HExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:20 16:34:26  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?Uut7%1 ȆcVpDuapcklI ٹhFycjԏ?)@x<zЛ/{C3|şQKd1v>(mW[mRW?DH;Rz0h_J%w}몢[s+`8{'11?[6ӆ8䝭YYC5$88k=o9ܣ$BR#)'LXj.ּ[dsl#PWQIlo_Oc-46ùԸOj'*&7-'=0(5]W+488 II!ﮋ,`1RS2@1| #&X{wІ!;WkCgݶ@^#PS%ͭsli L6}SCa1ﲸ7=Hnu~5}飨}_s=GlehsKc[綯}6JL cj܄F$о/Cu4}$y^}- !4~XK ?M?؝G{ N9ߴq FE'@Ō@rEeoVkD7Ӳ;kcSOKJd ;]nڻ+:sOad}P{˱u dχYNl@Lx cCôJ/;s1{Ή!!uVߋACq~Ռ,[=p-'#\FT@OԬyŌFv}J}p{UN}tfݏi]o +?XX_?hSBC. iq 0cg kӱmڸgbχmɟ͗8Bf`/2>HkM[`4s$NZ;=kH'q5W}n9~b\,mȡ"˜K ڻw`Z8nOZf[5UeXcxJ5fߤgIOxJZ]4HS.gwRוfn/LJq_)4z`F_V*G7t)Cί5Z,#P7#kP?ckOx ,9+qR̸rx'dbƄP>atލ]*a(Ӳ2?\lE¾}zC*tUqMC935SHpoJ游Tne+-?yp ^N:ksl`ͤoFCCdKE~J_(y_߫ΝԬ~{~'-+cN5 xw/G4xz,ȦA=F~~l9NJ:S$I^s+ fM܇ZqYYda{6xc`칡~eSg]~J}G{52蒙el.5ccϱ˳$JC 65oC=ݵIch Ѵljf@ d [.q ż?Z?(ޣ.`Fѭ#ĸn¢i ܮ_~OvǕc1V8uZFѳF^_ڱɭ &,[q~\h.\;A̹ -? ZLU^Xp66=k#XGB:~b5܊ʱY@i<85AԬ)5gRy|1@e;״\$|[X6e\rʆsũ%IVmXM`KfwuW.L}k{ۡUrom2js#Yì:HLv;ܕvZpsKhtǁw%i旖 иyO 8EMvO}]HNVg_ź: /GOw-3+9@ }3aeAoǃRMr?4^44?RFE3[Y]]\;+A+{6 Rs^^:&F\LwOvNW揤ȝ;;yڎPVk(qvC.U- deW-&N+1Y㕶u;T\q,nzn]B6Z%n Tpz;;0mv3_mlI9_XZe;tZ~S|?DLM&$ؒKGNѳp%ǵHk_+g0 a1mo-F>3{z&űj@2r?D@0>vrFKw#ve; U">wV˸|ӤSP?o\7VmWQ]R2,!wm]"l Rp1Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$~Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXT EXP550/PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMY update_maart2018-3 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM *q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?Uut7%1 ȆcVpDuapcklI ٹhFycjԏ?)@x<zЛ/{C3|şQKd1v>(mW[mRW?DH;Rz0h_J%w}몢[s+`8{'11?[6ӆ8䝭YYC5$88k=o9ܣ$BR#)'LXj.ּ[dsl#PWQIlo_Oc-46ùԸOj'*&7-'=0(5]W+488 II!ﮋ,`1RS2@1| #&X{wІ!;WkCgݶ@^#PS%ͭsli L6}SCa1ﲸ7=Hnu~5}飨}_s=GlehsKc[綯}6JL cj܄F$о/Cu4}$y^}- !4~XK ?M?؝G{ N9ߴq FE'@Ō@rEeoVkD7Ӳ;kcSOKJd ;]nڻ+:sOad}P{˱u dχYNl@Lx cCôJ/;s1{Ή!!uVߋACq~Ռ,[=p-'#\FT@OԬyŌFv}J}p{UN}tfݏi]o +?XX_?hSBC. iq 0cg kӱmڸgbχmɟ͗8Bf`/2>HkM[`4s$NZ;=kH'q5W}n9~b\,mȡ"˜K ڻw`Z8nOZf[5UeXcxJ5fߤgIOxJZ]4HS.gwRוfn/LJq_)4z`F_V*G7t)Cί5Z,#P7#kP?ckOx ,9+qR̸rx'dbƄP>atލ]*a(Ӳ2?\lE¾}zC*tUqMC935SHpoJ游Tne+-?yp ^N:ksl`ͤoFCCdKE~J_(y_߫ΝԬ~{~'-+cN5 xw/G4xz,ȦA=F~~l9NJ:S$I^s+ fM܇ZqYYda{6xc`칡~eSg]~J}G{52蒙el.5ccϱ˳$JC 65oC=ݵIch Ѵljf@ d [.q ż?Z?(ޣ.`Fѭ#ĸn¢i ܮ_~OvǕc1V8uZFѳF^_ڱɭ &,[q~\h.\;A̹ -? ZLU^Xp66=k#XGB:~b5܊ʱY@i<85AԬ)5gRy|1@e;״\$|[X6e\rʆsũ%IVmXM`KfwuW.L}k{ۡUrom2js#Yì:HLv;ܕvZpsKhtǁw%i旖 иyO 8EMvO}]HNVg_ź: /GOw-3+9@ }3aeAoǃRMr?4^44?RFE3[Y]]\;+A+{6 Rs^^:&F\LwOvNW揤ȝ;;yڎPVk(qvC.U- deW-&N+1Y㕶u;T\q,nzn]B6Z%n Tpz;;0mv3_mlI9_XZe;tZ~S|?DLM&$ؒKGNѳp%ǵHk_+g0 a1mo-F>3{z&űj@2r?D@0>vrFKw#ve; U">wV˸|ӤSP?o\7VmWQ]R2,!wm]"l Rp1Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$?~gCcqSk+SFC·͇9h-4W2ן0xc18.1Y'Y?[b{^;zCGc]??Ok]nEcV4YR )!V>(=O[fM30kOOqUڭb/V=Y?|L_G5v}oȽ\DH]G,Պ/6z~9.<#޳kgdjSR'ߑ91t<^mDr} X:<|=L}m̌r 3pF.;| rT$|,81Urg q.H>"ux֏rޛ5b8W-:]c;vn(?m?qܴyܞ/qh۸2kb{[+%ӂqN;zW?iwNxp}$v%;'N(zP;@iw6<9bHǹZ|p7U?"5a["{@t OjOa%=Ƚ !6(S'wyrP\rHhK?Kb{Vno8nSAbc?tWS#Rep?'tNUwKrtSl0\x(KNͷCn.Ews!e4?2="9;7.E}ʟBHٖ*(Ϻ)hdn?4\Q43jB͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb˦*]\]\@uqE#%Qn(el<AC]A!br$S#w1㇗5O1mM[KqA4dQcǔuSդ8,# z֢Nw}Gqz+!=~v6}]+NCt|lwxÍc P~[맥q84n(?,5[ 6㬊>ǫ bphV5Vl6;Oqw:S;`:?5.~qt?~{{J6(?(u΋ҶϏOy@}8wAa.+Lr>^wO9_hp#~_ǫ~1w-5D<S_b?#ܵ]? blGoOH8W&aX,t,?`nW;g!Pœq? [ͧPqNq/0(ǹ5Mv+_ǽ4?v?1Gy 9? 4I0(+O-o8JZS)w?N7яv@F(?!o?N?>HUV8N"Li-tB=QB9vBlqAD e3_C1oL2(eY/n`k~[i%B ]Uf?2qD# #!.כd=[G c&J2# 2w.59gX#̝SX#~8^Ne>zT_Y1),G2 3>MFBO嚝_zk]E{FуC'{]dcD]?,1dV P&>&zqܒh~Ѡ_"us,C~ t_d(R#ޱXMe" Ht%|B7#p}z|m%-^U,"ȝT"rO|Q u1˸ƃSFbR[QH´&v\=91op1qZ\3 hURBM1W!ƼEk"5[a_lL5s)Eۏ^Ykn02Re| Wz&}:Mvf5m\Km }~y!w GuW M2&Vq,WYG]8Gl3SU=,xȷ% ej1(IepZtR ;tY@vAckCԡƈ:`=k݉ QGNxmQ#`2S9O?0"u)ёS@q:dPZB۶_ kkB51eĿpj le*)н)/k`~?z?%]75I@kE=e=SmeY>Ѩ+OyGOBGʘb8-M`N mhQ~"4q[RW݈\i]郉mtJŞ'"OrԌe6ѼBJeJxбu ;'xӨ(گ;F$ܵw}[LI*1%A>\ dW|I7Wú*$5)!l+\VwB5:4P2FnO|Msese^~ÇavLtɄmFSJ?S/Rt9?vOŻ%o4[ ~ԟW787>QN7jgF?vġ#TtPf6w.$( (vyJ{T?+f$PLce]_zbW&_Չ}!عZCkf[Iv>9!(v0=_1grc|ǝd?b!,朤F?kxze?.O.>˹{)ߓKMS6/U1]ݏR.Om@}xOːCr6[>TE?)[-zKKvٿp߬&dG2ĸz]%?N;oͽ_=XJɲyG'}<%Y <wwsfô0ϔwہsÜ%o ^p~ n p1vj>Tj6c@qo4G/M7./R^dSSe3 jxC;=?XObߕōZ$[;7Lݑ!S%99 O)SF㪰 Q14G ą?O"ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*yɇCu~i;Z騱[Tv,yxe7"$Z91xJnolJM%,*93+҃h+9q;{#fibNSuM"+]*C44N*/| ^=֞SFWǦ,ZIڔ]ڕʥN M*,W+4S\!(4N5JyT3햩BvTy( ׏A%:wޛ|m)RxyQR]vǫ``T Ȥ PKW'* ƚ`Cj(SRtlgl9qw=rNءQlPэnTWM ZH1r;%pV_NNlRVM7Z|JPw +LP#f#;eSl hH|p2T (|jS`Td-R*|q'ɱYT!]+F[p9DFǹHzi+b NiqtƫǦ[=)[RG|ReJqJcQ*qPU؟QI*qae TB5:T8Q`Jԏ U(|p$ THVn[Tezp 嬻#L[aあTҤ 0A|e6coL&|nHa,7Dh3] WF̡V( U;kn7##JcV<9vmO~m*)zvU5=BTՃ/ Mʾ5U-棏Lܻ (Z[Y5Z|9CLR+_<2L4#^8}9@=2,,g0X Pw$9j(4Z+za[Z\8>9jGӅc!+AZ9mS Ѡw᷆*` rg_%PeҸ(`*38R xRV$Pezb")%\֕lKF^ٸvȭZ6?{ PVE;?je'aUGt ,i\§*":{튺==dPw8<V]1U 7rw_ +BWmP;dIUjO[b02|Lv=6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊Z-)@_YO<Ơ l`2!k}~N3RMVn#鑿Ue<<Χ6?vO4*i8W~&o:,>?nŨOWakݓb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊, =k q' JlEzxǩ 1JKZwlxKD*A@'+:\ ָo, `"<kMBȫ@w=r遍IMeqڧj• Q&"M)c- ꂕ'S ڒJCt#O |DP26QC\_ iք W}%X)eQi5ɉ+vF$clj M!w 0mdY/ sUU*i\Upp7M!ouʮs \Xx̑@]C R*;|®Jxfb[Ӷ4a[\h{eqn%BB8䌑VĔZ[P'IJfhw r\TUv9^%/X%A4 Ož"%fSJaI9Ek `ƳrTtpbem%V/٦=0q$Յ}`AI6`d{dԜ6Kz{c텍H J{e{X&#է#'bvư*v*VHT|klƵ*(FFiCJđlI CAO:8Rca,,) FlR| Y=ǩDr 58PE,ژld&BՏ^ҽv6V̻ B ੧юڛIS`S1Q֘ĒT1ȷ{S-ݐ[]JTe(hWsM8P%7P 9CP78K08P`U+|mOnR*yҝPE UT)ǗND1՟ӦW|)w F(*q9Jk%!X0"ԖM\N7OlX%q2b)*40<ȳ187B%59l2[-?wNdBR׹y~q5|ժяRȣMr|/~.e(Ҟ8u-}#EFrTjTM>|RFsРmOW rh|RMsv\dž^Mظ,?KnajnZO1˛?_KGl8azqvO_]#L4X~Ի? b{NJ@@l͸鉷eCb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثYnT@[ ~.YC77t}2v~˃闧CWd\ir$[O9Ga;<ї_?^MG_۰͚"0qs d{stb};:4tN\{9|3vɃc͗ٻ9?h Wu?O[8V&Iǩda&`;f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊$>J3y~\~YƃƋLzo>g , SuRq8Iu:3ǵ)b-,bFђM`upu5#OUSŃ8/"M?4ŒhmPwLJ;/÷qʻȓhA9ڃbM(6Jy1c49HSNC|W,-N A/N'uU/&-%A7IpVʠLA\!Ӷjm bsw%?dT+ǚ\$U6 ѓ.7HoM2ᴅXޙt$Xڅ>p.'Ƃ+ČTʕ݂zM+@1Wp>'*`)¨l psD{"θ #Z]3@NyR;bVjͿn Ve009Tw`)Xın٩]S2S|~=ޞkJe4ۡh~Ts`Ze(뙂,عUiQaP##r~Q,WZ'(keLw) E<11PUVN Vbˉ+nT\p3Qmuzo)W_l>K#/M-cq:IW-أH\g]`ehc;62޿<5덥qj%oj (QJК1176:* ~Dc")ʼjvPm\okfp ٭sZԠ4i+݉嘏 &!<4#!myW}:ޘMkv#jcI/(‡$bn#+-eDӡ*h%c҄ThGMmgrj];6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6* iڌf Xf2TmŚXK.y/jͣ;kkU؀/L:N#lJC?һ"'Y*˺6㚌Z#\.m>2 ԑݍ17A〠5o˚YlWt^z pS5 ;X; 1ĩL%>آp]r |lFLBE2$T\zn$;i6쭰a׿lܪ}!wxwh:j+8@['lJxwc|UD$mfX(J[jT1k |Ӊݘ4Tљ;ci q QJe"V[OY5@[Q`Pl*p95r<E+YISX 5 ]Fa\I ;|ڕ4=kLTP za[mSŷ]񧗎K7n j*K c֠PEX21 ^$-%xW\ĬP>8ǒ`J{~+r6%>&=Lk"z,@dxk^fjűJZ&Łjf¶Ĕ>6ȒM¼Km褐|LZg $p"J(bu1\JO;Ө|ZvF!ƛT@Ct(:m+ %#W)EzVqq/]뇈#dv\ļJQ7\KkWmlmm<̨$[RħW\L6J9|*w8J7,?g)D~_n\i[WV߮RJx4BkMo{+U7TcX|wjܖVu:%hP1`FUĪ/-8j1ڛnY u|2'j\np4,Â(EF\ |kl E9REz Rc2@ܟ5W󚦘ܞ?oSZڨXLUђv;f YVoN$Uv8P@'(JUː5|)U@OژQC3;0BU߈SjmsHڙ\kxyO4lWJl U ^}` u=׿Sf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]4"VZ!Cc+,F|);?.-tP7THPj{h{.8=Rc<xO.tf`ss);Gg4_^V fa&ğ9mgm/Yf_rLD<'oLTv[fMuG^/MWizpaoy{:~s\,zq短5Z>GvfsvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUSmuHk,gzW)ˆ9G oÞxOG&h}Pby4]r%; ̻x!J{ڧ:N֞ÓY8P*vu#[!6R :Nv5('ϧ pp?̞S\.H2=uZ(jEK[cq>/II8OG'p }3}/hBz.;'f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*έ`{ rlv+N1CFUs6&@Wof;<^hQ`|5?sGÿ&CT|ԬkҿєM?g{W$I &1U-(wN[n@ءn`cJKjaPaWa#J?c"OuibT^!!(qW|QKTRz-@[R)n50[U49@EM ;UԎJԖv8 0!d!ƲB'F1#Z[zCJfmQ\Ur ! lj<08*KANUm[ŀo *0[!Z58~ kx e.1Q톐J+jVFLBTscW=ݐJVhlNX 5G{`Cpۊkʸψ2," RN8׮H1?_,FV< i_j\mYU|3v61YCYcִk\-~9E߮4r@K|?V*zZWjW0ƗrOPƓmr ab[RT?M)$) rEI (|;dO[t>*QR@h;Ƃ@v|GZtaߦ]|pO-#~qU߶nc1C_SbIɿ(r@Z-@"4Q{W klƅzLZMʼ bjM:^+~#bwYh 8"S{nlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vH|仿1K)#aJ;fEON]ҍY?_͋h>^I~ُ;gyOYVzqL??v!O5y~R!k/Y^Y 0s4zG) ]U׵: hT& }?F8ڜpq;*OqK/'S84>M#?Oo]3.t8ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث?$yKL :ǎku} H?vz>ɥ;z/:7F䋱?l=z2^W_3_d+ 2+⢃l]04Ȧ"+B}9NHl ԩE(ƝEY*),{Sa߶D0W?RO*SSN_H@DathƝ?)\Kn)O+ҽIv\Tw~_]2Bk(J&_rjNPG_(lE<ՊbC~UYv,"Li63p]f;S 1Z]>/TDht \" ĭʪē+S$*6*Ztƻ !nzAT6C8$_P ̮qԯLXT #q (e2 yx-z ҃W϶pçf$o$ 8mPi 2_2'`֧q7eCZoV`E$>YTޝ@Uj~vZS_Q_Wd<}蹔R|P鑏p\jC2]#sPNڙgݱ jdrQ G[P@) Wsi-[u]q?d F㈯Ʊ N)M|]FŃ -6'azb”>ȏ-d1 Js[86^&vLT;o:q4_(ׯ˦ V58Tis46/AZm1(Nʭw#@?GӦ4[7cP؄(IB *kxR"6r|pT9" "k`52KtuQL+J">-(M+\nڸ UC0oHM+b^¾UHjH]'`}zy&׬dW⧎򂞼Gː{J7 aWb9Q|F߆Prr$5VO##jک)5riZH)seƃe5JU$G:jh0Ybd qcE+cm2»xvĪȵȫ'H8mBv臓Q]R1 UIӨ8I5^Cۯӛ~"*\m3ANrRv=+j )O?z)XÚ WV@gs}UYWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]\uMHꑝ_O\7_^O?O1ڝ~/?g]DX* ;@)$vs?=fqGb͜hz1#/+vgcd?v?kSQ'z h׊S}㘂}rU(Qh*k|D MUTA05_E,v Q5i#Z:zI(0-;u8$)NHQ"sxs$ tS)aV߾;|M(/`EYp,dg @tpQY|q&G O+"CHU b}'oeL\Ӌ/j?VD цޘxKK $f&Hi~  w-;*M+P10|``@4‚~~?bh+.O Z␾&JVoS}%P;-@SU.*M2S\(k]jfe X2!R Kk# -Ԟ:6VS cl:43W:p:?ٖMD)zhV?,=qJ?*4х[YTw>U Xm-0SR?ZcMI5 Y6:qTɒ"&lj~UI+155N`|~U=2b Њ.$8UAݎqޔW!5zv?m@j_0kjq^ Wւ䄔0g xurQ Z["~<`5`J) 5Jn8ԐOie)oZ:(P3堡ӔlBn£:Hј mlSڙFmEBL%iݨ6A\*hHlxPM;1QSܱ?*Ni_NŶ?#2jxch\$B:;rAVŐB#񋈭F̒ (+~GbekָmZ`AP$:mE,x1`X\od Ɲ sJ}l0E7nF4憢z$(2檴ǒa=) $oOd[z ߖJxWA.UmR?=`BqbwOeBEN߯& ٧ Ar{knþ(U+tASACj"pS}c4p%UIDwc~֘F9@zcZ^mr?h7acOc;"41һW U@B:l2éQ䦣3r ށa^VsWLx(je+}tW-(FĊ0W}~r+??җYs{x,Bzg?o!y3?jxGS9·+;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb|o8(KL1D4-,_\?GNYJOZK?߉Wg#d1/轞M1Dy'gkӵ5(Ճ #eXGxإF221jz(?lbxs˳gN͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]]U~xb(ö*ޛxbv_f[E+N迆(voA1WezM(b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*)hwojZ7QYsr_l*cȲDO lI5߭{ZaRfNT=hSɰ(fWg4ZoPF7`k'D, *OO2vI^Ҫ[4X, f_5ľ*`lEQhOCsPVF9urM62QBFG3u?,p-ֻS,*OƜhyr֞mVVwf,Xs+#S۾4^9Vٶz; Fŷw8#ūJBhU8EK:!jS濫U|?vݎg>;#IuPq I>;l\cNR1m6ehj-F¾ATК|+s '浸#| \Ěz㞋Bn.O@vUF_ACH*ROQ oAV*B @rs H. :]P%琤+SZNJTӈb޽{bKdQUS፨SA'H^ mlU6dB װm68+VSS>ءl 1/OuvF+eV, (>/ RmHP9$Sr} OqUd*[ jPWlJZ6 {t̴?^ܤV|w;oM: ?%Ĵ)#mEWzjTBrT}P? t%]%W.j(zW|T"V+RSYMAָBnGN9PeЁRv&+B5m֔Jӈ邭UFn*7!yOOH ǚlZU~Nxo;wԞvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWd>QW|MV:_gL~u]X_I}}X;V- 4UG@z 8Fыә2RvsO>}Noiɥ͜kvh$ӧ5K@[nGퟗٕ8oՏ6*tgP]Mi:su [VQxp^QU_Zoҟ ث|+@,ثث̴?9VԀ֟P3b;pit:E"bHU~(?ey6ߴ͛z.p<دpoV"~yT3+FܦN~ثm#{i<]VV0ph#b<2yoz ޛqr:>8kw&N %E Tӫ~Uky/WmyWf)mns'86*تMBk2GJV)8 %ĉi K2Hyo?44oqiYޠixSY%n~p*/MG=3Nh%9Lp8,D3b֮Ѽqry5݃H]AZ&g$tVebo 65P,}!YuJ@.o4Hk6usr{r=~zfSʿ?ywɮ[Ӎŕ*}HƧsox#b1\QFC6*[Bfhc$|ت?Ŀɶ͊+rg<,wH*Q~lUbz6nu;ItlDk$n/ȿß×͊ra[B9͡_S\ث7?9-5 y.ʠ"ϑyW ڛ3b[h7,h.P (\sbsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb~EI{}0TבA'BcwъzJ*ԮF=@ Pw|BZ@ڝ~EVPGpƓUjUPe@v-Wߎ4߾ҤQ}lw3ڃ~) A,XjB4YTAQ$z)ޝ2^s0Z[`G AJT׾ T7LLN ̭@qZ_"@5ۧlޛd v~,ҾW4eփrh1jQB8m'3}P?klO.AmYA+a/+` GNG;׶Fm3+xG Făɖ41 _oǶAEr_SaH>ˆ7el+M5fu|נ=|koJY/9p<*(k[5>oQSMm_fY ǦOUqaJTt•5hiS2ؓ#E`kJoU(n7?vbv_ e$ߓׯ/$FHEWj*S OՅi`)wǠݑU Gzשe(@47 ̼J^bJp(Ǯf_Uzw;e *f];KDZ^ߔG#Z֟@ߥZmAd.Bh:m#\6ol)RܷvovRsL3##v,2Q=o\hx#K)vGgxğQwWds^q X$?om_d|YK۶;K?7]o;7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v!u}oh9\ȑ`,y#XC/'`D6^[{ SjF,tyG8dI?0GY2z̐op[cٱWf]vlUٱWf]vC0?[^6-G4?Ļˆ_KNwǝ[HVHvu1_f W?}Ň5$EJ8 (As"/ ó]zl$S#gZsѻ/_T/;"wN͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb.qHØ-`mn!|02vXS]鍫6eplm]cj-ٸ66 [ 78qlvWeSvb1WebĮb/a K?q5b8ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱV riy}&lU7/%8sb^_<ӦϤj$-Cq$YSؖ:EѾlUn*uk-QZCfӂKL3$kt}NnGIfU55?Z{}H˰pdxXߖ}j?<WyWi;OIPW/꟣?.{@Nxoɿ͊Vvq?O#1#(%T|ث%hAnnYN1lU|c&}SZ:0ّ$O NKx䞍 ֮$?XҼ̜-%J=^__͊V13Q&qg~&K6lUX~}{/=BպR䶖;آzn+6*mFcyC?3i-$i"V_Jr2ƍb>qϤj-OR\|\sboeKau[TUQ@BEVw]CFnhv1FdLns|<͊9'4%Kh^iv$jkFlث?`YҼSMfr4YnQ}Eys|ت]w˿i WҞ^m`"T?06*_U?3bt% CDfR̷)E i Tz2͊s3wrMMM}%W污$~تlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb~C[|<._%hNu5ԷQ.N%Ǘ6? w4Ė+;<);vckON4 eEOlboGr'xnJY6߾߆3+J 1۷f5JN4NǶq4p+$Sۓz1MJ>xOՅTU=FFcWH@p14)W Ja s0+@6@|1Nڹ$R P=M)b4U$1Sp%r`B_)CpUѽ%|)*/|(S zuƅ+ɩ T`ˠFg$ң᭷S=F¼**)v8w{Tj+gڽ*9ԭ\ ACんm jUB6 v9 V<T@İc\6#Y:Z)U[cr"ŋI͈Pz(Ux,)A@<> v3P kW܎Q]:)#o`ENdBv)lTIuCZ>$A>*Ws3P,t4M㊪G*jtރ7#>Y Pej@G_U6,Zߠk^*f` Ms(D#mP ?8gW56;~R`Mj61hSV vcxƀO-Oah*FJ+3 ^ -7
