?ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 10:44:00  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?z]m{]X̂\~oVxݟ0h|ܣOTi#{Xk u@nSE%2X1V<|8IN IErp<Q8o`'M~Jb"DGy vOΡ)>"\; g"?9r:OLAd#/D>gϺcJGgP)-E`Ϗ1zsRGޡK]Dm;V<)M8?eqSNݜy'}@sE1.XC&I~bpl?{O9zفų/.R[3P?ƣ804~D;n{=Rx2Z=d,)01fI˔ƢXyp[_T@}D9J>J?[/'q]J5G9,Ila@<xvLp34 u_i< )ohY TvG1^Z@qr|G,cd涣@or/qϟ(A.{ɽ_h0;֤"aI?S*rnD, -etp73i?9~,;7okŤDoK2Kku[lxNـ\'{QrAS~(b~f  5ڥc 44|N`yCNIa[T\N}QPI)龷:Ds#{4&Ljtm}l`wQ#~P5ipp AVaŃ'Gn^@KsD`'NI'JDz#G=m<T, iӾDV&$~qpo]yy~ߣ<ѹ?|C~TgSõ[’4k&2 xOTkK{VCn=mklZՑݓF68۟P&ڪ6Peo%lmMS2ŷ_NlȢlD݆gSN6]ʑ4H6[T} ?#Yn}S COvIO꾵=Z˞6Ik?wF:_# Oc |'((Z@?ZsBtsy)j}۷BI!:ess9@1Ҍp X\C.'Fj}ڂk:[|ޫ]v Z_ n_(1&d\K7fi( x>_EݫZ;:Fc@!ㆀG[PI<&})˕tqs:~)4wd\+"9"i[[\]X}J*vMmw hg;emp~荼*9 &8;}pgkj'9dV@pCZ]t59>dA#v9YtpB'?HVuCp' 8p;ݽg}Nu=cp26w޶#' hǒP2&7ga,Ӷ۷]KJZҥѣ^Zu}RzB?M"$ ~CAXt=J<},f v%+*< ڠ@&]U8?K)pd&Ջb9̍MVW ҷkӨRT[Ca^O*N V.3U_,o,-!is>_͛ZǯGσqnٷ2Z;I}UcCCQk5?ЛY7kJ\=<-<<z/ޞd[To`qѮ#)9>.:R5h?) +?3!ǘ{?jLNhca֞cH5hӦ?;&È_mqH?}'I Y5Pϥug0} 'wH#h}hDCq$n*$dGPkthѾx[8F#)JG?j>c>634]:'vw ?ȟT_Rlf_龷ii3v,ց#~P0?B!{w\CxxRuAZuR>h{c2/"DXޑ}3  r(#Pb;(nioôBH 5niz2`r#s{1ÏEW4HJu~md; k9'O=xe76d] X9 9f=4]Y1qoGw c$L#y3{gOsԪhs\d;h'Ycw5=A$(-۵Xݍr{<QyqqN2OeylA(06Ob{LNTNCZGyZ?Usum[wcFЁ:5}N4cdǹELu`: =9w M5#_!{ twWik\9 i?"!kFlhcZZucҟ;:c?cw psTК#}%+s~ѴGۜ;B{\;A5g_rsK:@ _6.JήZ6w9csK[ZGdB25=I^wվ}oo#e&}^[aINi7e)8y-?eF\7%9?8;ep77A}^Y'G 撜ZבSpn~OGPվ-{z!w-3B4 9]+@?;XKt^?Knu5Ե 4wqǪ6r 'w ;Kw0=Trδ sVXGԗ$Hço֐˚5$]kGc`Is9ѣ_kֹZ|G?ָw _HJۃmhp$qwp?V>f~*'X<ڋ mFAmR~ CTV1贴7O5wf]fMa}aK7褧Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTVersant-180_PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM_ update_maart2018_v3-3 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM !q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?z]m{]X̂\~oVxݟ0h|ܣOTi#{Xk u@nSE%2X1V<|8IN IErp<Q8o`'M~Jb"DGy vOΡ)>"\; g"?9r:OLAd#/D>gϺcJGgP)-E`Ϗ1zsRGޡK]Dm;V<)M8?eqSNݜy'}@sE1.XC&I~bpl?{O9zفų/.R[3P?ƣ804~D;n{=Rx2Z=d,)01fI˔ƢXyp[_T@}D9J>J?[/'q]J5G9,Ila@<xvLp34 u_i< )ohY TvG1^Z@qr|G,cd涣@or/qϟ(A.{ɽ_h0;֤"aI?S*rnD, -etp73i?9~,;7okŤDoK2Kku[lxNـ\'{QrAS~(b~f  5ڥc 44|N`yCNIa[T\N}QPI)龷:Ds#{4&Ljtm}l`wQ#~P5ipp AVaŃ'Gn^@KsD`'NI'JDz#G=m<T, iӾDV&$~qpo]yy~ߣ<ѹ?|C~TgSõ[’4k&2 xOTkK{VCn=mklZՑݓF68۟P&ڪ6Peo%lmMS2ŷ_NlȢlD݆gSN6]ʑ4H6[T} ?#Yn}S COvIO꾵=Z˞6Ik?wF:_# Oc |'((Z@?ZsBtsy)j}۷BI!:ess9@1Ҍp X\C.'Fj}ڂk:[|ޫ]v Z_ n_(1&d\K7fi( x>_EݫZ;:Fc@!ㆀG[PI<&})˕tqs:~)4wd\+"9"i[[\]X}J*vMmw hg;emp~荼*9 &8;}pgkj'9dV@pCZ]t59>dA#v9YtpB'?HVuCp' 8p;ݽg}Nu=cp26w޶#' hǒP2&7ga,Ӷ۷]KJZҥѣ^Zu}RzB?M"$ ~CAXt=J<},f v%+*< ڠ@&]U8?K)pd&Ջb9̍MVW ҷkӨRT[Ca^O*N V.3U_,o,-!is>_͛ZǯGσqnٷ2Z;I}UcCCQk5?ЛY7kJ\=<-<<z/ޞd[To`qѮ#)9>.:R5h?) +?3!ǘ{?jLNhca֞cH5hӦ?;&È_mqH?}'I Y5Pϥug0} 'wH#h}hDCq$n*$dGPkthѾx[8F#)JG?j>c>634]:'vw ?ȟT_Rlf_龷ii3v,ց#~P0?B!{w\CxxRuAZuR>h{c2/"DXޑ}3  r(#Pb;(nioôBH 5niz2`r#s{1ÏEW4HJu~md; k9'O=xe76d] X9 9f=4]Y1qoGw c$L#y3{gOsԪhs\d;h'Ycw5=A$(-۵Xݍr{<QyqqN2OeylA(06Ob{LNTNCZGyZ?Usum[wcFЁ:5}N4cdǹELu`: =9w M5#_!{ twWik\9 i?"!kFlhcZZucҟ;:c?cw psTК#}%+s~ѴGۜ;B{\;A5g_rsK:@ _6.JήZ6w9csK[ZGdB25=I^wվ}oo#e&}^[aINi7e)8y-?eF\7%9?8;ep77A}^Y'G 撜ZבSpn~OGPվ-{z!w-3B4 9]+@?;XKt^?Knu5Ե 4wqǪ6r 'w ;Kw0=Trδ sVXGԗ$Hço֐˚5$]kGc`Is9ѣ_kֹZ|G?ָw _HJۃmhp$qwp?V>f~*'X<ڋ mFAmR~ CTV1贴7O5wf]fMa}aK7褧Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$;k2A!qy`^ŨIpH$^~XywO__e寗 u>g.oE?+ߙt ?Y_Qڞ5ŇxBv+sRNCZG0-q3FpA֘mL(5nc4wj_.aa_xBy|EN2O,cmςLV:*p$[Oȯ~x4m9M( nfIm1%ȿ A-K8XmpWSzvoq:k|-mob!|̧qU|W冿. 2]MM~'e6*xpZ E}=x;.Ʀ>]ӎV+ ާ0yNm ԇus⫠iPBPk;z2x3kL5 mxBI}{}\,KhۑȒ*k?.߆PG[0$Ԋ& _-X)b :J*}qXg)48a?b!s3 akӺC q=18Ǵ? 0]I?3;}+n_U8`_`>^zhHQ) 0?3_/G1Es90N\Yө-VPׄ<Z*Hm"tѳZGn.ڧ4[ hitR?V+A^e1=+ȏ-W+ |l cj7Z{zW2;Bᔓ!+O.)XAk2lxQ]%'/u %u*-_xB6.y\[C_b!v򇗴*ٻl]S|6m˂LW4._|E?+jSos7m6. v۽s&t6/]qm /h/|qX4aLW(O5zT1 iW 6N ` g;*Es3L~ v?.:m*-EJzй<b! xnG#§:qm _h(EL>vkiְ1xBKqNK#{LmLW)ڿ3o.i X YNl)$Z5Q( ?\grnIb~f'bEJis~[E_`ZNJzwF+b>3?ÚkhAQ+]NE4_bmtލm _xCRO?U'4T[D?/xBد\m_^78hhL+c`0Ǭ5Qp+\/I3]ӣa"iƤ~ m+{G-'43[Z\S$LVצTHè<-Gh4oڣ㇖ñ+AaU8<)/wo_/˱2ȜM5k1G /er#Xa?aZS*?ٓ˺ewEȯtח,*ki[hQ) 9ďsAV1e3ОA傟\n-->ZpZxBVAg~9EģV$#COS˺[lma1!䲳1'zG1+AV-Ji67gZbsr7Ir8kKXZLV+?m O}4n-a1Z է0>58ykNhiLEǨLM ?3<ͬ$^ԷSEŇ4ev0z b+qkLJh.T8#WoM=-aQAZGzG0ceE!q- #y4-iG7oMmak1E~$ñ/xC__XӇ{CO`Z 1ػ˺g{HAk0Sn9_9<`^5+529h|Fk8w5{mOYw=qI卆ƠUߔ4SqOqj\ A;3w4٫IT}?p!khxBd/'SB_E1^rз6MqA5>?/¼!I#53/[˚rm_\67tm/!Qo%m?3O{E#4_M+e~%SgNmf#wo>]{E?+A\]w~1ż_aO^.XhZ_E8CfyThiO -s0?m9ATm /AM3`~g.i*/-!CGwN>?/igkHkb*3]'Ʋ#$Ɯma"&naޜ?߶8oNmL AZ;zo6kh4ƌ ts8$?Z LQA/?n5Z1_d򆚈&Zf&IsgzZ 97Q ?_^-b_O/i)hAQp7C^nW?zd}VoBwj1#9M/A81=rǗt7-G(-7w˺bM+AMga#[ygM궱|.߆))5|jh7ЫXE'՝t Gb"N,hoCmLW4gWoqQ5~ Z~Q MS\p,/h,7c}1ޚ:[CObohkLW.Udb>g|/´bO\NV`^yp5]AqD\F?_rL~#4*^/iڣhzJŜ%OFGh FSuNj{SB ż-^N]IdM6;hְLW#ydIۑŏ4[hiLW(-h& 1Z qFS-=__T8lma_xBK#{s74V+A}7^l~_Ӂy_xBj*-_xBѝ9c˺oCp(_[XZL+¡%2>Z-a+bZ< :p?_*OgV=ExB4FV0Im !C!;oM/ž)ػ>]Kh58 _!@h>gӆ{+|K#SrzwQmLW6V8ysO]ŴTPL Av.kӘ/h8̦ڟi_b!NYgy7/¼!L^E82Omo 0/R7IsONSEV*$ *<=)m?-?V /yqWr>f1zx?,UZ Rdm #Ƨ`Z 7q"ȣX>M2`eIkA k\F V|=Oo/.iE? 0Z/ӱ_xBM;}C˺r5DmaUv :PywMh~|b!HF*;/5(:v6LW9nq#95$p#8w1xBƽ4-imap_'#S iuQ g|9M8tMJnF0kN" QMs_z5 {|?;+Aog?y`+A ~W. X>+MY|?ZFׄ(k)nFR'u.M!X\ų~f0ޘv6boG%b?9ȵ Bݏre+A\SSZYXZLVѨ\OxoMN`OUI7#C\"51^ԗ#+xhrp[B-sj?'f*zk0/U ϑ/XdupƧZӆ*xpZW.P ~f4 1O\N*<ςyp77q63Fƿp\0%uo1C0Im a^})]տ4kLa#Lh*p4}qΝ[E_b 7OӁ˖ /0D䍸st?> 0-9(oqSpHuoфk_b[_Պw>*h8ϔl <,OO^qgtlAjS?lbyKaCkaEY.Qر1ycO]Ŵ? 1MrWo@;C{r'\gM~-Gg8oNm-?V ~go급-V) W;|]MXiLW4^:54xB$C[BG*Ũeo 4[C($!\лS4mx/xBn"دf$14ǬTQk^ɏ~{}:j{_>=/4q/xCFa6Y-EU?N4hqЃLSAqv;=/¼!g]9_;Y_xC[9f+ܽݾ;? 1^ػ;SƧ(N;hxCbaߖ<+kӺhb!J6,~o*p jad8?Yo%?~4Oxb!p#MM&] +iGb>g)ػúctbػwEi5M- k1^y(%u`oZlmm?WOQZXo;z/cm?(&?Zn9Vԃh.R?~=4 8u/!c1_)OKhd'^y'ކsqHyo-i[hHj3-y_oӃB>?tSA0-dC|+>^=#E^.=4>]Kx!w=]4;? 1^ў^9M?_aOmodiߔѭ_i:owEp?Li N;hGXng[{C mi _ 0w֦;3|+Aoj|{mKJp5?jVR-/bĩdŊI-9WKx^3" }zws~&TMk4ᱶdo'ӗ$\7P~_Ӻhb!t?л},y{M=mab!c]1NgzwQmLVbG4ְ/¼!wץ4NƧ(y{Mh\`^w9G4k}.y`4pCem6fT؍'9~-)lUٱWf]vlUٱWf]v*6*ثb͊6*ثbɏP '$CY- ӳW9{nHNlMQ$ip%]J/xC*SB#0%SF1ol(_?Ʃ+W ]ITHv1*(za^ J:[cƬ}IoJQB?|,iVXtͶw  " +Vlr"rq'JJRPjIn|A \Z71BxyX_eTt89 x68,lrzh}7^džTܚ7QOQqFOF/*wUX"9x4GTFCQ)_艓Pi(+P߶',bQz C[|55`‡)Z8PZmbU&@z{0qT$d*oѸٰ*G$hnl{G5tR .cW0"<51J.9--\6ͅVE%*$áF:x}j7(Ss,="uaWl(A6q:⪒Gz#$|v;* *чl4*75фѾ\,هLj:(KV M6 Uk{OE$wF~8P)Qӿȥr߷|al*SzW8b~UE 4n}=HcV26J^5x8&9„mʢh {0{rw8&bA{ qQ@|r=qB\ \U$M1է{Ue*9(r}E(msM⬡P#)FX\, ~*  >„djDZxͼt#qWPLm#G=wҬGhsTqUKe2sf\z3 +b%])i$12n>71TG5cF=zR)E8Г th׷lRJzu\%,hJ5Ț;_b\&)G9+cJ{fޣLiQ0 3⪼>Ks \U-Pz|'&e!O`KR$xn:b {SS\A׮*9ʙk1R*HF1B׷VPGĽE0%[vRMnf w1͘kjuSBak{@*y). E0X))3]<$qZP. 1 ߿CqbhءEG%~JНzft*y/݊Iv_ [Ι|H# .Hkbc>Ԧq(uq>)n{AEZ#1UxʎB6onH|KuƕlsSfĀ Q ǩhRu-N.~!$ cea$f;i-|,)4g=1r}wٿ AGMd&~Feh~ p9%.ݏ:n*CJW|zm1Bj:P|2拘[oqnq͸u[ȲGle2.W®dV8xRF$$@E{euVn;ҝ8'קUN{?ejV))߸q8L-v9O-*WM*ScuMq fӺkxb_ՔM(mӗĻll%t7lp Wq,G RJ3P}pb0voutLgJ%?gG* 9ACت>%lPA_=혡MuZY?8nZaх$(AҙNuMm TQIE+8?{P| ӳb􃊡䊆o2Ah[FQܦ V>cVNͱ[d)N[aB.=1ǦF҈!&iJO *+^-햯4}#@z…/WF~mFܗon.^ 튩yU|W_-]VᗩwOIEY~r튧 !ڛS):«i_ z?OPqqe^㧆*; h|]6*$t"Sc  1&R, GC)*\(JVuٱB)돍 2q8_#U8#i:xU9mDZQ$Tw_ VOĊ0%+Uc1IM*A|pM̖jU=bCOQл#i]ǺchJJqm;~?*E*DZINZY$%IubĂ(ێ͋8^'kY 2WIU`bnǾ=BOZq΁IZԎڇc㊫/9ź$늫(aSǧLUxI^$Tc*cdY qU?u*u+V 핺dĽqU'Oil '- Z孏z銡otsu=_,յӺ͸کjo^zRWo[XICTN2|.(q`DcከК^m";|*܃U؞ݎ9TAF1M:o1UB lAtjziv=:fu?c;|Xj?g_5q5bUt9)TS F-[늴ᘎ*aW]bϏq*FUpVvUn0;UU^IL,jHoc㋊?ĿNBc<_cbV_FrNǺ4+I ՛p5bwV!ʼ=UZQQ1S)S^(|3޽*J u~.70 $EMWqoT+nWWr."SuIDG8oc+ƕ*j0!p`6XpBAT+CCZv9{Rqb^]h*?!F7ø"p%z,56튴EwrBQlIrʂ>̃r>̹Riس]jeo?ħ!\t# g{RQmOS\lb~? s _~)m0폠qChR1CUz>8kqW#OU7ߊ2G\UC(یULS6?PRںqbUOE)D8oƤr[U_Q kQn? '2qD7>q "۷qlm WI;JcO b~yø銶G.q݊fx׮*x:c 4{*IEAeS:bG/ǬE۩]v>88l>% *.)q*e#mV0!F늯W2 lwXT6j 6Q }֋l}<>Ugz[,TGq\O8*w6]':N}O7W"$a =f/V_JlISPAxŠEGOsVǎq ưMmHm͖ iLUv=lE0Rē4 W1U|-_q̍ñ0]:GQ(<*dex>*"9T;ea[h O/z)_\H1SC*cYTx "T3Cx1gUQ7>+7/vk֯5?! + >~9Onljq[n;ҭRGOL"7}qLcJXVe᭭n=1TK0GQ?:k%UNSh?qv>mlW#0ڣ0槶?lm[f_Wd>þ*YGqxv8U yDx%;c>)UcxwQ`E$*hzB8=x 焎۸$QGrTq*P=m(Ec_j 12(?­}sG->qWK ?lCU`e<$\wƴjTY#IWfU F4tlz/fAOiR:ӳ~Rh?n}9:?^2ksƧ]pZ]uccxp&**\Lico|UqJf *b0⫊nqqU3QE1VeLU땾)nQ⫕. iNf>?Op$c?N*+L'qX~0$@ݺc79[cu]*0cId5]{UAMշ銩Bkp?huT#u\ ㌻g* o *Oblbd#\rbU@vVN pQ xaqec.H-g#dWf]vlUٱWf]vlU*6*ثb͊6*ثbw/ܟbi~J?:RHSqnI%n׾*|/x늪E/źcY5O1_kp~8fQ ąCF> b4=0% QR'O (\5=1I]LU{-w{mNYz>Q[?[E[6JK|XeOiƯ(ϧ.e.`(e4_  W 1cJRiN? Wo~_ĸP" Ţ{F)dªi)]So|Ap%EOqM:&_q=|1U~of}*1GQ*7Hw0r .W\Pk =^*Zݘ~ w^ e6nCm+Šmq@*WO|AŶ#*M0&Kdo둥IgLNk,CzN[=Oե7f:SGUeJ(`}( 0 >%T'cGTb^?Ǎ1U6_he1IءQ(7cB%o>FKzu,}zP7 /* z{`w=%[^:1VK%dd,‡f«v?V Sq J$D~.ءۯN  e8% ƣnR W!cT$H(zd^- ,- z>|E֞йӅYk|lw#p".ԅFƽAW_w]bqsG*{2~ZT▚0<R۴gu 7NSk XxⴥskQ>p B%4 |I`*!!lw_ R1f*SuN( {>c~ ?1 zn{`J"G 7c岉:}PKAXቆ+*̋%Nݽw_=OMr-}Z:n0*)%WfYBNi(_ٲ`CltV7$q4qC沍T?=16_J䒽NbEJ⨀p*-XYAV~υTJ#o? cOMTp:TrUDWcj̧%.}++URK'ňnN1Ks6rVHzxI ~$Q\K61h:by kY+)֧O=1wqUOc*߿|Uy|'cV)n9l|VM*uŃvR6׶mb;}۸R׸h;@˜E {#[fǶ)" W*tĕ7\ d䛌 V`UN@c0-څAՊYdoRyB6C؍ͱe~9kw f#oaQʂN*J9?]|T:e1Cߦ)DF(ټ1H8Tvo׎x߅ #}Q۸I8Uzt8I),|2l߯#遞"QqoQS7$AǾ I U-'ĽAMLR n*'Uw†T~ۈЩȪ&FXKk:V96j |ad`Vzw? 7JKa%W$?ʏi&hxL-o#^q5M)[28;&?*EWf_͹H*t3zfi]r m~G (:UzmTlUD )(cª,>%{ p|q ^)|JHiU-u) aU}iSub9W}̇qC:qJ*'}Z Jhy'1p߶(B ڻ c`UYG!- *᤺9Lf#FL"VRT/ ~|c6}[[.8(?ϦIe}kv+0Kx0)CхT=)Fݎ9Hmc޸U |F<6*1 t8ҳ_cd(xprr?㊶S7O Q_ن(#Se=ϦZTt=:=GCUʚ+Y -txc0:ULSt;U9#焪ȷON$zv8-]$Yv#Ł! Pt2)Z l T-]|ֽVpUZod!'?)PQ,9 2nLcvOx?oޜUlU51=L6;U^>_ٿ^Y]jG%#N'nUCǶ&Cz`JIq?Wjq}PqU|r®Rodvշc2{*!7uA_N c;QBEQzq|(Phqx*ٻ,w0**:Ԉ╗V^r:pd;dSiKߎ0)_iA!á,8ֆb˿l=>ڝ`A۷*˷E7p߆`qVqr+צ7pv늪QX|UhlRro m(ٱըߦ[q]*QF@8bwƑCߊݔzW, dž66*}cUCQ^xJ8C44;"J@ff֝z_8RPȈE۸=Bwj>cƇ#qWն?/<0,l=j*v*]~&튫(n(npZUP늮+_t)^qCjvR_銶ʯWtª-1Ǧ*c)w]qTټqP߇OlS…*1WMq168@Jq^Q\m-0V6o}p*HK³#>̋ƥlVK@GfLK\m(X5"[`E14W߲ d Z#퍡_)SaF) S1fEGúC@Ѷ=6tb}2ӶE\,=>XUieZZ=<;Wۋt^)^؏:uq}s]o UFh6uF,]U8Pt?ta) }\4{IJ8Ԑ߱WJESJt«C4'aƤvb?vst869F-+'{>̾ˈYH8{DZBF܏JOC~k^mQt뛦u;7®ߏW8u\zv8ڨ|~!1=W[T47#Cbu=*Qxh+N qT#M|+ncU`4>Ӿ]M LWt޺ҵ5]]π#P$l68P~ٷYħzxfSFټ{bztMøWlU>7\c?~ݰ\wbP#Q\ J_.˦I5x}[%*:pqT;UISNJmpXy)SUpEhzm#v#`V PZY~-?wyU#g㊷7݊r]B@71S*;)=RelUǶ(h3D#GQ]oQǨ8@bk1RAT^Hp/UʟZ7h],$ 7ˢ=V%mI(k`o3v'0eH@% !7,pyWG]1Kz;0*X6ؼWlqT<ŝQѻBh~qu҉&R?%G1>B~*f(h*zؙ?kqd8rD B&cJ2PljUT^?nv;R@b®~fV+շ@4g1z*K , 8[°|/CB^KjJ|qQTė`TхU(hd;Z{\Lk):bë}`AuOjqn+Vtf[5|zb|Wq.aqVӶjSۦjW݊ӱ^U<1KuʧlqCfq; QeSx1ޣ+IٱBo)@TѷP{IB @JJz1ULK0J c`ثU Ӯ8S 9~ˊ!SOUrqRVAOQOEF(<$;ҿv*_tbJWFm^tW ϳcWcV e4K|656'-qܰm)ksNӻ6,.}1O~-C~p}W -c{\R"@81Te 7:WmNEt :!*Hf"9v.--e!!\)PxLS+wPp3-PV6e21Jbo˳oO'~Ön67LmVlqq *)lq*T^"^Wnk/<p{Q?krE$}e}Vr,ZlUٱWf]vlUٱWf]v*6*ثb͊6*ثbɗm?HK_&-yb~&HxKqnI`I;jJtp%Yeo;XY {7OdWq%V {alp*N?t1HxHCq>@qC5 z8p1֟,J 6c*N:(}_#RF&x`ѷ.?E-gQXC|* l,E~XC*C6 &銯5Qkeq׶d1 QcCq( 0~,ܗid'Î-ױTyN48r!+޽BhJ$g_B,:*[y"lG V+_*h9Pn:0ڮY:OjtSH/|2wp)_0q銹m \Pۉ48QwcZ?+vm(!B7Ļ7 (2 b@Uv8+E[p2|0% v8>! $uwPʃri؞jp%rzL⭐Gw1=A BOEw g"W5S.$VpGqbPl68IG[ 4])#n1PaQ8_d|sPnU~B!M-ACUKe֏EWc]ۯjT=p%T7ĸ+ QS:j _OCmӸ,$O^Ҋ/[}VC}BLUR0{C_|i)8;xbHn"&'[7cQU*ux[؎~q&.ካ87ck#qTOmt9l@f*һ+p#픮}[%P;bIdАoq n<02WDZ$DG1;?T1Œq*{COzaWE8ahǦ:XHPSH)†gWهl*)I늩1C |Qn/)I_66աTЌ#hAIE8,]VP8]6%TFず22)G$ "7c]WfbvSqUټ{c]ۏ*$GlS](Q[.?h;Ċ{bĕǸ9a~8LZJqmb6VJ0%$% GLR8͙%]džnHytpB hcL]7Ҷ$I:WcJ;Bi.-l?q^= Y?eԸu?iINKG :+VyUhzc+⨗q^m \6Yu뇚$ۦYZB=@~9NxJQ<1EN~(Uz0p%UP1<=> I$ .(Ew?TAO<|SA=MX͸U1'ƛyߊ={"*>!M*WP6dr> hmTZ ۃq'V=2*]hv2Ӯ*ڿń2WB R9,:q kY#'\p-ͳڑ΅m(?QQVY#43)ˈ2PVo}0j*w<1U5Wgøʔt~l|sSLUNk(tTBW8]e#bl늪C+* FجSSm*-~$?V!I=צ*NJKpMI(þ>.cƄr&p\OC }*$5;*t–_x‬(hO_#/{R'u)J.y!suF& $vlYOuqЌP73`i$M\U8Ru_׋0}f;6,v=[G1CI7+>Gct;u#mUxaB)Mf7]uA / q7 $̿ ~'zZ F+nP$ԏ,>Ub#oF2lp%T}ױ (V5v\rWc/+Caxc*n];*;f*0%AP;$'ՊB 1(Nc?eVOl_pwt>:7BHa?ˉGźUi"y'ъTtRSZto-ǿVȈ´?bzaB~ r\c;6y^CmG|5Vm2`Uu~.wA6)\H) S g&l G2[ǮX=*ZtOlUa\OvScDNY«T<9[}(lw[ _v>LRS1>,ߕ}-.PCC،iP"ʥ%^K6 &;@n0rTG>Y!&[nZ9}sh7*^F$HTTQ5=<1U}*;U?ت-b,邕W4p*jcAǦs-wZ WNH;|qBiYٺPhxL}S ㉺UxzrLWm 6hqml*CYkׯ.V^=<&TUU 좽*cz|R8T+wˆYmۜd;iV\x)2`EOJ\w4l GvnF<([bcsËE# 9 b[}f]ѿVۗ_btޝ*uͱ4=po~H*kW6ͅT䄩{W# WPrC*G[cBӯ\ I? UV9r^I }GBR+Ȳu'cVADz}8/|ⵡªdd;ư(hvo^e?xw7L-B\G*RQ0vaQpu?Tm8RXkõ{H1p )Rk68PXZcNk\!b2W(I69ߡZY lw_ aJ/?26CqX^VE An7_Պ[*$[7l)olz⫊LP>8UrvƲT|]|qU!Mؙw?~U\PL9 u®v8Րw_ѿ S??N(S(GFzEGĽܽC 5Iّz?{nPV T/"d_C{bQuSF5אUbq7 bRA_~*$ c-ZlCIq2늪,/ 9u;eρ|{-_ U]. 7O=qV"zaUHE(ۃcx/O_8XD~r3CRaUGnPƲ|qQYw⭵?;xbsZ^mV}6#/ ]*0m^)ovhƿRYzu0Yx?5I$F#&9%bT <QUUv\NSѻqxՒB&X f9e9 9J,(|L?v R(6#ݒB^!Iw(c0}G)]`i #)Er\d40!`I IVA X^#&7UZ; ^RON~*q >z{U%- H=GƑO*T_b7 Bz_Rho,LOvq)(Khմ 'x?7p< Pta0!i%JO(Gm=(;dme+צ45:UCn>=\Uv­ޫ|>8;;u­m1mO18+;=*9 tVUae7_h>c)U6`kqZtd^Uzኹ cZqU=+{Ukɱٱh䆄t\yh H)qIö)kZ5?Yc qP⩅wIByv#F U^6qzb⠬w•^9U+צ*QlN*8q3l|16B;beJ(@wb#cҿAWQ㚾8w`]:k4kV eQR~IϪ P>U/mB9Z!'j'q{'ٌzI-0-VMRIPUw]ZXu4yh'8k-6oه\MYxR+-Yz~5C], s[nՍ{lR:TuzR)lJ$K-KLLhXXZ"C SǦF%†א2݊A|r]O늮cF=^vhE\\u«Q:1B!e7lUt v٫\e,e_LJ\]vlUٱWf]vlUٱWg*6*ثb͊6*ثbo&-5 Q`‡7qlPe<=צ*Wu{RPÊ!Y FT~FXE(y(qOqUGN?1hXhIӸPᤡwbLv=2*I9CՈ\}4 l^0^{XZMzV;Uc.שX ˍ8(jH/N5Z3\m-qY.)D x FU|{" ctJlz ETЮ҂# 6lva+5]RPWe߂vI «TlGQ1EEM8Ђ6?Rmrjlaeb)j=b>xP.آwN*A_^9h(w_Պ儖61VOBn뀪Ky`/5?[_ilji:_pvdn`yѱTy6;yaVkO~YH<_CV+ª`pqT+Ae(y\1F;xAMw$#NتvH]džPVh} {jn bqPD#m* v>U>0 p xq<kx~p9FzxpR/-IQMlJC^qGU]3S[GNe?gop-(p0QZ 7>rlPq߯YqC4 φ(]Zf銸BPpH 32Sq%vl|rWo[,TqT<_q&H5uppj/l|p!q1#b-j6f^;6\Yvn123Q*%nDj.brub.;GCB#7ՄC\KE"~Ҟ'e5]1J!%*,?~њ&%",F2Ăc _Q|{7q+Ip6I$=qG~q4oOC!S,Tn}cU]%)b1J_+zB߸ŌbAU+DhیbCL6 (TaU Lf&*އc6fc zn?_ PW[\5Q8ˊP)yIQ92Y>'g{,& s CuM#fi1pkrHB;z+g㊨hcq9 5fx)*ނ5)D:0flo8c፪X㛁*־z킒aabF$p7ՠcF$mQoLSC⪡›c6ͅP[<6[~_ ~̊1x?dCMfƻS_C݅ Ab_:S,^%1z?8lp*&+C;k8/ ꧷R=F.uq̘"k5t۞Q{>6k}Eݎaѱ02b2銫I ;x"AT(-X͸tIO81'p*R볌H;O 6u\R4v6g}}C7$4zT~yL?~mڸVƐ6*ڳD)1'U(%R4|Xc aUz;Gq2qUPqy}# BifٸM\Rkn O8Q-T=G1:sz7Q0a +*ĝ;xTN҇3(o*9Mc9q48Wa~*U.45a70*?+T{aU \kpmz+zm(mb]ى]mwl1W>ߵc튬O1ۮb݈r\C+UfVd ",vnG6PO \i, ilӛZ?DXjpq:n:bǮPr8c71cX><1~+| ȯN7u8RmYhvW^zaBʦ*=QZt%r4_n;݊DVӯT;N A0½ƕ+qWh64*qbիcq@t?b{Uz [ř}o JY&0-o?e\[gND xe+ȥaCS]xaBGCQM7«qJR}ىF*!rVÕ-d(wZUhۦ…%_!;ኪ,m-e7hHe,sjCae}r+lt*DA ߨVߵv8Uvoxb/-\UJHxW hTqJb f>Th|pRWroWfV|Ez| ~U܁_qՃb f p!}5qUAߧQZVewv*V#@nGߊWcM:YU ?q֞R;iSQt PBj;։f9hA ոihva5`[J}6e~̿br7TEwI# ?PWO%5? ゕГaxfIJ'l*ܰqe4vP(" #sP9[ehGAqC>GlS 0mD߁W1]J|-UI2AZVDZUqI~${JFs;⃯%aB$8t}*=x?\g%_5tw[N^=wFیE8"J8>hTLVRrSL$ݞiH?(&ׄ?d hLPp<>G.^|(Zڣ&UuU8>L$ٶl(FщymCqUB5SF1ڣG9QW޽+r² #Mѿj~䟇,O… 5SuqTxVmϺn1dk\A]*aG?桂]hed7DG'F~{ŦXȒ&;-N*kf֟`b7?¨m{5}*}⭕]0+U3Wj*]cMTn_ lq:ӯLUTL%D_\㧙Wf]vlUٱWf]vlU*6*ثb͊6*ثbo~-?'$c79QoJ0‡?.$ '+IwȦ́q%[ B?2FTIEC0qQ ]S|1x#fi^- IQA^1)"Ͻ#^;8LPA1Uy|i0e A?ŕէWFnFLbP2F̧>xixScNA)CсzS.*ܶoCӶ(XTuZJ(YE X^wSe=WqQU8(}*;e0ݎ(mOR/ͱ-$wc1UVEqQ8%$ wPra 3d4=1UJ7kۿ^S1:l?J[\nlKLbE6O=«>Poۦ⾌-۸:[<[>ʍf%4BFyDz6FGr2Gkټ1T[´JePd(hq xUG*1hتw^l|Ii% 8Iǫ ǃ~*ŭNƱc;v0*>*g}k`(.iLgD:,dnPR+@hwOՏVzSuhMGUFKOQ#TUzPTmc+ Q1U'B}ch|p*sz#$G\|rT7Z킭o |Q7S)~+\r/|V{EE[+qB9;/m4,~R1 ,31N `5u}((zbSCT&ې`o ~7Iטحy|* w#%$Cli61p*,m~QOኩ<~a8A f_ۿpqWЃ;7??{?I/Ӕub:ERZ -1U;o8Cg`ia)({nniTotaq pG÷ل_Vn3rs\ iӨ¨k qjzb~kSQ5銮Sv?E7v*ƇƑqUc(Q\ q;W\у/ST7pyݱ?av85fF1tqUU~cè_\7cec4}b;4U5]AAQxwUa!m'4P1/Y/4f?1FT?ۂsi$j:$xzQwwY>t8O]g20-}}/*M$E:oUAc ኴo Tu ?Q!î8?<*;eoUסU ANUQW\$)tTz7xuxU|l>~#-$$ۿcnJ^}ڒ}#eh϶D+,f>Kj6=1v®"mo4AF*cJ5j7R:F%u 'uq g +/07Mm/82lF Fj{%qCO uf4a)slUUO>E* =p{b,_?lQhEWHn/RnPoP}yoZP|4і6X>$]lzJ%N AD #+dH(p@8f6q= |2GLxn[l*GH<Z ajֱ(~!1PJ㣔1U/0J78kv8Tݴw"P}ۤ[ui:5 SO^'occz~*.u`>#x5>XYxY)钵P8`YEA[R4; Auȥ2GWq"<+SqY\봟~‚39# ~ lK1|kJWsʈS$U㘩e>Y"H(v8ǦZRһt*P R?;✡ɭVEh?ZqTaT!f};}V6; )qfG*k}o\F&H|7ƒ(u)jBx:6\g_WPI xZhH?