ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:20 16:34:23  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?B`H䣽߸$C2m527=g>64`{,v즓Iow$k9:׸jkHq1OSc?!~9c'v-o ώ? xOjwOּgZt[Z>/iOW'w 0, >uX6}ڥH6 &oqT_teufK)owZzn-? ,u9`dJۚ98Ǐ0Ww76ocu%uClطZלk} .&O.돟zIVo)$IJI$RI$I%?]Xmc^tZzkwaޭi^Mqw{Tyжmٶ⳨0s.ytlkg5Eu..D8}^Ź7)cdˎO(}e$R9I$RI$I%)$IOYskh.sk@ԒXy=.m]&LcU]c6X.ymLoOçYvKuv鉆?bv?$zWu:1:1a; c\Ӳ?͋^]owRgZaRS^gs~WHrMc#V~ܢnww*9YQkxee.g~]hũںZ}бwNmn42̋ hqіOw_$ |w^^r /xQM-f./nC*|Z!>ӷ{uWllg}u[++'~隇s7jxH$6l򵻴]vٕI2S]neA6=k{~u7c6T7gfյ>uao^389¯wzyPD ztso88T93=z.}6}BPDWSL8۷cPd b~aI$U$I)I$JRI$TI%)'.K*__;,hpr2I)ųCp>VP[`WAKLo{g-z͖ll$.g Ghqn.ֺ._z8c (ǧs`s]k!˳?AWLzGݒ)7 C2u2nkmnUqU_X0K}*{s.EcZ4${Y_~^:8=J=K]oϷg?`qѺ[nmŭi!F;>rQxY0I;fwdQCw\;n1?NP.9ψrQ~9v}{wHvʿq?\Q5Gw=%dH}rmmǀpAҤO Cv'ݞݬsX=:X-}nԱ;ldQپI$$I)TI%)$IJI$RI$I%9g&ieuU9Cn,k5Y̱Y66ֵW? [gW?\N2ٕcۘ6 ɮZwTyX%"N:~68_n2\[ck)-ͿW;x6u\)nW~?2b{pG̹Qa/>۫uAM|no/N=e&I=n+'Tfיu6 Kl,2ʿe i~3n3nq7vj[кsoc{wMok\Xgbz\`>}ޛWLѝ@c7}J=Q+?랚@B;1G)$!TI%)$IJI$RI$[UfU`%~el~~klZ s ̀\aV=7 s\؏/VY}fe{OЯjoѯ޲Da݈dXc { jnM,F7H;Kbht{]>2 NYkڇoZV=skli,sl7OTAkKGdNuk~ڍv2oЫ6n2mo]iH<5reoN/ktpvޏjGqxs.Ӗ3,ȼ^CE`4+N 636qq2ŹRGs 9{w-v?=zOս<:w ?/y3zP1~*]')G^nRq($?]jn]mk=^\KEcu-HvA?TI%)$IJI$RI$?7z;KZNr;>Gsl#cZrC2=^D}B镸c,y]u~{lt3&-iJTW[XƸA5?5 '0qcH$bP1DFQ߿?XV[Cִ@hֵIH2mTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXT EXP550/PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMY update_maart2018-7 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?B`H䣽߸$C2m527=g>64`{,v즓Iow$k9:׸jkHq1OSc?!~9c'v-o ώ? xOjwOּgZt[Z>/iOW'w 0, >uX6}ڥH6 &oqT_teufK)owZzn-? ,u9`dJۚ98Ǐ0Ww76ocu%uClطZלk} .&O.돟zIVo)$IJI$RI$I%?]Xmc^tZzkwaޭi^Mqw{Tyжmٶ⳨0s.ytlkg5Eu..D8}^Ź7)cdˎO(}e$R9I$RI$I%)$IOYskh.sk@ԒXy=.m]&LcU]c6X.ymLoOçYvKuv鉆?bv?$zWu:1:1a; c\Ӳ?͋^]owRgZaRS^gs~WHrMc#V~ܢnww*9YQkxee.g~]hũںZ}бwNmn42̋ hqіOw_$ |w^^r /xQM-f./nC*|Z!>ӷ{uWllg}u[++'~隇s7jxH$6l򵻴]vٕI2S]neA6=k{~u7c6T7gfյ>uao^389¯wzyPD ztso88T93=z.}6}BPDWSL8۷cPd b~aI$U$I)I$JRI$TI%)'.K*__;,hpr2I)ųCp>VP[`WAKLo{g-z͖ll$.g Ghqn.ֺ._z8c (ǧs`s]k!˳?AWLzGݒ)7 C2u2nkmnUqU_X0K}*{s.EcZ4${Y_~^:8=J=K]oϷg?`qѺ[nmŭi!F;>rQxY0I;fwdQCw\;n1?NP.9ψrQ~9v}{wHvʿq?\Q5Gw=%dH}rmmǀpAҤO Cv'ݞݬsX=:X-}nԱ;ldQپI$$I)TI%)$IJI$RI$I%9g&ieuU9Cn,k5Y̱Y66ֵW? [gW?\N2ٕcۘ6 ɮZwTyX%"N:~68_n2\[ck)-ͿW;x6u\)nW~?2b{pG̹Qa/>۫uAM|no/N=e&I=n+'Tfיu6 Kl,2ʿe i~3n3nq7vj[кsoc{wMok\Xgbz\`>}ޛWLѝ@c7}J=Q+?랚@B;1G)$!TI%)$IJI$RI$[UfU`%~el~~klZ s ̀\aV=7 s\؏/VY}fe{OЯjoѯ޲Da݈dXc { jnM,F7H;Kbht{]>2 NYkڇoZV=skli,sl7OTAkKGdNuk~ڍv2oЫ6n2mo]iH<5reoN/ktpvޏjGqxs.Ӗ3,ȼ^CE`4+N 636qq2ŹRGs 9{w-v?=zOս<:w ?/y3zP1~*]')G^nRq($?]jn]mk=^\KEcu-HvA?TI%)$IJI$RI$?7z;KZNr;>Gsl#cZrC2=^D}B镸c,y]u~{lt3&-iJTW[XƸA5?5 '0qcH$bP1DFQ߿?XV[Cִ@hֵIH2mTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$:L`Pӂ V;Xyڌ~'|$%~C.lbQnͺםV TW61l{^T۷h-W$bQOL ,9$KuQ bC<}&,a.d7VBĥƜXn#ƻC7&aR]R@I%:y䧘ckȯ\-5r'̍; ?(Z8f8aJ`NĽ_lOWR^riJ-`*Ե㷎$o*85voV/qVւ%zVdu -qy{ohvWG2U~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb<аų{Z$+ 3_'Y˿H2|Ud޴'L\ P9C,DZ :o>*P|\ymd-y2T(U2n) xPwrApiSVYErIEOND#zUoV`@ cYT}TpQ]JHy"h|IVVGhC_~)_؂HdOGgf}aV ֋e'ې v$d9?XBjeĭ#!? (m@|I bJmU U'%:y @qeV#pޙ,I F4>83b~JFpRpҹlBS6ZG.ԃe֫Յ$ƴl*i[`(k& sJ.cєzb3QCQaa T8ZB)Zd3P!vf-.,Ult(E3QdLUN0DhەJkă|2',~xiH،+ ASCƽ”l %&M"ip!}1Q*)?i{T\YҢRlUZYK0ҹB8愂3&)gV![ gb(n{dY0֖haֽ  UfL;n"7s%HEk 0gj9̬#ҥIb|k$Mw;%nٟWy9m턫`L&n>[WJhM4Iʮ)4$73"> "*,#H$CJ},Jm ; OZ En*9\k˾7(tbǚ}/rj@?iVqKυ^r3E,h>2Jtr/5R`RUaKZFj) xVԂx@?< m2%]v3rv@c) eZhHLB'1һ` up>)$x{+ʦS} lLӐk(?N*#u77i+Y87EīTp+x:/NpE70q%zn̲dĥbeI|ǀXf+<_.zxlC؁i_ \͎~N\j0,zԿY>ӡHX())@>,J< p ]$•|;V; lW+$^iZPGa혌XZc;o4\$S;dl:f9`Xf1dK5b9Hf ye FrKIJArFl7Ĥ/׮>li􁊮m9 bj>g­Yd?>uHYzoъ|}x]~X]ΌQp.@{F[sUA YJѻboJM5\⦎:gLm&{*ct8P5hZ؟[X.ٽYZcɔrSABlnHñ;ju;N3ݲ%PB7I(rSU!֔SPU(yd)^"Ȯfazn/Y6>,eYMScSk4& "+d_݃FI(*cJmzBA)򸄰ŴH5=wUcEaI!x\Qx_rLlcSUUQX4r:F (WRA#rriL$4_n-', m(/n]&pN/ax%CGs'r+DI{tj>.`䃉Gzeg6K\BWӎ4F TF{|}7V8 \rٰ"ҁWYTNA/xrAQVh %j){f;qJaqۭq++G0H[a*#I ( nuN^" ' TJKmYVKmVMʢ5]>4qH;usMUЕ*ҿx*U]똀;cƞe S3"io5 ә|js0?^XH \)vwgo!dd0 3G p؝WҚS@$ث mrQEJqWa2LWj *i׎J67"4t)'oB̭mJBlO%A߾#"*TWȬE&–ޘYfĜ*1:Dԟv\.7kL .BW VN4%JvKS3y^G *02/Qv e*;WQ+* [Izx`QF'ppP S`%h11 ƤcU9i7A⛚kmrm ^0 >bÙCϼtcҽXupYYgUڝ홉zJ/ā@ǿjle1܆$uFc 0Q<϶FSWDPv9YB_"|GXo_|)t؆}ctV),lC$϶*ڐ@cvWRB|UA*DGo*w>-ѣQloTT% kWLB_ڧ\#*ڠSZ!Ԟo2ڡW$%z: 'T /R=}HyΝuy2L?#إqBӪrK ,jN>,JNpMVZU0,e; =I. ۇ`4NJ\DQw#OqKkWrVSqD]ZѐB)}*;uȄ!,Gy鼉 ؝'ђ]7~JֱHlзO~CnAw\R়&]"1 ']J+$u$oѧ %ZaQJDB UޙXwFқmWF0r%^vHKucg-b ;|>mp)"56.ǵUskh$n}7GN\ DXtM+l~L)\Ӏ xv/8f$Ө\5(*Q+AmO(>,byWDi Jl3'C:HZFĻF*O\3z>N!n$ք\z`BUqN?`V*F; aUأ|MV=r /|*$>k+9dxB ~5zt@* **:m-v Re:}'LZ)[lV\RBhPT% P|G6SMF;eau5@՗O|> (YQV9~[1ցW:z'oq4v*gSZˢE=^vYC"x#ܒzm !i nn|T| CJ_fɅGF'0{1 {dWj$y =7hRi* nY iV@%{-()rY2n1jp>Τ6skTM3^kF̿hM<0H޳ Ӗ%3| 8vC—sqYw=Ma*Գs@<}C10+%ȟ,MOp;bzcq(q5NRTSd`,5@{S8TT@i_ˉؕya_nJf*14l\(mϾ\H,!XX1!T_|)_^ i {a vm( (itm26GL,RMJU*_t,0A4ۮ`b^GB.o: 0#T9aR=F* ~͈ݽ+I_p`0y\PO|raSPZH.)¾$F!yr u_ Q9qKoq78%N9֠1"jT漱yL2DF aj E$euRè"cG;2Sd:`+圪0~=Ns=֔Ĵi`_PmWHȪþ8|iW߉ RlKS~[=iV +P |1Jב'*:7!vez晐b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb壔2SbHr=fI(+mѢ(fw kS؟$DO^IV~ZI?xR=dB۔2'B>-fF>j̼;(U{2 FOgqP Fh%E05pLjb$~?Qf=q8ޑF]%R>Czc.#Ee4uj} xUr/AŴ&h%Oտw)8.?M(֏!wy!q0CP%?>;`B|XF4[#z#,FEqW0|TZFTjBr=IsPlJZ2suz {˯͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbΕw{q>G \*N@PsgRz;xJ-cy(%XM~'Q/5D*ъ9Z/7?uٜfN5fOJ;~J~8OP" er:UeRNyO| Ք04nTPSᎻ$aNU|+|[$xLH_q5iVu >*ixSl  PЫs"F ܟU](g8;v (LltȕB^E'*UlkO 9T*V94jێöI#wpYH 7m`2F%?#0{4D|,,*lqkHr)VÒF jN`~)FG#ǡ$gUdU9$QcZ ԩ0p ؛3E6UFXBrڧaUYd nT+*GU΋扥 Bz3sy/[2)*w9J|.fs9}5t7| DAfxA*+P7 #(\Xd] H@U`Iҡ(E.Jrb8:mY*Tb>'CrY[ҽeA©hO4>5%[B PWU`СA{,v ▬ʏ4$m Ո'bS({dA E|hH|JiZgD/zhv>0dPnQ!? F:TE$¾"32a ZbiA۶BS(: ⲶS2iU䔷$@ hZW`޿:B?!Wcaq J|G+(P4qVM$([ʍ^Yd+(%Fv'J()jNY( 1A[q-"|GW{d JWEG3dxbZ|!.tX]c@N˒IΓy"ŏ4m+ܘo\O1F< 3s\u81j6'T;) **u9{)V'`iOq`R( 0ՓÁ>4Z8n(ɥW!EpoS ]p>u.3p% 5)LD:ʊ[&/ =)%,~UjV 3y^" "Q¬:w1Ida/ ˷摂xܞx~QL s;IUGhd` al*lT S#:U|EJWqZ fMЍ*銩+RXuc<]Y_U9^]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbη 8`ً:Xp y(]BA#b1me5- ?~cXve#oj૊zf) 5s''>%Ċ`uo +#6L,ՁČx|$xxn66^ju* 0w$K*-OdUȬIH oY\فLnLg1n!=>|GiV|Zq8'_l7oTXnojVFxgb6' U-{`AڧѕIXި aR|Crn&}'y25yTxbWNuR#ׄփ/ 4$2BywTZ0!m`)?n,zwdŭKp֤nBK»DrG}ثqM-)5n{"qF:qmnr+ ؎-Tn2EqcJ*X*|$p-:e,E$JxvB1$'_U*E[S0)W"U *,$I>pKu]X˛]O9֠買`(| 陁׬4|5n~Y%DI"F ^B5Z㊩jy +e-@ / AU'\r({|r*z)cKqP|2 -P7d T 1 y6+ZMR_1`x}TgG ( `#۸ h|X@'3>)z'8b/;s/[/2ԧ ȥra*؃7!RpKzŒ(vv];zQ'bcV_N)v%G0#48U5!/ 0􏪬z"\q#n+>dIɣhIW Wxg'$}1D ԍ.RW]GeQ҇ >fQJ]qN!gPєLNƃ1dōkl(ݝH3QFKxrġǦw5knke͋ǵwԊGY\>W4ǾPX/|n=L2z H# "';kE鿓~רOL&6pKC̓7Lh#U`p]2(XV#8fL)\R/FDz}9y\UЌ| 6qVc[LtO `U!G[TZK~uf e4ʱ2i+*܊(xw 0VZf=:aG˂.|1C?<p0*V#rA(UNBVaצ7FWuiM2ģ1CM[*+LU5|3  8^NӝyI'ȕCޫpz 5cj%$oCQOHŨ0OPE)Wz'{wk'?Iw ]#xК:ݿt>Ё̿*izza|/Kzd*jj{m7rߐƄ`W9WA9?Ap*NwlѤU|愦q#NEa;I}{e_a2g$*`$i"n>Y.hy.uS;sjwAgE/Ze+NTV)YaQW4NZ~%V;{a0WUӍKu&jo5܅S%)NOxU%#ӌcŮ`eEZ\ bDkGv R0W. Gl2G2ƥ6QB;*V~cj\Q*ڿ@ }Ÿwɪ;bj>2\;Im^^\0kV v+7j;<ԟdO-|_1$XjEX gJWU"62xߛ$ ^ iҕmP,r5)'.,įlS~QJP݁1SӠ Rf)?oza\EdIz_TI،'/FQW}=0vY*B—ei$u8;we0ؗ# QRj>V3,QJЎ 6:[*i3t"ڋ#5>dϷ(W3=4?l 5XMO6wu߮*0a:VnYtGiު˞mvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثk5 2)1n.`y;5o3;YVrY`lJuW1aI  -v_#[ 2Vu؜Lzq8C{#%JW,Ւ[Ưp{S F=YE@|]Up* 8Me z&d{~@50*H^'8VzopFH sSlzYNC#@J5hcv2It_|J'!E8EWr},w`zwqApz2Rs׾Y'XP. p޻d5Oc{eRRā|Q:T C#0,O\ۯ} #5{x` 2* ¤ T\V-cY'bҐ9mPɥ.#k#Q)$R(Z\xk@w8P M1s)nPd aCoSH.#h1n5L?Mҡ?x JU.cwSq(iVyF";@U%Ju`xb)[ (T6eI拓όW܏+SSLЖPm5U6ߨ ӑ! [geb|A!(TَZ,Bv U).g8hsfOFП• 0(6RTTIj7+es\6%{F9`yv-mԩ6-$P>xd+JLG*Ih2$mSR dgjFXžLj#+Tv2#\*2y V0<NahyI5QA=i噉za]##GqFaeOM F @ d~C$R*~X I#&O$?IQ0 }ص\ġ =p]ݯ qUP۶ #0(i\"ۅ3RxUp<^I(~Pppː#r}䂷腚%VO:~!1 7B6S =ļ\7Uma(lᑏ6s`? ^G Mm;V 3<5V(!Fr |*ix=jNzQT PZ#[# S_SN~E}ec Mf8v&Kip5y/*^!cPw&V1KEpr)R;``ʒ#Ŝ:wjo37&Ƚbs1Ps_1byרfȉ`0&+E5j ֘JqQ^K -!|**N)\:{kn. F`-ZF?h쓪m픔FB(Wj\9ӔIX/G$$ W ~P9mWIf>(ԷF0ݬL蛎ʐwl);`V$4G#)C`ke47JlNvv({a*Y'E?Xݪ*UT-T4zتN8w{aUGni5(ҽkBFو=D8NNEJW+*KY1 @KGl6HMRC,ʤ^,\y( ]'nbD.VM{C0ZފxrQJ.%6%?ha5 eFM(Biy#`yhUoIc(jֿ 1ާjx*1'W XRd$)Tbe #J^±H^zǸ[;:#lgqB>ªz\2kSC ]ԍDj>uʤBgOgX"*|\ "w|}u$hĻ1zj휊0FɹR>%Ӏm&QPJbFЭWwAU # RhGhLGLUPi}C]%\/0NLĨ %p>y%\;H, `V| q*W '+'E~W "6< LS$ E%8ٙbN,=CI}*A6A ;o(Z",3ٯV:Ж~uciELdO\ϊ^äP9_\$1+`JckyV59!Ʉ}UWڥ)-s]+_p_vP9Weʬ ?xFث3Cc(T}t4)9;}Ǧy4%*>{6j_>&żUdZ.Fħ68*!4iNa 0iS}o,W;{aJ`Kħ~0L#CׄKNb)}\,X֨i΃4^G|ļNdS1G[Wa6s`>A?q|8$iTT A};@ ;ֹƨKojjI%}rZV;l<;aVZ-0%$ •Ÿevu0$kJupwzf76俙Pj3[b%djF$Aֽ3~fY%íUwQ͑z䦠l9$Us,bXxC3G&oU'5S'޵+Bҙ*%wxkJ*hbS^bh>BLzUbC1ӄ0V]#5\b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثE[EPVs@&vv4-TAL/LC+9ᵐ-C)Hu&IC2KhvAaG+t0 6mG?81Wk5izOVHхZA ?V|W8F_~*%1-cqBMt9RpקN!\@<\V'JwTf?60m1(|4o@Q ~a!N @?~(Y>cf**:dJ:ԫl(hq*M?\( j:M4h(p:SwTR\RW`W 8T)} Xq_Ҍ/5 棉N U3P YB›HwlV"UiOzd6J\T,D; x׋U~dꌁBK ٽf?HYZ l!a@k(COH'c\?"I.ʧR2Z8]=IΧBWKM0ͦ qO=܌BY 0O@HUz/9 ;Nd>qFZ䒬|i郸jQpt[BAkZbUNEa<xǂT}!wSNc*4(1K{l&xc'S9$y|J0 grd?іZM UR%PV 2+ d: JɺR3\ؗk7 \#ųP|x3Gľ6>\vC_Z9`Jsoyv=0HKwޞq}Il5]8m8J!\uZjF>96 U1i+6Xy$b2D#2xK( [jAjC'> 2*PHdO HZA$Vrcbt*SaxQ$!!U?$c~2Ԧ1M'Ȅ)[)13SָW,KǓP U, PB{aV-zRp6$REjCPNى&,oU 6'*9^,%7$)5 е4P_ U#% w®lj@\Rs򩤒ћls`^c0ߝ!J05;eS܁cHvtt"K|3/d^)(42= 8zzl(z־8^0Bx"`oF Yj\EExA/׏$r p5f;cbKo,($ +|=8#QpDrp0=uaOP_1:o"a?mŞ~mf]vlUٱWf]&F 198@G,]WVj6E&Ϣˀ^H9xd5A3 ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU4Wi쨦Us*We3ǩ` GQ0 oP*B;Y%27KRAڟklCP1$p;b_d l\{dH31J`"Ta'ҔYgr Tی-+My:S9h;%ڛB")xoCQ onmŸ4(`>`A{]I%@SmUX 1wmW?X#b6p6Bl銊DhƟ˾ uaUJB:v8mf?rdQ@Y{ 3,|"uCe)>RXۛlJJ̆DzXPk(S~"þHWqQҞLŅce{G3żsF`Ǜk"#9;nl{k"J*S-(Xq}I(Mjޞ؋X&P W[`E%럼qAb}}w'_]DkJ䒉"u#H%bhÒ5r qq*vREJ.)9y6UXӈt7S_dR Bn(41}(wr>]AwW*8`6X9"֠|FHMrC7QU&:&VP{S0dļX<]^G95LNdmJ[F8UP\c开|tdI>;`M_ՙc$RH#V4\16FI.[̅vu 0x ś17 zWt*ҝslKOq=~6er ?6QrRd |<L)qoyv'&ͩwNlդ+MQ!.b:pvW5$®Wq+K~U}fѐl5/1նXaH&M]pbX$2*{m,12}?Nd;zwf[T#y h9lFrF ?mupYWmRQq,'"*QB'늶]("Bi \mZikR↛<1r:r}Ͽ2+FODC!k_vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*iR/G=y[cVVv:)OG,,8)6a@q-;0k7A<בpkǓvW ~K;f]KLP7?,;K ia__/tv>YcGԵv$vr.v)y8|hixRp: v'vXu Wc4pTdc@vd Z d 9dثUT= 6ɘH x$ $7ftdd@Wa9-.˒6SE2Rpy;.8MKSW `eU@sv5„v94R +]H](ւdq[K 9vlUu*Y,r0bHNC${MGGUݟdk97n|dw O7Kx8u+YFDV!UIpviːFF1%tXB#a"PcR}@K_1'BAcR)QͿc>&9C\MnC!/Z⛌:%z!F6H*=98㔹/ ]"YX+)+MD]1Nelo*R@2ğ =':<uT^ #n[5ge*r]0H\1y>–cUnƲsx6|/G8WJ} ˢȀx@'TI3@WNU"8hLܙB!%7d[ӡ{v`:Ҟ> U8{rDtiW lqoC-qWCLMD#PYI~4aZc‰8KZTJ^- 720Xcnpݏ|BfsrkΕqWP; (SJ"YG2;dq١h[}LՄ~xT@M [$uZ}S"#ܜyrشҁ<2yb1%@ޝjl]?k#ot )'8@_|!%'i?u'@j&UH\Ief؀MNbM9 '!MƼ"q a\Gc+ŪGuSW$ЏF5j/%Q>Ґ r?~9/CN^hJsl֣f|Xz,+q0K0#GD_ia Uo5$Z'XX*HvtfXȢ-OF%矛,p?|C:ڙj/X 4 5z(r!hň<s0-PVJ?h62h JV͸õOVzr,T q]\ E F &(>/aUG>p^F1( bP:5ws''?{0}厝~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*I(O_/tdW :{)l )kOɨ5qɖ8&q[=[%iRG_/vvm` ҿLt!|Q.ǎ)<0i]JȪ.nPǣYDd|:)fܜjnb $.BW쳘Nx%Lh #q=ml_Y@Nm4Xȩ5as#_Ms\s.Wd<_?9X\}mG-449OGĆX.*q[$x~Qu8oo)8q?lv&9z8?rN8zy.sA&ra⑏F22{C 8G[ܥk1E(I%%_#e Px2?rc'刞!T9v Xя})\wQYRQH6_ڰ|0 xx^W,brd2Rē7R722Y|#},΂x'2po?I#o*?5_gbdk97n$^E{coֹ{71$vt;]^sZ_?{ G(lvh6)}{a'j}q$}<~_\~0b/M:j~lKYpmi5}4e\>sa$.E]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU?-lx&^r4a|c<3ƅ[ޝi1\4|N܆(C=cd@c*=-3}Pbo*׸`*:X^8t GC'rTW_l쏣 %1|(j}?A 1d m ^u0PvL*=Pb콰*Wn9 JM{F*y~yYT0kӂ:diPp̓WmL/L*i#Pڇ$$3zSX172AQpƵ«[I9%W^1ϬYE *P}A\dS7>8AiZk< G S(QEQLJKlX~XNI FhREp}1u@cԍGou%yJlIǠRKoN`XIhppd rNY, jv!k+ 0Ío-5LvxW8/P7'|)EQNƔMw%Gµ~9)Z881) ($L5p$QQȂ<6s+]q"Gք0\I)-d^_ݠ_JVwn&m]hW p+d[?1CA/!}}o5 [}K,$BPIYGĆ$ȁU|hq2,AZWoc6*~] b^c!W溄@6&3ɓt)\Bҙc݁$.T<0+d5`B䒪Qt3^RE•*Hڧo ƂN*qT"W|}h;G ="JFcEtd:|B_E "{c7ІMOOHǦG"0!1qϩa'j Yq# OcW,wR0<"g_6Ai(̼p|,#O0_ל?֏c>|Qs{\V0gcuc?Qbܤ=i2w{Kt'LC,GFcoGvF7E7Vuf6И7*ܿ~[Xaq†9^'pi \?pZ$}7vJl:] sᗇGr<H)-l1Үl&DyUW~=Nm4Ypd_>/F^Y $8m-j+Hz 5>{/LcrKtGsvK(e?\5?~̿T֏q|2GsvK?>u~?Qwv_gb>Mۮu9u]l0?oל_֗c5m u8pO1Y#iQjm V9O279{?d'?,?ŝ3G߁e?3>W?qcz2;]_4:bcγ yhZNo.2Q_]_7Q/oS$3Ew?Qܿ/+>j1evZ_Gդ56}W.}y#07Le lKt'L.Wdȿym:f?䜿޺NC?98]lvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v^*?ofà'\_ Ko=:М|G\_"WHtWy%ՅGB(,XS%u7H NeK{"גeڽ qu`H` t?UiF{x݉R+;SqJ <%_IHU|FiV)C!U ,-J Jƿ!T:Je |(~p*{mƄPQVH ,@{PH)#zSl0 RVQPT๑ښUn_M<e+Q XQ׮92J-{`iא4n{)=Ԅ1i*:>0 ^#]xG•9o)By)ZV>)Swġ#vݰPoR%+QR#TBGa| 0Vn،B* uh2"`J6 $G|g@^(9l_ӏt;qW muɧZkRA`wiK=h lȥ 3 8Ld-ٍ+!5\_ S[(;>[,ȩ&9NqP*:TJqbwA^_HUbun`Vy6VQҫPnFʏ񰎄Md⮣ӗp1JcxM7 I'I;V5EG&5sā3y Zxoo@?r FbC'ǩ!*sካrA(TՌ/)jדh W$ 9t>^o92ޠY<}aa>'hi 0GV]_, N)u"0gP<UU!_JR$C so{m5$Bs$}{TRi@ dֵO ,P=aV#gcZrP7 A$x)fh}nDA*(Ujr!ij7PxϾNqB6l1\PPOt+q(68ZWqkGK(ڢU<0$%#- ppvo$Ei=BJ>!6V<4>f1䤂Q;X(k̈́r^G 4YWǛT9 -"r4'oV<{rP^75'L\ݴ7TD GN]4<݁. J^ @C\NŢ* uwPhw–~OF0ymQЖݝr:潤;RvZ(7,g>GIbxѶ9v/9Z=~.d|UZ :A$Cuڟ,ҰTTy2*5@•J Э[*|=!Lk͉^-`zە2'!@W~W,(6'q?