_ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:20 16:34:24  "*(2%HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?/Je):Lj撘l'x uY uio=9q{(4TG(R;9s{D)Tv wh)m>[uW[ET:\Ƒ$5:ֵIL>MUOS]&zOJ?+^UwEC\3!q ^;Ugfetﺫv9e3MV-S0QlO%7ՑkrQ)fr~.6n*eXϻ%?~AG9ndNnI]=OJtZ汭sc|\`I3;vHhIJȶu:$ֽӷU?]i$n^ vWDT4WfEmws^Hka:mrZqjm5VAָ0V紐Jjİ뾫״AGqʱ21{eXd<:w gȺJ.`uw[{n6M+O uktәYm xaa?5euunT3eO'M1_{B]XV!L))ͩmV5d6WK5 81ٻv?Q7{~籍u6H:lM;2.'PxeDz=Uz코Gz,{,{Z^og=7օFUޅ-i.kD"?@] 5ƺ=@E~ĸ29^?⽓<ޛMBG\` ~T] {2\?}-\"ZGl+zcy$zN\杄i_o*yS3kp%/S:cZdh~ab׏Y]}M=I$:sK _i]Uν1.mw %`7*Nj]m!$KǂH-sv ],l ;9~րڝ-{gm*ҿ*s_aip~k] wu]ebdV፮c]ƍQ~:HO]Ydʬl{]Soms??_KGP8^βuow?Ţi鸶YsM}1d==Ρm?F_ӯ:ަ_AeLy{]T_vgf=[gf;&k}e,6G%KUYd[sDUWmkY V[0lӺ1;k+f:vkזՕmѢc6v94Mf4T;)ޝķ kif:şэOv[;lpbU{]o^G^ڴ/vM{[^@YҜwF$>ʋ6ηw^?-ѥ^s2^Y{n@v';+[=}g5z.kq.ysMl}o!Y}+ ֏\cbg1c?G;,qK>V> kE#:*Ϸߥeu{u_ My.eTMk}ޗ:ا2NM u%>{}Y[;YdatuYoy+{@-y7uLz_\j֗K:2>]-ȫA֝ŒEvdSoZwOE=^w_,<.@>g4o-kEku8^_!|]ܛdGUQ՟P:#ۻPUc/;mvOs}niAsL>2G".;&֗qicD.+lFP+o[FgWzG ]N]]YUUU!g{}ߣ辫dYfe[YF`M=_cY/\V}`.a0i#UxǏ9b4kZvnn&fSgz6$ɰzTulcjp w'ѳt6h+`x8{&?s^ozw47c?=?ݿԱZ}:bh;}JDw1gRjqk~+4ՋY7d<4ōO֋?kZ 8 bkYOý?V/9,qa İlvi{Ϳ?dz;: 9Mn3[wr7ʹZ(?Kzͣ.F[-9Gێsu%.ziM=GS.dZUct#?FXs}Jht>Sx8=_zWeQm[w=Ec*ec6̇4ܚݩ{f16_F3~z_,^~EecvsxS%cikmlgwOOiW:F^Kg57KGqkǟW}ᖾmb{wzMjFsF9hnS+>ج0m-v~uZ] $}[8Uuo- 4Hk~uR圫@!`ʶsۋVSg_~.j*ǹƒquW$wg^=ۙ直R\7۸˅mVSD~cs@ -k]]-k,Wism۳hkf{wV4W'?=Ԍ[sZ?W~m57asXne5O]oh=o-eX&P{+OL)>1ORƜdαqk~>uEGODfCp]?W1xeԻu IHsRŷ~Щ2+N&j6XYs}2-}dkkGe_gQ57mkK۹U-94˽}?{Zv%[}eC{AqFۿwGU~maDzc书k1ܞs7U_CvR1e-=MAbjizqwϭMlnۛY1F\_MTS[G G9ceyoGenA~?s3oSߐKkumcۻ?Ө?u sv==u]iZK߫Ǿ>gk9.BBd49ԀѮ7{8ƴ^]rծQ# Ÿhu ©ձƺ[/ԏJ{[2,γ: ]s58B^܋Sꢷd oyczr2Urw+?m9ʹs1mY}~4,YcGIb̚ V\ ;,}aC^:~Mql{Z [{\~O#:pn;AW;b7cmw_k,lLv#{~ԭin ~\K4 }̬_}~^Ѹ7u{u%ۖNkƭH얙ߴY]2L]2DI"Ω1(̩^24o90q+la9/!5I'/QQqv;D}b;Zs_zu?kt]^-66Z[~?KZ;5wV-5 rIͱkLM.g?As׷N܋[S ˛]jUM_@oJmiqG?yg7_2^]Ypnܻ̼3쏩1x&뱤fskn;=̿Isq7guXwT_fkmU=:VCuTz-`8ȫXxw2.[{MúyQnܜ{mwV,a0{OOs8mu68({]VuSe>\s]Zl N| `8 ^A[Tq$ț%yD\n F'.fR{;jEiw mICJY>g]j 8A4VuYvr1>{\KCv~+w4$ ^wazM,m㵌 sې\{_EwEhxíMN1׻)N!_Meέs\>B }Kݍm-ϣ7Ή'X3hkYCq1ew7 OM2\+p xM.}ųRq2v>9d9XqUӳ~Q½ڪq0z{N?cZV5p.>`Ys kolb[jl9R8utZ͖AgUVƀX\v/RMVԉc mB_XkkixxnH5wo%9 :łvkHQ.-xXV3v?Xi{qlx"jx?;w֙Y^e@:{6Ы*gJg`I4u~wz̋CDT$cgm{C]c\vVtmS?U]d KD\ֵ[.uO8k.ka$mo[{6m0]ZqRu,Yp%枝_N޿s1ûƸmw[{yA)iTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$#Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXT EXP550/PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMY update_maart2018-6 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM Aq% Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?/Je):Lj撘l'x uY uio=9q{(4TG(R;9s{D)Tv wh)m>[uW[ET:\Ƒ$5:ֵIL>MUOS]&zOJ?+^UwEC\3!q ^;Ugfetﺫv9e3MV-S0QlO%7ՑkrQ)fr~.6n*eXϻ%?~AG9ndNnI]=OJtZ汭sc|\`I3;vHhIJȶu:$ֽӷU?]i$n^ vWDT4WfEmws^Hka:mrZqjm5VAָ0V紐Jjİ뾫״AGqʱ21{eXd<:w gȺJ.`uw[{n6M+O uktәYm xaa?5euunT3eO'M1_{B]XV!L))ͩmV5d6WK5 81ٻv?Q7{~籍u6H:lM;2.'PxeDz=Uz코Gz,{,{Z^og=7օFUޅ-i.kD"?@] 5ƺ=@E~ĸ29^?⽓<ޛMBG\` ~T] {2\?}-\"ZGl+zcy$zN\杄i_o*yS3kp%/S:cZdh~ab׏Y]}M=I$:sK _i]Uν1.mw %`7*Nj]m!$KǂH-sv ],l ;9~րڝ-{gm*ҿ*s_aip~k] wu]ebdV፮c]ƍQ~:HO]Ydʬl{]Soms??_KGP8^βuow?Ţi鸶YsM}1d==Ρm?F_ӯ:ަ_AeLy{]T_vgf=[gf;&k}e,6G%KUYd[sDUWmkY V[0lӺ1;k+f:vkזՕmѢc6v94Mf4T;)ޝķ kif:şэOv[;lpbU{]o^G^ڴ/vM{[^@YҜwF$>ʋ6ηw^?-ѥ^s2^Y{n@v';+[=}g5z.kq.ysMl}o!Y}+ ֏\cbg1c?G;,qK>V> kE#:*Ϸߥeu{u_ My.eTMk}ޗ:ا2NM u%>{}Y[;YdatuYoy+{@-y7uLz_\j֗K:2>]-ȫA֝ŒEvdSoZwOE=^w_,<.@>g4o-kEku8^_!|]ܛdGUQ՟P:#ۻPUc/;mvOs}niAsL>2G".;&֗qicD.+lFP+o[FgWzG ]N]]YUUU!g{}ߣ辫dYfe[YF`M=_cY/\V}`.a0i#UxǏ9b4kZvnn&fSgz6$ɰzTulcjp w'ѳt6h+`x8{&?s^ozw47c?=?ݿԱZ}:bh;}JDw1gRjqk~+4ՋY7d<4ōO֋?kZ 8 bkYOý?V/9,qa İlvi{Ϳ?dz;: 9Mn3[wr7ʹZ(?Kzͣ.F[-9Gێsu%.ziM=GS.dZUct#?FXs}Jht>Sx8=_zWeQm[w=Ec*ec6̇4ܚݩ{f16_F3~z_,^~EecvsxS%cikmlgwOOiW:F^Kg57KGqkǟW}ᖾmb{wzMjFsF9hnS+>ج0m-v~uZ] $}[8Uuo- 4Hk~uR圫@!`ʶsۋVSg_~.j*ǹƒquW$wg^=ۙ直R\7۸˅mVSD~cs@ -k]]-k,Wism۳hkf{wV4W'?=Ԍ[sZ?W~m57asXne5O]oh=o-eX&P{+OL)>1ORƜdαqk~>uEGODfCp]?W1xeԻu IHsRŷ~Щ2+N&j6XYs}2-}dkkGe_gQ57mkK۹U-94˽}?{Zv%[}eC{AqFۿwGU~maDzc书k1ܞs7U_CvR1e-=MAbjizqwϭMlnۛY1F\_MTS[G G9ceyoGenA~?s3oSߐKkumcۻ?Ө?u sv==u]iZK߫Ǿ>gk9.BBd49ԀѮ7{8ƴ^]rծQ# Ÿhu ©ձƺ[/ԏJ{[2,γ: ]s58B^܋Sꢷd oyczr2Urw+?m9ʹs1mY}~4,YcGIb̚ V\ ;,}aC^:~Mql{Z [{\~O#:pn;AW;b7cmw_k,lLv#{~ԭin ~\K4 }̬_}~^Ѹ7u{u%ۖNkƭH얙ߴY]2L]2DI"Ω1(̩^24o90q+la9/!5I'/QQqv;D}b;Zs_zu?kt]^-66Z[~?KZ;5wV-5 rIͱkLM.g?As׷N܋[S ˛]jUM_@oJmiqG?yg7_2^]Ypnܻ̼3쏩1x&뱤fskn;=̿Isq7guXwT_fkmU=:VCuTz-`8ȫXxw2.[{MúyQnܜ{mwV,a0{OOs8mu68({]VuSe>\s]Zl N| `8 ^A[Tq$ț%yD\n F'.fR{;jEiw mICJY>g]j 8A4VuYvr1>{\KCv~+w4$ ^wazM,m㵌 sې\{_EwEhxíMN1׻)N!_Meέs\>B }Kݍm-ϣ7Ή'X3hkYCq1ew7 OM2\+p xM.}ųRq2v>9d9XqUӳ~Q½ڪq0z{N?cZV5p.>`Ys kolb[jl9R8utZ͖AgUVƀX\v/RMVԉc mB_XkkixxnH5wo%9 :łvkHQ.-xXV3v?Xi{qlx"jx?;w֙Y^e@:{6Ы*gJg`I4u~wz̋CDT$cgm{C]c\vVtmS?U]d KD\ֵ[.uO8k.ka$mo[{6m0]ZqRu,Yp%枝_N޿s1ûƸmw[{yA)iTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$; WӱW+N=^cV;r~Sx_8c Zv7S}TxU8;+f6e}\xƘcኻ#*Qm4wǎ)eHxhc^/|+NJS;0LUbG@¾ 'BK~^1ƓxʑF?@HF#@O?v4DžvWscK KRi, S/ NA>cy+%ef$30CYRNt$s`aŠ ?ߠ݅. ?ا_݊/9G ~O?v+ߡ݊74sb.~W݊74sb. ?د ~O?v+ߠ݊74sbeO?v+ߠ݁x]9 ~O?v+ߠ݊7$sb. ?د ~O?v+ߠS݊7sb.~W_S݊7sb.?د @vo)x]9^f~Wٿ@vo x]9^f~Wsb~ ¼.?د ݁x]>~+9^e݊/>~Wٿx]O?v+9^W7}?د<~WO?v+us݊𺹿x]\sb.o9^W7u?د <~WO?v+'usS݊:sbo9^W7u?د :~WO?vusS݅x\9^W7q?O?vus݁x]\sa^W7q? _sb.o9/ O^W @), Pثb͊6*ثb͊?*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUXb͊6*vP]+v^(vV*ثb1KWf]vlUٱWeWvlPثb͊6*1Wf]6*UٱWfE.&*UqK*i]vlR챊,b]vlUx)vX]]qWebf]vlUXxG5qWe6(v$ءUXHzb)v#.(v2< [ qWeb]b1W`;8Θ +؋bc1CUXUӊqWbgv4cqWcCQ.‡braW`ce Ucv(UٱWeUgvQ]qWbm)qCE.]vX]qWcv$qCv4Ǧ*,*]Cv^*ECWc*lY;/v?>XY;Yx1dpN"`{~xX/*i]vlUGvlUGvQ]%Pإcv^*vX]vlP죊]ءUcvX]b81YŐv œ*ثbWe͊6*ثb͊6*n*ثثb͊6*ثb͊/vV*ثb͊6*죊+v^*ثb͊/vlUٱWeb͊+vlUUٱWeUXWf]6*Uن*UٱWf]vlUXWf]vlUٱWf]vlUٱWf]vlUٱW`#Px%S7Ւ6ok1,crIAF鐳4XٱWf‡f8Pe(vk ]L p쌐f`%BÑCȱ)_g ,JV*U#O~x~d̟`|%@i=O"21Cb]/;6*R;51WeqWf]vlRثWeWv^*ثb͊,]/vlUXWf]b͊0]6*ثb͊/vjb*f(vc+vlUӊqWbgv5Cv8u.b]$ qb졊,b/va/vQ]lUK.)v^*ث*v1Wbg;\Uv=qW`qd* ;b[;+v8u.!x*MW`v1C]]vX]]ثb͊]1Wfb͊(\R^vqb]v^*]7\PUcvlUኻ6*]Pvx8y'QfaE?<, U6*ثWf](d`͊]1Wef.͊6)vU1WeU*UxUؖ*fw8xvc6*\*UٱWf]vlUٱWf]qWebWf]\Uxb\UU]6*ثb͊6*n*ثWeʦ*UUٱWf]qWeb͊6*ث*UXWeU٩/vlUٱWf]vQ]b]vQ]6*ثb͊6*ثb͊6*q?^TGdal%G?̛Rw]vlUX.́ͅ]2IvkxW ]pT}*ëO2Altt1,jNEM"8]l *2|U6AĶDE2͊6*ثKb͊6*ثbf͊0]6*ثb͊/vlUٰ+vV*챊6*vV*Uxb͊6*Uَ*ثb\UٱWfbvV*UٱWf]vlUٱWcWeb]k0]+v^*vlUٱWf.͊6*ءxb͊6*إٱWePث UٱWe͊6)v^va"z'ͱ1Cb͊6*ثb͊6**6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6*ثb͊6*ثWeeUٱWf]vlUٱWfKb͊1]vlUٱWf]qWf]6*ثWf]v=1KE] R쳊qWebf.͊/vlUٱWeRUUٱCKWebf]6(vlUٱWeRPǦ*ICb RF\PN< _ ]8XWeUx U.b;ȸa\Xb c1Webʮ*ءGvQ]Uӊ8ˊ]ǁ!ذf®‚ qbvX]\R~*ث*UGv4ve)v^*ث*v1*Lc1We]`.]zbcU؋]1W`'cWcLU]ۮ(vPǮ)v?vlUٱWf.I1WcWf]1We͊0]͊(\R/LU }X)v8be]ث']]v8b͊)WbG;0]ئ*챊6*UٱWf]UÊ*Z,Re]1We RlW`i:`adiJCC"ذaM `|Pi]vlUGvlUGvQ]ɋc1CbeUxٱKWeUٱWeƜU͊/vlUgv%Őv ,Pm]vX]UxHv^*ثbf]qWe͊]ʦ*UٱWf]۲*UXb͊6*n*v*ثbWe]v7v]1Wf*UٱWf]]v;v7vlUUٱWeUن*UٱWf]/vlUٱWf]vlUٱWf]vlUٱWf]vlU/JzX`*_#5rA-iG ɴY+b͊+vl *Uc ]>Ļ"تKU늴pLxvC$pmC $-CȰ)_g *XٰF|U}3}ĶE\Ze/vlUَ*U٫/vQ]];6*ثKCbe*UcvlUٱWf]vlUٱWev^*͊/vP]6*v^*Uن*UٱWe8b]vlUٱWev^*UٱWe]6*lUَ*UٱWe Uxbf]vjf.ٱWf.͊/;0]+v^*ثb L0+8Cb͊1](8)1b]f.Cbef8XCءUٱWeUcv^*v'v/h~,R6;1́.͊6(v^61Wf.ͅ]v^(vVvV*p+ٱWe͊6*ءxKbUx6*ثWe]UXWe͊6*죊+vlUٱWe\UXbWf]vY]6*ثb͊(b]vlUف*XXǬzb3a,x\dHp4}]?ۿ+)m(0c04Zb0D!;6*ثb͊6*ثb:П N2`y%p 96+6*ثb͊/v]qWe* qzUآdYp%c銴p쌐fwݏ%P_u9%3Xf®8'O~xUd`̿`|%r-kL3b8bqWf]vlUٱWf..͊6*PإٱWf͊]v^*ث UٱWf8UXxUX*UUUن*We͊*Wf]va6*챊6*ثb͊6*إxxb]vl Uن*UٱWf]6*ءٱKbe+vX],f]vlUxWefȦ[;6*ثb͊6*ثb*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUXb͊6*ثb͊1]LUxXٱCbf(vj͊]bf8b1Weeb͊6(vlUٱWf]v76(vlUَ*UXbS)e8m]8XٱWf]/;6)vlUcvX.bf]vlUXXCb͊+1]ě;6*t}qKJ89ث$] )v4eUX*]b38 * رv3vQ]5qC*kbUӊ8D.bU؜P qbvX]\R~*ثWe8v&ث;\RUٱWeUَ*MWc ƜUU.b..(]lPˊ1W`'cWc*kb%.njUٱWf]v2LUI]vlUUٱWf]vQ];41R~,]#]xWe6*Ef Ux*UMlPUxWeb͊6*죊qWc1Cbw!ؾ)v8b1WeR챊&(v;FA&폣;$ dY«϶p+8CUٱWf]](Ĥʼnv%]1Wef.\Uَ*v^*i]lPn*ثb Ux3v-l~!C~EXP챁]6*ثb͊6;6*UXڻ6*إٱWc+b͊6*xvlPثb͊*Wf]vlUUٱWeWvV*ثb͊/vV*ثb͊6*ثWf]6*ثb͊6*ثbf.1W`/P{)d= rs06S*n:G_ ue ҸnF]!6ǐ%L5SHfYW+GS6*ثb͊6*ثN0['C? `y%:Пaɴ+b͊]v^*ثbb.cv*تK Zp쌓 `)B_?< *+W`;*o~Xy_>Xt?3lZavlUَ*ثb]0]0]/vlRثbb]1Wf]b͊6*]v^*UU]bw]6*ثb͊6*ث U}Wf]vlUٱWf]6(v^*ثb\UٱWeUٱVb]vlUٱWf.͊vlUٱWf]6*.XWf]6*ث)R|4˛cbf]vlUٱWf]vlU*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6*ثb͊6*ثb͊+v^*UٱWf͊];6*إن*;6*ث/+vlPثb͊(.͊vlUXUXD.njUتbcqCCb͊6)v8b]vlUxcvX]vlUXXWv^(vlUXW+;3 WbM]\R:INذ®8vV*챊/;6)v-i!kr> ˰l,.b8͊(UӊF(v7v9qW`2F6v'/L(vlX0]1Wc1Wf]1We8ث;\RUٱWeUَ*LPi]].*^Yb.\U㊻~ن*p]LRv*x]ث<.njUٱWf]v2LUKb͊/v^*ثb8We\R*]ŋBt.njRv*ثv"qCWcWf]bblUؑ]E.]6(vlUَ*죊qRn(vlU_1WeUcva.ʓv.6l|kp휓`c͊6*죊6*UGv%&,K,PR챊0]6*ثb]8]vlUኻ/vnث}ae vlRثbWf®eaWf.́]vl*챊6*L(vV)vl͊]  6*WeWeb]vlUٱWcWf]qWeb͊6*UXb͊6*ثb͊.We1We͊+v^*ثG,T;%Z_㻈MU[7^۱Ê2 tx<S{W6 > #ڧ.,45Y6x|^q횢)"e'!>f~Q'Pz'W'`J"a؃,5{d3_Lq]N^L"Bkk||="̅b)&;VV;6*ثb͊D V?#2X0m<;yg9́\UU]6)v8aWfU.v,ت8&,Rկ !&X6mSbS8aqŊlUٱW`;!VM;. Uن*v)vX]~ث<.v`afcKBddY«߷\06*i]vV*ثb]qWbRbĻ]1KWf]v^(v4c(v7vlUٱWcWe͊v\Gqaȶ;6*챊]vjWe]6vlUٰ+b͊6*ثaWe+ 6vl һ.-] (v^vVvV*ثUUٱWf]v^*ثWf]vlUٱWf]vlUٱWf]vlUgvV*ثثb8 Uxbʮ*yW_62zR1mÆT~݋/C_:$hhA?;[kwKi+ D~q&)[mz|o-^Y{ņLb|Hd6x9, W5ǔqQ=Q< PPypڹwIcH7=EUfGǼyP qhZ*g;(.p1(O"ٱWf#vlU+Lz#X`<-쟑ɇ c'ghNb8bZbv* p®.cv*تK Nië_2Ao PljŁL Cb:wUd`̽a- J~g"6*ثb͊6*ثb͊6*ثb͊];6*إxb]\Ux UXWf]va6*ثث銻/vlUٱWf]va/vlUٱWeWv^*ثbWe͊6*ثb͊/vlUxb]v^*ثbqWf]vlT;6)vlUcvlPvlUٱWe]*]"'IٱWf]vlUٱWf]v*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUXb͊6*ثb͊6*ثb͊+v^(vlUXٱCbf];6*ثWeb͊6*p.lUXٱWf]vlUGvV*ثb]qWeWv*v*.PPثb͊]1WcWf]b]1K*Pإَ*PR].͊+;(]Pi]qKH늻v$kWbaKm*Wf]폞)yaTZ˰;tCWf8*av4Pf*Q1W`2v<`Kث)rHvlX0]ثbWeU]Uن(v(xbU]c[v4b*^,Y;=1K)e)v8Wb-bw]LY;,njUGv#&(.Ć(v8bbvlUٱWf]vRv^*ثWe͊6*죊+vZ]bغt.)v^*U1CS;,bf]v5Wbmb]]vlUٱWf*죊qWcqC*Rx#"ط /%pӊ6*ثWf*UGv%&,K,PUٱK*v^*ءٱWeƜRcbcqWf]v;va/v3v\]qWa; hvY8\Uu8ٱWf]\UX𫲱Wf]vlUٱWf]vlUٰb͊.XUx`Cx`CJn*ثb͊6*]vlUٱWcWcqWf]vlUٱWf]]+v]1We͊,]+v871Wd`KkEf+nh/2msvAw·~=e\A(QN Ò2MV<%{刯u}0ɻ"T& 7dLVE{.c;0AyCCxPeN+J0 %rc杬 $I5?X9ɴ8]´‹v $ 7| c9BkN*gVkՌMh#ȱ" 0srWb].*1▎Z oo%g#NELLvl ~<쏐ĶH-+/vlUٱWf]vlUٱWf]vlUٱWf]vjb1Wef]+vlUxWe͊6*ثt]v;vlUٱWf]vlUٱWf]v^*ثb8Wf]vlUٱWe͊7*ثSvlUن*ثWf늻/v^*lUٱWf]vlUٱWf]vlRث Uن(vj͊,͊6*ثb늻"'IٱWf]vlUٱWf]v*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUXb͊6*ثb͊6*ث/vV*PU٫6*]vlUx*إٱWf͊5qK6(vlUٱWf]vQ]6*ثUUT]G] Uتt.Ra͊6*إcvX]0],beUxxGvV(vQ.˦)vV(vlUٱWf]zb;6*])v2LP@}v \,ؙ]UdbHO>xq/U>bbxXbeu]qWcMN*c Uӊ8. 'cvY]$`We UUٱWev^*죊ث(bb]51Wf]1]8]1Wbbb* |P1WeLU؋fWb'evQ]Ɋ ,Prc*UٱWf]v5qPx]]v;vlUٱWf]qWeb^;1W`7b.)v8b͊ث1Wf]vX]lPثv=qKثb͊6*Uَ*a]8]1Kæ*]]&~A&>c;$'쌃5Y qCeb͊+vlUGvlUGv%&,K,PUc+vX]6(vlUف.88b͊,bWc\U9;/]v]p!U—e\f*T6;6*T;.`Wf] 6*ثb͊6*ثaWfˮ)vVvl(vlReaWf]\UXb͊6*ثb͊6*ثb͊6*챊+vY]6*챊/vV*ثb]]1Wf*rSQJ2a2:nŚ(i%qCU9ёa憖P%D]ו]#7{Fza5Jc|Tf>l(et\q}lDeC&N`YA f W(W`$R?!daG%jx O$G?X94'U] J Qnġ55;j0qFpT2@ u 4O넆|кU+4a1AMpˁ]&)v,8wiFIo,Y!m~S`DžT͍+b`7! &~f#1-K~g"ǮE6*죊/vlUXWfb͊];6*ثWvaCWf]6vlU}qWfP.]1]\UxWe͊6*ثb͊5qWeʮ*]6(vP.]vj͊/vlUٱWf]6v^*UX Uck5qKCb͊]vlPثb͊6)vX]vlUxb͊6*ث*L< 'cbf]vlUٱWf]vlU*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUXb͊6*ثb͊6*ثWf]v^(vV)vlPثb͊];6)vc1]vlPثb͊6*ثbf͊6*ث*UXHHv(1Wb]qK;+;6*ثbeUኻ6*ث)vX]1WeeeUXXٱWf]vlRءَ*Hc1Wf]qKR]bb`'c_;]1WcUUٱWb]2}7aTX`geb͊+vQ86]lPn*zbdS]$`Wf]\UxbWeU]Uن(v(xb*k Uؙva\Uؼ8OLU؃}P챊1銻lP졊1Wbgv=qWe6*BLP]c1We͊6*l;\RUٱWe\UٱWe8We*s`7b.*RUK͊6*ثv^*]6(vX]1Wc)v;vlUٱWf]qWeUӊHv ኻ0銻/v^*;b7lXZ bbXٱWe Uَ(vQ]8zbeSv(;L xU؜0\X6*rǮ)v;vlUxb͊ث3b/vlUcvcث6U]Wbbv |P][;(b R]:bcWc*죊bX.*ثb͊&*bb/vlUٱWe]vQ]-qK͊`7b!ؠ]]vlUٱWeUث#,bnjRp]vlUَ*UGv4eb&*1dUن*v*URb&g 1d/d[m0+Pث1]vQ]vQ]IbXcvlRثb8Wf]]]lPn*ثb͊6*f*|}qHv2-͊6*v*ثb\Ucvl ءU]6*iٱCbͅ!XxvlUٱWf]vlUٱWf]WfeaWf]0+aWf®͊6*ثb]Wf]vlUٱWf]vlU٫.WeU٫5qWeb8b]-UoٛoǔÚɽHGt~ vWoV|d..=qQs6 b3x\%7!iW|:c;4 ZI>'[#Q|ʎA$~.:WHH qlhg>llRn1nsE2Kg,@b|f J' 4Y.HRPѸ=gw2Pm$H?X1О]qC (v>& 1j 'dGه!/~INkL[5*k)L4j 2lkr+E—bɊ8ukFH% 7ݏ%䆵g#W~Dž+Wev ?_«&凞e#l`—c$8,UኻqWebǧQaFa\X`gbeP졊5qWeblUÊqCv(;";.‚ qbv=F)vR蓚H^2.~{dc\đ,D.: 4AV#zF@DA5{_bQ-X`=DPXT8:x$b3|r"zrHaڸm2ҦLw⬲ꇦm2?ٔKÓ'iZae]O; V̼"f ?$jq:KSc?di®8 5(0+ͷYdƨl;lfBA%Jd]>Y&Ab.\ bV:#$ |,휍ȱL~P]tOY7?,(v#UXXGv4cN*iw]&LY;])H..1Wc)v)/|<(.76/#p-NMRY6+,]A՚jČ  IVrd&/hkp)N)0>ppdM) j\&*z`Wbp>GL\Eq ?<XٲB% ; 4k671цH4vbr8qǚe(12 hOWbRC(vR11drmmO6Y7} 7k1)] |,a&Gopd*⋊CT¡V:#$`˿ kGoX<.8~V*책.Zg &凞e#1- J'r-kL3b͊6*ثb͊1KWf]vlUٱWf*va/6+N]vV*챊*b8S6**Ԧ*UٱWf]vlUٱWf]vlUxWf8b͊6*UٱWf]bWf]v^*ثb͊6*lR;6*إxXWf.͊vlUٱWf]v^*ثbf];6*L< 'cf]vlUٱWf]vlU*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*ثWeb͊6*ثb͊51Web͊/vUqWeebf8ٱKb͊/;+6(va]b͊vlUU]]v^(vV*ثUGv7vV*V>ؠ]&)v*UٱWcvSb/\UtݏalX`gb';/vQӊ(ƜU;L 1bbĦ \X08b͊,b]qWcv4.b͊/vlU](v&qWfA[;8(vSUv$Uؠ]Nj ~*챊-Wb2bG;/vlUٱWcd]]1We͊6*챊6*Uَ*]lR'\X)v*1KWeƾ*Df]vlU`vSb(vlUcv8bc*UٱWf8WeUӊ]LR1KWfv8b(.h|,|EnG%pG;pٱWebqWf]vQ]|XbXٱWef]vlUٰR] 6ƶ(v4v^*UٱWeUU늻Arv^)vUqWe͊6*UC.ͅ]6*qWc!Xڻ6*%vlUٱWf](.ͅ.\!] 0ī`b];6vlUٱWfͅ]]vVv^*UٱWf6vl +,aRثb͊6*ثb͊6*챊FF ;帱04<懳gy(@D8aY3ٸfvJ]P =$jYXr%ITs[]ZPtF5kH$zzAN6ja#l.LIA͕Fw ":2E^h79F&FA4ɖXPo!ss~7Kx2 2PldNhn6HuM0R϶Nh1ߐJ9@?Ɗ˒W{b?da](vƧAmỵ ժ6ᩆ:01 JXk1)_}y~>Y&GopdX⋊CU¡ŊV:# Pݯ m#wr,JgX͊+v OY7?,:)|%Ai?`E-iV*UٱWf]vlUٱWf]vV*UXWf]/;66*UٱWf]/ +v^*ٰث*UٱWeb͊/vP]v^*Uxb͊6*ثWf]͊6*ثWeb͊/vj͊,b͊/k6)o6(k/vV*ثWeSvX.͊6(vlUٱWf]vlUٱWe͊];6*L< 'cf]vlUٱWf]vlU*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]51We]vlUٱWf]vlUٱWf]/;+6*ءٱKb͊51CUٱKb͊6(vc6*ثKCb]6*ثUGv4]LR8a‡ebf]vlRUcv^*UٱWeR챊/;6*ثWf.͊vlUٱWf]qWbm]vX].8.CBt.ě(vV*ث늻)WcqWcvE`lv\ %b؉͊5qC*iv7;qWcqWb!&>v?6v%6`ffWf]qWcv4.b͊6)v^(v1WbmUkv(zŐv+\U،|Uؙ5'v$qCv*1Wbb;,blU،.)v(1Wf]vlU:b(v()v^*UٱWf]\U٫+vc-qWcI."] Rv*ث8vX.͊6*챊6*͊8ٱWeU] UٱWf]8WcN*i/\U%:b;1We Uኻ/vSK)zbح bd?!m[XP>X+8;6vUqC`K;/vlUU؛Ļ͊,`)vlUٱWf®͍ٱWeAvVv4c1WeW;/6*UٱWebǧ\U0t7N\)vjWfUyvl*ث늻0]vUqWf]vjvX8x.ʮvl(v^va]dٱWf]bٰٱCb͊6*ثaWf].ͅ1Web8bp+Wf] 6vlUٰb˦*UUkګ$dgMغ~)n5mT"zPvB.A-S %UO,8c,7P=S4fr;8KklZv~\{M~e\xz9& K[BF:b!ABKqv|c` h$p ` d2ͭ\R0xl3䖪{8)˩b`\9!F!qza\7[Ersepݴ1ө­R PM97ac"R$~dKPkVf,.x֘ UtO1/S,$mMS±`.)v*T8zb~v,JPֿlnӑ)x^p~V;6*~<*~Xwnl(-+["֘f]vlUٱWf]vlUٱWf]vlUٱWf]vlT;,b͊66vlPثbf͊]\UٱWf]]vlUٱWeb\UX*UxWcWf](b] UٱWf]v^*Uu]]1Wf8͊/vlUإٱWf]vlUٱKbf]6(vlUٱWf.͊6*ثbd[Tzdh<;6*ثb͊6*ثb*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeb͊6*ثb͊6*ثb͊(͊6*R͊]vV*ثWf8*ثb8WvV*ثb͊6*ثUGv4]NJCALR.PPثb͊]0]6*챊]1Wef]eb]vlUٱWf]vclPf*ث*)v9K4k;'LRIeb͊6*n*]P Ļ7LX8ٱWe*kbUӊqC*R<!",Y;͊$ qbv8be͊6*v*n*kbƜUCv=qWcWf]vlU]Pi]v ,vUؓƎQ]6!-qWf891Av!\RPb͊6*ثt]Px. Uxbˮ*ثWf]̘K.".Wv?6*kN(vlUٱWf]1Wec8ن*챊1Kv^*ثUX*i]]^Btœث Uኻ/vg銻(.,Y`0vH|D-=p|b[\qCxӊ+vlUXv^(vQ]1bG;6*챑KaWf͒WfIvl*v0Ӆ1KWe͊*C`75qKaWe]v]qvlUٰcj 6(vP.]vlUuZ`KaWf]1WeC aWedٱWf]vn٫HvlQN͊6*ثb8`Wf®͊5p+aWf.XKb͈CaWf]+vX.\0#֝,8c3\MߦdMK̭;pNN_]FRL-B)j؅KXGnN[IC<ƿ_D ?ӅA(v*Rb+NZ,)IecHCZNE3aBn;/v ҿޅdaXun-}ȾA0͊6*ثWe͊6*ثb͊6*ثb͊/vlUٱKbf]vlUٱKb͊,b͊/v^*ثb͊6*UٱWeb͊,b](͊/vlUٱWf]vlUن*ث UٱWf]6+N͊/v^*ثYVbf*UٱWf]vlUٱWf]vlUٱKb1C銻6*ثbdWTzdh<;6*ثb͊6*ثb*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*ثb͊6*ثbLUٱWf*vlUT]vlUٱCb͊];1]0LUxb]vlUٱWebebf]vlUٱWf]v4]D!]8XٱWf],bb͊6*챊,beUxٱWf8XٱWf]6(vlUَ*죊ء؞*ث*LY;&* 'Ӧ)v&qCWf]\UM+vX]6 Ļ6,]َ*UٱCv1WcN(v4]&Ev)]v%6`FeUኻ͊,b]]lUӊ(bc6*ثbƾ*Lcv91WcKL=1Hv8;0]Wb/;(u] U">vY]U؜ X/vlUٱWcd]Px. Uxb͊,bqWeblUqLR /\X)v*ٱWc_v"qC*UٱWf]v0f1Wc*UٱWeUX(ƜPo|U늻'LY;0]Wf~:b,S`0vHb|EiobĶCx]+ 6%];e*U؛ŋ#;6*챑KaWfrA.