ǫv?vRtrSeqW$<}ԇAޣB#or6؃\K2يIբ)4)tD_V0Ԯ b:Ўw >(hǾ(,(Sh;e3PtUpm1Ip%z%>68UBVIl$1BPmtZcB~ҷ XZ2p\ͦ8[R :[;䒜w=4 c#«&~<\W$ g;NH7J")N0cw8bٲLPcPs7nP{l{:u8UQdlmiW#SL БSUA@˜_nUZm>}n5kDj:oe݈qc4NMsA,.؏OJTTGrv~/ڡ{wtY$%H5# (hTXzU:?V1{V9)qCO.$0Ƥ0߁ʯ߅[+N<;JPUZiWGqH9+xc*]uٻ u<1تaU2 x|1U̇a2}C[*gٶ=MFhw\Uj|IbLڛaUTp8{<5bCxMPAa8(D cQS e~7f'X:Q$#́ǃb쬻ƍ–W^¥:n0*͗ʣo ăCBgªr]cV۾U1VB=_Um߬em[ߧQ(|>تt#_ UN-= _ Uf>9[v*ب>8^\پ5WV ۾/yOR[o80d`JO{($4!-W =i*{&j#fJ:W P„NnӘIZh{bqT l!V 5_^o#d#q y 6UЍ*z`\AB:ww~r쟻5|zR*:b ;6PwD2vrmsqu]̩A^Iw8´`J ;c9*/ PHCU[ݽ*(7Vp% }~VBLW/Q5qVYWֱ$4gv_pڨEo'ue SDlTl fG.Wr*ڲrJJScxJOU ;*1WuzqC+wF*Co_W@ӿQh=4} 1VOlhvѺxUB0 q@ክ2?xiUv2~8fEq!'ӧ˒!B> : lqUbQX?]U&cYJQኮ@4_˜1"wC{`4Uu&+W]z2=+QU*MT7C14VT́Qd 5;qU|;cN&T «ŕPhu­6;%QM$;x]howyJo+M튻v:]l|1W7­{tƼ`bBv>8ŷ8;+uWg}7?Uͳxv ^qUH4FQZ68|8|G\m}({Jù<%#uS"8R<{ ]//n[ăxB%zbr÷+*9;B?V*=)V ~UIZ8Pc1 #)JuzZlzb!QTH(zb_#^=^dYE}9h]p{UGgva0q]Gf½V*rb^ + iTA65m\-M]q,aűޣ*H"1dzHVvTH!Pv#`q~xg&!N補]LDQl <FKȮ:#1U)])md#cZ\Uq8 P*\R/Ҁ*zc7Sl=x!},;のf*l8ªzg2uƐW6 *D1SN&? LV:)קc ٿhfe 7`KkcPU\qw8)g;6*&5]ОLgt D{P>)R?OG\c*ՊS=;ӦI>(StM ^Ǯ* çA#Ƹ)R4ND}O\JN4_ O+#*Fn .ݓ ևf*hAQVR1Vt2UMdh#N;Dr+lت=1Ultn&;>S6~(}}b:(S$h۩p<SŎݎ ~ʫ&Y P!qJ-PW5{E } I;Pت&)қ邕 0bwqMӊ_ o^ܖ쟴U/Dw6e8"}bxi{~m=~ ?eǿ*oU3GhGAS {*w…]>lUB{~B:b^늩:F銬~+J/F?݁*Mʛѻ{ gnTPH(v##t1UF$پOA 6f >/թT**I|29[7M*+D;2Wq!Uueۨ0ڬBTҠa^2  ZsP;JHu=)VmқrnԑPz%چ5YWY'-w\U cȒ ;n=4ۧLUSk{^pHlS8 " _mPVey/"Q\(Pj6=" CN1J"o/ň*6(Cn>UkQCqXNl6SF¬7˒*EAUw;7ߑTdr+1> /_ ܊[ 7^%%YG$GӸƺ4?~(\+ jه|*1AG[gTcxIԩU0\c+MBF*HD}HBM Ⱦ‡?qs^v:@/| B}b]//g\^`Ub8B29R;wk]\,PS݅T?RaFPjy)p4_g"Bmot&CkקVGL{6늮!evlQ7OTdj2G/L(AmԌs ;,b>Ċ0,~$(.yQd_1%+U$IЅ(a4긛GO)VIri%LdP/@v ͺlzbU{ 1KJhwhȒ"C`J+I0䇨8.)R4K[nl}2韼]?FTa(g[qLL0rJ!x}RtѶl(XPӘ;r>_t$@:`䏁#V Aъɯj\U\UA) U`!ZL]q'!6*+Bգ$=>%Rhm WY_ZTϸrkWcRI\TqT&ӅTҿg?۱U>DTp)u}4(,)yr_[ r2/Q $Ѭз8Tla Uk9]׾(SxAC8fªA#]ױf⪀*p*8➿ b[L{DLUJ9J;LRJĊU ]+q8΁$U $F=LxۦSaQo@ofV1WcDA7rx mXIfAČC iUDHKog+%](`^**?G, uhU0\~ƳDH[v=0ڣ%emdž!PUt#xWOJS։.6ĩlZ/=pBxJ<=SI57L:w\ 48€K$O8Ν0*j޽U7q…#qאۮtrq;L GO+n0M\nfzd5^.J$ovC Ui\˱!*G4IFCÒz|2g`RKV}Nr0©wQ nJϾ5J@|0!@&wl*4;|_|RW8PV}^UPcQ~q)׿CW!1ʻu*ƕ5cV`Vߒ x *!\Sě|iNp*CrKL! |+6 rD$t10RW*(~~b%>/fb$lqF0gRYdE$lL3#rRUB;b2`Η I0rJW5ZV%hأ ?l(Dݤ%="l 8cQhʝpjuxUGQ^r~Ɔv8/dYqKJxⅲCMq:U*秏|Cn:⭆d4;3U)_?~~^͹ڲl>su4oZER|+ AT/5K{AYvvSp!U#եc1ī7[ QIFhN.vD["61]`J`Y'z+x)'9P*7i e+VQ̿I^&*Œ:k #<L7c^VН_+_zPhux=1dUulj}dp$l:cw⫪)$~*7^OSF>881!^1BǏMuTlSS oc $=;l|p%XJe#ӧLNMqJDz N;㑞&"%\xb9t0\(xψ Э4K@9\X13`i )u!EwZdmߍ"DnG} rcԗ_aWF*nñH߿|UX0qrbJlrS( ZI*)) u7MuԩcЎe+n<1B?$L $-tmm)Ta⨀u19+Pj1Bh5 ~8ҬVe{ccJeVY+VSIm%߃]x u@tCu__ؤWHK~>k/)|0DQl*"\2ps{­\=S~TIGŕtw.͍bz7LmW*|~;Zb? qE`wB}QE7~ Aٿ͹~8ڠ7ߊ:E|CW+>{cWmUsEFQ[Ym&޻t>)|{ߊVSrqCJJฒ٪.l^ #zw{`7?cRm6X&Kj'/\Gt%XP¨UwcZ0qU9Cŷ^ف2| VY) ~!ZcJ7k Nfo)Er^3+[f­2|qIᘯm[ I:JHwۮ*Ǧ& )T(9/Ol x׮*|=YZbfS欠J|Jv\BTuuuaBxSc8A=O/\J[pG$`J88U)e(w`!WJm d?ݑU?12=|1UUrku=& ZuncU`o6sN_Pw:}O 1?i~3MgPeF:F[ke&iTq@qVGE1U Ohzuu Qn͊AOіEF)iN1JeOq{Qq+@tqq~vn1lUw]dž&N`gR L!q DWux`J!fm:9{vN8w^%RIJثR[cɱJ<o`Wfb l߆47UxjE[V)LIqBȲ6suiJkjӊq ٰIAIi6=&OgP~{a]2vJ'1JoVQl;#¨o~ނՑ%W;EY4jc'?GŦ(Bye ҍ+Hz>? |4Z Œ;*?koqTCGNAۯ|U qj폕i,8R8mU08„>&",|c?C[ (Q*|iتH>w CO>|MӉ$'1G]CU#Fj77^ت 0a=q6*?i>쮇[BleyzrIz焣$$\(>Ҟ$ @E7]8CsF%S+Kc@q߱NRSO~dLM)UV*7RN :E7pMMjF nBqE !6o卑8IIToPzr7bqAt2J]28p"@sHWb;`KqMA)#qpp\rŶo5@78^Ɗx.>xzКzit , J-JKӸ *n~Gh)dj$qv*+xb)bDߚbDp+QO<-AS;VĂA=>S?ߪܷG\R#c=R![a8>H8(K gn1 …(?HFT\Qx|R)DǸqUj *r)].(HޣOm*Xyp~ oR#F;)@ZpWCX_I ]!#޾+R.Ӥ[;_W 3.O3۔b"@=q!CǧLZ7LUBkq r\PCq?_?k[7^-ejѺ m5S4a^S^hx?LN׿*Fu_,b>!*0~. (BeO_x$aU7N^ٙyn+I)O2lUsGCUaC^W ,f~8w=1U㘐^\IVAC CFէNY P* fZn7Uj-c"7_;0zbZ>Z!s4c[Vڣq$)邕@Ƕ9yFDҘcL(+U(|*XRect)B;'hG'N@#c0*I^5UrZVƕ- xPwlw qkTqY큒ۼK_# cpE;ajI `צZ>۸=իqB#O݋$ >*h/OnHD,YvTK+&A~ ʴ|UX>l䍣4;Q%E(nW-8P#e⨄pd?Ļi(nJ| \@8!\mC^nC~PatdN~?V(vUd<{8 [bV;צ-o׎;fभѝ%ECsOo^ /n2x8JO{v76?n_q۴-Ň#%lWZ^%COOxӧ݁Q|4(wRȩGQ6m!AO(wbaU[0\#r4?ebx­ǫSfT*y/}R5J7'n-Bo^Ad:U1nѾPn([tlUr)XU#R(w_V cTJS)M{Utg~uT<~\A ^ RT&ޝwr` WnPXt#)CqOKb;^,|bc*P(YUnk1 b?ĈUS#͸TCcȂAU늨G#Dx0 ԆcJ+4qU‡n[7_U-S7i(һT6UaR-\¸׈H9'V9nKZԔWcUF֣T7Me߮,H+  qnh+UUޙ9GI4ywvf:r! 0ڷkrѺ<-Nh~_`AU?,AS=*rlqU]ц+♐Qq"+}\?ǫnm O>$T7A*_|kc!SQUud=?iPI[Y fu="7CUWp*֏(2 #baUUH9n0Dn1;Uiz9E9nb^ 񂩁 Dzb oI K}]\|OY`uuXxnڌ8F1V;˳+u{ i⨶8 :" ~rkNXna$ۡ¨VSuګڪ7SF*>cTNz>?W?ٓ|Uޝ?yݔNUto^7q 6\TcᘧE[Y)|bm-&97ؠ=xGa査 +~Xu\rt$1RNUDЮ́Qi(uW=Fx}+^>ǺJM.ʑM՗_5eZo 7jեPAU4hۯX#U ^p*N&<1IV:,o*d)^%[i>!@s_P1S4 W9e~¤w}*O1_~ QU9&9r#_ZPZq5k#qml8ƞ3tPe||T)EZm; aT\z\vvܟ,>G(D,]u7݅UV501_qel*BnLtȐ^O\oz wvap* L~fk*G/V^ˈ e=t†^uY1|?|J7\U1*\~|Q$] Nk3ğv V*xɿ!Oq *1|1UكlUwŃUF^DqfTW 7늬U (S P퉕+0*oc#lR،iZ`JD\P\ /-KƸ.Yi!t?ew6kGSDzb:WLW)XO⨊})\Ufܟ3f1U&u1)銪 81PFءHN'Jn{bP|q+UǫoN,t*ǃ^)R*WHc?-PnR RܐzH*qBs4fd;u( ߧc?bBPWv(QNe!$UY/^:Md*w*qhN|1BF}q*0* .ftwQ̢;XtK5.)JgZgF~7.ކm QZ~ ˳F0?OXMGLGQ>U:l2یUkQd+Ʋt@ ]nznX;8_<11Nk1l{؝J~R7O+vv(["WveCxwVr(hq8U6=jGL⭬O"PMQv=M I 2,'xƀT=!R.Kg,(#rhw%=wn;vd}>\(V5]:td7!; sӾ6K8|pҨQxcV_[FuB (ZObn1Kk/3Ň170*S2a)lUe={e«Ihv;xbD8UV"/ڝG UaB>…9`Ľ1+!~avn֍e]Y^fM)CRON UP|ot`T Փ w\'g]G͍*[jŭ>Bzi.!{migs V-4gb`Q0l U<&є;l} A*?PvnmiJkv_ =#CQ*Nr- 6W"+b;p% 1h„4bA:ęJUe`ço_-dOV xzz6BCo%'rW=SS12aU@WT&qWLNإJkdS{ׂaHiȪ5ƛȐ[ G-H(?lPE*\" ʮ%l zWU({lqVPo VWqWl_*Z(G_+®f8Uro)qJ6-$ <`V cYT nyx(yIWҝC&6*q5ի5ݐˈIF*7(E2ȂD!#|:uqV#iO¸J8ߓT$"=;xbr[tBڼ7( x4r)EU% (\ LP0lUDCL«l**QQ>,T5Mq4Z2O *.Y~|C*~-Ǐ\o2k_Ч^t+ bI#|xUCJ{ ([Wn>{dRqC8Ta2)a^ܖƱW q&1zwk _ctL޾~fQAb"VXu 3ї|D;ت 0mqܼ~ mV᧸~XK?qc.JR!w؍qq&lUٱWf]vlUٱWf]v*6*ثb͊6*ثbɏ{HAOI1l4*Tr9ŵ 鹬GxbgQ<_잇 QJPmc|TE|:V)ʜPql$9)P$1;UYcYEWaQ."q(Fm>%K}UalUMۜ};9y1qCB#zxb$[UpCk(>%r-lx4߶(X_׃/c=GąJ}W $O(Cr@QXqQ|=qnQ sXїHw9ժy ʕ?U`xǣׯӊ{t9|}3:aV~ 6=,U~|ІJcXS_Upl$66 }UaI9IX  (F(lm+s #ͼ xC[J 1껎)(k-)SmL`$miq1x(X< B O!v/j{TNPӓpj~?̘Ťs["%5SAƿͅ~ӱS?:*[.G_ x&>XUHa#)1ZqX'pB{~?qe(p*q ~{ª~ q=z F[\8?*PvQ /A\Z4lP}؄.!0u on$rAV(}UIHǯlU&/zwrlFtVuŁ:TPr)_lI҆J)?VUs%w>8nk xSq~!MОۖ%VW~uqV#oUi=F9ZlþSt &z c%::⪑pz(1UUx|1[8 QE+D„ J.xcB($?tM@J-2)Jw12YG=S'0 Њ7p{d! SH#nn1J` ur81z}*Cٱ)\_6qmx+51W2 Gű*!Y/40*`§;aNRW2If…(wO̿HU~U?i> _c +(kT튪|.1dp‡”;j{{+AFCTU:&3^8{PcM+ Sz81%[BL:7f?`TKy4-:KNx3„lR%O$UZ6Ǯ4qU q+׮=X29MwRINY!v80sݰAߡҟ,iU+S-I|1U_.q݅vfZv#n(f)7_Ձ+jyjNs%w4q⮍-/U(y'O a+oNǒUqŰnTG9>؅Iױv}5B p~]kr68r]2ŷ\*kq0v898MF(K_Sl-uU‡=oQH}[躚xxIwW()u9p<[ mͨrCcG846}9쁆EN13 J f/zV qhcaBЕ8Gc(qU㏩늩 ʠ?<*p%p=P4\G-Qw\i vqEp(tn J_sk$R5吤Z#_i){sFFATEWD#}? LJ 8U@FX)N!Uٿi{6Jkt(>c OY@G8FmXH(‡V7T#Qhw׉g UAC&Hڝ7BxUxYv]&sױUcOs aP~Xe fNcR.$A_*p7{G?b~U -bٽڨT&ͺx%NqW4\ET) UTٚ=8OOW*˻?ZoN~=3#цi~%&)WӜ}?zn:B(R=?)SRudn]}RbV;7u䪠} `J_`:iN늪 F1iw/Xr?cd )ҟx֣1U:q?v9­ p5!a5qV\mAu=Onhv?AcF|~*RP,(PøƺwJr(qצ UR[܀)G8[=_R5qsl+Xw'ǁo, Rߺ6)Ezмa+óQN ?l{7 *;*_cT$O kC*y wĈUWuG1LP#YEcfqT0nip;!SQI"ww]:ci=>銨o_>+鿶*mcju_ P ЎIJHDŨ$u„0sQؓ]?̟ڬ[wV*>(v? ~ĿF~,O H&۾eክhGG @17i1{t+JCPn;7LU/v8LY+)vRW$ܶnLcU-<\`TJ0q`v1Vʬ8Sxv(@qLP Fj1(vR(0+F|G4UP8 TxWw_Ֆh,!4ٺxOP|1ٷ8a8-Z-U= J .hMRUb>e͂~%bfQ[:SN7~*VqVsl{+ؚ(BK ]cx1UH61[b=5N䚽va{C*.f|<<1BP`vUߡ OZy+S*ِ8ulU(P O= } Њ};c'n0%zJV~,YX8تc<Ğ", &c m_|u䇪%N;ţ/ِlGӂ)2Ҟ Kw/>2K`BzcJG-Gű]8Pw\x5ªLu늭|K(j:`WY.ኴACQ q+ f]WT5opRY" %w8-R5Yf~|mgM^#.iU_GSNm׈_鉻aBQz?/zbL6nbtev{bl]džo8^> c`BՐԉJxcb4*|*!؃ܯ87=Ӹa)r^Ma't(?fAHJ©w o g"G+کIVQTC=lE+ TDsei*~*\ Ec}xrWl(CM !-~UM"b'cTMUV^6^|0RUCS}h8і(h]Gbiumn$FCR,",IT.-w ؝g˂5}[UE OY9l0„U7C~<1TqU aϩO 74 bdWcª|qko| P%v8}n`~xH^h8˸U0#moZE*T=EPڎ ȣ/ِ}&S%g(xu9-Aa`>P1\)cWc xq+8ALu<7Ajwۏ UcZ7áJu{ֿewuXiPvs۱bL Ğ2/ R;lDZڵ긧 B⏠ĝ-LR0}zBP8P9)bOM"9m9X8uhY$F3zcǦ*G~8B8^4d=P8)PlwtT~˯UaKmS\ noFqo͈$a@[щuJ;o z%Tetڇ|UH =XP֔}?iqU2'Sm)_MǸĝ|ъQ7۳b-nl6Y |I&tU8i#qӾ,>vFOL3O(ifZ]*$hO|Q` 8ń(.9NhUdzn1U5uټp|U=8Tг|uITU'ZQ~8^U`}A[78so0ڢfFMb2@qZYʵP+FqWMJGlUe]hCn_udxJ%OF~E)(Y>夿~5$^"Y9 uT22H|R;`m!P"q].8  jH*8x݂mk~1UD@CWǹN6늮q6`U6|1UU&;8,i(IR"Wole"a1UތѹF~ w„Ys W+;l~^wSeԎJVi`=Hxq{Q3/8꧿وTRsٷ\ ˋ]hQUh%no}6;dr,7q2dUY\t;O*\pvD~_mqc.H3_ 9&.:vlUٱWf]vlUٱWf]*6*ثb͊6*ثbɏt%ODēsK5D*W/sP8$4CzxVqzs9^ ϧ.zA9J%%1-ӱĩ"R)J ETu(4v<[|I M(VuY.}ӯ*Gh۩\U­ 3GzLm`USĸ+}hˎN? $#c*n0*خ9l6$G!CUfӸH)jAu GL)wlqDzn> . 9~mrbNziR!>xʿd pL(Q${zp@G#1KA2u ,C *eƤwlzdY#NT Pb_ (R/p5^)8t84ff*:48Hy9,Պ߾"AN$27ʲ;Bx6T JVS[~U ,Ɵg۶]L(Ye'*Wux`U?}Ǧ%,A>Ct77^#R$q}GӦ*זǯl*{qg{V`;)AYEtGQR2[x#O-LYߵyE ·C߳㊲H+ЎE G\Ux!=2$«xgWnP>XTLvfV)ܛaU$F9pv8ew8bTg۱`Ic p*:)ˈ•u`E0D70*kfC.lwDj=>xWuUc֍-7^Pԑq9Xv( ErOb#<$ E:(Ctǣ$``fu>& .b C-O 1`}L K."Cq'u03 m>ھ\ڔ5)P9;l }ɸp%bl{1ЦW"o|rSc 5aeMn{ݭ8vaЌd!.OPz`PZ-z["Qi j'd)P؏|H6 eъWt:`UD|{R@OxێPٶaTu\Rr>HWS(]PËt aźi"1g3-; r~PO㎧/qU:*"AS\*dZ c\~jc4=rozIQņRxy.DZ6T«g" FUT⟵I~R׈6nVq\__dU.KVGwxCT~ MBk[TKh;n?d6t6?kadPYHzUro#«d|JV;US`cGqRGUR*7jW8OہUxxp<UieO|V0guV>g+Mu[V7cOs%zlEG݁\q;1UB6S%7]\ͳc:n1Uy }p"{劥:\X$;'o}ŷGOa)_zꮻʎVCRaJ\PV=u , /ć`V%`UaT;n;/CU(8ze) qWæ)REGOՊbOvlP8&c+>P("R.WT튶E7犮;Wlc㊩{Uto^+Ґs_0%uc[sCL*{^Ռ]i1zWIvYV+;xB!0;|X˜UP֧l|-v JzdNWubTfS~̟~Zar1K«h|.( ` 32>ٞ*n 7<~ٱ#@;n}iBv߁­qB1BSP{,ƌ(|p%wN$TȮ6c!vڧ?<Vܭ{.UGҝ1젍`Jݔ6a!" -}JSz)re|u6]qIޙ3oN 2d+8U^7\m 2CrMAV<~%ҪCrm͊Vz$ljtۯU*~eWpqV_zۿ*cq˭>XU" 6/+[ z}F*uLc`G6n~3OKۡªO}ͺx`V@aQpb+M݁*q{kƋU=P4ȮO)Vqf 3_qJ%¬x87.~U>eoqXڍB>.WqaBׄH({ 2)XQ琯blv0%Y$c|I6*HWc|16\ V %I za[$@KxgٽksCvp]+v 2E~+l8MJv?J亸g&_ԫejmz3n0eDhإiu+]*hv3u=<0*+&ͷǤ:dFXS߱ǑZ͸ۏ|UPy_n"DG22;UX5Oxo!;u+MW 9\6Ǯ(Xє{̯\R揺Gl4Z8up*}`dnQ-k58Nױ;X@I@ Y"化??᰼RU BrCPEj:{2؏ wMV4o:bhCkKx(SfvMu 3 "8RCCxaJ8>be6צ4ܺ=<0+DWGn=V_Ƿlp<*AS@?A߸VzF'c";0]DهU?e(wx'Iw]3O:`VN8ZUCCr6"<\bMN)xώ mâ݃E.-wuqĔ}uA,_ªl~87*4F]iצ*/##PxD6DŽVP*pBo2H; \!Q'v,a.kc"fR+ч5]8UM&huF$ _@vۊqô=)jj9$#-xtipJl£ٶab%uƺ*7W'ZujV/\Phq UF)IT&V6#pwm+,y.Z&xϾ&h>PȲ b|; )P"Vن.0Q(B ~lW?0ollsWa_oҩ-)aTb:Bȥe<zhX0<[ RGp6P~+ \>BVEƙ{I!A x1(÷l*Z^Ew䍸#(zUR[hI^q㊵fF<tªek׮ؕJub]c犤;*$De<|1Kq]Wt v˩xb8v=0©bf_QdO\*`ےǑuTmF鍧ኮ gޤd)Z$ S3 ;Do Rg5myKj&2~,dlXl:P7чSFZ1 UIžzaUS6>{[|'Z;Ub;!GsOa߱Ğ W&;vlU ]Pr7L*?l} wO]5~UZ::#,1T3ýG8UaB0bKq {6낙++OlMUQ&jt銣"S1%hF*HcQu$<_`*cqcцx%v_OIj%L"x/c8pLѷ=ǸV@ ټBh u}*V*Ek1"GP>qV puU+bt8P0ߧ;~q4zb:~1ߡSGtXUi5]<* fq7Ucg6\w *֪{Z0~銡>?~U…~n8‡q`bJ_Ձ(MGHh߁l}L*~޾wm {CyŒ::07Gv?Ѿ?j3jfӿߎٙ{OdoJH5.IC&~9- 6*ثb͊6*ثb͊?*6*ثb͊6*ثbɏ%'q&-y2(9ӘSq[cCh~G_01U;uxU)ߧ|dMBCsq1>ĐJziUxn1T XVAh (0Zݩ11UB#+8UIt=1 !)hs_;&Wߧ5y트F|tSq[Y<5ژ9.Rb>YClz⨔~*Wo WǾUx1W7^G>*"}{ 8)P7Kp.>I+GP+#22.%!m1{`vNc UcGǮ*$|ztTdH!Cqo6liRǎ*df32\"Ao;lAQ&Fvun_Knڡn $xedзi^Fg?\1DCfW3 jpX)M!dZ=\UN1Pҽz^7+qT<}!RA+8ʆShYOu%,kvKv4oLj)¬Ϩ>8)p*!:TJ1OUG+e~}w])Z:_^? 01FN)$O|QgN@EF TU`ybM>Fڵd޽G A+׸JNUcb,H$u5#aUD~}#. F([8Ur^*ӱH4ȥs#,J┨8&6Cx:<,|`)di{?+~Z@bn/1qaLA SJӀKL, 7 (;bq)KqCP69Q猣"[yt3ڂD?Zx6H(G{d15"Oq7qU„Qe]Vor>UpP1^[\Rn? ㍥wv*xS6zbUaĸJnp%>w׿Oǐc @WQJ8*:e(p4f +~WU”OI"ct_aU I<[gݎ"S]džWI>Ҹ ShGmǀ. /p G'N J_udYhBKae\ZFt?vIݝ))KO;tJ27lU̔8CuWLRclUbHmǵ}*>WF*rTqV 8'aUxlw\۾6d#Lq?~4}9iQ/+JnaUs2v}c.? =*}Yl vރ'tUGAˢZѝ 1BMvQ3bP`> w"kpO(~l6%۳zw ;4~7nJpxH8! L^FbP>298tU%Y hFQ_U̔<צ(PUM?,@o P4UT⸪T>>${vdUF*唭ףbTpj1JQb($5\)qW!* A]bսMxv?,+튶=$ l8O Q፫Jӱ}EF$, *ۏ QW+/m9k 8ڵ$ES #|HWG1Col $,8LDZ\|?`Ap*7JU'#430e<\t•v2Kot`v*w6Tܴ^F?:ulUC*:,0 Gߌ nVؤSS M!*Up!L I|'0*hiboTX+Ӧ*744;mTVӮS(;PjlsG!SQb0⇦ H?l**5xڐh~ nu#q‡l]& ?\<`UL$h{SWV(k+lUr7Uk?n3CmU0F) %"qCogȪKqa.{uh%jۼ QFH!i{ bX0oñAQ ?k"Ӹ…2M?7\ lt68rB*;夔1UASMG㊩ 0CSJ~5)QP䷾$uUw.;!#cfd1Uc48F uTjWaQBj9qNqU=qܨg'xi[2oV8 ߄x<1?V#QЏS+8c (7S^?rJd,/qQd6v1_\C%l1n-r*}A4ocےtYiӦ*6o9 pn&̲WcZ9-ኩ:Vn;*MM~(VՒؔo$~^]$A RY P* ]8/#w_Gx/wa'u2ठ{v3QVTTIn}nnU]v~ұ!4G9D=mi.}8݊=h`aNN;R67̜"?l~Ǜi GLB[ {0޿2q8ǏqUc1zxUTr7_b=E$Mf,ENh 8U8{ 1UT$]O\تEv=,TH* Bi8GWof:?}|r4ڣ_Aj h0ͳ o utRELGp\7zW#nR4͑%~%=omBiOF0Xߙ B ʽP Dv;TJC-tqW ^ UB۸*6o UjFh۩I68-9 qUU "Tv(D)=:cj,=A +PZ3C13g?!o$INbex9}6'~UƂSc\Udzx⁁*7NSǾiZ cJiqUO%ݎ/o|bԋ4ShK%nִ>jO?Kn b<=mmmy9^'Q\N…qXnzJ r|*mrÐθ֌>}dz1BXH",i\tq􎸛*ԡ*CU>1&Jlzb ;Jn F*H(v9eVASZVx2gD+,nˊ$\UJH>*X"M͊_hrCI<_´%#Ԅ拏Ę[i.NQgTc/q)EE=;\*G Ţ*-N KWӜsTT[&ZJZ\FľGԏۨM'oFuf(qqc_ (WߋsQWѕw«cdޞ#p)-S-q$A^;6qJ.7rCbd*Spw RB>ظeP**n# v*!HW9%Px-qd| dqn?^Ӗ MRT}\}C u 7cUB^ 4a_ Y|/ 0Ǥ*$q^U*C pNqX)POe-!onm y!ӊQZ] ʿj6? =eqVթצXr6lU̕_u#WGq\]ߍ+^v U׿|+cjcTA+M+|pv;Zn1+늭W#cM«>_g))\2JW0 7c,*4C\ \$?v*ٺT^Ǻvzw;qX].bxFz7ўtchj.7IתiqC 0?d+!h1-掻Q}qJԚ+߮ TR]70*%zªl ޽W} mOlW Jq|s|G6,ƕ †2lhW0:cd0x|W%M:~IKFp**Iھ2jݣֿGLPhAojJw\dN UheF!jbMaI@58;*S8ڔhJ#˒Kѡ&(jA휇 ɳb͊6*ثb͊6*ث*6*ثb͊6*ثb/L"oCC#*G$&OΛ,zmcbjvq H7d(4wq麜UQL)lqISޥ#,\TM>חdY#cC]* 7dG(|1WI,0Wb F$GUmPy.;x(Av=S78)S\ E$኶ b:j>*UwT#xH)Ƿ|U\9SwQ20̭GQbr[cmQP:7Qܘ[QwT ܯهFF tY[h)lr<\}*k܇!׺-~xjS| DőlzhCI2qWaUcXHۃC 'ԏgF<:aU%NMUDs$jқnqq/cW [Uslwx#1Sd…p8>λ&p*%d\bF*P}PtaЌ*h'jm= IE-u GO ,գb',aB:Tdr%ta]Z**B?LBʡ^rS %%W,$!H58)\Nw$v?gU9a>%_-mc'>,E0Id޴8 EFZ5>oDwxT+]UX'bJ*1TuJ q810%^{a00޸ a^>A&ubfCž6%F9H1U(0F#IM!f&`{>s_R md74qV.mT]wk3FiU%S"T+߾*C/n:hSn*nmfU~cz늮q}x=cN;NHKc;R$~׿|r=EZx *7_aB%[}ñzlzxsV{u8U1+0*f"Z CŇ\z968cۮ(>-w\(Q"W=$݁U:)٠.XsJ_{e$VN;bۀ9DmxŽ)ҜuOO Mצ4WK'N1|UqVȤ튮>|UQߒf -\wRMemAUYZ)\,5:UcZ1P…Rgue.ZSC,H߭ScZV⪊V8tn_%K W_of?h6䛩S;ksF#b (z|sTCJ*<1fh{PQU=WeM}~Gi$TWX~ J:˱!.Y$xjp/25©@lpmOP<++ WqTzbRZ=kSf\%JU%*`[RwNSp$'i]J@{_ x!3w_ c)S⪊|{@*kQ9+4 8C)O?Yr>*68Upfjȧ\UXP1{i+xZءcO>^U= T%ݒ]rbhVU-aU!Hѽ/ی*Cp(ă('ħ|P5:nlULGCtoMHyL JTi*ʛ\~fWPuNbqqR@v8U$MWfJn<1VN[>> _@v?lQ%zbRfe+n<0p+áAQb.hݎW~]̮*ˮ̧=wCղ?aJ=Fm=w.[Qzm_¸%)iaTHU$|1Zmb.D1Y$n2+Xzbm]V*ZMzXz`bp!U8X)ٱU)Jw s#g㉼]_ UY&mǎeOeI zR+ټ1 =uF*P?Ļ7,튨U̡]x U1Ur{fwpЌ-]Cyy/fu>#Hl.jО?8JY [313PGђ @p~цqwe]cf®# 0ۦITAh{wi(C㈕R ٷUw@Gbg0팒>;ǎ*rMٷhSe1Jz/c1UOzW*PEmcRmA8v4quª`4GI žrb@lW;U 6|[ܼ'OU;P1-ف(p9}=*_h}+U#iO迳"Bb`}1lUcQ^1UW[p`zb 1_u{uƚwWz]*xhjrlc_*c]+jilJzb+|}C aU:8¥wP0qC5CpZPR^^pr:֌fx zUjA43&Ǧ^Udu"$=T8MKꬿeс"s_?j720J~?b|hv#!ث|JwrWF*~q}!ImThz|II;C!Jp*(qq$TeqԦ v=|qѹN%waqC|QTFmٻcX;qUnN7^P޹lV[vXBJ%d=R)(>UJ[PĔCO &OZfVe~%C 0XdRji+:n)LoÞ/o@8E.,g4*)wY1q|ثb͊6*ثb͊6**6*ثb͊6*ثbɟa#QL[!*"r:/-M }b3Ba SAT])6*z1Wu1TJY6qăzG=H}G Vo׍ȽcJ6 ^Hj<=^*b>~؛UZH(qK OC.EOLM>XY[^z?fDt늬#Fu=cCyZKKuU`϶$OcUZQOdpMD}[A]%r 蓯8~[Kjq#)MYz?qs߾E()A#c«W¨gU8m>p< ~/hQ{rĵ(㷎:HU a8C4m늯Q01J(iJMWd'QcbIy2 i #xp`*' *֤wb*hvlU4nCcUmqGX1U6*UT$gqTYVT0 G(r6oƐ*ˠ9 өO ghPJ{ky謬 UaF*u) 6 *w'N=>)VGY;UFkL[~ufS8N*_=(G%?u.~`U`Jlw#,8n?N +)Fsf$;t8O0GL6q*j>UO UJ1U>kUejn7\h%v=qJ{b*> $ u.Cri RRI,XQ9{Gߖ%,O aC|(E[EtDAaN\Rh8^PlR+,1LPӸ#7LU ,l!d^ c1U,\RUn~s Tos lAN8[8UcDc*ڍc0bMncEW#LL_;{#Dl[Vd%=wfiDz0>K In w2=_wU~[sT\UԦ]늴z|=32Wqr=6=1>U>28Rs#b!' Q XCRFk+5xንI G 0\-|Ё[PFZHe 5N㺟*ga)? kBT^iShp*^k]qlUQ7Ŀk,u-*[7~P»銺۾Qpuʦ݊h~^tTo0B" SQӱN*\K}׎q 훦]Sѩ_( ѪQ'T8fX4n||r &h\:][%~pusiN>능&GZߢI}rv=©϶SMPh7/$UMܴ_kt#~8 (v#RT rHTJ!i*CF))TUN$J%f;+JI7;@d;ud)??x(!JXַ`qv,t8G8x#156aSؓ/zWq\U<= F+F<4pRUi5^0!j͏0T5FfL UUvlv; WfĤcP`?\(qFC=dž+~T=ŸoG{GK*O_N=!Ʋcr)ISC\^uǍUO7J"9lؘ$\Rqm׶.P!5~Q:n0RVYE x0**MF8O*JOi;m=uRGKWDGz?eʿ!ubU8mQZnmyGxLM4_θT@[ >,IªXW}cW)*9G„lzTN)Ǻ7^e\UAdh[ PE"*q U~=h(In돧uT~ǫr?vX1/wTE~~-9Y>{͸~T1i`J\5튷EqN0ª4h8ْlz Դu.2RtzIյ5Q? mN[7ڒ&_©0N9\cFGğN:oc> N0«Jv,¨w ߡ!ft2_*"<튢>f13QUc\P,b T*P=VeF64߷\P J5NJ U~cVB6=1mV߿:\* `wcbjZ;Aq*K 6nv#cI;AVce%E şaykNݎ)NS׸$7ïcӶ*SWuT^.d{5]{(Z=bIپpP7J8LUz^1UCGPEF)iX+CUw)Wl7іj|1Vq 0HM1Na$R14?HNҏhأ 7u9%W"9ԍ/fouWG3EEPF&׶VxO [zѼp hL~1E=Jsx( T^qG.6(C,Iu1U1 $ _*G!,SN%_9]]Zt5 M_ UP~!(jU㊉>%U5vV3P>͊źbNUE#U@Jr`WIQ xqT<|91J cB6 RBoQ_q w\a*:xc1U1>b{>㉔F«B7C'_BU8RHa{~X CF(XA\!ц-W9U) ^pDw=p*Yi53YuhW_Fkym[2J, T2}ouټ0!w[;|s╒@uqm~ءBt4eztª m_׉UNz`UoNCR2iYqu\o &nllsTj}lz`UVDSFn~%ZFe}OQU ?mq P?