*;Gq_iޠ$/mf$0ǂOnJ!gAB$'>!)p7'0ԙWlu?e''SOtWFՓ.'L&O?/Kӟ.3χ8]S!hG5q2t?~;?]^s>Z?O9t[E?'p;;[L[S坍IsL\Fg4D1Rk ޽'x[؎HzyMC?e dd{8p=ר1bh ґ,;M&/"]ٹTf>c Xcˋ|B2?uԐMmyǷG48}M% }\_)-`1Gk''S7V9ȯ?d88"%|.1әeZ ҝ\ǖUd t.~,,u+a×e9xQ<\ ͗Ɯ%|8N>Hĸ{`$Rig&=돺M#˻U%z2.u ?~wQf_kG9^_1Xͤ 34'? F I9x^O+dP8 ~?slybIەH]L{, Ŋ?^N!>g_nsӹ:%SDy#¤O,rQOy1tb#;EeItĝ#3kz'/ej1aQڇ渔X2IaqGs a+ȬK ;_a3<\9qe'$e?îb#;p68IWGΘgw>rZ4:_˒%4I?HN| K|jS/zW?~#˻U%Oç/<;g]F̟}5s/\{5{suCcqi㜊nOsz|HNqIq;<㉏+]g9XB ):eY?\ykx%_:>aOLZ]!lF/7'L.Wa/VIFI|v6:lR%蔿piF/Zkt7I-;Nd{x&'#&Ȉ(͠۾8f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf][ePu$ YY?VݕrSGCFU%Uu`Ocf[5E?$W|T), \t8Bp>$mH 3<ۙX"=F +u6ni&PR4֪fj2(+DZ3Od P| S űUC5xo |+%^[քdqP{c/Z9mUBF!]mEq(@»%V L"ORCYXH^Vu_$x;c-)kŇٮ N.z"U4b1ʡ")j U9H qKd`Tbei9`>܍c E1ǥ ,T&:`-hy/jbШ@$ߍpjFJ=O.nLeIJ#:>;YWƇ7ϞP{gȠW[2a+i hOlXSkGZf\UjZ'OJQ2ӅUnjPs3JƢOB0Xa w;<_cT(kLp4dH#F xMu'JJ(Ypi78TJ:W۶UHFW>H> 'c$& V(<*=It@ՇB(2*A#%EA!Es<ذ6UmR$us`La t CCO "14d}ɪk!m+;,dQAJy.昅;*UL#={`a_ | .$E5dT$b">U=0R|Tzvp` D!n,i7}>.0CXvȪ!^C)E*|iV5Į`nJZ ArL)4=[}"QQbR2~OlUp[$^0JG3}$pRV7[lZI/NT1ŕ'γBA}Ue%`6kzR` 18-Vs\'ՙs GlFKY> @@'Ȭ%mɺٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثFW¦i"(WөLݛv=v^_ "<,D@̭b͊6*ثb͊6*ثbEU/&h (|ؘ;ʙ;6*ثՊJhGq7"ݎwoNY%.dށ9;vlUٱWc V8y1sdUٱWf]v=yŀS\Y%.dɈ;6*ثH=,IG1bb7c]&$);KH1DfQH#QL~,LA&Y6Xb͊6*ث+_LrJV_#.E b:UBTpMS_ j*VP#4=?Ojw P^/$CsTW˾X1b@ Iz zUƐNv-!OW4IXȡDU,Ƌ1#u" WeHqY$92Re}װ>>U^CFz aڀIUnO݆Y PlrS;lj)s7& ΅Jݸ4CTFXe TMxƤx/9ܪmnt=rF4 ͸S~q$ fj̧ 2AQnr TV8U|Ň*|51*F )1\8LXUxHaUUCHQd/c]HJnaM 5ĂFe DSָHhx1٪~G* fFU|U*sZ}l)\0xʽ_urIlC\amXZ11c~h$nu.(eM~Y$\r-1}s_q]ZV'ѱ$9G:o%@#!n#5㗄h#6 B9Pu![N-FyG'lW%TuaZCG2:i-O-QNƃ(!m&qˍ?l|4ͺU{v-e!w-GHPTv˰S8sfV}~&cF@XqI$E &A6_/Ċh@$qE'&ڀHW0J~ȯ Iz8InXkM>F͇iE ?@9uIC;Pԥ\~w`ڜvfT9:LEIzvRc'lA ylJGOL!*ly u]dAw'jNla/cl#E : zP䊦;)#~f8-z9@G ?HJa'|UUv "ZvRIWH` ȥ|zauE קO%I)շ*ԠGU(1+8B]l-֦&6 vD)fMy[t8.AdU 0Win!MI Eۘ ±x"9Fi=~x 5 JP*L6PWw.+v3&6ƕxXwUJ\ו>*Jvڄ׏L*G :IW~k<6{8j@ [;bgH8jF\ӇQJW N5qOo!I"}bUқqUȫГj}pG},Ӫs.ZxL*gl%g)C`PT0VJ:Ѻ1ȡ+P56 3]nXyO<Eh ӭNTk"c)L:G **}}YfƊz}[rZL6QL*klhzJKK|T] >;` EVIЎ$uĵ63A 9 gv!+!7sj́#;) Afxd FUkNKwdo~n2VQM87? VE}o-&0Ү*ʽ˄ycW!T`Whߌl\+V0zp49@]({"m۶RZ_Sъ'&˱##PQC ^s,%Jxf:[Bv' e4؝_")hUVB Z$VM=VsL n[jU8mv#%~%vJ+WdBIV;~>]`V|;ͫD">qq?WCsqmUA#l#r"ءCOHھ+VZ3@Ɣ?F_Om!*&3x>v dU)tMyaJQ>ASp!*¼LCxux[cB<2҂gҮ=#n;_*)!+T ,R$f;W\~h?N!Tv ͲS'$ʋlv~! ͑n}6'lH%p5;FSHg&aOjS(,PN)B @I1GZ26;1{c'Vcp*@3A&1>ʏ'՛Q 2N#yWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*_Z/Sl߳r%ls 3 In)a_+(69 \ө.f1C"w+B/X,d5YUAV'jg*S3`92{VԷ[c@>-Y@ h2eQ T#lpNEPP(4oʎOF2⍁%\8=$WzÉ{]=:/AČGMyf=hm]## [3]Q5<pLq`J9Ɣ~>3ň_ T<ӁgxW@0%r!13bc_-uO|FVSDƻ|4V5Tl*:j 5ڝrHGA~@]KZ xUBq3-[gbIǮ% A^?%iD,JS킇  UO_l AF<܌yzq(SBW~?AыأLTAbTuR ~0D4Bs0 Z9+N*sQ|%Mi/n;T%ch,SlzF&`8SLs%YΤ>%h7yX5;~>{j9|<9o-jGP0 ' ;v*d[S `jaUaчL*:" Ex)Pһnv;`(1rW2'Ebn$!OۯJ{\%Y$Aj9X3cJs  ^**ܶ rT6"4^=rA&ukrEUޡ?B2f۟2i-R:1fhpe?eH_|ar_{d1}LBUsv^]fc'גxW "9_RPr©k_07Q$@x* &RG|V1bءLH8SF"6GҐB1* 6J^(۔kjU9lOCXj~U-9 GlW&\)EI'e\j&D*6 ЁS^X؊rُol*vš=֠VX~VhqUؓW(,*pІZ9 <2 [`3"wqlՎu_-HS5kޘ@=阥ۄvQ#94'bPyL;@uktc,2`"65¯462PTAc;JhI44! G;fuzLT6[P7j95FH)ߨ8&عlhQP 4H>%na*2dSOӎyTs#o0sV9K(؍\u/s$w_|Xk")kqO>5bATRykU"#xqbHU$>[_||d\zqnzⰲs`U ƣ=GCp! czxDz:`JLJ{ъ*FEP2("v˘olWc9$UT\ 2D#D0}Ql$ %3a|4߲~ڎ*p.T#]i^-̨*NF)Rl)eW*gz`0,+CcddRۗh v> gmc^ M0Y)_~ɩ}8|2! 6^"=q{RB#0='p>T1O9֔k:Gk)OU9)#2OJOW75j2s_k{X:nIRVl#}Img9рNRK eIpz,:;# x>X(*Ņ}!QɦhS鎭7l[ƽ3`qv-k%H>x% 'ZPmSŗ7Ǟff7cdX*^mi}u84b~||ak%@bVߊ˧H tRG*t\ͦǰ"`:jT70a$qVҧ?X1Sf{"P7٩,a$}!DZblv4]J:e܅O:BCwT`R\܏\`\-N͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*_+93B+C]5>Tt$CS@c݊BeY܊[W$D41R5DžIN$0 ʼn5O]JE6ja&hEv4Hd,ڊ$|hʨR:xc']30#|#!"ԌSSF={`%@9#{dJnsA^&= !~UzfCq;"t28W!.'waF s%/ҥCX"e8oBXOPhJ*"?UL IyhNL>/#UpiMGю*ڞ)׾:ؒgrP$R~ȡ@]JbpDN Q6*h+~d)jԊ5||qS>aBDd{Tl3pn `D%9%FȡVa2FA9 B[q֧_B)ǧnY E%@c.F#XV>[{6tL9+Fv_ՕB%ƲŭUV5QгlVNO6sj88\fZ5%Hf j{䂣`f+bzREmxS[ B  Uj N a/P {xdJ]}Ρ|J ד=dQm!90B{bWQ,q+GxTe>'XB^~#_m?'(a-GTOUdFe3+ӉWSz vpe)$$ š?D\u'0H39q~㐑TVGw$MA\T6 ^Zi*s$tcroҔ3'4JEA}7(P~Xq+#GE̷(p3, ;[h{XƥQ̃baJHXQ\Q.G̜B(QRkWPָa>OOALUq뀮T#$,BwnP*:erbPaJB![E$m+)Q2:Wy $#kNoVY>8bIH(T6ŊGˮT:C R[IW //o4oHT э%}]3cP챷eyִ9̊ݮO}4_g0͂ynD]ZwVzT{;,8r%v̈́\\x WW>A 30˂;hB< xad: Pڃml?NCh1Vv3BB8@2I_MKd?>6[qʒ7Łą[ x힣񼲊p b KBXs@ŏNhXȵD _VKv0A6mz nk7" ձjXP0IYB|A+UL:gvs_rZj#7ⅤN8 +BrŏI@N'$O P SQTuYpܤcSH+]пUsNw| «[0Ű Sӿ#^QijG;b2H!#hȩ>Tpf#`㷈ˠm`>˒ DDG:`0Lv*|[Za)HaHR,k-v5;VlQIࢃ cDI4/UP?d+R{oC+HQ@~U{mj6&_ hOUؽC !jZ$6LW2!:L*^HE^|ņҤ3$mk|ܜ wۧPk9C1N!U$>ٛ ܧ~UiBIGQWCnR)*)SdXXH|qBHd g%}:MF[FdUJT\~RVati&o\F/.=3ԞZB #٥7|'~bH: Gc|59*װ휃[SqrH?vͷ|ӁND_I~Lipäq&IA-m `*3I94;'3PdMVVLAiM 5M ?YʄփZPMA8 c'+-#9dL&~vڙ`D+r5b}%xPثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,b8P>ogzB\ԯNb1MPO ;ѓiV;)3+)!Wj#m4鋁BC?0Qjjs/dUeS4J /F-1aʻ}9R.kFHDpaZX6S9w"nVHܕp߲ry< W[:[o\a:y rTWNإ6Ѭ*$iAw&|qvBbU6^,M u Uq ^'*!4g&b6^mzU9,dT8 Q̱)NȪc  *jsНȡjG|qӹa͆bѪ;`K QjT1h؍ہH6܆ %Z=q4҃ԋᑩQڷr ]B>&-Fh|P 0Aq'k->(kS*+OCji{BZ`ކXeզoQxDZ lJ۵h}DzԨ`33ZT(3_NGwָriO4o;ѣ{?^rz49,Id^#aAjX#cNîDlOɪ`QU;|{'NU ѺF9nL)m!\G׶*b {BC)ש))N 4¨־**`;mVy8F*JQE5-{c\BPWmej>Fꞏ?H?'ZDu"O $^eNNi)? d#.UEAyGZPl "Ʈz Ÿ;f5L~"+dAOSseG5rk6DF,g~`e:Ǘx^ Gops7',>~p)bP"ױ+s`_b3)/@Hxwm ;$FC1% nB(LCFzaKxͬQz MqPh4˛=CVb2Ep$qͶvuwc8ɋ葃'2 P}9nI(J*Lf g+Kr |@(q|?=WF@=1#25 za?J&¸.g40!j0T5=aOFr/ V*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊, RɪR:SaxED%+\ڒȲ/Z[صFu5,OZT2APX1KC?0~Q^z[߅=(xB-#{290җF/zX>eޝqfPhOlUh$p3Ih/:49oぽ`i!bIJ)%Ucfy8өL@}!J6V%;8ѽW/b%UeZ7~F h Po8Efl(y튷Z#ZȽ(1VAĝ^(ѣZUR3'jhm,mF4Ȫ3--k P||n(*WbGqaM*y яPp4W%nC8a׷O]ḩ{L*>4*$yGS]Ӳ8k`@T Hߠ|[&f||8cS= Z)06)m"#ZbvoB pu665Mm ,yH?NX7T)^Tf Z%*G& zed+:U#ҿӚ~2n$,UtuBL rFR2)Sco#~Bg # tPJװr2T[bm؟ He'Uݼ}4zUSVa밯Q.zNƵab^e%r)ƞ84wV|Fj$w@[3=F/? *6qU?NMS=_LrP-Ƿ|*Sj㌚~ueZׅWG5=*@v%Tx Bi1VAQTԝڵYqZ"roK!Fy> CJ25.>1 C;oc14Յk)^~&̊$2vjݲLT팶 zA^˒d(~x5'eb=F@1W\ čv2Io'H"ǧ,Ȇ-M:Ps_6<{!Y ƼF29y&'!jsjy|s/ɏ'w-6hiaOjDfR8f2z d33hE{SI(xb3Ww4*b~9f~l" k–Y8=Vz(a iǗ7ʟ$׆9 `H>#^¿2d)}8 =sez\΋j!ơw'yr1r)ڹ25ĴQIPplR6j|MSABµ) UYY~ PѺ"J hѕcǡB5l)#m!^X8>UC2)~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊-z>R"ԣ3G/1N7X*ƿvb7]R'NnI Ic)a$Ddn b(`ĥj dJS=N^,4!T#fAV rw=jy.t;`tCVdvUt9bOC!IU逪GB&|;p*ՁAh5O4ko5B׾IQ!%qWSXEcc-4kv^۸%WK,tqQg*OJWX\1ND7A5s(;@i*jiVz|U۠#qް8C5x`\ T2#YEva@z UMddX}+IEF|_ oNF4jXnb;0AP+0|p%bnPj8=ʭ$EӋ _bScjؔH˶Rr_LJVx8&}rBosPQ P*uenæ* \n#nej (C8A:|mV$hTYشcXV^R0fELEHxIoln@Z \bb^<1fqggt>8 0]pRb<+ͨ-}9^|c; e٠Mc&7u]ũY[u=T)QTx (ZJS *ū6YctP>]Q\IVp ۏllM!M\rjcfҗ1V:uJRZjᮂn-:n!5JC5;@.xdb)Pz5RDn9PiP:F+퀫u@K&~6 [aJ|" UN]1y}V7Gz„ߴ\^5PhwQEnF c6AhkP @,JMjwMevo|2*H _h7\N1-U*y$f Y_!%nM:|` /B~?pZ~)6cฒV9Ϧc5_ro|2\k-9l1h˟U3n‡侇C{L-+(.0h9zDO\ }HF@n%ERJֻwmkȘ![båsDT`K\U\(mFyqJaJFC۠~xR+ۊPōPһgSl?g5`^=+VJK")1y8HyR?0T1g=}.dr! O4OqZQ?ob{93zu1F? U,OJuRj}J_w5J 90TatBAR$).5 qNnȤ_4EH|blyOaLaeנ8qkwnNڹ4pȪQLk@~Y p^É?- L1=9c0ZJC86+Տ $}ֽL,$"i$*ZP%a(w"Ĭ#5e'Yn.s,y%ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Iq.lf6No_!.r+w^;B\)wpbN[5  K $#!Tԝ`͏"*J-nS썘$#i֒uc<Ҙ,!ጢI};r@v'":qNsLSq3tSV7)$QħRkj epo M"Q_Tf,46$A#2bE$̄Kt=GҀ堥9^(j04Rg)^@5:%W|QPƨMGJUY!н?]A֙T*G!)b؁L6dPFkIs|J[H!14UyMJ I44Ss*+~6p;@+jF،PȠ$:>XR|%MG;#<ĮB)C* C #T`vI^Ug~wD#F ^W);#Vj/: &EUrTܼUצL|DӋ0rj}V!@dԑWnR$0nl d,Z4?L=JbUKWAT0ؚf^mՒw \73-\~_'eG\oB9\ m+]RWa}mm2AQYUI+|pRv+O%D!p,0$c UHS h0TS]8~' "N%`ND1i"CԁLz@"po1&1iō-b<0 :w<2L+X*~{bp~k׽}KTڞEUǦ>E+K58Rצ)vMxAcLŎyy(Fwٯ/3$qb7#%НViCrAOnB3EWVaa,y ujS"g Qe %DcSN_"i,$܊6SdRGuP S«ܫ-Ӑ7Ȫ4s*u TYSn!#ai~#:T eǵ+Xr.›P ާBk]IV%)@P(=J(=ʫbYؠڸAzDoX|u7NY0%$;`wC՚k|UACCLE؅*j,jZW^Ҥ!l":n;`"^S=hQQ{ t'VpȽ@u˘H~ ? y$l9S,LcUIu_.*'\qfg=NHDVfj ||rIT@܃W.@I(]QOI#qU Bl>:b7ĵɶ4-7Vpu&wd }]JğɅM c 3h/5x'+CB|8y. ^;PQX΃=4OS^ $ʇCfFGF~~+s$ޚRO&jv鍚EUbFZAcU>F:F}DB$UڝzpIt̫A8ڹ׉DWܧ_iۉ\*UR U`OQaKlST78M9M1Vh1 : *T(;TW.N._ )o'^B mƙf Iо& 思lK<#$?(2ILFSNz"Nd-=N[NW`#~{t̨=kF&x{~(4r [aMӀD;-FH%V2WElF,UFل+!XmbLy Utt3OqvN l=?U fXb'PW8hERG#6r#Qz89 vt E#E | ZBRPM>*C6ocbr+菄z⫁_wNpKrA*K!~A*sja/K%WAv7oʦlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*~^_qt'dCٳ&$w,Uwѥ6Jf a}HP`Fy~F WJe'|SPw)u6l},׼pa"ք\UiL%,B]` 8e$U~8r9G%q^{cj],_4ar94T(}*܅QPq8X"z8|T^ Uy|p+Ŵm:Wqr*۸F(GDS+UK֣q̧"`VQkzv)S,04LT.H**'5I)\Uݢ7HSBHݍ11l HK| |%Rр(q7!)*Ta]R Ŷ_Xٹ-Zg?*"TUrhP!^V ~x]~#e4]%XoT@Gh: XV9!I0ԁLvT$ԟ JO6}a..T(X`;P6c5)S޸6,Bq{TfTX. (t;˜YT-;TboIAc޽KNFvIQJJW#^zt''E{{eYv,kBHSe޾;j3^>Cr3R~ ok/ (Mխ.+prPY|@Ͽ]7dl)U}l+Df-HɅL]9ف",h8Uy<61nj@ݣNWQq FZVWhG3v4Th1dP8SSz1"OST@)o7O*wB\p"@X.@_dJ&bi^BvMW0sb^g8KSN܊,=y~qs@kjl {~P3ޟf$iZ\ %+Hɪmmf!fm 8@:0•zP) Ro⭑pLR{j{`U70FT,:↪04pqWmJZ߉ٵez~7'J/WӯLB9+I\yL9 CQ#ϱ O\JW  cÔQcQRr^ZqWM"z3~t ~@! 1/@V2A݋9x-:ʀٯ?0I̯9+AV㗑J3*w2))K\Q,[|MiglIVG'S,4§r>/VRA.0`- Cz0xef5,p=I8=:;QLdOoۯ_Y<8cᕰbDeڤw 77cQLa;9eѡ-8r ڼ#cAS2C6cq jireWļ#1إ3+tGIUS\@}$+oD!/vK[s~`7^c'nOd=se<vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb˦*1i]a*LvXli]"c"ݔPi]ƒAo"ݔcaK ' +lz )+vlUٱWf]vlUٱWf]vlUٱWf]˛#n6v: w+T9YVX32uZ)Zj|R*OL,m f A%R^}thkd>(uݳ#ifv6s

W%Ug@Zs(7jUju1hd"»]Ofz{p~ܶ*ԮzIb_lC5#«EsLe@*MkQ|\~[ q ۾:@e jhA;Br]REAF)j}XU;!g=ah#ȪU1tm%D`{Q*GoZCuq0 S 8I*Q0{?L%֥)ц.hPUe"{`m9duM@cㄥZ)Gl0G(CV>;$MNjQF2Oтt?*ULEXԢ sW~BӡRجqbYh:O079e%5mвǹ&(J#?HYÜ֡i3-*9 }]u:d w|f27n8SQA-ב30\W.I;p.S9^L ڵ?9-o};bh`&:zd1S 068`nz@*>"Vrmn%E/Z ^ 8 >&5#U@qEOj?נĦ" ' Wj: ̑ҘU{J" 𲅧!-j:逖 s?=jRc;|4Zd rCotnMO@JMslK|9'y+YڠN4EKXumE{T~@YbWH֊20Ԍ"9hU Xb$P`+ɹH5TL1@)| XOݘ߹? Y+a1T~tݠ}#޶޵5w:%|ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊3JT.;vpW` uHSv\%)v~1A]m 825Mp8(T-u짶Ri`W`#t۾v %If!\ pY{xRhT;:a;0--QᆕؓC* +n}+nVF*}즅>nƵ=~!۱?6M'Qĭhz`]vlUٱWf]Wax,9LzF|3_' [\2Kt钫dtƒXF@8N[[Р vb^{US<l\BO4ѤD,79ĂY ٞ׳D[aAS޸a5WC| 1Ɯ|H{xeYU@x#"|\z %W*Q҇opQB3@bH5QN@"M;`UTUF'31q4,X J6nUWŒE+.d;($@$T'bͶP)\R^#rNS])1W-iJxFd­NaEi Fj=)%PGZ0i@pk"*v7"ۮ*Z׈C!OC\T| pky"e5deGvƾ&馉y cqWO  $/ 33.LBUdX26.5S& oX$#A[ٗ܌2~$jKg\%ʹhk*q _W!KTxTgHOK Bj>XUQnDNƟ,)B?~N?,4d$ҝIHp\ĊqڸbMx{v+CqI8X*JSE@xQ܏P ZԊbF۽1Vn$ޔ58Rdj֣e\$ԩ"rICЁ.ބF6۶pj~U{lpHOQxYNq+MPSUjp8)Wb׿\U1%.iJaKdrDQS Xi)wA!H |yKF Kb|8)r/ O0]v>OK#IN›5 DJ +Fg׽е~U}C)*2"<ёW?hW&Z ? M[BTaeYT8|0m7OfRE)b= X}kXK\Ÿg؟) tXAsC(OӐ;/LH5dM;*M2D^@|'E/e^eM=itv"ѲAAnE]vlUٱWf]vlUٱWf]vlUٱWeNv/ iCE\Atڎ  ]C5){cIvI4,6Q,mc"E}l`) mv4LOLAvL-;p62v2XGQ4һw'c4a!m!N&\-OJuʩSV5 U\rؙǐ%ȵAMƭٓK4Yeq;$`ii!!.T#A] [H9.$; jr(A4VbvfTf, E.]vyDONYrstFg|>L/\ǵDAr_Ud ƒMaVG c [0h/J <1U$pX%2x)Ԕ%)9P\f\ :xmU/Z(/EQ#ҽ6yU*yO&]˲<ЍUμTHE,a@J-|2 Q3t}Aϋj0!`椷|p!j1V1ơTUH*2lG_svҸב15W87eLa: U/:|Q]-wSs*CbkFUT靚Ÿ]& ɾSM*d!O7aʞTR=76'߶MSIpDqAC}Ȫ2ON;Wd3;u혹FI9 ~c6ozgGwrp̬+ chs_,PQMJW)V?`V& p`9&%ڬAVZx 0Z!mdsPQB[FV3 w 2=8sXЯdvwE5r*[b֡nUTj{c\M\${t*N*=.#CXi~]+L4$miRdB ~R%nb8"7ñ'UXS`i5N*uªGqМIBqqKQTƙIesA^IĈaE UN#g `*UqĘ#nyozU$?ViGeAI<ԅB(ٰ/5hźՒkW+q5~+3zbǞ|&n7~I̍N~0{g1 vSU,o[yݼ<0VpU:L `(Yv<8BQf0wg_wɥT tWɨKyz0 tA1$-U-[CƓ?6+H$1bw|៙7BkdjV; `}Scd,{x(Rԝ!ivsSƞ9y s\Fү+Jt{ow ,M>MG!6&,Td(}Ej@4 OևlF~aJMehtS|G kU͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbvd?ݩ8&v~Ky_ fd~LV4pM07 蹝qßZ߰= W+g6fGcltmLsc \u7 nW sGƻrCO tMt~MP}=ZXi{lV+MV}R`#b(i,oAS]Nݵ #ƻJN <َxMv`O-C۳#oJ )GbX8ƒ* HHv8ser"&scZ~KQ4خ ;lrr{$~CuX_+FHn킢 꾪 ϖ-+ppǹ^]=Q~+--0 5[7 C "D{aā&*NGGdҚQ0r<RI/w~T6n l1f 5nL*Bms)*49!PËn*UFګ!WF)޾a֪I*i,L`<<@"I]IUQGaW U llpRU8fEa't1HU ^o%̈Ȁ0N[^*XtqL^_fvi 3BpH%|N.VGB9}#J0ABJʫаɅMiN,/?gIe7AL }FKWYJ_csLmfZ4~7f 6(Ѿ j\K9>&6,v`)b:j|OUJ$+(7h d2@5*`{b6#Utwޘ("U&e nV(B -b2@sO{tlqpV~g  SJ'Olppv-M㊻W$8i4ČA$TR"㋆5WV.~xP{bP@jJN[ҧqK;tP:eyy)I|)ө4բxdKӶJ'rVUHS#{c쓾_n7I¬֊{ް۷"TfXm{=R>{?ĺjBbޯ5Rm DDa[GfqY4}w]i%V [8izJգ(!?/n\7bLOgә&D͆}X]0z}s]82J)Y $#)W:T(.kc,zg)/=p *=CFaO$jC|Hۨ䨪B2W\Ċd!z4p ޅ[C]j(ND2J6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*is_Fa84j)X&zX9mtX{:8>2QƄE;V8 oPxbәwۮL$Z5Ӯv,ǿ#Z}uWL>Ʈ*l(+oϧYǿ*ga+LiTbh0e,S;|sT4Of @+A_\\URB qPdbw޴Mw3Fc`w=< ri84~K}|3ZD=Io=Z*3vç+S N=Zhr9GCҲ\ѣp5)ߢMݱkrE[-\@Zj@6_yr G hD:kKۻc>ʸ;|r91I7a ]u$%. F*IFKg@Ct㌐c2”es9J$$Vxp"3E/w ~0˒!s102tS/V^%@ 0MRAH?~U"oXpn޴d}XIcU##OuXO.bYqRCb wՉf r}9VqH(}c>9b|* hS~*v`;re޸f`A SҫZ,ETԂ? -#2qUx/kj  sLS#O}5_qU´WďrIUWhU=(J](h ~kBoV'%)< W'ju5[cnPn.bHI-w  O*,)JmZZq;~UI뚹yB. 㗕jyƴמ^$V4"v>m#+NR 3^)4VUx3Cs(/,{vcWǓ,Jd¦vQY|0 ͷY {qE“! $;P Qܼ^Xa [E\^B|w2w*i7O|e{ jϣ5%ցPS߯ݙ`QP0e{1IWzLh`>防b(:\hWju&*I@)L)p*iX1njAU$+xyd__#T_,u ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb1Weab͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,)cAd:=̴fCE}NH9PzfO2k1EyK{-;9Cg؞ˏBQN咽A6Ь$Nq1G6%!:Gy  CzȖS_Lֵ7hQ`Al&U IkFX.&5H+HBM$%H㮴@ò tBr(.aJH?Ē 8T&E ` 6}E6m`aqZvrVl* Dh0WSY]6U#28M7Az^9.&4lH郉ic$e#% mWĊo3ĝT bL;m4짙T=&1e 0ZӲfؙƽ+e`698 ڕEJdҵq+k*ODEmq4\R8 R @J 6)yq UةA \mGc(ZIZ+E:Iۡ.hvj6tm ɖI<3ʚ|spܗ|~U5Mӡlß7,{\Sєֹ18)TS1 3W_JvjY(2c♋&<k^_3#&a;)RjxD&RM/$#`k¿0x">98*syؚ BjVgoP8EUAS+V.oSX[*D :7jUz3lh`/N]hFG^]G|$);mPNeե7"[sΕ;퍪I|doJWȪ~xK(*D#קq)XGM_lUhJxlqC2M*ܓ@ ڽp\HU6䨽)T$̥Yo^-e6=@ZxO '&)SJJm@mE7aV}N/ISo5^2PZibzdcD(I!