ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:20 16:34:21  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$RQ}81. RtZ?Πy$HG˯? :{Wh3#]xx-؂bDII$RI$^{kZ q<9)$NI$U mu]m/{4,\,esHe:1oHD?;U0+T~7XxvVcWہv0-Z=OU:+Z);ACunmSli&b4DqU9`ԉJ50?Y>^E[;gd(m~ݖO{VFvvǹMiU3C<4lx1^슭s{ݩ{?۱Ch`yU죴H %SGh;: sU-lKAՔ@>&d'&d: oYx˺Eb7O=F?o.}uu; ׃`ݑӭ7a\{\?t9͝w=XdD5M:~oLoA^:u9kkD,0+1/`Ϋ׾Z7*C Zƈs#J37<3-.͓oudK7uk].S\ۮ3߸ns7-&`8Dboorg,uʰwAqFWXZn,~Q^0ˈcѣx=ӊh"Bh 3~^@1JV"L9T~W~Ksc9j]WFԴ]A|T 졇nQc7qcbc_ߤtA1>I)KzoƲHeoz\_N]Z_AY{fuc8PKMAO},%o{M<}7Sv}&<^z10u7Px8{5,tѱYOҏ^G)t?+}Z[!u4Y-HhƊy _[E9͒8:1>lAǏx6\HɌjO?ra &G'~=͔[M!K+davU]U[u/x{Y4 ZX? [{,V%#I5M P OjKӉUxSC8s#@#PgU+2x$wK?howƅ;<#:V4"BC`u-liT|c?3Pypv$=?$"'c]tV&HkekwX5ߡ[u۹Â?t.KrO#KkOE#$6}ٍ cZhI$yT@nM[ US-#s?$}C?-C&睞KvbRǺU?Ow;s(&ɖ0乐՜`ov"v,cp;N۝q]oG=hß>q;BlӍrC6`Lc;n뿔`.3 ,`w;G 2εЦ^kznn@c-k,zm{-=Y]gyE 4sx`2x#Yvmk`N<'uF9 s=#td:Ǜn$;JljfW_NMXlG Fۚ mp+U1G֮܁gѵ?jVԠ?wLYȝ};5tO: TI%4ʦn`Z[c 1|􌝬;{%6[1zeF~-׷uv H}  Z$|u8m{Xڌۻ\vx0I9[ƿf!d[367޳=q Ou0lD!wOur.}Ǿ}FcbCGqzWw4~:kж@y;ִV:{~z>ԾC`Ǟ$ۻ~uܜ[(SCOs ns}ZMNqxDD Z~ Ƚtlkn/j_ C?NF)sGeIMY .ȱ}FH%HCJ?<;WvˇEV_07c|ֻ ԏ0Ek}LvtGV4e1lsKY6f#X8lٺ{=Z̼)bFeIE)$TI%)ET$}T}Y+6؇@Z[ɱ6>;JN*ڕSX04x:HM$G8 i$c :I!&঒JFhNژ )hH'I%?Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$RPhotoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXT EXP550/PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMY update_maart2018-9 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$RQ}81. RtZ?Πy$HG˯? :{Wh3#]xx-؂bDII$RI$^{kZ q<9)$NI$U mu]m/{4,\,esHe:1oHD?;U0+T~7XxvVcWہv0-Z=OU:+Z);ACunmSli&b4DqU9`ԉJ50?Y>^E[;gd(m~ݖO{VFvvǹMiU3C<4lx1^슭s{ݩ{?۱Ch`yU죴H %SGh;: sU-lKAՔ@>&d'&d: oYx˺Eb7O=F?o.}uu; ׃`ݑӭ7a\{\?t9͝w=XdD5M:~oLoA^:u9kkD,0+1/`Ϋ׾Z7*C Zƈs#J37<3-.͓oudK7uk].S\ۮ3߸ns7-&`8Dboorg,uʰwAqFWXZn,~Q^0ˈcѣx=ӊh"Bh 3~^@1JV"L9T~W~Ksc9j]WFԴ]A|T 졇nQc7qcbc_ߤtA1>I)KzoƲHeoz\_N]Z_AY{fuc8PKMAO},%o{M<}7Sv}&<^z10u7Px8{5,tѱYOҏ^G)t?+}Z[!u4Y-HhƊy _[E9͒8:1>lAǏx6\HɌjO?ra &G'~=͔[M!K+davU]U[u/x{Y4 ZX? [{,V%#I5M P OjKӉUxSC8s#@#PgU+2x$wK?howƅ;<#:V4"BC`u-liT|c?3Pypv$=?$"'c]tV&HkekwX5ߡ[u۹Â?t.KrO#KkOE#$6}ٍ cZhI$yT@nM[ US-#s?$}C?-C&睞KvbRǺU?Ow;s(&ɖ0乐՜`ov"v,cp;N۝q]oG=hß>q;BlӍrC6`Lc;n뿔`.3 ,`w;G 2εЦ^kznn@c-k,zm{-=Y]gyE 4sx`2x#Yvmk`N<'uF9 s=#td:Ǜn$;JljfW_NMXlG Fۚ mp+U1G֮܁gѵ?jVԠ?wLYȝ};5tO: TI%4ʦn`Z[c 1|􌝬;{%6[1zeF~-׷uv H}  Z$|u8m{Xڌۻ\vx0I9[ƿf!d[367޳=q Ou0lD!wOur.}Ǿ}FcbCGqzWw4~:kж@y;ִV:{~z>ԾC`Ǟ$ۻ~uܜ[(SCOs ns}ZMNqxDD Z~ Ƚtlkn/j_ C?NF)sGeIMY .ȱ}FH%HCJ?<;WvˇEV_07c|ֻ ԏ0Ek}LvtGV4e1lsKY6f#X8lٺ{=Z̼)bFeIE)$TI%)ET$}T}Y+6؇@Z[ɱ6>;JN*ڕSX04x:HM$G8 i$c :I!&঒JFhNژ )hH'I%?Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$pƗnaoIhHL}.4r]U;?qmd.iiIXj=آ~\%kL7[/{]雏B3a^w}-'(V]Uh~}?_/{Yi%S,eurv~pO^W0i_r,ehOnۈ1mvNoMM+ɿ6; 7`m.)&!?bgv;wɪ~L$Op0T[nW?ӷwq.ù 3z?鷱ǽ}ĥԓpX1'WOG3pl'W?ZxCv)un |{o +˕D%ȇW &C핐Cx6i.LUXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbw'jcIg t33>6s?b򗋗𤋮̶zgyJs'?d[2P>*_6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*U٩51Wb[K)j}8xK 9 m|unHK'zpCW" .T޷ƾ§dC.aT C,J pgv\iq{?c!0&nKs>:/,ZD>Qiq'`tQ-9zKZWx ت-iM1j9 xL67cZT{ac ıv8Yl jǶ!FƸx{>aݗ )_a^.G^Lqsm'c ;xb E.sejfZcŀSG^߉Q xOLIApdծѭd@E:]r#[#z֑uW9v2njeV|rLKYJb4[V"]poL_~T1G ]>>g#w큥.F]0d;f뀩;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,b&ɟ. Az;׽+9|<\/-:cr+lƧzluy`RIXTwG x/l$xcP~p㖻f{6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb"4v=$`9?M2B=Xn#nLm/t)ma?,s˫D|SuN\v Z2< vQhwh]3T#lؙ,Zxu-Zb۱DS"Z8}!P(J"ǪPx mاE2M[url1[jLんӮ*]‡X>mp 1[oִ UU z1V 0[[( $Ļ+R [=S!TSl*}*c>i+㊴1zblv61 `M0o$2UE~xnppcB SVAp݉:ݰ>}020J[W6 ZcLdb055!,oM$dgkA`2[U Z^#op\E5,oZsLFNZ\dFGnFҭeH֣&&C Lȶr)~\סUcIQ&`v{_$:2O/+0'{i G Լ?<-^wwx0W\Z[9$PcXW,mn!忥qpGWr~O߸ƿ8xG{.9[uoɚ}p؏ʜmڃsWk _ٝ`{o+qK/'o'"+Ut{j=Cr~U]L#;gqvU7ɿ8;#˿)V2ǀc".X2 HN2,vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v^*:~ mCbxP2q9<8ӸE,ƀnNzGEH ٦a2I5n1C}<}}RkDȄ 5qdž 3 M]6+`7U b?+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vjbG #R{SPH݇ukX*v nY&>e T 91u.'m+Ka?cധ$D:3]ߗLR3NrW"%EϵsK˖1BE#"\9g.d94FFˎsذ"rWH$uc(v?Ao ۰cn;7JqAt$W2 @je4⮮`GOlU/JT4ҺaH^*z'nYWwNdR4­{eFv. ‚$}6H5ڵr~-0+ƕڿN7߅]7h CE銵b#N)Cxw|+‘Iv?>c , 4=Hpҵ;lG7iE?BmpZCV AM bF J2KĆ5vY&핢KQL #LSk H}3 -WӍ&8"+`~/l4%UFn)6 4W1WI#]S"b.x|S$1 -I"" 9v ܾԭeioIA!78Vgcd.㊹I|ezpeG>)NŖɶ02v-08)6uKn Jl;[Al*+M4pZon=mPƖ'+nX ۫ޘڮc1[usWqq[o"v5Il-`JMmEFLd'x͂꿕]&8"GU$S8x;|=_bso)jOS&ox$SC8!.F.[I-@uq:dY:51Wf*UٱWf]vlUٱWf]vlUٱWe\4Ý+Co i DY}E7п&bQzVLB!;v#hdI&PsTlry'2]dUvm)7b;v(T}p2v+Wcc86m􋐯|i&6qޘ=PfQk1'i_r12 g,lxdxIOӂ`rcMa"]X۱Z$T}HǖJWc#Jd  7&W6q;KmcDcx$5k2.&ljۦC+1b)Ӷ^+T5;0d2clOˌ;)SߥpS C՝EJl%B1S0mjǭOl(kƣlR\;QNþEk)X҇hNT'6Ć{c%?ٓ F%r׾ ڄnG^qm-tziԐz`9Eb2y*x)x]I2n8d0S(sқcS_4+aljg;>^ea\;f2\87Een "|0!مzoᒲR #e|8]nF|$ d/eb0YOP6 YpPlw^f7k.au:಼u2ll:iOc48C SW&lfK/xGa;"LX۱Q1CUiҽWfݾUM;ʘR642q]LS7Sf R# islRcVBO*3s&x`*fR_02v7F*0)oh1'` "sq!Ũ3q.NYarփДt&/=4)7,= ~<6dh76*bLUـL ZcysPH[Xޔyp5 mG)P 4΁ȝJj !Jb G7_![=oOLX MM~g&w?vT.-g.>Z=Jn|y;SIĉV42\]'Y։mB0#@Oo%R„`"6Uq o+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]o/f[&_EvB1Ivk|,c s]]*>f= `1@flS=8k7bH>rn͑eb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*+U+,xv*4˓c&' ǀŏx' x~|qƋzzA' +þ. ye"z' +C?7e6va7e&uO_vW諯̟'_=ї]=?N<>,{َtLOq+Ǽ|ݔ4x 6t ŏxvaQx |Xf]t QC;]Bv>bsü;_-ǀ:cv-u' 21Yb]ڑ}8|68݂T~y5;݋_?{caO</7bEBsd;n.PLL}aA1SZ%c֞aT\yv'`)451cp\yvC`Oq{g)Kmkǎ4N1yB=|c݂b J+ޙ2us=]7Q'^C38|B_M>csl{_0&>񄯇o5CoWߓM̾n vwKI7HQйG%S#|rGj=]\yYsnZA8e:R& +omA"SSLTsF\p5DScmvޮr='GdwP$h;ҧd{ۘI-kR:h?&CE;%:o4 vŅO>O:lݫ'9;$jFUv۪inݎ1֧cH!'Z`!%ۡ놐dT@8e6h H-fG]+Ƹ37ݑWcjAp,tz*M7늻2kfiklUEG\ 巊@jdn2+MAn$#.~>ӓnOړ2~UVb'j =K/'A$ɼ;EFSOK[H$k?U8_ʙ;cSM\ZiJLiL.RHS^D aů-#T{ qe^kFg$5NH +qRXRsf2x8#"4^,j? *7ʣaxN?dsWuv&$jޟ<͆yi_8r*itSױ'A<c8&zP+fP;|]Rwgh.+B}|95wLzK2 GǬǓe~tnH_W)!BE*b) aPj'-]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWa\kWIcfr1e.AY[$0Y=!44m.#'>KaZkfS<ۮjQ&l`)Z@$)` Usb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWf*N*k]_lc%yd;-/5ya?a2^ϴGgWTx ]v4X]vNܗ mpq—leG.f`8v_P"N-6*O"e 96+fW.:Rt W_1#4%앣2v9t8(IP]%/a쿪inǭ#LCؠV.voD\)c*vu.?o|JQ۳FcHeIB$$Tۉw~*[j7ڞ-ƛE,-+nPP8)69zcIcۯJRӗ]dLfK/x cۃ*- (qLxs29&Z7h`Zm<~[2v-  1%( Im`i2%Cxҭo@[v D E;d8ɤU x ˭PW{{Ȍ5IKLvHE%bU܊ n+ҘX>}bT)W´CTr6e!