+㊸Ҕ8;TCGQ+_ӥ(z`ن %Jd%21 h.RPJd֛ <ڍ3ٰRAwW%^~8吮ءk~ZTq`h>AyxeӐ Ec']iW#0wZp4㍡_*=9SLmT ŇG oPH$ءI;J{u*lAu  TaIqTlSSjxjqUuYqmC:7@]ٕ` wKI@6KidK5r{f6q!B1Y(ZV`J!]'ZQ$2@1⪐Jw_o/UµS\L1S)T!XbC / zl0*6?۔ FvVRaCF=N=GQCoEFt{eԍ(hwM|w+Aۡ\=1Z]w\*94}!Uߦ)W0!a׿8IAb*l~'KKp?^8Ri6yYO8Cnn(E_Cq_L#lF%N4\)l=: CwlAZ*\azt*u|m "7\R6n5:lUoˮWЯLUp`r^UkEr+ƒz7LH늮1^lPGB1W0 >-=\6!QQQJn i+@ ~ׇZd;\mqRm4lO+/2j',T#p6r!*XQ~3nU*H~b„+k;-o|*+a7L!P'5H5; b(7(>l|qUx_cYi Utr+dzwl1qOLjFVOkJR#W!C]$bAۨ POpjn0)M\Uc m VGjM}\i>T2o~8- 6*ثb͊6*ثb͊?*6*ثb͊6*ثbɏz%I&-@7t~&xkJ @G<=$()|30h !{r$SgsLdOOc(*d;@&3* ٿ^ 泎'fpBҒQ;:Q(#P؄n; >J&=DZ銬£f=P<5x{b,3CӶ*G_ P'] Ÿ^/qlp+@qi ]4~%튯ݏF{wlg{bƕEXx$lpÐ댖~!CpTlE[C7t /` H<}T%ݼS!I=Kn]}@kNz-$_Νtph==(O 6$d(ZSC8b-7Nb V={ Z)(*-˖#zUN=q{0 OúE~^80n(i߶ PWdW^F J:xcPEߡ#~K…88=37Ÿٰ%ў#|I5fgISźJg גle+u/Ӧ9_[ZWRu1'`T,$)Ti"NMcJK;4լcr'Ӆ4LU1T'E3UH7?VUÎ's Bxb]צ/!ˎNtvT0j5QIZlm+.w\(C)C6-<{bS7= R܆7J9$cǧ}Պ7oQH7=<<1~U|S{J3źbWErN nT}SI6;6(Q#U5LI[%5w;~VP)zwsKYJV "WQ_RkCwP.~MV%uo$-C# 4oFS)3~0MmX( We)(Cr>XP,`U -vl]du8U 6?c/%aĝ<1U~Oٲjf R^>8Ր͸~lZ9xW4FxXkC3OqKmW3([R~xcš~l7]ql&l81h⩺ڠzg,:0(9.bё) =UqFT$b+邕|7#|OOGj<4oንTnHU\EO RI; 4d IC ~Cu3]ׯq]ٺxjv#Ъ:0ćC̵;㿎SŵWuƕg7|L+M? )qEq;bJں7{q A˧Yө*?I67aTL04e=TCl(]J*v=++uV) ISŻ7j+ֵThX8ӷl?çM1M2%*wXpP*OƼ&a#M)_u4FۣJ1Q@xn~44r~P?دbr39Ib{JCDP̍tcٳ N:8K0ʹ=h8V:/yWӝz=G`traTltVq|r;a)F=sqJ`?]EV4D*H*:`UHn(hv׌߅Uؤr<_8UBXD1ZW|U R6lm)…|~Xu*j:)ǧLU~cXA_qr4MǯO H D-SjzP[SN,O1ifVexr` d)v8ƏbsCF8[3)~xRz2n/S\t (3vC~_1U+MfKYU>̞/$S銧JSߊv)W]U;*QBӳlr>[)1*>qlv>9+U6.XTU;wb2b2ƒ)W Ќ^Efs7f[8]6iOH?ȯrx\.:U8%& t9`bzt¨pM(Q1U7Blq UѺ<~2I:HM*q̝L4i%6?kN?,UW^~0%\ecz|qVn<= U3%;b[q&6oR YkE} qzwY9$*q}vǀl6o EnoCr^5Of:Pz1nei;RYKlOCR :iu^1v$2e>ԣaUBJҘnD (aG*ٓ㎀ݎi#^(6+LBH>\W; J`J-\0{8SF_ !I T}DwQjRm!ñVPU@:aUZI'c}W $U7+겍q`0}C{s7^ţ_uQ Mn<0Kr8ݛ]!"(;6IiE pdwcqf0RyS%h4UšA|q PݦF9є6銦)5O*ߨVlG|«3WfbƒKw)nl?읎0pz1nw_N xWjWQj$ݘ=*p`Jcf㊬1M5u‡ 7^5OW|JhT[~o}%AFV*Ffd*ƻzz7KExOkP7Y2}f o"o6ĞG$8ˊiM˜@C#.fQޙSU?qBFSp.g*HAu­9]LAfJ"2Ɣf Jt~u.1Mn%MF*C6+(CmK鿶S]|qw\U+|-+;W#q) 0i)Sׯ~^T>u+ߡ M*7k 2iR r ?qUiRn0)CTF_cm/("C))e~nQɑ?hbwygeX`BQiv:ӼmjqVx!aB~c'q%Q%CW+E+_BO>v튭fytow*xr:qUv2 HSFU*N0NJQ56Zm⫘TTT7qWG-|1 0o ;Qt[ƕ=UEpr`Uԥ-nC|q{0ժPV9ّz5ȦKoT?i桂 #Ha  wev8Oc1(hv89\z>}7xTLlnwp!|.?)Q>*N7"wAƕnǮ4U~*gR«B ĊVdqKVAQuqd M{nǯfP Wx`PQ]p{f^ǿ )8zf(A^ibODLs2Z,S\UBEeqf\}?*cVǷ\ Us1USῶ*-vmT$8%z`U܃eWG^u;A}ت䐯^HU_*v BSnULUq/߆[JoN{$#Z1 `مFj=p*~8"ćF)A^Qj/u؏>>^8PڑM|'al*"8qXcaR{Bjz~sĮ*7Txۉ#im%1ѱ071Y>ٱTp>UBH.txaV/co؎1rM B<1"cU~߆3ö^T 2c*7W17JI^l^JGapcD,%[uʳb͊6*ثb͊6*ث*6*ثb͊6*ثb%?'$C_Ġos#;$mU7JPl(R(#7Q4HT3*Jʟe}nm$5?(Kx9G N5ӟĽ|0J7q!\ F\W 7Q! 쟴*e ?lJXkƒosٱ [+4|$V}Uc V 6*(a;J\k 1v?)%B;G5 PP~+X~/+n1HZE$]NGjG̑"ǐOIGOc €tmUnȂ:ފIY$q?fO_5UKiŭx%Ҍ4TqU 6LUI4;«9 M'!.|dQ[Y-{wl}aJLU:tfsct Ԕw؊D2 A`AJ3C/b4=_ AwʡȪ mcN?ªNmN+PЍ,@`ct=ZW#rlR,k $lPrR8av)+`!)$in6-?Qv87s7KY80*=$ e S*|KTj/fCӾ*ܑe`b;#!,kR3@hw\U.Vf1(|4XhO 1KOUYAM]mt̀Q3N$%|X#GZe5}tl9Ǹ%8μ(U'I^CQiӺ2!-TDR>JپU*ߒuţL#0U=8CqIt_ZNz8V,Dy)U]'T[+B)Fz4`I-+CTew†qhiI?cAQUB8HPn1U)a 0-M(Bc<$|N5~R|~HaUPMRji{ҸI~,{6<_(QP$؊0?Z=1V^@)$_1=SNxcס1U6MfNY%>L#QJDvoFh?i>Av@͸sZ^=UEW K6+!~˯P~xͪȟY?mBHeؓ\}=$0Ge?i~!FX$lqVek*jlqUp8•c>ءŕuXA**>1buѹ!ON5Z*s(EWCz9>ß:J7𞟫*^cW|;z>ȴ_c^aW+\z7@E:U@N).7`JʆBaF0Yo ?fTXLlM`)ch+ye5EQI%zuSu׾a⭚8qaU06;4ǮTLaUAFǫWߒB6Yxe#~P0?  T銣=qBHT6MIAAUC>9kqR fV+ڣVKide<['_UP)Uem["OSt0j̷*#fu?pRm, ,_ 7P{ujIPM#[z>(Gqc5Kδ=GCcurMqBX#{OVMWbO$޽,|Sfx&Yz٥AtA}PnҤ*_\o6>PSu^}J 8`J!%\VIM(R oe6SI [_ GvUʤ‡|^)C0h u20w_j9J8'kbuA%~b~^;W\zhbs`@Y4';i3\[O8OFG VwvZ'_N://XT+J KĜgVݎ=pZPK{ЕR_Liͼ[݁I)o >GO QvidV?%81T~(oTtǂFءL[wƿU7ߖo^ZmAǼaqUc48ԬWM7Zv=V(j:2EǧL W`Ju[xǏm؊7OhccZ٪Wfdž4[\'o]=m}a|$؏êN.2-uCN6Bw-. [ٿ={FW:*^]*Hh9&1^㯆4 GF-[>Blv U1Xm*kZn xl  rFzSCP)7^#ڝmڬxfuIn)cd ㆕I%1ۯ9$VK)pqܟ:4lT;1VG 2B|,6SY)צRh}7LUn\*I^8ኬoQh݌/_߷18wQ 2n1Jylvl|l)Y"S ٱbPǫp0/\UL7er6=qW2w/_ UV-Ǧdx`JjwǤUNHhy'\wSlP0zo++xIR+&m0Μ MZC{v*z~p;Nb@w;v?ٰ8r/ !Q~qU=pA>ñ34bEi&xZ}N6oU$O.h+xŒP6 -Fy!zbYVMc2BM#&VzΔMGX銭lpt7%32W~)ZIzcUU{ ~YoocZ۪,vQ *f Qǩ; boNw :ge$➬ԋ_ 2JmҸ+__(ao^PDP :$}M۷h+iڬ䛏 7.xLsY"#q(e1_(jkq ۮ YAL*-qMqQ0܉v}ZZCR@VOQ8li_!њּGn>(a/ƦTzf0#n0ixJ|HjkYG Eb$WqN(v=pEx5)+WqTC hMVW r)%U?'6:-ꇨ򱵤*^Ih ّviop„9 F%U`CuXWlptªd4dt {Z7Y~[^*=1L劸^?,UFH9TqmQ'q`UHTS05p%P8qSe$cJzb.(rlOxjAEz NteZ 㭮nq*z*W|:zsu6e>*d+^~/41>V+/'|RQSb*>bg xVA߶Yp6Z"+! *1B e^ɾ+IP*Ѓ%=GSCUc'uȥV@i(P8 3Ł*TI{R$z #xBy.>dTq/eצ=~3pw[um' DZPlwQqn?pS[GzšS~T/ҀKWJ>OOHZ6 :SncSFepv8UQLn9io| xq(*>!/f]LPrǮ hjEz㊬#x?~SaCzbl;~1U_W_ǮX$b2džSP׶WO⭑_p U?O5W,\㊮^@rUqU!_li~ >=ׯ>9Z2I ;UNNQó,늨nc<;xbr S4 cOq)ʿ En,}g2AQЕ\[uUǡW8vS}T#kF[kGl0;s9EvbA-rSc _Ӹƒ)yE<1UΫ?&㊣={6wF};07Qeޤ?<$*+^/RAc*B7޸%cBXx 031'u«ʉ>/{n*C/1UVU$)5?7Hh4ߧ+ʂ)֟x^{Um(7v`JEs憍I QU*sž'R7ZV9`| FbC)"\Pqn0?<wA%#C)6Se+o_p= qqCkwswUU*i[}*z|늷ګ;:8e*b:qV\Sq5~cF튷BPW*:f*ql08olpjpi\|:V-W)\@acÆٱB5_pqVԆߣtNy!x`JѬ@ DuOSCRg6So:#?s[M^t?# :zU;2vqI s 0YrV KnGC _ HUxo2n<{-Oȥmג~9fZ1->/iH?zcJVI Axw,TRM~!(@غ cU}^?b ~?Nc`cvcRc׶UUn?k~񊮎@ }:9wVolFh:'Mqa.Kxoˡ;C*͊6*ثb͊6*ثb*6*ثb͊6*ثbɗpP&-yFP`nIJm($ Npq'KK&j~,Au_,I4eOlQ=Ҋ[bi|Gq&Q5YvqxUt9?=#_QEGPv=(S8FQԁ Svׄ*08?-^)({6;V+tQm׮=Og)6o+N*e1?"7r)D!NF6⪛qrSN2㓎 _A8(Ah[^Mt8֨9fe|(h7xTq0 P$CRn@7шc;Qz jJ>͏5~)mjlG)Ӧm*?bYFk)[} fq)3A85B n1[ZVT#,M6y#q IArhn*Iqe5y&o#x {`T;ĐBStz|RTqo2wW4Tc$9-j~xsL]Cӿ*x5^8c ]VqC**:)#[q)OɁ+_ .ߎ.)GE%ELlRӸWIWIQFPBy.b8!bd}zAᩭhذ\qmǎMrOc:lw*lèľcSwS,G>D6nHI߬8?'nIwV$oձVG5};&?0,+*eD@;ܡۮ*rm _^MV`J!O'1BI} Jwª, o1B)osqwن)oD6=6C⪩ GLlU~4q=qUt['!s n*B:⌡ª)!S\ER;SUHu嬔զwqRu„8%|vqU}#{Rl)*F0;yh߯#L"0`K3[2ud+^8<;$>J ?eQ+r> 銹֣|p$lqU]wnQ-ቑOq MLU]%Qya4l|1zbNHJcVĊ !N[W3F8=p*%Fیu;me|rSCQ⣾=uxxaU8$MDZ*>UT<_@^-x1Yw&J+v?<HIf EZ}JFH)T;b5"V, ЂWrof0YVCxR6nQX~hz1US xPGFbv*CxVs%늩(zwU…Ǻ25q*0qC.RZtͺwf H<*Q*v낒o,z2Sq 2sWOJo?{ Kgxݩ7C_2ŹBp Gڌ)p$>$ީ( ،U'pplS ɐb)mmrv8'NF*9Jm 'N)$j⫿*_o|D1ѺxIQ \X7ѻPu0삫eU$1l WI ԏU"lQd]*~8(PC>"Drw"kcFkbأ?cTsuīٺ`U~=YDx-]_ rn ˾ v7VJzHB]wiU RAX-!O }?\ KK;FۏτrH>' YTq*:9C#͌#UAƟaVߋt0T|(& C\"#Q1H5KtE{6s6 //M*RY^;SJ`ײ!UFLNmVM5& 7޿Gf8YTGD4 =7u:XJ&ԾKp >j~,c5^1A(ҽW_zbO6-hj$u^|sm2+Wq SsMk0'}LUqXd`háP4mT Ngpr^is; L}> Ѷ#| #q 7^)W)(*cFjݎ`:8JV#Q1dFrVQ5cJqxbSUwoP )xxd«11P8W$7~#_YDzz6Bnj}w"ҭ C^d% #FN;vt~,B 33+4ndMqd* 1"`TRqCӽpW txH_Ն*YFi2ۓW=o# ~2 w`TM`" `lGBYzb]}W1 zPH1SűEopy.07\ {6*8*$,ٻ^8N)1TBqdĸ~돎PEY$$*uTXۣ z=7UNAG|ylP|U-IUj<1SѾ r_ቲhp*EF9$+l*H,Y[Zj<A8\ K5-ԕlErF_z78G(bmWќuF))pЏ _ =RNG4nT$ªwcn 5h7~#&c#n)Uļա~8z[lö+~LmT% v>$ K)SOxć}UølD"tJuYVImP8Ɛٱ=RP8n.?,}{UH7 T⪂j/02Um/-`hB9#uS4Թ"ǺR\X+ny(u$o_#(pU*pʲ?.$PwW*hݰ+dM.pTxuƏz_ RTQ{sgh\b+FZxeU|bw,kc7S'Tmj?LU^CQx}CCT"8q=]wk^©:N Xᗼ~?y%$YoYxKGJw\劧kQ2UjLP{Xv׶J$8*]2HC2$+NG$OlB[~a#n1Sp*7>8&;? 69mH>#)l|0*M?v*E|F-F|rHB1x?gƲF{JJgq UEr6m㔡l*Ьl{Fu;wJMhu1nت$>kpUVG.xLgf5SCZ 6o b iIu(cBqzb |i^?zr s+8ڹ;n2+W) |Ue 8Px}|;̤ u_*8mጡL d^vl Qdh>SIQW)^ȫl'j+Bkj|KS3=;_ Gvᖄxf3_늪fcVħ(3GQ!_ 0[Q*M&>>-? c7.h Oć ^*.lqǡQlvubBH=LUs%*(~%;&.8EixC5v*H>-ǎ=|WM^2}ӾP#XAi81U,0;7LUo.b ]˶*uhO*$n7¥~XP2f-aC:lz7joT UUq'ƍ7L*:p\WC8惧mƜ+\ZNcս{魽1! e֚YДzW#Mqݛ*B^׊إ|wfB`TRȲ/Q\Ic4mM# UǾXaѺaXҭ̽Ud7&WYUw Iƴ˸­l0qE!]`U W0Z0Pc,oR[ĝ)Т,ԋfF[)Q8Uf<0ֿ RAyl|p:3Dy)"M,f=qB[sf (Cy(e̿/V@5G7#7S[<6׫pLRqTa|[|+CQ\kM%R9_Y2lpݫOlPr9FœFu_ FHCv8^;7_!TRuV^q<4;lq#RBUBDccU)@c6=[tvaq#ǶWq~Ua_Lw>+Mӯ5_oqFzbm}cኪ=_R*ac-2m^ PN|0T|WҐrOQƒ?֡<&mk0Gny2})z.78qB87P^UJU8PV7 *jqV6o_wͺ{R7@ءh-5*P6Pq\O3B(|r_v*iSJ!qBn32W+)L Tk'0k1Ԩ`UqpSq┾NWq4lcz2jv^B=AJ߳4lV*+ =WxC ǎ]vCԘ}*:`J|tVVv[4}뿏Ob/!CFC=RJ,~z)FW`g4dS~mVKn7cІlP\!e{/Mp"\-0!IOb͊6*ثb͊6*ث*6*ثb͊6*ثbɟjP0biO$ ONbqΜwǛsNݱBD(~.j"qc4=\C\Cf PrF1$2'C͸ݧ MOCV(?Ro8^&"ꊍu)Q1K-Dz qT[7Gl^7~cPsFd3Wͳ (Z]D`j09gn&F+V:ٱupWC$t>׾Q_GnH;t׏zU|rWf)Ǩ[eG;%Go,5S*Qņ!&¨oٱ3 Ux_1Ļ#o|RJb9Ce0bHwkU[7rJRn)WVwi/O U%~ن9^qxv> \ f8n0#϶*$k/G0eQo CI K \ZO^[su6Cgz8 +_;(qFQ?MTt: +4;bxwŠb |?qT?z#w}U)< ($ݏc*)WQ j$xP)Ǧ*Ew^`Jb#냢IҺ5_~`Jgݍň%j ہwaQv'Scb=wr]V#U (w뿶, V:`Jz뉊Wϯq…~WqZ*f0:by4 6L*٧Q,6ZWv8PC2[GtRǮ*CQW| \oo T}cۊUT ۶h.O-aCCN4<9+(.:-_V36y[T+;6 ' rM=<F"wSb}$bLX剫F=*"L8 P C{ A| E,ټ{^6Y^$$%梣Ʋ~DZ_Q>u1'}tS劢A61~X=k QኡH5>%qUX?e|t zOlU8?wxUAIӰL=z`UaF}5)xbݎkR6&ª2B8"98BM L{xKL|I i tɢK/ hhpx`x\Eqb-=Y~r{`&c]=K ut<]{|ssgeu+1AᅢԻ3-cSMZݟvNJč'|_G`aaG|}O q8Ǻ"RjI*ze- n4k[2CCc0dmoxFHhzW3aKQH.l/tR0Ym׺xvKܩ22>ad<^ oZ+q 9!J1ǚQvZAA$j@4ڕQl1W ƐG =\+K)Ӧ<1B-w)h&: ߡ};XY@%Jo^t~2ac#DJAҧȓu $O𪌐4G}e|W8*6nIC aT4'^`~P9i܌NlUT2欪6[ 8Zn:~81mto,5E:lUZ>ƹLߨI\Oc}_SLRkJ# -ካmC|0~ټr/^sěbt늫mӨpRۮ,kJS +qON;ؕW4J P~2q|%/kilMm~;ڌUn)/=AZb+yDk u7VbNbLO%`D$ %=lR)U=}ڨMl˺_1oF$N'$Axb?߂R$ Ǭ|qU&}x( G=?- ٱDjqh0يaVBOF퉰" ᖒjXy}rƕzu: {UU?ce7WI]gʡpd1=qUN>liLUg6 \pF J]q`9ru+-42٢g m wr?~gqT|5ٱ%6m= }ت䐇* G_`V✃=QˠI {2wp*]Lo_JLR튬8Eoц«VCCvPJq|euqCx3USt…wl|;c/c U%v=$WUP\ÙlzeJC޻V)'Aw@"^QcJ99oB})c.8/ >=-+cqiv*WX4MNjlۮ#䂿|-Mצ)R -elp!P1v8mT5^Ҁ%\%#gęii*#-[ZM\_8!폧uTՏ~NcU֠Æ\WQ9a)qJS>0*kj{ Pl߁o߿„'!;v{ *w 6u+ʞ|s+$`]@=3FCqPZ2&_"fIAάBZ1He 20jӣ&yѕ\;rR:V!d8j21Jo_׏ |C8s+ :lڶGǿ݈nXb72>G$pD|2n/a>=V}N\;4>n?| (GQ֑HP#- Wu…E #:׮)VHǺY~2Iኵ$#銩 z ) zfY+ >튒P+Ğ6*̒ǎP>v*P|=Z~*]㊆c؊p:`B8O^ݱQ̯#劯(~V ªmW򍸟P0$E ={_WBH=+LLXTLC!) U ʂHwUC(V'XoUE|:2cʩ^1w}c;*#\|9a۾*ь.^|G⮮sǰ߾Y*ϦX5\W1_ UUV4:b>,Q\?_U6FueєV\PCpѰh`U+DLs|z`+ \%8RB:Q«.*i)]8 WF+@jњhDw1NUQ0qzum rWtJshdWf]vlUٱWf]vlU*6*ثb͊6*ثbɟot%'$A)' 9Hŵl:qVPq5Y gn9*)$tlQHqCױª,"H4nњv4I:`y[=ա),zO{Ӥ͂sW3 hlPI䇧"TJ*7 Q } < ,eJG|(Yhɸ=FxwyA V2Id4K SJ7@+3> pMKΧ5+m nMPw8G3Nd#zq &i ?+☍>_SD5qpTRAM SPv>_BB6OqS^p!S$BACxJc7N f Jo&*V1VCn1X߇Q/ScoCQbַ1|p!(-CLy]YJv$o]٘H5XwPM0#ӕ 6" DT){Q`r:8Rߙһi$mLjlU{=:b?OBE FqB)NزQ(CMrO0&?Ð_4A%W[j`F05dg%s{`nh4=q 6RSUbgGnP(F~Q% nT3ku8U庚67W$+銭opEڷ4OUPZ Afw^6hJl略XzzId ָU7ʚ~ x;ុHU]/bi` +u'X!~>ðqE~ láT^?Kʌz~:z=1&*IS튫uŔmPQ,XK#mu yG}Scǒ*%]zEtSgˆJ|-!m>UBno OVʑm⮊bv?،Tg:҇89Y5 xrd2ˣV ^nW=1ViָPGX]\O CK&̭]\Uμ~$e々r57DrJ uc ;bxjdYiѼwFm;*4MW#>#IȦXêwov.XFV+$ANIS(*_ZcIO\m=$@C U3u|@8)ΕNn㊡hbW"(|0*.Ģβ2aZ!͊G${19#އG%7o^>eSqZftN*xӧ20 }HPПjc>#U!e;_gª7o }O*{7ߊ$UNXkcaUC2%~v &Yau7-4x]4 pAPCt(2 ^ت}+vR*۟+ce_DQ+G bG$~w`Rmϖ&JW   A%'j}Ɲ@mD<⥪p{Z2#9]A\CRHRsR*)VurNɌ8OD Y^k4Z^qI磻D#d>ԊUTl_lPߑ }̟ȥSIA_ƿxmc䣔2"",҅E9GCZx7vMdQ_cEQ ,]I苷B1/L?5 \XE0ol~ǦU~%V \kCLUc|?klZ+xUB@ムF_JJUyH#/*խItaM yPMXNYO UMFH$/J_Պևq߱˭6=ݱ%U)_W4rC,!z8#Pg4lIZ99 6(VcVdm_~غa݅vB9u#* ټp' Vd5meZױ>x TaB5lBHRQPW"R#(э71Uuv-LxTo,⻌:FO$EMN_ K!i+@Z!_[atI TdPC)A$r y"~/׋) _9C RkŶo|O>8T.Xl|1VqmױVEqyv [}*:LO>sEǶ4vW#|p'GE\ ֽXnǦ!Zx\nʫ'gèR6z{p 1UO UzMO߾5d|p*!bPwBv~/cOfqN^rv>N?{U7XwA\% 7]uS?c I+Q%)QR L{8-Ox⪉!Pv# ؊R7])TIk)[MppJu#, Wc>cT o l:֞9a†9<qxn6ªQcux(•Ɠc㊪ w^Zl.JKuqv>珐U$x4iN-[>}W%q ՗4q;(׋rLl=9F{ oCl7Qqፒ.=>þTsSoj.ݱªi'IvoBتxʝpz7j[pۧQCASU$eMF*~J\AB9G-U1F2AJʛaT5W0YvmqPߎPe n7\1bOܗVIMxI\)T˾Xn1b=*]2ziPWz*IG_ VKUu2ԨꟴJ/($~|z|*E/AA gnVY=%Ob9 cױh6ªx+od)cJ >@rW2hO#n4zG=v  #FSbmSHPj#qOcqBVѾώXzuV鏧ZGccH㒵k]ק$߶#d; =*(s0 ׮*JᖮT s(qCxeIě Rs$޾Ԩc(Sxup\39+T űS_7 [n+Cm$CtVYP6ZF1rxNvV]wE `X4c]ƕ&qWŠF cF6ݵ72\FWJ6)Ǧ*rT}|!]q\>#xaU")F@"G…lnTپ![T j ▊> ;cX ~gҵ«Ԧ*Qe~YxUoR7?˗lqWQp~LN Puټ|rXG^orHSoMUEWqNҪ.G YSsXc~]`hǺa"fF؃lmV:QSCߨҼ[76b]'q *06v=|p%}q_RJt^!0sLȥqG*xCRƮ9>@ۮ$,IJ2}TUZ0mI $,+ĉqF&~TkYxH+}*@ԁc$o*+'Y!q#NНثsۤF=~:)cc4lд;>vORqpR-s'xd?4sU=t8miks1ŗ!>i|G|DOME(Qdd$vl*,KS*s,~;LnաcCqPw]u~U֤}#3I}Qq0 lmWK 7qF!$tݫ^řRwq-̴Wz7cVnc4Uc(a܏bv*yFj =2n9*:🅼{bf0~$UR xtW&p =q@TYxtrzw=AMb}[&ߩS[5.'qjcP0*a ?q B/+݊WyS኶VDZװ~Q|jpWizR8|k-y/qjg'c-5?i6#J1x6>9+ZBOb xb AǮ J1% G43GצT*tb,3UxSy}CS oc464F9a\ҋ\m%ZEȳb͊6*ثb͊6*ث*6*ثb͊6*ثbɇP~&-T -UZ=6y:/\-l0-bv$z_X6ÿW~y~eO.Nٖl7^*k@{ڝ1Vvјv C œ ۟­u?57{Ur0? }@#\ )T0G(" eHC{`!ZY/ :`[堐t>86?&@ђ!0I2?t"U0J?d)m㨨Ł 0 T7}Uc~U$rtqT<>]O\k^/ iN2M(U _# Ȅ d:~R Ǐ%Rb0* 1IcIa jCI{ OCOWl*#%[cU3B}DO_=CCJkkrACV+qi:|ULR"8}AQBNcsR>h[Ӻuae/,R##ѿ`Uvf>\/ڏ$e8㯱©r&FǮ)^W;t Z4ljU >cª=hæQR[V |,;b%E(Q"%,N*ue򥋗ĘWA1OOJ RG&PcJo"q(|Pn<1Ԧ͊TqSu*(gP['cAn<1T3ZF5.qBRdXciUzbծGQ=+mq%b=;x5ZFԩ (l>/OuВs6 51ׇ]ǎ4rvaOo|z :V ªuKC(PB {\R ˨aN1VV7IUM+YaWxA_H8t*ySc(Y֎1?ªAS~fR6n`) e*sRǎ*81ۦ |~ Ih=?^<7c l\k]׮ ggV+6 HRvlFITGC8C@Qaɍ}\s%ne R$d7V#̟`䁊q+p$SY|s\cW늶M0iT 6{ #ޝU60P5vV+W XWXy/jv86@CO E8? ۸UEzc)NzqP犭 *ɂUqF„$mT?n)GUb$`J!Y\`; TQOJԴxL}kPIu8m[;.a;{0eH\U0VczqU7ZtUu޵qU=2q7o|UPPe4nTbߡª,znӱcx{`WQvT^.J qPێPXeTfu7C2=v8]uq V+6+U_o)W~ؽFE ,U+@0* ` {faY)#a!N.@u©3Ȋu p 劦1NsxfZi@7ue8/|D<{U';v8p8Uc渄kJ*47?&qRۛ"{<1N[p>.Ğ5`$˛w~B%"`A`Qi HZr=<@M1?AV @j0a^2@%!*}Ð_^)R5 LےvQG*B$ҘveFW$H q`61X) hZ }gTlHFN#F]T鷀UscMz$z`֕.* v̨t+ }vJ5S\}"ѨKVݰFD`b0ĊĥfbI$}ْ2iTjFž\l=J96谊q,)[za|UݒVyڿn?-Ok(!W$#Gz5l% >؊1$oPY su_a.p}!n,;fLrsp){6"3(OŰ+A'p t5o .ե$(b=TL`\uY?xc,BL}?`לVji *cj=oHv4,ezv#00WWg?&vHߡIVǎ*/veQi(Í)@qVhGR IFbР !ezv>]6=ǎj?A‡PUኸJp|lqb4?8$lV=Pbd)LY\0ɡ Y%~XOf U#(q*9Qh Jh1̡nxV[tcT!X/a3:IOZp~BpA?+ciMU~% ;UMV*ڵES W,#LbCFUEያs`^**S%}MҞتrTv#Z*tn⫨?X{6*xt|1Bߧ_P0o1U2}׍<<|qUeS޸%$IprC%SREL|DHR_PEX{UߨCV]HoVDWFwUp!!ҦssJjߠ?FhuЏcTvr;;׷ XǷUS?6q $;b,9|q)hO01]W *߶>(SwnqDR}|1 xszsb,MfUFm6k&n7ӿv>9`cJ"̤dªD#㊹M£/ԧ8@kZxY L H9uaB\k/~R9۪`{!a30Rot V1λ ?fAKV#Ԉׇإk7+܎{2)/Ј7ĝq~$ƖC1qOCFV\0}BhJF46nU5<^.1WVI96~Ʋr/Jmz8Gl|p)qA7^8@uT| ^$wUWzqCAX+׮*Xtž!h{IEF"9|jhq lw_U}䐧M J׌H(va2|P=*e D#u@}*zR{vjQLhqE {r V7fV&q޽G d~_NT6~#thƍ{bk!bjyu኷ώ͸9k%Mc\ѐ9%*{m 4Q(Wwl P&T aq8lAYN #;hn*jq$JR3N6ݭ{E8 [FǣLJQBc5#+ 2e;ICl(\?|1@JTcaVe5;+VkcU5~:7]*CQ@WlrӦ)\hz 7+m8Ue}3CZcxN*;J(|WhWuUCOLRԴtXIQ̟;qb q/ }@pjdo1=2h~Dxv͊ɷQ4 UhAdfV6=ue?J_הVsARJpOr ƫdiW$ECc gٿ^T_V3<<12;b m0=VȮؠz|U63Gg<~x;({~,GsCӠaT:]bx]UknIV؎ I":Sekc7u5PqC:xa=WlV0*ze+?ǂ? 7!wʡ]*0]yuV*j3R,*ks`VP4}تg qU)ڴ11UTbb)^U\o+Rh:{fd_m$RaTotqNW"9;OӁ 5'Z4w(V(ݶQJ[4'qrWn[xג7/*vIPdNxpLSz r3w ٱUaʝBֈ80*U،#F5K'G09p2ثb͊6*ثb͊6**6*ثb͊6*ثbɇ>-v&-VC5t={bܐHMIqd$lBEF80]L 6{_r,(] |Ny 01WSCnǮ:75iO rz8y.8ek p̎r#k_Rvc¨ħAh>Tr|Pqa۶S/.*$ߋq 7AªDSuzw'k;cz64׉O~ QQ[Gjzjqu|'r2#*H4|jT;y­ĵ:{b7,zx@4cM| i߯|Up>8rbG^U ,u;u2S]%jK_\SH6*Uw`-aXvQ6 V9.hF߬֟`7B `Jd]GIm׾IPJetOLU5#8IӱT&BFSO&> L)UUwsD:"olUrl|_Sc H6Nt5~hX SSZ&PÃVہS;[U~ٱZDu F aJ"R$ǎ*e1|1[K'nQ6-cӦ^{bRdJLQ^} ^7Oi\UjAchWqU*$_qA]4#80M2W)_p?bex=)Vb$ٍqŽ(w8PDy(F"J2`{} >wS(:Xd7v;H~?{s^#QvWT/щ+Q㙖JzbtlRP½1 gGӊ=W*i|c!Uzz+Ǿ*lUFHo\Y8:㄄uXЫ|/\c_U+0%@5Ɛ$u.d14V zZ{­$m^:|KJJ"jPzAr\$QHjRT~Ҟ*KVޚٓ[lG*zj6UbMlR(m_|U?U:go*pU`Oӊ:e:tZ-پ(R*Wt;wƔ^% JJlzbY\㨡 8…0Z3a]QJ1{%>\rӱBu1&R8:Ǯ5ז)TF߳{u+ ǯª ŸW2]~6i&){^FO W_9$#-n6Gezwj( 28ehN;*hP{,>U.x& _L;a*Վ #qU"āG1)ƽ0%oqm8~f-\*I_⪥)>SOLUB{q ${"Fw1TH"AQ/Qh:eLI20'JGM v=2ѐKm4ng-pyQR? 2% ƘVGz?D[`ƏR)nS4VN4J+`Ң Swsⷎ'93 &#эE[6I14ݽ$RWnucRJtSO.N*v =~?% llUnnmmsųDAVwr+MؓLTVd%r$XEiOդv ~prhK.4%l;oHk-'!Ty#TK87CpMn٬dBvj$J% v8IRAx銵v8 T\d7~Zhp(v?5`TX͢ecY ׫M`oJU!R *X_jК.Q.7ƕPw=VW_w~K+j>f`CAQDtE!$ >/C%Ꮽ?l*{o UNH) m&=9-Ol6, 鍒 F [T (|@++v9a-c(y'ӗu鍡o۩M_zK9۞)4q; R"Q@Uɐ~c/t\[N읫TG&ѢjU:'^!Wf Gn8Clp҅7]ħWY)ټqXT֍W)0c&5UzबIMoc⨅$T"u1)uƐ]88;RĻ^F*ڿt8TRٱ@کd5r;t]H7ٱ1USnT#uWT6hO$v =\{n}iRq|'q%"=@,l'_gfGD,nҨI +}W)0Ds>8U -c=TWL6ߣa_^*>̕+qA—hN&j2 /}«JR>6e;w0*~ǩ:RTUqUp:Ӷ?qUVhW*~/m7Z`pI!d%~ڤW2~QI"ɳvV`U b^{6mPnc*?F(@8[`i*ZmeMbw5>*1Ljw«w]&}تڭ|F0US֢3A;ЃZ2(*„v8`^DǢTEskA=X| Qn*mZtt­+bm*;~-ǏleY>OPBMz̺-re_8哳lqBLJqኺ9wf$Ew?~)D=;c({`UJuC|?XTyE+0q$t덫R(1bA\P|!CA- ʵaT! $ffGFGB)JVGN#$ ]pNBc;U 펊fUd.På:ԗ~Q6|rRC??w97f˒i%xio4qŏ8ckuʓmҟ\a!bJJ~De)h]LJ*"N( x8ed %xYw^)m1rz@ӱ(vUCIEq׊Zے-} U?j&lFإVHqG (BH3VTqUT +,U1NlUiq`ŸYׅ@6q|pRKW/c&t?lF{F41:b=F9ۂ%Q?w/i6 iQzU|-,[6*ӭ7^+\7yT 튷ȩZG\ ~|2 nnqW3S'p4B:vW-P|*ƎxkzUH}ؓ!UUcv8R?(x`go21⮕P 6z9(;N*]Os?\mJhy7~~F qF=G8\ٶ8$1oO~l|pqWf|o^)FEpF*PwX^;'}Fy{Gd䯤 |{1hdWf]vlUٱWf]vlU*6*ثb͊6*ثb_ɥ*?$Ųz`3E/*Wx8:xb _„$S 8i}^ǎZO ?#,`{'+'J)03?NVcz~40\ WjЖ# mFLzfE-/O~8^ 7Jz[QCk/L 1(v8Rۂ>!wMqBǨˠ;ӶZjz>?