ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:20 16:34:22  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$RIyGW]N޵2k*ɶƿmlsZk})tĀ$%x뾰uʍ?LʮOQ˵;"l8Ln}:Ϯ1lS[u^mWqt,=z,;+!\˽7yEeރkdq,{l8p*qa^v#w0r*_i=O%5۽j!I$JRI$I$TI%)$IJI$RDzl.8w\tRW78:RHBZB;w~<N+C5v++>Ԛ5SGB uqcҨ!xhܨtkԱW[Q>>p?Ҝi.=qNIN^O4dNee}β.k[nzk^^l3|ߢgAꙸuNfU c ks[)x =rH6c-ʒ$X͞7)3O'n92k-۹$HdzArzl'p!ݵv}v^u }$ ̍}?l sI!K\KDݖ I$OTI%)$IJI$SWdN'k㸍uxZlXgs;ZY~^WIif%1CW)l#ab<'&Y]{~ڵAL+q4F}(%Wzb{Q' 7/ƴVKF5 ˀxFP_pٹNhomtboݕcXsǢ mw}V51=W91Nɫ#8i2a(tu"4K] Rw ߡs ="_h}m,cK}ŭ0 џjƍ7D}!)z !ceuge#:~oMSk$S0?TI%)$IJI$SՌ5 |Ư?Wzu>(op;f9g Ï'.XNmȲ[UC+kch#G\2ԯ]@Yp5SUu.ױE/Ҭp?>ۮ%e7n0zvlq$9߻1fַϦ?P5x16obwuZvv;]$~D6r#m V= 0c)"?[n5oC=P̷׎tp-}wٹitnh$'{~y'å]Ǐ=x]b>y eg"8L繙Zj큮EUX cvͩBB]FQ׈I@URP dRI$TI%)$IJI%}nWKv&={ao&sDKGS9rp{1YF:u?mניFSAhȩH$|9~ƃE}?ߪ [o٩f.U-i?fmӳ{}v&Z]m{ kuh:9Ο^sS46+KE-k;-O hzVVKwV^Oel=4]n?M.ϻmLm?s ,scu6#Ԓtqoj?\}gۇu:a'Xҿ[UoRǩv(u>NMs]UC+,k\,NS#PY%~){OXXWtl{ƫ=hѸzV7k5uviyOLz]EX{|\ʁUMA/n{ku746ֲ>1EY @}ndpdvf/@X M}K^}FG"l6IddzUԏG7RI%+I$TI%)s]7IfU}샖Cѭ{(]>̗Ea^'yӛ9ēc$ė>}۝I ='T:lD>_j$JTI%5m}6Eؔq8\QgGvO;j`WIMS:i}X4KI߷?޸/rO?W ',vJnm98y6;x`2[`0kVIXH\?/8kMUt;}7R~#f=d^gE9gZZq;PU ~d;.4 }~5s}CC6̷̌^kC/s_Տ{ӏV>qIV :u4Rȁ?9;%>wz50׹ޗnYSӱm?J>.636cTY4}̄Uo޹mm; Tk婉K%X0 Ѧ2̺ݾkRIV!]&_V;$g"z7.Tlfl3_*ضII%?Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$(Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXT EXP550/PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMY update_maart2018-8 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$RIyGW]N޵2k*ɶƿmlsZk})tĀ$%x뾰uʍ?LʮOQ˵;"l8Ln}:Ϯ1lS[u^mWqt,=z,;+!\˽7yEeރkdq,{l8p*qa^v#w0r*_i=O%5۽j!I$JRI$I$TI%)$IJI$RDzl.8w\tRW78:RHBZB;w~<N+C5v++>Ԛ5SGB uqcҨ!xhܨtkԱW[Q>>p?Ҝi.=qNIN^O4dNee}β.k[nzk^^l3|ߢgAꙸuNfU c ks[)x =rH6c-ʒ$X͞7)3O'n92k-۹$HdzArzl'p!ݵv}v^u }$ ̍}?l sI!K\KDݖ I$OTI%)$IJI$SWdN'k㸍uxZlXgs;ZY~^WIif%1CW)l#ab<'&Y]{~ڵAL+q4F}(%Wzb{Q' 7/ƴVKF5 ˀxFP_pٹNhomtboݕcXsǢ mw}V51=W91Nɫ#8i2a(tu"4K] Rw ߡs ="_h}m,cK}ŭ0 џjƍ7D}!)z !ceuge#:~oMSk$S0?TI%)$IJI$SՌ5 |Ư?Wzu>(op;f9g Ï'.XNmȲ[UC+kch#G\2ԯ]@Yp5SUu.ױE/Ҭp?>ۮ%e7n0zvlq$9߻1fַϦ?P5x16obwuZvv;]$~D6r#m V= 0c)"?[n5oC=P̷׎tp-}wٹitnh$'{~y'å]Ǐ=x]b>y eg"8L繙Zj큮EUX cvͩBB]FQ׈I@URP dRI$TI%)$IJI%}nWKv&={ao&sDKGS9rp{1YF:u?mניFSAhȩH$|9~ƃE}?ߪ [o٩f.U-i?fmӳ{}v&Z]m{ kuh:9Ο^sS46+KE-k;-O hzVVKwV^Oel=4]n?M.ϻmLm?s ,scu6#Ԓtqoj?\}gۇu:a'Xҿ[UoRǩv(u>NMs]UC+,k\,NS#PY%~){OXXWtl{ƫ=hѸzV7k5uviyOLz]EX{|\ʁUMA/n{ku746ֲ>1EY @}ndpdvf/@X M}K^}FG"l6IddzUԏG7RI%+I$TI%)s]7IfU}샖Cѭ{(]>̗Ea^'yӛ9ēc$ė>}۝I ='T:lD>_j$JTI%5m}6Eؔq8\QgGvO;j`WIMS:i}X4KI߷?޸/rO?W ',vJnm98y6;x`2[`0kVIXH\?/8kMUt;}7R~#f=d^gE9gZZq;PU ~d;.4 }~5s}CC6̷̌^kC/s_Տ{ӏV>qIV :u4Rȁ?9;%>wz50׹ޗnYSӱm?J>.636cTY4}̄Uo޹mm; Tk婉K%X0 Ѧ2̺ݾkRIV!]&_V;$g"z7.Tlfl3_*ضII%?Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$'#ضMm|;?UZV^JvY<ӐHŤĆEi{҉"`AQLErWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqΩ,}Zduʡ=.L#I.$giᝯ=@3Т&jḪ\;̑^iiY"7PytȲJ.؆<RkAO+Kw(ZBzP&P7q ԑs$Ml6 ɿo2* $Ĵ9'u]m5xQ׷ FLL$X=$P =#\Z]p #)eMj{k}cSػpnQ('o#MF^O\0i_+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbɟҀ} ː--mcc7)X#Uz|_ +xD 46絟!wJn+ C UCOB0#BU#/]#cኺm) iw:5ݺ %5NxKJ q;}2KE0 "\,2@FXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbΫ=p 2Ɗd$dۆVBs]H%dDP|9`D jM7$1v.8?RI@]qeB"8;?v,Y@NьQP[twxIXhTJWp}č"9wHJvqUqkpҨY>npqiGg,[vݤzU/0^[3vhef5bOUeowERgpQPmo5cWmtPVq)%L֛l?֋KoP oRSmk5 w"5ma=6D̢,>J%%;צK-֬cBkWok8ǑA;ђ'b?ӏY:(ڢ,-0gx?iKTu$@/l=iJH&P>`/wk bӥySGzE4q;G&co5<д@jҝ@}S`N EcA,_2<$CAA%]ǩ?, $r`o^e> EY,FoJ%|W<`45I4aJP$^TN" I:w4ÕqgK=D^A*_Z_O@[ Y%ҕbU_YyYvދJ 5BMxGPL.?6=`8Dr{' PuMw"/7.%&1T[B-EWsGɗoL(Bf5Zt$2}ekku1Xr?z߶kp= 5JeYʖ-on)E;tbRl0_婄kpaS<)?$'Tk VfcRQ8X5qu{4J`i@vqk–?TAC0(:YaݑXh f3zwv@܁ᅛ%:.܏WUōm- $QCQW,{Z'EXO ĠRSb:dfړSI$GSN$JC=Ӆi:2ח) &pT)һ0Zm*un/M˓17MP_"(K=$intZRA~8e"*WH'ar4feft4OkAֱ#.Jg![Kr.\[Y")ǔi^zj`͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWa֕¼`r+QSN,mI* vTiB>&;PӲa/ EHV> .)1] p -_6ۣY+ҹ+O@FH$.)O~VK1JŪ&(ԭ}->ס5#fwf340Z7uH=bI=.1 4dKffmPXUqobػiɕj_Å0X9.jF Y5K?wP?͆)"1FO)Oq>rWo8Y$b؂W"Veԃ9pX*6>3EjzP1IX~a)_RmmRFg5$BiPA^(>XL.D('r6=~82ao #RA _k<శ\ImK$c *|l穩/4REgʣ6+#h^s啪T~ 7$rj XdjOnS#Hgh^`LUKmZsQŗڙϨ Qk|ūe2u4BF,ULwIU;_?k\n+`PiZfhyz|-Tty$fw*)ť0ڈCR~kFJEf[LUo%L1c_KE2rWJ1V RXXP}wE],Ege=`=䝴 do*V+ySU "7z^PA Tql}gpHZy 96:dpGa>'9n,D7^ꌃN"N6<ۼ(!Z ֌_~\2$?͊6*ثb͊/vY#yMI=74-錵UG4xmW:,t#O)1$S+lUٱWf*]!Rp@%c̉q[ bucpH*4aV:y~09B=ݒ<\%S"M>c l0=0=0!UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Yrtޮi)f ɭ0bpᥓkOo&lTnI2$A#Ԯ^R?dq=p٬ xױȥ5'ޣ^qG=(-lMj~Bͧ.O*;oኺ]} GZ"dmH8R2R"7쪚,_V_H=2BXM R>RUM9f cJ\;T@ ͸(h ݩ*C%dZ*rv>я*bQֲ PQW *J؞OCS 8i[y)A*ٱRha[s,I۫xq 2JI$V'DaaDETϖ'F`,|4Ze$=\> }>DyE*~ŏ%=:8$a"W}8Œc$?TwR՘j憇̯01)ر9bYCB8 { Ճ-,>+Lk^d6S+>q*&I$)h@k"_rb4,z MWFxL@HTu2V$ 4|R6ʋ.`q /?[J#Uf$TdV+Bm8?^_ke6URh .S ٩ `@n4ស]F Qh)!TgL0,*5Me/b>,{7'pnKH߰?Gl4-V$>ddEVwxI] ;y3R<$ Sz%-zQ[ʼ{ګ()їOyPוN$~x%zwILvONx)?丘pҋA_"% Vo"dϛ/BSqC(#Za~ѨW4\VH(cĎk Ĉ$@ǐEIcӒ=jeiC]jQZLir MC,Q>3iKQN˜-˯R! Qȝ0Ji0PF%P8U yI)MeI%`-J]{+mvWJl>ld3(ѵt ҟۜZZb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,-M1WgX7ŕE \.L?B |(`~˭E.1L7p6{i ]E77 0cBծ+K=R gҒ&۾]"HN@mcJiS~^?PV xsZn?cV4_މ!=r UM()cO( F`x-#Z DHX-VUk*y©n<x)WMGXOZPvQ=.48mĬ41Z]zmH^T'bXӎ_$ "B7#m{3xҔW. DoZ_ R{Kyxd?Ą?!o5Å*Ҙң(Ŧ$ʠv8`;+$}𤧚 mm2UVw"x*R n.nH!O&7߳_$h}@K ԗ tdw*iJ}\+x~?{6L )<"(6-q:TlO1۷,b8.˂B U(USsE˗fkS`vс("ˑ1rp~ojR\j^{>AOkiJ ,c W}dxv?.AS ]!cʼn٥ u26̼pJAt tHnÐ;@om<jAq=)Oio[3< //\_;7%) ߑ~_[y7M!Wڧs6HLawy/0 IZ]γԲ )*(>erA+vw,kSRy|0+j7R,NXcD6AU{{MˎR܎! ~l: i/`0;gaɋw6tr"QI>uS> j5#*Z_p;[Aw‚%!ga҃)KeϾ!@MڔiO/~d߷,S neJcrOg!@%Ã5X͹',L qo<^>8"iE'j%{k j(b#t䅽-8  dަ>g bjWު+o )*-iI =c jj- 'A܊SW#Ph&†+tA[p $&%HFiTX@~{WmK&ف,6̄qWޢm۾i}]x=SoڮJ\Sb1dB_-fv4Fz*)n.#mNX䞘PM|NtH=vGR@AlEn%s(}O)'OQc!ef>ɯ? -B%OŒ@64Ūb؎H'b*Iaq}{yJQН#d>^Lxn EX V ވ ʤK/0Ģ 6^Ж+dݔBߵFj)I_E &HH!n Z}X/,O!?ş4eZ[b>I%cVt Jׯq,P^jDR+RS#/ilZӘJ␄Ѵ=ZsR[iM._VY9^bɐ Kqq'bé-} XZ Fk^{֑;oO"@MD]v"_@ŋ0_CU(?x;Sb 7Fc[i 6|-P;N_&\g[1$5h:>#UUR,u>;~}T\2+oSuE*_n#EMGv]qA1۽2M=,p#Szpe?l ~L+z.!Bq\ m1[Pxpڔ|,ӻVZ ٘aG .In5ޝ"-R키JI'vr+s<^lN(R}"FͺlQl_BОP.'ŭ: Ȟ1[Ko0zpI(h%V>-_Xk%cFdRX] 9 Tl!iP<sD5 #$i:P>]3j-j;ad,tO^H{OB"ʼnQIh}(NUV(1T$OY%rԓJk\cc R+sr8U~]kdgRH$>#8 {{ŭTj}ThY AsIYl(׍d%?d !1`JM[[FE#T՘12ZoOlUؼ XOoEK}FJS?ʱB (?V:R"oo߿s큼&7;*ⶼ[I*ZyΫ aO<*Kܩkˍ0$;-Nծ)MnťaC@6$س//6,yS#e_́?vȵwOU;m+OʻLU!F<7O -Jc4ǽ?=oP|1kBoPj6*# (7'$ⴡ%ërzSՔ ~n8ԤSzbC[sIH0gEg' )Mk~cGBUmJE}HFdh!G߷K6Yt*% Bխ⻣'n(FEf@+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/v`㊻51Wf*]SvjbLUT]SvjbLU٩51Wf*]UT]SvjbLU٩51Web͊6*ثb͊6*ثb͊6*ثb͊6*P!_|PI)vPB{bN*#*"33tnqM4X L|zc?=@<%U|Fik{# ,փՂZ$rr=sn1 !L,W [#AV=*i켽ywSgv^+d^`/$jdpeT&-Oʻ*n%E҂4l4$bPC7=m,$#|=0{oj)[sR@dq\V!B_:HȀ" nOߧ9U&%rYƝh*> 6o)2'k3qoȖF7@O}Vp+d^}4𐟇۵8e k23\15O*'tO`'̾ qztD _ԍ¤NYRG#xew8Fj%Hm`8wzƑw#aZiLגjG٥pBKȊwՆz\> }AF5c+TOL*ܿqmZjljk,E<~o.%W{M /_ݑz "6dnU 5>#Wf?`DM+@5p;NWv' -(VI\)-QLrsbGj|#\_Sa4V0+@)_k+_߀;|$VӂuۦY[YSMݼi\9hHnv ?Xӡ`&F*ƿHXqŸSZ po8N隰YPMLv(O)ϧJ\Y%p=ᶍbƋݚG")$o, *> kY`h+ I|;ǏEn]yb9"Qu?s xWp1z䭇T2[ҋn ˩+ R04׸w3qpjFBx ݊?*sa@NMǹ‹KtW&r ðͰ+CvA5XCo - ؠ('P$9 E@cc *懞eI.X%~<`n!,߿*}I"q^F=9P}渪*㔏 D>iƔSllCE -dQKKe]/ zU#@v@13oia =?zaX9s+L cM^F`KHOWeR'/y(Eî 3؊R߲\Elu1^KuPcO 4"`ݨ? U:YPz5f Sn@dŏ)IXJ|Y -G;Lѓ;JOX6Fjo]((kqU*qӷ>dBEvVJ1?(?ϖ xQEMKb̖բ >-H I,ouX S҆qzp%΢!Ch0cew[]FGqo@+XLn1f]=X"b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]v]1Wf ]]EH!D4#Ju8+D N#wOh@B#R KirU$xi+O*)BWqB~@@M y[P4a ^E]y2׊He,O ഘ_0-UGS<ۊq%1\43q RMFY #V}pR#:⫤4ixK^5E}Jǂ 1e3ꐡ jΤA?jk6ʜ'4M'1c>xXp 8UiZ/"L yKRA$ ++ rV' GZoKѱW0z q]LUٱWf]vU1Wf*'1Wfi\UX51Wf*gvHWSb-@umIA*lO)r0XAE#z͵΀XUn.lB:k@h1]WA}h. ;b[-xT͊6*ثE!Z -h+N/#[n5Aߦ r8BH.v+>D( ޟ<U]CH]?ɖeǩljDB0NI'"7;r$Ҍ;}jgԝ@oa"n=Y;)'oS2r؅܏t\yʓjpd WcӱpYoJ#jЦ)>؝ϗƣj5=FUJٯgZn4{d~<0-I`VbpļCTg6yR$4#r 7۶,&MXDI__._:]S TH?/nie-@LJC':Kig%QNض'>GijvT >ߏ.x*]II8C+u&(9ڿ#"RHWm~gGĢz׷p-=LST#S9Wc%Zr:AQB67%c$ yË=Zm 괘hda%X nFJȰ3ou9 I' $xoYM5*F05̢2 LY'ˤ^fc o1H9NX +XTLk dc;<kK1-Nn9HkB{!.Q&@ޕ.&?gp2!EZm o(Ycr;~Ug0b#}P1BS$%%YvQ#w4ɐ X3I&4TԳ/R?F`RԵ7{ڍ=I Q"xR/n_N 6%T&Rxc:/6Ua~T<9An̫ܧ #FO_72n"i6Sxc3ո:~ aAPHgz]_jM8E RɓDIId "u\5=OO,)MEbce׊ȟXwk2F2`7}o3'F^eR-P)5YFS$iR N*9 WlFw  0'^#'? #.%D#k;ҐVaf᷎^@YU@ &W5l>X{/r3AA0?USRe$*Њ) hUGćUj ؜qzΌ*~* "Q ,HǗz`v!A#+➣/8 C7Az`J8#HOuvAW|RX'j@jMH;Fj+AL*1 N iR[4tTz,kp+ԱI-$on~ rX6GOHXFP\Wz‘lڭT- YW_: _`Uƽ݅錗BO`B~\gS~< =ݚjwcyCV$ X*Ոm˱#!/aM,,f DL(G#]?k\n9zWZKn XmX>aAMZC_\w?X;嶥*؂(iqnyǺ!eRQD01QI >a[BI1 B(aOo#z )AEErJ,_z] AkEYmoEZ~ŗDXkgzI2>ENWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث1Wbb˦*V[fUSbuk:_<΀ڧ1& &0њwcRU(KdLXcݣSքObG UZO giHM*CUF?o_ǘՉ B@GZHğh+5do 맊0=; 6Vi\_%1j[RZS;[ l_OE;W}=aA*vڳtmRk1:Uv o퍨Bjcl*VX屎7ҫSxG[/4mn@!AC0zw'EIG1Rk:\MS_zWi}EcfPԵޯ~?c,j6ц֙+y}"x"ҬĪ!Htg26>:΄/׶_eGt-z,84c?P&$[o3OhjPKlkYBSx)0k *SfaFN(J1_)_Ga"$y&0<0ծNхZT6}LiJ^/Ov``yyOjpd4aCZs* usy//dM8 U*?rk#NQҿd..K{S<."X.?On8"-5*QNkh//krjR2~CSK PqϿqG$*Z ܾ">97kIOF3ORr|e`_C`NĊ@#dEiU{ۗy`E[mv+֌|?fX4.E4 THcHGJ5TW`AA۹zJؑl _ 5ņzs?@遌ֵÅ=}1ZWEn't?FI<m%?I_\ E9_fkqo'bfXHR7OZp| (( gBfz++__~)(8HĶg?Jn5- Rᧃ|_c(25ڪA‚3Y 8"(u;MeT^;`6@XTV9)/ko*:@ ڸ$&Z%Ԩ&^.W iܹb 6S`P.ώ y4)U 6Րٌ>d@y;#<UejۿۉS'DQZeZr_b5?iPKC_p?YvEŒ~j@PZ?ʸ{ES T7_Ѱ[2NXM}|?R]>WKfv#,?ejތbBs)+iv]keYbsZ[|1//X"Id2?O| +)Xn*M'Ƈ$ZTJ2@e?\F2̕eR>hbvHf>2'6;w&&ڭ  M8ݍyr6&+h")QF{).c)^5aJo%#ĝ~??$Fثr[OКi:q_noV)upoP9~eªc.JP~5XfCRZ=.%q{M鏆0)@zdtkćԸf-VO*J8Ո=9SkF2qD ɧ<Zﷆ(;!- z %(#]|XHŧ'ilVd-= (gcg cFWv,"rb?7Vc@*IG\jOBN>Mi0Nn‚Q^yӏoR_a4oqGZ 7f#s%z6Osza#R_,{.xWr0HCk;Xv}J:= q@[\}~fU4$*_8oNA@jbCMujpCEe,Fݿ+}(Psu)G6( .OL+1g1)S-E~1 F^Pnѐ5 NQyTu^/#kbgg4fQH~1yn̼Ih0zs+B 8KL kWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثqWbv ҢYnFeskE}MญNwi6y(H$Ҍ=BHXu=6ȒɅyTVjқ/4cT#<6ejT~X-n#@?('}2{p.\P}SofSܳGZYgZ(Q!|!Wi`Wj}$9@nf^_O8XH E-:11Ĵ܊g5 ؀h:(o1,cX.%o&P-ԎvžI61%4ߧ/J\*M <l ͻ5@\1Ti HG?.Ip帱P<:lTyMc2FRkZoO4 GKbnwErGxb$!EҾd`4@~HJ<=y}Zv @€+62NJf+? t*<<+W`dB.X5I`l\~ҨUcܹ&VB>i tPT~Wl%j}8&/jB@7ȯk}![5Bڀ ->y P em:nn"ߧ8vP ƫ%q.X=8i$b˛jT0 ~=I?͊ھ e_-#LrZ ~Tc[Ub&PV=9+h.${T"Ykdk0֛bAol?,&f^PjG<bHb1Uqt.;HVQJ2L+PZwbBCw\k0)kCڝ#@9WmW('rO/Dq֧}ĞU'(G&؅(Ɲ0ngf:EOw>B"$g;`R U@Y{ ٹ514L(u{KhcLK8#JGNs!RTJ0Iڶ)5!B˿9U[x R ;קߐ% ²#ZCn)p5e\jw2ƫnGe`dLWSNTw 80Ad]VU=W7\!e,×$JelX =χLdʏ]#[H1$4Gc_md *bĔPktDtGF n~*{D@&q,!B)#Ƞ}ƣ~EV{ewX#⌄UM*kG+e$(cB0E_ʽV+a;cmTMԱ2M݀.QDWǑUŴl4=6K˻B FOs]GqgURHKuc!,6K%bZJwFhVs159IFXcOf%mj6v1+&k Z8JM%ۍaW\YV$97}u1)֧zW~oۦSqV/l5HR b~`jvۧ5a՜*+ |d VH:n9/ģ 62;|-Y܏Nrܚid&b Z' 4HʤB7K WUDjx@2';ڛEdaO|[K!K)'[,!a{R~}bB<,KC(/N4hYv}INKWvœz<| *ƛoݱjr#ğ @k#(*c$p[P5ƙtK2*RL>B~J |=;)y*˱'fn+qzu8k ƹ2?ii/݁J J$" jO]ëK +@E>]s,c_{ iF$.ȿn?$uC|AX d@0fi|-8]Hwbzf%(6ڟJ~ d@P*ob5RY_sıʱzM_Iue-o,?j͸Sq@}i>Ya5A$a?,cIRJK.[.,GUo‰P>wJQw=UFjxlGg,2ycfeNK_>/qʤJqIO,"<4M 0,|z7nYu)ۏ.hŝ&xmRB@z}f m;W$\{UwEXUPx'm+ĮzfSA+R!QѾd3& R7>ؠh-%&G G?kB]؞Gxsde4Dm6 $B)ugB `SɍٯᴔZ<ƅsM&]b%ZRdd4?Ggz/~޸Y鐨'Gw*)_XT8- $z*m=Nrĸ`Jݽ[KZ}V8Sr,qB@ oܞPC-?Mۂ "_X-;@ M Y(ܬz| Ŕ'XGk,2..*yz`(č -]?OP8 Ue~m,cJഃLb]nKԚւ |KR߶́^J>%Nۇ.i妣jdzRҵ_o8I)"`w0ԉPrOz^'OK YEӘP:e܂j!Z uE)ֹ R|rꧏ~ZX9e J'g&n!i A؏jdA2IE5ԑg  JUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWbvKt%^r2 0b+ P^FWZmHN Q_V[)~e&<4Dž7$]ʝ#y_ [a_r*5.*kaE[J̼pT sUhU[Mv1' J*;9Iv1ǣ1|4uƱgvT4qQN߱8+fɗ~‹%hHGHQ:_kbOV8 PXA<2^-.n#QY"%LRV:8@eu6pXS.ā5?e[Xy,X RJW]ݫHP>͹cm!Txq@^֯";3^E.?eF ~QRZ0iZGdVZol^ElTjVnDK'᪷ĨkE?Xe^]J0r$ch~K~~9xbt"-@"zCb6ip7 ڧEp~.$Z͕l, IO? 9<?1k3im¨(_. -!~$Wԑ_5+TOI+j(\{kR8П37fap6 aRNۊm<5gl7E䏉W. hx76'd%@^\kO^I=w v/gZ[}{V$=+4EN.߳ KXQ֔+CKY A @PekfNP%h ;zV/1؊[5]6դ4*T $o4)fP^56?PИ ,ڮ`#7Cā_PML?䯇إ;^}^S{ h7/%)ɿ"$RX#,dP1-9g]b }l m+iaj?*O^ˆ؈Z-ۤw(($IUQUߓyR$:Y֚c3@M(# 9DFf RX/KP #` +^9r3-|SňxHZQn#Oǯ*[ȊifĎDDtbI Ǘ6gg3m|1J#X-#T _͂E <ź`cihҽykS*B0{lq+n(zYR7L~9OAJ5IIeZek2b>"6Po/sP+S &?- {Wgn**j?~?.lI0k1[Bo\?hӏ6/3T lHyuf0ڙO+X$gMfVaE#-/A`5ݱ -(xaS* Kœ3 $e 6&Ԩ#+@B嫶 `&.^JJ$ >8VO&Lԅ,BOx؍1_mڇ' `&R-XP>||yYא@qdYp#sL;VUG`;b.c$/թ[p)kˊ=`G6!tYy eSם+N8C07zD+Ԁ{aWYSHAi檧(3ZŒRQ_EI?.4+l+l y=̒F9GRy@x䏲+f7ڴ8VR^TޣŅ$G`ioE"j׺וkX+LE~Q |bͬ[]Ԯ2p$H=pdJ!T6W t9!GoIbvbnzb1pZMTk_l.QqOw2<\k~eSRme(.c T~ɲӤ54S@>^GŎb=%KG}VX2jT^B;So\ZYH<V*G/`mj#HW{n7%hK ۧƸV$x[e[C{"I%?k#s(=:T4ce)rh}$aavo ^Z0^t=>.)S^qbƣ.^̓N44S%=^*M@cZ X6gti#A!{'e'a\ot%ֽSp?h_PUUG-t;›Lߋ<֠S. *PI'#iFjoďpNj@ ;KmKr_sU ;w)MHd_)RrɍTE(K;\ܸEe7`?*G+3؞ծ)khh `ar=~BSyy Rv?://=b+C 48:VKDk+ KկLLr8}½ab@k^%/+Zא%w5bi: *տg~\q*A)3O +4 ُbW  Ss丢 ג<.o *'Jv@ o ?o #>"< tIbW35yTx)_FB*:ޙTiƄ%IiQFR"\~Юc)A61d -4ȷw .C$ZWlX/8Vƕ G/7`X:x/,ViU Ʈz7~?LlXxֱ.YG^(;xM7%-D=k\,:L3"2HPEU%ʱ,@L4 En \ {eIW}ᵴ<4SMc!)U%ym_\RW1@ji?KgԎ  p$7t|n d^z_qTGu`>%Ůh$pC9{ruonxDH˜眴 l].mIdu5? W,kPh d5?F}lZaH #c+V`+5ʭ́N8N^;I#Fcu7mk_xߨq)zib- rFlXTo1)Zp298܏l/dk¬CjڿN[n8P ~'lkadf&2Az.QVƵ4 ;$}7Q1Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbL.zYES;n\|8{ lu% 'E,Ce^2IfwwV!