ͻ%`ORyF s½G|n{]z~TzUvJ64*>F)4x䎜%EƋo \ #UPj`C;ן:qW9 cӮRȢ3&_d4(]*WqBhdvrb*wha:]Av #j0 .VI*U 8$0O PScQRTUdYO$x ٩ǧӘyRdPԁ8DB> ݈=rA`~XvPÁO T ,}jO37iҬcowz[1䂢 䆜QzSªXVݦKҽ1V̊|LZUa} L|B6 '4^C•FTu9$nݔCL%φ۴eﱠ9YLJl r>U-qdaUƄqFz\Un`4݈俎1Ԁ@'\݈ΡŹ-@<)-bs=~o|Ury#.$ v«TD֝=𥱆G MyC'%)g JgqM>&5sk/ZRGZ#P2P=wcl5+ecg?S'}4avS 0i, Gpc"X50AVA>$Z^,碩>$l0J@rzJhru.\I#XKF҃4Ɠ_0eMN$b$oA?3,EGH48 t)ayspVDb7]b h{lIA+qO6lJ#1*Yƻf4ؖ=i ̜PT0"B.R ;azx&`T&>/@ x^ɪ6μ%?ȃ=#y7Pثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbŢ_f' +EivP. y.6O"6ֿFTEsʴFJ8A mߜtZ %ACShLJ e skSug(+JͿ.f4\Ւ)͒0X)PkfnJHO?ŏ.>BU_R(k%kkm"k{1"3m,hA^ͩʿXdU?1FV_*&@cWPS՚Wb: }v_o^R(Q#jC%ORŚldZmC BydBM[6W3# Er0Jc0d6X&0}! ҵ<0Ƅ?0nGT $0ԝGOF.I)^\o;|Yd c Y2~Q0lўP#rON,yo}ǎN\QJ%HL#7]}qPtG*Wo$'"nİ%ٱWf]vlUٱWf]vlUٱWcᅦ`*NN124/Ѽ P@r*IΫIşM,4NͰ2; \ QO':DḀIG0w1U?a_ N¯_F0_ ;ҫՁ=̆i}yGR0> NtdWP|@cGRI?,$.‡-SX.>ȜvCN_x9E`@Kp'¸C p&)͍6#"2=,1'Tޠ딑E&<~B})%٧\$_$HV Fj6-a*cVnX|ѹA/G*eM iˋ7Zoe"! '*_tJcPޕrXWr@ZH+ 4D%1bMO^DxW-Ab${ue4iқ,DfP;w0ٚARB: ڟFi~?ـI?#o 5ۭj2JZ^64{G~"XIBMOS_ ([ w {dh@P`Q~u儭)m¹crqcJ0zc}?OK؜v; (3ûdE>1ʵ zaUrNu$)tJ6MA .̣n0ǥvqL.9K[ԓb'ɉnui43(''0倄RF>[Tq1'ihr:pΖ1ƅUI W+8м8ľ@ Z6#~ ur>xi&mܚ3 vY| ta]]wc;ٚWii)guWcKf]8 UjM;hЀ{aC"l6kSvhcRչ-4+k'nC+M4 rۖ;൦kc޴:ozWfo1WcKoA Ub튻,b \Uةb`=bޱ NodJ O^OgÇ9F`DƆ>n'׊(&Z((6cC !6;R' ar/VcNME"$q#U|ޙ%Owx6L _k=1$)QOח+a$JLfKH, R)!#uc%-GՁW(:cM$WAԐYxTzP^j%  q\PHrjOġW4qJp*wU)ҧђ7*p"RP)XZvX9iRlFAR!Gkץv bSfӱJyVUv`{" ZfQVU^ e_ѐk9.hc jTEP[2JH2tq V|N~l#b}9W1jjOn@C'0R7tM? 4\tXhN*E2Wqxm!޻ UzZ59$4Y:x*ŧSMO:iWL+# ZWRY9l=U=3e䚟$%ھ8t0Dj'G#snॄ;7|'~dG2z#^z䲠g+Y 6̠PWAyPU¨jFjHVoN@GZꡔ3dJnXAIcȁ@>>arT:. yA~Tdn'FJרԁRGQ-(Ge4G\+;*q!hY7s@TPd~ܔr@[|2˥F}ޒ B >Lu:;t޹0@aXFAb;t=-R7k\:q ݔ~rQڧs6-pӐ!J-~鿢 ~7ɪ55ܒߚ6 VpV=yD5FSj@?^O).MQ(Pr۳ȡ,w*aEF  OE MZ_s)(l|*ۖ#1sUT#! J \)D_t.,@|ǐ݊C[pEw^_:I N70Mu rTUh[z|,8̈ry2+:Vb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثXerDf  ݀R>5cLJ =6഍@:??x $&1wʒd6 {n? 8x41l@]yyu=>aj8W35 0“H/`[FC0@ɸ[Cc{/.%H7R?Kqeӏ8nb:8ĄU1vJI;v?B>HۘA  (vI1Z5I%c^()SQ+/ 5˨f@?>< psa)^VQ"E\v*j `G\Sa%ƪ1l;X/GCfT({IXK^,%J4W%jt%K(*G 5P zH&eK&y\P|_ ' }TCDQRW2K+ u ؊:}/vr5??VߵbB 1 _(12OHIJ9-]x+qUȆiMy:Ͼ<=^˟z2-MHv]efSxFl6WOD:m-zc\4IWAN5+14yBB=EGNIiTUTCڣ~HEk~nix;mAJkNH!RvbZ,I# ֆ8 ;+4dHȕQ#XBbB8F q8BeP~ qXZ8JWzqEqߧGtm~(mA%ٱWdʺ2 {/Bh6΃ ,ǒ$p4q8|Qz4OU 9~A ָi.(eJp{د$QzKw ݒ@\,T@NJNH=k\IdV%j 8Ӯ ,ue{'#J){Hyхh7G$&D01BIUĎ(ѤbKSJlv`'lBAvy@?jr(䃩E~%RZ=6 57ѵjYpN&]Ѷ )p[yU$TE~0hh6 FU,PfvE#bMIW7 uE, MAHckZ̫rcܕk+!N5+ڃQ3wDn`k1{PQڻL*+Y&ulP5'^[mtN+Qd袄v)p#aZ1#9ą["Z7F@ J]NN"pj'DH;tZӘ,ƻ(Ůll8 BM|2%=uqYԵ8Ï'6r}@~uL477H;G^>xB94_[ H۾ 0iL&֠uq9b5t=Ru:%C|BS(B>'̉:.HK`/P ۨY䨧 Eu~/Ju5lQ@P֒2pv o)YV|!)Er%8*-Wu5O# plivZӨIEKJ2,EA+!W Cu1%j Ul; *6N\.T O*MH&vd`A*ѽE!]( 튻A]r^',R{WcK*g-;7߮v'uv7]O|Pk®=qWf]Zbծ*xJo]&[vUSP4kad; v)FJlI9%ӹE4H(:v&=R9XdN~$42%B EgZm `>g҂Ez}RM)Lw)AW 4V@,:RPF$j"Fn&~}3bv댒cɁ5 m/jb3cQ,tr{Uh±1T1̣lybfQR8劳reeH銬J)\H{}+B}Zxcb6튭C̅^H@d@ l*#!V0M5=kI'@؊P t3e@(1UBLcd^S PAezP.FniT;QGw')PPAt#-V(?љG/M@bD4k}AxԳPU4r̔tgR7%TYxB03TI4iT` o0_0/LP+xzb kS$P`JRu ZhRqWH|,p~[JdPZKER69e#h!Q(:9(;|*ª=0,GB[|TSfRG\:lBxz5ŗ7mkFyzz')8<:]쟓%ZP!b ̖Ǫ]U,&$9%GŠO;KPQa+@5{o*YX]0aڤ ǏQ g w=%5TJFR~ǨU #b `UO@U' u{*`) W+}7 k$ZH>)% cB4h[?#Nk˒ea|v|J7rw$c]nS; Xc5kS1}VbFeVRJ353$9Ve6=adThi퀏Td~ȡ4Z:MV*٢T7Ni"#H0 Ru Kl:צ$ċ\@5N2V~A$-և L+ʝ*c2IUEr {bE =VEqrhz)TЦ= k1VbկF<1U뷶'tO<)n>  dT8cj p/(R=B&Z}9 B]NvRNw=sW6b FP(;x/#ՌX`|5? 6lZT(4UJkSFxt[Bhq9^ $l+.iMkTc^B9v]ӓJ.q̬˷vW./U \0O ugJXg3R#mՠxfƓmriaA`bYGvq`Ⱦ59f3E6' MIPnXՇkȮn%l~=#D MyS|g Bl ZRc7 *w42bAdM d=^'J&&ydϑߋDjG`UC2ןvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثK(>Z pjL@=ƣoohM Fh#__S TnGb*JnІOٯ1A"%_ &XJ5}0%IuvXۓeijvƜ#QHuSRˆ*<⫵:fÈQǭiy eԔ̶  ~ [zh_|4]IV6W~&o!!@N߯"i(7q'i껓~!qK]h%r>d3~6D'/5iL[W e]EC#3\mZOʛŖVvJK-njQH%\NPo)I1lb'j5~/c\ȫ+Zk5]\Kp\6pm29$&wb[~LR2X56ȊP7'pED P0զ u~OXV>.}e`h8\ B_̩rn"TV-IZzh4~*ZmaXFVߗ blFtU3JAV^#_}r+!#,:өr"lEejInh=|w_K֜'\%p,7YGLg]1Z㫤g$t'Fa}2֠~=$S05\4?g8cҧ%3f$oYLn(Q׈?}&K@K=inȚ઀?MbƽU7(Rh $emEX*]Svz}M()"߮t[]$dsDk, lM(j(f:mM. uJn})=+ qQ=Žh. Wh {YH.wLBBT,gJ1{#׷1%4սewŴb*sR6#}MnCSjt2`N%hUܞ4pq5NLh2]%Ac^{)MEyxwNjXiY(SkOn@mƥ-BAqT{V@6ThGzk iӹDS%IVi P<)ĽG#tݒP&#bֿ?K꾰bh>xW7BUh~-N' ɅT )7e(Ht{`x֬ \ROE*XVu HCꞡf4Q@8QABWo+H_"Ml(Q.Qua`[ZW"J^kp4¬y 3%8鍛X@ʠPt֙Y+nM9VwHBnG-ؕkm9QYeI\OrǓ98TPE)bi=?-Lq`ljM}^I*~3ckMeQatgt'.kh ޤ%':KPұf;x 7+T @veS  v,RϬB.w=(22u‰5:SV_sjuC^MӰP @vTR><тh$o$j j2 ߶KkMaRƽ b\ ׮RB#@l)ֽFoe*k E]p?~4)v.aJӡ8ٞbƱk)w=1Wf l vc!n[]@*졊3Wv`1Wf^Ɠ 08Ȯ(ve.tTW :29zxI:?-i會m "$#^%M@Mi3 {"b=%*}>ֹYJG"`ҙ'Xf<ؖde Mw 1 SOUmt* ]+esZwRF4L~{J堫"z1;dUAN2Ož# fz33؃D۾>ILr!ܒ8 bEq@7FRC4 r%PݘTzzlqT};5 jM)~4m+RH]x.UGF@h^LGZ VW`y& fنHE_(x[U"')cz=bR\FbG3|1{$t|RunDR}~%m}X)=&pd%Rf[I;\kkSBׯ{,rrxTB?' 2.cOޡ'E]( GY*G!fjLw  ”g)ZJEWJjPŒ2X%0y:ǰɔe_SZVQVҙ,fV;{6~H,rGmu8gL`OrHK<ޠXOxО<04%ʷq\u1 u= Xw#1~ߔȫեTV2 +dP@v}pzܞѐ[]*R(s/ٜ9='Nǎ_ ?|:H̿cO)ՕnĀ~``x;ªΤ1Pi XF|0*PƽN GaZdV{#DD=}JҨ 0 cAWT 5A'QvŸ-OS O;O)Q@gO5"RT|P$r{aF$b**r6~[[ ʀr-ujyRo6`>=ž;-vȼqF5*xe0O/(1d]N PRb=7>n ՖNTzQX30@TUhj˧Q` x X 9ΡP JX* zf(hH?F *Vh+>/E^liO>8^KJyD>$'ZL38\~~)v]0-Z#/J+qXR $ 21>фR̲0^"ܩgiMi,h=' s79 >.Kx='g4p-]F(:J*?at8_> j}#Ac䛙bud!B PWg=82)N1xIy]ݚƼx뚠Ebj?9"x$$>ۯ%dզP }8Yeme[Z7 5OMb/WF=iSoD&?xW0Ms& =~ 0L:R.6v$%ƺ0XK\⭦j$ާ !(xpmvێ*;`!94FOmihm£n*bJyTiП[}Ȣ%wKP/bV*^4 SMdyZ-+!@Khqg|"%PVFB8:ml(' ))k1S_/5+:CV@IZ%^( ğ>ؘ]9e"OL5o 1z|J0F1j_l}qYk4q;0#r}>h ]'oEi;qZqv.f.k*A5_cm`m_Q2H "d~ @#tg'k@dNɒ]NI8tH T`"2GOxЀRPj{3~X@rzw}eAw?[ P s)W5V~J7<~ֶ(BOS oq[ P9fxo.?KmŸ(n0{Cx b(SޞƝˑAס?2Xo(Hwy$K9R~*FYH27hr8O˺Zi))gK"Ȱ1)ۨ ? wams(IAPӵ T>k/+E%@AkKTP -/C&֛bHۃrJ=k-5tsND@9ʲ Sb0a!MbI@GP(H];Ek:Rw#|LkÂhϚՀ$$ @^ N Bq kS*А)@¢4.-$r$>nITUs* BJ(Wb2R4f~ҟ.%^tqKI-AmHșRUf`R:: 7la6;Y0m9~K|FV?ˁdqS $tvQE~î0//R6SqZ%C^"eR>x%^)GDeZ$g+m+k ܏P;pDItRƵLIQINzT¡]S@%l_z!& 2B14?-Bi^ ]l ,Jֿ ePk8h(6UXcG=loDGߕBHyW~o KfQ54@|EpM-Vf8Gp)% #N4O@FԃD+MN% *M>?m (NN͒n8T0dZqo݁Uoa(yov4W-DB _žRfQh:..)D?;6jxnXԓָ) pi#ҿkhiEȝi27J,1wᔱ'W~y8%%A+ %bpp+zP2n"8ȫxMuq*ӿA[Ø'a; =kKn.ƹqWe \U}z=qWcz(vP]A0vjm*xaWcWfثabu1KǢ׮*|kC]b_ Vst*Ԁ>NG"{UZ|![e j`QRy)|9NE+AsIpGOrK5Ԩy4GU ^& %lkhGʢGa@cbpZԓ2YTq|)ɅOln%Aol1(`*-k`*E(CV1]Ăjk_ sS]*)^!d֛xaUpz%~V8,:צΒ?Fm Й l 2#z8" =*J>_ّBZx6(\pR80䂢-dYF20  Td5 \!QptnU(XU e;)#PtĪdŔTx~ɩV"e<}̜BWJ,jrJ .0W?ALYsg4Ja_1QdG ܕI+H>`Tg ѫƸ e8Pjҗoc8w8Za~X{ qOU9!n DdWW{HZnNYªO,y"!>\ɛ[/1SLUJ^pե7p6 eWO{$ҧ4mᅋkF Zx6iT*I,\5Eb2_lm._IU|+ƞ? nGz'"Bju>'^@XD'ݘF%濚o4l3yQ  1p¡G DXNSz.bwss$}$Vv=>ǚ  `G|2Q%#҃)iY̼ fWB43:.G!L*29Tfk#-7Y,e!f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثbGsRy>M oux-XsO85=ҤxYY6ϬRЎZV2Vi !gAY16v=\ı@T/xbEMJK./UŠ$NMyG6""nIQu\CRPO~v>%$ 0%gT% (E@+Juo%H5:wcLJE4/=1O&B\TF*;{}zH>Ҥ= )Ĥ+|[Tv/؛I d|U:'A^.u(O#KkV=6;aw)ja*R iOqw]"q٪?\,j1e$S]7vBm'eFQZ)%ɍ[+1gV?hևqGt9EC,mf͊[i4;roG\jvPf&Y"Ao5HUUgTi~)?-4Rr$_ I52 jj~*ro2kB_IPG5[MQJU`w$|,qx,cFZSl@Vƣ럵t;(>'@(D&`:e>cАKtH;;eXK*.[2|< wjIJ$ki4eh oSfb@$eZ_=Rc5rJ)@^+?b+TԒ(7\)(?˚eUv@C`Df1MJ# lvMgMkZYXJ|k 5hf!'. SnYrO4-ɧ)OXh=[c6WXZ8P6XRhn`FEбeVQ&r,Q,.Xd^WR^YӋ)V&ۙèhO_ye[m$}V5EiҔ踓Z=FiiAURvWKFAU'- *5+_זl;AiߔJ>74'~?kKzWAS0V%A9FFF #BDN>KH䂚h,ſf!vNOMk&nE2;ǖޒ,BRT54/u HA'fGEVd.&h%fNŨ;Հd~i}Hv]vUtvktYfBj"jb%*C0 huPt Oaym6A9[J1@|IG0F=xfc [bwGh!EyvMpodz|٩N΂;elm"Ӽ²0I3&*72iH,RSH 7˭2+KBq`fz6Mkաǵw8iukLdZ];֟v$JcUVy#,ZD}x]!|i8(&ԫCއ"PP5 )Yo1 XZ2 \V)) "1-Oo+B֖%|L)_8_p\'jRr'Om2JP޸5kPMViV_J*58M7;i C(ZlhanĞ#뱡EU0Jo~}zEۧJֳIw\_O<@4#`? ^">%PM6&+W_ @n3.9aiv\Z?/'+t=EF>  fuQ_äC '&ZY%ːJM+~*?zWޛ M*ҘӍ7w m:1zƧUj3M~YrvS"A#q@7ڝ9bdq)PB3;0ܜR/ʞM=ӿжM)+~iG'$Z%u?g}|=5eLqU ׾$ƙ#FBF\d1"A 4'q;p(z!cP cc?XW5Ō T'a)X$$3fXԍCoĶv'"P:B*bT2a\^ H*zm2 7'D PӰr*_LwdTŞQpH#PB !g+*1;1(\""&E @4m]UWbb={ucJӦ vc ]l U@TWqvQP1Kצ*bǾ*QKbc®bǁ㍡)v=FbSJȲv- s*peRw]=VshKk=s_.oDõ%\cAac5,7\i^!"tZʚRKVda߾U9xK-g0]vђm KKPy S2+ \ПOZB^Z KGu=TqBąqNE+1J Mq/\ӋRpzS4|>Uخ}OV2~=|h~q;+ۭ9l<+4Gq槛 >.MR|158קр`dySqU>ql ǯ?߾#jޔTQSa*tXaރ>RJ[pSi>Gɔt#у`WOJdJg^^n q5#сT1l{w>qVYuC%/, yZ*T-)A TSL""W%8 sYkՒTu␅^[oNrGZqߡ>%DO~[u qӨ_\*T bs)J:[d' b~W =Iu_ rm%4>9ͮ\$+;uF&f_z(ᓃ`NKSI6Kt4j.jTdD!XSy2L2w'%VmSR'@XBsff.MnIʵf'詣Cd5@빠 t̆OInH\)TjNIa`aⅢS*wbH%&F䒌UZ0!j0rARqQ#{L9ߖlZHFrP$Qsa!B((>,#.=BAiQ [E0=|J(a*;gN / oLUjrОUm_./=Jv䒅Ս-%?7JŠ)4Ǔ2.Cv``܎䷀cɼrz *VҤf2QBv?2J*O2R8편%J*1W*#UδHBCwdyGk ,"\lxeLUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثC uKS {.[6T[m):1-Pmn1aw*J&r+N ʟî]ۭc0ڻ jWOıFq+KP| C g?eFӯ왫[G܇.~1_ȴ,I?"JB=ݹ$n*@??[ꬿz7 6CI6l].J+7ݱ!.-g¢PVV?g}IIphA ىK\Uڅ+/sN+X٪ֽzschRȼ"~Sxrqjml{IޡWF]~,Fm&0;/],ޑ6kfEjvƼp,4\Mxb[yoQḹ^Tn;~_bb%K-+BEzˊfT ē\K̒Na, KX&DfN/Ž ?z xO%o%u=EJ7I8yev[u|y-uSddd % k$#xa4vUDB;95JRgj;"O琮}pB(f54'x>Ê|E2񫉄>sHHoyp(}'uo y&ͤH\s)Z)?u^Xr- z+T q? gufVX5ORG `k@$ 66.Av $]xh 5,eJػsѨ{r脃XXZN+S@X1گLpvޢUěmzO3p3#rBmoQI³Z +ofm 'hw4q>8k1 l` =)#/R7ۗ/Y*xRƴ& 7I%I W*B!P9JU^?PkT%( 4RiVS?qaDB#}U:\&‡ʈg~ѻ+RUݶ+ ;x\AXv%HIOXeK˚C1/Q9fQPIr@p*b59\=h T:A]'.Fۚg1R3mM[?I 2ޝwsEҝ:J/l8)Z=EXغX >XTIme$ Jz%YbZ ]0m#x VYOkX?%t?*:ħZ_j# ОVTVj"܍㇉ xxq`›GK!Z &J[ó`([?=౰fR┩$V퉒[)SZ 6%]JxdxkK"8Z遗Pޢ(TP%mEv&v9gUۀ0ŃrlbE<* ;uJËU+O [V{>рxvƚ8Z| c ktH\|Sz ' lӦke.9cOJ<%aM\a }لcAQ"CPO߁daQ+15>;ǐT\M\<}v9IBFSĪ]x+uOƝ0]}v07\PRQE$# ]0OACчӊ7u좕ZbO6fd{ƅ{C*M7—cp+5)e)vbWc v<£v:bǥv k進 o"@*Io:o;6*W;\ yb@P 0E+?7lP(j=N)Pw X" {eLfCaVOH;}8chթ+ѩ튷#NQ\V=@KU9 En%w8&z蹪vUBPUJRlUT(0KS܉ ƌ ^UY{КvN,O i`U&P\)0N!(O"U x_,ZFOĪɪm,jA|j DD}U-Xθ`r>[q)t65ޫTI 9QuNl\TKx=6ġ)A"PWU!(RhyF8`B鸹#u_Q@FnLeɁqʣBٸր\fT7|h+2X*'lGeÓMyi8Y^`UaCTK+ xtr=~d$maGl$q΢3 UT]EbÉq [F .8]33WqPzR{DԟՊau'F)_H9`yC QB l(IJ?d<ےc?Yl_f',*ݸ> Jtu7껏|ƚ h$=Myǘ*7Mܬ۞Lɺ<[$riv?8IqFt/dTnD>)]$4; `dGe }TC* |Fyn[%ǀ|<=7& .>Rћ4!V7&;`SbZ0g5O UNU`XEx(|{ *N*Y1VmQ@-kR'W;>hiWࡸ.*M*{u+Who)\ W^ UZ<#g܍2I\ q_+%O6&7:fmeZ2SmMpUz{_0P898L9/MGǰ5Ew ܎3rKQ!z$HFlk%hEhķ 9nWR(M?@SD!Q5{Kc? %#(\M6Mbd9@yH& iVf>8$ESR@ܟ}X%y/ hWN* TӓsNLſWk0 w'`?g/\i'c- >78(f#jmn_X+PmHje!Emzz .znIcZA_&q#4xq xЖʏO69m"Z1($ER}I*cԲkhU 4+︯'合[CCw%v HyD!N~&cˏp<Ь`r'}zW-#+Lm/-(!TŤ<[K7o#B:[3$5Ʊ"¾ЪZUOn&p5F#JnkEAN3M҂_N&fQO֬+R$Q.̑QKW_ /īh!T]U|wvAc_XP4\'rrS-8y .$9MʌTȑLQޢ7VUT"~ E@t9 Cu{!0dMc \ a'tkYVG?k6Dcrz~<]mgĞT*3u_#|%1EirI(&e5Oe7bLcMޚTd=eN4-Vh5)>Ԫ>#%)TfW9j+Ҵ4N`f ke|m| h NN$&PK*7ָǓRצfl)dR׈*q)%(7{¶ Vo{ T|<T|@2JYRj{xtľ3$EUŅ*E:mr(!uKrvLL z M9 ]xc‡6jMr(}ڄO|#ƊW1ʴcx {)Q$kZ}>.E#H%5Yx7퇅%Z >;uXڮFzX֮#_Dh^납UMzccPd%%'Z[pSH ԟVbܕ!F?\ERZ/m&C U٣n[4}6q^,*kG`rB5nKiQ4٫n:+Vn.BVuMGf n;KamPTG9F*}Ͳ`!@,$|r*Ҏ5o"dÞ%He"4ڽzAB}j|4+Zx6rARw?LRxB`YIj 4qÈiZ\|l t5)rP)_j x6x#1UbQ^p$>c*&2@.3["!OQA9Ib?8;3Fv7qK^ٸzm˧|P졊] /v<`Wc.TyydU}FMvg3[+B`3P wl.^\|Ӌj!h>;*pګFi~ٹCW*Zei$vP p9"rS624+ZT 5fMROhCFA'x`$)ژBU9\ [EOwYl,\ؑ`cUVBnH ,^gt |f((+\TMrM&k@$Q9$lJtJDZ#Z ((cXUA>y.f֞8UZ7z6Uf51SIyRd)߮6`"ܪP;֛uiV)@SٱUQbސG,׭;|SYKG?bK#+hw«Q6{c"HӐ*+CZbmE^@^.j#%D~\*@2*2^&h; N.bܛqB0!MТQNz{ULz)V>1vX=SujmJqa֛e,.]^\IϚl^,R4$n. lmLpZSqJ~Y I?OoY-늭ZzOǮ' =;(U1Ft?&[/>wZmv?,lhx;Cc2$+s_QڽMs2<PZt` T ^ T9 J!S B |*g̐g=2ђc'Zx}-;xb/RF@h܌UYFqA\<SW` pXS^<YȽHۨnd$cs'Fa,scڝZ  "TP+㷅{aeDR-*ư%_=(P#?~cki8 >F/LO6i$R~rS?33&{/咈4kqS2?r@?\3 gH LA&,)2$?6>ݫWYsm~ml?k2jni}I7#O(ZE _G`*e5dUEJ=kLU{J`>"N06ž8ehs"9X?̍|pb* n@pNQL)_U~& $j 2J)Ӡ֫+~Fz U_T(GA \qyԣ nlԂ3+"В0V,4I~e&#lK[qLD9RXG9-Nၡ侗Ӡ22_˱c9hT 'Q"b*HX2Jb ~0 걣TOH%YZ<*Dj>"h=%P`.s7]K%(mLRbכ1W zD, G4G շ2wuW@9oaE̔n'8ӈ;g5a +3eQE<{oPC2[E<ZF)@ef~Y R׋wî\u!8d؄ cxXqsQ%S̠YUX\gf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6**i㊻;m[dP? _g~a4#`Jts=zZߚ?f~AvYKZ $UbA>ڿd^ wjx(C3G*E~"A?e ;3W~Nl +:% i<W|'~Y$%*YvtHRBF**j+Sr^M.A#ž>FGނ@n;Usn.?fX#N\ĚMLnf> g?gnXJT S$r䭴ef%-'mZ>xeD҈CPחCh R7dodyjQHMr1'KUaԯ9&$T&Xj MX!#!b:'K BÁ4,GR~P[ro %La`̿?wc($ذku+$8: P?&1Pl!K,]qPu+rc> 抧`dN) w$Imהe; ~&U TӒ;*.7gVzB~xSdc:Ed({{Պr' ˠYdJG:FkN݋uDOKPl:\ȣT[D,cݚ+)ִ4Wu f'EJWޜ~ő[`@+k {H9F) bn-%9Pݧo*8T$iM2$iB*`~o~+Jd["WPļA{ umGHBQg/= |hZ?FPwSۆQnt_,i6Iؐ{fni!~k$?2x*G]',5;1|BLwjy5~w2&ؖEixTj10esm|w$ P$&Hwުl 4|GiQ2Ld A߷##kJuVĥg! /,@wvI\ҐP]{S}1I:q${eGT=VI!hM:fFUINiԍq(Zؘˎ.n+~cIt@A?=cٽ@^x 5J@czm7bZO5̆"І_aU8d #}#_xujZO(HH^R#VNU/TFIp3q eKRmi ]Gĵ#c Yӑؑ@S%HW* UO'7(]PkSl*u;Rlk'͠Lv{R/I)&*^_Pƍf pJ*U;tl+װ1REw*A]ʤx* @~T=p;&\1 %/=6IKH\UHjZcBՅ:`KCxc\ml*#CK#p;"v'.(v<*h:U‡cbǃXv @Ȳ ` ]$KV&y2'fI?S c!gd삟0e۰N_JTk4#U=$@^ Z%sZFoNѷ4r-y,x0 ~ +ќwS$+D ]4 qa_IbK<V/l;*$#{_ @j2t;$a/Bq-,:>/IP^ʙضb^7 0xUe)B9 $Sφkeͧ2j<|s,R¤rys&-VКFM ~6˷^LM/XVw6&肙$Ew5%(|2'$rPE[A|+{+RM~{fV>M$?##Wd;\tT N0$ZC'j%ϨZ2~£\I`0(8rawb:Wj UU oL]XٯvTRwzdfhW, EӁTCO_l.X S$h:NK7nV E#r J_04;)ߗхUҪOQq3էTj;bnCŻwl*h^@OsU(!n(1Udߩbh|qWZ` ꁹi%R3€\F+SINHtdPӨ33GRrYk%E;e-y^fI-*p1u;vޜivC[YhY>. 儒g+ IV*LaF4%v feP(riF!§erz䒨1m oG=B¨_@/>[ (Q!cbŶ1 o^2|?fq'ju{mF>ZUN#`< ?'