fG㰮gK7"{-%^ m iǷՍ\ j@ *kǷ21F:}QnT~+J"W?Z3o֔GA7qSiBH$q^ߙ7#U`UIrt&5k (~?cJf$Yڔ9> dk7Fᴅ辨26.6 }*!.zo4x*oBAU?dO SKש\ǧ5 5#Ҫ[l2CWs(;lroLОIP%Adː[ A@Yc@')%Ɛ%zu7TA჊֗F%H?`#U1nc?'gn$8TP`3;cٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v-15$mjk V|a3O97dbwGhvL϶ǗN\!wH 粮湏r?NÍ3HB]P'Բq) Gc.HĻ%t22tL' 6W1uyN,fq$a/gϷ5A:nG3~f{Jz3x>zlbP}^;:t.b.HB9#p_=7dX23Ï0'xKk}=~2H'L{J6*!/,vM'Hacfٝ&͊~NzNW͊sm͊i,͊rSJco͊,-SDfRO_,jC]YWa326*zT~تlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثW`3KQmiAE nsZGj۹9vxMnŝMnZ{%]fץ0VӶ`M9)u0p+nzToQ`%e}_0!FrUL%(wZҝ\iEXU xe"iJcSS1m[X}a#$- <ׯZ⭬ R`ۛԯAC\-6 ~pZREcP?cCp(p@6+<'h+SsPݩWR%<~3PQ-A~WCщn:u,(Xʖ}B61RiMi: :P,Iz{vxSZSҿ<5I^^cN*\Uw4 K "hGgk4b|?,קP۠7.ߎ)ihoæd)ZZ*Am zDŽU#Z?ja,mIF%wv2r)Vq޴,mŸ;3hzVYOľz%WsZ B%䂦;XO,i؃ZknHYnڢ2lkO"ʗ%MhNjxa Jr[j}7A-JS) ۫ S^; "cAӗ(޸+2xW1nB*zX,|1nuP¸ +U؎e  ,Ca+Bv*v4@ +5! &/jww,Ƕ<+jJSE ;cQlw>)UPW|RN,P*1 qSƠ5jG4עp%Z*n)/Π]JH=[\% {wB"3)װƕcOR_Pۦ[EBD>:bqxm;*Nn& ZfV |TQJ$lLBѾx\PT M8, JաeQO9gEF ebIQZNN7n@Jyh$Aaµ:@oVG|ChCăJ߲2b:2^P=L4I?nSq0rG5~_hV@kX+U20@aLjޔ9 MSm_#hVN6Y)W|YC٩ъW@@ $8E'd~}%iE<VqZmS-.1-Fmƶ}dGD? {A:8QV_.do[N@1涊 E^z-7]vlUٱWf]vlUٱWf]vlUٱWf]_^iO\EKėSyxq?gZ&f Ǡ;)@~D fDF򓳇jߝxM8 'C?Orvvm EEK+acNΟOO_x NZ˯ 3%vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU Wmt~|U ʅ=6@(͞8c3\y t ^>.<}_Zmd5oUɦ16 ٱWf]5rE7w AݳQLK?vrW'X֦ ʱRS!8ݫ9=Y?{\O,OӏgbCl ?8%[?ǙG ?Ny2e!W%1ҚjB_Γ<0^5[?%FF^S%G^/?ѻ9,UӠg9vw?zgSzn _dx9(GNk'EvURĔۜ,?edeJt}X/~?>Սf3 1??|XbKA(d_a\Z?x~r% 2b[pHVNGO0[EC?ceĹ'/❜O87НvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUkv2%v~&1]핳v<`WevlRp]Q*1W`+h$ Et'^>c;+;6va-E{Wbc&.# ‚#mj.ءٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUz4Z[\\G,m:$e~˷%|9T~R瑴/1p4b{7!*n^1lU 4Lx4UX-HAz\P̥w%Lx,ثϯEUy?FI)!d1Ǘ)fޕ |RU~[^z a4W`M 䱿"VX̑|L^q'?B[jˣ{%Sxe<}dzPlU{;fVue?;-T?uk}WOث56tgN2퍤1J+4y}ZfboɾX̄Of!i')lUK,/4[=ϒnK%A/$_#Q1̜VMsTG%אmȑ _Aquhq1ت8y^V-WZ_OfgHAQ*YYE9yp_I,ثbm[r[dʺ[AN|Z?ۻ_zv*;hGP3bVfMDؤ֏pc.B6paÌ!6*>dDWz`ymHvrG^g~??W~v~qi:6|䋓^]<]J+)"re)9|RpWm/P`6׶k+H㈑Y&^mx'3bCUԿ8|%Ω*'zp&͊͊bn:mVC_-y h~WkZvѥ%~q#xϫ}Ny+9Vkeiv1Q(A.6*}GκOlVZʱL(7[N\>͊?0iwA-.Ḑ\0T]_54f_Jha"3b曈-d$SlU厽j>ZУᕹ枒_?lUm)YU\ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*~OME9^U n~#35NaAΩ@sWAФW \\H* F@H?Apm0f4>EkET.qB ll-2PO^rw'yV"nGDVJ@Q[F1dwzim-Ho Ũ)`VR#&VA|kъXKCS<޸]7ڙ eJI* ?V8TwapҒ V35mJŕ(iV$T);*l*\oAH_q:^kPhEO -hFVpZifn5JfO;z4_,BlnXk`2841+nES冐-+튩1_+^,a-X G/OWeqm\+咤$ G}[tR H{X+5ljU"M{m*vء^L*)6. lnmrʭXOf@QBu Ҡ80 Z\->mlc@ڨ߶ W?)҃F%]h:vxjF;o)U!jź U@=,JgYExnRb<1],o##j w+Z0ƕ>9 ptB`**Xol;cjas[ P 탉-pt!{rWG$$EqĮ`2dIJ6-ȩ],=NcZ kDa ',?BEiᒶ4rEn$zfoOeK#P A?IUIZwȪ%҄jOݏAzAZXl3ISn4|)V53$Dՙ RH;@'Bi]7[9&p4 +z'rI۷\m aP~X5RC,}O4jTzw&J2עǯMpZ /S iOLiZP{}8mW+s l46; J$jtc>*Kr+^h6kBM ~x)TZr|'zŕF qx`bƬIJ$ ;͹r?B+V?&5nvE5Dcs+^_,j@ @@8o*eVxI&"8R朷+Ĩ[ګ]Ԝ~[n#$(G@w?Yx QseYꓳl~ohXcmklQ[z4vZyKEnwuT6=a/2glkyGd7>ثb͊6*ثb͊) ,ƀnI퀚Hkf+nWR FGXe?Kv&\Q+Df]>/ogR#΋oFK?qH*r9rLxcxK,b8'g)5/ ~2ho +8Oldxqzl{M/bc83❀mɸ~K &ǜp/1vX`+@(va4zo>y>Ca\Fo6l]aʳ'aD濰%v~G?zؖ!1D6{93::G#Ŀ 6t;O]?͟:/6vHfꝛvlUٱWf]vlUٱWf]vlU] nK8[.>Yӌ0#/9z]LOQkykWn]#̾߳"g5Kѓ/k0G_?W׋#9E2#;oph8gCj,)[6_8N3c?]_2vCsFvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v9:xR4#lԜQWlܣRz*f. WeKbǍvR]0lUU[eڞ`l#\)b7vfWe]]ЮB d; ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW~c7y_Ϸ{[]WԠU9|9V'BUkԿl?KN<8}!I j̻6l=9^ivUYiomGE~J*D^w?)>kAkb#Nj%Gؤ͊W4ܧӛQ"biS/܋z)P[@X&tė<|L92'W6*˳b=gF֭$ӵ8RaC+ S)͊oLnZV/)r?sb4_ß&i qpSJW ~lU.cڦBJEw? 7&͊sb͊>R5thF 8e͊2p_XʨD y>$6*/?YE݌ szU"IH_bΞJɣkQ mvdjD߱*r[rFe͊ɿ~VoZO{5ūf2fA|?^˛[4I24R 6*SpɷRG-ńPX%~HٱT/ WR.lU~X~HhP[o=j:P?.\b/P6e-;r,|`^JVlU6mAxFVqV_A[ex-Ȍ*80V\ث <5\$FXBA5ל7~)ZO6*eP(6͊vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb 'C(dA[ƿk2p嗗r֓S<}$aK hë1_c_޿7Os'.@_~#/24l{?q62v4tyൄi=!=??<+smk0*St8$gXIKq ӧ=*LJ.H 9T6$ݨTv=Η iUX˘KVNf Ds 8Fq`,vlUٱWf]vX]O+=XJԄl{_ rWAQI$漛/< H=7L֙oБNt@iRz@[LǓ  cӍH F4I@E**:tAXAɃ׉*Hы뇞(x!n?doVdžٯ1eBe# HJ!;c:ZXT;ӧA"Hw$,Y#b\LjԎt3+ lfр2n(+ M;C;o$@VOjfl)I+U1jv+AdTVV4 @ՌX>y%%P ; v?^g$mjcxJ0*Ơ*AA\dBA4#l!-P]Z$p@1)lqQŨ{b4Gb@ۑ@cKեr;z7O#3S]U@z1S߷Y&_Ö|1T+\x;ׯ"M(OP~-1P};t(ߗ\Rң%Abw#vU⁎LJ#zvBQ`is1K_ Jhv_)@l 0T ^~z\ I9L5Qb(USTr~YcL1r#䠀Xcʠ"qK1U4=rS` %>Yw9;56OQ qhi$P+䜻u1jjIB-ZY#ZR;Pz54IG)JXlAU%pӘ-JW|i] %ZSr-JmS߾4_M5 Q>$5&?g-Mv۾4Ÿ=cAN ۑ~T=SldRH\8@ӭ:w GAWZv8YQBC~闹R:{ac \ƴ: R'ȊFNQ> S x`eM@I}㹑R{v[ n(`(F;0uE)Ƒiv;{JAr-+\qC  c?P)`2|pPV amRmY]kŪƛS,x^p.@nA v8-mTDGA-N!jA"~3CjZV62ȒMʘTQVƝ{eZYŵ;c!y =8\D7n~dBDa:sF44G8/MkfjRޟvJ!#N/̼ݑ!6C Pю-~HjWw(_ AB8 TzWzx}Aj)ؒ 25tiN^OߌZT䒫##8kZbEC -VGod WzAu؊o"D NjvICl RzRӉ^9T$QE=xNxs;ԞvlUٱWf]vlUٱWf]vlUٱWf]?P:#hϵ I?VOx>xы>ĚfCƧ6zP2.Pi S]qE*ܷ<w)d_ӟ'mXcs;Vwo;6*ثb͊6*ثbM78ks:h)+/iv.wM͋gfOK{v[ qwTwclt}+/u7ÇL]_,ivmaZw ?oQPe9O1vUϕma$oP%c=)s?Ҧܰ)vf[_fkӦƌI_c8~՜я~}ؚ1~qǾɷbmVtUuf4#DC){Wf1??Ļ%tnĮmC⌤TYf>E_nYvnp+M''O{.2O/v2WfJs;7 VH< L{UQzߍc̝;wvlUW{e\&̑?J/㘚!9,~&X]wn9>n-Od/nOy 0J:/6*ث~ri[(oⓁ?9pl͛?aI^WVGȿW&U96=mN?,>t ٶH`t.D~?'g/]n&]D MA)9>GM"e~?jeNmEݹQ 73 eqtpz_(8]F<,3KJeKr+s<1n2@/Z_L":hV⻒z?i;m68 !I5Zj&g/G.q]}ҿhO?oќG/NY;1ȶmjld.j3V?kõl?1~T^ؿ֢]ʁG]{U8|H=&!xRe~^}:=>B#_L__b㗧OjdrW3<ܼ b͊6*ثb͊6*ثb͊9濕n5{u?y?ot|qcCsv^fG:E~X<]g|)}P?^pKŏ?No,ذ7 5^j `N ;P'gmq6*#ci88 !ؖEb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثu]܌hv߹[2zĿ,c1dim+0v]),u]; UցJ.M[i l?KGoT'uwm-WѰ!,oj5~1G:l4o/^isyvfثb͊]m?Ѻ2XHz~L+_&g<<2MbOӚ?rO'Wk:L] "(τ 6_χ?Ώ'Pc͊6*ث*=f>K؜a C2@vp$Etߜy>{&&ol =r2b1tm1z: );;1ӧT$u&_CC퀔.YlWbOZ`%d ǍAzUբ?guw'*X.zWj ׾Zt)Ncc_%n޻])M;`e;r SvƢFGer+#ޣPWbSrV!-*khĊo@\ԖND"x`J%Xn@-6?,UsA<ܷoW oe @btL3r@vcQMxY`T[3@ oP\(Qxb#ߠ1[o T5@PHiooCᑶM1fwyӧ4 U>8mWNR6c\l!bSJ:Sc҇,@S2G ZD вIC1He۠6`uV巶3 %Q ڙEA)UH NEip<=IPjV:'$iُ%)a)E !Lu~Nv9"-[Ywn`l4QP7 i+jR_0&H19劷Wi.6XnMݗ*PQ"ZjhzWx Jbib>XUfH&O\}6 :S*W$Ӑ"ڔcJPĀw\ Ҟ2,:U&zNj)}үBBiOl,Ks֠lzaN0hMKZF4鑦HPׯ }FP Z8UيBߙj6 䊩&N7Q| J{xVp'=xfq*I#bzhH(rNzjMCSbZ)5b:SlkbH "z{䎀SJ6PjX}";S\U 4bƔfwC~@;S;nAS|Z%VP*܎kiM߀! 9z;_egzdУ!Ԏ&14֛'#1#AZ%hێկ|p:x邕QA]n珣7 2(;ϦX`>,w-;mgRy 8y;M/d)a@R]|$%ezk?~R n_rMvŎ`z 1F>OƔo ATUT.t 6ƒK94҃[nG2QZȯ%qrT/a8)@¶# bRWrrj*TA@\o/%-e+*n 4v lҳb͊6*ثb͊6*ثb͊6*6hOjCዳO6*ث! ^ݖAj时1q'Ov.o82\?E1jZ,\;»擰VCG%'}+%banx$z5Q! x,rNwoO]d_Rq=*?%j7?1uY߾tث[E_v=k?vE%ޫƿ5K{CGvt/6i: [:]lxHB_sheÚqtU-z217B8 xf8Gy.!OTݫ˖v?ɘ*G?ʙߘF^d,m]rݥ"P_$_?.寚Z1\W6+Ք?lU·g<*_^?Q;mj8@$b@f9ϧlD;3AI)?:o}ϚdH{l[b͊6*ثb͊6*ثbȋ"p H5vpv&kbKjFDOt?lF9hs\zzO}M:.wgl+h-cC_,D؎)Kꃳ~nsН5xG/%;0 _YޗC(?L{D??/g9aݛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*?!lhv25*(!& 9Yd[{AKbJK*xev<]<1C3qCb͊0]S Wc®ErAg4n*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbkNDGF >#6*u(i ^WZ~L7'.lUkIX%]j`[kfG͊!M-tr"}\ت_7 {\ERUvbu76?O&WIudx9F/|>.k]b͊6*ثhj;bI~My;ё wr~'=7 U[)NgobiO0a5utDžrT^Hh9q'(rX4L ݄J׮"9mȕ+ˈ)i\\(#C]]R8A^Q/Z?FKeyZơE)׶A\K3:-hvǚ ԜbBK>Ɣj cvRJ1ڕ@ wY* Su2A;b`(),Q MNJ-:+UC_ -2ZW"(i*@`)f@ݒUDOT1(|vZJ"rf J |;aUb9q#)e㷎@7(^c6RrU(l{e;hcP#à(irJըxeWc6<<f m%JJƫ"iVtiA5k>XhO>jV mҙ|LAZZ2qkKLY}) {Fb'DT9""܀~Ԡ|IV-(azS\5 ăː=2n$ rʗ\!ufPmbi]{"J BhF l:+z|MNۘP5=z"2P0Ne3 Tzici(yQv(SW,o UzQ_.mr W6wm+J|ؐ,?A1z>bĖjtz}e @ V bH~+s:wcHqc[)}L{;b(Zք? SJС H^WEoJ0?j%O۶O~,KnݱߪƶbX70v.ʰj=~6Jk^]븩ټ+`"0iR>#|XOn0'd2,ň0T4yt=s*+dJ̌Z:q#c^`1*T@iۮ:(wm׾%vВn-哋( y' )R<9oG͊6*ثb͊6*ثb͊6*ث~UvE&|w.w}/|^.N.>b ;Fiq7`s#^3_\5'2~zsE^w?u|M揱4R9Oza_ F!~S=sxf]vlUٱWf]vlUٱWg;'V÷9~{;2.XWa/_z#O΅+˻6*ث>Uܔ`>(F?ȓuF&/gtsGJ8`H|ٱWf]u hלz- 2v?;Kg%ؿ'?΋6`Gߝԅ|'۳Ck]?yg}8KgF|ٱWb7weFCa+8?1BCHWg4˙|Z8^YtA< $Yax4k4D4n); 岉.䘻6*i~7oUUfo w5Dc?&Rz?S_ɽ1=g $O  h3qN08"0JFZ|tc?^odt\Mk֧.z2r软-<wgzC|O'qh]Y~$b|?֏hs9c/?W%铳WjP'4G 8;3y7ΗQf'g8&&?'gndd NXLL ^b9n͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWaJ l ߑ,QKA]y:(v*,3'E;ae5QZl<%M.dUԪxb"쵝v.ٺi.6E.vlUٱWf]UH+,a%<&]Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*تTӐI{4p!(?Ka篒t >{BslUw٣#XCbs;SH Ŗ(%L<):&mo !L1ʨVYbWcGb_1yYۅӃVɲXi_6*E8M/LYF^M6*G8Y`Q`;a6*t_"iH4ոu5;Է͊GGVZGF0UƅaBmu;x5%@pQm3.lUƵI8u{ _:1ȦĜSkeb$͊EC q]vlUٱWf]vlUٱWf]vlUٱVcRBܓT:"RK֟ObZohfSC$[͊T~_!L+ihW6*rjaʒB U8.e9o͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*|dXV }(4G[Γ 5{f7xǤ 'U?޸=GV~0b#n2v/'W`?7]ixM&;6*>Y|mOٸhҌ Tu>/91Cdثb͊6*U8L#I]_@$ PtiNzSl wȂ֫eFu>F9$)׷L$z=ԟ+KeJV*UUEk&Ps#UӘV@P++lT1' A)ˀO\Ac"l2Us|$wP:+]`U+Oz@Yo]ٙPeY<@r53z/L 6oo?F6JLLo3A ҧݫ-e)-<5rڛ !*3)Mn*k!y ℃a 8Ud JOluhvĄ)AGLhrL$I,SæUOF߯ (\i@m-Qv>)J,R'9(C$L(*XJ4~El/54\iѕ &1Tf4ԭw't/HB~W(3*~DJb FT#jWKdC (9nƕ jWcҘj[JZaF( QEm(*RNy qLx{b!U=nm1?FH1PVE'}љqN*DXH$q9Er5&i6#(}Z6~_٘E:{6S0 NV}l($,+*rBP}0-CV~]1`+ҝ2V:4 搗Zl>GJ% BIQV"~*⨏E6H*ny*TC:Jw *7z 'A۶4~5aw96H\SqIҬ{T0r  ֟e;F!$SB܏.X(GEBWСs( OO`sTkCYxdqҎamҙRHXҤTd7+TTPtjW4zt=2ېUbEj:vRA?Nk8yA[2P!$}P8]ݘv5sKEEE~C#L*6 H=Ic[RMBƅ=z|6ٓ쟄m)H*% Im-MܸTC_RV߮ 3jVRK8:*:A]|'%knJr?3*qoRX8P+ӹ˥g"EUwY;`ƀ}&*j\`yڇǓ,DPmte0q&#cڵNdr7i- e'&MaĞU癙/]%vlUٱWf]vlUٱWf]vA7lLJΣx%V?" ę3Ax_%z.Û?_NɝMRk;ȫ"~/k -JPw?N 7_}.έŻ6*ثb58A?ZWiطÞ01Ogp_]2f]}Ylj.X("E91pOJOAx q!t1E.5 OM5) qK}xgmԼ+)Ӥ3~~Oiӷg0vlUٱWg2[Y^FQoh>g)/JGS/hJ_?]>BQZx8ܥ{S#}ڞ/\yKOR+J,!1bPLe.{'J#>HEʐ|fqb_͇S쌹‡;9u]PnAg/g%Mv[8^&L}GO;;ŧ[Ggn)JSs1b#/r_Tr֗g|[@*38pG'g0vlU˭Y5Y'Ң$$+QyFS,c\ݭ}\< ??֬WxJTsZ֍OTgeH^H(]5塍ce@KǠVk;3&|Qǧ>.+KK(- HTP#F1PZR9JC&zQ:_%}NyW/hdml?&l .&߉W5'ػqN'`?G`'#LaO 3OaÏ//1 ƢTPf0tS);1vlUٱWf]vlUٱWf]vlUٱWf]vp4XI=wֵP0/$/gGC',[wxy?ק_Ǩ[Gwraw !C؎)7tަ.u"ޛc k:8g?8͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثvXdK`v ]Dŀ%xؕո cpH`f>r#pw0;uįvi[vޛ،Vsa8Jg!kv~E. 03vG`+KU٫0]*H:>AɃ rWf#'H! := .‡^'$UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfZf 1sbKVQy+/Uq6*u#7i.o`f͊ZOZYh ƛLتWDB(ิiEl2C#6*?<ծ}wZzDz8o8{6$ *ݿ͊.Dy/˷\Iq ;T0_OlUTao6*ثb͊6*ثb;g@Fסؐ#+,27_OvYW/kj02H#!f%ZɭL_vF(x#ipTM/̎q9q͊~h@nYx4r4ʛzz^G^UmoȔ[=R}F۔ЄN\Y-ybTk_F]~tyo/蛐l 6:zOM"\[͊ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*V_FT O8k`|,FKoSF?=.lsݛv;Vfóoiq?f~yɸ_Oci7d_5.ٱWaGM&?f(呏XóNwGakݓb͊6*ثbŭ.U H##!bX~ܿx'HGd1NIw6ǶQN)T=w?wҾcHZ.>58g d8wc.K V@\dT$OwDžsQSaBJ`Q^|O(i%ٹClxR)QLvU# 56zU(dF( {bE*$f$2?k23Q](pqj[L@P) ȾO\k X[I7a)l--!w,q=hN M"l__|x%,因ˡP:6jRBkF69Y*?N(Vp(ln V{lzKq%Jw߷L|L v Qۦ2%X5KP$1;niO-Sp~rbTdBaL9*KfE$+s)ڇr%+UO?ՂР&=)A^R-]1-i~J6y 㟍' @ C*yC(WrUnZ[\TLTv>R V_ (v&S2TcUB tۦTykzTmLrjn1UM;VajJ0CNHRF(E+S))L5~F퀄rhk]h6NGr{PfCqh_*jchUYP2Հ S%cI`{e P)4_ LJ rVJ9E}J&+4[/ZݡaVJ+ZV0R.+FgxK9"PčC NUثwڹ\|6c ]I /O4~+Кu6t~..H.9߮Ej QtaCE(3D>^M:TĚH b fܚ o׾6ā3oQlŪ@5E6lVa?ͳ  )&a}߉YB~2ֆh{bV-QOf#WjaV8 *4rVJ7ӎ`6Ȓl8ӦƁvڻ0$PqJ4h<^SInbˏbjwU4jTr!NV(OX|+B)Rz?l|f$eX(#, WQ=k bRlx +PZ\ %h;׊@: WqJĕFiLdJ'dUnU@o*&Ŋb Wű~p\Qj!dJd 2X:+U|9LF4O5u8YNLP=+%}Be+eM*)uӯ]фeher)HqM񞒹_ O [p#UkFARrw5ڵn.iH_H뉄^HPT4g:-iA/ZqNy۾ثb͊6*ثb͊6*ثbί;zpK>)v~?] C}rty[ Mv $mֻQb2/?ד72?G/RU-^J_ts9?rzx1'3l͊6*ثb͊6*ثb͊jz|zsw*?O*ˈe!MrRx ʚ[GD:"z<f`0A= ;;og%`$sOVwMd5_ҩ}??ᓰ3f]sńNPn$[c1.G9@ǘ'd'3ɏ5 %u(op~?_̟L#yO.Ք}?̟想D Xivh(r,6ooI Tf G_ge] (vEˆ>/ڹɓ]oc0Ǐn/?giރe;ݛ?KxJO'S -vy5˦Mgg2}L}o<_PzF޻ O|w=zcZ`?\,9?N.y=² '0_EG;$~B'D N[Nl798qQvm4pDx޻:Vu/$M66䠪˚=Odcl~_;/me*_\NȻL^.b+ܕ`~5'gQ]c/e~LiƼG2Fcq3{A##)ػ'fk-XsǫÆ8  ^k6yf]od*=HdD@ȞeئIb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊!?߮F+-'Ο>_?){S?N]`s׶KPi9=7 Q~^?GO:\+(Yw_cm}Q.>Q/gI~8}7}AٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vZ]&`fk,ñqK+UT }Xc*.e|jpNª;0jb nao\7be.`Wf]v^*v#x:`7A*ʡ:b<;V;Ӓ,iWu70.ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]J'P}kZ" g ʟhFH&͊{̟Pӣkq+$~\xHf^[CU5]4*+x$/O޵Y~b\ت9O=޼.fUOlP#V͊*Ď$]A8vܿ}yW?qɞTMJͥIgic>KsbJ8$*P3bb͊6*ثb͊6*ثb͊6*ثb?$+6*ʼ9[Nz- U"Y9HDhlU9u^qoj1#䕘3b凚?><-a{ہkO͊.?'9Yu][Ol$O$͊HC뚬q[FWxȗ͊+KC5Qq^+ d_A9? -~kڵxדoe?n2DHث_+ONJ'^HeeꮍfS\ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثA5AD8_MccuOf/|.H|9KxY2qsvlUuۈ{YfeH@K132}#L.`;nd:242-9瑉⏧xR-] 2ze9;#v͊$X\߶s^1͖O_fc,_ٻ6*ثb͊6*r U=_yjm[Tb#Srڟ'hJ3Lpꂽ2K#nՄ5Q\=(kD;_"|񔫐hk}ف^1 mRԡmA"ڌţF JSӏsATtPiJ㔔~*ĚtH4xU@¦FJ| I v51!mjL]!^zJ>0~,Te&LOŒ-ɨ/FJ#ƌjtei"RđҴrW\< )CoP* Ol4n1rQiFc̛|QJ?W*NvF6ǦUE.P(73TӦZiP.T F3.O!l˘?;OBHN=sPWl,`^ B/ m|>$=)ۮD[P` rAw7"BWUeRk- F_t;Duz}9TWŨ@5*Usn@BTaE+;1*]YA3kӌcLh6P@ۜ!mI~զH׷.* 8="f;*+J7PRqEMp)cJx5| KZUmhSVՄrH'GBNզ*Π;0dJVE_pA!v# U9/*G37ihzTm.¸m4z4`kN%w(SOϦkNFD?Di0’$Ys?◮_֗OQ'cavH3dvlUٱWf]vlUٱWf]vlUE'y'ؕF2fGi ݖ_=)~~?ʵsGԶF/ْ9eMqOv x?';'9`Tv:M$dThpqtTjƧ'ëϱ?05;'^PJo$ZMkOt=2=}Ǫ#G%3vEwlg pz}i[%Vju]9Ώslq{'d:{su ҕ\I.IGI;CK%3OPܯn/ƴj2}?_F_hMz#Sy~EѱF=Yc΋OP?kQ s%vlUؘ7C<"b&.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊<)?NYwZD)ߨ]/a$T)x,]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU/ΝkW󟚑,X[X="sF q璷z -]L3fYm`I ,j}˛Df]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfPzΓoYO({{)W9W?zGN?})6ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثڜ0ܣ_tNY#pY>K2ap/v􉴩j9#~̑+eK Oo9P$9͊6*ثDd%"8#/?m+O9Oa>@?9zq,}Rc%_N=xv$os <~q?Lt0LYrzK_> vlUٱWf]vX]RN[YHy~]NC$$柇.s(6sgd >YY|,Ic ? ZVMV_Pi*GZf!&Ps?;lN2GQ,2Vn!\ SL ;7|1U,ZWr<2Hz9CƔRT@TjŏV#d4NXڄ3`%n?$l% N A*{1햱ִmd R~daҘI'܃@{SdV޿dd!^'"k\ի5V&&:5|[ϊх3T) ȡۧәmȦ#^ F#%j`,eH$qy^N4x?7 FHsLD.k()R)]2 h~ 32`35I۽r@!lLN{sdjFX. 1jmr*H*sSlipeclIRإUxj;fC@kR[r*@,I ffH}hlm!nԟ asZ6sk^#S7ܒw1!~Mw& (Zse"$N"T ZrĕU; , P'BK*M5=2RrZ(n-P¡b!9LE)M?PRþ.2q@O6Y931 g7LU`+zʛ,2ԚFXj}@q4Z[P:eFJ:)S ԅe A3oAWZrF=YkCVX- ʅ@׳t;9 PT ޙ_B)U!oǡ*H9*GaWa*IڤPV`Eu=[LpoSJKğԑZJx1HfhzqȴQ^ OQӧcZ8PSGl4͂`v1ۯ4Ā1;e5^(Y=˺׿Y*.c)!mxF kōhZm[CCR9TiPu GQۮ*]PlYewSO _R8R\yPW8Jlp*]ː ؎ӧ|4Vb^Tn:}j#lVvP+@)~8Im =F`"eҝ-5`Tq(7!WM]A!UUMEA 2pL%ތ|}qyn1U[ vI| jK- n)PsM95 )>eR)*aV͔y[`iOTt_P{lUٱWf]vlUٱWf]vlU-?Hk±ۃ)da3'<bȱ!A$4,uI4M1 %Ie2=~.!c?Qg/G>CE12_s_7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]G!Ԑm*oK;pTA^b.'\/dȚ]" D_Mi/eggz%cv4\p"Oox&>j{w dߏN)c?.Os;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb :J`dZKcqVtLUL(2A؎X`Y8)~NOH06.͊qWaQoY`3Nk+ 2 1Wf]v`qWe8;"sZV^#gb-;]qP$]1CWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf^#8ryjzʏH$ob>s45X n?dU줒f_N]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUWӡ^5OJ#Qj ,}NYVEY!-ˋ#a΋i[?eWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf^{ g[Vw (7oWZ#ho6*(qs Zĕbgž'Ĝ^PMϛDZWY}yk|T,Wq2VoJm6*\ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbÝ3 ?Pc͕jxI?vٝSCc._~6njydbx~=.u9=9FgMHdw,$5٣,ӏp?˚5}j}yirGg0)C4]mNY߁8I|?b9C0v_.ipG$J/M28*k̿qήYvrT`M[_kŝ {$5X֧~kӗɻOI0f]vlUٱWf]1Wgg@ju׊{x_k5!5i#:#b@=X搼D$ 2׶%u*oBO/P(P^$b)MGFkU[`WP>mAL3C_n-iԁMcVo p xԊBBk]ʢ(()dIJ/"1f$֞v(Ȅnv&#d2$kSnbY,%sDH0 vI;0#Y%֍Tj<$n7'.S2:H#ҹr?,"7[o Z+RGC1G%H;qWⴢ"sT+J yPq4耂2;oRh@^(2@*qaU$H۸/AA4N<1$Ҹ*1J|'*W qgb֣3J7:wJ] jt)pZi|1IRkӥ11JԎ-D+JWlQJ|?!B:Ȯ&}+ZUhF*@:o(à E ר57&׉H $ ȷCJ79&T8KkQ* :єu_l@rDO nTw%fhTkaYzjH->"7=X#ZP #>XBTjkw6ۿl$*j158@Pb) @JuWF ~y5j`U/&5҇7jP`E,$䧕7^B҉P]2oH*LVq+~jUz27Ps; WU ,@ 2zb*:XTZU[{vbJƐ Tn2mPXi4c ք VO7%,me}ي ieKSqxRB)JPux zd3ѕ|1T^?:dYAM'Mʄ9j(hz䘩)xJXSL%-ӲU6є" fqⅣߦǯ(RH.[@7A q:2+^toDNA+.nI?gfZ:䮐7!|=*m%dסdo0 LJ\=j t~pqkmסz iZ?fkOQ{T sz Jԫwb-?eB\Uv &TTȼn |kL,TI`SN:{w9n0)p=6*wrP L r]3o#)׈cb݋\u[|o˽>P/j*yOpiU:ӡic%uɐ ~AFDC^Cmf)A+R]5:l?XS Ku ԎWrHkRBBcb.JilڟSև<$R n[jƟ/| Jp&79PmU5Hjf)a,諤yqEN-d*M7*UXu}aEvik<# e{E)Gv鰯ZN6TK(beP6 ZQK`B\;ZUhjhGl>;kJf蠨_=)~ Ǜ8­QbR'Tgvcثb͊6*ثb͊6*ثN~>)߈U?|; <𽿛 O;7G҅4yL>fo 7lj.qݏ~|.ΓEԘniy?^j ՓIԿ޻oh382_aӳyf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]Ioeg$G2>m!/XY2zj2``AcٱWa' ?O'd7>s8WUJqJUu6^d\~ÇP%(Ǐ$鶯kmJ3cMk"? br2;6*ثb͊6*ثb͊6*~`?i C_n9k;OCguV 4OI~_Ǹ]ɝWs T{Ovm} I;'jJi:/Ɵ˝Q//32by͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث{Yx08;ab-Аv!HJRJbr`1v&MI]a<&f*ث׮*2?fmO  2+dثWf]b͊*B[T`Wޞ-iïqb yo#I; ^' [b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb}[ m{A?