}|_g[R3*ɷ"vN1_'W[GA0#YE`IcTwت6k鬐u,W%8__zD}D#GĠאUVvU?lbwweZa6*:^k}nn9_@(c ;O*є ]*t66s2,R3qA! %rb rXġtJPzKv'|qȶԷ'wɪF-u62nxpV{b7W 9 z|*ѺWCȨSV5mWs/LK+,&RUk[bdnR0# Ԏ ƀ2!$|ޣ5EBeZ}Hi/!^{`BP#xhUhn\!n\i'ڕКUK27 V*B(u? ٧-Zc JXlkHoP,~?XI>]^SOZ>^0jXv4J\>*B>#P:?|*7d-GqiBiR\_PBp6b)*Y`?g 0NmGs8 Y -^ O5XBjZAyjk$RgV|kdAװTl 6[YXq %?ir<gzӈ di{1ZAg݅[fStUK1CLQh =zq2IR8ikqQCX`U j+ =CL(R%?_T4D hE005tݝh3rvK+zjiPSw8iDGh]br?hא+SvR JU|?@kSh,``(_ÊYj`CkI7Ĩ}0~&oO#`$#f[t#؞ӊӹldH%S7"^ )F/.4K>.{XXK+6#"^8O߳jn)&^SSgeOVkMw^) Qx+jMZN}mNlU. \4I"~?;{uA҂Emk++njĶg>kŔhSw(Chr[J 0}(f4~TV#$=Fn%x_>5Uo"#e}M'+Ң^$ֹv7j2ª ǰv 5w둵M]B W̡}*>%A0YFQLOv' 2?z >-X-=aZM`iCyQk .[HW "hk֠RhhWK?Z)}EXő)¯I{l-Sp:ZI' Ry_/&f X۹u*IJq _ŏٯ-QTSAԞA4RY(}AM~'+#G&]QcRKARޔr|,۱?/|??*̀.iz'66ޡ/ Bq (ت/okÛg/RsP#Lz-`iEPFj_NQנzҸ*̲1=܀Ǣ1XRߗ\)|W11)яeN ؞=cĿNPlJd X 6*'x/٬[j+-T4 pْXu?`PX_ յx*ҽ1ZCMӫ?̫),ʕjj@^Q08kyF:a@W}\m@.X9IS$ z~ʏgxăӈ7Tx# dN#;_KbVL]`C9*O^~k'%x+VQc'i 7RIcO"HBoScTp, $-RXeV" Nޘ'dZ݉#T ]W ,E-twґ[NP1\|6j\Ǔ;xbVknh vIeX "%4 A. {*ykM,ymr…"]B_ K&S~gPS[(>lz-nЂ=8U}!?ҬyXPVVX ÉX$tېb+^tybg1`jjܛx~y`ۈHdb#$MĈa5ӂſv>O_b #]SYwKv=y.]&UM9b6JObIE R+I^d}|?IvטQSjȩ,V&Yݮ6JXzQڿeDQmMd'0ݛw1C|Eܷ._Vo{-,qI5PrhBgR~N޳s Ajv+Leqyӈy(n /G.|N_Dc_un_É[HⴥE*wk ,#S9/c$jQN :zk?&'oY̊#E )H3?dT3FfBEwۦTElk#:OO&wWo2pv/oNf-U4{/F~ }6fg#Ի QPӼYڴ5:\<8kkcV#lJuO3u,ZZ79>9(88(w^J|LA?k qo%@(p4/<,~~`9|8R iҧF۳'`29_#F8!!&١fy;W"GR*o > :8/ct'`Rz\41kk|OSbj_/8E}i":Te jdӦeYAH'oE(zFPbI-:Yۻ&ܒ0q[LT*,8$$T $Kϼ:ƍGrb6#FՔ ? @6u{գ~xyz$mDZmo$uŮ)N&}aՁ|$޽k͋¸#iSޗy䵶yjE,Ux=y|uo^v-$ҕ⛴ڙAȫȚ (_ŋiĂiI-8my6j)y0%}ڟ-WYv+zWo;/?8_QE+o&Vk{r | ??MzWRRUPBŇ"iw^_[amzXo=elQ<"Ak /I z) Z=xQpf@u;/,FX9$SaקZa M"("C3 >>=XMDh?0_F"]ʸLgBswpUPN}7E-Oa<0?-F_O&#`fyݪUWl%)wQ/z*t|EPS9`# KڛûVdR\V-E``E]J D 5hg^?`fOAI1?lY o@ZH {RF,*A NHw’YtPڿ0y8q(:?W+啥^Ez5DiNoLJj!B[vpVBGRdi>$^~4~7?('N_P~B#o].0xJ׊uc]yGA`Ź.GQ_mIS}-FCBӺ|4xV|1A%chKj[ӑ~-JiGlqQj* KZiBYgheG6z `AߏqߙC%$:MkBx)_YnV#CCڙ­Y.bc^`g_Vz1f%iݼRTk_ Pͱ#?0?$ɜh%ƭЖ %U?dr.9g,]~ #ᆣO5EBz@p$Ƀko$2:߯8EkJ158±6kmiDqBҾkAkWt+bT0-t r㠖+2=>]߁BZn,W[rIe #q\*E` 9JVgJfBFyNzd_E$4/ߒ H!)U;~kRȞUr1SA+loJbğlu9(#WFM?GS@Pi$4^nXS؞%33Chcy~m-cZ5'd[ծf[SALpx;akHVN]dMi G ^38>ZQ%>cMBv32Fs}_Jܛ#3PL{:XՄz A ?cWEߕ: n%"R@EBӐ?heY04gMbSo4n)K>C^2y!QA2([) 3HZgR1]0/U[d"{u,$AXX_Qo'AC+u3կdt縊0~5K j HR~}MY",H([^}Àn.Y ~,,LmXiBI_;/半1 !$녒0e,Z|~,Riʨ7RzSKkY%? ݉//ËJ:W !mmn틚RiEopXsq)S\6HAQT|Mˊ پjWXAJ(vZ[yXĦ<+},gGbGOk[ oy (#F-4$u\IqscjJĪŚrcp=,PeMwlB:>5 ^FĨi |M|k~, Y`bOF*OM9o1[)U(r E9okܹܺXɦ ~o. %P^Ic\?؃J'#_녯t]m=c⨠(Zl/6$pU'6ߗo ΠP^û7v͙C'VcF {]yru;&ߎŸ!?pcM6)Z۬.V$5k0M< (YsMžjv}^ʰƕ S]>/,K8Dlho%;wW.|Iw&ܟnM38yabZfڝ,TDK8"e-[`xn]qPӊmu)IXJQߗi8ejbǒMusu%ϡtՊOMm×4 !ha1SM6vI-/٢zKNz d7҅W> Gj 6-<ӹŌsmHt(Ɂ໒m͆3jF` Qv)4ƴ'jW$B1Z-rO>t%9 XPe#^${bWP,hZVlr4'_? ۊoABkPԓSPTU 7ɿR?O*!o(II=I +δaAO+. j@)ۦ4-kZy[N1Ȝ Z>ٖdt*^),2ZqTiUSӰצt2kHu0bxh?YT@ RK켹bbUc|w{%ZmEP@$*h|"<{lT#m-RV&ʬJե>ӓb?w|{\rPգ'Rz`*Z!n Olx*\(!;X.ۯBu+oWUT޾oN]K.rxYӗklboSbO0-SWڤB[t T[}T,m)GN2]}?忧?.\·ON+M_AW #P u /, 2"D߱Gl(1<C"I~? 5Z{(?\ݤ0[Vg :*o6压kUvVܿ\B\n?pKԎ7Jck1+=ky˪n~'?(* Zצ,Xon@֬6# l(x A q._Q TA X+nmm , )4-B 1ե? P"ˑW졙W-s?~%f.:KoIUOl+j6:b[i*ە>"̿qxuW+tzukg2$µdΎIۊm@!c D@A +KB܎MWApGZm?~vJ\wѢiXU<%Mzl??1TB@9T`&_,%"ZW"ݹ]ӷՓ}qQCe Rʳo972P!FɱdGQS۩)~%L7/Ol,1S,3ӴAb݉`8?i0 W?,UKpfU%?\@AR%2JzNp<0|.)%iƹv#Kz%V$Byt„vhF}*K ,8. QԀ6\U8(Mz(׽Nˁ)j:w?F >dF:}ϐ(VTL0<+Kn#O(qSf*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*LT~rcBdZs.m }= [Sk A00я㇥c[sؑo9^MvfGKn)]s`ŋ ;/ļzqzmRz,!=~(15Ѱ(Jz0>ҳD9<}m~=LPens9jCm% Hח\|vU##ߊ*zX#S/dxQƔaZS:4*85cz\Qӯl|*\$=@>8p5.ɭQ [blSݿʶIeh]qHz=W)+~%-[Z5b'Vz KB āC_?k]ZB8{v֨$%?FvqNJQ~/ph%I k;VU,M."$4ckӮVO Kj8+< \ԩY&7ivis 4_PYfDO1#!oV"i>rL[A.⶗e5  Gno,+bzq hv;>Qgj;cK;)}}]*Z%Ԡkaev?p5e+ B¬:Kn҈FGZN_Ïv>Aa|\xo.5{ QD?7 'ZI:le9F S?dg?5]UƴPT+d, !u5AS4[zRۓ%#ŁYm_r?dT}Mbi-1~VՇQ=Kqڿ`6ЃN.N?l-+ g *95%lFwK)%jO)[kvz|s_moXRNf-j01 :^F$(µI ^AyMiS\GqG@K?}!2+mQfo}_W,bXT|5޽x^D;YL uc0ي~oF8TAʭɪM?c 1 ֜O£rb&E~fE1 6х8p(;FfgBl;j%~/c"E&GO /UҪAnʡىiʟkҪy~Yw6 A )P6ԭnՙBҴuYi jlHRb)SMrtqsm R| A JSD$< hߴRB$ 65'),A%ũ/mZlF;&~&"(.k0c6(@r^`83?~(qPe )g..H0 ^#$ ݀yT4hHdkF#8 _aMX |Dd"'XK1;F? fTY 6FW1ҧhܷP:9'`4%5iGhop #Hj(׎ k~" ~!pm[V(ezْQ Q*zH?ˍml.$rjOK7ᑋɑXEmZM5֮njx Vk%$2H'?zBA eT V{(5DY"Vaֆ>6']cQ0/R/8xxw]ύI]6+5%B_*7ٶ!%[A0ՠu2dHrF?Ӗ=h"xXѐ^j3e-4Y : :դ*Q Vh.k\%41%k¥@+W *f- 2Fo"0Bb?毳&o hBdH@V޿>?OݼDBNU?Ai{FKuKXEkax.CG!w{0) O%.P^εcO+gb˖ZulkA@StͰ~//dT^߳D{b yqFd PQٿjX5[ԔLvwJ7d`}q$W|sc[ TᯩL iO+$;Wlq:CglEE|\c\jN8,k7nBsW~15@7?IDy5ߐ3p"ȿ wH 1,&| ))SB!A܍Z`+;!j/@)JV_5d^+7(]|418_Rv -u_rW¤7`IIշ8Nm5Q4S`G7a3# L0<c$TmAz>q ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثר]*ϭr%Ȋʒs2؏|6<oK,XN)--a+zHfjFj bKPz7.wZug Dܣ;u$-ػRdٚcaύN2=ŁJP/`zEkWxd?4߯¤Z!Nu ’b*vg5ܓ[Χu"4 dW hF9ޛH'rk[#ކ)X#uyj&)SPaGu^F0ҷQ6bKd ӋI\G!c VnH7۪l)@=>&4o @ Z 9͸H$~-,6OlNh.;6Yәg|?ˇ.Q2`7; ,sk),X8"Ǥ]14l BݲY&4^lkǝSZ\,BFw7jVlX]smMXqՙiĦ(Zu8nR N:A*i_6X S֟; Vڵ0P6W\F 5 p" [ǸpVltrEOAqIwft3rA-bjO_cE9yhQ*:߷IkR[ؤEfA47EuY(\f3Hsaӽ6lmgvۉn׉ nTZR:)6^#\/eyadŀ܂)8 MOl `nmEVKN#<kG%R"@ε"Ž=-g)I1T|?ˁu;w-@=8XݦS!-#^-k%[p|J qc3AeDZd** )~Ο,t< ,  ('qX)ip[icF##:ļGEݏs\,fE%?RQDSRVb%VLm@O|41,<?eOjF?5o0ĖBщE_VɨJ"ۿyV cRh6ɕ,- Frqa-ji/%j2*BH N~C?z쎟Mqmӽ2Y "Q&b?x۰jד'>% ]þE[.EB=WiU9NˁAMo$Ae(y9%㕫|60Oe$.WRWlSbN ~8^ݹ9 Nt1c(x5hS/P|_j/ᔗ8`Q|kW+k%֡?8K8A~, Vg!@ߵL[lȯ~HVwƸ"M m>sac[%,VbD,{;m*GA ݳ fGw;}<ۂT~ NSN!*׷p$Zl_ÂHT ޛ7qKɈnhfljoakL%bv$ &Wdq!Y@ZmŸz+4"F$G2CX, wȌTbj~l)9h@ViZ jMILTZ)`!kBΝW_,@ʡTlKHl#Xn _[g /AaJWZ !ZTU^@BgyaB:=GԵ-Gmb?gn(+OX@M;.l NU4eA'Jm1P򵩴Ɣ#cƻq& 7Nu).mengAGqz|orC],6nyKk[yo' fa_Sj!OsZAX6{P/rW/TqyaT1&h;reڮ$`ӠN0# W^09x*ROYńwPv).V؞GN8L'J#UcV& H7Nzېb;k0[kkQȔHSL{0\&֬xTuAP;keT/#Bahr ҤسdǕTcRzzeѩB)%*AK-lR*g_7?W&pz"X6Mw'X.ڹL_IXT`A灧.@}؅|H9:|ٿeO_%rF~08U$;F2~ ?6'pG'ڣjU]:'ԭ!{ tz*U_[otU @)Jch h/{O -w&8>IϩzKR M.VÛҀv(7[raolV䟇u_t$ӂ/`:XeVsջ##Rig'Ooy7[߫('(N #(=6$-Z[#r*4jPƲ~/U~OVŘtg`"lҀH@jz}Y iab:@@/2t=Fo!ځD?'yym20 /tIoJA:ߔ^?͂#mj푒 I7ma]ڄ$rƼ|_\;dB8n4)eH«V2 2.si7bK76^IJܿ" Ӓ ghWZDa!J IH˃LX%$+.ZR@g$d/[7%FѺBv%w#E<Zr%Rdk U i-re]44 M'*[D;XYu+x#^Vѓ8G-'|?}X+NnÀvJbI%8nU|T!(ȒY~l4D???2 h;}cNm2--Q朷;qO\q,iS &c!['XבG#챥͊[C |uZiF%ԮwV}f_夌n;}iijBRuZ5EE8oոԁ )o|%2]/V4bzR2Mzƍ.h#Ï`*i*:%zw2q?h`c@b^+1|iNuI.% 'j:b2F> #mn$F OR I`l)dWWADrYF n)fZ!ZUJw+u; +%a"VTo4,2FAIg~QB5=Xl?dzrc9@_?Z~]ԠqݤM~fx6!9L9O ) ͻGc/IQe~3̧u6bRK7'D6$K~_CJ` D;V%yr[G Go?ZF"Ň]>\ƛ,5Vv݄MΒY_&k$_ &;dTגT1Ы-B4 mXXMEgo%m>y4qo%}j*2 vZF߼aƻ~W5h9 F~ʈAD}_gp-Y_ oWXbLLŞC?_g (Jlƿ-Xy11[~Z*(X+?Ob@@6F٭Ӽo4B"?Fu*ѣW~(Ycb!fmfUUT!դ\D'3Ӑ=W\uY mңR-;c8~g&fe#/n QCPr_% IcHBO)"5{;VoHg@$G\ߤxءY<,f8刨A$Wb<\ȍ:J]kq.=%bTeZn%PS gĕ:ZqTz;51AJ( j>/h)j6S--b8K[kHcxo^XZiX=7#}{wck $`)m^ pVafvfzzWQ# 2ׯOտk@o͎ڱe2E(fj 7_VqMIbUyv#NƳδB<.;XD)] )yɯ$I;' Mx|56 ."0VG@w,IKi.eR9++Vra%"(*j2Bs7p}бS}ϦE132+9$WMA|~cpx \jW㝍Hڽv‰m*XU#^(EIfN*i.+n#JG)W?Ő(-VJf "̧'b{=7aAoNhg@ǧ>>әA:u"QŽ$f[ _3lNY$W gDTnr4%vb?8-:jƕZ IbidO.[,`HĖbI'#&z25hA@ ; P(cDpBȀ^yKX2΄U/RI ZlAԵ!4$XfsAO{rXg&B3JGB@ӦXCɪjMGq;4N;5fXǠZࠖJ(*hxXzgG*+Q2r!+ O嗞LhVX`>& Rd"4eҌAO,2䆉֡NJtq)NҦ)b{[~Î\EbjO|a@ն#O|)*C#4jԏ޿gOrp>1ojH*(o'uj(%|?\KZ+(+[{| r) z-GR/U&JҜ^`dRnAG9S)f텉M.nIaZȗoA~#N6(-TX 6Ҝ~ =!z *Mtl-'ăP|y`:&ǵ )NܖjCH $>(gU(bz tzaIjK"Ӟꢯ8}`ʻ|:bk/x,zG_ĵDhn m|+vy|:^GA)CV'^?%hcq_Kw']|bZmǯ&.20k!?`;5Wo6)&X#կ( 5#NoJPḰJ+T7$iǒ{#XUKa]J "[%P6` H$TsWkži冥oF}!i~M8I\fݨp( Ե};}]^/](1G@5H R5݇-WŀmNq0e"g!+M"smyۃ`TVF )ㅁK(e'jg_*_L&aZŨf1o(+/̰zM"JAԦ+AZoH.BU"*3P< 8dPZEkPۗ,JqF.dhDwK˛4yMn*#GNLˊVAڧm@A[6I5e`Uw 6id"OH T a!b:zEKd/nGO=2xnM[j,Y#!MXe_mBұ]ulzYwṟ̨)! iѤZTPv+cvҼDmZ؃IeX)o3f3#WQUy|?%ʿVBX=iVYH5[5 U? #?1N03eQO&cr[sWp$?iWpO07 B?ۄaaǍf*i?w;Eko!,B L)es.j5yYTHc^t*`/2[HPq3_6/%@քW,ZY:@\/V{WA/ J-|jHk5h+V?&^(ȲRԔmQPo?G8v&IjL,$G5]Ks\5X*jI_.#PI:}7њy*9uZV1@rAg\*G#;(Dr9c6` `lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثH~kv"I˙Lgζ?Z Eq1ir5]` &i>k杧*HxV(g^!26E05}.cpyN‡piG$6{oسز{(50M`G Ok_֋@,'i*ފ,Ā*ńE ,, $9eFhA*(>OivK*i{}뚝`#x^ ݹ}<[.YoVbG DG'yK.y`/˒7\fvjW&B=F~$q^w7=X}FȇYN_wo H= ~G¼5/YWWrU8M\JP&EjDn"2ͰJoCg :ͱouWu׆iX1C_8sodʥ4łi6<9=0 RB|pۋ,O~$U|*{D;QrX !@<ak sLa 7#`%cL. [ā c+P$qSJTl ghAFV?T"=VJ4#oTE%͈F*.< $l7\ )> @R8c  \R3@@LPƭZK Q ٯ'yb6Vm|?li)z9cB)4`ӢY7eV&z/ZKeYbE ɺâd?VC8bƫoo+~/˛0b@n\qe]L>ˬQ$F.9+7Dڑdj 1j%Axe1ՅIPž'co, D7;@#2ik6v13&m8 U޵ߦynV|MqQ q۵>/u|G^2;}j82̄AfPx@@°@xQw*fkTb62p% :=L&>`RIIGd?ߵSקS 66[ʊE:SEe!IjbPX)ֿ,Yj?ҤuJh ׏,#EVڴWǎE14wq3Tb$FcjQVfSRM#RkWHIP}¯\En0EO)^BiMH |*U!q0p hE+4I/4׈S .]y~&6WՓ yq6134"oi^<+HegtY2짪{}\Qdr.R(WJHbⒼX/$cY?ٮ,t+MʀHlIbA|-[DbZ/ q x&+}Y% #?:+.^er1G ݿarF*nG> p,oS b]cUf}O~hS&gFoXUB)س_K`-nv'b-ho7 s_8MFdTr,S좟U}??.U AATԴm-ZHR~;/6QwlkoIp#.Fž=Z~MJVjpw„?4حKEЅۮe;T.i f+@gz6 -@~%5H&w>p:O.3ULqTGF?^KUn.g> {DWɍӌ4'WU73[ۧ ^lQLz{ueRMN_I"_J8!V+l&oP¨O_,)5-+;dn["'b Hܛ "W׶ӌֵfs׏'7IRN]Js3ۊtS__Gz, )O y9z.xnmԍ4M:(Tq)Rh/sk(ed_dNlWII- UH5'/^XQeִ#5^4?gG ӦZ6ģ,Fāl@' Kd/:/J>`ƺ"I8HXHUOݪCY8Sd2'eIyN;X)5*у,<4BT¥=JE#S0Fd`Հ nHQ4;?žF5O$M繆V2}qګAf@JƤ!Z%Q"9H}3k|]HhOm! n#wHAv S О+xpYYc5?IY;8G@<'NE4I/ѩ ObǞʆKtV)'r@M>b7y/h]vg(XR8S>$_-j.?=ҧ~ .$H74iznV[/X}_g /Nũbn뗖v:sxhO<{3L5N֠􈞥g[Jm}Iҷ]Rϐ #gmgs+iqsǩ<1^i8alRBWO܍?m!y0h oeWLç)8sgm}aYxj}2?UphʹEa|S[|qzMv D vF՘ oZ;Z͵BU jX*;ߕef;#n B_)$R?ݹ#}ʑ7'Upyz Y0iZlgw#FaNK!l].*}a]oJxR3 hlP׉?ȋ?ƙg3־mK[#OjV2 v M{Stfբy1]aI]B\|$6ο('EϩCq%_T>I;WĢBjzOU8\I5,Z|mˎfҽwOZ? [ G%6 ӄ4# 'O+AA - -i 'TTXac֝D֣M3~ܰ ^JZ1??oq0KzQ t?~&~\]O9'p"f(SmTi@4民0#yB/f*yVkg"tju8JX61&W (dVK ȗ6$B_OV~i%OOšM:Fˊ6*]j\._km~) o4U_.JGDD~ko,6UJ0GSMEHwq%:RKo"p5_x #'YA"VmuZ,AU`UZM#u?cjvaiKmrI0\SF9'㍸nYĻpWMJgAŪ>Z_jfxK; -b2HɾܿKv,1R+/o$uIwdAW,ʣ*<2,yy)4s,B+N ܎'i(*E (i:MTl-ԝAIH:2N ij=;D,ⴧ!$)B+ߴ$-G.?XwDT/O22nb8B[䅖NEAP,q-m]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثkAYCyuN#Q(nO3@Uz0XҲ>^8˓r$2 H"~(b\@k0I|剴o:ZSڞ$Tw|[$6BxtۛUf~ Qɧ~_HIW$- ~ ) h0)+s"KynǦV]\HeCT8QΞe4u}iaʾ/KxS*O;jWmՊ #smGV?cTcoGRI"Xݜ7oq۸Gw_k/BRVi+ai{ ӌ6QR+8g4Bjvjb5 -BX4u_p-VHbj\},]RM:)HxNGjq4ڄo* xѳ``EXj&a/d_PF__S_,kGϞ;f-ף׬oKg,O_~ n#ic>]~#>Ff/:n )g$CObEyoLm9 9_6W5x&jprw|t2}r3<7r'b{3Ae`ŀM@1䥋QeҎ2Zs*~˖i#T9uM33[ ^L@zWu6aǑ :A]ݏYd1Ht&#i:qAıKc6BՍ`W-eM2,bNAj>ŀ־}=d;G_OrelrJ5>+dOsM nJ "/~$]ZWZmo +86CJR\y7!)V? '7YM٧<+TQȯ~/ .4oa؜,[ 1}][Ž.I'lVRH2e2JHUBTӟMxoۈju?"ZAjڛ^\F#Z@yÖ25QFI'd\G4sF¼P|>,騢uDu }FNyASɉ3{8v!RWm֧fVF OxV乚J)ƐpA9%a Hz +smgj2!AȀ}iGkdkȑ@_yMwܥ=%R׉5>?H0^$uE{4#խ.f\=G*?/DpJ\չOȖu]'PxC{j%`GV+$OX^mRߔC߆W `SfV G\,Kva׉jwi6:)WX^ğĢH%";!П>v]˩#\,PS#~spXDZ' [TUZ|Czzt!yJ^TB!I&CJ^3ekJ$B P d=P=w9*tW0tL.ۋcu עݴ0۰s*P]q_i0CJ(i %(6@BXAگ; n1TSr~-}"j+1 e$s<~> #8E.]Ÿ$t4eBXwo|lWnXҭ߰Z Wq$V#܉gߵ enQ]rYT&;"v+<["E Kb\|ұBlmwphh?4piTE: IZMu?QG627',z vOTd p|9U#_H"p~KG4wאb`}I DwbRF Q8}]}޸h$cG)IKeEycSY$5_ӎ PQQ(bhdmIIn"N/#FA^\"u1@)f}ְ^Dׇ+k !4UUjMi EuA+ׯ&Г+9waQz) M{W+-V2Hj +˩k fHIҁJ%jV&$?p4+nApi][ԟVkד9r/l|ahwOcNSf ]f PJ!M~dG5* ŗ'X! ĥJ4`{q}B"n Qɛi+{GX{FhXWSk8*BOOZ}TԬMA>TT ӤckNRispޒ; -T݆*Qu9qZ_{0 ,GRz/aM'v>9HExo)1/Kpu{"H cznr畂)aӭjˉs.9VUHh=䘀"G򶜲E$?ZY_f{khvFYݮ^G! D9 ?+Q?g'Iֿjd5 "n"FZ~:7\7tH<+zRv!"1?0.Q):38SU-I$ 4}T-w[IjԱ5rpaF+`vBP7Ȃ+1C480T_,5"Ԋ#);'CClFd2Pփ ^EK/ed-K906?ȢP DܕjcWإBWʥy ;/YRެq I춓 )B3#6]ڲ]DSKc j[Z!jN-~{t+p_ (WⷸIt^HH*alj#o[K+2B6ޘ6bv@KњKkhwv/\I0"-8HHn{ua^Lc( SNh$$un?ܾ&0B07=p2,6D2F-ݏdc .մA9?( JIds1aJ?MٟD}ԧ, 2Ӡӿޤn5on|?l*p*]Y&Ehs Qm-J}^T鄱dR~+܉B›Oo |jBRYv{J{oӭ; ݜ?Ҧc `£bżثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث)fm:u64Q1P\r"@,mgҝi~6wXE2/134 ēAR6:W#~-/IjpC+B>Z6ZPv_|*αl=%v A.6~ 6q1,cGo-醪XנN_4WDj|"z)o i\fy*HcwkaEXH(6z? O#*VZM}[7-l|[\9fA cIޖՈrЀ ʊk~@%K2 #eb6XR&2Z]{)gdm51Op|h参,ߊmVm}yX<2J;kƣT0k!Hm0,4X5ޥy//?눩uZRWa}􏣋Wr,S}8e axj:/#d_5X$`+'A *8?-**hօkOCvT$18ٓ].Hb$ 1 F`E}osQ'jq?ʿ̸GoBO+\-g]ƴRI' BR qAcolUm3:&i6]'>4`M%ײ[H.tQV05W*~3P|KzhL|S)e2R] Wsʷ?_yb&s%)S6L[X( >/_BY(55-mjrY_]ʀJQx;rV1h UЀ8݊i^i}T?gp/.>4yەiiN{n.Y~ (go,>nMZ0FzmH)C\}HW$"dEo!H\ZI,r+isyp )"8*q j*8[b`ӝN$\O&P)??}1GP|i{/ݕ"$"nL>/l4eUڴGƟkj;=gԦK$P}5Vv?f|zUr?gS@?q|U9KE+L,H[ mcI\*?_cQwFzߢQ.U[?dq_[ʹr#1ev Zfb 7n[|+Dyop;%cu nxq/'kl}§kA_ji4~Xq5kW )e@w \Xs/qNw94WoLJÂ&f|K1@A6J zT e$a+ Oqa-*]iN'%` ke+A#oSdVYZ95@_-?i2XEP($w?V [y_HDƿ?>;0!$u4-Bjӹ~20護|?˂ci *3z K/5lNcO+U>'&SXր |1c[zOuF"tV-V*yRdF0އ*"P2 j}LW4PxM$X["[NTA|+adJZp f6$r :q^B˭IOtNx{xӋ2ߋyf?ťhJ⁲V`-TLH#$HKf-6AܺQJ)4^lrE IuZ!~|z/D$#sHU5RB9PH¤ MK+H\SuXSqihdBIVLH.K9oJ}sZ* (hdaK ݙ %Hx8*DYXxw`bj_1ᱴ+NHk:?.+NA’L-H 'àPÎ4*TƴkPXƵp8xr:*Ҫ1#侣2{]qaS!W8eka_]pEbn 큀V#G{̆B}=+_WX_fWxlu%gs?dFX7,5oa̽AȁLUS_QᖥMA ot=}'L'wv/i,}^"ڕSJ?OZH!