%ETpsd/~S x&7bDWOry>(A v|!wOMpZDZPӧlAώ%5K3 *8]^XܘT<Ō j @ڭA!T_QBq^Kg!X B{8vzua,]F){ ~7e>IXaiy>ҵedPҴRBejqd*X0%J7Tt$t=Fio3 fHӏrÿNcvr :ʔ=3&%du`&?:Oٯ~ٕ]*;\ 0ӻi.w`wL* -e2i=Tj"#P=SI&NIޣqj%iEZB >cdE*h{.)TF~_+ȏ_*D4 }XPRޛwG4ꬹ%UO@A9soy+XVqNDlQ88@ 8U;HI%n|6ݔW1%i V܅SqN #](jĪ 5)HV$?rvdFZ֫QS5u AۯJS*+#b{qU9y2t+z`t~)RM;dGPx4m€ItSf(>$נIW+U'UXǎ}՚f$izW儫( kf;5+r]Jn?bG>;8RHzU1s@nƝV>`GrmbvAYv+C+M ΢ E7ߠ* Vjаc$~kE('}n>#u*8Lhztcƺzdu: 47:Rn(H=>=Xj- W߉+_}ڬ1҄TAJH>U܃UAhq!Ӑ++Jk"GNkņ1*R6' *NYw"~:Pt hz*x"qe(0oL6ƣk2IH^U35E 혤VU5'8ٍ!J@w6\#}Q <0 ;)$z|@1d}i؊x6 ԡ'!UQsFq16P,[[qW I)vjҧ]V4R1mWe]c]Ph#AQ]W# 3-w)vX;7|Rp8a z*8;غ\pDt2,Z}ۋO+'ݝ "۠5?!fȩEu"nbrه.?yW+Z{ CnqfR׸톕q ! Pt?p&r Sbc;b{d6b@QL*JĊI?} ~8"#􆢊C퀠,AH4έ*PcGbPoRه?<ˇ&OCH$3G$j~5qT@$R<cd1t|D(fs^DTCZO⫒&2?=h؁H*9|^ 23@T|b?7$*5:T|µ뀫iJlF-yY@JӐ*'sO2ԥ`U}8_7+p 7$I}Eǚ0$ABF~6?^?V:Of7 wXQ g]Nr9$F~$jGJ{P +EHW.M.MOۨ&8Hol֔XzR[PϻMUF]b?Vm5]GMle ux{)k=U\z6-9Zzqȭw;dj'7զx6N=4p+2wTSҩ޸Ɖw P2Nɯ݅VAL>G#59dqn_ CL[g--ȼT  2qzXKkH RwjTxltSp rAQhI$npƎ wFIQT$?_= VR TT2p_R1Bjl=w $&#1{`B$:t8nn.#@'; ҡ;W%T)$*X44o8|̗:%Yl2`佟˕[}j<}K|2duws!/ᢁZH,OZ!*lضV#d_4D}PbCȗ&튞,TfV6O|HơOE Xn<eЭ8"O^"sTMQF`GY,Ru'MShi"u~U^Fg^SsoVb=#d(#R`19] !U#@jnw8IS|Gl!ߦk$BM)Aq*E;9F#t~EPEIG=N!D:IS"\ۨ@qU7'(h7=N*کdoӅU~- mJF*~u1(Rhu.X8MUW!h'KS#cEjhi5S`^ 3Gv%6W*huP;΁e=# wI)>]ϹK'Y`? ͉rOyvOIcI4S#?;opF\Bz>C8`(@'$ ^P%u+ JpXDc_z+'Dd$#cJs:RE*jh3Hy|$xԟ׀< Kee0G`s^M=O]:!kۏ#ms@}' !٪ FѺ}%F,M8oFd@6hJunr?V!̐QZ)j>IJ$01h}F٫ZxeeAS BOC UPTG\*2[riFs?;̘ryn*LcyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*4 bJ'ÿ́CDN spHsOt2@M-\R%O-!K!2J+ZzE1 rRǃ0گ&gRPJnMtU\`5ڨO㊯.# |z] SjWW~lpNqLS&W:|,vΕ_6`xQ>52j@-/=v WnžRm"ip 51rI,ѳ!Q?31j}$ Gbx,.'wvQIjwPn~{rW$Է^?8xщ_HEJIT0/?3+vnuޛcN7 o F2yTn>.KjC(j6<=S3ӺV/Ee"Əخiyu$~DI权v2HMUTKOU8PQޢ|=EyrX;?݇Ug$0߯_o9*jKkK%ǍH7%cm+G5,8%mdڎN\@%;J &EzaPB'/udOhXĞV9?c'x?<AJa' 2 ՝' 1V4Zm| /+V'7~ly/[ycE`´[tyR64,; N*P/"*}OQ@>i@=Jk*DWFe~У|T _͚_0n]|Gr V&dG(*ow%c ʡ;2΂.J4qW>lG/q[[ &6pFJ4VCո$ x/ř Jw?mN D`J_^ePJ#3ނv\I %4c +w_8By0^G[a"Y%#N^&HS+ ->|,ےB }:,sTP -ӏ`ڧQPc=bۚw#HVI[U4UR>CFr8G"IO%z?쭷Eu;8~&FbÍnv^_g%]FVںNZrv6lD>}1HS_ya>6_ P, Q]:l VH*~ 19*ۑȲUT}8mP] ΁%12đO^Xͤu >jS ) JSǭw'sSYI@4S֟Ƹ r69p XT OP)=2LKz+NW~,ATE6=GL2…<6>$?d+Sݰ"Ts$ 0;9/$?_Gs}_տ,@PUĴc*$GɁEMAV(57aUY%YjNN@U_%'~Y*Ow /wWom(lvx䪯E_擁V*iS@)?桎w()({V"$oRޟ7_I8ʻ?`)-kXG˧@YqtmJ*S=O%+R _æ$B٭OΔ*ޔI43hFI]*N nD @[8dPTîI*,v*hw f'7Lvyy\7.y1g*A؜ƒ4TױLAfc*U=の)"eR݊z.9/똴lmC",BU(^KoҙUi\IV5ȪቚRPw%]QbS$cj8َ ~dRkZWf\PoO*i`bcLPz,lqWcv,`Ku?"YǛG$vlRhXZrB:0zIid0{֧Ij׶Pi*#L:paS\FQU̒ jI:/|>MĭT}J;5˚E;~|u<[Ѝa:f`w'犮/?wn$A#eÓ'yv?N8Cp`_Yf66{'r'ㅕ$2D:KGfDF$96_b̑F\6@@9PWF W*O8 SU\lHpvܜLOzU@Ħv=P'7`U4Bd|-#ohO=_lUxd220dbZ7JAj+jQġ$lTR>X L$:lxG” v8&IܨWȪa`x؀|0!By]CO}ǑR`yn:7=Mr*5vRf)VPH]_$f [熺\@TWJhߣdb:j$2ЬMNq: F^2jlsۮ% mkJB@"k(i%P'$'gc&>nA?N`HLcN.uۓ kb\0Y#l9hg43Ѕk\$BNd9%Laųn>X3-ca$ȧ;ژ٣)!⇰W@ cMj|01Bh {$k2/0VתPSBbUF?hVAdᏗ!:11 {J|tz]Pxdՠ/k3B)C'w^FCkM:βt=}eD9Oxah0\ad9rjƪ*Em>ChHHrQS*ڞKn͌pOߊݕ1 "rTA UF7;a#ѠAPw7]&bcnqKFaSN%EB U*  $=7%!#rz j Ei늵)gNUp{!}qI#4E%| =N& uL*6+qJ/,݁%9igY"dU7 j|JeE%jr^^YtcJ6j9ׄK˜Eڱ[kzFmeZrV6$YnȮ?\34hd=y`"EKXyPM Ѿ/o*V$ ƴQ[1ҡE\~9LHq)~X"J tiX5<|<~/4y8c_ &x팒#3FȼK֠#¼౤v=o򱤐Gl B>¿W?˕OݗZʛ[O.), f1NK_Lj3ȐSz pDv ;n!Gď?x)aэOSh;Z_J3Hv/>~标bXN }87&^׼gDhĵ|Wf3 }'6IwǛrXnޤ*V߃VxeÐP=S mQC!uoy/>!ˡ5+RJ䩕FQH4 z|\~72[aQH9J tzJ?)-Q,z˜,k28Ίh'7qkiD,A$L5!5-5d8@ ]V+ ƿmЎ[V쫈&] s! *@כU6(ю;T5?n%5ުʟ?yP:]'\/Q[H nk1eZ/Qd YEq~1'Ê >"%i%\;1%_aO"?C"0T4m1Vh.$S_mSGdG^uP\ 381KcB}5h'zȵGC)PP/~U\~&45on,` EvP7yGc u>DsdRV }^<[|TڕUj!njp~{rI*Hd5OvՁURc:SҴ5."c?H(U#!(K$HVh~r"*8ˁ[BΧVEiOe]wjԞjJݙx ޯ쏲@_?I ȴW^ҫ4T]/$WE\ ![bPU?'aHI2iC)1?Fc]b,}~ӈ*Q">5 w$1;niN_r-D`/z-ylOkoU'瀱pVJ}ؘjou'sӌ+@ҮRzԏ -{b@a?VMb;=0=]\i1˳I!( jz`zҠUJb WFZwBAᕕ^17n0Z]aP`qWckC"WzaAvf5.wKMUhpνp%فqWe&ƃ!PJ(b̦1KFP1WbT`KT`Tއ8l*DFfWӊAZVt[ab3 'Te5; z]Hn~"I UOd3(i 5TbZ,n~y-~%۶kʗ^z{$P|C i(+EчCUH9~@W1UCBVX^e~تЯS7y%NrDF†M G F1K۶Yi`Tt0t;}Q>3^YYomٜ\[(#8MvW۱uUd&G1-TjOƝ̠=oen}5`Lcv=>xU~J…Rj|C(y }(H}zеqc F?QaTDn#E8šqmҧ(x·Q1MjQ|ւmN?@?GA>C|ܑ֦֚2SpbMca%_{9F59W,qٓ-Z"xKP (NLcxĆZ%M*\f,L(A$viS'yhzQor+@nh`vȽ+ԩ趁Jց{dn5]5~Yh mCE#2%U=b? 6'*`>WUߓD#7 Bx⪾Jqjx zIVRE: 1U q^ɜ;S*E4`bM'm5Þ9Zޤ/\dlv>䂫Y(d2l{4*,WQc^I3n? OTڸUw+<*}_]b"BBOӁV:`K;փ$| ŗ}^pLQq0w~kS7;xm/Sp 2idc(,~pX 0dene)2C/ Tt ҕ.nfQC헥DsnơG1mMS$~wT;q}ID`+15UUJJ8[n,Vq97O?0MZzCSpΒѾ%ɖUkj2.Ƥ1[9pېFPW@IQO"SS F9S+[H(jd!A9fcO/ dD x]]o ׶![P$1)ҙRS+ ,֘YwZq5$JQg;t6f ɇ'A r+:Gf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ث~ZZGߙx1EAĆnĭ:~n1لߢFj zB CE @քƿF&eo,2@ٷ+Jq^_F)${l{=iV@Cl-K-(~}:|':<U4*e lR>ݫSH-U@DyW)ad*JA bd+&nXi69%M c#ɱN@ԮE~t1"d,_g_Zl| ;c-*  G%eTOP(k fRH=;dH懿7DNk*Nʵkʭ yPF( .T<"u^OĔǠ mq6V@*>#W#Uz*qV  vǐgTSXdH#T`)cZp,|+P!kQS֕RlT+9eH|XCv֘T2֎E@;4b@b*>]0"jO +ԁHj(}lP55lO9R| j++"c"$J69er8jbSC~0YZ2U޵j )J$ VOo0 &VI\&nkn䒾~@M:R'2s%\qxbT#|S}wĞ: Pzo\R]de@= "hzGumP6)s^~bIb~BciWK*W17>#Z64  #]5=*{W[UcB]."ÒUP(?9UYXRT?RǠ.THbupʫZ8^[ۮ b:/"c-Āv5q$䢜tՅU&OCxTZl$rMSr*H mo,M!k(߱l)Z ZvVERN&T2:~U=?bŸu?om1T4F*3wX_J7Jm C 0`HCZ; jEb8V448! E5a6Pa\S~_$5Jۢ9IFVT_XVUnXSp!p*DBv3QTWރ BZPvQI;dJU)PY,(A84H# S*!q-S{ i"uTkrlmǓd 8TW1 Cv~X* 9NEbi` bkUI )GBlJNYUh=p$RsU Lgn"2 (D\! ն9YUu)v |>``*Bd")\&@#8r/\J\] \Uً#b6=Hv'"c]zaWcR] ]1Cڸ]ZP0v=kQK]#Kl9~7DsHy T|+BYU-M<ᓛ8sFfZ{c5 8̑ׯcT`@PT{m $*'aZ{&Cp(Hp\j@`+İ<7̥ȩ54Y*I#5F4ÍV*@큒İ8E-NI(]P q n$_o?#~`u7>|̙k' F*`qv#.VF'56*{)hAF -KfY}P)RrNW°(QnlqUM-ԞE却s֧|*1PAAЂ=O ֊'>JA4]44@rJBZ'ʬ|kGlQnhEI=|$-{V_}~/'P^(?BURōIt~v#.HAkRk+S鱧3 tfǺR;}ƣwe) 7#'VIf>א:Hnzn-KUraSH~>*‚W! ta*6КXL@΍Cf]R;Ūӌ~.#q|5s%Uծ)Fw&:HS1d3lTn#R"36ۊ{2%d@6>t񝞫g<2[Zׯ ~,U^E+ Jq9ثq QZX'1IJZPb/ծ"{ xA㈎?Mυ64VGCzUQ( Q^XК S T{V28kS 0>ar=7d**dFWpK>$kH`k9%E(3K t~ P܌bIƛQ0{̡ K UܪN2H1^«8T.rڇ$LR@qS:Yt+ O?}jļ^EȑoJ-@4I`bI0XŃ*Zk_a'R ̸rr)#ϧ!2ЁE u>#/kh L)/  eF7EQ)J2ID߉7?:dS %?o^ ݳ>Rptȝ7?i}M"vDҲS9oG&mfb>G3 ^q (݆GCc_ZGU43\ ҢV s*CHHD\|ݙ#X(?F\ȡc"j,J4]OrA*W|M$uHʋt5&-JaUȼjI)vEi\>wFn9|jHLл6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ث{_.E9IʄƬ; TPy͠z9;  Z1p)QE pޙ 4W āa`wA^O'Jǩڵl$yPvB_yQ% w\X!R< _r^c{5uvj(kf>8|;B) ` ,epј"ʘV,M:Vwe/,)+دS>&㍹jkFSpnN:~ V`+”<7Ĕ#bTZ|$WnK^]r .Inu^CRZc1 Xק@i$+K"#oցAC &MGb$Z6&_!J;eO:I+:Tv c,eV;O~*7+)Rkӏ͉۷̪)!Ҁ#ZW\3nu*ޛ/NY Vtgdװ{ tJ+5zeRz ʴ@(qzl!.%P SMsc˴%rT3 oMāMQOp,Jӱ̀f=Of\FP*~Oo1(UY"f64 ʠh:Y:Hg;+ƣ+nG•`J\*L1Pw`YOkI+% B ! MO$2FKڇr)C ?{)ҤXUtSS@AKlxW0G??ghԺ7,^.9KX{8L_B|6==8U( ^'_mB̃*J*WoX}E #BT4\vqG:,B?d,~0+Zҿ GGeZV=ia;%FJ%h9sR>dD7$hoPLCr@Ě"IPTƄ1޵JEU'.]AދOMXۅXY q#`!:u'c*PO@ (=s- ?R䥪*Xrf}5\V1RX}S0`Ul=2v~ɭ)_*2;Pv]1cC۪Ǥf24(`i߯XġCʼI (~а.OB }TQP@;嬼JZqqU )/\ ڸUҸMƀǾTgo.޻] ?cGʼn'n"%Dn$$>H5q!hG*H*P|1H䅣hM NS)Q) R^U7;fdJwY9#iς h68me#*hd?{1zP Uf*nC|yF  J;bCsaQ][J֪_  6Vp!؃‘'sbyxčΘRIVz)=G%I+Jor&X^sV Hu6v"}1NQr$ES qI-m+*Ib6ZeP~|CFSak(SEQ@1VePi>mx鐟&%y. A;]8v&V.ď,yΞu;d/ɰ)Oo X6&>gj:NLMl "QRQB„|.@B5Aiv!PyE\*$~#p,G| ݳrҎhᯆ>4K|*-@dǣ6 QuIQrgbyzSryg\VC@?,ڙ/˺~$dWZkcA{ЌiH"U}9n$r , eCSpE~}2Cqzeg"?7"P~-vOH>cZYO }&Ejȋs״AfRB-\ec*&q$>XUV8w?*ga@}i)fI(+yLLUaŸ~)lߦwĕW5Y9/[#O( Wdԅ^9K^W$B(:` $g5="rVߙx9C#saƱ8!"ޟM=y 3 TDjo@ymG&qx rA`J[wrΰTҥ#sEJ kHnBH:بnז>A^AHؚSa$҅+P?/.EI/oZCNˢ.FW̸g?7=~&~qaJW5TVq-̄lr8.x =l@Te>e&s_qF֝8El菵i\w47m˔Yѓmӻ{HZYn)OƄ* Qqn>\g,RGza+V[Q+,nɃ8y1 ʑ HnSv$U*Ƭ͋TbH]lN "O*% d$rc5zuwR+ fnL>?zuR~}q XI P >>52I^U*vSN ߓ(U1_R=Jj+ J?֡/;peRSH%k\/GJNRP޳IJՒ@#n7<z+0rEH_qab Ɣ?ώLm.䳨ؠn}T;=G/rţU v悸HKIʬF$ |iUK45A9@Zޓ~qbƼiu^.OU{䣳 n˜VYw lE>?seЏ֟ˀi^5gnK_'~D)L5PcF.$%ɾnKqe mi'&_nD)%Cjj;}6)ZEQEAW(PԑZvqX-I0ߧ}rdEjVI/% t ̬ABb()JL)+˳ʦRB6 N_\g*o&]#>1#VgqRJAq9(,Bikn}6J CW50xǹ RiPB7`O»Ҿg(NA4#M8.1G&=m3Pƽd rR6}r^BJ*{k58Ǖ mQ 1>F NkL2bBQM/˸$)W6QIedޣ՛uJfHl2=:BeAGova]dV#xYN$ۊ\ L UO\UCAU'|_Vk<%O*jVXRdQpz;q_:j~>5'߾)GZEE8 e>|+V3*g^Lwu:*@J%6<޿ TCGOK)L)Ň +J$M5$oNXX?f^-*rP>*|'}T㔍557|\c?n2($mɿCآs.jt8Ir G/z截$£rJQǕvۣql|*X oQf;?_"ZRk"Sʔp O̪7 CUdcև9N8;xBԲoZ_R˨*hkBz|+#T$R1A*cxx @.8>| R=4 cS@IaG!4劵!JFE:JDe㑶|ӉVU$MS;VS Ț?USǿiޤ E7}A؀6cZ>.alo~>ȡhTj^CG܊n8S@둥i) ִߦM&:@pO?9BT${o?qK5~>O U h;34_V(XX *PGRk%$cSUy$W>>"VG_vpzZS#ueDP1 ;6ַI߱\J6Y~<]^ZG=Wc؃sG+Q⻂LR Fa*W%FO#S [w_u=VCU<ҸWBE8$1V1nъFU4oEvRJE(:`ZvXըiSRiZҍE.~4Usx *ӸM5hNNbCrwy8<#SUvrH, .C‰0 Au>_LaSz}ٽ@14qP1Vʹ1h}V Ў0KxKm0NS"7&)j@6bӈ qO  P_:d98޹:8Nܟ"ΠͯIz81jVeݏ6"MjH*eo2ĉpR{%kf#5Gq톕[1Z|xPw;dYDl mlXLjv[z4ӊP2+ *movR^NOMȕ4W(.6.o,5jH>.9MTW.'9=VۙQayJU!$`k02r1(O0.O0F*@ Nr=2" ۄlZy,6zmب5w}p9 {k =rrJTl+V=h 䐎@bRP7Z*zE;aN*"8Qmw?,*vg* kSZqKdC}“Ȋ@HC\H]~ QoaS1/T}UU?L Fy} *=k^8Wt4|y+6SPH;퀮(:UT >%yKyVաңG;f'kQY|l%N@ui]JR2ɹ kGfSM!i_י*WcO/B JdoܔX" L$!#YA^+TzW` f-;.ڥv{$Y>{2 $W+,Pwq$dqYĵOGR דEk DJ{DV_ 2b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ث[hԩܩ?v_rJ|zt;:H:P3F!ytJ-ߘ$伺w%:d ,UXV zqz# AP$UGB6e$WPH~LO6vj@z/._\ǃ+Q sjIEB}izjx}TЏ, #/7,UJ@.m[pՐչTqXSK tb0~GPpHvݜoN~2dR%Q(5y9qr[( ӑvU%FTQ֛|K3 =*Ǯ$b3$Q<V~^qĎ}ӆG%̈S(?@^_Ö@*G̵ H "+ZsGvf[ڣe5Jx 9/Ž9*5 7'4G_ڻ}R _c~5!7+6'A~T\٤!'dP,:IUxuyrZr术H~ ĝ+`by*PW߳Xxx\>D ŀ`C)j켹/u+s ;chAnV4~_'@`O:#VaW|_qnb!$5.LPlqnɾN;_qzPӡ?'d}bTu(F_~Xe A($.>;39. q5E|l|#aqg =~\q&j ~O\i"0h1/}ECA_p6EƩ?3:Џ>*|_&=M=p{ACnVޜrzJ |=?ӆ:9۷ J"¿sUԑ^hܣqk@ܹPl{w#jr<ԕ(8 @ yb]j>읐*$f,'/[czt#j _ڟXLmu<@ i+W//Zҿ<"#%H 梍4b(ZL)rPfbHBrKR0돌SL ˎ\yM (?θD,433Ŵa|>?A909U hFvv>܆M (@W Z4 Sm.$WM}\2䏍˩iVbRp?hpAP Pƕ ebIC w OqS'L5ըX2hȢk\H:P %z5Z|_g6:EMsE,w<do#g׏bPTT'\B6kr @hNw%01]›^Qm*!)_}bNJ^UjSO?*hxDX1J)0n[%)h_rj)*6'io4k!-P i J@?؄5$H+ȸf 6PT.XQd!XaTnQҞ] ִ'5j?%Ljj*9zfel<vq9P!k͏E]#$?0v&D"_z KBҚSEA4]ւ0" >o;uǠ*cCZ]pҩKt$U0n 8+*{튻-*m*^[8Lv*qWeu]`PO]l*pfDžiZoCo\qhKXa2 9) kuJB+s{8raڅfM).jPK&>e&~'ԞOT>ώ[Jt+!o ,xKաE">*MI ;f!aJ _FGɆI~${2 zfPK9e )"V@Ҋ~#gY`pcJ [<71z$KnE* |+9JN&ޤ Ң xTR$ 8Hq֜aڸUm ;kٝXQMS0uMگ=TWV, +bq$%峭cj-ʣ;C|T]wG/ )TT)).:P|zo*|#U^RdjY$H5ī1 |망P+A^XE)x}̎ifRxH">9jB%~#ɩ;c{qUCN4ZlB tɗ \+D%;Khj|o)<(W5=haJr#{WALɁˋ1GRn}G万4ڵt˸ hd3$i[p _}qlO/B& Xf鶗$h6Y%1},-gW94dU06FK,9diEi\RZWSž(VÑ? K`@ DLƸqJW(SHքT,~~[Zi~z#o]mk72 =rr,:e{Ŝ߸TnFkO2AoSJ|ʼnP&B~ M>7|.,m!;9$/Ut9y=O&e"EBʔE!Th J\qB8UNL*kl yr582aB%SVN1>+io]4(T]H 9VbR[CM ;SR6cȊ. urZ},jӑ遮>UX#$jS}m~ hlU >&Iڸ 3h)ǡ59/ U = o)i/9 ҟ ܜX3;%(=ȄwoIN_ȇ'~X5֙rS+ ,Nue3zˇv>aL]}#,T% EovɄcռ0z`uUU7alz%PLyZo_JCO4K[SoYV=z? _2DK6ȊF`G[od+3y=IQ{q5&EcS QA(AL-%rx!U _l0i-@Tw$lʎ+8^z%;ӧ%j:yNOՑ ꖎָ{(d 0tf֧cOlJ.6dX ̌n 2b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثAkmFݚ~ YMl{Pح#tK&}=?8N4ޞ~LB֤I?ʢ|:c.j=Icۉ'U*|<F^hqH6'-#F9#H].}ݺx"vH[P^@H-ۄ-՛7F#˒Y/U1 Dۑ#*Mg-F)_]`47S\@[AɗX*BAqO$r:ۆ€֭#Ygj~`$Bp"A?q9nQMdXv!io,~U@Ru)zZTLe*X 9S_A0{v4l@0B.Ň8\$M *7WL[Ɣ cd֕k}17Nx؀>":M[b?j [,x~=_o,BD)t~e=5g4Js] ՕNס~]8KEi%+jdCE;fas+~Y*\!4, l)*MPO)ܜ0oȾSW686 Ic  g|B6dQ 䔭 4IJ#TPoaO, չ1ߦ8ux iqxA4ߺIq*j=w쎆*0h|n?2݊}k@V@_ #W__%6njvUlFG w쏇4p'e(=In%Hgx'EKe?U'U=?NI Sq(CIi _XU$R~ Wȭ,L%}?J9mr*Uk}͊*z,uk_lr $Gn0D߫()bWL 577J>R-O,Z4 k8_PTԃNU x=[kr^=Gte/.׮+ nM@;m;Zbۿ|^p!1Hw$auʊ֛[*ӝ[ɪgl'@ }vhQ\*V_Z|(j0?j C xE+$b7~=* ~QY}$P!wvDBv$DY@7q2Sc#o\ $_wdCsvȪ])8IXĬG@GL*+u Rh}Fɉʒh剈x \;aW9PA4]NuUW~;^- 6#+% w\7NdbDFdH"*,l;{aUW#C5av;BKHlʞ>Tۄ5qk/"ok!rԟlcwe㟞ޥp%x*vv->Rqㄗ YnejR[v>T2=MK.kۜiWZuI$ɰ'kw7n$NNƵ;/y4K<̽E-t^H@H o(|B12Qژ04Q"IӾ1/PAJUر"Sm湨:lPڟ؝q;jU زCS+7GJznzFΟ2o!W]vFPdr<]h] hq57E~Q_6 }-0e'cw<"_=^B|DIĐY:#XY˨I}v W^{$Qs}] qF5?$|O?ozjopܞh*$5$(X4lnaT=jOlkA?l= U@JpwǪ,j1F5n-OR51H(u^ ,MXQ{mϟ%W Jt _~ r; xc}X fV,РlI ;cKncaXkQՠN?liJWً%gg,Tu+ƏTa=lz +Tk0MuT-# dĞ=Toɇ-ڞ9 MlW kL<6ܥzJ ^pQ)m԰R5|EbcUb]uL5;lS9 guZwڞ9c P*y+LMT#?e! Ăy)ZrZC׹A*G@ >xbr;<{rLV+)X7VVf>Wo(*=VYѫ]^.μʵ?n6X"!cXX+ nN*S}UD-y~"̻u'kgS|kޟo[pUvjOF7 V҄|ZgR*vZM@W[e`;CpeX`ef x14"Oopm~+l׈7yF *{pҮ8/Z ҈~ 7rt A[u߷dBSc+$TPH5.(AJJ;\:ۀi^2~Ē+aJB%7 k#Tw y"w,`;bURGjѻ!Ǘt#JZ)ă߶pu5tƢlj>Ձ b;)U Uy9UfhoZTn<^S&=|nA۠I0_Zև&<{eG~J`_zGmHRH픝`iZIT\ji\p2 IerTDxd- 6h5Nc2p?LfBƕؔTw01-qp9DPvP8)l vRUي8Scv8uvPMيvPS]U늸{VBzq ; ,]ڙ8KM2,ٛo02=rSy#9=:f(;* r!nV&¸GqO @2Ѳ[SomLj;r [|\kJYWzU)ؕ'tf5x-Ɔ<|iQ/NE[mW-aQma%[(ژ -w p- }NGdœ-#>'U;THoĽ/?dWᄚTAn3PHTLhCJw#vrxN|r+ϺڭKڧn*## rb pOz uHh ^` Y&mGԤj,$77[SSɢjv8pǏO 6v>8PU5`~*v 幒pxW'`v `T2ON9R=1qOI0/g'~3M-%VhZx`P,vCꍅ|pZ#m ׉VF2cs{k4$aPFj%EܒV`ުP{6BE.9/>~lK ZY?b`=oN݃UE5 r!\̟j'aJ²'j܈?FYj5'(AZ{R :wUPTtq+jUmI@~$Q6#lU?|p]^ U,$#~>ػ/eZW㡓NMZxbs[8URQT`yEX„L$ۯYnq銴9u5tڄ{bHSlrJЕ{b7;dOXfW#|>5|qF4H*& MXA`y\1 9%UABI1_IAu;br4ƐT/P)\;-tļWEbDdr}1  SaG-OxǛҥ2m=GZ[HkGݾy͵RUPvaZ|dy6xY L@Sk¦ 1"фsb > k_lTȝ8 C@p|c#$Ac&Iv\ UpPkMYf>IBzw|ou7/̓Y)Dj@|+ªRzX=k%V`h%,6뷎 C\4w[E)BTLѝڵ˜ R*z{{҉urD* :eH@SRNPj o>aMv'2`w\7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثKy=90#;߯R ͍یAy另e)Qˡ/I*Hޙ5QV|QRv lłEgn}PCƋY&hȍAW?Sȭ A wG(wo_0 %7\Ȅ3V9@z{DQ@Ffъk1,X <~č>߱n2z whݩP!T&DW&\e2%@I(Oپ\HQOQAQ9(dDOkҟ-YUFrEXH"n%uR-_?XQdwnG=?6Hb)#//\ Jd=c*Ȕ݇p2J wqf"ZPO_~=:Y$3v qeo6$BC;dKe[ۄXfVpy_+-hCw'" $wC ?bF Q/% %L|Y):ɱ@*ytFs$Z=oƛV$n$ntuq?Zتа@}\y$eڱh⧈ 2Wl+e K*Ƨ_qDZSe'lZS:2MF⴯Oe?˙IcӨ')evD}I4fE17K5wKf>JqUJRT_Jnh~ j?Wo6Mu`+CE?E\уqMx& XA"~CpGI굮5ߤPِ}'%Yzr;?kך"X0[ܓR7.Y&?