}Z,(ziLʝXWtĔ\Ehv㸀 SWjaA;&Tw ")?۱*[voL2]n$C˕GlJMhD>u:a6\N˜=[FB&uyG:ֹ]:hwb*;n,cw켒 z*U 9Zثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]&h*hkrhYvzɑh6"Gd]¿ JZuZt>;DGՑw"A8|[Ic7FO+hWAw- (n[;6EvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث銻7 W`]]~-s!kkO 𫛃>ûO{@<@϶9a]g0s<.tZzv񏢸x˫9gRvC<2]mtD"]^]˱,cpw4]iק|YcD0^;,r;L(vb`]! ;HyB9O&%f [c54t+n;[v<&I#n=Ɩݗ QnJ„ VݏTJV®=5ژX۲0zo v<X۫Pʢ쵈m][ *8)N,'6ƒ'e-ٔSEh~XSnzt&F;ۧ}5*Tbd젛baSnznAhR UNP>[TX^Qn6@N [R.ai4vZ|4]c7W]w mL&ݕIٖ2kƓnֻ[vasm1׶KUH Xh66}Ɠn5a&\H"_cC q_D7I Wq,@zOq2q,/R.倸b??9> dbRza*JW| v((mv#=pV=T0k'j1)&ܑHqS'`t۱DRz1cQn8v(>%*R0׈cNƕ`KPQR6Ac m.'mwl iۮ*1ޥ(Ktz֣5 8[~x8NǬs}0즹X; 6.Ϭ1 Rfn ^ig4ZnY X]p8K~=:dbd]c2`5;X<70'WC:DPW@էL4'cJcL8"݌1FPF+@0'b MMkQR "ݛ F4HR6›k/G\0~CbfcثJ\R1NE;[v_VcKn>~iNcKn2~ ؑm=r2JdR+M;e;ӱ|;ق]Fv=vYm٨GQ]Dc{dRpvXN秾A.*-وj׶{mQ۱ԡv®I ƙ8.*f1K1VͰ⭌]\{f M7ZPA׾%Ɛk.q¶철|ݍU޾n^0ewNn##qGR@vn$T׾jN"0?yF` rY B1E.I/ԯMq`1)K$$Bk\/He=n3dK #@M0}nǦQ9.*Аlc-qS; }*վ.e,xDuxW'fH{xY)ۮNkSh:z @NG5Y8=rK/T͈xS<ï~ս5KenqC=g9h־5?jC9˝?6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*꿓F˩()Yj,{U{Ŵ~;.i&;P vgF?KlnxhsL9BYԓܜz@)*ab͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb@yf=㖌D5dovTۜ7SqǕ(A/m}a>tw:}K-64UY]RͦY-غr4gء؛\dxbFwog;opHv*ⵦ"N8#R-ऊbLJUĠ%hV4]%bFXƋxUpv>4 AYFRo8< mL݉AҙBn^4ˉ؟ՈuNB(0e+۩P:Ta[v4;ƖݔCNHcocn V]mmHfQoJI%][_`I6˸+nb*i@pRmGX | [vbՆݛ?-JnoӦiP;KWbNLY 2Y03CL7bD4道hkv?zS[0=mNix nas›vZ-#+nվ*Vm[us)mXG݊m+S ۫Vzj`W/ۈƖ8lSmAߦM\B)6刻iN_+N8G2f1톖ڮ;ѧ E3EJusq[us}[usN0m164-?f8U٩Q\Ϳ_ Rgp|2twJ:f,NNTaA6 b>n%%5o%43rpH- r(v޹8.7w8X>x[U eg/7@ =~.y?&a)䅯v~o;IOW,AfczuVH INp'wX+giZzR)0JTTXQ<*{cLSA)U-9 `K6lUH+ZjmȐzrV3[!q̗vnTW:hDi`@pabaʝfڥQ%L)T29hwq/m v0&LUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]LUu//>@Sk[k-ޑH݀6ϑZPtȳROֵ) ҝxD_ Kt~ 2-ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*^[¥8˓ LDYvK4 B솸Ic;'G֝d*щ\wm釈O7O<dq#@@̺i2]`i3%ؠ\m7ljeBPE۱9% v9YnZbg K1cBq=F.[OQY- 3v(dX v<,xXzP /\^4NzW -0ҿ,쵋zR۲ąveN1/& uqЃG7bR>{dX_ 1醘+li]!P||pRmTt8>&oj{cL\c[ŘTӯRmzc۾)ur᥷W(#'NծZNNc{S-hoҀu'|(f \PxWe*٫Jp7>XB,t:U.͹5(vUh~!oP=Mq[vZkP)ݎSpqJ imz1ƒKm۲~+n)N%S( M`E{ v[ ֝|pv`ovf 좔ܞ,:ƺE;F`Iu8Yhnu5e#ˁq';Cׅčʃtƙ.Iႊvu1f` 9)e=qeq /צ<+SIpp}X4¼N6~,q^'cABpRbKl.<8W\ GbtA`an0\L5Eغ]Fc gJrmD;J}PڢJ7}1v;b`WepUDFe4qcXvۀ N[ 6;a[q-.z۳r߮4v_?~۱Y OJSk_"Ɲ2&atO)4)1nF8𩛰B'q0ؠ˜eP%2TėcSQ;i\*}(7‡ep'm٘PS%Hcm]Re0+P6CW;24v<&ܪA+nʡ*u®qx[vYkNK POlVݛGƖݗZJ.Ɲ#q][SzȲ b2MN`,ptO=26MrdId v;icFm}B/C]}j` b$vqK;bbW/E߫v;`7;b50VFk/cp#'1 |+Xژ-1wLimD988SncnG] V"j\ :)W76]\p4W-'zu႕}[XF4[k0jo۫"؟~VDa7tpߠ=3Q%s!@<;͒1,PM;W% n}CPd}=ܥ'?s=CJT!n92}]_Xwcz-3(cRcM%,֤)P,eiFO!l(h4*Km`{/b=ՔC\1 Ho.[[v l|FS,CՊꟓhrO?0r8t5م,$;c.<4mWqN"4 Mڸn T76*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]W5-W 9O(vfC]qMebOl neNƕB' ~g?Pw;bp|9ֳEg Ց8jҸJ;퐛I\:28S*LyhKpzbTȲvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]?#~[iwiӲ˩n]#JW{_?*t}3?i#_szO1O<%|-"@Ye%4̡jPeBMJsLXq|F|f8"t8_|Z~Q]hs~̤ª<(!bMRMkLK\˃MRA$W|>KMIlߛߖ^}J0'C3Őg5clq7vcݓ;eBT8N^o7iԻ#D!By`A닎f]cݕ^E]/ vS: P]I?FzFݍXZN  v*kemf3Ku$KƘv^Cš4rTf*m\RӮBݕpݕ7ߊxM0RĄn+ľˁؙ`E*G<~a(ñMҽq)ñ?VgڸleY8^ 9;/GŽFcK 'cqOl<(vah<+p (vcnix˲6 m'URML4nƛ5탅xݘ|p_Un~xҐэ"ó8\mj= -Xl㋱νw$C.KKj~lgT.fp~!v_u)r3EI?N[NUV‡am"<TSND17ac1k\\v9").Œ!QتanƑnO -HpmيKC_bxMU٩ʀV5 R=2cǢ~1-h݈늻ӡmOv\ϓ6@Zƹ$|5ZY%Yxs`sOxsZp|VAI 45jàͮ\ޡuPE]"}%j)+%%һbKSL%|qRuĤ"saՕ)daͯ 6ӧlVV~6G23d70T߷TPoǾcV[VKnCP EǮ^W,3BM|NH8)Eڽ H# ]-./ ' #+,GjS_ʧMF*K 7Ѭo1ԁ_{:jz](yFTR)z qثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]SvjbLUF*b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊 t/f3ir2qa\;:'(ҁxA>o/h6rzv_ldm\v1ߡ[vR~0)4azwM"Xw=$;Ezbl*+d3amݲ@1݂Xhu.AmتL4KP&.*[\4ew®ENWeݰ(vP0L!.|EFGcvk\{`+^$ॷe۲Ga cxvIb7l L$aE{䩬 2He0/,mB:qM,G۲鍢ݖWþi]۳q邓nˠqC)};:bvc~4vWq&ݖ##~Kn>n0B:Kn8SnmF![vc1+n7>8n/}v4¾Vݕu5v&mA#Iv1T 2v4Zw'Y|$犂 k6cMbR$MM|qBugbnd>9BNvoUZ 6^6lj-a0v*/);" cvq)Q. o&%ب;w;h.ljm֛hcR6 o/b7†iB{⮮습\o^›uq5ȘbMҒ 1AjbR[S+p|bFf.\[1DrƖ.VtLL@4 ja+|KX68UX'+54dY:k !U,JV|R[ e}sIo&@Q7Z . \ AGܷcOh S6͠=[zȠERN;TZeAXWc+T;5A;P:N)Xd$瀤5匐`v2Nf_rpg$fQӗ!uUl`wcw(F1'<@(!SdcI[tJև71%1:q:oɂS,XO݌@L)T_o+dSWhA۰ rF4AbU7|c -6Ƽ4RF*dq6_1/' WWpS16wK@LsHS,ZcZ u럒m-l5$ҿ'w;jc/Yt{5+u0dpz )~,!CŅR+bE=p!ٱWf]vlUٱWf]vlUٱWf]vlUٱWeUح(|A sup\i%r)#-L#̡-YiFJtȝf/@"98hfsNr |s, x>x3T%ɇO$ þ5cp = E)4Y< Zxk"ֿ1Ghh j:sd{R >isP{G~@iok$T́]v [a^S'5mO8F;0D`zs[@:?2?#܋O7Ǎ9o,;wګ!!pV  n$ȏH>tx=\B*ŗҸYqWj~ZF V®&6&7]lU[WfTmٰ*좂nDŽ'cn| v8)HedBJmK޽pZ]Lh+ZW Wf' WcI,qCWz)道إ٫5]ъ,.Ƹ$Sv4S ]+QJcJSViJv4+-)`SZ;1Ɨl\n=Ƒ쯪 ix KڃwXcN<\*ZhzݯEIx][ĎylEO6kY`Ӓ3xP챹;=;Jo]\*WcP$$x{٪Wnv(*۶(v9.|zRȔb-|K'cps8U~X1]|CnءCn.A\i;Pl݁䘞[@v0F_s7NhN l/D"/ .ӟljxv8r!-e8($;9acԑANۦcnd#a۶* ];t\RQKۍq4 )kE+S|* S\s2ȔmW-V4VfMA4cDpbJTC|:Z.[js0XVv2Ǧnu kU98O] h*ҘUh}1yA>8R6=q֊9Ԍky0wYdR(?ieB>?ІJLn!5##IGZkjIdw|30-4P_wm=nʐdŭ?SxPר?^ R7fˑk1!BXʂZx]bf!wtZ~-ZI{@<0Z QN(/9((*)g@|vs>n? J߆Uvl,IH/%~6xeǜ 4ZG@ra@fcU!5PM1=P@FjLwqÜەPq;WYcqp?̯vfKSRӛђ9K*GomYEnƟg_iJ`FE4 P1i0N&*r_vlUٱWf]vlUٱWf]vXOΥmm[ h~AyceJkWU hz֠AD |w#Ldp@]Uq8!EBszds);DVҴ˽7IGm y ;Q_9bd5 m4hF*2 ᜤj̕=$x{fQs#.E7Unfk(2!z(}Xv܎+ci7F-cQZ #o cɻ ) )TWaN ,)YVS֣2az8"4lQi.G%$߫-켾NX\bc|q\($t#0O&.ŭܜ=nJyݹJX4'_rz QA%v~@ }9KgpS:զ{ G+䮼c܏uah4;i:7溄5ASLq7DJL2z:5?!tj}ad^LG*u.F])j?U&j?nL$h@ y OrR +DIOA0)qL$'p=뜛L{OR 8i=/Uٓ8 kO9b6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثD0D;H&.·/o+F GYb?Skf8vum+@c U d%u7"30U$÷A!dkr{ɉ.ǝ8X/;*튻,&b\epzl gbBF$'be](v(S&vjWbcԡaWe/^덦gצDn5zd mv&|p3熑pv# v(ㅁ.qo xoLP܎6 kvQ4]qSXdS;.]:cEGLRk] -Ml vaָvY=: AWe1bCzxC@=:bfnG\R쵌{ 4̣j| k.Uك"cy vY!wp+F*kbMi*kvR mJݍ۰Ifp۲^b-a[0e^۱z`q;<+n˒Ozc¼N"&)v_M,i6o:v[D [vPA}xbW}pR;+|iىw;b&OqZӍm4^]1nnkAiaJ;:zqT< l ԓ Wc6ƕى,UF9zv)̠+-fnfh,òARE= -̑M.d>5*Q.4]`OI(Ȳ3猧_`l=ˉ6ԢU08ZdDY]D w2:?. Lb\v`=QC_6q"\R)YMw3zdde,~q[~]O%Z`W\i W(F^qo P&PUt[\z!