͊6*v0Wc(vlP/vlUxC!/+r ]ӳW)y;6*)vjͅ]0+W/vUqWf*UٱWf]*WcCWe!] +vXqWf®͊6vjX/vl(vlUٱWf]vl*ثbp+aKbf]v^)vl Wf͊] ]68!Fl HWE(ӱ ״;2cb-,ߖyyxCùQ&-11A,bۜr@#&Vń:R!ku1zchɖ"\!IZs egx*L-NOAb:|8F1A3L?v Zwbm:<]Hcl"'"ޮw3QԈY$SX#˷|'3.n6A͊YEfKkr1Zt<. &6w?$jx\flKTm RXc ,kO64Ď(v*M;$RZ2C(P?ӓ[a卡(;4|dbvNnpJiiȖ2d_cZokDcv*R"+NtRucJ휎_r()x^p_]iB|Y?o Ka~r-kL3b͊+v^*졊/vlUٱWf]vlUٱWf]vn*RP͊6)vlU٩6*챊1]\Uxb͊+vlUXث0]6*vlUٱWf]6*ثb͊6*Uن*UxWevlUcv^*ثb͊v^*ث*UٱWf]vlUٱKbf.͊,bf8b͊"ڧ'IٱWf]vlUٱWf]v*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*ثb͊6*ثb͊6*ثb͊6*qWebeebf͊]bf]+6*ءٱWf]qWf]6*ثb͊1]qWcN*UؤXب]&)ǜRa͊6)vlUcv;vlUٱWeUc,b͊1.f͊6)vlPثUGv1Wc1CWeUؼglR|1K4qCt8LCWf]\Uٛv7vX늻-sb],]PUP죊(UӊN(v7v(c Pb́]͒AvnvX]1Wb]b͊/vV*kbƜUCv=qWcWf]vlU]lPa]LU&;qWb;(b=1Wb] R^3]]UؓAv#\Uؠ.͊6*ث]Wf]vlReblUi=1K$qbtX;\Rv*U]X,bf]vlUኻ(PUcv;enHvjjv]pٱWe"xb́\)vlUٰڻ6vlUٱWf](UٱCW]v]v]٫.hv^vlm]L6ʮI]W)x٫,aWf͊6*ثb͊6*إٱCaWf].‡eUٱKbf]]5D.?_N6o7A).vUPۮMl@If6mD0jAFk\8>?rՖK=1p瘞HȭB½+NQiciP8Nt>,'@7?; (v RUynMO._Yn3 A.C#fl9W!CyXb,ҍ݇VpJE!̀4/#W=wQTdZU]ٱKb\UٱWe͊6*ثb͊6*ثb]vlUٱWf.͊6*ثb͊,1WeUxbƌUxWeLUٱWf8bb]vlUٱWef.͊6*ثb͊6*UX]va/vlUإٱWf͊51We͊6*ثbf]vlUٱWf8b͊6*L< %qCb͊6*ثb͊6**6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*ثb͊6*ثb͊6*ثUٱWf]vV*PRثCKb͊6*;51Wf]vlUٱWf]]vlUٱWf]vcqWeUXHKLUآ`KL)v0ebf]6*UUٱWfWeRv*ءٱWf8XٱWf]vlUٱWf8XÊqCWf]#'cߦ* '\v,g*UٱWcvc,u] ,Kbؑ͊(eUGv&qWePi]]NJCDx;0%g;][.v=\892zCeXEv8#ع5i[W{U1pOR[/#Osy3K! zcm-i$eqd:% ~s^N1GDoao6h CeZ|a}M[gj!wڬZF'9q%"y%AE(ޡJy:oW; ×)YHN)b6*ثE>s#O)6c]W':Cm-m!036PNk;3EԵOS$?ƹ8&PI;KWc#8<|2p2qkӰrg2m&x+NG劎h [d1UD(!N7\Z'-qPU1KZpנHImc-9)xBثb`/OY?o KaҾӑsjG.]vlUcv^*Uxb͊6*ثWe͊]v^(vlUٱWf]vlRثb͊6*UgvlUx`We*UٱWeb͊+v;vlUXWe]6(vlRءٱKb͊6*Uن*ثWe͊6*إءٱWf]6*ثbf]vlUٱWf];6)vlPثWf]]S灤0.(vlUٱWf]vlUٱWf]*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*ثb͊6*ثb͊6*ثbqWf]vV*Pثbʮ*إٱWf]vjf]vlUٱWf]qWeb͊6*ثb͊1]qWcqWeb"]bb0%.PPثb͊]1WcWf]vX.*Pإَ*UPثb͊6*ثUX8Wf]#CI;O]8Xb\Uَ*UcvYwvp,]Pث(vV*죊8;(ƌUتb`,Wb3 )|qWeU]WeUxv'v=1Kثb͊6*cb(v0]KT=1Kث)zW|P銻|P졊8ن*쳊bX]Wf]v1Wc(v;1We͊6*ثb͊(ˏv(qK$qCbb]؉1KWf]1We8;+v^*챊Cv8bqWeUUٱWeUÊv_|Uغt!ئ)vP]]b~1CqPY$6DZpA^N7]vUp!٫]UX*Pkt‡b'(vUqK ]1Wff+b͊];1cAv0C PUن)v^*ثCHv T/Web]vlU٫.b\U٫ӲWe͊6*f]+ .QN1K+b\*p8]\UU.‡f]v^vVI]1CؕvlV6vlUX(vlUٱWf]vlUٰbf]va^lrWrM2xiFbTWK%=d90:_C.TCv5-#+,7'ȞjAk]b0_6A7HLIָ#3wS+P/L.|-ž1ea鋏(6Ėc;aJ VwL|kC_EEe(v*E8wkFH2BKo_%(kO~yPS8+򫊻6)v ҿބB|̽b[ KNFEvV*ثb͊,UٱWf]*Wf]vlUٱWf.1CWf.͊vlRثb͊6*bWeb]v7v^*UٱWf]qWe͊6*ثb1WeqWf]v^*vlUXb]v^*v^*]k6*ث Uxb͊];6)vlUٱWf];6)vlUc;6*ث+2|4m vlUٱWf]vlUٱWg*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUXb͊6*ثb͊6*ثb͊6*ثbLUXPvlRثWeb͊͊6*UxKCb͊6*ثbqWcN*죊+v))v*1Wb.ǜRi‡cqCb͊]v^*챊/vX]vX.CKWeUXXb͊];6*vV*MWcN(vV*ثD]1KKqWcpWf]1WflUX*68]8P],]7\PUXUَ*MWcqC Uآ`KB`dx]qWb2 zxWeR~*Ucvc+v5Wc1CbǦ)v;vj͊1]'v&ءLUن)v )ĥ늻LPv Xv-)v*إن*ث)1C,P챊xb͊&*LbcKvX]vlUٱWevV*]*Pœ,q`u]Rv/ ؉͊/6*ثث*ab/vc(ʮ*Uَ*a]qWbbCv?va)b7LU٬Cp!|%Ӏ1Alaep+yUeb\Uَ+N\Uٰ(vUpv5ؑŋKdRUَvlB6vlUٰ caC]\ v^vV(v:>A+).CWf]\)vl*Cb͊6*ī`vl*]v`qWeevVvl)v^vlmˮ*®\UٱCīR.G 0Ġ6vlJ6*؅vl,`CWvlUu]b®́]W W/;6*ثb.\P*Rb68ڻ15޸Wf]m rOA\d/1e3# %dV*ise,E2Cf@Lŏ#׮EyT]L1ئw9QXDGc-9-ҼL\Bv,kRF 6MF ^[K~ -DRvahNc.x=hq5˒Iyb?g?l1]8Nd?d;NL"LjM.6'劄j^wĪ""~adpX^eتW*ݯA ВU k#r<]i_B||ݾCPgr1kGf]ٱWf]vlUٱWf]\UX늻5qWf]6*vlUxS6(vl vl*ٰٱKbWlUUXWlUٱWeb͊/vV*ثbbf.Wf]v^*vlUٱWeWv^*ءٱKb͊/vlUu]vV*Uxbf.\PثWfbf]vcvlRPUٱWe1Wd[Tzdi<;6*ثb͊6*ثb*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUXb͊6*ثb͊6*ثb͊6*ثb͊6*UٱWe]LUٱWeb͊6(vlUٱWf]qWebf͊6*ثbqWcN*UXHWbت`Kp;vlRث*챊/va/vX.CKWeUXCb͊6*ثUGv1Wc(vV*ثx)v(1K4v)eaWeb͊,bqWebOd\qΧ bO;+vQNث3*iƜUن*Q1KB`dx]͒Av=qb챊, Rpb]1]ث3Uَ*ثUؙ]lPg|Uؠ]qKT=1Hv8d;e)]b;+vZŢ.N)vX]v' ؎(vX] RUٱWf]v&1C,b͊6*ثWeblUi=1d 7\X;4Xq]eWbobfu]vlUኻqWcN(v7v;vX]xb8vlUGv4cO\Uv/)K *~*ث*a8YT; ,ݒ _W,֜ 4WeW;*٫]*qCaWc[ bG;p%xٱWf*]vjWf8v4Uͅ]\)vjCvQ'Q _(rvl6ͅ.\UuicvlPˮ*]vl*]va/;6vl)vlP)va+*]v]p`Wf(vj]vl +cj챊6*\UٱWf8be͊6I]͊5qKbe vV;6*UxPRءx6;6*V8YdaO12v/aBsyHn4:s'.˜Sp}OL~D\3B'v)7q<*=IGl6p`z.j1q3mʚِKҹgrqKA^+)K|C F]Pvsұ18'I% 23WSC=?]n_^Odͻ\Mb?s1‡cIv1:CkG>EZoKSRgx"`T>QB_@pAE0+U—*ݷA \{`*g#r)x/8Xf' 7 1- }#EvlUن*ءٱKWebf]6*ثWf]1Wf]/vlUٱWf];6)vlU}qWf]vY]vV*ثb͊6*ثb͊6*ثb͊6*ثUٱWeebeUT.͊/vV* UxWvj͊/vlRlPUٱWf]\UxٱWf͊];6*ث)vcvEuOOͱqCb͊6*ثb͊6**6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeb͊6*ثb͊6*ثb͊6*ثb͊6*Uxb]+v^(vQ]vlUٱWf].͊6(vlUٱWf]vc(ƜUXHKLUت`Hv<*Pثb͊]1WcWf]vX8b RPثRUٱCb͊];6*vV*cCb͊)v(1K4ؤ}0+vV*ث*vV*챊 Y ŋ'(cqWf82qWcN(v0WfT.Y;1WeĦ vX].늻1Wf]vcqWc(vlU.qWf]v1CAva]bCv!(Cba*ACWeUشX;8cvlU؁E.ˮ*ثbI]ثb͊/vlUXvd8SNŋEY;0+Wbo]bf]6*ثv4ӊ]1WcqWebeUXW;+v4cO\UኻHv)]aWcWf*glU٭>*n+ȖkO\}VW"e*ثWebˮ4SN̈́1vSaC&cqKW"f)vUqvX8.\*4cN(v1C1.C\!حr%u.͊f®.\U`p8٫\)v^(vjWf®͊6vlUف]] 6)v^,]e;5qWeaWe‡f1]vQͅ]]v]0+Jث`We;*늻5qWeaK٫/ 6(vl va];6*UٱWf]v^6`Sq Alt:_` v(qW$qh^#='bf(rkǍJu_2-l;4Pũ KipHaWmq3;`#6G$~*3[HqvPH>~i=(3US*YɸUTZfuo NC|Gfudծ$,-IٻÒr[#+)qD3(̫}Ԋ~F-~%S4ZR&Wc)}O6ܵ$GX|CG l /\Pbɿ?#EC%iilIۮ =LׇDdW_kIO>ӄRuȰE.*QqKL8iûn Ip]cJퟞG/<qBUٰ3IzB|ݾCPgr0r-avlUٱWf]vlUٱWe;6*Rثbʮ*]v^)vlUٱWe]6*ث1Wfb͊6*ٰb͊6*ثث6*UٱWf]va6*ثb͊/;(be͊vlRثWf]1Wf]xٱWf-f]v^(vlUٱWf]vlRءٱWf]vlUٱWeLU?ޙ>xO6͊6*ثb͊6*ث*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*ثb͊6*ثb͊6*ثbLUن*ثb͊6*UٱWf(vlUٱWf]vQ]];6*ثb͊6*vQ]8Wbbbv)p%ÒCWf͊6)vX]]vlUن*U]vlUX]vlUٱWf]8͊6*^;=1K4ؤ}0vQ®]vZqWebeR2Oqge\P]1bIeb8UُLUؙ]8GvaLR#]Iŋ)v;vX]LUኻ6*ثU]8ن)v9qWcWeb]v&ءa(bQtqUؔƮ(vf銻\PUkbxb>*@cv*n?G"YZz]G*'" *٫Ӳvl U٫abǦIؓbӊ]\CvlUٰ+WWf*]N(cbqCxd..zbQ1dW)r]٫\U٫] ]]u]Wv]qCWevV6eͅ]]]vj1Wf])ٱKWv]qWf;5pW ]\v]qWf®͊6*v^*]vl6\PثaWf.͊/Wf(vbqHvaxR(vl ثaWev5 F7 | .nEX3D4ɿZ">o14/w d: $> F-Ѽ:`"f;{֚wËm-VMkΚ%4[j6vy|uǎ^q2dpڪE.5sa)e3Z*in@٢I2Cmʑ\ם`'Pyn#ڙ|Am+L`$3\Zԗ>x|sJ[ӧPѲՇjjO&˒MGIO&v*bCq9dY Ÿ6lpU~X֟< w!_0}dKic:v*D8i~$$.Um#r%2U~V(v]p^/' 3t,K2>ӑ~UٱWf8bf.bf4v*ثWf(vlUن)v^*إٱWeLPإٱCbf]6vlU͊6*UUX UXb]b]/vV*ث늻6*ثWf]vV*v^*ثb͊/v;vV*ثWf]vlUٱWeeb]vlUٱWf]vlUٱWeUٱWf]]S灪\.͊6*ثb͊6*ث*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6*ثb͊6*ثb͊6*ثb͊6*ثbqWeb]6*ءٱWf]vlUXXٱWf]vlUٱWf8vQ]bv)c%.Ɯ(v7vlPإٱWeUUٱWf]b]xٱWf8XWf]vlUٱWf8*cbCb͊)v*zb\Xc]Web͊,bqWebeR1zY*.bN7]qWcqClUPa]1WbHv'c*Uؔ$`SeURp],b͊6*ث8xɊ]]UٱWf86](v4b{be.*L v99:bƌPv|Pn*î*^3]beUٱWcv zcv=N"U]!+N[&A . |*g#r Je8~lUXR w`b[ Lȵs UٱWe͊.ٱWf/vV*ثSv^*ثbf]v^*ءٱKbf8ٱWf]vX]vlUxWeUXb́]0Wf®LUٱWebb͊6*ثb1Wf]bvlUٱWe͊6*P쳊]+v^*ثbbf.͊b͊5qWe͊6*ثb͊/*UٱK-2|4Kcf]vlUٱWf]vlU*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUXb͊6*ثb͊6*ثb͊6*ثb͊6*vP]vlUٱCb͊6*죊+vlRثbf]vcqWeUXXKH]8+ ;6*إcv;vlUٱWeUc,b͊1.f͊6*ثbqWeUÊ͊6*Z;=1d .,KtpWf]:8c 49qR['](8؛bP죊0늻N CxdP`KbbSd][,]1Wc. Ux*ثbqWc[v'k1]vcn6^C]*. q®銻1C*X Uش}qKs0]1W`secv^*ثb>*`njRp]*UٱWf]vlU]:űK4*_aqӬIWc[;I;&Qy,8 ,A&ڒ\`~P7d|%LT-,bS r, /)qHv*8wmd=9bS(Xf/S冞f?̡ϱnlUن(v^*Rv*졊1]1KKb͊6*;/6*ءٱKbf.͊6*ثb͊6*UٱWf]v^*UX+ UٰWeSv^*ثb͊6*ثWebLUxWe͊6*ثWe]/vlUثbf];6*UٱWf]vlUٱWf.͊6(vX]vEu?OͱqCb͊6*ثb͊6**6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*ثWeb͊6*ثb͊6*ثb͊6*ثb͊6*ثWf͊6*ثb.͊6(vV*ثb͊1]+vV*VU I%p18٫*W 5p!x0l(v1;NEvbr)vUpW1¡ى\UD튻$;+v^*ˮe$QzbN[. 6*w, ܱWe/ WeJˮv`paWe..-ٱK]v]qCaWe+WWfv^vl*ثWff—f]\Pءu®1Wf*paWe`WeWe'v^va]/%j60Wf]ٱCWfUٱC**m=ڒ#3xNBOs~<|[%I[X7|=}>Ey(PPdmW1,RS26\^eXI4M*+hzhnzx>&O\D@YRS%IumF:S!)OhzbX Pl;} Ħ1 (_vVv ?ޅU; |,L9ܬPإٱCbن(vlRءٱKWf.͊6*튻/.͊6*ثb́] 6*ثb͊/vV*Ugvc+vlU٫6*ثb8Wf]vlUٱWf]Web͊/va+v^*ثb͊. U}Web]v^*nثb1Wf]6*إٱWf͊];6)vlUٱCb\U?ޙ>xͱqbثb͊6*ثb͊?*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeb]vlUٱWf]6*ثb͊6*ثb͊6*ثWf];6*ثb͊(UXٱWf͊6*ثWeUXXbcK׮ũ.ƶ;];6*إUٱWe͊,b͊1KCb͊(f͊6*ثbqWeUÊqCWf]bd 6,Kt]]1WfqWe*n*ث~8Ivv%&*]8C]9]>8Ucv)`ؠ]v%.I͋e U]We͊6*ثqWbx.b Uَ*vclU؛bf\U2``KUؔv'v"ءUUؼXر%cvlUMv~ن(v8bc*죊6*k(v8b Rp]6*ثb͊ث.*[)v;*\bRث90,,]vlR/,bpӊ]vX.;]vV)vc]pGv7 v+S]\1WezbLPN/>xv7ak`}K$' ɼUf!ٱCWep;dc$Á.dWcII\*ܱWerJqRWcI!*n*RP].$;^v"NAvj.\ nˮ+nˮ*f]\T;/)v]qv^;5qWe,U`;, v^*ثK(v]qWf]\ ٫/vlUٱWe\UٱbU٫KdPqWf®—e;6vc+Wv^v`qWeWeUَH+"+ف͊,aCWebe4WdKZRߕ?F.\()йlI#HK7\Г{P ahi79 }n:h6޿c`j5)XNfE`6*ثaWf]d`3# e5x\R'=si#ucmGV>9fC%܁ N{3" \6.)N#v(v4u](7x8!/O&2m GJ|o{TmEuﶿ,}8Dr J+)qPQ1W`qJӇvѓdT=?aY628r,G;6)vlUٱCbeUxb͊6*إٱCbf͊]6*ٰbff‡f]vlRثWf]v^*Ut]1Wf]v^*ث*͊/vlUٱWf]+vlUxb͊+v^*ثb͊7*UٱWe].bf.͊6)vQ]6*ثb͊6*ثb͊mS灤0.(vlUٱWf]vlUٱWf]*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6*ثb͊6*ثb͊+vj͊vlUٱWebeb˦(vV*ثbqWeb8Wb.^`qWc[v7 6(vlUٱK*v*ثbb RPثRPRPثb͊6*UGv5Wc(vV*ثXKa]٠C 6*챊-WcqWeU7M?Őqoz`IvNeKGvUqC*MWc(v7|UkL  'b6*NL +uŋbኻ,b͊6*v0bc)v]qWc*va1]6*MC&*SvP.1~!.gĻ1Wc[v$ءUኻ8cvX]ث;.]v1Wc(v8bc*p]6*ثbqWc[vd]|P];v;"f]~$;ŋb\R/,vcӊ8bx;.͊6*P8BD!إr v=rA]UxC؜{8b0vi#"[%/la2o(Up;5q*U٫x U酁v5;8 ]N'N*)vj͊6*v4*죅We ]bc$Ļ\U؎Eٱ6*ݚ٫, e5q[v]qK`C͊.aR,Pe08*챊08늻,QNˮ;6vjWe6v^*UٱWe;5qWf®\v^*ثa.늻6v`qWeنv^vl!]0vc]aWeWf®͊5qbP''Mei v1զǒz9  b(|o]F-aթ 5T1ڛ—f]6v kDkbrHD6cq4ɶ:Obp;R1s"BD`_Ӑ$ʅyiZqn<[Ip/ lOXʃdӿ17l.1N&]lv(v0`K[\|qe-}93;eZ}( CO\ ڴȦ呓\`QYv(R*ݷAdv>X]l9{"1_v^* }?,17\K2fV*ءٱKbeRv^*Uxbf(f]vlUٱKb͊6*U٫5qWef͊]1Wf]v^*ثWeb͊+vlUٱWf]vlUx Uxb͊6*ثb]/vlUٱWfb]b͊/vQ]1Web]vlUإٺf'/;6*6*ثb͊6*ثb͊"ڧ'AٱWf]vlUٱWf]v*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*ثb͊6*ثb͊(f]vlUٱWeSvlUٱWf]6*ثb8*졊^ vZŗ*kbWfٱWf.*UٱWeUٱWc)v^(vlUٱWebcqCb͊6*ثb8WcN*a]v+\RXt`y*CGRn(vlUcv9Wc1WeU3N?,/z6|,Lv'U8ęN*e1CbCDcN+]HP]o*pSv]1We7U٩(U1Wc*銻v>] UdbĜbĘbfA8U*!Q. ]N61C1Wb ]hb,bSvQ F(. U1Wev]1Wf*cUؘ]v8bv^(vlRb8ӊnإ|P](v.1dvv^~$bXvlSNLRP.*.ƜUن*챊/ 켊]qWeb͊qWcN*(vZ#PdY;4;Wf=1Wbk;_>xpv܌l#r~xdQʦ6ʦWfvjcj6mǎCkd;pnƜ)v7vj͊\U٫6)vV;qCن* v^*Uآ c;nmWeKWv]qM66 [vlVݛ..ˮ)v_,v86vbrLӱvX8Vݗ\*up%ٱWf].ˮ,iufiٲIva0+ ثbU٫5qK(vmWfUنvl +W /vXƕٰbPUG / 6*)x%~hVZ܄nC Iܱ6v6ٱWf]."90A]rPn<{~dtl(v&'\P`](ǶN, {&cjIsZ K[J/O9 吓}[A+0.Sv Zp۠3Yp],%({o~y`S(_,`_(Rq,ʆ29`͊7\PإٱCKb]vlUٱWeb]vc0]6*ثb]6*UٱWf.͊6*]\UXb1We]vlUٱWe]5qWf*]6*ثb͊6*ثb];,bf]vlUٱWe͊0]6*ثYWf]*]\UٱWf]6*ثb͊1K+2|4m vlUٱWf]vlUٱWg*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeb͊6*ثb͊6*ثbʮ*ثbf]vlUٱWcqKb]vlUٱWeUGv7*]zbc-qWbvSbf;6(vlUٱK*챊/vlUcv^)v^(v^*ثb].͊vlUٱWf]ƜUӊqCWf]0%؄bpP]v3vlUc*sbb͊ib8ϳ%^pؖ(vj'v4Pc*LC]\RQ0Y;劻7,*NFe] vXlUaWe.[;N*i8vX8Wvb]*M8hqWc.\ME.z؜Q %8NqWb ]X\R]1K̂ bba(v8H1Wev_1Wf1Wc!Wv8H1Wc)ef渫E]\U늻(fVZb`iAv%\P1dxe]qWcv%qCr\U|vnK7%]qWe1Wc;0]bcԮ*p+]xqWeQq[vj.(v11CSlU`An"l*챊/vQqWc;v*2Y4DK[*C!lagգž&DDžxxŽ'e}U1ODDžoSe}Yq[Hv44좴L];JIfF M/O}\cKnaݗe¶U۲1v4 imƷiq۲ݛKnq۲-20vX]v>\=XȥrܨpqsG߂g;+!7ý޲x'0O;/? +zew9wO {많oLjǽUZБ܍mшTӁ5 J3MȧĿ,Q>"'|N8bbÉJӇvIB˂~a)PG0XU;F? W?`̽q-CMEfb͊];,be͊6*ثb͊6*ثb͊]e͊6*ث UٱWf.͊.We],b]6vlUٱWf]vlUٱWevV*챊/vlUٱWf]va6*UٱWf]vlUٱWe\Ugv^*Uxbf[͊o6k6*UٱWe͊6*ثbf͊]vEOOͱqCb͊6*ثb͊6**6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*ثb͊6*ثb8C*ثb͊+vV)vlUٱWf͊6*ثWeUUغ.`K׮*Xbe6!aWf͊6)vX]1We͊/vX.Cb]+;+vlUٱWf]vcqWc[v0eb͊)v/.%?%!v'vX늻1Wc1Wf] t>Y /|Xv2p1RHeF*)v&1bI](v9F)v=0(v TbذQ]bĤAW. 1WcU/]]vbv4*i\PM*r] ]e]**IJe.]J,C]؂Pl9]H4,#.+N0VLD1C,Vezv_1Wc(1C%:c8; iپ1M;/fiپ1Zv4vQfX]p.J1SV*CvocۜQNĽӲqZvoVfiW8;1iU¸ٸN*pe]qZv_f6ӲثiٽibcJ0CbD {ʝT+늻1Wev&ؑc犻 $yt2rZ-qAla) olׅ_SG >6eRov4˅ibQӳz2xޛ|O|U؛c(N(vW=1Wezo0OVӓfiٽ9|qZvn좲bc,\d]*|Ut|U;P]MKQ%ڏ3p$%<$}G$EGo[Qi>_/>_YԿOQpZԿx.<3K+p+뺗kq]Lxp_Kljk }wgľo 6w!S>6Ϗ|3f%;ľk zn}5/lx>n+Ƥ?i_ x ߦ!Mx\}ٿMj?.%>nc1ļ}?vn<2NjC?xܝt>mE~rw+nM}Y<1w canNxeGeEV0u'}Y<36^canNxfmQcanNxc~l-UO ͗#pA,~X[⻿v6rwgn6$%I-Uqw_26_ULyE a- dn$YwՓ2FFlɏ>f0]dǏ2Exl$'"|150XE*0T^gtBY7ob!dfB߫8麨O.Y9Sl۩뉟3M[ xߠfArw"]U9d#@ I-ɕ]()s/h#ABT|Ҵ?r>N1bol,]vya=>ظpbIv ]͊,u]nbVb;܏ȸat#ŃT,]ʦ*c Tq;1Kˁ]遘v,)v]0؜ \bCv8b.]1We8v7;v|5weƝ6݉/_aǁ(-h`}x_~}݃xӨO&Οݏ HOcDZ< +?q}~7{?ǀ__,icֿv>xBH}hj_c]Bo0Ѭk`^7Fo1ѬkO__ g_\u  pѬkcӨO5~<!?4Kv1.:?Y,k+g2c1k?Ж__e1׍Q+% >8%.awQ[l2 i< Kt{cߤ%m*AF[k{)H-Fڣ^8o#XR:= xa|-`[^nqJQ]z =Zi(-RNZu0}ETDz"msd (v" 7\B0+@~ i %Cm$C|bՐ @jKH8 Fj |kcqb Q0*Rûo2l\ybRm#r beb͊hBU; <̨ic#"vjf.͊vlUt.͊]vUqWf]+v^)vlPثbf];6*UٱKb́]]vV*Uن*ثb͊6*U٩7lUXWebbʦ*ثWf]vlPإن*ث UxbqWeU٫6(v8bf]]]]qKWf͊Z͊6*ثb͊6*إٱWf͊6*jL< 'cf]vlUٱWf]vlU*6*ثb͊6*ثb'cWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUXWeb͊6*ثbLUXbf]vlUٱWf]vQ]6*ثUӊ+*\t.e*]z`KWbxPثbf.]]va/vX.Cb͊(ebeb͊6*ثbf8ӊث;/v>.ظ.Ĥ‡b+GLB]*ث.*P]͊x1d7dȸat?kʸKvV*ث C*`]C)N* q`vX.]1WeUx*cUPd늻\Rp]bqWb/8vX].lU6;8؅ʼnvQ\P:b(va1Wbu]F,.ǁ]*JAS;v:]qWbRK:`.*p.]51Wf#vQ1Cv<.."œQ])v' i,b˦*ثbƜRcb؋bآbb1Kv;.ʦ*U]>(vR88( Y;bbcWev](v'': 7aӐ-&~x0-qV]vbqWcH]#7®Ĝb`iqAv.EUv(*pbev`1Wev&;qvX.8؄pqC_zG`2pOEɶ z3S.cኴo7OxSᒥl^WՏ4ů!Vһ-O4Sᆖ}y|rcC l^'X>ѼOlGlUz#7Տ*ﭨS]c!v63'bcv#\PuqWfv]qWf*]cN(v"qWebcbqK]\UXEWf*cU؛P8vF Y;1Av3v;vQ](v''QatYav~y4جc- K[e]]]d]2 UbfL(v1v$ <.آRU[1Wcݎ U|)voS;,1K7bb.-6*w,U|We (.ָayr@ Rv@M!ѭENcekQ֢\4 |rMEۿ@M^i=7f5[_鿛7fl1ckm~M\+ml1k=7f3¶ e^,&@GW AMٿLB1E36_xAN;:XmmЧrJņoטtCBlҰhߥai xӪÊcF^oҐqѧsVV49_›o4'/X-Os~{9JB:mߡ|NoҐaq8i7>9_ 6{A+kC'n|s~i7#Xm&,jpa["u(q nU7lx-?rƥB_nG|ߤ m~9IA&,jV8:EcN]*+N:UN ;M\66w#7q^'~B gM:8]5 s~b)u67M>㾿o-:m'\"))ix/>žo8ߣn2HAmL5 6ѷcc+~/^' >0ZtxOcu x,^۞^&uPx^'}RvIq0ڬVK)n^۞c1EJ{eSkew,nGԌ0+ ~pr;RRy#߭saq&Q]8n)F>fbM9khK#}8myRkC`2c+qLkY-e?|?N q늻LRlRûn&^ŒS1e`Wf]o~xB\v~Xa^eGMȵ銻6)v_lPRثWebv^)vlUَ*UT]6*ثbf]vlUٱWf]6*v^*ثb͊6*ثb͊6*]]1We]6*ثWe]bU]1];7|R]LUَ*]v;vV*Rثbbbf͊];/vV*UٱWf]vlUن*ث*L< 'cf]vlUٱWf]vlU*6*ثb͊6*ثb'cWf]+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUXb͊6*ث*ءٱKbf]vlUXWf]'v7*]zbc)qWb]ث$;6(vlUٱK*챊/v^*ث)vX]vlUX)vV(vlUٱWf]vQ]((vV*ثKq.dć\v Nv5HvP]: 0<6N008ۍ0p8-mRoulv%waUcmTfhS[# З7_ބmx¶ ,_>w'?φzvw˛> C ?1Wzr.ZI rP܄pa[/ 1E \mKop*jIb$Z7 g)vu$ uҖٽ)s]ldh;MG ɱv$ `IWeƽC΂F.X%ȡ P0ɆI.kLKW}$i)weep}*c*Q1KTiûn&_}IJQr;} 1P+6* ¡Ja~%QӾGFE5qCb͊/+vlUxWeb]vlUٱWf..1We͊6*Uxb]vV*ث1Wf]vY]6*n*챊+v;vlUXWf]v^*UٱCKWvlPإٱWeʮ*UٱWevj1WfWf]6(k6*إxٱWf8b͊6)vlUٱCbf]1C+2|4˛cf]vlUٱWf]vlU*6*ثb͊6*ثb'cWe͊+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUXb͊6*ث*ثb͊vlUٱWeRPثUӊ+v.0eR]/L vSbdٰb]1We]vX.Cb͊(f͊6*ثbqWcN*죊8Ux. ]Ip!غaWfq.f͊6*^ca8.¡O(vlP죊(ƶ*IC1Wet"< v;vlU ?\P졊1WcWeUٱWf]vSbƜUPp.njUxUن*Ǧ*ACˊ1We.ty..:,K&)v"qCb U.)v=qWcWf8؛Af]b>*Lbc)v]p%xثbf.\UDƜ(.̽qCBœ)b`u")vQv'\X5qWf]6*R(vQ]pXbe.8;+1ʮvlPͅ8va"[HpbPv*ث%1R,,݇?g,ɱBMyP8UU]*8.v9[Cv8;0sӲC)ٽC4൧fN7ӳ SF֝7+N [+xQN귉~x+N Ӳfi~x N귎+N[S N6ޫxkN귎+Nf[ ӳz㍭:qSpZөo6u2fNhJ"̭4Lَ7%P T-FyXF~&.:A֑35b m cjy?sm&;coֹIdUP8tBqW`aaHvHd0--|ra!%V5InȖ_@)b⋊LR)Zpߠ$!%W`|Q~y`S +b/ҿ<]v~Xan̨c#R/,b͊+vlUٱWf]vX]b]vlUٱWf]vlUٱWf.];6)vlUٱWf]6*ثb޸b͊/vV*v*Uxb]6*Uxb1Wf]v^*UٱWe͊/vV*ثWf]vlUxb]/v^*V*UCvc/vlUٱWf]vlRءٱK-2|4m vlUٱWf]vlUٱWg*6*ثb͊6*ثbœWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUXb͊6*ثUXbf]vlUٱWebebf]ƜUt逤;]pu.lUؙ‡f̈́+aWeUUٱWe1K*챊/vlPث)vV*Pثb͊6*v483]ظ늻^غaWc ]͊?a?,YaPbsbvV*vQ]lUؓPn*p늻L x`KUٰ+rJ]cF*p]1Wc*ثb͊(ƜUPp.njUxUن*Ǧ*EC9#o#+}Q|"ԣZvwtRs9dr.RD`1meK1V6ehYIhKxrN3%ʦ*c (vp!Vwq@v[)ᅛAb~/Ld=j{%SGMu+k%#sp}%DLLdUQp+D—`qKG-&IJQ~y`S +b. JfXeGMȰE];6)vlUٱWf]vX]6*ثb]6*ثbf]v]1CbeS;/]aWe͊6*ثb͊6*Uxbb]+v^*ثb͊6*ثbLUxWevlUٱWf]vlU٩/vlUٱWf]v;vlUUt]Z0b]vlUٱWf.͊vlRثbd[Tzdi<;6*ثb͊6*ثb*6*ثb͊6*ثbœ6*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*ثb͊1]6(vlUٱWf]qWeb͊6*i]]A;p%k\)vQd쬊6vl*챊,bWf]1K*Pثb8XCb͊6*ثUӊ((v7v^*rbb)v&MzWbɊ]nU؞;*]6*ثX>.iřvv'7LPqbإXَ*cě;-z !!:`d*؛.aC]1WeUኻ6*إٱCU] Rx]LUٱWf*Ibbx늻7|RL!]v‚MqCbb8*x]\U v9qWc(>(.;0W5qC𫱏v';C v^)v^(v^*ثbePi‡f^غbzbqCuȲv;]. bxPثb.