ԛfMmb?X5M3g(AB}kYyy/wLث/"A֘({hp2r\تyvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱU;{hE,h*BofU3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*(`UA؃x_ΛyKaIABãⷓ*B7aZWcX\Z_5n 4_ڍhvlU/04_:&ܤ¬D= ۍ_m9#+fYlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*o[0\K~]銘FPyוvmib x9LMW o~찇*ޫ|In{ڝl=&$ԥz0ک,XPiOe(|31}ڞa~UOxMi^؀,h˿ߎ B@ڐH~*Յ+l%4JVY*)| j.ݍkOQZyUwpsJ+Q`f$WQn<\>qr;uMV;8x@+'~;v#`[SlU$l@?,k%HFi*+?zr:Q‫T(ïl;dx0aPH0۝" 8A-&֋*cM7 @P1U!(liN, _r}1& ې b0UFP"eƒnUzY3=[(*ŭFYBjU{u?~+mGt|jҸČ~ %VrAH=zd7ǒm(()] )X¬΄m()^YV\NA.OM7SCwr%0Zm81@ȔZò}#IR{ח؜n^jrA^>XCJ_)#zW?]!m`ڢoDp Pn=@JW,|F_(NUiiqO&uW27kT=BA;'cenV! I8!"iRsIٸmx`Zh:9].}/*{s5_YlxuSMGu%BFh'?T45ȃI-]]#LGM~ya)2E! ]7'aJR;oRک|ƻ?*}f:v pX׼KO1׸cpڀ[P X'Q6゜l-!(R qޘFG4ō:QYnRertOϮ_҂ݹw3 9Lm4RGx2 Ѷ\|6Kz^KD5f߮ 9LI|+\ ^Ru+AW&0CS !jթsR}qM EzeT%0bEMrddU> {̱]kqO7 AR5*( 2%j"ƘiHuԐ#]IKT 4Ͽ2x0id*zWZ܄:Wol#Sj3@ OscJмFӯLU}ªrzwv뀭,sv( <>hd#.ǚkjHB @կ<O3b͊6*ثb͊6*ثbFycMR/t,qc>U/?9>w vLc~v[azge?sm3vm vOQoaOyz]ٱu͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊r1אyq/..a'_~g-M 1dPC)F/9v%w}zR$Q֜!</Ke~R5:U//j[!',تO8渵%Ab5 ,fcVO͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*bJաK9׌؏GĎI2lUO?#Liah)n[-X_U5[0As*IZn^^ ˇÛ}*#! PAlUvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb|F6g!W#OzOT\(cS R G | )*rVB1wB1;ӯ)i(A4iʊAMJL1!PJ2䆐 :Ư*B.ٔE Z?f GAEi{,oBX-M8D(Rf5?XGんH8{umqESqID1s#s ,l^-A;| {h!c,nQG=W1LKq+: AZR(Ѥnl74ع(\ LFHt\윋gr~"o\ylk!חǾ:TP% )GYIz~xՇNAI6Ӏf` WQ@۩?k(DjI'V=8(,i\pJoJǀ"~|? '1]?s;Y̟V}#lV1i=iYJ vg wx=)3:(2I Zj@Ib#>5"$ǿ»b[\;0&ʊkoLX rLV$֟f0P62SxҐܞe:W*ҘQJ3$Ƕ6Z\}Cmq4Q^9n.I~Dez*O| (V[1F:c\ ќ>XAB[;J+՗L2;o}l5$ )`@ۯeާ%vDpMM6SZ+]2 %ERQiN4͏5Rv,aPL',ky}52' (ܘ VjbW$auL4)js\ih=kn;K*D Ng T$RߦjS,SeR=>D%0\˭bE: ;?oՈJ3 Vgi</3b͊6*ثb͊6*ث NԊʼ Qz<^&XǾCP:^gr( 6*ثb͊6*ثb͊6*ثb͊6*ثb$%B0ju y$ĎnCb?2˾CW _N]W_v:=W'`/k]c$vT[Q8IU|/ )vlUٱW`mGQN$H*I>V\)ŷ)eGauY~"hEdo}c3U3~{/I,],uOb-fc^mw}_rv >qvgP Tx=8 }c??3Ɓg,7R~Q6e%/.}1'c4Jѷ0_lF#LUs~JI"e CQ_]S:vlU9a8zӜn`O잟~CObj\_(j|lv  'ΆHt,~eէN;^kgjKWn<Gvv.hvgn: wflh#'ϵzj&g/c5gn#;hh'P)r3K8LG(87|\LP!oB #Y/P~输ڱg2~?JNi]?e8,tb?W?G𝣥SP.hn"76Nٍ>RؒQS;+5/9 o1_(Υkƻ |u'+W9ҍD OlZi;85'.TΞ+_vq\eS$^ S癙'`qݛvlUٱWf]vlUٱWf]vlUٱWgڰ6MWੜ7mc?#4}?/Yxr16^gZoơevƬ~d|_vX2xtD#Qœ9g1]VL{sA//gx2_g;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbǣ5]vlr,vYœ@qK77 ]R\ [zR,Gd-UrA~@8_^Aۡ )skPLmއHJۭIؐ)T2O MKvUv$PVo)ajwVTbI\~`\i\oJJda6ıkvE: QLbkTUOvh; M]_=C)4D턔0ja*rKN|PmP() ļE@x񪂻\67ra U|7 S~̑6TZ=c\ ĪqrQ i@~ ʝ+VMrHeZQ`FKLz@MH_F#^Hi )xPK!OcV&$\jDA LH. J BC+n?Ŗ,@Yijtc"R}it?q ҖR9k!JۭZSIq]Pj$BO^9-(qM6 IOMM+e۶RY0]g( #q{"#3s5 #銬Qa RzR%w]/6G^ߎ_ x] f SSʷ^=N(_=r mʿ>`""J@Cz˖cN&?yNTH &PI%P e4 Njaew@P+6͒BJ^LI'Q_ jLu⢛vX naG996z qdƼM[j9D.d'"JDZ"SiLhE@"R(~ך8՘ )KAHw("%X 4){ 7@x7.8x=V%#|xW7`v߮[ !zLqBhFth'.G*miq3_a|63tJ\3D $ Lw@6N>}rZSҴZf#Sky= 49Lō\1f`ҟc %YԊV#psS u f#"ʕ!wZS|8ّ s^(,Q#( (uk[+&Yy^эYmtCy2H `ʇV"z.X2 n%zʂ,RBRJ^׮Qm, 9QֽLT38!0܆Ѫ߮%v? ɜLqa]޾6*ثb͊6*ثb͊&v>g= 4"͛Śݻ?ݝYrf$g?G,O&__^9~?ؽgLyG;~OMI>;}PGa3.?oƳNt6ثb1VoΝG4 w7ljY4/K.b/3WWdKD[ַҭXֿo7@0G{/y ?Ļ%ٺtn͊6*[C_Cƹ(`eˇ<z]rn:ۀ9Õe#=tسx7f]͈"Ǐm>(ÕgN{ȼDl>c滰%;Oh޻'~nkm&TBG5"?'C4|]n5șDJӈg?'?1Y߾rثb&bZW*g;ۘ2_znÔeĝߒׇ.A[4^GrvK0+P,x%s ;*\:D<]~_9—/OxWf] E{yWkwAӗ/9݌)Ȑ$?飲+^Jբ #?SKfsQ)?O8 fc;; 诙/vlUٱWf]vlUٱWf]vlUٱWf]Գx(~N+2wOH=Ojrv~U_}gEHɩ?s2'?Lpor`;WNuZ} l2_r{'SN=Kݻ6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,bRᓦئ݊A|cݻwm؉bpUٱWf]v9z[5;}6iɛ}kX<=z>#8ȿ({,͊lثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*oſ+mN&*&ܪ4 _BL7<ث50~lJ]YPu"/Ǜz/<[ڳ˦ܕy7K?%Vh+lUFiZǨiҥŬ$CU QyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^vz]2z9 }B6'|qX!S]񴀑qR@JoKAo+4r`IzÏQHI qw?g4Ҙx^c77*|R1ȯ!Ĉ+)]D;!uA%T Or>xyRmeca)sȥ: )U>J6Tmiy V[S᝽iS, 26FPӶG<*GQ֦`).-M,dw4,>.ٸ^k3Z9d('QFfW$XG{qqrAڧ>[:inmAmL1P* WTXnxZ |N+TbP+zeqJ!]b1nmQX||"K8^ED㘮J+ Sg;PZaJ_, AWmӗL[5+{C΂㘮Ң\]94e+K$mJ Ƭ1=y|)@_/lԮFKV!:)z#CM~J=သB !.o\O 5c..yU O7$𣼧8BVLa;I*"Qa)y޾36*ثb͊6*ثb͊:䵝"?ȃ& 6g&Jb}WCaAȅ?kړ/?Ob'xG;"{]ݟ# 4G`X?ػhr}1읝;:vlUٱWf]vlUٱWf]vlUٱWf]K:tǿkO?3]?4VF ,d POk*?|{3Q5-;',aؿais W82?c.+9]kӏ ~>kRGFQv@&M@O?{ U{A3xGf]O(yQI'_=ۑ@O잓%YE ZjƙG`!#/?gPn͊щ;RpFR2xH?Iv6އo8>#t ;={b͊6*-,wA >&)K˗Xӳ_Ry~ M,&G5A<;;$~rjP1?1YvSCS33% OMvc7D'slg"?ҹ4 `Snzҽo݀1js?rpG'_Sqԧ'eaR}[u?vtO:dѯX9k qvrʫOQG4CYq`'vv;vlUٱWdCUr՞0?  op~t{zkj;Cy[Ju0IOSL鵑! y]s@N?^گƳ{'(;nw;$sEPI' @A¯%+WƿOϲHG?4}@z~̿WcvWՎ_0֣=~1iGG1KҏrgLwgEΙ]vlUٱWf]vlUٱWf]vlUٱWdoZt_jC_K윜/O`K^mwjONi{Cd`YkDN5iCOS켜|XSZ`M,k(_ebf+@j+I7 E-{GفJ/lRĚorp&gOib>,i@̬6bC}84EX9o8-";Df3¿ۧnx-ۀʴ2VDžb:jE:c}F.mjG`zTǚ8iKf\ʻӶD-םњ#ijNe2@0A}do]"‘e_ٽ,ɩ'!@`~0x1젳Ca⤌jVΦ02PKEulސL1) Z þQ#ļ(UTWp/31jE9xAJ9zնLJ'*S KhWw7+~϶S%w "QXTH#7 BtsU\9Iw ( 3A ~SýI4+^5NٸW|,?;&yf]vlUٱWf]vlUٱWf]v5cRh*OMnR/#Cӵ|Ƥ~'bH _v蟚Z-0+5.??ޏtqq5Se?N_Os;;p]&S?~ضk;SD=}p|;M`e=x׼cpMw0HG)#0! st28vroʉ=mu9ƹv40dݹ(Ļ;vw;6*~iEB?lvo1tUb_]oiqw"7Xz<_%ճxf]_Fe5Ľ [1'

|–]lxHB_shӳ~S[Ux~\o|dݹ|gin#xdJ9"@OBF$.=_z?{i/_ϩzux@_E][(P}zF<$D 9ꋰFXث~rkJDTf'c?\wP6?/9e?z2ZO ˎ?@?Lؘx1?q;{8AHw7ւH/)O=\2g m[řv\<~?d?kGO/E4vA5 LL~al.#ʾ A_d:YKG*.غf]vlUٱWf]vlUٱWf]vm~i5_V7O W)8:2݂|()vr+KXhIaeAWsIjtS8f?L]Rմ'㝮Xq1x\3d%vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v |R%Xn2;ȥٱWf.͊6*ثWf]K&-bk *)]S eb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*yyGЮ!hR@;o\ثSrhK囙4}F>"i9;Դ<|ݓsbloa;WA2,XrG_f\ث?(wyai-W'h܇GQ~/{z/=暭hZ9F~"r'o6*3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ӢȥSpsbvW7:]kP^J/śy~8sB_VدC/=%ĿW6*¤=״iZo,kRRHXx 6*y8gU1OݲOQ"]Gԍ_obM9O*K󎄩 59Y}x[YEז}M=1X3bC?<[qC+qa`[+0X9͊)RUS تثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG @i͂P.P.9;TTy0Rx> k@7y+|Ab5&%@4.(M+-| CYpUfkPPaVݼ+@)ֹP5 BN( w5P}8R:xT 2hC%^jZxThB7 =QBԓib,jz bV1*ëuqHg~A`VR kL))t2!]N`wkKn@(5O$E^6"VTZWR#dnΠS2|!=sK|#7 ap/j}ҝPvrv V]sF`º{Ņ~uǪ"K` R7VmLVAPjDZyQ1/ܜr>y[i<|$q%cP#($sCx4;*|1S*7CB;č+dHˡ8-$U3 n I=R QH(nn8y!#+oN0 R -;zzthh^EI*r 1n@$ bd:d)/,M卲>CeBTB#瘂ᤑźe O26E@UY꿾*)B+0:Ҕr`aJ"ͱ frdr@ 9|2L4(V&<0RJ^$8vQ[RN$4{<+=阮$ l3GZ\m5k S(q \K:WOpɯwnLkPWjxaeJ[i4@ \Dꦑ/o|1P:ztc`1g¦@Pxf \Tdߗ,69Pw$T&*J  xVF\l9HdYG|d-ˉkI1I(:t)`&ۄ6SX7א;)қ (il2:dTR/(*"fGe!/Ifn-0pzT%{Ӛ^Dr#KH.Ss'OcbυF[#DeS'TDž .y-yN63>[S1{ ߓ:WCog0Z[2Ćr% ďKt9я&CW^NK mc@|3VX(>b˅HղacM(,>/|wr%<*jVqe'XRSP=1N6N=plL ,)pIRzzSd{w"t,ֽw`6*ثb͊6*ثb͊=8= ?dgN./m65?g=XRGoEP?./+-86ƽ {ga*.7{;8귖5֬[5NW>9?+N\Q"n25=_#/^gz5U ،LyHR>i#D5>u挿x9#;\R=;8Wގh,yfK<}bGjNjO!BNbhwjq _v}kh~eyU'`E:q-9Gzn!s_L/.W|q6өГT{2fC2O?zCӓ?;:U^:s7WV}a$/O#>DL]卼e4gfP{TvW,"+_ai{ $O%ߖ|nn z%M1Bɚ.zKd{z-^ ~?gq$BP; GΧ32d~;ɰvpE!tȫځCfBiN9 r6_OF9 R\.랂@<ǩȱ>tZ 4_ggd2/O{xKhdz]VP/o;(sLv >gYxV5fKD8OlZi|r|r.g4/5>}ߛ]UnbGo<ޣȑE$3,S.QZh_zzڥB<_{9"ۏv}; 2,0tpYMA)lUvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ u+cʳ}'ӛ>Ms/RPE=-A+5x]80R/{HO&ӿjJuC:7J4"ĊJ'Df#a'PrPr"M(wb&|[-w9wPwNqaEkL4ĺa敐2PwqšB4” v&t^n=WC5w+IVQ֕I!+T푶b*JŒSLM +m&Ҕ bBu r4Q x6jxe0*i2 I'$t&<5 />|+cA1֦Nc8lW9g?PjxSwI%~ek<Wg0ZSҳqjnHpkv,!xT.4uEpAI k]vĄn讀P/Ŷ5Ipv{-|6GN"”`ե+{ 1TY9Ɣ@kۗ\4Z݀j(Ɲînsh2H?#L]F AZڹtŗ] _N5T%>(jf L@l ]6""v`0$-PVWL4Xv$צa8Tb}8lkᩍ]|1pS3T `\$#åxF#f+%BP\LXjz7i@/qpl0˨p nWQ ZclTE7Ċ a)}yb9| QYaF2M^Ϳ*?81O~quXwrHvl|h's[ S}Uk^@pi~y\ N .6.MUEw j0Ow`Qa*M~Lڵ[q_ eOJ叄-8Z;R>c~EK RNYWCcᄝ7$-~yD7cဏ5DT SMXuwFaH[߮2Qf0ͩ5!zW n>~#J0{YZxG^>|\ퟢ9Wf]vlUٱWf]vlU/ֱ,1Fz~<8?/ŖGst埜sr">Ϝn{?gXl{gS!tXܣ:4xqB?^3U.,=`qvlUٱWf]vlUٱWf]vlU9@#Gcrc/?)6<d;P5aq-&  =dHr1?T}.Ųl=Q,w*;nVK0Y=?Np~vF&42@Ϳ)żgm]>?NΩ{;6*ث+&1[y xч\v1>Agh~VT9N^RdPPIaqW_q}NM>9~?=K[y3$]NQ)} &to^S/`?靂y+Pe8YZcؙHaLu0zv]T?]0J_S.0)qdx?΍;;gjf]l.b1vFx-s]Y>>;=7iedQU{Rԁ{IN{C>̻ }"уg4_ ٕCsœO7nf_a۠ Q@DE Qv)bثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*~n-җ?,2z5X踽z?"GX;w;`4(>`')$[V?O|,eRf^a9?fԔVUw·BW]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱUʐF $6*Ƶ/+iVkSN\bI>H<5e_bn_͊D),@Z7(-[Lتui~iyN6>Y3;tѐ6*B~gk1tU66r~4͊SqV:M)ZEK Ȭت/CG&%߳ԯ+??VobHz&Km"`j=bWĢ8TPP:3b zXd1X$ORyYg㇘|M2x#6wm"9z^lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ |i?^U>I8窬@3/R`hrl/vMw˚R8wȖvݱb)ZS| C$U+f;?E3SQAQSZI.28<0-!ʢiԑ@I(RXqsݯS$,p;vE%k1 +.YڤPs$|-9mKw>P2!x`| %ǧN=s#r^8w\0!$bzGuY&27)>x[5=)O8'"> U A< /2ms ;#rV"WP限ӦH gh98qWjIG)A9sAHF1.P~SL! TrQFe^88m#F~#Z|iƵb~W<)/E)O|8Tb\ =jxdYpR,漎D %.7H FJQ4?~K 5ACh\;}U֙#SMnTGӍ`=-g/kؘВ߆))Oא+!C8+F+l{j}[m%lAuUfۥ;e3F2 Ϩ-ifl6A+L cM PW,!C!Y+rB pZjD|REO-r#(\ͩ+la,mBV4+nJ4$1(1T@I2ʸ*0&[~@d|:gpںCʢN)3$0x>KNpG.x|1ա*+FA:M'-1LN֋mO3VpC*X IuY5rP>i k۾7>N'MkS,l/Kz`Mٲcd GZb_Ƕ>|ǡq'>GJ=lhwɌ!ikRm,˾G(:uߥWK˕5فa㏄4;ǖs㏆?,;TV |0˕Szc9 1m&#oJC +k~5(eVj#!j\c\W6ݪ4.(Q/B/CzDQ=J>/I>,ZLj'ew0=Icj 0SPN1Zm2G7Ri~_ /SoM//ڥ`LUt"iU?2ױ?t3c܉z ?NHO~v]gi|{{Όk6*ثb͊6*ثb͊=5h(ʠ}=V܉vq͙9kl?4M6/b'giӉTgu@lS$ٱWf]vlUٱWf]vlUٱWf]K_QֲЃUEOy^<} p`Iz>WG֧b//;/c:ܾ.YKG/ 3-vtK9le2Zo-e0?>cbc wQ:I79QMxI}>:\}^!@8gjpm)L`c]WQӏi_sn9y?T~w?_?lIշS\[e}qS_9Z}^LxvD'4(e1Uaix#8;(!/]oMCYP?'1_R K$z?4 DoW:Ghfϴl}1cwW7kbW5fd S1%#cH89xD˅fen]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vp=~򿄑7,g8I?^i@nN 5D9睪+<qһ ޞ?3nثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊H bv?mӲح;m[e}]Zv8ZӲqZvQlVb쯫(vo)v_;7ӳ}YZv_՛fbVlVfiVlVӲ;4QlV'fiQ8;lSح;,Y6+NxbRo V'Ӳآ,bbqM;,NcZ ӱQ>;Ki6EO6ʝ:dmi%.˦E]]6*ثWf*vlUٱWf8bˮ*uk ў0PEISiwm#Xa#S6#fx8;7fb쿩VGe}H쿩V';k6Vblح;,[1i勇+Nݗ;]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊"/kC1)=J)V;c>;KO?huNV s5m&3zhٱW9WnI~d Uh̛fE5xr<G8IHSӕ~ʿ_y6*xId#U fWf]vlUٱWf]vlUٱWf]vlUٱUoTyc4VgֹT^x<ϯ^CfW-OۓG. yޥ9WyE:@Tɳbwߝ]w.i\aQR[ϭdMR*ſYUڏgV_=Ax1Z۾lUi~FnSsv)fNݿbNMUK '{Vo|ث2U3b]vlUٱWf]y漢\sv,x7"YuCڽN&=2 mA JS7FGzFA :m,AR~:|9  ёJ}R b\?~ MjzL$%ʐbk\pqZ@3|,Tӿ_S0' Fo8-1G G,8(O01,+` cʭ҆~)Y1ޞL6 b 7 6xJb~(Q,<;^ҚiG_ [`iC\pypZ ;l^ԇ{⇧G^Tkhl2 MPzޡـ'Nd1|z)rF  F;厴ǁ>[Sgd[<-m2a㶳X'*) #5$r ߤvH~ᎍf1ͤԡbx*q,ƟͩLaQbqj-USڹ'ln5BPNxV._1uٌU-Q=61_ Oz9j@r^f1MV\v hꆟNn{|6Ie bHƵZ}e>LCXߖx Qc8!zo )AomQCd\oJALo|kSe\n(1eOAӔd+r^&3؜V=6l-ofQAAg`(zSGUgZ+ad g&N}A'mQ(; | 8)$"bǑrb30䒒w22&{RBDc ~+~Ȧ#QDq0jPc8x. _Jbt}e׾X0p3MiLl3iS/ 6Lnq V W8!-Lj2Cr'$Rq/Kyۢ11O?vCŇz< ,.SXIƏzat"ccE:m7ݖ4@pDBaR- ]&8RSN)GGBUwpr) '5&4ߏ9FVuFA}@48vF[5ǝ-;7ԈQ䜫cN IʎT@ѧ)S:?iOjQ Tu)L-&>d$8ZB?g"urG &/Ɉ;o,1/EYHO 6? XTI'/ӋKxUw(FXdy‹64U݀=&A2)^]党D`-|3zd88Ho"ک4El8O+`Dji,ljiTyVJe8 M"-X#r̔jWI~1; a*7{=Aҽ6*ثb͊6*ثblǝ;;S\;[|/6q9߾tثb͊6*ثb͊6*ثb͊8CVHMqˊQ ox&pE6n)FB321LJ?Nӝ͊6*yZ{2T ۖ#4zɆyُv>;%N:+0 BjTkO/ "7t3?W/.hv~ZӵC91r1Leô%(JHFOUa1#(fNDO<.ø-A*f|b"(z]tdl#S$ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg5[3 _EmEs|4G\>?)wtثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbļ1Waմ[mщ%feOxʱ. ٱW_ڼ]v$WG%F 42HWlUo~_-hn}Kf}N/ʍ×R26*/;`=A 'zB:k;p_#!͊͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb"yEf4\IX\E,Ex_~67—DZTw畏c:u}GÍͤ, nyV_7bN_޾S?Pyoϫ-x;U~گ&f^D?APҿb 7-`b9B^:l^H2 gרg6*o%fwΨ_]2Z1U@6W%ēP[YZx"8f͊?YL\MI7So$?6*!|]}uVHL6x\sHCgf^.Bc_V,bMei `szǷ\>F;ZoY+C!km3`jEpl_/tQ0 8-1g91a+(0i&N_:/'ma# s O7C/qTdc@'iYa|zՏLQQWTrhAx3%O*8㽰VS!bXvRc: wlH+:%+lwd9 P'++XPVI//Fw8i߮GeC2mt\՛G C! 8Ke=ɥ#{!9s~9%'Z1ΖT]1Lu'"u4oy>2'Δң~WK(|v %iY?,q4b!2'VV$!c~#e')3eT$cQ*}›Gg8 QƇُbr.vXpzsU|*/噒(U*Z~[x 7<*%Af0xi}$KͽoS%׿ћƚVo"@3Wpq"a=83z4Fӗ_"dYRH_I@=O3sLjk5o0þnx-5m;8H_.\zerĴt;mV\i%\ICWʕUpZQfK`(IUHKA/Us.PUiQ1oƠ;)W(RNFˮB],@?.V\mUePaDS6_4NAW6sB vߦl ]) P'R.mV}A݋ ޹U Ǧ^SILUmݤ+_bu8UEV`dRdDAOAoy?oՓ4)R@Ei>o稺Gf]vlUٱWf]vlU>xB ӹ8Va/ڿ1}Ň>tثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊8wG//ӳ|ӳivocp7݋.?tfݻ6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثka R/Z[%h֣ ; v&c=lW`K]b]v^*qWevV*ثb͊6*ثb͊.Wf®́]++vj\Ux]WvV*ءٱWf]b͊6*Uٰ+*UٱWf.͊vlUٱKb͊6(vlUu*ܱWf劻7,UٹbvnXr]*]r]\ ]\*Wf*+ɂ;2W`[=Dpi9WC5`L(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUg040cʣh?Y,xUb(?5l?24uԭ> u ؤC7۔yz~ňgWʿ63dx, N=O=C=WGu4k]~¢ =TRHW͊Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU_ 6d 5ZB p6uɍsVPoˬIxy,O/(]"ۧտثbGVlU'e ۘavXtɛ4_E͊~Z~r!քg!8\Ok^ԶWYsb?ofeuHFO3qlU:'4rW<6*4%Rqi,2 lث9͊6*ثb͊6*ثb͊6*ثb͊6*ث;uۭ x\=׬ DIO|<վNlUW_~4z4 6[L WyWL<囀t$T?z-yưU9Z.9W#y3QԇQDT=obq͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊X F?#.Le=Q5U9)^7&/*Ekp.S Iof4+B|C2%)%coム@tǵ HT;BvbUww1]A"4^޼_~l4j:';bMQq}jr.m-QV ia-Ac֛c|?Z>?v0ʻK?;ʟj^,`*fy_zFJ gcJp'aI§[G;PD2ZMtb0 _/{+H~r)OчǏz|-qKdG$a ƗxzFv(Lo@".tEXqD?n)b̦Bqߡ `R K{XwƝ*AuɍTYp;~)QZ≢T B&?+NeAC_#&b!U<}K@;L+pMInёJP?3% ZMbuD/_'5,iP2?)U(D TZ+ިUc]RQW/!,VH),a:EU@z}]<W"p/O9JQ0 PS2&jfG+!Ĵwr*W,kHDҹ|%5POA]働i^&@E:esD4Zy*)h}\O%ۯG'}q&Zf#*V{Ք_%k_-)hSz烉i_ ĚUˌI7,xN$P>Y`M+YJ^E!@Uio#҂AZ[&kS1ip2*{6*j IN|ണ2?p*hAmpcrio(4b (ÓWIT| UVٕ? 5s`TO$!4lت1\+f]kC EkYsuW+"RB*mPqk# jkRFbpڭ[boc[,D삇lUry0V\E̕P^RH `RI4kLp* ݚ-UF@l*`.NjlsWVxڊ7eWU+'¢{b7OdwAn+V$W\ޗvlUٱWf]vlUٱWf]oz6";8$>) g>ϡ!/ۑøwSٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v\).!W&EJ4e \Eο'`ܽvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUÿ2?y)S18PG?^LIs|¿3p<c3ϻX_?w;"w.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*dp=Hv?&,~xdCcJƽN5v-]bvj®bf*ثbLU٩]6*ثb͊6(vlRbf*b͊]vlUٱWf͊]SvjbLU٩٩51Wf(vjbf*‡fL*bfvjbLUٱWf]S;51Wf*]UٱWf]vlUٱWf]b͊*b]vlUٱWf*챊/ƑSv]H.P bثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*تS.]&E b<@,(oD?sb?/~LERVWN 8enHnd]dOxᕲz+D  %ZBiaRVŖX i.@<N&pC {d?1&i25OF73WINC`~JJ.΢9!u¿mѕx9e.T,~f늋=~\FPHlp{`NLt$uBZXt?߀@ n? %s7m*[ڵw-m I凒Ri3Ǽ0QDj%1Usנژ1=Rqo#Y4w12#!GYUb@t%N|Sυ*mmXeMUӬF{햮@19 xmby5F_;x# :I@RG|Uۮyy*ycRd@P~_NzFc>X<^䈒%9W߶F8RY+A+~EQJ|xKU]Pek#ĎeaۮljxUâZq_fļ*#$p_#Ԯ2&\*yR+~EbPezS^HeQER N0qG)<|c߮$-IƟ1 3 0 &B[=Q%Mew=8<0R:1Zi?2LxJ(BXta%P 2ĴpCZ%[o/"G^>srĚVm\Wjw9\:()$uV?%xS5pZcRCZ _4sv'N6_oh!%h~Y % I9Fn,br[ P r:SOljt?ekڪJ5qQ{8\lPcNU{v2Q%'ഢ%P7lPjxu͊\€+ֽsb1*Nv3b%QSҤV"I SԔNUZ^+KҜo\QƈٰD핁QT,U9nL(Xݞ@R3bR)OfV$@ Ԟ,aU {tfހwUudʮ UH|,6=98חJfU5a㛖U7`IʮF-q߹UڹJ+ֽ]qR]>5 Ɩ%(4֏NmhUVuZ]UCxNnX)ϧGG:%V uvbp%YbD jrcj`̻\[A@+ٹ`ҢZPр@^<7DkJCN?s&zfWf]vlUٱWf]vlU]&_V ?4?z,&c>IpCRݜ~.·usYMN_t]wKմOvM臆)}YkKb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb$SvEuMc "gi[_W.'v粯->k?l?Od>?14YQb$?&?cju> ת?