_)Sw혨T|)iZ~D]ĥx==h:iuW W_R")Åi ZP;mf Spc,*Ig*hzp/Zp<(z @F4AaGS=Hm7o끛M+i~n2E:|X&مO%0J xALZ B2 ބ8%E.l5 b*j~[IIqs"osS 6Ff3/$Gj-źw(;f^hN>R(PJ"]~N), Ǻr;dASSm3*S߂c=:vNS%Wstgg|JRJ W۝퉲r ¨ĐE:eæQAkaUz {x; t /#xM(zdY6N~qUx xx'}1[_sCr>cr,pjloק|SnbHd'oJp?"hJ+Fe~nKSv;9 l3Pɧ\C5er|Kڐ=^+vV@b)WA#r+'.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊:g\VXh#Fh;f#'n4=k4ڦI\XWf"KUfd£9<5Pjdi'>F$f0K9ߐ|>oiƎ ݎ~@rI=_Q?5Qg[?O,#g[ h A| 9= %w6 fCf'VMfN<];ʞD<&O6^+F@)d[ .h؝_lup ź(!IUsZ}Tdh6GWP,RLd#8̎Iz9ϼmޢRZ˱Ů'/i;NPx3+yH@$]Ldy|JsϞq6{`vo;Kx8s0?F#=AiVܛeb͊6*U٩-P'urU=k[*a3o*Q .kd @O ~#w~,@:l[E^~b[ x钻&VĜN]2j?ƇdN{M򵥄K h(b䝝nML?:^_TӮolqq̉Kdf4BkZ_S <) 6%~^?9-]W֍qO'XʐI>$퉴LFƕșVYCV*@?"d 5nP+5d[zZ^YȎ9}N;0|SAч6yOUkK aBFlrdžD=NAE(eʚ͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊.F' H О/Ljgh孮Y~GjEIWl(b\u=qMSބcdž(v8maCqNP]bT;(=ND؄)ȒEؐ+SAnN=6o #n7zpNǬ5 54ɀÉدiFB-ؠIbzbvZ]F ‡ZAu1A-Dq,iӮ1(x텋uŽ'H!.!R*{oA[jߪ 1O u9 :]6?+o#\@MO)%KkIaۧM.އw,S v9 wl ".Fә RF 0Z*mqǾյi2S4˥91yI곃uh:W54h(k1M Wjsi> fю2 ;JHl>Sx,+MioKm۴f f1 t)8LaObFى6zWT0ŗ5ŕbOc5R|lVV*ۀw867VVt Ã(I, L5/" *j|' T2|m\(Fٶ'T m{bnf]2j'չ( 0Mp(¿#5DQփ l[6㋁]RqJU4 jTZfZ#^tf*T^]{(0;u(KC3:09-zAJ`$dڻ d"[ETӶ/,>Wr0U|-ҽ|gtPsm͆BPK嘠iFcҔSiTBVTZ*"4HԍI %J66wJ?szRijk&TE*Ne~(^6ƈR{i\SsƔ=OnxUPH;Iޞ>ڻdP)cx J-WbQPSq> <25VXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*LVf>d(v旵x>\\.ZuNZF8PwkHx,֣̒n;Ě֝P8ӑ\ڤ@،dbvo3ܞ' N8"!qbW!,Cc,"B 0\Km9 YxV6z(Fww;eA}ڐ&|z *=`_]ceRc44:͞LJ깺̭[J"TC3Zj$D;XQ;K'3ߖڦp[F٩> <9yΜqA\bKJq[:@toi NuFoT'oL*7$f/USJ rT8rs0g3a<ث^~gݳsO IB~43%4'փ[HQ:m (zS Hv$NɾPȡ|I[~\kg"uPwg-%Y~KyzcSݏLGVkǪ rG@IXuuʿ1]ex0Sе~qGx-%ϛ[ӉG/s'>Hܛ?{f$DF^ɓI}k(EZ`$tS029i WkZJuA[Cyf_폀-XqȓLI~p`GϧPR|@ Aҿ,j np)*FEf<ç-ǻ %Ķ G~ߎȪA ;mNISm'l ö w`OLv Bk{dem‚ irBnnhigJT9JN5i!rD7S]TSJ u* ЂOsE)es1߶2]]Q6lb")SP)\[ `;u´@ݼ~.QA"B,ux)S5*`y)@M@km\(DFON.9YALmNezV +ERN@R4,]}r˸n !aPC*M:d{bƵ[k5FPrRtg,7 ~?N#!4efRw>=NQs;9x CPv&"بA#$f>[IvT7Q61eq ];f4ɡHHP2Lت!}N%ٸ ->X7녋t.W d|68;Bz]oHv%Bݔبv5N,T,)1%*1Wci]l*Weoߦ*qWfqWf'vo UgvjS;0'hNp‡cM;`Kr=0++. j,)v_*w4_v_z0һ-iC\U@xʧq*]m]*yb5$'}qǮ;5PC>5vYJ޸U|6ߠޔƤ72J"w]E1Wf۠:U\kZޞئݗ聸¶Lu#lur3ZƓme@ݍ0&ݛVn?)e1M2ľKb{{^'cY;SE/S۳pڽ"ݕ>Sn |Wه(e#݅mA9Pi-]iݘ-~(qbvqM\GzM~'!m6r=:M/%q6aam#mp(:;ڟ[b(#|U* ߾+n۲ 1[uqMs۫oL'W֫>uq7Z=`0 o&->9AT߶K nqk8DTa`q;KVQCzkB+#zm.ƳR&'+%+Le#n:c$Wl1结bYRmDQiOlب v?P}yoLU C: \zQzaC*bD'P]c㊸ᔆH1i-c(vʝqLbmbFYs_ t0ըZXl-_1VH4,b8[A_Q7酛UŅ~޹-;*")SNf*¦qV I J PWjuQ|2f KZT`-r#&٤`yoQ+BbZkZ({\٨C!^4>q$&S? =89WQyVdI'bO6La+9DW8圛Of幽{"xR vrFO \y7 Y,r %C ig/켘/\?QyWePce5+S%dΒ&V<ĞIK CVQxs~5cSƽ@Yʰiʫ%> Xu> HxDǥMtյU?ɸp$E|!w m:1& I,4)x?:VTQ q32;7 6W(1DG|!(Zy]I9jKk O!,u-RVSN '&ŇS!,OKkDE6wV5*-$ss,V`_ZkkUq<{oƸH@y PZPobqF#$2-Dd\u1xԹ+%BMȰ;xt0CȥB ۸P;|[dW#Vu?˔ZUmջ}NPjU^~|)RU x vˠ5RVVZcW)Kq P9"~'J-kV{cTJՔF4m,H"`ǹn:bn@,ifE{SƓĂ-T G5\xS½ؓV?OϮ;NMp/ #õ:`2+Xj{퍒eSlCn;]Ѩ@LaQbrDueE4R,TМAܞK,ZK1{!TgB)#+N#1.LHF rBM#p(SH4ROnȆ dsmJt8 %#/J$!Zo㘵2b@1-eORl>}ŹQHMehaR:muTԚ4O1Imy1n?aMB=˿)|+[[4F= w<[j-]dD_2=n_^We 85k| V*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*^~_>'֮A[d"k>q=iqYF"x%C `߮7n#]S g ӦF&ndO|R}iŋEb90rTLjtvqS@ePS#IvnTZvP\ +el~x`bኻ2P쿣 l v`;˥7‡eK t]Pr8U٫ኻ5 ]vWNUU-] ]WvU|qWc;1ƕـ]Web]2Aml6ۮʃWe)N]v7bfR;jզv]Hv`>xһ1 WeLIKF;5GvZG1Av8TnqbukJ]qWe+QBqWcqUL6]|~vbh(7vXZ R`Vmm.8+mfWv&ݍTk႕~ |i-5)Ӎ-уWcZ*l;`V?cwƕJ߂~vq۱=Wc oӶ;+5:xnU^}-,6‡eMv8[ޝ:dRj7+'riZ䙆:39-#PKUezP]\it`WW1o0QZ~ qGB> cpo %; oS[ǔ7e'J#$T']M¶2 qߦ41mJS^&3lҟN@:ߪ۾;cd74r5L<)s5 *lk p6?j'5b`KdJ|A.ǀݻ.A߶*r׫m bUآ {aWc+_ m-cZ8P0JSޝ2HW)~CLm8kl䞸:q #sф"+paN"6'$i &>S 0JJc׽rbWT8:brۇDŐ4ڽӀa+nx`q(7p2qDBLb̄%` IjvJWnDv Ru۶,j_\]2A@76-h+H3U161{-\(;xc" _JVW(0B>^^;W)r)ݵU M݁.#ϥݲ3!4՞Riԑ gӦNM9'&9N ԡ^2* #1HfwF vH;ѐ @|b0K*z G\ώCt૙z׊]LŇPkLjڸ?>Te4u6=v;A.ҥzmNqdՠ#>yhŬ+xQ{ fH@l2!5 W+}Ze%ɉ܍~$v;eTr`y+_|P41E|}M]-a]D*T xcJi&̄˶WO'z?fMshȖ\y\lC1kgQnA9`}Ӊ*?؃}َGz.x\P FF0ʟ~8GOl'Ƒ̖߮fcǿ$n4Āq o$H ہV-XʥkCTU6͖ h-%N!}3O!L|:ƻw>+{oԁzbU@܂H,x\Ē9v V*}#, isz)щW"ժ~@A AEOAQHϥ)C3(ǹS]Uq%z@OR+O @;^l w"w$uĥO }EL U޻c +qAS;-wBuS.zAA($+'V^%4;v_Hf$N\Y6tgH 6;/0'7R(<]v}(%Q ;Bkg0ǡu}s-f0[j=Z3z{ar(vc$ F\;A VĚ5ծLwD75|Uz}kUFJ#M;iDnTs~VyswfZP˕ 膯a2e泠 h~㝗m/jc¢9lI[fS6܇γ"O 0y>XXTֽXErC&3V͂f͎w3X1wx0ʦl+/3ob\ +`Z6j yx"Z#*a@reC=޲=d8(S]Tge3/LIm Ɇ.i$}Y $_j0=@P2-Dm_*M)( fcv&wۦ'Cs={R"McST( JBy64I,U6`,Cҽ~<42wzf+_׆Ig+@Oqjdyq5Sn`1)7Jok NLF ss9|H∇#LI/NJZw\Qc"\dҔ$H?٪I'TT^Zw8G#:Q+$ӑ k@ZS#>7?#|ǧ2N~>.h:,T8ߋ7ÑKϿ.DvTc_\e ?ʏeϹ?nl~֧q =)*!y>8&cDzO#I܁րr^г~}0,;'#S_EL(ԸQ/䮦Dj//ˍ: r ,'u3wVصO\n>W$vHԟHvv!?'sF.ab215:$R\*v }m9׶6rESoyw~m,ZDo02EN6!{X6Eg?*ķέlcX欜T `1 jBv )aعS;hjFeH:7o2X9ҵt"JQ5$B< w3G|| nqz\M@߉L;2qɀ"^j7޿H6~uyAl2ƩRi41=Οc;szNFiYb7 #9$m|r99" rfW$\U]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثY]XIHð̽>.#gT0@]дxtqK22|W9eej7)p،^;y|%;0jwfTj0;R׊8Q'b2"|;dYr !vZ8X-EG]W| v:Hv()^$; u7Nţ0.VC]y%[ޘC7z d" 5=r,W¶xM?N ɽ;e..L8"@wRJ (ZS&[]V[vX^ -, Sci;(0ٗmWevUS]#[ /] fbI)vPc*v]i*{+E.˨+dB]u͹늻+v80٩^kWe@0v_ zbc| vn+]784K+8һ,1Z׿\*}vXSHch -لg+\mvy@M;aWehRGxÿs/ FO87v4Ơq58L*-(:t*{+n1Ӿ[v6D B۳*x]ңZ4pPG­W2Mƙ6C_4aj-PB:C`bl(7? {(;֣N c]8dm_ኻ,!"mV.i}ve]Wm8 N{V_H+•۾([^֎}1V8ZuȐk)sVq01)uruV8=j :iq>)mC7pR7LEv:!Iui:j iMH1%ٽ27-ٸmV۲q5ƖݎcIcIY4qHmv<{aWe)}TWxǀ:®SF66jE861b+^\XkǮ®cކ* !Z|AM, ~=iCFk1Xk\XR߆q|2[$|:H2*d+@pxtEIe ڰ`~xƘ %+ W(>Yii}5w?VfTPm5vA%lsST,҈.핝X<dQɺ|ƱĂT?NV57~Tu aQ|9oOe^:$ %xQ]]/s6:LXOY~foydOV$"")BePۮdPmcerRToCM}=3WIgwӤ6c|Xi`M$V&4FDeHkLJcm|\l~_ Si6V*pw"TH)ۿnp%VmGL v;EqX=q-CQ}&~$:m}HG0ܒA   3ldťsF%ۡ7@N#.Uw .ЭG*1f1qUh:x:[$R{A]&S^5`zoA=*&޽昗jJ??$JPtμkz豯muפ5>{%**olw(5C^1-(vdGfLמ9si :㋦j۳lȎu`peBNmǾg`*kf|u<d55P)ʙ?=WTߕ*q2'#}Vз3%Cn@}C<ѹ^Qu4?z8JVs5Q,ŸF@uH*_WvjMqXjZx˪ HRT haSf6~Fp6?Gl(帩,GSlvzŻ[SI5l/I yϿ^[*^TZ=?^Fx9vad&U]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*?)GLPqIluBG./]W81 -.u!=ca'Vp1Jo-.clVqU`AÐ-|Kv}3U "JH~'{{q 'HVFCO*~c|BO]cb7VTS9cr6MMׯ`)(m ;H#w$O(u#or֣qb)5b3D0q!F\PzH2h-ݲI):xb Ǎ01+86q}G G/ A=9`&hgTRxv. e/9@ԎLjz l-#Xcl=`a˨+Pm 2JW[`*XŲ4t`~zYL+%ijVz:}'xOUiN'|Pam^?kĮf T؍S"O0$P6}>xŰ$w*q#u#ԯN"*$Ѕۿ͹0eV%Z ;׈M(p "N'tR6>jОwP<\\i&zy2*wUztރvZڵjxG2=+H*w.Y%t p~%J)^4s<ʇc)ޝ8xD\k? 閊 )*D4=̇c}DI;i/\BFrW$8쑏ߞ\4PóqG#եû9qȮ#^9 Q a2m;@E,Dr>ıܜ51Wc`f=8upɚ 6szlAYcd!&խ"4dÐJ?-f <Ᲊ\,x6ީ6hz= vq ?.ك=QӲKu94)Sr~4N`mH@3"2k2OJ$?v`:L7Pl(sRp2Pj?