́]6*죅Ɯ(vV*/]CKb͊vV(vl(v7;,bǦ*쳑fAR_ ]v":cfKt?d|dZ9l 6?PG' E%i1vl* (vV*Uٰ+]ئL5c$P]9&.'.ʮ*ثb\P]6*ثb͊6*ث.Wv"N*]͊6*ثb͊6*ثb͊6*ثb͊6*͊]5qWf)v:f.ˮ)e5p+2vlf*q[v]qKE]vX8ˮ)vX8Uu]\U`Wefv]p(vX\**챊/v^;6/..0b ®ˮvV/;,`Wf]$ (xUٱWe y^дrN> fGQ MZ&o'( >,}1qsd;*ƜF`.24cuFgJa#k'4C92WsYs}E Es.+#L i)c(v"aAItEmX0~zq^E̯hzr#~1P[\UآWb.Pb-&IJ 6NGo<qBUٱW`_*uazY7ds"b͊6*ثWf]vX]vlUٱWf]vlRثb͊/vlP]6vl*ثWf]vlUٱWf]*UXb]6*UUٱWf]vlUٱWf]v^*ثb͊6*ثb͊,b͊+v^vl*ثثb]v^*죊/vlUٱWf]vlRثb͊vEOOsl`\X6*ثb͊6*ثb*6*ثb͊6*ثb'bb]+vV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWf]vlUَ*UٱWf͊6*ثbqWcN*졊N ]8i]/LR]!Xٰb*Uxbcv^(vlUٱWeRءG+;6*ثbqWcN*죊8Ux^`WbI\*q®ƜUUٱWf]v)o.b̻ O\X;6(v8vj]v1WbDbcqWe* L v^vl M`w;C Uኻ/vX]vlUٱWf86]]WeWv^*]6(v%\UUٻ``)ǜB]tP](v6LPGv8b U1WbN.)v;/|!K녋 vX]]|U؟|P~)vXf.]vlUR,]z'LP](v, 'c)œ<*e͊/]6*n;(‡fxإٱWf]vV(vlUٰP챊͑f.P챊/v":cf튗`>b;~cl 6+v#.\R[8ٰvV*]]\ R]!pl0̀$`죊vlUٱWf]vlUٱWf]vlUٱWc]qRn(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v]qWfن*e5qK6qK%ف.f͊].xu]*p8]\*챊/](v^*;/v]pb`*ثW /e͊1WeWfvjev^;6vlUxG RUؤ+~ 4CG+; 9 #>"9,X98 CC?Qa>po~G&iOe>>Hzos.+#́]v1xݰeU1 ^gG"Sp+aAv9p%آWc ]+Nt,d߰>X9`S Wf/ҿ<*u|k̨c#vV(vX.͊6*UXثb͊+v^*إٱCbf͊]be͊]vl ثaWe͊+v^*ث`Wf®]6*v*UXثb͊6*ثWf]vlUٱWf]vj͊/vV*Uu]vlUٱWf͊/ 7lUٱWf]6*ثb͊6*إٱWf];6)vlU?ޙ>xeͱqbثb͊6*ثb͊?*6*ثb͊6*ثb'bb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]vlUٱWf]vV*ءٱWf]qWeb͊1]8Wbɀǜ vZu)v5PUٱWf]1Wc*ثWf]1K*Pثb8ٱWcqWe͊6*v483]-zb. &E].*쳒Wc*UٱWf]1Wc>xnы2)ocfcqCb͊#]^t;&.8JL!C]LUUcvlUu]1]*P챊]]vlUcvSt]7LPOv9qWcWf]Hv(p%؜£ %‡bob UU1Wbb!]p+Rpvl v^*Pث]b;,`KCWe͊(eUG f'LY;*NزK'c%َ,%؝pcvlPثbvX]]8PiKaCbfef]vlUXٰCCbǯ\Umv)\TaC*U؈*]-;n dZlZ~G'.C\o\,]\(f(f*]0%x;p%ز t ]X6*ثb͊6*ثb͊6*ثb͊\RTu]?\TvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUu]]W//emxvjWedٱK.ˮ*vvj]*RWe,U`We]\*(vX\*p8xbe ];6(v]pxPUxc6v^v^v4AvX—ec;tቢ8ƺƵr9 R7͠()P)JaDZe9oǚde}R V&!X|rn+#r*죊51Wevjb]vc폖%.v(.إiû~&!%7 bRk9} 1#e`Wf]O~xBv,07\K2wÑ`1Wf͊]vX]͊/vlUٱWf]vjb͊]bef͊+vX]b.]6*U٩6*UٱWf]v^*Uxb]b͊6*ث/vlUٱWf]vjb͊/vV*ثSvlUٱWf]v^*ثb8WebZ͊6*UXWf]6*ثbf]vEOOͱqCb͊6*ثb͊6**6*ثb͊6*ثbœb͊6*ثb]/vV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]vlUٱWf8Wf];6*죊6*Uَ*i]]Ȥ;F)vZWbNlPa‡e`Wf+bٰWf.*PثbqKCWf.͊6*v483]1We\Uظ.Ɂ]*Up+I]8Wf]v^*ru.Ó} [a`dءP죊+;6*c(v3v91Kt02v^vlv%& pvX]xWf]vlUَ*MWe Pp. Ut]1Web&*~*KD]0A]m 0؛bxˊ1Wc)v,)v91P~,Wbo)v pva.Wfƶv';C%xWf]vc]qC;(u]#]~wņC,cv'͊,UٱWf]6vQ8Pi®͊0ef]vV(vl*PPثb.*s`f*]pcv^*Du8zb. ;ю̀EaG"ː ͼnvjݍ(vj\P]Ac rR]qb]'LX`f]8X;+;6*ثb͊6*ثb͊6*ثb͊)v)bc1Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUxbe͊]\Rثŕ'fJeffv8RUxc*Rث]\U`Kˮ* UxWeWe͊vX—f6eWc+ Uٰ`CAv8beͅ]vlvX¥3Jn71 Y(VSɓrcVh32+b]b]vlUَ*Bo>Xآآb`qJӇvM\}O#wr Je8vVvX®'ҿ>Q]7]f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v]qWf*qKbe])vlY;]bxث`K%qWfvX.vl)v8Ux]0%qCDN02`?iNzb1-b:VφX1AR46cs`ɴDW- ]@ W XI o  4J5ѼN;HeZh4xbxvP]/vV*ث UٱWe͊6*UXb͊~> [Ww⫳SvV*챊0]6*UٱWf+nqWf]6*إثUxٱWf]vlUٱWf]vlUcvEuOOsl`\X6*ثb͊6*ثb*6*ثb͊6*ثb>bUXb͊6*ثb͊6*ثWf](]LUٱWeb͊,bLUٱWeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*UٱWf]vV*ثb͊qWeb͊1]8WbtYb.A/LY;)C$;+6vlUcv8`WeWf]vX.We];(eUٱWebf]vcqWeUb]e]L Iب.®Ɯ(v7v^*ثb T;#?, –XX;*n0vcqWebN(v0G.NӦNWvcJrH.wŋ RuqWeUٱWf]vclUن*x]\UٱWf]1We6*E(v%LU㊻,u.1Yc*v":abFLPLbثv,gN] RWc$K;abˀUٱWf]nPg|Pq—e.\ v^(vlRءٱWeWed]`Chbov( vE!G 'c,KPثb͊]vlUٱWePi‚ءٰ%ٱKKWfͅ];(͊6*늻c]F*챊/v":(vi~*g1d:?Si]ٿ8p[87ٱWf͊+vjb pȳv.1.qHvaRO f]vlUٱWf]vlUٱWf]vlUٱWf]*W0qWbXٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUu]/6*uqdvjM,`dRٱKWe ]2*Uxp+K]1We֘ғNF޽9ݻ  v7c(9 CmLng4Jջ-Kdž]v xe$d9ÖG'\7t2fiN;!Aa]Trkc1l9aH™>3T| v:Tc.cǓEpSM7LB{I9{7!y7޻aɥn<2r^#W0zRDEØWf*죁.%. 쬒5qWf®^Gy ?C΁q_Lt1 詷g<9cr+b͊6*ثb͊폖(.Ǯ)v(آaK\8i~, A˂/bY+^[ǀN(] Ua w|wY3d#2;6)vlUxb͊6*ثb͊6*ثb͊]/5qCbf͊6)vlUxWvlUن*ثb͊,b1WeŬĂ5U8E{`RHތgq?T2M+U\ث6*ثb͊51WevlP`Kv®͊fFIiFP7?<%y)Bc!߫ƀ p1 bP 3 1UGo/vlUXSv^*Uck6*vc]1Wf͊]vlPثb͊6*jL< 'cf]vlUٱWf]vlU*6*ثb͊6*ثb>bUXb͊6*ثb͊6*UٱWe͊6*ثb͊6*ثb͊/vlUٱWe͊6*UXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*UٱWf*ءَ)vV*ءG+;6*v48XAءe(v.1Kv0CWf] ,b`WeWf]vX.ثbebf8GvV(vlUٱWf]ƜUX],bŗ..Nظf+;/vc/vX튻 !űVkzb`s(v&I$ƒqWcc*U`.W.Nv#)Ļ;*e ]]TƓqCbbf]|UU8qWf'v&؞*Q*v*v Nv^Wv&qC 1C1,bbǯ\Uس}Y;ب.ˮ*NC8va.٫5qWeUUٱKWv^+n]fmGvV(vae|R]آx).W[v$[v2QnL n˦f+nLVݗLƖݘ+nƑ51C.t›vn8q]LPqWeF*U1Wbk!҇®Wb#fؽ;~flrx \iF#1]+}T⍝Cvo+A_U8eTbKv;13 496c};7qvo@kރckށNm4;b# 8]PQN+NӳzgeP1Wf b#ޓckޓckޓckޓckޓckޓckޓckދckދckދbf[^f[^fvoA^e ;7دzvoAO}]p/;7vo@fx]v_+쿫mxC}\kAٽh;/voDiv_q[voG۲#۳z'voK'b,ixƗ4WٽmOy1x~~,ȫ銻/vlUٱWf]v!7,(. v*HKTi~ 9pM,K iFALG.\UٱWa/T/??,o-7X#2*]+v^*죊/vlUٱWf*ثb͊,bvjeثbf͊]+vX]TS+vlUٱWf]v^*] 6fMɁKOjUXN1.n`k{׮-#t,ڌ0Ȱ;Q /eh{`B+* UٱWevlPbfvjbbʦ*lUa W*Qcu"y\zb񎘕h8(]o07 eFu>'`Bn*챊/k*yWe͊Z͊vlUٱWeUٱWf.͊6*ثbe͊"'IٱWf]vlUٱWf]v*6*ثb͊6*ثb>bU٩6*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeb]]/vU1Wf8Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6*ثb͊1]]6(vcqWcqWb`,-1WbqWc;+vl*ثWc*챊];6*챊]]6)vlUXGvQ]Cb͊1]]qWc;/vX]/A]L E~v.1KqCWe1KbX?,YacX(4\X51WeSvQ6*i]'bʸ;/(vb aAv#|X1Wev8]qWevU1We]8Cv< RN*8SvjUEN*M(v3v=1WcWe]Pm]C51Wb';1WeUU.ۦ)v2>;)v^ W`b7ŋ)v8WvjU٩1Wc1Cv]1K¾qWevc\UDbƑ1WbɊ]|R zجxؠWbo͊6*]va/vV*죊qWeUcv^*쿣51Wf1Webf]qWcH]*ybb!د|Uxኻ/v":Pt]Y!w["aX]پU٨<1Wf. xbemኻ(U٩۲]a(vU1Wf*.LU٩.)] 51We;bcqWf].SvU1Wb!#cL|1vnk႗ٹ^'e_ "cHvW۲EƖݛ_ i9)I[co)bg<{kQj< ?~AU~y&b[s:Jƀ yl[(MӾL"]~DzjbLUٱWf;,bf8]vlUثJӒ8rx:;dHA\qoz? ﮍԦB)2$!DM;Qp%P*d b So*|B/  I0!vlUثYVWf*UٱVVVb͊/vlRثb͊6*ثb͊"ڧ'AٱWf]vlUٱWf]v*6*ثb͊6*ثb>bUٱWf*죊6*ثb͊6*ثb͊6*ثbʦ*UٱWf]vlUٱWf]6*UٱWeUXb͊/vlUXb͊6*ثb͊6*ثb͊6*ثb͊6*]vlUٱWf]6*ثUٱWeb͊(͊1]8xAأ`WfNq]8UPڻ6v^*p]aKbeRv*UٱKb8*ءٱWeb͊1]8],bŗ)vi0%؀X1K;p*PiobrvŃbg,]vQ]*cbc1WcKq]LY;.x F;0.˦*p, Ut]zb*bǁ/vjbLUٱWf8'#\UU}K\clY;LUGvlX|P`]1Wc*r`M;(œbH1W`wvXv^*]6]wT R}*b /)vjbLUD U(vPv(4.,]1K`1KqWbn*FaqWcUٸA.vj U\UÊ*ثb.ˠ]vj UEF*F*abc)*y8جŜS+vX]N(v[.,;dK0aOEm' c}1)^i^iٌcS! UF1ӱ(v5S%ؑv8.)v]*w, ]Rޘ];);eؓ(ŒU|F**c1Rn(v-hpsCᒦv_ƑNo&\G+cKNƵxcHv4Z'4vbUٱWf]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]]vU1Wf]va51Wf*ثb]vlUٱWf]vlUٱWf]vlUٱWf]vV*ثb͊6*ثWf1KWeb͊(͊1]8Wb,Fȫ&^M8B]vlUcv;,aKbf]]]6)vlUXGvQ]vV*UٱWcN*n*kbcqWf]1Wb-+Wb]p;,b]b Uglt1lb~*رvlUG;(6*LcN*t}p%ظ. LUGe‚ zcv8bc*].͊(cOLU؞*챊6*ثb]ğv"zcv;v_|RLY;qWevlX|P`]1Wc*zu]v&>(v\Y;;ʼnvlUcv^*죊1WbCd.b Uxxb͊(ƜPb#٤銻7\X\Rv*IWbxcv]1Wf]b͊)Wbm+;6*rc*v*]6*v0ƜU>RRv/'LRn*챊/v#c*}CzG?,4c7SZ\|(]]51Wf8T]8bcv!&,]PRp])v^*v*R쳊6*죊lXlPf*v*UٱWc$KZ*bLUXUؤ2Qi!}Zq+^23A9 "¥/m<[%< CW\y 'O#~af$x`seGZڤ D{qƆU mm٫% vX_ZQl0`Qrahq52[tH &+t4).MKW՘ÔjneG+#UM"$G%h"&Fv؜qFFȐA:צ-1 m*fH` 8DI#&7 Ss_d6ԼuwN )eqy/*RAscqYV*]vXīWf]v!7,PrUqWb]V<, AK/IJ 6NG/l e8~lUن*1ޕСy|g~y)݌X"*v^*ثb͊6*ثWeb1Wf]vlUٱWe]H9P:*q, o6(vlRUٱWcb(hEkVuC|NC.bwB^iQ\+Ai1QaV`UٱWf]4>:E@%eNOJ6^cuBolBȄ&2y(HOO:F !<4f@'q.&ŬfHHebofh9&Dv#h(Adc-q9b%J]鈁]BثSvlUU٩*1Wf]4.[$ V9}>%aTMb&|_X(;d_#+,SʁVqCLSKD7F+M6*Z .ہB$:Jb G6S#[q E8\Ⱦ q,5[vlmŦ%^`")\>s"u#DשʊT]b/vP]b͊/vP]6*ثSv]1Wf*be;7\UXWd[Tzdi<;6*ثb͊6*ثb*6*ثb͊6*ثb>bUٱWf]vV*ثb͊6*ثb͊6*ثb͊6*U٫6*]b͊/vlUٱWf]+vX]+v^*n*ثWeb͊6*ثb͊6*ثb͊6*ثb͊+vlUٱWf]vU1WevlUٱC*RPثUӊd Ɋ]LRkbc0XUٱWf]1Wc+b͊]/vlRثCUXٱKbf](ƜUU͊,bS)v[R@].)v? qCWe1Wc*1a^kŋIGÊ0ŋٱWeU]PUbN v;]p;]vX].͊(cN*f*v?vlUٱWf]1]8]Pzb]#bxN* ]bIC U\RNĎ͋`.njR1W`wŋ*챊/vlU銻&)v;v^*~)vlUXWeUӊ1Wb]&* qbV,RXbcWbo+vlUٱWf]qWbm+;0]ؠ]1Wf*ثWf8qWc\PSqKv/'LR]]Wb=(v9bca֐x~X 0a~C [v7vlUٱWeUG;+v4U،%؎(vX. UU].͊.WeUؓ؋bcqWeUxb]PcsvH2Mf]51Wf+aWfW xU .UWLP­Uٰ+aWeb+\U"uqKY/vQ®6vlUٱWe Uٰ+C]\*2+Wk*Uثb]B]^puvMp2y$b&Z4<3S; Pe6c)v^(vV6;*WvVvhq.z>9GҜNLЭȷZJW:Zh>nl˫"zͼr9&ƅAj0# Hܘ RMF2;6vVv Tv̬8rߎKb:32.Ɛ0'ɼi$9,/"]H[-&3eѝArp浚}A8GE&9iܩ<2l0я ,_QG*V|k:Iu5$1w.ruBO&kqY7vc]6*챊/vlUٱWbĠتC8{o|XR1,S[GN(]/vh?J{|_̩{";/6*ثb͊6*ثb͊1]vlUٱKbe]PB\p0 $*i]\إcvXUt-~Ǩ,D;䘏L ?~LSz6oFuc~Y PTNjF7P3!4B7S0]?-F K*TP Jf=f5a<0c<+uc\JcPo)[EB~Xi. h3\+ ݹSH~,z&,A2鴌B` [ kN!z UxbZvlUxd`ԚbLE{gNt T5̈mc%yg%֥[+d2[IRi]hdHP=i+m{on;D凒 NcGOG/Y`%9}5ݎQB* Pbhg$ؐ>CS8 :X&0:"9aj{BSVfȌ)ɪ0Qf{=*TRh*90>9)m!KLfIfXw#[1]vlUٱK(v^*ثb͊6*U٩+v^*ثb͊6*b]"'IٱWf]vlUٱWf]v*6*ثb͊6*ثb>bUٱWf]vlUXb͊6*ثSvlUٱWf]vlUٱWf]LU٩6*UٱWeUxb͊6*ثWfWf]vV*ثb]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6*ثb͊+vlP죊+vlUَ*i]]CdE]U!zb]9 Xb˦*ثxUٱWf].]6)vlUG;1]6(vU1KUG;qWcqWc[;/vX].l @ŗ 8UUٱWeeR챊 m,ðuqbRO\XqCWeU]6(v7v)bˋ'`.8B.آUx*v)vc(c[v0\UUٱWf]vX]ğv"zcv;v^)v ,]U.6(v7va)v.ě(v)v(1Kb졊/v^*ث;b,be͊6*죊qCWbqK],]NJ] Rp銻|U؞(vX]vlUٱWeUَ*죊lUPv8bbv]qWf]]v5Wc(v3*P}R~v )v4bWb?qCesx~X"a~Y40(]]vlUٱWcqCWcN*i]lP]Ic1Wc)vX].Wf]qWbmb-]1WeU٫.(v|svHFI(vl vjbLBNvUqVU1Wf͊6cp` , ]qWe*ن*]qWfUٰ%ٰb͊6*ثWf]vlUXWf®́]KyXWf]^?h;] Ͷ֡ckR4~Z/C.cpxn/$GJݗQ\p:aB'Ldݳ;p r# ^iC%G8:P?k!:NlU]qW`>>dǔ8n8q4M0R;fdcNB;41rsW#M?jheΟcD G~8tžbŦ1o$KdPd)H\n oaf D5 vqTX!|bgHRj~ٮ(TH[yT߶o:Kز$6qg(ۡ0?z58 ̳b8+WfWf]v!/,P]\RUqWb] +NtFM!6#HQ~y땱)x/v#%~xBPX/k3*ZgC# ֌͊]va6*ثb͊/vV*إٱCbf];/vlU٩߶)usbbӘGq+Ek-վ99GyEqW1IvafVv U tQNJ-Ro,AQy) [DliEsHDkӥk]Fb!Ӕm9~Q@FƀS%ňDdP &1..?Mh)z/ӑ2]&)퐟6ekn1~#)%|06/͊6*إٱCb͊]vlPUن*ثb͊(]]"'IٱWf]vlUٱWf]v*6*ثb͊6*ثb>bUٱWf]͊6*UٱWf]v^*]6*ثb͊6*ثb͊*b͊/vlUٱWeb͊6*UٱWf]vV*ثWeb]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6*ثb͊qWf]qWebqWeUӊ;=0+'LR(v7 6*Uنv;]ͅ]v^)v;vX]LRUٱWebebf.͊(8ӊ+v1CWeUت}ROW ]®8ӊ+v^(vX.;\X,]8X*cě;Hv,!:`d~vQ‡`yqAv8va)ve!\mkCS"͊+ ][ʦvX!]]K7o1]]u3V1VCKĥٰb͊6*ثWf#vlUXUXUxb͉CRV*ثWe9⤍j%0u%HdAv[$#aB_"f.͊+vlUXbp!xWdȑդostt=_#RF_5v 䵙|IO1/п1E(ĝDYvv]H`e(-Nұf9̹5S9;)wJ !mE͞E-ADT@#>5`rF I81Э~yPHqeXb'LVڣ|DIɄZ0Ub9\!}Rj^̗rܷ9 $JfˎI<`%2Vsy?Qa.?ʦ19?Xi.+2®ȫUٱWeUٱWeU،l|UqWb] V=26/}Gd:_u<fͅ]ZҿS\9ڈ ;G]|ks_{{JeILk *VJl_Y{˂jFTR!bӕƭ/*(OB5,U*65%>Z}LBNǭi[euKȭu_ґfiy]0j2Eeaۦm"g=K$Td^,L 9NLI$dOK@G Nh@!i]ŸBqsCȡ[+vXSvX]z O´1Ӿ ѴyuBU qXDe&X,ie2 bUٱWf]vlUٱWf]/vP]6*ثb͊+vlUٱWf*ثb͊6*ثWe͊6*UXWe͊6*ث*ثWcqWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6*ثWf]qCWf]8v-Lv-WcW NٛpC;/ ]0v^/$f]vX.beRRUٱWebeUٱWf];++;(6(v3v^*챊)| ]].)v;Wc[ 8Weec*mb;\X7\XF*1Webcv$ءUجCHv,02v.*죅eva1K@qWeURvQƜUv9qWe͊6*ثثWbO8].ኻN1Web78v|Pn*v6cOm2l&M,)%NhϛMiJFؽ잌fIFXHw9X;'rQ.&R7XcQLRl*l2Hd|JVhnALX6*ث@zW/T=-^g?̩w"֌.]va6*ثb͊6*x1WW6*UXٱWe͊A_쓾H!x(CJԐ7N]ZF Ьl6cFWwVM:5 ~'u=W!L1J$遲(_1WeUqKw4c8*d 1i~8RO-̢ܷmd#עrc4XKmŧmʮΧ1=b[ܺ(֣呐̫X\}bЅ8;wvayJ"0˶Mqq E"/3 XV(5ebj|lٗ i$edq|hb޴b60/4kkwO( 2+ IILݩzd$MX4#v}c|Z}06wk1 J]H|OP.dU4$[zunwbOznw' Ħkث늻ED,@V (}i㰷~A'b:att(ng| +d]6tP m&Ȧ8r샏ݑ)!Z'Nj6|X kqU+=NC T ?~.}IVF*cϓΫ%%o0O'pov$)2򮖺evB95NV䍅/{X. ;W"e(d68pI5w?V*bLU٩+vlUٱWf]vlUxSvjb]/v`銺Xv^*`WedOUzdy0&(vlUٱWf]vlUٱWf]*6*ثb͊6*ثb>bUٱWf]vlUٱWf]6*챊6*ثb͊51Wf]vc6*UٱWf]vlUٱWf]vU1WeLUٱWf]vlUٱWf]6*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6*vV(vlUXWf]qWcN*V \Bpt'e6*a+ be0Z,b®͊6)v8b]xWebqWebf]vV)vcqC]vX]eL v N]qKU‡cN*UxWeU:f,]0qW`'cqWeUӊlU؋ Pn*V, v,">;rJPJ\P](va*x*v)vlUG;zbSv݆6;|of !o+ܻaKd%(:lNlggBN܆SVK·<_Q}Xw.r~#N+4L ]+vlUኻ1]v!/,J ]*Q1KTn, f %>#rqJ0@zW/T=-^eGwc#-h6)v^*ثb͊/vV)vlP4~ F؟ !y,*hc/ 3>#$RHtRPz!~lRZ(=QEݼ1$E6=F*r]xq ^ku+{ (Z :9mqbFiJ;lñW<&E<2)QJbbu͝W1[>\ ,.*#=AʔU7o/v) "Bn)]XR@N[1> \F{dfʃxjJ}]^ i7bV{@ f?`<]̊޽n?Og)աdXy-Y}f]Rf`Lh@}Efv@ J8HSrYu4MYXzuF\cA$yƗou? H6h-QZnr;2+5%Ҧ F!OBZP|ȔuOLB%z8KbrPvQ=*N,Q+vlU-բZ>( ǽ`lvvK,ډ5OP89*va6vDoO-2ٱWf]vlUٱWf]v*6*ثb͊6*ثb>bUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]]vlUٱWf]vlUٱWf]vlU٩6*ثb͊6*UXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊+vlUٱWfqWeb͊(Ƒ;K LY;)Wc(vVI1We2*)v^vlPثثNWeUXG;1]51Kbf.ƜUӊءUٱWeRZ>m.. 'cWcXda]0]1W`oaŋg8 P죊qClPh]6ؠ.]8RPNlU ٱWcv?vX]1K銻qWePm1Wc*ثb͊.WeUؓzcbf1W`d~*v!7\P]cqWfv9z+NĤŢ.ŗ&*.ثbLU銻ŗ)v^*p].͊6*ث*iXHHv9K,qbtXv.U؜,PUٱWf.͊6*P죊ثcv8bc*챊/vlUGvV*v&ث3;C[t.WbP}6.˴*:Ol7h:+36*]v4eb8I`s..njU]/6*1We0](v"ءPvX]qR@`bgW&UN6ˮ(vX8٫]8٩.ͅ!x*;+0ʼnv:vU))P졊[S銻/,b]vV*ثaWf8b͊6*UX`Wf8UX 6* ]6;66*쳁ƌUٰٱWf]LUxo˅g?o{:U7Lh>s Ȇpnfi sO|RN\F^")`c]6* +v-qnٲ@ 3p:5]l`6[a F'a6s5m.ÍC2,; 4^98u.Iq^fj_B"Nbu ldbn3k吺d%d`O|kLLDݶüC!$3LvE.Pv]qWeb Uxb%c .W LRlUkao,?|^쏖+3ӑ%3`BنvJ X#̿k3+4=`b͊6*ثb]6)vlU`QHF&A.O 3v76:%XP XrEpii~8y)zxb! W5Fgii_wʉE KMvF 4y(|1ܠu]Al.HF' Kp)™/H[׳0W j iܼrjbԾj(!r?Cᮋ"Sۿ)>DѬ's,nXtˉ\yu)Fq=2]Kk>Q&cdOaA,;7_NeFM̔[kX Ov,pNm\im!]1c"wr<@XԱ'¹641 {凹S˷I2721G(E{ IkOzx)dC>/-3' 2E Be(<{`Uʦ*/E@ޛ >JM ]bJoR5O ѭ9[A6I6FN+#5r ȒOlcNI5'D./ic-ӄK1 snIX* A =d,Z٤ ig`0$GMyRdn[v8*&0i7jKۯX_0#߯ j\Ubsm==T9-9Ƥ-UB UU`bL jTbUٱWf]vUqWe]Wf]vlUٱWf]vlUٱWf]vlUXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]/vV*ثb͊6*ثb͊6*ثb͊6*ثb͊+vlUٱWeb͊qWebqWeb8Xz`,^e *]:`We>pvPUxٱC+Wf®,l. OAbo#tSci.8Zvq.8L:}𺹾7^ep#?v6@.R6]qAv,]]bnjU]];\R銻8;(bc*vlUqWbغ. UUxٱWf]vQ]qC]GCϊI;..u.v%LPb͊6*ثbeeb6*f(v^*p. Uኻ/vlUGvV*v&ث;cSbm,b]PS)v6Êa֔z0Éz5 dGBf(vV*ثb8(v4ƜPBLP]vlRx]\RUxU٩,bqWbM.ěv&qC UUӄ%~XU؀;x1CCmk6*ثWv]pb銻$eW/S8v7Nef]]بpƙ6qU1 ]6*Uٰ+b͊6(vQ.qWf]vl vQ8UٱWf].Xybebef]6vlUXRثbv̈́+S2eg ^.N¸U`C**] Uo$YPP1Qbp ls\U/'eiFݍ G U;YY`td"ZH3mun82Y dI[ZP|s.[Sc 4a.~9gшy`c9ɸ/]f͊6*ثb%cbL)v *נ2Ό0AJϩ\ǀ/LUن*3I|Bglu#PN+ˈkLYP^Mi7»+]VYiiZݸ%w z\Zp1R7e-Wy>%e=bW ڟJ\5׃ ׾Giz8P Db6y$X0pN1 +V@n>ABϟOZ`]f[H3XN g _F7\-*_r_=z*ˎ K}M9,хǩ~^8܆L49bӍ i|0lXF3k1\#V4jaWZ43 8W (.4 * fL"B] _C3V`9}8O-񝇱{J9-ఴBQ֌aQG dU)Z@L+uY,a- ƠݓN>iH~矸Z|@̻7D wSld. >L\KPS iX}FޘmO)e{ J \15@V!YAkp-ݹ}Ŀ  Owz9IqxevM1⵱>`zӥ?!| :(ʖd=z gidrA@5FXsJ q;N~ JhS0Z­V$DpO&4R I/|+f7pM@4QH"kR%`-7> {䮂SMԕ1ò6.G9lpnjg@_'e:жCN -+r(QfPɖ5qKQ(Mb sU3*4Nj%7}H~ޔzՋxKkћ6`bUٱWf]vV*ثb͊/vlUٱWf*ثWvUqWeʮ*vj\UٱWf]vlUٱWf]/vV*]6*ثb͊6*ث*ثWf]v^*ثWf]vlUٱWf]vlUٱWf]vlUٱWf]6*UٱC*UٱWeb8XzdK [0ؼ}0$;åM5˅iJ) Le,-+^׬3~W7,sO+3 zyf-qn:[][P+4'n(ڢF ehs#MS z- B×ʘUL1B2l4&lR)ripS+Z|% To[q| Ze߮Q =V{eN* ZbŴ;/y5# Gm ([ sEuvvd H؜mhӏIaŮsnRFp26ӡ'ԩ0]@zoA ޵omVᇦr DZmdUQ>%U5Q` b1I^P~E;{hM˾TN5 oƔM1 q5=-y[={嵺 lZ\ s,p[cCEݪp-Ϋm91,{ؠz۾[>Gm1H-L~@W؟RI 퍗m\o0,ڃ & E0ڮ 9K8۹O(AZ;CCڶn<0f%oN@K1CY';q_arB,bTD} 6۪r n>IG/56J#!VXǾ) "v\R*,1<#(# PD$9 "ؼ_hUKQj̐lo}545jZL"XQMj1+[032yT~!K1)p%w d/rS­G_%"lU:擒XڴX"S=]#4cV6 1H #╏*1tml jm8:D m}%i8Ɵ[do+eZ+T-\+e]Ylv#l-+1P]/5RTk3rT_Lucb3r-ߨO) Mƪ⡗|*UJ jM(EhVdM8PLuzU qbb;#ᅗ~Rhےp.ynwNcwlN3p^J!PpBꌬPUXWf]Ĥ]آewd}1KcvP]dŋ UqKBRNNش]1Ka]bc*ثb?Cŗ)v^*p.b͊6*ث*i]NJ]4qAv\Xe.1WbrbıCWf]]vV(v;vV*MWc1C*p.njUcv^*죊+vlUGv1Wbg;eUcv^*D.?,T;tsqÙzb?<,Wd͊6*ث*죊8;;(va1Wc/v^)v8b]bqWbG;lPLe͊( v5؀g"#$U1Wf] Ut®́]rJ(o+7 ]).f(v]qKbƜT;[Ǯ*j]]b͊6*ثb͊(͊0] 51WeSvV*v(vP.\PRa B]6;66*ءٱKbvV7| pmt9f2ͺCx}QO?3Cxqa[C*;+vlUٱWf] 4i.lr߄Z^`%괜$7fȶRHl8BcoEزI9q#xZ$|ʉRdsTԘ Y +.%4ۨl^Q4Tn՚'TDdT:|t\N\j. y g$fk6v^vlUٱWf]vlU؄laAv=p%آWb]H-{}c4~0_ LX/6*2ҿle f*o];FMԐpPE0v\vmCŏ.x|i|8_Gתe+`xLM(rŐH~L5`jFZ!*L 0˗o=-SAU\'jaE$lR u@jQx-VPXj@} ƪM4wH0[ ܛ)>ɒJmơq;F F09ҭ$GmA lwvSG*Ge+/4!<]AfBkLz0˹#1"rIHw5\f1$U9[6cZ`Z!TCʤ` ޹LG<I*}N6z4 ҺEix/5=HAmY-"Ѹoʙvcb1@@ HomgtjVfaz6QR|1ClEIKMi$x.I6ҥ잺Ƈ0|뇖6Է@8Q. $7ف hp_D6hɷev~Iojr]?39}d=SI:F%ro Z58y_87_ZM'#4VkہgGlSlpf([]}jAPdx B9cV|\K+C3{0 JY nC:s>U bq]r-~~K.nԞm_8]zד4ԝX $m"X KVmƴڕ9и'IvXxDb"͋jSϬk:j+kɚF51ɴhVQM#.E \Uhz4:DCR)R*z7ܱ1jX]Ci[OmU4 :d$˾Wьuywv݉Y0XJRu>+NE I-nY04 jG{E,Jl7,EiP6v}amduߵO]GFX1#Meb"$O괷ebՠQv; ǔdʬ4{*߅WSFn:EA#ZCI҃]PQ#9a"<כqbUA=?$iO&ܜBhPmWf*UxY`b)vCOs\0,]vlUٱWf]vlUٱWg*6*ثb͊6*ثb>bUٱWf]vlU٩+va/vlU٩6*vlU٩+vlUٱWf]vlUٱWf]vlUٱWe UٱWeb͊6*ثb͊*Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]5qWebf]+vc+vQ]C,Q%х]zL"I*w pY(^ /5\r',,@%j2[b.ULE$x]4vrd'рYH$煇zW?