<qW1eVT|1*9~!Q =҆W v3W*w8Uc0ኮq](ZaQw] >8W۸] UQɆ4C col*MƇ\_c =:Yb#f陔~P5tAǤUI1cCU#\ڔ;Y&w(c`Z0(Rd(C\UI(pB|U є vq[kbt;2डW2qeŧ0*SQcy.:7-?](N+fVhpP*H.*襧~&O*]\UBHm߱ǑIXOH\q8UFdh!AJa21F>$ƾXHv¨~IICQPγ-R0k}ױ…7N{01I[+I# $\~|l~W8vk]Jq5?(Zwcphá¨YLRhQJ|"r>JI-S.࣯L j B(b ]MUUdžM׸Q֗dv=G_*É'aB޹NW2[6e`8ڭ2;|JXJ0RQ6! 9{E(k, S/^X4(ۣ㍡WNV23'S20lv8Uq)mH#o6[',bimlGՊm+W+#Gߊ銤/(IvǟV{6X7\N6U:4[*iUCE{]CKW~閒rlP#.S'1KhЧ<lGCe|1U5b7ĝ*1Uhzm wP :a3` KZ N{|TWRiK^ _\SŅ>xU9BsC_50~beJ`J`½28һ Slz*;}aNإT8?`{P7Zc.|rW 9;PhF6hӧ [U5q%jlzf@G%WV|-~(BfjWu,cbPq"= #R6l VCbP4. 6*nK#튢DS$Ua+צ(cFT/nHVݔKuril&Js1sSK~ZLK޴r|Q@'_!5ĞoB#(2/LP8$u+醖>q'یר>#*;EQづiޜiK 0/p0E<;05#)>u,ф~TxCe"yYPhHjSM}S qyPU 0p)Xc,jzb\yZFw1w0WTM,,/mu"z㄀*1kZ&Y1ua0e0A#]咺URU"Pv#7j AxഌIpE=E_9`7RCLaED ܃J)һ4VioD{ wڕ끭-Di%>9 \Ted" 6[9>8ճQкH*[9r4cR3֘.Jf6CjӾUA+"B-QY&n*Wweh7Lmr0f4:/bLń`ޟvRIL|VNd/+,E»zD|*Izq'½jظY4򁤲OF̭|Uq|#0Ab*΢XbOϾQw!oӖ }\764ބÑ0*D7~4e79DΣVP;VzO*WuT\P `9 1=~$8' Kw(Œ;b+ıHe?ߊдfe2un8یQJSSqQQqh 59[Yv<{"lsQU]'~JHv(h7ߊ)D^Fɸ銫R^kǿX&ŕ}YGCKF4Ɲ,2z#V_nzCX`T>g,puCMCR7c tJ%YG`E%j=#Zx/߂/|mNu lqJ% O W(ѝ`TBȲJ:b$w1pCCc>=^2 F (;6e++g)L(R\Hߨ[PzALm $q^Jý9ѿ3go Pqn *꘾8qUeQW7آC d;C0%}%(.0p_Kb Bv >-GQ4Jn%z0*SXmIenJ@o4OnbC? UӶ&銫G'%ď0os'ߊv")HpPj0Xqo()WrQd}E#t|rʕ5ppG֝S =qኪ#s#W P0 g1l⫕#xmCF*}c P߲p[ E9꽛_ U.KҋOhc/24.PuSS;Y*{@~њ8bwPϮ7[ɗrhjZ=C8 zbiJn0* ~6u;6fኴO|U%rHPxd p*ɷF㊺=Ğ21JHˎR:XC@pwSCPmW3jQ+i#GĊn|K|x*Ied$:00 %GC 2(KNҁp?YTZ\ieӾ;qܝbf`[Ild AlwP>a0*)F4"VիSǩ 7]Y lw׉d;6;o3?w(P~etr#gb1RmFmu*)MSL P7}OUI,…RxcGq{VR9TWTv|U؛(;8b7&kSu5_ Ez G݃W_JzKħ{2_6kVzyv6]Hm+*z|տiq0n(W*kB6?v<8;?~ƈ>ݱMW\+.(|rnt)u?Xr׌?6#]-ĎF&GĽ񊪣[s$ᵦ+n<2CW52>_UP Jl\~xe l,^8P.#W'^͊JWN5LRKlWuQ݆_lE]50%$k0SC8nvIA[F2rqc U͓Kva[aq"Kg,$_JsI[VڽqqGlč58Up+8mi 5MNٚ* g4IUt5\Ad`J)%Y|sSY,l{\|_~!@xO8W&O\|wٰکOhTUG%<>X@8Jc~#e ЌU ̫(EG nvIib)x5; ΀ 7&n 2tbdV ʯ*uV+צ*'.pD-U=4%ݚ\ D]~ҜUVm=GCŨIe;v a;eֽz?,p8E;bJ `|qV~8PzoUuUmw,U㊺nqjrV5qᖯM*Jv8bTNT:ǯ0n)^ Mu68}<1E~ d80*!~&5RA?@/ 2~.09O}?^k%" <6$^䐍#zن7Fh <ĨWq? ${/Mqc.H2 .QC9Ȱ6*ثb͊6*ثb͊?*6*ثb͊6*ثbW٥ėsBjbtEjn:bܕ2QHPPBT{?aT4Ө8LPt`y)3T',]6浯+׶ J䒝7ǣکMC9SQ }ݠe!%GQ^YiU4(ke;;UѶ#+L*HiePUeT^ qqR`AvWSƑCQRq=OlxtS vqu[ U.;s-wF*7NRW2?APr"??V18锵]*|kVF*ďn(~*{=)~nGR #6ՓS7]Z4mY_~zJnL:cUvW b|jO0s!'jtqqBX&Xaxt ӿc[`G.džu*j`J2'&lzUl?|Pr]*+G)Urfձc,\wNpOlG~tb8 )eXn%Z7\***b>#,‡c)}R$5o?v.UJolE8aCP[p<_=1yaƻdUR&{URD;l]$ލbic*acWqnbJtr>y@G @oFIzd-!}ȪDhŮ-ͷx{q8s$2G4K=z7Cf%E(kGc߸+$`J=HLP^-D U~F*vb9"W=;a^Ǯ*$@5'tvCQsƒlzR$Q\quVMǫ2.…Ceq+UOlFE$L-Ƃ9թ +غјTM2v>G(N kuGRc7WXٱ6.m.ׄoP܅\wU(lULU :op;oӸƝ=0%P|[;6Mݍ"qJѷ1H1BcᏧLJTHc|q$lq]钵SFƲWu[Pѷ8^Q S-d2\Rz-LPXvǐ:*Ҍ:c U||3 T:"w%jnC|-EDZ䔠 tGWI8a|4$V>%M.TKL(ۏVR]prqK`uxZbe4lqCdw튭~DSlwˡU:S,b$w]dPP 8U!G ߁Wo j Ui#_߁0)JF&AQ`UXܝ9~*R‡a H1UG Pm^c>$4=mʄs?HJ,H.!>ͯ8XڪYjX%zW !p$7߆1RڝG{# Q**0TS U $&O; P'PiB.9> 1UPgIVQqZfbzE-%47pBJN͆HY`hҟ$e*fIT=$цb(hwJ48_m)b)"R@BSp:a0J`3 AD 2׿|e,O%DڝrF{R:W4+(Fz7d R| lF-J\HH}v3s'ܤrI*hJ$B$;9 ፥[컓!/3ۖHl~$bDU#8PmLuź$d/.ݷ^P"^_h|pd<;d +$I!wHȍߤXu8I-KO28;!N9R6wwz`VbeE_ ^# n"2/|M t$6&xG21[C4Ikb(:׶_ u0Ie$b;njiO8«9JXӯ Ux@O }ᄔ 27TnVP48J*}$4̙l[Z|K?aUzQQٿo+EA銧|milRcTo۷lpmwUo^K M)&8qFE51UA]LZتGLU8~K*-Z[~8^P%zNN* 6F*@oTWMQ:+qE-<~Xb08di(Ԑ&\UY$ c2 :udž?V6"p^/ T-ݴsFby!ڇz}bjsw Th {:¥^1 [4DGU=FISkԸU!)]MAAL #ͱ, <]hP£,Wh(ǯ)ljW]+qBJ7\p 1J~(5)Fj܂㉴bO6o UUfh~ >%F"T*vZWx YebQkvCN>z |C6#5һ[A[lb_UYt⡅6TZ:L/vSELUMW&C'M* n";ԕ=JqfҤ_0Y:g_b7vMnCFjuT)"~<1/ x1\i.YPI#F|0+%L}͒B ESǾ4t(]C ~? *kM0x(|{h4jq T²nSq\UrJ2~m[*ĿH;|U*aBud4T_ELWN)Ӯr~z{V:FF("qhPeoqܔتO1*zi*7b]w>͸S5JC|rU(uŽ( |N;a+iS-̝OUdr tW6=0Ŀ7*񫊮!n2lzWu*)p%jF g._rvRWsndoO⪒Fs\P7fw]UV^#jm^ݎ9_o 6ONFfJoF~h"Ol6h~8%8!S$4570*a㊫߾QtdnQ0T'B$;xz$n*xAi`mLqj<;bo߶ (^-MǫBAN7[­ n(8mm+xW//$VRPN ?|zTBnl|0=U%1i*C; Ui֣fʡ_w[ i69a}4ir Com+m6[N!k@~{9/lAmt8R5h Ȧ}IMh~Ph<<1NuT[p+LU$o+ۃaB{RUT0}C\ ړLi+w8 {VolWlUD/x늫$ZeV{kFLUrJG\LrCUHY,42I+˗UK!ccTI]8~]~VI'n zn<0+nCG\R4q lȿS/-[ԏ\ nYc/ԯќl&oI$ӵ3lUP;xU79`jq!A(p@Fj^]OS]*n_bzUrAFe튮="+#"A_R8#cU_㍡DzqT؊ +oZ~9W@ ،⭆ 1fW|1{Ur췎2n1UPy5fm nPzPzqP˱_\ ?PFK"8 @Q?H#x*uяF«ynw'2Ⅰ1LU|l;c48cz✃،*=U=qH>)UEmbOnR}׶Tl˱(nTG}V$" oLU@qWዤP@T)zDnon2체npҬY5m!æ JĥIv8P Fhی|Ei6*nl:yUyhLr=%r_89-% "_p2cJOkMSї2r1_хpl [qQbb4nǦ&ٺU5Bv?]EEtg!S_$uG/mT,qZT}nJIǶ1%)LUVH7/P~# >$mq6 FVp uUQCJb(mA%PЩ\y4Ej0*Ѻ{;*$ߋuӦ*\r:b2,PløPD*ªzTS4|/T`O%~8Qp%ų\mهB=JcgyrT0VZW*JteiXj[ Q@1V{oM^O pSٺb9~㯆huf? 4ܜmW6ክWr+eUEMqiq*{c["c Gw~;0J֏{k$~> tsC/,G#}?ݿ><%HCmgz  TaM|qhm!my6[L$+vy柢n*(h/Kq3+Ϧr<.;!͊6*ثb͊6*ثb*6*ثb͊6*ثbWحēsBjft izZWǂFXhv8&)-YdDZUwųcY|zTW=_tT>dW Tu(I"B~۫5~l>.r)nS{wW`%`ArHM(Gqq>7?8Qj!Te)[WYSuT+L{ZAӷ z}lE+Ukn<>UHvq*$+2 $@Icjk +Po\W+\UHq2n1UUph1SqTǯo|MqU0⃧G =BH a3UJaFC R)w\-ӟ7vq5ͱ=X 0ٔ815bG\WmQV{6Pwrێ!G$ut3/03'^G-G\zHPӱ*` b`*Q,낡FWKtTq麜Rn 52HSo'ğk-(CU;x n=2)M-Џ% (( 1T|UI$]qT4v1E#۸ U "~Ioe.^KHׇ9,-u5!8=GTcEA W|ks^*nSa|1:U 6I8)I}ߏ~4…*Sro$AFh1-9/O UrJAkp4Wqڇ# Vn")9z׶JlzxchBO%5?+me|(UtY;mT4Pr]] Z`v_%;n2\Uuc8$ 兣5M+Q١_'qI%ńs95ѼY+!qn0v=*?^C)J|`yF:.=p)qu/%wkm UqŎhZ6oW]x/L6;f.( 1EnU#*kDZ4~ۡęJaCz\EZ{n:tv;6=Nh|qJ|IU4qǤ! RDc;}|K[FR=7`fW5E ȥ|rU9!$lU^L( [ǶbczFYi^-Aè>#YWI=$}SQI{I4V TС WǮ<CAU­~yF;`V#;}y|]OVblQ߮:9'(Y4%1jw0j-^ZWqM[XP SaX48V ZW[*qFǦZHzw«d…*PzW,=s$~\ц޸`4`(5lOg%`MZ!١%I[ԹQ*Oa00*-XKgͱw"7m CNتA^MwR?Ezb#c WuuⅥs)PIތ:cU aGٲWS݊QFy&A^>8n7_ A=فqSم* F1KDh7mU -n%o J[`'"U:r,ׇ Z>+BMIOBM> 㠣nL7Ʀ:XL{8Ra&f0D|}BX*;DZdw^hThSuǕ>.U ޖtX)^?HbH$z{Z!-^6b*XJ8ҮYǸĈUec鈲NYi!](Z`H(zL  Ý fueR|)͎y{fwiqF[]BK[tS@=jC۬0uġvJQbH=T"jsH% Kd >ON][|6C@+LG:`;5 SRrþ_& r(2I>5ʣ*F"rK&k!!)֝ bBd3NXrLI*YRהE;r;}Lv*P m_&9;r`bxdd_!fJ0 i6 A$rRvS2bl0%NoASbiZL+sTP~e +h KkfE>8Xcj2 t4j^P*F' }|ؗ:,<5yo%z, JefYw]X9G%v;l2Q5͘:౧q68j\B$.Wa1{ٖ rxEMhƴ'Rd§+: [QQ]AQ@P?#>Yi\HXWQ&T@%MWǖVĎOFY)ʊ浡0ߨM3}H9#$34tBi!|t N^㻸p.#UJzo45]/ +#ʩD%8%#6JC-O֚I zdh]Ng,u r-DFxa}µ)M*sqXQc~L;n 7A],u@ UTb0p)^=cAlPM&Рwy7(^1A, Sk[ TR~CucgR$JWm܉8HG%CO9SGOVU?z6+Ux(kD](Kb '0C;?pý䃎R k;oz27Iq*M+FikS_ "]NɅnTMW-E]Y(~ 8jHo*_Uh9A1AOSGx u1cRQHq2LN|8ZA *O$; ktU}j+e)haqQ^c$_ (_ IIH; %\?^hdSr8 of(E:RJwȾ~k!4F>k'C^Cq *j?̎b۪CR.~.{̊!4l T:9C Ml#?mTH(j㊪1Q|H{bEhh~*o4` \QQJRDwOlU[TYK0v9lҵ=ĨTU_i{c+Ux eiw^U.Fcު@h۪dUJMK²)2}b,5.JFTxdnM$/y`5b>xdx#Vu hc;tU, oU $/xfѷG Q/Յ ~ĝ;JSѷ\6{Ô1U0-UaVB fxh(~EUW]RR+ +ʔlP8"LEO4>'$|wꧾ)Un_هnRUv?햧 U=_:Rfd6, SB:J#!%=YDo邒u-}?u QuSHMr^1H;c]4oοomaBDxACM$%oM@ƣʊ)d [(m *?V/v<1T4 7c$a$xwPP>>8JScj-~qjbp127㊪ۏ |0*'H$0*+]b@vlPѲK®Iv>%v; (w|2 7.݉4eqUTSgV&.c„4qc?lp+Ip@YOabxGC׾[G_}UbOїo;ۿB]}c sN˂ZdW_SNKG!f&ʟR_8Eh((M;B Aqa PثMLzٺbm"u45ؕJ(Ud6 D|F;c- ]h6 9'ħ$5p*w F?5[zTan8bX;b,~Y=1U@j_.Z?؜늴SobD4,U\TTUۯ«>U^MFwVn`.cfil?kl9KiÜuҾ1 K @}XnTLpݩ0>mªo>c8XOk\P) T"W +۶Ii"+㙓q\GqUxccjn^l8Ub 1` IbR߸ōoCС,9MqV1.볯LyP…dzm6O)mPUHV3P;ws[Q\;GtƓm+&8b Z2ivm"(T:-lf 1h~p-ųې⏴6-4QaoѿH}߱v;۸|Uq%]BջUk ;1U&\10AX+82clw q%#Ե<׺_Q",Ch;aT¹x]îcQqcuʠ=>U6,{b{W*&A^T?1u _Z嘏⮮]kj~%W ` hs\WLa=W$VuƲaJî6bo8$Ew2Wq>Ͷ/kxc[2; (juN/xAkcNSPb}=^[dE_fVv;VQ$$26rWgJ3( , La.Kun~G8E]vlUٱWf]vlUٱWg*6*ثb͊6*ثbs'$C_Ƈmܗ'!Q :b(61!U 4E[ԏ+<[ulǎGǦ ev#ǑO(R _!"p~|  ޯqwpz?a44?AUrOb'Ɋ?c+?~تEۮ8~mb(`"nq8-Uxz8*v⪝SӾY_YDw0D$N tO1P؝c*JqV\?2GLUl"aX*u$ eJD1}ŧRK[r:F?Y!v]8#0Ѽo+۱܏3v'W/%u1I4̆I)FeC{ KŔRFNx0KNƹY5JĪM0M۴da,8"(śjʦD`IUzb\;D jSr ރCUZl:dR)֧!- {ztȟ,`D7*26fFD |)Lpp+ӝMY v%Í[KIL(=\TQ72Fюn=  m"|&zc,{s%_R\U}[M1Y8"]+m)Ir*ɵ8zҘzrBYmS۪9frj<1ך "f)S߮PW[N-[bʾ*ripG-+ep}1M.+<MzS#2/72q wY&29D93<ȬD~>ژU,!U$, G\rJ{O^[QRh9Zl}Uҝ4$5Zeȥeb"`b=w GVݱ{kxe1K-=IIg>n[)H?u*Hu_} yM0>}X1ۧOl;_ Ě<=f@/ԹW=( xծtt2zW!|$$,)LB"%/jl\~м_Uc:S_8!Xd} 9QZ:ɂ6qW蓔`7^ ;!a~ه7\\_XQ8E4vِ*L!vϦ,Zۥx/H`v2 Jk% w­Bk{%<퓀& \!]@L^I w]k@V{g ~A>?O*'r|@k1!1{25.ʠ|A<:rVUc큸;1DǷ_iiFv5 isujPAEc6Y`w|qJni+QhiN,>ʲ*hZ#T WcqCE+cP,7j:aBL(~lZA(Cx 6ML#eO\OgdUX ۦ2|Yd 1U6~}9G8|QTJ,z7#je*P%Z#ZUUpVCFJ,«x`kfP7_~+Q:O\k 7\*jvʯpMb(oUvĝ[⨈ *xOuڪفU>rlتۮ9\4a) *JZ •A40xlm sbƲW$>Xݹ!>JxocPM w܀Jv>)֦dUOT<_b08RC.wQ銨I>%OpR9A_9'n1j[B(ŊAnU cC(t q; UEءM;Z:nnIyQ_{Lw^T|[Oއf81Jׯne^?, C1&RUx`IǧuCmƒa%l>Lg7a{VSчJbKVPT20~XaO!@-N1S(twU%cHym]*ScIHJu<{lQSwrd;W<*PuTd>{(xxU$sARvJC+!^eǦ+r ߦW^~lmӷU] U > h9fRFjHoΪۚי*%Z4gUE]'ۨ8̇WIGI… LMNjxƕ\{ ݎ K} |2>2*KbmիavRYM6XnJ;LաԃO„lzbM rl{cUxa 1?H:vr+[XrSUF>)bT+{?FX6\b BqG\Bvn(8u87;UP<1uVWb=yu˨ C]zS4|~${`VYUfݘoWQu=qu*qEja 7V̋wS?!( )&oZ2bλ_Θ+uSqR+ŵ 9.>EM~ v„[SZvԮ+$Q'W, F*WYFHZ*,$u~q6lUhf]ĞC>8QwRv+ :w8Q=pa>!R;xRC:Jȧv_4G1>$=T><Е\,3뱯lV@^c? WAE4Yp !<;LhzWPqߨNAV9Qᒴ!絡9(,B~X$Q1L_Y~UM}.=nCE zN1Ľ ǿӊ#xx2,*% ?4:tV|q ev=1Xhd4#T.-t) |}+G9B>@=2M]G?1G#*ciw `<4W#LulqVzcllUqVߊ >X=69k`|0E\]ZۚDW^Ͷ*%MF4^0*>8aJ掿Qaשq +QűdlUA.78Qܗ0oOc 4bQPhذ{bfvq@[qB@; FDz(dg1U[V 8ѕ_b8!qB|+ш=q6U]* cN?/Պ>h~9R}\UzvLReNغ8aCDT#v JSn!J9Fp% i$>%K_NHz09 mJY\MkYkILQ^CCīUyTWCjL*֍ױTPtXi^u-^8qT?bV@4'=4;04!$Vmuru8$!QH ^$ӧ|RD =R_ڿ ߑ)F)YlU_ǮCe7?V!qj)7[ɱF *1XⁱU&\^)R4FP#4lUEȦ85jb%ʏ)JqnRX-L)6A 6 ⬊)U XT{cT#rmqVfMF:9JPXD"b*쿺ǣ :zT]eCQ0+|C6|2!  +<up$jIM&UpU";R{`qaBO6'4<$늫Aq~I{wB|U ,BAQ,!$+*x8q%B R@ኴ*>G//`{%,k})'_tƒZC\Hl#Qע2|}͡Uq KOVn9m?gMتeɷ= ^6`Jj]햭p)C=F{zK}PσTW[pqj=1Lc]U`M;>-\6^'ʩSߊa}Fb|,(kQ B{vnRGK] q}d~_? m],<:nC$a%늷 >I ?U OEӸ)n!LoۨWqqN2q^F)㧆*۠c.Q!ʕP"n;ō+g& h吽"6NwmʓA%asoɘlw,iFN274b"{jAnn[sLSUKoL}^W@[ 2zޢ݁=pE6Ϥ QHzehFuXHˎ\qF^"4,kM[>H䑇sSQJcA< 5 #߾@|U dj,* j}fոSMֺ֜Y>÷L>%!x !"Z ]C} SSʣvġfC"U`YLI |\JMĉĴ_ OJ'9 D90`(=-[$TZxղbE/5,wfK}E\=ɠOMMr:ąoyY.$c^@2NJ$73Ɖrcfai +!5bHH+"d>(n >.m5䬁]1*\eO|$*Fۍ-yE^~8#Nt$z#&Uj1)U¡XDe0A^3On%jMF<22bvRvkh y1oƈdbH,axU빠=iHDCc]8r0Dv=pqPux6cQrj*hWTM$>lnr38B |J$Ĵ&Ua+s#tnز' :1E=+(l2=`)Z&aBzuKhAjnZV^Ax`x.IG$ASFW< Eƀ.Ϊ:l~.D7}MS~xBʓKeeR_N{_2 -]v qzb6y"rXX|oފnH ӡVa5#2< :]coMTq5m$Q;Tl9.&QӰg5mK$G-4Wv6SBrG`1zf*&r%U,T -j)ଁ@">5;8G nSVhz J&X;{#$aDEOa tYYE* 3!wZ3РeѤZcNLjk4{T}2*ɌANih-FÊwv]08d:!]#.e5R K4>[i"]I_ Q]G(lwRwD,>-ªt/̌]AVU16_Ǡ=?,P#㊫QtħlvBI>qPA(C24 QnT\ѶתI1Cl D).뉕*j6 unC~LA2SjXVaYݴGt SF𞠏㪟5wJ^o3P, _X[$f=aB{ .ƊY hxQV}-b?&og8Xqټ2W^9*~+]Xg{wb EO\kUw\ܶm(g ?eo*\WW]*A;]ki>r pZxiMW~5n UE~x夔[jHvBϮj⮥s1W)Aq2up@;GpB6L K.[ ^G <Z/{I*aiwBh7e;%Ii.Ze`j9 zeG1`U@|]xMT+M<:95 +DWhЮͿ]PN q==]\ 8 ק\HU| lw>*boIn)@On cU{_P֣ي#7Sčc؝qEpMl7Sf1B7^ #-kvbꧧq[C_is/uo\U_ZY;K񝾭vM,>_ZqFx䩋&.-B710? m %+emCA?lEޝ4**z?N P)W{OZw|qRܺB.֌N@~(o8UNH8|q s- 8JǸETت!%=z7ѕ7u0u})VT/`Wf >ǯJmZ? ;⨄00;P⭑CqUA~vxb6Υ$S܌;ñǒ i/̸X -d @MA0,tRe_ eV؂OB-:yu㊩R/ 0+OxصAU*F$lUY%rJ6?ñ]*6#m+S :WH|U $MWb;c^/\*+a&PPj2-r*=.%%늪YjQj^u((d?"EUǧYCUGƌvUTfwlUU5P|df1Lbd#'txMő%GXn* MUBl.ѷ~a&^zfV*^CI+<4 +52=UVA!F>=2w?]J;3AW4bQqOA݊|pa(PƐ$YBb~8zUr'늩UmeԍVq=udj6a\UöTn:?IwVc\Wuxb0t$01JFRe ?V VE7ܭTK]\w"I 7prH䊊ED0e=~Ǧ#JWP7q0*p)Ż؃-:t¨zq7OUMU6=;S3qx`Vշ[aTU [߱+0ڬx5GLln⨊,nK\UFHn:⪄l}*ڝF>=qU%잹T1UJ:lG߉]Wq2 q.V*w\P.m 5>@PYS8ù 0J# zwRqqgľǺq#u„Ty0FmXqr\U4:1U~fW**4o*%wR)\x}hlێ5Aۡ n=nqV}2U\U|1)e4|uW$vTUSFa|%w_qW GӦl˱lj9l c+o|<~l pemS犥 Ĥ]v`o < mb'wXLlBke}Lثb͊6*ثb͊6**6*ثb͊6*ثbɟi-'$SQ[ugO? 6[#zg`TU=ȥ &-;~#0=N G쟣G] A )a15FV=J 6;NXzH}BjQUH1~D6lAOO]}qORf0B=7QH9JhËxMCtaZ}T"}oquәa;$ox􌒦؍c+N0RUN(S/\*lAOUǷ>-~U׎6oǗĝ{iR\P %[; ;1T4qAۨXs5 oULglUw( UX6  ̠튶TTFҼ#}#)t튮Y5BTfߨZzb$lmT&yљߦ6^"|QF Y}a`xLe_smC3ѿɃjg}Ɍr! "W=qT)'15vȪƳCcaK &2pOqNaJ2s\4(1,*1B>%1(Z![.9(*;! eϱr[^[Q;xZ3Qj(B? p Ӎh6Ş1 „4S4M^Wny %tŒOP W?.-CK)V1LEǃb1\PŢb #pLUUQ*) p6FC<ō]T'n7\mױܧ Outm]0تcr$"A2!rOSmwVI_3c4;aW: |t7#žc}bMiExtV\هCPw6|j*`H5{(BcӱH*qUܴ?gF#})D:,%)wAllٱU La; _qWcU~ţ=#b:6ih,Bv#Z޽as TGqcbV`P0 N^'ri?: $K.ͳx⩜S}tX[,-#M%Zh®t1MO*ߗžbF:Yʟ -h(kb};dTRۯ#  U^Xeߧ a({PK Di'{c6BZ?qUTH8˱nRC%~#_Oټ{M$(ΘVHQ'68U1xFOANHP]l:-)k5]E 6业}A(@oɿ8 UsY3N0e)"B^}e`구I>ke-pSU+JÕUV:7ACQuenQ"ҋa|U!`X׮^ /@M;ŽN^6z[],U邴`t=7d'qEҜcXw6JTT{WTRunʒM>]mcu+{y2Wҗ RkfRF7p<2nj%?7K!БP6db[yY6*Ƹ\{78;W) O>"W+@椲DY>Bp=LfXڲCw#%3^!QUssi*H y}HJY6qJ Eomʹ5.Cd&Ǿ#Ɩydx`q1!W'SR2!Y0MytMj=5Ē,)%㼶k_ҾPߨ?#u{2B7Ƈ# Vb8 d{݀7ޕ*#nLFv'S0 c-iBg`  uI R !k]v!eh L֭k|B?Ncղ z^DKn.3j}+~j24oԛE-xIXK_5`If9G`]spx<ŦіXeYI׃laƐޚUX&NdxvS&&`@TW 2pk 9y%OUѨ 8l*r ǦƔ5-զ.`s>"9'Եn|ִlCꠞke|vZ5UFӠ?k*DBKnXƄDrll{2"B)HAG-ީn"B#dE# eGaHSer݂-OOSoYI QݿO~eP)NzYKH0փ2FH&188`Ʒi- čɍNQ" .OEBHa퀣}3,֣k#UfY=0^ Wߌew>&,S>MF"1n#,5mzڙq^5A(0bB!Y*|ORy)ni+M+P+ [:(kM.F%R / rm~jJH6*jޭW & 6"*h+|0D_T 1^18AEK͹[J=֦)+!@cn`6M94xFļՐt-+IHL #W5 #=ZYVa|&+j(ਖDzC@7&3$$|2YIpxJJiAj4~V#q;HngM 6 rD2 )4(:.MKtƥlNɴ OѨ!"R:522֔jxY)"4]t]J?*t" ,k ؉ks#5dG8.<ͥF>$YA)ޛ)Sp8k=]Y;ÁFޔaQ?jN^;*[8}ҥ GLblP۠o0<\t#)Kmm`"^29o䄙Jk jW: -E(ê*Q(DHG>&TN*72⫑(s~qoRFHC(IYIӱY:تQ|K#l*ӡǣ8NLpn]vlUk'TUAEᘐvq*Rj<3SqVUz6?f)nl~)mcZ O2rTY uqXn_Q~#RS{fޝ(OUo]e]YG l6oB}+zwF· }*(> SSB+(U>*Oqxn!g[qUIQF ̴SBvNWר*h](Uc4#w*ڰObqኢa={ML `;`qT&!P*dž$w늫+ n4a+19!?,.|wNǒXgݤi W0QB)IP:%$|zndTG$6;6[,2 RF!R+lç1S}Ǿ$٫ӱ`i!+\7!#FUxպ8r1BhL{ױ2.CoiedYG,5>xҠ혀m\*~´%qS劯 ٕ~Lx zE d|\U{Xn͊cq^j7Ho\t+x⫕}37^P8opvZ(GM\M4!''늪4LBԞmC5tV8jxio#? r e?npe&DW/Nפ M8~'ߢ)QS!Ҿ8`FیPT'ZWfVC&WNol* uRW ~? eT=\UzS*qB޽VQq2ۨHw9r⭐A.e㊹,R>}(C{b㖲[qb ǒ߈xCK]?O.7 OUN'*%xpl~IOهoI%Ί[?n1OJytnɔ cq|*W(oa_UE(Щ+  )wʧcL ]+CW&ŕm kO n0*哗\a@YJUSӯƇ|QXUAcV7\{j>hrM8~`gf@~U|r?T1U]M;M+>fxฯytn}p*[q]c)-7g5O88vжԋN:֍i# tm~׏#0!Ii2Ҵa{qNkR$i<P`Jd 7Q:(ZFآStQQ*x#}嘊Wߦ)wT.aۚF,Evn8P y/1#0rJ1nzcYA0h[4#!U%J*> „ I :Nj QX,"rA}rd7 WS{~TEF(:4=FS| rWnRTH9.3(*ҵ>x 銪rq CT[E/(qT%Ź/L^WF]xɏjC\[6Jaofe.m36|>y mPWήE~G/_cST}#b(q 4z UL:,oV2KӸ"~)OJqIcp3;g`J5$hH® MD)OOl 滟thGLU(}oqQ*i(CE!=7N+P7Rd uqlrOZI78U38](ZF]kVR,^F늨\@>1cCPª"ĕ/ri'Dٲ)\IVe?ʋ mZa{bP5xJee2}ءRUv9$(}VJ)t]yCF3'/O⅒c;13FZ5jqF^CU(ܩ`YTdMi dRYZ!B1T-ݣP P Gا/nP(W߶'$k0UVZ^Q,1P+߯*h:xbek^MifU^h wZ&1Z qIbinzJӡO8.>nkTOe_߀#e(AĨN!Np5S( Zh|'BH xI֍J&'n19~Uz1vK"9xK!G-~Z\[}llJ ctRٺY5 קT_`(]m/27#ccMW+G;I +q7^8F %Yfk~h|ѷ/bAunM_/l:|kXV1(}IQW]&:zLU~5<:bԃC<;`KmC;t«z-ǶPv*~9:bҸݲ{Mc㒻vo$\UoTUwPOZ kP~G5lL.RqW]:땷})+#^@f\@azb~XMӗ 2ӯ2SuUQ[lVj~9Jtèp\r}\AT+l[ߟSc䐚%i)D+W+W|(XCVP*)+1Uc_(SnCl~XĽ<2*iR,UvUz:UB6#@},RPOэ њ6* Ϗ#)SV}6T:1PvlUML H*1CCª_䞙JxRۀ{wbIӸ:7u+ս{-~=ͫ~pþEjޭcڛ2y"lvo(F1pjЌUL %ۣs 25]rJ@{ˊR6፫S[W=c\#xxciUOy^MC?dgD,bdh1XH RZU<@ڃ_,ZNkM) xg=/i1ƙhuvqncsGĠ^bC@GZe2$y! `$cLvȉ9A R +(Mxh;+z|`읕n V: я]WErFaM,>B w;`}R(=o}{_*nnD!p]vk02'rU3E7m/þ'5[>CMxYJa|=bREz^H FoSLڄH@ @7ȋ d VٰՑ%/ P{S-Ɓ^"GXaSP/mb@G0*P>X!乵Y !G󒶈~~ئt-fn"ւһL$=8$#w/b^F S{+鈮o7Qp!I޵, XuF2'/sP)Yy9'4x'1 htaDӆ/"]Yf9]NC& %@06oj,!n&Y ,wT.Qm'nMVf;咕nY-I~M0+B{ӀiuӑS_K6ԞrH9;T9#:&!WeP fI`u٧AE߷c)MXb:M`iqUpfmfR['+\/ћV[X}n,sJBؠYeIB-:轤<ٹM2MwbyRA)ͧ_[۬rHB)$H'`tI@XS6[.+Eޠ wʗ<1w =O HVeSǮ'kqZ+|%F+ts:<@q=N I*k| ӧq#0d*7IhW_!ꓯ$Bђ:0L#|,ŽBGZc-7TcSP7A}Tp>7?…Hj]onUneej1$Z5unkŏ[B˟5ifEf#ޢ"h%IdR0-^MdydHI^ Rv2h҉XH$)#DT15As ⛟aƙL쯮Od@i%6;S&[ڄF%x핃1bYm9(z|biͳbf_VJ驐Vg}8$Yǧ42v^[q܆ c`콈9dr@WJP|I֡ |˅V$O(zfȁtǒĎl f-/CÇ*{UҲJ5l2\6 wVп}(!+^Zڟ,$=ڧ ^:5W3*<{W]KPZP\u&ƻ.LKuTJ/:c-!7 %>h{䉭Tԭ§ WEbirgaTJWj{da˱\$Cޘm{|TH8 xoߛQ`OV {mG^=Il5p%\ש$w{*p=F?N' kv!n}IǓ"v٭E_`|biww .ٙjkEe@*'oP:$4| ;I ǿS(ގN' THOno PƻoO$!}YڢG\ZYJ3=!J 8j3,bnJk~AF\ԊI (5wqWǧ8ZV=~:v9%BhEdY i?\Ɵ$ gOQ,2+MUCQVó!Jp-8ڦl*T8}k h!VQZmW;ND7)UFٲptblX$V|Isl)mܘ~2v҈ px8UR92?ctۮ>=q**:fM*L7ěy1B70. mq8Z;v8v=0!{D>6Oߊ/cPQUSjO UMS^$5"(:bc@wuJ-#*׾5 mR) 1p%baN)U׶b(wڝrCNRx}G)Wc@W[ w]x)15BAU$ &eIN늷(^PRN8ud6{|^^1۳`y u_b= u(BIcClp%b=7]$9FvXmFw^늨KFm#?ZRW?qW~ 4 z#ZEWt8k*TW6]}}{UcOQ婯ObJ>=k"ox#⏺P7j\|D}o/j0@s%Wwtl,]n/ DU󂐩i ]FVֆ0x sO$甬YN%O-ONTE>V`A {2+HJH|4 K`IsruZdIlQp$#t9i%~xU";P늨 Ѻx-v8JKzn0EF l|q)㊫.1|p+j>n *CC㘏^jaC늬1vDlیPcP7R YJk޽q#cU~dհMcPNlU7NEs߸RcbnZ1Z|><ӡ 5TI׮*j;L_ |?*?ƤxKE_TKC.ލe(`K1Ǭ iZWmڊg+cu)Nv*qcþXR=Epb SQ׹6;{8u?go9T 0mH>xF)S">-x⠎K,|/k| qb $,F>8e>᛽*N\S4b~f1*؛zM6WS7t«J'rኸB1k{3w)({:+_hF5.