كD eR Oq7oQWol)JZ61G{cJoVjoޛ̊xcSe4%$!7GL#b@eLuŐ"5%PˢɆ^JJЩҝpq'¹7 <8҇F>U5}:l;< RӿGivԡT?,f36*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ZKV]#A ,=q~%|ْ"(>gT듕mYYn؇^N8v:4$V")v+ 59 ėeuN¸@Av,&.4aݒkv1S7ffޘmFFEvYvbE{hv) H"B݃~VL;0-Rrv$LK7c()c  T;*KȠ;+q].|T* vXi'zb,T3 Uى\ ኻ50 vU0vQ.8LUDv;;5+]ƘWe(8Jw8Uw~hvaZ\qCxOsO*S߹‡e,9 Uيޕ\Uآ6W.v트҇­e1 ULvvfR)m늻.}X݅]b)ͿWҕ8c-TSJcWīq$6ƕKkCm]JF&X쁽1Wb8ol j=N<鷎,Ӕ7=U"R+&Tx b6ҵxJS-wcxf{P&{V:U`<1VRz%*?~)wL+Z&P߯ N<.ZN8:ciڵh~Xuk3#U,b4L "<0)_­$\i 8%6~Z hrDOoS`6i{aJߖ \l1k槗} NǬM@ćcYA5;2f$8`i2z,) uh*(GN^}ٕMmZus4US~Pţ!+[lUImk h!!#qz{rQj;Oj  '(1;t # YJWrj| 4PҝkmVZ.1[׷" TvBW9-1ci@ъ'gtyrJGA]*lhj+x<(BZ$1cT+CPWj~ %PVS߾HqN[I*1^8MZD<%xfn lh8haٻS_ݤªsS&$1+$0)6h•2Aʋʀ{WDޝEwڋe S`|0~X_GA$os LP>L,QLZoqjF(Vk\%ÉPǫvg,(K(Q񤂎>Ş!.$rVB'K0'=U$ԠpEWoI=<Ѱd1RWۧLhOlǢa?(b&C\j;ՋF~2 s?Qظ$T ) [;xf:͠)"*&N~f*Đmh;ul\jIfC[!ͤicx;u߉\bF\ڧB3޸"7B ; by$6Axv{A:# wr299|l,~&INIO5K~* [%'qgW tmZ(塭8Pl:u˭qCeqZT VƻEȒ\Q^ip41CaWIk&⻱0TSG(20p׿~zxUeްU"eA]U% qDN@e.| QҨ?Ucz4P]Z6KCN0`0o1yd1Mi$yjrʵ ֔kOV1wN1P[)QŶ*:lH$b֛kֹJWcO| C0]_G]>iqLr0Zx̶ $7%鐟5~pdiInjk\͆ݾ'>iމy $Sr?3_-b;4S6F/A t'O"I%Lb|x/}yRԘďԂv^11l68QG@QNNiRUXSusSupF֡Ҡl>mr2Փ,q+3AԱɵ^0ᣆȏ1=|K>dU|Gq8TO61u{q QKV&7t aiݛ5IJaKhVVqo˭ڙ"^y純?%'iaDD2.ӗT^4X\5Lv S,ŖbR杀ߩ)k\Q-iNQ[`jH<߷B׉AT Mʾ8QK 0ӧ|,[J*{ hqЎjr?@]\ʴ=UقڸXH #~aUb+1F2qR"Iڛ$ kzfbAɦPt%R?̷,Hw 5ʎA;&Vߙi"SOna2"G ( _ƔJT|8B6-^j_8Ni #! Zá ^Cc1YƅUiZӿ̛Oe#$]*爷bg OeI mF $fhU0p=p<:pv2`-rƓ (r>'p+H5#a2U$;ц5dחHA~繣E#a@kX]1R.Mz Zxnhj)zf_ӓ o88NT_ƴtiO|wMJ O@Mңla;dV&jr>8dT_H;;o:,G|jP's0oCj*Q>o#169ٴN+ؖh]lAQ٩zK v/)G_Ks=~)҇0'f2K·r RJ ӶLN'!~X=TB 5 5f"RdHbiZ.* zb>ZG >/KqFzsLJ$%VE[=k”kjG.lAD'V&S.*E{pLWLDg5_˅2md,ЏoyG6#i=)ALL=z` V5Tt=26)~ r% WQaJ=ECצ&b,z^RAoĮݒ2a^ov˱; ߒX5&sg'Ü5E2leA=7%!괳fXH$Ô\cWң$###-_s\PcE(!@;smd*J?y hb;dDݶB#z|mC^kͨrH*?IY4Z֧M@ 哝JVmq %$MGCi o&#h&M'/ 6$LjZRS$xţaLIuqVjҿ~.!Z4&qu ͠#E e44pv5:Lv$zȻ za,C,+RNȆeA2MNĔb{`Rm$i .8*g*m%$"tȻd`qjWO.q\pZAȇ ,@{``;zȻ)Pb iv ;e4U&I.Wƙs-VC;T9 Jh+МUُء؝VaWf+AOL kSUhOUj e1#$JabuHޛ P(z!n6LB2uۿLU44‡e^#$|q j´PȫxC=EOߒVbl{`!]Uޝم u† )p9lUa{Uq®*w G}Ev*7;s\3p犺8BAVh7ojZ9)7"!A2Zs-(Oc߮w5oxרoC`hqK:ݔROZbCaM"•V%o~kjF*<6U5&ώ)k1Z`WVJ{*qѦ5?XV=+@6#Z>c}k b>Xt50o8PWUEF4*)*6~X;XI~UN5 Y$Q1*>f+J>`@j搿n<:dsIH4u-l) /܊P9 kWO5qP`~] ,>*׮ %T% xK 0B(&됦Vzc䏐}CAX 12w-(=GM^R|>x 6 K th_lޘml77\Jze!zS"kaS@*{bzcѽ3S]U9tmQ$%:|WñEFf”dV< isɕZhF5icXW9mVw$\ژ2;f\ Wbzhz`$'Ξ~+9XoP6mE,DHԞmOTI}i8p-Mi2}]}+vՍN+ PO|܀l$ڔ[k4Tx28$w/AM1@:,Y1@jy (O2!!Ujjc}VF&*wQ]PYGzf#0ıL-)Fߐ#b\;vƐA *$04jԱ[EqJd< ۯ1peu=+YAmݔj;W @ ;.+%אjPHA" 3)4Y1^Oo"P =>^75*0 OĚt~,I Z@[o~v9m*:x[oC mAcp,jDNO^/0(HT*TuClKH 2-G^ۂRzF?xˣ2v8V粴Z>6d J9kvQB\D/G7R "|nvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUu]Ly[Säa[@hcal;2Cїu3oK$dUOzswӼlʌ* OL|IA_L3>XA.g9>j~~ר8&FY7͐ai^084Kh fU\U"zv;IRBf*|*1Z\ڟuY)|B!A$(-or w J3|5 Њc FeYyaVNH+18vxR)]㏨QVB!*( }FV?dPxd@K8ԵBN I1>T`[F2y2щ<vm- ڣWOWn$ K6E?S*{ih_a\1ջխ$;աlI-~ bY=:=kb*?Lģš66GhǍk13b iŷdn"eƽ2 kܚ[y)+{71Wl "pvte OhSR*=B;$n?xN5cR6[`Yꌌۀ* 4]J|kXZK 6gJ}%kC]ȸ LKY+"wگkZ`.ĮIfmFIc/c߾MhJx bN}8B )\!E O??1jj5ǕۯQKT|CK(Ӂ]wڇvnFء;–B}w]XEGO|B)!P  MF;8*v6®P7)㊻鏧We)­W3M6]ƚVoӧ«[6ҚXxmS0wěoשƘZPbUaL!Vytkl0qE$(ol*lj\UdUcc?,_Mk cƤ?G(uy 'PONc5S1[w;VmDsC" 4gĀxaUŷ8|m25p~[b<<1m%k687A_5t[hCyK n>>v .is-cWB6>gnK!A?߁Ӕԁ6g~iM⃠?l.˸eч 8ҿ1@WuG$+*0!5iՇc_¸nX|-Sv>9E7mۊWloWoQO6\ NӮSk Pa,`TP}x͸-l4I&+å(!e1 1ڻ写SV)*G:~=a]Ӝ:5G# j!.{;l]ԘìA5_˽oNb$f|C|c"PNoבL(D^0%]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6*]Z{. Rc8 9p ;=O7$nZQNrzuLG1vzf[:ݬ d&$04i,^FPo$9L^M8g@%_Z/cv湺P}Hۑg_ÏgCh"zt?7;G^.os&HʪtHI%buW1=7)Rș=].C$-Snq60h+K%"D}_SX:j%*p eB {)eLed1j>i"p0TD<5Y: Ǧ?.cAwƛT"ܸwK.ݪݚ;rP~!&dZf%ڶҀc5xŵ~KxG'ꢬ\uzQ#?F ;e#pE '.շFe`ĩu)0)5#&rlKe,ֶ_G\~da+q8Z6l&`iˀW1|u돮v>AVua17ڜDP0S {6 b~*2\Re'f(*F_ěBQr|u͐<0ytH.Gr~ N41Oj 3[Xe6䙙%pnd QJLSq_ WӅ°DxP3;>>:ZBYiF'}␐ (2'dDa{AV4C,a-v]UFbCE B%c$Tl#ZӦ gKOj渤s@M%ڎfh)Jl|q4;_VBaPǨ4j7ڬvJQG"OL '##AUtWхzÊl?~EAYnjb}O_ b|twK[WGg%cSS.ٚ ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbvu?O8 ǤOF =St<^oy!P~ґAb*ҏPN:С7ltCG48o$;9zbűLSC%CC]|,˲F1p@z.8];aʴb|BqƸ DP&!+,o*aKMN^y;P#5ĖL&e.U;ZSb]]O\P@mg0|P`4[DžfOk~|@Z~$;Uq05N9@P +I+CU$aR`f)J}8BVӦ1Bh"(j{B%&UsLiB{|_WN=Ꮡ8-S)AҔ+xbM#Ī+Ss8p!x5 ,Ur 9~-SV=;߯ U +ff kMRj*էbkSVU2;|t(kA_roLj bQQ^PM@)Zw@助XjS[]rJ*50$klRI鹦 ᾊo6a) ߯?f%~%oV!/ ʃ"VsaV6aҹ&2 ▎/뀥cx#@{|%>X^7ڭ, s'!OHFǯ߁O~:dCu>=WZP2WpkL4C6D".;~!07hx$Ҁ~hkҿp{\CҜzr6 0hib+ө߮5DvbE{i@+$u~2*|:802W=2# N5Gj:$PV2c``}5P7㊭`ģ wk%G5#x:SdU3? i9M*'Wled &pz<%cr53nDΡ麬cqu2$trcyзx׮5c$—Zku5,눘r@ Ob Sɨ(}^5(EU"޻kGl:C\z ޽s j=@ECpEvm IL`cFJ=- N` +МkLb*HAߨ8VTA}džEW*h|iCnoiPbӵ}ՇqZi֣ŸA߮B0(M +1r:W4 Te|q\"V|ߨmqk@T^5/R S,(1O?qnC_aH)%P7bhK-Ov;f$\hȑlULrCRiN?lNKdr7Ɍie;*\sO .c3fډ-xRNdV1Rk8ٞk9p36'Mjɱ9aYul%[b<V* ;%Z5Pw%l1֣ĭSjW$$S*N'! !H0RԨ8 sɅ ˆB96+xƟ 'XkhE;0H; :ÑrI*z럑|Z}ff-Te;nN94d׸~座嶷a)*hٙv"!5V{6#6aJHU)%X0`KyXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vjbT,hN*vup-W4VҰ=CQ,3"1p]}""fV:3غ)?+<_:%oӘ +X`cC{ܷ2_o00GZt`oO |H'o5~$ף~#Kwox\tq(B#,dX2 Qpp?Xvm\x`mGۗ/ ul "",@!|04FNCOW%pO5f^==,=9Lm=V4;.?)jwڟus*wjVSQ \iN'*F=o~aC\vZ'oӮ(liJt 7 v(GOƸPHwdtqBqVo*0ъ!?~p+dh(7\UFc8~U֠~Ͽ)Z(kLw*=+_׊Ev5i\*qxo<®-8ܲ }*@} _ 떉O|+YPL ؐj1UqU=1I=qKoMW,=ڔ`~ c'p9k-)|N1kbm8oh;bKDlEWWYI,c0%HLz/nتol4}=1WijP*Ԧm+KTUL*oǿ1_ r p1(ȩLI\T$PF' ~}TՊޕ(?#*4zIG&1WS@ ;ݐJ= ZɑIcp#6wIGi:[LxԊx|,]D_IDxRXIBnJb/e!JlrS^xu@t2(P.bTSbܚl~FB[&XA|u.8̆I1,I?wO-{uwrR39.0q(u{w$Lw!Yӏ|[׭p6T"wLPdJY*իQQN)Θm*H3@)_X|6@hrC1pYhu#^+[AH SᎯI6Z,L7mPЊ m>7ۧ&%LHO>6m!\ &R$8dÄ3-/Ww܎u1fv>jEOAZ&>1Mm0:u6]#3W0Ɣ|a_l* ZfA%5 ?\UmE7,tE<=BL]jVLEINdQ{q/"^e5]@) fn=Wi9huB}'>"!##oT5=Eìȟ(e_g<.5!~j<ǫ>E r951IT?)n1< o6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbSvjb>+wK+H.U+ p?c;Zu MEQ4ŏxR7QBc'ٴ?_=k_ۯYʚja4,OP征H1M"cLxTaz?_ÃЌJ]>a,7_ Dp] ('冑n&s'؊CRqq`;ʚ(RH{ddxEd#&_yUޙuurhJ/<@' >W|Ukƶ [PClw:pG!<\4{xin.ouQ蜝.}V"}$4Qv2͇ (FP~HO#JA?i#$2.6$R9mOj*_1|B<If cK2T̊lQ`@K&4 E:w0oE(/2T-i9m܊ƞ2. ,mqro!`STK%#)9#a6Z#16ƛ ,b_@w`6\ЃQmX]4{QO$A }9$ ۽v٨ "KzcJW ֽ6rDqIڸ=+CVb2D H|1PH5+O*$ +1ƔRlRo꼾ozS}8 Hw%9[Kl@>qlUA-mciy7ʸUjT?FdahFxW zsJK1uN3J`!m..