#b8@ XSwlΜOh0#hқu:H[צwzDyjU7`Z E,&}SkCl*ኩ'q;b)`VP(kqTUҞ1B_xh Qx֝1 & CmAv8|t~pMVtjZ\j)SZmBjP= W 6Q^_6֗ђ'`M(ڟN,caӷ*bb݀?F)zLyָh6O%##s*c]#&ڋZU<24 N31G_ D_[DI;k*\J;Wf9iJx.bq&&ejrӨ`#F[|!q*T}^jܲ;bv (@}Zt85-UP NHL^X^AvșW&q:4GB%|+i< #O<՝Ô:W5O (./0vSPHdL[fea ` @,zaQC-<4BWQ҃mŤP‹\OJ4( d)hu $,TrG,ڒACPPUzR+PT_l*/(˘-)' Zn{`J`Rv=-zWt*ATuŗ=:k֋oĚ}^^ZSjޞ/#gZZ&(tUCl &8e3xL6UMF"{`=:T ax-\og}О6(+F$ :^REw3xO n<7A\mZ[Ru4S*vO}J?^W[bh:&%7PƒdEi`R]^ [W[׾wQPv ZVTԷ0ˢBU;ⴾ;e!Q$TzNuNB6kkij62ݩ䡔KB9$;'4rA.D^ݰC$ #2{ră\[I CNCAC,֮!!yX"$D<@Nm] <Ѣ-w9 IZ?˚#lؚ\y`&FbqP~Y+txdفr%az׉&:~h]?a}^HPkeK-2Xh=) mK#%GI6M~ӚU.H+Yms"C8AO]2kId:|L_ՓV(:\-;4NRD"v/ x`HS!8*Uc$<"cn6A@`s\"}Aq39j-ˮIb99f2чNC+_MQ ڵ}Rh1= u,7WgTҟpYO2;|%MݩGs& @ȱ;Qjo㳹?3:c1/jЏ^FxVr9;)p3n![x!SiF1UQ|6JeGXŤfٻ$D/%.v5k@k!GsNPŘ bcևvhZ)cr|2q\N&Ô:6eYE+O^ii%);SYwSh#>t0X 9|ʧE9€r) SÝ+˷WJ]e'ּgimа5$Ӯ]]JfΎRl Oz‹c]lrMt;6PWDr)&lcO[P#Os<ך 1ZVVisa$:Fk[qw'vof?bPCvPF', D#v}')QďV+yMnwڹP5y- X=#N7H2Ot?/jڮi.Y_\/1y[yLVH 2E[$Ѱc{lo[XR%ͬ OJw"1[1JǑPU aviZ^x}FQF\)i.SQ_݀X5q-OSM>GJde>䵦PY mُRp2Vt.͊65cv]0% ?޹>x˚bثb͊6*ثb͊?*6*ثb͊6*ثb>bUٱWf]vlUٱWf]vlUٱWf]b͊*WvlUٱWf]vlUٱWf]vlUٱWeb]vU1We͊6*ث1]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*UٱWebeUXbqWeb]E"Yb2Wah a;m%k_li~T1ɯLSecxlg'N\ȫZw.d5<dGcX .tI L~5ڣ'm@Z!2#BY'`gϽrI[B܀ݖ>jk^;`U6j u''튭2ӯ+ߕJZS|TTߍ䵦lAZY'BqOPzbY Pڸֶ[~3iWQ_ (xI*  m׷L$5Ω$w1(mrpEn1(N#qeϚlKKntֵʔ%cbynݰ`'`U5N5>NW vz\T-ǘۍXN*M,7]IsnQr1Qn(xoUHq 5{ 4֘R;hƕpL}50F JNh%`ekZo˦Ht ;Cٍ#(n^4Mo% T6Jm.C SR:|)~oa0)#r=rhIZ4o+)1ɁxU{@0;V$:F*t+Ȏ9A PG὿r3JҴ;k#LgP{x8tG[4i!qTt'oRiK  i\Ry>5ـ?ϾRE_v_B疛XSFT=ObO zT)\{F(EbK#Tr2KxGi8{}b$N4 +-ڑIOFiSw Mx,`O$4j$ٯr_QSUFe1(F%YP#m튂 IӐr;t6jƜv B rE5.hQ M ס= ]D40'%62WA _/jWnXh )ʽ|5T?UgR5ڕ'A|kT w͆jREwd~!vkZ,L^?ŪJL.TT{6ow hxZSmd[{X>b[Yny3505 ~1Gƃe~f򅖧 E{{ 5ǝHS8櫧u%LV&qm:F'u > ePIWb=CE].bi'bb Av,]]1WeR1Kb!銇b]Wb1C1K(v2NLRv*p]ٱWf]vV*i]Ŋ]n\XeG.)v?)v&ؖ(v^*챊/vlUXWeU]8ن*p.njUcv^*ثWebqWbm8ؤx;)*~)v7v;vlU؉G;.BynÍ4a,7;D6,]/?<,WO*쮘b͊+vQlU؋`c.͊1Wc)v^(v^,*챊(;|Pf(vUqWeWeB](.ĩLv?_쒌]T;8v^*0.PL(vSba8o-qCYdbci&!ٰx6(k..́%ٺWf®LvlR*ٰbٰb\PإٱWebaV)vQ͊+ ]vlP]vlRUٰ!`$% A sӯFOV;S&|C::MO BICEN.E="AG@~5Ӽ,phۨ91>MYy^YawTis V^X K czT,lV-P(?ʸx a4Vd1UO8nGAМƛc.L:24VnHۯ, *q#ǺˈLmWV ]N6&rExlP`mnqkOHꞈay4!c+#l*{?\sa0SU־%! R]N]7YH8ȵ/1|/m\n6qPG|~Kk hi\K|٧m}8+uq1NYa 5云49}(ڧo3XH ið)P>Jo{^vbUٱWf]vlUٱWf]vlUٱWf]vlUٱWeb͊/vV*ثb͊6*ثbʦ*UٱWeb]vlUٱWf]vlUXWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6*beb8XٱWeUGlUŢȖA{`K*ᖚY%ZCـax<؆g/aƄ}8_4B?\{)vn6IZR)Y!T#*= 8_˱Ƥ\joPwVْkǍ~|N*=HinI:nAsPH؏ձߐBj:d:Mmr=ALJ\@*n>g# f/ZsڼЄr v'΅a #f`jsXIdr{5REߐ fǗ?4Xf`$O!KeC5F4XeP*6rF2Μbānie; UDiAߩ9b#ހQs,iAUi _V,a|. Ax(+^N2Yvd['+^0Mr4=2~1O%L (Ѭ+U@8|ԫ*jM$V}-[ZfPz]0S'5JaKE(qEoOQ Ҧ);jGSA]{bR 3k*ֵ=8BDf#jPu#L &Iޥ)^QHVj e,CJ[<Gz ; ?)Z4 yCOcS!`{PbD2j{#PxWAjaeJ$Fx`uhb7H 1ap'!vn{]FP0j\BբUyzUl=9 23uBwgc F@-5OF *CjiM AR2[ݤH1rw ,,g3F S`E>vYCQȭ[K"0#$wjx^$S)!Eg$LWqܒG"c%bí:Q­n)%ji7Eb,@b W(Je.zQFam(6}.$BӶ4IheZ*rk~w) ҿxZ0@#j0 !Tl{,yRZK s&)G7L @+Pp*g$ԊهՅaEbZR5>y B#Fx2NXM=64n#cҵ۞Ocv$*+v^*ث(v)]Ŵ8K0㇒ذath^13(͊6*죊(ebƑث1bqCWc*ze. Uኻ6*v$ء؋c(vP]1®RM!صRl6Wf.ƶ*f.U(.͊ͅ]Y7\ Z8*p+beWe R]F;6,,Uٱ@vX—fF)vj͊6vl 죊6vl*ٱWeaWeWeb8yG6(vlUXٱWf];(f]qKA48A!\rCk@惱Σ{JLañZE:d0h{βݗjn18qJ{.|*Jh[mjZeCWW&q2ix9`xcp%xEP@LHvKi~ J>gD󈦙71W'Q}rĆs3gC/"͊6*ثbqWf8 >;\*UqK\BAe_?|Z|#;>땱)xBث+BAz[}8ə[v0m`͊6)vlUٱCKbff®\Pثb͊6*W?S_ѭ^?Z16<i_(][8k q [9_ snE `K gtf4IGc*صMm%u$cᏙ.#C[5>ܯ2slH5,ߘ\tPp"52~ETœ])Okb#*KvF%22DjAAL 8<ѨCȂwBÀIt\(`( SK̛`&@l~v$[`9Pb alqOGeor,;Ā&n\&,r?Kw5^HAJvm-[* zN(sFjvڄBTx;  ugG+Ð4rl+MCג%vIVZysRUH ~9?;NTюLE'gjS,p4sZIV6vp˛ :W遭bh<2 S WF?*H#XC9݂9M"j^Cz5>!1=ҡFXk'.%VuR֥c6r0^~ '­gP}Bc;{ Ie:tȴH *|p~ T[XK~6אrp2~( 0Lw8}CF6b ~̉K0 t+F[Fr9JMYNפ{"OeV̥,|Z|t q. PUO[tJZ1o\o)pPD,hkP7miY(g|ˢ+v@SfnŜuПސzɉy_OᯥF#ڍSOhdk^5^܎v=i6md-uCcf<lR/3$k#З>Q{rSQ^Xob 4U 7i/cӆj*f~*V )J VF;6R)~X6*jz QO4g!19͹Di*+Pal#j[.i? W 4ڻk8 K}b=="9^ nȊ5]S*KNi4qR 6~Y302H( |}š1UCH&% h=OimhE&LȺ^]VF.LO5d;X+1y=K?uG-2̠lNdbXS-{q4'EPjÿ]+,]51VqcH«`CWf.LPث銻,aK‡fbrr|4˚週bثb͊6*ثb͊?*6*ثb͊6*ثb>b+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeb͊6*ثb͊6*ثb͊+v^*ثb͊6*UٱWf]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*ث{k ,*X K>`r6˃Hܠ\<y3}ci߬נš}m Hhܑ (([|R>'mڠPiR}G6qa$xA!?O~?:E=WC Mə8Ɯ6VzcHS3rMv ,kOZ+^]HbgN]jр?Y,Aj;tzNoEu2[90)ՍM6܏@5'U% 47DxfTd rj8S㚓QJ fCadRqbM\P˥+ )L+5}(H~( qMXTv^ئQOm+}. N yNR 繐´|0uHD XTw8pIE|])jʫL (Ev'ٯ\V@O jkAu«-*qoNsv=RkpPIdPЎX.d.R>1J`-vƂssCz &Xne=SS x[j8`BZ{~o!@oB6*6TߠUhO?M42iF{x 8KY>7)ۭ~ ej2*H~_H7T?}& DI 2mTo>x-.-ZhRdhQ^]Ι\pGǘ4[RMrխ賘R?yZR87ݩ%aJc0"%$G!ۑ}g c%Lcُ\"=Ҧ`zA@j)@MNZEBE>_-mNowƅP-I')TNhǾ(OP@+| X}i8MxHaƂ D\NH ߠ^Dz\Y?ɣl6*)˸;Ӵmܙ:Ay!n@ᴓ#@i-̌ăZxQeXX 0-)/#%,I{S↽. mJbFk 8&95 #'wL+]Ż)$(NKs\AŤ$; HP4{[RM҃JZAS^f5!GP8M qX$[v'qf P{PzⶆGc+7b@ߥ?܁`o]ϰl H$(>•"އ%YjbA>_ֿ>=~!#dr>5x^Bt7&b  ^_dbkC ^ayTlۖo2 \yCᾟHƵ@;8%u}̅] ֧vqlzd Q]J3=IcjX +"v?cf"`hЂ}z+Lj~Jxbiz>KrȽĎILI5lxUڠ6h Ř+ 6#9 Anbm { y#SFy_˶w(h** 2_Fؐ9^ym΅bo-x3(CftӘCm/"ơOQS4zy <M԰E9;~ӎ̉2BÐ=GLVƕml40;<iC2q7ۡl4̴f|Gѯ5tKkHُjB-NNqy" (bO2˷|~ xtc;Su{K _ǓMVRitHPJ8uX+hH$A宥y9$ƦL"p%IآbeZbUٱK Ļ,]]1Wc*Rgf~vh1W`]lU؃U؞,]1KWf(v1U;)v;v8bc*ثb͊*]-J`}sD_"eH0jyjh OƏ-19t+Ҟ5ZDl08Mn}8m~Rt;PWn$mS߹ք6pM]SWTn# CxJ>ɦH8[ NqE;4ɻثn&n1cd$F僉-S Nё[ }EۊVmoŠ1 `~x ؊|Z)q@Β ,$Q}Zn,M~[}Mu\ڃz 1F+k ͊?h1Wbkvi8䝲 }$8Web͊6*죊]]lUؔ.;+vٝ'gObñXᒫkƏ?vuv%v{>(Wdzxd-AQY%g|pFgZ74%]'鑍GrAVrQƣqꋅ=?P\%t(x٪"3]pV?M6^ٗq6-FOme$M󷌄_!fA(LV0~*|$dAT'tXͥ# j;6gNtp@ɶFwnF9yeI.Fݍa0Hq!(D2íd/X7ppϡNcp'ٔS j JrЫ SH6xJqA_ćαq7-?T^uCǾRᆝ*JD3#xdQ9}KDik'(S mczēMq Qʌ ՠW+Sjv$,DLxWg}fM=!OYcqV>`A.#'-DذO4kXrq0RSz(8Ӿo8H =0q?WJ8`12Zt&k `Gx-«)F{3Tg ԓ>hU(gY*U[*NFqn. a.kR[+=}M݋05QL}ˌj!<٧2Ʈ"(${W&2J:M\Z { @ X/AG|a̢ժ̜lTC-?jS oɒC-6bN͚ubVwE45)Cc o:.RpJ뛓o򭥭ԟ qE\>ӎpҭ^TNA&]&I6H"XUz- /Fc׽f=!Z dU3# &iEQP?VY[_RHH U_K1Y9TSYf%ʾsϫۏNϦOQ&dJ%jǦTeMnɺD"zlV%q2y3tKuطBN$)G]& k5)jV5qlRifg Hn.M#N!BQKAf=s`4 ّܨ|h?)>$Mt9KL~2xv^IT:Pg:ߓ9T}ڽpV;˹.I⦛W 1DQ(9r#ɁDns-BR<@Hka[u{8ဩ>93: tO+#յuO@Bj#cSRrl!D oi%DmkTi!`;|L!LS>5B#[ *Wy *.nA:=LleE}=`"꺕4u-96KW]5Z(_ԐWIKΰsu/|'Ig.DHk_2TD}>Ց Gż53ibUٱWeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*U٫6*ثb͊6*ثb͊6*ثb͊6*ث/vV*ثSvV*ثb͊6*ثb͊6*ثb͊6*ثb͊A+R~ဳxbTfآ8 @OSztiS:#-7d%0F]F`ʩ_ aޓ䫫3j*Y\| >Ƽpb6?˚ךxi ^4C0 jͽ+K!hI!VFy%9.a,]CCm! 8JVya0֘RCzlv>D\ZĂTӹJA '$ܒ /Ÿnhm *87hV=7GC׈ &6Ƃ fOGȎn=W&k4gZ/=x:\Q}8\NmAC^*}"Vn Sf)&ȝC}[]nqvO׀FBGao+WHrsvq=Ss_ Y džvU<}vb,F*T52Ld&&T qyF6ib%NPX\NUCT~`?}xs jH dPt'bjō/qTW%H(SZ|KZ7rg([r';\N9 Qx\*Xy#t Aŋ=#ZS#PJU5$vOE5@ֵoدJ?<7ª^& G2r{ܷ)א&ƸQ5VZif&ֵY#bvNKA_.ܪB]sxS?@ᙔx(W\z3VqB'j.8;10Z.@?lp ^ 4ltQ!Ry |R4ߧ)u@9$g`)Q[4*4sZ׾*mAdWaeٍc&5nI ܽ4n'X-&ـg>Enҹc7$cV6Oa\WrSAݹ/,?+ 0Itn_čb nʪ߳#w0!^9SbiJJxURsMa+Sx.& T u07h @/Z,u$Q?يI4f Lj~l%BʼR I b\ ҏ;fC L\ZuȞKfO!gKcp}ɏE>}Yv~(spN! pO4(zzd,ӓ JDHFő*.ce\.AvlJiߧby,ΏAM6o7+1\\f{́.́]vlUٱWf]za ',%ǮE.W LR Vvn,T7}*bS8 WfO/#&żfV 0EvlUٱWf]v^*ث UٱWf]vlRءn;*}^1 Erf璫䛽[p7xv>3j!J%#c&1m6ɮT)ʿ0BN׼2+1۷OOn5c#Z턼4%7  ʼn+E{ l>Do 5Ȑ˞Sc#*W'N!~N,g,'V6r~0"ՖX]sB/tzȤV!\Ԍ^7*a̒F5vɉڥ\dIL頸A @rr++ 3̾@[D}āOc5a(AP[5݋Xٳݫ^$ EXz 2oP]JĘr0VU8Tx8%"Cu88EԴ(mQZ{q]28፤*)DPDeeC^xO`}!\.mQ}H~%(ȴF $UkvFaGtE+җ&c"T*ݶKx>GC(.)'ф|B ٞԄ"+IyuG)J oƠ;h5KgϘana~ծXQyvtQ\JaϾ6EBXL,l 0ypݦ,+ulܓnNƀl PHEX|kZ5] 0+& 'B~G_3zvcӍ _9{c@a@o0MMOA fGYŠYıJhrV9eS*I5KI@;K/3%ojEIv₻\?Uh~eϢfXmn}74(|r4곖cQ^Q6Ǜ;MG(nV4[C fa!1k;WbTUJ-i!U}[M=*xniܜfeTh9j;/B{Ҙ/E-Ċo='.' Wm|M#{KX5.ـ^WyDmՄ=ڙռ4##jҝH̻)_5gR"H%۠?biù<^WX;}Z`+ @1*[qԜC#\7 WfZL*Jix1UXWf]bvlUtV®˦*?\dZeQz`,X6*ثb͊6*ثb*6*ثb͊6*ثb>b6*ثWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]Wf]vlUٱWf]vlUن*UٱWeb͊6*ثWeʦ*UXWf]vlUٱWf]vlUٱWf]vlUٱWf]vh4Twl7Yk@4(dH\NJՈ_\e 560)#%Lm$xûmZ*yP4 gR/דO/jYHف5{R+Wt4Qkf:5R-m(3]뗖ѱ7f6>i&#f;e V64hC&3Gw-+x7WOcøm<\]8^廝N}bZ#SZV̈́sVDI&OB劜Ĕ`[u^`6p;ĴaUP$&ʫS񩡥pd]1n5Y;r|^EE)8q+Ut=aQ閍7S'gjFgT#p3@m# -SFLBTv4I R @,AP AĚJWF.@׽ڕ^ώ+NtC A*q{bMrylk]!WTǦgc*&{z*7!v؊!kF$mmfUb-m Ƽ1z)DuS#m\w X1PiBEiO dm bL%2%-u}QuOёT7<=-h: w.r`Ozeq P) cRx;}KpҮxbzc.DVp7*$WZ vʁ |Mfn0Z~GMs^W7K"HZ}wlvGAbDž}jK(;]UsXi/0m]eV4|hӡ4:n@\SۆPS:>;w>)e:o424;B DCr-}qr!g-V$ 8S(>ҁ\J|~pݳ@i{dy{a)Nh(vx2D*0۠_bgVSZキO!bhr;ZqMu8VoW A1Qѻ{`SjEWG Y2pj(6,aIVi""aM~bI&$2[_~A fVZ1 v1⊴Wr>Ѡ  H >]pu pNCPWt4kQyKeerQ(_HjhT(;oZ1k7\VVx]p`iC\QEآ)4s N8D䏄S747]]o#@Nۄ'veҮOH(p."vƘ" q 8Z ۯLj6>2TcİV?M;Z`-x\B8`)o-> ^\ su鷆Kb.HnN>cPTDŽ3Wz^mq p1xZb&yĞŰE"W^Q[;kU]ջ(FKEckul)ڧGQ 0 BS|7@9b@-:%K"*|y +큍P9 yjnR~nt":dZ+4%*Nl)-VMAp+\Y<7ze۝̤ ad-5Ϗ|9Ѵ!"єyVX|L3ȯ|R4N!-)9t`K)wNFeM#X6vl*42APڇ-żI[v0 b1Wf]b1We͊6*ثb͊6vl *r1SQjlոAm~9(W'wA3Z|,Ė^S>-!-buZ YD1Fx 8Y'|_,\ȺՀbmc[FSoOɽ;/j>7B !=C}[1ZŒ7qaFҚei)8u ;˵ıQL%y rv :E>c桜lkl#}N<&q?K5h'mTE `h~C/=Uއ0(qaZ"XGqČ^9wJ2Qʿ=#!d62S3Eq`*B[8 v *+jj;KIz[3Seqm9ؼoJ)gj^cQ9$EG Ÿ7[)*Pm\@l˻q LO")Zm*D1,W,oÝ:ޛlq8G5v=;:;\Ǽ6oe*օar @U=r K,Po'bcƕpH25̺u~p qB?E琈Qwy J9囩5T"P K=߂{aؕ+C,L=ԊېrOF?ԹjIۧInϣ]6O3NhN>m湚'NF2 MFX|nD\/v+?R~C֐*cE|"<<Ke5峚~_RFvĂʑoڣY.bzwRp.vޗVԴE5Ƹ 3 T~!(x*'QECLd1K5'gbL L`ڄU `:~bRܘ{ ^Y(YGp3٭]댏se>_n H/A.e4FGJFeOoxS2>Sre][aR6oEd],IOѯ5>SjDI͑$y1%Y40$ ^8*cHlcb0*qblPQ]vQ[ƜUXPإٱWebe[*k?\`i5E週bثb͊6*ثb͊?*6*ثb͊6*ثb>bUٱWeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWf]vlUٱWf]vmWf銻/vjbV*ثb͊6*ثb͊6*n*b͊+vlUٱWf4ثqWfiق/]8;78;iz[^rp[8B,`bY-_$Vzz 1Ym~B+Ux_}Yx A(EP9VLW3J@x-Q$a[$)ڛclP }OH A"r6Kfc%d.Z"с5Tvh~xp\=I$p=#.<0-Ύb!ڌnTv*AGn 6`}Ng(dmլ.8UT{~2M$89%PwĞwגnv|fR:r $\R$m۶4nmBsr^tmŁ& ҙ Yc<j`Si(~X5늡爥+lP^0 85W$W` x"U'l/G*n[%lSjG@^ ;e*H۾6|p^&58.mhQ||PN^Pھ%LJB~?la Ө;76"Z *T|IN?fN+ $7$ Ģ}藋pcS^< ԬrMۮ[B7uۧ*;1 !(Uaɸ1Ω.xӄqSqsxbe+,FabGa wS8ʌEX\}}$®SnٖQ7ƕk!(BW~imc)*HMGL Q'O&;㦁 )\ y߭hWJ *8m6;p`="8RM(]) r=X O؎ڛހb.+Ub ZmTEś:*vYeTcfI@ӻH(U$;jkd T(,sHTSPrR ~l;Un?Gv?z3 2Z [q5(JNAY޴ Dpi / E]$L1-ۨ"d|kқ -ܜ0N@7އ?3I&'jA/8q:G8L~PviG2ڻ!ii@}=>O!?559d!sRy̱bN6"[DZx9?>9jn pFq_oH9lt2bׯ߉I1RTbpfr-{@NRA,2f v|l"4ZF``q7)[870QPjJC!SqPrl`z+ăsi̾AZx =p֮G_|ms'y[k\5yq Ǯ=iN88@L(aNji\ )>)wHRrz|#Pj~-iM:6^Kh!w%}S \6+3-6Xt ѱ]^2S|1r4!4+Ҏԑ4GmI钻B/mDdf*)N]6qy:̶yfhaWGأ4$" DyD^I_,JH<xwk 1.{NCkFèW "c9;7nX x¸Vޫ z40Pr*iVRkIRNj`yu2F=IZd"J@OG ˻qcEGn)P\@kѹ@J<,Z]]dq*թ*l':$)( ؚY,e$x%zڰݛ=v%ż38KvƂ|7S_PuPhƓmZB Uv¾Z!ɕS eL..Oe]e*ӊŧ(*ֽpZnUF1X!55 gpl1Ie Q# u$WF\*,ZаcOʮh רJ4`;cdׯ\qQ{Wq5 Pa^ Tv!~<]1w4xqp>403āQyrJ|Y0dz,KF`78Qm; ݲQ P{DG|[rV.B?GNk!7)FÏ_| 8Y%O>vK/3(4AK.btUs]& !ha1T>φ\y>HM%qװ) W ki/2 mtqQEjc#"1͍)}k -o >'A!UKadZ}6=q&]9j܍ z-Pl nZ\ <EW \5k䛀b|O]q +qYF(@_Z叚 J^U=0 ޞ-;o9mpl ;Ҡ|Mdx k( -!DѰpGg$[ \2GUn eEQw; kSjwd+N0?`|?<26Zh!i\Iwm;P~\i:v!o/E+Iq2d,O[֖G>8u qcW75NFNAM#8~l6*42azO/pI[v2>r yxb͊0]/;6*vlUٱWf] 6*R챊1Wdh["mnCrK`IbrH:NC\WE'`&#9)CHH$>V<ЇH[u>l&"!^+۱)|0^7kA|"'XF(05u#.>(kEN.SΏkj /Ĝ0шJ}OW>W&4g.^d/O4Ie!m5SC4J+ı#%ё-lM$싹8)UEn:/ 9 TS Ҟ ; wݳpgɑ1&rr8E>8 Yž>#ҕʆE"7:gun=kʒk#q,2*d2ƴ/ -Od#OS'i]HIZU{dx;׈-w]9-+vZ1!Z&[[kc#J`x6kcu{ zp;o4oegF >y=zy;پr_8}&JvƆFHXZ)z_QVW-RnaoƱ@ynkKR~Y27fBSa#-Kұ̝KOBmlND˹Z>խp?A#s<d*E<1[ÝAk$h> ZQkd% oߚ/Rt׍@;eH}w.s'2IP)ƘC[~Okʀ,[ECsolyq`Lẹi. 2G;|YC6 \(S!P!ܷZرVcqVbqV1V0Uqb[Ƒ[ʮ*qWcN*vcebf]LUnlUUن*vB_4˚XvlUٱWf]vlUٱWf]*6*ثb͊6*ثb>bUxb]vlUن*UX늻*b˦)v`i ~m4zJv(tۮ6c/zckpd;TW Z0,z8-x]@$N=tI'lmi]*++N;d>]> ӫ !;W ma>Uq$4\p)"nqeA'm}]4۰|&UN ^O콽 aaJ/1P:J-'ح:ZSǯӊB Ws튻puB#\Ul_ ]\iƵcbپ 0]h: Uآ٠݀W7ޛ|C-zlaZvn\UOvoHv]!&+NO Nn>P]4[ ઑ\H $p'mբk־YII.Ct]DZ\.N4;n i{ÉV.#,U ؟oV ҽ,G +X?4*qgُٯӋ$L"@=>cEU&ApNkH#:(T'+|{ÚJctUq[Tw0ZFdKz!+\;u?v"d)~:־$s*PШc%M I* QV r'Af¦{ODѮVı䑍r (A) i>)b.48{4SF..~4ҦpON6`Z4߮K4/cQrrKo9n0B"ІfhQT9e[|>Xj 1qOZ(TjwO'`öإW;21h QJUQ^,MƦ’v?#Yj=5cj "/Unmxzu$Bn;T@TBU=HnSJR9"}j}늼$cSo)ʭz8* /lPD*]bUB ;KRx2>0L"X .܇#l{iㅘ&V% t*(2<يzn児 eBPOu6Ey@6t# ST$eMH;UF]fiA1҃;SWE!.߼F*bK9h>\чUv=Ctf e]SқjAJqAuZJYZZt+ 1!b左ݎ?ТUO\ V2z Nh~5U?Ĝ,B1~U@_j1KCP UNZ{)pZv߽1198z!5Y_KDx`- &6MŢi܄5@+sqq^O,.}RY,5I!ڊaޥpj@{ys"MpER_s9@X%1 T-k+$,[\~u9W)Jx|9|Xuˑwf2E \ʌDy4zϖti$dB #5MS\Ut'aڸhC_f|1d6q,yecf-4޵'m%xmyP^dUQ0!íAsFȑb:ױʹ Ks̒աW$|_"(3@GR=<{7<$y"5j Ah s i2*i"9_S56*)vQnһ)ncèEUrD}_*FgHIDkV'n } 6jӭ)hG`.=U_NU r+92' Ă:\QxaFot~A"{lQ: _ T44[Nkpfȑn6LcJo>0`A5br[ipq58y PIc i2 $A6 vCj#Ҹ#S+k@MOQJ\)=wWt{f܍ӱ ocGQekl H{g? :ulQJoҋ\+Kh;șHT 0"NLWe9,LH-rBl |SV/PZw5L^=zHM 8CY L-?WVn`-FODŢXZh)vpBh{ d8䐣3>>q{A]mDp;o#$MmV'LqfAm| )؁nJ'BA(vj d 6]8]wԯ|oڗ;,™' AGccIWш'y m@P Nh8ouSG,¦`X 1n"`%  ),QdGRե0x<րثUXD U<ؒ17Q2 vG Ž* ?Vs Xn#v8ƒQrf  aWؿo!A_"l5ɇl5@iԎ>--hS~ [ƾ0m& A'$uX55(m,ymlzħ(qF HxZh ^(؜:Q֕m=6Xx.yAE!tUN獱9Iie[IPv~bfWMvHWoJ6 SzeWoR0 r]9fI$I'@ھeKf B.VbJ&;x%X1Bz JB;P{ ~1VPv<\mϠqeJU_ہf<}|0 TkǶl}G!+ 8>ၤmptud1Rsn9S%6[Cr9AQӯіE%T5A5NɹvLȩBFk;Kd|iPByryuN7.\˹X%_DȄ!mc;Vnj>Yu*h<Ggd:OCV]Jhم专ŕZyUR;a\Yۂ6'&'(LF@刟,Pgoҕ\E^AˇQ^Cr+3mtL`|Da+Z;}h9nči$N$vPWIS*9*v5x]W,DŽ 4 Sp;d( 2HŠ50J֡I WGv2Ptv8KakhP{m,)p5@Uԏ(lJHEqKDbW0zX)6@ӆS *}wY\Jq=kNHlI-m.Yc#\T u.8 %a@} pk)F{SSMT0\E‹TZ #'aD5=t nK܉lCw@~|Gb֐̵;{ YL=|)L!i,[a5f+ܿJ`'6:݆y!7nRN4Җ )#K`ZZD9zYQeAn!dB=?jGF$z7X͋:o$ӖCec@c TzI(k\FCi&]WWP> Ix5\F#zB{bBn6*UX\*죊..Lcpgo+.8-aWfHDӲ“=c3Q̲D{D{4,'c!1ñTw 6bزB<3&:xA;b=\"-`saRHv9tKwZqӜNAei!1RGacT*:5Kku!L9?RAT#^~ j QW"}B{a^J683XʭL |Ke<|Jpޝ~ԐB,0='L ]t:0Py,΍O}r:|ȇNO^v㇠ebʦE]6*%vlRv#/,%.E.ŗ LR V6 ѓd-}F+>r%4P6vlUid„6żfV݌ 0E8bxWe͊6*ثb͊6*ث *쾸ivlU̽vŏ"-nO(d)c;هӺGBq]<>y9keҘ|doNuq{A]ؼUG$~ɍyR"%ݴr5Jȱ!+8ri G׈OfBV),W͖>-Um5_P;zW$?ܱau+Y8)~Yִ,&hbNACuY5Vb[!}(pm}V4aᾀq*ǺSpiK ͺ3$>%ݻIo%,;S >>*^݈'[دC>,Ṽmj`wP>,vdr@R#$:Ek%E*PZ渓MԔ*;PDJC^-c=; x:?k$ i e>a-אQMfU+ܽnj@ m.o/<"6\MVS{;TB6^k^bך[{m%rJySʫ# G<#=>yJYuk߶SGRw?͕%Bu_cqpyf.lSxX׊*3}?(`z|Ȇ[ibZcnCSn(M12QA_  8z`nPv>/+SԌ(@EA[[4B,i/ݳ} Id=z]p/¨> =q4*jtS VEF\%F$*ơVGHiKSS9&-eX`^S~,eJWf8[͊F*4⭌a[Ɯ(o6*ii 1ͅ]Wef+rWe6vX]kl 2樽0,]vlUٱWf]vlUٱWg*6*ثb͊6*ثb>bUٱWf]6*ثb#IŐ&)rjJ#6oGB@b{uqDӢ`*\!JQQuqS +8JZRj? UjT 1>.!ZSib9OT~UءU=NZ;(7)urTXPr Ua*n$Rsz@tP]\l@ݏoe=kqǪnz-ƟX+ l- rܸ:,YBͻo8Z@Sa-c$թ\UXyPt2k\Uٛ URO~HS+ܰ5B'.t]oN۝Wc&ۧ*6;W;A;S =Fq;ȭ,$u8X7gg-EԃC|+*9H¶[m>hDŽlЀr47L⧎)Bx wjI:짩OE[ك3 S lW*$ˮ4Dߨ޴cNA>`A G)O#VލhQ<AMTI+VEE'1/v(ZZm"bA$~%"K>I} BIlP~#lI@Gp7qSK1;t#}϶,-Z(ZuL@jՍq0;֢ iwmlQ]Ibe^i5 {Rxy 5YLz )A{aK oPnv_ (,!H!LXjFB T(ɲoȀOliwA*=ND/* LN]+? #)E26QQ}r* MqEX‹LM;P6>m*v b~ԁi7} #|** m%n%j6 t1d`T4†@"؊ lR)j{rϰ*Jpe EG,YxWjP$(?giVڤ҇]! GR1JԿ=1"QGC‰M-+pŌI5ރm«}mXE3Dt|1{v15jǧ\<+֔-t9ZI::ׂvц=S4< Եjr?>k:0^m( uʯ2ZYIow2#t>b3,1yϕ/[itWfJr_GiQzH%jT(~汰`^Y -&$4gv iU?9iuۖΙ% >4;}; @DQ -|;%2b)]ӯ]\ӗ6..,LVsCS"Ys̅$C9tjZT=/!֡:l"FɠRvmp|{l5zKo$˚oNRoц#~_გ3pX&S➋([ JM_z@`G N7,YE^G|" #ZFkOJؽD *Tm0YY6SY$1*ֽ>L #8By*3ӵXto RqފzbYsB2ClY ]-=#]솧6Hʀok B>Ñ)𚞿ʿg nGԕ&۾1iQs)dȐc_Oٵx8 '#lHwom.<2Ӡlh4%!Adl3ȵHb;9Pi_ -RY=RXRiUP :xRÉ$'zxb}k2-` i!9# ky_cl@a M9BZwS0wkAFs|5 I{ᴈqv$z|-,nbbCoj]ZdZ(d%6֐ ǧAzP_,r?MY֐F2"6E F)jiㅓpyrS@?QV0]%T{W#M ƈ:X.c{BQP!E*yv;-y!Mvkހ +s%ľ# Q@ @ '`14M|yzfnH(*FzhN=|P%_cƒK G|bM~jG-S n,~uIE$ыߩ# %.$x1dxjؼ:4ș5K r(9&N4_%Z"ϛ0G;X$t LQmO gq@Zi׹8OIÆclW+dzE-s# eFM"9;m`DrQ#AWѓ0!>;b4{u8U,ֽi&v)j!1d*ܚŚzTޠ ,IJn8OX٭1[P{m8)|RTЊ3Ci9Eh qg¡~#|7@(Ƶ9"(C2SeVv54Y~`}}4>X;; "P[{FZyzIxH*\k1XNH26d"ellR[Kpx x8M y7$ PrAAu =jE>YNndugߖij#l,݅`cd>bw'o[ֵ;ajAZ:vެkjed8%)`ߝDb}4"$*;ݑKUkXP3P`}(Jw zDD1=G9YYHJQ@>*`R3QtX%_F߽~br#+@Uhi_`>4K_jPey'zy [ )v7!PPW~Ƭ>ʳ~=D(lQާ UN4^5ت>*s- h0DÇPrM5a\6NJ΄hSjdjU"C!L`rD#“w@܏ 4d+Dh:2NHҙY. =7b߽v>XMʤ5l Bh8UXw415PnxaVW#>*+ҧؔhSOhuK@i-4Wv;a̻4;Pvɂj*QIU?J 76Qv2!YZTE )aTf#~v `ʜƵENN4|pRj>TMx/{bhE\!\Eql [ %.|2|N`mëJ@j|Зl*<_ d[ov*FB[v2UҴ*z*pUԯ$|)+.:cGẺ'Eu=!Sڹ Ԯ ð;et 5qlviVRNr$t3gUjxf݁lE$$-T+|!H)c䤧_/Mi h=cLNF=? !n hztƜH7tþ\ mC $Hcl a-8͢صba¡MvVXڟ~$W8Xޘ2rĚͫA6^#a3ƞ7Tc & eS"7,]h$a@gUZT\y3E$8{$zdpܺbw~\dOR? %VEi }BҏLՓðqix}`w`v6@ɨv9эOS)!M5Y@e<D&qp:rLǏVü dΫ\W)vlUyvlUٱWf®pL F_>Xc].v(A l?