*VN ƹK'e_ⷋ ִaAhtٙLB gMA%ӓ#nC5:O+ivn-LjKj7Y~45 rݛ݅eu/4ј;.5˻ڶޤf켗߳ˏcxϪDI4#a+j\)V*hn)o꼠ijbB9u3eL:`"oر ` y$t=d9b_SgA3ئg]/BpωaS.Y>Okq%mKL`Jp&\;JT pnY_"7™O$ɝi Hȥ /$H4+"!Ut6b g5X'j0%6TH0kƅ)8\v)L!WɡԞF3y1~lثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثH3&*m"9^Nw9|$|.L7h;EQQ4WlzlJcAN3x75 b#(45\9#~\-V("BASB>C$F4酝MVJnL^U&c eIRrOAlj$ϖrI7ՠQI~.Oj-U^_]4nTЁۏMdb]:[#d?go|OY̶v #%!n_X3Md+ң6ěcoqL>G`SJ6M!Lz3&d\W8HlJA'lJ3clqooο͍c%Ҁn"ʦ勍Bi%B%isVV5$)| gòVG&Y'#:hD ӹMܜ S19KZZi.h~-ScFr[j´XդK^qFh?j54m`UC%]xY 2K-Zck@ne},dAE*Wo@Oӊ7L㷜HABH7ސAq Ԛtf/g~`Zq$Pnr4$nMt" ]]1b ܒ2NLzG/,{ozN2&N(2B/,je3)(^MW,"wYr QOe!@xZ:@d/.+6#F4ۯ'pRT?o[dL{UuެdT3zaiCSRP.4ɚ`Nw.9wnoK~<"\;F7S:dpAjnOrzzUg?hÉc5@+pOM&j}Nc;E{!5tq帉ʊ?&#"{fpPg]xcK9~*?]*>'*K)%1r-5OVm/ x~HS8Ax 5ѫP=GE?)4Uaӹ=O?N,7Sw$%s(7ǷZ8}2I`ŀT{[건<]ߑ 2bRSYJm ZMj-H]9#o]:%_\{b ||륒~!?iT6'l__'[i,b+x`9~}m.uƄGJ=9^Ky/.\zcks(iM39?$ j?goəO7Dt-B[lSi̐Mq(hsToɗ=*-{vdK _h}^r^ŏ.jޛ3[HC#@qpG6K&h^kXVEp6.ɾ*| y IIU#~4K;q0 #_PM =``M0̝FF媐 E@mE5#:\,{ 9e4raċh{bME˩Y[c.^Vdfo\%e`-ש(єc=|X>o`NI @b! k͉޲mApPpw m-fZ]\@AߵP5)PvI* ySN>i-ԃʼn}_InC>|k =hd?tC]?&>)IA*e|x2A-e .E?&?U*,I`Ԧ\rAZnK,J^EbS~*|?_@ t@||qekX"˱"c~6iI \Rs GjnӐNիK'&;Xkil̯'I(Z7`V դe9+.^UU`i@kY/׌<"̔ȭ>hy; Q ۲~>?Mct;&ߑ <|96 Qi#W;P?9|e-To')#tTQ,A%5k6-DKuG}4J,m`Vj8;| cEťȲYҦ[ D{-+W73572z<.Y#Q^iLXGQ f165Ɇ!iv udabS ?H(D"mGZzaSu{+{k$+Bi7ĬoN$Wl| n2(XrA]jmo?cMZA)0QoUf?eS[vH`1 YyG>'bU:_~\G,))V |=&LphB*k^G8rVQIakAe?d-OcX#OT4,k޻끙%h&ĊPؓ?i'aM3Qڛ@'">eFLoSv sҕGjOTMd c\$ecM+viY-cZ6.?cmnX1Q?䜓+i'Bh Jʼn|?g -$_s53~YSe#,mm9VCmnnJ!O72qY%YGU?p >ȋ_*ai*բklJYdb}2ZvEiim#\گ 3MA,KIKkmvSg"Lk]ߖ2]98B-J++vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثX0،U?*{[Y Hr!+Hڪ!Bë{grЈR+c-X67>*ώ-cjJ8 (O$;`ēZ8y$SA vW5cv5Q60ALIe5vVw )y 'h&}7W׽((G%S关wMISۉ/ިA5j?N,M.|,I#ƨ6n=ד8%9 9RV[[. w#a_MG*n~oZ`.fLXSRA:XG"Pm›N2T8YFVt}h*w;/*.Sѓ%>뿾%@R?t?]P G"*IqXYK ?e~U pkJ0HqRkBGL$w f;H`5x*-JO.KFeXL c$r5[ 6pwbUcPG V'k VQ:1:F&Я%Q+ ney9C샾$Z:N["hEiA/;3~#߾G)kЋH1{q' #Su4@zM.OH$@b-k_]sp5}ҝ6iWqKUwI~$%~˯KJ0 `%Ao%vʳ#'tB-@ލ_׋^6ڄbGRS`kі}J8+ݪ8@ivWؗwta* ̔T<)'8e SU\|1mSR[ukPR0d/>sXUi r|!kS{ +H$Z q3P4mao(jH? n|F$U|,eD0KoTzASWӃ"{a졶jHv=k2F)ESXv8Dzs Ǧ2}je*b4eV**l%Aꅾ)e+3v>zFci.$]žNΟL-+#FڕbaK7#zct?Ӭ>g޲rhŸeT^eGFmZH!I\q2Q)j><0'*H7Ӌz9p,H ?go'RMFU͒Eq`4TRf.?:h䂢;QTIesJ)de;+rW,[Q?EX)yRHgHG_]7iw.hӂW#n 6+{Tܔf4?s$!H{(cJn [Q*/7^n3޻@ c ogO]  nwm,V2CpmOp\CY:[=ev*bj(x5? 3UJ ql_]-{,4_/?ȷL{8\D2i]E'y=N'Av4n)0G?@Ha{ !aʧ> l4ՔqhC-T/Ζ6,վ~HBJMZz_^_.uX,Pl+@0#ؾ+S9Pm^+j8-%A*U>?Xo1'AZR@L~u?g\~xQjūNl!'d˄OyFT1#SÄ2Cq!sn;Zz}Υz*-g4|>_,9aC(,ӈ퐢Z:|},Fc5/>=Qd{6;*nt5#8RI Z0OJ?F-xI DPՒ@:w℠=ebg.˔>*F!ũy҅ģŚ+L YL`Qځ٫( ,w8*] U"_:wX== j6)R7C,[g+Jo(7/~R4QNNSX{Z'V,HVg+qq=QӦb9/o Kq4T%DiJjYeŸ4e-f)uu8$hrHLy{~?Ŵ˅ߡ_ƐMy{H|!d,Oihn "-SN2iQHzjyzr<9bz|GyHYhA7_WALP{S\-r>}qB;ni /)EWեW:=kUc+r5Aᐔ[qn=#bKb5]\\! K2O?,&HhGޛdK;ͼ+cxMĬx_ٯ$3#}_'b-2]5S̼֟p}D*T+*op"]w~[PY$lx&2X/W%ۘI+-n~ E +YE$F)#G>h?q[ ZBIHlN,vd}E2|(7߭|1*M(-[S~˰ UxS9SWxۗy#P-riQ[ 0o.j:vl $,DG͇ň,35_qI [R;MZܲrRүf1HBN M x$41FIOe_1HѬ=3H쐩_̭lBktQ90URcg~9v1 U&s ~FdGvEvOÊ4A'2~:ֆbYj6W xuqe'6`HNf׎c,(S+3/Ym;Q;j럇i )rqAR:r$>kQ5jbwi?ѩ`Q!mWL-Z#'i-BVd!i[[8UkR2%=5 gąX Ј,\i[;av~fhJ jOU|@B8ch&)u Kl͹M#R Y;ku+|p;?$wiDO],yG.^dK|HӦqD28\bPثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/v9Wv K'D@A< vh4*Ԁw߾Nᙕ(W5qiMn.&b X20/M5v+Kt# N mYVo@Ŷ&ѱjmr#:Sqś_i>F`ew9oO|-- ޑ]~o\}ĒUSִKi("w҄ ~&ǦAh֥Dc#qz'Tmֻ$n 沫׏J_lPջx|X!ll xꚧ>ˎVÅK+m9"4,e:|Cte ~(V@vz4ۭ4f2h5(yEsU/OHi֕z.2cr'4EѩWU;1J)ͻP ?߲pUAbҤI).^HDPuV5 P N);"b[u8IqhM[d[bn޾tF-1ٔ;5[{TC_"4w 9|Jp"]9;MS:tm6uX ?Q̗h^g ( ]kYDpB̎@XߍqL;uesN6 X75).Ou# K8Rki!3+Hؓ텁  .$xUa.O8&KzGl6I]sT+܍n{rr,E)rU^ ? 4|Vv ($}\zۑ qw&lzp5*Uxiе2J@#z"]:<5ec0`~bUoחĿ8:VPbfX.z͜W p4@AېV8UatZ@; aITQwkruH)+_lBvƴ5řMtŶZ+)RÎոsݹ M @G#I=ŴYEXe ہ_\NK=85&o/jJ Fϖ\F54kXN;&G )ÑC_.EPYU$ 4Qd wB Z}O~w)ԗ*QRl8݇[< Dm!HB>b,V\+Cr/;Ixq.QN9\ם-Z/P"fTV{'?h il-Ciړ/8H[v8;걧*zN*;5%p31C|XHz6,(y7.@ gM>]= ĭS&"Vkӌ1*w5,I5.-";GEPp<g)%jDhq i:P"ffv)˖/iFwZH ]WJ8X)QPG'~R: *1l.cpk#R rViX ]ֽ0(8L-(YE&?_pNr &Ss^4Ũ)GƏU-#;rL~g݁QZS{~ط|-ъ Tj/~")A_(]1*]s%# ]‘('5ݼmE`sL>0Yi:)3k`->%.ixG'/Q`Gpi@ړYkCyP O U qcLazf[x!!oڇ5ORVV#)7˗,">UR\Y8ecumNv'pE;ъ$iG%mb5v x|UmS!1M :Xn%$Su.+r?,1N]OъeDQ*Avmqc\h@֔'"Jo@,^5H/'.P?RyMtDMvYP(v';P戩⫲"܃,q3,SO/kD%V`@*I@Mqio2Vr8r$EZ^Mؤq_Oqd;IPۨ6sC`/G2T޿#Vp*p^1exw_gY萍 nYg-GYqߊq-Bsjܱh-jr\]j*ypW)r(Hp0h}:bin%Ge¦A_k+b5LiOLP`+mfy_T3V>wVB:)8ƝkԵ JVC8'__,.JB*9Tum*{$mÉ9rP_=E+?Z fWCF,*%v_y|_i&,R1tX6Hkx p~~-au\$nl,4O/E[P9q@Sf*q[k&'E,i N 趺}[QZSPQ]u[%vEY[D{BM+mn {s ƽ?kQiSB_7/erl> Ifm N:TˢTܡ]$H}dS ypx 'd0ҠHʝN >ezMUz5 1eIPvv|ӗ̜n4U ]b>^8Fm/pvԍC+u*I-;$a-tXLm%~H〖QL(;U$X~j: }q P\G)r )2 Uw*9Ҍ| orO r+^`˶ƕxP f'b=~*; s7O4=6P:C5TP/L M~:xi6'nz|#GA =g/p6X],mۚEE<͑O3U|M6—85G칑Ӑ&|^1 Pثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث+v8.*p;MEb"[7՘)AL?xOCvV%o#פ"9GH=7٫+ՉpL}Cד8zR~.8*ۏEŦ^ż=ͦ(%em+}o=Xl-"g*ƢNrT TBQT~MDxAǍGROCLJƌ֌(Ƽ;r{lZ nWn<͸U:`PAO T 6 ]C)SG~iQ)kwFkڍ qj 1,O>łЇg "} ahb OQnxF7U.YG*w8ʗpXRHRO.= l8 TpUe.eOV(~. Or_SX.$IEZPПXw ۛrU=>/S Y^آҽrv c A 7*WnEO"ʯ ;LDZ1ˈiKY撅^0X%/qn遉ݻZF 7 gj-9 vg8W+PB΁(ys1e ۏsbZi^4qn[#~HmʅGBM+텴,ѵ2L `ʝx1oHZ~φ!@O<B(\Wnby;8J-R7!2[^J!C[>(?h~%~i |NAfl%T# z(~f_ąZVj3@IJ(4ٵE6vdk3'`k?kؤۙ` `ksYY"o]e,Q,ۨ<}22Mss Z*#TUxXۉ>ȔݼqL3j z3u>[d[.Uy'gM\}-7Lv֐-ʂB!81MV€Uz O1`%jyr' Gw 7 7PDdA#3P4E^rr?ɇ'x*wp5ε^H/8 r K*(`e|}wxY BqX׷'ג?ܱ>9#`h*@Pָ o-{+i%./ӏiW.gGʿ1E&zv"R{OG=G*I6RBA=@>R@MA #V OSdD$V኱fI`&N .UJu0(7 e_J yf >Oyc5@4*8BAacxHD%)M0My.qE ?I%~?NjUN:X=Ehqa]ъ{n ;Cԍـ)Óy~_#L BG"WAqLQ)44lHR hn7X4u>q7`r@z,14TRx,IhocBЃikY_}ZjNeVxm"gY1ǿjvY<;mIh`_$pv:ϗz!ڶcQ$2L-]^au1F$hS_Mǂ^j>#]5ʉckɨ-յN E}VG@T 59 ϓҼj35+p%@P8M8I-yP=^' B+Ukדj=%d4c!7+GWKVJ4#Ɩ2'VKX@FzWmDUP*1dy[;i~WHXF~)BBn: BYhǐS$o^RB?S$jdS n=5>gq/%X[jGBX6ѭeMDVJG5y*oopJ*ř7tb3Hݣ_V. $>LX㷎̯T w+׏sQBB݁nW>!@]Z7 s[QJ=ъx]l,/5x 3nv[5\/4"F"ԁci,Hj0Y])jvQ=ދlS˶Ļ('է[-ݑw~*IV+02"3"EM}glJRR o{oQ hɥ̪JuwPi>.:8kFFY?!{<[kj +Xÿ.~?8tOzH=-S;"Hf1vGQX R zbIq=ܑjS ,kÓx/}ZƁLG'tuYKcRv& 9Ͳ|I~(Y愵X,38 eV}+~_ S3??&ancr(RP+BVgfv\ C-Dwo%%4Lw( * !;/_?2eFըʼnku]!bczԈZ7HPFPE].,1vIHv*|&g^?> gqoLT&3U_۳@8s_D^ibe~'Xٮ$Y,kB(p(閗J~V ^>o|4e_+]Ym_R㉭y(FpN@އVo6#HȢ@ʲ$*`bw],sMw$XZPmm# )IpY\0 q,@Oe 76yf{Y.5kdAD  t? aK42H,kM@+~8KǩK:1@'WjZzp&-.Ҧ_A@Lnz~T@G@Tmŗ5KT\@̫I "qR;i iaQڝpU鸡ڴ> "Q(?E8|&k LμJ);(߸3(ebA u8 4rŷ=w Ewehe@x@n:0G#,ƇG|,$ALejpv‹pIdtkvx֨Ρc?hهÅ-'^Mש' >p1b%@q"V0 G^@5SL>Ӱ4jUqL!Grk#9Rي?`I(ܾebYw] V!ɐ4Jթó#oHnk9 b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*z*P Ubf1WezM]E4ڻؤiTf'<V[ xw)\!!9I_%CB"FtۘncE@+-z9̤P_MIVn:WŒ(8Pap-*FAV]Oˬd0aۯnR.*Ѷp*UsC(Ggt^q_K,Uh;5XƵ\i%*_}_RH8ahV<g`X[>fnqX4WV'DAJ~ip$WCBvx.1M_Jq 9*M\=$\HaVhߨHR]r>0ut'~H}1V馾5WRqT(\$U;@1+§|"Vlq/#WП 1y􈡶]LƁG/e>&8oN'[XX0p~үDfp #C,@=1 _CXgK±O+3iWeWR9i] Y*Yf krw4$/ļk퟇{y>."ǥ{,H6e.%P8AN}*?05@5´iiBYPQyrf?V2n6ȧ+SpH^YOwk-b2'8<Ÿ7|B;'k)! Y`nH7S틕jɀ-*aqd#LStlJ$R|.s GjV6k P,wrH(kBÔ|pW*)\<}[Cq;(d~'wenG@Ob =Єz1-i *PKKFW,܀7ٻ?inT./d-4봳FrYHk ͎(6kn̲y8 6HQO)#Pib­yvG,ejvo,Xs w9>1NɧVCS8ȴOÃnET`ңI>em,Z?V\ZkqU+c(9v^Du[F+FnrV2bScD**uz|XզiY$$pIe 0wqzuƚ-yl8FGq?NXq T#m.HWKi1 99!)NkW Oy1V,-+3ٕgxө`x`xAqآ.Pt-ٸ֥Iޱ.7z@Vn=HV,\i1ռdx8a}9S͉J~x/9Ϫ:z9%@_7`+OCj-Y>D7fn%}.Tӑ#j'f"LW͞aepo~*Cp/kxH`KkTԘfF1$r5 ~(kʋ "T C¿'z|_%U&}Id3DA@JGμvݪF4O0i 7OՋ0Ӵ>Hv,]XN ]5.扺z#j@2<5RC,}_XG3 0;VQTPrѷ8[/0nȬjiƇo+ƭoMmk*)-IGqwQ%N}qQjK4b0Iu^16I *Fj?A][5gKhY8_S I>PU∍Ɓ ?ggld-R6ZH'jb65b[46"ԞGOl,5jC-+#mpɖ󹔠% _chŰq')O-zMsL[n'zXRN%c;({**۫*8q#رU;< QEg,i˅>_ZHݩvoXޱm9YHBۏ_mk ΪK6{oO/ݺ-ΪYwb*+^\2 劔WH-#|5n_ Glb-xMݤV~]YQHsÒG2`|ju?]IVޥ.N%LNw6.!RG}b#ۢ mW`O_8l*ᐥ%pMVȖ# '}ĞchhHS pf>@5ihϧlȒ6f6p+"B܁ranv,kb* w5d,~8Ր}psifVN ѿ >v05\OqJ oq Nۀo8)! ^\W/4s yV x=HlEkǙW_)p$ n#L#čo?eI tŁK)-Ny#)'/l uxPƓJqi tI"CF]+m^|nuޗ%W;{FJ3|g5#`ߵ?c%DOPWFѭc*A-B,xGp$mOoP$NI5ΦEkz`8ihX.OryqGkXX+>&򿝰j4Pj C JEPJW[p(Gjʒ2$Z,݇QqTe9CBAr<,(m`z& QCi[#|67on _fMn7hM<KF=)C hثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb˦*]SvX\Uหb.(]bB~SjYҡHT$2nyi<%= <roO؋`Qi6kq1S9

$*v0_cmjbbj,6"Mcc@iOQWy`;,W^[ M,EPOڕ> RrPX차 K hMT}_,}\ z: ^^BtQ7`m.$Q"v#s:_rKiM (U?dS8=AUz,յKsg cƲ'Z}#:ky#,$w j4![{݉vsB'dde&; dTPګ~{uFO7P>t+2ڔF=P-vi"49Ӆ 1WU H37O{1jZR- PݾWrjJK"Dې4cW-mzcB HO\Y - nM)!g3c7w)0?AOƑ :C}v1-27&'7&'X8>4F6wUFª[zE_hT`iƖ!m;y@#QB%ak Liھ'~L{1Hb%S)č/.<,B46ryaN$ځCL.V^Tĭ w9nH\l7jXؖzֿx/L X5֯R+pSq+;5]8O% HnOV’|u- *QD7ÂuƐMkM4$Q.eFğ}\)h_ㅬ,;vߩNUP/>qW)Kn:sN3z̻1|tW61fFQv3\i ^5yRC^DVO_KǤ6ASTD7Ka{ce^,|X?oK $n+BӋ͍YywԻ{{ijY8/8SϦۑdmw̳&f餌1R?o8o/ߵ% DS~N-`ujʖV?q73ĐA}צwh7J~*S=qfeIVci[CAW_Ko)iSQrjgrW`?B?_ =Ѽ):q_~+qfer5@1b W+(&`@ Z_ז^J:Ro/H&L;p?hbn5oji22-? %V7˸cIiܓ;EyۨeB=K0/;Rc)'yS{pj\ZmUhՁM# 6R/fb aɛa^6Y\EmmDӡG`O$UrN `F;mBzKt}BXal$<҅֝XlI )hX~b2#F}6D :vem1 (G$lfoX]vB`)F|elvƥ} OĤr Pmnv zM^U{RŹ}n.,x(ʒx/QM.=cv/t.Dk"d$]//o,S^tY.Ɛe"-@LhViBڲZX+Őmɬ,R0⊣p'~K@ iMR X Sj:*Z%0Y~,1`Ry5#h#v)EJQӢaO4/N?.Q7w^'X*+qe:}>? QSIYfi#Lѣ'? 6^mbH,749!):~YabPD(y\w+xڧ~D찣y7MkJzJWV5n /j1]T0A1 v_* oは@B.zPTbhg.1J?/).^B~`,ieion|ʐG@X6$qp`8¼z$i1#mUe"$qW G?m5"4{kojKQT97/l1y:-!yj~XJf OO񏅿$P~aBs5M]9.V90?վ/neZ%[6j2wUh?V:ݒ<;{_|R[{xTPUVSO:/ֲ>MV>4boU Dc$d"†4jsy2>F ƞ]5ldJ $XYCOL@1O4>c~'aS8."vաop!$51SŶk{ԭ@UZds4c"cR>7j+'Zed5" 7gL1ioE}-٩ׯS1Dvetzw6(;#U0w##eZtYOzbMMMJ9\v2f$Ҭ.P,7XܛjV3_iJ¸Se9֏ZƮM!O% M˝BWQ7?HC+?AӞLPzOQC^ixhhxsbRGt,D6 ~.%&%4֥uۣG{$iZȏip{e90^`ZWCq%kr+I48H--h2@jnżrkxg#ĪDXIX#.$}28# 4Aȵ#rWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbv]1WevXWeRث*ثWeU,Ǧe]ɩ5?|2%y[˽R%[[YJl~_[[x(zZ?0>"%/ ?^QK{7EcHٝ?ئ*bӎ!#OT>'@U!2@NDQf.#M+J>@(o\E `Ʊ,iP$mu[c+u$r+.<`-a"`br1|VDQAڽ qJArEzՋ>a7PfDPI?3rS.1<$O{DERh*g6'7A\﷎-5-nj DJlNaԎCf_o*۱eGߵ0$ pRWO^_}VUS[:Ɣ/IId_II!_"3!+_c+!:}*dY.`0:Aa@7泾G^q E _ŕlYN- p-H$Oږ rx|_g2E%xX_yq,{V9RSMzv~`[)dzېzx'z孮bodn V>^<6+pM98ӑ뷶q5˥J.lfڅZRv=(BXY <e[Z5H ]w 3"Q u׹o93RHnSb(IQ,$%"NUoEW;mKbIť؈bP*Cx~.?ˎ(=Ԋ[%jH;S$8dӴYpd *U'7:nDP|!^AV*%mi{Q)^S?icBHQWZʼn6[4SeX~V'˱Tu5*Z7VˤHC&~o?k)`G vߥ;aj4Uz[i'v[=r6=1lnES/HBF 9?icp2<3Ab$2&$VKHS_a!h=Ko#]&u=Z a#ʴ`抱z|Z=R-q-ek>sZ!@d5Ŵv;23ʮ F(}J .V5%stm!Vst5\$J{RS"}ADޥ9Z՝3_JH4=^m# %w ӂ]0U$^>8jվ=EQIP~="9)CP\o1TiwTYVO*a-3G^p)"AQg]]##_TUn]K QizC"д11 ͸G%E`X&nō:Vq,.'د8)5-/մh]t)˫şg-AN]4SӴe,2NG٤o)Xc jˉ>8}ԓ)*0FEZïu:i>zHkQSO.X"EinPہ4?UHt"FvWsc'os wGa8SV7kR/elHG0@{l@s}(5MiA@E&yZL*<ŇpidQZTpu1%3 |DS0\N/% ~$1$9'H҂8ԅۿ%fVfW \xYȆ,;U܁/չ2Vɯ]ܑT;}½Vo(ҧe^F򱻈CpPMx.0: pHa$Y4:<hsqCNUH4,g^E#q]k?Å۔4*v'5qOyoQ(,ʔQK6]IH]ض.\\$Li-^Uf&+,*}$w- |"RR Q"4E!W,?g幎վd3?:~ouh>+ޞ4(6VY'Irİ%䒿WHV$¬ݩb#Fd(ߋ;3mOpFEOI8 6-4_*ҴTZpW"܉i L1!F}N7sIq,I$6'ژPItkk0x,~">/ JV$Fx BEv}U N8Y" UEwO{Klȣ ִ֠RW ȲS4Pk%lMjWu=iA1O?*ε˜F ֡ufh-у_loK!5? AJ-qA6:mlb#@74?Ś$PhLR$}VzJٿ-T()Nþ8P m'g1&9WSq+xוČA"'qA=-65eV]Wed73BI.@}dT]1ԑBx!kQ>|)LA<Q }|?kJ*zo_B_j|0Ǎu4?]I Q?y㊵yKŽw5FQV>k=TRܴ +ܪJxGR?eYSgSv QSKN,PzA$p)I<✹Z6 ;>?V)cu7  V5/6o"l?Xan@hXÖ-0Bvtc4˨;'S ֍ЖaRSJ81 QC Ń1d}aFTЏy R5ن3-íPH -{voWpِ-zmW꺬 ڵ}e6wYp~DlNDW%!'%}x(ki oBGqh"51Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]ثWe͊,bf]LPRثV}Q!$' d@u$0'6KyJ++UBC@U|VKfG~i\+UާJm ]WȴAIl4f. . }V?ŋE*"nǠ MwL+xW6'tO8C <i{#5d'P~ eiYw5 *:'t$ +<%'lO=!X[ B|Ą Wd1&Z 糒=B(JtT~gJ1WҾO}+*8g (ћp~X!_\ȗRݕ?f~'*#)ߓS~p2~ D_cN\)"|)}b-jHAc0ou 5 1Xb7)~a M~J6 zV`JJY!H$m/EO%Io,;~auuک@T# *dIJL,^hNJd+'HF,ʆa0HS}kF{8UڄWqKaBn%&bX4/׏:>VC,ZM6֫kJwnljÎ 1쨫ZT 0&ѣveI嗍J%+QW,pĻowv[hVP/E?`ƔVX$}p܄nV5I>x}JWd xթ"/HVe+-+GޤrZW8m{'((>gi\Cz1cɽꤟ6`G r&T#cm|B \+_+xv5Ą ڬWBMy2650GDJ_`O?۶4 Φw;3/2= 轿ώ6:D*v6L4y]V5cmGoxQ ^bSՒ+$S+x+p,W/]ȖTVvƈ Ĺ=3Y 4J&R4s9jP~q8/~ƢY H\-&eY%PPhx77™L8Pz]YZ2 HP}8ժh̟stN<#،KUyVxlCF/`z&4 MOINB@S; $2,[Qʝqa+VIwqyE1`?8[eh$aJW-ijMXhkX]/74U[isQ*ĝ h5٦p. 4Rk,jڔ_ vDYvDqJnM|JJV[xB p"[٧zFY!؅!k>-뜡q5!_+T4?v&6YUjEmN_Y5Pѫ׮+lfk$xʀ_ĩ%<'`=j,.bD%V+^ruD42&<ؽZ%v17 \PYLq4K;~g]?_n,*W$ 2 d"S ihWE⏗٫V¹tE @2f6fHYʟ=zq\1[h@՚ƀ|[^1GG kBk^ \IGRogvu9Q ))ou6#bB7IuBNm#3__e0@SbYG|6~, U#O$%f_ ݋X>,J_ 4lN/d(x~RE"uoWml]a@R(X*w?i%ޥ5MTXGFP?gs( Sޝi VwGO3Oy|_ůR@@7<:ȋ{+nWm$2Le2r=e\MSN*7H < M-qIXQk$M Yuun*[Ys)L <~j>'ˇ TwN`a""yтkΕRj ۑ+#JA)S9((-:XU|/vhPw)nԻ+QPF_ 6kXҟ LE0',z Sl+6VR7#;'&HkxД G "?bg4tAA'ؚS aSZ8V?u )]JB$!Z ]pmͺ&\Aj]]JQ|p]Xwd㚰a9$l1[GoX mMuv+VV 9~45~]#~F*IU [P ¬e><@;/xJb z%~Gf6zSM& ;cTr555İ&kTAh`Ÿ;Z[DͲ"-n,iiܚB 4ALBm*&u㱯&A9e'Llc-ON5#JnIG⦴hֿq?, UčŘRw|A]KZcDȢ=8_ ,ެoln]qN[)Dq>.jXi#e@'cIȂ{EI|\B)ʶŪv bݡ ݼM q,Ev,`Vb>tڮ&,eݡ\Dd}c9UVƥ>N" ~x-CDI\& X҇OQ fRB? ň  /R抭Ol/hK=)7aPE2(D1%jSr><~&?Wd@w4BG.h-bh2!8b:&@X2|?V+wrAoE@^E** =1%XFy bn.~ t/ʱހ{ ڽ1s(X 2j(k[]^`ҍQJ~.(kUSF.D%Ÿ_: $" o|&d< 9~ۈN+^\)iZc[Čq4,G/p[BJLS];`إ4 Y*G3|* S^wۈ! oSnXsXHPeSz=Y'1=?rL$m*yv"@;,_c!,k&S0GGof :n~P#X"Zq_oSs[mW "kJ[fPBgeXy?[(w -Wo<ԯf-u[D4f znܸ?g.yv,|;d;oA[#Q:|DV #/rj?Śauh%Ԓ$Gr_y}Ý6搛5$M <ߤ4vR4 T,*j+Ǐkc1Bq i>m&X:m31ŚDbU޽ຶ)=kj; Pqኡu ZUd^Q(Y<|<[I˓`bđĊ?a)VNbߘCoD暥GfcVB߮+tRNP@ir^;{4:,~#rbk6eԮS"FV$'r[og"46dh1ZU3}1Ƚʨs_zT,L{ˬI,((B0U._O"y$*Np6Zg =@XnjEI\Ya=afb(!M?M%?Gbe*|FGi ֙KKJIa$̧B6ǫ+ %^Y.v|WP%@PŸvd6d^K GmFA$jOPTm+Amq,CGTl?Wb-ՙA 4$z䟱 6e#.i "f$,e[HAA*8I ~P,=ȭ_L rMp$dZ3_k0L~e?kK?RTւ5_s_aE}P-0"착 mb,ֲ\/لT_,h?qA }jcCf(+ ^ hOqс4٤%^Qb5#nYc -ӞRq@lJɧ44XpS:b9 G+lgWfhcqnD? &qȼ%\15l<2L<+{GӢP =VfܼsoYXJv5aHO*Y#ʒIxjhXS_V-g(dh!