_iOn*>YFݎsJ9r;sHߍ%4[o,C PǺmʿ+^ⵦ;@d#^(E7޵=T(,ÍAPi|[bJѫai_FN6V/z6"k2]qӘ!wqƣ|6c)J{S*7#c1<꡷_;9l_גPZBБe +mӭdO,x.nuzWq|bFazQ~2[d"GikŒ;{Aw:٘M@9CկN?K}D@%7X&It,S-56 &rL|%xLj+&D\%/.lx(hz}hkwJdJ@׈*H>8ωP=)pUQ"Mb7ik:lZJqxHڄJZƦ4'2aR=醒j3$OkNj~!T8VʖhCW,,APCpRF-AY7!;/ә$)_H mSNú]$\'J0cCA_Mڥ6HdpA1ern1P ^^&~8-lCԔрz1x`A4 )!x2U$W7-)"->H}5\$׈o.@@ҁPև#>^Ca SW?XP)(Ͷ'ҍO8FH+:X3Hv_,jSw S++X3ȢB #c.0!o_мU@Q, WT *h(7'֟Y94.jW~A^Cr({O5jE퀮ҙD%1@֣\E1S$q [ 7UjA|NFB9XuWt8$0p+xһ,PiƐZb4xxȫyTv0Z+#޸ٶqWe00AP KN*Quq=P8hZ5'VTgF3ROt*#^1nGapGhylOO*@IV1wrC!K #Kd0͸=iY4{$K8v*m] 555dmXVA(*\JLUԀ_k/MnJq`^5R>~IOk,KR2 mAhS!Ld?θ ۾Ȳup$c. o6ktRt^\ CT\,Є5G"UJT`isNiQbkr),bxKTև}P0p1iZE >x'*Yk+lEII =h¼s]`-N]$d TJ*@S$č+Ltከ:(U"ՁOvE„@<>qӎ\d#늭%jM{b1qV`/bЊo*AOrw[$!:es:*+@㊭WVy|]bQ÷lUIC(j%ӊ_So yG^@~WO9__?~^[yHn2umdv2 0 (̩R>x$ [7>53Q *OVJU}݃CNsT9@Km VAGFBVh4x<+TkN$@q)c>U˿SESy'']*izTP:kGB `jwb^ \Iܱy#aAk0HKn4 [%s]7ۍ~QIY+ƣ9iR }3`vn{tz1GNX[ iT5j@FeiX1rPW¹cܓ_I(Bk0vv \sn5| I>ZF}d62qj9dS?^E5D ¦I$ sǾI*@pGw=68+49p N8CF;}5D-MQOl+N$nђ Vr^|@z|&9X"FrNثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثbοP]BOUљ͆ bZYe+G! fۃl*>[drvUbAᵡR~XKT~ z=Cq,7|#e14)c/ZאpWBBkҽ$1)*]&  ?Wae'SF֖JH IR|pHVvj&'qo( M ->J$Lj*DSpj><.0aʻi=Ȕ"e>&N*_ h~*@id7W_Pp*waɶ?8viӉߩHD5A zx~?FkQ^VWTPP-kkqcn>jHu?y=j0M+~~/>,y+-əUZО+~ @ZT֞>.۟ cj$ޝAO5K ;VZEdn)ϭ$Sr};rSUE3o˖BIUnr',m~ۏӐ?Gm4 :riJPOǏډB70EXT͍<$1PzF5 dQ֢_o~O{ A2E,d%_&Mir#$+įA[}C//M.  nNVGnH꬏z X8 @^ҩaU_r m~o\n1_Y;,>fviP/_q QEc rSo_,)mj ?s9.R Cv"[bMNhk~H_o6l( qA๚փ$mF $eZ(c^2TFD&wb:~Yrh uSCMǦB iz:4i7jw3RNTɆۗv?2 7lOkźՄ{qSܓ2Wlcµ!EM8S2P-cnA}8PG̊f7O- n"XܖʼnrvQ_I_J+Ҏ) 4+`vcPMRT )V(@ʝ= Y>5q8PݤVj>._u5(p~TQPTE>_VHL~"E)c^4D@P*X>Q+N>vSTnKF ?uetë/Gz%Qr*T)BGm8!.5 <ߦ*ĐGTv-w TZ8Fp9 _U$+jt$l?b#8G 8G.#dBYح9|d\֊lAU#`FE*]\r?zJiN4Y?rRŚ|XRE/S_㙒RƘ`\ _~ߎ nr|CqR@uMƨJ7Z [me>*>. cJWz7yqBF/bCqG&mJrBrTޤ@+W]ԊPm\Pc OWzOfEA݆r!+AA .`Hڵ=*FƊHh=+C0U c^Hý>O"zT l|O\P\1ݾ q%G)[Xxr ӷ\-÷,|%l歽 0DMQƚC742ӱyNJA R(<ҎW@?dmNN_`{r*2р$=k14`IU4ʢԊ?]!\5  QdUTlhqhGݑ_ʸv/ClƩLBN8Н+c@ڝCXǽ0ƅ#l r$0>W,|B+#c]5bxRUCX KU:G*qe~4[X+K` 0RwLvTԾ1z~M"i\u?+Fo^I^Gͨ?`Wo|]n Y`U ,,ğl#R ڼldweY] ܐiXKD^U,JQO.iŖ 4Y UH-홙 #K_1fa'ynLchnN-)L[d"nإi2ׁnҵ)dzyŴ3m?nw=^z,:!:uU=VDK'R.MJ m ɅHBsTuj drʐaUtexF5?H"<8 )F8$ƇYHe1j1^+-j<|@`hN pµȕK GT?g.95īWsg$VP* G\@K{m3vr F4늬-" )$PBcBhUԑqXԂQiQ RH}PT+y^BN7,0aZdi2D~,DJ/㿆gcKV! M`r-qxҹi#Ny ͖W/0#Hdv5#JNpk̞b J6'f =5Z/XgߠS˗Q,4ZA#8 JW/e YҵrR)zS]be`)Ni4!5 zv "c`iOs|pZ3R6;j:ŵ<8ֆ H %̂8?| vT6adlUdɳg8U z/n&jȪ{$*lf\;,$^6H)5bk_ڠ! ZfUhz0B֔#^Ԃk˜*L* y1N]e>kU8fw=Uy*VH> CZݹl1 X**C6 H'w.*&7#" aUF'i˻oRt7C\RܼYTjsb^БME AM )J6QMbbX€/PIF.PzǛf6aQyKkɔP|jJKBP|fd[飸mќ}^x_d[~+"\E)[$~=0ɧ&wcɓ,ѤV[(|:r̜gmվ-VIXk7-걪"zJtso B'2 SoN|BB{dOIR|BU<| "B@|nQXRs&5Dr%r5:b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb%/S2pI?s=G{L.9 T FV N_a{EWIfQQ+;_AWk!Ek=~쒢%XH~< HI;I d-Z/ dP t'ƙζEC+sf,Z_$PvфmU% )~?e9Rjö̹?D)U6Z-?C!7| h*%bUS~yEŘqW Xzt$P+5@׭pAhHcZp hܾ+xp,7`k6jHN^WVoi*l?w lƌњq- 6T[~/x敔MW}ݑ9$<#HH&>OAPAxच;DţJ0]W+b<t>2 o- .d;׋ 7QrY)@F?Gb-+)gZ䵭Ev#'5CJP|+G]*Ձjڧ/KW)ԊuWE ~x$C`Oc pbbz Pg9'(Ē**F 2VI-Ċޤ@(cZ)on\W1 7 HWYJ .l ]_68UWz+m^8mX嗧> -Y^`lK n)ꆐPk <CӔaJӮmRA*`~y%^F >'Zod3Ǟ56lWp! Zi2l ʣ), 0=*q'" > G8nP3 M?kVJr+ #-Nc~Tͱ(1MG"R7T`$_=˿lK ojm-nDl$Y^bUs =O8S! MO9rJ=CES` ]<>Jڋq:S=XH<V#ۉoP q{}h]"! oY4 C2 ;ĉإI;0WCN'ʽ)ZVD4*cJCeZDk6x@ )32͔lw.*V=|baQ6N~n$H5v=0 S2ZLk|[^5`:`),gZ8QTD JIᅮ4)7W|:WqG+Daf~UEWCCCȔ*޾86 F2HqW U(z a]ޙlcU BwլhM7ƒržf39Sm𫫏H늴[Uh⪀VߊQړO0pz$NhHn1 BHZrMkH;\A{=>1G4?-Z5+ ېp$}x{T oWqOz8'N*mTSorJNتYu=01S[ }c" _#b)@7hб4c2P_v&蚫Le|[[w]mB1.\=ZgSFʃT֞?ˊvס G&dl ه*P0,[]?> [9MW<q)f…H ~"Mpe]0ldևxAr|0"2J$^䒭])k-|yeu_#$:-e끾 ԧ ָxC҇Ǜ(FݿSm5@:%4,MGsKRic`ZXn6>8.0 d7VǑ%ʘqڿ'R6JTe%G)Ve~4jxdmVf碓]w9bnMV$&+x.Gh7Gf+ kBzۮz{GFKŝRHKz-SR:׽vm<#<x|=O\G`]kt4LJ!=q^4_V[1रVPr@OFՔ,m@O +> i(@A tGVI̔(+#W2r]ƾmhHP'f]`Ws_oTVFYYQ[qWj+=_tRr H$.\8#cL#@s9pAeB9\Lj)?j*YQ8>˗QQȨ$|J&!UjQ~/YqiJoQO#-BQ\?-M}A^.q7P|!;(IGڤ_8REC OSWMSr"#Hw45br0?6ŏ7$_^$1>}]z8UFBǨ#\zV;1#Sn<*:|d kC$( ]O^鐛o޸̌1)g.Ƭ>bM:-Cv;Wݛ }5^ }iqF>|2qkBąv|nC>xGMzfLYt V|&h Y/S$/@Woד ֜~v&nS,fK0ѓ|UA;+; fhU!*7q8njS~IUm GM(?}߉”ed@*+ 3F;nNI-Xג.9yRގ7@U1uQ[s]s:XlNWd,-:Šۧc$$=@;'l*$/oaRJY%ZwBEn+ N?eƦ6 8IU9C 4@?kpHjēwU^"Py(P>.0qOPG϶(?WÍ'Y8R:xWaWpj}iq( *<6ާ ;9 pl nh+qʄ)<~/K c"QjSO[؆N8SڱTW5f2.1CdN%"62|{prZ|@fH#HAx}"J=3Sj  K7kzW=? VA #HX>J*GO#Hw-)?v܏ -MTWМը Z\4mV*~ 7܏oo– Ԑ+lRsUwP S)fҀ?QJ(9u :nFϸQKeHVE=Bn"6´*t-~ PմA@܁NQۦ+kdf[r; mr*O딇$G&j(RX$PF٥+6HCw |ĊAEEGALi{iTZ=x!8uq'\C`<'| jE lUx2%-e U\T#quq`P*q0uqD+Z$bkGa1[R#rp$n;k7dx)퇚 GRNW.Mؾۻ('Ժr;QGЌr'Ą+𨢌i(/J&wPZ7+v334;Ѷ;}@6=tZI0W ; S)U~/0f;ٷ(MA!l_[G [PWjgFfW v -e:1>d:/2SObq_ P6GE-~YLAS@F^ 偰399pdbr퍐RU"*~~-YiԎ<*jVwH^͉f 84ЊtU$YԎqU5_ ]zSҐW8V,$5 MJ5HHe! इ|pE#A>N)  c'탦xbP\=+.Yqf<z{{bLR*2 wb)\(V{ irPb׿cƠb-؊aUER>*,U\8zn#-"~nQaPik(ez躪j6QzHf#&')yHTO(+A{ aG퍇9}GMSHEt3r.*>.(}N-anԓUCR(YA&KP4QJՃmTX?^@[yp u1K8 .q X\XL$} t]2;y>nOZL9=0+qή#nٌEk֞R0ƝH '&Q?DT%ߣy;7A A=«n.hB@qNmq 8<i1Ucr9Um6g,J|-PT]MS*M?ڦID*t>qDW;fހ5;!fUrGjǭ6CYa(Ƨu`jj,:& 1+Rk9(glǩYjsk Sfhrzn }aE+$F90y0?lс.G )MdmDrw&0Xxa}ĥ"\US:ISH ԍ y疞.mx%5UZkPJᓇҔ&GφP(j7=Jg8دX?bFEA©SV :劌ZT#Ív{H` C)y7UQZ\y7AV׋]vC SY~ T`:r?~ET ×~ YMpP|x?ؓl k6?%˛/4bq,4S@?qO)a@|?˂EP]Ls'eV_xCB*+PJx4Ż~U)Oe 8_r4@HT&6;rG_8؞ T4[9R9 )U~ױ6?_- ylRFŤFE@U?UAIZ)dX÷'ehMA EWc_oZPNn *<$ /쯇Fʉ~|pk-huqe4/O8h N<. Ʉϳ2cGbAҪz.N+"֕G_H:iK;cl._ `J+Ce*Wħ{@p:jW@ex J5AlӐs{d?cZB+ '2ydcB/~_ct0B~M.RAo\}i i![ֽR;m0+~~1W9|P!Se?]T햍MmhE;_ɰ O|KHKt<YM#BMS"*^q%%+Ndd|Ui" =(#7 HU7Tf-A5\cEU櫷*LAM9HB(; 䈶FWB<;} c+QFm_9W`ąV( }~g ?㑥m߫*@l@x`WC>ᘟlIHXPjPqưi]L ڵVڛLu*{dmVML//ajŮEea~.ԥ$52ZHT4J!f~Lj%?gߴ2$!^1^2rxb2E]DrAm,Wqr GZ]qc_t9DZcӮ b2)( K\4-$ S+"IhYrfHXc0*6ت-r.ؔ9d|JKmr)^ ` L;n?UC*q 2%.Glwԫ"3xe>@EWkpn66[M-QNr)Mmc\O$|C|!dj:Cd-m Fe´zf.}YyFڿvZ^ѩ鿎65| ^Ɲ1T| lh On116ЩݓQ%]@{hb[QAiCkÙ~IJ.{)֞W O16qYQG3޵l$j!=2J;4j2RGQ}X;P1R +M⼉-}2$Pn%dIҁAZf/(ȞS/Ҹik,N9~XwcN0r`d[GҮu) Xy 5 <>"Zv;]2qNhZ>Mq!Z rȖ5V1= n@9 0I~K9?.R֍}/2:lI?F׮NS}2LRmJG Ix;1Zө}.r(a PqPx\ %Б}Y7Z;dP;Ȕ_aCaXT+өU ﱯ`Jj6M=x)N[ՆFrkQ2^w+"5x~0Lbpŕ.F=DJ5?#Zڍ>wLÒD#,FLoW^g3FBhpln0`ޠ aHAZbn!<Tw\y%ᐏh&jXQ$UzpRd- g4+ASVE~9MYVr+6ҪM;1&*O PZ6jXn-M&~o%F1~~6/y"œd3OX4i*ڊdOo_|CtUkyPLMwӢI(z-(x+u4 /\mP~b5S\](YS~$ bGk'!`j/ɰ*MEo&-"QŠY@#$~|xWo$UIns(^o im$RFHW/N;+QOɛ1B"AA.,F"%n"@T$wFTQ7CvM=C,QAH7I8f&v!|>%?4Rine6yR5^FQ}N_XHcH]TQm V^kwƈX?kMś|/|SuwU7; Gٺ??lWQͺ+;b»zLe:|mXeFhX?Kq`z⨣S(d=+)^(hA~G|ٛ~eav5#p &=# Z/C\UNo-T;P`r\Uæ&*{PbRS%@w#*&q"U/ƵLh̠o^uSڃ!ۡF8ۭͨEz^%*#5k&4^vo;(=,TQȨ8Y@ǔkAZ $kX2qdR4aZa 潲4ldc$WTq+H=*w'>Z72 hM1U:'@,K|rNrMSu1Eñm뎕 s@1U(zvIc< ',k4 Ą(ߥ\|JNE~q*fi`WW#qTIGݡ_P 3E$uX>=0^o2=|NN0N  dJH+I k]DΪ@ WJqPQpv "(Oʂ)IV'꿃Ƽays<D!(:fx Tyets,:md!*gagү4]~O+#0 \Դjud8sM?.w8 ;`r 5xI7B5q$a6#,N>lr:} GZJ2޸+F(L*eE1SVIUEkL~U\deNcj,'Znl48i*1CiC-[jˎg.kbb rWa]FLFPOxT+Q8VE8@螉Ubx |[8ke*bSyTb ~H nlm&a\_bKi?-vN$ݩzOGooWWx(Qնc_4i(&}rS퟇/ -ӫ$k!7jE1ߕ=o$&,zaWa IOJX^n#BrA?G) È&#,(s;7<rz;CpF@X)lRGĊÍuo~bØﷹ02aN;oN|eAV= }Tֽ^Jo%Z2KNʂA^|v}}k벶8P OW6ڨ 1F "E?C 62DJacXʒL|+el܇mK+)B{a#J蕫:U]/"cgoƶN۫M!4Yh>%?c~85B}?%H9b:@oݝW/7Z׭wq=>4ZZgW1^.h)G^Fs:Ko4*fkˇ95=L6XOřæKmO7 q9KR)Q,#*O󟛟EhJL7S'VV.od'ޭFr$eR}En@ֹogAi)LKJ܁h{sf"yϝMN5+v8Jy{mޟE ~x7cnXpcQ^+9GVR\|$mH 8= ڳgJ"1Cӽ?UFj4TxR¿␫H=5ozxJ˙R겞* |v;ew5xƭ\aZw/XGJa+X 6YnBߑkMw\ ΀hX$m-cRڪOBy{x9 :d@65Eїs፥wՌ,zFةq;˵-NT,]knV=ҿ~C.A\6 _>oV>m[Y}RSOYm!#*P{=2Md E-V:dbR $ e\RH\)_ !QF穮AΓ+{s|,W*!4CjT`V :eEQq Jԛ8(~1lK/aaQ[\ myHlew\vZkFc۠~YMqZ}Өہ&KIG *"?LK*@1ؚe6pitIi J\t!!A@AXkBp-}mEB)ja\]ap lC466@)ڰGC!aP*9 Coqg DfgV4~wE$Ŵ.5Kf85?o#DP&0DI_ ]>J>hG,6c<(?.OLw3rs+A3LEn m"נ>uX}JT6)v?ʂ:Пp?\ZFfGOY)rg^̃rQ?:fȵ`r$9HHrp#.gCcHmcHb5 6cf  VgPM@|,&Z8}1lM>g@zWkS.;)\ ¼ztm#`~}qF늷CuaACث@h´cf2_jҦ Ȯ KWjf(UױVnXݱDGUk+8˾5dJ\h:ӡ`]qVS=X_cKi} Лh8FJ/FË j%]1}7^^;6$Zϖ干}=nUy3Fn '&_\j*O˳wwTVĊ|{YWoqgL:zDdbdu(/69 yMUO[5E w?8U0}B/F(i'o XD"HV?| I.|(1_h)BDdK Oe7T0-+J_l隴J8Xޟ? y@)J7"S#*rŐ-ERJ7Y s +?SE)ꖷ[,$1MɏOPZt{ۈ"ԣ4bN}o=I p?p5:uf)y&eg!]rC~`=f}]8^O6Kg˺m;h q;3ߒf,2 Xqإ_)\-ѭO@0hVZFžˎS- =id T 5k.8TM&GS7IxL/^WF "}S\ӈҤ \L0车jE~n& ӭ29}fZ0ދMS W[F S i!rP% n*̠" { uIih>ˀqd(>,6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثbr̬Q4UPT9,dNý*6>cl<)< ߧ߅f~#T2$z> Z&/K/%`oRA'O_1&5[rQ=Ҽɇ&t¿fGH޻8'fIUBEēшXSo)̓v' eUBΝ Q՘b:hXƙ}Eeb6h?*erwc׵) MX(<#A$>ه޿(c,ܔ"q$/_0vۧL!C#Qy~(൫^ƀVۧ}IPv'$v)DIpG(Z&gIS;~nE22pG%R:aPr@AIp'q^dSZ;sUG @on?iQrv)JI> ɣf'f$mZMq^@_"W%;W'csP7{*BA)Z7d~鰖۽|2A6$Ks H4 ݖro j!H4_cz}|§28U!eo:W<KFޗ^KbRt ´{6L3F@?aNjW/QW4T`$bvb v(t4LZ'c/m NDҭAo[55 wc}Ԃ*I余>/ʔGXFZ#⊦Djl:~_3)[by%+SАH+%?e"uj>9EQԱR @6qS.M7ǚ ֻc89 iJ9ĨXFܙ'qOݷ_eqaNrH,nHj bfB I nix7J%V~Q e#qn[&mǓ5Y4 WCc_*|S^^÷Olk;j!Z P7a*7万m载>tSHMQhf͗, z>d֖q R=T%0ѵy4#b?xe3FBղ\bUNu&ބ;lk>~ azǐCxerYkA>>r! Vʗ $\PmPRG>xV 0;@ Sµʩ!@Qջuc8wSL%@?; ojޙ5 >dtB)R቙PH K;[WJ wWFB(@퉻e4mOzW)DBըOǩCS<5:ڧ$aŐGGPT8 UhwqUE3#Voe}Yc`~ρǒWYWʣx?Ƭ$Bjy:տ朊-" ,f J2VrG+wW$!GP O miuy~.-٣]Mdފv}$+SUx?wQVUˉC)T?dVH!R: F\j?c */pzG?<KHQ 1GHaTcU58pR ; ׾2̴a4aUqʤS"2SH!NX!Wb:qH=iZUZ\!AVP€P7$G*I>;5qS= 6*u'b#ѓThQ#kُF|+Cŏ=~xHځ%H>ʹdq!" \S >Ne )]A bߍXԚn~r9:S|pHXujWPZzfV ОV5Ոm]sQ½_^K3G x m&cAs5j-BR+k9\eޘ5 *XB)0;20Dtjp⹵cά\Qӡn"O.O$UAOӚ)14\BcWj^&=cn!X"d$ڄxea]i{3M-ʼ w Qۏ3ʨԎE* ɞk_1ڼ#5(||/Á-׎V. 'WŊupBp$rADAȋ?Cю9v+^#1恹4h2,Qqb_y[G*zU:):וg pNĊo elc~\ݞyu we##FXE?_}`-M[,>`}r#t]n.9HiA#\􍙸w퀚TİdMBEqv"Wu]'l}%ǙK#F3Pз㏘e_ÅZ\E(aGBwMrB4m6kzlc[& TB;zѸxMm KPUH=RPu] g%"ӕ٬}#%bO٩oClWWASЂNDUl{@Zzn:K+,nF "y"tϊܺOڌ> ;se]BLd]_Lc%*d_8CE5zlD ;ĆpKh$pD/DM`d % k, H*2>HbZΚ `׈'H&oZzaEhe'[f&\FÿkG +TDrF4[Mj;v :5%"ghfP1`>Rٽ7ؕ%ZQ. Toz~zE?1ɪdn ԁ8 ^CEA{%.QYPyM!#s_avQV82E'/LS[}" sCMw| 0v\$SΪjh}GBJ3n9 T@۟([(Y$2JOU^C)Lz^]ݞ+BԪW5WKȟL3/a @Lnռ37V&՗nN)Xuh6cqF(1_!1wh]$qއU__.m^ؕ M Z7X/LKY&@9='`#!0}UVOڿ^ uQZ5LVzA-]~׸=*bc0!'b:D%UǏ\Ppqwa$]9},k)10He=GJ؏H5A{h9Lw­(xQsN|̏ \E`,h9W7S+2L hXu䌍!BOoAz8}Mj7OCU5V_0RF%ˤ0Pž߳#1'|LICyܧB-kMynGF7+=U;'"i+p¾!j.m/Nao?VM 'r&jU?*? |ir&XxO, TIE@ےa|J9?4t,C@FꖳH!iLby&)L{oecӡ؂п,*輇=AHYn "-QimTJ'q۷J.O%9Mǩ}@;סkRb6$dOs wiʭØщd ~o܊;~(UE' ucZ٤cE`)B@[x!܊AÕG6$nlG)ڝ끟 /'E*U{r|-ȑL#f2+Brt1{u=kURB:ToqbGr7$L<~%WLEhVe J0geޅGBH ebvYBד( U(Yj z}On H u۴pV &3 "1cѿoO;kN`0?W c*ۗ6*|Fx>94aixJN)76tݫRTtq'o_疿y \nػ4:VAGoc0!Ld_)h*K%YՌw"(yxlM.$ )EGeRT P >J:\ŘS?]26 D UlSg)AG_\4oR Ct__g/'nR? ;2ZT1Gs2i5'"EA<[)0C}/f6s .lUآhHm9!Ε3\C1Svnk v;Hu/[G?˵ON-uyD7 no-ی~jקLɤH|_.{|g" (CaZELQ?%{Tz.Y5N+O?eh7j)z>4 J-]J*GBH4jCZhZdn^$5ZSg`hSOR.ec隯Ų^qTȳק$.^4v]$U/ w[S3#+ +V*2c5SYUy.Sf\s6<oY 8F|T$Z匒2 ڴ|%CD:˷c\Qr)#44y9y0X=]x&~'u * 6㤓T%iȊoVRR FP ?gRբx Vi+i/&_X| 'ВXMk_"W~Lh<g6$jnd8 ,A+^O_7%TT/8JnÝRj) e*Pw{kFgUv-V696cO,o]eq ZnbSi'2LG}6; X+ /P«&B+q280޵\w~ANlIBPHC*N`ss#ND7!a G-20!`n\kE>QU)OPĕ6=Pr!B?<~e£L^%ˇ5k9 #͋,VvQd32 R\XgŁchrHH&9QG5%e%SeES|/\ =7Vr#Mi*'-nYKH֜W&oݥ#7Gv)Bo;M^I6^gTFӑPz_ag%!v1ґENK{ƙx1/m &9 {bw V #.si?Fb?Q2a#j9^Xsu8Jwm% '|#i? nVX=fkE,O*O46PEb'+= Sa+jh9[ʓFr=*z`bѹ(o\ϯ*mf\_O˷[ܭ޵*;$ [8kguVHvzIin^DUԟ|2gO5G6 xI՞aH{t=E@ͽ K0d\/l+LxO%{y)NE6 381m7JO%\84lAyKWֲEОZp^ꖗhh׈=e u@{ĥLňdzr ;˺ܺ=-BդX_).S^I ّFC!ȷW2΀Xڧ IܣkWCɡTq`!-cFh E;tۧDTXw^-퀽" Cak)t=>Uh*s7=0L*H*P= p?!;5qta: hLc^r2.V|rg?,V_P j M;o1iS3OƢ1LٓS\SѪi22~ʯd6_RՔSTNlcl){ҕ+f~ӭ)Z~J0$ ӿoVpI+}62`"Ҕ…pŘxsc/M)RA5p*e@wb/jP;x⪱)RkA^鈺bHlP+FjP劷P$FeڤM~&hqJ$ROݎՈXUoZL^ ~zoMCZ)TN}c%˥RKxV0RC-\1;!(Aq\i6FsqJ/_,W1hٿ N>X*׶*ӵ|j:3W~1)* Cu#MOCU¤mcJR*n#O6 2>C '?NmUcNauzrbƯOnnz >Vpks3i#~lI' FPIZn(ٛ):xR: ג _T&{#[F6 L];+K.9<;xr,Mu1Ue +E|;ep#a2g # <|*\G2qK!!|AW-1!<â&jñ_o'!P0moZ\XO`HYdVQ27]2nH@A IKW&İ)݈xXGj>_gJ P@q*ndd]Ԇj8Xvه0tO*֖ZP)z|b64ĀYlRTtF#"lh]vLJv{֎2"OƟU6=(Z ,oN B)$ȴ'^KwҵH(IDw)h*);W?g1tŪԁrVr~@TXmƘtN@ MLyI7ňG% ]lIAoqZցzh~ ~`P5!$M h}6(>)J\l*Au_-Z+%qHW0gQ؇vUB2l8okѶ @;oA=7w5b|C{ U E6@R5`ZC*׈7q9O>b}2M-]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊:ϐn=]2:Ò9 y0FVrEhhdN>o,Cf㢊|f݆"m큏sl^I,DZŸ {ALLceqjI=\uAN(`=36{)?S<زoiN}IXUG:qT|H DHB$u* h7*!F6v DV h.v'|_ftG,`GE9cTqeщ'~" go?unHܼG}j"⌖/ gwpPoF]JH,EK]>(w:`$Z:DDH%.'jʟ]j'f|YBH=dtX$hQCIPjܿdS@>~*}QwYaX~.^[DVYySzl'.qhE\DG$ſN*2! ~S0XLqzJio#71=6c?":_aL6)J,Xј*/&LP}NT m޿>B-O2XrAOڍ22xP%(}Le[܅iE?*(OĸPn6,b;G]_hq|bR)\dV%yѮ%BM*@^J:`dЁ1.iV!]厡 ̌WԫLA# 1 M^#):Rz{Sm"KH=gU#[4;ЃQ #p)r~8@MW7@#+,>}|w#v@s>qPGYnhk:/u) O`LYlK&?hڥ2]Ij]#eCX#X쨠Zf*b͊51WdJzE_nI  yvZ= ͎t-z*Ë]E~ŪaIU昊9&bJW3B* y,eak,RNrb30֕;!6 ^RjijMǽ~XY.8v?T؍䭈_DPz^ÌoM.ے#8s}"vfh>Tz0 0@@8\Yk܆8;Nn}) T Gi &;wWaxѣnSn}+VGs䍰pO_,QI @+I ,SPd܃n 4?Y@(*L|8Z"W_ˏL6z )"7dn?آF΃/+O[|K,F7Tb)wI/0JHj.ZC%+Jz ydxrwE-l3356?k<[bןO5õ1G(Q1]OX.iҦz#XP4GȅILJE6UZ5ȉ$[֤3`/?=V^Q0*pP<.+e ir)կܰ3Q; %0EVeBzN}ٹ3`.j%ԪYTqLGb󿗟ZTd2䗁  e5WzND<#Tou}IoTkޝ%~^JkO78ڜCS>4hZΒ]b5@U `LO$7k,RTDž 5iL)M-\}@:4R%ސ)IX%~Dᗟk3"Ad"OFDml1@<Ƿ6;oDltKES#ۂ;B*g?)=ƿm w2~q+WÃnC۞m<0G{׎ w4za[Ih>R>9V,s蕈G23*Y%u!wuky0?\-{&'-ԮO!Io׬vnvK1? ydtu9h %zz GLPԒ=t1b\)خh*>yt?eL)zd]w=Ȟc(ɹw.lpꂎb~c~b+s߸_,łNc}h_/yIQMF4Vry1=gl##g' X@; h (H#P`1H $D1U5ӗTglE0#쁰TV29+o#6I*.[ #jD(gtz7Se6%hֽ4^PTG2U]APO\Ul]P.A}{'iǨ]]^dTq:d.