>@M_}JӮFeM#86vP®_.$sCj?ܜ[̿o&en`8v]vlUٱWe͊6*ثaWf͊,aWe]aURƲ(M'=nocIe^6װL%zt?V瘭f[{3r酷?:aGGrXX2yO^K辧9˼~dFVF ^%CIߊ:UG6u]َ_i0۳IM7ze0k1 dB>\`VQЎ~H ^K&AY-!<}2f:\(z2"}K8[sũ|̉ ر{Ie]f=ALcWʮ`V8GP9DMC)&:wxOl:6ŋ)D@0AKo~QyswWI6޳7.5;1t6J@Ҭ6;%a8#[MO*zuݽ}|(;ymomNCiB^D+摾ɍVf$v񸶗^ɰn[N&+7?𸧗~rBn!NJ?:^x m<yz7)@qs6ޙLb +M_Жyٖr2o;RYDb^m4Yʽ*F!ɮ'u=v%6U48`RIߡ9:MVNfh`2\@~vejE)ś!Roʚsܘu-=79z$Ѱ jwcqٕivRi"1tRi^_1} ZN@Cawv|k|rWJ:nnp{ dIrkݝ}u(Yᘏ.KMi ު|].!p@376V SbD q;\-f'66 =\`ie-D{"On&M=]Jenl,o:LD`U\Y.& yt#66l: oN~H LTV'KS@X'0D K-k &",mB$*1qzҪx02oF&Ϛd*Bd\l"bki\Fa *bȲWf[]N*m{bU8x*V;][Ƒ6*UX챊6*.Uٰ+*U ֿ.jbٱWf]vlUٱWf]v*6*ثb͊6*ثb>bUٱWeb]v9#g4\YmfzԎ2D~v|')v:qnkQ0+x҄}`®ǝ@(G㊻KqڽUQ3U݀*Wu:SaC6.Weh,UgHMNI[U@q+OlUz@KAMk튻)Jmv^ij|)3Bzv7\Z(QA_N5b'zu5٘sj<64eQ^uvIlm(62<׾@'CtP(+O3HO5W+Th)]KT/#K6R3q\?l{R UE9vt*FL!^:"ҧ|K&'|'%jA /݊@;lzroxױ+~>=fcHn  ;VOJm! "1Dn7\Gs( } ,fV#}eD{ӶLE4ЍO VQڽCK@H#+k $>;bEXצmI=wFR4?62zчzTx`m@ B~]܎EOs yQ)b TV%rmQco 2qr$VWv! l1MG.{vڝp-|*)1nMMza[D%N2i1-ad8R@Ԧ %JWWm~ChwOHM:"ݘP ڿXX"k rq8Ah" &S mm A +?N bk01T1i+0f RIS þ8 hn`e ~SXo.Кoo|'vqU^#b :kShS8$p݀^r{#$ƒrF΁Ax{S7*JWwrjQ X~4Q l즻 ӊҔҾ8JnZk jmx MhnGc5b'ZnoQ"),~tZG/ᏉD啈#d+=zcS[qOuMAkҊV* ,?+KuJmޝ6+7v?G TۦLJ?S׬ķ$hH>Ye1FFƠcIXECtX]``kJeJk)%S8(ZIuMGLd45_eC(&yQ,-fWe4 oHm^0(@PTW4 d;r&LkW# *ΝcðQG{ Y=^;j]oIgi^FRv҇i3jкGyn1ECN߁_en5tOP"۹"}'\\VQ (5'ఒ[M5ڕ$BK5<8ˉM%RHNT $sA$9+M&ydNMb'.%MH=&"^u,i{%c6`WP04;ILU֕"'M6, ve)tԚS)ޟ<[Y/DlU@ƑVюQcVS&t1.T jRɹ=*rF0CNI `<7N˃/p*1Wc^'Ǒq;,!rcAZo呶CU9n $ d`-ݑ-25F4|H3@@o} ks; <0!?ↆ*vRT68v6↩#+_|q 1V(2maZ%e 092Ԟ2%z¹<ʼnAE+h.˪)QKx]͡$d3@&x5Y %Ք9UTSv`h_~)i>1k>d:ँ$) Zt iѼ&R}+\ t֋naҨ¾9[ 4$O4v}:$UCZ.Du58BUY|D}u8AJmeK1FaVp삵ge,)^DjmthVCn\Wϯ.R.a*aɷ\EۏR|qWf vKHՄ!4P\ȥ@,OmCL!dSL2Hg=#rҊʂmT-?F+ .ɍS0Dbm  w2+?A?f/ǼQRIڽ~621$QBGN Ԋ+ܷ8ڄ}Inۥ |ƟWP'>> y=fv,v\AB>FMNA)87ƧALPk8Y(Ok٦d)j]W*urPe(ksc.&uaC\QtHd^GƸ\IWp@•qO@}Cro%=jᥫh?lqD f` %D L oC$c gȠmG7S<S݆zuYxGVS( ꩥ:共4Ua~\^CAwuhX i֞<u)Q2Uh-!e=k ˲ B;5s5 maj*Li<#)4<@W㆒djq:cY{ xV׿-B4fI%GzBى"s"`P[Rx|J*M7't)!ҕ%NV< "iEjT Z1 l#tEr6=>?)v ql-s4qW!TT=WN@c]{'8cN&o lzu| .w^ޕBJ$W*[~M'.FxSɴFߎQ̞D"*I«|szY +)7`|4x- ,HHIXx\1]S*՗`H^| Mwш1DS\=ɹTR|r+FY'd-R(i' /G_c;.U,9&:HpLU5*yic#n4ڹ>*♈W׭&kÕF?g_&f lH|}mc E>D{7f 4X@tӑ̇|5r-Ia)v>#6Q = g}GB+akZn}EXvzH;$m*uC\heܩcWNq9 #Ó e=s͌¤Qjrܡєeͬ`Hn r{oOL!| ظA͒K`Wfȫb́]$f]bx>XJ\].v(A 6H-{|M_>+}G;hLrɭf}}f"~t%шO\<;BBaJ zDm Ld5`[׺2Ĥ^żju*TE~0 z=:8 -:{ޝp;,5p bQU\#`lSѻI!@:aQUyydHf sC랓ۣ9+aj#}u`2pf"A lth/ZdT.lIŐ~lS) ^Cez\+lԱ]CO duki%$ !B삡,dNm徸@LJmVoe3;);&bnp* ÝL6mZ'ӓw`Kvrp;S6jڝ~zr ͏yG57V.iA RkIǔ̹OFҭ)=h)Z`[K,[5p9gDCO)ecO0t' d 4VD i\Up9p@8EqBe#4ָJ(9r*{NKrNH{ņny}{FDgo۟l\NfjnpPAh6n{JO;hKSmZ~>VQ&@G- -ȡ0ï,[f1ZVR8h-Bms3J&"ME6KXV('"H®p+yU]8c6*iWePn*U1WebH]v7vlP6)[v^*Ucv;vBu_4˚XvlUٱWf]vlUٱWf]*6*ثb͊6*ثb>bUٱWf]v+}`@;S].BJӾar:PW N(;⭜@m\Uhbtޣ*Zt8ȴ4PnkGGMWmV)v`ߊ㸐2Ԁk 0QxcjE7izeN *l)GJ~UwB[lQcG:}U|L('6u@yzlU;}-ĝVͶ;P⭌0R\IP@[' nl7;☍f+ekҏ, UTSɇ,6K]?gbz,Q'-ƀtiXcSA P0PSRb?`zփڛ 10  k7QNq7(PKL jZʋ1]hpS]ԊEpM. Mz-"!ɍg+Emf2DJȪJqJ5|}g":UHT ?F$}'XġOۗӄ_Y)r@5X(*⤎]!`fdj)AĆս`5zS|Fkzk&!5S*-U0,n<@4Rz$\R)#ԓZ+A ֟*Gwp@[_n#lFAL)R4{nbEZCKlZ5IN1D[Ʋ0AGQ2ԓS•oh*%VN,UBߍzmAzLŽQ sMte)/]K .h:arUl/)⛖=¨S$"J$5a ufއ8pX:# 91qZ:+~yX ԏiŐ4&v ރ}p12C&%jO!휕`T2siHtR f) գ(. R~Y^O3z^Ǫ^ ujH@664e&Mq[SHK?F!*zT< 3mp^,8RoEhO9rzt[0M0geYx)/3oR^F9eqlS'6 \@דZD$wp)vh>ڮZs ,# 2=3[&ܾ_$YtW |'Y%6I0Ł*UA?N42$;8 %"ܙ8Ob\M9HWrAa.#3J 17,UIR~/hƧmJD+/Wۦ@Lq =6dgUGgm?FHY B_g 1m-z|&.-b&eUr\u(RS%E b:vÒZBpyZS,8ӦĜRk2n{tqѡ `PU1 6jR~VP#$oOPHPNB>*P  Ҡ%|:*Io #O-[짥{ 'G^?IO$w ÍBŸL=ձRZ c"WA%0R^ރcH$c&h'RrIƠAŶ:2kOl^"Ȟ!wv%zIj0 Zd$ ffy79U5 *2;)jC q0#-M4#&̋v27~4_QOP'mo JTɵEʡ 5F*+V"}m'j1!"PO!luEVgW(dW20Rj#w@=ImX ᧴?Ix&C*@zFYދVɲљB/?lC'Dv%K7oTmanz:#˵9c => a7%qZ"\bzźB?G%*;=CǍq;L<$0j(45&lT*[ܿ7n<)L/cSO PCMƶ`c8*|UmJKPrn` D\ ^fƣ'NTqvN*}KBVCl;KZٲPR{nyNvµy$wHP[_/y9>eEw? +I*l}5 I!mf+/s4D.VB#=q>#VmҽEo͐^E7'~h.N Z,w0˳b#mܜR\1B]XOu0FðʝT(8UV.@ M}Kn1%P.>4I|qwݘl LA-qMc$o ;$^v?eKn<{bTSq\\M4~tka[iŻvyj~IoI̵p{өycP\ qrJS(25HP #zך*<1 ,tADbA O]e1p@2{("PaAS|(xbBCANicmJMM:֚DE@<-PR:c+aLR8>NHTƘAcS{Q\ ;`tq2 R~XYZ -h)K lB}bgV.IAilˈn#vf%'zv0{nI qliZ uHķ#HȷZ[ZUT,KG=  i Aha&b[]L9NE̎Hlw[rэ_g-_zo 6Z]#&B(SM/U?@3Ox|P֨BP<0$ܔ9f@EeL[\Km.78eB?Q^viӃɚ!]Wˎ9N1C`Wf͊6vl*ݰ+ ,J\].*U0Rɲ@L:׿d|)Rr%48/vl 5H0 rqO2i݌!Uَ*UٱWfv^*죊/vlUٱWf.͊6*v*UٱWf];hkL mF{TC‡$7D"IȍĎ?ȝ˽%3JdU5*lW:si3.iɱ"m>[Xn޸(QV){ݏ;f6 Hf*WSj"e ^׊Dߦx^pz֕丒t5$@( > -Zޠf<2昚IotU[>NA.fH uI i.d#`:ß,j r |''m6bwbzTx-nO]X]yP\6IǔffsE* nUkmQRA^IO.F ݩaZFDlV]*u49&KKxGƠ=ؼ =P T2}x!VaTg[@ԯ­0n幓e}95Sy%B1T?k7x=Fj`~}R+Hh:klYnyGч[S˝6[-- HK{eHzl2[fI:(QHޜb=QO?K\jzNfGO]@)g5ټjT\ Of0V<`?@敤<־9KcѣcP8\Uu0+=?|M& ƥ>(W C9džZW`i=f JPDF*6[8zLPYH].Sq}N$Jy!m R}0dU\1ǹEQKmox/.=YQ֊>X|wjmK8{I)w/AS4BVJ5vM+i6/!Yɐ"$.$tH?' -\ 3Wvj⮦Q8SvV*F**V*죁6(vU1Kb͊/vV*Ux\ŋb͊6*ثb͊6**6*ثb͊6*ثb>bUٱWf]?t'bSClRV*N=X"wa>UqӋ6QjI;`Vn*G-UXOmg] mPzxaWW e4`Wfpև 2&4*4NZ`b#7}*cLB_[9%gPsqVsSnƣ0+ ;b9,,~v&PQ@;WJ*\*}_~1WW)ax刱JX։$㊷2+=~UĆ+˰k_]Ā z@}i\qQ-?LU#n8vF<|2Ayr$rTlȒq$j?yt{O2Ic(kˮ`J/Yko\ X#L*P&nwXUO߶*#@ÿ,+qXڕz3?`<=ĘZGCO mV83krG5Ǽ(># QZw_+N=;}=qU0Ź w5hTsM Cqqa]w|1&n=iVUF݇@ƇhK \Wk|: xaɇ٠0A_ՁcPSiuFiaDqBv3^2 t|ym޽024i֔E< s%Rjb7LH>h=h+P~ЭTի{ By@(n~(%iWz1%( $'$:~e~i%N~TPD]R!q**?HʹZ..fpC} ,Ҥ d=K'j)v `g.}&$dd{-b[2DހjQW_ɚKT]FVnYVDxJhsmi[.)Z=6܀?8-7Iub OڑGPVEv1;Ɖq#~2KSҝ?c4W-R3#NjGƹtTJ}A֛2v21n2@Vr'ŗ%4U*|!sj^V&S_L-% %N\E+6z(U~+yd^#pu{s(7?%!kcΊ 3F=,FYM*OO23BZUaΞ-Yz/WֵUd1-mJ#D5xdy$StnPc #nUĭ︒帒(dx*лԱy% 'QT{]OG(+HZ!<_ hG N՛D&`kE:퀍˺U/,h>,EUbIւ-buTYT _le M}VH^5 dX#X]Fvf$5+MW `3V##n>}ԤK *Rnbw" iSvK-t :sYʦ~d\<,PKrr= Řq97ex|$l%Z+[&$%M0<N2;}U.%3-7I-ͩSo㑦FgC]iZcNJƴcˬ ( =!sEj6`c"?dlAmbsSWnl~Xߤqir/Q,J/@}Ǭ[_釄*<<$tͱ F>XC{RJ۰eʆ^UzL,h^6ɹ%% *=;YA):"Ew<,HXq>-p nC~cNH GL.% j61? 4#J@˃Txcj1&MjX٤䢀-8zGnqG d@4K/1\KT&bpEJ}:)ģc]ͼ,@lpw!HEEvT F-Rin>+ǽka(b؟ wۛ1"a9Т텍zr-S 4Y|K9]ݻzq翀DZ#ܱPrQg%o&0N,Xls]qzaWb{`CO{t&LN@\FGjl+aFקl=Ry/1"L^I8li^b* Zm ,%f"tm M.i~%dLkXX &ޔvqaTS ]7+,QT rmWd5xsR3{Twpw)&Kc9<]b& UC|(  6ˈ7QX h%44Y 1*^"d7rN}geh=ND8ҙFi O.e1ZmîXqZ4|lS4&jo!̠3 sOG"G{(m6 k>eO%_RDﷆGp㑲jq~OOm~;0#*񟅓cK9vd C4b{%y/Nw id1-Uł9@wlƇ$`=)_אq3~~Z8 !P?4ɴy2C13Qm%)!6*@?޿b3ŠA1AF9F{l+R!Bx;zJ`ӕːDmY4j/L)<@mM~ E ӈQ H2 ԧO}!zye'|l بnO)]WU'ZH'/kz"%L \ܵһ{H/4jIc9 -rTni\%9A5J>uş3)CxNCQY/@>?o&"%`># L+yXbf—f]vlUـ(v/:K7AfC rRJtU5(Φ197Hie\TD qxNjE-HD桮C<ۑah3r7@43_*`K3]KGx|$PhuV'ƇbJb&a)S0` nUWXK5+k1^y)Ըbߖ²[''\$d7—f]Wf9vU2Jq.qK .ǮE.Wv*R!V6v 'Rg7ئ'] | Q rqO2n`qWe]b]vlUٱWf]vlUx٩6*챊/vlUxG,57#%\CAmHO]_4Gl1{As*gx&le։-xo'"lEi 2|2#}I…w(W[!ޙKw+IC8!t7 8w2y.:(?%R+&9BOIO6+۩浞>~r~Х>%=`:@'{쌻?3z|Z۞ 5`51IS> VċO­^"ùUݐRFr_J WЊ7`'WW麂k>%TӌPT\C2rlXIk=6ߦ[B]!i*VP¤| ^hճYH{V< #R!4hс8eU<]$"?Cyr%TZpMN{@ vqPSxtm:# Zҕ9#ҖkDdbw%eWગ;? 85T;*8?Wmc8JP1Y ~. B/ TVE:O\tsjx`)tiMTO6nQ~y1ޡyYmJվX\ǑN" oH|`)G͏nbUٱWc{l v=-7} $]ĀG;'1We:Q* J7;с]d=S\@T m.ƺ;(o]U/#a~UuusNՊ!#P첧VՁ.bbz!;lx+]:~P:8_N+ߊ2K'v;*H.G2]T'QƄulSeEZX ezRM aw'm`~{uROqtjW|Yj+WI&b *HNF(] QE%#g]^*VK@vb:ؙRBtU9)u,$$}$G*SW V^!>YqvP4,HUܞbSFv`()Qj\ǓWڣ4m_j%.:{$|8 A-(ݡnh(*ME1$F_=5{f0lK=)Wq;flΘi;*\fE]儭1 ̒rcҠ$z5Or_y|'gaUo0s 񂢠c1o9~ZGMM?i P%7͐95zlI_?8-l-^yu)fت&)隱;~C3=J>_(ar/NZ ]ʗ-=#ZRI̿g50=OLc[IP)ҿ(y4y$GpVxe&_.*FP`>d^C0co3kC4χ|8C|Jn]R}6QÔ ?jiqVbG "=HxR zNp 4Kn8Q#ra8hp䚚䘔ZVYUXVȖst-֢-!$ӛvT1:6tc!5X) f!$ͼ䍎(vX]}Av ҤG|rMr"iT6|paj03Ȁ(;Ei4_,#'ێTWFdPЊe/+=0o|RQ.J(.ý\U~3 ,;&$!߿Rvuԩ =1Km-x+Ț׾BMv+푶p}j03akv~o ri&Ac1\2ʱIF Na%'#ٷM~`+.(?ˍPT$:xIFA=cmrdlv]>FH"r*\P6YNW u1V#A5(4SF6䰭;倹^ͫWq޽{d܆ʑ׶*H'犻 tP=N dKw`=SQ29: z.Kp .,u Z;gs$J aej4\Dr+X +N2.Jٚ@c MB,[za&hM;d=^Jk^&7 Nj5>Y9>L;w:;C9( _$VulB?Aӕ'!:1w Y2%W$ SCWU3+@Ǔ)A-#aNd d9cUpA>=הZRn*A=;t vE?Y( wi45ٍO_o41Vd7k֕)tR tG<,ke 4%nD{$|/W|)͊iؼ,^,":Z刐O_ hz0QHX]nlS#wONVpgaJ z C^KAwmA?FС((0^ Ƞ:{W :k*SdAz~mluN X}xzZӓ*w%iJ.[KH+_?p?aXLXzƦ}%et>ry?V@qZ21)sU'-~ U$v躧'#jqrJSv5\~n/w銢-5(NEAi|<{uŭíeه_kź1Oqӯ`k/'oeUEIڟE17_ wōڪH„ȭ(}=qtClzlB@ƇF?y'*S㖇g^w |'le"7ܑ4ć\ߘd#FDa|0n0W($V5Gjn%$R~|r=)φP~&;i86(WDž$t'+t9(5=;dʖE/J}0VI-e(܀8 xP F%S32BxoK4u6q,6t.i6`;o^g9}-?^!|i=T+kɡ;l `W`-T{[hᶋfy(zRerpJw%L-JF9XueNe䠃AʴH ~͑+n1ԕe@ ep#B? ҋÑAEOO ;56.=~,`N0:cHd~G,¼$^*)VDfJ*kNn#X5?G\OoXHԖA;,)רvhy9=n91$SqDFaWp޸{Ӂ[zLV$JP|6C\˚Kߏl+>Qe0C+P@{^5=;eC֣Bث(vl RU`W;4}(TI0'+:ܬvL)v:@:PbS|M2dԋ[PշȝƩs|ޞ0%M2DL&}ڻgM#͟\݃F̈"7-K lϩŋajXN2:9<3ETg✖i13.HZui>͙?'AGzb| >#O"daړB7Ab7vFJP⎭Jg@ aJnB S[0H1 $:&!vV/?n?L繒#͊~Yi sqvlR 6E] / 64]KC.W CT\pdc &ů~`)R둻NVXq8vlUka ''q2;T`͊6*UgvlU٩6*ثb͊]6*ثWeUٱWf]] oV+\>Z)#yB.ѕ~B| W6'd{- Gz풫u>괭= bX~F!ߝ*:T_io%5!7q3()H.SPWB]zh"!pw/IYN>c24qz%,nOmݏծr .Id8>tSOJ`Bb/C`OE+8Gv45ԆYsJ)B @bL+{Qo%$!%2]_"b! ;튒QS`Fpm*7)Bjfn "ZٮFsT'XT [z&vPbeSaSJR)(Ǎkq vÂ~'U!'%} W|ELnbS7,*eeWo5qWf*qWf늻+v6P죊[eJ*bbWf]kl 2樽0,]vlUٱWf]vlUٱWg*6*ثb͊6*ثb>bUـ. PbJjb̌jM{Vg"RQđv2Twv 85zQZb9&E*h!58- wv+14VR:2})U@CM~R䖮wiz L8cnV*[PlO_pa@8pYB܊]ñ.7aV?)nG\JػƃD=(^7gEr)9_@'E+ۦLcDJ#;Wfb+-&\.:VT`fZ n^Uyc%@[?}z,߿ʕAbO'⯁SF, _M0e *2=q]GvbXȄ |?@a$b lv\eqoKj_,F䨑*%3א 4n#}Q!6Z(t mWג&KC9%#-mړ0C+nw5=d ZZz V_\cw4yτl53Q~oImXw巷&|Z&)?]jo/Ī=>YdјĞ]:w/ci2kO :+)BJ$|4ʀH6ԯ8K Ԃ&ciq{6eʠnR_[PEz?$Ml݄"m֭[Tuηa{ o;pU~bˈkD.:;5$u_9{+8Mv>/auqD,o7C]gO[3!c1 䢍0]]I#lNl|*3;/v9EN)vg\U N/6_UU6vȏOv\-hOS K9z\c7/WT y/b6Kp :+ FHZRENG`Үo J=(v;LcI1F!Ȕcb$VVl xdmImƢe@ E^ :t?l g I`Wr؏{SlIv%Y5?_11صz}"H&?$ s<"C1D9hm4Џ Gj`J2\KҋvF9(qw*GfF@-lFiӂ?rnmmp gdDh;HwA3IO$FY{dI!N^q: 叒.yѣqNB@ͱGv?OHIUá?Vy1iJhK.?W*ǐ:ȟ_h%rB8QejJҧ/i UP0b*v\4숴,i˩PFBسQMiޕ늡2~xB?4iGkb*rCQS^ƝZ||w!ԯ!YZk zTv#ɂE<)Yr({+[Ҧi{4倯>[JTzEGQlyzafg^ֻf)d") 2WJu0ck'8֪zT\]Wzx]!ZPVg7c_4 pVܪ*3J[ |@W䠂A_ՎZ֦?[M9J>[nX&JvyϤRխ|P|JR* ׺M}N>ğ.䜁a"Z7EGR=m{I|ҁIe%e;2 &_8D KPU%/ܼ@I4kԉI4?#fʉt)F)kpn#dfpDUADE M+;n$,C~'`uWQ< (DS͉f^F :S![aae$u2)ؙ\PkqWb|kdJhI٠$U;q]Uξl%cRMwNb-q9-@U^l{|"۾[CۊGӮ;rj[t>SNp4s##=i\Uؿ .7IbTdKY4$_LPP Xa7ͨFK,s᝕ǤGCI\kbRJɭ?D&+S{pMFN!YIb)G8\)@3ZՁ=Ƣ6i>dQJ,)^&aQZŕ+[X!ڻf6"5Z ʋ+׫. _W?gFXbj1~O!ܾ=iև&9q jpJO?]ၵ$LrU`S߷ Ѳ)jQ_6*xCO Vzl~}K8 !5MƒS)%j{t'gl\אڽCvN%.ʆJi(/4e+!e Rzil# w У)V+CӮ-ƒS_U)!,8JGS1Mr)v )#_}6iV؞}A+DTصհ2AڣKu5vR tb޽rbBZ"5 Ќ;u1&QLoS} TѶi-e?P_ ]t㺟 J`>,{dgZI%'zdʎ0op߮-%쾯xCݢd=i[rf%O|Yp3#8]-YdZ>/b+ ^{]"d2(>?0PEmWƹY7DYi*SאMz?PT^Uv9SteE)!7$m-FV\NkNKTBֹMtH;S4*U9j-GZ3k$18e%U7 w»1+؟$"COމKJ?3ҔG(P)AֵRIRmEP8AӬMf6_6ƾ×BFew&l7`qђ8vRMq:u"ը54ZJ)!:Wj_Ș0">w-r9O>'h9" ,P%kȓl|9j4C43sRr68!Q]\Uf*↳W.Wvl UٱWe pWeUӊb]vjvīSvlUَ*ث U ֿ.jbٱWf]vlUٱWf]v*6*ثb͊6*ثb>b;*U٪늻FU|)6Őv/1*cK<(~ N~R9\)BG\rOPHp+qj~pqW qWWo\U n)qjwSqWce=N)ppEA14QP=8r~+}8s+Ҕت*E )ӾoъZUoL)PGN,U^ o_89E>:.An-ӶbS_Xczcbu$O%I{n 3q.ۮ*+rV=% ]S<~J-C: h@(S5a` ۥ*qKXm㊻@ R>ghc$ Z ,UNjִ=We:R[pJ!5LU!jο꟣bR XU.RTҦ>8yq|L@ p+%Cb]đJm.`yq{lU^Uv+&Z6Ga㊷Gǽ+};)iP6ĢCQUp%kc\Mp;(lvƻM֪ծ*lGhIQu* K j d@EHpI02 %҇u-aOӅqqsQ T RhA`|vd,,*XUH>eEn!F(poF6zCZuxAc.[&VaZ'muyaNyRhK۵E2uːG]`RJWk- fQ;Eol++zH$d;cHD =,)P q!_ !5~b")L@Em_RPA99WXI ݲG.Q7btU v]2h=:H* G*\KDڂZA]Tp!Nڸ*3BK@00%JRBՏ@;_Z͚-yە>xaVVwEZF3!_Sn@fۗX$/nz^9R-]\iJaWeZb/q{!B5h2 raKuzEq_z0:Weq$'wO[Efunp.8H/:]&ۋ+F*Y._.QiI}#ycߨ*)r J PH;{P `BmOeQ(n~=1ߊۧ|p׭MqPG*WLxO֨ݫnSQׁq#˷}ሠ*ʆeu߶);1Rҿ:v`WRK# QԅuZtWW!$zvVkmuV <}PrʜIO2ʪXROJr$'l:]ƲȟLd>}X'@jI޿,kz4N}'(&&oI5Y F䨩macvre7ܭs9Ԧezp^#1ٍwȑ{6c4R3gHTP6ץX%w"#f8bOj7%«ukC^-F?g~%|˫Asn*m?rC5JvvVѵ Bqr"V5?"͐LHܔ;F_w|ho KF4HLU(E-#m֝B-xDPᲣf-W j- ntb+N T(slFXD:P~qcuX1Hes=pT2;N`{|+`Kx8R'.l&#sZx丒6F]Pȿ5|;|:lVJ$R5RBO٧0TՎ,q\RGozB^@Ha㉚{l U7 ZQ~; I@1O&$XT;`!BĩKd#;3VFF G<]i>!( %!rf9 q hĒI4Q u"Q@y,)`#cU7Ko}~ Z?6_jAROa+TzOQ݊"v`;X-'=X}@C#Lk<0i NR᥍ƈpy+,:jnO !/I- z*]LͻvЊ˔ E1W`ؓ #}$N%:oR)7OTIpj/^?-i´POs.j-?5" ȹX$o]4EwA~mld잀b^vj1bZD* @PZ\}n%@9IB)6,+}| X w˜K-d0liTW1Y* `ٯl$6j*GNʖÍv qJV* ͪ۰j0 @=ND}H.cHM $dj YջZŸ?݇f%)b|NDǞ" nI¹Y;,^`K9\q6 d)9Ws\@שoLXjq0{o .d(Br'$ut}doP: 3-}dROc$U㈕jH7E(?Lpw4߬]F("ߖ|1%'46kSxם.q`yx04N3\gds._.1}:g+v6qψ2~BNv56جuVE\\[Gh?ώUN{## =AEjrqdH$5&>!LFjIbd_&Ԥ`Y7$GʼnWqj;o\X1plJWT >ŝ/)WiB ŅԑUcnS!_ Z :`Ic'*A4q}ڝ$'Z~CLL!Pc$1lV`g=E;텴;ҽ*iz|*QM, [AGZ T$t%% -c2qg(?Jm\‹S@ڼ8idvV R5A=25" DmL+@ɹamB<%ˎڬ}9"Vd(5VT\ !.q!{PNh6J*IM1F^I#J8mCbx)(F+-PUR;ָ SBiCA-Nk npM.^\ԗ`=k >Nqk3%J75_qETz'q -lBiJ_dWrP?vn\9#{T{z9˯s#+nF).#xZ 3."pXPF6 ]tKBS @ZԚ"[8uiE@B7u;(5qJ I( }$-KI$.r +Ndxwq)ZX9(#`d<{adG h2':r4ևaFtL_IE,%q-R %^cŠXm@Ҽl; hGNaIƸŚ"A֟:6mJw>;.j@Kn2+QB' 6e7iR{{bu,fܑĞ@ܔ|,OFCu+3'B>. `2M˱NaktY;0$n6c`Wa]Pz$)*6d]Ek8*4 nqwU6w8tS8K|u+m S5ڿ$L;"26rT8Ӵp+8Z1SΣ%ݫ+ot.@XԚ֤)"TRmM<\ފ7r=K2g U-pж j i5Ymd @4"^1޽qn/Pk*vh#Q%Swc=Fz? J%a48ؠ=xPHSc큁+0‡2|I_)X`h\lASֽqlc} \YHT'> r\Vmğ)|z$`h[ iO3\/z;Sgk$bqOt4G 1[}G9bG;-'XX-s+MAf@ncNjų"֮،d ͊*d:4,@Γ;'/:8>;(LtfQup-λ!Q@mZ氮{&#m\%2%`F} b}qRv`*qWaAWi%fDϐBJI+ӏѦIPHݻ:RP>.F,o#ʾN5F܍ipKQso.C`,հ[½pܡv'YKq$o٣ u:(t⟫*O.GĆr"=++K)v^f]v]1KUX،l|(v=r)v(T;LR! elZ*Vr9~7r38vlUmdu/N?̃pIv0"/vlUXxٱWf]vlUن*챊6)vlUcvlU٫/vlPث+aKf:0> J&+fCQ\ް.-RjH 0 ~X$Gl(vr$09;0N$ !$Wl0sզ >潾XY#щU!MZe^Te:hBM"5/‡Ziټ~`{d"Nؤ t4e!gV)^.Jygpz& 4ef{{OFb{eQ AO塪ޚDlƟ C6ɆR U>d&'ѤUU*B~]ď!\mce^8g T6ɆԒ;;$7He%E:TX:ܼ21r?,1ݟWk:J@p DYI2Đ݄vm9:Hb:t_T}b;v0oUu8">dQUQOcA1djHWZlxd Iڃb@^N1V(DqVS`Kg)nN(qŦZm*D)B+%\qXvq!*~[|^Z 5U|Hۗ8mcZ!̷juv=c/~Z](z_nb+8aVoA}CJKj,t+IAտU&F-leCO w݁Z} 4^UgӍ1j=8ӑin]U~%pq8X*k RIX\lwUsTڠх'qUMj7l)hwcI S_\16ڕ 㚌7$ U-)AULOWf"v=7Uc~8PYI'\ *_f8U-~Z@[V1ؒ(j?bjQo&.'?^(v-i%Hn;|(+Za\ispzƘtƪ6Wsӫ~ٕ$CKre`*O@6dIUɡ40cAbx',Ҙ~2 (n6BzYRMgYPw5m&+?N/A ͤ1՝؁F,u` :V!!=G\cU;S|z~Bbv$s8#QVf$?}朶&08WH!t>70";mTȦݻe qĠ[p(^VܶcG5y7ZWGrJ$U{chI5(['He.Ir]2ʱ5ÂAv "rV"';MuWEUǦk#M|hB"/L|*?cqʤG+DNf((F}9%xzFz/U쳗޼VSd3:#fv,e8U1Wj. A0W}2fHTf@Zy,[X"?C)UaO$X`)T߯G省<2!G23׭r$qc]2) B]׶f%k2*@8.B T2o.#$Xv4N$ KuiBO1mxb:7G{XmSN[!@ >'L>=)敾wooĘ$;r)~[Ii1_P  32?^A,Dр"uʿpAgڿNK!5($oL迖lZiv,v o_͸U5^GFXM;vj2 q4Z҂'Ī){7EqmP>6p%"RJ]jA_ӉQRiPvgͶ۞2pھ8##PnztIk(U}=RĿ@>晎6ǡz]ץiq| Tx薤35FvdFurn2J1`vXhĊ#$wVPtmAA`>#hא& #*(vl|Gi-fq$ܿ~U0: şGϮ-  O4Iɪ$sY.r̍ U3~/yZA;,mE)Rn18:l%M9tcI-־+ ?h=(3sm[B⤨'aҴEHQfU<4ܚL|4ƫ(|Edb:<@N}qE5;tjT+1ɮˊ$.m_z|TwGGpƝ'UUvUZ#ѸB ֝?^!V]#JT O]!`f8Y( 8NaK"F$ A]DQ|$ V"⊴8R;QGc:lOj-y*MP?>^9ۨ;ua'ei֊2^ܥK KN_cԕX}^ݜ|MjLZMMmG^W l?U9i{1dR,Iց=S% ivH=:quN<=V(-16Q2ƾʜY(&AwZ-GyZ[mvv­KU}NHTk[I2?SN1n%*\ִ+;1+(Si9/rek9b'adXsQWeWAVQx?bJ(ccTH$iYw)j 9״6ڴɂџ~Ԫk(7ZjEldr6F洮NW@Un.!Xb!DaZkLא$: xb^3q*a#wYnX6&>$(~Xn Ɉ@j@$PmbSg_cӗpRא|>`#ƧM)4hͷ0~"ݰ õy1!i0{XQWP8TRaSr5>4-OaH)mOURY*mǗnZN#$~ I4+}qjV) CJdfw^b-C@T4` 0SӋY&'`,\|+^/劕d NN<b˼)Cާ;@7=9"?C61۬lF-MWF+|O)迆MN)<(!wh:%r$ n}Tb_+pm`6 k8$9)qRCd0LJ?P> \ T#p"IU EUw5$*'b޿ڐG]~%HqV'§! nYX*"b<$ӦVzPdzE |bT+A(w0K:=d8Qߡd\2Z>϶m`~=[yq~RQN[my8>s+ /eM6 "u]pŹvF݁aE#u7I4Ϊv5H`q{dU9\9u8XL1q* ~ {erpH*2`&Q$0*euNeyо?fxciQ@Ii_ !(wG`q)H7=;D`l Zzǯr?KVM~"jkmU@)u5jo^\dS̶(YaDLF*ehTԞ7b%*8qWak! O>n٪||1vOZ=1X7<{_|RQ*؍/J-kB;൳V ^?, M4,|WNy|E;酉Aꆡ=sXZu#+ ˬf?vG5:IaWpR@n}ˌgoiWC\MSVL,M@~Xb#Dsqq|Qba$ 0@]3@=PTV+G]Ơ]dF55n=VEO|K"YUza/?jrؽŏ3FZ촭\Fx2L͆&Q)\>-sS2ӶF *=c2@q?ȵa$$& |c%Ryo$ۨ u늻26o[?,PmB:fx0 ۆ2rEZ ii1*懡'#ͤ۶"]|L(N<>Om4DEO፨!&5ͼn(>lUb\?/O,֋XB]Z E)Rr]it6aӄGX} ) ͉hd>G$a] D,9NaƗS ;;x݆L x:\KqU n/YB{g3:mg)=4Tـ{Bb<1􆓐yYbNkRX]LfVe`Wb-(v*&NqW`&zYZ8,-)6pkR~ ,Η7Ղ"_ ]!'+ 6*켊]UٱCbePF_>Xv=r*Upv(A l>2A.-yF+^~yĦq'"LUٱWaށ rqO1g'i݌!0Ef]vlUٱWf.͊vlUٱKbef‡feUXxKaC`Wf®́.͊0barOm_.i;Bv ?vAUj]z'  G E zY@K.džӮn4yϗo\M$6SHN;|)4lXm^y웢*@wz̲z6 rI#*# ;'>C%!tthn9q p% O.Ac,7pUrU4SuInZj7wlŽϖBӠ\AJ`RXjl2@R3=S|]e[KMT#"6)=.vhdaC,(j0k{Jb;M3񚃊1V;LXPs^1Rjb!Ţb̫.