O>Gm*рoRؘe^JLs;!ه5`i]?c4RBx&©M0A)t8ǔ}w_6_iUmؠ 늬*W׌߫.YJUXbqcB 튮 1B_U=6V劯VW)d*v|6>J⸪քhF*lA+sc:c=!N*z}h~.zُ$ٷ\U,gcB48kףRE0%Hc/F*[c4u?qª@6eۧoIQ@FKa>JnL_L73͊6*ثb͊6*ثb*6*ثb͊6*ثbW'b?$[qB?`|tujzRQ <[C@u&θ6u;;+J(9)18UR99/!ud,Uܩ} PoQ|bg ?XKꯁ8?ǩ|?)XW~)ZW=qUt،)ԬxΘCk Pqmu¸C䐘*pI>97$W~XM'u?Ϳډ`J ܎T:V3oLbq jx ˪R):`ԝԍA=1 d J)]v#\coM~]1UpE8c TuT^>~bLt!~UY8ŔL m^FS~qUG-d_bYthb+ٺ<z`KRΑ Hv;D#rv??lR&shFT\m۹F(Ċ5G*7|2}m}~=)M'NvrsWQ?Մz^:a HOHP+CC^CFJ$6E/dL')_げh90hjD܏)CqQT3mwBM IvizFoO8|?U^7ټp,>"& AJhʟR.cڣob`e%ZjCb5`J/}p0QG`&К)ކXBCoՊ4c۸V$t>#\tyZfMM)vqX7?.ѭ_n;ЌTӵcXlTSvԦݰ*wG\FHl Ϧ@fjb6ۮ(R Ӿ07bn1iZ (_ )n|-?PO0*rt8h|kZ&xPzc✝pSC|(qT&&~>)hp%l.XcUK9/1U劎-d_8Ru.BS},lU܄´xbSS~aoHi0-HΔqc'1dz 8ӯPSź5N#4~8P ӪW'NkŶ, OjJ/^@quŨJb 5qc=zVI;6:佻aU|~$=dž䎣=Zmb'wCn'g"F;{5[ö#Q ^7K^(6&эwC>mU5+3Dc!Rk9Щ'pHiOG|e*rB\Z zW8cE5W\Y>orezҙ!}-eC60qQQ+y>n0ʅiZCv_1aSщ=YVy5ZHX^I}_")3͖g~ob]^Eץ~A4R1$lL/JwXgԑ=92`(UZHASM#u?&MnkAh!(Xm{=eʓ[ q|$ʇ;?,G Zh#3E~GLx(b\RNJACO @PS6%U>4mXM4pwpOἙ%j {=:S…ay1j 4Z!H#n8"Q4 1H_c5=66`kq@#P)Z`/M33h\"de;:4 k$DFYL, 4׻#. p_N~nW%܍%sgtP L Q()S@F hz6~/BC߶| ļkV8mo pJ>5ڏ A E FW™8QU{__TFCǵN%KKD`cѻTi5QvTRQo_g m. ?ԜzyP#.&#K4{h![ Oїt36Dp%~ks 2`mҠ&MXb9" ԯ[UQEQ:H`yqmOS}=ZXo`-B+4~Q eQnVBOHD}]#[Fwc4>w ^qixiqpo}hޔ On$ rq= $F>? "AZx0 3 ,'兑,ۑ++9A;wmӭ|XImۂkɲFwVU*£&bkryڇ)RI|gSYv>PO1_Egk2Q]IFRO\5jz mlU`u`Z= SN<[Dŗ:5(J HtP9|{WMi)7_\T*|}Ƹ[^aG˷\;,aJnBOfKG<9EK"u5juArqA8$Sknbr*Ԫ$X"Q-l[ ,2("v=2B SĚ-2C܈J+u' =3EU+ɔ(h A0K];RB>̡gC3. Q,U(~3&M/R6ԩ r2Ti  +zƧ q !#]H޿Ox:t>3}F j 9Txha$\ ҂?P&" I6`* zbN!J{,x\qJ{e|JeEH; ̖O dZvḿ67n_<.AĄ֫dM"TBAM3@,rG*QI }x7Sͥ7+M+7?ܸ > O\WC)f$٧q --IR2lȢ1;+XAH;d}5\DnjB fBaFnCHu} O3ӒkD&ITiLfE%dU6ڽ[zW|y fTr JueL+s@BfC$^'c윬ZК OJ9#cnF't94Pa^sq* JٮYB#HՀ:|l=EO59>*A8c3' FG]dbĂ<*2GJ,`ۙ"߮#[Zy'}C{de@ָ2To}ֲEcE:'[ǫ0^.B7j'J(S-SR#n ׷т5X,'BTN\MA;OFPWzvm(Kn.2WF#eA&eJPsLDV5ի]\qn%j4mZ]}#rm< ɶGoh2@<*;YJe#W܇b@O8D D& [{I%;u"eh轉.