ׄ]H\NN']`}ʫsf>kvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW`<|`b; B;o_釒CZc۾D; \]]v_p+zxLKבu_[ ~ibV );3b_$oԿҴ5, 0r XCy/6*{Ƹ%m |\ثٳb͊6*ثb͊6*ثb͊6*ثտ1<:gZ<n9sf%W6*5byGJ4S/fX+fkhHh:rUfuʿ4Ϩ- ~Rj6*__^`o̷H_Fg-S2,?WJ~lU;GЧ&GTt$P:Yփ Ji=v.f^e8k _[%ZT$Rh[i__}o;K+UGr_-_1JRnDpI{oF5g͊%uWBXx/ٱU\ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbOn+ۏsXkpzg-.Kp:u#S9:eO.,z~2rDCHI5p=.d*ڥyDu !^ _Ur?QGMLB{ШƸddInD`+qڿFnY.%1ҋp?h 9\d'~49aQHK-$jPte XHy:LTZ) 8%R7*൥ e0?^jS6q\Dk ZG7,mPS,itQrq;f Be lTj U;#l-)?G)E8ՀٻW(<"„4LZT(h ? ]*N^ITSj⅑[+բ`~{'a6*<3W FCtsf3 BpVEvªn|Ux-y),vn9'f銭&'zրf[yTQ rf&EPM(>yuDbckQV哂6o،jKf*q :\ZU~2HǚGlMe!^f ZD UpZUūa8;卫cN]m( TBس0nOA)i,9AAa5ӹ5TR3V-iqXsًckMǧT֕ku,1%4#3R٭p_-rK UP|X-iUQ>[僉i ericP:wsr֕~|"7,6mf |3*Zli!I_ᛞ6Y~ x\8H$-\ZQ3E=򋓃֕Xh@F_,͊6*ثb͊6*ثbDyB[H8 B/kÚcrݜ ^[M2|z>=/D볡B_H8 t2<9?/o b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb5=MNnzGTEx~fO_^68#dW9^Ϭ?6gi;Uv<%?N$ mzĿY=e/S|_ayM 4֣>$j}+sQ8Oݮ5~ǝ~{]Qrܶ_7=Iryx2?;:u㿜pp"tx8܍e+Gt/;FB,IْwX|~?o2}pvw:vySz܃J|3̵#9}SE0ЏaVb9͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*c[Y`KI@;'eUڐqW`Yد֓&L&4fx۩i-۩ic[u3}m1S7[u2۩I"L[LimƖL4u3}m1u3}q|1:F|4fim8۩ƖL\۩Wfƕپ<0һ++}pxavo{cJ\ƕ_\ƕ4a{+Һ+}sWf4+}m|4ƕٍ8۲<4[Wel{Jxi]cJ[Wf\i]li]cWfƕb`voimپ1fƕٍƕ_Y۲1vo i]#We}hxcJ쿭 i]\ƕY_ i] +)mپ۲i6XLXLimٍav"> EE1K9|(vav͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*hRthVb3b2b|?0 cH05Y F$i1OqS??M_qثԼue]UJܘžq dLثȯ켭4_H]R1#|x7gV>_]iڵ%"1Fh\ij0\ت+6*ثb͊ok=8(2:?dfX??ٱUmwQYŦٍ@oVieO6*O_8y@uDUynH>OGYVEb8u#^ɯ(m]3KII]=IYf$V)[6*b͊6*ثb͊oo]'MjH&Y?g6* ϫBut)$PBQciYwAW~RF~zn5kiOelUyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWcQRq&;Ddկn8na^ƟD9]>;uP3.l@eZ`PAc̥j9TkK1%*@{w*RBԩW2:%a$R cL!/]*ZxiR$ w6]$bmaVG/?U1U_XHvfkwp$^|9U%QVI$%͊fB9Hb: *(V_ QmN TLV22 IL* zE#0Jcf[UH||UrZ|S[op#j69$YgclRZFiÕ{ U'q*<jUcaU6n5qTZc5&:m߾jj1\Ps`JGl⫽zl*i50[8=6͊8ju2*1>.إay*9T/ċGBֽkTw/ݏe YX6 T~"o-uV4DXSČ«$(Չ͊ѷB=lUxOV!԰UpZQĒ%j ͍bkF:6bRT]pE$rf*5*6=jKiqe mpZ n 97,miHZzVZWmU {t͍F8OךDJwˮ6}UC'QCi|3164qu֖}TR~\  +^P 1muAZu+M%PvY\Zi]lWoO| ZTkJsrK9qf-:;X#o `OAh=(i%[H6ɢ( N1Eҝrձ '( U9ШָnաqG9T ?_,+K Mb+*ǽwm]Tx(: K"S+JJics# 6HAPˁ" Vjө2 JhA >o} iPcӦ(%B9o\mHk1턡PSnDW ZeiBJtJ#~&*jƁ@vϝY:]vlUٱWf]vlUٱWgv+f.zdˋ|~؇_ mkq̼v=1oE=:/&>(xˡb?[6=>,߫8?n?LثDftJAj#Juo|j1b3b7[F}S[̽c+"9_d"I8Hy?,$Zk[!ʩ@[?_Ef]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]PPG"0daѿe{+=" ~2HLت-~vm{̡ y+ ,vQsbΑ8QPRo1q)?2\?͊[?į![)-fx=Ā&Y=m;IX)#FԎKEofYlUٱWf]vlUٱWf]vlUٱWf]vlU?]ԓjPi~#<[)Yo/FFob"5?0%-/Vo{#I+G {U=?~ث#~mk ?A,yGrg_Y~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbγ#mFV9vh?T>hR:*@yIwEQqSamvHrgɉ">Fr62Ztb^hb`u+]@Rڣ{P9k PWK!>9"ɔ{ҹxU 2-ZTv',:Rlإr!ڝVO1pâf4)"rw5$'JδP>晆C;"dxebbB܀ WqAH`K"病 w@)3`JJQA.AaJS6IT Kp>L-݁jtc-(lLyl(Q:D7N2LܜF]prF5u9G H͊[,X*Rv046U}0Uq]#\T$A]צY8m[[WFo Ubb 6STPX?5pZohf=P8ڢHԖ"jjе@NAҭsbS֊ju5'UC*lEKnNnXmiE T+횸-W}PZvv*v9SZsi!,@ _,mi}0TvsrljiOY$qxM+PH+ ZW? 71֖JB:֝ӕ|M: yaJsٴHes?GPIM3Ĵi=4ɶ4Ҭzz;2ZU+N9FZ LM<.1 ^¬#lūJӢWb>.LoVcMW#]֗ hI2Z];~UE)uO,k#dg-w\l>/k[+K$ YrqZ H cg#e'%QK~R8 s\o3M*}\mC/jVuE-GO܈2Fe aa^u$7j⊬?/OCoA_NҦc%?z?>Oܴ=Rr~2•#bk(=}'d:'vlU9o/Cf?q}DC{g.̦]Տeew_eGO9ѭDe$u.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث͗TҮD.̎+ s[> R?Гǚ#qvsɛNw=/_aB)6?u=c>/>^fu?B>|Olus# }#Xqݞs1}YٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v r; ᗖb.vn^ثr]*ܱWf劻7!0lUٹ{bv`]*XTbqWfqWfiڿ,U|]݅]ͿbɉUًPܛ,]ɱWeo ZUuzu]\UD];byxyxW*6**ʤ P4]+,㊻6*&* k\U٨|qWe㊻*qWfNJ)Z >8>8U٪| ğvQ-S㊻,5H~*쪷+7Wf&@5KO-G&Ge ux?x?W~]a~ғZؘ)"6 E aeb6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*تɡIѢC+ ̬9WzWm Vl$,97͊%+M^iT^KI -y":7e f^]68,*(> $+Lث6KrkJq@?DٱV[O'yn_iUL%wVS^?sbPqPVb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*t]^]>5t)$l*Nث=)j~\,[VQ IUZN<%+E?*6*2ΚO!q*?Pa?nXO|ث{cYe)2:U+ Xt9UWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثH20E$bv-/Ih s9}r?||-Io.8kQgFRynӰ^#f?acf_ΗI%N$Z#3 8pzv.><0J;8vp6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*2E#q\vl ݊p_UA—Myf>ߦ Zrq7 E73_ZoqLK5c|~kN{f^ _iZO3.](_;IW Lʿkqۼ-x7 Lׂn6n[e~# ;we?qۼ&o@\x#wf?1qۼ" NQЦ\v A[C7 LKnnvexbzk+ ޴;Wo4?ߐю/Lߠhn;jeO ߐюzvw֗[?`nvw 4??`÷޴;G8۽['7}vn}p#]on}l#q 6wq vk[ٿvw?ÇZ-hwO[ r[ rnX ԟpßo{»w'?Ww^mWn}t||f7}I+A-P}cqbkALn>Wf /j`⏟UZyw6(]?/טhv|Ү}jO5e[!//m-lly:}ogss}B׵lm7m-Zoo?]o] !Ļ;/ !ljvw'_7- ܟO?? J[#E"8:fSLثIL J֚&C⁤_dO~,ثlثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊]EluzU͊]KhsuXG^J)}(OYV)G,o=?blثWc߭E͊+-{MOQoU7 "mT+xu65{NQJ@ )t:¡ߏ:~fS8#|3P: ${2%Tr-yRY`C\Is1v7/Syq'6*ƿ!Ⱦi+g-^Y7#O͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊zϚKj ZTO8˛y9c]1"KxXGތm>9Wsr?,F^0x-JfR-'wiO-٢(4'MofSh/;!YN.h;?n?u͊']wZ욊F"?J7OR,VEث[(, (!E4Q@"U6*vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثA;t"ULQ:r4ѲceAA32K; Xv5IqWbӡC,m̑.Md,"m# Bp@\̄nBh%PӮdGnmeq2{|SYlim-^f®⨻צnXڭKUҵKJcl"t闅TX^5l*2 UQ (YsREy퍮Rq׏5N6 h^l:垘P /dm\J8tͅV(X!|Ł J0Sr=ondq'\VRx-iodhՉriw*@|Xa+Kg7,6ZlQ!ʑGO3|"8RrN8J^B;+$Ҩ6\E4*ĆNW+M*fZeiɥl)2gi˦Χfp&UE -6mR~dId(-dXMԖ`v-&JՄT+B*0evu0 EE+&|X7#\XQhw<=* qSSkzT }$c\Z#yA6%kMnշw.aZTA[eP 6AQ,@.Re`W&Jfn@xA•P‚+r}ՠ@ޫxyṢ KSăZfpޫXS^t+B2Q _ % Ӯ0S+& Pu=~y|v֛SZVVUhEM;~8Wz1uĂj:PhhA9G%W(M뙁 צUrКVjSRZSҮÑq[E=r6mv[Wm]]<|mȒ0(E>A Zq@E *ֽ٘{\#i^F2"7W#/)WnjrDZ9)*P|2~|Yj d- %eCQ| c˚w:eT cCRBzt'+/P0lRpmwvįT$QVNbV|Vz&Wf]vlUٱWf]vlU&nILgsky83^QؼL'uHǦz l;B~LLKV?@l?އѵ:RdKvw<]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]u)5k)dJWVbc00?6sbc$Fs}PJD9Yegg-&[?T C8/.PjVwjqPG> ?hgyd8e`Q`Ӡ{ beQ2ыn,R!)InZ%>ÀTlQ>'<)k3m!F?Oct8w>O=/޴-D)#\Is(_YseAi:/|ͨj0,6*qsd:i…9j>qǏ9V7c8e {q4׳ۍ>$QG/ث1?dlU^YX>cKF-H\1.V6*3nO!"QGUT6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثGziY^kGUa{ZDYLx9){Y8k[`M2LQc)\!tf*83J{*L[ cq ׭r0Mݹcx59d%Tmt9Lp vZI*KbwjF_,mij؞w卪.r*+n)SckNONnxmiɦbҎ[#iLp/?EF`]E8z&)d!ƴɵ*OLu%Ĵ*Nn^8ڶ-(?H\25k7_Dܨj:>ũ߾$6#7a4} dC3@/6^؉5~c 8 iK%v훕lS,Mv*+d;uʉG[h+RHKVƒ^ILKuX]QO5mr*h6ˏnDi06:&+*hGSN-0Ҡy];m!|JPA}tiI5JIF&\M9+% BEi8oaQO L*|s 5[Nl ;UBT .ƐSqH~J=>w;ԱR_ҤenZqFKuET֙۶%k4#dш (1++ *jO_閡HV .D ]+0nq0/tZqL6߫% z`A:s^y:͊6*ثb͊6*ثbm.ZdC' !>LOgmn$=E >DTgBB@^'b_-c}j=eI̿r1y?^2x8OC߫iW˨ZCv%EV@HD>/ f$b46*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊!z zj؈TR/kT}9[)oj7^_?zf*S7h.r}g/]8`rWL:ɩ?7˹k?:?KC:ȵW0vیK'Sq!n#/eJJ4\C+-ۊ3k:gGL,K{G4=8:gf]ח쵨Ā}їViT+O;!Ws"/(c`/KGb~?YmvM4}>!oiUlxppS3'`ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU<+kd{xA`_jR6Ipm0i/x](%a(>tM.sZA&v?Ш~?}xx}l]<ӻf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU2PAwĻwȶ;0]+ƋKO+eMRF7тB֤d[R;®͊6*ث`Wf] 1ٰSvlUٱWf͊6*ثaWf]vl ثaCbf*نvc]SvlUٱWf®]6vjb˦*aWf(vjbL vjb˦vlUٰ+aWf͊ٱWf]vlUٱWf];6vl ثbͅ]6*إٱWf˦*]X؛®Wf& _kĻ \[Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱU3(xeaPAٕS~xwW\~\~Ք@c߰}Ob_fDgAo+K`]!$"*~N_IbD͊NӮ)iCxcq OugqMŚ<ث.kaӭmw4rԯ_/Sثb͊6*ثbwkT|]lثOg<vG zOb:P5-PR fAnEU4<~m/xYܬv[6*~KyW`Ϝ/gqIDC8勘k{ -Ԥ}x.lUZSyF FXmٿfdvu oq"lUvlUٱWf]vlUٱWf]vlUĀ*zfRo0tt6`%?oi͊{I7y|pݫK{ abNVdJiR8 4-Q>1oQB~ԡހe)Qs \Wʭzl1&+^]J֝J9.ԅOBAJ y.)o: m4e\[J={e[v=rkQ"j?;Tu&"c[u w !z"tNP {e`MUV#đAM_,ߥNL +niI4\D2lJ7ۮ4RFVbd b2v_`rt\ljîzw).sƤ9jE@( d B[{cW,=- ǾDKdqӠ홍:bl(]7;S2ER8JæZJ1A[!jk@i;aEhC o0) r9rBM1Z퐕US~NRSm.SV\r%)e5:u=qrMe5&]2ЀzW9m'ӹ@ݥ󨯶GMhԥkNdpeBשc fQP 5@+ZjPP"UR:Δ u [+o,@A#d)̢*ȝJHf=2 `5+7fCA¢l ԍ6b6!k|MoeCI-K26J Tr@6w_F'陪7[(rQm]Q[trEzt=NG~I\Z5RHQ_zdeNWX#(vkZm#dW|'uj&*xP׎e)Ȃ:$pEXmd)bEаcĽJ3H*S|W{E6`*B~]ƾ {lmx $$V*TlN";R^@I\ƕڛkZL,^b5˦B}T ׮8Ske"wCo՗`PJoRi:s}<͊6*ثb͊6*ثb͊;妧M^b?~dA윾&G_ W>'aG|_oU.?39݁!C;M}oIo[/sqSjPoGFR؛bL*qSM;#xJk_+EEߛs[<%iY?88Jӽx}nOcV7~YOc´*v4uoZwcauliiYa]Ɩe}-8\!=~xCq9;w_Si9H/Qadc@wثbL*ͅ]vlU٩6vjb͊0Ut]vlUt]vV*ثb͊6*ثb͊/vV*ث銻51Wf*bLUt]0]vlUxbf]vlRء؛®*~Gob]$UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW~zOE-IsK/+,|~$ث/WZۅ$w8I4\~23lU!gy ںȲFAVVц̬lU.wפz򶻌ԥT*r OX".lU(O6ʱa]>Sqvw!~FflUlUٱT>[iЛc0E7z.lU?~Fzūp>~%6*o'P3L!tdySsbGGl,W@mˉU$UW\//تW᦯k}fyv?6*ŏ*Jܫj#`f*_Sf^ǛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱT>}*ŭF^%Fn,|YWyL ӏ48챥R:/WAKQ-PʕZ㛕qⵧ,\)7K{b2RolSW TU!@$u9N#0--XzoGZo*:f;7*7dHZqWsn{oᇏiފ)*v9%pzibA#wJSr^x@6zbwL (J_"dr6e5޹Jm6brNKDR;xbF_AmH8 m1 Ķ+q+;w~ )A5rQq#a(KtzVV͹ UsrOc*%)؏HLP[דdPcq>bnt,:#ߦR {/*M\SzSFilJZ.=QA \u;Sm*d(wVԩ"PܜmIZT-mRCKQ^ Qb>۷oNG"oK`'`;S0+\#`+XtFpc /RzzՓw$ҕAQ^8-Đ)S)iQ\!CX='!*(54VGBWHY"qM+L>8 Ҡe'܅th)ADW%\}m!Z+T2t={}\б 娡%EKRVu1KZ:sc{ ]JcվAm٨+=T6(A;)^~":P-WW5?Wr÷jPc[* @$e%r(m1aN2AIcʼV׮W&}RaLaZETE[31RH lH[j9 TB>6 ҭx$mܟ JT*7n;?R)Nrdb!S}4fEVį׵:nS-!|O@3( At,KVj<2ҿHUP뚇qjPݥStkNZS7Z#&#zWl:Z53 o\ܔGQc, #;Ft [VmL`Kuf o2BV{\rWp$ۭhzvW3 ɨ1ePPEt@{檜)O\pZ\!)?F C)\՞ɶlUٱWf]vlUٱWf]vlU&_N}=Ҩ~k}j/W_9 daƫdzʄu>63_eػ9W>luV[+C/n6o/)>?=n`0g"ܼb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*oVӒOrm!=!&?;-'kްܾ¿ަ=cđCߚ4i#SG"!?/Y<$z?ظL~N͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbŢ$t]{m3+H<uPrr? Y_ڟAg ^Oȫ(fr*E~ʧ Q T|3jW-C!z‹P>o?ߏq5_\_؎9Z4mFj_0y󦷨Qĩ4^YVG#heLq&곊{G?8Xf^aiЭI,qEQJ%sbثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbk\ҴVKo*RG ˒pN_i\ثC6*ث?cQ0kԳO'#y y,bI?&|z2޽\e7)r n?DSVMDw4rBu^mZ߶W~8E\wzہNøRRHX { ] `r:_ &(#RۮD~?!mdva,>7J R?*KHs14jʥ8lFhߑþ46G18ԎTCf ~@rlC鎖zY7$8Ңq? %< M(h2MiZ2!1_BҡHQ?N⭆1v KoSvR>}W p˿Nj#pAtNՠ2ҀHUnTc*VGWpIs[^$TvRFw엪@2 &7}O͞5aMo1$l{ԺW{壹倠R)"<Tj֋k6iH3bSR+\Jc*XjdRBϠڝȨ pZPFcCʸ"Z>3`,iAJ*@C߾+ O_mIo$̕U}b8@CЩ2+\#nT j2ݥr:QLbOJ&[4aRC^,qUo`zaZ1$o\}UƑ. 4Tx#pF*O~auSK%dBX+ǪoA+^U.]2)CǐSj뀅 +E( FpZkZa+@?~۾KᨩZɮZ49` Qi$bCP/|AJr;NP4J@ͺDTe4}NUiZ%N-V  گo>t'Gup\Ǯypv"f<]QL=L>`.O)yOS4ooVYA$-@H^Ku,ˌN_TZ1ÔL7ٱWf]vlUٱWf]vlU<~mm %Y? Q]N4~)_AٴDw8q8^6SFg~oY V7Y# 8ǐ@{~?!v@zWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWbv@!`l<偛oxrGzݼ FSvG)*6d߬bU U]\]SvjbLUٱWf\M7|0ib`Wfb8U2TBANӫLPlU7WOՉIR'fgS**ثb͊6*ثb͊6*ثSvlUٱWf]vjSv^*ثSvlU٩6*ثSvjbLUx0U$`RZb釶v1ؚL>N\"O/$|5 8;l,cܹV^XV%`# |D AͥY0㛇چ85Z|Y!1S؎"q'.:-ueJj=FIl%[) y1*CQlb˦vjb͊,UT]vlUَ*ثb͊6v5ثI]Ka`-zd`lPثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊|ek Q^Q\%>(Sѽ͊=bmgF!tM+&J'䭛}̞YW3e"9g M&G߻oۍeVj*C$0 M6*q;0Kk/i&< eo lثثb͊6*ثb͊6*ثb͊6*ثb͊6*تT֬tƥq#!U͊^&?H}jEhJ/JX毕[DueyDҲ/K^Kdy%x.~f䍛I?͊Y!Xb„ҋ6*Vss!;?L6*-8_$ukA$36*]p\mJֽG//6lU:O_y{s(\Z8?NIGY^8-=Ć֚FJsXf^y[Jmgoeа%1ULb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb8G s3"Cޘ $M!e*|z9- HxT|Rt R X^e RʕLmLRH,M+\jvtip:奊f$^hFRy3DR9ֽjkLe{rY EHZxjkw܅#Q:c#\y\O+Z@OL<ʺ@Z@Gf4pKhISs%i'զ k\ue4,E3G#RsUjjA+eHrW| V2*ImT IVI\H!deXf~$Ƿ,;!AHbn5¸%m W9TWʌF8.2@l#)[M m2鷆BQ;WX1ͷLen'VMU#l`{b V )߶!|!!V1zEGQZ/V4ϝY:f]vlUٱWf]vlUٱWf]vw}kcY`zegpC/~/v;d,>bZ6?x<$v'rN(uϬ>!WF_{QIǙ 9d;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbn!ORE?(!9D3QG>aKyESCwkG0:.p$2-/ו^ :fV<ɂx?8]f]g󭗗Jvy*{Uv_ 5 q\}=Uu Пw,x K:!)y~t\{XOvHtm?RAvF4SF|<.lݳ)~_?:Wbd8H睜oU6My40H~Uɉkes_+z$?C\Oǝ OLYi<խYԴz/{:XbyEoPM?LmtEkc}|а!7͞y3'`@AZE\kUEa I&˱Pثb͊6*ثb͊ |խ NݏŸهc3KstZ(oSRmB]Vsow'Gc??vu۸cHR}v&!##9$">g+.ezgerH}_!" 6Tثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*48-<0ac T`f:Q^?p+$GEJ#6vֿ`IQ>g 4eL2FAŸBe>RIQFp]W۬hOGz5B>IZ30V&!y>–pQ*9#:@$}xO5љAH$;Bѷ T'%SJb#H7QZ^$r\V]:$lF4ncrXzFZܷ֒P̑ۜit]]EQ×l{.~0"\TR- 쒬B@ԕBi˨bBԹآz|b04# Blks<=K9f99tdR=*RT Fh>M\sՂX}IQpFgG&9p>%?8H)Y ~u}2$֣s0V5V *:`_i)*vd߯S*]6*LU٩6*ثSvjbqWeb˦*]S6*Uٰbf\U٫6*إxن(vHK KE- \"^7n6gJ. %kw&s`(W:63RV7z+~\ @:l8\ج`de⢱,mMKqʙFgtpW E4n'1 v𘐰E0TxJSVة\ن*ثb͊6*ثb͊6*ث1I ٛ.08XSV0v3vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]|9S&i )--w0?afeu}UlUBwKjt4ѤyLSxz><_YyCjzy;z2yx*٬Cz|>;R.rkM0dNlUivlUٱWf]vlUٱWf]vlUٱWfPze@z@E윁y9A:Gq0+WJfX9[Emyw'jƟn'͊[ҟ:}$I{GO%y䗟I5iq%?\jsb^I7.oukI$/͛gZ7⧞$vH2)C#%z7iO1jhvKep}]ث>|c0%)2+ilU~K#[DXVVfY6,ȱD ͊]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ <}{߲?,Ǥp?8Yu1O,?;-5(CxF8૖~[C'֯d?N9,x;0[j0d6?m)$AtA<|pW$jە#aP;u [ ?FYa kMҟUG\hqV.Rv9^Zicj F&ґV72~B+Pi )7 M;唥jkCKKtM39TTp oPjň,V'/HkXYV0S"#TޙT< Y.&;+beFnkkzOE#a\\M6=i&Vr<#zmI)P=k2`TsVU2`ZPwHm褺W Co8a,"'d [`E<*` 8EVeڴ/AENSĐ<ANճ & J+o㐌w+ X܏ג-FSJerzK; c\ 1J[6!r(F2aJ] 6]I ƛ}\4 A:v=e.պBA@ 33RxMrP֭ޛ$eފYԂQwQNsU>4k;ت`P€etv-XN;oR.j(:N &$T ˰WJjo`i)Hfރm+ ߶Y[M+ ~ڃ޴uUSgѮd~sDr{~\pL?\躈 vQ2?ATnz ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf],񽸎&R~/f.mV<_\_\:L_; ^M>$3[%G7?a֙Yj^d/^'q__Q D~m<0v wa^K- ^_voW15:iRs49ew/9E^BX%NޗDs8_zq;E˩lv^⛥.'gMֲ̈́Wezhji38>v[ˠZ+D,e7Z>!՗þ:T8,vs+ל791֞st?Ϭzz?Rŷ͟^:EѷȶWʮav4Di/YrOH~=.MŬ?vN/1NԈ?'@?_.;OOed#CO9?΍="E?Gg%^m1ONkx;gPc̞.#\GN'lrC/bx]\'-, .-ܴ(C$MO4#qh2ՕEĎ'~ 7g8 9?d;@A>.vcKv1+@sAˊՌ/7Zq5 ;vKt蝛vy}O^۰<'9_cKg_/vlU֋#~<lvo]bJF_N{ȼDl>c淰%;_h޻:ּkW0y_W?ym/%Fغg2e9RKHڼ-?]E6cF7Ys/g <CEK8'YoXSK4Ja=KY(9z+ޔ8"zc1+xa7BZR=o+5(ќv ~z`> khSpFK -eEuZ ПiH j3]XqTQ:铝.{f2_f=6^R:BdG-qVE]] DW{_{[tӖZ0& >8H,%i]]He*7őZc5b4++({lzaбһdB!;$ v&B:~2 tdy$RVIT,ݳy}䩠PiT;VQFũ'/OIfnUiJr72UHڼpXYؐO[k{Y#IE+ y"ӞknKl梜yW-1B?HO'.OaKzq6oggҫuFkq% Ukj?ow 9;V~%%J,V]6*ثb\UٱWeb]vQ]b]vlUٱWfͅ]b.ʦ(vjb˦)vlUٰ+Irv3aqJej?dYB>aͼη DZI/!#WPf1M74!ӋzKҗIڣ +؃SN@F$t5'c1]!%H& TaQ YG 4/&@ WaFS1ȧj )Jj6*ث]SvlUxb͊6*ثdG\p5fT¥zDv=N %xNMrMn]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfT!K[Y`Y8:Yva~yz~XӢڵlM!Ź<3r>SlUA6|i;DBp K kD.lxs_.|9?͊͊6*ثb͊6*uw fk(r@m`>bF:<-ɜ?b+GLثo5?UNkM#fX9+DSDU&%̥|bf͊]ެS[ƈ?S6*<~wp#'ƹVAHyZEI(恤_L~c9Wi?>dP +FFUlث%HT Ea$͊BN&n-e~_so͊'CfM&(zQ"YW7MNsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث0DN/`@]FCʷ:umهo/02go,?S')O݄uI^Hҿ:(\˚YM;XaTv[v -KI W.?#q5_֏8*c/vQA(,$5Q"4㎤\o??kHҚ|L?Ûÿ"ջgeb͊6*ثbɿO%UQ0f=7jt&9YgOX7 n1Yw߾NBDKH{wƂH5Jw@[j;lrq,KM XjR:WϑxA#O̭˜b{)"l@"|vW R4C,jH5tY<`6;-M6k"'s]Wt4Lw-& !Z^FM;J$+] bA|QbV@'_jm#0#jeaq,S~u$S!!!r]L8 YX fr >d:J@&@ -JǶ:; Y AޤST P;rA rԓQB(2ȑĨ.M^8]C4#W')*[PNd)g(덯\H һ֝rP?zjZcP6%|Q÷s]J졮 ` 6w[\Қ'nۡcU̧KS:P,+U@R6\w,MbH榗KZ *T+ׯ+QEiRrl4EH9- Pu>24B@ qTH@*iQ}O'C5:/無MI~Xi*9f+x2PG'9Gu;fJҥI$4\ ÀC7÷\" !-؁J ۃM n oZt1n@W69"Ao:usmMI8%HSgRJ 꽲DҼ 8,I jF@!ܕJ]8HHXƢ3janiy= zf? +m&M-`Mz &K:xf@X;}#*8.[aZ𫕪Hۈ;u#n6(e+PRjib"Nʭ J!u$HNى|O5j%*.