Ǧ'TbzZ ㊻)dbv4WSe`]LR`էWU ~ 1xљŻxqVٮ"aA~ rLԏV'@q45LG_}?lcܐEWj} @vKx*Pn,87LT`>B▱OLl thOV*XW,UJ#Z}h5}*wUY ;MrJ<[~&:q"Ni}k8#*ZPRPJ߱ȖYDx; F9-Nr²b' 9TJn6~z͌V\ȀWkfW,i!Ip&œEqۍ&-w)-$DYr[b0N,89Ӷ )rRUvS'TXzg<˨~#,p• Pra{y!Si |*Ӑ7fIp9-nu;?ZLhIF Hcmi@ ރ(D@S}J *kNj8t9Z'p(;SzL+wRvDI:Ө`c}YK?$JFIF\.բI-ݘ쏣B>IH I5bzm,[Bއ[0@L)$66mOJ)KtQ2 N4N+byr 9c˗:Udo1UOLɮ0T=-1k,m鿅qU ض;;٥R;ֿF%EkϢ F7e_$Y  WoV OqCMn(V2{i Of'cfJ j )M* LlJ)Bf"2^|%*S뉓QUUPCq$B??NZj V4M%sJo)B6ߵch\'u˿cj⩮8 HV \Q74&)(ݼ2!k찼WJT8-fCo83]Ĵ}nJGȨQ! ^@ru_%+xz|p5[9!-e=#Iȡ>`W)zLe"Vׁ,[߭:iqC@qJ5ݽhcnзmS^M>XHI^EPEp6գdB;TT8'v¨@֠PT?DzS튍۔TCrNNL’To2ݟ n\OUrVw?QF&Eyd5VcF !~UNIňMޓ@hM8Jb)eg9'^,d4l)GG*L(0f-Lj_ԑFcn1HPe 9jkh15?|-,ÒAgʴ། MOAa:Ivz_OrHڀ{䭟u$R dj8P9w=H[9;6f/8Oح6EEp:sE; ݐ/H&ZVb?$LU>*N1cHHm r̡fZ8E}6Eh؂$}Ϥs2mU#q^&M)ʃm)ƽ2f" H>Ff~:x׻S#m2`ڔHf~e*C!c97q Iǒ{bB=ePSSCz&[Fsq)V2(6n_g~md ?jJ$i8y V:%NёA+Hȶc 2#֟dSe$ vzӶ+]otGޣs#lm{in$I+2y30 oq Zn]RO#j29Sqj|PE t]rQw\㒄]UHN&-~VEWT}'-Sz0L0Rew4?v RTezM/ep04?nRάI)/i9}R j"H  ]dWͮ8vmܓ,ܷSȊVṯ+'7v|-FWǧӅ]8P‡&]ƍ5a5e2Q@-U$OřyaO|Hn49Bg‡zF[+)J g$6b%TģȢP{#se}NG S =OU>iZ5>ȜC9|=)r_~׎mBv-Zʸe8J¨59+P7Clo3BƴEe k`ieRp3NSHꡔ}:ki¥mv1T@Wpu*hG]kDyϾ^+ܰo SY8Udbi߭2z0{ TRxE(wM*Ƥnև%"bTz[|85i<-~"IZUiCp]2S:LC/Bm7"TGl- ۶Xa04mئ2>эz8 ᅖzt6Kl2EC@WnI*2K4q--jk2lc^"p8a .''`:F7>' bT: LI;ڒ=!i;*ӑihEEF6B1\5]_,; QJw'"P!ZZ*It˕~)ʈu"G% E:xo2eڝ<\8;0օ 1ĩ_NvrbvmnK /wpSr03Wq8O/2\}&YmJf 9i爑Ou8y of"LNuZႭ48QDKҿ3dI`s^rNd jE *+6 2V !^vF{i:QaO 9*1A/ ׮Iaͥ`+"CDܤџqFe& i^n"fBM`|)\]N?~Y$]Yh߾N%Ku$T{WKs,.=iM?"acoc՜ i!z 33?j*-wpYRKO,l\1*E ]6*]2\vXFF 8"NꋴtWxԵ܃ƣ'R/2Op,=C^^+棠d$m{XGc ƞ'"]*lPiNvl Uٰ U)vlUثUGo6(vQ]qVbf8Uٰ`WeaWf]Wd'Yz[L/Lf]vlUٱWf]vlU*6*ثb͊6*ثb>b;-AJu]MCBD#WtڄbYA=SoLRZ%C~v/r(ģN8G@զ~bδP:|+k::tw]@Iޣq'n%v(:xo1V% !ScPT⭑CZzBk]Lg\ 剬~)\F٘bUkT=pݾ~A >+G\c1*0=aVoJt4#|wbӠ.qVGF*Or5Fı}*.Hߕ@m)+GNB#}8v49ATS).ߑRC_ƕto+QWǯ,Ui1b n"RBgNNG`4Z.î3VcP -+cXSOv]zmS~VRv(e;.|{mJѕv`7o~*q5$4NYJwޝ6۩1V:(Z'՘8o~XU曈`*ޟ*xIkSAbc@wqWW2@A؟qWW";`@߳c6;`Vi߷^[zء3ڃkCO'%TWʚ+cȚn;[~T&R֘inH,T=5;-v5jo8|ĆDJ m}%?lmMYf]yQMn?͒3Y$Q[2c 8O9okDLDh؁6m/58-KWhW˖r[<s%ʃ0">dZ,h1i_2?ojָІ8eIO2^7_zn1lYlFÁ':-k{`5&ƞ96'Vi@*|r5cKŝG*o[!G4"v;d@Fԑl:LI5iQdr$8צR Z^ ?>\FGZ US< H'qBӀ$ ZT(W.Xzw*^(-zT fZZ߹FKbZ-ێUlBV=Ϗ'ȍjVS$ $2 8r"ռ4p/&-*g͐[+#;Qi&*[FO|&Lu/'q1$lZ2-rc %du_MIJU@$̀5M:U] OslpRvJ OM]f"?OP6 :|&^@;>nI_ƻSĊ-#Q^- !=KO%HS )4C F 4~V#`?Ip#0aH&`7(KU2 7FΑgX׈;jI=Na/V>Aw~}YxXZR!k֝C(C3m5KEdv"8~ҷ%՛iѲKTD~NfFWȴy=^uYcU<(ֿ kRY~DQ[`e*w6zMʓibMpƴ=0h(\[&`R`ík đDާۡ@)ҧ+##'ryE_˚+HnEKI$}び%Z֖ - l[$lPOGDqAee</\&=5kVDB ^1J-5 phN##͇&+(aۖ c!|T4F BI#׷.A;S~GQы9 ZSph%MEMMٍ70=Z! V1K~ۖT`փ}cX`I& HJ֮|kWMj=+sOgmHҤHiˉcs`h>g0R'+Y9^`OJPGZƩjXHgw-"PV~1pBV|%EDc¶Qi.>҄@kC#bh ?[_Imȵ h;S.B1HL;V?5 )ӁiF\-5&BJ(@VTENEh"33PPwJ4UnqB=TU_\F݅7oMҚCGņꦏV5)Mԓу/P 2J(8Bސvp̻庽OL&uH3Z}M> Q[!x-ͩ Pʛxz&{ľ@rK en.MPR8w-8YC"K1vڼTx`Yؠ00NԂiIZFiC0næ(r0τ| ǯs{fF‡̐mij%v5]6(v .LR #&+nybjt t>زʮA>?xƐMW\ b=oY8qnW"ӊHe9)L<0ӱ4/M*P*qWbEEs"KJU[Ʊ-;#.ˆXv),Lm6rXZ֟"C< W%znШԡۮVcNb ГAkYk+dapk(ZzWr 6^Kxcd;SJy9Xm)2EBO_*q^Tu#ri ,YPQJA=wVsWz?kc*r!"ބ7SV>呓-+W 2!\U:&bFN9=[YsJwu2 ÓӨSTk31ac `" $,h\;Z2O*BQAM8'1q9I *v4?*)D©Ҥ}#.) WWm8PUSߑZ|V)FFJy7B6h o [R((Ek޿Nkf@ߊ\%Z"Ӑ?$>yxv)p,v aK2JTڛaEcȖvL`_1(2h 5K~\ҧ}|,mpZңþ%^AXy)Fi,dPܟɞwr#9/gR1e4i*;IN ' 闯:4צs2Zq@:d$+ջIQ z #.`Wd˱ۖ]~E3n@==cCTS{w/ı2sjo%1KKEx޿[F錃6V+g{i e */ᓷ<U6pMH1%N91X,a\z|.aY65raZ8 I%ƤrTˎ~TLYS!Zӱ6WE;*xөyZқpciMb)N`-2 ƅOmAcrfhccau\('E)]JqA`&vH-t”vļhN¸I-5梴*(+[@(iFnfa#zxc}r4p*aΓj[)<+Κ7C*)Z~>0MV+ $gE o#:-hOjd :*|_|"*)ˡ*Ƶ&ㄗV7 Tta8b)N@.ܫ ҧdshDƝ]u.vzEzl~X)xk liס@\}o_ m}"JT_́-JykcK@von4K'**VS-Sǿ~CmtmQEۗoll.c $7"z?ۉΥ Ax$p8r+rM+9c3m?vZ("*N)x|fS\U uB e1غ OנI=札õ$8>-#! zc-KyIg( W5?n%!lҘ§aJ*+w?i-w&X:}5q쑴d|ܸ̈HKu IUx=zLaNr'*cqWf[ī`Wf!ٱHvlU]Wf q9#ҭ}n4l6ksi+y9B4h9a"À(A3 84:DX܀T`kwpciH\z `4;g rHFW we-mRFKy{)? ^63p%-%'ܿ![ܬ*إٱC)vW\UxUٱK*B_>X Wb]&)q~vX Tz9 3b˟@]K'pIv0"6*ثbʮ*UٱWf.qCbeCb],aC%cv^*ثb͊6*ثJhF4@" XWYټ~xy20 ܼQG))L)֡K>2t.M7PZԦoƫdwNk`I5h윑$(jL֭̂$F{#`m qtG -Ý.d. GSFHo{$:6f֪*{;dGU7.dYl P [LT ]Eꦸyۡ XG' R?4X?$ܷPo*pr:52[I5*ImW/3#8`i"u;HREWe7yNlFp;D)+-Th\Ct 1V FJ_BY c4^QA ]z#5؞& i'}E\b |Ga.ܜ@_lD@0weVނ$lrR,bSװ2O6yGvQ[͊qWf]'vV*챊/v:Yx]qCyxG ]f[͊1]vU0`Web͊6*^kw/eQz`,X6*ثb͊6*ثb*6*ثb͊6*ثb,Y;AN*xNOՊ3Ju RVI( b`5?bH8ёǍ;{RMTqF*PК~'v4 )q&YE|: P) ޞ,UOS}s\UCIo>Iޔ'lR."Ƕbb2/&Z?!<]V}?U}*smaTتŐj}*/D t0$8\}P:P߿i=㍽mdv <3H;.(p@Qۉ4•e[L=Ⅺj\"V)Z׶(WGoPujIc t5sSnQޭ)˱߿ V*`1Hq$PWb~B|Sbǀ=8"T!ޜ f%{{bˉI6+Оl)p(%wCySA{ƸGhEk(qWpV:O*8 աr~v*Ľ:BG/ xmv9Sb(EAeAۯ?g6Zz]*ZTqNVVn{|Xiɔ^8o)`I{Պ&rM8 lrRr Xo׿Ol z5@0UcRsV v5q^ -13`@54_n)n(Ujt녒{y|GbN@b%PT.Kln Tv2amy[jmmwXԩqkO-r]uV 6M[m> $RH7RZkgK}2M r*dל}O.%XrlH3Cֵ7ɲFxԧC J *x oדg喊ɹQ6[:}LUR{ҡ4%mJ xi*qh NESq-yw* Bmb@b~8EIU(u'+QzhJWaԁALDɺ +G^cm(Khc]=xsߘd"áݗpE'~\yfwE+mGtX?[wGù dkRwskȖZ5Z1/'cMaQӉfw^ uogݿr$ItR.mDqyH4qwW2IrET`IQՈ@jlNN^k5,r!'4. 4#rE=r$S_ JFqSy75gЀ{HeeeN1}=?gP~wЌy+L_0nY^+,A <Oc%'̓M?wWi"qj}r# đ53!S)О9*Pmܤ9U<[z5 +WkNlfi |ON o8VxۡۯLm@rABý#?n+I;8`n8UN%U%|&?믇"^`yh ~ЅRgp?!ѭnaWsC ,Ln7Ʉ=(ʱ*MEOCa$,#CQ;~ h->nİ{؂MQ(E>vQ_ӷce8%Br:=϶%y~Vn6_e~# nk`B2-/Oyx5;9)Zn1?w^>^+ua^).>StէJ5;)]@|@?<.Z dK3dX7ۭvʴ֠ ׾̽'U` d’]h~!gѨLl$0eS[Y+"F'|s8_nfLPuqCBpZ>ϛXSL!}lC\#LyZ)LlY;(vQV]tFq>9DM2cSZя [/%agcPnd[FY햹s)v[yb`-$W s.-vK [8Q)F  XKIYP?q ?ۜr)ʽPZdrLFN JG w\) ާs[c*XԚ-Nضg^fG\ז4r @ ܊ |>pyb^C%D~!Av"U=0~ {bV8k_no(v\P4 Ní'+VqAr'.jp$- `q'rጳ).BQ4r7&9dK%8-r"CnszSTI6hQ[X[}BKxdGQ%Xӱ0L CS a*hRNNË*ҀGJcZe:qv SMIvil@X"CF\vD =d*Jt:EvPyqBPSbXId(oJ(R~h18mH(XyoZ؇ ^b}Py}J^~>jEz}VѺa6VAL±Sڣ-vq_®@~]qWb֯ʼn7Ql62Eo3v|O2I#J᝼f@΄-RR3-?uPO`@F=(єtx@ND9[jq_,ԯ^Kmu >?(ùj»dÑTS.(׌csO91{ԍ:q]e QQS݅]>^H#ȨddӘXSK!sJViOaTEU R]j|cjQªU$qR8JWLUm]ZW"'[sv-whcf>ѐb)zx \z0<~if#RKWCYX&,~vĻL2 9Om 'j )Xa\QlX6E#ӓh :n*Ե1P+nIM]78@c~SE\aδL) %gM>I"FU? IZJ)]\d:<"]WiǙmSGᕑNMbo!\IdHO#;uW[n4Iua6Zm(ZW$l9k"ѤRpxx5;~SC|>:rF0L3nIez?H4)\Ui%>*ީ^|U߉?p-;XiF 0W ;={ S0¤|TqY'B!S_euKJqWe3gvjA'@?]'*U:G%ؽ>Ml-2DFo +!mb<;egw,g3s "]$RpnP֮h8wJ[yXր($ C$zz6㹧Mlŵ%k&J;·Z{|uyOߝU|Jc}϶=_( iNE5hš+rn2?)݉#4ӯgV1ƻ?_*e O0n~sEYde=㗇s8`"jjwIب=;aKt5vԅ?lM2qGe})%eux' Z rAH}1I_T&k֣TWӦ(ĉJzj["1B ƸYčcH3TT,^vǀ_BmI@spC4vƴ·7 z(8'R+B~0Q;RZ;XDtv߾YGn~*td d-$doQ˪hox~J kȴGmSr#k KGX!^+懖ݘ۞=>2nd#b3$ڌ%kT(\]2RwgO4w I³d͊6;+ &`CWf®˦쭰ʮ W`VGRrqLim(Bstu Ks6(g@{t;RƸYRaLwcjc-ͳw1]?Oyq Lv s΃n:%xO ȅ7*o ]6bjgQa# C@Fg ̗L ^! ?+ .XxKb\(vl!.e|c"W b\pl~c$AĥJ׮G/VXq9*eb\Uodh]Oq9;Oa@Ef1Wf]1We͊0] /+v^vl RٱCbe͊6*ثb͊6*ثaC \U:faMqŒoI{ lJ>VmǑlj/2YI|$qB>X$q<\ >>_V}U% P00~nWOY)Lt GfFҧJ[bp:d ]%8R: إثk@=#%=J~R $hGc$j|-bkө.9 *`-Ө$qV'_qW 0`Ǯ)iF^?`V6B ?UOʼnb*R⮮1Bkف[MRkH>_75mHlVθ*UtGSQo{c ضVCMӧwD $FG0%4B:߯݅V.eHBu i_lp5W\н~m.#w Uٹ*Wh+mAɖorsn T|UxҫT"nͱvlUg֬AUO݂'z-J OOolrDX*TME)J#;{~pO q6aʕm TfU!ݶހlFx„9$|m`{GOH@QH񠠧{a5 $|i^>ω<ԟ ĭ1k_ +M/*|XHSo oNrD˓!?bZLiR>;$<vo 볋,״^UˍW^) + a9֫5Ӳщ̊g}zbUD|FqQדbqNe@%XIJbX' -"bZ[N1ʥįʀm¢>E'_H?N KwpRKLR2^'V.5Rz(z.U,mlM93q+ۆw`e54?͓Ԁ7*k r㹎F83 $WV9fHox xK0PPX&A-xf c/>i?M4,Wns i ,iD5[$zhCƱ@JW'r>, U3GAֿgPJl+a!)bXbyxv;nc9sWMlJH2bH T71AJ#U5 -O7` ɀL;V+xPG?T<V4!JEjzRXDR8T@(z?7/׈OA5>x-)pi@|~"nXp6%7G:'3K k_J}l([f޸vH#/?7R6B~8ưhVBjǰ;BmB> R?1SS TJ0ƞڼN0AQhTԨb)cdى"SGP7f$N \s2%!# U æ1i+ev 0kOFxBajPVu`OGc:ۺ@4-@+^İHۓnIF`4S&zԯJ8~di>[Ϧ^Go2 tbIo `4ZIcqKVen> !NPnIkw[bj; Bu퀴t0x鸠Υl@ÕO8Y2^ȷʬd(ڇl]س/E6nTⶎK#j>٬L* L)s|pra{k2׸둫o-rpTc'dS0*/VڦE&.y||Y,eo]^m%GӐ"i@BSmFNLn{m'֍6y͸,}?<\<.!>"sTbv\{Wa΁xVMIW&Q*8&E=ck،l+Ɇ#w!~Xd1֨^ݒVS~\@] \%7x!QN!᧾mz +>bI!o} m0Kr ٦Ҵ[grUzLRq{妄)N* +plJN&X*Bt0G5H-kb:t9nW!-ސDr|}P!q%_q!rG@' gP2EP "7Q'A9ߘ Q{#45;ڵ`z )p;eALc;v2$/ûm=7g'-BVA hr /?xI? j+冚A][Ui,F닊Т` %*6r W' 2eRKF|xn>?;d"ݠ%S3ka0V=x9\ -N=_\ 0{S#J\Ԛsf_| v/޸v4C} VLZSf-yٝ*+OIj KJ/E(<_\y) 6 a>1`)dZuaB6Lbbt1| dnYM9 6uS;z$MBg5bIl 2TH 7]ںyoJ"ڰ!>w=w3qVZQMWCKڊ6̥VBj[z8O1C˕9&IDSjunoW2햂jDL!bytlܷ?~v=$e<]:|ޣ>ĝ&,C5#IK\8#J5 ӯoUSK.dʽaKCM͊6vjv751WbV t8n+m vU=pq2pnmJ..*:e6YPa}&u9L]5vZk_yZ'6 ׌B3PbTq i/_҈ G\i"Y#*jdpXBC߉X+k+8Y pՁ~WI^\[^vlPR챁.́ͅ.͊6v#'倠v(0v( 6c4|Zr9 P/ sB_ܜw>ӌwc+6vlUٱWf]vlUٱWf]]]vlU}Web͊6*ثb͊6*ءCv^*Wf*zoda^&|8$ǒ[]c^pkKJ/~bXڬZed)fi,%QĞ&CP ,(A~Y V؃O Ąh 2Gf.# \7,ao9`˒},Ğ6;oG67ݡb>W 7И't=+RYRzwjm):g+HkcJrf=F˒@PPn(_RW?LG%m)?e^*\W R<@=q0!Pbm…. eebwZً:{Ƅo^OL6KSO(=YRp _]Dl>9>8U#TQ@;fnaKYu.F*vl)vlP4 m1V];0]bv^*]pbUَ*Uنo6*l*l *죁]vVvV]c灦\ f]vlUٱWf]vlU*6*ثb͊6*ثb;CDb;(bf,v]%zo~]CǹVj)bŚ2Rลت!+!HUFbkZL~Mv劭8 TvWfqVY4Ss?NyPjhVb`xƀ؟7JA.idׇ!fߵn6j 55ت#Vv4}تFP(N•\NOx.,P}k۫(v?[bsUIrv?/f)nڟUeZ6)RWb1%$"B0㊪P>]X~52OA7jҞ;U«L}KqrTN+QV?E bU֕zOy O+LGIZN' MEV tT,)vPdJS`K.*T6]qWbjRGBoc\qf5?w`KX"e@x\R#*~ثG.:bc_?iGء$փ*ğZm WcbkJ3'C G1<+zc XPq}|Pƫoҕc_v-U$Gl iOˍȃaW+-Xo|{cPUmFVBkw\O:Ha8>X2Ň4U^SP QeLR~#ǎmJ[BZ?jҘ*nFÈ=»}uwAV}|),dlCTC{-ZUP{d S׋<$jEa|CW_}lA )=1,z-DM(HS̖}Ȣq|?ؕGYafa%;pHrdUzu:c8[xӦW$I#ԌL G|vZdX o٥ة~C4Z~)7*S]eJe55bu+HI9BUPba'K:JoȱH4{aUDt&̜9R8ںTQ5?cKB=O2/"x+>[`g9=@MDCƦa~8i| 7ZV̀aE$҇hgqh@pZ]Wpnj<0?"de+t>֘"Zz~JPSOjEKUYlMaCژchޔVBvQC\]Z)$JޓXoڇӃEkJm#n܇z~h@SŔңuy'߅| iK|CqO{7. ANn]`CLś~eL@0 \@JO ߯xT:2JAl*?d*j`Ҟ-b7GţNrFb;!֥KI[('ddƙl)S1`+4!"4,:T/ nrB&4db[[cR(۞Nz(Mj{.8&|rJ:x{bG*jOS.2rK1h0U.#HHȐDjMٕRوUd(%+<};' @ʟkz#SZ᱕ bڃ}`]khOĵWm+1G Wi z%WS!Z@$-/gE2JS7XHDi}aDe |=[`fDIq`ԧap"vK}5y\h]T__}1Bk4Sې`,t6i¿ 1Z(]:$uy)d*%k & o6 J`,n |\oG%;6UwݍݴJJLx51,dy"P4׫3|XOL'dZ_\0)@VkE`u8VP̊7V$\Ԓz? ?k(UBA6prAD( !P?kj\ K4v4۫~7 FҝUp7eat StG4?)KFRQԆ +8 n2H#F;M%6$ l+vAS+I@AW\j9 N܈ UCM*HP܊wV r ?D, 'm*fJ\mu2Mo|Vԝ7D!' }+SET11N|&۳@|BF;vJһ{bSv˰`*HXRnq^p F͔dbޕ!:1lz屑s;h兾% |'.3Radwv+upfjbӰ9\- qKn*yhB6dvYt+Cޙ+qp+Az ͪҮشbOnH;Wv8< |Cdd mv90w5ˁv6p 3vP*tglU*ɊH8 $,8BdDhv?gvou«:S#ej>Gt8 CoM S)R-:ԓ5\M]G@>K)({瑔1ܓڬKҴ-a6V?N}tQL pn<.~ၠl[j^75vy~+b#B-s8HI㌣P:NYT:DŽR2*WjH= +]bDm"*փč]|N?McSRsLm[#P0'#+jAr_4,X'Z)ilH̩A>[њlz5qZ6,@U7 'cSOӊKCx0,(U'?%*ZXqxSGߕ[,sUPTanQZ.&)TXG'au5,-ʘVzxv GAVSjNXFQIxm pf2H&0^;.i["Y&A#M?@M,ÒIjxzd&hJbIZxq+PpvѠ]5'1F=2w.#ƽ7U̠^? }4!d[XەXPVy|!آwrX[k`v#3JnS 6 !qOl5Y$A(0l>a#k0,f ~ >c#1q億+Qj{J_"FX 3#]5E>pz$(S/Ȧ+[r(l2OI' fUA'r=>+ޝEYɠKPи$RDF] "^UF|,YHZE7y5ϓt=2FXZ6]D ] w톖RI}oljt ERb6D֓8-Q o8p9DOCR`xUcz+@H$z#q,!}2+5V~!R?Ϧ<{l?4 l:}e\u![y'a!43'2˯O"Q 3f9pr*إٰdJ6v^)vVvl*FOCCA%آK ,l<2a@M/>ĥJשnVX/r(T͊6*62AG4.q9:y6*ثbͅ]vl ث*ث%ٱWf]v^*UUٱWf] .ͅ]ͅ]1].ǫxepXvlUٱWf]vlUٱWf]*6*ثb͊6*ثb(0h;ԜPw*w늻,׽7b```(iT L7=v*cV>oœף-~`9 TGv?G>ﱾ b2o^goP0_~{7㊴1FCȒ8OOYb`kRccد] 6{|]GZb8 )Ryv]1U}O`O2?͊Y\Pq;={|UuqP0݇R~#}h۶U>TQ}D4=OqqU=?|WYB\RhR Ib[T?f@Kֆ:`UԁvJAEUnC~uJܯw+HC1z}PU':*xbj7XW]da^OS` EO/ Rj04؍qWZCSZ r==KO ;`WbÑ(7SAnإSɶ-&'Dۏ\rZo/|R㊲J};8Y\ߙR7Oݿ7Lv,ZTl>)vToV;r@|OZa;ȧMmK=\2QG\ ('rG#C^*1Рp׷EZ8Qk`WW[ĭɎA%qWUT|]E:U?)4lkŷޤWiN1y?yr[6:|}/TjlJ=rAnǎRZ]"+V`їGHuG*mR|rԀFO|y'(ߊm6Еkp !aȂr31bT1PIb&ȠC9EKO W~ M ھTT}=ЧKA>?Y;fJ-7r[m}dN"KOqn"V4" *zTI$vpȈFOOT!J=Go$`::7X-8=ǥ:`C"QwzǴeRo})uGoG6$bpO!E=7p*0I-FIҴ'b1Z] R8u߮=T, CA,M'*! R >Vx`ks^qN%pP̕= ~_[kAL YoV~hGkB8A;\Vb"Ǧݕr7avըihkzaʹ2$!44$ܟn~ QXZBEԵH;t针`UR=r/yOFvvz -Bu(VNu1NR9F [=,ĈJ ʊ $?gcTgCF m˱邞>kSn#+Gsk H‚8/0ר/I*BF1%^8VBPI0$+MVܲZ2+WE4'+5*(]#D5Z,{Cm-|Go$eP w>8IH݄G| PY}u2'y\;q|QPa֋l#7Yq*C,rg( 2XKtWIȀcBm 4+(*[x X6# -ZTxUwlR[GP{zecg$ҽ~Kly!%jcFP?fyZ(Cwf4ىHyLkE4??2yf(S qhzd"Z% )~_~iGg&I,|*[NRw ƅԓ^fAG'8,B(@rE 9 +dlsP ,~ -d{$E3oտ/X:NLD%INA]۞߱(XU~ڛ+p4.B?iS}?o@rp hHoV?Mvq\&[n*_QEiyFjWW8USj>ieb_DI$(Ti:P [RdzÇsRB^aP| D |C2-0oGm6VYH +ޟElsnjM+w"$qV85.)܂rGeG$vX3R{-~5_\viY*t_r{$DJAK~'̲ɹ7Pw!HzǕ(}ZHV'2twPm2[8 5K">^JiHehMGM"x+rRC\»Y YO g=v_l\!? tJ+6^#AݩZ8\6-k_+ DΛD,Z %{ͨNXĀiC&1_5'GuMzW#~ff Ƥvˣq6Y/F гrcMz?71XڻW~⢲HTPڔ[Yluit37)u RVnn 9k< Wzْ!Fgdu{[p' x_dS[STT9Tci)xt}CL~"z$ĵNXlh8)cֻm FB[:|rhT5I/ hN P0:\R3+ TҝMGSnO1PxS 4'voZ.ocmm$I߭v\ >8hmv>2`XwL%Gs[ u6rH8--$2wS%0:ГdaZc@i`7szA~!nC4Z-^ҽY' ia!T鍇"pŠԡ-6=IcF6]GbAX8Z4}nr ˖!]VDi״Ddn~,D/1C#j;&ڮ|}\h5JrjSl;zq_8@F,Cb?:S '0N0>VN]QNY=F+NErChOqP5Ҿ1`` T| swlZՍ0##J8-H7v%Yc`V|6Rx$mLa3k9@vH4+@"dsy ]COHqQ@KCia5޿H~-1@=Ei3}\K=H RqEZ{bgj0!kGQhi+ˆcPI97w!zEE؀VQ؃\[)566HXs dHh˯7j>l!BQX rzw68jNسbJ#40P(O6WLmBv\C)$x+ȶFEFaƸMWS2;'rI")|'; T q:Rn c#,HvH=ZIB ]~l`(@oZ8}n> ҤL*17QIL5Ig>xAܙOĪ65Wul@˱'qؚZVUŠOoq{N1 ԏ-à=wlTlYwtG1v|(I*yRGRv5Z`zmJ|:޹D 'U$)CIjkR @ o=DGE>Cmzj@d˨5iʤ;Le(9PmSRpRxv' \no,:#Z $?H퐧$zF7ZxLE l+$'"Y`É۶R-Ȏ2c呓Œ(@q]jqK]LzvȖvNlY ƹQuSp:VE: `vsXk c&'Dni鎤6OAKs<$Jl\ 46Nv  qx1gu)N7*A$m$JFݩRAG1% cLLEx&qQ#xB:w꽲%N:nkZҿX ZI"yVSK{m3)Tj5l|?\)ę Y 8ᖔ9ʢbhFN>^Jr0 f1"ܩU4Qnod'½k1hSFjF)Uo@0i]LHۋ%e&w1(Bݥ_uՠh۠/r0)=EL,G]tQ~;vT0­ٰ%UJWLU٫(`Wcyv,G$ 49·=GxwCvKEYW$@ܷU|qB?4UD۠5 Dt{uIF X~n"N=(s$do9N&@dŅz2CUv/0G j|k^AF[`'{T; W5±TB@.E>xZ xœPGʴ5$WbP170:ܞڍ݁\qG}BkN'o~) bv'*፷ƣe6 U)SȁZN GO*cA<75yք1NK#lʐ4?ksvP^?G8HVpC݌XTG}q¤ӧvڽi?$ OaB{VĝX RzWb}BEw'߽96*ہZ6Ǎ|)h$ܖ{OB?x?, X0 6Nߎ@(']{A:g0<޿#+T}@K't,iӸKo!v+*G8}m/'O?rL@IuIƭI|-O`[f,A(B[rͱ#uW$|3 LwTny z!RD EFl`c# nPeD*e۰$tyI#| l*%{^aZѕXT?mH0Mxbv txW Xx$߿e$'%:&`K"C`VҢ8r[<@;e%C,5 S_ˑ*^(K3o@v \&j CQ}[ h>5H4C@\r6Yp*[ujDhAhhO/|sB0 ^P*{S&ȯ.rX3!Z3~mƫ5tʬiTjt>,tw!J+ף|=*Ƥ\a1#@(jAZűxAR 9bąڽ*Bu>]3Ldn~hY ծshjhHנ- þHw;vvȒzߦ54Mrc^p6bG^)[{4hqBqd:mK*|Da4ei˿z§m`ƽq=!̒{~V"4#|滝Ut/MM{m5Bϸ/.kָdh{d t1 p̿XkrrT6\BơTbw@*8HLEYw~6$M{XˆyGzTo|a@V ѲH6ۉX]aT@p6ztEӑm<|pB7jPK/ªA 8"]:k}^pT-~XIBwSQ^g ʬb O_ o3 Q7jD U`NTF&- "@Ah($Bj LdQNӴj$%oǬik{n9U,%i#GJ88O$\͓/"ZιtC=!ܝZ{@v Gz#4{Q#9f_nGƹ+IIɖg7EpRh᣹Ӡ8Ǿշ$*RȵҦq=Gq㔏CNxH ܊?u.@4Oph,>?K"2')T 7zٺE2^l=PA&·uѯ滴eR*WW(zquQTtqF}72$ZnY2`E?vɜN2=͝O3M"ԡH]5QC-bӐE89H؅lk ;P{P%S;ߗj7RL}m~Z[R}2 J ZՕ6,}'N`(Oi$&waY5ݸtpxxȴEQɾ"ڭ_lʭ[mreD"=!CH I#ȝB؟JRT0u`F7a;e#nmGԫJ:ƥˁn+M{ך:ܼ8ې-~\&_ٶ'bk!iX Mӻ0|%*94j-"[8's Dt#.@/$N(U|M2خ{aoB JSF0A8NSVKYۛT r$7)ZC4ɖ]w?]8YRFƿ#_|=PM bsdL m;_͋9冯@Ʀ|Y}8 |MEj6-C\BX_M q'4\,6؎x^.6,ۀs˹9.3(35Y,~,BNxxI\Q@(E ]F_KI=jIx ?rR@]:rPȖ[>4X=V&&UuS_dn24Dٍ;ҸQcu'Dq5sH X.ZtM+_ -!ܚb@2& f0^+=W!AX#j.gZ>A r2'{=C1;d1IKұ PG,GS.{! 4V  -r LPE l!4sUȐ )uX@r*1xV0x.7. R㙺n֛Z#5x`6}mr=xҘT8 dx[H:!l-Ӄo[7˖[p59&E6`|qWdb槅 NG/wr](cR {b`N$QRr$\Jђ؇}e&V潂Z?X"*S琟2E@ۃ;"; 2-v1C3>xحDŮq[0eܑQIQ܋ v:y%fv m$ma&@s1&/Q8\1㊻00!kijaa(26ViRۜ1M[E7OĂ0ѓuCJKQdd%xo1Ú.q qFJ+1;t pkuȯ a ەL&>~{\lz)'M'8 (zW遚mjI&j>WnNwnNISݻ'2PI)1c5Ѓ?,Y6N H~XO\YP3?%02V2*?,@کaG Oq&ֈ>˽p  znjpOLY7C }#㮀WJ `lFPPx묛(0Tx;րqcu 8bsRO@JJv48xYEp|z 6Jıcj3SSSA`ݷypm[<,S$ rODBh2.$C\d'y߳J9)¥F5RMсس Яl?;Udۮ+B P<1c¨퓣]uvڬhǗ!V5ZPlrbH;YEp^"$=MM1G -Sz p ;Ն)v5׎"XǤlI?RdT`WcNg4® H)PHnU@)n(.Nj6H(NF3\ުw&F6 iVC8EAȵknkJA+Y0 q`zF}]Oa4XB-T$Co} yvJjF.&i_=CF;6& 7F儌9*Wڇ6ȗQ64Cы6O ZUy^EM>_sM@,;oLG,둋?, Qq$ϡ~u9P \4r$s82 TXq3J@͸iBkP2IywLdLw޴ɹS3ӍR{bIXu<(v6 KVAm0ŚezP2dU*|0WٟUUv{&7ܡ]Ew'}p5yC *N銝eP qa6Ù-`W ҙ! M4kڕE {sJm*N7ysM^ }`N XH־S#86R۩_{1v rGU؊JNiK[`+odn{&bXZF;*):x$ZAxʰ| B Γ8 yV1Kq WܟάO5T% 8Xz <$"ej,kTk25 p9"+iSM M? C r<hi+qc@)QeEKsQj ,W8&mB CR78-$L}9?~W"e(y\3Vt=ݐ[KP|#"5 w~*bj3Wz[++@(  Tu8(8f +PWSۉ +֣$I^*niA?bAt]jzJNȏl} ( Q. hw^<) !7YWebLQn8Tv/{Gq}Sr!!݇Z)2)v·C̜32ܴNKj|Nl#7ǚ_#V``3]#e2z޽npT#JM@^o 6˄&J\JdIps KMeI:11,H&ef3lFzf9qzW[JE.H2Gd\*Q`ap< gdGNy 9O0I!zc+ 60͑KqWe*FO>X \ آ` mvɳ@ˋ^NG/V4BlU٩ H(BjܜdNMt0"6*죅]vlUن*UٱWe]vlUٱWf]]vV*;5p UX%xPإٰ+SvlUٱWaߔd+|}Yhv0Hb$QpolƐkjw)xdXCTOoNGd.wC f5cS*-2?.kCSw*Mv@S0"[,`.x*0kadEK]0DFiA nQ򾌓ujXc—a,V{呍8R9d&m[i2 o{! p͸rH-^{.MK)ҙS!cWeWd)jI իڃ-.H-HbZVk K a z:hT_p~,96rzLP(U٫.ܱKXqWcհ*1KXqWe`Wf®F(v6`C][jbZ]vQ][pW*aWe`WeaCW]⫲c灦\ vlUٱWf]vlUٱWg*6*ثb͊6*ثbEN`lUٔӮ*S¿oM-WL^vPEaIi:M,e0?.(pc)ƟS>϶ď~TQUM7?R,Rw?N9U6~@CSȣڍ 8QstҠmUp+G$r${UD!$`dUi>2zWobV$/N} KF6*HRHތ 1I~>]b$@H#u:{PS u(Z?F؄}ԓM녺ah~DS#Q*Pu4"0CIoRZNPZWbfN$Ď+j7> ,FIjV[q2YzVDO|UyQ~ TnBx*7$Sñglrr.zŊ\l)!$v o4=>TrEE8*qV|*?1RPaOze?