<(kMԦSk*.o r2FOJR0,$o`¸PBۖ'Dƃ~5,ejSN vmTjfr5"Ѐ9*ÃV Ě /#YPïvH둶vW ckWJ;Aib;i?+x`솺cdgkO fe |#jmI]X0!@T\Im$R٤D^N@$ hǺ0n\YLʟhm".e!6 MU| M⚍vmECFd$QvN2V"Z[!i'5( T5P۬%bǭNf%{Irqt ?!~m7Zr%HHHz-:rB.zJ+,52,**~׎;PeV(U<%sf$b}k_O5_Op՘ ><ɧYj+ 5?1/]B;_utcc(K^d:#~w  5c 2sq$6)ZrY#qRԦ)/B)!ȸmV\ u7*Oܐ,XPta^GqHH;`Kˍx{#ܨFvtV]Y0R=9.PiM^TC*neYghJU;$Z-^1e^{h0nbQmwZ*&6^WƹmvyD_Pe@`}vPaAbrX6=VK֜Pm*ʳdP1aO|ݬH,#Bēֿd[ m^YCekk62]4_qr.ȵm᷸<0!v$Q.:'f\1O@AJ}W`VnWc}\JZeX|EpOb̍ΡF'?[vhGUkA8LҬs9jTT 8BbIb R `DcoLZrTċb-׮pXJxAYzeesn̼ftks0S}m0X$8wݚMO>hcm a)7HJ7 c Ī r]_EUznc]e 1B!5ì=>TFpt-FEP(3,m~Ky%?ޕ9.L@ES$Q#PjMbSciVPjUޛaΓӭ%])e Lloh9!z(ܱU#, Bw.U(;dNƃi3|jUؚW"%mpGX Jw6ʫtI;zɲaN2Eo:~&VCV㾊kV=Ukj:n / 0pi>VFNjG͔K4O2</ngNE~m 44fŵZua'@HK0BkUe,ŤC]òHTPh(aUwbŭ>8DJVȓl^NBqaaV,NE[XDnֽ^[CԞ( )㱮# ,S߾%M,]Ph?Fڍ8(>qCZD("bmV뛘Z]zlg^w~AG8֩eO@)haA?-ͣeyX+%W@>\$%@` #D*?D3m=R-پ&"j!l,]C(s(B.o@(X Lbip4/ʖEx-]]cTti%» olGs&v P#'m0WnR/҇w\&!uK)ߍ+1A#{4_rx_|+$zժ<[4M""TvUIXf4~JBgc!)Ĝ&FTVZHl5>%%ļ%#“'T]4ZQbj0ܑ(64G4kS#yX&N `=9O;S!ާJOc˦ت喝w# &ݼ1UCC )rb5-W-ALѧr=hSi}ƎIY]OKm:!1Ujl1OP}ph : ̲ ԛ> WCs9tb56q#aUW=w6qA&S?ƸjalBt9R6m[x)qWm r_WQZ~Sq8rWc|aUeu;1J׷ FhpDLwuث^#q⪩('cLMKF)W>}U*2-ųx8";6b<$<ء]a{NSDKk!M%ĆUG_Ey[Wu5r[;bGscG~Ub'_aⴾY7+J|04f+O(w/7>Wڣþ*)B c[U78*j6Yf TZ;8%7SQ-gs'⫖Bę QX?s<{#u;ek}@x╆"~u .*o|hxw|vTwm`AM_- woe2/"I9EimXQn=z8!etvė|V2E7g+ɸlUٱWf]vlUٱWf]v*6*ثb͊6*ثbg~%?FI)vvz1jt*$>Ǯ9lV:- ѿ ZEG\UF&0FNӸp5q=i㊮|?x1B$? +_t SolUc[}_8U7McjXRE߯lXÐ銨،#UX%6ਬwKr hdn@LWi靣NتhTo'G?n%+_nb>=1a&;㊩z[z]lXv#ڟd\Ux<|?qqBfjA߱w?bd V9tqJ}H0(|PxȵJӧӂcJ|Qb$)/ {5!V؎*.#bcO5^UsЮ$ 'xtq vc〮mzrHFAr:+"J÷V%C2WP=#P\[ǣM8 oٱ J6a'Xmӕ"sn'r }\]^[t#[N"T#vaxWpzozSoyyU^)[ t~%bO!ź8*SzJ:ukpٻY*Oe9tYWnh>@GV9Q \?Ŀ ➐l kF$ej?1UaTQȷ$ >aV)IdefOiN!$ؒ9Z$\Q˩vzT,.