(>LA  1=14CK(_=| IWX#C>u篼gvlUٱWf]vlUٱWf]vlUfxet!nJ216:1DE.k)C|d_x0 =3Kg&?>WӜ dZ7?37,y;U?ga变JSYhįl;#Uc?^/O{gIF_WsaDثb͊6*ثb͊6*ثbZ֢4)Nl}-j2P3dx>/q"R~m.j=%?ŞGa`LVk?bU =؟;\9FX 3/.ivlUBbnd^L8vh>}r=/cpw?ϗK#{0F/a1ʥF3fGSԎ9k{^c8;$~K\Ĩ#Y=3vyɍ奝deiYhSQG͛66xܺ͘u'd6+ˏ7kAC} :Tge.BGӟZ74&1#83MUsńPI9#X`w] xҌek NHoJ?`KHK{u `*[d2=WPM:[~H\Q2?8r@vpo5* KNaGO9|gWgzbF$tX.?[ꓳ[m UQg"" fl);1v%smM72&(03Od0iW]xem/W_4DOCz^;4Gg'*,)^"?,=egD.uͨFX'OP _98#J =W<<H_](4AA<8v&#FGDqZNt6ثy/G\oryhݙ.,KKD2z,e|q$w;1vG0+P,泴x%s {*\:D<]~_9—/OxWa2OAT,1}?靝Sɾwe@Uvt_uЎ7$~gKH_LN.mKb͊6*ثb͊kZZM}x_M 03?i~J>nn$V3{d߳0Vn)'G=?;; g|~SX 6||_q>o/חGٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]E ga\\HP~I;-+R!nܣS%BTbヵF'Rj?w8'LmexyOvěKh[-naq k^CmZMʥJږ1'5nCӬE@-|D mY"8(eb@ުy;Uin&|>,1$ZCO7jUdb?z^I1zJe*"V8`K KY5.GjT}k|D+]qIEEÈط6o6.<1Vn>$lK*ڝR5H@bGAeɩۆXRŀ>qFq׎3TN(DS ,%EߋWc>6VЗZK2ܫ4s(iV<-mKxaE.MO5kVi,s %H uN8Yȸ)M6Sb ywHxUс>ٵ:$$!%kR<*퍒+NlNjLPJ+zIͣDfj>[I)AE tP5NƝ>0I*Q}goX5z/bx#u D OƟ IS'fgBa/vlRvV(vlU٩6*ثb͊6*ثb́] 6*]]R'*ثb͊u ~na$+K{*4l0Q.Nf(At[}p>1Y%Av~l-p*`=L34Fq.dhaCZ9 (¿O9Ya zr}x {-M%>1.HnqT?^__Ry%ĥQT2*V(=5Ǜ,"R˱{9w<ݔ c0Ixxut|X o­cp+yWf]\Uxb͊6vl*|L@4A\r9#LkZ^r͹&-h&ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf^a9yg "~ʹ`xzz^}y;[NbOH߭b5kM$иF搯dٱWq.#۵|nxNVu͊(8y')2v47QClUIܑCFQ͊sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثEY6&Rb:,W6x?qO2NQ?NO1bYIܓmNa}gPOml3,Uj? ͆.͐\bkn/iaxe!'aUqmh^‡0b3!'7XQape "U]')L؊*@Tu˥*[ȳ)BN[9/TֽY5䉰(1|DM:hHBi\,iM`r679*v FQNUY~ZNffؙtZj*w .4܀vqIJ ~O;@\Da:tV ֢Tczi+(*wtįoՖB SiQ؂j|iμM3b͊6*ثb͊6*ثb͊6*蟔^b3:p>!?v&G?T?zݽ9?eԵ=>-FK9cJsˈe>4svA$ٟ ppG][h"G۹#N?gꔧUӨ$b>)?V#D=&1ye'ع̧Go?K⓳m UQg}sS$ٱWg ӇfoX'klF}ezq/\N}2_2{W;],DB?^Wӟae8¿5CiWq ) ibܹ)p;97<5_57fOoۑQvv_%?̧15:Xj#/ePs4h ݜ?˗2&h;}9? t83ς_$&QJqq<ݛvlUٱWf]vlU7|̺<-;_9vޫC}Sv',vL?.M_TRzI'D`ܳwz_\R{Cڿe?_mUAYWk,|#7[Ie?F/Wkb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*'dHy}`v>eY9\q=9 Td` GzO8U[.ٰb3b:hp+N8!ki_|ZKB`CU6*UٱWf]b1Wf.͊51We`_i_o׀ib.͊6(vlUٱWfL*]LUـ]vlUxͅ]va/50!ٰu]6*V$US<ͽ0]̇yvflJWr4̉jHѤo0݈0D^'+ WqəjAp^i)xʢ8P{b~cࣲtSm Rzs/%>HDmLePFX>+r?uUm#t87D# JBAA$j)Zd6e>jd<27UևM?S̞X웋!{Pr!e~]ZNJY x6*9Apj=ʻS2U]vlUٱWf]6v7xȟP]{S`a=K"w ňıCb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*r{?Pе[6鱴M4EL'#i7VoJN?v* تuy+\4}>њ^E5e_YVQo8Gn+e͊?/yS./^3QFi7te}f^YF=^YV0,f$o6*Ŀ!X#kӳ[ g~Pߓa B4I6*3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثGѺM9~ŔIZoR]鐇c'9:@Roӏ. ;7f]O=]0RĪ(ͷ^K^;??Q_W] i !UbG(sG ~2b_ٻ9sVث1^iGp?=Ee'O?c5 ̘yw/\ ;7f]vlUٱWgmvծF/Ąqh΃/= ~D;w`EvLbkӐ+P'7"1*O#cJb8{YvbZp7T=EtkO|z|#\۶LtZ{D}` M9ߏp7kk 0Mf*|25mq=en$@R\ƻB] j:TW ޕ_8VOVBԚm^t젚Ҕ+L<}(Gr"w Cҧ0<0ܭm%~w؏X :G4[EEGY'%9o|lr]Il)ö8/ֹ`%?")ҝ1^BE /@zo2=$@%Mi^IjEcJW0:xsDMH4,ЁS\$NjH|w:;z |TF4@ҽzPm\n#C\kѻvr̮|)34Ƨv@'-рJ\QM/#SFĠ 2vE)@ק7 J vM)bĝq2imnDZpSzI d'd <)Ojx5xe)FH qN@Kҫ1QBiΧh,6˜AV -%5]r|Ц{!I$h~ƴ# PAGH Fr$Wzc[ Jq:Ng&(w!yoN`|ǐ iVH̚(癆댔7n>+9V08;ԩƯtxvkFXf;LBMhzdU0ߩnoՖc&R$BkA:y5͊6*ثb͊6*ثb͊6*ث[k-eI  P; hkIh'oۏ"2Տ?Z{oEďѓ❓iٱWf]vlUٱWf]vlUٱWg$=K{ v2i8s?/{?)>\??'dZ2CAc:d,?|s` >)I<޻Pe$?]:ZICR6.$=̄u?K;7g|eX$pzgFBB撉d'k*"QN{<}C/g=؍>\?ŕgr~M*jv2EQď4:c.^8t{;GvlUٱWg; +h7g3DK=WGuE2({z$ПDC2WAUs֍U$QZ]GuMH՗y}b!!quzNvu9t>Tθ鱑F0J2:6%;\%ŝE+~|?8Ѝ<I'^u11g;:7瘛[5_rΣ5G>+?\=yN >ZDqvIjݛvq(xj:< q3P{?I{W]Sz%xGs^WxsNغb7Ie2#<1ˆ@_rZx/2˕g̟Ghic(;z#ľnkS Tn=i8߫ÕqQwɰvaVAL0GGⓗQ.vq_*XKk62SPhe&g'4<(Zb͊6*ثb5y=KסqƧ79ԍ>33org*dוxoVBiɪvr:r0S{N ..ze?D?gkwTR@P*Iܾ|~󧘎rW?濷q~c!0ݟ1"{vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]tY1enètfp///=|fo׉X8_(.A' TZ)^~\/,U]bˮ*UٱWf*LU٩vj`WfvlUٱWW6)v-mk%ˈ?' YV5 [U$J $xTbٱCb͊]:Wf]w\ث6*ثb͊6(vU1WevlUXWf*ث`We+;Wupۙ*%+5G>vAשzC#+PZL*,].@6pҵJ-_-/r^S-tfALTM)@oy# rj Q97tI J^aE&2-ey1BN:HIGl m)~m?z^1&L0/!?+&0捂CiA^O.Bx f꬚ݛ?W d;W6o!+L \V*UU]UxS1®׍OEǤDZIpYTpvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfZtWRR(AFlU[TyJfG9ow&͊k{xj(@eULثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*`7Nk_,xk`6u{]~/HF^m0˰0f]:]J;;qY%`-ň同~41D_L]/ 6vH@>a>/y|<8c ?cb2/4?ܻ y=#b#Z$/6;ĝoirwakݓb͊6*ثf˦%ݻ22D-叜#6`ӁGyiΛ! FòsB7׮j]Z~pTkVWV8vƏZ2 {6H$:ˮ:-sצKAA*i|mG7Ut̴$vjK N>ws@r$W `kSl*@177~U؜*(F_"БL4m\u|2vW1IȓwW(5PA\69"*܁Z4|rH_Z'hwV}`T9?)}W5 ۭ>n#ʔpwjԑekB(S}`( FP\m v=;*=b9qق4F8ýi$y.M\x?~L!ku*<;S|J^u|#ǶYԜ=lUh7ۦX]| -.{faoJ|[w†W˨=U2^K +njt9cfhBY6ۧ1^T'ƭm ޹q\đ mLaZ3@5;Q}R li+nOno, P7#zvxO*CUE EszH ݔH$`=U}|@LjzNSO{J$٩e)_OzJpa2 J>#ej`(Y&m)i8"3n=*QZթ&+nYaM}(2;%YK`w5'Y5l6Bщ4{k)ƙteYֽILJ`М+)눅lM14v0lluG&ZwR܇G7*ZnZbMz\vԌ8GӋľغS++i:D0),ǁnSSٸ<@^y.xL}7<H}]GhYG/xeB^g1:(r*zYgru-tQY"U皾#}?N۲YO)_Ǹ]_꺋ع.SoL A'x#gcݛvrΘi=̎qSDI=c?%) #H?ٷy^evkP|ܻ%t͊8V[k[bUm@t!sϴ'ˆ9?/Ve)ct~guA|<MWUeDWGT_}{K /M/\Pb쎦tZQ%4kW/p6*l UٱWfZlUٱVjV^+ \UٱWe͊6*XU٩\U{b1;51WeKǪ`v *wȒ TJk#2qpԤ2dZB`xPd[$Ug0:rh4nQ3L 7ܯVje3cʉ-z(I{$WdFD'X#e`;W|'d0;qMbV1ƀk˩7LN吉 ZZcWn!Z4ܝHhjP uc^ lun{k,(6aBHQ'nZ0L=i>]\AbW["BxeҴ;q^8 ((Rq[A ni\ǐ>Q?s  9U'jvʺ+@j*;@[m^M4zf4=1[Pvʮ;/JRǭ>e ]Wcn_ 1/RE;}9J{%( ^]|>-(+Б(v+T.f*ByjO\p`j]EhznS%D**ca#\$W#jۯ\PVHYq>y]>)Z|RR4;u M)% ԑMꦙ` JҨ=|6mQtCiZ&vư@#j/aHOɭC/7?9;97[T-n@,_o9ڝ_Gws˲_=idx=4Z>ў}PdAzP<3T[_K''Iջ?<nbC)`fcvG<5MmF`FHd⁇ e%xc>NΦ+M\]a򭖿fqi#Z5?.&?N}VJEȵ 's[xaj53K{˓~d8͊6*ثb͊6*ثb͊6*ثb旛VH~Ci?so?\?Aŗsv򗤿`D O_e[(m_O-5|_dYաm$41_reG`g.Qy> gycUVI }ʿy|4OG # (rvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]YE6wȻ$ZPA> ._3C{-Hd\('eWeKaC51WeSvjb͊6*ث Ux *ٱWef8Cb`Wf]\ثlUثb͊LRf8PUٱWeKbf®]vlUxb́]vl*W`P핒iB##LVSR(wt 7$\AAtQCNCH{}4-@UPrʺYI*p8߱<ZYOuO@p9BD lt)YV ^yN#-+O `F6(n,ʹO'O]a`85j_+F+/WV7C64ҺimOød.cĔx]d$,&ʲv8 x[V*ثv;C_2A;to 9%GAɆ-ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثGb`Y?/QWlL7<RVC|T2C/<w/];Wc %FXdW&ܽRy?'0b_֦8V2혺ɨ+<_N^q>/pCvZbEIi!,Wa5;5?uSsg/7):7sx?S/EcvlUٱWf]vlU+Od d<16IYe<^S/eljJAQ8z6kAW7ZSqj\MFRu~ψ늚L}ʊ@:!phMwFhʤbƍ4۶=I-$ jzWqli#lbU%=>xj ( }PS"9iqE5ƃn(>=7eHȯ'O zױ jO]Yj+O-2ƽweL!{=#-aQ{ղ SZtژߓ A9B i{wTq'l-hեUQƛv,{m\7is)|z z%*R+1;oerU>zb#uS%q#TۜñHeZ|Gስ+n*@"ZNJ% nc%I 6GJʽVfW ZPB:jS#<>45 _`Sl5[!K u]ZmVzeKzf۾jJnH_?[]횿}pMj| TTָv$*8J.6 ճ$n734 VmI2ր5:S Jt55CF2!tN H딠O٦D_5Tu9J1; 9dUOJXds^@V+C&SPnM6Ui`Vjj-JTُOIW"nIrNrt"AĚf>ᒵX)ZN[1B*rzM2Ƹ9*)"* / V4Mv;Re R(*oerޙ%V4u'18U)$ֆqV~$n)W+.㨭)o| 5>{;~9UPP'bTU>t箼svlUٱWf]vlUٱWf]vlUٱWf]vk_BKwg_SzMIL(z(=è[ݳrE b2DJ?L/ˊXc/.mٮ_g/OY؝FKĻ ,N^7T#'3;'_×] Hw?y ͻ6*ثb͊6*ثWFh\:x v^ 5#L\yN&?;?%4w`v~avu 9ٱWgG[R+쳄7}9}_S=qpvt_{ƕOoIt~z%ou;WMf }3?>yO-‹#j)ߓ&CuJpՙLx#ߎ'a55yc`÷`~W_~dL/qC-U揁]6ݹ) ˗UE~?cۃ/dc>WmmK)ڿ'_w&zKd{ǥk5X#\u;qj@g~ f˳`iZS/QZ<7`ȟf;K  ae(K;l\ , nmIvGCYv7;2 W3=7h?+WG/LS.zx?䗮>L<[B[@'?,t($viKVk?f;6**<6o5f}LtZۨtv7_9A8C6m#ߢ?]YݛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUM2&CƟHjƚGGs:9j>bR.<ߩ-ns?zF'ZikrOKkQ'gp5B tg| In/uV:;-e7kk|ipG!/2vBsB.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊i )v,0l˲U!:e }?2(;I;?8:"(1ن;6vlRٱCb®]LUT]*vV*®\UuLU٩.bu3bjWf]vP­.0+]urVn+vl*ث`Wf*]s7LUٱWc+ @(k  U`2ʵ$ՖUpz 9H"$Fd\<#؉}6L&.2xovOjUS =>XwwA#F]I'BqzKOj( ;XYa)r&'FJh*g8k Ȩ u+5T}A]3Q-"~8 M- HQ _i6 $uEi 'A"7e=%y#Z !>p$&OJdqD$0h[Iu GS6pnRA:u"!h3pw՛&V I,D^Onm_dЌڂ1FM6©7#c;R0 #?쒌xf4> ݝԻ:.QsI6F_,7A6*`ojP]\Pǒv}90]X6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثkKm%[C+&`Dp22vH&̕ŨڽC)cNo,?O+Ii=9=x?73OIRXPk%Ggk byN͊A46TT fj#L'0R<1vHcX<+6*(wo$WGY:MϯQ?Q2l.o=Gc_I#JI gbI'rII6] Kb͊6*ثb͊:_ژs1f<'@obvMC+׶WfemrǕڔ '[I!y#؜bif&ViZ1_\Xq', `pc9@\@-1JWbq\kƵ F Cs_ԂIP ڤ*vb s)K~2S.96aJ(ojeFKT# ,PO|Jjޘ9#Bd.urjVMw9I7d1/ `+)_@v}Rl@j\@SlOH ɉ-@jd5l=" m|֤x׮N0 |*)Hjз/w޴įJv}9g1B[ޘ| WCi2 j Yol'm,Fw5ɔ5 H4?Z s|*)YB*@ڟ,=r2) P@qn@#"`V> -\Xðҟ~LbANRfM]e?SCBF]k |x|,*;Ӷh0%;*TJ8 `XASgNc85qb>m^G[\fbO@Ǫ# j<ʻGu䖪PN[~n=k=G B-n(iVSµ٩M2ӦR]<`)wKS[w֔(qI^)@隕$*;PmNaV\ {f트5Z)) +ɹu`@Md O5XJŸ\>w%P7_ J- ^ƛdtUKuPrz mujXmJ#e r_Q{m7ߦGU9rQMz32ׯJQP=j1ߎH` }A8LQF~{m4xvȍҩ/&jI MOz6) x3mqX^֡"6"^D55r% D[]׾WsP+]ȝ U ,`PV\Vr<b1B\ G_%fjc};q9-dx]䘼4_}. ,»wf?iƛO%/<S-DHȯoEtFJ~"?anmw?O!'uKėp?8pzثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbw CjԲ|n~~# d2/O r,ݛ;/vV*ثb͊6*UٱWf)vlPثq]LUT®́]b\ ثLUٰXf]vlUt] G s Uثt]Svl*ثbL ثb۾*zwkǗNFа t!n#ew 9j]"V%jrUP]2tW.~Lsk4N3lTw%0KI$ LԣmE56XT+BXxrQN_[еEٚDПGÈ̊t$YP m J_5$!6aA/M=i0ևXSl.`nk5o9|mxl1ifjF3OZ(16XƟzہ}E|#1/SeNO0zY|qR)nDrp#n=+rc\RثUSjEH aXOC|5ɆVpvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثt*[jkۤ7aj3 qD *Eqƿ\تz_{u)֚zOWrsY82/śGyVKJjR(A-H]^cֵ$we -}EQ qKҥn4/V1x|%cĺZB%qA~^\lU |s^\2 wpװI ?#rޟ?6*/?TK'pf_ٖe4I6* $ZΏj:!{t=x]W=KGgh˧=LتW_0r~y \GCq#/ݧVgx+|9Wy_:5YUܝ矉1BqM/vzpE$WzMo/K+P521ZG s"TVث< [K:1}!# 4X#_MgvHy,lUDizi2F*\Ix&6$2?c6*| z_1%Wg ZcfYhWɛO?0{VK89WFY',gQˆlUy3˚:dk3ոNT͊l-n-Xy ~\3ͨ]R7dTi?}?~/?b_~x]KM"qL*ʎeX߂?p~VlUWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbQ/6"u(㽍E0?ɝ ٰYsϯVGN 3,kUKn7Z ۽'96&y89c/4c.|rc6Jp6`K<<ʸaÆ~41)f~_Waһ 3;6*ثb͊6*ثb͊ R]^U\OKf?{ݞ8'-~O,ԥ' ztOH(lEN_ ޸Aں[Z˨4=h1F[ۈMu`cޮbINL4kGCkqLx"/v+HRʊLxnh7SW!>xJ̊bZ[A.KVRh֝~m N2$8I%)J:f `W1LSz䅔V@z `$o=1@IT&wlyTO.ۀ1<_ ]I`Nm@p - (-,h~^7ml(wʡ ] eb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊V'_Sf_8^~^y+\U8\[QrY% ~vufyƋf6*Ƀ韗+jp_[xPa*UOĬ,ثuKݰU0ywe4Qz+lث=s=7eƭc b$RGH8N[dV݈TSu_VY֫PX3|Ybc?(\2(/ JKIӓ6*=#ƑxA!Cs*&D*?{$EUu\ثܵm&̖^TkK`9 T WOˋf^e}m֑<ϧIPO`~Q2ߙh"6IJyBy.W~ny 5# 2I(W6*%6G3 j3yM %^OKj 8U_8 :}6Hcܔf$p)N.z[lU?"[fkFKzd>ث Ʊ[-][UGX"ZYY#SbƁ4[׍uE0!p2/6*ח5+=L-zG#phׂGzp8Y(O͊y2l/5 Ȗ\8 -Mm߻W~(kJv*o)RI/bo1}RH,q/}i`.lU$E$⒲)pE(|[v6*6䝾Rolث#ec0sĥ͊_#&hVQN1_͊_ϟ&Ks?&M-Q]9dF^ l!ྒྷUx͊tWޫkjnT U܇}^>?'fX_w6Wy+DhQgOERʐƭu$SPqoI͗3b#/GY1GslGԯHG7#$VKŏ(}K?Hz\$i(Ȑ+O/͊8cז$LM;}͊ߑ1zrIw 0IbUv_c6*Lثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*a(x=Bb h==R-GNX5:gqwzwvj꣒ѷ'zt9YudOwՁRvwǁZw,S,;쭝u wH&F?'Ɋyzo\`SṰQ HWniemxu1һL fJ;.Z4Lio5\Nsq'~AޛwpE2q-a-."=ni72wɊFcv?F5N\!"v1AhS` (n7qlvȐN[s/5"3CleeC}2A] lb(Ԡ1d(RxѷG\h%q% ]ΝO~:4@hxHoClHRjԧ6ʥ~?.g 9ӾH,Ž U4ڽ'%YPoN`_\"V?^ ߽r7CLJ)#UOm6z%St̿IΤP$PcSaW2 )[rCC2JOloJ~%W!__ <$r[[ խGR;RM=0<v4(2QBX jFfb6%VHEMU(l|GmI Ҥ ׶FҨc,9Rve\<Er߭1 ܈@I)(AW@zLDP9Q:P ^?RE8%@''\fU߮QR)G)|=p,;-pgƝrъBeQo%tgTqFX)fƂP XJEGSLJ.d-҄S*v UyjU@`+36$ԓ3x !t*>-7b;{~kQR~閈cB=X`2{!A7swUR.+BqKjH u5jowOrO|p_&0ō6Z4)(V=?ʮ*R(Ԡ'`+n#F_j~v ˥0HPy̬Y~˔V|jzMSPj@>ٻ`"J˱O5GэiyFH&sLWy- ( Ɠ"JUQJTEjs|z+{ v sO!|O'l{[H՘Ɵϝy<]vlUٱWf]vlUٱWf]vlUٱWf]vlUؤo" ea%DHQ%8oZ-C''vvjcG_ovg,u/_%; |0Z?/\# ͗\]ZYG>.?>E9WaA"W{2˜V,;?-9#^.,},s}QvvY-͹Fx=Շf'ϵy``ܽvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]wTR@P*I0[{g\n_#]"#D>?鬿^0ilje;%D,bzaGgۮqҿj?,5'ֵ}.یi۹=lg3'O<#8̞a׮Ӳ(Fy֫U-DltH; vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]tW l,rs-a-@:mW!6sWh}3b3͂EXDցUhJu ӒN_f_EfPZڗU@ثθ$Y%K}5YXT2Ք^O(~l?3lU ˈ}GQ0K"“.Ɖo_&HYWY蚮oo?{y2K'\}D=.^:U?aeic%jݿYCfSۻX!{kQ*Ë)lU1>>IKiG)"47?,~dpDO?Bc>O^*cGs ;׏W'űT \|qX;{# A~Kk{SB0Mt.8ޅB9W/ i7'"D Ai[yV}=}Ĺ|)^ {2&VNQ><ث(ouu4خ5ri=v<\NR˨|}g5vr\MO85r^H?y~mkSϒܥ%Z+ޮO Sה ^\>6dثثvI-bK%6*!dh*є}G6*.$Ҵ"}EvghO*0[^Q!w>vbxVHjE7u,L@,*m_iZN?[͊ͿG?mbTux|gkp΢O((ңaӚM[#^cu\?usqa-q$$٣FʿYWb鋧Av_^y$~vDG8Fereb$\Ƈb2'}KEQcr4FQT֝ `›A COϐ(,HlRfS4Pd:U+b"搚Bk0"9$-_ldEl )d CH)N;}; 6)\CT+5DSK r2\([]媎1)7P6;dxGDI_tFZ6 @B!?^ -N$:Ƨ4e1!']lqmy:HsTSjȆ )e)\7\Dt* u>5ZʿZl =3 ![sEb]{wZ `U~ *5NaeWmSmMpD@@;L HQP i*?~FҩpPԓsaZQ]KVڿ~X8mԚN|j*s޽20n§sl6 0j#DJ\@PIwMv@<{|? ؚl|\DsD9:6kSt^eHja(뷾c\%VSN"=bvcӶbv0Zr @Nfoc]˓p ֵ?FY4$Z?kӮIV _/ MH4'eȐ㡩4#cIȓi Fߩ0KP>%N5@ 5!Ukֽze Cωnǧћ*VSP9jl+#Z!sl*ӡQ@ q*Ľ8rlUpZ=;f&|$N(~Q wOLJ*8RO|4iߊr'YgmTugmvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]N}2.'-ŖX%c&;;|o+oV:,A$}7赱>?m~ZYQgm̕1\u(cG 7:ZYXOǝL/#j- iQFOn\qeɠG {|qv;O}gg5]jnےqٳ#ԧׇg=s:cNOO?""c,Deh_HN*6-.n+E(DѡZ1hkrU9V;=FMΗ)hӊz\$m/7[fYFzMghӵͲ9` e2L<UyyhBٍ3G w s/F 6$B奯=N|Q^]+rGk?˝ ff9艟ӷwH9}DMWG~?8,w.+r=A]Im#'xxlUzuAUq]ODk/9dkUHYbʚ$~JȾb[6kj"F(shS拔4}N yg;ȟ;?cz)ׄ> x$&_AyO!khVĖfOMX4VeIlUu&Xe5U%KYen2s_=M=>&_\5EeAK P,"#Y^)dT'._mSb?nK,l&H6xGs/~U9_poef_B[VA q͊b*տ W?TٱW?y &*&`hMŮ#V-wqz-/OOlU~rYyJ4Q%7A29n?zǞ|AiJ8 ,,ٱW$[fYK+%.lUE?Mث.mW=bX$,+wyU(,-uy)TSB9:1_$U ;ԍXSx)lqre >*A="m ZBWv$9vh"kZ( ƄC=ԓC$$yVBIO@W|#I^ZXz%]3d: ~+:a\iQJT5CS+\pR5]{bq,9KjM)qW*+ʇÆ0W#ڠv7*mW4Lk'_m4?E$lpOe.q> bW'Y(s-3Kč\ϞlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU;F.t{n2/GuaN_<ˊ<}F9a?|o1[3/[= G6>㯛2ʏwy4yV6"w +ˇY5/gh?1ɪQQL?cJ$a,O0A[:S4+giCS?Eu)eR3;s9vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]__Aa \8$,r#qH6c,┝kx4YmKQP}ntLݡ-Q,{fI9׉_d{|ޑ#xV0`|<ݧڧQ臧4G3_ji=ӈARO\),┝7ΞtSU-#?7.__?'ѻ;㥏GӲ5lثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث~>#8 0EYgEXyeAry,XIJ.)^VRN ȥنv]1WeSvlUٱWeWf8%ٱCaKUT˦*]q͊Ź]L­b#;+u3bW51Vb;jnXU*˦vl*إ͊6nXbͅ]\\U]qLU®FusbVWf\r*]1Wf]qVUqWf8Sv]0+Wf]vl ثWf]]6vl* t,d!.r!, N&b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊Zok)iVږ4rI1dị×TV_gK eٱU;O8djvMQiYn[7Uգ?ڒO^NűWѶĖ1ơT*3b?F R%3J9zNV?z&Xϣ[SqyD9TWoΏ4{k}ݕITjq%zH^)%kwhR}s[n1ݣ==)$z1U?9tkkFv>m}Wf.6*O=i_hѢ~>U|l!:xtW}AM1/s mgo (WF4y$~4IUo#تuOFA5RGY"H$OK͊UұɳXb+y}U6'Oպq.lUlUfԬ5_iҕ3LC~uV#؍3XL"osb^u{hp@U.~lU=~MߗcSnaԤP#[I"Byz\SS{{lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث銻OjH0pR'sĕ,RHn?┬ C)OzS3$/jz"[!Gp32\HIy 9|}-T@}Bx-c\ٖ n5XJ<4XnISM;) n1W10jXUU>ksUM4lK56ld5ۖ9U'iT!֤ -k(23PԠ\Vhzf:*rE 'q0ƕ!PGorHPN,Iۑ>ʥp%Pq =+i_ L+7(v=*f sU!P9ǿL0ZGũ)<&LiV%!+BG}5$$&EAG*SQnƻƸ}]KmAsB "Jx2;wd;ae+dY P52 S)u%Z^SJ=}g R7 AMߦ%U /2֛t]*-d:}j!V^Tz٩AA U*ź׮_L*IE=n~l T"u"]@5?lwƕ*6 (2V 9((AqUL %""- G#"Ũ6+`ix@;!7#Z-@E~JJ. J@s4fR6\cQWI$MP~4q%Kh-`vvɩe0BBhhƦ=6|t4oFYdy:=Jw[xl@sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊i:ΕpvnRTVsK jMG4L&8]t4#Yuԏ(EgKJ3{/; [6Ni<3긚mToY5?%^-xWs/CD7>.|@9ĽU!!;:?0-) 4}uz2?/)-7>_(_).ӣvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUU/3Y0z>Gmz\4ⓛS.KbڦmRVKT;IqYτxt>D['O1vt&y%aI:gGL,;!C4=ný_X-Fy?ʣ3L]~ <ˆN9\j1g][`>~?]gKY?#٭v͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*1z 0aY?ד)ģ̟t>ו[2)vjb͊] +UtJf‡ffͅ.͊`KL(j+bLRlUx⮮4(usbf])vafu2銻7u|18-i~xZvXCI^j!f+ZtSF W<<',,?7nca<x ?9e5.Ox ?9k10*oIcQ_΋ wOTg(:_΋_CT=-ǀ^?5)2c F&~?a]DOw{~?8ySQ|cI=?xy#Or!