>Je-ç*RRj @p2lazdL1S"\>ITjaWSyÊSO D=2a9O$`&֩.*1Aqbƽ} _L \E~#Qb\pZW4\|W"oSA/U1k.ĚYtv(W rl`deƑv 4b6ĖX4m-7*E;%"[k*w!Ky|UĻ0 Wj;.-)v=tP`!ُoU@aWe]1P쭏N%^NӾC`Rv6KŠE/:bƐ> vo*n)v:!Lp k-,R$fͽvFI.Ǒ=qWc\(v;*NvX'®DŽڝ0R,u l^i]aإ2;KX <|rJpRlUؠJ` >XU|j"1ZL**7@>?N*s'*;oZ(Vh|@VW@#qVS36_vI.;wD5~*Z'OL G6q4=%k6ۃ|3*~, q5+ֽph59>l.P >XTVڵΙ"qVzuCVoE# RoU4 qZwrׯ}JSt5; ߈TTep|*&n:mo**wƭbWaؚm8UȀ65c$Z`(^ȏ m(= x,Kxr>cN'b{Ҹت.%SETLB ~ɰbF鶝v?+|z/̮4zv Deum`۹99PR=ġT6`9f9}M&LHWqVH|i48v?=B2Ӯ7ȄH==vt?~*NB4Gpd>]|OǧъFOӏ&H[C pLOiIvjTb-EN6<;L -{uU:IuCZև *EE;oU-t+zt嚤L*lGCZ`VʼnpQ ]QAZwivT?vYNEG(kԥyT@:`*ҹ3 ]>GQ)>؛u\R:d;c[f7،5\զ6Uv\!@RM7YӦ BrPlj@llIcaNqPMFn 2-[E)_>8Ɠ"VVZ-;{o^dh8h7= FN-4|ݤ}fk`"߯|1qF\Rfk`|; kEOB'/N>J=DaJSoEOJdxCXi ȒY9n/$b\:Ѓ:md4=uA_׈ӦFXD~^]ɽFs~ mu$tOm44.jI>[[XEZ 0zOJ֣szn|k8VmR"zQ/ešR}@7!FU7璤0* H"BSJPt0*~N8q)P2lH;v6NBP:w5rѫąQ (SpEC.CJAC ߶: |] ރ,)z{XJقzWb뒶Jed#~F:$6m_|V"}/RIRN5)j>kq,TS({bxw~ဥzDL C;1-d`КPo'rLEi(ۆ}59#y1qR1U:zjT;$0؊wd[4#jVċIkW2:p.)ʄLEq!K@mچ[sa=*9HWRx;T9 T@i7lQ6R-&7V$m2M3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثW`M&$UIX$c̴U0VrS%LLxAI!]~x6/ʟ1I|&qi=èZs%OQcJd@ Hk!T N*t jAG2kW-Eiem]꿢Op>X|y#Œ*=Pǒ463nV.FCduY#էT!4y3Fe{dۿ2rZb~8PdSUuK⣋ܚeF+zn/GjT?O~A=j6dEgA)$ 7%Sޯq]J鸭i-iV=I!e$9mKֆv~؍U_QwOV938]s#bTS&fۘ?~c-+ڸTq>+wīmc mN>榹b{lԤ(YtiS74=w }u'Ćp[6"၉*%j jdobKZJvu_3Rnq qޘLX~unwĔ[~)V bϷ.Њo7cOR´P0ڨK Hui*ƂW|WZb`wqB%ђk܊T=rЎ ҝNb ߷q+B`7ƾ9ΣrN81`۶ҿpbF*$aXڝBHtª&=7?|݆c}e%S@6ZelPҨ}z9-D<)^9E*%z׿9`qU)v*Z6\ G*&VC)QQ㎮PiV߆)td0];.XV߷J֍*INCmV^tjA' ]6NU'"Z\TT W'm`ae`G{+Ȓs4l+<-|Ju )qeː `3#2 WJMsw&vd}Wg?:xmZnͿQ5K& ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊:ߝx]9Tw\.1\G ~x) [ ޔʋ`l?mB74j+fpj2fU`+9N+ w]\ ,[elp8F*6L 6VM$qHX1AT&1JC QZ˳뒋 6p`\rု$d[`0`x&NWRJ0 e0v^Ë" zG:md 8lf A;0ڙLn8c%5LE*zRZ5cn=0\C݈Av^WҿN*iߩ;|'$ft]ebe|R=Wc2)v=V c+tژvRolRWf8;0è.‡cPʸnDž *A.Qdpb] 8vC:Uj*k  2;5#bH܊P0+%3B+Jo k^s *QWz ®hhy{j;:t[Y$GZQ®ƪu=78{JV(*(2) mcZw4tTj>=VPF Τ i_m?gFMbZ …<e:bƔi*oxVL׮銵Jt Ҡovh}]ʃ(<).׈`hH=[(lMFqߦk-\QF,&pIU܇LiVjW8`dz{⫹Wd<=CdSbkj(\kDbؚJZy#EQ#bajo(XQotĆJP{K/Pv5+mZn0Ҵk1EB۞Rg)L劭>ȧ_=1R bdn8>4¸Ǥd}=pgx-V*Pp%E_'*U&6uZs)J5miYƃim퓇5KEUk^`T ufIg\HG8<92"+J׽1*6'n$_ۅSJ SD :ኮܻ2Jj0S{x"=WFF0V^u@4nStª/}:elUt^Eh:P pX?3n .V=-&_.[J:Rm WǨ+K]sW-ynv) yЍ%Pj>pځzSzrQ;@\#Hzlʐݓ20`(HZW9Li ڽ:f/'˒ҊeL$L"@5& jG:.RɘLm *֙B¸Mh<2-=U[Ƈbjzdղ:eƕo/-EZLvsJ? 3*7uvqIȔ}v,*:vڣ*&}Jԡc渕^"А!WBĀM<ʿ:ᴪ(Zca޸U; }o"hO:Pw㊸GjeEj{dAUӿ BF acUQ큘WfdChrxW7;0!I{PWBj7 U{dyqY x Ua*G7rs-Zr(R(&PSp7x6CÉJ|?aUWmz_D.j%zbܲmÑhG?ƴtVѶPk̷Dl1,C~\X\,F=HUFZ554ߧ|X\W-rc!j@[㹦)̹՞Z ^e`-R4 _:!fZ&j^BH7\m]Mw eWn)6IrL?d cuЌ< O!յk&^/quj~l>k$^L7c `kHu gcky $e8SNjb2&AW {ҟ1VZ/=[%f xbuFiQ'5={KQهkJ `Q$+_?}":aE"Fk-^تԕn]r: oe֕V8Y[@"l5;JQ.Sr¶lra kR?_,m65\+m z.m>t3WJMïŵߘQ?#-j(1ק"rNm;py2/ !N^?kA;Y-@ч#0Q\n$fJG>;T\Xn*~NYZJv+5H$"pt2ȋٿx**hv?<otE'osopÄ=gawcO9;TMsSvjb͊51Web]vV*Ҹuv@W'-g,G2svߖ>a+uT;jv`+oɍ~`IDR;ZibV>nI?N*>`Z{>,;Oz֭Op-]^Xje{I|aFO3[/@zt_wNOpծ]/SӅ?ܽ~C#-GLyɠ0T?ZdB+Q'W=nKy~=Ǚ+t g2T7+E_jn/#o땝a<{W ѤP>C .<Z)a_ב8ǫ^˝ſ:::1:٣; 'VsmO^vh+_d{K(Sp }?,"=s}f`Z{T'pˇk%*H#侥-j/gsax5u#=vVk*m9>0zC[ ?)W~W7U2"9c.D/KX{W #cS6*]_}NB>JbM1Aژ9vI@Uܘ})]{ UnqK|YSlW⭓M~pQƛnq~DkȟN*2o_FSP4v zÎ dto=6W:n?cH*e7lv/Z6߉YbS -~uޝF**\z'J7 5A?TVzx|: ,ƬD{ SK# >+v8WB*7 *֐FE+*6=6[ׁUo1V U91;g쑸Es"-#]wv7ZУ3Wq\@_/w P,¿9W,DG0΃L=}Lտ%-db R3J{VlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثEܖsFFN6p'ӞBd>`̽>_Z3td+oRC\R,+[HBɷNDܷ2at +ru\Gߦ(s`{)6fduL+Mc!)S#J$]]U^v4сVNƢFцܩRT+M(yPzxhh0V⫻W0Z>gh1EV56r)Zzv8@0Ufޞp3vHLSK mփ0ޕ銹ޕ8 j)S؍oSoU&]q5;8v=((f^I1&}bEϖ;C`e,jzWp z \o*n>M7 ZSb7Y(|p*J(8:U ;fUKllU@PS27]K2(ZX1qli_ت9Eh$Torv$\V14\ :xUZM ^8C}l(Yˉve@qJ;{,Y#{&7 [%hAVoƟ ŅfK|İXA*ĎԮb0 iƘ8^3,e}*:FH!*0\*)N JBf?Fu|d\ICEzMwr DE nå)5Uv n9Q)|UKp73SlUg8y\=k LP7#܎إv QRv ۸… 1UqJo\u1U>`O hpvʦ*>:5ؕq -*cDHBI&x#r61qԃD%Q~ƴzSUʈ7'm*v\%Ug0)W,k2kI\O7B>*NU^z*ӹciVsQ|qV۷ӌWЌ* qN64;1#L'v5w%@j[@:UW혊(\ɎBHvV?,D+V$rE+xuIȡDMA U`ݷ1t [(e{*v7c¸BBނN)azۑ7&;U*wXp4S *{jc'`78U9޻1aZR<Pb;o1ԝ\TH8R)_ h>6ULjX̳(ۯ\:]+늵؁B5?S1'c$7K4QI oĂ>QцX(M((F,!)l܍ w䏧)v¤mJPtk86TPPťO[$Qӈw݋, R]CB֜hMnOQ[>$0sGjDblzɦ"YF{'=fLj4Pg(,29@*yxӧLJ'͂.{moF PE6A~X)%GnHprGrx\#E[,Ro( `'DbKG޻ cjp䨱>%yv펎>[scoЃޠ88jI_ZCJuLwpqcC滘T-iOn1D/SIaGo-{v>QB01*jvBh&6nnUH o˵7mI%"S[X7"B^g7077.I26$#hH+,єEq$&0<(6ެI{do\b#lJ¶Rrvd+fl{k˃OrI{)¡ צGqjˡ{oaZ ^Kk@+FGbi JֱGuFhj}ЀI12r,ϸ4֢ =1qt?Zx"w-_ %AZ dߐ:](2CWCsi J|alJkw6Wr}c>'DCi\>+_fRXHd'( C0= Zǻ87_1:lGm_F{*O3I?r# A??luA« ;u#q2*~P-Sc6Ӧتvc_uث%FvrUW$܊eA`JI(?joZaJvRx{I&P>9=(Pwo0V-K͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثvt[BRzzE3; HmKjޘZrHLR vT߾ 2 }4Lj=p #hFqZ~(i8ڽAt*E#`{bv(lp5q LArt" ѣmRh+)+.(„`f[ ho2poۮAæX"@l %@sڂCDc_O`kڹH]\5')|iO )Ch7 !gCcn& c\I/?Vv&:e"ѫ_IƏ~-.͹;Wc|)tl `\݊($H^)J"ݖp E]0ٺu銻, 7*aK|H5n] PIaCdT&4 1vkªjN~~8-:wE#֛{TbU~m|CycsAAv0o߁.SJuڌziJ튭4ثg65(urSZ+X2tھ=1)veRH haU…++wUrء-v)iN4/[;m]\gju8qe9xb'l$኶(sq'q⭖Ekڻ=w*ɿ+rrm'ZRJn7buh|i^d@8?^=V> wk]q ljl~;*X~ XăZm-##$BI9xaS%P.A |cBEO)SIKl>ψzӠ84: n=7'pp*k_qC'ᚤTt­ue?U^78:Oߎ튭v4N(RT-R(M*:b&w4”') zoS`J蛑w?.$l=J.%S-:nsAAj2ĒR™J!zaᩛ#r=qh^AȖaFu2s*Cc]f:oi'AU%JR.iTiJba)\Ud,TRG_P^B;6A\Uj ({VCT-vWo[i&lvk(8ppLĚtZPr;7^$)MJV';aT?TTᚙ_kQ^alaZXnI5|Op)!zTpmMNq[=S7TY:&`Wޣ4An TOGk`:d<2DAؚo?N؋i!("}MX ^>Hw5޹GrS2$*'aHƸZ cQO]1U߭qHkӾi&7-*{Ui˨-]ą=<= >x)!ͽ;WcPiIC?hTӷ;l*O޽[n7 8em+fq;֧|Pw1S_c)|RSOjP{UEa}35>}r'-N5?ъ"N҇ā_lܵ+{`*VJz}Hn7U:b*>&½!*}u,LvH* ߡĪ * |P4c^5y wVme5-@zkJr|Ucּz k늶< ؝TtI+ڴ5=Ub:W!hPbj i"Nع&1@)4_n SǫSCKkA{cT=Zm{~`Z`*w?\z% q_nk)C=r z׮>64iPӠPW,"5ɰI>^Zm'kۏ\Mc^^ cĘ-Ys k7kZ`S&hf(hm6 էQ<]1gtPt;rp8軅Ӫևmb^ |סҞ=1rƧ&^ :s?#eU}իH]xt,Q_/FޔidQ|y86 zFFFLfbFTbMY*p[W +a$3+n4E&^`+ڽC-!݀gUnֆV5]= C\0nmx#N5rh!!M^C@ˢ{GtB֥U^F_ +V4W*0zz/ |F'3QI'q F^hECmOF弊J~ ek RlMT}7Ce[TKG]3s*RC隫tΞ+L~%1P,i) %#|O%Wƍ8z rǒq|1rȲ%N6d2$_Osuc>1%TY^ƟN Jv4LaO 6TLgSlIJ/<1J[wv#bvh+|y[GH4$aG4Y!d)f~ a Rr9_yx5r> :Ggq:8/Z#U 7ߓ,漗Rݵ2+cĕ%<(Ep[Zփs TN2W+vWz_b@'|@ZX=* UBn-CI-'jUU>?v4 \mT:1b7|qFw r@˥!*Dw 5xRAǬGA-4;u^zoþ*ҹNqi^9FZw뛍M{Ju,]|Qm )~n8r>l7+R*vƒnkmޭК >Ҭ4?0pRcsPi Xe\H#|I 8m\hPa,UjN4X73bLҽ;mZp mFE•ۯPMtbjdJm 4vb5‹RYxEwzmVH{d2V$"1]ۦY6+5q*aS E<(EkSp%iOmCǚR+Onjnw<Y"u=+"ۭ >w1[p!F}[pl*OSoJHSZcoS\POB+?