شrن*$CoU=|<1=aVN??x8P!"n|eLFӱ•SIEWq߷R'o m ;S y W+/?8fmNh9.pZӣ A:=3%5~<0^5r QF)_t867[C)K捭N`SQJ[qnHyFwi[Fv H[@Z^Q~Fñů,[ ;!(};U2?~GF_Ɛ`@hG~ب5|7ý(Q6xS*^Aџ6a\8z zQvTo{fx VQ_a֣7߿M^ԯ]8?}690ZϦc7X)?gU[YŐQO@wq@cLT@N{u۾* $:tdɿUmt:R v?˰N*)ݹS|L0IS5-,Ii7þ;;e\nY$ ϤuR[$e GFASrAag.RM ga"?[i62U,/*;6[뗶z1ad4}`HxbFJ#dr>*> Kar~]Y"$*Qۉ?k =̥*U@r4 X-)#WX)DhiĎfHf%$qSĆ\>*;5nj(6핑MTehز)@0obpm%Xԃ߾FFq$!onDJYGpv8i% #cm#(jv5g8kZF"ůkR}ud#Zx #QX=943%Sc0)HĠj>x5GuNq'R:,+eJ$A$dz qS zwo0(;bQ}P*J$F$8ǵ~m£XD@ک"v=9Y-RQA.s!*wS,a7ci-[fFƸStB-嘫'&72ԔN45MK]ۨPlVX"#܈XO')dזޓ}|42(T /(!C^].[hKU۶H۸N"d~-o%imrAO$2X:JƤ%^ Po?,g]!C%Op>AM. YV;]nVs.恩@>4h0u=;c5 !P9 H#+g [$tJ.cʙJ‡l&@fw۠="M|{G.4Z3@ެkغ]kc*2))1=}rM }>S˽w[Y*`t7e VNnw=pD$J&mQ-p5 VJJai1R4@jq\ dAOQG}ҳ;%`q b<0=d7VZZ"тa'Cv=0d:#B+Ja憹K@yj48ʥqBbяD5hgubw_E *GC7ZMHJ .Y.nAND`DEx8R$ET'J@Ozڜ \al6 F[ib 8Fo]]d8]r܀Wq-AAdn_铒B?9dHB^H*;S n.j&x/FOI@u#45׌RYM|CR'hlwHRȗqm`|iKR`$ee#ɦS=؁]G˦"d'eHo]Vas QAm c* kܔ6jᦜ7]!-dAKP{&v :jv#-TNi+4єiZϙaXׄbfVb(kf#푽VғUOľ49 S?YD+FJ (p5e΢e!&m>L J *kXJCB؁a\qqi}##nd7 E0"+!rO75 p)\$m7y8dJNأI$6!Ǫov὆n) kotŤ# b:NQ#4˜KU h5vy6Q[v+Q鿽iAe@T-Y$RUP )4m(VZ-r>-Ԓeǧ!89Q[3H< n¡O:tҍv_' +&Jښu a<uV,A'|0;In'g^0 u"6Agͼ}э1^TRB,KPB$#Z)``'r$/$J) t'n2F])TV+DcmH]riX:SlĈ T`w)Ԍþ:mN&$Kź<`PFAm(KALKuێLG 5z 77?V+Uqa2I>I;cǮ hQYXrDA4bEC뼍!ؚKzDFWr"-7 ]௨G޾f[1ķVUpjI0W+T~0Gnwĭ$Q,Q(6޽0ev j"),0&^JM{v/mf$VzU~ؾ2[rZUnA wu)x8|v,H.Ԫ/BӝCHMr;pH[(Mj iPM0Ƽ^&u4Ol.K81h;Iu.P64Ce-Pb/|1B fK6߷m,Ly:Бe$Sc GXRdF%Q<Na4` zrUw*UlWOK{j5h3j^,)2X}L &ԟ21TXa3%UTڸ"AnӯW^5dž%,Pi%2=ZZe˾Lِ,X ,lXڴ ~mlh*i= Ry4>JS#ז"x;8YhamEUfh(𸶠@gPOl olz#6-YpƼ\ ٖ* 1e܎C#a\H4v$+4^V_Mŵɹ(ʞhմ 8=-JzlV m" $`|Aeid4Kc"YzB9mMl1lǵWD鈒m4+,HPObZ 4z8@%%^rQE3`M.,UEJ JzdI'Zʮ*44K@߯ᒜ&s㆜`w*MSRr1ߛWVx 61-lApzޘ H .aQLe7,7:}01([mi$ˣ+YUr"=28w`a,Ƌpퟲ=|Dd .NL+("铻 ZSn~{7]fh T鴣dn%RaE4߹i5QU#Ll8K`nRϗo eap8))Hh||qCc%VnPe "]`MS{C䣯+VBoH0 #͜C RZG|;NYqqn_)\qSbx9sƉٓ^>ŧ1Wp?l*ݡ?aBe yD`<^6 MZ՜Y1zfS:|wCղ<ꧨ($եasFc$ bfI#pzoS?