͎Ħz儷V70hCQh>Vp\iZQdPU$$P}4'6kYU`j+Vc^p1ӟUWo:o9۰p7W:"N4c;ڙn@@ƞۀ1*,nuye);US;țAez7Xxj$",@1хLLvçSJ&'-IVgU-SN>FZ6nU8!$JO F/ӯ˺5⧧C#K41ʡU=?\V%hS\ZWE}eBj)c?7PޔW|`fV[[nEV o*!hyS\y)1Lj)i=ļjYPO±Xb➢Yi u@:7ee'n&$oNs](AθRK"qfXObXWo(7ey䀫"";X1HRX|NW.Z*H>c欼SolKOCE";(O+yNBU*@=eݫ%%=MVi. n-«D~0yȼ0Kuk3J otu0Nm>?,0#q3@EUY&Ps-X1# {Y/--XG =MKxN UH}o'Y9/Ř[DEPwc1am6kQ8(#|L?g'`g$ܚ+WQePKǂ̭y8KdmOBOzNL>3V,M9*Ňӿ !lYV&⦯Jo i1̱ EvX&56K[x #i?= ; ;4vɻ+(S2_#uo$*ѽx]i+XjvڔUkYYxZ՚O?a>[)A|T;LW9(vU⤓ZT|R%h}9&Kk3 XC !5 niy/x;uf>59IjЕQCx!g%v(c5`I4|\rᑋcɫ5kuUEF#GB4U/| GʪtUx/) V0?Џ:N-AI)󟛟S$)#ԃ?V6k/5ZSoliN_.đȡYjk~x:e94M>8ďVŢĀB̠1+ZfyM,v\cFv- }XU=嬑|-[^._mm`i=Q6 KOώĂGOzkmjQ4b>-NVkC) %Ɩ7aX!7=D웋FPybԊS8D-ﬣ fӨBkRAۊNq_. sd*$a*onڧۮ-Rt[d|u-9S *~ధ%KUW-De%Ya5U W˷ҙ2NhI=9,p9T û3F=ǧJE41,|>9$5?;E2ܘXUISo8 4kPdRciZԗWRN[MY]z KŸ*T/XռKpzNwZ}fʛc*[,ֺ)!5VA_ ^\yL7lIAzQ8DV2k K,XiRp&=ȵMBOVW_?7ݻ|sEi@xnExĦhIL6obn'[KI7-@6!c 5'zx 6אZ?woa$E>-OOq[ZFATe$|cf 5Kr ?gA}צF&O0·qmQK17RFE*|jHM:Xɚwk!Y*iZ]k,-)~vXjѽۡ Ce;mÏϫr-+gEp*^)?Q)P 'WHhlXT2ĺYHHOxM>X}׶澓E(ʡ?eENq6aO5~c&Kxt͊fSjƘ#.`X+?o͆Qz0z1'}l0),+7bEi-7GU2ܑ?|y?v*>Fcd]n *Z7V)bX$TX}rbڸ0Ƒu&ň6,~y'G5qVc=,/-4X}[ud?fG͆LH]v@vX݌ۋj(OK1BQ˜g #Ђ۱X֗R\:\q(5;EM,RO- I~/Krk]Yǚ^{LIڽڮn[Jv"Adu/FjRѕ%i~-tmzPӱ5K.|fYs~ Pc\,"P@:K1PSJd4vJՀ_9% r/բ(zR56e]O8ޠKmTLt++#"1^tگJe[HL' I eBE Yy~Ϩ:hp&E_`%\ GjU_ ҔN{~+#K0ڥMxYVC Z1$lʟ[5FPG |87oq]8ϩuxs!:#NN,4eˆYn3|^WZ'WŇ:Jm*dm`^ym: ف$<<\l#$BAS? k(O1 ^(NSje;~ȭ6vY@qOLox!B=⸥Z7,̊h4G'YKg(;KG !"Vq?#u!IqነV]Q# ԃִY5,98Q?p1*Zn n%VL s3'Ɵۅivq ȃ H܇]RSS`n[>XchY#ݾ?ËzbGstPC> ?`6#"Jm1ZCDw6?#,n=ZfEv=0MU68VAM}7l {ZbjcvG4=bn@]ۯAZ[YEZ4[ Ip Y_YL*)Z璴R:]_1C^&6*Guo[d3:(Ro1C!9$ɿ|??[!!>-m8_6G Qw>kǶU-|pYv .f4RŽ7Sin4ˢ-EKLjzx\qnGۗkzEFBDZ 9։͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*챊1WcWfWfKb͊] t mZ-mKrqeeNu //mTq*lKgy]Gy#oJnM*+o~ʎmm"84E)*`\{ys դG\pOs\}m$wmDqN4}ZKF )T%7݇/,GLV= H/V.0;*\2|~oK!Uс#d\+BI" rw_lXʚF۾N(2 ZJsE4Z?YUwzobǚe5jv9v Qr#Tgي_jX}V׊j?W5q.m}Xրԟ XvP'y33cYG5]DCs[8-y仑x~[~"QI b= gёy3 ]xxbkOAzbsFF Aޕ;^!)xc44e~'Jqe"}&-DYY@/^[(>S=IQa g}{vQF/* F?~+=M ZvrLzю$i=#'cX ="zZy$;#QѼċ R2~" ^?L$&RFooM䂧7jUzV@yoRap?*G>;E>@l1Rn4u^K<}ZE~$O,xi1qlA@O U66z?kDIq/6frk(_ rX&E bOrzz-U@ l/e)E@ b12-3<*eiH]~/e.h~#4Q?fL#S>=ڿoa+P; ct˗D $fvluDr?RwY,spFU>L~2儤4$ 0"k$VҡiRV/4AJӕDgjӠeRVOO*IC$Rjƈ#_k+afs?Cl;So<(<c[]MF,5ߋ|@$/XVKiXD9>'*7Ol]V7>,%5;^so[t@-}ݿg~,b^B1 R1 WxCy9?(@9RjT_]ԔEolJIAq=V??k/-8FUҿg4\UO4q輄enK*[˽W #iWѤmksQ>?X ~,P(ńn<:Hx+U5ۏn_p4KF8St%R 3GEI GXau=R|?W؞Yfc(K+J@'wō22=i Ub2ŚR׏Vc}6+RAR)fmg:Н 76V\T}T7=rWԀ@ +7&rIJ0,:N|(MX9/ia1B=Ũw)*Y6isrbBEBITbXjUMj{ [Dvݫҙ SZ|NUM8v'*Zܫ zqb bҥCƢ|Q÷_}YK@J) h,ٵIc9KEJ"D'jb[J÷Jצ("җ喸[0H z0IՒB9'CmWճ"ޫS*)!'ә\/@1S Ƕ,uPJWzI33\K S D@6kcJ9 \ }㔚z;C7lqJcdi%A~&Uw'|5H[an3r<>_ܘXei bOFRKbuU!bGۿpzlOaߑWK!З^aE5O}u!Ho ePi~ܮ(EVy2!EoW<ʰsU!DT_`KEUy~. 6Ais3<(iS@JGOvUXp] 1ZP./4=иSݪ,DXDV-~g$M^_K8D%}v8Ki)zWS?)G=4B;PG9Ȃ%Iu qqDA%+,s_x˔l) o$&2ꑡ߁;}Q[滝~:|2xx bX=ieūi>./#_R؜!6y}>8Bj2Qv$Uqeإ F+ GSPvli)* y20FyIWſ8uƒl&^NbBy6Xz+vbS"FO`zУMn*vD#DF0x$4z.fWۅ'Z,&[kgc$yj N(%ZƯ$V*T-`H&sCXO欪Q~+JVǻaڀ?,4NJ!Қ-w#3;'TGGϛ,WhmJhCQQNNm(~Ӿ` ?F\D4$ *}?eW1 {aJ/rŕG vv>[>LI-~ @CQBۓ ^_L4aFo 𠆬,UhКUZ`Yi7+(u”OH(C*cT_jLD*ȗhĕMa_^D1ZH ) =+S~._k,Wv@ PR&&Tkvj. f= FN988YkVW.$e?i MGIRՒ[@jP?]2sl(6~k=+⾟Xi|\QlC~Վhx:uBGwȒ/e-Spy*aoQd}F"_sCH9kf=eiF Jm6Xrg4b61ƗOծP8+CZ:KWD:8i7^Bc7we]3ڤ  _[X-:lWiNn\Z@I4ΛWա(U9տ`]sƽO#tF7PEkגr?*?}V$Q~؅z$ֳ=Υ oNC.?_@䤯ĝ]h/5BDQW?FGt B ?qJW-(~k 3uR|-ܰk1$PFG\ G6 g$ 2LJ_/U'Ap þWoAՊb*F`LSdjҿŌ${YgH?i8럳;f5ek\ H#@h"zvVg,#za`7 A=ř\E+Ȏ}0(|ORWwsmi4SthhQ>% `xY"iҿ)~rn%TN`r Z5xVx9wOGj6vKJѶ`k~'wVޡnEWO?N_P}K\^FO,kW*WTc Rz ZK=2 kƿMe72?E:wŘ[FXXA~@ZwNQU_ecSAORoXhd@ |4^_Ou'աXDGĵز步ZV[#~N5.f`~W r hp"sӤQȜE7R;OOns*lBjp"6PEK豧$^Qzl_1չ*nMgŊT-́iys0_XB[Sq%qKF?PRXP8ҩh:ͨkW R7}O=(He?M0Mu-.WhJJJ?Ot=0%[]tH@|)O2Ux=)z.2mƖae}r2|4!qlZnO{A*RJB=)}2Gı1juxTJ{2P_N@'zb\s.zACy|K`!j)=qITSHj*;E6egyeb|U_^Ԣᳰ}aM~Ѿ̔Bw0V Lv ՞G?.XvB.ڍ1 jU!ƝW㍀5n)#U"/iX7U#|+rU^"5U=ٺIK[H4F6Ybea1.n^?i0M˺|VwqZIɣ[E0E#OS>/Ö>G. ѷYeiد8 U=4wĊSE<WOk/J>8CHcJ39bCcb!UO~/pP c֜W1QL2mql2?^?ʜ86&eVQw?))M,zRq21?~|'usNLHvc0z:p[YVA^TOg7^G~ UiL GnCԿ_fid(w$v#fX}l}beA^G_X% +AS OU糃Ը;@vcxv[djH}[Qn SQ '§b< ҟUjҟ}O< ̂ie3}- ?RZXe7q#T G0p{ՓM^goQE]&bHn*\7(:LEKznY ni3JHji$%iߓ"[`*i֟ۑ))=c^ڌ͔-.S SuoWFF<,Vo^GDj@VRfn mr{`cK `fԧw nUP}j_.XcA ؟  Ԯ5$y8U?}\ ař,%׸~m'g ʀv DN۠^X`<3E_n8dZv-Qltga<"4$(#95̧{!IKZ<F-v?rڥnpKmRI6P"'Њ׵)p".Xk6xʰ ]!ȿpmL `rikf QBkSO򿚣[!_N:Iu;u \gDc~#anQvLw\Ȋ۰SrR+V6pOaN(_fʲԃ gZepO0}

"{ S3}0>4.nJ+=A,`cU5ԑ__첢mSnNfդgAsΊGl4[Z! SRH `ì_Ck{8XUGŒͅP>{L)eD=VSQCBf IR1W,bxj;!+Pw7cx<7 VD V'$.~/8ђGāh6.rCjHӝP91%~.8լבo|R-/YXƾ jT}ŏ]PM +hm ΰ\N_+Is_g;<:Ňn!V68n$vs'7*@]@C1iIl*FP`57j2Hv0$^v Qd=}AAGJAO"~M2jlk^t_S0h[3pA r&ʧ^QXT҆D˚$ p I^UF&q=,[2O/HW_lqo?*(&.$GѨJ?nN<"H(\)N$x~WS?ݢw'/U' yGjPN$U$xdbd0~&ŻI=yrǪכZtOߑIW84[ xI? ~%>lMrM>Y%7 YWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*p]Wfv^*UٱWf.͊]Z~~Cu%YDњPƞNě \Z'ܨΓԒf^Q*:^@#'j#kjz@?go|3,\l`ߋ/5AŌضV8EwR>$߯6yeevU/Ar*BO#-N!w9]ʴ/k1T,Չ 7i}WoI×g APEr+l?UI 9Y(drUNL~7/ܕ l? -[MJ.aDI#WbRTT ~ m'05ݿ`>iZ\!4NGU11i-E!Z?_pz(kl^7$uO=|Q@|q ]mt%*j eunIM(i +6M:]25U-*@~/?PX+ekmO$b c`vU_e_ /$ ǵhpB6ii\zUcۗjIRceI;;R$EG&J*>.qm&I,C28.̛r[]r]>[;s҇,WkAZZF{D?$`5T~'11Vm JH^_y?3 V]n1HF ͦQ@~ j~.'hndӁޒ2a-q/@.?yıkKJ4G5=Ak:LW R}$$?Ypm"1~چ- =K[9(.TT::!~q]2c$U@P:+{e=Y(/ |r 7=w<[|8rI+ $␞yy6ȑ#;'oW×UOL(=56vk=&iE 7AH|u.et>g%9#Hf(iep,Qq#Jmռ|)"^^4i <hB ز ̅U_dfM@Œ3ZI/S0"=W|X>ZW6jr H;}muxj;`c#Bw%ׅm7)# +.?Ih#ek[uPV7w'ǹg$"ZTdDXuՀgsP^?~ hٟɭM-6 *u*47,J. ʲ߭fZ% jԋ&~D\';l8GWFLJ߅4 }FeKᗩmmMϏsbA.o*(xHޝ\YDl~M+JVme`(4S_r`O%umBVG.gq`U>,$fƆύ{`)?MγrLī27e5lӓ G,#~fT! zjG"Jj#~I($X//g?V){LzZuZju;.70 3Iqy'6P݉EMm}\FCQS y"gT;MII5y@Wm_ 8C5Řd3ZNjY؎Ky;WRۓuBxaՋk-ƭ4N V7_Ey;1 9$mQI·( ʀ0ֿR"e'łs}PrQ;%}wE@ԃ| ]>߷XտyȶPtlYZm~걆"&R Lbee䟛tEyWNw:/?ٳI v>$}GGus&㇖,oo^s%טoKh;C1KJSү]V=7S]]>X&3[,/=ȑVGBOÒۯ\ebzbT!H=5UR_z傩$u=ndZT <liXC#jR6QڿezEE}6#+ӗ}pd&܍xfih|aBMj>Q~8ѣ6>^KœՁ` ~?g_dLYe3tv M*~9eh8N̼~?4Q ;F.nZFwU y,u U~<8.98YqMx,*}? ĭAcG.*wR1=j}BПړ+XTvA庥id`RPPC4|~+_I7-?% sX:$q_OUkJۓ=MaXG j;՛۬CQ@> -ΠbQ/ vfp;9* kL+I C"+H0 K8mq40a.T| iK/lUɑYCP,?XLU✈m[$򈕙=8q- `VC6ccbyFjMTIٓ;_ ;\zĿ M lV(WTz9"Q5GӐC˜BF*$Њ#p]L2 */0yr+)ݸ-e S᯿גޡvhmkC؝ucI]* SWC";bc!Lhւ f$G Pn\6><8˘cp}此\ #no)bZ 5;(S<я_^/7~5'ңƘK8Nʒ ʹޛk?k+&t *ݒybX*Z 6;Q|2A(ֈ6l| 7(KzHɰ;?4`( I5G6Imcb |;5ε;?sJ276ʼnnOn?Y:yv]&'ĵ˥8ݴF;A41\emh̬UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثثvX]0]6*UٱKWf]۸ÑPvu"RRr:u԰j)C\rb0˯K-$JN:ލZK0{^GpTjGoo,rAPX )uh#,B?qD!E&*Mle! Oey`W0woҁqe/zCcEnLʿb#昦YE?~J%tԺR8 CJ_-[o;~ǻ)_N,AIΑ !y.IHVn?)VQwI^,v&cvg-zzzcWVhc$;+7\(G.iJH*ێycmTR@\Yq5Ms% kNK$҅,ѵ8/??2ܬR[Z5l GʲEJd>Z˛fh&ſck?/V=j&_XW=O.I$qhf?kp; ?SG:F|4Eߛq|E`(i_,YGͨi3(ǧU_beYaJO׋H;K &'0SW8/ ~-4ϊӍ+T]F zV3Tl }RbRZA$ٷ'$.7sJ)Wj&_2jqǼLZ -dz`GYm´Zh V:k=IWy2)>@t .rYZzy~b6r8+'%Bz_m^ݒI -j{dB"vsJNy1WWW8Va/F*8I @zk:T2ƒNO.:}_[:,>Mi:`a$>b[ubHP~<bq)a YPoF%8Ctv yѓR,YoVd'ptKT3m7ִ4’4QEIOϐ+(0כՍw;`.\Gy{oҪ1 Uro){ 2 j|'ηywP)#)HdcL+Hu"!DSiݚC+!h`ᮜD OoUF\[ԢZ7W2F9nv׀c~r!*ES@R1ydX!?a=Ē3Ű328H qv\u)~p9m05f$_[Iеǻ3Qz|_%I_H)QJ (9>'(8ŤY7_$rc.}վSBa%uM&t Ns ,_>Šd:X1mkZ8ak)-!X@ |S7%PjAǷ|y1A%:W^_ Z-pl|jEk)(KZdCP)$Poذ1کqci|PIuE4>|ZIa^ Ult&eb =>"}g$ j?,4/?9f(61N| ;&Ĵp8_a#d$.j )צHGYaw2[GיbH/G7³JGݍ03n ylk;}ֿ-m,EjbBW&<"xpVH<%VPX.< cU<@\jZG r֔ňD4ך"8cު~o8 *(;[ud@e. ?~|_,+vpɝAo{Aƀ.MG_|8݅{?܄QV;[aRRGhS^Kq~C1en(nI'_."5%aW E%$6I*@sSw2 @h:P6j 7wn~?%x8D#M3|+VM%v|@'E+O#i~ofw* XXģm Vi)cG4~Jh*ئU$u벇$%{<qMCNTMz<0 ˞iE^,H*\9?Wp}A!ORFn#qR~"z`̗y@z&kke]dS7Yʨ+R8MZf2HG E%>OqB*TUXF,py~IQzI4ұX٩EpíƄՔXs'X}S@+?b3umr*s3U\TnSbzkSY$ \Wb; ̝Nʾve9.4*iTS$P*pV?5-+MS鍁o?N-62PwH_L W>&olV L[+fKi]~]M$rgg8*𘇫XDGvRrAqvTly OMLvTrkɁ_9CQRǯqE:WX[۫bF-/.Xyu,T+!oňئ-rAU>1fk~!WY@xI>&W#XeFP QG.Hܐ+QMt3cSӜEz.ZwKv4^'㋭ozaޕ=z$$񟀒@x?,1p,Umr%?m~O1M.sA)P7$Ls4U,M*A~TCiA*^0 )j//|XZ! I^زN22 aj^~\j+A#r{y5 $'|[,ߵpiIHHR)sB Ey$݋(^\`xV<',Ku;˙Q)~8JOkZʮŹt?H^8CzO \1y]bd^Rz nPxԎ9 %|X$-ds(`iРy+*W=>*}oZ []]GDfA$?T.HX<ׁ?D 5̼i×kYi`u@2!Lp]kn-ѣ`gOΘChgP(@*?` `4S5 th/[ }J?Tw Y8$/,~PX%> R6}mGUr;ӾUu M*@jiz2PQ^X-Hd.NÃ첹n Pz|2 iBF G!}1,j8@BI4 Z7H)+=Vf p@8g*HN#`MOR<1cH Gk6EZ_V(BPu?O)KCWn +%x*᭍͋SQ)gu#̐.*)!IaxqY@n|#O-hʩlNI)bU;$P8d6r#WpK9)EЮǮg<$&[CCʽ+]l}d2-;O՝<[P9%M*<0EWb;B݀vX _6$y>ӪHޘ CU(~'Z+兠RbN6-v_' XS0u~)1S{Zrcmk pm17Bv E~6Z-Ҫ(߸a$bJ~Hnc൵Tӄ**\~<:m$ \(U{ 9l¼'}R%f!FkSkh$z Mxd w~\H&7s3V*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثv8bWe͊6*챊6)v]1WfvO-uk+Y})Yf>? > !BU(}w}"I.Gv$ YxϞ$4%]Tsp}Rp^f-U`jF TD,PWfŴn; {Z}?e~_s$h0,TWo {kxrziSމ \R )њ\~)?ǙkǑ|[ $ iOW[d>`kZXe~/4b֝zTؔܞk8Eߎ-p$M)?cƤ.!/!VX H8N-KI4SQTU|Ts+m·hd,!j0_6,u`@(HeqRɩM "xЃ#?UcK75qة䣬֚sC4T`f 6_k30?@Ň0cyqѠBzD6.x$gY$kM1,͂"8z~T_nkĮ ̼cV}2Ew #Ai98؏mUK(ExځI3l{M:g+g򪚆$on(Vƭ8дZ Y<n˸vgʽ>GKvL;B[Rt$31kBX9%ݞXY$QgUB*TS~Ň&F/)y\< E ?_ŋ-S@~O^mvMܱ3M_HCĮ53+qAHy:;jnO(~?Fy/ hwNؚ_IhfY#^l z_VNڵS5j1V(B>ecC|nr)QIء/t.*mč!׋77d=E7[LjHh킚#Z*OU+M0+4[{0 BAJų7gsg@=AXY rA_g|{H`8֠Kԭ$3 Jq`W,6 ڛ'lEye\n>Fcz|W|XYFma Ypir%>|?/ҹMHc}ʈ 12/dZRVf N?r:=׊,זcMv8PvɿeN"#l?ca$wjn54Tt^_1bXFlPX=ƹrw3AMBv$(d?wbX@@,L飲-ƄOpgv:oٍn^[H +w!9ov5PaE>?^K/-GtP*)Bxf|?Y b,5;l*+X!F,*,>_k袧AO ZI* *u ߴ_?q֬dn*1qE@m!aGr??kק'5ڔCJdvZ?pDk|Wr`O%#Ib>JH:tˊb&ٺI 1?v+Kի37ʼn[jqՂoTv OzbL򮡦@+ŠSAOa0c.uKT ʆzXHHM7qID^ >W4L9"P|<~}6WhOS y tQ?|6(4P§,bhlP=4!A'ru*M :1g{z3o*ȨԿm*˶CqR}-qo𣪇RCj-oYIjHcN(jY[k"cuOx54oK~KMfx5N ԰!A]XGKuFqԊ(nk-z<|~oZuUP,ҟ8_YXG$R5NU[;5BGկE?oO7xa+W$+f˅SkZSvYzd$dB( q6i}#Bx%OH#4MHu'r2tlWLkq SqۏJQ+#nMċa'i/=ȟs;Zk~kw2Fzpj_[ %SIal_lQwrm66 aAwuF?m-=Nȕ?J=gM;LQPzP~)ܹnpS5ӧ%1!'f,w {}TΛwvHB? ! ͊XF)\T|uc p#$~/ͫ;xĤWq`R43Mj&"gp\B[h AUw?j)95z_V|Y E?a-c6v텀77Qq\/UE+O W?Iթ%jk޸O37arl3:_Y[j,l?9' J0.9؏NRޚ&s&$nm4 ˒pI2qW*7 4XHoi$SSE7++|c_K2$PrEkV*u}ee.@ Ky>/K_qJij $oxQ"`ֻsf_8˻IW=A1c5M[JT*;v[\ml_n^:DkwQ8MfS%\ky$jЕgcI5/^MJ%HūO.\E~N\-)Ӯ 1>*.L?,R09Ezň愙絽eDq>NJ8 فlY+__K5jѲV9)׆<s2{i J$=؊0$Z9=)y-lk( kO^O-B=ۆ`Wڹ$gm_2-B]Z]b=&!# 'M qyEP:4: [ URUQv|?k C* SsŗDPh )5ZqjD>AZSǏ|QtPbAݬ4k_uYBD`z3,L<B鴝)VxĂ e>|9~b:bh#;-_!1'iPG-^>)ojqU,2\z|7O-Mm4c~WU|?o KeXr_+)tMu IV[H?O\bZY v4;/R(^ma4`rPix7.?oqI<Ɲn8-oL6o7P ZSB])V1HmԨ A%WNX;JBI>5Ś.X+{wxD`"@8XDdn_hbXenѹJ(b>/7N1@6 _ EI+hVCsu!YVֱ<TJV%EWZN3@Δ^J@ { MygQh@o m.#p!Ri S)yY"5E:6b63CxRx1  ?Q=(I5İ)7;k!Pw7i?O` ٽf)@{ g6f, d $H9IGZ-fȊT+3Swg|kW,7ӷ 55IS"_.X7@ uh[=,+T}rLEV)#\,F['qJ.)VhbnC{o۲̧WFiǏ,mT,fu# 9&tS.H–$FrfQ~%o\@nZVǮ-q5HtKi(ۃEɏ~_gCFӦL~}jI-7DpNd y 3&׭nU hbךz)d,Sd];P1YۈaQͪ>*P ?~,cZsGzWa2M{ i [_V|uxYIamq>N&)^L)1D{n+ *Zo9kr4ob}/Rz7.J%OQi98f4M5u+4jFdGFbޣb_YzE-O7ԥ'QP;olJ1.As7?~++jC&da2i̭a%S (GSJk<򟓡ЬOI+G,MtJp^V쵢 1Ű7ӄ6^<`?e!OO/;xm05Hqw=/Q 2ƭNrPa[]bUku4Ų4ռo{eJIZ،]i4T},i-J38TۀEJ)ŰTxqКq"x#@#҆}^إw=$#B_+ܼnj7pCsa WB(&}Y w\X5dţ*.d7l}əO*rn`St#T^ ;Ua1B u@)D)[׃Ww5Lwy4ۉ") bUlX!Uwi|yy۝7KVyȳ BNX01 1JESv?kh}Q#jWjw\8Տ;j+bީ Ss l(ԩ@|I݃E#ҿ^`zuOa4g#Z]G%7_?ʟ$&dO5 o$PDLXAqtU`衁%B\v ?t|a Qԁ[]0G3Vi QW]wN3Xef+WamdKG]Fy0UHR_O>`ĠmNWa ifT pCJ'?kŤ#$×LBΚ.{tGzUWJ\\Vq}#aMai%ߘoAkEU_wxԻD) O6?7Ig/ڟ.uknW)%6~ V W?gB4`CCz T27 Qa=KXKyo_ %F|dɲ~~׭ufhiUp E|,@d^^I5)i #Z|who=IMW b"mjy3%Fyp ^+ qo:jpOz}(4N!Р)umkVD4ѹoJ>^Q@Aɖ@M[/Ggby;+x{6ILON?䌊"i(RuPA|?k]* >N (5'<:TA<Gl9xnm[E$qny׌u+8%mJFJ+ڛ`k \ȺD ֥O~._62/S)l[Q:S6'Z$~3^ VWR xq譬D%`ƠT5#N*r]!/,j>+}Y Ba滐~?H:PJ~T i$7#5>Jbm P9 W\C H:5:HLK m8hXm|X 3w blLVKxb*ӵ@prI?2YfچGEO}4R[Ht+^-O.سF8EL C$\9F )HbGB\T$!6jxBZ)f/^3U 6Jqsޮ5[8W 6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊,bbWe͊6*͊.X+L[h ^ [LE|3s DH ?կ%ȒDY$#&V4 >Gl dGWy'{Z #b>d.0DMLފD49MG˪^"@de'?pFaZopCknK6Ԩ ?!iDUYM>$nijmA 2URP7`,#g`FdXHt];uEk}~<V* u_fgWUʎ1DC3? }aōNXSS@ ˣXKq{iqK*Ŀk2hWa6 ( Y+VPT|'B$wzsJ-ue {q,/ձK6eI-k(+Z15sԕS; t&fŒ'V6dr8|iʡ1'Ŀ`mE&m@GuG4S['  X:kB'#zU+TvZ[LbxmY$,xܖ=p!u0di@E xq,_u9OJڌ@>xi,J<1ܛKIg&˳ ԅ哢+a8 sC#ՔnZ[Pcʕ`{*Ց6?l}͆vљCcvUl11^7I i!cNDPd߶(‡|!hXc")!}gn+14?N6Ck][U2^"s*c᰾;B*2Mp/%\ZPig/$F?$ؕ*ZQ-Tn]֢"hս#Jy+fн7^ŲK@sEmJ~?NJ"!TS8H,X$sMP @H}2DyVv#2$~5_ӭ/'$Z|3GoDU5?,r7a@'w, ЖxJ`i~̓tYSw)V0Oq'Z-9F _QcۥE~Gbw4Ƨʹ"fgoS cTm}`kdzzik8 |\?kXr"RmS QbOYjUk,+; r,qI?*8n*By}?pm8CN(_Mz,y5.~_ۚO!?mrj#썿fHwwN\;7z_qE/HcBk NʺqMBFxdn*TPիӎiMof~=Gؐ^eM95KVJ~sSyz~m"al 0*vUSȒkҴ>]l>ͱyK4~iM:}8 "@ʀ x 4.Tڄs0̭J'X%zώ-rB'Bhr\3e?yr37āOgI]?B}KOՁ- M qdJm 2eـ,P!fo8mzԑDdڼnƅ`J|&ta8~ tkwrd'_9uhbk]0 RM'X[H2O&(AΟcل!b⼔lvͬ C\Ʃ Ǒ`EYiDܲxxԈfoʟxŁ-^j6fAM F*HQ7_? -ThQPd~~ိ5.. CR Zfh%Gtч⬽ L%RQhiPzQC ZZ F%@G _沽5',$XNaG$*)=}:ٸ7Éti\@$Sz&yZſkXHB+1q~H ɱ]޸w1;W /, $g P="PBOQmoFN,ƴ+2nq`Q)L I>> Ǘ_ljozw8 N:L,~#VNrQ2#5moJ8Rj~ZaElS+@ǹĕrQĚU`S8Wq"dpaeS*͵bݔH?p4N@1I$ʩ,4֊̷lk2r&Xk>8C69Y]<Ǡ%o w4ozTş4TXԔp(hN$Xӏ/X3Nk1FE6>v;r8˩="#Z ¶Y#AxxdQ[qԌ(@<.ԏun4v[(w&6oqqi69) (7Y~vťe_8)"b+ոo@v%C^ f4XE|?/0j SU n=VS1$x]䨯!k_ TeƱoyoClU(ƠpƼ'eOߥ~XRTet7im4- }I?