/aI)e'jGH /$(bhݠz /%Q5M\)*TT{P쇻!1cʮP.<ߒMlK|oq>?ə?_fq>?y?ko^O评]f:4~伟O]c?O.~w1po 4 ~xWw1 +¿A~xS ;?MW Wa?-V&r d0\lsYlu97_S/\[b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*UصR,0gc@FsYF {`Z zg+LS>=@]jRY@h@1dѹVg#"իp;e/\!%ӇU$vE1"R:?,J5auX^8K44LuHZ%6O7qkz* ڄu*<#($H]hw*P x{kDsUFA/H+wOAƢzfOes:}+bl^֠҆\6 /Qcr7mP܈&Ԯf_|< ?;: +rT|@8()PfHJ7< Q(O  ="X`cTV%c&3ܰh+Ƶ>aGo%…&aTfޟ7b3`^ 9` ?+V aCJzK#I ?39dw®IXAM#g]v雎)m(NJ_b &ԟP1)wc@7܍ !MKV#H5OrU7(8mSɺi G,mĝcsf«h#SM{V)c»#, bLK1{7, 𪔌xк4 Nm p\ ¿r&V H6#4M:ӏdr^Y}ڙimc¶qrB?Ϳo/䦄_2]@G Q4&aCȃ7?( |2T C_Va?N`qU)zׄB PNnUIXhʥ1^ކS }Z1,E+^-4逪;=Su_DVWm]ǾIT&Yڌ+(S2?TSU7_U}g!^/q~eUxImҿe\J[w ڣ ǥwZ29KS @\=³p`Ebt@b8<$!mmQaB쥣ۥvN]pԌ,bA=GݚlPz(j6Q.H^h˦Rwu!$;6B3jĞ4J.ZUZX@"ГޤCX&ՅēM)Z_Qj\_rTGmᎧ|-!ꢆO]dߊz?l1 8(Ytl FPA4ߕL D4ܨE~">#lW!i(CLR[ :M̍^$ܞp2HB;~do maSQ͊T*SCJ|=sRcJxؕʎ?͈q'q\Z _ɞYvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]YMg*[9T5V^' (A!;;'1aւ+ރg韧/hLzoK3awiM "qFV7S(E (g$a7O)-Pn_luݓ,^^7ތ;2v Z%Ӡ?o[N]կA/^.Υmsk4 6VSPG:LXEgR22LvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUmO] ?,kZ8}0av4{/[:iZq2i2K Eu[o-!zw,]O'Ky;_v?d' mMs#Zhֿ?*\ FQ|Gߋƺ=,_ӐC_y마ľ=,yn#x+QnL#|6C2z6 =_ȵYg 5ZuqTƚg /(w <֝V5skZ<1qD2+LߣmƲw;hطIJln"lyF@Hh:| S 19oXi?࿳{?:89pxO-'؟_n>._hbi=ci0VO#4[=x̭',?7'W|Iei]?ۗտ+K~eign2_P}c#ėyldieVo>- |$_Y?h_Oz˽YiQ5dg\a[Ez8N2"KNY7)Km]mpTlp~Xa4rMnWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*|QEK vzCO,5}Mk+P}gÇ4 Ys!TJ4傴6/_ [那5nR۾Q׎E:h(C0A9"-f#-LԠƩ\%\SHzcJ\ )סS^fjz|ǎb0K ?h|?r*VN L4Zv; پxr#}9]FTPQւ閝i ܐܝ54D{.n,UTT5ko9bsUpGJuQ/ oJjo73UF||s{bH7N߆U; $eQ]N9tVz0rȦJ5 6e ܷ |*N.b:wBqUA'mȥ2:X=qMV]̕nTscJr@Z$R+7Lƕ}~N}ˠ0 *\ wS|nK3z@*1?qB A'7LR)"ʼnzx䐰qV :Y!U !W,  ҽyٍ:bHCU*}[_o):g"!~Z퀥V`@f4$;^ ?J #E>Na4pVغ⥻}XOst3S|p0s)ƨ{O vIubS9DIPmlFjv)T$P_g,aB\!MT_mHQsZ jb5cN_Yxd!.ہ@:U#2.ޙ3Ti]"$>dmQU%1Q!4ۖcZQ_+t_YDxdHJ2 T]ۮc^JZRO,otpT+T鎦!}n@s4Zl:1ƕr3Au)MuQY H ڒ7"VVY`W *֛Ҕۯӗ 1Ȫ u9T׬ySMݛ)\Qx$ܓݛKWaOooG$QVYh*Q30i:}>q窺&svlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf] b1WgHgAY%ԏF8}y?;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثboZ,^e9u'+OY?Դh`s*#׳D;Wڙ56/mzaǒ1RK?k[w? 9ke.+ӇV;:|G,PDQ@(""##gr&FkeI:3Mwjao},1❜{Pn5̒V?'.YeZ ?iޞ>?.|  8x|$3"Վ_Eh-?؟A?ŠZ2Op68A4̝Tq]+>]}X + >Zhaݤ_Jҿ\>U W~㇓t_\xr> 2ǔ410Ǻa zWcc;kV"18ǼtcϜ5oizSc#۫2~cA a T;5ԕ[/5h#"w宏h?1Aқ}`b]ɣ=eoDL䀽fNj\BSm4=> op=JNǵf*:ąA- 4tWz_NvjS%Z]ےM{a`J@aWcW|ƕh[P :*8?sRL)M;j@AQT${Q{{b-KQKhuLzW ٫qpбj,X4n8i Z$jx*KPs"ιL2%(W<x56JnvN=J~~`0בdbxcNHǦow]2HPI~G'z()\ CEH#_lim{T#7L*⥛sSVGT_P6 B*n`(Yꡫ7wN0 XV]+fp+A-4Ix]8C13 `9s|櫍cP͊CReFSLo^lMHnlw«=EEc5,5+S!S\d+F>Y*"%GLU@ ԭxI j+e M>TƽpҨ,U#?q,*(Ƶ Ƌ |*ݕPR~;f\B^l#E#zLims;4뚘U vY«-\*659 WAt"Q!TIDg`54_aB~.t`UBƕ.jaUeEj z`Ja_I%w=s UǕ@+1lyHʬgr#F*J*9@amJ*db "Hz?ˎ!3}вh 2.I#z~T)TyZ3C6z{ k/?V [e*- WoJ…6(]EJm^g5ikCrKSrP_ˮ($ gM>`{e_UۋµOʦ_Y} \E,UE*(@4(f#(n"Zu/$fpOj5GZ U|;ooy?oՓ4ѷ&;cN8ssb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊$^UGԶ'≎4F6͖';z溽ogc 9??⿜\m;G|Q̿G/KƗ[ @W?uzcRI7T-uXMk,gO~l8f8<ˊNYʛntgoؿ?#icb?gdܿN_]wBI"RSq[H?CK0r~??l6<ެ*?]CC= nf4u}^<?dӚ;?; s1vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf] {r,Qƃ+ɖ8ŷ)d<1Rx {z?jo!%%_^G?Ř8OgdoF~~ṟY+_/R?.Qâ<| ѓQm\ zqxghdԟQ2?OyiVt&E%Xyrዅ ˆNMV]`;T#vӏ^Aر-u]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUepaaA|xO˳}?aڀ.yCҠ_C-z/ábXQc\UnbS6)q[+,Er\ثb*xC| 횸6*f­fl ثZ6]ڙXNUO僊VC50*[͊e(\"gEFl l/AjnE)4!`*qBFIIS%HCjnXJ9|qJ{S.\j`V͊6*f[LU+zaB QV[08;eU /,j \إ;ouI5q(ua\r*eWnuN*2sWqVf[9W,b8VM1VkZUilP<1U*iRڃ*7QAҥ1ο-ľל|$ab],(rMn͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*fX4c(޹{AY02v}*H(#u?vy\;a5 ]dLxU+Km*<:@`p}bġNX'&- FW[$޹c$)P I5aB#%j׭r*lB{QJ7sU̒8} T US#KNg5+%p ʻ4;٩9-FBH eL@Ks)!yt+\HCQުM0RyĦ}O4MjRVv`Ɩ0xYUSg/51VȠ`)&zrHX1;*pRUZ.䏖cᄫV~qA\d@TEIǠ\41ވʨsKm5"=k"&8QC/L!.ȼM:?qI\o$TvTġ;~V߂?jS g 9V)Գ7%;W^x#u`k隂WI$c3쇠7eL<9.o]@]4 2b%z:c^K?'ݛUZSI MVbB-F p•8~L5IMG_s`VՂQ`M7#OjS ئJCcS=eŸLimSG~#ǚrH3qX/V? _p,dZ-W#F%VZHnܜT׽?9TJnCl i.*To=n%_ܓZ-R]4&_ +skIvª*߻,U UE+%AN1ªQE')@51[%>Ywb@wlUr;Po\B?oՓ5*#&LޛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWb2ȳ@923`Ʉ&*C.ΕoͺqևGAO }9d'+k{ ʹWggJ1=FSPsEgX )tyku%*ly}Cnv2id]\tẂ3Ɔ⨑EOQYp(z{ 7kGgܿv6/R_6'?Veg&=~ƭWaɾ36?j`%?_gOW~]?=?Ϗ;3=;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbZg'}*ĽQQ "D\:y5fHdQaާ:b#W\vE={29l?b\OZxs?;>p!gD冟Rk\|t^LJy~?ElVA+c{2I5! {^vPۇZWylxŗ6*|oyzVagG 2"*|\xYlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ZKY$(Mg} ,W׋+Ķ7gҵH/ԷdCЩ+X W i\F5){cˠĩ LRnTtm.h9k!BӔp=)7#C(< fE,(ُLUfgr>ʃثP/ޤUNۄu PҹtHCxW:W&*o]0dW 6́+SSGڣW|U||45yn_\iV *O0fU+$ 8rlWB\UlN *~ rn]ADT (e !DOvWsʵl4d3J5Qvj`J@J |Uw[8НRҭ:7PL*n ՘VpRHR\qW+ŽhMh+ª-1(LiV '?J(ߛmXUv ;ˑb~ʦ4V7UHnLƕk^P׷Թ*ŹFƕ*ۭjtW-z$[RTƕ~ 5$醐-ԈA*P}Nƕ ROۣWVb5 ⠕ k$rА:փc1tI#3W(=WK8>502qVnٛhiD@Sӧ́WpĴD5jʦ4Eu@Uyu^;fUsvڕlUa֔QӄEQ_1i]kpр0Taf0f5銪[%LʮE8|*sW}>?sj)Б*en[DŽ7@MPw`܁ПYs/Wr*4(Nx)t4[7 ҬKAA`  /1CqˉYOkJaSK( ש6B5`#=3SWZD@xTEȯ8*wXU[p)=6 |@++Nٺ⪓M"ѰliV-a0v*V&% FlSliZ7ۛMz隘椞]KA*9ҭɫ*f@Q:LN; Uu*jkBr;sJ xcC\\2!M7LĨuB(ZS| tF@ve*tw&(>ʦ4yщzU!y"59vsGRz9`W%HC>(Z64c̲6 Uh..Uģy7Dn3`~ϛ.빱Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWa;OVRUNOs1LqΟ͛;CLv7γKPɶO㿏Sjx7vN&A$LpTΆ2nQ14vvM5MC~'_ϖ`48Cg /T?vssԙ47 ~ gQؓω/Us ; ,qŽrpK.=~})S/}X_48,.(03yiغ G`#' vLbR^vs$\b D΃.xLJv vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v'qsguVbFSO fj#E4 ,2эڋ4c>_?wX;6Nc][WUOb[`rsƈrW?bX;-za*Nt˭o[^VmIsa3v 8ᇯ8O^'dAI*faR}qb_cU9sl?u}_d`3rݑ1~ai-c/\f?O9v<_vN˨޸!syXٽsC@Gm#Nr:ɨ#gZ}Ǯϗ#9v͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]=; mڤb;:n1~SՈ\<~IUZiv}ʿJ0T=A uoC4R9U\m6"ARƸ!%c۩HqLF˄EZ+nlz5Er2BhQAS;E*|zaJL<3aUeM]M@fWfVk1\\UiR0ڪvTlE*wD=ЍΜ rXR?L54h"k=Z4MöIen;fHdlīw¨y%Ug}pUdkҬ6vѬG4-:#u7S*B*GL؂<ͧ[ 0!*@;!;I%Nh2 %j7["sΜ{n+N;CQZT*ZQdӢ2+/%jyc`ҧ,&s@:|.V&Q}[jK n#(Ѷ ZXPꚥ"'-GJӧ/`h_wsV"tKeѡY 6 2Ba^O0K ⎊#<o,)-h%ꚁnav:.ki4P7$12Үo uAɘ(q8H%.O8Ґy8yzہNSEpg4؅.X'c iFYT*C//zC#n#uvtSLxE%QPkdچ<C!.5xDUh_u41K$uxc)ّHו)ZlNJ4DA䛋#XRE+Q սn* %Đjci! Ԯ M(,Z#6*r/(WَhcpkZ>ى '^dv9~&͊??k=#6ArK Dg͊3g8l&'yC2UeN-ȫs'6*@GwksbL/qE=CD29?u2eI.iޞYlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثɷu./lHS4ݡpG'vzn׬فG|3';R(09zPP2  R Z9jƵJR*q;#l.4 H /e߶8u!r JC 3SaU}S !lU ^C@6f*L-h~a!u!GA4zotJ5vc@PO}eS*j.ǔjG bv HS 4,SIB Pn;fHTKDƂrvW$raU8Ng.z٩j-PvF*($#U DJ}+M~@*ZIVo.J#me]b)WCC-0ډjʙ]5ȊP$SIH Qz Uo#;*|RZF{R֖v^qh4A*Ÿ'ـW@-v51UJX隘s݉Am51UYj(LUw~"+EAV.iTcThwI`~|2醕9Nb0R!@]S *q b@6j`pvf4Gui^s*T@MaY="1Vƕo$da41]Rv]=3S*p ( +s_΅R:(=S*43S[s_δF._Z&fo>?:2_;$?%Jб" 6_\N/cgN?FN=j帊R{+~sc D2}2 2ic(Z%7/qݛvlUٱWf]vlUٱWf]v!uoh9\J`,y#XCKE}ZT5ʻxF ( O[93Yb>[q{=31!5`%X-ͿsU>Il/ObVIk}nj Q7./e?g.iDG읒'n:>;H15XfaDoFM LJSm'˚~)cF |پåLJ?}O=W?#/?~`%X*&fI n\P 4wKKӪJ;'d4ŋh_;7b˼u}?]_5_рڣm'9OiϵCz/ebqp#v͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*U: fG,ó_ 5枆ђ]iJS/ 'T僩TMf\kҕ8 UT 6i9t鍪vW爛z;Li {e1d y/Nǣ޽r)FX |!h|S" Zt, ]qUf8sb͊Jf[kxej⮦crD1W};$*=Ff4~ř>X2͒nf†aJ+S(MOOɓG hIcb4 ͼo,ڕvⲑ@5P^0K\%2Yt],tuE QV< kkjO2S-xިň+Yi_WR"!Zw?lKsP\V`RrԩQAe7dR)RӇ!ץGpN mZp!DpEysJSh?|a'.I $e& ЅÇg.d dj:'e_ ,%w)*zZeJu1tX?l2)TydmȏܓHѥǹ) F̣=6옎h^9㓝E *;`RbR\{X1m,٘ bƠ1Ti4PXŗqu +J|Rwaۏ\:/Б_KBN7_4 ә=N8Uҭ*czvq@L4I#[Ie?$uq%R341!!!VPvѪ."oߗ;yA!߾"-a[pxlLKvsZ3aWVW|I(1"D bNpPT2V녚K>t ! 4J~2-VyjP@BTiiF6."MVs߫3CH]?HA (!CY#rPh>-C7dO׆BXˑfKK5c#9pjz rn6 (Y&؆(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]|9 #06*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*[dqєG3bK=嶝cQNU Y7\ċ6*͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbvt|sbZľ4=cW;..TWͶ>`VNEOtƕ=qn3qƖ `TRztL4Mh+ƕJ^k1UiJr{cJ0뚘pޕt<Ƞ?<ƕAX/v?3ҫG3xPm+_+zC{`V䒉ˢ1闅T~@`n}B/EXS\pҺ RP*{eU&y|F$*NLiW5I(X-fBdהFFmuJ5>4$R Jf#UH K԰7jSU_U+~lHQ7+jvŏlcJ=㚘үT yRT1OdJ= xJثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث{;ZH?i !P7bדr =sR^ܠ~_7;k$6dc?QX/Oɾesm!(^I7{_Ng?y!NUW($D=H#ąeR'N4Φ9]Pe!GuMZ%K[_5{/O:1v|_yj;Oi7⾞jv O"?8?hd>_<n ZxA^?ٯbe#,}\v yK$@?RWM1?)dԗDi3s82?R.ǸZ#L7>?qGy gkklƼrCsf?Xy 󝂓V_oO`aCaͨo'eΟf?ڇkxr6Z??Ov&1[.f@^f=ߓ`Y6&$'[*=4?v%5=I+Ɖ'#/!\|ϟT7͚.̣r8?hr'bɬ8Ի?S,cf>Z_MS?/ye-]|i3?`:_Gˮ#_c~V薔/Nü)sgØ3uy{k<'dL^$K#Lxhd<LB7#cA(ۈUÓ7=r .^EJf ƕcESJ&qCj*;f¶+A-17*vz\}9נ[rGї\ ZFnt48U aU"uTʑ˯|USl*H6*\dHUQ*Z ci9IĵGO+_7-kx}j Z7*tq Thr$ZXZA(Tr:vyn(p 1n^9\F%B?HyZEsͣ pxa 'bI:KY"1H`J/7#ΞOx EQ'55ٺ1d 5I^hX)-bbRj$ T﵋-##P_..4?ӀBZPVTzd8*y@9ҴllSӷS§$ԵM[dW2`7"6ZŋrB<Gc Jʊo'$I$U#m[[78cTc x@[Uoo#?\XpCJw#,4o+F5,&E(:->h*Kܬ&n]\4Sz$}i=JS#Zfq)MkwO^NTy8Pz(0 慄#Ff$mb*uΥsr+ȣf'ㅼ@4cj7,JN,z}P\UԨMNh0]ժzvŻu.QW|wWnmoC!dL@ji?q؝ia.9(ܑۏ3[V#DERTAuE*"wZbɮ[Z<*-F@EڔU[bb*?!e}]␎Jiwn^yJG$S $fnj̈xq%p[D?/#F#u_£&+x宾6*R> ~X|DH)-/෺xCXb^\%%9 G~ _ Z o$QHcj/gXf *HIzy#wjpO ەQwJ0՘9WE/R` GZaioc~l5,.p>$eU2a ǧeGljV}hLz89?7C9qO];I Q~ Oxڷ7xc[FŃ?ȿ(=d\Wb\!(]0/v'XKgqs#v3Rklj8v\G;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊GgG|ǛvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU6v,&_ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,U4Zcb[;4go_\=j_@qPsb8Ejpу.RH`R_,_|U[,w^Uzuh R 뿫ޏ.i RGǗ^@3ҭP9arT֩+HRhqHޫ#%G]q¶mSɹ4㆑h1DqAut$قZBX_חLiZW>;oiV6Y51Xƴ^٩Uu& ;PbvVF~ॴT: $3SU^;޽P⽵( a0\iαݱ *=Z*Ǩ*jhP),2*Ik ƕs4kEv\J2W/ h=OlJSTЁ*o}AB~%Li[R(jh=* LP<${*UkE+ҭ[_eyNlA4=khMDN*li\XK|S ijw~Y%U/#ǫ/50l;?LRO!횘B7[k9tHQʦ J"U5r/ƕZ[G3SU:!Hw=)^*Whvj2*$ޯV }y,"-Pk,Ⅻn`+q @[ WSZcZîqj‡mkKj_}Oݢv *ԝNL(BtPb?LiWAQsS -O|@ڙKjzh _tHC3ヅ*gU>Z[I]Ue$L5e_L4uTT8bz)]6")A4뛎<+kOm> ڜd# {<+j#(赧\p[!$ Iʦ<%WCI*Uo/Iʧ5ypЁ7ֿHdrs+iU)2ڱ5x}mYHT`<b)+nͶ1o9+qIA-ZV(j+jia `GZ<6_;iX@#NQjM&%ce _>i=cj1+n:o£~pNMNff73];ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*g\Y7k+(O.Y n$Y1G ?'dMl$tQE 87mvhs#'O ؘ'?\N>nΞoVͶ>މG=_./D8❒+/̍ap#o 58fjp[uY;#)r1{?_Q?vFuRjۏ97&jY}"8KK8da>NȮ CS?(,x}eR5F1uv3ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊-zkU;>Nν`uk# Hb5k5~i_ד'$j_ uѶFvˡUnj⮥NlPr1RM()ƌJJ#5\~X-V%:qLUE9^ TY4]zQ?3HPQ^UGN%T #,Mヅme_i ƴad.W3`U/k&V镅WWjeU36vlUUeW0y_]p*'lR®6i]7*Q:;f.Q޸|1UEPw9\hzm\Um3b;ӗV6*fi /YƍpUƽzu0%J*Uw-3`V'(bG]')X O|uׂd8*{fH(@[d, C 6G(J?ʿd + R e*EJ? X`-iL lFDpTSV6An.wsH)ۏ u+vb9aKP bB׻t.+-m%Kx-!!@F*ܱ// /\,XP7'ςVL">,G>UB wbwO##[HWJU E9#`*jp8~ (~7Cy1 t[/X SQV4iXv_qK% /'q0Ӯƅ ri6uA0+BYQON9T( ,yt[ǪvWKrK ʨo\"32F}4sFSkdO&;أ?50#PLy{%mA^Ep79PlEYF1 :q_T̐}յ^a9>>O@B=jG)$Pf[5m?3V.›`]f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW?? (bb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊Sŏ\ث6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*pjbΫW6"ޒҧr8mRjs b"a a<É 0pP8XЯ4be1+q;9N^=\p&}qU`+mAK&յHm qW$E`۸S,&Ewڶ[eTdGzk‚iqTZ<4֘$ XFGLk]3\ǩC MXW)od?ޭ;bzt=Ԋi£#3T@eQOF&g ӎpƹKuI";2yiE]qPs&q[ie*B <ͯXlx qU wYqRiPi"IcTJ;iɁTZ]Jr,W*0U jBj. dt&as zHRszwcL$;[qޛr?e[]HCA޸w9(*ꄀ}M;u'o|WE<#v#D"˗(l{TOϷ'%dLԮ IXujꌋWީM-ZS<:!.&C9)M/<妥0RJl'SoPS2()X/u |W/Ԉ ~%Ϋ*;`F&L>>1{IKMmG,K.edzf/߀dO.I.?%_E>#Ϲo8 oRߵoW|O2zb*IOݒqe9rI2xoLG!~k91?XFOzO_KHJU# u?'E58jA$+R>gsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثW`m{Ph02!RΓ=69Q͋-vv`V̸xc/N+O.qE'x5s?LIūX$Gne_M'0>qv*?9u>A7ד]_L?/dcu/sx./_%؛qn?طTȞݏ/c0!_͝iD$eG[cx3cu ?RL/?ȏdi?l❅>g.LŖ,鋗 (r?\y9$1InX vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]Nh^l5!׭_ՙ99syZ=l3X99 GUcePPma wˮ*Wxޕ͊#jCs\UaZ4pz}8kJpx8^l:U(Ӧ*CuҀB䔦ikLz)(2Z*thdhH qZ|d _a(HE{fARwY(l*;9ǾiS۩w=Ƞ!Hʒ}oReۢ6ܚvI)IsQkt)\ XV =Yt⥏D_9T[$ @I-S hdovV4zj\GPZD?WKdRȷQs}<}nH[U TGTAG9b*w'm6qz|RMK9'-i!k:īBA@)Wd҃:0'¸- i*(47IJkn[)ʉnP iP:ME1 mr#1I7EjqJ(2q6S[IVGC ~I+) *S/6**l2iE7Sa Wbp W\|­zfLƈ|G r^Z&I!<F`ˤi"dx{堡+d9'^qKO8Ecm{meR:Q?!1Lv)o.ZAU)NJᎉj# WT.N?T̾a]R$b~3S)D({ ekn#av VQt M38H9TtW]-ý 14LL(0ےI9TPyl݀CȨ_xᵵ q@;iHv*prnP]ԪIm3ܨ)ǖl%)N6Eln#E=U@?@PI=bwcA„LV!Y^o>O@ _㐢+awS8C|Y&؆(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]|9SOӼјz\z/>.o*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*تm?XL?5͊Ob͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vjb9 @g-0n4*K=i7hv/&OR)%m? (yV>N@ DJ!u{7ocź:@awκ73oh!(v$@w2_AB\>3:'GQܴDEiCv1LN@r 0Ry=SRr?sr] Jw c;#Or_,ۈ'P杩`tJ<1vvuvҽr2  >,J@V QJp0a8~VX曌p󴜇*Pp,,@޽0|^qxuNK/(.20\pcL2i-lnm,?d(wcN5$-HU*z}Uw '=ZSHItQV\i6"rZDIFT- [!q?[kdR :`M*I5LQUiLXҔf,f2T@ Hm4B;̖ >=p# >dd'ܟO@O9 =㏙l?濖rGؘE4?0jw'3<1O_rPT uQTfh##Y,2S>kj~|)$?(J-S{Oݏ4RHE"$wl*_Iԏ3~TLݝ9z*<^mG[NxR<'2 w?U?I %Zoq܈o|N޿Uң E<)8?.GTD"e\Hh|ů|{!Z=:$P)!hkAN&3_ bo (r_d4A}&ODnArƋ?.wҧ?9 zEWU(4}}Z<2iщ"Jlvkq#ywRa' Vt74#׷O?\7"Jl:XńO޿S_J[?QOK?\Za5U*+ScGB2_#Chјu_n8c->~TG{q~N(OſM16@~#J{v* kb)ȅH*z+_4D.?gQnӔ?1ʍD.o9Ɵ(彃 AnxmVk^߇򣼔J-7彇6WzE1.kQ‚rCF? y#@S/$ܭ>XNJ-9~GzMy%]zdc`<l SYW$ӉUV 햞l`5$+ʈ(13cu|%C_AQ5=*|6r[cEF$JxэlAU51/?w87^>^پ%'-ZF5a{*$#v1ƫUğ^fn/ tt$w17ט wxkaҐ-q]20zu>(1]6-?DΫeF-i9v` .K4Qd912 j$uW[ iS@'7`: BR<Z܃ 3|;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊\UwQ-ŭ|A: }JMVd棛\8eT99)gh.ڛՃ1/)V®sW8핊wZb.W/ZFQU ثgUjJe[R +_J^zf +aQ kڿat6D3: M qb =(d3sLZUXV]bn݇\B; zVK ^$M1U0uhŕDfӐ41>gֳЖ 3TܷDJtvNj%Iz<RF]ӧ[YSÇ2_nA\1!X,-ҬT% O#6hw[j2r;IH[r= ̺}k@![1h| 2/flVK VxHEE<2'GHnAM[k aɟkeny)RdT*: !V;{[۟ Q@zS1@1gr7\Aaz[kPox[IO,^(OIX4&xkKmH(y^_/ZXBv-h$UQK{펗HIbnh?!qH|>c%FKIފ0 ɮĬ61}yPB;Nx|4Hu~"uU\.WB BZ= Us.Ov|H)fj 8@Mn|~\Ld)\ SC\ Y@sVփj ,~8c ث!\-tUp*  ahUI`ANUKH F^ }cH)S!&=ɍI?=~d5cpUCy/xa.j$sj ]-?DVo돆͚g_NoЖn9-{3\|0O/%?Bfs>pplyR?NQѭp6<ө{}f5ppiѨ{S?+onyx߇%w^^/4 PD8Ƨ DEsOf͚ʳ?9=Hw&12 Oŋh$bf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWjim(lUVlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱTرk~f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbv g?q.nFM ,|W)ӽQ$>_)9]=8r ;zW(:1K}mRe|]f;|)nRTm&hqU_4t}mޘxV6K+JӾWH!^噼z` KZ0>Uǵ FS^cS*$dx±'`N<(ZցQ~IOLS[Ee>8a1ߥ~ Gç MbQU`0AѱȯSƻ:*ԦVp3E k@(f)c='纃}Ko3Stdǹj(#bG3r'9|pgI3nn~xB#lo똇+%t)7YEYɧ`b㌵ HS ce ) cNxx"nŷj`8BUz~c]OZ' {hh|:DWMe1]ޥC 6)RS({DTFZjPtn I+m!zkww=@/_ zM;d5֮16tVLDAtzX&o8'lxA-q?r+r >^vjbq8&{ BO_Lf\;T $|+,ƾ5:' }B-| ڤBm5nWmyW%_-Oj&չ|9.