^b\ `ztCQPBVl>XR~xU ۶(3A~0U7Sr{댣 qT@hڋnGvjҦ|5883D+i-JxOCR:u©TGr~c1 NCAzE cgpeu58%ox74=1BƪU߾e?KCr|>y{V?ڮ< *XolnC}_kQLRښt5ڣَ~ءM>*)^P7==e)L T9VqOjGኬj*Gι~1UZVHIOaFj)X4/تZnثnM'o#j˧uJ`SbQ؃0ů>31ңͰ yQz*hm fe;S@>Ypry1j7aE뙸ŗaYݍUwۨ?XY+Q(/㛬<4v23b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*a\j-#i 2c3ד$qvv? DI)@?lCN 'LK8 mx,ڹ6Jܾ6Mm!~f$ M6ĮWʆF|N Ln1S ̅͆ j6mLGTrWu.lG\޸ožK"t!=V{`[W> lm 1*bAdjgHZ H v9Plo Ep6*#Ͳa M4cC1JJL0;Wq D.ZȥڝJhȰ-!<}9lMee؃L75QT(vv$Id'iؠ;xd3SߎE\0+`M7=7‚UvrL߇)v4] ^vY;(`K? 춪w`w55]OU٩] Zv`|qWeМPwLP쬗%v8Peҝ0[v(cy*cn*;HE+ҸUآ{.M#v>0I-U(OzaKGm[\_cZʦڃZ?%ZP"q%GSxb2i8#T M;SaƃsxKLke Ď۟lQ~t…4&ʿPAE!n'a`Zc~{ճ˿ veklV3Z{tke$*2#h ZIN"+M s0԰bk)plb_Q^LUz˒74wژд5ȕPOlUh*Nb8 V )q> {)7\R޿G„r=GQ|;f ւ\kPvOlPn;wN'~)Z]k\P Ҭ|p#P+lxߥ0L ZS-VWSN +өLUkBSVjF}<i $NGb;xRU߰ڟE<߫L#jUI!6qbMeP8Uze"xW=#~J=[6…bBM{`HC/C}J1hӏJ{b,$8ޛh75j\+N*<1Z׶N{c=B@((>y\ڍPzx^iNW`:psBW~RMh)U97$o55;U;SǦ=XV,*POz{dJjrwoQ;N8 c}wu! lAvc/9$V7Mv5bg\B6R.63:Y '.d޻bPaT$נ2}K{t;V7#B@߭OO mZW|֧v†zƋ0*azӿp.d|4(p*IJJSV«Zͽi\){?IT%kNSއJ nf95n44]ʂ{aJ֘כ犬}ZeDžV#*HOsW6R|<AV SƏ ^iJj IO Sn4k(޸uxVtmTޝke'uKBEMצD*5fMBV,+>`J]n=\ jA\ko|BW&:zdaU?SbGmm|m#-O{Wڞ9xL,Povb(wOZ ㊵35# +*I?mTho|w҅joҙtڽF, EAۦ9Ԯ*չ{qjk+iܻ UoG"_l [SR+vcPZ*G߱W}e.?t I PZv !e4>?Lrxb.`Zjx\y }(~qL!$:h*k^Li{m F!^c$߿SŲ(F!E8pN@2d2bOݑ0ݭ7@{fM9 wXqI>ԌS*yS:g6+ޟHڥ)oٍBa^R[6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊%^K%י%AKu 3LÃyruZцo8g.t0-XВMNg#|_3jmɾY:I ɉ%5'`,xz8ˀCd2del9c+}j ǐL* Mk4baJo67pJ{apv[Ìf5`}mL )b'ԺЍ*TqHBLUʟ(qBj B,x+7bFCLG׷| )է2!`%iwQF;Sj.'(g#͚$OBG}̋h!iBq$:->yYcMyitAwLBx8ñHSl U,JmdmzE>*^ޠo$L"bQ$RRT*uȳo2Av< X/ث{p%L6]R?]H(vR޸v; rvcgfһ0N ۲ڣ(vs -GsmcX.j ۱LPx^XXN? 0%=Fv.(v-:´r{o]҃ V\ʧz^SM6UUNJZ'h5;|%esTnL5+rtFZq+N9:v•bzm4?ҿvm\PWKMl2,=V(qEGl XvL}إaqSM降+S%0+J kZjo=`ͱ {1pڅXv '`GOir;9q: t| 1OCw+y)4ؑBw;*bE(7ߧ|)lN~0Ve늵JsMU~Z};J() L*$n%iQVz|r>cLRSZN?,]c܌UI.MA* 5ǁTLS{c ªi#; R!c_r68S]*P;|UcLz| $zڃ[(;W*r7l§iUэ*<6CqCW.V'z]*/, d1%+C^»V e)Ӧ*ʻR‚Stnj o|oqV4銮v0SJwư8$x銶ۯz OMFҽYG˷єVB?Ӷ6=kMߋ*@I+5<|s{`UJ\鉺#"jbQ_Ւ4%%E8NeWV SF=pA=7 LC@=d$֘+ڻPz$ MlZ턅[^'J G+`nQ^陖:幭a LUFfk\7 z nveƣj77=|0!j]U`paO鎧Qv u8Ur}vJ2P \DSJOtcRn5˶*AS:Io57H2#}br %BQcrbvt*N?NFҶ;rkRf&%4 TbmF땝اK%EI~uڣ(Vuʋp{u,:)Su nSu{c"G?/;m(ӎ]ώ J@l:S]JwX UjȔ3ס#l*{t?FbmA>Tᛉ[T-MRdm)x\65iTHvlShy- Tm\NB6KeVJN6ڕӈ0#~-~*: #h6";$#"8;68 -YOڽrҨ֝|1CJ~6܊6Ш@3 L*I h>J?,N[h +qt>sI\RoΝQJ~حýAT,v [m(w4'/LmUoZ/^|7鑵k<{P|BS8TASM54 ۽REv/hOc+T^ 1ׯ\hY>7Wr4M\ C^+AAK ZuSC< Q75CIM)UrzIJt _کRG*aKlBUTB:^߆ ,V1x;݊][ǔ]CUy{ 5h|, f>`w4 ?ۅ.e#)&>dVȝB~Xmmuq(TY|; QnOc׮6S7oc })v`wSۦ%]JX"G(^I;ukSNJo޿/~v?1L@aVVQː|VHoLRbPckn/N?6jn+hiB6 AT؝I Uh£, ZVi\}ܬ:=q/.T;-3*0%+1hwѿ(Sþ V ׷ݎ]؅9MG0L`HQ1hȃ`Ume#eܜ.AbPZP3p)A45ZrmTiʀ0Zߍxo]s=za B: ֣ĥsl(8ڹM+tjdU`R Fj+-kۮ:W1}U3-hM1VrHG,}8Įy$ߕ6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث銻$^L@R9Yultг n@̜8)eW"aͼPʁunh!'Qu0h@=26k,>_&fSH匬ᘙb$K:mxF v,|& <LjB`r ^39ᦩo(mKD`Ǡ2VKG=i):whwZuĩ{76+dQzuD-.1eaAqQNXҙ4'>DeAxn- "s jVXlVCIxİm.#ק|% @avBZX|DZm\vl<+͔[W0% SaVL}Ɇ#-Ibk`V!܂zaRA\ qd7˱Qݰvf$5GL #}]!KAƑZ(vjx4fv b5cݷƜRajSN +"ݛqvZv>Ɇ.OĻU_H bKE,]+mLKE߹‡`S4ɢq<M9@>#-iB6=nߦ]S0+DEKU\SxKw ^]6 Vib+ 9f]\u-TtZ8J+gӏRO튩O{ZtI-'jaƴb+ri^Pn(i S E qC|xm1KEcBXPF ID,({4v,D«Lx6A_zS:1ڵ:⢣aqcVʑv#1UѶA*@w8XK_o P1:zbPo?«1c!dPWJV PzZS-n8T|]}nثƺֵœ tVǿͿ*\ 3nE]JЁ1M-*k8#aSSxe>{bcND6R!@M7=~h"Pzutrz;{aUēo|;PwkQ-jzt8קs_+Z ;ekJ*I?w|+_ ?E{y7pSߦ) eHn‡_lRj q/y{m->@cm0ʞ،njq^HǵO S(OJ=1Ua^Cqrvm N"Ñ:C5s8Uޤآ(Ҙv}HcQSVÆƞ-w c$oS~xmWĞ}6Q*GBۓ}9=pۊ |VUMQe~ݱU 'j;_:6sBҽv}|N'zPw:r犬-SP)1u&n'䧑w*G]^#⠏:Iŗ&,=[}8IGø鸩6D.HOU;һŘ0+jZyjZw al g @*N+ |mTs;@{xv(y ;W偅PZl޿Y2ӨptR (S偈ZX+Slr)BM@>/LUF_ɏM)J L jۉ!J9㡨'>?lAA&Xkq@:Nm3^JL*˱&6EeZSu8h7548v8nk#oncە&6R ߦ*Yjynm*XJ}P Q4# Bݘ{߮)XAӧ|z0Zb@ZצDk~X+`U"~A"'+>l~Y[W)q mZaVTS_]w߭0+DTPLԮ@jQ ƻī᫶)T{f| r*@4<Z…”>liN?Fmdp4«XW3~ AaWVrjiM+ևpvʡz-Rp\oPݗSPAVqnة PݺcFƧqW:8iء@!???V{lƪ:tf| Z(#Oc^z ?LUk,>UdO|Tn1J ׅMzۖU6Ԩ׮Y$ % b ۩7=v; i8@9i! jwNUzF$S$ BWyR8l &@kOmL؝++m>r{n7xj+KD?A=$wv*A>,%(hN+Np"Ѱ쫾@9KnX AjlJAΔ"o闁Vʭڧ>«=Gv5EqMz.d{9E6lv&:bLխzc䩌1,T@,íjG~Gp㍥0(MXVҧq#b]LiyU3ezoU{y)B+o|opO?lozª obqU:u+O㊪|s?Ubh41]鍫BJOX=;Sv촯j5(z`W)a^E8W \q5u48U[슦L8CjJ~>+Uƕ_ZBTӍ*+zGQPmA({+mr@olRھr'*+~ǥ01Y{5' "ȥ kJWz1FPS,L_n?N ֘R|r^ ^]1ԨEV^vĥNw^5=DJIW-v>6by⑵IMɒ̩Z[ifj_G˹ʹ ztpT|x &F̤z=و"l~*yu‚=?7m֣$ $RV«r~b'jWp#۷NJS#J b~تg ~׮l kO|P9XTW69%G@lzJA e۩imI$c Pmj1H}U n>찠UmhE:~U+G|BJ»Vhi{e2\ZYkq=pBh$PB+Uܘֆt Uh v˦ W;*ٓSxLRyfV;W VLԢ wq%VҢv欵卪(S=}wߧ 6X⨤ZՖc\%GzS/ >Hۯ0[CJ;v Wn7O}(hsӯ|xtOw>([U4v۾8 vZHG#۾_-1Uh9P il@ ;xRIP|kZxxcwpÎ,VJ6Y84(1^&QN- (@Ȫ ;{oBWtI,i\YE~IP0_E?-bqcӯCLR^J }1|RGqZSLxBq}9nlկ * *G?{V̕n#eF㯎*(~QvT䑅Tl=Zh/z~UD$ T V qЃtlWP>#vU$Z˹uOqP {f7+Z#>G8Us<0 VLx ?N֛JW81T9cRj<jʦKam]eJ o;78{m ~>%=PV$;Kq<0[0jU5}H3 |֠(> eliڔ.|CP@*ܻ L/r[#lPu=pMLOj: z xqx^E0M9P$\[<ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث[xαu3ZjqܨL2x S -lFŤ`5;H-"`N"t"HA6y%x5JY4$`iU+A~i, 2 nېFt[G$6p[|IE2]@nyP"nBJWld;ᔐ[}qhbVs҃m|s V޵CK@צ l+J'.ɓʀ H$|ZoқdОAu1IXס֙KtTtȲlbN6p.S_L(q$0% T|T,) U4&.ƺ=)w]&v"|p3vR7IbanP.*bw+n#o 2`|!ج`WR;bWMAUa~m@@6N߆*]*h{~%Z(Ӿ"y ݁\qțtiZN.PrA*luDu J jd"f.QAOTWqH?*?|hBzUިO>?R7ƑBr QN 4nҩcC\H80B=VyGr:Ͼ]0Ǘ2zmLPkxm2a({QC)ߧC}b64!AO]e @[)]ǎʚ ES(ÂTqQƧc:#|UJh;V]AtbbdH( =`dm*{|BPmYdتh@H۷bStħz:xWdPEy* v|<wRJ#kO|eRjxƆWInxQ^C]a Nkēu,d IdHCdwa4\VѐQ§W1$&۽6.jܲ)KXHobRZ*”uTW!J@_ Bِq#۶U+)_*zoqJUk|6ǚkZmAqimJrA-XPcHEHޛ ĄR&RD;w1|ipGv™\@xHVKcP{I>N2Mq_4N,MiZnzUR9*~O7`BX>Co|! 'z: *_U|+` )ۣ g 2V`Xֆ-Y^|H mC@ I.1) ,=H/#|(؎p]*ĔSc֠n4Ƣi @V鷆W~%W;qª ӯ]/ |Eogn<c  BX zcg𪮉%Z0 M:mȖJ om2 cj܁㗺 J"_ߊ! Lěd&f[Ќ2gа˜/l2Ae^GL  Cļwm:`tJr4IUN;L̊Om⮎F}sLh|U2ڇT TtNQxU}8'RF뀡z e#~niu"]A{U7`Ҕp*%4E:aÛv;ס/68mSXo_ =UWq5[oU-cLj뿆*f~;J8GхT n&~qUqJ1I؍Xut=1BH8z hWn^]N_gڹ\^89S;xC@xS~Uc{R'\UaaI;Jq %wXT 儩l)sJ+}9 GS*v4;u;rߡye<p"܏SRh+cbB<ԆW4Sp*_ 'K`wkwJۡo X^0At|mW$|8UhH#uڄ߾*U_ 唧=@i6WT@X2ϰ6ը[f%BR:UBv;lwe1UP ^~wmlP@;)z埋l)XAZ $uϑݩƸBiyP|=ثR@PEG\R3aM+Arju>.