@K4qUK~IW8TGVbOxy?pwkKyrMDt_ݫe &W@Oʀ~!,SHØ< ?aBwFU0}"AڿeOOkPc6Jïm)cɘ7W @<=B&Wr{SnI77[S:. UO 8vñ 媭FnQ(FZH4 .wjJz{▶=vu*(633"\:eOszV58a,ʊi?2tI`FAӐ- Y.:Yj x> r>YnmdMl~Ò1CՋ~ e~YaNG nv[S { _svd9oˋz҂N<5t*~}#tKz!]i LQXvZ#Vg)XFW#'2)l3Pwdx2!I@lPt 10xcE MƂtlK'=+Sb$1xZe snŋm~hِӶW] ǢTB7WYs2{zlndRZqs/7^Z8QT1)@J ^Gk Ik!XgnʬW T9saD$Pl44:fā QV Ofw넄p[k2\1u3LSRRS^mU适X-u"NfW=șm6Υ8CĖ'_5&8ѯ%%PN {"y.}XTtP>O׍e+фDi]ĝ;N2J.(Lo3?G|R:x,[rZ-F0M%SldmX";PLdpdֻY ŌڋU@E<|q2솣qdKi4a R 7b~0>. -%%BPXp$+*#/6 ̭%`)co2 ˽>^Kh+_u"'U+"&ZHÊR{P?VnWs4lz?r(,ơ.X1/RwC1=iz T/PJ2\PG0heC# BM_S ? &P ^3aI~ĘJDi4GF"]ȡ'!Q3 {,PQFMAF P6x2s&]Ti YC(XOM!nĢ蛕VFTuZIU>4MH)6$\t|n/űU\O JY'JL1.Wfd<qiFsV C㒻ܤEY(h C}'iX_#}j ,5iI˗R1]Dir'% DQkP7N`m5hP@K|9AʐkPG![f4e1B j>i[,dQ[ۉ$"YLU٩+ 6*ثWPˏ$;dK@#szs++xU nym3`IG(Z-EOQ+2h*4V[&d!.zMX㌢1Mfqa'f{^$4uQ YƆ%dFwT NGwdW6IƄ'ZjqPҢ||P%d%Ĕ vƛ$b"[K 9lMS4{.$;Z/ù$q"jPoV"'.?_TpwX@}&rKn? N$+6eҢMĽ(ȯ-G EݩxqTTSMj֧q<Ɗ+yF ^MWxT=z%R' \S=Îcx#G dGȥd@N*pAcD0Sewz4YRyTx2m~އ;_ƙI ?,qXB3!SwU#crֱ'ی1Cd)rBtԬfҜ ß)AxTAWߚv=aIK p_^tbQU?g"Ҡm_lP DC֟ɼD|-bxj&${d?:(Wپ(RQGA$T5)Ud}gZ@ÐcRR*^eU QĆ=LM y|jk@ZXnt 3czR?ejm©B*w.FPˋ.z)z($Zv?pX(ڬ}p2Ng#TQޘZ2Tִ'qX?*ւ"*cGz inbj*R"`{׮(m N5'cmJ~ID^­Nƍ4?A\7#}تoy{T5:3#O╂c[YaQnmW':7DV_ siҌtZnxfTf)~c=1n[ES#ȷjcTv9B~3jYD^aEi|@D}fzrƹlTI[Y Hj`̋J-K!gSFRhAㅮIHA&W5 ]7T_GF )="~@OP 9q=kI`PLy)ZE Vy[13K4)F@F}9qѿ "}ZNqFjFLFa-| Fʣ`OOFrÌ&y>Rh(Ec ݫBz`2p0DM§7$_cWTlޫ5*Π7\ƴJ"xUuSO@kƺ˾h#k_ctQm#'ceuDIpE^"k=2퐐`B>d45"6Iv9Wu& IbѸhgeVӵJ'KRƞ9P{\q֥[B0TT1AfB 9,%IQ@zџ81<3ȃA>aq\F^SBEiԯ98v×_ dQ?%홆{f>PaߩMO !ՉB|MW>,^fW.>yWa"{(kcn*XcJ|VFV$ץN@H qPE< T~܌_ew cz it8Hh+AS/_SSJrI6n( B>+*N(YO%Tw|jYYdu5鍠#`, (7e5+RA z,MV;=+J ,|+̈́HI UcOaJ.>X~TmH> mF P~&teX~ƀ]h|E+32#$Njsn_F8-PS 44Y_HZYFY@h?[*42Nרau;iuܢp(G*2BתOʅzH6QS_69"|ߡP8/)G3՗|_b&>2y]-"^4)}>Oo_Nkjֲ5|"M&#r>/.$fvp@㯉%sS#oqCan00/Z>D֠ ;trPC1SjJ?7@NFJEKƤ)?f71vORPӧ7hZ^Xʊ/~k [$ARVUU,Ho=ɺmmG5ѝ?cCSUlT?_(5zwvNۧjV,Z^F@>+XZqYkĻ1n4p:W鰜V Җ.ofk}@`wݽ> zmTE$3ʨ 2+zfI"j6ostxrM (ܰ,Ѵ.cmN1fS+Ka[Yd@ 2,VH yWݟr+-K?՜f g)lY63rt2΃RžZX1=U%QM8C !0ː*Bk}9Z0IW=iY׆IQ-4 \/iijSRȓ6li={TEFЭxn2y/g< fEԌHC~"678y2Òu$)(QQ qm$}"1"w()CwԾ=<+k<:'vՏ_Z=D}97yRm>IXNjsMk,% 8Z@# o>׼ kcwdp/?QINyMygOm;^6zs"~\(*D`kIy(pDT^_쑹`J[HR-aE^k;ҶftAn>'E \>S $CZǾKDMH{AuyfPoxRUUˎIaVu-jN7WRQ HvoUKkwi_vJHnLkffTGX<=Ov sk.tB ۉg_ږ 5zK _\ׅ0目P[T#JIËˁn-hQAx![zژ5ӳ->!ޜK|)"_r-/S&д12,a6SXBXëP"QNa@j!#Jq++"H/!1Zwp:3SöItoS+ޙUlz䎂HP7ƇQh>%^FlUQ`g.)riJ6lB3m HҠDN/R 8ymG_VQHdC+t5vbD|TTȣ}6LaǑ?\(oOKuR*xS[\"QXU7Gt $POe˅4pzCۑJQIU QӧX6zO*}R t"ݝBQ'{ S*k^0*ylž\[%©`6QIPW '`J}Is  JjF؅ H1~X ׋o\储8H/*]RiS.xWzM6@W=^".*u ߀t^[IukVNM?(n;{U§q,TTVF(]BIįP\6}~L#'f<&[qF%NӗTQDx??ƹ~f 51Hx|c>#2E9UTyZЯ,%;U A+QHϥ͗R6P K=UV% n3cjP+1X$d%_%I@!S*(+Xqhb4+VJ DXp%AGC)Z1hO +TR#PZu4ڀ}\/lUwXv(qJ^8bߎkAYJzЏ@]50q7Qu])= $HָǺ VEE;֎ޘ喧swu<[S_Z?\OAyW L%kU{tªߦv/i0h2BI.ޙx:ѷVB֛ iBn!^,[kOj§E;RAp&_1!g=7;qˇYۥpZӇĐbKl<~T9M4/Rh&hېJ8s$OpΑ~AJ~&?0PF8Y=RE-P_RNA LØִhkNQT`zwlX ~/qۦK$۬qS#WSB1"V(ᔃ55g僄GǬDÀ5Aj}M̥3twTR֏&&MW. ,l0~j>$mV0N 0U+%}l dIR]ս`o2#\ZegV0QA1wʎPZ̑)f.>ٍK]<~y<2n#alʮXTB2O'-KK6si,qC`TaXr$P꟢O1- WZ\i5Om#5tX&Av֟nR$<ҞUywj[#W?jOm/f`dk|]ۘgĜf{4py1ݔxӹMiVm[ZFĂf!P|6id^5ûZ[$i#zO4-L)+"OR0ƾ< 9.$X܄A#&2;0|N@>d$stD޼XÔ麸n%UTj6CPk̒!$ڬ+o_k^\GaM܈㚁 |ڵѿnbBȼ~Y^pnޣ~hA`>$-%8qq L+u _ZqC?3VVQJ~NJ r%fI ɕ~mq&-W׿|0IǎƇĹl Twc8l7Nū=zNHv# fիkY G5[5nŝ e#aҴ=q,] W&H/\j4W2T\}ۨ_>h"M(҅t@V_RP=efyȋ[/,ki::\y{ow]<+ ۲AG~mT$n#c}?eMm{h\Mi7,jKvyc%L!?CyI s@)"}?C ɤl "/ORKwMTuuB7O%&<*l™%Xl߯=&i}ǶiG7ORϹ^I\CBJΒVuFtS9D:3"4GkK +[& ~/T=3u7y ]wBX2Ob68$,xg2$8e"%H"}Z٭/m9v3Ց|?Em3./=^#0xIFinUg[_G˗ QZ8#N`IgIWp?lX%Cs1o# o&W-,EsvJbjGWFX- 2H ?GLile\/V߫1#^}CrQC?.vSH-ٗg ̓jCbpqkc7]~xI(uL .cF@p$)$ .VShbKs$5ٖhHʊFʲCqOUӒO,ծWd$M Ț(bC]QBOxBxyv%[㝞8OixOrjx"8VD&Di y+*9 A4ml9cV,9q1hgDX…T +t卓[?J(;W" V q5ǣ/%.*kW,,Qbxr]IuSLOJc/n2,O6+mFkkDxLXN5-Rm:J.=IN*nՅLP򭓇`i?db4k=Z_DPa]o̗R#XYKc%ExCnkRQblАhv(#V^(q B2mtB0xcKjm'(^JbE6m%|1*vPn(=TN '~|piuԻbyER?W97bŹi IE,ᡣ|EfnsP/PTvZ`TV06_LԠESKX[2?SВO`q^kB;UZC&ۘ`{ r9q늭Q+"sQOO]۠ǣ |pɨgvC"ȏ,F{`=BWV* d'*Eou`Y ֠RUoƝy'B VD4cǏJP2B!ݾ/l*n@C_Q0Ԃ(~WϦ BzTZ?QD q:Ա1FUj Z Q+29uv偮,-n^B_V{5PlVrw\ Jb^V]V !+N(ʒpw)QYFܿic⪂C^c~.7ޒ;q8We1;mXČ|ULn{bj#4T*jgyTf~z/DVz +O%5pڙRBտiؚYTmR ߭? f?/9Lr&6jl"O/?fƈ4ǹ4+ŸhՔqBQb@GyI{kj>c}%uɻcr~]\E],d t؍Gv1YӮY.Ф~ ƕOliCC&rƙif40#.%[oW. F,\ |;+-|,us88[O64&~j䚂@nWÍLO5icJ"B3oJ$rs:x])ۈʯz`E# K(f/or]sE5]&V#nb ojEPքQ!((#+DP^$(;#AӮc1wާ.)1qA Tf )#zi1Aa7Of=A 9bjOʼrVaC>qĶ ߉9LZhu$DMBX%E*Mr"Ƒ4ހqf0hOlm4d!ݢ $?FN$qQ01DvI~z֙W(~]u͂q3s >8冬|! 4ASAg̨EȄ QkQ[!:Uh+LoK[r.҃ySf8MSe̔;.04b\j2D\0.՗neئ97B`bb%,uoׅhj;M]UV #MΡTӫuTǓ{bjVo: }JIc"QAO=α> cS'aN4_f_q WF+#blUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*hj1WgX7dEp*R0_N\l_3@NJR,G:SV]?Yahfhdee-F⿰?֌)'P)On[6<ޅ×%o&ƊzdG;D[jO}\^7cn% `k>EQ_E(QVW` E>YgeqژBiZ;R$` @oV9RYr)B ;7hBUX U;~>>jImޤk1_Sqj2?dXqս-,*X_B9H7gxD{1! *\rnv%G(wV;wdzAX%ʥ?`qmeZ Hۋ_J6 nyl+hn4oV&*Yw͉$=Oq;)E̬^ވLE8+LՁy!u?Ye 5>֣cbBAƠ%z+^hHN#SDr7#mHUA#ZIXV|?8fQMI@_ $6<h~ƅV5*Ti^4,'o'ƩOT3UJrљPFY40+@vz>h+ѾƷ>ğJ7VR7Ġ1GqZ Q5XzB'ĿP@)58mM%Zrf$}ZDge)Q`$V۬denDqZ6"]0RcdOz*Rh%j2\;I؂7&L0vh6UPP'Jppk-7:yZ4< )FEUO"x'~XҵH2 ӏj3~cC$ H\L|As ,51WeSvlUٱWf]-#31FJt3/S4T99J₧pژ$A4PE6rl&nYURڧ!Iz t FͫR뀵ֽO٦.aZƦ"wR<N$!N5]I>Ҏ?Iw8ƈcz$)X?RTvXaֺ] *u؀G͌5C>uXl#3L9 fvTmi/[sqi3|Q;);y{F#)],B?Biv$fSsގHc_Wen5ky/lxӒ*,&c޺+Krx|N@aVwlvuZn놚nRح$ 9 7̯o7l.sBAܒSp=<38,"xSq\jeS3pAcyMc b{qq<W/uCS.͌d B'͞]ZtȅMJW`p4j`%Ui/J5sCyJ17Si67"X"c*rm/#tdcمHL`vG4Bnv)pTi'a '-rހb>fApl4ؚ@#g;|F GOf"+đF\1C9y%zIcVdDcRjo&/LJ,zZ'>JK+JaOӅrqTFkߐ'._L_C]56eM!?268P'MH t~@L9qDxQմ=Tj}j6@#PQbFFE94~j'(P k}^iWuG$nF6֊TKx "  g-704kҤc} &uga]yM#+)Eq :d #;6ʒK끊ޙ|i-W/|lR\‚7LP]Z+CvǪ aSqMtczxdIJ]zdUcgLHj`8vx`_C Jwܣ{Zڛ%Qn.uڇ/40RFM@"Ah`]YTHe^%?bkS\P &Qa, -(PmȓA1Fdq B zl&ݬEK)[(RH*M;ḻ cJ)B$4bXWeLBRb aZ/)P,9m$#oBNw튤[i~cX}t,lJ{q?TtmB*MX?es~a@ =*2 U. raF;۷TU=ıƥ '}Piq Fe;TT|1Gndҟ~*A֞öžň¤:'Um?O.@#΋.z =Bgo#Jy)ƽNfDiH?N*ME^|[q#}+0nKF>Ո68P[V, V?`hK[¿hu0-c{'3Gv?KhK.-F\9'|95K/3%ճ+ wS7.B=ӦX_-NO?l gnLb|,6c].HFh$x!, T!Z}, 5_(J;Sl*9 k5&.S I`VRbJu4š~'|%V^@bĨ|Uaqr)-;jދ}U6̑n늶Z6ڈwj.帧\ A"$GC(#1]qA: TI1G+\xb[qEUFKJ|pIiX :7+ 0\SkcSmJU  #H_'c DmEoޝz&VbO)o IIqץqB0^{p* ؒxUp")NvzfOjO. @}Y6_|5f۫@ZYTBJ1J7U='-e([(wLi8Dj|Id@A?#;!oy\6[yq+[Y ` X6;dNw*;e#bO朳3/V` y/kL`jҪܺܿf[P8/u }uctH uPq*Cz퓷%hO;Ep bL{z~$30:~ʷ,d]뒦:~tՍ.hH]LV>H MۑdO[u0x#g|)jF?N5 SkfAARSaV)q26“Kk4%C*eHxz;uUS MfLiҔ59\qcH#"5*‹CSNT%ȡh]њUܵ@R[ź>4ڙ..P͟?($@H;ƏlRMדq Wn$pf88OܱTae(mI漪E>]4*Lރ_k !ҵ$,a)"( MT%AO_ 90G{,̲) W}-r|7n<4k1[(ZAd5JnG`Jf"paIDgT|qy'F],əp%֝;X_+2aj-m @)NA 8 A{u#9'rrx#o83 yQ8fۉ59b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثw1̬GdVt ֵV#.yai qu}_, RhqtCoN j2a(kSd8 6#DCW!wOy kxB*G}\ֱ~AIB帇;)ߵA1YrC _gLtvc\5 (Zze5V_ceRc5vU4EHnkƍgM%Nnx#"2lT@:ג7?bLlpzxTw eͻTyڿNkiZR:o"E6R[ q VBEHɰUm O$9*\G7[TCQ}9k\4#~7XKWs\e5T5Քf^e sIVV(Xzr-O.8p;bwD, R3#zޝ(EjT?/4収و @W؞7IVvd.҆+ךB?gb*nÿ_ōQm;ZL8P#Iء^G/B?kae[!WOXD^Cdn_U<>8/d&̧b(v!Xz 6 5AȄUT`ĦIj\N($" dڏin~gKR xvYIF"GZ{f#p0r5%oBiHl?*۹KjH?_yT%ece !e{fR5J8?K!^( v &)b ^+%/ԩqe-NQCPXGko'!ef.U_AŞ'ҜKo2A ؟l W 4Νm\-l7 )CcHд VtQ.ط_o/әD5pqr!VaJz}9bmm/8T{n<1]6g+Fw2J[jM2I`A*+`sO[+Dtt>)w˿4ͯBK{ 4 JRDO< iw'ee. n/^cO3:OEqbi0)^5P+wlNΘ.QRoP*2KߧZaqodJ#BM'i]ij S$#J"799z_X#Um7kƽc|UϯR'_iZO|CgASGԜ\%$ ^ D-f8KOҔʶ\kZՄ ke2 Qc`F_|aaz /H<[eF=K3k o㿈4?vpI((U p`88j¤?zX Uno As45;UEN_z=36 JK8wLٱfʤƐJ;`i3IFC\(K0reSp3eQI#=0+ (iVWn"wQr'!(>=xc3\L(cNn᳕-8HX?7J-\xs!_Hƿ)SiZM}ZYq2OӻS#JEuc^e&>rgvdNkUˀjYV)H"=abjt;f8hA&]>lGKeىU>+$(Gkdm:+@I!B +*<:J%Wp܉W ?A䧧Iu["1B,$W㍶'hql7)%$@^]h _?GmCR vs10dD?s~1 c$4 ~<_@Ե - =Uaj iby$C3ytMXꁶ_W$zgsqʕ2ϓ9ŠmkfC'ĞF2((5jz_:դg:zE?^T~jA @bEErPw2%埔oRi'/7 4~!k鷧%6棪=^8.~mȃ7L!g9]QI7nηwX[FT ' T_ד:UV I$a8ڿ-B-ҿݤꑪ {kͮMhY[z[`00Ss(qUMTj 6%Jva"B(M5܏lBP!Svl6,Dײ lSB( K.զ%;n~~XYJ:.*HU-4 X h8 犡57%iP)R;'ĉbøيRkduv۠e[$3M*[Zn We97%jOON*~v~XGj}b5yeVjى-jֆmZK+@"ݿk[A'z)5Dmڼ[ڔˎ;ɨkq\zއcO~x]Uۏ^f+FOil^cTO@S luWqTQH5~_Di4S+Je A5l'"OwY.)F(|z`{P3PnkOs7~*$bB{7~VD@4>^*J>!Gc_ X5gmȥmvSitkd~gi'?ŁhʰlXU5uY"ݹ,TmO8LĮBv'aAgZ}CTҔK }TL=ȵ~<(N=t2ijlܣ5u4F?"~+OlJf}g-IaBl|WqVRJ'\] |C5>;cC G_j|RCLN:E;50BIM>2`tѶ8Ͼ+ Rcpcl GOTqW4.(A wOwkOl)\צ.c%$#Kgcv(s5V,U %X߷8Eت_Wr@ńCсP-t+jz?.%,@W}*SR{(ĤG[_mڋ_'n)/P EJkmuК'*~cN\U۴k$f~hNO+P߉-\3-BH(VQ^5lJ7ѱl+4YEƬjH-\3Y˖{249#Li,#go$Z:>ld["4eً0QZS|xi‘ߤ=$WS(وo4O=JH ,f&ƕǛ M_V$]SӍ(2$1!5YM!H[kb ֽiM=Rov3U_#lj$$!_jA޽w6^䬀ˈ4m:)v\kN݆GQVNM("jr74&`#V|)ZB,Fb,˗ЕX|sBae`ү!fXdZӑ_b7O57gx,6Qmp"aՖIY+o"tĜxIVt$7j﷎XLj9ukbx1lOd;ӑrTT -Ԡ'm蠇m;n&930=l(1DڸYBZm+pHv>'/ m bA`()>Mi˴F×a5=fBj\ʵqFJ$K7n/o#3ߡl1濯, gK<KANg|0.\UUk@*woaI4}2PYeByHB +žq٫X؟N`z&\W1ni좕b]E%T"'윟Ѿe=W^[jKyE??L k곅 qYDw':KvQ*-׋g!oۛvr$N&uD"kD PX\r`S`zՑ?<[Fb?^cɃ94ܤ5363\ ]vlU٩#ecd钫3Ks6'pxdxJ~y$PoL;9ōߚWlv2H'zcL.퉟M"o Mz`HWjW7I*SzbWJ$QAsS#d7(t~ə1KF5!kJIgei$-g}{ ^AJe̸pHy͟cynZ7\J?ĝ>5, |rO,a e{`ıI$}<[u~%ZtR"&0ުRO͟ΓO+jzpVyīK[XWϺ'ow6-1hၡ,g W:.JH 暲eZ)RFh̯YAc%( bo9)b=+hjgKyP2JTX(}8%P:DFbT3̞Sנ3ܐ(GFVN<1RJ=R"`iwFSu`ZnYa"=sIh6Ry #gYBF^g5wh-@Wqҵ%DlW[h,F ##Eҡx,qz.y2,m̺~VN,\ P+<6'A-#$#Ç 唎ɧUN20aL24!,idR*J8&t,kKo5b|,k%\SI[ejY',~%3zAl tR KX_*L<%N^[ih4)Qז"($-/u%N34.jő[ǫ}b3 mn2LJ_o7[4GBɱw H;GǢ}oBM"f7ũaBGG#W-M/ \//~PPo2|[^\_#ck38 v2{av}ůFebAjGcB]ń`nq$rHd;ӶBf)SV#JR^ZT`n꩗] P=ǴCStaRصM34U1T&vq<'PHO/UگHMNak␰6~}Sw”`vRz|JEiTkS^bȩg/UqHYcj¿=BxZuXUh7FQdZ// :|]kSMeb"#nxZĿ n-ArWu^ Ē":P>ߴpŤ& PWhB:`ɉz_Yq ޴*V*0O7Ũ(*GRX%|T=}H/DAhiOm:Րnv'$6YbvcH9@ASC{DjiF<|F4xWP1(cZ zLlpw0n R:BkCJ֥ko_ U:9|$uZAQsN"!VQabwTfHC=Aţ]JGZ%H\.8)`#qKG>x* )p*]<>X"4ˋ: 5b8XOS }r7æ5 ~Sq) TxS-RQP~O0ij৩Cp4=TA;t=JdoAFQzOGvy # ؟ZFm4Æ>9\s'E\wsӾd43z/##L{*lGLnRJOJol7%"qI\TSCZ\w&CtMGd9͖mo +A_64s]n|ckۈGAcLj@t*WM87?nVH1FC08ڕ@?2IHI{N)g^,@= ҹ%Z]MAOldBsD+ Wl)ivݝP ?5!GZ]}11 ®7Fq*X_O?<}*K潏YTƃ¹pn!$/]6JOӑ2+EެJY~ r?~"AEc^}1^T{$(GQD=¢pX]M)$5j[5ZPe}a.Vt=rx

\2wI]vz;YB2%:qZBh0r8وyzv.+UIr#ё9p]$j:{ھ۞qK"=+iOin Z߽`)2ƥO(Cafu9}>ɻaf<H #ȱ$>`2r/сYZ))C.Ɉ${+-:H-rZ9N Q8/\FmXK5/^y^cyx?;AOn?1pBZB4 #UjߗZ:ݨoD!`$ Ҟ;e܅2ONK,+6P-٣ }%p@jh>lDP#tN}2md7r9IHi8bjP42+0hhM,L V\p5,ıa $ϓ`PD$q{vmY?I8Zx^JO}X A&~--zl+O"$y8iUMA-*7:9/(_U?o{Ix(+ɏn`5$+rrU+76ecMݬz~~G,I_ʥKw\?F-G5kvZGڞ¹Nar B\'G ~1b®LUٰ+C=s'B~]gC }!ݙէlcbX֢:m01AF5Q=+]L&:mq#QLm(jbdj"cRSmrT҃owCBF*= iф^h"ٻ#pp&BymL>Vң@VE)$$w0H&~3\t?bǟjd?|F_42jPġ̰٩T <?ɣJ5 LTpxxao<[P9Mͯ'܄}GFm wo@ )ʋ_8"MV6c!nO1ӑԊK:( J^`r|?V+hyGJo_\w|mO 'A4q26-E_s:xLVG6#ĺlsZ}A x:\ٗ 8N2$Vg2)1)668wnv˚ sL.҃Mm;eeSq)F! !m2]q7ZEGH(ӡSvLJ2([ =ǘ.(!aԺiȘ =>a?/鏫Q }9rh5AV{SLдHtL|Ҧ-B[G+ar?Xikg[Ka@< j,W;}>Qsc(NͰUgKvd/p*) MokܥjnhXw*[ _i/א K?fE? pj&i.$PS#*^_ ORUIHH;ˑ#I>ld@])XRS^?g5# 氩b?H u/[X WJ<|2 PY^R5F+yǩV6/2jx2{ u,B5aXH}b)eر%YCNisPEnov|i-/_oΡ%WO 0'X3n,@g9~~C$J&* Ŗ* m+\)<*+M2E |]&%Yan?+!By{Z-^~¥cɴHPNrze];b*Hk[qըO_\k6QՂn'*%?92E46mESɈ0,$ڠwU$cK33o]d--}D*'?OoqU ORyH\ `()5?ہ 9V")Bg_z`W5')`#U₽zB(:aTeR8Fܘ{?h_T;{bUv^^~q^_m ӽG* )',vZ6ѷ__>4gBT(=,Ps4P̷TTVNi#/l ѥL)Lh#J.D:P(Jh{W=^>֟?;x(VhLd9A;UypLƒJwp*]{Ɵ)PHCБE-Ux}l(T˺Z [P1`:V%xy bྎpt{֜k G|(NN GcOR̜q-kcrR.Sjs8@v鏵uAсT:@M+b5z`JiCt)$뷆 D)K喂}.$4*]9P`ҽ6n$tJ.yTLK.&kvPsKS{bp*婡˧*e#U q!@$㤎6v?3b,OSpnR\#PTVSH.zW023X}̬:Fv|n1 |fFNƝq\Puzfw N>yy)(iUѪ* m_lA*eR: boDo?:֭hJe)Lņ{yI$E #VO(+i:O/.-ļ,-<]v&/dZ{M&]^m H/ŵH{/ߏ.Dh\KT3_K< lǺ; ltAR #yOU4l"YOVOI[Vb j~CjE(*NX)LUiހ\rNH쫹ɶ oBrQ߾Rzx%\Hm!!c(+q2_ُZhD\/ ,*Vl3+D% Cۉ!V? ~J &B\#Rm)R>?XmmK?̿.<0y XMߝ^0j}B[A!XIJc'IKTi @j/\΍(|ms5GjcY)<#~>.XR)4ޕ͐[gvx?UxmqPOEƹT-%h c\FsdiCSZxFح0 Tf(MQO0#21V$VG2)!(-{Qcv䀕1 sIDBhp))M-ڸ\HL`8Td 0TbP+m3`3i#$n{NUbMOBK;R2/བ_OP/qd!Aܡ49)Y8+J=no=SLp`MQGGN=sNzƷSA/+T=P֮|T&=x'tpk槶]V -ґ7I#W_>mf[KF+^Nͷ_)#mj !Υx!@`~kf)kN@r?Ce㝊|}yv(/4ۂЇ!vHѿ$cbq1E(3 ^d@E\~`]۵uB@SDBv$c_~+%꾟쏞Jhk%=i!Eծ#ij*i~psXSL<]橠.sGfX@($VLsT u\^zzZQn,hX9n%4Ua2ƬS[?i[jבJTɚU3b⧣q vvl KQ Tkp? hN(M<)7A_ߖ5& KAWتn䘤7(ȏ6)2EiO8K 䉛DJѕOW˂~ ;Wdv:ܓw0x&8AshB^ $ƙ5 0*te% +4FZ`iJ mNڔ g{gA^]1 d3y_|NAR៘fAZTǿ,]- O>XrJ9 (]ѐ9VHG,,J>c v݅{k Z|;o| qX>. ov1Jn珕~U4mO*v>އۦ$İ=*Q~Xbrt.j9)O(+@2TjRKPHnFSlZ(S&O\ R˙(H+^RTn*N)KWj0lH _R:>Fp;}TYE7_^ InzaLmUY* k 1^J 6VKcjȮGMOz~l%V(jKXCC^Y1bQP1E$2}rLlXȻVap/ 9ە*G *M#Gaܿyƹ1@S߯jxq# )^+wGDMԋpA4#|m1WBB*zq4Y@U*Eq L oVWN". zw_[, a Qg^NV.Q-&sNoE"+R>lEɽKlx -QӫL WQ'(D,IOn; RjvTo"P eO`InH߮KrXU$Nj.iڸq9Tٮ*|<} D˒|j+6f>#KqF _zcӮE2J&mPMq[1*(s_”&ENہ&0rTYe2S#‚_RwkD-ʯ~+^ƏCu54:bB^9".rQ ka꞊-ȷC^]eʔ .ombpSǮSd#`+"%+ѵ M U,m"Za‹ 31b LSBKM*$>{]!m]nOdrsj~a' WD* ؎đ| Yk٢Q_u&p;_J}Nրc֍IFNuPD* dcqO(2`kHB4lf$Cpf2:Q>#pWԋJ_l',x2??jO)>X̏[pv9vT2񠅨7f5u +jZot}:ʹ:+J VZ\]#Mm\[PבuoHmSHMEuY⍞!K,j},9{y.Mnl2rJ٬ .955Km6].k=Jm^x~Vh?4nGS^NO9 fnʿԆa_,iɩiڊ[K~$~<}, DRK1OtS?9mqNW|G"/3bu\P: 96cAyDMȋB(Y |XpړEt-* tuه=Lj}|^j?2;;u;yx|<&mG$_ŅqD(\!%J_Z6fOxe$lXmSGHe&Y#,:dedDб+aDcTf=-vX97ۮTidcZ"ݏL -Y& +BW .,l5Ycl(co_ՂUf>HTlf`T{bzf\RPp_8(W&)QJNBc*ʉHM-ʉJe}J5:mt k$'*׏DǽA#5ВwH>)bk0VX{`oGR ǰ 7J$M9뿩EC|" '?F/]Nn3'>,"[rKu/1]5^;&)l Ly3q!3\$vV50=QX8n5 U3 Q`[Qd~ǭTc) mvwK+Fl UDeel0|, ̍IM0 9*%!4ڭݕkL$D%;G_*=%4fPEDJo;]^$nnd2@]37y,rdjtea=R D}CJZHEzq\DZG$o^Pe3E0]H_0V?U'>m(ލ a?