\ ƟCƔ:ocO># {,W598/YE;f" ` }IRj2T5#H]1R"". []bE1pq!-)S#+^+ ŻaC_<)olF8jTҸ8[)Rp _WA{!֘xBx[@o^I U@=(J 8ZX@omxBoQR2I9SB cg&MTW2. »r2ܜx¼-}Y Ql+ȚֻLo֚pp/0Zo%hM6Biq]AMz>ii}d.BBFo{NA)hV÷SM/|<)T4S+R5u W ;(J[z &(E'$ ژҮ+R 16B!. ߍU=UűIQNih66=[sjWL Wq#0Ƕic.Tn=11&տ<wQ9Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUôq"[@@ ,oeofLWڍ׏iX'$>d-; M O%{eCC+ W`CDU3bvcZAV㕽}BJKciU!3UNU!Z֞T:?mASjB%[~=SU=) )Cd+16jO}PhCpjH(#v3qjO^dn],}CVk1!GYNJ ?bRiwlU@rWTe4tjvl oc(⭎X}1ۦ^ Ca]늴PjƕsFW9gcN\2W \vVnˮ(h 1Uc[muWP1r}9we!:}l?dz/ ?2-)>] 90.xٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUJ/3u|UvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU6v,&_ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWa}e7]gcg_cZQFV^01)MLc\2М4%g#L83 LqHX{Whbz+!ie2_2 -4QF9%mޛ०s#Ad&'.0R)R!e i]ȠvK|k3rjdiQJwE-\'4G7Ɣ=NzUǫ Jbk5d43VMF%iLzV~8)1z%Hu̳Dzd00aZi>8}DO~ٚEђ K=:햄) NWj )=JNa![sI5E;a 4\b=|LHR D`uĞA&¹0Kƣh2DUH덫(p)‚ie==P|zi4k33sdC&H}B! .UJ3zڠ1(ZoFM4u@.O|v ^2I(+޹ n*F1&*JCU$V>mm㍫RZ˦`V^֭*6W2ؒ;VG|Sը)ouƱ|TViȨl ڃqt"qQȱ+]I"2A 6Urs*:b j"B)arSCЎڽ(h~Ō)Vqj}I+aYTZc'2m鍫d=dEziraPFxa 4[SȽcJ|=AR+J⦕|"ڥr`< Z@ǁ]Ө2ġ "e#gj[p;e ۽=PKkH낒 [52xU+7DJƣs\hfbw F S3ɿ l 8A,i" )os!9.ڥ2(Į&<}a) l.p\پ^vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*Wi*+T+\Sq0zt\a VZp6u}y`7F@%O2TWkZ.&(wRonZztP{Ĩ]!Ql1FnG6*qW.l j®<\M^*;b=)pVp;W]O6*]0+jb,b'(⭯] U5Msbu—b6*7\ L*͊\إW\l*4+UusPʥ:brN`ezPR#SW*qs0\٫՗^h\Ub똌P|Lp1^ʿ2SAya<GnNF?#1'؂Ӆ}ŋQgb]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]xҋLf_f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]Dau *CPٱWߗu'4MB@`V.,تavlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*h^|gLJm!sv21#߶Eتl&7SJHf"b9Q.]61ev5bS A$PPҙwlo& GZSWP(әiW sH=!hRw,HZkpx"dzLJ'D1kc׮5F-$|Jq@X, i ,ii+ +M2ٿ Mp'ꑾ G ^4JZ Rf:fgJcKN \+Wߨiio^ء0R)oNQ=Ġ2bRNyqUBaZn1'OP+M)Z}w邖zu;qCA2=&̤ ;(Xž\zUA֩5{% IjI'3>5 v`5I+*CNK~ *T{PZxJ Dij¢(N;v*P*<0RQվ\6Q=rAI]Ċ04⫇эv [U-i!bT!wobv$@8)7Ȅ4+;lTW"Of^ih:@CP2 IZ$\N4 ZSVȩ%V㙍 k׶Doc2;uLJcW4JZhGcI\YzZwcd %XNkq-ӱEc^H2V!Ni8@4YJK%[RjOly(i&/l uq:ⅾ-V4,mQZ)FABj)Sc ).:o|qKuq![AaWmsԍBaGGh'Wp<>h͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb!늻MTx cD=d6A;KKXW#"7r2׆M MJ޸cZSS$ثT4«W1+@q­te (s bmN^)ZjQL]P:f#p'0Znxm\n#x鷁kQVf\w2/8cj[ 'SchhڟC/?v [Xu+Q1f6?vW1O?v6*<C+)hM؎1_8mTN ^ ~_%\6A+/qT񍣈8ol6 -7 Lf^ m|@-dͼF%M{z?7cľ ly>ğ?ۛ1İ=967O'>5f7?Qn1qUo Ϙ?om hy*o(ڵ:m> ^aa\a;BOD. Wg?溟e[M7NB~ jOJ/;@Jv4ۿZ>jfV#׊a K.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb?2|Ӥyr *k5̰G*4+c$*ޢqfUnKsbb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*8'oɴ͊Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث|Ly&I@`L@;U|.o'cjȆ1v/m l\?3Lg8 ǰArU"`"JoQ`;`WR3lah:V\1$4M7OQ Ȗ+J׶4[*)\Uٽ^#-;sO.##O\> Z\hI'|) W"C[+zKfiH8xV#W;;f@E-TҝIKN+8҆ۮE,+_|R9v|A ^2i4ۦFO|d*2`ʌ"-6(\0v9 E-oʠx䂆iC<0l)Nb=Cf/¤vƓMS񼃂leU`l)9e|)xs#ᤷǾ4<{{aW#>j)\i #}i+MIL(jHw4W-(+] 060!m2—>@J#li*S/b(iZw 1+{oᆖVvHe[Fӂ'$U9BS)-77ƻƇzM7vwOcpFC%H8a׾%iA# M-Zpa*wƑMY@4JrN^!44£$S'sK>|BjzE} 5N>s~=ԛqsU-1_>Z9|/݊8cLOv+W0V&٘8_f=n&,U^2 Icͳ?_beCK-?lS~]ōrC>/X!7CQs1q,4Mr4W*iV+eo~rVحqq(E^{q}R"iiNHzG8VmċLG8B TFvW6\ k7l{P-Rj.ù•WQfk[Vэ.ǾB¿ec0F_({Uo]aͰ߫vUg8`A $UD6WR+M6UJq0* ~/مrJ @Fjo\QTwMCb||Uru«53">"P6\­ڹdZfbwʡҨH@@|6 nHsSP2\V`xũ(^Blr[Fb(0%z[&ƒ|i(j}j~`T40AWK*?[ZvWt"ኳ5zjN<(oj-ȍAL!vٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱV&e:nMD볤ZBT?Tx_6cRQcȫ.lU^鿛-jp^Z,4mmnzcZ6+$>™VgHSҗ]ԋ @ ?`J]͊?#yWСs#͊﫟lU(~F}\3bC7Gw W?<LثPf]Bo?6*?#yWСs#͊﫟lU(~F}\3bC7Gw W?<LثPf]Bo?6*yp"iSYH>)lتGB=oS6*?ȅWЏiwD/T͊E Y3.lUВy6tFlU$`'ћKu_5֦{ m չ1|?XEFvu }`RDo]fRTp&Hs<تOycU",,A'UNC6*f]vlUٱWǑ?MlU<͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثhA#q`yv<aeev % Ȝ[]VjBmcVeM)p:OPE2pN>mi$POR¸E4Eqߨ(vT*X*qN$cڽ1@kˈzbTӉŪc(@E H޹T&ÕHy%ĕ*E4=k\)]OWS\j+1l WĊaeQSڸT:be'jSj` 閫TtKn'30҆dnGlHW0d;6V2%]Ze3oO--S69*V<7:dPZ;FժS5yt S+/JU=Kxc~+w=> c^CqiZ"C]>9fCZTST6 EE~ӂKx `SarOiGq( M*q+NSK׮9S| NkZ|R)5waM;Ӧ=&Ez,iM1 rA cCxxcJ`}h]29t[7N4o!oA/oZW&Ƅ`4ƫ'|4Ԯ5KN A6Zqi-Oik/1Zu+* Puda]Zww᤮Pؚx5gj`C`ofd)3$QN#\uZp/8xV4]J㖯Zw?~pA|6ƑNY`EIjV:o,T=q>X )6YE⧶86L(Q^[5E]hCdS(Zөՠ8*M˥NӸ iiC N1hPCrop;g͛Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUح)äݫؼ(a4A\q <@Q$bKZZF?mA Eh _jb,,NnaK`5j‡$0\GT/`8ה@6V喢s®Y]<:dUo,d&*S|k2ZmUrNnLJhzSlU^2Jw5) t f$"Ƨ*tGjRsFl(vYP;6b aɧ*  Cn7eET12|pMA 9t`r@bG2U2G hiߛo[V(U^T+8wr%Z>8R=bj،UX8kr^^=A7&1U'0®mӦVn|@ t[1U{bEsUWa1CW}Rޝw5땊 ,V@y[GA]vZ\Ũ1V58T VW*Uw{`U 'a)WG I1 )^31[(} Pq&~Je; !4Ӥfp7n9.o1otg ~"z|bDQ{(vuaCb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊7vyG%WVcYT4T4|K v*9l)&/+X7io(U0$axQr͊ѿ76H*}T />SN^je^\(GHn<ǩ]-qF—rr?#7_W򢁥D&Z|RػfYlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]CD5I!YUZC"fX?=rZeӐZl:}#6*/TySHIQ f L$Bh4=vԇy__DM;6T6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث* KW)\QN= R+eƽ{Ҙ)F""ƚ LL9rS *lY.B>1[e7Zw`sSMSg4?,iiFR϶E10$MS`q!4`փCic+]myhJOQZh>iA=Mi-,7]$$7 iƆ,Eh0F+N!h$, nq rZu3)`WS3Hx6fIZ^Er̠6r޸J-rJNH@\i7LSaP74҃,JMIp;Y ש ")iӦN =+[Tƽ Nb_iirq#L ;ez5;ivYE2+N)EqiPcet$^8spд3Z M.e_ii b%1[Ƈ^A0\!N41&܇R2+N㔲W}AJגژ) nw8:‡S*CBI늷Lܪ>ʩpzW4j"aZnlGns+TViHk nxLm-e;cYME7LQTҢqB\ CZ4oQ>xU PIs]?(h+㊻HcMh܍F%LT-8-1Zq%qVuQSҸ'ĭ7eLNWW CgS||[6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊c犻 ;i7H[!흫%AripO׆!z0Eh0Kbw'mPqKr-F`ء'N㫅  *ӯl|]Uf劸70+]kZ)M ;oPsU$\.DVMJX銬|T r]VA6)pRw?,IZWCB䍏|˜R.A9,A *N]A߾[F~c(1)T1)r|P|CӔ1UGxmS\* }]N|WrzJL.- 5N*M'*W^Zh: p*AjbWT\ GMqWsC;S|RcMB.Uq3Sjz ;f«wJ)`pl(v،]ǦSaZkU }3Vܦ_^IOfv4I9o(W͊{)~l~j]j -M#a9"bp;\ LIh(Y&Fׇ^,u:%jO6*#cP66*lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfRwZvl׺v(bZFG6>ӷf_*~l`M۾襳72 yP'͸~o_Iy;|,r\L~f9TI|ǮZIh G}"O%b"?LتyvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb#5F,ݓ_/jB8*+!{7U(<+r|T;pR(kSfP?k\;P I녓B?u.ǫ:W~)]MPjژRq4c`A>iزjm޹pv舠@ PZ ӑL 춛!iLp,I4̌iSRAiǍ֧lv1xW_mr +'ZWSHS Hs,–LS) aպzVew4blTn(qM:QƬaM8^T4nmQcMyWl v_.$vHnM'Aֹ NRNVu$KN#390N W´bPD1N ie]| MS!{ZcZƚ,)ح7LqjoS\UtV^S/i6cCU39޻mWOM0ָR*: e3ҧ´4 4c5ހJ8&' ii9^jjM! Ĺ} &"5v;إPp$Wl1bb EMiQic]*7х.2 犷,[j.ZMZyL[u5L4a!u]L`2J%5Cī'sboƇKTr өsNP{aӈFULICŅ*{Wc<#Z *Ԩ]O\ULӠīFj eb?jbH)W|*6, zN*B:aWثTnFT7®yu\d-F*뚘JXk7OLPr6;ci\P̀Vw52 W(hـFNYFwʯ]Bz}N܃CmK܆ JvnSaY7]Az}Kܘz55=)߶sy^X1W` ܓf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUdn,̩1X^s_(<:]]}j>5ro߾͊g_ԯ-kһޗ'7D͊ߛ7ɫOu="Rr?I,hG➤iEث4?qW,Hm ~1/yG{7*<궋eR@@B' /OlU]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfV2B,fc@{xWvB^D5#7"BT9'/M^?pW7yW~E޹P6ѣ3Lq_sb#^WԼzf]frf%?͊ak˛aQ Sx՗y^Ip<_6*9EG)}OGiO3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊i(ph;!g8a?@"T.$IP;|9f8gnƆ~.nݔMwąv_F]fJjO{m4c뺊1YJ E;-CJ`vPh)c@v\w4vQr M:Ib@\v&ҝ놖,8uE:ޠv>C~ Ms,sQlwN¹KsZu2\bY )LڠMA_:ᔒ VFTZR(pڙ$mM塧i@pV>UrIS,H "\&z)v<AOvQ$#\Rica퀅f,nO*z]؃l1!fkE <.3x[h'-:M4cKGIb kdi:QAVbJaO'b$Vl!a]8)iewƖ#( UN*ᔲM>-;+tܞR[o +ǨWZ x;c=@viaM7LW$}P]L# =ZhLEks\޽0+cպoBSY45ƕكs_vW5 |U ߾h4I^9*M;+M–KO|P*@t Wet\i]LuwX)]Li(J1Ki|ᥧc;;EiZw\s3Hi(qZj!NVcZj1V5*AWS1 }iZ[oR͑ q+;!2TS%?l\rJ=CfK6/͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb~!k 0aP9glSQ { r-?l4)ZmAbڕp9@W#%HJOe`OZ|7V8.J`a)%O×As=qܚ׶]*9;WN*ࢾPc$&N__lUeJ@p+0**mO؅rI/nUoG!5Jvʠ•B3lp++ҧ6|q,TW(gV O j~1UǗ5pf')n1SO6Pj7x͊A#mbCpAmV?<U6UiRכ iBSaJ`UqV5CK6*\U9`iV-v*F֙lPԌN늵ƻO|܆Z#$T|\z특b僅V4}a[e9U0؜0s֣6(oLR`Wu=2[ufs )l~3UZ|񴮯Neփ) '7LP =zen=+N/hbpH6X&|qU=1)7¨Zrތ)JyѮXlJP};c6f_khX!Oi([V`EGٷ']9hW~|vɱ.8vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]Y4 %`:49W>PgKs*0n9jԪ<o6*1hWʺ\\ޏp^V0vVfX57FytE - h$^|lUT.Xծ.P[Đ|Ykc)lU>^Ԇ=*  ٱT6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb# ˞AuD9HA_lU柞<zOcc8%BZi=??B)lUWRVǙ:޺2u2RI##qfh)m96*iY.ۤv#B"mxy6lU{F"KI%;GahX?ÛfWʿ͊'oɴ͊Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbM'@PVvX-#?l$!3/Gю?VI}?F.}PxG29I1]/N4ars?[dglX|Oq}?鸚 w/}IiƬ6a"  2?zF0r?Rva}QE{(e<ȟ N>q8}j?R`Jn'c1eC}bbqü<Ga~Og$oj?oF1募2'nV Lsr?^9}p9]Sb͊6*ثb͊6*ثb͊vt=1ѭ*BT>8ðRFFP0v80ޞ)vm1WcߑK)v4@}c41K䨩;]>8~v$x|4ʝ,e[j c}KpmE)ec͐qܴa>2Oļݰ;b@8aLXPB_%TÃo0^[@7o(k, Uc8sSqvf\ifG,Uo\l mi !AٱVj+\*P*Ek+^Oc*I52mр~s͊*(+銬:R8ǽrAW4(특f]_l~IP>TRGP ez`Uʋ2p+e@\J2p+Gj|ƸU;uDWWPiA ,\woV%:]iS V# `;`Cb1VaZf*vY\U{ᚘ S\FU1JӦ`qCLT_3Sp49t|Uo*F4 UPo])ZMiLP{%74n;oA,h xaVƑL*_jmuM65k Njb$u)r qv;0U#m鉐wQ֊Tl)ųYZu dClK)򗘓GªA_ ΖV-u)N=O\%G6@u59+8"%9i2(v&% f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfTn^w4|>,ث9/(9\݀ҷe+/\|-^/_TxmaR<@o)=EHU˕"c}az*yU/ʟGPZz%zfc^\b6N0@5=Osbت=܋)gw4U'6*3r#"̏3D0m[XA5?7f8gINlUl-Rk:YO6*]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث@Gvvgi(d&e zqd\-VsV\q}/Cꓱ޸bb~/loPrxIL0?rlY[b͊6*7e}k -%Ol8=2\NGњDOG]qzAѾ_ezꌽP٦FGӒavc9N͊6*ثb͊6*ثb͊z,~$bvtEP>JP-:S)aWcx¡آo7c +ٖ6j"v5F]$aWcPvn`N\ 콶Rs׭OlR˰5:A&v1Ypb#S~AJ%C2*JQ]15Ɩժ:m i,lv\r E;7fխN4o"7|Uأ6ݺ@ WcVSJv$-;|pliؗ" 9 v*.EE: cKME{ Uل4P*RG0 ;)0R i®M iR>$*; ݊P):wqC^؄35bƊ:+oL%]c v3 wܜi4qj<{;al9cbw=| o*ƽ\@We>-޽rAiK('E]HX 56' +~[zcKNlj>^1C{1KM;Wf}Z`@vSɷM LHMc҄kۊS`CV?,$$t'!~|ve'i.VMM+p]SoƉ*A'a^KG fIۀj4cd=v+:,qK9y®vj]*)(vi;BS)v+ҵ$7bFkG,}8$qS^urjE#{4+S׉u r.7;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ R$Tn8lv_Dx ˗6=^S<|5kPxdO \6~`Z=2ªtqBE+;XB=2qUׯ\ULR9t>8,P(sRNw5cMbRB#SFpn9W7̹$50 ЌUnX$2늭+\ثfZ. F*Г}|U]6rUō:eLc/ k ={KD9*zثw9)mH zeZ4"m򩊯g|pSY]^6U L 7ౠ+®GJ}9idRE6L f#Z$ۦX®c]و)i[SQL`V̂zaAֹw6#lrJ2>slp+e49V$W0®5~m7hJžk\UPvјbXlNbaV*qCj-[XToZ `ç7WF(\ *΃ HW|WJm6dr!Mr*M?S UXU(bBğqUxpkth ɶ!yfX؀iN Hniꘛ:V4%G6O `u2}ʊ c"`;ޙ&%_b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb)gL>d]fҥe3Z2DbY8;~?b͊-̟jA̍5Z@'1] ⌰ʜy6*o0պk͊onbKmjZK52N]_͊xtM#]CçբoO6*o<]Cyo?6*{rSһ#&fS^>I͟V[kͬz*\Z*!bثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*;zsIMW^j!}Mb7G1.S]չy-a t29fHٗ# 'lUyɿ1ݤG{9$'Py=%W͊p|o-NLj\Mꥯ%HZqיT4?k?G_GW;yoC,jŚeCo5Y)6*<ثbwW1ZHR`G&c͊E?>5GHF2LHWDOOF$>N{`_O6i7 ԒďLj8¿kf_~]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثA>KME3ܡq|_I-A/d?NN<\%~Ok]bɖ8m1%TM#X|mpߵ~%cZxb_ꓗ.CC!2 7>#x]նq ņJYWS~5ښHᐔ>:gx] һf] F'jb}h}6!'O ?e1,.^M7Wx9ӟsՊ_xkvlUٱWf]vlUٱWf]v]1WdV|iTAȒ]fGCdB҅4EwKۀzmNƱ$|)vZ)C]`d췢7:iO `;cą&Y;-I'OlUقp/ `v5?,P|[P Rpkv5_ mRljۦ* cN xĄ;׶ We(@JM)v*br{J U'q\SnT cBp!jd늻)ػDu+ c}N'KNrW~ii:dJ3ʄR5]ZPNƟ|;߶*좻.RAqWf,yM0!bMkؕ.!AbƧn1 O ]1ji]_v*Z*jUٗ7*A(v&omPW}aWce4x঵إٔmM֭e@'$aV޼1c㊁I(bЎ퐤;gOX~6Pa I&m.Qą.f@:6w$m®dž'޴rj6 VrJ쿴Iָhx}sAO0zRjLPhM;av9d%SAث(^#jש]$lo]RHƨ 5꤀0s*vڨU];Ԏp i$;xbfv(n%XB5ʖ@+N` ŁF=]Ϲ'qǿL (#pGш I{ %]ePaďoib͊6*ثb͊6*ثb͊6*ثMs|-"y[G-NJY DT5dbca容8`G˖lcY_2O4kzWة9 ŀ^E鋊abj*\ $zi d}xHwjU6_XolUMHsj_,1–j EHD bB*sVUL6SS :f1JFT(Sh3LR@|(Y*N* |UGZf*@rU f8cc[SLWlJ偊cO/)Lzf)l#\kZl3b$jr\#k\b*WqWH8-~y⭃jo@+aVEIYACLث\2^uͅ. 08m1[NVء}*Ҁ=Zw$7ߦcbH1bqN޸bW56«C|YW{.#U|1UF"W,PT-z܎(iZn sr8cjaBR1`UF;tۦ?p+AN8Bj2++f_@5P5UOKTo;K҈i;Hdjm?ey~IJ:'M>ӥxTr:K Z\X;G єت_& 9}eAN5誷>\?b WKoUkQtխՔ#͊^aذTm3WwĆh_9V_%s~4{^H@ kn2/MCkߜ_ j"u֨ "VC+sן oJ5=5k&DXSՍ9S6*ѿ3g{oky/"}FVCO D6*[?ث.=$^#*|\yoƿg6*CծF&lU6_ST$W=GGتwCi/jsb>D/WT $N \폗44}.%F;wfi z0)CBB$0j`<6 ҴUM!"!]$n 7`WcUjI& ]=:uVblX1454p̎iJUe޼dP%i~L<쥘?һ7:g*!ԑZ;2ȱ=zuB-I$?_vS ]a[vRKP`Wcх ׶4'r\*i`*Oþ)v<ȭȖ*:Ub@vR[S7lz`˷LUSFv9jT"Pq*Jk`WenT_ ,\-N=p-~9^JM%{tkn6cIv`ӯL rz>XaWcӠ~ءRK3]ZRKZSs^"qXi;-d7IJvW @vPfj HKoJ~8Q˷ZSCxrbC,Cp𫱎Ņ _|./rH"U٤rUM>Xʨ5޴)v=d@ZvR7A(wJiQ=z|2"vlUٱWf]vlUٱWf]vlUٱW`D'1#20i\0N6S  L:oW44O(jqwejl?ϗv&_FХ@i2vY aq]&y짉<$yokgS(?.2`=Vi"#՗C4G&dg`c^25X㿃eQV͔;RdpΪ}xi}?]ÚO}Sowz)?oqjw|<9?OkWivG$acuXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*^~>cjr\2i4݁v[ª4W6*-E! >E@>YTg Gi͊Ͽ#4]CijsbG A}eow:הĔ-RJ?x6*?m#6*kq,ǖQx\ ZV6*uνZk)|Al "H|_lU >kwNi2)aHO'ĬٱV-/Em@N\7gث͊6*ȴo3iga_[F(s*"DGU\ت./8F[IR m Y Gi͊lځ=FYVoVWe9zoMpOr|<+=Ȑ)o]ArG_ܬrz|ʹTY ޫo5 ^rDT|9vX OGتwCծF>lUߑ?+$|3+5 |_lU9T&Yj:xa P.gNQ^KKEX?04o%Y5sq$iT/+Uӗ9~+|_̯7|5[G7tޚ_|^m}%8_ڙ$Yi9`a^B5i_ r׃;|?f4͊w6*ثbsˬk")+0Wb5.i~bJGH:IrdTor>lUƱDUEao6*;J{͛-cykDRh3QWG,ثثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*R_FTX7rQ vyKXVq/f>ϗTG'밗0\f]Zi"n92 Ʉ('Վ8 sP㨉ق)ol4ddg?>Plv;6*ثb͊6*ثb]:g4?ODJ)P? H dҤ|cCHf;Ƙv6¹$;CR6eGZbcEXidJ3P R}8lzv›vQCӸZ-٘zP Uَ_ad$(6vS%HQckRIW@vfޕ%كǃÍGnpv؂"]OQ|ƇL*z ubىK|(.g BqX(?Bȩ|1$r=r=^4]χ"F*캺;'0 =..ƊǑΔx;h|zWelKJ|!!ن~ui]@$'&N*Zq}9Ybk *Gz )vb:]`v\UٹH" W1vf}HvWޛK̆J8\u4knvcmD\Vݙ\1EIऻ9iS]d"M:xU-; v?eڙ;) GbȃNjv—e?&f=? ]#:x frEjwݎ`Tǩ.ž €0"ǬӅAvWZNr0jԌIC+T {i]Dj‚\48œTCvP Ҹji\B×^ؠ-൷c{ݔ漩wnư |X#o%RRXӥ)]&` eYaUrbz2*]|MbpJj[(w ָzLjj% ¦j U9YSeo1saC|jw49Ua~ƸN\Us6i#u«H}lU^)]v]V-҃6(gfS*$B|Jt\+إi5~qB=rɮN4U ;fL{ lbրu Ur VGV:Sܐk&qM([nVoՇ d9*kjzpV(,Kݔv' `UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfPoYϩ_?kk+О(dgn(eWlU7V(X a+[6*6*ثb͊f^愎=rĄU ğHGy'(f]*;?fC6*ֿ<SCn鸡οٱV9Bo?6*?#yT8s WOk[KhAo7ܗbk{O!lU/aHCT\Exֆ##s6*Вy6tFlU$`'ћw '?gI4fX8KV RX^ |q^u"k^bOf}MKcQܑ,ث7\W<FlU/Ib?_kvX]tc03ܨ&nA[N'/:gĿ; |z(bxćƞ4\?3!C=0D?VI;#v͊$+7HxRկeXL7H^CӃKӊ?;6*ثb͊6*ثbƅ*N,#A:ޘ-c׾U' ?SE~N=wJ Ap'N]p۳#(zwcyrtŋ4*ijݎއvb0%ٹV4e H&va]lmĜ o*PKՀCz;Sm\2즠&ه=IvP=cV vQ< ctő.j~c5ܞ@eNʡRPM7 c$}[v_;hcH.rT6aChEu&YcIp)vR@ v:.'sh1M(@iiK%:❱Cт$Z]}v&kSCL6~.bcew)Z{Ɲi:ө =ƕ"єx@Av7&$ez;] jkߧсYߩ]})vQҧ~һ(9^44er T~*pQWldo"@; 4cRT ^)l4e6: T1ؑUrLhLimًK1=LY(;p79x>g +6Tbaƞ,=8һ=brIx|=WeUACkZaWe#h78-\(=9: 4cƀR`bh+i퍻Y.ˑ۱4fjSWcdM7dSn!bڮH%4ܷsWbmI;$Wc_bǐ~-W@;3PELX~~@vfk| Ƈj(`;0vY S{e(;m$;MAX$>N[O6*ثb͊6*ثb͊XX:ZێRT{3B1՗ )}1vJۨŤ[-iG̃w_Smkr1>Q?㿏qNrxߏ vlUٱWf]vlUٱWf]vNt\VZWQc2?_ ?Srx)9~?]vR 4$SЃnf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]EqWa!HzYfHB]Jfs(Yy/+ Z##aJX9ܕŔ /?aBI+S*m*)_"1U تIonǯ[6ҭHi,UEc8)WzU3U1#VfYnULVe0+m#jWl1+]iZ[prֆ2lׯӚqLUGLiޝa\RېEtALLP2&eaUڻq*}Zf®'l^PjV |KH(iS1 \a**k\Ug|p!s!*\Hdr\\џ}U٫|^R$VeVU0*@k+* [\UL +t9qWr^?皻bq6jlUhA\Bp,UMqLKo(l7 ~4*:M R k\w'c6;LUN(mzbEAPoVjҝp5ɲ)wZӭ0>O7aLysv*k*9T((/tr> ]~‚+=pvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbWcPoٷfLثÿ㟫h?2f_M]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf_]kvGMڕ$IS u^M/lUlUٱWf]BMYLI`,IH͊4?