}oZ +A7)>a~ks3srxz cխzZFڴclűWV5unb9a%5R͍IV)L>SW7|.l佳 U}O5u6ƔZ~n.er)7!ZILYa7aC/qL1ӖO#D?݀},3 )% @,& F,OV'ZƤMKrD:@Z,bx5'.|YAcB<B]64OlBB6ad+59z6ဨ?)&YIS)5IPƟ8wM8W+M&pƕ9%|s%^*~w_Jy){˒KQ_h&3a`-V35tV45NFly2yu *2vTEZdU_"#oܣoí `"2,+(&`?zMrN{_~.̬@?,!((,Tרl`B#HU Wљ0 {N%̭ L*OSNypM+qkk VGVfSڏO, ylN޻rvb7¢4hZћ31Ĥ$|g`#*7A/5&==3݄_37i5 B9JÈElb;~#MIV%bPU9S3֭pi)pҹ$smK8ȂYc+ˈ0 XZ4a`G)à iѐ*02=?_NSІZM/_leӴ1 bvbVJXWU^1(,eVV.O+毩hЪ2$E<ڇjFoo`up99|&S+( Tʊy<iT*XX'L,RNO_kR 7*mS~`Z-:]/3:hS_l X-oT/yc~Am@CFI *(8b٪)G'7 ڌ2 }6(钔]x5pX't$4f@Jfz)jWӒ(l G>ȥ=byE.uhm1Z70 5v :fbæi7d8U{)$G?kҿiiPM"$&% JGG_hJ,P-.i-=$*t?g ͼ*cxSp- c&,wVi,"1jW_rSTzLy:8(oeevq`ԓ\<#xɶuMV><[䵻s-S ۯ)H5vqL-~+enǧ;Mw^~X]T7I֍usl!B W'o^=fBr;n1qxXKD F.?}T@xSjMJ$r$piCq#rlZ%P_I+QŁ46| jEI>=;Kvw<وD:mlR>*ng70,(|Nn{[=E"nK^, SG@$WoXIpjq& )\[-5 !"Ȩ-rbjK*YI?y0;=1bmi7nyAd[iMDtMA$e860GD]~J?cm t*OōZ_>ū[ f&*g6TibT7WD> `qVW]O..H’:ZM/6xӄdXS<296 /n-Pyಡ7I\()w:}f!$d@~Lokq)^[EOj)wvEC:fBE:~FET#leԒdKT?^F' ;Ӧu_3SKAGj^?Q* Q~*AR4k7PzeWr?i1* >`zvFʈGڠ77Î)6bWu fVK{gv![iCݬ,MU:Jz~$DJ0*Ovu4}^@<0cT|[Fu6;~>;+ByvJeSȳzV+V%w2?d_MDnsq. Yuc8ևj`qև ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊1Wev^*v^*ث*졊/vchOmj (/xŔy<z7OF9xIVOE/w erHAqNÁHZmL,GsZ 2Ԃ/ J/H ۹wuyַLiSuVu%ӉHb$TEh)' "'PX#P<0r [ LXy6/y|LaU+PƟF($:]&qO p!RtoE&yybE .jpOM2`kbP"~16m˹k9Hok|[r 0Y4IۡW-/Ê='o (FD֞"eسʝP-摹@>gJ2XI7o>Ʃ-n ~[kKѫK zPI#5n),P##b654C$ijz{ƌ*Uo'ۙ&uZ`eTmnYRN4,G&qjrb_)C D@(CF^hrG8Ilg l~~p}ּ< ۣյ+=j炫D$ry/÷ıQz*kF{zJ̔^Ȇƍ/#וj" w5jW6%Nf.g!@Y-%kʑA-..Z6GZ.%6q C_r/{kqaj/m~^@˖(BA 82H,uh$"BjW'0M2.Uzuխ.D,IE,O'^:͒شR@4p3$ZW:G3mk ?AƢqa^Ɲ7ZZZ';P|Lߵ:$ޙ cBޡl3 ňLVkϪ2{l,8m/N#Y3X)2=^l:I(c (^v,~#o| k-m.*~`Xը/a\HW¸Svˬ䷽%0d >SĎ#Oɍ8#J +Kjo1Ҕu;zH |hX{5 $gc޻^]Lp\I WQCr八s͂rRAJ.LoLRU:&\d2Ubh)*mE,iV>MR8~~HD =}[teTgQqx$YrO jz /4e_\@rؑ m䷳cH1=7YUnl j2L-=K2%J /偀;2} UߘC@aǎ'$a!ط8T*֗6ĨjG l?wM$MWTWnyTS4#>HY@2-9M#͋H+T_Q]A,+A4|3SR:׫vVWɏLJACè*`""Pn<0An.Q\nCĢ1Jz n]I&U%j[.p@ 钦LLӠKfY[c[ Y.Aw-JkำL-1@Qƿmܝj,Y b#K==v[dHvqVmԋך~ e$G:pio6CnIpN?«c(i?NqD?eQIwe5Wul[Rx~"h -UTt$4˜ꬓL>`A*aHk(E{3^ej6ñZx/Aq%U ^t(jznSlV Z_ŅMKyKL"߲AF4coiubWx}kqƃ܃M <-_|?}#=qImnPQs#GAQ)oI!6EqJrVc"Z}# 0ize . B^-5`oH)bȴ>4I-5˫4y toSbG"7r`)ciG mq\kӏٯ`9e0bӧ)"{H h( &9Yq$V)u ې8R+wq q|*$PpA-6tOL2|2YL??gyd86U` YKngU9i~}`U'6< #Ogo %%F 7XбrIq,4˒D$AtUv'bA;'$"f( K_D?-k!Ԛi)k^U>@ѱ✿>vL}aI^A=R6DY 1 ˏqĕXaOz2y!^s(1њ%W` B$~@G"I#{ekhRy+7k,j~m@gfCEր_\E~ mOs"2ğÁBI~Nآ1}c"v?&`j8ҷcsзS`4A" *_])+۶ I(G+Dɡz潶X VGR00:.%,й|%C_W୸=jEω3,_S" =4V/E$7ؒ&`j X#kZhTPPcO~S=%(`>upEjWrC;sRv ܾejz5U@*F1 K$/~p,+9^<=X6GEh}f+ǂ/4j#~r쿗a_RB+N5A]x6yKB_X_m$(k _d Hv'1JFn,.%|֜oaQݪNRd̰]J7- Cuz~v'lܖ;xS2 -cgOr"@!RNT|]i.RBOl0_N%iկ#M&F.n&Cgϖ!$sz``;R giyb.D@cF$j~,bZyH>ȖuIN#ԵX&heS]/Q'X`mācTPQiӧ25i-K2I՘nTqW^_¸S(0N!GȆokKeka+# ?vt)q('Yd%Dx">=Xy~,Χ6h8Q =@( ?O'/MNFR'$,C({_7`i#<ԟT=b63/ @+S,<~ۄWwDTpѴm/Vs׊}ߓ.ybGoՅ)q&'mjysM5WC_NCe 4*r^$TG)^ܹ<  Y:IVS,O^k@e;,fO[XBjXJAe)|?G!Lߡpcw:iƲixn2a1L.NEkď1m;kz{JƱ 8e5bBJZW ADy^ؤwwӺp]N(vX]{E훔yrIU': Pu/:[ j]Ǡ$P.{bX&+%E~,_ H˶P[cX\ug8 ;5kL}nA7>f؋ $vC.1NTaYVI=2voeK )D~-^6'+ָ!> =kH㑸ЩZލ%M6RU(Τ NˈnK躂э1Ե)mo3$kR;UUӤF%J֙7|kq\f5]{؃ 1:7⃲2e;;P˗Oz{JqMbyPd=f_pG%dkBG(T;X$s2jj|4o$44,:ൢpYQ*;?9ɩZQ@Ocl?)`N[~ m<Ӫi;7CL ShHH8 .͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/v^*UٱWeUٱWf]vlUن*0oﷷE=š}Y%q;*ؐ3yOd"=;r;o"Jil0w "o-ӮbkJFiAYihG_N)([em=8P h\o8/Rx)(HhK*e@>0zmrX֞82CX f$ r?k/-VH@fP)Zm SNi"W`xPHZKY4F[̢HA3%d) O"o[o,m ( M>!_R oq _<<*[k X+( > rlfֵ J9Œ̕CR!w|XhU*i~xIO4M+u9'2ˀ.xj!ycjO>5 WGt6ާ-@/fcWX`޿qlO%k_D=UC%| J8P~[a ZS?~cPj~Bj`b&jorG. dn\~Í_0i)jJlSOaa2א/T"Wc<gWW0ٟ oJnyJIE,#QͨOo'XM}1ވ_ɍooGX>(|dlV9&0e_N.܏\[AݲL.o Czj(v \U|8K'9Zk%z \?8 ҄d^$Ǝ_OEMU*'E|^t-eˁeUdcS. 1#B) ZKF3Ɩ05 P R Ԁw H2UEfXĿi9N4S煺5ŢTy*, фaJt́G{=ͼ)pf7ߙ4v~ǧNJIKFc<@Rip= hORkS,UWX@*IS끉a캋<'j=*p^_epR2R*Ԏ+ 0N:]zw*Q[ڋme4;z⧚˝T\,r'0(2ׂ*^UEMo\hyqjB-Z> 'Z6 gd|3KRkO-?jOn+R|1@A6+D+5Gqv_<%N;aeɗE(#VQ%h@&+Y;qA 6FhfH>5oX>Ҿ8),cPyJ1vȊퟳׂena$w'%YF~AERi'm|,-.'U) ’QV:N#Tx7,y}==y,c˚ּלEmAn}f)il7O-Z"g1rۉ?iT ևafl.PKr8<: 04sE+] uoSm(9 `OTAo O޸;#؟\,sS G~^E\QMvG/8TpUe%vDP~H'\Bʱ`9j "}٣g iGӉGM+P-g1!+^dVإ mS :םn!h٣5=_20A0:\Mui5T&Z3uf܆vGMm/I8a.μ|!.uleŴj=Y܏ B,;nƅK#V;4_ kRh+⩔Q"i%iD^OA9|k +s'hMzbK>m*YW593r+0=/ ԟ 4*]qdg4RO?|<ҏW~ ϹU_*;HW{;(&~I^(+)MnܘaBCej)?ic-n|6 x-%"zIݘ?bOO}'zCLR~ Vij޻ޚ4q~#AZo\>]? _8c`ֹT b~`2'6{PKtcIN4ImC^MfT r,B׮r;c5$\iKv/; Ic#O`׽;M6{6hBƭ`ҿ]?vjO8 *?/pfvU_?%x >Vlhh.QL1T5~?ſ~IT#qDAu(\;Q-xѹF@nif %? I*|+r(bM~k9 I4Tu'́]+Ě ~/eXM~*/2#dś[@򺙨@!*I5l%>o#H pVI{lbr~[@A #q4h*)ێ?\2ѭ AoɍyZ[#z__^DR>>K(--\F*> 01K?àT Q4^)]fw?`5-pZ)$XڵŐNcR+x$J?e>ٹ373aӣXɒOֻ1/nT&Uⴏa\;a,Y#(Ţ~"OQd0Nޤ Ԓ:ckW2FVUH$[|y$WDž~d/RFYn$et%BӃ_ӇL_P4jju$)i+ngS[$x nMuJd `f%߯ܢ!(EVk[v!tnn!`?|.Hc[Q=BwJ!BE2*/ƙoEHÛ~CKѫ1ȭjUf~ͅ3;9`gk$Q&`Z3O. tPT£o~I^o,ZIa~/օNb[t+iA1M4~Dr_Ձ5+vvj tb zZjSWU+rbi X$6exBhizQ]ZῖUPQFka,Ӕ?vETkI"bǓQ/v<#r5 `i/$ 䐠Us5|M %Ee}:Q.Za2<7-+sGOEiͫ˸3B嚣}=$\c qg zdy\/X/IvVϖ 1=K4oogD, Fɺ`$C fzԥAvcG4~ra_l`n=DؠmvKwµi`9G_܊֟ixqf3K SsJW / hf d95,4*I|Wҁߨ5 DȻJ&uŜaִZD$wnΧ!;,~e6s񔨠 D[@Zsa1m:#UB"_ޛaOx@O?10jHZ߯ =sHXxt~X+AүT۬p!}ܰɩv.?ӘYYE6؎. ek|2ǖQ\J3jS'qE𹭼M wJcabQ0U.f8y CeKbb]30ܧ<~WL!TWauˠk@7 1=j&::ZrY[SCO-,`7_!,@toi͔hWFK $E%hȱJ+~'iwj7.H* Rљ+{` 'eRcqvN:P ?ӿ*k}TMeHW(3I&u䢃oBlXz6QFpZ4m_ˍO#myo?Y/ =sK&r+v?ՃŠUe K4M.ZMG~7}2р3^/4EOJM?bG,ny/=1+,_y4e]{"mGŵC=KGF3RЁR>7?.+dzߛy8ai˩N O [x7j/UMCZU?i欄D9"9 ;Q!/>BHC\Zc<F~OQg,VյMEtͫs#-'Ǧ#yJ#Xqe6P$|F.'Kph*~&z"Y5kM퐹n6o()WSm?XN($Ӯk⸝3ɷ \JҖv'@_ #ZXhBIqnj]1LoxBjuL".1klf8yCdڜ ?"FZAm*.F[pM&a#G !Nh|ÛX<(S곡Ԓ c'V }N(f:ĕN(YmS5`r%Cj8KG%\w `.x7 VLsX3uZӠPq~Oަ`YHi_ 2Gᭃ*' 7Nywn'KP q %PBmaWoc4Ux5 DWR~`;)i۩Bzrz#ᄜFs;'!mSӶ__R{x¿m欟6j}JWn[ܟ),4f`zRX<(9ޘM &mKm ]68<ϻ`)çj/ol# Is$h0ˊ6SM2vRwYSr+6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/vX]6*]6*ثb͊ -ue * ibZ# gjIsk $)<Ҟe5cBN"!^?FOb{4`H5=nD-r/+i <˾4|xC髊 .;A$⦁wZм%d+Y4eA)ώ%:~(AP74Vc3Od0eF!}6S!'N_$*&5=`jֶʱjՏS,+6+)R:my]*kkVxr*zk dQ9^XԟV mǖ>XF. Rhģ겯֤jJQU~|=AB (5ut{M rf? ~%ᄺH#j=H1'bm_MQ~>wc\5'eA [}isYum¾<VcSȱkV;+Kn_y}B&7gn*揿R;rQo0/@T+ROV#g6ipZI!NoNINgkjޟF,+{N|E(6ڥ-fn@."`u.ȳ I ͨG|<Ud!in8u`zW"ZZ:~i)WydDQWOQhT.wbhH&7]q Xj)̰?fE&pݺ-|Dmݑ/YkO-wuS֪{{ :};jvȕREHA鷿mR\;µY֠H> bgъR/ /% $r)_lZ5c}Gvz@nр1ޘߓIZXpd~ҨdY,aOvL;f6W- k W;Xm*|**(2itȱK{}qivXԨIw?Qgd+z =袮&yOh=#Hz/Ջ}*@ 7r*SkʿJ}>\¿JdZe멶 JX4 x~Ƽ$ {`H yNP`^'f5+ݾ<p+Ǧ~+ɻ[}6M{imݪS?PcY'Jݰ(jLGMF I)İ;)bS[66XMm CΖ Fl ?|o_N;"YSؠƷqAv˰ SNcOޔBmlB\#xʰ w|o9!3*93O6ˊ/ sM~DQDN Ac4Y-E<_V"S'Xd)EGEv 6p}~o}Fm\Vceh(ldXߙ5-+ YUlS_lIf*>Pd6m>8(EH lrSg BE;X˖5 T+Vlu3WPt'Ů3H2$@(FK|r1S>1F'|mHa4,q4ؐ\ZF O'Di({b~΀MW 吏1+ :eL#E 5Q~D%@PTw͊?4\$m`UѢZ3#tmvԼ3P|U¡U #GqwjO,Af!Y;Ëzy5of[^gbv4&+GmBB$W69Qb? H>QjO,j A^_ɿg_r:ﷶ4,@*j |\~/fxu&k6 c"z!ҭvMegjXM,ZoR pexWغB01D+W T>cL4 Zd"J[!W#+}7,rf#lVJu"$E=+NNq <_ (L A8#vcqHh^!`f><ώSex':ZyˇHnUUA=[W.8ދ~]aN%Rn'5uH _murr6`6?n8)m/Tcwy1mfoF3{Es'ljRӭf}DP^'_`!F•␂IzƦZ& /fE |#;67'$ S@|q8cijJAA㵁*~NpFv҄3jRFo ZxJ?e?& _?M"5HbTTǯ݁Y,k&dH%U>?\ 4vQM0 V'}{cݤ \q=5<էbVq#? !ȄӉj'/rgh+A텛/I=(3'#Ûl|hKE!.Qw9 z}lM/f/ЧRIJH?0~,q,Q⽶OШ!׷O o-nǗ-@Ykuxb÷^JU쁉]E@yW28W~?Ɵb9?Z?:9J>5n_nc A1G5;MD_YnUF kϰOj,y1M_Cv}4r?UҦр /;>8YUWZPAnEkw,'ˠGbEVh")QϨqhg4RC#W}PwWUxY*؍?u'1ۋ_/K(vȳe{ n=Ȟs PE{Wa" Ai57Rd_ej2O-Oӵ rXǢxҊ&xۡ Z2,aqۈZ`#qeٮOgT/^!k+sm>HBT#opUa/{aՌi S&CXYi0kQc-=!F턋ÑC\B?XqȻ|+ڸ[e`/@|5FRi$C$Fpaz(ȸ~lhjQmRzx4.D>&dYDM^ %Cp~?{N/ikZUϪM9q b EZȐf3K"By~(咦(fq.}{"Gzm&em"Hty]NÔ; OT,FDK묡$ToLe{! nE~:켛$6;"'--ۂ8=1NGt8tB=Pn쏌=1XB >QGZ%d:# Ta\+[PsɩEXލ.Ola(,46V<9kKrHGlfdnA'(알{yW،\*G +д7P[3I'~5WE İ͡txnbztClQ S $Dy:r:nRgrHn@ຓy*U )+ိ@i"GNDh@?+B܍-#f.a]OM\"טTj}j ?{ 2m^iW6%Cn*u߹|YOZ@ 2rݣ#t1jF]`e=]mJ1pMVVȝ Q6o%‰J6 p@_n|TkKxpIEb~Gd$Jn&NL8{m@-ɻı([`W;%y éH! {Xd-O7A"  'W-~;P.E(Hk%%5)­Fu3wDI1)e}nXN* ZiBd3mB V[6-!ٶXc<+]Ojp.EAI풶5J]HK*M:%JXJcKdy _"̀ Q#9iS[)jNNE%vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/vX]6*v^*ثb͊6*Z Pa\gNy)本DEcVcdNf)lg9,ki"nS (2Jo.&^DKw$\/ߒ t뷏)iVФS0`TǛ'DkN]6?A׼9ڄoQ~;V_S,:қƁ5&mw N%Y^kF D(bH ^ؽA5.M+-#?|8ڵ'rqM%Nm /ܖSPm2?If9 )adY?Μ.HX`kvյ UcO#Mq_t jdҞNF |x['nA?y*I,&Ԯײ!'vUNH$KArHaו8Vo6u95$Th}2ִ4_kvJVN5ϯth@䷨ȿ OI:+6yX4u8:hd6ğWV -n p(wE1-ijķmc R}Ʀh9$Gs#Cmq"[Sǫ;aP" TVvBd T !yGF!;q]6#oݓ?8y)$=sPҴ5%Xw`UMVnG}+e\ "qJI+#$+*q_,/P$Y&qq?˅!jN[NXdC^eX}|_ ,Xʇ=qd 6 (R*Ӷ26TykSL! -nI=f-=$))Sx}Rkyz=K5 E'v|~,(F|O䘐+vck\c_Q|4_o"zM3QӰ2U RA.e&^%Bv=wEw6Ri}^^;EOy#q_EQ',&QUoᅕ="4F7aeNVm=(TOt%@kKsv ǧ#_+6HFb; W6L 1#hcQG'2HA֝N|uuqk鐭;t/Rc#u,Xj%O JJǏq\ kAV?. ";rn2ȴXzcWNEA5>s6,ynGii٩,j)ˌi_N/B ?H-ML%ip'酨OA#ϏnAkjjNn_𸭈y[k =5=%&p !T=ޙV!,YLQr59M8ڌ&K$fzm̏&hKJw] y}\@TvJ(ge&~?5^In;3X=LhɖPF?\W̊@O~HigMؒUY |1k}BX%V*ip(J}5R &oS ūR{2|M~vIi!c_ '&@",Xlt2\IYR5Ϋ`W?DӋ(OqM|DQsSV4TZNU=q\wG]]>p QGkQөҞ|[!D']Xz ›=Un<`w`k^4WSQ-xB aqXcm"O30v/*ҡp8ʆ;rބ~N\x~M | }؆LoM6I9/Ho Wݑ颎'-(aSHY,VwW0eptu<_Y0S~X,蹍'B:אV(VQW٠?7XeD+&JWeuŌQ߉b\gրzX8 G_|'cH @E{lHPwvX)8 FqZHs_ \2erHnM;cZAS+Jp?:bN2A֌jvAU0ݐWCh,Ʀ|7fXUTr_O4[AyPX _p=k;sd *8/%5e0[zA4KIJjrF[!\fm)6?gkG8 D@p-MFT-op$zZNHizWa%M>l-ݷ +2N:γ%Qa}Z9tWжsF)~V;d] O ̴XQ+7#/!^Jcӄ|FE k׆pKfn;zZZ\ZB2jLsb͊6*ثb͊6*ثb͊6*0=}6Xw3A{Ki#~3A6ˠl8TQKxs@fqmj+y`JFWB`O$5t;|AjNgqc$;rYt5?g/s̔g}{W b7({{w?ՒW18 M@pړJҕV5jIDt%zd/vc)᥼p)$OH@O,KN;VIGMW錫Yx 7MCѷ6[4eǾ }U`^!;ۚ TQnyxBWZcn?%Ϩ"OɅ+{ݛ[fU ]&r,g]Rm9ӾzS(W Բѓ訥XֿN/ r&Qs%]IP" a@Ooul֛ppBHUSUzb^$t=L -IiEYw :o ,% 7?F#mOD\4$} U{Rp&C! '!#lD˺] İ։޼{o9W47i#$/ԣ`DDұ{Rv4e]@N\N hc+S>%>)|Fqk;b?=QXa՗Ӡ+d\K0PhŒqqmX^ۿŀ;[Гu]ҹ"BS+L;ȣ \"?d[$C*K s%(<aUWL b[1vMO-mDMvP2#rGjVxlm{}f,8!i?ۂlVGF, [xPWؽоQpZ]HA*$LDor#~1J^Y%Q! 7%:C] M̬dj f1"@6vMnn;Ӷ2 1CZ)oҝt.8WX[ǜ;$:pڞH CD+^댍18h;Wx+hked&1)P(v8Un8]4yXԬAMXc(U@斓,s*ILchr4Ȧ)"ToE>xc;YYNi+[l`HBhx-*ߜW<"7-R;Wn#@S̗2 ~ěHkkKe7۩N&Gsie){v2V !>F-QGSANY}Ek5cuK0k x"F]iZy3x- ԁ|Qea5r#h 4FLHW vۗŒ(:%)Qq8f0E˷ȋ -"%|zo(hjMH%OFi).pX=6ȀUNT K(4fMFi: 5jT>dȦ>$ wZ #0c# lzTTCAჴ۹ZBJc[%n(@Оė$dIFm4)knc#{eYu+HAoZ&U#{z|bCtV[i *jTv^n?OmMW>K W x㻉 r>޽X+<-|GN-O#%;R^r=KTߗ/%8mϒsRT;$Im~" oR5Bhn$jpnTt={ KG5ޣ1F4C_Y, <`n02Z}O-D~$$Fekmu.řPOLx15mH:S^P=XB*d1Z Ze˅iA&+C:LbF++ * $-?8me5h֧I`is-Ԓz2)Tmm_CX7&wLI5Ux"@d!jz7}i ck$jd3ip͟\D}u_UwWіU+~#I#-H9z@ pF&1fE=QE+Ovr$ߟ#d[Xs,fiPw_8.gD]T!$L kZ+w-෇zqkWҸW,K2]W]K( dSV06fſb7_[OՈ Ʉi<]Zٯ.?Wn`!qjIK_Z$,ң)?*~bf@z\XR_ UgN& _4ۯg6!V 2${́,'zi M/\uOF! % v$P2܀P 3vxζޟWm= M-u1]I%A?`r'!,EvX Z|֐[O˸pnV* 4ٮ^@gE`Ӂf5f{Hic,~CQIT]ĄT7"1ݤ婭gso4!(L~7 }Vux1XMe!d-cOت\̠B ?6DZi';[Q^|5EJc %=֝K~N&Ɂ Dj+*l)wުG$^د~2x8hB,Fʑ $Qs.iJoW)ֻQٴo_qB2Dd`Wڸ[gp̅߹$} m%7kJ RGY[ %uSB¥:4zx1k+]/U61)xwQh\8CpՑpcRwųԬ'4bB8x`!`ִH|zcг~s$$J#Z(ĝAyu ҡA>ߘ'`:{C(ssQ?K ]&K>xJֿf'K*pzn>x I$NB`0iώ6ԬKrMhXqRXYn\i$H汪Wrs=HӐ$ӗOaX2n_ Yޕ'bIpUvQ6I9e6 _8pļsu3&n!gV~3]a?aeq!w rSGdzT}4_k m doUAV_ȥln/Iñ 7Uc$QBz)j%h6rK= S@vӯSpj`qwF%ٳrјrlk*(`GZ.͕qw 2J4 :\f_W*@4\ˉØ{O徶2@"q\7J/h6vΦ#YFa@ ]/ϓzl6%ksl ħ:cG%P'Č\D_zPizZ.!g.<̭=HemLjP 38&^@ţO !;?yZG S}<:o}@??VЀz׶6R%iƣ$>4jUrbq,q LKv@pq 8ɕgSۧx914o,!QxnMNUu5qqp?݈qmQK1!~/ؓSR77Zj7}W)nzAnبP$ phU6v$n?P($.B),K['Q:d4"?>l#ܵ1)`611]]GU 2g=NY@`:WB/ʚXqW1bqQߊWvӁaj<6@`Ǭx{EnrG b'/GدDwfY<3 $k omOB| 4nKmQޘ כF Uc<ʚUV#?).J(/ íthﯔ,Y-O8?I<)ɐُyFQ>*I5XHy&;]LPnv腒^BȕL+Z =Y'ޝ`%_`;[YĄH-kZ\K/3sRIj).#$nX/FS'MFUUDi&<G}VUxaPHKy(ȵ$hME+B:+/ٯz ΨL#%WSfBIZhP&% ?N%GV7ްZ$,ԭkҴC BR7j]Ǥ5P|ӂY?| K1䇎Z~@I3MH\W%iZf/Fg܏ׅd1CC|!5pldĀ;iHR ncd!`, 79qŬU"NWm גG,6(bycb~/B9'1,Cinq L&H܂`9=޸Y<0RO@>5+ԙxT(O şS@JKT~<qFv*jq((4V.f_J|I, F *9ԳG'61?k*iҧ"՚k%> ^R*_ PCK9#Tr༳Gc""N;jqI]yK9nv?߫8j#t܊{cTZ>?ۍ$[D" zo,#?^BE5I.ztݍz`O|d#cP?VI|~wpQ֔8@l4ral̪xŷ}ra=%VK,~Z[_43u´K)mW~q>on\q[[]-T`IY}wDGQ$Vѱ/%uE+;R}0c\\$%{E0}I"R;Pgzsċ Eh9Z?C׏d4A/܋jوՓ:g.ȴlUٱWf]vlUٱWf]vlUٱWf];K$3K}IEJQZ/"[դ־3]~M$=1&Gl{Tlp:JN.v}{&[bddct,&Iwi  ‘C(1Ew>oeZZ5̣s 9Ч{I.y43$KPVz^I9*{b$ig&_KӔ#JH9T~|r2ٌfO$2l#idS lnzj5MDHi (N 58?A7ڜWI<)4%.D&2d3ɾ*ҴVwe Փj2J' 5]#?k!el1 HSjP)+iVh:D74)=gk . Fs+p dehby^x)D7Vpe?Dmhn.Ov=Յtf;I&2|3U(P;4xZ M\5_d ME,P1Y &GX.渖IT5'kN,U n~>v&iӏͶУ#&w.ACߡ ٝn,èHbn ӳ~G-󦰺|2H@P>?]ѩ."^-b6^^@q r%z Z5Irgo|N82 6ZOm˰=渳6-%=l }5\zuWqqm@%@D +nGV9C|6QqѰQh $E~9H|iVzUV+weK}J[ 6Q_FQx"Xp]XeӒ^`4x@,cQS[Z)boHl`Zu+Es+[|}KGahkHExø)l.DsLhh \[d;9R29WpDQF( df20 JOHtg<*ޟr'vp68P)Gm{sʶ#ӹ,Wt]sfA表Y {. ۖWWxfmd;5pIOMZn6_H"N{3ZSPȨ7OV64 MvYWޣ9捺Afofo1v 4R,N3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊1WeUٱWcWf]vlUxb͊6*tjY!򝴐+UT;v?rrN ĽFʥyH-j"AUk5 =K- CakuU{OA)I ̇;xbIn/Q΄SuߵqG!¿6m"4_^:=#Ǖk_b+u,$8ҟ+Jczk” ¿._`kkxUaS.-SwABk6063Z7 t&#% 9T޸R7l.t,W'䜂'/TUn? I ҟ RJGIш?l׭]U%~/%>V1v?Ic/ .w'5Uڥ~򕱖GU Ag5' ڴjE}rD0w5iA>Ec`ӯ<>p8Ϧi|"D_)Y+)qO쇼L: |-Jr}qPy]nẰSkJ1MmsJse|Jpe<(&C`f5jҗiS֌AP|J5}vd`zRqy<$V_\A< Ps t{v-, h裰%P/Y2F&N$ }VkG jH|{7__>%jd,r@w+yyox$#~ҳK#(oY%(9IİL־~VC + r[Ƚ9n-f> 2k?|ZJeUymfeadJ܉ ;^{85bƇ~/Os.I}-(դZz2xB;$kIR诫B-sY K9Tƌ!k/wLA&SqVo*r2ׯe#(6s^9Y^ˆ@TNiRMzkcU@ѱǎ @6)kjfnPI>|!sn[/nd+1RwY]2Y/.t`kO1TSOڄ( )),OKS_AX(9 }fO(f'4 }Z]{ml!