̼ـ'qت 9-_Ѽۊ,4~ƨ¨;V@NjlmT{1AߡWs۪~8%vo`UuMӧJ\ukj0д42cqUC9U"Gen:cj$}=]\PExW邕 ҿqݰڪ<}OlY$qኡ劻>?OC~$+z d1t[(PdgL~%銵_?N%O(wt=F *O. VJJ6^V=tr~~#6$,֞οՑ)v8ZLaIݹۂ12wgbץWu4?1Zx$WV}b~E&1ߩbl|/UF)j"4gQ̳l'q :m *>*Rf_\z7]*⡽cb|4}c5fb }J=;JuxϤk,p␏UBgǚProB3SS灧&6=4{utC2#8fP|K s þSD ۮ)m'ڄTxܬ%بuN B[4ź'ic<=bV%1P084aB9:`aU:Sn:UӶP>e|~Ui~cq]Qc+bc7-W뚝CZLU\U)\u{6*FWk~8PZm(w=J}I쎘T*^]xWщi卖V^04S -lC=O|(MTPq^0Τ2Ӕ}a霛 ]vlUٱWf]vlUٱWg*6*ثb͊6*ثbɇ僔$#Id9`IR+=J9.ǸŵE)ar׃pW\ zӸM:סVqQ7نe(j:`TX0Z|6LQ[銬d`TTA:NY68bxؼOPqBIdǑ]LUI\t1(']8^뇚 t)CC C V0/twڣjJ),"y 7ݑ(.N$0MaTT8QVcevnZLHݎ7] ט-Vm?4TmU|{\jl*j:c銴A.(|1V޽1ծͅV}J*EVPe*ir7Z|zC[ ]u劷ZT\*a81A[zmUÉ邒opo-LFSo? 㪟WOV=øj= F̸֟ 4:fUeټ<1'qT%b:4?PH9.bKoPq=?i…(fߧMDZlRw5Hm^]Nrkh|^SQVpb\TS+J76G.hlU_˸W]_"7*};K׾U1Mɡ|>x!|abm0DRT<طB\3%^#|2%)eŤrYa<^Y NcL㼈KPl@9 t¨N_ui_O«)S)\Q6qcmeG%O& XH&NJÊCo<[tU $;t́xY>1J9Xx`k~J8,ۯc[kq% *rt48,Twǩj1U&bb!gdWo zw[TG;^)OoJ =|[{,Ԍ'GBNJqG ?̧K\!'q*Oc05+ažm8I6qa}ųFkSK{15`1UW\Ŋhy _ĝ|0J~v>hQMrG0OE!ghn3W!+Y26=p#U'#FإBN틂%uR>9J->frƐݽ4O#n3Ӊ:bPluFY#~1U6xn:J1-zP(%XoW0qYmʝ4|A`[u\$]e/7cnٸwVJWOK*?i4ʠ8J=pLr]dž];Uml\M6mlm|:b'1\ݔE*4xcC^-V!|(Ewv)RRAێqUٻ*+dXm (H7LFWPQH\ wSVb 71B@v=@C|*CGxkFz#I rSFżw 4=ߎQfuo6A3'~+R Y%M[MǀdU][XoZqcVLib|k'u늯W锤C\2<:PV҇_E60t?}1V^[U$U(bwF0q|0P:>=,dz ̤tNY^_ ㊭V/PUOcŸV+oVׁG0R8iȞոN A!mu<=bZIp#/6nWNx#)E$(ႡJ8I!gh?y`UmcGZ?k\4ӢCRfix9 ထ|@_Bn-B\:dQ#H9dPtsYdA124ս.CoGGZaLp_Jm;-Fby;f^ӎFxn؟c'] FᡏQ*>g"z!~ 4gb{dȶD+]q5rKi +i2AaLRe6Hʒ{ԐIJ1%;\b,vE+XGN<61^zbtȪe C3 o?Rʚǡ#RijM(N\Q\^CHo"d_H;^婞6Wc.Fw^qWoC_"H-Z;n}EӬނ&q](LE9Ew1@GG4z35;Ҕ9@VPx !{9ࠑ#gc^LɠvT.{rqG $P? "h2/*O|֏% f&-JSK1${t8J [H*@€c*nӆ}N'` ڦT7PҨZ4A%ķr{NW@-RqpNv+ܼr; W[4%w;K/xZ%. j>[OFF7k{駺fF,Ϯ])Ezj#;0Z7G޻X ArQcQMՈ(}nve".HU6**r1 k # jk*3=rǩeKGQ@Nk5FҪ O*hB~ɦ6EE89-2>ﺜ~C;hlFv E#}COr0V9QXsaD6=kĐj,ؒiz׈4z%$[rJaa>Bۨ$ l!J&"'^r / &$$,_(F5 LpMm=[Dfڎ.DDFoez@Uh#ܯZ} .w2DU@YQ)K5߽r*MV0vf}iR%B~.}#)\ڔG鯣Fy\ N`.Ă%bBE9R Ti%bm%jZON[|;- :P2e]Wӥz_13ܩࢹ %zffJ >NTx_gus<3\z\~`6cJk hPvluF.vKssx@HmM6b^Q y)?$)) F?z\%V! x?1#jJtwbKzbZmŵSFSjdeMJj1K;x!=#;\sesL6֘/DGԣ@]7$mG&\x\֜Mk !E5BzeVBFYվ5`oM wZ?V⎥r0aF6ӗy覘\X rEID @3J}&RF$cA#݉Mu2ẅJhE;`)J jQr+$ CaMB wڨˏA(:upJ!S\keU cnˉWkq4 3E4SP*|pS?11| mMK(錏N3ub0-ON,k@/t=b}Eo-*~xS[yGʹ`;"ZAPxIjn8ҾUUEµ\NzǶJ@'{(O_Z)LG+) ]ijq[ۈB|R Z؃)_v>(Jw:bшME.$S%aFucS:b qJԖ=dܱ1.j2[IGz dz7Ši"o-r8[2Wrr/0A?e9v(j6ݦZ>-c)'`K|J'kÛIH(I/ba -RIH{pdP<(+\Яo=ɬJoאVEok^G5듰PkҘzret,gv8U=.Wdr*dq]$5OzLRo.)Wqc_ٰZ`G-$BmKACF9_̦3FdRWY%ٽ?Ͼ]A8b6?~*+㊬qv*(F<7XULY*e?\rH^NHJc|CI!MO HCU貏%4rU<4#0*dLShPw*|(Ԏ8^}m"yMivOM pCw  c!c ?θVS9~/^s+U'b1Byn:UL6nl6FQMᘊv8ic W^(֌7NPe*r4X}F[қCK%ĢD<=ucjor'sNPot?!qĞ" F"BL뎎e>8m-E)`kFټ|pb?d7j r LfQ_ O,06?b7p*H4;60M6 c I*:M |[>ǸďhFQ o}1UwE<5:SqSl|1W ?fJ{DUWh7 FUHjr~)w[^ MV)bK~=;dqBO Nux;_IP]w퀥#L2?S|jJWL WEq 'lzeӳbj~0T me#c#UAPN Q%qU ]ՔB7PŒ6-_?׏](YˉȡT _:hͱޣp$viYx*WdUcnŸ~U;̲ٺaCMm FQ ׉ٺW_}sMNï{eqFkUqxv]T\UQd @׮Wen2OQ[G`UaኺxT1Fzxv4ooJIY漦^`y"x8 QK*oR6E2[qK'*)bl{LU/‡)Mzlp+r?k/]^߳~ϰٲ{~ v|6[M<+ u«cxOF#{`TKqaS~آIߡª2EQĊ V'aU ]~%G1V~8H;Yj!,GlqOc44;|?p<l 45St?)!1튦N%z0폆űqUڬ6aa >%a8Iy{Okk7 VR6#lB{gaJ*;1q1( (Vy]Tv8BcJ)C~\rqGT'a{S#GO|UrJfE *2lK `UpwUtXUEN fN K|LZcSԙK/^ls%?`m+k WvJwwKѧccط$&v0ZN(=SlhjUe+E` 0_M1_TIUPp~ޟxb-6o ?݊Wj(Qn\70nGF8ѱUC+B~;b;XEXQF9ofKj+LSRҐߒMP6Su6#+ccGqW t4ǮqJtWS+Dv9\ʑt+† Ybwk*[ڠoh,A?eWvl?$S>#K8U9/pT({ ƕohC^I M1_aNtsT mcʃ8UI\AP;wAe+NėrG+LYɰlUٱWf]vlUٱWf]v*6*ثb͊6*ثbwOL[!/ֈ-zr:dR|-Rŝټ1B)=(zj9],bߧP G^ ?}`0 N(-ZPǡ*kpPMGxH[RQU G q\(AOUp+JHe5=O4|O(ԘJ$uN^?*)=:wCc v8ڷqZ`ߴ0R }\PO6zVXVTPL6dy2P}-~+f;WTPA :)d "ʠ 68`)1cqV7C}~I iҿCsLN;*r|ن*3t9knz*𚃖t8kq6nSIx=iN*|Iѻj70 30*n5\I~xP\x)\AoOj†12< Ue`GPPzGoHvDpi'O}BܺЌ Y-&n:s:zuɂ[Y= nXIoc䎆:)O0*٠_"a;d=1:>4~pp%{Uh QMj01J:9VQ[ 㗱• !)pZ(j*)t~?Bi- {w1(+Ȗ{vîN1TaAS(6U#14U9688|Q2w1~x|UwIUYȍgC仏iZUpaF=|CfxaOGj=>/Uz̛ Uνk[?Py` GcqB *T΂A^0i

)E2|Jh{Q(% 7( U80,*89|-)D׏o]@~$8I-(CVA_qXđ{xoh.5#] ޯ.*4D쓟7'X qŰ8W(y&0Ԧ8LoDb(\w:bA G;bH9 bo`aBܟɒ (GKdXԅ_ 4hzSDݗf)r 1[eT镂$/AFpYݯŗ#ʲSc6̄sHRBw$sMuE%p S `/gi T@ EuB&n4 @)(1u2P0p[95-%xn زsRq _٘Ʌ{ـ0G"vO\Rz2*fKo-YN)j&$fVn<$ G }N/Di n hW:*[=~QnqӶ\82!ך [F.iOpJ8VfSO;nRdA Qals94UA. 2%6c<*/V"=|0-:'Q@9z tA_HmTF m?vylyv(E;O9??Sq\uOT́erBe`e+78;[nCbX_.֩!-%ۘkge IMШ͸z0,'ũ'Tӈ44S  j|1dTuY(Z^vA]]'tRZU0 VgbRpjE:Gj XEr2Cdy E)EOmu~t #jߛmCKy7?0E7q$`&!.tZOA0 6,fԠ6drL hM:zZ& PɑŲwVePRuX PLjHkJTXrA?F9L#ZÒ\IXJ^~Nj>ȥP*Ud`yJy]ne{+C#T"Z%Zv" p&;g x+ǰiɆ5]LȻwJњ[^InSݻ򌘈"jx68]F%sl HTЎui5R=%(J~`yFYK`Dc֜DWKS|J?]O! b27[_3p;a!H,?dc6nP6fĀA0eP&U^ٚG3+~e~rNYqc(I7qfה! _jVi`2mS i˹7Nr>w,ecC@+z$6敱t\2 ieD&d:d,5Rh tbJ^nE_w%fBF (dX{3$4glo߶JJ[^S.R]YT01^JA4?:Sե3 YC#OL1A\&^Ěe ,LHPQz9P?SZZ + "OFIlH;}tɡƴ$ ǭZ0R$? ʓa%Q{3*8VсTB#{ub"V:xwZ+TnW?fPێ吧g)$#f ~$1F |(RF(kDSQ PvnJHx:ccV++ip ?E4ciA"]qƇP=GђbTw`v>ᱲD_mR?cVRmWInql|KUM_Ipzc(;7OUUx1`TbJOY$XkCJ8|p*;FxӧoS~ n}HN"TBNهQMoWPBHbsQTIEt diRۍ=c=~zXˋcnTIA0 pRmowV 8Bt7\*q8UBȲlvlb&1]O|1*=6a_ჭ4ziͰqwݜ-+zH"~Xmzآңs]$Ewr?nFTN--(u.۵~xA#lT*xQqCFY4Mh:b?ğvIZB?lz6*D??Ϸll7M[{Ʒ51\4&*N*)M7U_ac4;uSOC:@6"]ci:)|p*[žIe}YqJx((#b@A{yblz@⍊T&LkSC6t«{׍x{R9J_ӁWP\Bf6,SCTѺShin<23ۮtsS4zbz%7\RcQzn1U}aQ-4kInЌz>c$?_Q[ q'ʿhknI:}B-t,ֶ1eTqqU‡=䇋 ocj0R,ӝ@c: rDr w:!/MnMM7k\Zj&IGC 6QPOVك+ڮ7l~*O:xc(PaU㋏#oQRtڌ6 0HCQ1UzɷU|zW҃U Wr >*|o+n8?+38Pc`F?l:x!Xt=6*rLlW\i+#}0lBFZ0b6m0bϺ5\I`Ko4v#nc9!??a=i}NA܎M+~ƕg[V Sh aXuنU惋ٰ*N"8S\Uh }1hj6'.o;m?*З}'Jn+*!mV;aF%hY>(:bBva$+u(B7߉#fWxģ;(zU/hgC3@~kA[%O(7gYAނC>L%j=A)5 Ge %#FƽFL*)!5!ṧ?RHS#l kurSB;1(Z'?hA'bqo; Q4ՋL/Rr)Cͭ<ㅄFSݎ?lqV N*|DO}+Hzce i;T;XP2hz?dJ cWqUqª,3c&hψ•ٺ{bV,1OqY;Ѽ*zbOf؃e֛m9|2m9X7LUk+!F@qJWq)@Z[ĝ;pՓjdaRQ~ҏF (\8aqVB1C[ZS|u9l7Tl+|m[lUs+t>un"?ZI_ :4ʧsW\1i+mEҧrAw”͉lUY0ۦIii!^}_ UlSfĖFcqVxaUaOҋ5|it]9qlUٱWf]vlUٱWf]v*6*ثb͊6*ثbɇK^_$Ų f^?h5GsL[X w%6VOPv>/}׊wnA]+P*5G8x G[\u==/0!u햭OpL,UMfI`Ro 8rۡ%BOJ32t]q^? GlRF>8)ƺ_7]8U zè„# ߾(Bʋ|&OcJm)PZяģra[F\qqaT)Tn(0…&BUqp*V>c0=C ^*ZSǯJxbrnytS\źe(XӶYZk*Ǩ^6nPA6a37^+q~?,!WJ`A¨VRz]kX蟈`߿| `aTJ85c\p4IGAqąn>FmxRi{IMǎ)sfz?B~yHNcCQSTLzu.6S]BpS[/!V+LiUVc _m>k$/&iYrre1)˄uvE}ltqx]HE\9xc D Ni '~BYu9RO@3Š!&C.h} 38,݂Mm3·heDwy#u\pjۤ`v߮=P ?Gk0Po֦"9g`IUZm{Š_JO*,]0Hњ6 ANVܥM}lWRYHn,%cʏql2 xIQwܧ C{26 zbR~ڑ + o[(;~;& (?is lѷ69_㊬)]e(Z6\Ux2xcJpvl܍k⭕ڇuc^(IrFq 1MCWc W ?Ħ;m\hhv>>5}Oƽ{e+Ck }^0jp+Einث={ nn 8#1+^_|%2['lm |sKfޕ|9RKLT8he~IxM1.@PPUmemQ}E,G䙍(ժD,wBj_9!7^%vZO=m?%r8 9]93qWqL3Ԧku'%z3:A΢ߕvYD(GXDK ٠?[E=8(9r6RMdn=M!ROzצ'wJ q=({M}NϢn%`wn[d nDQ2 c1nRBAA99XS*[6Z#}Ewrf zu ^w>"KSxRTp]%XL)#O#{O '_2h$/+e^bm$72 e JV:%E9l{uk/+)֘hIA>ڕ\ }wZ* ꃶOK14y; # -m%Na#".m֦zLxa,W=?Ѹ_RI9YfeZ|H^pZMF,44Qx e\`M$شRм"6#,,]Ba+0@W{rF*M%sާ |B14p"=,F)‚VcM=&RO5=FSK- Մm"q*~YDbAqZ/5 pᕓNYb8DbXc͌Up +԰U0!T溚ZCyh10wRJW֐ k;ȮEA؃RA} RFOħjS :py)z 3L9#txAw-aTBk@iDd4%ԢKn8oQVKv>aASѮ"6jC#8[t`Gd߽֜Y#`+G~'ȧt]9]平n[˔ed"e!?x9M(J;ؕGc4>) H8z.Ӝ[J( NÿJzz63\L+#_a–MbMBlN)#/Grz9,i|vPbԬLsFAZS [ W i-3:GzN Z ad%0^䅍MkL5–t5'kFBDm-1[g^=@'>&hAsxҙGrU+Jwv\f{WݝG2;3.vV^0'y$yHXZZOUGݏ$ E/!G\OU\Wpt GVdhЂ=ӭK 8Do5x@4[Z2\#m6Jj3: a ^`?˘ĕ+ E;ho.jiV=zq!*Amxc?G_ bF <):cd+MLusZX,@bHa|*LG̚#J{mƙ(Tl6#HTxat`UKZ[.$ro/CKY/2A67D&g^^N:X2:HK9d_O\5 {:} Kp&qmGNWα bc'Ap Cv MZFQ*3jƑeQJv'&zҝ"(_m +DJ_6Qv2,o5d 9ݲU@j4i jBXxtݗArp%'$힭_1%hxa޹l4XciO+u* Uq:j­EyN㓐'`쉺'!>p;-ʍ/6Z^1hb0CMTH_zJʬ˯-X(\V;tۑ s)%Y؆bH!'m Sn'S{dzXƬbj7?(K,A'N6"W{~؄{\P av^k L2(Y!i `+VGV O6F}>o$VB.Vȳ^:-Z\yXMl)i=u]OJde*۽Pgnn b(F8;pX"p;U43F ~[m VP6'+NôVFi#ܜ3>:#f] Zqozx\U 9; 5xA_uA*2O+sCx.1K}g+4.i p('*Zc "ڣ|_3<.zV*)UZ]SV=]"~~*MŭV6S*Mp\v m~80*\-ՠnG7jTtTOC  qUW1V Jk^E?aTd W~/I SOUkXPێz&rptĽ?V&uUP7_ UN*g(^cpqLV<i$G|s_t,@ǁٺWc/\(+}qL T*+ˮ_*ο{2(C A8e!b;*IVB [s~6K{ A{ZQG4xoNM Ξ,|{2A})UB}ۡAhnȗ_d$&*?Ϧ"Wc"9AZ\ D9J{UDb ? q)N0-M,u=F!] j =kǷ%p%|SqG0uwUH9^ö*#0i $QS߱2 U_$0~%ª)_>8(}UZF*qPATYHMwCcJ[$d=H>%1ZCz7v8oӀf-eG8 Q*>=d+b7>,!$є1?1Kkx<@}-(7ժ(0=WoYq _j{8a}ĦI7ok(mSҍ?wcJ H*wC*h‡qP~XMuf_ 7aCg;w<v6 >ĐTxpJ|[A:8 0hPGn-\QwCOh|Kemz'f1 uU9lFЌUwd#F„auK`xdU&Oh,`f>&_/8Yqi%q)7BcUtlSRlrn>jK`}|1U>D|tr cն75ӳn1Ul؝ }7\ WgTSw*|2}=qBSUFqኩȁ8f4}UEE|I? 9^8<:d-4WI|٩CJ՛sDMFNDt6_끥VY6B:8`OAP"f˱ٱCCuZ2qJ!&Yrq\o%%덡BhC,6(ICTy4 + >p=TƍJ[>fڊ2'.Uŏf/*-_ ΃0z?CxnU1d5ٱ?iw­kߎI7ZxzbLPE m|݊x\`n+;q޿N4Q3ƛxL$K!!"iV⭝l!id+7UTlv\E~x%zt^XH(1x;wPm^á犿lqBĸ>rr6}xWIjrN!_>XHþSFTn?RN˳l޻=)Fs^ TFø dT-ō~(L "4;%R};PH?|#,o ƕ 2U4%jڜ\\5+T=kegQ;~#R}!U|?*\Y%WٺPn陣++|cU㕣k7qDzUdW+dqB#TxLT&$vr2g'㧙Wf]vlUٱWf]vlU*6*ثb͊6*ثbɇ)rIdxIEhK|s+qSjD\.?NHdHc⚛(Qȕu…O唭_cWMw8zKw#nk1Tu ӸQ;27Ze'f늣PW*NfQF;b9ޠoA(Zq~rO¨+sQpif`}T5Sp;v4z+_ W~G+UFTnqez:3OUh1bDf2=凉dF;OpF9FO#e1,$4mWlPuL)WߡqZWLx`qU&Rt TҝWcZxRhH8 v;X,U w7YUƕ1 Uu t# D?Hj6lUmxZW3^iIE>%U׶Pji#qWG/-\6Y|K4ruȐZ5r^ǎO>+|ItX~B+tѯ?cDŽHᆖn@[p%\oߊ+TY=3^̭c(~G%7$ 懖?* #ӱ2(n?,z=2HR: {aQFF"lRٳG'wc)]쑃Z8Pm)^A㊯R/@|?zb o۾gJ(zRgh!-J`n[lUyPu zQ*6;xW$ZBI<2^rN$*Y{a$r}{O<'meǁ툩 чȥ1ux%IfS. _9o9 B>؃!L Dˊ ňYqT:xcCߦ)T%|*6z(P>"׶*J0lQFJ&9? =FT 0>}l J9/OՄ!O̾ZCtTM| EcոKpIӗh~8q ߦ*cǮ1U$]x۶)WFl|3nSKE8ѐSBlӔ]EA8>9[پ~ IM ^u^?kOF(„v©H" '%4O\PB mJn0BH"QNBk=)'ph=Xws qUƗ#m\W&vq1PPUTJsEw^_jt9h<1V*awQl6;Τ=UatoJ!תxcjH 9/6*aQT9 e}#VMcP?Vɡc?aVG>ݱ "% iSQkt=%COPPè>+Y,g#'qjԞAi~j%[ ѧNtUeOZ†zp?H4cڝqUU,WZqH"=-|cmNEGk>XvXUQL",~j[a+&8mccR`TbWzhcW6xD#qFgO@S*{/r==.+M hj]>Tb!F :$'s?h:yP7? D1_ۻjHȒyHf`7dcܠn$-,cRk܌ N7_CCU@(I-,`M9 t/ec+Y64͂&Fh)iZ=ĉnAJ $T2 MFoG$ŽVC[׈dhk 2%"jvmN%eRz޻&VRJ4Xm}( +RS+Td+[[Jd,eBAݼH ’\)p,>-ZզLw =rc&^Nsz0ѡ3I$Rl$'R=ԥjjk;VN1W٧XA'`qhכizpCl?gegd)ZZc܍&f?8sP-\4$ -0%Z|)s( IrmF,!OTG{iKU6 ecqa9taBːoy(W|9lU)n8F薱A2\CrSx gj"" lX{de{SI.Ǩm"I,ӳxm"[]txZ [u(xnb]WAo(V=Gq-eJz+` l栁J0UQSG\u?Y93I_oz|*wj`C,ꆼv ;!d$`»7F'sIW0*H{֯ GJڄ-+>ɐ4 "}4Dq%߬@}: 镑Am "@>=p ݫMɮ4H˔S[ᏞoҳA~*t;|9PnaY7BpekqZfPjB;Gdܻ|䘎魗 Ɓz?QgIN4_LɌ+8\GlhDZ#U#!#f+ЁNƛco D>}:TmmqV7#NF'$u.hVf e`mr{pi_N (.EDP eb_UN: QF{zҴ*;}(8UVv"HZxd 8Ў4?<[P7$N.HOr F>V톚撟m -i M2zdIH6wKQ忸(F >ScO|Rh~Xo-V$Ggq_ N.7O&SeV?NLntZH\•#,, 3q5i}Hn7BNkĝq%rXx;$3$\$mZ FEZzTj+mh1 DFAtfXfTb(eL%H)jSFe^*i4fn$[dpr7ZKEUܓ0"T〈,MkLFQx?rn )I VLwI(0*N14-*m69`w 4둜GnvbƌzZA5L{1HM+zq5J I2$3Po9`3!nk QXoۦ6fw=Yp\R_.Zp*+M+Xve5`!j: [_=׾NpI@J#2B BJqFF,Qʗ%CYyn>lg:m (??h/Rf eNk#&}H*{[gP*E|U|Rᔲ[ XC ~߳aB=pڶN؛ ;ժJG1*oO Z N5TI(=2 UqPFی܁h)7LA=`iK8O?zcE1g'~#epV2T(=})LDlqUnr7Uah|q0qክeׄJ TŔtB׍VN=cኮ@ c!]l*ٺi*? @~ e>8&)lwIpnB¢O~dž)Xqgs[u#lSn܍V"(b㊩KE3IҺ֛傕"%sq0ɩ_6ךk[*|Q?r;6>$?ˁUʝ%L]́TMcٷS̡,دlXHټqUY%OV3a=LJqx5MU}"ٰ%rFC^A4P?6+J5܀MᱵJ?O\j5lTzU.6id%QNG\zZMPzPS8e7pjv^@ml6l(XAħYbO~8 Ľ. lF#BjcJUIڄU{]&WdV %EW[FSƒqr]I,_VԎc3[S' A ۍi~MŠ:<%N^XUp9RuXw1B4ďk\mU϶ Z.ݱH⪁ՆckW:fYرUo!I_ eZ/Tamb%wmi -6aQ 7N…0}:1 ! bTwܞG`Tdsӣf?̾sZptr,uR#h ?(zqT%͚Kd+,+O8LrJP"gxnC~8g$Lj a~Cl‡]ħĆT^$ q[]ڇ5;.ݎ 1\r…7>Ǩv*6mc늮Xrw֌7ٱ`UA(cW*1e%Pt+,wZ ?MW*?lv;ث5qǿ8ۮتvaP3$I ژaIz*1y=+Ii0*qvm=TxI0SU޸y \,gznZ |q[kjG_Z?֦+$4u^0TlpTS WqbY`hZ^5N:#ǣu:kAƲ=*;aQ 6፪ B;\\Ўi„(NQB:p|Kx)l$W=֟&sf?;xNhأ0늦}\Ʋ]0*k`pJ$*\Qdצ*s(|UQ51*ӧ!G`4&O -QG|PxF2{iW$`wz\s8?ʍ}],tlU$n؂,K qb v=Qe ѺQZzqc?\Ѭ8!{䐄ehq6O%FWR/;pĻ7*ݸv=Sbb.ڛढc5PN =*;r~*[d[qA`;}oZzeH3c.$7l}x]w%ːƾݲxcItMN QL^"װ%+4&Jw4,K0er-J>b ,w,Aaź~3]WbU ck_ )ȕ,+LN [CL)Is $CMh"MCA`ɇCND}wbWVre?RQJt;e,kt>I4UUx {0be(@"BR-䱉 :/#z2gշVfI֡'$Za7qJ*NvJM.Ԓ͚VF]ST{{uH9;|Xi?Y\ /8T6 6 TqjJ 74Imd? >8 oobiCX;RŊalIΡ#tLL@l@ U\yz[xYSdDtۢ-d076) d|/Џpv4zlл,}NO L/so^-KuI#_j8$RMZ+I8 Rke#釚%W l2k1'Mi"+ )?#ɦ(̎T> ,7ln~9)m8K(hM 84.)QNfd< I%drU`C JV>30i|kpe K z(?evqV'k í)pH R;- N M$([_LZz풳vRo޷GJ~8r&ha^Fdw'Vٲ#4q{|׏'ٯZ_bbA76K^]IqYQͨ4MVl4Ą^x*Q /9=%*l,9hx=_wݸR/kS2qdQy }9zn>2(n#BqA .mEҴLJېóYF%{? 5FTPBR4pǥŲs"w0E$w4[c %@0р=:1EpTOj`=&V{{n&B?hڋd;ᆝm,q3O# @ y(4Cie SxW&PB;KKK_#1os=[vISívˎ PHQ9{!Fp4-B #ҜqʚԌm K#L8"ϰH#Ҁ7\ƚyX1hF$<}vO{j "[mW6\HaNȉ vnHvt48]<")`+jIHp?QV>&p.rE>pcLWEr^QfrKm* S_'JP|7mb{}6Y 9LI ȣF M0JD) M6xBnգ\: xWS<`-RK‚Y#/ \ |8ro8GO|q)RMY%}4uӱ븡;|,%xnX'sp1G6C.jk[}?n Pv/EP1kn(GP<YM-v5Y*8(i1KMG{0<34q+~aX@-$jTR(qAn?ª?F&cQ?n%B*~Y$y!8>[?kL%7ڥ²|]np;tpZZK-, b;b*)"(Y3u?>+hJwcjPx6S<Vw8ҦZ|?S#Ph8i!AFO،6=f:HRٷ\OF,Oq7+S`Crۉ7GCVEu~*(]ƘMF)W?.9aЃ#,59 (B 㷊8Bp%]$Yð=G+q^G#_z +ױª2BRǺ;#*9ƲźՀ4e:b>8ت閒r8#+`oQШj)Uޕ"r>oPDCЧB>xzm.=e-$fY>ҟp:NbxQT8… %|KcJ 8G|LN1UPz]Z+1*OuZagUUAhZUqh &P~ccd)Ȫ)%lUBkABGaňߒ߆P8ĽF=Za( ֫.xvX/cDњS)P夘PZ TTc_j0>͋˧t[MuN=*eӜ[j;i. h SCWu=/2=wƴewI^}ƷpeaE%kg~,|>VXmhҟ]e?sJQaQk%y_XUI*폯1iۓ\Ad :psѻ`i`Q\ (شs 6mRxJn7\QSY8'(W?i:xcFN(XϏhATTVWjqJ29C +զ͸A?GqîR{OP|-sCd@HPr_Q5fA̹~.>h@ݷtՀzmס&n >)*m$O/yW_ H wٔA] Uw.[ǫnX^uኬ-S8[↚0~ icJPhFY0ZCb/E\Q̲v9lPVS\8b,h8 WaU#U*T;ւو[G؎-_oV=v>=f@lUh$TQM)®gvUQZ 358)([=.J qe^'e e3Z>ҟ> HRKWݾÃ1cѿv9.j4U#`+b{ 劮.SiMzuqUP x)[IU~(낕p~͕VWl߾u늸M;(Ӈ]+]LJ>Um* BFh6bj%zn1U@oj6#a_׏ ceoo1V͗P 䇧\S !tQx\KYHqSq;FUI/)/t=)[VX[umU14aOdT*xbΫ0f…K቗d4|'䞣-ƕ)U (ozcp FN5+ڿ_ h~_,~uTw918> \XO6GN\t6*ثb͊6*ثb͊?*6*ثb͊6*ثbɿ3ƺQTh'OsH|jndYmΛsjajU?eB1?a-q#.·+OF#@c-N{w튵SQVuxkq{{?wPb@dMo.{(RԬSl?W t1OOח")j L#`)b;׮L05:t8RZ8~cîQ?ゑTzf}9|4>^UOlU$>Mȇ$=F8?aW0|Hp;C(eSNS[!<>2I_)t1`Ct잙5rdlz,n@mlr1B@⇮ eqlmPr[?b>銨G4ټ21Q튭x Y8# DcnٙA`V-#\RP>8~^Tx{)v퍪\aC$( ؜fٲ* g+tbن!}#*klS$볌 FqsmX5On1P*Gq02@ۀ) 6|Z#˛襉t7 OQeiޓzJLRBV) ?w33RŊ8D:d2N,b^ S|NGDc\n"@IKil.zqSKSRq$fQafMT2\L֥獣c@ `%&lFA;ԁ\ Yj;n2\ٝ]6;ڈca!V*,-~$ 0m0B\V2Kcdw:Zt|)<2F)Vb: NEޘ"hGFؘZŰꦸV@SJ|]\;fXrlLd7R oXGXESCoy7ziJ;dz}L61GraCB׌ ?gX$<ΜzU1!b)1ojƛlT8)+/TVuqmֵ$/u+mBH\[_E_(M7O׌+犪oՍSǯL -OTaUƼT}إtrlh5tʩ]LUƏ|PQPe|R# z⅔;xlMW*$Z7\rocd+>Y_pڨ׆?^UH`H؎UFS]׮*9ٺb)*$H]&V+޽0IAN-dN"`lX,1dZ^2};>ZӂO?=@F'-*7<19pN]-666r}icj%1V[R◵hԮNSxJb+cw%z6wbM)܅vU=bzw=$ҩޙ}V沝ze434d_`NBv}׉!Y%U69,~3Iάd2E,hlMI8aow&'+A{W.ԒE ypv)r铍*nQF ˜ i- +A^ -)mz,,8`-%-,'j] Jp)^'Nt;n "1mF(683t{T s.$.YalOQeKev ݢ袴ڭ)>Zb۲~vvn;f[>K+I7vؘ-Z$&XiB@?EzvX.7@wl\.oi-AJaof掠ִ2`l6Neih4Ɉ#@ZGRKY$Z:jSHyE-ҙ8-`O!Ytյdpf 1 "RN+sa֥,S*Aw,L|gWiLZ,wФ'u\4p!GL$R QyO) kW4DlN'eEZi;Vc,@pg&SJ #Gȉ/K$yq5ZRU#tZlCʠLӧLRF"*cS6/ >fҥɽ0ZS'iA5O;zg>l+W{Y%F6ZRj4B\7cK":1++,Zw׭T3zxW%-tdOEg:)APYa,5]$]4Ou8 Kko5`~W+tIiVQtu.O,r)ߎ8J7^Ф`!y :I7y{T8g!=ɰ\"GWh: V. ynQ; (Uy%KL"qᎵv-%99=C*v݌BGXHܒ-)P:oJWXzsD9"I#k "܋T0Ǖ2DY:|iB炭I$w 6!n@ W#["FCo,2Lb4jWb{xms3ښRTJ;(hs2y?y8Bc*wfTrbE l҄T5A$OFx"B'r@zY~XuZ zO { 6i%̱2-IqZ56?ġt C)1+SjS.-k'1Cɕu[qjD껅58uN+CNCcB7`7Qg uOU9cܟ  > Rw>ݱ[p_T7(ʊa0:=JN4yҿ"OD2Y$eS;lSOtIقWode 7A '#djrŤ*ڕpio.N⠆P:݆'II+%WӒee&`+z\c$RJ5ޅ"u ޭVbSr@Q!Fش`ڦZZݢFi7DO$iW!B&CF$ەC:ez&VBL?~v.%_OWr>A!5 $8:K{yZBJ|ISUzzed,4Vh.Ă)Mȱ1K h?Ok #` 5rwu&$-JS6+ܽ񓱠epFr+M*.OݮFuT#2QQWsf-.7y}9,H{%8CVjothh;`M*O5SeԴ`3Fԯ(i h ljթ߾W&dui2Ha 7Ͷ$-iXy17\#PH*G|BIdpZmQއZ.N-1]LQʧeCri%dY-H (QD[qZt ZP ( LȤCȩoiu=xY>2yyE¿|"M/"dIbA-Í^OSRy o|ǁDfwr(|C WoFKPnpZiaK,׮8i hs+ Iar6]Y)Fl)u]؝͠ulM ahULhXT^FIU(p\7K"zQwU.cwl}9ĝսlud߼Ҋ7ҸP*6ˉ-zuxP44mceتՐNc)Oz`J5_|Z)(v„,ּHavu=Awٻ9$4+NQWBe1~pL=wӉۮ*aL?g>b`q`UV<ߵ1Wq Wmcu[ZP7:#iE U=0bi2FƸ-)\dO5ĽJF,ֶ525hTFqlIuUR>N'R>x/]*nW7V:yFsL9z%sg븙r <G8O8(PzW#Ҟ_S?bbuaB ~XuqPh&qȼvn8 Q1IUN1Rv8Cmxb:QM﵅V}?Wъ+m*M<{(SٓöS~U-62Wfƕ]eb/2)D(a2zxbSC$5EWqlq(;$(%MGLs(~*)X/hGߑJimzl7$M cv)vP64f9c-GiI{7cqh ?Z1 ,n)ߧ㊧6:׵-0U3S~/q@LR޳ُzKKCXT A.Zzhc~8Qia2Ӵ;]> UW;QG\U, NBSI4o)Zlzc>cFm⁖AR!;8bxn)~ $4b\f P0Ph?fqኯ]Z Pӭ~|queٶ8U 'nJnJ&Mor|0کMlq~8 ]!{ݸ+ozЃ4m?OتJK3e:u!Գ%;KիmeAqG0mfK%6=0fy%*{x~ n05UĆ[<0np*B,qBmSqJ!c;p[|F&}$|2WVتuFe}x:Uͷ*FqbO]Wa >WT&P+3GQ݊[YOT. P6(S+ʸUh^&@ղn7l늵Zm{cJzoצ8t;U|.62nTٺbTJ7<9R(axc˦[?5J1KW>=`GQ(l,*;{c┣Cņ*qQ3~_S1J@ b qob]}H<? RZ p:7L E4I(̽BI FJcWnqqo CCA_)T xcBءJXCGf*;U5(7c4{:LkrLttg&Osb͊6*ثb͊6*ث*6*ثb͊6*ثbɗsq%?I&,*su{kQK*}}e#-CEqsl`"b 7xhz :* þYAC zw͉J)$ Fr>U@t㇚vF%]bD*0ٱ8b,P6ۿƘ*KWثM?c…"+d:J-ehGƕ=W6wxQ)O*M6=aU6SWOWWb?l>|]z?qU"60m ]1UXrq*$L1Ӫw6uʹwIG/ It8lGL$*ootP F!k(b?