$H|[f5߯¡(@ O*jGӗJAS>5߿S24QUXz`*ӹ5"mU[_-{bmބ]vTyA7قw>jHإa"4㛦ݱV+֧~ԭrV;xoS| '#Ei@Apԯ~Jw W8>!ACJҩR^~߫P% Iŕ!o-ASZoӵ?M{i@5~;:cO^Ɇap@$Vl˯Lh@lpݩ,+⊄?xS 5945;S30˟6S=GykWڱ6䐨I{8`߼H]rAY2,UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثMyi έ37JNf8;=oȓv ;dLc $ AijU,."zN?;8j(Nԍ@YhSkF]brAa=rm\UX늻$Tކ:'u#df굽 @vv.TMh؎e KU+@1 iLkjTvml$BzdR(j0>p'8,BA? –\_L)wdK WkLF*v"8eF Bo2$RҠc$|MKG}%:"O4nco';xH8팙})"vf7iw.6Hj(B~u+Ndcq8_{Vrly.C\-r}Y01j%w/q$:>ہ $}87i$U@@-<6‡`Ws#iإ(:S`pQFHv2.Nbbn^-Ə]˥p2*uxCV2AgbȣK@=L]_mǠڇW`F]>)qŇ*ZUwbPvjW ZǪAjVHUcl;=i_8/!k_dZ}TPE1UbkӦ1z{W) +_+OO׍juMUOj1KPmX>Rƛpg27޾uQLP<+NYvhi^iZTtik?~_QOVS۶(>.ت'4 ")Y $ڸ/n<w#% OPPG|4JmA~xPmNشl%liFE5GJJ{'"TC1Xá­SjlR*Mɠt\m!JGIlb֣Ǯ>S N. ʠ% \u6ZVWS"zd3 (~ijۥvQߊA9VR(|U)[1KqHKu|0$qƧSP( okbQb'w(P$:vk?N[ݶݿV43 z~~9\)צ*ߩlw]Xś߮<.LUHvQJOp+Vm_2qRJ,n9}*XRt>ĥ1LlHSO֟<cZס5Y6tm[v]*c0!D;^[VnXIpڠ#勢 $"O7댙A K+C5ȥZrk۶ ZҤɪO#h{};W(_d1raJv"TqQmǷߎA^WSwnUc⍸8PA-wl>Z9J~8Uk(ڃ"y)RzԚT=~/lR#@>M)b<;1"鷾]pa5r"Ud)@LD'Ǧ)?MiQSˠ04$u帷*hQN3PmYNu$ԒzS P~d_  ZpRs:tp?nmUޛ 9ВB)LM%GoئM( Ԛt4ȡ^ YrMP`TGЄ mՑaB@??l +08n u]+T7ntRŇjmFXUׯA';梵={xc3O*_ݗtcZT•"5liZ| 'cɄԠ8`@ Va4 ũoFca}Ձ ص$S S5zm z3E=klsK!hjA$瘁W8jTzba{)zקG+%vӥs뀤-4x5jqJ=E1cӵ2*HBrWsLR)E<{V5+U:w=%͸MH;7ӊZcu0+T$PXh>L*j6\ /aJ ըu7nƟ}p;>و1V }Oa@+$۾]I U`GjWۏSXRqBE]?.cݙ X 9EG~a;{ V()Zu®z~g1O'0k*i‡:p;uZt#lR~.z|TJ C`>E;LUʂUIvZF=0Rh(6#G4>>LM?lR$zZ=qUU=+ׯRg$ۧ8hz+@1U0EMw;omdF₸V܊Jem 1=1"x kNXpMk׷]8uYGj5xT$`A;~wMw(v>FWb%p8M@O~$%5)CԜFbi s"e4>;d?P|(NWERVN*A#Nإ"5(XȪ.ǰqJTm &\p,GAmĉM p+|L7NJQ+-A4_r&$i\pU.bwl)7 slU@܉=?S56+ ժE9G`) Oj&S~l._A?򲊃KbRu;oG6";tN*RQP =5lT2?P?o6h |Ac:n~iw?,ci',6(qT ϏbB丣P-UKԊ{}C q5ֹDWsQ\(NQ?L(]׾ծjw.:bP.% V\N".A 6lQLBPJn'۾P 6}dZd 'pRqt0I/D׵:ul*K2qOȁI@,M3 &wnMu}1፲h7F?~9k;dP/JA@3\N0ddDs5nRJu(^Bƙ@@(3#|BkA]1a`A=r#ڿݲqMjY@>XhX?㖪)׮cQig|roXÐ{b T3LuT(>YnN6ANUZ҅E8GZUׯ6ܚmJ+}8BI8bFO7P/!E6rw1Cp{:8m0I+e|QA'=+ӨZa|(Zj*N((&Dj#f$ (k=A\AqKo!WnzA>oS*4P)ҿH҃W.{R㜍S6N؄Z=MX )Uȩc动 ޞ#mOƸUj7c{l(XԂE6UUMM|߯>Tnrvۦ(lkw#v# W¤`|B&GB'oj PH t1F喟x߶,(0KW*֕y>ȠˡsIZ}rqKJԏczኯO;=z{QStJ*Tኴdpi4@mSWh21U~=k5qU>UM(M~|WXeҿ0*@c#cOo08Rڥ)r~T /M5~:|U*N*C"n7Gl@m%+fJ$n1~N* kmXTnu4?|h6*o8-ߩ(R*$6;q ;Pup ?ƏJJ4![ CxV@GZLSnCFm?)l7v(V:k_y R<L i^ RvIyjcmf5ݻS%{Po׭k䔮uR:b0Eִ "-q"[.k|~<_i)8aUbzR>=0%GcUUߐ3B]|^>_|6Y NqN@}LƷ^m+)Zc8xk>P 66I{cHȲ]] 6tzkz9E;l<0)3ЊzJqmzF:aO7Jָ3(zRb jEi|\\zBqH•jсJH{W~*tL[İzc{o RJP]KDAۭ{AM4U9H"it VT֜9MvP|GpkԟpkP:*e7`YWzX`1cNBW4,&j9fVh@4&D$q+rb;ZP,Oר'_jJ&f;TWS#VpDJN'qҟ,Rw+^qUjPq&Zx^9A)3)j[/{cP|PI5ݫAOnaZLiL(KyPZ}?qNGN%U<+?ӯ^iB#ۧ_)tz2A_y.Ҡ֠T_ W:6*Շ%4N߆4E-(?={BMw+\Uq:?߳M%Z}؝|3&⧮!T$(z+_;n%C&I`>YTW*.Z%M֝\p._aSOx P#c *&]]2[b$/9!nj Tv. k~*p?_|s?L䂯R`zQC78A`Az>q 5M^=7ޝi 9|S?b;ЩɪO\ibBXL`bJQ)Ӡ=0I&ԑE?Nf;Q׶0Vn5{uDkTmJ8p4 BiAԮ%HX=|#v4"5?0Ņ~]x(Z\aKaSC]W-Gi[APz oȪҠN|ASƷ*8ݱU5뙓p*咠DžK{7Q14^~G.Z:aHaW* Dt튶Z0*u~tOv vnx\{ BZ[}l{қ+]1Ug`i*S~qv?FY R=0z?3oHiP@؊c(F6Rԯ߮<)8IUI wL^~I@|;oM9O~lTmƝba7 mwBlA4CT!M@!N\TݕzPc]jizbtb(p\= 1MU6$iJD+2)P6żqd_BAҟu7ǓPuTxQA_Վ @zTdjH;xBb:0Zm:ܦ+ӿ/\%MP|_O +!TНw= q p16,> cbzOZrp*ǰOCإ+9?x9;T'M|jlk|UiVhRڝ65B`J)OckCJUexM#-w6܏3:uqJ~"EyfTң}WL%-Ȥ#bw j~_^bmn|HIeP+C @mrv?4r;ݱU z9t~Ew_gZW*9&zf;uUc ;S~+>+*etq5nR @ă63u«ɠ}f/P@z:D]ʃ.>8C|!Q1^[Wm(U܊HzlwN(hRj#1^8}<$T'1TbYjFO~+Q튩Qw޽^U+Vu퍠|JWԩ䣧J婧Q\(QqQJ*MF~,UT%Ē c?lQzbΪI54=,n2JRR=) P+UH,cB)SM ) Lkpa Oz}0*U ~n;xabf5Z)Tnjg2(6L˱T>k=8ާ(&^\}r(G>`Hc=Xu8Sȇp)VnJP)V_"Pp:c2(G(6q+ġS:xl3w–(:Ӿ(joJ]7ǾL6KA”~zMߊZǨL(C; J튃4VJZwÎ!.J6sCϦ'}U2Q6qh PcZ5?E&Uv;W*n d퍑iBp#k*mTR*(vjq)v,{mO Uk {7MWUJSW,u[!ڄ {W*\sߏaBJʝ^ Dn@$\5; |qB {[kǯqTC=_lm=JCW+JwJ0~YoW]r߁4ޢOn؛,GBP&jfU~CWZ/}EP^z'늩}AP̊/l)Sz''jҟqZl1U>*hc^ֽpd)1MSU>u&o)[rە)E{bM*1R#-VjAz sɰ=AS!`YI5-T*jVNPnzbp%lJqۏ*]Fs()eWpb9ܿώ8uªocEw®DuCoXRv j| RB)Sm`9aք?1J֑Ae?daV=(0% 7ňcާ AHMh+zoJMzmjREP'qRvƚ^0!$!} rBjG|(֯>;+fivl|F*\H#K;5Fܭif~? pGAi&o، ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثKyZYSfRMD.EkVK7/ 8w_2-:ƣŌM4hM;va1?ϧoZb2<&NroԐmuL=cþ?郫&CGqLh v7]6*ث銻'O:蹝Oա 3a^kmp‡&z Ml2ˤL͖9`p FAqXA:g<:W֍JC˦Q!K%vza@:c`cbaÊ\G"zքwJ:(j6*^rS]ADbx$nw@bJrH!pIQO|A:)%O+kj@| ,M|];{1۵^إaǨ87l!Ɯik`{9 އ FڞCA/<1! @0Ǿ9bd;›^$t9Q b1;&ܩvF2z+( QWȜFr-q5%bi SnP]a1b=<0N$ᅉ Y{~&ġ܁ $n \,FaSv0]rA]UOS]˦ Zv=V ت-I.Wɰ.# -DqHv>?aUZuI!c0jHߥ~[`JeXB k9${GSBغn qֻb7 {E;hTOF۶(aȭ)WǩQ8 ,Ҷ8=r th6*(Wԣl@$Fµ¨}u $6kJjtv}YBs)3] K!3&}UdWZm*M;mQ,r.:DnXN< ;)؟Bko˨&YO]*PS닩'Aթs^ PֽxPAQJo())Xf)z ?mڸUMru`lYl E{U5j1Ҵ߿Ŕa#L*nLr"*Uڻ+ fצqS@:a߉$Zs僾{⭰<Ơ4z twF*^ I-6ث oԃj1V wԑO)^8ojh0{VPqU4jmQ Tw;l cbr9AZw͐(rB)֘RBFzC;oc)u qJ9D튶`ynA߿ǁASv ;㷠8&'):t-¼}}8SL^ώshi$^V8vL*6ߩE;t)Hw#o9 Wbp%FeVz !Y=)qU]6'/Nu<0ε|*4@ P T2mZ}&U'o q V텐(y-J۟jolm6 0;,:HUƄo˶S5? uqUuN$P Q w=c#j}ڣ&v*MG:dPrEzNS-! MnnU|2*7=3R#q>0'ۄGʵԟ钵VYU ӮAWz:1!QVPy)\Ui<7ʥ:~Uܹ}4J)[V.>"v1EGLU s \*Jv-O݁PsAnAJҟ8޿kB8KSLS\*TS|wVer) 6A^c\U JxlM?< ;ҚDwzvĔaN _kn0Rs*aItKS>߷**Hc$PzıEْ ojJuȪjۏ*ԚW:aj8\UMZQޛ{ )h4ٺb S_8UkB+SJU+5:I}cIWͨS0銶!~m\w"vT( ̬*E$SOaW\QQƔO+劫#(ƤLeӊX=#p6!\j 6>Csz⫆GA;;iu=O_YLl7[1ʻRl*x 7R~i$`J*Ujׯ\´Ă6=}*iv;|ʣzu K1G@w8)AK i=i@(0 oz(VT$akL)i>y\TR73M+UAY →E E'o50*hn{kAi 4&o9] pj\H[@~JR"UW /BٗB?Svl;坃Mah#v%x<\Rťd"Rv,Zc`-?1?4Dl40!W5.,H!}ؼ>vrw͋;$]+uWg铳{ꭱrqy=GfFXA3_UCTŢNz0Ɯq5Z ;>ln)6;' v6}(2v ָ8@?Ԧ1X.zLn)KFC dеqr)nID#zW(">*d ŬlBIF E#ѹaAM)Y TaBLױr^TLLm!Iz/\7Ίl0!ᖻbl9 Cx>YrHks KgZ|Pn;KWĺ惍6Kh-|k1%؅֋Lf=p)v0&2Hv1D;bXU pE{}72HSvAN^Uk]+=]])d@+Zc{Œy(xֵ=icT<6a, YҾ~}2M%@=/**fmCASu#jV{ PTZ*H+A\m j큥ZLXeQJm\d&VF.z)Ͼ* ,*u>ڻbh oՈw8Dliz⊃vvrOjWrsΦUfm†+u|UFeNJ^> [Rۨˡc*a{ʔwPUCU;aolCOp7y< x)al(,oo4P>ࠊ9~G«OJ[/o6S|NفH;^F]hjNZW=*ē޽xUJfW#SKiܝ0\J<ǯ{dJ!+ĉ1B5N4Ӎ]UׁL|MNC6ϾӰe'`X~*ֿnEvSkI (çC*FF*U n>1aSNƝEE<(CK4Qxn:P,i)wWnx}aL% .MWmV-:w\{* i&»xUi4~*kƃ)] WiU>;nǮI(;!w7\UT mo(G-zG?1XV}T ޝAhi^O L5{#㔕d]T/@ 7\ Sf?.>ֹ41JQArzcL(S/Z#P;U<ǜ)AG$lNOCNkJ1;B>;GzS:bIojOqaT4dۧ~3w[Sҧ~Tad% fB667ڛfBT&jIckT==إD0|@O~v;&RyBw5?lz*oLvM ImC][LJuCa&w/IlFUfUĉGW-1V~$OlP`U1-S c- 6zt+kʃ1۱늶 .aRjz­lJ}WvrW pݿ`O\ZZtTEփR{oChOݷP)튬hnc)Tfb7iN{h@ U Z-_q4v….zT:{UJQ}k)߄lwqMGA*ZQWP>U,{ZR1T^XNFEdm PU WL థ֙l݉R5QƷnUzM>?Ą)[#@Psx׳lj?8IPW½F)WE kj}8]mP0#FƛV A @PR;l(>CcQ_mV.m"N~cN;aUD<@=Os-M~JT1؆8o]J~6\p;W nV*SݽƆ| ^? ˦k LP4*YN)6kaP: tF M= ۷lmG Q ^߭s95Px|~{m74'å1lkA\UcxxPZ▪@mkAaU S'lu*xqI?]E(:bji5>R{CZtRG!