~Ff5 FK'jGZS 2WZJ-?cR[mɧ^T &pHE/-Q42ЊƸOKU2K $'Ÿ~ y:rW~V*C;DMV|G X>Ts̀M`(2Mc]XZ@; |%d\(#ܟ zHժ) $eP<_N(aQ^6 h]X( *‹X*KjɯnKHC4^Kkt n_+r̜!hhс2/2X# U/#Tr^A1̀4x|VF7c|ONX37/~AG> |*?QrT >JRV)ۤIXw5xMO$%, v@w*6*UI^C@愚V/%c+Sp?i >ka;7GyQZO+E`}V*_z mC̰R$X="@jOX= 6 I'(Ō7ki%Q@?V.1q6!~*M3]g(%VKO[:;{f<1vjr-ð69e4'pP] \J0T!4 կ\TqV,YU.%k{pS>$7V (oL:qdCdOʿ[L!Ag|%9]#Pꠞ7V$veo^ŘLnM68exyJk la78cw\yQUcclw>}8EOLr4E+W8Y Eo"aO 7&XŽ~)lQ2CgЬ6Jը8i_j7ncT ۪t8&/5FYaC7/vR4's =21.EEOv/lWJn+LSM[ur v4pE 7' R t %fRk0/|p>Jt$x ^Ew>QUcO̾,꫈*z QehZ{Az> 04? h7<%cm4\Of9 >߉o Vox|bߤubE'7˖F}/Ė.S_oOW o?Oe+o@JY8{*Wd9;?Ɠ”k>Kխ "6fƣUM"v P"/NHۓ7Vc^Kv߷Śy\?۫pĪ_PvE̒$vW!ӯK[q\|@LKdžCiFQXatp+_kLI,WZƂd*"vcI<bƴ9r#t841~ v޹xفNl`XZ6>xFzmrMgdElYGC^4i\"lnȞګld%;SvJ4 qmoSN,oǐ!N(X֋]PJFR:R 6+yzWA2~;ok1HzP Bomܑ 3-?HlOSl 0Mu %>8&cڊ52Gnz'^=\#o8Um4Or?lR˵;[\M>qRAbkdg=wdKZ;C¢R|ˀ϶ S%̑J [@/iEoX.j *;u .jzUfYcjJQ$v:LJӓ0 9ܐwܹ7,NUҵS_"#B}# Sn )vc& {+-n6IY;U\wy,iYiPzXƿ=VT-hW7SqI ҋcT%b@)Hh J!1ߦfݩ]IO4mV[& ;q\YOhgJ8*I/}iZ;,#FEv䆃s%XPA]vlUٱWf]vlUٱWf]vlUѼ. WcO3p5q gDVM5; qN>]*gi=J''5ףEQ-0){WmkÔS͗m4i׷^r6Wۋ}f$%+l"-&:`I)MQ催X4Q#l1jФ|A|=dӫ+n$er8%ՑlV$,InQS"XL(_]oL0af RsˮiH媦\2 ROnJ6-t Z SE0^LV&Q@:R܍ӕi94/M Xd8 So3t0kO2B6#a:Ҭzu[F*+"6FVS[չv炴=HG12dd2鞼+,x:P.帖dJ2)S9˕#""7Yay=`dx؄Ʃ$srVU 'aZpM֗A!g|ąR<Y"db(<~jU9 A&C:|5a}Esb~.Cw ^d&l., &4aDvw=+6jsR?[!.(^mg#Rr;WyY  Nl4yOuqC۴D"",z.b~5v4,է=S$,Ii$փv'ĒHL );SD[FBB79ѲDXjK4FgIUUڟ#=ij}-`ۥ0\K;0& k!=r􂐠TNT3O rڽ "B^0Phil *}|г]$K(*}nVxƪD}a,z`Ӳ(R7^UmOZ^[׭wo ՑPSAv$4ΰS{=Ӯh4%Ҡ!,蔐,rZK4E@=JqK-OY(!2Jֽ|Fs_F9DYsJepR3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Uኻ,b]6*ثbLUxb͊UIM+CA(`Uc܏cʌP*-~cPNH9}E꘣Jy;>4UV  *QljG :1kєsX+*qIVS^])%3Y OFP~/p4fvf*z f&i@3f((ʯ/|FK*#A$im`񫴅UU[ܖk+9mˈdg_-\ Ae!ih1S_J~?݁USVRksm΍pF<'nQ*OPiM\PJIW|(8qȩJx1O~ dUa:bFd?YxI*1\pn%d9,ī6oxe]ʷR[Yaj4}HՓ_N-az29W$Zp-ã`oRNkJc.%sq::ͅ(. ua426(//_?ˊçHG1A(MC̶. /SV\U+Ƅ+!"\ʴi(~&8UUMY/bMDǐ#?g%hZHfeq)/|ogGE5{z#1R\04[xcdYjSw R+߱2R[nVЅ4 Zx([ںKc>b[J _Fxp8 K?k.EYl7?, &tJĪhhƪn8+e,bWaŇ:␫Zڭݚ!㍽HzÏ+ [[|+ij{lG.,rG^ܚcʶӥBݫnOAzȵJ{}bH~.+ϗa*ƢI1Ddng՝IJw _v_(ל8Ql&oa15vm*+Sam9j0VXWZZI&r#M%Bxq`K5K'+gnqCmVLgH?A y:BjojoPiqz.(_֊V AiPwkz=?X6LrOo .ҭk̗Q[%Eo\uj R:)uRVQ˝ tpEÏVQEt8P4țfZ"~!q`᪻Gob\&%0;G# 8*P7Ř mµ O+Tq.K+OҿF!m%-ojQqߧP`Oȍ-Eu M;=SSxln z酱ZXc%*VA8Srʰy-7Vvr遤pA!$ *p\赼lʧr?ⴔY^CwrƧ?MI=3ރvW 6Sѹ浂N&|)[jv\ ]BT$y1HcAż:(um[U,pG:#W?>/tJ' u@XziUkHA߭1fUXcnJ^5_l#4f(1HeVKs7S~*\q`[ǝjDq6GlY&Omq%ːx.+V^?Ys$ž:6(;25AU\^8-U*-۩?kAJ>2ՅkO6hv]͠" K*}IL7b0kKs $ʸZ/$H Nqg]K#Ѭ9w)#$QR*o]-e$?,"ؖ={ RrHG*( j 0,c=*nZ"Z~n_|oeGṮ\4$nƭWKEDPU#_9)BbqF$O^5"3ur,FLQN?2 $i?c1HHOpDvPִth-.dͬ$Se g>/G }Gv5m K՗SL#+¡L_(.?/ w3khHz$N[oi~_3*IP>?\ %ID}"ARvw,.3ԍ@LMM,m.f`>8~8D)m۱+ھ&Mްh$߇u?>bVcP 8(mXѬBͩ"\HR;|*(b|0TG? SѮ^9.&6YB0 e[?yĥ=A(UzbAl Bɲo t{ UCv)o0)ӘHD(7bTRqNi\t$rI TENlח%>~DŽZj+VaRw5>d424e-M{zTn?k/pDG0Q*BH_ }ͷR/uW\Cj I-~R>3T/7k`F{1L3iFW1[N 'I^Y8ثS$-@㤭ir5$eX87{RB]Y$m%3 jվ>)_Ŋtg\BѹSN$6qF T4#Eh~\Sbik=U4mA)~>rr⍊ 2׏jUU?*=FdVi2O( 2N bl@40SP%;U_6Y8uGNY4O4Rs0؀?,A%c\I,h|{MUWSvČk 6 p'W!*|+@~g,ÑIҚR/ۓZT(健#l!S+b`I!=!Xn7R'e,_R(l\nO@0QߪG 1-HD7,~TZWpWdZ8;1z=3lt(HcOܷ) iJ-"7ktȑzGZm靈l Hl5M\]Wgc)@Xy1cxҎjGo^eۋ̴ )G;s N8JP-65i5iEjwR<(CS )(xm]C]r[(c?wL$k{b>n?̿kg)r)O:ԩ$6(l2[ơn 16Xo@T'~S_`;%JԒ S7<R!aTp(OŁ#2uSMu{UVl GeO?Œ7AtөW;O'Zh2&44*tX>xis[;܂:ޘ%eRXBcCS(n[-U#PFQ@,J' Ĵcr_#$Yn(_c!}07o.kwn12>tŠꚥ=KM`G*+N~ iռsGtqP>HN$4h@[$l-[WfbaͳtȂ bVlR|F:|F†&j+R?<-S9VQ04)c !Xxp+ zu~6aUO q~,F_MLQzg^P&W)?gF֕y-8EOAW_XBoJPާ yq?*lr4TB߽p(CB6?K#%l&i30~,>s.j06ˢh>Jƍ;ؐ{yֆu N)shlYIV턙*ٱWf]vlUٱWf]vlUٱWf]CȐ$+I^3K}IMF&#QOrH@0}3*B rWcN0-M ){a^u)U$TdCt bSY%kB̦6%W/vyhmYdsz* sZ ݴ Dڞ;xdHݏQ@w8{ !Lh*;\A0y&XԠf21hџ?% =T8Q0-Q>!Jw.iTM*Jx[C1!ߑb@?#1 RyxD 8\BQ2T;-FèK8 jd{fuY O&&& !T}9:k'BtVcSɷ?lmd4)8:䇧f.>I}֤uJڱI4 lOZ^]BzJ*Ր"챚oNtK$ܹP.t;o2*ZԬcoE'c ԥ)Z;U<@^Pm)Vzpz4$p lC-b׷W~D *DAf$־I"3Ʋ[ʭТ\ȐJ"FIV˼"X*L}a̍k ckJ]Y4GuSH=2' _VSˎwiNbֺkfj*rknuWIg%6Xdt=*$o5qQ?nZ;۰f#$wMV5 <iQ[$sP=qsc"O%ڍܳU #Y$qE*r@w䎒ҎU" =FpHҍz *Wh¥턖w*u}M AbZR=e&INL%wc^p5?V6hoJxl86t}Znb=CO%'q^`fM"aLV[l}U2f42?ƀ݂,-}aX(?h86䆼T["#&HC8 c UzL p1d>9%H R٬E24rB&VDUd^5[(̰ +`"#I Zi5 |팎Ҙj*QLc|1ZH8Xuz`2yoj-Ñv(3  L J􋻉d$sJ` &ȜQԱWɰ@!ӑeT5( _4Rot _e@rlcߚq3SVf?m[M(ꓰ]w rZ=N(մY5")0+s"j:޲&*3m2:@:33A$RqZ#!Mvr 7>4Xu=S}]riP|TT~X ICCN#r;o]Z~sEש8+TvԹ=j|$+Q>jIwQBԃN{{;svjARY2 솅d{`&وҶGh3L )r;ve24^\5ozR_F) lx2SḤ+Oi7d)qc]^%.ďB0@s!AfCV8$r O۾Ҕ0GnM"eң.%\of`+Z2Պ]}=m1cb7j7 dA]Iȝڿ1!v~4fnSĞg!ΪZs펿.rBGLbtVoSrHa QZr 6F^[V":;EJ7%Sz4A$d djm}ocH?7)p`=ϲ+ޛa&փB_]wxǨ>G$C˶_X0Yvx>C[uoE]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*UcvX]/v^*ثb͊5qWeUXI/]766ʿN[!6H#%Ӡ4t@ č |K| ŨMvO0C_rls\zҧ9|\袚g-.9zko'P& /i0[ ;f]+o᭜\+DGֻ/1YZ3-,b@ |) .nleR8}MҼg$R;ҕLf P+Q}S9,-VԪqmն'`H-J 5OL,cw!/C>*l hVە QG,Dg&=}f 6yemWR3@6U5&`6(Au'rw-ɿIa30CƟV* 5sG I_Rw\#= QZE Wb{'[HXaVieUyԀYE@m-k+g\Mq0l0j?p%FaOO]}c<̩W =qos hXĻG>]GKnUPF8i娢W@-Gj/{FiAiE]e["];[NJzIȼ.f?P_apL3`B Q~X9)o "[)Ni7?nN\Xr\]n*m )8&a*~=D>7/_FIx_#IB19_k$e )?)ǧy22:GV!C~پ\8}٫-,`W]kFЈ_hlxbr\`E{|( f&-A`{(r댎c,D (%ZU!ieidCVX%ǥlI>/hD>Jnc]_@@z%KgU]`N\Kƶ֍rVZ yo&|  CG\oM[~ L&vms)L/% ¼G@>F:|ʸw ;x۱7fHHe'V$ׄVFR$hՉ@6e?M"5 4=E@#ӠG3`kA_/b# &!IF ܩoǖ!Dfdbܦ5wWqf l7R7\qf9.Tq-(6ƥ;+J. 5}L"#ʇ ʲbv!>.p sZz+ӾyWN^ KoOZSثb͊6*ثb͊6*ثbΥu,ϧ,c˽|3cYOGJfxӏjd)w2TU|ɧ^2S}}2 $jYfyR>jo8\Ւ%cMọ̏)㌥!s4ǬYE~Nr[w Lb̾8cbڸ1mEW e[Rf-tNJ$=G:t py/Hó*Ai#Mj(԰[{?K~a %}p#E<5Lp(+:f4Np7gM>1Dg l!X{M-wZaf AS޹8dQħflMK1*5Q+6S* "'$3A8T-vD^TFdRNďUi.=*ɯmM ǍWOYSax53k]_bGMr$(cQck$^ڟjiifR݂AFc`) #B #`!Û=(\"V+`D')mRt'$i}Ef*'4Y(ԳSLQq~I`M{ /x#V$ ceŬ']r.Eo`HnZBBDk(:|5R}UPT?N-}PMCϋzEk^=GAFIGguyO1jmdqE>4D;;TojӉ? p ꣐ Ȟ}j&-)q%K l؆}[ ]2;Zq]<@ `@ ֍VK[ǧ!5D7RzKt@߯l"?z @e9Rv[ڞ?pկ 0vZxm%nC7zv')Gc-$Y{v'lM8(xxW1X$T4&NLHm-HZ@PlN7w1RHkիo*)j-Lڇnec;Iu_u=nw?2, sM|Gtm_ޤ' 怹\j!T|c֘ч;}8 帏E #A,VcQ^\֚Z%7۾ IuRl!4߱ N&GnLF=JYgcֵ֮@FDmW62&Ei09 T%"zbtXX/ V:x[8*9k{:wqa"w?9+O2hZƝ¸Uٸr?X-g zMYtt3JΕHڴocd|r"}p"z$-Pmm4ߌ I5˞H+@UQX o)iP$Q'JȄ$leT + &p$FF3ZSi0qhfKH@Wj=:]-iپ2Gi?ƒms,֬Gql[L[f) LM)Ȉթ\9.Uk"eoǓ v2k64H8;V Ӈqo?rڏ;4 lCmov*yr2`lWJ^qdJPSӎ^<7*)xX2Dc;2U% xFn?h^.z|D&"e@fo)Jl{DƯ+My|fỊɭ"$ |+y}$p}F)p}U;r5N&Bբswi4F4ZPzq(2kM;boLŻl#Rg չl{B@`u.Nԅe=>qI6>ZPJ,Vªk 7A}Id PH,X>t_Œv#Z4tӑpB-[V.=X؍ H't@ҞeI//A.*]#ʊ{Dǚ$\YxdR[,U?gYƱLОyO/&*W5o gq<)Zal"¬n#,o}_UĞ3l1jLY_0*6O4pbik乖iu<@]Ca"(E"%)]h[ZYyR8ZWmnÆ0D,$_on/u nN h#P[u_8- wJ+JRބni Wv&Y#=+\| څy؏ʿ q8'.QeXΡrLۅR8|0b $ZpKlzI=OFjO©#!ڛ0ڧo%Ay/$$Zǐ^:YytqLm%k! Si?ɯ\nY]cjs|G,+1_[ianԺ͵I]?eOB75^7yh-mTE9nmvP-i.$܊vXXv}6ۑmJ-h9P]qLpp}Fu&ʿkv 2KkJS; |&I>/e_\2yLytKlV MĠJvEn\]؎_v@B (!P ~g 2P~Y!l- Ǹȳcp=k)BޥE20 ]MxuZڥbGJf_Lw3&]=3\эZf HP/aܲz&x.OKt( {⤕b_5ݿ$$mZZ4q2,'@ՎF}V |^  QăI/{X}^G̦~'vqrf+F%EU9{i_Rd5PjI\:.DjO5>?"2-f:"s]J Y~|h]b,=흸8úKHTTO'^_Ť2 ޛ!/lWIJE=#"M0‵OK 7::mݺH($'ONdR%f חWA2FPwO¼k8aݏEWjhNO.zV>~dhW V/Y,qDUoǻYE]]ɦpI s5;r-t0Ff}T|8_\M9 7j(v_/un_Q ;dFk-'S0ݽ¨jifqi\/ P:#oבo(iZ\[\~&U;V *7&D0丯hzƿ-ezq[bnQ6ȱTGN|0b2ܢbP4x-kK4>'2YIp_g_]EPAk QԸܚ5_p}ZzH=G;.LI%zh(epsRn2Hy}c' F)+VaJjԷ`&9yT/pr,γzjB x-'g4lnFLviӁRM>T}NG*{#߈ӗ`bϴm:-VT  yV2i"^GcN3C# >+~6ެj"+Z98m/1%_$[58XJն l_$)lSX V!M(|_h2 v=^oiU[ƕ_͍k)˸t8>߱;ckD݈f 9Ŭ6嚦dZKn*M)I{]e*ƥي-6ӊpk̓xO)^TB-&|!/$㔁i^ z\PvOc=rd'hЂR1*7zt&Q[c]|?i'&NN*R4%`1wĒqoi7$m!Hz'Erdޠ]ʵyvOfƇ}h}TLPz| 6D/v#Nд1Re?j#c\In4vH"D30TU |R.;l.$s+(aC e%U醒"ȟȂgY֊SvW}uE #cN ^ckV,ÒTP~tHhC_o7!Coq25~+}_ A45KTjdYa ?Xb4BT?V!*r{Gf»"HwWzo&n]u"5 A/WœXj2 l[I I;tm TVeG2N,dT[ QU8MFD%ZV[{ ܖRWy!rPOp̝~vsfk?e/g<@^jr9A=͊6*ثb͊6*ثb͊6*ꟗIJ‡^"`|-XATTo4_Iq3QHcnF(NT%5hR^a{ydb $y"EcDdfE B2d}@ƴ;2=\*&Zqt>P5>`J"(A@zTkkWxEaiysRPh6r }5ߴr$u;nhwP6J65 =eF5aO{P'2.}t#P^G =j W-,Sa4dtYڥ5Xu?ٌ{Рwr4RGrw \mƝFFFӎ=JVYpF&YZ@/ +<{n ,TPTdԤ[Bz v{F;1[KBּFIlk7~c ^Iʀɴ; A?` SӈZ8lø.LdUʙ=#bpTv2"j!E -9% w[;hVGʌ4G/KmhJ;c -ni6U9)J.me>Doy4h{f5!TYoނ L8^;tkWԔ￉閁L%^1օZ%yM>28AрFLXM;F83;ϼϩOߑĜRY࣢bI Z5$$&[XгU#d %5̎2`ִ1vt$TK:W$w4,-'V@2<9*p^)tbxц`YYՌq;,zd] Bx=2I $(3=cX S֝}]WzW&"&\;+N#q+ HuzM޷7j3 Z %P(wxi^VGnFߗEkF4By7@mD=;J5UGؐ;ڵū;]Q4PڭtEI:Z0A e-/"u Zk ZW6I-Zڞa5F(ɑHIZSM=_.9Jka zdk&z,dL<=\Mζ͆i:Tivdj4pM2F-f o"5 6M5ܒJn$j/c2'6Oa(KZv#&E+Ǧ?@&hT m^Yڌ7 i*&HKNHXEX9\N-$)Œ 62#Ljڛ m-0i+%w'>Ac(mh@'@Uhj5xb3 Q!DrilI+˨|q{dkMWjC*-I;,Uq#=>!UI-hUS⢐<3 M{j⁉(""56щy|F!hgaq'J(O@YK`DvVx(;5sՌd׌Azn?lrifO@B"quЩ:uW_T0;LK( a 䝲9ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/v^*ثvlUٱWe͊6*ث($nN*W%~kTl &5HΜ%]A76R,J CMᕤq">!R}%ruۛN[JH!p?>H}T`gúGPk+QR (OM0\q(Jg3CSrb̬ 7)U_h{؅kT1EVWZ5에鬒yۏXBW삣 ɼ|ndԙ[!~8K/w޵8[c.֏CipAP}X!cCӗSW[VOߥ2ĠьF>IjV < G >ϔVDZ>|\Y8D})ML!Ғw \EѨ?ml#ot91 ESd]5 -U%AџO u%gŅzY]T[2P#! #`  i>k"EFڿWq./q"[?Ő@WԖF|No?h̜.%^0&wm62A2l*y`v![@Qi5HDxМ/ MȟSYH!7MXӤWGjH/>׷rAt\`dRٴ1j~ =DRpj&@،-r %hdamR-n!bݔ4-[g`̭_VVPv1+m?^8ڍӍ Wt[xOTXf`@*~Y/KѨYl`Neqı9u܉ ֟F! R2[۽Yzry2W\zaF#%ZCY;R!:}r_b~ h>kІٟjpbSEDO\ VRcD/5d>WY;@EM69~V{Bڞ^#l~gLbyuy7 'saLcP -`b8O+/8XKNߵ.;Ho!_8>-gy!}3Ŝa9+i] S״QPZwwW>)dy%)kR@lQGMq' qZ&#k:adS1o*B켿 #jH]y`]KuWiM@}́rw]ŌM+`ChOm!1,Gr?%_ (6JW;A K,lU?P^A=Eyhfxز)Uo^i4sB~8}KalLhД#G&?AXjOňGG按$U9}VYb%'Qi\Co?7~JAdZ[sr 鰹p &FH=C|?ţB!$j=@r#Ac! pXQI^2r$ l,A N.O-M6Č@Y0QjZH$b̨kX qRƧX9@ 8U3K`xoH6 A&KȷvH}ʬa_Y0XG+'Q2*@JHiKt.jG_%#qT{a!ބlA7o_`-z1 -Ʊ44r)oBJ)I?sH|[aF m- Gh?Wa0Pg>yUo%ɋJ䩰Iy3F|6›d6 PFczYJ\J bo#f;)܉}Dg!]R+^1D"Y /111d\gnJP AZ0p޵aERK sH!W9}FXh*kZ`@([Ȧf S A\K+Z{bΕv? @+P<X+I h$ʑ[,wZ(?`İ%|#w4E⩎z\0@JlGW>K 1$Ցb{<[-Cy\OVxBj?pl;Ex5F(w ;J(vR;(j/+s oM,="S1Qm5;BKMNe+oA1`d\ 9-"ޛfN7g_K^j)2F Ƣ"P,Q##QM)㗠QzI^ r%CJn>qk|}RW}ת'Z:yl}M#;IU h[?8Y*wU0썵  $2{v '[!b()`M JYFO*CEq/ }Y_h:dSޕjlv*lU+qMfh IdF]Wsvkij7?ƕ"fr > tCȜamעmZCvHBItN*J2fU߹I D i"׍&O|[Fԣ!Wc n ( $YXbƵ&CO)* 7ıG`C*)jrޥ-3II SFdznm;o0<2d<O(i^%xٍcZUe^_TVY>r^;(cU--nE5*|`2'KYa<|sj&yc4,g_82=eڛk˞bծ>Z` *?3bڿl67/<.M"? Py{7ӻs" P6B%GBAjҏ4iPlUC?&=D9Pu.Ujz`[x#|Ȇ$V~~UC 5eI #5%-8D+VS՛3U7$QklM1ԵT O5ƝVÄU#b#ȏ­Cgo\a\z֏*j+/8ִz$t420@پteM|oocAʣbIZX=V8|)CKeА]WrN=^EzWɱ#4nz1SF#"]̌EhO;bLE0(ȋTĊ[q<6~q"H5c*$'p-$3IͿW$<CsmLqr3B&@)?_7Vĕ;`GV7MT ,$U #bIWWcb`z- jw8V2RS7d2XQ=ɀE Ua¼;+ /7bdxZ›לod覍@br,YU-"Ω,)og (90.lN3zp ,O~ ĈV`j~[8`(zmɧZT jw ,4* wa'v ,W+ƿb$]뀛PfioXBmBq7hZqjm)&j/V,S6 2֨z L! leKKeyNUA$ ]*6݅>t%Prn[U݁^") xaE9֡,Ef* j`+kKJ T%m#T *Ȯ15ÑT%~(!(9퇒9am4yJ 6'v_և(^R*d6+53=tt31nejlzDd^^g$!<u V, b9)e/sR_4Ů}&>Č7^DjdmGȫI9H|Gm6Q w@ݓjK52Hx H=OќCH7ePƢ7mn,Z#RP׾r]vlUٱWf]vlUٱWf]vu_ˠךjYV ٰӋU"2Ui+]/VhJw#eϝ8wGkӻx@n6MB"x֟,F=z+gR|Pk\ЁTleM9;-(dnd}\pEFRo\,& `g)PXVeL4M>&rԡ_+l @eqʶ@o>VVNߦ2DVr# *薷{frnWrTL#Vl:թ#qW49B T9=FY>TT-H1 )A>ѧe^,"_CԐ.u-)1ڇS)(b3ܤ |@pUFXWׯ| lKo^(;Txa-`R.hUُ BXXiCG.WcAR+%t(%w4@T;Sj.TB#˗;WF!8qP?gį4w%6iƊ#; :wP2 Wl^3P0Jk"B ##c{,> 1+K1G ai>.*zH%SUoG:mrhGD,6܈5K3^JN< e=Si!XnE$tOOpMjEW -2vrD.I~YId^b"vG\#;1|LpEADAZrҁﷆ]f6&ۧ e`$V㕒n¿|T_8IM<5+b 1jOM服H\䅈Qvocw2{K+@YTVWl,\!v2T$tMhM7K*#5rAf_R6IyIN1E{-"F()1/*yjm6gbCɾai'2ڥ _iW~jha?`=.1ab0 w?`h-dr$ƕ=[\Hn#U)ATgZ-j''X^iCNu-,Ek@vه["j}иCdĴI>pH>+l-j$`DynbIL61vrj|I%oXv킩GBXg Odk[p7m=ce 'q4sBh"[[r^9$v5 C^E0OLm"ݍ3⒮GAMBhI:|F\J9 <0a04'2Q8fӷN ZSJUͯANs>]z`Mq֘ܐ^*o]ۗ¿qVcEOAT x`$BH%:`O0C[7ۧF朄iZx'=ԯ^fx2li6@UlN[Ij0p%XnvhN'AQJM淕 C MQ~#ז$U?FG@!4EGmD]$wR#*}Ldl[+x/Rq*EwǙ.bNQa#b"՜;8ek" q)=JҴAn(=j,Go "`SC˭pg1bx4^='rv Ÿ/FxE&s :olw54P셼[AoQǢI ƛTx$$ȣ„ e͜2PĔniA*3GQ3zlk5fӃd9Dz }#P|{dYu=~/`,P|TŭU*Sh{/Օ~ҰƲ5,)B`<B*CmWuA@?ZbehORzA'gy(\!;:ZG .㗩ۏIU<*T ~SF3P鎞~\ wX(Aփy :Zs,p ~m- 'RZWđ`WEN-$%_z,'pߔsF/OLJPZ0;d;4u,1Zlw=OL.P6SKCR@9ln#C)xڞ+s^7,0?> SiSIrĎM̟)UJːa1*ny1pմ b{=V(c@G.z&| 'zߣMU~8c=HLCbvjW _ $mc+*DX"`Ҍ|i*@vU#j9ε=SAL7WzocqG$jt+>]kZ \J` %P7455壽4|(PJq"6@r :I=BK4[ؘ3-J~9.:4xV?`q7lHK%ɳ(n_Րu /\͠v nZ 5Yٹ^+ʺU'|m18=q(Ke6?HR:@CGdQ)@fPs t2ˁ@;v2ӘއBZIS-NR*Xwn~PPaM߲b|zP ␋H4đbb OdO~ M8ze%N)Le?YHd*"(mOwv,V!Ա!l%8)Pkj.nZQa;GceF+qONAv=z>H*JcEsKߪCqEv<~[}IKZ4r¬8;Z9bPy0?Baݮq~ۖc 1u_6i?R"H[ g.Z*giݫSRI5U:}v?$>ḭA}^g9SQX2,mTW;,U+Oq߉d$v4#b:/*ScnYK Kvw8L[mV[Z;W Q+Mէ ܹ]EXF⤕;(`,,| į{R +;g o! ZRqHYOS,!/mᲾokA~\t c+QI>`]lbsǒŜOXpxBv˦(掴ӧ:cY`[dX+ÊOzK bP|tƵ ;0.+x~a5§X/Q;׾aVTZ L%VYXH#5~ɟD SJ%O%uh>)<+[miH݆&Q+[0 k\FHN"I%""7K&m'nKS^pR)=c+vlUٱWf]vlUٱWf]vlU)`A#_6cQtr9怓rݜBGv*G|Ji5eHzo$z1P {P}t%^ DjA5U t&+Gb=G2~' Yrof%|Ԭʴ3/&{F/[+29X")S95iAڸ.bXGcr&$sIĺK{uZҠҜO {qlekbB̷ nvs?I }>&'R}2 l|skZ{SlدJYmhZ{{Vá=v!}jl[5${$ZOw-)8CH$2rb;'|)^@٦ \\P -&Ѱgw>8(5f1-~|G)>6t8nL֧./fEi24}=/Ll|N'kT_TRO BdIV^lLFt \Gj̧~2s ʍEXP=.Km* ֹiΉHഞGo+Z'oK@QʉmC)Vڽv;.e?He;4Y滒QN|'",W/qE^'*nfJj I7!Ia\/&ˏCtMҵ:j=+G+䳸OTN$qS m&Z1 )҇GH[;GsnF1Qron8T|'O[ѷW`i.i)hӓA?Z\=Dİ(‚_7& ɴ.bjLANb@^K"ShT-uN҄rVte06i̍[)C?wn.HhID'$jW5"iO9_; v[J[1NNJWUUaGQ!'S+|Լv^To@(S"B%-f1 $5}/ c큍YIYʳW?< hh)SWrf} ZݽW\v2#'dڜhQ%i67sj7j3_~\~(ZZ_ I﹂ҽ*OOpmTA ݄h mejv=8.[7V7_J4 _6\;%Qq'+NZjZ[(X@ 0KwtH7M=:sz#)]d-p$U}:I#z-QHHZZ}% V`YZ Ys`{/?qӏQB;bҙB:`IڸUYݏ^a0 {`"R+N"$y\4?gU. ~xHz"S[jHYxV8`wT~Ć@tܪvT_oRM_G$!M e?x yƠrv0sWBF'8H!w5G%#tJU9޽2&*ʁCuחt8&فJ֖jIP|FAcI%^@7#qD@*v$(B=iwaW`&Ԯs]R= 9万(rlM"P1Ŏ)ovw>!NH&p+VU|KR㏃)p$qFPibP7EkP) "ǁdYPCkdMj0̤%6?lQ4eFFjf,^E$n;R1I*4ě+nee|@xd[}nR. $GO1-IgAw.