Źbwvh#q('d^-yV9m ~X#^/UdlA+6pd@,9;ׯXR0єP|"s5-KX̯0rяp-R^ Pxi%bj C9U3/!qɈk2}7qi]Tf>yts0-yHH v?NLq.;vm{ Z@G VolJ  Hc̲) 9h]~+gP+񓿷lRYAeDjƝp\6-N]wCl6}_gyE mnOYuGAǘ* ڔ=Ob_YOH3ː,5?:5~ ЍWm͊h<>Sp;X Bz.@!4UjpNXݧ GՃj;N%x[q# 5b~*(n.EʅSUo ~5TOMzt\iX>P7%^h[1aO_$&}1B)NG] Ń~ď?8_>)d762ؐ |~$IW*( JeEp ũ_Ҹ7u=ʎ'4Wu,O US7E+/cihvbs]\δ--OXAw 2̼d=iVIYrf$c$[m?&+abYНKF ?f5|038栞ݎ*F95\? tDJu|A_T@ W<W| N5n*&]qJ`Ȁ=7\ KnKA=GтC۶*]L$9t$2낣@qTr*H닢B[s-<(qutONv< 튡b: P0SA&@h{\Ul W-G*tKw8;w# Q`!"k`qTUE1&Ӗ&SQb\3 Q"u„}=n>yZzrCq_r'cdV uu; bj~$ JQRZ{fV 2j 74[6HBe~<^#/ #ZUD;xܐ^ٛO<1EF)8tGlbUmY׉fQCSWL-a$A&90itU#)BzVJ$@Y6$ҭN^"Ѵ":&X*Kƕ͕B1ǥ)2GSò#| T,@""mw酉GDŽ0~N4bBefMu4n:`(Ego]E[m%F bıFum׶mWB܍J[3-q(!Rb%kRGN .:jW];A*Z9>ԓE~y][ Ld2)*v+ҟn+ƽwΐm;FALiZmZ^)дM:y1Wh;1$ҹO"bra8J+͆Vq9>BCvd"6@Yw-Ѝl[;yWxm"oc훌`|0tV>!F+vUjyKBUH3Bkx.wth`') ,g䭤3XXAa4wPJQ$F_Ti˭дقѵ9onSԬ۔(GՅVʮ*ثb͊ tce~5~#C,lG>Xq7_>8qfzfRBXIꒋPִ8+Bj RzSⒼ1@|VMFQxӶe(]^⪠#o╥;aͫj6pTtpTP|?ىFԆk6SNɷ347+}O#3'MŴp<&U>OO% 7ytNGr\mf?gѴۛ;ut(fm_C.x0_U5i`H[˾(ySO4|\rmsh;+^=@gexS#XZeBz8H8SqX)5◉;Çbw \}5tvKLddE ơ s_?ÖQ3O94R_1i7-$LfsW>kGn[I#Bn$]aȐ|?’-byBmR[mV+[BF³#/ٱ JBz8&GtĎ/!"iv]cPUSfV^eԢ$19|=hl'@BK nǟ@єwVNX)~HTk. ?JS0iiM0Ӟ9WIJctȮ)NHWjoY wo].~J~/Q!͂gж4n:q'# PLm>O/ycGWҰ̵I ||ca-i8FrxKCn(ǚxt/3jm{=^+V?M 5vkp[HqF(Wo/G$RO5YkwytD7%O6<)@)N䥞ȒiZߩF1bwBIO.v ]&p,,":}8[IN#\Ԋ[K4k!V?I5QƄCd3"I˶e7}!ZFL|8f9 R9Te$$&V * Be`IH;N#6A4~"$~a'=WMeKsFݣdeۻ;H$ŞG׊cz J:n]w$0kWHb圎,]æ}-+˙Jnܣ|?qfĬJ4l9WmӏGf@~|b>88i$G!Ǣ_]G/(n*FGf+&wFS3 "CF&,TmuӍ "_ʚf0$?h_5OS߾7կa!QvtG27>"CZ!FU h*iQݪq- qVՋ܅/Q$2fR6X (= H?G~6/v8"Rr a>]qZ|#_~GOB6Ҷ`dcM֤%.OϢoWĸ ޕ)MP}$m~ބ)ZWO/B{o%@2V n Pw$ү$U]ЍѿrcկzP/HqVjzz#*&Bט?,6-$@{ȫUYOa0 ,v$.#D/BP i Pьe«ֵ$  .AMώf^Gn#c]U*M?:Ou/V ξ#+!Ŀ6V*Eb*+l.Q.I#0E,{v}6Da")F9dPT(^\ OP$;NkL'D8WFXnM9Bd AT#z;yHEz劷AZ\;۶*6dbO㊭AG\T V6{SǦ*U+]~ C{V`bwb7(@*S7n_#a(6S6H܊tJo`VpdKC Eܡƴ>:%銤7nMI;*4ߩEl Nyt)*9e xǁwЁby\8T'(= ڮ* .96k PG'6,)Zt(zΜۉvmrob.:n+*uoC-YB_՗܌iS:v4 H@(hryv)JNiZw/2I.:QC_\HChGDPj@ڃrdc+H\;hxs1Ƀޫ ݣH~죶\䌵_Xqn*;͈Z<%F=6\S jt,=9jn1(gN-¥ í Pbd8-)R\Z@5Q5qUT~ e`U(Grbr.,(h47J:0b1IYk;23q N4 J6*ݨZq'm>pkz5jt>*;#IpJV^#rlLi>7b"yz@ۍ:XPQvӑ,f\*܊H˧4)P9+ݳa*(uRM;(2,i @`v@OQZ`1=M%і.%xI^ oCXa(I%TeM6E| Jc!H'G|[=N؃ֻu9Yi( ~>%QhsTRT jq;> l'B{S|d9Tl2òVXi+E@5'9+ZSdw\1{f0)d5s| lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثBjN4WҞGAk_`55<2)ߜNZbQuI$nweoNS%P rTm2p[9=5ߠƅYl܉t5ȨS)RZ₶BVӘBӝE|lp޿FM MԞ؂`AT(Į)R?qk@ 9N'N`oufO.r@WopRfnHMK1PY.l(.AjsyD ĵ͖?x|AUc% 9RL2UB3^E{ H2 Œ6;փ\0ô-Xת;K25nAezM|]2wxSMLEm_R'U1Vޠ$_2&ft[Qe$A*FdXCC_[=_G@ -BilI2zR`2E1LO|\sk9H ?dwPl+y8֝9LGB֟/| N1Vuov267zA[(8U~c]uZMnHc^-/̀:BțµK)(k^.lRS8+BG;^ 55+Dx2^i(FH*ԱVq (#霛Qzw{0)#󳉿* ͊6vlUX?H4˱42m3cJNw,BU|ٝgcbCl]6){PЌBGcrrIDF:x$RT٘ҧr4F!(LZ& RR=c=E+;Ww nXueYD" MPz ;1bwCϕ(۹FFYƀ //#,u.?gdFiT15ڟ 20jo[=@xF@CV ?7 q >Kg#>ZkS gn"Ѐե~ZZ=zqoS^Li[i0f튠 Y4L -4LWDܾcexxɈ݊y`$5 8ޟoRv.[e3ԂYG7cމ8=Eht=1HS'Ӝ[+Wx ǩM@Ĵsb[,͊.ٕ`NfCYc:`MPWU\IstS;s_lB97 U5x+#甞lT8 w0׍@>27ظ߯(L67`Mゅb7lJ1=Y}TEvۢʻŢXEGJ'l./+w?xoCYTj}~8ZX\%OqnuRP78DPx @PF Ҵ(Ȥ )<ʾ]kLFT~#y6 FfYXѢ4Ɵk#Ž18osyPG6&ic)T&ӯZskw.x0YYP#7Y|+["" Ai]k&׃5LaL(?3 n UX"U}78nM$ K|]➒#BWn!ܟrSCkja5 M[ BяݖpcR]cOԵediP)Qh~kNh\~YVufGׯyJ-r9UBuz~#SzSY&p-AܚS˺fr6*:ڢD9ֻ٨{{wcawؓQRb5-F-è۞W-?[?#71 gn@/'n>)?(?ಆWfAnpz םc 4ZrV3EU8v|fPf"A?1%X|U#mjxq>aN#O*!2Ķ}Fz !O`2)!vw>WgN hhiU$ U!Vف -B>ܫ#*G#bPqʃkOa,#oQQR/=u MkXcfyr~#V o[`X_4<`DV ې :Vx18֥$_~.9֝"#ZzrrA^-֔,##q@xZ+olUKͶJĐ N朩_ wnj= S=231Z q?JakF<~XPEI)'Ӡn>fUZjtc,.~'T4هIzVA6w26G #Fm1zaBqax%2Fӡ(F;t+Le@GK ¿0-{ cֽGvI]Ǎ~G,2!,:,vv^Q7![,I~/r3X $ZmW_V72٨Zqa-VҞIo Cmre#z\,!CB„zNZ4uU-A"N5m[,t*+*{?d$*v>$RU  T&qȁF)5;n )\} zX"!>8 ;u8( BGZxJ ֕K/f,x֕o~at 7U"f B>8&TSVbM'HWqr q+P2*>1M1W-V1@r;848\UL xdU8TYT;aA(B&ONQȪrfPP:xS$3qEQ }++>)hԞAj}In} w_گebu H15n9C38$vbS;Y}vy({fJ{;c[k$?GC;q훎$"ʡ-U^)C+JDu; :ALF$!mKIF,h]{cV‘tHcP9߯0+'v$0Y*+Hjq6RMzBaH4~lI+! Y@cX{d*iwlN@)lEX Wb5d&IQc!-Ű*P@{ЌbdЍ.8>Jb| +P)޵b6fĥaNIv87Ĥ Yۍw=3ߛg?*ҝ6Cgg׻K| hւ ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث~ԔSd!: >?pLO[4? 5AN[$æV,*L'"|j)[Yjz틱c'G%i)J\Iv>57e[<(,Vtv(Q;y~îS^M:ykcw#O4}؉0йQ!C[m!1ub)nӴޟV/eERtbobUM5g?ih %WU5R@=kHGMuDݵ+;11a$1Dت eZ9]lpeĥsKnvְDTUA\EҧHE9mҡ8T@mh0 1 ZJ 0 Yvjv=*\O As W&E[Fȕru~U*r5H' (SVO S1@T|vO`֋NUeAnR{5ۥf0% p^_ŎrRf+ Jr  awk)ƝDLY oMjab@`#*9P~)[.?#_]h5k9N_Wf[lC;ES,2LW}XGoM tm.C Us`3Y(zOdTGvjWf]&ltɮh68|'ޟ,JaqeE<3;RW Ί`Zbl@ܚadE.7#!%6|2 0F16~E*ǁʀ}jVYq?E즟\(/X1oHP8J"'Y; &Dc*̬ u.M+1YRڡC%-BiAZ5}1qjkjF~y~pVOqB8O4\c[q$iuItkdUԨ;|?C}> ])dA$;mn"ʁw 4jC1e|՗41FfaXH8 Y((ު ++A(K<XTk-ܴO4pj2JLٜΊa@s2<A\Ԏ7S6)32f9H[LʻdK$ݰ#(m:m&f$e`Ԩ|ry!5YF=OE^7NT$?k lobXJf+Gr2+qr4ky(]ݗ>/.c/˥KoHZمdhϾ, ap h:V:5hX/;.I@SBݘn)27L2IK:xͳOcoX5X£_/}z)^6|i/iӡ=ΘA{4-)}:7ĒT$NmlYڌi3VB j8< Z҉ ?  m.j "$O]Ux&y> dP3nz)Q~>*n\LVPVE: +|6c̡r*?|[_kGraZrݫڻ։sh܃lMnڰQ/K&#iM- >w߽A![{ᇗoP>>>scMbmƜO1%9bBݐ.b/ݛ"׋=A%? /V)NĀ=c ,,@5ن&ʿA„\iDXwIڸ{aYTj:w6K Q6vn&^wyd:wV"{AQ]UomR,u# :č Ǫ3"1V+5{5c(TMIڟYǸH4ț(@r\Fiѡb\-O뚹_s+C$ bI#|9y tr Y1J~f$mjc˒Dj F;ᘚdD,xoQ`K*Jש$ƹ]R^[V%ʃ{,F,xRHŽN;쉳"XrIe4ۧZѹz͒BԪV6d)-B;S_maBlH/O׀#~P>B:xӮ7#ɊM7)AZ)~U)E& u8yJ ը>\=`S%"NĎYTƐiB9zISsS Ʊ\&S;[uf@6$b.NW#Jsא"e{mQ<27#scKiث̚{ujS|iKJV@ ӿӌ`kSmV /QlLLUPb^4u V"c%Z֕Uu1Gڮ|@Cx - 4m-cA#d}ץ3v~`,Q۵!i+жUt?ߘ/vLNq?]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثfi&J*sMqޱ(.SIXUi<ؿH ܭOсbSK ,ؑN&HxCn6,;d//MMO0l=%=;wȆ>K AbsX ZpxTctJm er\Pcӧ (>J2PaoptIW8`TjnMr8MF*9 nGν>˥p4(w#f"ak?q)ũ۵M<|i"U{u+M_iL0><$jLVFnA6߆ć n#|=X0a d~,oKx4C P (¥^.R-mhMc5OHt|!Y?8Xb͊_tɦw.pN噱BSS^ὉFgĤZՠ'\8( m(͒dWUY3]B) eTQګ)݊6F^zxSITޝb1Z5¤ls4,oRՓJP@N~$ī.ƞxf_IAYm*E~s|y~Ǥ^>/ɓ6M06 i Iҁl5-lV#`~+e"\2T #ԢҵxcY'bSȪ.XF-eZ;Eml:U\л<G'HŚI[ϩI!RɜFT[|oc-`I.89I9cFYAQLP 6TNq]M 4 oMmc Z||P 6d'ƷS̗k+i𳵿I\~.tKw#`YlRTn槼H(r#!K y'n-@YFFKkZR^A1$r!:qs>!TPJOash/\ƿ/^hlS钻#6B~!RSgzT j,cTڸ8aJH AUYIrI2%(M1=*%R"Y"=LJVZ oB੧ O5)E銨5+ 7*EM)qBAp _$R4;-Lۀq&,ހQѩ?>4߾6Rƽ1b^J[KéqTV}BeJ7BjZ͞M =F --d." &-VH ENLx]i7$~П 1(1!&|j5ܥUR\A&X&Ϲ 7rARYT0V 璔BȜ$CΚ]I$fTիnRN|&LQuhu8VؒSHS\;4Lʖ o*7hڜib锬P605>6 ni@+,@(4$4*NHª^H*nG߿݊vр iރ?qǝ슟~b:tUhd V杈HuWZ k^h9 .H#[f~`wjj _F*T#N!==Tuͳ/z}-( H(J61΁&`ӥ}(mϙL 1FhWv'S0BœH&E]Sn",kmQNtv^MIb`Pnj0ZMw3#pOJE~skkd?bE:v*My3oٺ{q_OePa] V7[ٳ1 (>o̿ji"7{w{iq2 B*cĥHu8+w+-K=_RoUv;Jhw?&:E$1qPh7=~#%KOȔ7تK=VkNكė.HI_b3kRfrDwolON8ܳTZ.-(7oFdRnK eQl է÷?q=D3RSIz __"bO=2ý2Fޤwa$`PM PW?dJVj;ׯ*Rksme4O*>QZċmSl|0+ ;DSR ~+dU§z|_ǢzР1POa^ aUz ;VoKЩ|1 4dH BҞء\Q QJRtƄ qUܨ{m,dnIY@(!KQj}9!4 ΄1; yT<(4!h#E@Zu8pHVEP~$9Yg="CG#GٲLQ*3?UX8rbB |?sa\,Ch*ƝXZ w$B74kmL(WWKeH$"1SsS*$^U5$18X!gq/^YDbD96A)CrB&F2?vk_ה}]sbkM"%ꠂ@""(tw'HRO]N|0F[?Q B&2TпUCW=Z-|z}$nT/Jb\^aiR$1E64퐓W'`T(=]Jo u`|FȁVݺMN2'׃u ekCֵNBWH v;b.@,U@Ğ-ZlcUi n#cL; I0EEjA#E 4A֕ˮG?00ldnn>90EI_qF׳:Z?S)Vy>`H`?s])q}gOGL+܋lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثVi s/Tou $jk_Y|Tjk}ՠ ,;AcAH2)0׿&-$ԅB5SiĆ!+8[f0 VaRk]<鄰R+_?VQ,dq_9Lk Ju19m*SToz/Ÿ<H90#jVY5|%<*Ě߽,hlCiP I>IҠ ?s'iʺ>()߯K g!_CHr;~cf447_2tg~&:sq͕aaBWLV%<@_\3VUu1E}FȞ4qFN~&f+1p Uf @4_~>؄&]1jލƞIaF'F/(mfZHlV\;Rt hk#=9'(=$1?VG$ S̳1-x<{T;+Pvn &Ib v+H><&Ԯ-4+{I,v[Ҟ9哑rAnk5ڿ Lb8Qjk=[FX("TUg4?\ѕUI߯LFO.Iט|E+.cB+ Zn/K⭷Pl)  q_7l 5yP|$l}łi&~z֢>9L`*c}>): LS՘ťOu+:HQ^)c#^u@1p)VoX1𠨏.]~RY35 27˿_qu(8w<9 ?/d ǠkWM(!LBxHq^88"7(Tk=7<_R:uq=eh֌ND.[cjJ0>"jim[/޾?5v2K%7J  R޴3h7Qo5w"sUg_u15Ι,1'@'nLA.*Ynirm͔̪Ƅ24@O\e륍i; Ed9J ƽ eo [C++JXy}7$KNJr_ "ud4e "K3K G *~G k?#LI^F><^aTy>/aQOG//k2귊#'UQPrS!.(sZE\#3I񈧎pxHxۚ|QH|_>[!gZ _#3?(YsQu#֦k~^b=?Yz0z,~u̾CvӶI鹣V~*/4R ln@ǚЁ9U+_X:|)Vi׈LY4X%hmVJVJ#~&pY8=f$H@4C=τ},z$IFPچh^J:/qE6 LYS]QS\ĒB") QǨq4 |HA :S~9jbLَOOCӔRn#2OJl6)BOKLa% ՉnsmLZiSlLWj=|1f!JdZiFVT&AIQѶ %0=ڹ%n~*`jIESnH/#H w&&Մ7EϬq;Eh0+E?Yw>LC8*d܅MA,בH\Tu}])7&.4l._IeFjUגњ殺^ufrkdDO1kzM2E "W`},c-"FEVTU4V9^m48嵄޵rn-6d+^rqU4,&Dw0<|hH/̺n.`O fv?H%HHՐ#ۢlmkmi W$iWri㇕<Ś[ZC{vFKxQ9 Sȿo r^)Ox '߉'v)DP[}D<ʽiAƿ%vZAّyM&H dP+O6IE6>7c2s[LrL`T]< v/ 4ʼn2r|^{-֔߮\ K5CF8U?o\,o(;vr4IŘyAiM$?X@rbԝ\z\zHvP)ޘ:Sp%)~ 91,^+"oC_LU.8֪Sp(J 8bf KϧU8nG 6p+e)XG9^DUX[Z)Evg@ {`T/TRC~v@8U: ~ #Ɵ>*; [VXCK PUh$1|@u?1Tr l`?KJxUA F18^C,Hɸԕې ,7R oSbUrܫ7*-?@~ u1ҜEi_vJ(f=.Ԛ4ԛԭ<FPHi”0b~5;|_KFRhVm=XmQRj6&,U`81Uڵ78s*0 F oTm:E"I7 Xm^3GHa%m^ W4<g ͹xF3 *Hc<̿8e|DhRwz(FTTWY ZHz}SrT镉I2rʀ+ TYZd =x9Gl $QD@RXµvqoL]"&5n!W~.9D'  s(P],P},FlE%)z|2\!Q3 v;lH"HjlBI}|,d0YO7Rptq>Y&PS\i549^'z֛m;1*B>.*\Nݱ$Mr$XW0!d+"مw&hroLLe@SvwcOTn^BHƛ |y+/ܴI_lҴh!dQ,Jz *ȹKb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثMWgQ^q:;I6Ca{Hݤs`v |ߒfYᅙѤzu0[ `ÒT hvFƒ\Wn ٲ : ">s)0nP:!_qmF)'Ofx#,@߄cơھ4ێ[;C KSa7neݢJJR(P2\Թ3Ob֒eG" r'pC(Av^\[dQC%Y67FX]+߶ceקyV!8e⿷ )hZ9uRirp5.! V/yYѿG\ARJXF~Sj7/#)ɣ۪GԪɚ !) y%uc }UGiJ& ԗQ t q&I'ryjo-ͧNҵ ˞`S8?-s#^3*rFm#`&Ʊqc4:6 O7+*/74ʶ⸕jx+^-J؏\wZ(H,e^kao" r5 ~U2 yי'S~Pb"P̟ 76U⩁-"X*Hv=[l;=RqOw:\I4PJ6g*(ۅoXGNG$!C MmDO/\ߙ$EhG9,,a;ZOc`Q, -Wm,dS@FRG@RR7 9f"|bYDۯ&2 vqMB+w# U(7xF|LܐX5[vA#PܞJVgZ9'bC׾X6BA!?-ajT%/YlfWeb͊+v ӏ'j&l_uМhѺ7l K $m$r']mb17)g_Uhb\9 U>ls t 08*B8o&0XvōPm10 #ՅiҘmL9T`[=O\"QnQM@K+cLH($ DлG SBb2"V-T".mߜs(d`>?lhjJ%\iBq@jhӶXK7ZT9ef>,"iA? |+JlwXJv7p)Y" VSŇ6d jО#T)$h$|y(;eO ILԟqt(#ߋִ(Cl(Ѱ-z;o `: _ tm0^_b~m'8?#hJ$ZE`o}>%iھn^靾yI|JEsUc lh*e)EHA'A^|iN\y7#9&RWhZsl?FT?^^ҧ~ kE(P9sZ ̑O-6AI^^I2 o'}ҙO2ҜPO;ep_>4 [AeKFDp8QĨ'?d W$PNԳz9 %i < )A7 ~7J8Deħ\mN0y~ǀ$Q8ʼ~6哒L=@zoH똳J*VST~_,ߚ1{X~9S`9x7d3HYig6>%k8}5 xe1Jf,\ 0JilpYdA$A)8ȕDbTQ5 p!ZE2hfI|sG$&jvړA*2qo*peeٛQpY h\D Ewh#tHK3V(Ie>vEjG\p8;3HW)gХed*hhdm2ySPmOEH^UeISG>,{jMrn%h>rR–E--t+V@4Qۗ u欗,VC})S|qZӽrP] /? 7@*h>C"1ԩE~[^h8> h_<Ɉ=$H@WǦFU$um(9%m۟\u@=VnEJ/ؼ1VFw8 X*iGlBx}D==B2C) Z@(I\ 2[O;oAo,U1 ©eؒ>g\uZXC?N*YC,oe_[DK##L xEoʈd21>VHkbQZۯv5{mdAV[vఢEFr_ҘUiFTrc }8Wܿ3aEG%wa\,SB$ţ$zO{{U|^l& R5 #5l&PIB5†O c,5#uk e !PB.##pA8'OzwtĨCjr ҽkL2qYhAh{ox#7lXR+b9ZE5Uڣm`uiFNO|!4#:F~#jVH,jϹ^9J@BOmY%t0U[_fSbw$"H$k#1 ܃^`E640,`V!BIwҿ+*cZh]L"_f<xGu6NٱnKFj +׶QwE#EUhX59J(C}0"+`h+(KuDYJ+M>%o|UwhO_(suUҠPߘjepz2ŔFe @ 䄑aJab`0-@8v4/M!% iL"2%hZbANvQ(zqcPGď}$QkN@ӑl|})Q+AI\d"X}$ u?q9*2Ƽ|8$7A bled0D߸GnBTCPjt "2wĜ.cӆ3l5 j1{'q+Sifvj3z&.O;;K+v5$'0WDESaٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثE]3@j!V蝂$j"(ro|+n 2;qT+ ,3o$QIcHޢ<oi܊ 76ƕwLrݑ!!d;vЗYvKbu;#!d1WH1MnZȖ0x9/6V~?lnGuC${V,wZ?ՖIEۻF?1./ "W~_v("BlVDFiAziZq[eTP9@D qKmgss+G8Y}" ZN_iQ2$~17#x-:lـ+:d^֠G2V%X㏓حVe kP~6!I.}ޥ.C^ W_;/ŋjޔX+']@+¿i Ni"M6O\D#gLSդ^wB SIVj'-0* b558>CMxK[GPџܐPTXݥ'.BVX̝HmwPSO̹oMfk:pL|\/&ޟyOI0^J(iA3/'7IĵIyol I,{w|Muo!yu@eCGzNplK{Yb1Ek^cz-p'ڊqɋ~*zV^-k NiQG2Xbi '8q?vc ?fxql>Q_~:`BޣBS pGZo Yol\L9§zScq))=3L $rr\{'Z g>ͷ-<2<}L蟖VKQ$|)lLI8l;Q-FJ4LK:e@ڹ&)TFf1dL2&vM5H2 BNxdR6#"Rt#(އ|Qn bl1bT]뿆)b kAţ$ME‹Rz TCo1"vW>8_ 4R-lXZ'QOABG"%Ƕ-gd R"P#Zoq8=#z },Wb3~&N_,z"MSܲŹZbW}ô,:xЊrx#% A.#)^)P{~,y,hׯO8PWN4zփ?k}C,Vԡ-a.@Z|CoZhq;:bߗ:vhXfGw࿵Y\d ܁ǎI^o ?}k[m@\,S%-ZsہZ dQwHҡA!1M=ғGw^ۧKj8/֟/?l(f:o <j8ثnܓjT}%'#G"d-hH佫erÁ! \aM`|FY>{Vk'+_OKíb$q-I`9 Yn8Oxk (%gPK kM FT#n=n/Fiv&a yWӨ jkW?Aٷ#aUZ`jH̪Ae|GH}^b Q+TwŐ 4aQJ"w?ǀ~a'{1T,X& Z:LRI$cRHpG#Ӧ ͱ;bH@|_> RKX2GE܊Pw/!dUsW uYnTU|\$#?~Gk !FKp~>cUm\cj' ]bi) B)T\@,bwL24JJnQlK>gEXI֣ȡP!4 w>aJ)FZT׉u_%OThoNLL $LMn@)E!5ڞ`S^0{e(P 5=z.8~(?.>ng>.!b*_D̂G&҃ 4@]IpA+aD(3VFY#nl;,Mn<>"w!ZFUf\`{Rk["ot=շҌGrz5c㓏WɌ}´$r}֘FG:_xWYO?pGU?ٽduc}5$9yG'V"^-"@j1 k̼@-E=z*ks3|3(C2#e*ֲjW Zޛ*EhK("ᕆ7B=P Snjzs_,bw@^T|>;!!5f4a^'7C9o-kz_*zƱЇ-Be`B5U#㷇mIա}ʽr*&hz`z{r=~lBԪG^ڠOLEBL%=L R$)[N{Z]xǎ3s׮W}SEh)0zNCXi!|LBiCLLo+ܰ)>LǠcaQ|;%`lcu$Pvu(('qDg#Z{u=CW!.lUc*kȇsդ\ *; CTo+r=(]GO4?!sEU ^L7eY@_:n FgרIblUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث{#\5eF J[|3ԌNTr kVHeIa,+q jT0m|@\Ucaסptv8p-ڵ*itM{6n'쓸?r6違-*XA")kNDkQ{f O +kIM@_YZXݭžwv2)R;צk(Pz0&/p(E|GpRv^@xG].|tԕB*6#D$crrgV/6iyiZ|S\9#C .nf'fFΕ%n gӦ,* J?ѿ$|jC@?ʹUHu-&J_OVV=ͥpII^C~,\ARK 1ZHļoY8Ӌ ՠ;|9d$I1A)& V؄bd ?O/8Q,LAuڜF:TJ@y`hq$wmG<,~ mrj6 dEQLӋ,ok*#FGP9VkMp? Oz"XdtY2KAŘIp ,ldӷR 'P7f)w[!/cK{nGP P~M3-$2"0# 4Y r_k3vVEfG 'w>h ~!2 Lf;-.4f!mW1WV\q59IU좦m8;~r\14q +R&^l^/!vr9h(>C\Ȕ8bOF,iYY+2bjs >M2Vʔx ,vt;Ay)^KDS8QN'4G'eqCyU]qWeWvC x}Lx8 4>9$?*% z0ͮ%ɉ0"X8d{fsj ~R7/sg4mnՅkj2W-*16p6Q(b7?7q#:ӌTv=rM+G\6_)rM`kץ2֏WZ;4 {Caay & S*(;߮8JD$ ɀEhYYf R&\;iO Dn!YG1<(bݛ9rYIq"c_%ItiK!JG!S$ϵ+]>5EG- P,I=ЍcE +_EEu!J&f`P [X.R:ӯ6}>4v4Q<ч?Jc^5 MHKI9q(Ykz}ҠGQeli&DiRzoOJ 3q )nyĬh` N(DklPWĸ(@SRE{7nҡYkCS 6&f,D ?1(*z56PyTu)>-i '۾)B^OPd`c7vR6Ok: -PQT8DB(;$GB:Sk 8+_#/ɲB5)ӷ*[uZC~Me'M\ڴT_FU5 $+m>XUkIG!y;97fvŅ II:P )u(?! 0G^|T-Ӭ}=:x]REؕTK|O< $rZ)4ֹg,YJkC-;(Be^ohr@ފzYe!Z&nj?fxpLg͞aM%F$\E*<%Ea oS.4Vk G%z*OpV_&U.k , Ԏ*RKH֟G=1B(E~_r^dsUYX"XlϦvVP+_,Ggr»bf(ǀR%vߊW}@6V}G=H#V nPGLRBhp*d!5hjGSPauATe =l<*i!փiz1SLUR=2*Nc S\H**N*[?7?~Aa+nh0%%֭*Xi'`%zL$p !z|"&BC"ң/;ŏ_58:;d_j~) <Dx;һc)$z(C1nRN_XK׾g؂zbB9+* Q֌j1V.A/kcWn"biBX؁Qq#9hI;/>*ȭ ݈Q%8ASC S: vݎ24Y"%. y +5%r)ō =0nٰۛ+]r1ޤq YG\YiQsrX |s|ĞLkմ J:Tos݁ n"}1SN[18p'[i}b a{"e#t#mW|;1(GPv; FlAV}5%\3!TO}bbRNTl.n0޴ِC( U 7brSFྐP*?mXy0L$CY@F'^i!WN F E)Wo`Uw j{9 ģ4xS6WLP1?O{#D^*;echEȄRz<<+ 2b)+WAIuڔ^?