}gnNm< ^ZIǁ jG 7}ircǚoݡCʀC4^fAS@ m9YjNH4#a"K# QA$$;fTԑK^$o(p+^* v^v{!Es]"b'e%8@p0g8Xq~T( ,@ 4<>?"B b Qb;u80!  7B:N +=H mȮٍm:M,GGNM]V;Ȋoa1FDACB{w(|zP0kS\vT)Φ!U޾ǭ13,E&`Z-"J?xӦ''2ӡ޸Y/knU,g8P|$='=킨rjvp1B.hJxb.I4cĺ7P:*jN WH@c%\JI>>5c V(vc;5kS Ҳ7 i&ğlb(AO 9vM%VB i&FZvq.JF;z37>jzK6򙾳v$L6);`b:R^NYJ) 4B&:un9ʉ,%h2 /21v ;aS08V45+>#?IL V&V W$V22 H4;^YNmox?֘[7^./ .SkR\No٨Hb8C%" UiCLR0Hec$ * t{/-iuK8%oձx"yș~St:2SC_l`RMNɭYHh)߶iQE[I"&؊ qMo0.~S{]*k45/Bw NRKqX,h(ƫ 0Fs$rlJKVM1I1<$Oh=Y,~"\6R2.!U}CPJ97ÂSR v*pOR8ɤk@NU Tt5II5e$M.ګ@ Pi,K0G9K W ' n=)WZK1*'kܚEyS$t!t> zx iY<#/F8XN`j50lk-5̉ 1T9r?,(*6?qġ I$\OAiv# \@bVBWiiMRG#E_0QX?xz/}` &1O:4mlj<%ڼc!m衋S }@Y#S׻6)(h:`}j+69P1R 3*upePC`jy8!8*eAHo;ӗ#*UH׃! 'z1ĸC~Jr(mނ+ȱiz滚cY±x%P@Qkh)HL H? jvE~+%qy-uAJ|h\2=y/4FB cۑM3!ٯ]͊X5r\5:/3vRpZE:am+jjY_$5zx* Џ*qWNƣT}T0ŋ,VNB)| s3i$ 4[c#KF]ncX -\ piC%nEx$F}ƚl hvf-]Z| oMyPeNÝ3˓Nj‹fnX2W!iӎ)?XPA>늚#'i[+Dhx9 4;eW؉jPrlA]}+x;_]*54;ac^_2iNē od!*:R<\Oܖ{ @Jc8Y"zbG!54 .V$n͊PwNF%C ~ \"չT2cg3 ۰2q "J(>#,ś6I,&\? ń2SNeQE~yL>aEM\:ꭹi Gou|FZ"  gե1rI=>y7.8l $Ŷ*v SR9"̤=).# "Gz5XXt`x׏«֝ PT&h_'oŎE(Gwn#-=XۋL@QJ0 ^.KRW1'|;*]N!/6ƀLmGPxd@l-/Ĵ둶1l 3Q({lIaNadE,FaWfʣWc3_Gl7kCmɉ:]#A IAPunLzt0ĭ7ɞxr4ۣ%$l;&p'K-``e=UV' r+M??qnGϦ%^\$J}0mסvu͗T2)h ;rh jiwQ?5B&`treBMH+Orڭ7_#wMS\R_58׶%l5G4zkvM4rǵ^9QuST^~ sn{X^÷-&TdۦZP"`4vI+ 1)ωL']}3v& 乎[*)v^*4dU٩1+I]dJ EȫE%v(A e@ˋY(jhlSHȡS6*ث˿Bj_ܜ1uc 2,9͊+ .b́] 6vlUن*Rثb]b]v]pX*UXUٱCbe]v+k3A*ȦT[pFH 5>c'Ȧ]gfB@>FGQ\v)> .]υ1}nZ85f?XXdH>gV25UGyKi*co!.T|SH{30Try/VŒ!$T9JݱV釶ZzsKޟ$ eF07ɮh@;q\ڄyɣ^jixD CrfS=v.9mRQ) Fz 6z늴qV;fZXMŻ~c*ڄ6s`Prd#)#܆ⲫ2r/0+CR@}MBqӨ犭Oltq8PR j}%fQPVreP :קM(O0X_0* HT?hA>Th(wc'/g'm7 RCQ?.*vlQ/ aF$IST4WFO| (xmbRXt)L,|'\ {0芐U{| W9&lyܶƿ z, 7CY jI+ VQzK/tWiMh>_/-1V: Fר7nD` qKTrpXǧә\1PU;$l+]hk;TmFPtݽ\rK(u?>1Ϯ)P=zTt=7+yW1m$Wd ŠC_7qV3T0)Ҥ},P$F*0h_J.B~-ȡ +)ӆqP%@ǙYAcAN<%r7޸>վ"Qu0RR!U\UsS}6p-##U$rmFvĬ+^^C\NQp7)7C5J6q*6`.Ɵ،P|Ȥ3Np@čRTSǯQj!f{}͛MGlmIp8QZ7|/0/2Y`׵0dQ r;`%hV|QkM>>91#RP~A܏l*:7.iJ-hF¸G xUf(7x{`JVn]0` 8Tp?v(vU<*qM Ƥ DA Q"Lp?BZS?RURcdO uWwwCo4^d5D'ޤH6=zmLK>SdHe@eƷ{V2It+xI:LLd5J Mo)ɩO"Êm2njض9#­[T:ZҞaƝkG>5$x&A>>8Z󖣫A%ԅ4 ߖ?&{rʼn5xu)ALc*ő2"q$Tf{ޘuN14q.vt sWZ,9Jˊ~)۽z(~f }v LV(7_lG[5rbX'4 wb~v-YB`%5uK|uؤd'U}5`*pjYC eI$#*jɤ7s@pM~~FV4@#-AID5&W ,Izֿۅ) T@>_}k lcSOLCpBFBI{\4翷luVlipH⦇8gH2ՑXVk1!eW,(:bIfwR {{bYYA#N !-?m W!t΅kOʑ:y1pysKodg4Ѝ'+L(˥Ja^5@jN#rg#O3G*fSj;S/^3P ڍiQB(>3Ҹ=m $Vފ W"H']ؙ]jx~X ;$/|{@6*X|Fီ8۝~.{1J10m^y( M %M#Vx^P3ݯ5*k_lWv2zI;; -(;d -'-4M0uV du ;o*Et2-RڟoazL1(TQErQm+I〮FF~ PrA2TsPrRÂ6ȉw0X‰*NI{U*X8M;u1eO}xӱj*`e\[])ژR۰]T$S-uhVIW)8rЧ+nQE~=y$Zw8OBZ]rq-#ƮW].5WnqB ]4+ڛSj<{k!hUD8Ѝ0mYW5*@>y"nnKr=LR{ S!m`'qĊd7.}_).\?D+15U;wF-! :mi7(0qXj}Œ`=jOo,+Jr: 7c/uKP _J(?Soq[,+BTT"^+5#i-Ob]9XG[\M hpE +yr1c%"$) ~9QuYk:@cbI'LE8[ȱr}v SxjWS|b8v i 6$.u"\V ?F]ۍ,FJKpI.OZ4caF Fڴ5҄7~}hJdrAp8 텘^klY#c8[ P x ?, W$>"ʉ|.׮ l2qn6_ŽE 2NA F}Zg}n.\wk-zd9ڟUN@jjߠ!(ԟonm`h }m퇉 \+Nrb v#jx0.A$t Ȁ+|OۧoG#dE7c޻/`kE&~.?B`.4n-?FX k}*(Zr Falv>&(.ɥTl pŅyPk+~{fP՟cNE }r4#]t>9"?dBKYcWq0,#ѓ*Z5jw;:S|pN4kEU<+Ҿ?X2PUðƚMlh"=5 k;M!= Q|zI96#-zQy#wbŒ`0Bdmo@)ʼnvK|#,4IeES@j030CU#o8fR5i'&XAS)nj; aKX64^p %~XKy &،N>s")j׶H=Q2! Qw#j/>EQWnxuŕTנXA#$e%j5yI^ʃYmʆ(YŚ4F ĮZR>lюӭO؝5$rJJ~A%z?djt  ꌋ}HX~\;L|e|K,ñ;Y;[;m.= S%FW6r 1pLjQa~{)=~>]6}9{915kc\LS+5/-߶E2;۾FulO`;d~z l~X+mW ȒFW Pӝ:{bvTj$d;nj`# ?|_\ֳG3^;oIdbX$n{䭝\qL)v ~Y5\|u&hn1CdW[N X֝`ymD6@Ob(R̷"ق|}Mݺ,i9u45=`Ȏ+|IJSx*]G+FC/\Vmӹ+\10@r}_CM{@X _K) ֝2-YK2x)ͅй_#aJ'++vlU2yE>-݇q(Pv@iuuEUrM|lZpdex1)wiu`Xt$otSuVX6!qyz'62ʢqW!5Qv퐤-\-ŭݻ rR;y #P,-Ifؓ/hXNnycT 7B[LP-%hJ`NW)lGbFaPZtڽi)h⑯kU݊z}Az;銻,$_S\{b~-7*{;M-'o*Eݫ\U!+UwIX"} U*"+ K+Z[1^aMWZ. jVc0JFc]2j۷ъ,\@5GϨ|:B^uOaCs`w߰?3 _jvcaO`U|aB&hkªF&@bw~L C7"*>&חӷZ!L݀siɫy#$O?lju?jVUGM>U&7R7ߦإجwڽFٹkbcըZ϶H$Sƀ/Ikt.'fbBM8"ZPlO\Y-gZ8v[m +N\;bVU;_gXʙ(Ù6\\ihZXl~/nZTngti݇1UƠGUۏG#R2*J~`*j⭯JEW~L `C` Zv'+_RVAPG؝`j: l6 Ӯ L4忓[@H|J::-s=Ѡ4=HM)/ES!_65wH _0E%cvnuM V1GY1 莏Jp>5 g ]FzZa,bQG.&GC*;ѵ$"J単)]Au?l(<>Y$զ)vj[̱P/-,{_zjl'rw23CCmaaJʡ*&Uf1j/?*Es%:ɂ%lcVȮg,3næNHl¢bïLm#)I9м%14I$ 9F%`GZ|UȠy1Ɲbh1"FS_-F璲 X?}!QhySop[ʗHӷ7Ǝ:O0(XxTěRSIFIYV_ыroU\RSbZ.H ba(QG~XϰZ kt~K{G(RIAEUqXk~=YؼR[bYKR6CO`~bFD[i4 I!49~Տz$-E3!ߊJkS T7_}x~-jG`6뒰o!" QJ<739c]1I*JE⫶A'[m%KޛbA莰&! @bsŒal+B>2P~o_܋T҂-Rk (bޘ5"w?(pA <@c ,@߷Eت~+{.M'jc\tEE=W5Xp[ļˆy8tQ#1U@|qҁh>B1,:t ( 0҆GT/frd˞tH^ódH,zw K<:V4_\|t2͆#gϾkҮ9&ћd\HE?0&-8tYm~pDTnOK"Qi7ڧr ntݰNrxۮǿI|]Z֕M$3K 'd5z|ѝJ:'#DZl"3LGWH4-,_)2]Q{ Φ>aۈUTb e| Q 8]4Eji Hj32"]9XD6bkQ;]PF(.ɏh8yU sFlcԊTeM brSHmsUX8;L3YSNX ,t*쾸xWbÄ[+.1jM+:o Ō g\x畘9p%)Е4뒸|G*!" *<{vA nB|VU1bVL8)լ_ 25rlM)6`'-l%W.^CTxW%a+Z2O݇zMZm쓃m5<#(Xy`ѤK3_ \]z^Y[bʢ|'5!q[$4.scT<9ޟ-كl)MaE庁A]UZqf=ѣlņsIk]W;uP<;<hޘx,[Ăm/KSmқW*u+HZ4Rr j>G NI%ؔaLMn0>Ol| FS}Œ$+ dMx…S'HDCm*Ex8@$k CC>۾D8KJ;]pK,Xo)OŶ."j퀩vK<_N@HEPCu=N£t啸\!N` ۩;{aA 'E=׾:nBҴɰ&l"N§Uq)&E]z풤уĸ l)W%&P~-:{ PGnqЏaXcUAVѐ0@R\6vgޮ0"{#ZmrL1Fl<2V,;m" -3S +C!Y+RsuҠ{@xG! 68Xr&n>0eikŔ?1R#Wb<3T&%lR ,ǕqiӮUgRËtl%[(ڠSjdgPZTc TĔF{Wڂqi>@ygG yfvn=ZyfKCW"%vj햇>e[icOv8j0Z*K!6wY CnI4Iu22#t?dAQB1S~5 +='":J O{$%nDr.j VԞ [AACsm` 뉓:hpHХz2/%=iș nv$EE4{].4m @ ׯ1eҜ*RY¹ ib$oeb. !^í*v tARY($ ~(-1ò]'$0mRڙbLRRwqc9$"B&FF!@=K`;hD6閫OU"';$zdr 8?e"Sr#GSzQfiK%2:>\ˍ3F=`Q$[j턷Pٟ*do7s[1r؟Cl%,3@:mjfE0bxH()d+n48Fރ*o-A]a_Hj 79w ROck*pȖEZԟLobO*OU52t\ޒq$'VfvLnQ,FdA()G'aL4.yMěCCp4LaSAQL ;c!Qbbi]i>T5]b+be "Ez +z~8I=[rbȵp k(v\.jM+FP~v@vzSnK]FA\ .bqG-„4Gb ~9]վp*mMjzqWAؑOp+}pO uT l&z~mP?Ϯ+o7H~׆)Y&ƧۯN056=UkmB ToU ȪaŔ TM@;.f՞CC]/y?0vnT ҤE8*Eit̊T;VfQt9R=T#zceL(_k  F *:=)\Ͽ@(AѿA?4 "M>9Pm]b<׀ j`T%ˆ-P޵0Pkad6 ޵1g**OxWȍ9&-+׾LJ^(i(xf IJץ>-n`A[p9V#>cZ`(DwAȫP 6uBM R7lP:2o'.#wnKRJ~z~o K)hhrwiມ+6$*llC y^i|WZ?yQ~گ/ӝVU)M|p-OKWcTK(R6HayM\F `vUDCdAҮ5Kli#ꢮh]A㔐erCA~ zi`¨T>t&ap xUUEDgcZanzDeܑ(&6I!f`OQ2&MG;D܀H9Z`AȸJmbVv$t$큁+=vŅۆ#0Ԍy27-*QF--:ޗ_ "\9t^#6׉$SpIFJ oJp*@'%5#!ۯ2ܰ^[Bqj^2*-Ʉ OIp2nFWzsxd?][,['y? 䕉ޣ->8DSZh 'm*vBrzj ?N)oV;ণ$}a'CA܇JXRX/ ↣)b QG?`(EiW"\G_UjQ~& N0~6~C,rƭN>B>.ċB̕;]"ց\iG,+ZR (,x7VZKIV[ v0Ķ':m j ?ޔÅƤa;C CA߽{]$`7b0OZڃ ͹\)T`6~n.%t`5J)N;9 :=*VIcyWpd`>6iKh)7_G8W;wK rG9j`Oi!wn;Z?⒬7R9R)Aj?8P~._i5L ~atFY؟CvTbrM&*hth|rd㒽&-uVV\bpC{xĎSxw4c׳"*Pk4G \4TF@LYZ4k ySrb7߫$y:ؔM+!Vi%_ ֽ>Y7& W*OD 9wmrQ|1/I{.[uVOAOd3L(o.A-r4.-|):% 3nGO|z%(1aug=qǤ8¼T7 RXQRÛIr³}nrW+cԡI{׮<).t3kQh-v-,T cFr'ޘ)7)\\ H14z_ۉ+LgZޛw6 Hٌmx0@rAޞNT(iZ7u SM)@K^i܍pPÊ\-NZolFO3l"1`~vưPw~lFL$wAz)Nn:)# ouĖ=#gIK(UӚ9VTڇm.Lslgx'6a÷D[cp: ǘ\PM{[z$='=XIhd˽nZ>r pO*^5'["q?'9K%s9|X@<tYhzflUٱCbeSvl vlUxٰ؄zCAdVH{-@hYHѓ0k?Sy(hTel7@+i&}($`JT& u!F}fm'X{֤OEi+̂V uc49 >l!a~Dx~fB_.mB`b?h_yؿߤ cQ\ðzGf^_Yfwg?#wK bz߯!шmc.lWz t?G rz<`-(wVZ[(L.i;Hf-3iLPVɠ9l`Ҵk֝~Yo ϩjǣeXl<!:odGe+)%Y}V>$s1!`KDbqUbVRDb4nҸUm0+*Wcv8UUٱWf]]6*ث]L m1VSvVv76*vV.8ٱvCuOpxٱWf]vlUٱWf]v*6*ثb͊6*ثbԠœ ~x-)|UآHKa1Jxś_Av-nhR|f]oa_RYPv OFOJ ʘ|Y`O1KX°ڽ b"2A?v60HmbZ,% +&]d}j)*i@~Xi\OOfhߎM5:@,IR?Xa\tXy4jSnp5}ڕaJ+OOU~UvU&8Mqj8ZvC]QG*wZNvRWſ'*(5jM~G[cCkU4#Sdll_~U_mk2„ј>p%N9SHAaҧS8U^`fpǦ}PAJ("G(9NEi$Pң&Fﮢd//S|cb򶌲u{*2O_uKy y\%ō̷3iw |?2{(h*w \MF|;!,<]c&x(WoG4BԲ4dHo qJY^Q0.x7\_,I `AZxd^TnRN`1t,bǿ\Q;:b5SE8~(jI~`+yJǕQ3iAD^;>j 4;d@aFOl}*([6QsJUXŅ:׍Ezu۰\ 1ۤ}~D\ɯ¼FUu$;$?M rGp8̴+H\+x7=X@ @$^,'T=ӖA!'meyD= 0_JH2-0=kC]:S%J;U&c_OMk(fRzLeUf6|M'Fy"*z8VT/1gev; |T?@^CiׯӐ!,j_ER};99Lχ"Q#Aa$v@^ԯ (*NdR|IJ+$ҬmoDgݫNnBܪiKe3~ c!A炤OB˻{V%q,=eQl^2(XM4}rH W*\jC?]Meڝp4Puzmx&j@'|zekƑ(4/ެl8H"쎧Y?Ѣ4 ^j,T~dzzo.O?͕L[de }LW IқOvEn~$yc=+0@ߖm4Z26)Fjn>!DbiN$2`RKРYP{K*ק#RR"䃿n$VU=펅 ||4W E[DF*JČJT0|tW"r #+Z~/[O9\$U/Z`bG1޽Z4+|h,Hj_cSo]TдUQ`%DWLjRɂyaYr8Aͽo:SaɎLذ62@%޼y "?n4DLjgޕǽTm-zrR;@dkM8hx!\(H;:A-75L㊲1ΙmKuzىsb^g.mG^rz_Ϸč˘MG"dy, nB4dc@>U=hbĚti %qyՇ^ǐ=7ihViZU4Xv n6n:Bܿ0I+^GpON2A]O|nE'2@DNܘl_^z__d=t).JEHV.~? ,.T#'X%rT}_-خiI 7?nz@ًZ]%g5,#r֥13# ujWm/%@dl]8uOv¹%%6`r{6È/B|1H5ӗ@Ƅgm6 b2iRKmpwdH(E=gi؃_0*e iqe"5©lEۊ| SϨ|B.*Q)O,*3CTҝp!E|ǡ߾2q9rYD$lȷ` M0k tbEʀvɫ/'6BS#di؜ϧcHv9EN)v< RUPLUohr\?'QJN>L!j -AWda+uD1zӖh=g?(¶1V ]Dw.ŽN;%Y9Ehj>^TϏP#|*&?8TXSbq*+M xjPk\cd ϧR{YӂN9jNá7Ua)$|E8T Kx(?Y{xXNh9 ;̶,' f**`}I5S-R A4$!ƞ*idwOL^eF PbNi";溕R@*OK ?L*|aPz{PLu!w=lkNGhM1OO .[\|| <N܋sKIu6Z&#-v$DJ̥znY^@1`EI5ev(R =u%%6FXS~@$1m" ѷhjrK!;EˎOzD3Cr0 {v-S-!fvOva+0 Qv)~G&.">[mOӀbGw~0U5&-# > Į.*Uƕ;6/{gE6ZPge!&y[@_Jb<ط*q،YӲcJJ]7Mzf?*aAv#+Wl.kխ̍~YlIJ6!'4\rgl0;A> BBEGj;mTG5H:_}GnJ(: j!DQԞG57  M$X3ҝri}ew6рEyw~O0\o\rG#j 5ȚrbHe 8Ո$ԣPa #Er z' ziˑICT7e(jaO$zӯ<Q|dUi`MZ0`)6b;^ s\;0\R܁8U"BuA΅~א6'jʋ zapJ: k@jIcZWͨ䁖OT@uj~/_lCf^$Ya-mYY"^ $V7/? \EZT?IŮY-gk)%*\G P?*{Sȶgj7ۄeJB[`P&N'dz?IŻznw"#oNE?i2?/ I dn.N.DVaDrאiȟCcR26LS8`6Jm z|?&1uڵ-y#m+ ɯe;Jhё[P|C'"(9N:Tu|r|Ma~[>'c}0Z8!cؑ GOьwpq[77i+JIB\잇k W . c:a6I3Yl`M];h Eז10wX'\!#<q_9ݨ]99T~#1f;q01(b2"㍌dupȌjH9xGC'&So#D-篆:X1'fmJ,lϹt!Rv#v^Ctan't9, MD]wzj:J>P{gKP69vPW| ˃&+šd(Gxk|7Lg.틎bf8ٰXx®͒K ,C].c+GAaUvɥ.F׮G5HȡS6vlUoQ@Bܜgӌ+~LNlUٰ%و͊0]va/6*ثثWf] vjb]]vlUٱWcvvlUٰUٰ+bp(+]Cɏ`V C岲-=QX^zL$^.97_|S\ Xc tH#Z "'-[Y~%G~I yK[j6ґI#?-:n9DliHԭ,yO޾ )AjgmL-5;퐛qN| KO!45l$ՉTS~'oն%.(؞$8H\kԭgQƒjn)옊 os*iM FFTJ|f,c:T|>(HMj;e[[Q/a&H7KO҄mԞP)\qE8XlR1E|UiثT.#;)*8Ҹi*,b *pZˮ*R]qWeWvX]vlUc1]pV`CaWcN*Q8UXَ(vQWeR죊_灤\0(vlUٱWf]vlUٱWf]*6*ثb͊6*ثb NI-צ*r_v+ϑ;U}weRHbr5Mv,Pr;v8A=OLmiv߅]&h)`Ijqu `b䢣s_}RoثG4*P.z|XʊD +u)lpt0GOofqU-ny7&OKwc4csï6-fe E4oW?ᕚ·W)BJ]FO;7ӊcJ>R( UiQ?N)XҚhhkO\*UM(GosP+QB+9FoL6Tqj-H5_8Mxo$n_m b\U@W@qJ X;04O0";XIf,)_2FAop3Eٱwr}#yUZ۾I;Wa\Pi* Wv(f].Gb~? Rx'nxCi+Zφ)v/n\^p%GqNçb(0ea,Ummb6zv_XmO|6p+c,h}2_NU"E6>R'H/ c#u,qKN)]jЏ *x" :SMtu| R~D~bI'v?.Ijð&d#=B=ǭbwV= 0rT 8qM2L0 b~*ey!ʌ")f|[΅ X֛ӿ1qL`)~_]kw?4vDsM~s7IU~Uڟ e=:xeGD %oynUfg*r&*) DC0 0ΟtQy7MZ+tm1wl: {{70"tRsw-&nF:^pY8[*T ]|%.x5j ն[9)S}"ڙעnRT_ pj=ch8H=HXڸl$`xMߧnqAs`g}jONF(A*kS^ TdVemJkjA"ؖbkZg$D"hպڽ7遧Qƣbz |_@z~g<6ƽ w: }~8P7ɫCJ־챪(aR 0܏cSU'(QRrQ@vQ19&p^H&mUrq手GigוM:I/'u%qOզIBPaڻ؎|EG@gtE.J 1tJr PP b>BG 8Z2Z #|0 h4B.T%̐mmRW獺TqR ۾|JʹFڣ@Sߧ_g%GgUBGL#bSJu ~m^ԐYO'/OoWx%x?o ~QG (Iʟ$*MWR8B8ix( dRYRZHBtZS7հ 4Ez/o|H;~\eYj/(wlZo%ɆA{5*%P[#,'#PL2x2+ac":=pH";ˤ$F%I Xjd ¹]-ٸz B|Xh@`}1@; y5T5I5N „Qևe*gbUȉ %iGݰj&Fh!S=6ҭ0`a#hSRc&UN,k=6v.z|Z KP Z"k``dAPE!z  BpAbx ~!:dfmV䞔w?`9j6'$uKR-uB^Bz_oQ;ҝA=)M!M(vrOM"GPP QRD2U%,!,9 .I<og;CɜM<熉=KOFTë_ lyRKN!r{Ql:sP9ZV|][m6dE'޳gGSDFf ™`wAv۶]2tʑxCL: [,Ag_D. |r=E0C!S!NÄ Y",8;brv! @bՍO_ C$l4P~ &l(LaNH;?QQPҿw XrڂLBu1UH l ]Cҍ_?/r9+W"7d1Vo IώA%xlv X+s&FՓ}n&3?"ILMqf銻"1K}5)Mr"i;ʋsr>ȗ&Si4Å8 Jm ȖZy( H U.ЉՁ؂NN')V0U72qVԃmv=wuEӝXɧ$l-qPszܾ0@B >c1˥AҀ)F?F*P{T Rd4-%NNC3PО.7J%2sx5IM͌@]nQY5\4r4-Oah+.i9Nƍ*1s ⚷dC˩F~y\P@Ȓvʩhonf' \!nH$u5$81H;bnhCq8mm\|Rہ(gbN5a ]VF@XA,U.&0I,e,ymoz%<[f /A͍|2a\|b~HD:W6 IV C0L۵>բZks#Ֆh(`Cߦz 3_ e#nz[(ȆN' L58P&v*]Kud;aMI?w;W&;y)>': (2]Nы7TTVGI'O|j){ 8L,q$wvzCQ!ɋvIv\>McZI\Vxbn^NJ4XE6,x0Ldp۰^ 톖<:)+~ rS+u;x`#ABI"8G{f3Ec` a. Q߿.0fy(QsAZME hKFXIU'gn&,jZ1)>.&&4/e&8Y' )N;7vf~)\TZx}2A*-uȚ?,ji"1΄dѩd-\P!` Zr ]y d ~ݔ@ {}lqW"Ѐ{ M mPOƸ I@`}Kb{wՁT hF*U3Pr0P )m%WxAm.d.d(Jk݂tVG%;.5U”s j>\ux׮.If&}R^ӦCH3q2qO)֞>g n|!I߮GF +@ ue)k R@v21,7T Xv`=XQ]8R'LZ@HFW)4dGBǓV .F&; 4J7j,;'6C+=x1ѕ:(/N@w5BZJTGvcڣ%9=AL5b)jn8;5m#[7?;lifvh'FG#ROAc'#p ? ,a]pMG\e^ @ǦGu)y/J=D#s]֠W܎U*Ol<:}8SvHc/`jAId\ ߶~YZo\ 2u=Lh_Ր?<h Hmdv)Pd˭T!N\,]kf a8Q@<VQ2Gzw'o\ucwi%\C#1XBgq"\Pȉ.w$/Gl2QxHhf/%uӒĠ-Xn?kjzyOOQGȞd|J2?(Z-NdK̼OQ_떇/tOUA5rӐi#Vsk9&HRZeC%Wqi([rUԠʋojr\+8^.@%v }qnV DƤ '>[oZ>!h[WqG\AHwB@8BI Wc]j2,`ֵ"ߊwCM6OJtW Ԋ/@=&=fý.Ԣr=Nv}'c-$V ̍o8u"yvr̂~^?k./H\aŤ~a!9^晲8C.K&X71 ڭjL(kxg7ԫ/ipsmذͺpY$.?_՝' 9UEHI~0M4 12” 4pt8(Nǖޢ/%^ ߎD ήJ9|)K#Mxyב7f ؗ*UٱCbٰ+beCLY;PzCA.c1V n0caL$ %7_d|Jr9uSX~LRvs!S<2KJFA'+vl v8]‡ff]1Wf]6*UٱWeaCWcqWeUنv5mƒ4eWeaWeWfp`WfvM<4wW:dbWe(xef%,uHJ =)j7*kv֌O$St6vvXa<ӷgC/S :jw '{i!S屵}6, Q<ɑZSz˓pGpR[I~Tk"P^b;Mb-|rtbv\ȮР(xUng@07`J^q Aj~yS/JЅH rrlJE~yFWivoL(!ԓ۶ƼlRH"):P͗m$d(:^T'wS_G9~*-e72I E{!ZHޟ/T # RuƬh +cm]]꿦ސ*TFn Z\~!ۮeBJ"TmT] MMj6.@;dSm5Ԡ8UD节=\IO?dqtrMhDT7ڸ؜hWbː0;]늻Iz_ov9##w>Wc=|@,RXG^bb>Cqx#5z \ vu[c\z}"8+ h$LXu\N VoxRN%獑Y\P?6ъX|R٢ i5kދtӯ99>+p 78#o/lSۗQNbS2OMkaإm*6A+w$P*kN(V@ICF`)#qaj" 84@A]p+me/ Z6qg zw.C]FI<r< txH!kF߆#k\s Psޟ,|<>p G/,N֣^C BSGl=I6=)6_"y\hxcI2ƼGb2 Xѯ`qO%ň5 zSNSNMN-b+N,NУ1H=A,(߀2@bYGPdrKDAXS+="8;1%Z@w#PƣG˷ӑch YK?:z8/ 6v({t5o[U6ޡzYىȒec| mqӸAiNw$KFz%&B)Re 9?Fl}V(( ivq٠ ,biHGQ=!++DFTRMh5 ZgR/%VxvS+O$7p"C_ǤZթ_(S#M*׾/nL`x8o8Uw8`I$HKhLD$4kM<&n@0}YR.";F@ctԅA7I@~̰zƞDmm.78,+p'8k)(~*)Zu?3N"C8赠@v5#.g Bb4ڹwfSf5?]ybWTڛPIe|#scYxVъȅ_ls*jWL A4WeVX1'rPAnF2 (T=Z5`bujn0$oJmN$ \p^G('Vr|]݊5*& }=ڂW É zGj_ra#d˭ C%+Bv$ב\=KKއ,UL+COreFYaHA:?ʋN 1GMOoW6t^WD}F L`FMl EE5_%qvLIjIUnL 4*w\2نk MɊ ʏ%--bvk):ƓATؒz4<ư:n7 fzCz.S~L=b!zrC~1LX=2;҈ J d0ff>ӕjviWiB[ۊ? 9T_@Dd6o$dGilh S@ Vo%*榁AW$B>g6)XoP~?wLr0< -mV ebG'aFɦ. ܕ uqbdF8N?'M9r&~ vHG1V}b6حJב4ž(ʨKr7~-p<~vZ5%r8hT6Ih»i:'qX;*M:yJ]V6UZ>\aV;ny&&jM>E<0*#QU$2(T܃vTYꡇ_-CN-`Z(}5#RtC U WnMwc'mE#^QPH4aR^I)4љ\Ld≯TӭX i҇sXՇ"H&?\AJ#,l* ާ}?/L]zSc!э?ǶhC ۮ*H\0F^Δ48al$Ю A;ǐ,5ᅿ"'GIh0Dۍhw[Lzah6ۥ:xd\yJm\Ek!2H*ǯLZijJVxіA'V=2= 9DFXRd|ZPiCHJ]c/)1Ǵcp=)b5E@riv'vZš@뀔A3 (aZ2..Kq8 ̬_ M[p8dVM\e*qHvE mbbwUC\ad Ś1(4?^RChS*sBolKΊGvT%*ƛim2]L Á+XbbJ >E.x&߲8.JD`BݨzS_l @22쨠TWn1Avô&?5q{wͶO{J$@ߓDZ5NP]$EEzR@A?e[X:o㑴NUfG02D|#ɕ "P0x'BbX? ,R)'ٓd^ z틬!T;ܰ$*M'Al7r#؈dV;xe.##5d@@Y7;ɹ!v&C~/".s'141neʋ(;oPq wߎVw퉤zx M0Jڠo!* %$9%T#p?dcTMNp,z$M,a%4 t ӠıBvֱD(Td\FͼUgv?i)zcݎl1,;xۚ%{`!!57R{v_5GM-i5Դ5ŝ'q&Ss+v榘p\^zmpx$/|m  m ؙ=qWbDt]1Wch*qd"MG\QNobbZvtiqa0&I 7Jn?`76Q%Ilm* D;?'Jf5Hzq=]#>0ɓSHHO֜ћsl#Ï0YR'j/LZRk[tfwg|[,a78chnl%.\#;ae9J );B/D/|%%S dmZ^0= ͦOO㉄QLi7zgs!-ՆNC bOوwF&87U+)t <~.k1ۆ~^}^iаC]× E哯;iO0":OμӓYc9vYXUَ)vV*]]1WeSf8RF_>X \ Qpش}V ªovHpM,*r9 kLb]]\&sBjgO2%_a\NV* 6vlR챊/va51We͈WeaCb\UXٱKmWbXmhq9rc^M\K"`WevV*v*ثb͊+A,D 1!Jhd(z0 -WQ쒚[AGz_N"*|+ yrr)E8`Weî*㎮*(v<Rv:XUXT6v7vjaVUc0—eCYt]5qWf*͊]vQ[8no(WeW +o+6*mvIy;6*ثb͊6*ثb*6*ثb͊6*ثb,D4bЪR8 )CSqKT zҸ1mE*)-CZ#Ml~Uv:(Y:PS ҴDjO`*# R+kZ G;;=`KT>8պv5Iv­/e"QJ{bA\qTqb)@vA|-܁bӼܫ2c~b}璴n}[/Zce)ZbZIvX+QMU,=x/f* i_8a էӊ-*xSƘ;]{{Q#]=Ku Zl u0E޿OET$=yor]"$ PoZrzRaK1֮Kǧ_AP@zw4VqGCS sƀj>k)k N0U_Uzw̵$4:E 8d3@P_RTZoť=dmU$?xQ1AVĊnO /u &LUv(УaUcZ 45|7m&]Jk _:+vt;%[_ˆ#阳t/55g3- YA!0zox)$$Gj<0VspiīpWHs$!WaX->`PL z t*=vNʤ}xD0,ޘUv@sG$V*| Jԅ܌=cRe=0IKu7e<} ރiڭTb1O«e)ڿ=ח';7Z{ )4=I?_W M~BO-U]O^([>cA .IE=ͱ Yuu(M{bqc}Ƕ 1l̨flB)Z2svo9g0G:bh>2M.)-roƙ2YQ;U[ʣ1k-9`AM iJ]h")`QO|(nQY)_oo%i)ŒHc6mqZv`,G!bG6BmJ\@ٕIw6d9i|Ba7rEMMq*+|lO|^7fkA߰Ȳ٫:PTTZBr@oK?: CREwi9mE;p"ש-B݆=5ƿ/|}xw|UNTȿmipA!6|)! `* S ] kv~.bXDOwp_n H>%F[]BLNk7)L#.0Gfy[L%z6onRMYvRY ރ@:+`Вw,1%d ZT48ƫ7: * 07'ۻcw1EK-Z5QS4X9@"Ř!Ռh۳T c;+n&'iV ޴cȝbvǛ w՝kr?,r}"{KE$)#^MJ#AUcBII_ٯ&¥U!v~{JsٌKfMvrݪ u *Sz{*V#wB"82+MG^; *:d\?~G4!ʮ (FL\93N!Tr ;fjՈ=p&`yҽ푦()xӀ%FŇQA8(h*(Q_Aܜ AUWʵG(9&b44^/%xOzJ[%9Tuxe}\H]rxzڴEs7Nҡzp7D_Sc]-^FO>~KƂ,4%©3d@MxJH^f,O#_2#pi95_S*p4[E`,F暟Aզӕ@S"1" ;;Qhg׋zX#`?a6E,ۯ|P=bq*Xm TABr}UM4Oz%K[9RE 8@+B}%K L$udYqCM'0QRhJj;ӌŸo=>ehWݐۚycxaH* #S?<~ePǹITKMpу%!E?.&0$SEbrQ*V($ ᵴDުy:҆Py|DJjғ)1 3z|?,( T5^~5+@!׮Hv'#b/sP1TC=7OחƝXnUUA,'a#`EQƥ~#Nnh j-,V>)葚rbE3 WVDVZ!vm[ FeBRk(Dyya;%IdASz PPqۯי_߽ MU{T]$7F>+N[n%"X 3Iy]+N:bGsv/Ht-&ezHX X?{WNڸ$gXvX1N r MX9?4Ȧ C@|rțw%aZ[d&_]Xd>)\ 6 Q޸_2>L!4r=- \h:87QL:]F*)b!c wk$U5KhH硥~ylzxT&ȪmZ% Z2:5;rV/e \>,_Nܶnm9QL(ؒNmv/]v04j]/SQXE!]Iv 䁪 @CTis.BuY+ӕ1EMPG$jޝxŮx ABErlQj2KoRjR Y an(O0ȎvX@Z"Z-v* uBOC;;%ĂC^Jt}!V8ѳE _f fm ~lcvP9JnM9xl4Ҡ3!ywjx\܈"R*kokϲ0UP?XI b"Գ9n:&l nǶ\H2#q{Rnb`ۓTxS"RP򂫱%|V;|S'O #}l?