޹O"V~&\SٻaUslYןĻ0qB7+>تDunsL*~}3A*>c]H8ԝъN? }9I!0`LAF뒴%䛩=22}#CQ{K48ɸp*- Kژ[],qU_…2wWتǏnK/ױP??`KƄoBnE]*i'i0*|2)]Ndr).+*r868+qBn;RlR x.ت锬TѺaKyJ~q~J6Pr8rL 4\v;ȥ 덊cqWIq0tnPP3BG7ϱ QLc*}J5YXm#)K,i UZzxb/ Jw뉑ML UScⅲIJW&v8U xR[^_Fn TJdޜB]VPhJH 7#+JbԔ!ٔl,@l)LbZWmf  \+T` P2.l*j0~n-QVHTqR -JW| ^-'\Rp>v8T*c\Q$`1 ,!{x[I#}DNX?V[_f=|R=N7(]4Azn׾+a*$z$)cf9郋P 6GiJ =YVJ*;:_#媗5itt.mAxw3a-2"[J :_TdoeAl )r@6RQ,^aE81~qcӶ IxS_]'@܏BhiυPDvoј#w4niޡM UV7,J^F2c;V[ FQ@u[V+LrI]*8t h|[@qQaU %rCC%XoZց.Զq'ӂ-[4/[D$\.e' x0qUE%}džP%MaQ ,|Ur9^1bB9 X…qNZ/0ۯOUJ|늬>+qR9kfWlpN;늤ءBX6d­%봃8 uI'gq߶*"nq*1pIŦ*#y%ww2K!I_~*q̣U4٩6z0CEIE?x9AMyzW no"n }Q u6, {oLޙ"$!Aص҉n$B1chYQ% ,jY..KjqM I "Aj>UE$2b NX]'3Jч%:c`z Z&F1A$G(/n%uO[[D4jPƣsǩU YJ N]r@Io"epMvR}fb*~Xi2M/ O0Ш }2* m$WncPE-ּH (ȉ@RY>V}UCoHi h1I FTȓYe$39}b1r &6ِ4>}HS6H*)T l~IKPSCp8u-ToESRk١p{c-,2"[+"cDY Ѓz}ZUܾߠ'"lZmRty5qӾ^m9HO5SBOɃ@CC.L޽TRSU*+|ċ [LЭw'!y[?.O-x}:ld An=>4 ˰zl϶W/3]wA{HIE$6}qZ=V!P ޘb9˽b4}Vh63PS kg4?W1;|9^is-4eié;|"TMk!7NYWƷ]\_֦{_vy=@Kr5W,s̯8-e^P z4pN,9$%DjcPW.-Ok٘SFL?.ܬ}:Sħ16y4(OjXN[~r7ՑhZU'Zf3LbO@NQA֭ !M$5K;Hk¿@?g 1Db|Mqq3bDU=O7O>a̪ `Bl2KkabPlKjNK4(K_ ##@XmlgI\G}i qT1ГmZl lȏ fS aƼ:f`G'`P^O|!HNu$otQcy= =3ة̀ ]^ۧPFfP@H'FAGC"Hv ГkWMJRrI'1v=okkr-[PMjj?҈}`^KTJ+Syʩ\no8%HW# 9JJ9P]# edU^8C9G_<2tbr-|N۲\܉nH0R}F9a{ӗĵRYm׊2$"#JgN7˥3ȊVAJWH|"kaS31#m#3zIJV!&;3P1+*)N6=ᄖU-2ݙ[PaݻeL w|'aՁujz`N{wZ0ʴ|2k+z^Z:qGZA(Ŕ9" 1&ׅzv?Q}>%CW+͐VN`+|12"(Kƶ6ޠq+F㟶?úǒ"@ sW3O(ILA|Px+OmZyVa2#&%Rjj탵c=8抁Wjo3E {x& VcQCsș(7q[Sr1ygs,5А{2c0h2%0N41@ŕFĕRHoZS -ա ~QAӫf1h!N9%yS'`=BK{+waj<Aiim- +I91m>#,VnLmyqkźV)F$M}pdֶ*iTv4/2>Oa4} \KQ 2&n=(`09+%Q\jUZvk F@)W_ OE*zF R=CM< om/9fU#WqFaX9e7;otz4G)H>vNFU'`皨7eژפjVgU/`ZM:^ 跫PG.!Ăz+k6_xeh2, Wi7XIO$rH˦IaĨ-y~ZNN.j;}QdUD|rܭB$$$lZ,54ld` VZ{WtP9Ġ.]j?nj52-VDV]V4i#9l@#d&(!l]|'[&J2^Jm\=)mhMY~eBD,j! Cl;{:Jq9Smk%(4m,$O24Jí";hĎǙ5N\[8$),֠[^PC ;6A ˈ[<&ƙ4);_oerLÍ;5צ^dOU=*ң.ч%_ZˠݓWRkIjS٘$#w48PoJ6=boتcM+ٰ*`%?9dXu}{*5#"Gb8I"^Wmx 6\[e妧 {Z)N*~jM{KW#4J{8ӽS ֩d8AP̎qApCn1b G|JhCu゙"m~h=1J7CFVNWCQG=Rv(PïsI `#I?%-M;)p,5AáKS!1G_ںKƅǣUƤUB S!>񉲕xb zUhC48j8ţ(C!M*PKAҼGc`r* |;6JЄhw\mc% lۧHǮEQ*Y lzcjԑ,Òqum>%B!!C&2mx>m%crY"2 U3Jmᘒ?Oq2+*АݸY{>i#xqp>oUGъНC,3NإY>x)\8P 9\tXUw;|v}hwM׸rUJKul{sLYSźg< F$nW@T,>(B=yEL$aqP"C+u?FqjErzPQ[il @i|,GbyH?Il9035 Ќqlr\U-^zbh}9GFªrWu_U Ɣ>`UHӺ w8$;⫃t̤ٱC+'=$ޝ?R-P{JZ#cyf4a$F*mv`n7#\aRw>UWA7qU}QuLUB~ P%#i~Gfʓ%z3VSm~mj$0 0߉]RU=~jߴ1 5"G~7►m۷oqG5Ÿ=F3*‡{>0*>U= UFMhn1J˱N(Rh-~m[ LqU@AIqs"(\:L(qT9[sXJ h;XqNP-GSb+0%S4aױtmjT;ym]DCpkGqNНت8T(zK'kkc<X=̼J^7o(qolR3Y՘-~ˀ%%Xt*r %F]wY+p;wUu||~x׈0=+qxщUNJm]@,*kY{\Uz0-,0o(qRmS[|IO0R$GjX<׮9:aUሥCh9 |iӾZ1@z`]L68R6@ L`Kl(T?RW1~φh$1\9ax48nI?%@Ǡ&FBqkt Pw1dW]BXJ m OԌj8]Z~sFe#xUZZv'9N‡$?;lv*7˧_ׁ.V >b,U{׍V*wB!B_qnA$ dF B)ZqU@2,b5wAJ}g(x߁S8/Q~Cpi(6 ^;PT(PlUM .ǭ0OUNF%֭~08Z'c_W(rtJ2)& 8aC@OnPu0(1cq`gB}(đd]G|(Rt*}TF*$,>8$Aęi(z픭CoqL~*/kwSɂimtEūٓwdm"$-#J-`L7Q{ds@仩4}DZxv”P!yP5۾ m)BOjI`NXA#}B]$+*_+߾@2צ4B6=0,oz`J: NqqT )یr)XvO8P );YccPM4pCrGLOPZ"@Ft^A^'>~UьZHaQ LktlruĒYq^1<1xڌeQE2D4TOP3%5j g)/;\q11K8dh86P-:ծdoJVIgb?E U>ӖUb7LEWR R@GN&!dA@ ڠöR!Qz-6b@D[?}‚̜ cJP`|YmCX䄭@2SBftI҂EՏi 1'}N%Pŭ٫'^ŮR2t>1H-H'd>ZtH%v(r0ސВXv80Q텴I-0ŋz1}J"Z 8ŔM%cEah%1֪<k5xd2 RE x% W6M P^k?%Yc5F< *Ql ^YC2uͳ6#]SwSzOu Wc5g*FQGקc1 sCO|*D_NUG-V8]:;>lpu *R wt#H~Ϗ**Nk=?UÿOu(h7ͳl~)wĿ1T 8k*F;mS`U^XUnrtTI8q k,v늩I1Vs[fţPCH _ Guڂ?,{1]VաNA#ڍԭ)sȩ"ރ "FBҔOH^MVwW$k]p^6wTeo ԏQc# C{x$DB%8*h[{wsM֣se9R}H!q" I㍺8#. C^'uU.h A#++頎V"> ǭ0xϒ\KDIgF#%icotP=HǹhڸӒ@Y%~J+G5sj \Cp =h X` MJjuo+ѷ"rN[ԳW~{v1_}!#$$ .;lC\XU7U;m |й5;l^f_XGPV'#tԦgR#YI+ K R%7' ~,vvʉbHѪ#쩻K4i"mp\#ؘ*x;bvBKfI/GWNHw LDwRe+lUdP ='cCOs){AZ&8ߩ^"O^#&<3EW~ZڕK$Aڝ0QBGbA>%"^#l>䔫/vdŤzshE-+ o|bUu)Y)O|BƆ_$H? -ƖXEE7a{no[ŋ "*kֶku)G,KW/!Iz|d xm#O4h%svgu%I%u`#Z8sjQfF7D@̈́y4=.{Ѭܖq-Ph&UW[E2̛Lej/Z֙Y&yc!)5`xe#R)jv ;*M vh*OW2(HT@O1~lxRM_˱OYV5?gi׶KqrEMzc$R.nnR9 h# ],U+ruQٗDge领zH{/Qҟ֚SN/R BnH:V(ȴ"%@EY٭+gnAۗ#˒5;RleD$$5mK:ҝm/̱\"0,ھ.hBk.,0 5S\}e:KT52p2GQ>x$ח\[WPkx][e0P6Pm.b.Ei1ZiKud2~oڦ1fkFSM%6cdjݓC!ԷS2KaˤSj֌(^4]>?0svPFH4'!<`aòCHBr Lv$}A-!rVJ$p i%X M%`|9(VV1 t-ҩ*h,&vueq9TPZ!RUВHK[tn¹)mRifw%)(qOԯ533#P}k$;MLi\Hܛ[ŧIv[qҙD&-ePܩ/8!ҀW ifG2afቨْj <.'!MҸfMΡ zd#rƂ8R+g=h IKC $|WSPւ1VU$OK妟4v&|Jqm\׳$C/=ԯ" Ȃ)GX}18%0Pe%T=~XzF{@ ?,MpFHQ" ňPӔ[R9B[kEYjGHY9-&M)2iAN6ÌVX-d˒VWÌrsᔀ&}.cr(=-VX&d" '`pÿsX6"IV4ou5~ja)0jb t*:-m=hi!߱|(&YVu+hFM .iڳi9P|?ڎ_[HG(>C'Fl.ɩbvTwl^3!>% \;^yMUw$KLDBh zp;~s;3NQBm^hdz3TESv5Zjbђk9(:WA J*+w4]HTdHhč.m+RH$M\,-J{`B=N(S Q-PzlwRxfwAJRN)#Z25hmxRҭ&٪nI%D#4!g7$@Inif.$T-B)0KqZ2߻$b>eVH/"YŤC,MvpG,A$CRZ|Ye]A]=uD*cJpQp$><}o;E(X[";E;5 l \ iJ.n5FB$`̭yr!?U0Is kRiW~YO󙀬)ZҤӮ'%ꃃ Mr3a$Z*ot9"ZF.O6^LJnnM((;q9]mVXii΅0:6an):\he';q' 5)ͷc`3nHeź5sW5Я> w?{bu7f+h;9ت"*8(C 97_q:F㍪ _ kFWW$ܶ?k ^1J\zq)UH&'ٻ?qdguh&xB;0rVZfHk /\Md1+Tf-q/?J_>>Dޣ» tķCUŒ qIqBV=\ab}UQW䦞MUI'7quH ê8XMbLNv)Dlw8Fqb1Ob5(p%i އIlzi#1:fF~*QFO|U\I|*[Ljg {t$`FSe۾Z=w ^:m4'cCbQc_ a0D)v=[Aӑ6 D,o2/Z$*x\*њeq\T;D7 UX}9Z0Z6*(+FǔHhqU5<$_$Am QJSuN(ќ WYsٶ>8FHJn<0EC|/BGL{pq&RHbVfmb EE9aT8-SdGтY+)Ě27YdWtstVQVYE͒Bx Wu*;ѻ?*]s`y}kOa k-]1+="F>8U1ޖU1\'ڍp-]b+qV뷈c[ncBƷc۩Urɴ̮њ7O*EM(O݁To] oOTٽƴU~Re'ߌ=~ j;1;P]_"pLQULrMU܄p=q 6 94[TGe(p%YdWeߦZ;JuIqU#>U1| T#jaK>XP⁽=Z0)q@8~jZQ;VuUi;,HTѾUcF9/<1CUʚՉUT}eIEH#!}e^2#S'}IOFWTKAIvz|KՁ>G 0GG?$=gc)qCKqU8GUA%5 ,;c4{(ThQU_~ҩUڕGu#H\Xϒ+Ke7 Cќ ]vlUٱWf]vlUٱWg*6*ثb͊6*ثbw&ZOI1l4bZtyu،[bw RwuA9D}) F4Mnx\Oٮ}*yFz0݆.jp28 Њ~ aS.AF،R"WcQbMR]~ׇ(Tz| |8RAQǚVonJᘁ(7c[0Skz08)FH4={UiQ~Q8_Qp*Fa+I9lqU)9ӱ2$-|_{uͳ|bS"jU{T(R*G pD?b(j1Ka^c~R:2q\MLk늶@_IX=*._qmR)6h߳bMq(@8UMZro95CC4W*q7UDLiW+S.6p+R!aUCt8C%=q M_BWz:ݯARm5̱Pd Z[+S=Mb?x|UIlP\*;'d*|2*ч ]$*N[d$*wF GL STwǐٿ^)Y;T1"9j9V1l $uQɵ{~6)f`9cYX&K[hmR"ƽ@iLUJixb2Z$P׶&Z}WX*.Z 7RJ]gK8 c;E9I~,ISJv-NUj9S^~8vQ*Ac K ضxQuJ3N*۠1BG݅TaF[8qt#*g~ibq( 6ټ1-ۦ UbA|o0S6u&6(;Q0;(RI j(èΌQ*ȵc d*+GP,%4ٳIn) lAJ%t2۶!V\[{1Kmn؝#}= QԴHoNXQ> ũ=TLRWҺ^Ò}# x'`xI6튣{卷\*+/ ۷COo]Al0rJ& h{xfM:i(l`O!h2ϘlGAV޿jpTmݕ0ƞG~r+ : X9'mtŖnKltDb7?3အj qDr wSiVQ(=\ f,s׮\"XB/uգ5MɄD(ddF>:W%j_ƸԩbK>}@ډp";Pb3FoC#1أB/;jMTf5qVmѫɚA̯I7pV!;{)bBW Dc'cxk0{>&vAWhLT2־8Z(MZ0S镞#c\Q mU>%TUZGOFHO`6JR:c.Y!5qFq)dCW،QmK,(T_l d{5ǓdʳӁ^?SI Fz-0-YH' hՔS+v_8% |+OҘҕȵ`6{Sv*)C+l s*HO8^Lo&LNK4XVE̚t(gO)5c R MၥĿv*PG ~-QjJ 0!m* |Kb8?80]*]Qt1*j *5c;7(-IJ&Is5/n~R`)&*Œ;aBik{bHd=x UP@wAٺW*"n16BY$(z VS,T|K`CűǭPpUNݿk |qVԂ)e^aUڴ9q[I)*[Jۋ ^W >I*p*U6$ǎW4b`m:;_G{^~kYʍ<1";7a_Z f:-.S_h+/GL>&Hh $GJw#[J0Ej˿8UZTm['cPԭ7#W2TO.)A#TVzT\B<CD:mSWfd 2NEo2Rx@?F @/$kVrƂgZDž Z P7ZuZ~H &^:Da'#zmtiIw5Y Hv6djCӨ?k|! g, AlWPh(h%y${jZMrE> $#Y^YH8ry#G8ޡ mm+,bG?pI\]Q0G$-mJgv|{n %Cq!]}ƣqhM8uqQ DA@GuI`xQ{r9J6'0_4Kk(ͭ6 R= ,W35Ua'`e!ʽkN,MlSl5y F&'GClvcL#~o3A)MwN9*5 p=彔 (%A57"t̳4qȢ9r7́kt1nK, ڕڕ;l3yvI/ubZ F{-6o/(7;bV:ZZČ(*Nێ+8CtvX%ܥw$QzOULRgJ֞oFj'6 ٕ+U[GU?:ӧᗭN)qޘd1ve Gl6 Ѐ nEQx+d6#i|.)<~,k=dHb\M2/ZS oB`(S0 (qj|DjlWqpFŵ)E <>gS " ic+JUs#]#[ol%[Ԩ7m+czWz7P;2vweOGEN?:~q}*T()HFұfjNwbKxvdE(#4 k6ԋC?^;⫨>=Y@nBigsF9Tw)z-I u#*M36y.#ЗȼA鷎)..8!> y% "@&]Jh[Օ [^o{e팰%eaQg)˚x`#t3ܞS$Ow3Mbqj`'ɪߏJ_ _ʦ+h;!%//0kI;2IcLyRyXJ;O5[xݥ>?@91 -2+8/fix4P{`Y۝VȂ-{HycpyX/\F^4;awepsl(J;a<2 d%dVqvfJa"=5u8eBǾDCvrPf#ҴŸkoƴ\SޙJw V$ӯᗠWRM Xԑ)OwTzl#oVh[ӈuzȒ#`9Gl Ó ?gK6eHF_UF0Ecʕ}t4zh{jLyTtKkg{&܅*?V/uls4i VWV91Kr -kkHċUs]],s0Q!zt 2YYl74lX&I$jP`)0(zdŎiXH9#I&$g_;}\ΐ߀O"{ *X`Ucm?a7NIUYjHK=8|ri m +0 facU_=A{1RZaED䙜 ̉--iaȆ#Zp?V,-Lѳ7-yHHv~!G܏](qmHSIiu=?}i/=9c CrWʡDDڜ:8,C^@Ct2e QTn>>jh@5L)VOҹOr_'vυ5J?PU7ZklxO nkH貨qV2ң`@&lf &uAWl:r'Q#JvG|]*J1\ߖۃ*ʼB,Z; B@F ӥq+/A@H'껁FD2TA=\ !^0ؠ--G[i=$(GBEM[吣Hyo@kNی bHU*6& #+oAsৰ:=-[E; }9obM\/OS]lCĒ}r_Qú}g(]i-C^clMU =~pŤAE֤ dktiTjavYoFYMw4ڿ˙3DVAeg5|˩c#ؕ:G*`ŋ$ lʋ,Z|- !XN˼#u~tf#uܦHA_H͍Ҍ*ڙ"ܽӑ':[ RڃS:dcib~YNXvyoͬ| *_#~uIŋ(:BkOlEW #\ sLRe *HP'n"z$ ِnF,K.4$k:ڄ4XlG-¨+o8qV BV_qҿ10;t#qH:`UEuq-ra;%׺D&Y{,ceskf9?.4hV6?UO^ghM~0QV^ZRUyJݏB[0+(Mvh\% UJpqP⣷\ i$hvئL-A#ZvQ4|R)3CQep㒜(K匡lP늩+Ӧ4;uOCJ}\( cqEF\}*SU;ǎ=dcXѕn1E8 ܘB9z)Pwv+; 1ʽzxE=H8ZPG1V~؏j* gԄpE1)#DE7qc2}ڋuę>^#G"6R9tR[y&u犿 w d_ -f ~X)] lv8X v0B^sLU siQPz @YI@Ap%"H4F/d wBgL-ո)^UZ}:GgS9ׯ\*W+zuվDuZu­һQ$#|UE (U\Uz⅋#Fx ۗ18Z-]efVI ؜Uqd)EG0nQWf[xC|C PG_B[s) OaV$CbaǸf[q(qF„+HvWxU Xv.U㜏xaUYy &)ی 5f?op|HzlU.}9 pG_tl|Q܏RwWAͧRJ,Q'#ǶM@il0v+O*-$}=Qx:tx]ǎU txb:w]džpm=2d^Pp!b1CCOn}UR?i7Ʋ;n1Jq ClR9kªRAQǸv`bk۱~ wJfoҸPR:׮YUvlpjPuƑó~.q.> ?cWڿCxD4#^<)Lֲi<{-#_t8UZPq}N1dpZ% q VwN"j|1Ut+S |qxlqU@vuXӾ Rj F)sƓ-6(P<_ 2,G?hGñƕdw G1|I/qnwn#;UlQ?8-d4o U,mRңv ~`" qh}_彲\>Ocj;lf? t©;aB)RFmZ+6%Z`J]P YCW$ TLR\cVq}B+2 UD `Ui^j1V:= #+W2FZ܁qtn<1U }(U&c*f*9مG V^Ǐ$; dxl,#p:?$x\iEc3hlJFz8>$+YݬHIډ7_|ꝍA0$kp=|GleM\4[>қ;7*Eľ> <1:ok+#9ɱqثb͊6*ثb͊6**6*ثb͊6*ثbwZuOI1l4[`)=9ol 8T\f?+hV&"R[qbKf8-T. R6oxyǹB)ԟqrԬZ<קdsdVϫ<0 űS)`~R>+ z8PP~NFA+]F`#WFH$HsfqBXȅP6?v*OtaUXojt8H*qM Mg{ V~6$ )sm®;dOFo؎"E((C'mO]sl揸=FVWݯ8=T6p%ٺV#*"Ŕ~(CPT{LwqW+~ qW0ݼr (mX*-NX=\P%>%~)+r6],UqTFءJ`dU}nUs'!˾;aB|z`* R& qoqU_<2FzwJ 'bzN~n{E$޸gt%FR+Y,sj9" e+2)LUlG|'U\s[,x*>!Դ&& SEU"9*( U 4'QtJ96Q R8Qp*mS*|Uh&V1l $RObY=c5`d/7lji-U}(k3,_S\XE8\ T_`[Gvw\M)'_NGitz$zK7󱩮QeURJ}+bt8x$|C|-p!s Vđ Xcky֡0l.=kaIm<L ]ˣ0(Ǐӂu \:SWX{ S[\\,.C=)O j+Pկ϶(w{D ޘ@'zEDڄS`bi SߦNc)Af<~RO#4mdcټӐN,#e(V|}e^EQ~26'7X'FOS"9ҋy})At87#h晵@JWiCL z-!%7MGtq㊮Ifv>2 ĸAA[olR:kI ݀&V%sl>aTE](;`fB  qF?(wJV\E85}*F1U#4~tޫ4aAɗxmi--~*qQ#&f :<F|w>; B/㊪趰?!k5;7c/>F9aTD8mcp6ҩWUNajM' Y Vӥ{¹߅h/@8;_]"Y[/N/*˹^$VGO(HvcB-sS9p~%'gp֕҇$*MG\ą XS0^x)R_ah2[x f 淹Z6?j_!NHWeHP5-@"E-:?$]Ly*#Bn%#!ڱBϗdG4ݜRH!)neIjB)SlbZԝ}BWz8$ң+V[3sӎM\zz6pT,D$`O0[ǬH L bKNErɐTLΌVt#x梤N#|MBh+OEݙXy\TVE[wnZ^q=}MpGK~ȗ 8m?P^*ebdh x ĐG+yv~<%5Hљ'=0M]ոXe.(C Gmo9G <cu-b==kL=DAhm&OҾ*0RQU6-d>(5N2H++8ILOPWE]A9W+J6Yhxx-.dki֐NđmF{-m=޻ ZE@WҌ8nDIY A?FL4G*A`~?kHy,'8ր{ 2%X90riAbu~F+c"/U"X`hp?clF^+MJnMY(yr+5 \'GA)iOB|gLKń(hkJ7yêBh̲+q)u1-[5x\J]bǍqXGTD"WRm:~BGR#DK$_K&cƊ),/mXFVGŌԠKpXr3zϩO%Q0P6FٵۋVk9-<+A.610HdbbHqeU(ąW;H&>+k1;\魠!KOi\V il \XN!.r%~l:8ۉc@Qe@i_qKE)pr`xwZ( zEΕ'zo+o%/քm]&<."JDjڵ2RN֣E'3K# yaiQaeZ!aB?g ^M&REZ0Zge4>5YAIMM/Pƀn@hGsKaioo2ʧ~ԯrqYHZE3M 6X'<"VNF1IiܶdآP}8u唔K +r¾'r0yoBٮR7m* 4zrdQ PU1Gq!I 4C 83_H,7zFh=v\?S֠`#Ok8ㄑ _T`" s"E̕ZTk\$C3E;VagiD`ᆺ޳e,-`3`+}jPT!TX'\8}#Pn OA7r:KJSoM9"[%+y"ͬ}R+ԉ,j?heiUxNdJcj"-[~\#}Uf7H2TCLǵ2[ H`/U#O%P㔍H4]Z` 0+:-qWz5>xc/ᥕ흻ڪ4%ISvJ->x+zE {(T Gh)O2JJЎ]R"8P;t9h)ՕWISpbCRynv4ʌQRw57SPPJV5ZdĠN\/7$عq-Zp-`z: 8[`Px`-M̄W/VYhmTդI*}ev"7i :$s< upy"NU|Z`9~5޿ &J18d"B=O$&9 S,hk]u6:Ys`TP{W*R]@QZ/]E QV@?g)F^܋jI1 ^AIoVFRTno"%pOēFwMX,|d/L =[slw?Nbbk*h6ٍ{uK!QÐc&{Px{@JWq"vX 2?!&1u^3+$`=3JP&O^h/ʲc$5C*)Eq n~tk'μ+e{Įe_V?}VWy#Wwe$t't vBzԊbzH-bMXRej/uHY={+`HqF[LzijM}`- x+tY.gXr$OJSݲ&ij\NO!%NS~ff<`dd$o"v2{&lUB aϼHjj78JToUݒ7-1Q =[yLMݢOJ3ԷG@3dS=ǡ]&,U>;bvlU)Wֻfu[ t==|U9C*`[x0}? &(\KI}岨-I/))pZVHu0G'@+9nvT=Ư#?<[V~!O hbD;M-čpk!%Jkvc qMLP Iq_bX5'^:b"jS"A>p\w ulPٴFtY{ZR$1<1J_p5ťG%Qv<oc TѱTp*ۮ91UF8 uٱTkgq✈…c7_ 7.:p8ߧj1|KסS/qJ;Qn~VSіwǬl;mTt4#*qv"Ǩř6̽olw&ȯbնh=I i'~t?#5Gu};Yz/q`TLSTQ>2j1^K l8P1Vu#l Uө\ ,|I*?'\bٱJ^8 $4GqP⭫W^\zt®Do;æn i]QZ1U@OL֌T n^.*D!FVa:T2[>cWhUxĻrڇ\ UE\-;R$R"JёتaD?|*M$\";Z:/6%w2%!?ӵ噄췼m_,qTɶ5|*auU㕈b*(qUu}Z6LZ늴'}!'*K \bI>(vlm&7qQqOٶ8,)W!\oa{sJFoѼ(QG#ICI8\V=|]&#c„ T(erV9n:bS[,6*.ǮI6Q$:WM,wu? O5`TmgӨ ܏ x[cGt?&©ZU"̧F鷶V`SnxnT)THv8Rn<1Ҫ:4 ; ??j>U2ƕާSOqʻ6ءhR7MLJ)]|Cj*FǦUC91WتJ~X?y_ 뺜Ug6mVQ<:<І屮?q]{*aS2PQSW.U\`ym `8*qbYP4-&zt#BȊZA'\_)8A%Rv֭ ̶?V{cjn%huWbf_\:{FxU╱\DZTnb;p+hiuFeb ? UEm?)TF7LR-&Ƕ(T6 J Q~F"TG1 ~)H)mpT-Jn{ᤠ/,Vp UЃj0oiN\A␚ZzC~*_9jM*6Wb-?L X :Q|ױŠQ2ȝ;]$'(BI?{?iqOcRc$@v8UR9JFپYl(u­ztqDLqn0lr`WrIm>$lqWOlu)u-) Z9Qm:WmZ&*F͊ga~F oq)Smž|b9S+Q(„)r~uW;PN=>$\4sI5 Q*(B Uc፡teWltbk;Gr6+}q1ivWqYKH!O4uv38]RRb<{|*ei[)KtTS7?󧷾UǑ]fŷSe[$!Ou|3O(mO-&Wʥw\UPlzT7L PA锤WW07Qa$f|1(sC8 "5A up%(y|}+d'n*~&T*hGO uR* p8OQJAWSe#*](Rup;f})qQ0(>8Ò(P_DpboCLMP ~^ [ AQCmJ K}uŹc?…Uٺ!,%!Q1\,RSa_Lg0c#c_v4 EzkyOMW߬R M2̕}Y,Qq%Mb:;U&&z-&NJS3cgشp^^thrcQƹá1,\4Rxީ=k8NzifT4Wƌ픓_]xthER6D:;w=Q"7N@2bۜ+"vj'~HA?!Za)V$Ol6fLG(09&`M>-ErSB?!J*0Xců* [1'ʢڿ,%WY 51{1ޥ!L%-$\% DnAU3z+).*=e5r#n!$Z`@x{ njir%":QB˽q@20n6A$WܓvʥGrE0M%&#6B~N4BެCʆ«kY xep7 9n-&pj8r x#כI#:q;oLY?ŷ"2iMĻo6`*X}8Ag nI]o/i\VثBPӒn h;i4fDjK`tl= BѾ'V{d9j>1Ľ)dw4W3Ug#85s 'PG+1Dc)VӐ0ej-ӏCne=pkѵ#`cd2l\mK~VF$2ɧgi"S ltPHNpݡ=48F; YMI%3W;?#_JvclpZQ\W ^qbz>Ǧ)^G!\U$g 2Cxn-=ئ؊lG = Z#F}aueHƁUų[o$ WY_%T2VJn1B57TWkm+~>L(`U;XT :U(gq~^)kI@ -ۓnkƕE.oݝ8ss;1acJXȩ:.){$7,4<\xmr*«\*g0]@voVM44w7Q۰*4HwzHpSK{;6cY'<»խ(9P}DHsJna5R9ų Ti욄ҋv^B%({k@䆁Lq!*(i^}Eڼg$WObo++z2f i5\)?lv#f+O^_Nc$!#5j=difobpp(&V3L<4+{3jnYpӧΆ(P/rbKwSS$fKfAq-]2Ny#)Q> Oe_ ^Ah=W`Tv#!)M 7’)R}i$Ѻa<.Wӝe")Ij(7s%U'I&T\~/C_RIR:/$dVjU#҇I}<"۞DĂQ6Lq8yZ~)h«ANfA8>OLMzwyNfEwUC懮[YW2&RhGӑK88=rL̮te`y Ci8ccH罍%"t=~ң)1f7(O>U[fte_HSn6LfBA~$*m^X~Jr1J i͏a۟i'kK&bYe|[5ѣ\ Mݽ)/$Gi˳H7'uռh@iǢ˥TW:MW^" ǧs/GbHVQC1 ~ܤʂgalwXDGr;+R?؜i2KoB(0]]J33*H + >=VTZL7O%{bas5PzTPO͐>kděH<+i X݇OƸO>_tÊFdKqL;G-Bcկ3T0 0$zxs%izj i^2 D,=JSiB0)U݆~\gh2@X!RH G-4q%y~ϰ̙?ž˨&(x,|a}s Ggl1߯q7`Y^/™s%0iKcܦ#vf>q5 bwڽ-Vxi)c24A+ pV66PIf HRjrRRU-%ifZpe;9Hvm@ d5j~˒,{^%:wUؑ^Gtvhy({el&i*U33{ 庰 VQrcPAq:AxuVE;S!;R]K)l/ʞzW~#hGi b-z#ZY%ģ>eumIe"r=.X[>}sW~#'FY+C 6"P,ڶή׷%PGpgM;}0n@Dl&JE2Pt}L4!:) OӔLp24PD]-B`(m-gHPlI8LiQ_GC7OQ{"ˋdYk0mlaI>USSw&<˽,Ώ kQmx'cEI)i4e[`)Yyoݕc+㎎J=0%ےx0*T2}"O*9|G*Hq@á Zqs<%=V,ƾzs'-FyG|z_ A OrzF~:cZ(5?O*qU[ԃcOC1:wcU|,:Q}׮ J&Cx!7LD\]u\*x?NZ8´;lrJ6hbӒwֻc.;wxb>>ʕٷ\ _ulQdڽPhiOvYZ0R$5'@}­b늢#I.b|{P0;EUdb¨wx:ʡn6aN쇆I@7c%񞰞TдD,NC9xiS/ՍYit…[r=+|nI04n24d7!f `JRfیUaTٱCF0HC)KGTmb<+߲~RQt\{'qU}j"jLuq/MTY|Ib@gmW!%Z5 )%Iv} K?<2Ni[dStȪxIq݅U"\ S ߾W[6PxMA`q؃>{ڀSv?7kT N} pIh&/ YB|(#_o({R7/c)~*8/®+Oq]1U'_ qM'_ S~ĂY|2 ǵd<94n^K(9c͊ܢ[#,>qһp+GLUTS"#cVKlmqJU|<1T/č7Ľ2.*$/`ۡ ʌ Tk pT̵t\O"u(\aZ[,@]=BI~ p`Ǯ ⾜Շ<=%/ӽG3ڷ?\X 0w4. B =)V~m `_S%G4>N+a=ۭqBP?1vZ q}$ ׯ*щ y?~*T}*\PTOFW#Ƴ|qBƺ?)\Lƴ®,rߥ? PhnVT`Ѷo*j)F*97؟X,PzV>Ox wšdnQ,15͚ʼ&P?@C[ba[8U{n0<I mD<9\I[Ȗ)AQ.m%V4#MF4REC?fwƆUP=lSOՊj6'Ǿn>[$dN[G bLUU]ercB1H)f}ݱC~(8iT?:WcMpZҜEG 䃦sDVzxbBے7|{8'ȥTѶq19"Y=$Jo^K3!⨴d]CugT<@SOLRp*IG1NPzdrg5\QYOٙz__9@e5Xګ[ H/mˁc>8PdpJp x N*ILHя`U`7Pb`UCoO1[Zҥw@r hӦ((Sd|[,*rv;UN60j)]W˥hA<*H51P`UE75SqMz TtYqY6;sſ_ՉIS* c\)v#~?$#TMTĆgaAA A2|Ql~ŻECЯgx$4h5ҽpc ٭nǨN?2䏱ep>-r\t6*ثb͊6*ثb͊?*6*ثb͊6*ثbɇZOI1l[1/Ke$J„ֿv4=;`U쇉O|L| V]U{8d9=6?U)P0 ;V6lU%4m4^͕{gєV.̇cNU2Npr>'EXqJ!XTm0LrSNBcF+) ~?:fQ͊[xmxWq6=;l<%6yĺ|-⪿k|2ԕ48U^[n:bMmTu <[*E1I>t8xxO\-ªC<$`튪5>!)LU@sM(-@*N6o>+SoBXqbͼgPPR#iW+auݣZ۩' S?QKWSGSOlq¨iU=(]nm@=qB%MF67 U `lpC8CaNsV8t8#qUGlN=[T䏁g^Cn) v=1UmtQ.qH>(Nzvնq<`QK|L|J(mq U'0u^jrqT%Ŀk-һWC-6?dˊcp--6pp)u1JKuhnmEIݐto5ͳFXP9.hF$3_"U3}|q5b~ qL{P.([PႠĴ_M //Ѿ7/zc&bL6-+ -?SQϫ*/ءih[7u/8_Je"S+bxum %-FB|'q0*$\spO~*$* CeWٰGSeL4=eNoՍwUxj|-9gkvױVQXhAت«"2PL0jBB܁ת&Ʀ_$Xu S)qpFNc+Qg~LRH*:TS)AőQiVQ_]E GC?1U>D(qTmPchFؤa #}-E$ E'#?mons IhzX@@>O`vս1KhkОIEǠMofi޵} LbE= Sj{⑽>Th*3oˠ?e)Vfƃ5b@> =4ݺR6*1whJ'*RITZ8+Npzn2$5u xf&fbAF<ۣ԰);:<0ϗn }0H1@PzaR/gWX2TIt  hHߡN3 % #/tT]RjMn..K=Pc-H㏿(܌ڀ`?,CTiu8͊#ݴc[kl>uS@;l*E!ُxbwk$$bR!qzW!lk]b05TcD0CBw|8-Dp7'bȞl ꑳܙhyr\R!7nixlQE!cːZlA^=C7NMA~FIYu?7Z/QMdYHɻe9hQm#u̠;c&R&CAŋtVP*# dmmKU 9lg^HGoye3,)<|чJx>N*kթQM'FHg|J)Z FNF#g~r~8gиCU&T,(:TP;OCa5LoNrgr'a>dSHU4esUrߎMf'jźv&TU8ʞOXĚh|%t85v8"uPUrǾ13ҡr r,A hihN h'RI$\fx=ԡF/UX_$JAJ3WL>J ;Ly x&(c{`_.En_zaL ~ cap>#Aj᭥OM$xyLF6(S*8Th zҟT}@)J팲TC*OӖ 9/MTS:,drYXVy nĞk=I.'