-lUk>PnP帒 / }\تTm6*P>F=ثֿ\֡PPvVW_lUBu?lU'^I]Bu?lU$ 4KT|xlUB=oS6*d6[B6AA?Ȥ3b&q?+kE$E*._T_b&\Gyim6SLت{vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثvn`2%O&34ل œӓ(8Z q7bZ։&  rU.̾Οi#K,6qc; vlUٱWf]oOpލ;)??W>^Pc9 ^׵S};xG ʃvl?-0MŽגϟv+ثb͊6*ثb͊ 4(J]gNj(>EG9S1v(TP"TZ}سsZ'ezP L,ԧ\v7(ct@v]UtoCp)vn nvȕ.ˠޕ'cAǮH/˷S;0]PPHvn }K*vYژc^;0NWeܱ$n1WeJImWĠ䞞=0;)7+~+v6'-ىT#cm^F;0jW' 0SҵywuIv7O nȂ>-@*a52H.jbM**qNx튻7,Oa۲6=v8ƒ6xӳF2u' +ʒBĖ:ae5ToC9[*ƌMw;(ČU;`@ƴ[1> ]m.ĤPMx-R]2'vlUٱWf]vlUٱWf]vLG B޿_7csKGN>Ļ!],MI=i ˽Kb͊%Xx0ߛ |9vVLt{_a̟͏ZNɮsWGyFYڼX⬱3}"_Tc`l2){;8qzثb͊麄uwDrYN) GNlC,L%"jzݫMVlKcg켇קg;"wN͊6*ثb͊6*ثb͊6*ثb͊6*wqR}EvlUٱWf]vlUٱWf]vlU %C6*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb#:bËP}[,%ӧ vy$zgfON8y/#K=?p r :H$,2*HٗlUw'| ckMBCR 55d @zW0LUts ”rLJ]l ] ,/!ZyH$+*Kb(Z{fV9|hp!e6r⅂@ךISeWze|Uq@2U9+ Uk1Vn=B&w,|)Zq{VaCTʦ(bۦ]-Aߦjbs W/qWzq㛈 M(s R7NTªr0+GWiek5+[z y blr51VeR8P! *jS| v3W ׏luV3v Qacgo1N]G?984ſג_^Irb,W-ٱWf]vlUٱWf]vlUi@˓CzA|"_1me+Q'$ٽ^a(WlY;c퀰vjTمm_jݔI4zC54߮*pՍ=q)vf!4' P]$;`F.Ɗk@ze%;S8K'fqȠ;3nO|Rh;EiRv.Ʊ'lVݎԯnUu5e Z 'fFe5*o.AS#]ƻn@®WC{mhƃ¸T;T]Mv+e >`RX Ӿ%. ֡pZ7vQs&Yf+J!L)P;cV줎bv[F cdBmQy)(sΟuuI>lR:?tS֬;޻6*ثb͊6*ثb͊6*ثb͊6*ث f [hUf^?7b7?_%z&j{c"o(3bث/珗4Ѥd4anQK6lU8wFꮛ)Uqp?F_bI5.*OfXށ}M6H`!dt L3b/~maNe+7_B,تw8iV( f?ʈ:Wbkߝ_B'P#ȼ6*ǯJ0KlUlUygBV(@fԢ'bYVi`珖yZ2! ;sb͊[cl}'^<+<|~lUfX_RT2>'b[seV/wԎoĭԕu{\Q>hf5`J~F9o8y.lU3]f=BA-¨QZtj0bo\_NjV1Vbr\wL[#ˮY遱;W}4~Uc('iT9ޘҸxԜXw6|mQSr+"I5P"fMvMr-U)A1VLD~l트c] ~YiLƧ[@|8)5M2Jq`UNBW2_٩ኴO(ZQU1W3F)rGP)h_6 :]55WF_l ?,UxYxRscozbs~Uܩʦ)^8$ xeVʮ*aO]qKJPq27OH5ޝ1H͔SM(ājWZ3o_ݷbsM|ŵn ʻpᘥx: Y&%Wb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*?MlU_Y%ӵY%GƦ`ÚL+͗f^QyVS^5#ҹB$zolU1FCV'C6*YuO6*Į m+.6*ŽhA%3b~tH?ܣsi~๱W>\m=>(ﵱ^؆􂘤Y#=X"Bd|?>lUoR}: %[ٱT6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*rHɺ>G4I>j;.͊6*ثb͊6*ثb͊6*4؃#.Nײ7ZӿqQv?ޛp6cJ/$v5. $)΃[P6 K_ȣחLPѯ8RiPk}1v88\Ӷ$۲v+nTlvcn  ]TGz}8ݕ"=h1RuR@N B= 6'6 SEޤWcIG7fU:q(vR%پ{];+j⎮)?M1K6|UقVx̂F*qjPlFN|{ BCbc3@+A@`PxtYՁ\i4[:bv4Tر^n߾ƢTq)vY_{e$b{PTןbNe 5^ v:8#ƘٌtJo-.5\B :uUSqLl<:jmWeڴ6cZya i-LJ45IvYjW|caMPps,vXݪq@vXb6^Zc$;V$v_]XJm;Šv88!߶%ƳsmDft8SNXG'eM;0%k .aPu._u®̪Z5%ِЁZ'v.ǫq#~T߮*FF╭ A\;9NdJثb͊6*ثb͊~ߒLdh[Q/-rXى#Af۵#1bVe/NȦiӳb͊6*ث7|1繿?Eij} ٱWf]vlU.'mKS?,vv/􎏴2.яwdG4ٱWf]vlUٱWf]vlUٱWf]vlUٱWf_y@l!sUh%OM^oȝ4Da76oSRNg!pN<|ث<=O>DSdn(d}Q[͊7_fXWgXn<3oUb_z>lU1oD뷨k}-ov0XBE6*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*r WaŹ=|`N.PS㝖EUs.\o'\SoUAȠN0TWTTXe V*P8\(;T͊R^M}CPٱJS|PԱ[f*O( US44#7,Uo\\Єa Xc\brx`Bň6ýFP5+:qPW5Њ 8қ/#a7LRЫmDrZ LV/*L Q]횇5ʧ㊯@z.1WsXZb^G0,y(2] eUa\b3vLUo bSU1U۶jW(kL*zͰ;b 1HEBH-A)޹ lFv7f[]a͊Y|NJhFrJGNYda-IJ2J27]Pm^e.+`zfr9mj، :eኮ~-jaVÐv7[2W1\RИ+(sN/qKfP~ Uzz4.UWr$3 PvGVK6Qȼ!Zԫ6b/v>Oy ^,(.|[b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*?MlUo-6ܺT ~NfYbk?d{{n KVzsbg םlqyWНyGLṱ.3 VV+E9qEQʊT_ \_a?6:w͟Ϋ#Y.Q:fpl- Tv=> ث?'2&FElU2_4‘Kf6DV8kI5ث$ssGC^PfR-oss^`Fio 4j&UN<~Ikث:N& %UlUEr%iU fZy:ƤҮ@bmoyR^4 J͊]vlUٱWf]vlUٱWf]vlUٱWf]vlUW Not8)jmRɵsb&ug^~Ķ]U~^sbWr^z* %-S̚{O]ʨ17MmNJkEy>,ث蘢HcB@tfWf]vlUh~g韗TDJ7~IŽ4__`~bj}ԛV !Hq5HAS3~۶lU]ߕ$4kxB[GPJ<"$IWbb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثACyJ"ßPKUiTt ljk#Hv:FڝS'f$hw;PdX;ޣ /^—f=v:2 Bq[vP=(;ݔHڸ;,'瀫@Wn$Ǜ 6ݏC.E.Ɩܷb]CʽKГCQe-7=v®˭Wm1M;0J=C 0+t4)v84LR;)KּGn;RZ(*bfN*qM;)>׶eVߎ!14}Y;0iى4n@8Te/M.D!]">UJ@ ]HpƵ$$E{6k7‚eI;LX۱E8H@)eN)HZzd5;av87QNWfZĎo]4*SWflzƩ]6Ie+ɶdWzSjvZ;Op1(i0ٸ'Fe>Z{bvR%kZSl-C\ N ~^JK(#o P6$ ,jD1vZtW}vR =Fe ֝jz"Xg#}(q)Ё T@t]J*AΣrj 4R)@I۶.=Tr5 b"rpiFۀ>PWhc  fCn͊6*ثb͊6*ثkG~㓁 GGMz䞍aYo7fܻ6*ثb͊;n(s>{wKC]K87НvlUٱWf]5)E}ssٻ n78|;f]vlUٱWf]vlUٱWf]vlUٱWf]|8)B P͊"W˿x?/RFyVI9=rNI_bf^ol-67$?,ثͿ'm4I%O͊ɛs==ۨGO 1͊3&T.(u6*Q6:ƌ͊mrIs+Z8flU͊]z?f^9#xa0/*H.Wy|Ǥpf-=>@~f~o#w?*?`Ss|LP\nƧ,V&ĐwGl(inl}}@F*rb#ke㊬e=UG"(2S)^0i  UN3PyJf\f#aX\UkJE6E1U!=F]1UI;3qQ3ִ9\\NU0+|a;)I$t*}!a<3Sf*4;e*GsF*́j^x޻؄-@:eW kQ5p+K+ UiCL%ieWTul⅌ kpiAV+1%rV5nUUaBklXx튴 ^6تը~\FQ4+\AqUNFQ4ͅ\ v=jb:TEMsWvo1UzT?k펮*59U­Ў䃚f-(p7!v;•+6wRC =Njb5mQN*; :퐓 e Ws\,֍,g'߫'8dU-i\-b{ *ĻIXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊r%Focߔb'״s #oQ?f^vlUٱWf]vlUٱWf]vlUٱWfR(hײՍ9;Œfesb[̟~I:\FTAHGYUsbO Z3b\W<FlU'ȲZ݂Х]/Wث?" tkKMGGXn$0\fC ehx_6* ,%Hc_!&f?n~?lU(?oG$yIx0`e?V5f2^Lث7k4=Qr1?fիG,تȾ_'W$^<}Y>fY_yH6OcWs=,LQAPxn͛e:姝=SM>+3,(I$KًÛdACK i*KHݣ]X9F,lEYCIg5\oٱWys"͊WlY4n/f.E?͊?#K[Z׵tFOBy)'EZVC+?y6*J&fYGSfڅ"T5?sb\6֤-ıN;fU`;z2AFlU~lUٱWjim(lUW?ާ7^[KvV9d44>_x?T}}(:ަZQ񸠈5#o{733|yVΤ/3qHb?e\o+lU_iyϘ|me4Me@YeI=H>NX׃7?}Q@6v͊vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث1Vu)vtH5)&hr#GRO ydMvv48Ga^iƈGZQvWZmГZvR;H߶,]Ɵ;HvQ]>d]~KJ>QʼnvY#z☭)Wf'ߦv9ZL]Uu$Ԃ{&uv]H;)b젧fEiQ쵍,v8oҋ} FJbl`Tp-;h@ Rc|!|wژOCOޠ|ݏn;ݎ/MӁ]b$L:H|I4]ȍl*T RQ;`Zv4ڽ8Pb:*~%{|Vݖ+ ZIvRң'fd M:lXfq>C; 4403RCW6k^ ʻ]CCA48W`WcQ7P!ـS]E |Y;.:uW40&"RA^Ɩ2֤Ȕ)bera£wezU|#{veBƾtVmلD婦 We|:CGБNR 7NثBd֔^ H nAX(Gǭ:v]e5;u]փv:2,hz/| w7X-wF`KPAPZF*z"/i^Uһڵe+I 1;"sх>iKBZoZXxUBZCWb7*r)v1OŶ6jT`dc/0hkAMRƵ8.Eɳ%f]vlUٱWf]vlUٱWd }hjnw%i2:.qR/]һf]vlUٱWgm?o"b3s'shgb͊6*ثasQ;?R>n߻(t_ied?4ٱWf]vlUٱWf]vlUٱWf]vlUٱWf_.>8_4F heҹWNf4Tث:`O1?dl&ӮeT?0QK6*o;u6AMM_K4͊rv-kY"V}=fl„dlU_'` ثv#/8_5;W Z̬ث`'6*{qRzg䅋OQU&ɛEBBo$TRmʹW~}'͊}eJF 0Xr͊qʶms h\E!^&WN-?fSoɿvY_oOKx?2U`5+rIlUlUkӸɛ}A$Uz3b/-n5<^[Wӂ !Lc_L)3bq.Nۭg&Aˌ36*<ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbŭ֧vƔD"&=ß.F;Td͐P~;{gZy^XjD.˭Fo]E kVnd|Kņ< Pv5;m0ءH Qt <2Uƫ^晪+CƇ.\KRplP݀ʮdQ6^*،Wq 5雖**NuUiCZND$*Bw̧ T&ߗZC(ߦnX^~⭕4:c\4%X F*+|^UQ[ksm\)qRA‡q>;mX8k)qC2늭T޵?Fm QyP5qKb?Ui |Uh"ӶU WahTo|YvVsAaW{\WjUA`71KD{l*AqCkCxbzsKKPJTYu­W1:Jn+86E˦*^C kZlmN6)iX(U}w}9GwrVˮإ*2[\p$~#XlU:xܫb@v8*>Dt8զFLie}@Ob0\o?coՇ1͔yr5s=@v1l({n8+,(v7\SWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]bVy7ZD}ˀ0 =HU͊Op{9f#&lUlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUw6WG_6*3b͊6*ثb͊6*@po5M2I(/"3|9T'ՓM8lU(?2=֏n0@kq@NYV o)7>-Ɵ=u~w>sbg 'yG4fRopšH%I V^45n|fROCȆU+}IЕMreosb8Hk쨼U/ ׊ʭsb9?-Xhs ,s$@坽4Vn_lU%׿ 4t~}%ҀLrZ+Ò~6*_GW2\ͪc#Yw g6*9~dqhEp/RU$8f͊pZh$./r8T-Wa0#/."B"UQU|{IjoM fE#|—c`*i9vcM>+l$һ(mn= h%RB7ڸ.ڽ >9&NjV$"Ei*Z˜IN,-h(q[vbà TЂ1Wfd n6]S*Ǎ 1Wfz^ƕanv`S]dIc"܊®N)br"+=0j줢~;Rs۽vv`zm]3",es%7f]vlUٱWf]vlUٱWdO_Ӟ[os?~&/?N|H ?ԏ_;!w͊6*ثbۦ/E'$gOug 'f]vlUjU'`-Ӳab4+?/_Zz.nC0 Ny.Nvib͊6*ثb͊6*ثb͊6*ثbeD#}6*sjm5=Oѥe`en/f^O->GHQys/[ت;qr鶓khRKE>")_cYVU<ա6݄@*FylCD DIStkL7.9TwgMGK8"b0yK/͊tO\q|1lث_U~R{=k>OyWm& 1H!r}XկWӚvmsdWF 9 ت#6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ka>d[;]S{V[Aαj?:0/'^?,eɔ$z:%'liU@ [pþ]N(R* GJxqJA/1hi\j \eⅼ]1U0|#aNkN'51W-4P\Π }8kmLpJ)P7XRvFU+Ss`1W102qUʤo\*{ |3b 6특mnyu9®Gޛf)ͅ- 8` ]] Ƹڕ|m1C|ccS6ћ(rs* IT ~'Z%N.gԨLPM6ƣ9V5*vA\ Pa֙tZhsq ˸#7Uf"銴j~-F.G+ROX\ \bZb1Cb1VĆ .2(|3­N50+DaCBVn8ȥqRN UH\-e0{;׭2C+[V=v̢tp%YG$+]5fj i\tV\6cYa]YD=c*JA8P7SjvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbg˺f\\C&h 6lU"W. QȨ}WlUlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUw6Ve8\F7D1y J(6f^vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWMmmaݵ-=$In]=y/c6*:$dߪ<ثsb͊6*ͺٵVE$ԀXi?YW_Nnk%;"~3$`lU1ԼA4'I`BۑԒ7#ofS<ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*4 [h+onvd_Bi(`«Zmڻ-oMZ)]<8Rz#mWeي 9(SHvn>>8Rƛ|Tfh>ue-Pp |YSuh0ۏZ;.2;JColY[8ٚ]5H5Z&@;-%]ש#Eсv(f"PU-OzUMPjvY1!Kf-v_=,zAAvPrASfEzAR%I#p0++Q]®˔niBirz`-eljԌc-m"i:R<@5]EETe"RSN̂m`bF.]{Svo+T!;P!Ghp2.P ۨZWcm#!+RjO| xQBk߶ʢKlJ K iL +$jjk- AcRiSRqC)J>Uقq#UU8J ®o4zn E;(m;dDFF(7%X8xHW|Hv&NDv:5 $M7jcrkかFݺC̋~Nb]?Ppaa% _]ȸ<.G;a˵a\Q'<26/FX9kvlUٱWf]vlUٱWf]vKEj-Dv/*l~!s_Gf_t}̍>?3}xvF-B]FK˃Y%b˔呔;l8(G郰6Tثb͊6*ثb͊6*ثb͊6*ثLVblU.ƕsN$NKG%[6*IxnEizȧ-fYrQAWfXֽmzSsG$ǫ$cD_lU4мh0m.r|]ӟblU+Ӽibj(Q䊭M3bgB6)q ߋuo6*AXm2YWlU1֗mtoഷ1bA!-_/6*T/,mSҺ&PlتZ^-a) 3blU뿖]n d95gRXgLfVN_|ت:NӢQG+R5(UgB͞ O5⻏^.lU#?+|N.,fSUf-!S➳INe֗---ޱ QEoW:śv/Uq.ior8$r^ ٱTtGk *4UTP6UUfPZtYX.Y/Lت* (4TE تlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU&oCeoW(v9 O-B[pOz\Z91/"$|6/bՏɔQT(HfoS)niS]$P:R_A uz҃1®TblRj(vt-X[?ٕL zt,u1U!!5)+C.‡r)NJ +e+NRrb9{VOlN Wn<04AW1o|㊬j׏ͅ\ƛf;tU '.U=>y1h[ Z ytVtʦ*ِ6 *ŕ`|nb`S V]22(h nr\kP} bR+zt>9Uءq^;}cmg `2+,⅊+7;aKaYLqU5ƃ2PMk1)ZڿUp:uqJZe4ͅV0ƢenqV҃08 LU*:\jj|!tşo_ *}W;UR0SZ(Ԩ+`r*#r[y*)@f bDiĤ* j}0)D՘mJu6BRՕ;̫M2 .m>_cglbv%/j{CSb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*qGV瞆sn}LGďuoϔ_6*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*soQ;c|ث#C/ثڳb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*?MlU#:$dߪ<ثsb͊mv-:M_Y`un߳j>'e6* r#WkًŧQ}bOlӍ3b{̭BH`!Sܠ+ұo ˇf_ykZtt& nnGRHśLb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vgEvreEv(ǗZۦ fh=~ ;-MJKN ' C0$|{`We5OnmIf`w;tPqf|Y[k\Qn#aP-a_|T;-c \SN̑s`P-<@švnv ]ƟvSڇiي*bڕӳvM;,J{ ـJ'Av9=).Ƅ#aҽc+*5ӳj6ܜ*qBUiܒprK4^'e%T \ ]A=;aWe-{Ԝ)|,z *제=لgvbZ ]40.M6ݔSR{*춫0 r,IcHKwli. vWj'HWe"1[ve^ck"цrj{`;+- N]К}$t'c؝nn)F ]-ݼz&N(ve5AZw>´NM]z0Wsp;40|hXv5cކ4;4Rõ@$L ]HԎبv<jowi]Qkb GX*54$Pf4Pҽ!ّ5m]LWfb=Wf=A]`A'zG\U>E)Zo }ɠ+Cve',ڃ.JCBl ]CHZd@'zQ]TQ^C*C֕>һ*4)k$;0A$+Ȥq yu—e!]ʧ-ր bN#ƛaWeRo*rW*{}8"乐 b͊6*ثb͊6*ثb_i-BwOOϛ}&>_F:]nB^>GZ¿1jBҜrE.*\i%'3s4cq ; 3 vlUٱWf]vlUٱWdT}Xzt;3l(?a??*-Kц^OLyF?y̫2ZY/[0?mV2aÏtg3>O'?vGZvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU2T:ne1Wa_C{Tk[6=?ANX\׾]HǢ̮%)\LT @ޙt«IlUP~[Usƽsl(j~#a+q:哅VlV6 g, X%޹T#* cP*Tٚ6Zb~Xw;ebncme)uP|Usߐ Rsu]ӧnX6޹W w˭qUxo F5*i]q8(&{fpzf PҺʦ\$50屡،8\ s0'lǙCu=3q­ k2J aBT;z`JXT­s Jf#lUbƹ-w˦j뚛rA\W*f=1V|3GU0yarxi9]wW$fǨ2X:f\h79]qCt2\\Rjf*jSn+T^, JCQmUk*Mu뙀0(t2 MFy }n6=RԱZ~qv$e}jv7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf_(~k~AyԎXxYGG:;/$a_9Ź55F>%^IW͊ :9mi$Rͦ*R3b}sO_,"@*-kr+6*/v?Lngן?WӧqVlU6[>ث*?,|}h7oe;L%W,-~?O,تkc9/{:[E"!5v d]A=`b×(\ 'MH1v4օ 'ev]+*6N.ǓZӡ49 V鸮WcG.AoC5Z9x?g3UߑR &p1Tӗ/8_'gaO>[E vf-VY#ъ?F8.vC̲v;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb#;W|kƵUo_F^oVE{S <3V^[_|,GAgl TRV늯޴v|U*)LU6( U|늩׉\ث)S\U>#lإlUPӶjXN*8'6j4S tz08e1U[`6ʨ 149W5+kaV횣-W`p*MǍ3aU|P ­ql jCtڠ qKMA+ 6([Z]/V)F*O}Wh)v][#}VƝ*U5#|bejuk9Sn3W [Xslp+*x>u |sr zlE|21Uo|\V-ZAr«0ŸNW.1f'zbt^TM4 79UW 9 W""m '?[~82򅿧)@f3 ́]N;G$f*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ت4b jP |\f_'~@omxsI+ i;0R L_Pb@>xoޛcLlI>?WcBTƴ5 ĄcAoo]ԍjP:|P;\T;2-)Ce5e~~6F;+%G!imA7 Wçl4eȁkKMBb6lh;upO|QniCMm r0v&@5>]ZP LHIvZԞ";ɡB>!i]U—cFw®EEMO,UzЀ;—e sa!ECO`Wf+vCЍڵ'"v66ܜY;) iCʟڟ"B]Xn4Jxn)zIu@0]S]UQ7$®Q]ƽ>-X-],|,һ|yL^XT;2!MIvYJiSNvTcqNUhk@zwJ줌l=®˨;H;0Z|O 2PPa튻3ՠB+һ))$)̊ۂǶPvDž]mZ`K Sm5Dž\)vP8ߏ a@\B)*V*r7놐jM:J4Q~һ*:)cIv(H )"݌P]jjjze(~X>A=0;h7]Uzo92 4$uJXFJᩥp- *RHve۱FJ1j { erݛvlUٱWf]vlUٱWf]vlUٱWbR&vEH#8LO a8 {kA7_C6IY3.]o yb{>Xe1 C?~_U$g O|}V-'voKì%c>]Li[COpgO2_}HVNT?z]_~bjSG{Np%_q֑95 f!HаBÛnjQדfU_e\ثGϒe)$u~w9("_͊g6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*YDqJ`\تk~ak_`I HVSF.,3_Nj26߶b$Lتymn;a .>߅9sT9~?تyCj/}Lث&Buc$AuDZ+n\VݔPGz imٙ|)c5&lVݍ64m]ڛt`)NGjt놐`A7x۲f5ޤ xP lj;VWcT;)] MK|Vݕŀ nG[v*cj*x?~<)v0+o%JĤJll>Xһ3E¿@۱FB Px`Wc$)ޞimىP{n̦6I6 8i]8vU=(0Rmc@)AWe#)v=#rI& ۱.Ɲ)IvRw=RX0;W4e*v^һ,*kvRWr7ĆNVp+ljaVN@WfDZއ v:=낕MAZCv)3{cJL-kъ7Axu}|C]{ॷeރ`O[vXAڝk-£}]1P7-O CS`5>We}ث ZmEISb*AQ+N`7]:Ăp݌+V4v)/ CĻoݚnxm!ةFS"fXGA60!j@qvXPXR owƕʟLɡzcLeDzo;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثW`? Ya[wvI?/c/(I<1Ү΃ :eYGzoqܴ(8QI]ƙj<05qb_a(qT(e$f]]k*Es m­1nb1*_t_1Vv >ث'ǑuWZ}6OL9rEbsש6*'^#a\ثpf6:,Ek@ !\fpOW6*B1krتOkȣG.b+5"?͊O2%yE$;}@VF%h>b;u6lUкGU3buZ&fXgM zqCP!}O.k Kzȗsb_ʺer azJbaDo>c5Q/&e-*GT>clU QЕeaBثЌثֿ?(̫=b[ "KqX6*_pv[^,Ig,rک?YV)½oN4K/89#h$bG쯩, 6*_>բo(lU^Aˉ,.Rh6j2-I,.,_ѻᒕ"4ٱU ثbMWU/#kI^__/_lت4^8؂G%Y_[6*]vlUe9WZ6*i׍WlU,?G?՛d_翝tdgH"U<3Z1#Nc@<<,k^;cTv\|A EO@HvZ(P_%v=hw:n7IeqoݎZ6=>X)mбɭ>݊C N[VHϾ=k-#=N WfT%Z;P|)v<hh6NWƓnːpf$oHvW+8.T\+nʖ>5 ܁L, jБA 2eIڽ۱-Kn̨ T[v<F=0R۱38Ǧ[vZ;Nc=6$ӯDžmeA"bmt NH[vn''bMr4bl%iS۱ զہ1!mٚ0A dnI=[;/۳$- {b{?l v'5=olU;ŋ>ۚcWc`nw.!Rƕ٘H14tJ iĤa i]A`[{bQn}?P#A;6젡BMq;7o۳0ރJojzSTDA,JoƺҪ)L)v4 I=)v(89}һ !@O|i]*Iٕ$E(NA4vR41+DP'邘ecJc Pn;vܘՠ v>E*M: v9-u>5=FHv] M*:vQB[[v(c$ Ƒn3CǹnDzBv~b8:.X05Xv($i]yCƕJrГDž]xw{lX=(qv9} [v6BO'ƕHq}fgRIvPJ*I8iŝ T֤T`]"ƛQnƺ#6쫊lto;g>Lثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊o 4Gmf^$@28P>$ievNXEQAZUFH 6jAlaʊm٪8UDzf`*'^w2*۸QblbUm 3 jJSdWZ(W.wS|U&\[~B--'~sF$z"1cckJ~<]-E>yjmV Mzo\)ZUrȠ횕8i"\5ZW7)h ]ꃿ˥1UVl \tP%#7\ l|5)혌*6R%24,.*])+LPd R|1pY51Kob*L )LU);S/l* UX ԧ\ %w\1Vն7NmyUǠ*Z1{tW־\G\R%j]5<1U|\L**S.´eaVb0+A Fjb)qV㯇ݘUl+^ƕS"+WlNZLe}W*+A\h$0ʮ* oM3`Jx_qClfcU#xcL  xWt˃(llpI33 k&tǥqWa h˱|G@m={^1Y%^?Ƞ4]t9ژmS‡c9UO0۱Qv\apR۳rjq1[v3EiZWIc/ET[x/+Ё_fbԨZS¶ x(&ƓnY B74mF݌U'—eG.=*j~LimfpR-z8۲ OS֘[us"Wzvd@~`imo7l4j'#҄}-(TZ2"v۫-Zq4Uc-"/Eb~}1[uq1 g Ut0x\Z(Ne#K4*k_IƘ˓YrvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWa@Twa%GŁŝM>)qdDzPvb^vMFvW x6T-^HH0 Tİ+ٞMٻF,RVeiJUc#́Z3^1U[*M zuW(7\ {厘iZr훦*u9Ut#˩dU隙%[n\{diWkVs&W\UOaUkmWֽsp+Ks`CZg P8A͊#|VS*r˦*`{ e sojqC@79q=2 V*E]0c)r9V|UQl3 K>{ⅬtqV;Wp@ GCwvl*Яj*Up}hO\miU84j⫸R9^e08lJuZT6"DT`UX=VSJW51WsRzf]61Un]t«ynZxS(⪊FW+f؎v)!$QlUI+\70ۊ}8ڶk5HV:P0-4abOC|ҡqO TkLid݄^p4P<ٗvc4$ҟ,1a`qWe >;n>ɵbXٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱV7[{GԬb[WG\y2~/؇Osb6*O#kv_#w H&EeuOU}9foo6* ?o?lUj_wW9ąѽ\ت[OM{&(#ghbVO*Ӛ<9fT3b͊6*ثbTD=܊8Uw W!s7Km a{vȐY'vxX۱50j*E6IvfR #n!ٝHؚ@ƙ[iԁk-XL+uJ?{t+D4$i]xSmrV!^#Z WO;(Ƶ'ݕo^NK6qUJ1!7|q[nP|<+n(cjdLPKUZxcvQ@F< n, :l1M2^E\;`[q9~=9.۫QES@mTp#OU .o2GNsx\@$+鎿<|5jOx>x(+lᣉ :'C1Npllj G\iٷ=FxCZxhuqdF Fq5\FZ߹IhNx5Q{m폆'e$uq9R<(v9~0/:Uߦ< Bե<~< nU @zOdLJ;,B'x[BhJ(us0n6o/^5鈊8_Bz{|^'r8!aSM0p/ x\F NL$ r:N0knZ )| n,$zhk"=Fx2s -(^ؘ$[k@jᏄ[\|pG烁jtKGgr'8fa>Z6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*5*l̻TdCcn;%ߗw1E2q b:xۄzBX)+ s%к+רbƯqU=0P*WȪ]X4« ֝mY ӦcLUzUMe|[FphSuw>r֗4DѮ]鑵z aqZjXٔ2Xl6Y6w`jFʯlm[+K,+3b隸Umsj~Y+=vWSZ«9fqWz f[S|'*.`=JaLu