$˹j)A_ʀq2WaZF=`HYLyd)vG2ՎvI&q=om9'۝/Rzj|HT>}l$RF[a>E(zE.2"ˁvq`jsV;# c=#Ry)[egTrA ~866PCt5o A jStR$4XA؏'%KJO;7by7e-U#>Hc;x[JaTO@w6 AH}gNŬY: Oc5xkEp7 INiLJӉE?&x842$?:|"8#QJnXVgOe_jGAa S*NblZ= Cq('Bp~7ۑ-N`6m@r"cӯNN d7*A핝aǚ>?kITۧӏ`̾zQxw6; ȧ2bC4I48bjz{cF&Oș5KQKZP0Eޤ̻q瘕'$Z XKVNڛ}sDk@eagخ|:M=SLbe)JnP/rOp% J q{8fr"H(ryBLi6:SaqSMFr.@ LNNnU>j WY{RI$|1|O*uG){vĤNAP־YC`uVZaV 5" QY(Wl W52L{RbGGVcLN:*.AlUjmA'~kpP&q`k3! sA >޲Pj|=7\I?-A k/i4)Ɛa:)U]\}wjn;y0)bW$&Z\1r2)߲\M~Ƈ|Y5K> ƔRh}#p[iy7%j\)QŊ t\i wKX,r>=]H%EF QXESkNQ}b2w>(_\MV{x⡾"D^Fcbu+ -Zzӭrȹ(r>h:?xa ˆi2v΃euͿX˶v Q2.t++;^\}x#ğgav%+DN>M3WGLi0-wxxvAp_ӻf|Ml )_ k8cohd@^YmH$e|Q75=rF3(ݜ tDFz˱qY#H @ڐZ@gơe"n -1BSJQŖYw9~iz;O`l JYÒGd$Vƨ2 a+8XP"!G'Omdbc)vXW*HZ{`Ja$4Hrj)R MxTFmI$QIy1B>ze5 E:bn2,e)QB1U̲ A5e#Qt۸C2CYPrAkJ=~ VomP(v0)t@I'-."}b7w銻(ǒbVwobb qFRҪ>TqW`ESkJ{% ր+wq&(>"R(i8PVW b4JZ|R5!MxM~Щn'.4e@Wj7Xj)^T Xh7b1]oXPx\:܎^6JV\֣s{U.8hq4^XvkQ_(ن 7J{bĚUH֤\R&xcIJxw $C_W#< H]GŁZ Ts[$rhrnn?Whh c^-+RKO:l';55l-%ʅ ȧfVSON';މ]*o^1驭I 9@?IyNs6C3\MinGj}#i@qly0jp]u zF.µ$xq$h&Q厪heW *6iFqHz-m䎕cJ~̹12Wr{(& 3 5\$eϢTulvp+_NY -BOLaznJ8SKV^'J}" 퇩TBG7-N\Џݐ4tBKs?rŒ)rHHQUw:ٞPIj]nj0uBUG#~Si7Znre4 {9 "T爱EthIt"8ӹIIA]Ȥ ^nDT_}RTQA J%aFmї|D  h O),9PwFX=GGPTTd MM@fy탒bH)b?+ [!^gmQ=jgq^@<-U`!Y"%ծ8Cd@]A:dǦJ6!T ;|~!CLt5PF9zSȞ`brjAVJ›LuH[q? #MN=>)DGo(>5w;@e"aVH+#ܞjFFҭ݁4)CniMq b BI5bK# ZARiZA⫊VAޛbo&@?b#•χ2߅QjYێNbuޡTZ㒶WjPY PbdpAMh!t]tubץ)O P/DR'0*^Ѵ>bܓR4=q@ 4m@GJÈ 6$}͂&9=)75ޗj1b-T_o ~W/o Tuso-n^o@Gqr 8@%TrL9_J]..$P‹/md$UD?"Vƒ6#5__8 [yپ% {xR )=HԀI+Jدo;YIb N{ЧjzOFn 4NTXos#ip=+90o)]3JNq8ӧ/٧PԕPA("?I (ܩLb퐉ytdOn?ᖥb#@"8#}]y*a@=T'o8p6Ss%Hk;m cPs )JQPH,wzA5>ҫJ8vQMq+za}HjvkAr M?*)@2'%ol0p‘.;m_hM^ Su't^ hQEC핵u,{ IM-NؼRcۦ%!`'Sby3 kvEFIRþY@]z%KV]K 4jn))/BĎU<22y4(a"xEE`$KVM54&zR2;.|=WYF ;Av\(^\i)VgiȴT.x .іE pPW$4~["aS-*v(YB ڜE,7J]!Haj)O.XT+8[kbCRM>>`{ڹIQ#q I# B }m֠Kl>u(lXzz0.1KE YAj_vI []8Fyr)ExGZNYӟ?BY#|;}0T<asY"ÐNj~qm>H[ikLue ;smM_'dXZ]BG=i*$$@3|"=BEH;cLP./TNSN*v$T'Sp)S^'sHL#FF_,7_vɇ#4LbMbS)vVv)y4왫!GO[[LQAQR|M{dZRφ-1wTIAHpBTCF+q#ƫpLkνEm ga+CRjV滑D%E]񗌇~(ޙc ڊwIJC9|Cy#҉hI;uzA) 9Q|A?ם?=6H5jx/n=0րװɆ`']#焓jpFI&ΧLE@PC4mSn<,"5V.bjkxPqIH۵h~ RHCQMdi,›#焚뱚!C]9 iÒFA'd|' q^` #.JܟlJ ٺd53@¿TnPNۊ jNZy9R)],xI_mmR=CTj!cAL68D BMwcJ}ؕ+L$TN J cG[XK^H[L7:6ێ*WbX䖳]?, e/7;$eόkz}<0SvJ0 3vbs##lÁS@ZҾؓ64%HKSƠ)484*e:?2E3,vQ׮BǞ~.H^OL!%ɆݖE8ce;WEGӜs޽Wa8<`\ZLTeD: 5~)HjwSKS-!) Z n6N'ҕ+m;*G2xȦbj%ߠ59HZU 04 '\ 9$TRmaY=w7D@+5 n~*#-;t? dGX=+;; 䛝<T 2;5d4r}0")__7]̡^xu%H&-f$3Y]+v4n?~0r@nۄscz"W[&9~=a!§r2޲o,3rL.mTmH79I#tCу+QCoxhŸ3 : ֤ҿ?a%VEH &Gǖ=Ip_+T*N?zmڮ/ ]Tj+D~yK*Yqdo^=r.eqR]/J1˦Qfܭ|R}tGn$"ᵦ>T1Vd*[|=8QT uN"eeEN`*N.M5 jѺLZ\zl%un` !$XDƝFE04mGM6s Ns-zĬlr^ =DYGjFTmLoNe\XcjLa%9lHm}TV?ItYEJ dSBE~Y IOQC `G_,Ji'#p 8`i!e؏ `vkNcN.nG @:x,sCxicH5* 5*0px˽s7Kb_-FХJ?\jW9SC rP]8pC`&ˎM퓟;@m(T-ˣH[h^m3]f6g>o8pJ\/ cͱ/3YI؅2`CwzzɸryWqE(s1( XQn+>G^/8v60iIr3m ,l6BAv) p4+ ˫.ȇW/Hg+T7(ebٱWfUٰvlRK ?,J. Z.GB7M߶M(pMAY([u9Qb *f—fȫ˿W$ tq?0y r,9Wfv_l* R vc+;]1Web"4PI®bZuq́] 2qb"Ac nYU(4옥 Io!&"bqScNYii7\Bk+ $xTRq"Wf®E:WW+p-Ē~g(,0 '-Ŵwe,_sdJt0  c#cYdd`y@}?Wqe+£ Ot^27Fr$;׀)}77Wb>y5W̪9AlEe|ؼϦL5c' ' 죍< bESK$Xϧїٱ(xw $SI%gp_oq tUXSW&&>MXst'Ĝ  Yp oFϡDHUh epl Jgfz1PIJYmS_ U1WcvP:Eeef;[ʸT,j*+Av&XkBEm\Uj(o M+^*˂O3bɡb|6è bv56d;djӎ(vFH+TR7CbάQS"O)SP*OĠ#kM#-_ޣ~qWPmS6|*h?ȲFSh+ [!woBh$W~e'd 7<)v"N*( 1qvA[Sc3qN-?-UT涎T4鷏ӊ`^y?qI+xw  ħZc3 Wk #M~dڋ'ysM6==%~کؚbТn)v ('ca Hv(zl ,HEh~@f (Z KDr VbH8J؊V? ^5 _Z})Zi\j_tWSb]vOb(|ݒԸR=3zwOU?k1o!4}pC0;\ CA4v*3YIX`EAI+7@.Ö|[4`h]ǎ'{8 q! (zu!Un>iZ^ -`&SMӾM,(N%,$ >1R'k~ Ko(Pi8hԀuo E:dsJ2':e~ۣ6ٱ9;:҄d%y/#K!I"f%NWc9ZW;>8@8Bu{EB = 9ok%>)P>ɶ-m`٘s*+@/>YIe} $Ӧ [98|hzTR+/ +CVJ<bK.5CC=IH_VC6 cFIZ9\?s~U b _E#FHv4{e.`&j][=v}fzƓREiӦF\nq;W+ mt*QEkB<0*O1GZUI-I#7ፕ QIgcl:Fyv@kP3+ĒI_WA& E7Q7H IM%~!*A7cPx+\T Ӡ#[KX3R>?F?  )A"6ޭC~J!N;'am? M_T+Obx*~׷JL4Ǫ=0 ߱#}҄l*_ZrQfhDlP|!h/Nb}EaBISr'h _)F$+ʽ2!;1ja>%"dp:'|+X[TbC!Ԗag%fj-C)SRn$s @;mZ>Axei ,;.T$PP#v4- UMdX |ܚkB! Z#$vWܭ,Aq[`N6E~G.M~g0r@ 7ibtbd;._(= s a) SGĮOt&!6 X ӿNYhTS&³˽:aEiȊBMˑw~Cp7ECOxڠ'q8QpY^FqPk˧r\+t?NV;x` F{žJvk*ۊ:b˒Xrj ߮ Exb%@ iSmFZt/_w' VT :6@7IM2P%YTx|UҨiڿ+VoerT$c#pQqg N-0zdpЏǗ<nd" O b6-L6yqk~_oe 4ʫ$#-̖Izʱ7kс0yz`vJ xcxbezJ <~eĜ37d'(iQUvBw$ 'l0 fj? {aeʺӓRmb(\ȼ]d}It]ȍL[T2Z di|$kON8Hد&h`:8"ώΡ# /}Z̬|ϧ3V a&Eh}ia42ĂpPTݞѕ82r>$|]OEUy*Pz|C"' H兺)X Fljμ80*zv^KFYDT2#$ճB54Foaƙ.Oz;c3:\,APT i| El՘J7ni[/ CxCo^w0v4ۏ Sn“@hhN mFDG 8*7QYqZo${[r]%| T(ى Bdej?}*AmA R<=@@A$ *ƴ }h@MU &96\M7 'e],鐗&_$[Xۀ%m0^h: =ٵIrY[ W$ @8(S0o>:Pt~ jAN4 G8:W%z~$9-ɧI/4l*r@'[84bR3 A , mY;nraضMDV"wĶ))dN^6䚐H').> hGq8QG:l?$ ̓C6s[_@.Ά6WSZ- /ŏ*Ν ~F+N]R[oׁ+J): >r[PE"z: ƣjǾd%[HNͱ %7b~geV8;V8): (=NJGvZwjǭ}n]+Y~WsZ`v4qbCJ+w?FXLӱ1uvh\pD:E X25lS[0҃S ޽Kh`q1a>m+Xp3xv_ͱ8k_׊Ǔ' _6J߼R+AzE4rd5lOf;`[7_ ,J,J:ҬzPCxe|g:8(^-ӆij@S sXz?;|Uxtbh7 nSI\w?A=[ÎqB/*]һ* Gl*ty%" G`<}!b^ |EF:~00qpz0qG$;!N4Rn4cifmr*HjΧ';rሖm׶߳OÄ{-A>ɁNTtPC0o#Z̲z{d !@Q%4?v47A-A Pz  p|e`B8-?rť`_-~T#5K!䇒!ʄxVp g"9ӏE |L%i~GIؼ.Fî,݆^=Z"!.zSĄ ո'W۲5A!ͧŵ-txA}y4:S M%)NX}3{ExLI$wm m1dBKz` -8'euy ’nWAԁ1@pĦWשYűpE s !~.x sC@}4Fi@j,8gW䔢Pq3.RsͯgCw'dMPdn:ﳞnEcj>XO1u~l9| N~i-cwu 0g-8L Rإx(v]0+b죅]?x>X \ Q0.8]qV •6è;d$ "bR XUS+ 6E]\ɄuBj^ax 2 &9Uَ*ث RUxUU®\Uن*2Юq3˱lǮc-l%C ؜*X+du vLƓR,cNAܝB$-f|o!w؜11.Jr'HaEum;f㱻+Q$#p5ƙ5D#je,k dnҚeSTt H\8WxU3Q *v^*:龪0P0͗b Ky)',oWLWiGB\;{k5Qf3 XSu{%ԭ<$$l0(F((:`DŽ*}4="'uvuN+mV?j岺ڋhiݓpmw! ؊\o_ڣ@af+|0vm6vB#q=:#n\vK,xv k&C~-%Ay]_ُag͜l5§=yNwa RPc=7 VAUaJN@V|Y\v DO!9ӭ #5 6I4 ;Lɋ9+LRa1WeU}*p]Xኻ*;Z UUثb8إvva.Z͊6*ثvlvl*G 5p+*Vv7(N]';6*Uީ>ys\0(vlUٱWf]vlUٱWf]*6*ثb͊6*ثbq>] MqKxEۦ)v>`|*E{ևaWw@v޻|=gno gI,-ؼd'j;1!n?N^~݅]S -cZZoCy M@*4rz [Ţ*d_ '`"w*:v]1b`>6=*G쎟]eOL >.SnيTc׈y;J \;(dZ˩+/SNU7cާ"0$|DSQF۰A+@ҭc:z{U4m@w1U%қ b=2Jv$mUצ0*sApT 'qJ_vXcl:{bs  ؃Z8~ 8ZϘ *$ɑiVF9?x,M!؁ɴp0)nEMFرvUA>),x9F5b:\F[ȡSɔWr{{4 8 hz~k*6oIc37 :8'[p4$AP=!@c6TPk7pĪ/"F[ns=F2)EnrID7 r <߶t/Ac˜&w)'eN4V%|Aʘ0qfRi_lVh!;tŊJҢz/**v=dbZkg69A^"JfN# #wv}2X Jo8ɛ4U0k|KJ灍$+SFbiIQ_*M(N&I8դT ׿SMkG6щ&j*Ƿ{cIVl~zC=HAħۖ0DI? Ͽ62+:Ź Ȟme}~Ѧ*ԑ٫N8UKE}Kee@IvjfZ$t0PrwD|r+ٖHl*"VqOSRg4ҙ=р26vW&G`1 @lRdҧVOTkAp~55 %M5ȷZ2P:!ecj3M׎` &[E?R{wtK"'**Bli+ɶ[c2ROkv'|;`Xq MABPZ!N }BI•8 B@ , EZWvH(Hc55?p_8TN%}s$چGdHc٤zwTpZɎ*_ɿg">nnRm=AzՖW'|'NPֹ6;%7"q*튤-b$CB.A]|iiLOȕ$ e1(Yy ˩O36YBpmḠ {(9-45UADrnXkc!nU؊m)IAZ5xdܔb~.+p>f5N*@(*jPZJ"%'RGxey?~ $;ZͤZOqQ{:,*vK乍'J\|ڝ:iYnI ^PESa^aT_"N4AZݾx* xbj]HqֻQJWrXB{UCU&S_eȅ(A"0ȧY  .H WQXc";E=j)O a6;J C!aOVsrEAdmCҨ߯^`b ՎuK#܄׼ mp͓JRϥ0tb7ME>Gul $Qz@5fvT[ qxW&OF@;݇\ՓxS5\4&4[l֘p6!ir4ur+s!jn Ow8Ɣ IQW q=:LO6S zj[{avu= м_L$Wu-Or+{b7\JݬglPISq0)3Mj푓WƑ7uWrcS؀`fbsEf M~%];j;24r$ika%!_*3q2gd}%R)nRn:G(tיlI@}kD&v9F)v,0#vIxޣFerxuZQ\;*!)pCK8puk: 5}0iTcZS̥H6;:u‰5 n?VJ}&^8H9 {)bďЋxCTr'F.˰HOMqg&^2KLGE8? bJ-nwd mkM , ZN]r @񵜠4X Ҽ/+l7-E)8B%^\ TW=ݴK9)EƬeHN& 2FPM0C.뺙k ker\p>C'_o!giabsEizj|(:EJN̝UlOˑ0ݹtSASN]mm!)ח#m‹ r60Ojo|(bTN](t'-3-J '喻Ԋzbe0$ݺMRO\$vqɼT)𞠚Eִ)@7u|ާsLr0Sv hD7@0}6)Ӧ/$KRN26N7 t "Ptɂ4W; P~e#1>4MUؤq<%}*.(cR>.z3ՠcOb09`+^}wWI ҵ xIw$ *=rtC 7ð 5p26-4!c+ӐڸBΕE/@w}\ex˦) w(\ݔd%Khp쑵:s4xi#sZ&tc7'#SL5;(GjȎ Z)IcӈDZ޹,he[ }Q/ U@ӭ0OPӷ̃vō;,];|ZQbE=pƅ0]PPw=1d0qE]ӊCZ|)x3-za/JlyKeJ6}k-jB ԝ닃/zEZ w5Ǩx CCMm"XomT1= %a] SőLROɽ:TV"ZiF:c{KX`։ACllߧ!.ImqdvR74G[O#(=A(nڟv)*܇Pz ^(=z:"ȹ `t7+l*6a}=2qْu\KUFXݻTqhqt P$8: }PBF9ȷ7/nv{<"sAF0 &rΰC7aW|v T&;S供tc{CԀu$tacQ*8l_p~uE[?,^sҤƉf9|sv=1+7+6vl)v;;(Gb2x>X \Uت86Xul\t>ĥjwʊ mLp1T.́]\&9?/0y*?݌&0D#vV*vc0e͊*P+r'+ \6vVv-'u VIJt*zgI9` t=(4"[1X_}|^eV,BǦHnrL9~>j/uF2:ZͦGD9E  h&]2$Bz&Gl/ҹ""Azf]2Z{R&)AyI oQ_eeb XL417&^8FL@RIf#;f\QA`#d\7"AJS 5-]{4kqD D Itcm_!Et2zW tIn"2rt> ηV>_=68I$z(?3gM1/%_&48CLܿg\#~b뚈Kq'q1,Xtip[<ՍY nV!uLp]]Ye9T?k,WLBC <%X5?#Di>|^*?1䉑eSnÏCVAVaP<_ ǐzb[.i)QbbꀻӡU+!} B'}Zt $;  zmٲ+Dqִǒ"k SjSssd#q>!*h:/Ӵ}kmkc]|p~M찲R'/}8`V~\*Jwڪ;ı!wަ\ &_DqS@x};K0-v"X ٲyoz$P)ҙYBSP̳L BjGF*$õi (yu𽴌L̻Đw N#P5[V&|P9I߮*.ö)hB$ (œi jJv߿ͪIN,A>ҏMxy}bV;|e(*$gnj]҃ٲ[.Pžkf6Bon]qw]Ě{(5G8^ir"E_5Q֞sKSGlB,m_Z+ -`2."њ3>h[-d}h$M?d]qG\<4DڍϢ6lπӨ;8V xN=X~ ^а@[uGX 3tp[1Sm3LB&SQJr\-"h AzmJ.N>82M+>SPkQh|C fmA$lSݏJIc4tE$|m "b*6 d~~I,a#.?.IӀ g4C;oi; gn4#߬dq|1rO)-"4kBcn?7 4WZ{Y+ $B6 !k+f۶.mLݏS)v)ZUeq\=2feM+eX:`mGW[fәOdxr-ytıN[NWL#4>2A'(HBMvi ^\'i2 AE>bՄS\$c\Xcbhګ Fݒg4 A887j[@$RөЊ &hB>"6'\)QmX#NL43 aNGk0\Hwma 40F)mykLe ӭ+]YAA UȕpD5]"X 8''j?)mD5Nă]VhАBzAI5h&p,R͇Z*,;K ̢-`~g_ {aqC΢#k\9*@LPr"ZOװ q'"%VO.M*ٟh*{o|/v%:ŋ7*bk&瀢Cgh(z{_אNnvvݫ H8*nSXo#&<|O[KpE?ͅ) 7=0yW504YN2 PQ Z!_n0\y;݄ SrnMX*k\[*~.yһin}FCٖVv=>X >ۦ, s\Z3qBoaup=r-2QY2V9NH7y- $сJ55=.jO!$2MNHP*l(2-v@&pC %=nv&<1W`Wo*m$;\R2HhG~C4mi80~(`$f|ef M+M2t,zv$n1P_@,w N B $~#`"e#̍u=h<6qUnQsc%I~w]6i[x; ,ta /Zdۍ<ٵqsvF+X`J1/]9(x[duk(QJerpH9J}U="Y>Ξhsw4 ›@Pl-!"FhOGJA(ޛ,Uj4,(>[t)SNM|'?'8 >-lJ>֤ӷa١(^ =#I6H1WfVAm!4e%e汷۾PS˜~xiWaF$u y7|t1[`dvPk=M̄[@ӽ0R4 e:xdDPҀeq6Q\K, ;wWԖu!JF 8LH%-#Ս}Yd|r.hdV 2m@:S݉=FܬqeZ[ߵr7x=[&P:a51d\* ʕ#Ƙؕ8bƕm;)IۯlPc4Ƨa%sc.Y>(2K݋GQ^"bX@8euq%V$c&ۺPvf&\{.xl唥E0ݡr pr?PP%zm]qq Iu}8Ko6!KcS^\^O#RCQs#S K<zerp΂S0lrn,wʙO7C+EdH'G6EQanKȼNΣ^[o e6DĖ= 10+g :Wb=` F.Pah2'*zoNن[Y0-L,ݒ F)ǎ{|SW4䨩]z!k%;4;Wß"fy|(YmNBn3vN\$J͢#.T 4sac;7RV#Nl' X#M8Pir8 4£%^,$D|eaD% pTJq\;[AԆU'|"PL b rWa=} , wf.Z{aFVoZݤ֟?),Ng` (*Yz}KXázwS 2ީ\){і`$j&j(2KvO'M7L _Sp 9 11c|@PWMN0ʹG9F4=zs,AtRJOᚹ0;6XI1;F}.8aEPƁ0< faA66}HE }2LI EQk_<&UyUMZ^  Q)[hثr -y \#OQ";BiݒK}nC!x;\ڢʔ^RGIOdԭoTPOoD7> ,Ki= xE(=+v "5IrSPd? 3"[ڞ+A.xcCrsnd?/D F9?WX)9x`KV늻ث|UzUqWcZ k®͊Z8][WfYxٱWfeb]+vl*ثy(v4 vVvVvl*]]](®ȆIȵKbثb͊6*ثb͊?*6*ثb͊6*ثbbت~"1KBj;HN )v $}_41]f]+P,].VܝE.c_A]Ov8vbOuqKU?KYqVWmB~v*㌧jSE銺szRT M)ܶ*`rV"[v|c?`J}u3]LB (߸\Tz?UkqW$C4u;~7݊G6<Ӕ₵GCփS~ z+n>Ջ-np%Ikq1?ثeIVi Hqu/QCt7emr.›ӯ\nōz݁(KTocpJק u6(ВF%9ը;yWƧrAi?`IQQ~UدR{S*L൦~Ut@N*R^ 8*/^~ v-U11'n𸥮qU1XmRN)lvq^  e w!8CͿKg-V'#M߶X˄֘mERRmCJ6n(Ɵi/█5zTZ#GK|dYAWχ={b&O6)i|^֞́PK7، |Uz1AWZp;@^MdkRXŭ<ĒSZr4 si,,N`)D - 72)Oڿ0^,%cנdO$7ԝ!l߾떲) )G%Ώ[?ooCMI xH5!b4.rxĀ3ۍ@o# '!ڵԮ(+?j8O#Q',hddթQe"@48S=–؎f.|Ҕ9;X^ cIqb;lF9 爉ywlV9Unzo0sB;G(-AjW5=B$ HH*iR:oER 5(K$g` ?Դoӗ 2nC$Ƙci1̊Z2,ܿ2)C޴ܶ_o? oBڊ-@G*c d؟N&JnHڅ㑵p}D9h\ 7SM0XRjx=/Te'aN=7ڴ?ۊz?:H"޵(XHTֵ4=N9+_iE-7 ]ߊP0U<|*hށzt?_DzXVNKb8ը5qaFAF[V?;;trA.5܈T7COGr F[Uuw#ߗ ŖY"4h/BI#P$[B/~,O4ȦQIbE$3[anGG0$, YEM N+$TqCbt]xcYRj1^mRE=80 א0["b@>3?p*GSJ|X\AO|*E*S_ldd1ݍqM/xj>Z!f銗A''M\HEnOU`ޛ_Ncp):47 , ǜ%OK{Ʌ} d^rI,:^O/ҚZ>$_p U>XDB'Px`j>$Vz&dm4 Ĥһ cZ*}9J%rdwmJ:|6N$dU6+l-?hiE,_ 4Z_DWRƟvEM|:<GN\yr!e(2A$BwYFU#i  <(B!7v!@޻b$ES$(#y67Mz !5SZm;/׵g/[AO$0<|~ٲ#CgްM`@Œ^? [E?.uYldVA z?!d̓źo %gȞo; 6>4-fQ"I^i[r1xE?hb a - pZG "B_qG){x_Q4b;v[Z7il?YH-ZWgAb_[xUp7 |mrp.<&uHb'~v]yz។P̒$2wNl42 /)J]2\1DZǛ1iOriLS[K1wGZ+ߓtȔp@*щdaȂY]y _еLh0OjQ=&LRimzP ׇR)LÕ"Iڻ2 T -[Ujq768 =8R'%! 3ez, w&?^; u}%g^h(0iŖ"VQp6#+oofuw]z*r+5d;8TP\CQ nZ_N\c9/I1lvQ<ӊ]9㊻ 6Kւ\L'1J,(iϯ2n&N"˗ <4(|ysns]=C w 6HvE䍇d: 5=0)ؔQX'"KiL;u5warivАT @dF 1E\2SP-ր9=؁1+ƾGwBU)(&O p/RXivbzRD2S݀4fuv*{ dpmI,Z|Y..9QGO}S*,I R/#z~ֿ3 E5C0Gg%Pۃi ]']Wa P %ɣΗ"ڔfUxZG*KBv, mc`Kwi\B6d( #1ң߯Ac%D1>4ϘLm^>^W&35kш;UYxaѩZ5v6I_;Co9`,e"Qy}$4 i\O+lLv+R66c0XfQAH8x.iu86 i A$ҽM'|l tǓ! )GU^aM.@e3+m n zm䍙ƛHEZ]5 =;an OJCwdw_L إE?ϧE9qcyxw MZ )vYz}[QWXIb'oƀx)M-MEk#4$.´-&TVmCJ瘙7Z{[Z/n.&gpv;c͈6T$`@ ̩Ez߰=JxPqLl*oS\Z฻1`z2 &n:\Vh߲EdAڊm'pOE=r)cM9m1d:\ڽU;nAn$#z|)Pj|kˆ*]L'y }c@6d!giˏCOj{cœSH. qZrc%=Mom28xeFx'om*>vˆiKu@$?8gm1_O$cBݪ|M1+lX6K0]_4SZ!Mj߹zam+yL^9+Sևz~4 1 +^`ȴƁ|4 mȎ/h2^ZfO#N>'"9mߦ22TC  _-R;6+\ %g\[#!7؎|0[T  p3(V~nht'GU&.pҍ +C?:O=sZ}Ƙ\dV6B  oFcc:\imuSF5K 0^;6, &0Q)rFԎ&a5^ҘH+~fDQ+㓌e=z؉! ȌQ'L4frIn- !NąoRCk?5\Չ=)j4ڭ~RjvόpYUS*V?NL[çz00j5{"0+c ?KEסA7[)2']ʔrNF"&HBe5Cy~;[ʒ,m`kD}L77+[0X$(0 Vq-;Ͳ] ~C0$aZh1.wwݨIZFD91eN,(XY£p}T4߶cC)݋{|irZy0X8d*G#sib؛ $Txf9" -#ݰAҸ뾑 ~5.d ʧ#qd,[#(%d#֮l,{{v*c"=? 3$a/?KTF. H W"P DMK4Hij`C{iإ)aٿ]0+U}UME*7vcWAߧK?E-Uu Z+!E`ExءmI${#&wbC` JlL OqΊ#qPz{LPt<{(iI5?D ݁( n&omӃZsnIYOFiLe$ao URUЃ߭GkK? ђbS3DZekC"N[M'#lv?rLzlv*o bcYh>]Ev]SO^غ4]7ͩbO\r5 Gߊ]&*i$=%}9qт6-|]ZeP?6*~^(GqJwPIJ|9Кr?)j.? b5Q_Ajr?/Kge_.*mJ+oR?dWWF~/R{ت*y+΍\t0A Zj{0s MSk"ӓiЌCQDMQy gRt&CXքn>YIIcZcѽ[cz^Yk!DX2DM@$׿knǿ%X9<:ugvuʩߊY{ _@~ٴ X`~Cu5^IS42qb˴cBBhEM:OJWN$BoĀqf0>rYE32 JǝnWrWBcR087&xa|NT.hv4{׮-BA?kק(V5wVMZMHt I-c KF#Ăde &1ۡ#\+֒CyDZ7݌E<0(VݸG$yxz[%pIrLJN&1N <5< BOrެVGs؝ub< "Nn*h@ޡ~+c T@.)=nt/޿&۽*)*9#AXuXf' ]_ 4PP7%N%eI\dʼnL|\xBGwr?}$LFd\Qܚ e%~?j kJa % ٜݞkQ -+^78D UcJSA]`"ǯ G4QOϖێ$}߬b9!QC4{ҀİV \G+ țJ]׊H}"׼ohx +_NS f |$2"%HjzXjfZ׶8 ) utNK cQYl6r9uPkQ-vuk"FV@U+` [N+ Bmm KU>،&RQV>På2'y'oWz.L,sW4}pI&T XȮJsxC)d:;ӶDEM!o++}Xڌp4TՆ>PGBkR mS޿p3UjI ޔSjjz\ PP}cvXhMw뇆uI%Z0}ЁC)'D1N @ZЕo?qHYV ==}ɗZEY|+/NB( Bˀ*7ν1nH)҇n|D-_y&3W‡o|ɝn@5嘜4o:ǧ$d& ~ZޖڍAR}1GoXڵ1*g33z{̈dcwgcTQ# g,VZrڧ.PȞ l L :n> l'dg _,c' dgڧsSPȘ.XIӶZ7lK;h%źl6;R ZbnI->\ ItmNؑih7d'rjSkiO^EJס 'vM;:|EQȚ5ĨRһStN PLd:tEUۧ8w^Ăr{LÉӧմtUG*7\終FdPv?M@~KIA*Im5>-ճkn Ջx(xX~_[DE P_9^pOm Un4$톲ټ,Bab)z -Jʢ6nQ u˓-iWi G!d(l *+XmZ#Jz0F$XSlSHọ)kaeJ.p4T],z74ġ^"U"+mH樄L:SiZ,fm5Ȅ-v q|MG\+VmuYmȐ!NXA5*]VLd!d-Mv~vTU_׀%`y iY$|[V2~ SV5c)4b,OJd\/tN]m$ 7' a;wK$FZ&G(+l[,n] n\DegKQieckp$v=#ڸ)b-M-t.Kr€NU)3PwuZ!7r]+Cn\=I 䜵ˀ`lYt.2,e]˗shܪe4lkS75jj+}keYwj(WƑcڄ)!.ǹ>֋шوt_ 1] B ox1^1h| ~H޽k#t%/U:(Tx]@HdK|C+5OiKzwȹA̚?,$&V,h}rM&ʃޞdK×NanC"GĐv˜.1c$>Z3H X7]ih,©''-镀,hc4ۭF^bD{raj%H'`+"=r&xxdʎ K4i JbgcN*|1*8 A4'HaŤvU= ȤR9.✈⣷l&!PAb14-JQSm"jv 1*5FlnKS܀pnz./N,0)ni Wc%>Ycw@35)}}қ񦬘dt9)NeRQ0*p=p*FlvXq"? O1Ew>Y[lh9nAB[يLg !JT v;cv%Azۆ$U|f+YJu$ Zk&;UĠK.(`9Q , ZdS}!UI;|D+3jKn9s vڄl6R[3J-!a+f_HaȰw)urWöBĂ+zbj2|YjdiQnZw۝)&h.v9ur-9 Lœ~X3raT+HzupkHJ|`lhIISyF׾Iۿ:aEzqEez‹$WrbkpA}!NPgZHPS{|phezj GppoAd }#E 2=<|-O.K3)#~,r3*Oa-XE>yɮf$+'(tǚSŋeMs(F4&DIZǒ)L,:VY~poJ u>jbRMEI=*?^Hr NAa APp'+1yOR7,{sa=HSoL<+6Cއpi+D$)ҠxLR 2T67Nǎ K*xVV')v^lrgq&f)^6'%kIƪ~Q{+n>-B‚O rou0BXUPѻ6N >Xʙ;㗻elmiatbqBF FHێNuO1EJQ]G zPVx٦en&~4 $(I;׶Nˢ*?kkoUyfdvې[q/j=Oaz1[+걍=,-?$4[SގJI*M:Gˏ@S]PPUnQMJegtҩj~pFW萚ʎᅰ"A0SYPcJ 1S vh#anS̗#..)|p۲IZw='vR)㓭5d)w ErpMݖ-$#ЎȡH@5q1}ջ#ԁ@bs}.f,jzIk**|]N"ËUt6䅭a3;*^ݶ50p_`W5$\Dvh߃r^c.a"5Ю+Q㾮t'VH0wq>zkc6rsaWeS]]/;+1K?,;L%Z8X!0aѓJ\u~K$=\()=0C.͊ N(=OKdK)*Xv0Xr+aWf튻66*ءَvlUu® ե1AN_,E@(M>6 ,Zj˧cdB{F++谵R ^v%=s#$"ˈ(~kZV]Ό`M(G_C,ǩP{:?SaDaN[~r(,{S$PwGT Lj<2AM`nxgSCcnA"q`pIr2s#fb23锸xXQѷ[(W u=YEOljt;KCȁ\NF0_UC  BQsQG$m:V2AKҀ7NAZ0+# bc\:jk ڃ_Cv^)-q|[#(Yj:NLD=a- z dH) >}?FN(Pay=-/]2ɐ?IwdEo #,, PVI{\qkFϮ2M+}i֟'YtUB @ ׽n%# 9 m|,FX LF )'t-bc=ĜREO_p-N$`čexG(ŔANi+ƥ8=kqv?D3Z|L#)FFr)}u;jѤ6S}WK4|B׾lfGCEi1񿉕M~ CnG><3`Sإ L b0+KYx(vX.w®G, x8늻)[k\R;6*ثb́]0ثb͊]U`VY[®Wf*죊(⫲;6*+]_i< vlUٱWf]vlUٱWg*6*ثb͊6*ثbQv,S|R|x)vUjGRM\2Mj(.lj9'r ;{WvZHKl;ob[֧6.d$_iV1S~x`Pƕ (bh₦AZ}WE o\qBhx5|vZ?-kCmjoZm[pB-&bO@vV>ؓ'sֻһ7(l }au u%~9H騮4:>"fſp2 5xl?ݩ5$O. \4|Xl{_㧬v)7؊1jLPX5L1LPeؤ(Ԛu8dYAZ 11-GCt щ azQOuR)_ "%amN@PqޕG!I`SB}!Z{3a i@0(R8+M}UجhjE{ qdCULwzbSnX}H}~ ۗWkb =W)hѝߪ? kybP>-XWWJkJ6*@%~Za:9JކGW6§=cOj R`v;7bP >Кױ_\R?Ͼ-*@c\Uk}ɡ*Q]JPJRHؒze-Pi_8u(v,A=)Jn~, 9\K;\ JGTd|7Sֽ}[5lyixdf Gӥ0 ^(,ݳVY4thҐHiً9Qoon= ?1JH| weVOgcut ߏlJʰA%U*kQ3t-GRԡS(87s4OoEfUx#o!Ok'&fTOCʿz5 f͇$17 `;.2ٜ+ڌ:u^nުz|˄M$qBYF$ *ݚeD%+rT~jz|q`m-:{6 c,x U/Z30E#pk E;4 +S "#,B6>,}NGzbB_;Wr`W4@SҝUSA؁\wO!Zl;S2G=o\+K4LpWO4&e??[ A#6r{9#dM.eиv Jӯ:5탖߮J86Zd}@D$I}_jHKRƠW2")^gDl.`YCQ|+PUhxLFh)+űP]jnHHz RPS=+^>(jO #BEPIcіU•&¦ř&梴A[