@xӥ6ȌṳMY䐢or\NG0}\[+ Du)@o@B;TahF R-W =:vQSd\Hq|p= LF=lN6pi0m9;uLMڍ;UY AZl)yeQvwl)gj.yK$kPX-SrfT5S|%薣v@$G]",Pxń6ZJ\f###КV-5 1ƠӴmkH"nI짾O2%+$LEa,e ޏq},naJVFzGԉׯ4Rg+jqM&H᥷C%{ڹ ǿz*zn\01-љzS /  *+Ӧ ԯp8S"u=*'Wr9P"YN3tY)&5jqz׭S8cIbW>8D4cIBS|_upo,dȭ!O/.(11CoM;ц$/^WYOڕZ^qgEx#_aGB|~uGM(vJ[E#bi =D1 =e=YmEkIfg^+V \^B>re/0FWKq@_J‘m֚^#C5]NWpވ[eꣶ iG_0;#*҃j+ 7N(tbQZozK5 Z[P# "7Jm]A 4/JoLxg͙i!%!WI5SɏQ :^I+MnÀ: g4iI*ۈ<2Jy#~v`F6TFIΤ8q|v1$ 4Ӄݰ ܸTӿ0k~{ZIGFqh wLB-*ϒ[l0;XSvuS+KwvtVRˀX;GK[ZKv-8ץp5Oor. 9|NZ&+oͤv"1 WIfv ag=T\tw 1qz2C-R!nyLmΔA>gcNZ((N#QSd~ܣ6pRx/^P؋sŰP*|0F2LO +P ޟ§a]NR S>˕Z˛Vd~c}>sghheR=F.^0jmT0~.FM#B,̯N31T7֢[:nʒ|2Z JEy)m]#ȞDPd /׺ߩgO*F[DICp)2eos)O\(dĆRͱέWuFVMj6E+\M %uj V0mRu*B2O%Ҵ"IFj~a8]6\2bY$TmNY ծ Ҵ'f7Zqʮ'l+i<>(O=OqCF2730M*bqᕸ>u)>=<v*Aeث޽F2zUhTufj>USߧf(SuVP?qЍxuV @d;op4~JOqxӉȏpv?ۊ"OV݅zAb+aJ䓨8% W*WۏՍ4aCƒYרd#hJ8(t8,UMI xym*3_MqV?z$"QFٽajS_,-߮M!%Z팮bӧ\^ 6 -C`yn [6IrafG*hv>8sF>A 0j ۗolMқUhn5^UsZE|> * j|$tšC)?|yJ\Tu9x6~4`pޛr!5edO\417S߶0&J «9$QJv…)`Yw=GF*'ӟf{t|*HК~Ͽ\CG銢*jnUMҿ a_ S<)Ǧ6u̯O\*#TXcAQW 7c׮hlM"89$kUGϽqUT41ScUTч~O>*('$SGb0RE(}]S~Vv<}ĸPWAIQTSc~m&0ЭY>0$> #8=T6pc;bth,  ? }tY +BML=Ddnm$j0=^X]_ )Et[|ǁZSn^8*wi1CHD| ˿C&TfњenTK8~*;xc$*+X)GC8=+DwWK( A'4lP#ƥ{e*W*/VcZ~Q@"TؕjUJUP:Sx}8iZs \wǿӔVъRPUPU_h;Eۡ[٪SzS+o ^*o1Jŷ8.;c+?V6JyOm*)Ac7Uۨ?Ju? O*&q⪊oc@ vt7ҟO0RWZc#_6T/33t6ݭSV9[%~%cHE8]*ɺ8Ҵ* ۑLI (0R1S^Wc`TAn:Ul«T,lۮZVl߯n0*W!cjbV9) M.qf(u/cU-U||0&q2қ,x(C(?͌dǮE*(Ka_Ս!~$/GR5!v&qAx|9abYCn1Ebu8 GoIch6 3~$'^M +4~4nsM׽'"r8UZ98GQnTQQ:8`U7\YX6 *j:ݱBFg~X:09DzH(ice[3O횽P-MJ;8ȿm;O}\(EV b۾(St;S#q,2hkdVAF'8z}8Ƣrp51UR'οcqBMa!FNPqUqlA^|r62Tn !Vǡp.BSn`USGbge)­ubPvT:}^)T㘧dQFͶ*p'?{ J.^7կͳFh=sB*n8a偾(ׁQ^rŠ +{eK[(Rz3|+X_$G(8U\ [*?=X%sY[©6B/\Iң+N%ă^ FNJzcPF,Nª 읫`\Ub"zJxGLlnc4W~x &b(&#Fs+W$ (*_Y?Uz'qqMG8qp&=8i 7O- Q *=gMM=+~tfd7@bƲG՗%6 27B20Gn!JE:㕩צ*MG\YnF6lhF*aC>PQ%aU:M܇qT";6@OLz- ÑiSlV^vEޘ#)U^+Vd$)W +Fܻr9G]ej)UG^@B`zfMLbFHuwlD!51YO ~~8EwRJ#p}M=@y9#&n#}$w,jܰDv)i,Ě*K!]=KKN.ar^!z1i,aA11Z/)ڇ)}uK/doȆP(X=T':ނsB+edž)PvFV+(4#jr* N 9wEXF[lǕ0,jjCȪM<,*vZ&;$ԟYm3lcrDdd .%gCS$hZW e^qۉ$ѡ܅q 7L*H29+ e~yv6Q1_(lVo_^v*K5XGQx>끛sƃq/_(:(p*v#)CVXn:hWq+qmW|U%z`CtdrN N%8U~ª* Tyez}u87SvzElNzcF? Cq_I bAXNv<_S-Ydc˾ o!Txf 6rpf`6#xͤ"0hؓP)؁Jej6b޴ ;$;YÉJh~SDa@nwD, oeEHMW<P;>%5<_R0Ѱ*tXdIG%jQ WWm6ȫC|>)*DcW4OxfHkYm=jGz3PHԒ"ק$٥^?x^ P {N 1-Z]#YHd|kdHʈgY6+p# Hx+ɘ[U^2KӌUOJZQ!Rzv`?*(SVK%i;+4X s@.\N2@jw+oȑO.\ƪ@V_ m># 'ՎH"  ִ`dH\y$j VyDT<I=z٠1HC\F:jxq2=>$*;1%}"`>HaO+&6D,"B 6?Jד 8$zd",B˽6Vy~VItYjS*$PESWGѷfA+ǫ<3BJQ J1Y`F$ iVzdbƹ1]BđȨ!I^SCAsDV$gceTՠ$@+(rӏcF4;c*$"nU?qǥkj@*v7JvTi vٗB{J"h@$|rzz2\2lAPGBYۺ\H6MO*.er>J&f}ichH'oq.W,lKj6<~vCD̅$ QkQZ}8Spܥ#F #=YsL#^EC|1,'P56rԚv5[`%X_C}}IU`(TW<m5[d'vLD@#ƻ P,[pqܬӑ!m-\Eu5o okemӘ7 "uQNm\bJ P& U1 M\[(;%hG>ٽy!?;P)-'O}5&Fbw!oD(,fwC]]nӤ+k.Vi#U[(cHMH6J̺ՕC# Sn_*;{۶KӛzH(l`\B̬*x_n%[0*g'3RXP0>KH >i$VvSNBBs#t*ڌN>o-/ VU 2ǪKoeq2iHof2Jr0| &;y eokZ4iQYi127$ݕڥZ BU8[-.9Mq"ֽp̙ GZ޵V 0WVR"PE+LH@n;sL44HÛuG4UrLR,Fl[3%HcM1RYMi`V;uspE}z谉XUI{mˆ$XSd=5'UL ʉH["#7؊j3ZS":/0~ lqi\Y='0bFmSh Jo\%z׊޾9( G ֫)*Ix,J爯AqِC)Cgk R>oʢ(ShEW9!m@/Hzn8.nS yf{2U\.iBY2|ΈDwEB _=JY0(y k/,dZzD"?PҮk:'+(J%牢g=hN䁊}045PP /̡!bBD4;F lZid錿z38S7T| *ڃ.5{d -b_@Mc} M5f @ok #eP6RIc"lr jQ24Wq[ȴ y #ҭ"ɃmU`DPT?25ŝ!ʮvPúMoHMF8כ0 W]e3rNPaf} MJh?u+#@q)A|M2Y𦚾$" b:hൃcVK\3=_JnHއKel\?U*G ^+4ٺrUzߢ>?Ea#1GdddP]|DtzXّ,6H#m4[6VzLPQ+з%}(#14BH?\jrB΢5Eq2M2EQ]LRM佋T@vc 92j'Dz(ː''\D¤)ϗ"[%՜ 9HX >e,HeiTwlHꎖ-Xϱ 6'|2IbLTmۥ[ DEZxT _~U-^\@|[6["j{ .uY%(ե66/^[ x{#^_;!PM?hƸ( nӢxA/ڧ݊iwW7hQū"h$4=nm ܲr*]qɈ( %kUL ёi#~؟O]R&.i&TROynK]81h>,Rөc GJ S4AUG]n̫H`ZqEI I*#SF[B3TaXGv~ >eGb*Ant̚'WrAE>f/`*< E-ےwKj-7o"wʤ w]TCo=Z!q3P|;/ CQQ1,lU8fPhn:feruRSu[`$dPtcJ!#soj7#qQNq.uBJ!,v?Ae;&76*{uCH4=qTJ2QGߔQ+8my!#qVHJ=)!8$w#bzc7J--ĴCn?ɔ׈QrHF)uܑ_v>&_챌l~*OU}_Ssxkux?ee9/}9pJG;夵ٶ85$q@z)CW8+UĤu 6mSg5کboٓfʎR:`Ko| ğ$6͇(O$Q| TOڎPz 5q0*6 opzUN ǍXn 5Ҕc%4S bcQEq_O|m֜(f%K_c|Bg=7boѾ,v>8hVl*U W/^LQ\T0G7-!e+*W])i_qXBXaVUdǶf W+g~8[| Ѳ(uqź8IxY=|1gPB9SUbthUg;aU_|qIu+T4[t+}Y$ 9%kጡ^ ~xrNX~[qaBDhA#\J?K%*X'?6oB7¨-N;Dm|mq4߶˯h-1(FP tWli7U,Cm* c5f*{`Vw_h>[T]?aClp>;h>!cBSRߨ:ǧO P>gqE=qኩټGXm t#{O&U5jxPUaU}Ǹ;lq؎vڽAp! }GvwR6e8(oSc}SX/@hekFхqo#c|/*rCQf9'&@v=pRQWu2Pe||X44qUioՖ«s_~i!YG\UCudޝuTeG jR?81p%VH+8Aء hAS Tlw!Ō]T`W TZ2:fx]8!\U\8~juc Y]?L*M%vm-|+6Ͷ!:aH;*`ǗCs~}7q{Uc'!A2 b|Jlz`UnBMLȟxC)2*>Jcp Pz&.rΟ|Ct1%^ƑH}_OCY6*ثb͊6*ثb͊?*6*ثb͊6*ثbɇ"ZOI1l4]Z79@zmnh5\loV.rG&kf,=WQ0‡+w+SfwV_R~fdl rεC#…Gu~g{Dz~ @Dw+_Ɵإݟkt# zm.#ف`5<⩣RZS~i#>*24ހҞى#5;⨉#YGN#አdFdz Ph…{{e~PL)]Uekf eSg&cXw`Z+qSNDsWfu(rHC|Q=_{ Y/f7t(pU 6-hY~Tw5oFې}Pa-d#6_G j(Q_VتimoECࢀI w m?_ՅT&4?[wCL}&( ϫN.Q&GbhZ ?ʵxMAm\GAQ\jz"BtVvPN0ńn½3(@uq~VjQZ##aR^F8$;bq  ;MD%D<*tXҙ| BBf؞.oEk M5ȘlrQY41ݷLO~02;iQ_Qo1?^k0֙bLc ʨwŤXZ! <)\m\-|E'%3? k,Pc/'G(zժF8;cɦ{KeUr[.ecw' \$w)HȒ\Gk DD0@$mGnӶWpm( Ә=[aVQ6Rc/qZx l4RC|$"Iتhq;Zu'Hlې3͎ /*1ᑋDal9iڎ<(pP<-@8N4E4<b5 ʨ>RS#1aۨbxG Oq ;(ɀ%=H$Hc45HVuoz㦞&EE;F*N- ]1Sq /dhq `Wo͐$Y>> VjrR6đv[CɶeilOA#dMp ߋڧy-0DW59h"Fư/OBIy~S#} )$Q"_ՁN)fm-}An =U/Zށ,MI]2a1^ݏx2oxX:J*< d&* `U6p3OqNRBhPrQ):nJ;ZH V5$ q$n56.‚xW_St,}MEnbqaX*;9'GwZ$)KoqjN6Op6;dgOJ#%tѵ/KR*z,BVԋg)..R11 "~aʋR)Qc#vf,>]x  qm_Nz|0+tߎjqV]ف*]q =+޸VQ0n#Ymȉ.ᖆO>+Ѧ#-2W5.x"Z.[W A*b(ՄoJW/.,I!dhL"-l(9&~WZVf'V*-ݣZހV7̞qB=F4Q 97sOlǮ@ `y1ِ0s@$]Nѹڵۿ ^@q9C)fJ&W׈;&xh\;L$ﺅpx#OIҫ"t됙R$-Q# $\c=kO|ockJ.RNѺ;u#z~2\5~tAoٮ 4kHI@%zOXHe Hb-%5bBW...=N۟>y,BgO}r#00d'͑; NԂ}is46n҂ń n-Ȫ CӮ+i@"DfRo'+ ϒHzuġc>V$!MJAC''lHܺԷ[;_# ʃƇ9nQ\ڸ;&S V\7r a'%o8. B9R =AJ ڣ f׸goDrQ"1 cY!Š8!I7(IR>ߵ=X()^8eX e'k# ʧoKQanƜk^@zBz*Z3hvC6G RΩ  iI7RWǏ U?L6õ}6Mg #ldIxfu ÿMՅl``I{ҹ %"Ѯ6|G1Rn(:G-zJZp,`? Z"RǛ1(QE,q jVeDk2M4"ʗKkDo^'3gj]R7m!S a˰.7vRV)ZX,B MzCZ+{{bddPIvBp(i`4m }kfA*Bc,:lMOUش &;"&~C,PB;0!O\}J^8yT DwiU@9Ү}) U!(m )l/CA\(&d_Ԑ7)DEc"QHZI,j#v,F@GE QZ$w`1*Q(n]$ %4G!}U/Fdԍiҽ񤷱yS`GRBcf04c]ؤ k%.gf%iޟǩK'b\6!eN n.T᠒="әLpT~@XiZ/D{rCq]=uYE(edpGڵ̚j]qە :*ԖjP 7iw _ݷQEpL(I tsC!)S:mi,q{sCT},I-[ԏG\/c\A̶-qj< zeFH;xȊDmz5袆|mϙwhIGA$7S!Ӏ/HFY{VY(-~/R\ynw(=>xA)߫SNp^$bH&cԟoɌjwߊ4"ْf% E{ e}(Z(Ucǭ@Hu$~{ԜV6E=p~m'mjmK3Eܷjp@TsqU!Vڬ B5^3Ya%뀙T߆*e(Sy"+\S>v]\(sGq;7J}ت(Zf5?fO UTqqUgASߊUmþ8:}تWm*Pu1V(+qkk4*zc#zq0$m:q5.@lF [h|HI_"Z;q􌒡&dz}b7K l|0*&Qhc3F튦j 䦣-UkQ pv8 kb>.t0RO  So`U²o^񬻎Pdh?~*I]rz6Bxpq5? y*m{xd^i[8HRkK:b2㚞q㍪* XӘ ?$9F p2[7"Tڴxȥ8(v=Irnju {6*0tYzKo]li*]~" 6l +Q7ţUBHC OqUSZGQ#V;ULMu˭68[>q጑Q*CA]*AN8sP|p %wu=F(h6lUH:Ɋ!y~$E:8)KܐW lmt7@j68?1P688J0pqeLU_dwfm)6'PGx`I<0%6W, xH?0%iݧ2uڇuF+=W$W~YJ}>)vZ[e;KH<%__Fq؏ *E*NXC :q(Fbo~تsTѺY%*ilyA& A#GGs&+)tǩ=kz0DWǷ,7fV$6F*|'bEM`@Y79@ єMSʟ Ue <\cEAMWUH xwU})lUURO x(OpRPv1_V60]o_[-Dfx]x9Jux 8!%|*xxR݊ei>7qWc=?5n)w"Ie5._0vmϾqR?؜]צ*glU>c㊻zn<3C^Uk cȮѱU3UمF88oLUiC˯fU{_ÏU#p HLUwroe«r56|ED:K#J: {h2d^- 1ѧݠ8ZD ăb 4MQF=Y?-4"{fA^Ҭ9J)цC95<0hH;FI3U8ol(U"Z_Ze 늫*]]Z,UhC8L=J9w-8-4]j1U*|L>d3~rP (GWoWYă%m<5W>1۠'uj:bH #0URHndJPqݽ;Vol׶FI6麪V ӸBy!RW"$C) V^1UPr^m)@;RbL][ƻ-dtc (C{sbƺWqU#r{G˧!zU)HU A>l C&mJm~/q«Nu>V^9_hLzHW[,*+~/eCŰ*^CmrQ6)KoC;v?< yb֤2Q?lU| 8]Op5+|(FCwؐ9 k!Sr8ql6:Sq|U=WqWsAʧ-aVnWTqBQONٍ)QR9L~8r2b.{(1Kz- 8if;U>M:xbx8UWQ@C|UN3L C߾)Yȡ۵pmM:+_c_JNچA).'v+`k&n~X;N⿋׋jlN|ѦqHDI~-Pi?ݱlgq ouRt5l='«9.G {*1U_O>i;J{k(8zt­J̡#ffA'j\| 6I)eE"=i;v{W3؄ɩq8.(Ou$@ A#s%#edvgS97edxP(v'~X;/J 5XFoɑ9aQ YAcvPx偫]/o,NiPNcMR Z5n9-[lI$JV6mXNC h`5V6l2JĴVҮeQFQe eLUq)3E9F Ql7Ysf^].m^w>Mb#MCAt!^+(%6͡yg5iҸ͎N@8jYGvͧLڅg?Te8FEKh) nm)*T|"VH舧 Qk4r;@W 4%zZKPo$G=ʿd7o@|%aa?;ᦀn$f= d'E %*)֘S#r46r5s[>6;Pv-c0O7~"8Uu 4@ᥙjhթzX.=`lG|"B)Old"~(F(w'i2<2[$EQ dzG_`Z&*V-p}EFz>_maqܩ[fZNsxKJ Uz%ɞJ*\H$.93loeEO2;;w;ɢLUo(cLdPc&&$QVK~; :rbJ'ճݷMT "ۢU㹗Эv|2'{kvŋS^YQEJ(=+Q\Rţ,kL,I$nT$h}YP(WbsUj"a49NZk{I(ҵWT õ2TT63q& |΢f`cn@[*:>cO А+#1[F=Է*HC=}@kݱSPleʀ4X#%}F(F~,~0024 @k`;!{uRZU $VyRVA h]%K,ISO dkUfB:'5܍a%ĭ CM<=wխIޫңB$AW-'b9-(]PT5AÉȂR)^<4B/T^Očq-S}J kb(;EUC4l DVNPk(Qe#lq}PQo3G]\UlImuo~j}^*?o ]|I僸 8ЩPO7*hD5N?Pc!u)*+ jɩ $9*J&yGY- Փ5۔M(FIpQ4GmV=|qB*@?ӉI VGlR\m8냖!'Ɲ{BQ%у3ǥkӿkus'`4x=|JZISLcqEn.ᑼ?2MsaJ9+GI|os#* $u1iW"ŲB|_|/ۏv_ȑRDJݴ)|%GV>>~]HPvH>)q1JTЭ]n*G!!*m@|0Zp=rhM(k+8툉BZZ\JIiiP^q rp_2ɝ*N$Ѓʟ _&E *F9צ!a$71Ɲwtz|T) /P5waZ}eU {R#XXm^0hH25[)x}:z[ު[l%dI߫vhJMZ}54phlc CnfP*G|mZXFhX2?AiBj*nV5H&*7қֿmb9}H%i% zd3SZ oWGQʹE;<$RH#!c٘miCq/$yz*ZuuU\lت'|di7O̚DU,%NkRӮT`1t:O#қ %eF4_c+>L ݊k1NO߄bn=?DHVcS<`ou "MvWp 6SQhq* I40Fڀ5-pĮ?6mfA.4TugA( 1dz HmQFV ^+чG!U?sj?UJחHA]hƧbVH@=T3r͈H6-2aIM{qw U͈ZsgG~%=l\eiZ]<l>xB9iVrǥnzs+V (O]!+(T7XYϊFx\Uz䄏D$ZMBxr?wR}Fi%`~KПBu Nrz*NU["a"$c-FXTB w±pW@-E*P7?\Lތ>)vo#vV"7}IZrڸe O(ScN[bc|4,ܖUKJ Ncڽ5#hSȊ 4]q`DoL,UeVo'>Fܨ5]E(Dmn>LVu?hIBj:u iok n&KQo" T={ }6OrgP8(F54W$fjoYWIaF!FporyP6_, 2b.h .m1ޅ.m$n,ɭR\\HANO_-{sh0Z dqpL$7>8;BՖ8&>DnOgʐ׭X}biڟLe8uhpfx =?"9*J.DF[zIVY l^8enݦnH^1 GC&}̜ьe&%tw%~ZVUV?HJ&ՉRzo,&7;yl&.j҄ 5j9&r"R5톖Ú|vcVcdvkCxSm<EZ a>.ImMEhd ֽ?W m|3'E3eI*mf]20[ z75e(>*vonHR-A>ZfSB0[-횺R,:ʒH=K}FE.RhH{IV=m!5ʒ"%|7Oe6_q-H#FL̅EA8K Ë~n>W ;`b=E\zIMLUcSŃ,P6;B6?~USnN D z9zaU &* j:" s')(;8Lh8:DI6YktKiׄݔkXJЫ$ЏqbRb>GӉۦum7%$|%xeSUȪ!tŖ@Bh]U fWYE㊣UA(vq6;(RxaQ@9rq %l7F#OjS^cUo$1չt(QCnJ}ua)4"AqB0E޻`ۋ`7SJ50ƫ8U7\^9JP% ټp\v.kA+IZMvC#pݔF)O 1u8Ң~$oYqo *e ~y[G+J*SnT6b2TQ`OPIhO-8B4n9U+w]IGqaU۾kCMf䷮QQ]n:3Bv*!&^/|G\ 0fm0ۧ\Ρ8ȧ;US!1@io늩SG홢u+i?|D\ W chTbfŠ 6a-(X`FmimDD :W&wwJvàƓicmn/,}c5H9!OPVoNo/%+@y'pzBJct#Q1b r(jr!xbo2f&M)VU4x.#JR>x8GF\Ue6YaM(JФGE CkXޒIr~Xɂzx-)#iSPPqVQQtibmt{I~&w܏逈އ!3SFeVW 뗺 5e[W#l'cuǚ6 ]׷lId$tZhy'\Mz^]I|n6b'%v ۴-Sc{zTkKo%Vdh\ACrۇoq{FTn0M&xc#Q*Sq\p`zVxR%S,wqBEv=2v8Uk ;ft*䒙Jv=1V%qbFzOUqQ,ojZo+C;r[X.ϸǫUJVPApx/Mqc>H)P b͊6*ثb͊6*ث*6*ثb͊6*ثbo幥&-Ֆtzm!ƽF(GLJ+%~X#+/LUtR :zwP7N28CU1'uȲDcfd/LPrs$V7hS=3^YSQ?\ -)#,-aP5#+[#N2aO XceUXzؒ9V)V(qq0K扣ju?࿷/q׮;b(>$p,BQ:`UH&0QDA)]*›xlzb2u6!5,=*(eD?J.5I'moQk9KzCj3_c6{.Oڧ )GCCb}&Ty.ت%Jt>PÚ}#md1J_crT1%UkB[}wZ2AD,vB16nYon6nJ-(HDВ}cRXIhOCj.(+^Ru$"䊛O U_Qt1xb5$u镱Я7&N;v(t߾, zd*WcZ8z5=b;{ſV G_6n]tmױ qU ~I\Urzt\ctYH;U(:f_<5XAӨCep*hG婧ۏבCL%؏[]pMָ.43  olL#&|=DiZ%}=L G-\*㕃6)Ȇ37njLLW E\ǭcX95CbLMN* _z%(8L;*H5;6 Kzep8%+]OUH7^Z'גB@ vٷbUj-/i6=qU]TӶ*H50(G䥋D+S4 C*FͶF)485G[kҕ>#pR( Pt#?K!<{ QjnKI;\Je;@q۪|(x^/Ќn)l]qFZF 6nB>7@0!~CQ'}ɻتƃ2˹MP 0uolcLV5<|,I-@u,BAO,KSS}_6˿LԢnՇZ_" kZdb); *61k;ln w ׋qK%Vtz< 8o$t r H۸/uyEI,6ky= 7fŕ@q)rq1(_jm?T$D (vtHU"J]Za8V8A6W1}oW*z` >9c;j}4փ҉SGQ;ЖEgbFplw<AM4c5Ho>x2ANsnрM;x6Fw1-tn%U ܎d8w`|p&hT>b*n*%&9&DoTI|E7 Ghw!v1jZs%W2Z kIQE|}j7'Y`'k^~2Mq`y7E 5X5KYtCI&",iop_HbMSP>Y1,7OzƣhRA,NJ05qAjq1 6.xĜ^Ey&T]A3F*zY Y܂ȼw0*o f׮TSi6??Ԧ*f!Oъ& 1 QQUdĥYd#n8Sb)8n.1V^Wf٩(ShԦZon)\_' aDWRY&Ҙb9FM^/ib{c@i{ք{P7N$!仚8MG푥io((w_ iUl79 O[8C ]ǹ|AK }K6ÀS/#AH mn- J !*;AnY5,O c+]$I q9L&̓^]gfYUӦЧW+H;'4@e vq\\N \ D\Fv^OIyt_ro>G+M|adRTd]Oc`]S"ݞq-ų`eVdWKGL#bIU$q R2IL4䂤u.?P#H ؄&t!$?#sn Os wDw5품淆9T%^BS 7wc5*Hذb6֞Q+p2 Q۪ȷu]EV(юA EIz)ǪƄmBrPtԲ!Fj T(Ekp"k/9+zQBG?lmڛUVSi"Y2A`ۤU 8kʆ}2%l&ݢ:Wq,f@EH0n-F.㠛ǽ ,"d$460J\Gk!؆ڥk³DP9`:rFl;bh}'qO$h^ȧ5ڇj eIնjF; {ض k;až$`=r!ENeOJB\_x|,ԓXȌC[/'I%eH48XfLK]^.R"P=%j]cr-M6=V)ow+COmimX*eĊT}6$ u-*;I\>x3JӢIC#tGqee%'յcu\H`::U1r&o_M"@U~8泵K Ҥ@hʶOq=5V {ۈ4n'!46#+@)-/lU\25;XC0HzDR(Y(RvWnet2j{"Qޑ!>b%Jo݁ѿre-6ڽa>R-ۍ>%MvTO?V tE9&]zs\)([ZEKI .X ;'(;5n ҭ$zc#Vqvb\ۖZe[̚uuֆ H줓Ёv1Ǽ\(Li ܏p2IqTF6_rRmYXAsjd~g:8RR^?#%=˒9M:S(hK*ܽ`HV+4uh _|%HBí0V߫K'9$<Ӷ7NYE~[q#@uY`O|W@ܕ\1=}L&.\}*eC^Ў &nh񒥹_fLc좎`I 8ZQGL:Bg#!cy}7nLa޲kk]@B%kgRMFstGDԌc#eUx> ھvŴ+Xlq 5ٮgvBХV3,n8mEO$eB,{{o%ڑexSsۦ!fȽ8o Q!APzʫa B@ȿS{`8v,kѥf7!E)Ƕ- !i TZHAZZ?d.5 $E}CիLyV3`Q!=5c$f v2#*]qzDeM մӥ ՅA&6~5,PҘO c ff)oAG w"O ԡSaK9e:gՈX5gfBh?9zVwl8q,N~*׶(ʲƕM$h r1-fYlwUbf&*۶5Z^TujlUC_q ٰ*A]\$<_ ֟ MF͊(w_05>@ |FXoCEw=1hm$Mj8-(kBj?F IVj}^-v bnL8/E`jW熕9j]_lchdahUnԁ*~U!I;lA;)^|0r$፯c]N1ޫ*QcRBcȼ[6ϒAK䷒O? uJ/XQe^Q7㞄Q_ >`g>$b8(q~*dJT:' n^͊Uqe ^PvoU%q܊ۏ $)UWm QaQGNX16v@xR$ЎaI)9)*qy#Kd="E&АM5D!~ҏckN~vӔ{Bcz9e<`Cq㊷|/wSWh:iU$wǀxqU6c 5xg57UQ%1<|EWuXUlr<[8گxZӯ*8N3*6;cJ ؝Jlx*6]?OI E+Mҿ UXz{DWAIHٺx䒥$K,>(CK-~ :e-vT淧:vŔ>,_OdYEW> DFꇡT THId[bDzJL5Μ}kC;/إ=mE)? x~#,nlSq ZA^<1]^[^F*P /O!Z%N>9ClR%qޫ~܉aT?9XHh aU6Fx$6VMa(YGz"6*̧N닰ۧ% \vĊ(F*%| s:aKmg>8꬝vl tę(p*HW+]UUo;VaQYhI> 䇯oRQEYyNR. QG[=ͣcQ:WuIFة)zxB-d*6xcA(hqVʫVR+bPc lqj1Vw WcWيo_scܝ pz•Lk!*%}]J Hq*Q1Jƕ)Y~40iWߺkIkq6߿jh?f[{uiƖږ> ⇢ {&<8B[' Z 0w1hFG|c%O)URNx{ApRQP]ѾOnܔЌU׶1G)mMToݩ0aT\2G:$LrI\Ulx]~\AӖPiQAU5WcUb8mPOBHi?w?N,n-,!LҎ`1Tu*-=7 /AL,Kk@?qAfh^Udۡ qC G\Z{*ҵ}bDtUTrz@oc-O4~op`U7]}YL}mX6۶UH]txoW+Ӯ>KPPѷU=TotJ%%O#*F};|mP%z:DlltټIa (ۧ|\0cxbVFq&$mO7UF,1p+Ee2늹e#f_UMnBB1V¸U˱ۮ0 @ &C9nL߸†ʚ⚿ uT像L }W Q׋F*#!iU=qvƓ9$UD ge>P*yc| FF %Z&U%MՇQb"0#+\܎7+ײd DG:تcT:1̠}늮hmnjUH e#tsצC249xiW_GCsٶa~UmxOU9{0[]zec)us -{{k▣~;N*GNEmپy%YR68dWq#6(;!JH**>Pzl;Kǯ)VNqUěQR>xp~Cd7* i|Olm!6oT\b켳1su1Bg'GxiG̿ eE^:m?cU" )ffB@%q3*^lHqe*NPQF1+VfI)q Vx|cMc3Dk uPh_ny/}lCrc2iұ ˸ƴCz"6Oű(hB1Hn)=RvXhÑ4ŤmFHʊHM`ܶ8E';1]N[fÖW^#źyM1Lw',ݙO4rJnv ,D.+n^@J"yH-֥G\, 3J) _Y ( zc$J*llXI%z1ڟ,mIy2J|m6N֧]prKʼnIv;fO #]8]A4/H2Cq0h ?. )GnL2_ r\O gj}/nY× hB~e LAn&іoQcF  ,c'6ݴč4O>}X61NnvDHat'Ӊw)#,Tr&LV"Xs,đb#vG3,Z#}ʼ^#b8@v ӖuM!A]|2T`>$p||q݊ rڻel;^$kH%J^=KxڑJ=9 e%eDzzLX{ ?q:UXt%[ҕseߩww hi咡ոB$r ,O+e8>މmm ?-BԚh4jN߆pWXb#=z需VX  \ox-uf6c"d8meEd56bIf$w\a-lUS>wɈ0%6vvKHMJ͕)-O#|tq)QOX¡luMRDoHARoSR wF6w3H.IpJ<ǬL y =)bA.7f,Vb22׎Z)"zr((q(yy=2>x->\즪?gM3X&ӆ?-єcױQR7\ Fe~! m-BrهEU7|a5]qJW^߾(pnݿϦm}T#O~Dbxm2ק_׊كoe.^$Z-?ᒵe~T֏j9+U֚W@x6#>"P B\背LjkM<4zG0ay:Ezr$+1ciY!V{žzs+ACiӮM{orw OxKo"Kf FSI]"W'xy3]%HiǕ)±)`ğ :ăʃNMF][m ?wko85kRY7$ Oo׆< |C9QMc Dr(ilze ۶]mE"#OՇ:xR JE:0c7dXY.V54<e4;wT MF: jfxQ|*HiQ*<[sw8MՕEq7dTY/|H1Tiu^ %R +6d#ulzx}n3 "cV2G~8XH+#,Ȼ3+/[fA?;xd 35L{PS׷Ap;J@%]\*Th177qhcv>UR}H}hXcqW#э'jN\*VV+%|8 mvjƸ#h/0j "o"zㅖi$uxȴxg[=0|O924nKW=&j2yRNk*>*?qͧIb2+rS+}R-> xrO᎑u11 w+EZZIkP`}RƲ/}uMF둈Fp0s#ƑR|.V_ K80 I *r= 8 h$XݰY\.f[~*Eq5/BOMK`;a'p;1AR 1B}| (Fc-%p teۨڮBcH?" HO;S"ūC!DD@E @h7FH(HvsۖJ]sC-1Ubr[v%? ?&uP9oU-x?IYcjAg]/*IܡIA!#c_z`Y,Rf(9aH+hJ0yPLZs<+C' !/RNޢ݂ml-.H^qlĒA,M7)sj9nKq(('+QUw(L= Z-ո('\vhq-Rۺ-*#rQۦfYO٩ĺ\d3 XTn=Z@ !A_*AIJJd O˱ ˍզk~1^d@|I?JE! :3hpHܪ I"R hY̊T~-,3Gl 9M4qb+$nꤷ\5$w8_j5LVh6Gb*&F]MzSTd.@R^`2Liq((z|?!級&' X |;c%ceН'fe=բF, >Ĭ3ZЃԓֹd٫ZRA邭Nm"4\o伂ˋeo>X#s~C;߶W1$\jpӚDiFq~}(ZňZGm,Y쥊Ӂ~$wn%ÉJ  h+ꯤC҇ݚE2)bJllV-B5"{­/JK%Z+HI5> 2WP%V"ml ۓ2纆̳΃Hޟ<-ͧZY72;Q>(@2PԞ5+.,"Iu#!֛Qfk~+҃1G<̀)7xJ}95F_TQcjmRe-L:[gaɩN m%]XTC#6-;Ѐ Jus P?NKbvLcɈۧ0Og)ƯZH eSҒHZ>@oUQڣdŕKqp[pI(G= mSU yG/] ƹ0J+h%l%&}F5ZvT#HLݿܶqQ@[ TWo AkߕQqWGT6r0 (wz:^Vi ybٵu5WNVѕ| 6HTv^ڢ5\āa=qS\3pQN":foZaɀ{Iv.MU90YOt&J `6ZtPO|ss*:MHh.-,庑>J1f~aSu} c̒J~tO';0&ˤhlq~$u>8# W6ۗ@mROdxs畮Ė0ĴO@QiVOqO|QnzHKE "o|Q]!fIؔzkǾOH!q3 & P} HDIu}9'! -կ@:e H'K=#'@>8*jOr FBQ1#^iH^n|Nu8c؆TՉG{:d@/+mpZ @HUX!Mח,YwPwDeK *};WZ\O"zu%"NMI&֭ck;@3PR=:k H@_gfaHY`,D퍕ާT5]b˜$Pj+Ma>W=G xxH]MY2|a G#}(1]l}YOByGӸ#*\ 67NUc&ǯ&tª\xF' i'](*PqUVabY?bN~QT Nac ZKnkY=4nRQ\q~s/n-H!=~'6< Ȼ$/ ?gX2eߒBF~qdȥYnQ;ѺUXۜ{b{Tɺm&+鈐TJ#qCp\d>e)P 6oLMR#L~2l8k`ۮFrFmZD0 )}!& x Icv8W۱U@YiwAm+Qኩx˳a[Wxߡ툲5DkȮǦ MQ_qI6a -?z$ccKiwF2Z|2VCO[=7CCm}(+*)A %> Ipq2OQNkЃ;z!pP|oŅ/S䧾!$=z_R)KK^8 l|1U+e5xaTMOqT7 DcXU;UJƵ1,v*!&4=e#˷/SIcTW]vŊz}8;7_R;d(w㍪)H>mjM2BvZht늫F];bUpE;G~ˏ#IB}Z[Rrn18l[o W2&㡮{7=$Yv?k$b{_xu2v*$d*"9 q"Ȫ0mlr^ *W@VFx)SCUmWq ^iRJ>q+ qZ<;bR'nc =b[*<1>UcaLy x:,HW Z>__H8 zzo2;Îp-}*9t>kR>$Fzahꣶ*։.;xM0>«B=l8OlQe╏TfhW$8-p*ߍW)8lx&99+BHn6aa^BzƸsd/Tt%]Y,UhyF>=WaVji6^/[ֻU4Wc+]lHmWZt]=\U7@zvlTPAS㍡^1U hMߔ*:`JdjgX'<P+_ xrnujɬ[ɨElOS;׿^ȧ->,Ffy"Ios"R+UAF$CckHQh{im2+Ud;U~)(wy$!ee2/\FHC|% & CGȪ-Y&|7[fh|*Su,>&2~ `8#á®VbczgC|5n)Tw(X39\uѴ&Y׶'aRWGjz}YB~mİ ܷGH1N4:R OV;?1ܩצG(7^h0v;Q^UI1uHhLϷ>9ob# DoEv>v B8f늪GĻ!u ㊯ -^6늹!v<(R*ƚy[V[a&+Eٽ9?B";֦z*=dOqV<M3D**x㈟bCl£lq7\UeJ2*885>XiJ=0HdVMW)qtٱA}ت 5~}h~VV?