*adǦ(m A*q@u늯I>$>REq튬Pb#q1$تou16qW-x&V4 ۥAԬAUDSq#M5/d9lö)mb~l5}Cbyݺxa~lOݔ\Sb5X!T`Bdl{ O|dWp?m0b#7PJˊ\%Sz$-DK%/57NqzS ⴭg# Wԍ؜.(ǁ„X1<>8niR[>$Y6l CL VĀو2ݶ>#++5(ヲp+\׆Ǹ=.lR0Q0*xsza%0e~늪W?lilIOF*_WB=XX2 UNKuP0T]1 UzF?"ѐy#'/t7#X,LJ[J) =U'=1 -](%~*ҿ m_PP$KH’e|BF;dU|WD ,XU|"f00]њ:[C]$V=0n`pCSg^HRgqaSGbXIC/RF*!OX?b 1B0SlqUXڛ V Fp*~ 0*!_:*xMW$"E1ъVG+D}H6,FdcIʡ~C=>ژPx=:]Y}?ȲcڕYJo ޠldjRAG_ՊcXz~HE仡1B"}adTb7ӊ7Q/|#})C) ,;~G`U F$#d_, #zOS\ @{5ۺh_ωM/ަWRet?*?ADb+04ڽGǚ}O_lUNOQ)PGn,U܂zz5uVȥZF(}CjXT;UOQAz07_< Jmm-21F'pזǦI2[[2?4-lj텊d{_a|)RuTߨ8F].IlE=n0c?m)Z(~~Gm fyN J$[^+f;7cMޢtVE/NorUe|)ႃy=GC2$C0ӱ­+vٻ㉘@Wӌ3qQhZ$(iGzv? WM/b}o["C#,gsWA ' xXB: xnD`z4tM)[sǾ'_T0Ϻξ~p~Y.בJTlh+fhQ۱ $ 1wWfpL9tqCxbMW?aUueD_ׁTB~a1R225kQ~"9<1K1UQwT |qJ]06H;c[vU5 ё'\PJ81J٠zs*[^8 'q~(j7>+NhZO| h=_N[#uq{z}wS1J O'6V+>UxȠ=TR0*XTm^R$QEuUX1}Rv1 hѼ1CiqŠۡ;N~xx!,F`gڜ,?S#R0\pӔo14 Jn!Ok8%P in:aJuVTjɁ' ~ mʃZt-XyMtu Bڿ+mdJ0#ŹYӄH%@gɽ=+F6[҃olV'Q:Cۮ^+QPqwV^2uʏSk' |B U})|2x)['<ЧOH~\= I_%bV'~9wv1C m"c07'ncotFK9wJR(v,;_yf1+Z)ux^I(Rn?dƙp)rBc_G4Ryx[)O;UA@~scKKw/l .BݬfmB;y(|q]"E,zmW5N)w݌[ޫ*Ubn)m7>=q1Ӯ#mCOPŔh2bT :6]]5S2i'b Mk϶KqK{a`)'u>t5#c፶C'8 [nl"m1KVt,;th0ݓT^aA;}wjŎڴC3BƄ=aC3'!ZmCP<.ԏ\'ԧ̦ (N#d6L!hЉ'JWBji +_ލž IH!> +qW1z7LiQS6jBZy}^D`Sr@hjѱqSUjc~(pQ'ej뗩kq\q{pWͻxdPVR#mi\SHYIG| 3)tB>8:<ЧZֽYdݘ-`Co22mU #bkZې3٬怏ՈRC6rf)3 qimHxHL؉)r =G=agVfha\8Y^uZ\u>Yk4bPiڔ巗 ?V`5ՕOCPd 5.J+qxmb"oNBz|ZRTU4fs* # Ke9 xb6¤?^i+TLt\o- \oze@,ON6!]11j| Xy2\&=pT]ycrrS*cjzaDant"Tfc҈{9~MExeͮDhҞ8źI` Gђ6k5txf`~%ڃݱ'eN6;8Qoe}jBoϣ>-_3[rKSLIP*llik F16Gu@ڃ t'T#$AKUW)E=P~-$fRdaDf}%xT秆XCr-=[DAȓ-Q"Ak>$-*N\iG'/XiGv>&.0c$wPnhbRW[tspGrWM't@q8QE@(ḤMBk^Z  $#j{/0OJcth._Q99CuLUm]M[$*ܓMSե&)I\\.yiʿhB3[ڣ6U-T 7ݖ_\8