ۈJk7K#Arn J[MpOE $L3GOw '($,,Q?{/z= RAޖ>|jFjrn1bگ?愨d( 7٩Msc)]]թ'O`@ecPz"S]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/vlUxb.͊v^*UٱWa~u6>b-Hhu*TMr+ !,ŋP<קbU7%²01r^*j*?l&'f0$ↀp;$,`A;ۓ5T~Iq-`y '"9M,+OYg$r=KGcEne$dnC=ޢaarUӣ|\=qC_lJo6AkvQ$F@CO?uekGC,iA,.ћţf475rd u#Ѷ[?im0!jΉapTN#?_ `6/?&i B~ۑ9gXr^SnҖʞ-\ t1q@ṉBck )B;v Ƽw?NIO{|ךE`PW_v9=) w⛶Us\n Ec'K4hi<ˊ~yY/=jwk&\\uj]±zr,F$[*g|A~ҟo9q[3|u;QN/~U9_#)ӗ[H8T>H_&R>Up"!%OY$oEi#5$P/&ZJz>' Ho5jR;#v({h9UjW%$zߥ~`o[L[X;͊Q\V*(feo_,)sslܖ29œ1Cj1sNrd 'Fn/9?Go $2 hސ-HU8x0Z*[پy wţG|SJ1RIVROF9\>L:#6[d>.İ 4@'5-ol.WVTWQX}rW5n'B{{X帒?^E7'~_g\/KhjVBjKP=+.KVޛt? t\%p` I O8wզH,/% ^u?͂#$$"Ă+K;0.UOqk#jN=1P$GoE{/<~ ÊĎdۧъy o.ZY`P@. f#hiX;?b4ٮa8R P~O_\jW3"Z2C4kM:Phk[Loo+i^v^j~Ԕ4i$ե{~έy5[i\Dz?kx/Kn4}5~`:% %,mK[ٷ>g{$klJT#?G95C@w)[Ys5\"Cz-OY! E&Sm\=EkWщOmG)*H&@n5'KW8+`(6 3TVt*0}E1ٗMC+]f<ƈޢ#Uנ刔=$:-n#uiȞc~m-Ӆ G&-m,̐¤nؖ\LW"P#=(_b:Di5z{biu…uȤe%_A^]+ʂSc05{E1:,a!E!E8|K#UMé?$+>D:RŠJAozvN1iG %ԯ쪱#7✍9}~bPE7PYOʑڅZ g"ahCz//9$PNb{'j>w$D˧:70X٤G";]W;K`,qoOڑo/ʸ(;~G r_yZԺ f,#>/QNZ[zSS@"%<_eUPcw]}rX4gSOZ>j?+qxpa (A ]ɸu܎,uODG a û0^* 5$:S=B. :F*$ Ƹ/m^\KC>\Pܒ>hV-Lm(E< uv|RYZt(GP>*QKg՛%&IBkŹo?\ cԉ{@+`ϴ BSiy<( 3J~~ oLNjGJ̧O7_VL7/$vޔ!zK O.>Qr}ҿ>-  $S8[Xցf! 2E,vM9* d; u$b!̚P Qa \qnEo])C  m\ըj~r0m!UtBw$ƕPra*٣vv4B)AqAo͵vɘҢl$Z Hb~$/&ezH‘*0ľ,hv4 Iv/!enGlj%7%}T~hVqyzV~*9Ёp Z)dK35oy:/(J"a\,1_vlUٱWf]vlUٱWf]vvOΐ_LHO՚ciT>Km,yFO#@; É)]^q0 o_+Y/czde*ٔ}[l.F(+M ~G#m 63(,60A֥qڂїua!3ȴFKf6"PN7W{kPj|4[!! nl]4n?? K-9,id;`U r6Ĥ#c%jW`S9 wPy1jD_w?r|K!AkSiH)y} Mlϧݐ:P7n؋(H`P0Fq$fx놘)t CWiARKlrXf*64iW.M),0DhSz̓Mj-R\o޵ź$KQV& Hѭ?Hưu#{ h ߍ7J>%jIXnuR{ 8Rtu8/\eCƄLC-/NK4aڃH"`\V&V?iM4ҭ&Ed!B2Cf-j)FE>"Cw'(vCɀ4ޢ{JMsrpʢ*fw[`lm=ɱXkt١8` *(?l S)jwaTub 82{$+x$ b@ ^3۹I(V`VmtsJ20%=kꢐ6=鑕GBEzR+r7.6F UU7- o"όwE%҄T~70*AŬjv{7")E3Ӌu.C~ޘ~W ͱ|' BTO\^?ʫ) *ݎVCɀ;0Ӏ'e.vx@ӖUW`ONiȈJP*/jᓈh-NṨ}F6:콳83 t;:a@X)ԖT!w")$i4'D\4'O4W0E(FRmC*hGS JS|e&đqjlkTj'1>c&2A]_wve@}pQ7A9Pu.zV_[0? q?a|ɠ?03L"- Iqą?oŭn#iH@Mq݌wpʰ<]MRFP8^F&cebTF8a%Id3$F*ܣא,OliONpA**~!<.x^KtZTL*h[Bh~QSNJoom/ԐƵ6ȲMW̭oJ%(ʝi?[Q/G9"О\?LC%IC"j?kp@Ӓj9?1iװ[ꓓ"#j M*AaeoEn[duVM-뼀2RP;;~+hOE2H^ٜNk0e 0+GLX$H'ȷ^ftqK|\Z9݃UGh}K =X ϻ}Wk]^M^}DnM>x)hG֕ͼЕ|_Wif$i-_YJ\(o^L٣nUa/A^˖V/{a~OkG?Zc$]Uf I *k/YU;+V9'. w6(7 |_0P(ܚPm!4NP4`уtVdqM5Yζvyܫ9-Y[m#=;*+n[j#`9Y ni?q u;ŗ|(*?iY`r> AHtP`Q<dInR06>9cZВ622%n5n[gMCoŌ1>^jEz`dzU}&/,=Kx6@yڽ*Eנpdvp1<ֳ4n%A^ $*:␌⟀^\znp+?&U6Ӂ6bh!5U.4 o`k(IJPa wNta*$_`8r͵>&x.& {b>LӃ<)~·ϊ/,$ ^8T'wv}{ˊV1J"KrxSZ{pDJg~0omIt{[=sv;ʧc)lrcO ?*teSFz3WXW֐~*+-1:kWj/65+NOUXaevd(6'oW.X`C)n$i-QQk~8R6ƶ]vM1a*:gW # 9fy  #kݼem&Sߵ \$!S4ć-klVkQǷ/`~*0^B\Y]*V ш F: h%uX@hH5T ǽ a2n_2+i@u,/ISӾE1{\<6ҦhBI3Gp؝uwkeΠOiʔ}#nTp2%Z=VhUX$vVq#lӱрl#{snn?A[¶_SUsOKڡ#qlm5˄\Q2FNdtCn~46 l!)ż Q[ Ԇ[P_\$*7f4B,3^s-R(]GNXSU) gd#fc>cmM~_q+čxxyfuYVKyBFx$#;j1o JW?f.D%|;銄J9޿aîQFKu ՙmȅj|\Xr^|XщɔzGw'/d %OQj8~P_BEdX;$/n^M%M(}>04KrTԝ "4ZYVZ-\UzӬkCiʨ2 2-5$ݖJw* Oڽk2׊Bu沵E~ACtbYۼ,#3R $nUܰ_24ey֕A u߶W1J諭zW ~IZjE m8މT-gȥI2H=SVW@cL ,ocd'vZwJ`gA_fq#/uK}9CDDnTknSDnfF;$ oq: RAZ|U/y`:%TovCxDPk[[ -C3CI,ڥ֡i0;O_˼n HT؂){NLݵ9H)mAO Hl _uT42?W:pA@=*9PWD8{X^6A>/_%z:dnnvH&֒:8*r\tʋx},\`$]GsL)ၐUCwR܏wdDk+>?}^ HKkeX՗_J5 jmJ8Omq~Y6$w5dZeOĕ-K0^E`͊6*ثb͊6*ثb͊;|$ T $)Li~o4οHed#kJ/wIytxfSH]z9HF:SŻu1utײ? we;}Xߛ#ɖZYgP-5ie$}4sjGi^8݀í:b&R:N; SbŒ_ iQs\.c`LkpCƌ֗-sb[ZH?e9鏣bnL~Q9>O0+&ʼy2 [;F-Zb3$IZfՄD$MVUlWR@Ԟ#%>bl>PH$,OHrL.>M V  [1<ēfwq0igUG6nm4?.&#ngHC`JPS %Q`1Zͧ2_FI[1;| vgb(?i;Kn=YnZ@k R37*@b>O7'a$",Mʒ?#rl72%nYI=E^ݯ pN@(e!Adx j J@ qw8'^4:|SsyG0-}`>za$8я~|_J@&ClNirqp k+g+$fI^*BAcja 5[QJiޏtejt¶pAqM:N"QĞh MwViГP)aR9.'T+,8ӕ +8>'rITB!;oQŵ 0ڝpJjna6Zm.] iʴ'q)1Ѿydg|;#hV|eռǃ? JۢD 8W&!"鑦$+c% [?M=Ɉ_EtOLaJ|R+Khyn)Z teS*|2Q4%RK櫨m}yTT+8( +cr)dt+/~2#S^L>$dIm1;IAuC/X#QnS@;&rN\,91\\D3U٩O$X\V0R58NY"cE=v$A܇_]ERǗ6&)}UeJv$u,k֣R| 7߮`Or.V=rUL-/&1i|1v 2Hsz`Lw~QcfQh(OӂSJ Wl<`!'``~FV? (VKj p6\W">.$T+&?rDWwFv@R`Gu?)D5R 0BMC,Q-Fjbؔqɺ):W5-bVRXTbnySbO_e;ky8<"I uwčOMH{yHBރ61/Ia0}dxO5n~ [e) +4b鹏ʠV8'%]-c j1 .UE (H޹ڊ:䄳ХHܪr9Ԩʓ YAq6EfO<]#Ģ({xO;x%}Um dJb#:W|X%zaCB4 &8fNOxlnǍuI.dh P={RId r q$e[F-[ZEm2%;&0cј,J{K[-sF!vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/va/vlUٱWf]Wf*ثАASC;77$F?컯YG͋X.P"T>~ D/~߫ )c}<5ĵʓ kQ "S刎\iCnK؇!jo5_O/8u+c=78ZtޛkhìZi0VAr$z ]X9G' Y'^;ƥ@_rƛYnֳvlN\hc%[^=A偡]aRLު>eߺ?ܛ-a"H\z0W=;۬ R)}UN|y|LX9 |wcۛNe%J*O!#%zz y]n$n&04+}#Ԕİ" !2D;^Lߗ/my~SAaބGex-Ԋ\GC9mׇul#Wq,2#\?3L8wZPV0sI-a: O-dv֚EēUnc78rpOXC^SgWPE/ˊE;`#;Zb˄lXyZ~ _\g?Z) ɿ"ifxWǏ)ub[ڛسtDYc*Uq'nmWy\PH+)a-N[Xj2IfIJ~_kz0`޵n,QBj[)[@cV +\ էm^DOxOpBxd=1 XZ@!V&'VT+_7jWKeChvYW5S4 $A0Tܢ9TK.N9\ټw?|},.Ek-EKڌ*H?TxVQ(¼R*YF&9{``Ko Wnoa_x_kB  ڼq7'@ 懨 Txt<-PE['Dosiqy)K}qatOKaT@)~6.Ho3RI%e9"q:HwﭯdG o?h<Odڄ+zE`U2G/l)p#FG~YJzDidjq_KXJ*+חMQyQםrVQW T.R̮z/7NpduR4D{]KUm)Ks8z7~xeO%"mC 󥝯eX$Z)AJ{oXj77l`F$4 ;oH9lp )Zٖ@KE;`g<;b)ItL#O3q0QK+Y|oE$Քrc^ 7h6m5wVK8C#тjJW'a@CB+Zd̪:@}6&U ,c rJҹeB}8Jʿk_&WFNK1Nv(<[QNcP.\o!uT<;8t4N]?dO*{xdyGԯ_ҷNMZ$kE_6WE/-CZ˿݋Y|BANf6 ;5x֡Gt@CwZoXޛ >^:lͲn jTDA#'«;@jHA!#dɦCt} 6|"K+ֆ<,T\Vzq]Ɍj*M>`֔Dq0ˍ4imq20CFđu_X;H$+I'c{<_k%4*Q{^agi]cleck_q+Cq+hz 3Huhj?dsy_SpTHT/遮yGO:$>Wj||im"ppHE׷-37Xz~ k!J΋Zr¯+Ic5bG#vÓRI.o"$V=@Wq/o7R;dhw' G Nǝ׺fukF @OQ1IݶA.>ʵU O㗋6Cq-L'ҵN)DV8ԺBSZ|fInk֞MfҼx,/D^;/?fڭ_8ip4?WemX$Ze.%Q؃v"Fn'YKԅ_M'v}6)bCʭ^liȭ痏N*+bNSe;1…K釩ad,HAforqLn]K]IQy=ĠA_>#ZGЏ =I.ܡ{*oy*?CDRjFUo nd$:'SˆޏBƒwX0!ܞ&CʕմOqɼlʒ!l#b6oZdmZd%~JPvsI$hSMy~ U*߆QN^Mym;뺌RQ'߻$$#u Am!6IM +B?Pp;ZfSúFP՗ I6(E)&RTtnZӋ Oݒ$ͺ K.nE`dmweiA$%Ej7qirl P_Aȭ]49`j uɁmum킀7i-r]X#3HAwp##z<4 >#IjRۺP cߟL*i496ޛI*3*v]F gv(6fYJ?ʿ, pO_Wlɹ~çϾꇒUUFJ\-*̭Gg;0$g棐Vÿ,6-͝%ӏ5c^<@E7ؤ<Ԃh+hJĞ끚`4e>K e`wkSU .'Mc޵0ENn +F7B0le#Y۸?<u,dX8 2+(4O|g(`@*Gؘu NS-ԴP*j-^*;8IX*T7)q-}ݴrSbUO`U;|jja e[!@%[[{5;"@<;G(e\4dr>'lM ة,w8|: s,K8 ڻH RH5 K} kQJҽjjs DŽpz('i@lP101K%%v&u匩Uq4hUa~&UNq0seJΦ(R-sU~u:LW8ӉTތ͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/va/vlUٱWf]vlUٱWf*챊hssoԑW#.H;1/>̶s?miA:bc-Ǩ#THPGOnpQ)_ݣg[OOª~<51j7ZY38*&1@7ShϖunMT%n14w䱣`p(=LAkzl_S^R $+7[!qrD`Tw[GRۃPPt_?q#nAjW/HC[BJS\&flZ 7=~!$frZ8n=\Op}>`!!ۆv0{MsHz۳QȯsCt+}:{7Zl/0iOgu'V*a0Jo/RE_S1@ |]HXȘJ_]>>Rw*Ulo.ɀJ^l_F.chg?Xoah@>n{zJ Iήد`"?$FSFOʕ ݚX=,#Rf mW-R]󄼬X"4,}D*[w2N}8Ǧ[cPfZ%Ɵst܆:y+vb+D!UjIw+_‰]1~oW֒Ӯ*5hH~%Q[")qӭ-%h)tu/Sfcn>!ƷqΉ)? ԍj߲?krbkꞬO.,21|9MoЬ?<$aԱ $Z2-KPh/EzsVߣeWbo~q^EmG;^g~̿oXN@Uȃ6m4JQHO Fb!V3Z(4a_|YY/pXHW݇4 oB1's,,: -*PԳZz啒! @~dO er15ڄ ʙݤ+ƔZPldyDDSH۱\9- hr q>b_4$jxw7c}V4nU{;7+ė4n z2kuښ*KDbcxmBbc犧^~@A P)ǿ/إĎ=)IcP(zӯⴣyBYARl+O\2 mC%E|05bW6zW|'I)NJKxJԑ]Aw2-yqP%9o~4uŐ/G>l%;$ )\ Š58ImYb+O~9|ɜd-nNAfpp]c?LV2(dޕk(g Hg),kȕ_\mV-( jsq!bZ;"mY]+H䱦%`iAǣ-. #D3TOCtɗKrF;)zk?N,M9d[!H!H-_ }R TTl&(.5;qXWiU1&_-kҢXgcG.5o^qyaޓ`wnL _曭u}cA"]њ n=}<R\{HV8Q6\GkbԗYnC](-~BҵgLNN9N9s{7]-FfPx_,c@|j(:og+/˷LjA"ǿ 1Q j8qoA_^fIUT,t$~˺5* -kh%xWZ`^+5x&%BzWqn:ϩ?w &00gK9yJ1? D6%֢b$'ĶƥL;raTM􌘭q?V!Jiޮ{zd@3kmx?k?Rp%m5 h^\PBEoʼnqf7Ҥֺ4<@O0"Q0T`Ho .d)`:|a͇KFci j~<=v[EpƃvŚmvRLy5>: -]kneK" Do?5ZꚥΑ!Y&r'~SJy;TH9^izv4~(ZGz?e/qնZ >@ Y#W[8@fQn !0;jv}qPC+ D̥Pse4__ m略giP7۠%)MN(gHѐ&o37[_,rs( l^Xm_k@i%bgRXЌ*90ͅ 37?DudM ;D TM%iu?`M%34kO@Q_14G̓12G~(N"-cKHI }on?X@I~`il N'|päYw&?Ljuyέ%Q-DhBA}-EF&>j| I>#Snh?^Xz.؀jw7SZ6 AR*RUA6qAJd Iif]B$Ծ;w DBP *bH \rmuWM:0T}GQ_& 67Q/I'vVFCJG+/ھ,kbeaF.r1 D$)ƴ's=*~X"2\#'ăC? ?o\#lH[ZԾ[rI [{fF; x=CL%u[xS [Ddf4bk /[XP:i풩ԃC T,OT}kpK%8~22Kr-2?nnȜ)rW!X+kśP+Gݖ#jhAޕ^FY/ 0Řil'$^2I5٧W%ڻ⃻ S1u ނ)4gGϰOኡ쮇j Ǔ "$c,@F`);1=ֿTHԾFfe4/䅂ȡI4HA p(uߦ%$u'M*([-B)-H#Ǡ=1* #~UStEnb[+@3;(ZRcZbP=H8aX\|x!@o*ibczjoJ>Z\ ǗRA>8YXO"+X-8?!h ̟Ĥŧ-8#pxe=M;n>XO3jqE[}r3!^ڣŮB=9^WAh7 ( vۆUN ՕI4agSkαђ*Hwt$z u#9+y0= 55%M 2l"_FobXfT}#ܐ~ngem-R/ҬIZdBVn!X*A4Kmj,# IU5e,.c<7둺I\HKj 6"8bͥK4FhW$,=C{v /#'ɚwK4庸P'#!;}sq & Ei6b6XdE+P;]%G {b7xC)vVz>m #Q%'FcF7 }kMj3檣lqcwcз_#mAR^8@(F>8(\w%yM(V;.oM6tRcZ/rP^a)R|D2+j@ee<@kZ]^;""\wkRVldGdu1 ! Y[߆0hҿۡ ;0(!/|њFX;>;UWr uʺSӅBi}0dX)iIr£)[Gb,r4X!s nb;ᾕf򡑅@;S/9QKu 9.fmC M-D+ 'OU>Cz6ǽ1^zywSOl1.n#gRٸ9 "%hOI;/ۋG!%r;$3߸IC*r 6ȀUtۢn2G_o "it=??5' U^2~uC(-f@szQ; r-m[xN@Iɂq7#|?N=.7 g1fI֧I"_caꚅ>Ym0O)nK֤֭%[`٠pq2Xs*-z&!0l%י'm8lIvbqm ET bo !H(ȀIM$OxcjF7 ۍ>Qd-'H& FC~IڝO+v-ǐ'E h-h  ,%[U≙N`0mdP* n6^&3auKqZ(&eѦt~_]8b[ǯ߅QNg  N^9}^w aa%"tK&+ڄ#Zxc"I[݁$Z#*!U~~%u%ASmp0G٧zou}ynIȒ D¬PW`PU4Vyt Ө2DmىUSX鞓A9:b0G2'-_=)e_s, Ԝ(@z׋ELԑonqSR73Z6i*!$)%Z֫mgm,Df5x}+Ys(Klٌ}Cd6ۉdۃ.Xg$ H0(HˑJI2RaVZn^Eqs=F4vvFNS>>xP1Hz A1>7RhfF/NKڏ\,N-5{[<{1b-.2k}ƪǃxO㉛V:ȲlZȊQ^I`$5Ymi1C?iA?܄IcN&G6#{X*8z ",n mSAdAdB" w#IYTGN\FDPHZvD$y0?xps[砯bK#xWs6Y$bBd}MZٞa N7ԷT0]ŴkˊwA#N>cF0(j6"&VDS<ڣ.)ZYy ?JsPQZܩvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/vlUن*UٱWf]vlUٱWf]bIfyؒ:TLO͝J>6֋RS_ol4WCVvVbI rp 9Sv__'H_olRB#R ;UST! u6 Q} ԑ0]]sNk PCO玉31$LT. j<ޕy5`{F4 0M*=[% J'/qU+W Q%,&C !N?:8iKp9mA_jV#n~ A!v*?DM_[5q޻5/'0WoPҭX;Lq}Yk3G_,bV)#IOUY-ٝA?Û }!,n!A=w8)=_TKYd'~, [|XZEyoYWCTƸ%-䏟źփE[VfV hT3:ѸIZ "h*L%)go$wl0Z$rپ__q}jh"bGH \FROٓ^_a鷬ʞgp= %m X YťxeoO+V䐆V ኔSњDwMvNZ&v :l{W,7]d/MG$v`:IŹ"/N/RR֍A u'nyz[1r4YJG*ƃ TP~o j8`L3'y2vjoSpeKi&1A̓3ɖg6V}_QGOmȾdr=h7Yt&[B?xA?P" ?q Ne቎(|L} fgU#C=w ' |PcZ呾?k]귫mra wi'ȱ@H؞6PLUw8jlh䐁nXuaž.$pNBF7{[X0PO,T|QI9k'GW6i2sOy|Xn(ys s$orC?;q?&s^ 7Oagk NՅMwͰ-UqXS 2h')b-beVG+uL^G1""T܊=p1.Vt a|<,ld)dM,5G92pѸ*)"ilZ#q5ѤVX*[N3r5 .ͬ&F\c?gž5@VFIV݇>$ӫzq+Im3USn_af,$K8$w CT\\U褍Ѷ%bkdoe#ivŦ5{I}Ew@%;.j3+* z|ualfXbYqX$D+RZe>[[{UTqE6ީm@_̬~|3ݱ2lY KҬhR;mQK?nE kń$rD $|K'xXjJƴ4{bM4K9 4-SZҫ^\WqBk*X֕ iu9,nDoEM@^?,ӂ]MWn iE=!a MŹbU~ 6HSDez:pG9vb" MiU!JjU=:W dpB;!閗vە@N ¹-ҏq֟7fjP\Bnk8)^G< ?~C,-U|O5GAqU'5.Z+,)_MG۾_(s,zV }ƔRz |/ dmgdV99o Bd÷oѰ,o./z?Z~U8(5K jZ\s{ӱËvdTխ(ɦژi9*Ej26@0F@x >RW|*i'!@jZt䤁_LΉq H豚LƤoPo l3Q]EGl_j}ĨI'*W8?l( _q5ܡ+vv$ SWk7X0R @Aë'$ C! r5"wΞchxxԂ_nh+AZ8~{k=FzRĒNq'WkqB#C@M7wޝ lȓ$Px x/_˒5%|aZ_4 P ;?e!׮$lր{䪙 = MJ:;JATS_~ҡkE)|(2KǤE,{s&xͤqj; I׮urK04wW4޻G a.vI _łZ hm/O't|2ͩ)%t:S6UޫQjEM~XY|m 8٦Hj ֜_k}tIy1M&CCoSȰ fvYVea3tbZҍbY{w?gᅶ"Lg IglgVŐte"zkWUxy3_+J+8+ L:tؤ#t)kQ8jOdj_qpY ,ŧFmm?( KNL=RVE74(\k L,dʨk>,8rZFF؝ːV.,v\GԳ*ڤ~ !5D(kQlWӮ$i.?"83pZ` šr3,V-4Xm؊~9``!MZ~Ca tH6B6o-Z[rJW!;;S$w#l#~~iӿMiK{uwtA06CB:иSf`P pPY) [sjWA:)>bBxP|L(#8ؔ{v=32O*-G%vqSCƿ6!_B;xf!b(>S wO[|'/Gۊ0 n$M ^]E 1< ~oD)Ri_| \CWPJ\yOz-Y܂?Sa m3І~]" 8+D_\Jv7qR :t#'ef-m3uؐ_˞67@ȯ2P:[z>4\߲ˁ doJ ,L|Ab=i|?u?{UN !Y6R|Z ,nO bHwV5!EŭUcP>W_reZ2'‡qjWi q{ #YFEx Z)E4 ik-ܡ*(<Ha5V \^H^LAu;ؖ tP}6ج^)Iq]r?gI' ē+l&WWadWdhGDur8\..3LvaNʃaPGwSED~Trnd9ӴJгLLU—s${?H<yc%dݼ_{` u2@lS2?*AFmLKlHG=?/Ŝ7Q+eH֑C֯m$? zdz3b{{ZW%k~(k1%Gd9㲘GNEos,E ESk*ɐֶ_3Qs)QA1mEk52N`{U7>`?<1SEpRDT:H0ޔ<2U]I:`辩rU(lac8M2G0LwX(GLwv!(?ˆlP} v!y5a[p%rېW,S7*>P'vw\#s܄2\\#ԖVTUI==8dR&̔叏ҽ>xլ\jm$nH^N5"j{ޅOn#.;kvPMG=xLr8m\YBvSWKvbjXi6 ໎% íGa-ݴЁPFJ.so#ZӑqqJ1v'%h16~D佇AZ! "G臒aTmmcN^M]ֽI'-OUx4U=bvHIL /Y>m3B'k_ tK\^a|4N(=Ԥ5rh |AQ#Sjz&ҵ+'g,D]3H4Hn 8BmM]"|J`7+V]NQAXŰ5K$VA4{fD.= nn.q)Gbяw'p_XSт3dZ-['u!u3r)Bd>7 zʹ\AdD,dF?0JSClM=:s0QU[ tV~4KG'.@? `Xru~$ Y$E-{\j5@?lꊶу9]=L\?R`ਧsc+2HTth +Xdbwėgné҂T]TҔ GӇג22:tX hc1sSy򿙘|څF9>^8h0m=*>Tu5\OWdVFmCͽ7h28`+UzNj j<'(Pomý01`f.B'II!.8RNa惱[Hp+NCbGXTaVI Mr-S?^h+1"@RX#1`:R4PBgG< ZQ'I(  YS2I*T׭3^(AOSՈbI>AY^*1##m68dYQ1}B KCIv>+&(mEC 4Nm" "8")b}Rѵ WT4kQW׬ v'dɵi:4#iY "V<,%$IP! ]J"$ù`&op4f߹() ^?,+t}!m?\Б1@ )H޽,)߮XՠXIНl Dq-ѻ}9L=j1MF==<9ܚd'OLPc9_N1UR!A^<,Lr~7zBD'uᰕ}Ƹ{^Cxu?j"ƽ]0Ԕ'pOe'r FHnȰŔ$B`AjFpNJV؃+%~`S&3ObiRތ͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Uن*UٱWe͊6*ثb͊6*w_Y]66cu9 9 ?0YDh:ҠOfeofe2 2Ϯom ؑB ~/ĜJ@E&Mὶ^DVM1k*t WͰ4 -"'cU/-䛜ԻPr51f.4mF[\Xc%qӘehiB>o aiזk>x+3'O|%b* -SPotK/tbPqo_+o^G7&Y^V7n(οw帣~$W}#“2H#)ێKs̈́Ʈ!4?UJgh..~%HO߹N-ş{yrƨ>ňDëQJOp9 ӗ~amB L-N,LI$qM'Y* Æ:e|R҂>ر%:L4G=I ܽ5/?_T5hAvňC<ˈ6 TT?x'jVz!/mB BQVF,dƻ7MPU ~mˎݪT2L-FE(7??&]ȴp(*06rz%M5nT4%Gnv8zFC; Jx3qP*}y^ӖkbG!ܖ?|M G=XElk)8؅]LJtdnr )(/5yk`ŸYȩRxW #1tLX-_LL:՚ JS+lj u"˚zK4/C m(S0!XJ)5hiJ 9-`܎&5T40)#|1W{ϪѝIRiQrȋj6h#j@*朽&'!dT1UB3.On.tKxDX_O"~$  z%wxJk?}l!$1] =a#[7.,kA!`*CHBE%4v~i(wgjvo-C\@+PX}.vpw|-`^&D\zS µ?gXu} K_ќScLAk:k`Z+ybORW&M Ód3|mQ(ҍ}p|vsL`1vOu+HeV#B|+Plb$;9n tZ!sChr*U*pޱWi hI.8.>ppp0"K ж<]veYvZ<xГ)N.t,W%,H"?b' >;}U@-,erWzZoۈ`{"(J>{}eVk,Vua1U<5Tť<-JW"a^Qh=Hk3PT,8.>aU0I,-[oji-W(Ř֤p A "I*(+ǧ~ח6ޛeQ;W -$r If>mhqԎ(ITL:TbN*ޤj7o;&KrչPք }i%i|$|x4P*.u|0֛ Q V(Sٞv˒ 6\6a)f4*)Jpd,h6 xmrmfTY{'~(w/Fs!όޑ-k M%kqeM7+PB(ey(N3(6$h&41m_hV7)6|7"^_ɛ\-҈!p v3*:JBD›kDdzӾH-'>V&^Il k6jO?!$2E\4N9*o*CSLU-l..hXVEFeA~/zNȕVi[K5@$zaBu5sQJd`O|IlbS+2R*l+Ǝi6-EjwiP0s~q(<=CG.ZuثnjwǓ- ~)]N"(ߦDR:EcRS&@bɤe )x(CF$xaq|5'l6 |AбD}F2Iat^]\PM:EI]$|. ujjaҾ& ,|ccV&_.՜HEzPiOZti:G r.