#늮+x8Gz~vrDuIw9.;#͊6*ثb͊6*ثb*6*ثb͊6*ثbɇ%ēpKu+O:D9xDlqJ!7Ŀv-CE􌦬{u\ 66;־0xknIXJ=96qS c?._8P$fTu8Sfٱi:xaZݿ~7V.Frx*۵KnzӝqOӊ][#&=UCNk=;r-~xS„iC،FX>% _{cQuW|q{`#yk|ZwZ+0SGmĀéͨ0_3ވmV^fF4HS`)y#pO(7B4 bOJ,d_21JvUģfLqF->+U8|?h\PQ翆bPnߌ5߰lj}*`:N&W{BEq0Z3UJ˜Quuf7N2إ$OLUS6=*PwVA˽ ={}o~xIw ̿E}pڦ2EULs%~x\nJ[_$A(fxn1KQǯLj6=qU쀊늂L(PtZqwp?~7Ľ;URf#U=_1~v! )TVF_6D~E%>$FxҽQ(zUۦds̾£qPj"CޘP.ԌwVA{bzo|U^Yv):\.v”Pb!y.3]⮊ntF$VID+Olæ*[lUz>XnBj1Vآ-)2XTvE{U#Nf`UAVv=b̏V vŸ Wc \h[& 1AZL²iiMNa<-5pS_UcѝP*q=eKx{mQTrׇq;5ƧAd=Q|c e-ƴ,zxe+_[FyHkދL/:=ktshj9gh[zm&;zdq6ƒc['P鷪ŝv2<=ee"x`Ӧ&xƟ0=JFpv hIANH(dV1Uܿj{bP<\)(I8MM-ѩS=2ԕ- pdR40^75)m!nbuu2w tkhI2 ęsh$yRE@#2ƨn  ևLٔAWiQ.E FR"[1xytӊBU~$e"GcfZfrh'eS*mxb 4U4 "$M19:](0[4a;eaYe#I- hOja*ʞ,MSe][zl]H`f>v4 -@Ja4 &UHclENGӕZm\G6X풀FD+zk@F/}Yv *Ol /#砡`E#kXoXxkv-Ӆb2HyhQN1yGM zL𻨨^.fV^kfF<[#]-k`;ˈ7Út'[bonV(Q\]Eh+px TR#,c# )F:W# >>}8v?ߑyuu9~c4wՈ*̛ǔM:ny+ƲPL+;6Cjᔒv?A[xn˦͊VN1d(vxă}AYV lSx7߅URj|C"TQ Dw f) lP)rl?VXP}k╕*q0O)8oq&t7]N?k`?elVubgB6.#~Yj +5݇oqY CjM{hYSC_>*N5]Uq婬h+O+NYcqj'qRĨ[=ݑ(Eޭ8:GLKy='m~b~݆H?6Ջu; R4YHxjdEr|7lreMRԂ !ѥkmȗ*\\k %`?gqҁKtE[`Zzw'iIqRs٘ i6w1M_A6r<#e>.4vIxN!цeWP+]:q\yYH V-{t3 R%'MNI7*W_r*V*"q=Qm I "T TӴ T(`:t&`KfT7=|1B'TӍ0˥7k`y0IUH5R//rH@K(yOpww!J5dS.HµQ0KDd+ E)(CA@w#vtWpI;R+Lqq0!1%UY n}tW+u҄x~|MQQ,u.X" uF=SI4U|wHID %x`).ei%(GQۖX@W` PW F (a^\(r@YneyCק%5U@kJdDNꈷٙIl,`ulA KI]Wgu<H;t,rI(GqTKʍF6yH(6n\ 4Ub>)  >f.FXc YrfHFReRyTޤn1gө5妎d@V#^}&%,`@恊XZ/U,pK+/>h-,Rc^Y뒭EZ"(TM)=IXrjuUND6TQH `GQZ.2)E#J;SܜVbU (vۯTУ1&RsbMeE '.TG[? 5#Jul(-E>p A1pSĆ$p8۫a,S+IQ=miаa^# ȝS]bBZۉiZՏkoMf_-egv$w7V &c5l0ѧB=Er!BO\ر!$׭Ց^BEM/&&vH ը\tya249(i,DZR\| {^m? ;Yd6&ƋuPR(2QY&Hq$7VW̟g` luKYۣPvwJ z ŽiIYkd/N7jTr|u SI7ICn9Wᇧ?l2͑rV rz} UΚ\Ԇ7@LA*Q\}f#m_3X8@O|HazlfX`KSvcqff%8& k;o >#Y%5Y=US]؝+ x4dGj~ʁۗXۤ]O0MRf6&ﵛLS @v; uٓR q CrV%7\jISGfQ _H8>]Owood;wapFU8,monՏPƣӽ0h_Q5b5йM0<7WvoA 4 %u˯O'(T']w̙\Eߤ"|1ڑdS+i wzBTe2OK?OZ[YIGՀH[Z}By ?N V꾘:?;7LND]z Tfn ZK 1vٖȬէ*kCZ|8igGjY3kYVBy(V1GV}=.F'Ao,kO5yZj:Ka|lh &FԁE:k1^--(v޸Xc~W` /.Hؕe"PmPaXvGrt=wm$rNvi(9 zWBYh6''uG #@ڝpeKeYiLrkYH-Q0Km[%Z658٣~B#嬌bAa\IwzxērOICsɉ O.Yǿ5ub ͌jW`~|ȅdfcZ c2Ѡ[Q#Pp}䭍#%1{{e~Đ8>S SOzxb--(9b2[ +Z<\[RGMv9M~%®r>㈑CD|[r犏íp*Y"^nGՉ>xa辬!SٺmRgs9~}c~+t zwOS@`{}b|lvVpY|F n8F(yO L~Jte*](~8ўQ4|]|pt2:w\n$jFvpާZa;]㋁gU˦!&56|5Om AMkCV ]$eO h|F5]tr4 8UT0#?!_9]4=,DuWpOCvZ HPsqڇ%jv?H*:ढ-LgZ&Lm)ʏ \F-v=1B!qqJUw_ M6)UUFh2 F,?3|H{+nc/ߌ*zU)T|1मuS\zGlE)U>$=THqlKJ:87eKlZЎ nŵI\Il8Px?nrPЏ(xʿ IVAŷU $~t+ `>=2)ECpWlB:(m-XU;ⅮËB(zT+$qI !"YrnW=xc\*1L#Pƹ2:98_xa')b8^GY(B4o WcҨu4|FHJK9 70%y^'l«:8F|1U&#uָ&+ S!6V\W̿kN*&Gڷm\/(F;bօy rCAUcJ /'}l~XY$(v9Aj68;P⟵b}j!W$l]eY6ph x4nPlF'$E7]Uui>&OMT@se=mRۃXD$;T,"oLaB+ g\ ZTx?t[ ߇рJRI)x&)צ*ߞbܯsvW2Ik3JtWWW{ښᗡ`Jik1_Tvdj/x7?~GoqĆ}UJǸJubrթZd*zxaUB%ٳU5]eKPY 0H^P7_ UT2\l 7<UqU"~7M *uxZQD$˸82+qFPSڴgw0ϸGl(X_=BH-p%.ecqUG]A+d=;zCQaU猛/݊ۃ:DxPW".Px@4M\,e=gA_^042ثb͊6*ثb͊6**6*ثb͊6*ثbw0bi~"_v:GA䝡VnF*w퉊oU#튤Td:8)*ʮ=LWcN{a/Ļ7c) )2,8c!MjG$ѕ`J%e 71tWr1AGM gz`=9+}=vڊ. i.H>(: ;[OFůha"V!mYPrTW;HZ=gr<ߧr_ni凜QOU%HjI/9;H&Gx|2qbq1_ӦIxևCt<{ LT|0*qo!)G`m\˸0*ԍfNmĩt?)VI:e qnжH YZ tp֣m2q5rhz $)D3}58咕Ŷ;E}7S?ݜx|) 'NǮ(M %*aBH8b $\P TA(|=|p!Ui >n[J^Fp rVOxHH05bqPXj:LUV J1aF%CLBHQ1O˯\m+*SǮ5w^g%nD/.TH9/\U  *' 0v=A WK['GZ){b~͸GL귛H6V~n1T(qF2HCK O-i$UO\LѼ0*j|?cHo zՁ*t[W ߪ⫫_(1U)"oWaBcAQWƎ*_ #)ZV6z^=&Q Zc gn Q29q4T9:Dhk3hM/|ΙA;jjZV}:%A9$v0:_ዷUm0M;P˜E)w(FvS5N5K, _GH#6,MzӋqeY}U2mONᣧj|["DeϢ $P 0r2{e!i%D9Vx1X$#orPRM1Bf&2bq j04`pa~N,qVg=B!-hĔ He2ٿ%;cFK'$duUO/LDA3 0Ȃ Q2("¨팤 -Sg%slrB%| = P evSq)<YkUdOS25\?K9Al*}%ibQ%kkln!SB^UuW$6- IVq;k¢❇HaQB*(A6DJ+JS8rT"s6F7@2r'eK^*:P0푭8z((浮#uc%BYkZcQf2p LP'8^1-^ؙ/MV[kf)•^bAS׸l`U(}8E;bъqU>QZeK(\8\p)Lvkn_ބ.hU =Y+.0/-j!jkA$Z,+w^I/H2mN8b Xzjk]e+2"2GFGv)ӥ{ke>$i;8j0cvd&ahgjP eyFc Ákk;tQj?N^x* Lku#f qoxC~ZFe[[eQ{7qK454* .]{{VnAOj*[{WOO@q QKhw+|t>S*>(>Ǔ$-.b@c㻅܏Z߫!ugCiY]%,Fh. ND$&Ӭf"n ӥM)8'wb[V0fz$tF47hޔrٖiq be1Fa{N$tk "/M!^*<0<@!ʅ9})-CQDY6 J@& y/d{hІؐ3Gz}2`m漰\Ë ytDL9S%vavT|/&'҅JO;> 27EX/3)/kx{)"ydgPfmQbdh`B8aXH,bŇN 턶yRK0Lg4g+QZ̬mUwzwKEpnʹ {`"dSU_NڵR"qc4f,7GqlHy6 D,Ճ"u&2ˈY,dWďX>qrfExq]r$Mzl^i;zVg7JV:/1Ҧ;)_ukyIpOS{h7272n ( 4Vm4^!VHu qj%])ݭ$Y>/INr/5m9fxGow  ]yv)3)P>/e366 :5q8#) za5q\([IfH6Jʣ5 vǶFy$b>ڡ )q(1k{K{%@[sS(%ez -Z++"-:aTeyD8ot"3"xi]XR#Bk ~Pʾul(Wli6$kN4tRoRr71RKòvauDHzw*7~H5'$j/ɷe|koYu>圅[7x)ŀ-axUxxҘQ\Dc~#Zx z`Kti$MZ0 $ {d$b(Tm5jMgj΃o%pV@c]6kr-K4U] AT~|kԓmsan 0N;4Ckk9#\j\AۼC([tbv@MKo@Ǜ4c@7_XYm?YՔWO:- xenˆhIu9#!ΐݴvDϋru6jxaB1p%wBQ퇌RmźZTDO| ON2 % VL+jTol d6Z lUleԞe Hݔ^ǩSk\yչS}ھ@vʪ„Ocu '[@]|J7F }2#[" x10^ij[Ě|#\Ȫۃ]OHa)ڃ9T́%'U[bjNG6V:{jNavD0jXZ%Nqm,j!ױP:a,ՖE*`A|լ퀝D%U$~OLjm'B W'{%ڤ'1M-۩*)_XdHt?`7=`A`oo;Gv=Pb 8lr8v` ŴW)dK_ٖT0W]N;C0&"g5:]w dҧլ[VՀ_?kW p@Vorwz n.V܇)NUݩF&Z5k(7-pmnL3Pw(Úg/>'`Ctrhof_RsjOevvITZN v\WHe)iBdHH*zo3,JԦUmu^^]ޔ"1l(L-f[OY#Em9Ց$er z}jx@otR><Ղ9Eb "Xm[՛#i : #~6q,9U^2\raM+Qك1Ο "k0cNQJ8I*4!aICk$~EnaܷEnMl0) < UW~ A*[nf˄騞̔y?u # &W$zVyZ>ϪUq/ow :S&&K7mde+OԽ*bC^dㄚ꒒+ѥn KNx#fAQ҂"e.=<:Va{tQ`̋D]~\ )vswk61,146K~19(d+Pk~h> H(W3oCՍ)gI^ߥ8ȅ- iiq'8Z>ҝ?7]ǎ)O.(è9Q\SgԶ|($}F~OlAkQQȓ Jn|1U/=b*|p*$NbZK#qKouZ';5(`ӭ%ȻV5@^*PB[,)ӗS*y@'O; ƲM*ڀXJ}Fp%ʓ0J0qxx Vj{Jmd潉~x6xU@OUbe t|0%Y]e/Q[ZFٿIin.)ʝV-Ljaap.e{rH?V4M^eZEKk# {RL-VABp?늢x^'VIqL?Ļ6(AH?^ؠ`zª,5, (4<(?.; aF2"=I[pGq+lU[g卾$$Đx 2bwkpj7/(h]8=SS N#RqjENe G* pqCO8iV\X1RGt^rp+WFG0~fS߾*)U➿ ixQ+p]n1s^˱߶,U7O ) z:ªvXgSG˯ߊ,:oOlm ;{Uuw_o|U5[E~$5q$%ٻEټ1Uu<[_N⪥k.槆4VvRWk*RDZ=GcISK?N;I;4Tk GpyEo6UN-x4W=qFErCcoNPN#52w)UNͷ47s(8(z<t)1Udzl~P1|0B(BȤ*H{ +p\x.p%h?gî%R6lU_nePq^b'݊e9eiv8Pe>7)m 1Y@2* f?fHJR0qSPo \Z9i-~ai}6enF`Lr&"nk9e,U?U mqm~兆ijc݅]JSq04b**}ءELqv8hӋ w)7*+B_q*¼8a1O r^8DnqJtI7fV;W!dlp4Ud(\QЪv)R1Ho4C;# wd5q8jރ)I|Q7/JܽIQ zQ ͊C lU9"kEKqgLJnHݰKTzGq;^RDqx/_ * yY~H{~8T児קѱ;bA CFZ M8we1:b("qqٺaB֣ >7ViE<⁃aU5Bdi UQՃlv>%Qxn:xd邓jܕ=i&UYIZ+ݏӊ/wT{mH_U݉Mn(U*hv"+QN. GCҘ?֊Rr@6qiֲ@w1?X{w<%#00}Kv:q"(wT@~}#,7f\S3Z w[RTz ⫀1@|1P~%:UjlqT {BۑVcAYӧ^čWc(U;}ߊєn<2y-_ԏo~頂 S^#z+4]#F"K#px8|(E!IK#;klUpE7u)|+Wto^Rٺu]@ێҔb0]2קZW݊T7]Bĝ_UV#c*(?ڿ;QkrW}e :tI3b͊6*ثb͊6*ث*6*ثb͊6*ثbɇrLYÚ[ ´I9n:[IaV+UW)#2=5늤-Qx|Q3b=*x7=x`?0ħ~A_++˯\UMԯ)Fr9ڿAĘdUo׎F~UNH<ӯq+SoBHnnUc 0\4=8fQ,SxB`GC<~)EG.8);+lcz~{T.yGAݒ:btOP~$N,%;#ˁ/hA|U!'ݎ?T<|Lf"]\T$*wE VYVL*Sc1VTq=2KbO|i5^* |{p'kaV^{cTtUXZޚI Uݚ`ǨpxҠN~0Md1(fb *1U%E24+o(w>%luͳ0QV r>?H^ak"vqs9>WE(T@*z 8-Y̭>&s@zMy37y8  U 鞁N! -7P(Ği9a{Ɣ CFRrˡk; j$kyYCSb?{G7b8$oʜ|2)oƇ{Uf>;w儷ު*Ÿdx ;I 6q]Tp>_,  )cZ>@SG ߪ;O))>`YZHj)"aQ p",qiLn=k2bUɿB&IVEm|N/dn*'3znBUQ&R-c Q\Gekqhjs/IV{PDo/n+#1 `&Y4xeJqC-큠[. ct8r 24Ɩ2^A1ص@'#<)#hÒSj{"qX۪MH1{oOlg.!јMPe/Y')|1eɘA7d*q˯lщ.¤&޸o[Yƣ$`*WӭAzF؈i"@𪼎*zr* ^#W^"V`nJfvۨnGDjn+جIt`yV[ nd|#aXD}o.+yɰ=N؏l33QQ;u,%$D-N![,NB #2=OL  mɊ& pᨂ$(5NyGÏ022$5_Y4\^[;~[)Mb!Wt0%e+bVQe!2eED!xMWp/u 9L_qCCĊӧL @~_k_:}V41U _cML8zE}UIy켛WXO-ExUX6KKr $}6/CB6 S8y},imhbh p$-7$cD!$2"@}%ّF\IdjNqk]Tk2T۩#|2kV`>Fm\P{Tɑ=_{V&4n[z+oo[ѪqB)?@SXU_AJ!bmړgjc+Kz))k}8丨*߬"þi@uj"E d)RE)\agVG%x`BȖB)E{gop/ZlDY#PFWln?= evX߭0UՓ)i˃RXۙ8@(EݿiDPi@cmM9ҎuX?R{qMa&c=9z -v4Pd(~'.OH"s%Sj'Y ~"drdJ^0ھf)!TM^NV" @&4'҆bh*JgB6;}(eYElm*۩c1#6ZU۬O =H Ij:<@wVasil$ Ůl.VL@ev+Iڕ- UAp5ĆԩZ7R!z|Q=Nir[3-7)PBDu2AOpGEJpܩY%PE̩ Bڹz=0oelA 7Z*@}FeT $n R[S*U({Vc ~mr؎dS^[PTQ$29I&z*krf]"TЮ b%wal88+`y X1K'/U0Děd(Z}ԊJjz6g3D (1,O4PK(`v*vS_6%ݝM+,2m47v3*ةPGwV))/+R$e{zr Bƽ鑨J 6j^E=|9b6tx\(S`G*j*jS8",v ߷$inI.CNҝRnYiUQJJvl:}Vެ*I ysG-נ?z9# ) Qc؜Ɖ;QAN0$(Ď}+ԒP7'iY١;T?YFG n4).FBKF܀Vr2$D`7ބ͹N'~Yn% $ %Kӆ+0bAwSEI @P VrJ`37;,pueĪ>X+͎[?ZB{TrƕaRIT%>JͫkVq7eztɎhv$zq@޴%4J8@; >Wi5/Vj !P ]+Iko,D (`|?npDŽ:,/ -$X^rc/=GpވYձ@Vˉ[pXxqluTk\(ip6>Rr˸$4fW%V8%$Wo0/Fjzh*{=Ɵ vSH/ӂR+]oZOOت]%ֱX;<bw:))t |Ң,|ilnWV6²p+ |2JvdUlzbmCzH1:bՖQ\[6I0Z1U2xwN9BvN<;Rk8Z|i $czU~-b2rnV8~ur^*}뉲x`JMӶ`/A_Br\ w췳ejcaQYۃ+Un7%&Z5A1R] cbL(8iD) q:?6HKk+߉4=Uw8`W_ ).Ѣ&H첼7UKèV~T*ܗ`;Pw\Qg#)_pێة«&^UN6* .=zBPn|0*Gɹ)+5b~8)'/rʆmV6؉R%d77^ ǟQҩcjvQ 7XuPBa&ǹ!^*3ҝ0{ZUe^G7$ +&ѐ]lݛ%ګn*BHc0RUc7Sq޿q]Tr t3[,lسF Ҩ$ϱ4gn(hqܾ$U6~ W9fTmwLkU>]Uv#V*o夅=,%Sxc5SFI4$_|qTJ#&ቕd˸^:Wm^[fwXU\"ݥ ?`L|jў, Wa8,Ў~}X>ͳxaUDCy(kDGğv UEW|{bdr5UCٷQcJ`UTmgj$< L!~% |=<*4)8l{'_%|.9).H1VǺtľ(7_)V%p~%{ZǙ?cH銬lc㊯R7{{|qJϋ=qR[Pǒ \=} 26O|4 H)RT5YPqOhi_w_} _;v"^)^ C\ZlGP("B\k>㷶DPѼ|NHJr OkPካ0 mwT3=Xf䐠V]2׶*%#z~6v>=)l;UAw\O(@{デVTU bQ~6XxLU9a-_JA#'W׺QgpgRmz}֛ðz3O +s }ثD*ߦ*rƔWfc(PU]5+zVW N8O!^m\ BkuV8k"Tǃ_f?qhS)cuLRmq3}U]F(?,*|CV hnUl?V w h[c㈐A@!9$qክxomi|qݷA Ѻ*UXU^+oӦ\<Gcsfe 1UԮbq$6nRx:eVr}_3_\Zm=u]Vr|\t6*ثb͊6*ثb͊?*6*ثb͊6*ثbo'b?$ų4:\rv8RG44s:Wq~>UXrU1\Up#=F(WcªREOn>[QZ_OfOL5?"ȧ=MEOՄ*G=8UbP;#4#n$)T Mȥ]X8c 1UU Jַ&ٶoƕ zSX^>8)}?zJWe'Bi/cqI;qU9")J/*Zm1U$^cǾT6+W1U6NmOVo_՘tv8PҟN|1߆Tc퉰v>U_ϳv8)Rie2}rIlj?V'c#PqnP'ŕ*x|i*R䐇 >H0%<8QN޸'ik mr;b,⨕zo'dNUU.ݎ/exU49JyM*8*&Ssj>^KI['fVFL*y.bv=0Hwy{l a^,aC*i CQi U^,[-z`UkPzZ$Sn3<r9lRD|kOq7e`zU!;cNTPËcA(q.ej3)(j:bY\U_,M(y.Ux//mrPCČU {b7_bVIxkaO0%BRNe%cD_ *hza0Drr¨Ia9 ׸Ǻdn`o=}|- 4 #H˙>ɣ;#ز#y}Z Wڃ iŋTKclG#u_r ?QkcY9+P/]rIj Neb?CkWGuWa 4a9{cn. bsc-<*ĞjhvhD`* lO6C'%WqA40,L8OwYwRO)@OL34&_yU!co;}M{6g9-`MGh=J`^+Tj‹ҟ a)+Ƽzc.aYhT5>0Hhn$CmQB`ɿ&3Vve V^DM$ɸjGyUE@ ѣV my*ɺWA'Y) nG!8 ;~1[#D:pEmJĺ7^.qUz&$i}U<QrMؐ儋FKA$%?kӛP0ӭYE^>'d`5&*Z$1,~&^ dZ Ҙ$/mpj(GCX cY."zț dX zE*b;\o+_|<6H6PDc]^ޤHNMI!!º(JU 'p&x6r,w$l~v ݮ4J F)OL~xd imlFA1vdkFe'8ssh nmcK6^84)AC{sw^wa]9 ,J;R52؝Uc3 ,R,3(]$Q@xΩ-T nSĒ2[qzEwlqV *$eFpڬWoF3?B6x}h-A9&RS!E*M#rP^&r{S`;`"6FKn@)3[T+:% Jnݏ>;AbjKr}JVC,,%i|-4~&\ۦsQL Ū}4)L5IO1=|0jWc;%Z z% Z|Iҽ0A mޣ5a Y&j-U85巔4gAѼ>[ܛDOb0uN-q k!vI&?Ƃqn.1{y-d #_,q74ib T NLmlK' ?rh)_@dkDgm9W' 폹*4 (.-n Kr"E'~8>gfWaU[g&SH O]Y"ҔNH ȅK!XsָIlod DžodRxR`v*]gjȥYC^[dAdU MJYQGCPָj :c}8:K dJWZIE k^؝wWYe7Hjk1%T"2ԎSJW~=% *ESQw-iOAR73wE%L*eCT m#ԠAo tR-8ҽZE\ƣ~![J- v4.f'If+LuZYm3<^TRo{1d~ni$H-JMׯ>lCjQJy݉Ӗ *N-#NPVv ޜ*ϺQ!A(;~hUZSCL6hq듶2rڄBޚv6`r*BDc@)ܹrݎ.>[님#MVFm-t$GZ !ek[6UMM7 zsPMׯY[/j%2H(*V8Aޛv 0+%K2q$1;JSv4$/L/&im$M2YJO ;R퉲m6zjb/2Pjdv0-lm[[U#j wȮuQЌ3Ni;iMn{@B1 ң燾]$Y/U9ȥuڙ"%ڮV-,ݡhT/q^fmMH)+O$|hFS5"L,bqSBdGd6f4} ϫ(Zvm"G-؆Ke"Lw`0a ]Z W$hD՞KڼQ `-,7WI Dj2\s"@!w^9zwK! P3!Cm0މNL@$Zbbgx:ј] I!-Ҵ]ÃPSctg%ՃTH%~H"C@ӘQ q=^{̀vwY r|b@b:XE ]T |h<;`f+k+Dpk<0 %,o7pBܙޥAN? R KIue).'z̠/:xe2 '/eW_HO *?k'6ᴏ楔t/7C묅Kz6DLu^jSÈ8E?i;8JͅKM?dlGg0}MMO 4orCJE:*QMh֑fZ1P4#\eb-Yd4X)^|*Œ4dl*M"%ʻ~=*>FKyI9&\DVB5Epu)F*79?r*y-k`oRPIV=[炈 l>]㚬ط.~\MjLq ;Zq=Z]lltQ]CR]ɯB|0ڳj3,v K|4o-N9uG<ו PUAGQ |!?m댽AApv~H! :XPw>XmD…+# hj'3К#$vF%SWҊA]7RG S8ݓM Kc ZkEڮ|6 KxJIe^\O)'DI ]Z|Oyz+$QX{TLXH`E`#'mWXδT g΃"9 5;V|f}$ Q #r<0ι x+!.Ũ2Ydeqf9"-Ue?ZῙn7!O!mmqJ(ͦj PS`arebLB`QET.kn9!#Q*)tbKkޡaB -|mpdz/v)Yٜ hu("dZNYzP@krQz+K7\":a@O ѫȝjZ}Fc(1:; k28od-dJ+zZG%>NY}!&R^_n餻#D\VW OV|7縍!c$r(ecކ0Z@ IqxmvDƃ}RZp\)s.u iXrp5=҉9=>qҐ > k,'*G\/."EVV(:\ {V'Θ_Ƶ#@I$W7r+f} .{.dvAt@64{oJhr;z!v{K D!<<8^cMs!=f"qnmtr7|5T ^n-/zBR"_Qa)$බ[e؁R8]$[4*Ƌ(?eeCTKBH܏0DZzDIܱC/󅚿Փ`1wmm/4uZFȇ b3jS]  x 1TMkA#Wf`f U LC Zd(i >!vez`UU? qW2Ӧ5ąpjq H+O>i-(? qhfa{m.÷x%w(PN&Txw o UUXq6 VBP QW.gOTl|yv׏lzꇡ*wlw̞2 0YImz Y:9de擀TcJ*{"_P?g6t*̓ 1> e)e)$q68KJxbS}-͏?=bh9& sKc0aW~.=b (&+h}:xaTjH$Sq$@Qf„$ק*N{ RAu$EaIw=Ho=4RێϏ_ qnhAH~^8* U>_{{e4e~$[Y t፫ v9cmV0bQź<^w؛+G|KUu~8G(W URPO vh`v8yBXn;œ|;=>z~,|o{S#\+0L}{R#}qQiJC2'%YUxlmcVt5l|r*7SblzIJmb.qK•5<_nU]mpD7= w65d!F8׮QN:U*iM^)D#ZUFQZv*}H͊K&++a(S}lEE:WqG(x0R7m~({j0(h0U},=68+6ከlWxW2 /Ը)RK*KYDFՒI?4Ƅ  7GӑJ;LR GMSJkȾ#W c % n7\ckQWve}z⫊Wq,LUEޣb1Z7(Y>x>ኹg=RaUU %M\ Ѵmت-]eZu_  a?*ˁ,Oc(P12>%銪ݱG \VӡŒEaAP$%:1UױB7O"n{aZjX;4<$*آDw4IdRX%e !`KCqC&6\ &7(~اōi }#]*>%R:T0>@P/M׸ŅF,P,l6imiݔS]$ @q#h~bEJpױǬ݊O h|P5(v!8xZkO݊Z y7ACʛ0]CBzӡj7-NJvI?qmFW6l$MՎeYGKQ_K&m2f'˂nJJJS8,S8/[oiKKVxXvI LU!~^+`n8#3q*/(F~*H4?lM ͳlp2n2S튮?Cx Uvڿ`H0!ڇqRQ<|w凨lU"A׷[-zn5k_WrGc\]pqh il U7Ľ|0[;,UȔĔ5]UwUaź`q^P3ӡ!dTnd*znkw佼zb KMK(G^w6:mwKl -$I;WV0&n4S+æ?فZ A߷l{UqQG\*9CG1[F+4a8eхV#t;xSfSuF[B+^Ǐ1=F*bqM*9/\@70+QHeٱV@NHbMQFƆ߮U3S*G8JlPcYJ$QucDJkDLQ{b 70 2%6rdcڟ߶L-0d0I wٲgbQƖp"S)Z|5TQɢ ;O6qTqd:PAc'lH\t݊bDb=gZ-#ҌX|T|[uζ#gO1; f9 ҽ$St e\i @4dL,2x|$H"!a@E@9;-YF O}alU$S,WɭtbZ(I!5qܭԨge؃k*Mfl2J{<ʣDVMl_aN9W4RC-%h:2:ڰm->EъD)W>N_]pu#4!}?jF wiF[ a'%$' EiGmov2*);`[M:sbj;"xM0.IFC^Idd^+_w7mY+cC: ;7tvQ40>!-ۏHs#%T|;4 Z%kևbx\MUJ׹Xp [gp|n [ʩ'5GH +Pӭì°y&$H$ԇ((~@+Avޔ)n*ǶL".vf@pZV1#-cI\7%$̓ l4fY]##i쉇YI0:s]Ѹ{adP[r†-+hnO&<1[#)FmA%V\d73 t#4],A.bm v$mNͦ@ZMXf~\\I0ڻS0%{n,'?Hq>x4jCJvljH/RN`;0[q=ڠM|0uagVXؒF%w59mRM#FƧ*@!lݗ>]GBc M;HYF4aЎ 1. t7@ЪT6Q@w8\V^9 \*z׷^Y< G$`TW.v PD8~YKm^&Cw-qS̚3lD粂Ne@jk4nmSbl Yo;{9 r031GR9 85M}%uC~_Fo[>9 $m!nUx8|$[#eFX֍Ł|/Bc 3SAU38ژekd%*k Az'˗li#'39ZI,&,s13'Hڠ};(P^\ʱ-3G}VBdګOfJtwS QOM >RT7oɀI^hQFz8Й.-wLI=2v=$n5!H_9;, rL,2D9?!;\.w 5:2{X91eJӥZ+4HmSV=9#.a p[RI v8e!c'ug$~Xjex5|rJ2Jm"$ xV7]wlm"bzi9K}V7$V|Uk&;,VHuw?FAJvq v01FP{btzrOg[IAJA&ux c^;}wwrEĽG=(s7OnQi;m7 -تj2y!#e`qbOPivoZ>1+vݪm@7䱐E),Zi40NbWP0JTE2OCtӵTOq>*H8!3ا`0am$,Ǩau{ki 3)1'8!# HȬw{cf' dJO\QVgǥ; ]JO>9-YHt-&mb[*E+Jރ]rK60*0vm4uw!pÇS p%)=WPze$/ɑg#Z}e jG}YeL#ku^;ApK(cr+]Y JV:KloН}Vn& };vIk풉}RP<΋.\J;S ƙ,\)gru$9(2@7k TrTP>ȧJ9XPɔbOJq ٻmF&t1sJm1nXڲ:g0B "Xa俘*&,k#"-nw˃Oq$3y(?e}xtB4h-9~'F2kr*S~cT-Z/aLc%ߘ:;Ϧ2RXlqqmzW?LLN^ 4TU~4jqykR+gDe^e;?!YUPGAztCt fjQ7BٜJ"`]1w*VrF6Rރ CIrSȞ'r54HDBY|dSh)I; `rK" )܏!"ġIH j=VyNyPQ&%)J4Kϓv{QYԚ(#qY&1ꎇMWҒXО,;TRLiNȉV-E{_k`m:!nIŀ9ȞLѷwFA@& oOIzX0-6]ShoLAޔknI/vUGs%>a.1Uf;6]׍0oB8LE}HE1۬l93Tx8A|'%x rEDMHu4evpy9) t'(1$ ZS&|Jr#rFջq~[x{sT]+NO\kAa335CYoHTxdTUo-<VUһoErFYS6i",̢D ljIY^(g <@vj}9lgC`m$@8s ;:Սj6?g(ܰta=䒼nUA5#` hjooBeHWxx98 "ނ+ {ՑRYR_ EPCt;dڄ_ ҽ{!T IvvQC,nx4ʥ.-ɩ%GCL4u;^"ԩえ T5ջ鑉pb>y|)Pg 4% }W|"3eG.H;!o8ȁyP| u^Gskl+/V8յvW,cUk'. ln22Dp:eU ޞ,d4l?漂Ś^!:nHo@̨ι8|ߢjP;~>H\,wMޙ+tǚUxlTY$Qo,2'$$JeaChRd*2B)\ģ#QaUfУ|H XPVO :~K]zg1 UiѰEq|0 rrljorMdžܡ(.REcu`)銡g,uxaBm8Q\~i@ƍlPֱqLy|-T 4m*eUM])nHDbPu#gxR)ABe%SسB;E~_KWr5__A1L}Hm)[{Y6n<{$of 7߅VѢnQ16R UXWf<:xUdƩ(j1J qC$P*Н\Ma\X\ىzuUlem`MOS(Knslɣxbi%q~ r5CLQFmw4]? Oq6 Q(la4TcBӁ o`A>vJdJM. n'_|WZ[$C-M:~Sե`x[,7,N<|FۏOPvo$͸Zh­+w8Cc+S|ULE)ccT(j7dxUiԼf,SN(p:aL{7(zI}H/Ul%LR7vm*-Ć@^ YA,M Vb"kc*6؂s$7P68s]%vm)DE!]e+.ï/'qi =Sv#/02EWaO[ }r索y{`WYj|Fa53r\*[ҁ!v#lU>-XVo| w*c㋂ 6BQCeqU;EUo~\ه|R(*{v?.cI)OY 7\U\8Txj>?V4Q?vlx` Ihc>?/li6&|4v9{hc,3Rmdž--Oz`TTfŠP0<=;֝$M'߁e`J8}*pb^" >#Kilcg!kD`ZcGCCjQ쐵UQp9ۨ!C]lz أ2*⤊c«Cwxteni1UkeqĸQFc6cI On<2+銴cBoc3}Rr1CL=pliRTC )uFolP)+tk[SnI…$W\ UI<_̓a:K~[faJ1ܫU#|#k?aY8#1c%KVGCj_(qɺ <_ 5TY}&U镾)u-#W\j7kou넾sgė rDiֻVr\t6*ثb͊6*ثb͊?*6*ثb͊6*ثbw/a?$Ųo[:^(zܑСg CF* S'T$DRnh-uBz|e0%68,U]ׯ)SN?oB? ^WNtn؄)㙣ލVZ wSdJqU(?_aW\g<1Uw}?wp]-gvY7f_Pږb9 McqN-wfX=Gu8ڡ4NT7g0Sb4КmMNZZ'lNtXT7?q#G*,=4#tF^[Iy(êAP7Sc ~/r4X 8?\p6ѓ;…#ЊS3'q]߉}1Uq$n0H|,>Gq>R gӗ8\TJwqJt8!J<b+[5q7UhOAһ%8eJ{I7OjJn-v~b]%#H-07+n*Uu،*?;\UgO__S|銭هlx DS\P)\PRWcW:c«55_z⪂va,WA_([7\U7_ᔭO@~4F`GCq펯f…􃉺wU"n'65\$/XQNCw̜zi\?, mE_E\o?˫M+c$n('.DXY iD`uҤoBZ<5^D~.Βg9. \A"LzcCOJl(,3?ApiO Ie "F҇%L%qBK3|oc$RC%( dbn'cjJ؎4-KКNS"(j `hk_ N {eED|qg$8sj^r dMq5ɴ(rgJ,ŏ9$O0 $(j:Nʒ |t9+lTAs8ȿmOQ^GCҙ+g|%U/fʒF {cLjppI%Bۣn2'^Ƙe]ڝ"rpʊր;Le3!CS#PK.> 7MI'EPP|r;ۍl eDӥ0DiߋNY)n*䊿HRP'$j.4l9:EPF6AMį7SQQoÍ\8*HLqG'Mm$AdT^v|/} Ƃv[ eaCֲu>r uimm Nq327mQ&;` 1$Ҙ'v%w yG 3] "@WvlnjsRJ-^ =&ȥj>x I*47