͚4YB ׸迫(XB>^f"6gL24Y$nHB&¦s`CcJr//mקqҞ =(:;n|KHKX  Lzbydr1% l<æ౹v0&.ig-py7R?HDYPz型J#QTI?Ȩfoh$VZV!+! u[ #1_7-~5 eSmq<)ʑU&4'?\oE$a}5r=Q)ϵx~] 7cT9e1LkJZ\1':%Zqo3Ii1 Tw rYWL!:oƌ|nVqi[ innQ@>w;29ZuF-42qj31 cTle6yh1 O/є.%t-SQӵ8]nXZ]dI"?q”^lvrYt}^9%:za$)tW)փ))1qn:TzԻ-$~y#_6xm6/Gq0 jGjаZ7?kodOH'`2B@ @bHD'Tfb&7rzˁgd9 CǦ990RQAQAC_(dm !ԂiE<ԏ5B[(8µk3gNf#=$>%h?᳝пMS1("Y}XR0"FV*ثAӅhx ZOAi"tmJ{ 1Mrd"UB|3Uz}91mJfO$Xg"~97pצlǭ@Ts,ǿ kF.*e[o'r2b( 3뚎囻 gu2D~x·0 t#~0d?)6<خqCʨ2_OƟJy^_XV%GbH=v̜cS!rw]7H,1pf1/*J/s~;<֥{fMcOAAϡCsSP)E%76MFݐ)ƒMCMV5m0o+k,zj9-p,e4R`:`Ir 5Fp'}\cww͕̒G &uPUrsXm2Gh 0nG%;~>+#ڟxFi e~;W}W)ޙXIo2n4R^-d@&T1H+1#FWd>S~%|qc\py(6$Koe/RB:;(eWoq04F"D1KQGYU%G$-L$aN_L;R|"?97?كxyKet;HAc^9}\gGe Z+O)4B]mL>Ѡ^_g?%(|2yDm%Ԏ;/Ëo@ k̨i"2j#h/NBXŐy9FՓ\VWÔ_})VzHi:16Z 9w@֤IVmϵ\u"v.*튤Z"$?bS,@)b.!AK怩!, ;s,DR04Vڿ c׬!1CUnu0f~P~Yhɣɔ)ӘZśev*z,Q5 n)Dҟ8 ʮU4S$ͣse$uS_eȡ-Ƭh .^g%Ć)LGznnTM]Z x$]F,ݫ_UXbyc 4?-:ֿ1.Ӏ߱ZqkejA_GBiS6+Ɋtj ѝԵ~#L`@uJU.}*$H)Cļ'hYTB~/2KԁR"GŠ+7]~?vۀ SЃ A:zR߷S`Ƞ,7AJ..qI$sBkTqVОNA5㊤8*ѹJ x'jhLpȩi 7XޭHE/E;͑KOdVzQI E?Xz:vaB;kMC^9!ѭJ.%OO~K fnCY-ԯ'Uv{oNZ|JQ5/Oo(*hkFI 4rLf9)m,t#m&=U_V0B. 5IM"!N.O-Az1H!e5Lȝ_P($n§䘽AhEAolZB(w4Ld?1 TGjI"ONb{C2ЮKz5[sEn`}tal j=ZbNUfꦁ:{U8aYx@*T7OqhF+ bRɖT\#1ޞ׸DP⫥nc}~ Et+*ӹ?v* ]gQӷLRϨ W~ٚPE`j́(9Z|Mj|0*Ys3|?F*^jѨy~ bP*MOcwz̄ pvb첚iw5$ MwT`TglT)P/0Q nMBiv88HviBTO}E[ &pU(&튢`t^UA"3ByZ~U3x树Mw8Y A׾*WB*>xD,\?I$ l;{&ȤQ}B{j '(.^#U9tsD$oɍEsv>ɖp#mdk{Y'6(̇Xu׶eC,Nr7V8-j_俵5]툌 w?FT< 7wn9]2aE#4V_<cCuK[@ F6_56F*kԞG!˛NͱkpҾ͂V~eS-on5-G,0ڣfn8hrӸLꞵz~S㋧#1AB$?IJcH%[iU^\EV#$RR2DVP  5G+*qZ  sm"Zd<` ˕18A?f5OO㚸_d4VAJSŲ(*skw4<8tw`cܒ{ $$W9{},7U%VoVr (tQsC7$_nT$u6>Ԏ9vd#6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث}DNaۮeb䒖>y٨?F[=ÎNX;:at$udSiA-|`R<>f>Ŭ6Czc{|PLpZ?VX([P|wP,l׏Xk߅WM+NUiA\CnA'>XmlLtB)#8Va-:&8"HuXRE 64HۣZoN]K.(M 1LΚiԺJjUHƣB!F*T39drH@6]O=k+3$n*Te|f b̑G!XPՇcx]C)H+=}5Dj9?ݼw6ܤF'ȣd1HO!XjZ\S+<ܡoWV@?N?݋"GѰVq863 ֿۆB#XpR!-M~d[IEqƭaNtuew&[ T1d 1SfڙonWu C'cFj)H/;fI$HWk(-Ϙ5X˨ך[vyOZ!r`͈aZS NFe딜b푕mM6)سDJTaT7s[8xSG ̀wd'[dL‚N};t- S50j:²Ď+BO&#<Km 8e#JaAZrL#R>?295 rIHٌjZvD31ɷ(ոr-9@aU Ўpc.5 ˋVXX\XNhʅ:9TPď'Xn) ʖE2e% (*Ae^/ƭr6lNelmIe@T`8:v* 0xd(IUC+?vLt9RelSU`Tto-i$|TIˆl%)R9J*P(cz>"rY@$휜c" A@Cvbmf<'u+pޕ39 'ntY,\c䙃h_j`OB IÙӷ|n RĘw¼ EccN=ҴjsBGr(q+>9\${/05=sn5)W)ާ0$u*(0MH$42FֹNLfDɉce./otu,oLo}&\>8$,.%/#qJUuZĒivNTd2,t\{uvinob(lPM~ NQ;7"9<À}5$i",ټb͡XG)+şVrђZDb>a-9pxT& *]8—ADv 9o_7 je#(pG@9F,q?Ǖ#򗒵bn +%bz$W~`kM_҅`P+_ֹfM7eIkB7j7Ίx _߼ DS\JM^y>ˌ6c1 Q>IӬ4Т%ЂIj;7ŎP1*7J`?!O@ny4$PbN7p2P^uo/$`;ULyK ]j >\tɵ%@ VH]*+qȇjXg")lXpHlsI5uy+@ǏŌj\&R?m#m$Ku4c做۩#©lPTFw8+I[̼ ݺK vטRQҫrV/ 'eW|g ɼ3\YnO\RݱB EcIewjclLP3 qNĢ qĞ[ JxQ)FGb:bHA"9S*&5#f5'!Txo?\%Ы L!,n5 +?˔;P~Cjf nE^j\iMGMO&GUe Ϗ=N+#5ʤ}_[u(€v >"+@,7UjCքiT:S |ÐSؓGk N:VckFi{S`CncDrz_?k_Y6?a=邂U}ߊPRKG;l>3CPw܁>:;m)J.umUA0*I,Lh<{`v;ء)(I *lfqRZ.0z!$j zl \"XRlYEp*]Kt/>Elc#8^΃[>}<,_SU:s~F7y#KGoC? dW"2c8; fGp _/ȭ 93-\Z :5d(U kTvB)9턊!Ntf'۽~yG%/Nn(H/&#b/(|z+EZZ!&^T Ҝ2Ju;>l\<ehQ)ף66(E\Ps_xbr]f4(}}Yr!R֦_)S"חrŊb NYI4޼rDn38/Zu+^6 7? ~&A?e(6IyB4w$, pbBo_¥!nFآieqZeT T+;HT4h^ZUT(*,Lhz$:4rClZJ7" ǑAv{QsȉTmJ+DUwmc ӽ%F,b?+Y<КR,6h#)J@ 0mHSFʡʞҽY U&AWOj+t]$QNuTvs &;yZY"ݫiH"6Ws@{e\`k̖6}omիS_8֣*ĭTքuSݗ$fXvh%DU~2QISV:P=9JnX2FM%~t{cjO-kh/,2"[i ~{)26۫D',ڴwA$p O~̜yc5wY}YE( +ֽ3#O2?Cm ;x%3Q^ .Uٚ4 ׽v́ O@,y!&3=R&xrׇD |X!Eې\[m!cF8Rmv(H$ >;W¿F9V)VJAQ(SSq-Eɦ%BKA)jXO*k]q0U/PcȷO]h*ʸ;[kfa4Bֿb(͵>BPI7c[0oOq^LTQ x'Ëۓso=J3KnumXoA##Z/+Qp ݩ~@'=81SSv 2ӮJ66(߆DXà=p;f%K 7X˨ŀ b rSrG;rb@ZO|[6@#r[|#1scxrfIk \+xU' M@ǧ=bh '4f6Ci{D吉ǚ eYC 7lfrƿk#QmD*PPbH1J [Hzl!&K"ӓjK?g^z`js Ai?aH4O_FSO}kPTQ)}y$; {xGޟn֧=c>mS ZT4fk׷3*Ihzh~aau4y~:TItAøk.r?hu&p8&s xr KREOQ@̲FVQ@hji&0ReȆL#ҋfK@jKwoWn>oSViZ䘳hh:Estt$.( (j*&-!SCR8,)U"-jƊ:ʂ]ZH5҄Ÿzڸ<]Ro튮"Z唁OLUcD]ZHURHQ jH'aJN*Ǯe Ҥ`5W ǏzkLP;0Z X27",H ޘhX׶(K.V$0ovcڝ?j\ ]pT |Yn]{b|0*IEq0Z lLTDl ka\U PW¨_]0\*N-=aFZEQn%+䂲](R ɬ-"(@ߨ\$_Aq&96u]z 퓛u%r~O>#T~Ruan2[CZd }IIJ؂r=ymzC 뫩;a)uWhχt`1FXjZDG0W$U5bT9}F?l k-F(&KѢJ(&P 9Ӊ?4mZy4@ćAd1w T4 w[K*vZg+X@k菙`r#SŰRe?@7ĸəԮcew_qɹXˤxYTʭ*2;'e8TVwKY0a3b3|{{_)[.xLunvĸ6Z8zruҠ~|da$xJ!!OV_`AۦF* ~"~*?k"uO-ԢpIˉ{n_fa{dmBTBVM9\FBJs0j">9\vaHu"9c.͔~)K Yfڿ.kIu"@_ Dhd%M:Uq}I pLq<:uPE~u̗Hx1Qk37 J(ʕNײ5Rjq ؒq9nP>x,#*ElJna)=2TvA(5bI''H+j{jcMȵj Mڱ}٥æ21v}FFܩtĐg,ku9?]jPS吕8Z,kvg)e*J̗W]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWdRVF)8PZU#:G--`rPn+mf?#INjZ'#rboupt;a&8ӥWU4A񲮁d^h)BmG)Qeu?O4ܿrîHL([2-I1ZyDd3ŦӣEswP6n-\r2O/K";f[GRI,=Dc_&Gイw99%*֝_|D("k=WYkkK KszQX~\V-!'*~Dn =Ap^7%6 _}8JP8?V%_MTg1|[I$K ơhYZJ If?eoEFXMS򔐤0$WbE+řRLhٿ^7B²GG/mNj~ R)<&x׍?96UW6|Vy^Rb43iYq$`j"`;_W?]C1'4a[Ĝ :dm%. %權"%-+ۡ分A9[B8C%Iȥ_,.hF:(Xm3>LjSi/^2Ԏ4{ n oeHI'uI=JhR߫$hn8Џo QZ;PE%ֵYT {6:!Hh?1cC,}m~߇[tJ$sj, )xDW&҄S\L0"oi0WVt's(Ƹj}+Ӿ:e8~D*?},B-jcs2#/'Jj+M4QDqPv=xK9i1M45i企I.UjqcM:zuw2+ă-fSqĕ_u Tmb?UҠVpU;56'mfz ]yL1RTѪj@ilxӮCe,Nf̺lqTΤU?kHYoOPW:Ʈ7Вn Ğ+SH?lHf'`C'iYI @vTVޝ,l;GOh2MCvŚH )&AF\.Bw`IJ%A+s,qQAN+0 \r}˒,KGma"-_(pL)峬u-z;ƱHxE:gg><ͬ[yp_ݭkO |GA12@Dcep*}\y!ԑ\i3| >oJ{0X#-Qīk+uEIjw;8I&^Ql =rHX@xUc>QY"11`iNFixF;;sOg zNQpYHNKo 8pp!mFS^3]RaUR6לL0p)pr<)GaSRyM է~0yj;gP6n*|up(o~qJiDPӯٯSᖟḱaJ szaQ֭^n=g+BdUBSbi֫+L[&paUf:G&"I}¨e5m28T~׿?k&n^)A o}9F(obU^8UE,JBbdjz{S>!-ˇNKi;!ifq0g9P ^;To"cerܷjmhO8u BI}qE)8@PIFZcIQ*i+tRPi#r0'r)j5*Q -)#ץHuMzѥXM|qeH'(K䑤 >V +]RBb8oWaRK=ZH6`WjRmFbG^ J=:  %fŕp*IFŒ:ITӌT&F }P8PJ +6_zచtess)EF 8Hܜ^޹u h&"Ֆ\;`} z95Q6}eK W92,O$ F›sybE:|Z~f@p|BhS2hHNnh$P13ȍՁke`D_RVgƝ$M+axN~IH?0啯-4bS}JuQZڃ61!)6_nM w~0taeFO|CL@^<{yR'1ぐs4rcf恦}e#E"j/(hw̘ns w]3ThLj uax-Ac(2/dX夂^P{SrT2<9XCY)4Φ:kɗrkJ8iPPkHȃ?&(b)%mH  iP|rCoHASR~gj2K=r2=̞2`~q F?#7+PD XoU ~k\7xڐȝ ҕc SiSlZT zE)*Fk TLuOO B,EpAZ7*G`OLyibu**#1)5X{($b]ZH6E(w n)io &3𰓒/~_]\B#Xm,ZNquw[T \j8^_ -w5" wzo1em 6=.;YOHB7˛WR(+S^Pda䶁yq,̆Wno wA=GH ~7_WxC#Gd Vpm.0sy2D$7ś--mVDp+a"'ԴH隝м@fG,rEx%e[VZ <#:ŝ_"Ci9I]`[kd@P)&_ツU2$Xdh4FVIL]B$(dOW`'ۥ+DkaJ4})aKO-)#|E] D75a*\KkEk:{゚{§e2IH#$PEb\4j0p G_f.ͿIs_Ǻaֳ#ETbٿ6ʵ8Y9$3ӽ7BZp$S@4 ߴ K2FE>02!rRckrD ,èO3A1aK2j=MpZP"0e05,[ ۦeebv WR)#XW?&.h߯#a~|Gz pp om LkHe*1$5;`Br!b+'nM)caGo#}= [Sk%,{APj6}@֛m-iKRX;l`Pu땱;(ʄ3T6nL%OV5ߵ~xq6imn*lwȲh˰*Twdd:}*v›,&0d\]R\)-`g ՔHۋc;C\9c֗!-09Lrn~Q׌~ ޚ2{mj(֊t "(<%KI&v4[A*uz5FmMz9IԃCJl),[P]6M4nGf}9O)^=6䍉?+/~|mn-1)ֵM5=ΜRX n:;h )^F K+_}hݔ]d;b(>q++^T&ȆFK.T84N@|)_n"@gt^( VO7 |0f-idPPt->5M$TmZ|ױ2<|p*QNu*J~U'"~Ҋk0EdP

JY+'"(Оq}.JU*f-P>`ō_JƁ:~tpQ< 6U/Z7;.Gy׏r?#&jҤ7|(fq,lTPQc )Uk4a!,[f4\3CCO|UPP'4Zc^~+ЭM+Q1hA>HJ0_|UdRRh\Rn8 *p6[R$"$LOsJXF%@*p*I1fbz;o=mf's6'|bz4)OG&+ԕISAcz@yv 4ȡ_58E@Mt:bL)AOs\X-2*26*D犮㡋jtJ\! Zt-.eG50 |oQBs&bX"-˫U*:1LG NY|ֆ*(dhm]" 5c"ֽY -F?vHḮg`GBrHҍnG֕/%$ tk;sLPI|ApM:9ǦjϨ3TQJje:dv-ZȔ`#棴cj?M^t1۽V F;Z5,7+BR {nbYp/v8rqWoqJ= |[?of3$HeiDƜiO'"RG$$ =Nu% |F󘿝HƮT :dLjQxs0yk:_BIAn p5˄Ƥp/&^~[ݾ/nbc[ .Ӿ_\@}?&(!Xcݔvd]mbFqm`jT~8@xG_qwrROc69\7ٺKlҔ ?d &Ny`h.8h){}5S_6eoAꬼ_v2Kp~c;cj֚Mvp,PPls ؖGa{#wn{堶]#5 QO @_s$&rrc+Oپ&nlU3)؊\݃֔CH۰ƾ!\4,+T-.5ˎ- ucŠX!I`E~XrF#!b;u4뉈8-X+@WRAF\̜ @zP4˱ckDAZ7Ʊ'&گDb V?-)2j8vWxYӁ v>hQPJn2+RU ѧ ٕRƿ|XTj/威"id)փP/ }G `2_qDMPFZ#trV7Ǘbꮬ=PqW2v)k,r#fPħ[cJ=IpKK^I4 V䉃ɶaJ,D, zjcnj6# ܐd{∜E  4By9+ ziu4 oR# nOѕm/5Uj@*GnV^LbN1H)ZL$Tfŭn̔#b01RYNd&` \ȴiMQ&ydTZx`9 d inǶtF+b.]/\Z-"`VLy9&MNJF%L̽Ek"^1H ':v`M9囁y+6y^BLfPBZzۿ\LڌMڵ@Ehwѭz&( WQUe2! ..R(={bK"~0 Pӧ|?MˋfeK)^AY^1:hy#%|YB0Ja%!oHjj1EbdmA$,BA;z+(v+Z u\m /j~~dI<>!cjW-Լ?|aUۗ._#v5: ZeNXЩϦ6-Ha*SASx~bq:)gndVVV~0/.##pQQSZWzTC+N\ ?+1o!}jAqh>Te)l"i-G ˝9xC\g= Ds P\K>]Dx>܈ } }Xx7;u唹 -A34B65_}ZjKUe*?ir>q4J)z+Bk ;}v8&-G3ȟM{uf2R-:,'1>̀~k@~0>/%S˨Z)GY~QG:BzD;F'~* vkPw25 &<Eߏ-@*ob-200͹ysg?fɔRn{ۺ G4x|~fـR*v8URJ$CJ0ln޻4ZҘU;]"$j,xHPbK RXZO}D+P }\ʎ[(nYTAwfSpc_+[e HemX̮W֍ckS֟s`+$P((;RiZ=q~GnKׇ/H[2uTFTܚ!6nQ%if}|N7 AQ_N„U27%s啦$ Ol _~> GqitfRTq J ,f*ʃSnb{1JI}rdգHܐƜǐ?࿛7#vw$E +G0OfW"*6Srg_-RUw C ֽ)Y)P"rI6b?k eP(w9eDp^Km mq/)#t.ܲuL3TCa޹L`#"P*s$kBᰶ ԟ t2dm T8핳-Cŵ{ɵz++ܞ,gidRX53᎐}8B|VAd[r5փۮ[-dv~k}rK miu}`ilZ#Ok߭;PPdzo J}2|)SAMUTש~%TB g8Ɠ.|'ns"{G LW,t]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbG2• 4^Q?:ԚU9&  o'.;ň+vfۦNki@57jטdy#N15ȦܲrQn$PZO1)ޘ&;: ӵyp*ߠA88TsRKm vFؗDKiQڹ.J~"17;""r*Gnuq?g o׆I#1s`%HtYԙ>k粔 rT;v' -^acl*ȲF@*Rya[[yS z1DŽI#A#m31ITO˽}D[OnUT}Wƹ0|2og 0h6Y`Tq7݉M.|aLcI%}Rl4$2[+#RFy13XjɁ~sr&8M$bզӉ lU6ˀA EZj;EpÏ&iN3MBScj "YaSEu+@O "1yRG:(t gL?ޟw,:x>2mlY ?E y$:~yv{flrXM;?JmОDW$ӑ# X_=1j$d he:s)r4Cb6DBwv9mm.GӞP A] qg"Jʲ>zi4afkXߕjA wٱNKGTcIXB&Vz}99SĠ*j]ةX!eK.*c-] ROiBDĩ_Nկri6R5| UYES oNq@Ue*TC*Ɗ j(呖POl@7F:n;Dz uW,b)C.<%kpjeM)A_nߎ)V$b: '@}փ=Göh >ڿC/N$ZJE+0nc, ab,2䌡MN?F"0, wɀLsFT0C߯TC^C ғ*xG^qE9$W;!'=Bh M|)"X+ gR7.A)ͽV|?Y #\zXuI#e$wMΑ*tPk;ed4^,޿=D}IW4%wq r7*HA -3'J1)մ7 Ld:dĨާ n1`f:DVSpYlX˶d%9]E67lL*"0*UjqBmbl+˫N2>$l -_8c̥ڍb CTt{ZH\~1ROPZAۢ$wc#έW]qA①AJr; %B{Ǚ*&*kk*hS|n$VMWj^?e=&Q;6Q@wo35 Px-Fov'i,~tYSIB@ر_#;«@>kZI5':6~ˎ\vEJվ!O51>x*;VVm1VX+P{s Ƌ@:한wm,fRP;(y2l~}:UCL*}jؔjɵ--Go_S$7J>SmԚWb}z{CeӀԠ+yUA^ٝ'#RRRAZ9$T}W5kCSo(ɈOi+c`Ju//CwΉNKl& i^mptׂj8PxlBV_4S~X#G#<*-koIGGF⦜[\&TnjiS־CZRi(%6=B5yUQП*ǏLR"A Wݰ* B7>uojF47R՝' W|V2>JF() Z&ZICּK0ZZPPdmRIJj "9C%2I-⪀d-4[#9%h)8K#ƂWTKZ=I$ XDڴ8@րtއS&v>!SS|2t$GaM44]z8-G_BA(Ho v+T(%Y1#p+㜡ğ\d@(]]H)ӭ: ibBJ*Tl~X3AVZeQq}U!u;6zlixo+~\V~2VM3;FzaBK.rq2F7ߵTliw ?F%Z:GQbKwD(L?̑*Ǯٲ+5ǜ-@?i2{]%v  GV(w1HO98`8??^KAvi+&çd@B͜vt2?֓ߟoܘ>XN\"lq45mMl-d#X;z2AXb(4z`X\0?V4bkO bo>u??͗iH-֎ &*rD(PP oDͷ:}+zJ rW~B o)z~_ȡ#q}t\֘0Fm2b#qS#*2"5o(ZAnӕQY-~-yemz'&9t8㿫3JGG#T=֋ @'8cG1kaqtXu]n{HP f y6^9qc\xr>}nLo#$R\$OPEFK-Ê=+'.E6.0,:7W'D՟32!=>.AysEiY.r8#5@;GLjjSqcIcR3_Plf(ӱvL»9>FޖEé!|=GóeJ)TZ}sLœz Ɏ\|a֯KQKQY򤠮\0Sk\$; ֟<亐/q]oQ]Y}ٮk$n)S`aN(kAQ8Yjp<^ /!d+)P9 W*|vrӗ}ƮVAGCC((K.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث#n}pA463v@5v7hWobh3L }dI֧HVLj-R9Xq;P bC!97ڏWqLF@9 E%*MIlFCMG|WzxbR7n >_Zx &jh9$ רtf%6~_jxdNɻs7Z1 {GƑM8gdD%Zyf%H]CEQj-[P>/wmy-z1G*<HEDT,x yqj>:e\tk;o֟,mM;-%Jir@;;w"TqMRրZ JAD8(!4ЮO8۶E,PJѷ'f,mhi^b B$ ӥp\ rw"PI|il}Nl #>qh2NGµ2FCmŌn=IB|JjWf#ox Y%CֵɈ7RE쇖RlXeqPWϲ{R?sO 읜[ӴY1 ?k*<'&CdX۹jp#HY|Asg/'al)ᓀM2--b"F-ז~gv`zڭ0 TԧsFӿc z~;}Q>+8PH]_h`y'ƙݰMbK&e&XׇZ n+H)ǥM:azs!4 ˁdߞu>HfZբ lH̸IHx#zI|i*jANwfmisÀJ o-YM@G-?F!:Օd X۟!VIr\ǔGQb$s ~ݒP})ѺʼnV{ ,ፔz)F*W' \lM>RFu!7n=jz Bv7"Z x>;R/*0TxxOJ$WI\K x4[rJ`l1W?R2  uAnX]u+RpP)sF_ʮ0)#p쑐C,? I|?k"R3 gcM<5,Cy/!^pQޤ7ߊ2dgFӯbQ_PpD;9$}ph# 2vaj;*+3ZT֟Uh>;J#loG$.½A?%UP $wp)I(RTm_H$f:;FUprAۯ=>, OBؒ?oqC^?Mau,G7-=Ȗ%OXJCCp#mbo $Td6Rk"_SrN/O\E71tZqSL&mS@ =E2$ĝ; Z٪Zɉk!}2F2|YMj c;2 *|' n*!_c0텳ldzɽp%1G2"UP| ozFȤT8NCAjF(IJDsh c)ћ@x\CekW|BdК|ug26c2Ӱbv VX*Zm'e z~>4b;d)_ѕdvQ$&ԤX4ۅ5ہY~. : }p2M7PC'p޻|?c×؀i~rw\6W؃woU#2bnB֕:߆D{ε¦S`ǐeKhvySZ},\kR HG-B1Ak[^ 1?Ķ>3Gxאk҄H$q_ HNLU"S#JITɿe+݆r-}U&䦡nU~,V <{$=*Va+ؼqmZ?W ICu60jI#$?`9f$1B|r#K#,M ܍>[Ğ)PbNȘf-Ťfa5ۘқW$1f&fBy )QlÊ4:b| 3"0 '5*kק\ɋ|gL?_Ć'x?ZfO}YdA ӮiswZ\ 1t>U9U tȯI;~_74KuRJv>˿=J`u8Kt$?g8ţ *>8ftXxPziX莼G([2hHJK˵@1d~SaʎY 0$]+m6ƶDʪ0 #f?pDK O.[mO@]$jOTB:lU1p-ӊ r^xHfi8C 0-Q!+?gs3~ ; n8V2VJ.E9~*cr HĮ>! -M*zWlS_jS.'pXTb6s빭 pǑi~%%%B( (<~82kZaTvp pڕ&qCbRz`)PGѷjTu9B'y+;W`FdAAwYBc>ꤏc&⊦sOZgbhڃz֛⌌hïT@*vCbRy54*VKp %zpBEx9g,4Qý.őjA߆a>klQ3@ëm<6V yU[zZPO N|;hIo\~8[}Y9`y9(J+{mu&Iq@_|[㏃)e00kcXS9,Q~J~,3p"q'b̩Vq PC'V?AN| c=}lV ( ^x*wߨB0j(8$89lf2D`C4?Nc2X]ZU)3n+$S/?xƎiA%"OM(')龔^lb^BkOiW_OLJzAoOl&3\|9qB[J,^P\a#'(ƿpA`:m֙ y b#njCHgK3e|^& ۋq;h#"eGn';9 ~ <&:Xc_//V6zx @]:GGܤ ^H]ӷY6:L-`3%.Fiw۷lpVL4j ]EqeNN )W.F< `qd4EJ(ԏ|v:~m>g#]B]_G=\@(kن=jЪ=qw̜rt9m72 5\ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثOik"q Yffglu Ť}|N&Q[QC~V^Og:]k'Ij]O̦_"秷48/S@|ՙAPơ~0:ia%Ƶ ݍъ9޴LF=js1ڣD` ( l1fnQOͽ7H5p>C]&PXWQ,ic?I4݈;zzu ;ӇQOL½Mק1 Y~~^"Vj0YAܺ;r#3ppJ"WʨS^=Vq*^[HD1l8Z=6+YQxW1H-HZrS|MI1k4#wPUپ&;YH+C-VLD[hWתwG!RzIUO/ls7% z B%3,v-`B6Z)~&tVrK7GRN')..57yXXP^Eg/(`e&l;IQA KSm=KXZ)KIE@>?ğ}\0 -P| $!dJylݵΩXT\(Y+_?wπv{fh4RIoaR5Iz|?aLm[aaRFIcv؇E{ s_w¾]9VH.|q2 Zk-Q(@&hA$)*d "`)Ml¢b(9GLBh\eFh Y*2~֙9nwk->~󞖺H=E'BvRUEʫr6} $Afod„xPO˃`dya@@s Z :nF WSXE [J∎ |@ UC,:ԠP )@҃LOPi=L"+cRD (A?(sUj/O|Ŋ6RQS$ȨoR[~Ur ,GOqV^ {P,SiRT~(@5?d-_XH9G?6T3=(#:;S6_JD!f5"HJl\/A kቒ߰x*h2AUGy&ߖ,[v(h+, QjUM)t[G#ukṔ('%$-{R8xT25:T^CBE-TԀ)H m:⪂oN$cQoAS9I +X=@A#FJW; *d.M҅H%8ڕR7 1Mx"T.;W%׊V)!O?8Հ*BNS~]+ڤxxB `u5ƅ~IQ{JizW%$QQM ^ '(j}rǢp ="PJwgH?iS>-r(+ۙV!)=y5 97/aQG_*QZG)„2$BԢrǨ< (k_N^G|-EImER5hcfȉ"Rqҭk@ iCg42 $ nRYf .`F\P[C1& .@Ig-68ACdDLPL)U,tٯZ%>\[U\[㲌F_7qxqxVsOܽ ~S)-^l65ooX?EKq|pH./AU'1݄P-b+0YݰF6&:ZeI*̖`$|RT,:(*aPhl{%!rU9N:Iƿg|X@w;#f7(gXE .!Rʂj"y_4L>^oZIodCGaR~؁eA뷏JeeMk9]/0C@WӓMPJZ< BJOň/lm<>"i pW$꿗Q)e'pcQ̐_}GէHlJM=H||kkmL* T}9mڍ v? lvP_x%.T̪#^sN}ZJޙ UOqqgsL*BpeSFj5ޞik!Н?c"n&zקҘ1lmmH-~~ˆvPLZ`V9$ĥf l .N #:T *ȴ)c+2ֵ [x@ 4络tYOsOnXYwޤP