#BdaP+/ l/ep% GJlHe <]Rݞ̮O 2=ڟ=Fӊ@~Tp{ *aňJ訪{a |5r#^J˦[hPNIG kκw6Rz' 6L4бĪ61wx"kn B ېo6+C֧0zT)۾6C'7YN#\kMQ3ӹ6\L\^yqu>nHAV`>y`eOAręƔE~6p2H(,Vv_ "4kŲ;表2"5_<$ za ğ_6WdRzrUW)犎̮8 XcL35iT(Ub#"g$WУfb̡ak%פ|I`1-#U칬p[h%rw~QpL{WS!;wJD`w>߂2XT %3@MVRkCS*Bjnqb@$Vp:.FA^Pb?a[ImNv̪|:-qQׅһ/a{otY*9f7RCWe E&%Ҟx??Ƙ_ޝG-5 Pa"n7AIl:׸?,hؔ{u'0"H|ɭPH # M-SE BfC̰u]WM #BcGz6 =\@k)4>&7 a[i SkTd"e$`VQfo&:բFGd/~xKmuqs9:da'w0[YlG^1!nՌ$u~Y& v np;)HN"H>j$K~MȵMjFat E@Y}|^C_,H}D ;m+"|tAn^kw媕قus “\Lmf /8ZTy lݎUȺHF#jōG mM6[fA#Ee&?±8xxt/iS g7 L-|4~)MR}<0pFI喯 UMc**4«=֔؜ZK7)Z FЩvf"P*א%XbKf< *W}L[Fn+DFӐ7Q^p &HX ujwom,2d]$.~B Sv(Rݦi4$ |77#3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*UٱWf]6*ثb͊6*r)cAvu;H̗I&C99Ojb#^Gӝ%5UnZna ־aWN-OoU 'F>*n<~Hi8 |woHY(^iGи xnIgbҀ7̏Vկ'cj87+*{j ߊ&IuRQlky dR*Q?IRI%y 9Ec?g dwr}^>pqEw/ѭ'CuSnF oZ=3F$ .OV-47( *iׄ2ph?~ϒm- `V nkԓ/M>St z}%q VW̖K[$s k5ZrP}F^N;($/]뗉uw(hHo>o#\3Z@kB:d^ !AH"/Ew #hI `EM60T~^M%Jf@„^;AlmT,YAɹ#x q Y >?4SL]69m6J_%VS؞GiSiŖJ)U_]ZL`E:~JO'ZɩO!D߿%7+[]Z2 57k鮩Z2=5HuPT ˎiPC%~Wr@X.n}qSg.X%)<ڳIZ}X,}#ߒ/.KԾYH!q棉y_@yK!pO.X5oZHԐƑ C&v"e/N_}-`y%!|?,PL*Ep d.%>5ޠO´_4Yg_Ԇ'8?5o㇐һh@끌ryާo=cPzcJەw%!kP)< qmn> GޟfŁ&^mTM:bOlYe|[5‚. N2R%0f$r0#B??0 %˳FE+u@Mݮis8S9!}N9qBKE RI{syoHXJ*3ie '*5eDGjk튀ޣ-$:, v,>y}oKc 0$f,\Oms,&5se+4s8YV;\I68c$i^;/`+%fzUG'aenGA,hf=6 30;VoQ*[xւ%[ uwԏ[mO_Z)[Ky*jB^Hʯ/.+ywnz/*MF,hZ&bq d^$_?OqB 7]$c E3= Uh'K å̊R7+F%zȵMFѢͺËdR7ix]̊0AeNB8qP[D 5rȄӡ2qm7P=?f5[o(tK+$u,?˪qf\uBUŬOzAcڻ|_6i,L[!KDV,e'WR28aQ(Y-W J$&x z AX4`Z#A_$vۨPI,6WV">u;^<ԓZ d )\ం9e舼yo>̐[3K84E`,o3jVAcd<Nm_[utfVRcU*+)dVCxK08?ȥG._O,su5,kG 1r&,I)͏7<R57QO-$[c&3+Ų~%p-#ȸ}BF>0A&;aN,XI+l;u&En-}(MrMt5ƒ,nXu#^v.iM1rOpQv6 c㖅 vF UN7и^6 $d;DcPS,}>iTޛW6e& dF lEc>`hFi"Tg+#HGwf8 SKnP v'jŁ-epU4^gg"pGSA^l/_B(6'8᱑``xԜQi~[XdXJۯxke1s?Fؖ[&j? Pj_~ ޕ#iGK;sV$ @k[`S܀|.S@TP6<Ѹh.$+,Uy |+Ά+ɡl="ݐY&"5N7E ysN"ф NǶT.kJ؄l/ BŔWr+GYWmI)!; 6KU,{TeIxleXݻ~MXhk- RY;3,j*O{[S7qzEJ?bcd&~LD\@)cavr\q\%ҦQE8YOPUbeFWٗ/ij9GV銥ֳklLwLb_׎0g$ZFڔrGn䰣HZtcJֿBEh~kM\[VOr>E?SdO0Azi,`73'AcMZTv1Cy BnL|qpl-غFI$*\4vPdV * wq}ff٦c@֧"a\ .~" @?bO?o9/Rco7夭jzvp)_Ӗ U(iឌZ!ģl#f(-U~: lpI:0V{"1 4pƟeߩ#,h;J 8J@r)+CrYB١HҔzxaADdkwKn5 &_L>twǔc›!0ۋ'EnSܾo8MŜWdPo!#b(io{-,'aDcFO˾ [a2>gx GQ;8"̀i\>؏lV0څxW$ŗm?#C֘sMI"")tCVh4^u1FOJ=EEd$#hv w܅֛l:"H}9 )j֩ ylPzkepX€ZlPq ޞ#C,M 1nhmrReI8vAm%GnDJ]JQCOlL^hxj+jӷ89択[*V}k*ƿNktb5<S ~O\hM_Š* f44D>0~Qj!ϢK5+m+2<|1$?eƾ L+bV$q%`v/4< ~,:aC l 2#R!.Iʵ O.b)MLMvIJ]h|#A^'k=sxP27gtG%vq%hBh3~aWչ јYy J}mcr57b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*UٱWf]Wf]vlUt]#iipL c့@!=TT4}HVKuIхn߬ #]8ڌ"7]צ2I Mxj΅BeUykX^JgPcZ}V?geR7eM<~,N }e%B=p+z'ԥgy:ȩ,mc`1eųrW2Xwf=ˬEKwm<<!6ħ7Nk o$%*Oe˅O1(IBRy'YC\*qf)!A(9]EZt`z JSݷݔ,h+EQ^Kg Kx#yz?,KOV?&]cۈ&**@?O+o Ib0&pW$(F :[fnXJˆޣcŐ ٵ"X> ZcQ oFٔ|@,i/r<UWnq/xLܘxKIu Ƅ<ѷg&(l-*;Oq6n6/$4egTu=x#tEԟ[O4r$,I M[IT?;6d`ܥkj}Tu?Xz'Orj&u ,85|mɰs h)qǚA=9)onVF,7Łgr^LMmq_cHYHj|n jV7;DVjn=1i#}۽qOʟo? LddS8Pܕ 9HX/+˒/1cG_vDEy~W /4j^\$FGLxVycDm.{+>ANOY V'RCǘ"l)(i{ej+b(>Mv~O)ο-J4uB'Qo:1Sbm0xw?kئ- J`lEɐb??%G&8mZU%nȿ?k"h9n"f~N!p= k3q{;{ɽHڠYdbWܗAmiKsVa!)$'  >a\Gv#}O|t,G&,氄J"}4MV–dˑH9|QDjEd;adyu}/a`J_Z+1-FEU>"U2, gcfU a'lX -FP, JsWҍcHP1݈C<WH=]^I"(;c:tT0j>&vX،[cɔz aVZ$F^Um40M+{bʟU#Ie5c\qn *^bI)Uno_̻ZкΤWM0)i *wYc|USLk;@bý?ɡTi 4W:~"V-*)z|+tɭã߭ͬvȵY!CY8l$M”o )[\Ò]x|*.ӼPT;b|lKjWj-TP\_r)B bIsZ%9G%<@4X" ^;m"J Xz Rku݆j~"IAOUj0d2҃ %5[TW`iޣ[Z꣉az֩T]z+ȯ] և1rHynGziD>.3H@FH$)6I$lj"SPT>\NȼI`O &Q(u 6ZTNV E%1^U٫[?丝*єEZʑEܥľè^(hH+U~k`]7ŠULF <0][:x0^dJQn8֓+zo$-4RB#+!?&mA Zȷ2I2jĚ$ކrjr@ nBT 6H#*!rbaܭZ <~/ %OLۙ!T⠒{ H=0fY䢃j AC3Ȓ98W1l7dMOJa&tMō\Yߕā7fa.Pj8)oy=[iNA ilUٱWf]vlUٱWf]vlUտ.%P@)15͆j@HBHn4>2f%i{p((@MջLH'3U=q# g ce1FQ§$dێD-N!HKO:\5X,h߹,6Mͫ3O*`j+-mc(4&6[KErZvgo.cˡџ-J,#*~_N^wmhUăuLT|aS"}5ޣ9a|wrDYAkz\4ImClb<%ھrj䕄zT4ޝ6p.$׮ 3PFQI'KOsFonlcmo/g(> w#.nळhoXI솵p! j +=4-(jL6U&ӮQC[zW|_O.x ^ș jw[r[u׀&MG|!R  /IS f6˓N[1^%T|½-I8](pO":NF-ӳ5bhPj P*R} AP7]C+|9$n u,can>(XY5Ռq} ;o׵y JM2C&o?/ťBbJȆ֔ۖiWUؐ$ȭo7OMphcNO 9PZț`G8"Z-2hn⻳Y A}--@aɾی,TpN,e JƖ* DhQޟ txFMdkWImf?U1w@x9mʎ*d^QQ .i]ːUe.QWz"Enj %T+AwGl"P@TO=PcVmuod[7|Mh1f %96Uk8zC6+onjC$L~&nѬW0v'؀/^H@6Y׃P#dq0X怬jj+$x˰83"їw@%,Db=SY>~\rH52'cޟsQ=GH!GSɮ8H.EjYr},{V$ [soIm­jӓ, [hUx;1&ե, ն-!Yin:pR^Gbj˃28: 6ArM1;$5n˕HxF4XrljU?P*It1՗C,d$0;k1$cV*-FQK&Oމ)OABkI@ [7"´ +zVk&YzbnH1n!ڇOŅ6o mOqɔ;m_%:(yF(B dV+ddٔUln\G$;8/NRꂫ1T YU.Sm8gWt\y6h^I)eדw@ Hv!fT`MM&%J&X 渽̟RYk+M?N au2*+Z- +4Gnl>.m(~J~Bߜ#^ݚ"esޝ0vmI*;SbH5icX_o20czZ\5Wa"P Sao 앛tĔRnT$ծ*#N6!FM.U^0CȒ%J{vHez5˶'cD@[D. Atb>X֮兽qC%#Suj<1Xe{*H-hzvXAF׷PzG;S,mFhÒv?FF7ƟvV2S":@TV~⚕4v+N݄dޫH PM6;,.2b]hr W4Zj7TQܿJl[6e¢:Y{. żT|1!AE_roJ]q

x;KRh#CWvد qj|'py/b:Cm4RʔR=9>o~mR8H>a GY0ݡ !y2 bӋ&ycD3E$ϻ5jք^)PE'oW5֎?r%cz+Q(UO I30؝) iЛ"y*Zk-s Z (6o5ukfi==ۛ}ؤ1\ T`ji텑C^z2 G6Z(=^-?k3b^B:x`av$޳VbG$yt8Ӯɬ4$F2TAC#Œ:+}?U1OP6ŗQӨ+|6:D ),p6uȷ_61Jf*? I%r i˘S7NIK[r*1s$yY&oo;`F+P(1̗ו*Tu4 _-ƢfOKU)4eߗ"~/8$p !I;ү~rCG(aq@AO/S`xF j:)2H)or=u+qn&zvin11ۖ1YulO݊(6̒-wub-E+g3۵O|lM/uHΩUE >.to«P*j֣LOM[%[qF_FnJI,H*lQڃgTTY x*K2ZxӒV1X𷤶RG"BӏvrCV?rㅑ5{XYݥ "Z3~K,f~+HUx1 |_/biC+ UO„mY-^6.#x/uFixFT?UNU&3#H݆87_q6fEf=z m\n@rkD#(ƌ(G#UTHr4Hޔ..pZ "gf\hC/~L \K;B:!x/Nhq۱+$J،әվ#5 E]n_ky kvRG+d}4*CYyV۷əÚ;bafaq/3|[:}-w;|,ntH"՚^gdewhI܏Ƙq"hWj5{FMD1 $8Y]Ρvn[ԙEVx]?)vF,7;W*)n?aD~-x 3w,Hm<]RX#; aSmzkMonc1s OeaqΉ JlYzWƧ;BksM\Y~*}oxw,> )iwڵQIC_ְ=A'eePI$)O?Va`$K6Mw5UBRMI'V-uX(F%J{q3޿ , q!rrH% +ㅎ K$W`"Y;XB vBQ<×%Rl/Ln !V瀒UGKt@pVk xqC ocn/dO/Z(bCb ZQŗ{..-]Dvx-W~a]7 B5sR.[[uF? S_ Kh~A;x%/E5 DvVgm+;Εı%yg4Yd;W~x?./vڥ$Rf I5iJ>O/H.Ԩ䍩0'1SYH_)SoD.%Hd^L3W^*\?WoQO/$Q)oԿ@ywӶ* ĪyTߜzkǖ!<Ԟeic%wĴV i/Tq F6LQiOnfFhLp^$)TIdX=0,,Z|i6Ido9~.cAȍt;`傯ۧZPٸEժK/ɤQ=(0IҎz*(o. s T=i0!&l;w$+sҔ-\r$;[P SMs(b1|8z_:\ %am6DBO$Gcㄹxn|q<6*T߷/c7K*pH --Pj?Av<*wRBVS*(xۃᗀ ȵ,r; Z֬0J,HnNxЏ ,y7nW~+bW9h|;}#!ԼZ? j7j›eZR0I)_%!CA1RK⌻.Lb-Xd@T#ҋV,mQZ=1%"$(⢕KR9H:"5u&_F޴55F<=[PA$\8֔L@E%G#"U0hBHޙM}}[Tbz jִ>&Aid 4rJʤv9]ZI@zSK{9ec*w߶@0nGb<:fL9){_K٠ \}-ItoiU ( ]vlUٱWf]vlUٱWf](40U=9;}X&[12[I<2sjҧ{/N at+jQƴ .#+rcweGhOVGo7kI67"IZQ|݂um LJ~2 k 5d"}vKK #c46%\i}Y)+wA$d9-i{JE G ~0R%*EAT2DuJ4] rZr{gstI໱eB.gB uB Nlm7P']*wwAnF 2QB[Xv14Y"K" ݇\h2ސRF49%7/bY][prLmt^:H6n-D{ ]2;yUgh %%n,jA@>C)XlkK{9(8tr"6YqpGvP)y ]SAS)^kV1z`X?V K"TDweu?,ʦKд'~ oYej(&Dm:Y0첔F;~6NS 8g۶<~ON棪_@iz+"Z9:U]-l)MhiG"gu$bطCሦc"4FYPR+yq$r02a@1]8f^(!|7Z|lh mZLBVHfZ|@[L\>Ef}}8۝<%~1; ȁ"[SrW bfpgJQWD n{iva#%kBQI'ۢN)&ؾO)j :uۗEroۈY`Rڊ(}k&XU{* 1qB<|2Q4Lt۲ެ>=O*2ŸfA|˨MhW`s\7ҋvQ *l;Oč9ҤH5KJ ٖJTBX΍{#C))EvZ/Y[+Aw9N ܿ\)ӭn-5ݐ16S}BA XZ?~cAnt?j~B7T{#F]ȯ g2Q:E1M5Vݽ7q9-g#ne ߓ;Իhny%5;rU=Nڿ9[RDm) -h)x`)'R$ R|qAd9q-iW1Qyn+v݌a&L~I'k^] dE LJp$Em$<'+|8cVRjW"ʔ)Z`%"6}:{8n @+V ՟;l#FAF]h>0 FS ȳ*JHBC rhUJđzr)2}cR_ Aꎽ{IgTa>*RF`?z#nG9FPG5V*zN I :]]E"v !L5lBxY"uWL&VfnnI]F V$;%䨼X@݅<*eXX͟ =n/`H 1 đnm~X57` SzsHME+]dX(қP{Pm=QFAQ@c41#D5zo!E)4`+SMX%no\(#:IqD}{f0?e_$ZgZ}مv~Cۆx=H#27sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]6*ثb͊6*ث銻' Ldy)SNmW!!a>sZ+Z*jmטI$K`Ru`Z>?"A~|ƾ!+}(*-[=7%^8Rr8| z,g-tO1+OmQDug}-nlW5wqgwq,ӄpFo[kUUQ,F; -U72|VFK=^DOZu_a=_nB9;ŕ3V)"0ߩ.;HCA`A\&^ 91$O(}oN.~*'[z% jM~`O5 P4RUP=N|j/ JKf%d!m؏[ᦠ)[Z]5 Pg6-z6Ŷt$ qӇJP@Xc_Ƙir:|<"S֍J|U94.ZGcoŠ>8i2|Ld&xW__XR9Hs7_ϖ-tقQ@cd)?.̒&d ӍIb@cZyfZiMp0-(P[s?8P4X5Te@4{K$3'8>(ߋ)S~Qpn+ XU0鼰@I P7|_g1=)Cu 嬱Cyu!0x84P w$t pf[w<ҚP.gq=k~*9iU(;[u}foߗRې G#b ЂK' Эe)BLeWr#= {aa)ėG=|TRM g67xc.EO|C,Ts%צ)DB5I-<09ጙڒJt$:.1ˍ:~+[&JDfjrs.MXw~Kq n}Nf-DЅY7*h)SO7K#: H'E~ :x_ 4cjrڿN(UL-{*N5JvNvZNFuPմ٠Y#FXN@_Lf@>ف[c4_QS N(Sd_[8]%Tb5_ՅAUh#NLTzt 6~D 8=mB u"t Pz'Ց'8!5 0 PFzG7?i$v@(qdZGq3_J`kM٦)LC41Y'+v#}dl.-vY( .I>u3Mu5Tek@#Sֿܱ8Qp[G"qe)mR SUb"E=T*dF` ' e]ZEM#$x""ςW H#"#9^Ҥ{oStݿ-e+*~%'CXTzrIol'$T.ޟ-7?ukh"Pjj>Y5[h"7qJq"AgF OIW++f.%U(]>xrqT'\RV8VZ%#>©:me`: b;vbVI'F+5YL fkEؚ:|8&UuaD ǥ: ec`G3"չ ɻy&@9WF؂9FJNNAݷx ̈́ŊEX@g"('?XE 7<տh1׼!+Pc!>[yG?#Wr\8Ċdzy![]4zCZ_ڼ`qcA@A6p$oZ)f.:_qU6l8S~k8TFc_1z-"~|8-6I((c]nS2ZJ@xw? sgJi 8y aw? dHުx-јPV-zn;ң`D**O XĿ-^~b&V(Tf%)wt3HTسG"u! WV`J5V؃HjZEm*=8ӿW䳷/긤kj:V}6#^fNHe+3 l)^ƹnl&݄lY/OŒ h`G#lA%Knx1fcѿݒİQOZ 9d<[=ľE$*8}?T3<اoy+8VCRz~ԌæXBҜ S ԼޚtM|\TD{tUSaʬ0J:" 6˕o&=*zq5Lz{1eͶ/=p]?.[4M1nTɆqbМw`EtĬv!j0Vn1@7i/&c<1$2bkğp|\aْ֧gdN/U)֯u~^"=J9Fc ,4__S E=, a1:Ndm!qK>Hp$oWNG`OՅ"J}NF9Xfڤ8 HZOZ*U oSQ.1$b%HK7Go6O%iՅ=ⶕW?fѹ~Rs0tGȚ0Zkf=y-ɅWe>Ϛf-! (@ޟ,Y[-dOAoI2;*B]:) WfS Lh'f*oq//[8Kk ^1ޛh.ʥzmo9a=Ծdivk~$@ W}0TVdYRYrOjTA?X.]9u ]IHа wf*8 t93mC|*p^^6Y ¹KҲGDv~XSlmdBqFyW/KVjTu:9ӽ)xlI5LN8&*?xSP74!I_]\suļA vZ+Exyi~(O͛Ԧ?ݷax؎UNJQX/Iya0#ptF'oZ"t 02Vيt~x7lB6VuWMN7L(fS3BB8vU_xrKgк= #S\\fc6*ثb͊6*ثb͊6*ߖq馡B` ֽljI%֥ "mml,KE!Sa_Sx {Wkj ;ucubגC㕖P%ns3LDeJxIJdzg+-~%z6$)˟RTe#= 8,R7R Њ"k:T4ᐈs=5US )ԒjvᶧZʥW&9)5@ٴI\\y@0}^;)'o2eM>U-A׷2쉪=dve-Y'kz՞ z3mZh^JvR1.Rc4>*n:{qKOl!i5+GɐOaB$QʜXk41qQ׽p P #KȞR"btj݁ !EiP1>Kmlkc$רN3Y[\2ۓ y/].-UB؏F 6CH~(mh$ybm.JH|\G{#%̅L@ vѪ5'jmQIɩ[ l=SZ(Ѯ#JposKv#{)$ _Qw=l9ۏVmb˛4)iFh(!OVV#xW%JT]\1OX>, Dg ;ׄs周&vȝqEFیY^|&ε-OS_x "m i&^bXJ#݅mor7' [%iJR/ }Hb sB#Z IjP\,*wd(13 +RtSi_B&" H-m0 O{YR)Z:&/+<"s9[Դ 0k^ڟj 's̮ OcQv~9.->˒NyT~G\6G1 .ta}O)±<@۷fug$d[THU>ߵ\;9:QZV@+xl0wVP2,4K$4,EI'sG*v^懛Q5ü!k5䵭}fN]j1j>Rʶy CtR''PPԜ3Ѭ괠$ӧ_i1ɀJK$<~ylDiPׅ;`譒Bx"DYܰZ7W0J:@;lgayk *Qq4*n Bn"2sny 9; 77m{pgJj":Fk(aZu@q #Ր0rLH(9DXF+O\3Q =)M|QJM̧&)֘B T[.R1,cEI5x$ȂXօ{c-[gJ;rW)[9B ?ug gv'>[ ,!a4QJ@mhթ?,G$i}L;pk"?Uv~d(*&Iʰ$zt9id-`F )ZW|ޡ<'{dRRiևeE( Bi&z dtt֔8c=R`J5#~$a0=ݑ,0*X=r`} ɻpOc㏁<'̹懹ǩnН7sO̩D "WLws})-~f !klMsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]6*ثb1Wf]b]~T?vIE= Lb_J79 {[:a*>ҟRP>i֬HL '.NՃNK<;] Z4maP o ir'"ծ)!7ִ5B-LfV_oxf&D(@?´/Kqː'?)x>˗p)y?L],coJ)ȟMd4¢b# ķ>·NChW$dnp3z?zАsg ^85;aS. ݣZ)Z=]o.a4M,@iWv&SO-.GA 2n wvz$[hUvQAY j;r`Ar/cpiD~07;P$Q~挼Fi?\IFFv2VҨI.vՙUˍE]G%J1bx~Oun\]5eVހNx˓ZLsip;N$oy,WU 4+bI,rLg}ؐPMC{Dr:lYdn-b{&Mxq[65gEhH.?y\VR-J8e;)ątNʏVk@oZ߉~Y=bH#K6pBӋ.x)mKrܨ(wI6(#X-O. <"RHm7c]a~P># x.2gfcjjq;;O)e>QqH F"_4HIu} VS@`v Ǒɸ8usP*ϵK3RwNB#O'< =ŪQ<7;H⻅'5zH6hN\|ynO|B b:Nm'٩=x8YtO38bxP>ubL@^]hw0$M*TiJߵl >^M9F3|fYq7_ Ҟ^X4]I&v인b 7BrqB[r.0$ G鷥#W7í%q%#1;joqT?4 ;"VHJ>7e˓~LVnϬֹ7jOemP {L/~kUdPU??X?Nu>: 35E}1G<<ؓ?W%Sl-<3`dR#n8bQ63(`|;m4@S\#;k[M^WZWbe'svp(Ʀ'> lMݬaJ(f5B0r#x*ӭWX䨔H{Mf9' dF*KېD:-8Rp޲Tf@n~ZGGkOs-NH@y7=^Pҿl'3FI @ p@Y:qIuk xmD_cO?g \^F5*vNZy%e=7$X5P>d WT}?ˈlbI9jO9cm@Fu#nPM06Cmh\+#5x§^Ԗ ĵwHi~R}XNB6$@ ~,N+FbA>iEkQ1ymF PEn?g/q=bKVbx223>4Hb3˦]% %BWG,(fcS׈?8i,(詎ALωQ'/l]]|PӁ( &n}YƬK>mԎVCTTx`CfkA2$E^(rXoc+-PȐ"n3EfR 23痑I 0ś"u҃n$XDVʌ Fޔ06DMnPDw ?.9vh9$miA^%۽,"U?aʼOS瓀NEv{ ,Y4}>3zBSM$W-1epUw D m)BVޣiYO82b{x%Z̬ l(d<tQJ9c_[7c(sɨ 'O]x.:%EU=%fqam3q8vW[SVщa+|J> Y;1㲑·KV'j)&咦"V#sCR޿v6K4^J}@@=i̫|45Kź Xn ؒm JhN!Ga|;@׶IY<|0@C7ůc0J=D%],|}ubH+Sn_PbUF8VUMiQky8^m}sYH%Dy%6Uzѭ,-ҸAHT/ Ck F}#Kkg$H`I(p܋era0;$zTzIOi<# 8v?ldT. r(*oFqE"{{eDF>rUW#ܷ>gƥIeH@EG>qR," 3E\ <9&niaĵ%~`lY=G^_^cѿ睼|e;6@ H#V͊6*ثb͊6*ثb͊6*_BHalp E!JrcsªĿBљ2pi\Zd ܆Cg-HdCt]Y$'n[fcTRApHZP`_P,~12=ˊ''O ~+c/(wjh7;tY6f_FD4oS`l5ߥQw-=/6Nٝid/8W}iomC@oamO @F?8޼gV1QmCh:*֚";-fܹ4\b]«1%NUʭg0BP w90JTCH~P~_<3LP$$Uz DAKm Qj|L {6_iZ}*F>?d ۑ FK=oKҤ61\27 Oۀh i &ےy(|%7~dk;%*`BZHq#ɋ3Rɥ _"nfڟ'*r`ͣ{{86#ԧSƝh%tL$[:s؟郦F#|P#tP0]4r%NJ i{Ql1,¤0;C2dHڰeiդ?8VFa,EXX> {mp`r]O$05.h߶s"lj@̒m5Ɔ0(ƘsM]0rTN&]~YQSB60kdʹ9= qepTjKM:kqq hDZ F*֛:z%@=>l:6Zh2$+Nk\֏˯9 UU 9[Q{8> a;vH6z1hǿ!@Rcze[쉖ECR_H58'hiNzdmw?/L%}N5B/:if@E| Ƀ(ܘ`zQX/Z@&r}Rrُnp M1#M1<$ m?OqO$PBG"y&mA$oi4{ᅽS? k %vBqWf;b#u>ʙ.M;5AȣIKՆ9jyZwbQ7J>aӤxJRBױe J1q"mh0H^錸6 lGp訩ާm zq/P||vȋM /><'%k'v|9"TpV+ƥ:|daO9K+sK[./mqTҐӎh44 m)d]wjOdn#D* rW.-FO<>XH1 AwdB\vp@wWઈԒ6 8M&:[F:ǒoWbV(~)(2,? I&}GoVKjjѵb*i !ZڃZ!i8xާ#\)%0jr_+D>qcniGw Zo„i#KzcvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]6*ثb͊6*ث*ꟖX\VII4~"K|Fgzq iRi}MSDV_PSaJwVVo!am'IY6#wJgy$@䄐<6Ȱs='EGzSc/OVuQB) #*O˫D3Ly,+CiJLC w<1y,,_>Æ8pgAkWA0Mh?8+)|k^Bvy6sLq*6<~*pKi"PgUo}BiSI.`C_?)x65'؃'>Q }eW2̧F?4%jF.7AGu!t&`g*7k/P=2D-%*BAWK]Fq?.*I;}p Ԣj̊37勽Nnhcju~'ozY֤nX/_ko ً}F|?!+i؏l r%ח5 'UI+2q{BF-W v,ifܳJ+TOMyܩ6PIiܞj'Zoy_ϕoqLk[YYTtBT\J-^:.זB06޻| HWfC8[lx`ыg&Q}eEY3Jk/ˇĆ;T1-i}WZr~%Lj# _<$/$GjJ” ` <1!3PN$ H(x Jv3ތH!N5㉋^Ei'J}?kRb0\d/o[#jƛqAKuI -F?>.) % zuNSK*͖vw$$I7c^\$3!\f( "e4K;K$Q$0bXpܟb@'~ H@^]I *>?7uoKݚ$ؐ:b[IYආ(o.*U۠UE8GnZ!U"egd`ORI37^1 cdl,mPܒ)ʻ}lظIjd=kc_q#Mgۄa8`iĵyef*uRj~uU=.'^Q_7/%ʵ1Vj5- &e:vޣB' l-VZw>wZ1/0jV^5OJq^fU*ҧl8Qo;%p)Ǜ|1t tecwS/"k@)X\׮i"-hPTꑨ~ 7s9;oR|Ÿ 9=DId޿×޿klnܞZ;⚤SOX/<,ze$"&Fu#J5G91z׏ JјN~?-X+žb܆:Wm7aU+nҞً`,˳[`P M}OlQ%x=qI[ܵhmURU SrQ@nĦ QQ2uW,rZ*5ӈg O1Pw`CQDN$"PᅿSa5Tv~qGE"hOTHr}=T_s4CY$ב5Ib H䙽GN įUb̢4~+!xïYݠVCT!#?g0|{Hv%& $=;;_=Um:t9d4[3m,_~&5w ‰V!ҕ?%˚t+]N] k+?$($06]X*#cTPpo#O)6}AG5ڧa"liB5cN!i{˫0а6JԆZeذi\GB܍GE c7> U?i1 9%2-E.KXC!}fY?k%HP5 jWg1iUR$9 7;0iF"Tӑĭ%֏ 0}zgE5gr0m'gl?h!>r />"5)AOM?_< B73/Z;T6֮P8SMpDivaN/?NhXF\B7GݭTq;wd1Y]2_?7. 1Q}vt֗N7Pz`UOO, =(LwjsL/esˆgR6OW' _m#P$cQѰLD>#^`PX,Pޅ~/Y fӨYɏZ;W3}Z>?g\~FXw!˜-l':