@OLzh0*87=qBXT(?AP+҇&GpwQB+U>W,b֧-hzڣRs'\p+6<2Sb s#W+\SmߖH ?12kC5;|sn)ZPM: {V劯jӉ1U] VGۮ>L 1e#MFָ-}Cur_w}pz`zu&V:T6WPw0w=h:uV`5TʆR'`$iy[utt91hp;J|־oFE֟K]CM}Pp?\3_iAXd.8qpIߖFQ{SPVY[l8qu'gF"OT [T#0,S `״vO/GӘ&L8#'o?Z8@??TZU^6y`J-o˜%5 : %Iacj&æibyRxz5{{LSrj1×J_+CqpfBaM1EASwԮZt4cp;N- $PZ 펌CH*Xf?"ӧ߉ NB@ڧ*n.SB. Wc@åp%$;umBfAN5?vU %)E$W},µ `J~TftP6p +iR)kCTJ*;|D{SJ~UQyqO "Tt{bħ6Tu)p8iZo㯎WvBG~]t*p*pv `«Jr4: ݊r' NQ<:SPS1햧}*vzt\pPA FRU-܎fheq߾! Cˀ$x~U{&1"|튴*=߶EUb"$b-E${ߚ5;+ت ,v;åGNUϹUqx\!RHEhN*2Jî޽p=L!E00Z{ i5Wm£\*2^߆Yu IJ\*)Z\*ej0E(>]3{1*]П`UPP9`W£f;PSe@:GV$Sm8N X=Vz8UsZ W<+Pe#­7-ʚbv~#-NEq|RPOn\*6 $G^<|CQLm^5lT"N$QzU# Putت`+Bk5Jǻv&$ȕGZ|T:W(Lm75E>Rjһ8Z|%b rOoS)* xm8mF"jP{)|UP6mҾ*~XU ,W^:@qdHM*qU w"84߮*ScQ1 \4N 4(Tu¨>mLJom14j5RH޿eMq\Xq6P`T@j1m.#| bPt5۶7^T;n"O߷ZNdAAS;w+xTd)$v]ZkZUXjN# !V%I$0þjV#RuG {ƒԖ|sMܑqjW+j>'4* 7;O J÷AR Hզ*H52> +r`OYuSs<>ٔ"nO ì[{*xOp{7J=|7؟ FvEW"Ui޽j1cQԌP q۟ T?֋i\bPAxcIf >#>9TJk (Xd؂@,P *!+ ;־G\)AMrR|iw¨r7&ƿb*=i[s":Ƹ傔W*Ҿ=wik"<|5]9JhjSŰN,qr.44\?4 8X7f$ ff'pF>ZuT q/UTPWnzC\'t+úҵwqQ POzUYE e߰ $#` q\Wl)JbMM~ LU~*M|}@ @ pV0;Ss ߭0*qU4]G|*R@}=򈯶l$mPzjS*b?4Vk S MRƵЕރ1ӶmM'=-U=v61Jn9xRv­Q&4izӐ^\QC] :XP~(ẒZy(j:8mPKh|z9uVʫާ%i=z68&ok#^xʔ )+\qK Pw?:V &J_ރ.lUkTZ\UKnV| !M*6O| [Zsm נ-P}N|R$Anׁ\W٩*<;|7r^R* rRԪT5kˮJ )뜮a)Zv4iS1 R$5'))Bzkq (=ɨ0dcMlk;#&9`TzEH> {` RP̬<ܼ@(#sli"Mb|@;=.e%R@Ag8\ǢUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbAIǮuǛ_΋G+ z C~SvپHH Rrc2[ax3'd[V׮W.aaLjCQvV*ثb͊6*ثi]ImIlqlQٰ˸UΥ! Bh?~ E\)In%\n P(8p J=;4qªls z`*Cƕ4M$˸9#+O e5Jt֝vϷw cl~^W>P-@߮*;t޹k֛W$uNj Hm? [lU|`ZqCĦ3_*/O)S,]z'zد w” T ;P:•O8д5=%!~=:ӏ"ت OJҧ5bb@և}EݙJ펥7…aCU@w|Dk+CߊUU;Wl tчvǒF-Nqkie~2EvȐZ5mFZwƕUJh7HA ;bۑjxuFIR]Ԏ!6Dk)J 7۷E)N)&%W0%R(=HCUfc RpN!:0% dA^>ؔ!c<)MjqV";HǞ%P@U|LhSn=6 "UB8d ;Rڙ\cjل=q2*Ճ nv;†*RMklkm_*{{x”4'!^<:b_20o22JaX{eysvT#mZry6t:qHT(5spXWl[`i;E H%H=]?q@:T!H; I$#1 HVBz(<(n! mS2\O\T)ߥ-(;%YZHRm@EId v$+ "RMi|yjB^3VPc]d COl'0C]6ķKD0V$LE17I1@HD(8lwƴdnDS@ݲh>@TmN'kBXߣv_/ (Sx / TZa 1ʴF $ o^@†As^co' -M9B=1JZ`U07߶e`:x yH?FW3JTmCP\yoYxb2ٿCAO_`(f#ö)p7,:bmNF_JӐ>a hF|))JwCDN|)sk兯;ⅥŸO5Hb1Wjߡe]+J RG|VZS`>1wJ1kǾjl;`UI? LͿl*| n=#ߦj5EZKB)ҸUs& eҧlUmx (Wv2U>7C^Z?_7T3+HҠޙ}N(S-)meN!A-rbEzS厠8IљGiһxB jUVbקbO]d4]OCqzwUSc8S#l*ʿc1UIcOolw )vޤ㺞ت z4ܔӭpZKSziM@{vUk=1M5N'?J}\U 1xR9RƛқbzwO^ت۩?kBlis өiB~/U4 Пư1Uhڤc Ur+ׯ_⭓v鷸qªM(U=Ev_5)0+Dbj隿MqV (HSL35NlP;{l{žkܖZָ- 8VSҝ2ރsbUY + cߧ@|7ǾrH@BӰZ憼Sw߯ߛsV'$Z׭hOwr\Uj7_qҽ1>PJHnJ;f늮_I¨"E* ,ƀ m I=>lG CUk[זU+ەkďjS»Ji*{Oگ|IT҂Go%)2u ] <h'/SHje zW+*p+^㎇sMTu⡁!S윜k2ԡ v>]. PF)52VMN'Ҧ;VPoXsö*ЩzλҸPQ*xV5f0#DWjzqȥxr=z}(+u~XXt;O9m1 ME?##x`dS_19n:*x|&'_@PwnPPS <-Z/mSNǧ*,EGW=)ZSqҔ`qm9B^Hʻ1_0P'p8ڷ̭rqcV8;Sc |j<+:?߽1iUSOmM`WPPv.…Tce>Ub~c_2ԩ3^`Vq#1USos1@j{⪋z:P*:~8TBءo #zf5bsCֿvT7uiLr2aK|uۧˮ;~Hrk_f&Zրmm ^9MZWK !].CL J>YO>G[BSqv}sc߁/l c?oo*N'rO>Ux5=>lۧ^ʠS(zRjp)|*Ψ>U|uۡ2ڃ Uj~9k`U0e7\qP0[cAJeE<4'?^X|Uv#ރabEMzEzJ4PR~Y8 tҘ TԓCa_` J.mOъV-2 8ԓe]l,r_ԡqJMW7z+T@5ڧOfSqRGmSʗ l?g%g*nFըeIT4n۽i قf4+d ,o(6m.zlzadf-ZWB?e!i ZKA|s OJ+Po,sr!(@?d:_9UGn05`iJ_$7٘ ,8ALBHFޙEh92 J6M>xx~ҀfA/XzWowo;<"b<\E;)͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*rSQs+_/?kᓽ*97ku'_=SjC\7y|ib5 \8h~_|f6(nG&Տu=|pH5H;fLRf~q+d^Cn{kq˧ɸ 20Sp4sk(+:y⎼2+ECv}SJV#NJ0`BC7|-F*no_+G~P%ub2G\]H+b2tolHG*[y(^k`7@ )-FЌ q[u|!mH8K0NV xV'ɋydvv)Jd;: d#01nSNƎ˨8pbļ+L$a朂 -Gl6l,/J7 E??vVY GuIӁ(j)}pgbѭ@>)C}ǥ;lMp%dWlR>- sLUJI+wǡ=|T+:⑯|JQ@6M*6$SqR)oF{w;`)WjdU[ x1u+o劶d<6Ǿ>pz Se|VLUk?p zV\3P|?pMpXE@*hzoA7eQU&%I5!95{a ZSr)ªr:£8T&rH5"] 6=rPT/NG>%AVjEqU/PEv;x`Yȱ,IzJ0 ִqT2ߧʙӭz%ƃvRS6jX"7h (F8$ݫZӎZU"(w„)p@WC| s'()\*vǶ=NB~MA;Jf>8t>b9 tƑ}*ڒ~qA({ӊJiPjO9|~UVkPF5f7ՏE /nbsn*p1(4MqL*GzaaK5:Y7`2ۮ*ҝjW=+ƻ\ VZZ4̻TOsԐ|=žl*Tt߭qU̇jl{߯( |GFW >>ƒˈ=@ڔ 1*+ʕ ~|Uq@NABTӈIaT- < R{Z~{uSCÅ@>X21QRKɸP_~gl$!lLPH? `P6:2ARAɚuiEPkS_9]E~䕨+FڧqQ*ܬ :ҞlQR?ԚvB+3q=iN2 jF qM^ ? m1'تPz5w;?UHU@ S>j@Tn<:UVwclkTeqp,2qUjƕl8`kSo|UQڛ9 |?:Ilz^;T?ϮXVvcJ3WBǧӉq Qپ|==8К 3* owm{N* = Sl qQ4mNhTנ?OLW)r#e;==K{}ri|0*=:x kīO ;6XӑU~.]Go&P?^e8dAc5|~UZ jW Aph* x2IBHIMF1O+lǑ$}vV>Tr޵ 5Xo@@`id|!۰e^_ˊo!V](Fju=0?Űryf!aRvj|Elhr֭(` -Gn.)R8hڽUB9ӡ9L(Vؓ]XoՊ$t$W~E|zxM ׶mQu??Bj qGJ(XJL+b=: )LNV]*N9R0L:8JI>:|P RSz- !b F9uzP5it\ZePRb )$tZMF8 l6«{_rIȡPw(7s;& ؍Ͼ\ҘU܃߽1m&8^)uaB4m=k^ܚ>bZܨEj)Jҕư QZnz׵3 +{W1LUQ]$\(SqC_ՙT}$|+VP iJ\p|0NӮ*e~ϿW.͊]ljw5)1U^\JP_PS=rjzt`~/TS|RXM:vr Uj]S*@w>4XU!B(wkRJj (UQ٘R,G nͳ|0q#~8tqSp]GqsaV'iB64l רV 31Sf^F*=WM64F8*X kCj\ ӠcӸ\*1ҕŗTTJSfbʔ4E*w.%>5#qR5RN49z=ه*޴<\)mW_<Qfڝ|wٖb/u>9jlR@(F0?( z]IPk ;fFե+^)Z• G5<_ZuT؆ V)VSaJ>~۟lSJQ֝{8 Zv@RTP@w ]V;5v2Œ4S5?$(`<;U_nV5XަBڼ-e?i>z-3_#5 u=E<*3w?72}G3^1,b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*V[Wwa"B?ʟλǦZ2% cҴ?3je' ј/;I<PXk5w/2Ap*ѺeY SGZneox$8PDV߾,- <4e 5Jy%jr2`*]<[?N/Clr̮* @(QL! qdm$!^@'Z A=RmF֧),HDs C+lĊakh\QȠ7#j-;dYBv9611z`K/o'/AZF2(>X\1 p"u#ɔEؔpbnQ!e4) ӱ]J`Wf] .Ǫ$;hyRIq =]H` rdX7֘]x~SMPR`Ov8R&T<~x6Ŗ M+Zŕ!mQJ֦Tb9ejPX_qC@]zSJQl$LI4')z C\MR}}uP0Wp' ƄoJc?0\ #L 7(O-QJd@xdkGlɳP|(jCUpQ_)Sg`>u1r6fo9X8ieZUW5T ??2ni.Հkcnzu ECZֆ})Rmaֹt=1U>T;|?WU`ss &qU8ĕ$nkNXA"Uwt}* Z~@<T9R?λe;P`IWrj{;5q((`p0Ony iE1'}jbPm ”cڞxb7Ob u=qm*|b/-N{#N Pr«~ƿM>WUTA f}8TqZz9@}qTnqJBJ85=DBL6dj58"EF(g&0Hҿ,UE)ݎ|NwW T4qsuzbN9yao n61(m[ng Rv3`+QO4awJ'T5rڊ7턪ȥӥ mno mJrjk? (r*,b$De۾v]ъHe:Ƭ(EIe0Fi,Ī߫_GiS%0Kr)S^Jڝre*Ck \7G>2 ZAmܿ  ;y f?1'l<6 rʻ  $VMQEX$ U ;  /-5d7zxW8?%qbX{؄iҽ)Z2lkSqq2G&l]^W܎?'!"]W*5Xn]GO1DZl!f4ZՠG_㕐JJb+\P ԁQ߾嗒$Iw+(\EJ /A˩Pަu^ʤu}+ /]W.;2szw8 B_w $cdeN%~.]@<9eRQX/fK׈|تPH4v, !#RT4m0k,O"5+bw*ԱsA(iy?/5L(QWcS* rҹVY7 wߏ$ tN |<0^튻ӎPhjpZeS*)sr0wQmƂ\'vZb?eu4}p)Rmݪ}jA`UONZkQUh;P~Щ?~*x5iMO\*ӃJLq܊R~=6 @AV&_(|W!(MNXtL~% 2p+:S1' ze_[#@cNl:wQ]1 MA HJM>ӁRzt8}PӉiM*ұ4?wݕ8H'q_NݳZWҝ{)B܊fӊAPx[ bۭ;mLUbA<M^0$*#AO_"kDM# lH~^9^pK6}s]r⿳N޹| !JDoю޵ߊ4WFsW*A`*?s6ik! wޟOs V NV8aU׹"cHN4PîPSb\F 6}~ZܔhRQ8s9FnO_ cyToǨ\T R@$M1{aU'aW«Cs9u5qVXZNzJNEY-:SOSqV|n'yfmV4&]~NFCviNZI떽w!|iǦqU I æwMzUQx؟o)^MqTUJn6 ޹;Jjn~c,ThnjszVm F)B ;FW*@1KR~,ۂ1V(k^Uy+ w閂L g$qS_߮,w©uԀ>S6VkBoYOZbqbz&ǹ¨pkk 6 n|M$ #b^i´ڣܪ څQqS銬n;^D ۠oiZGLUk;mJ{eCUk9av1܍v{U0Tש=+GcT_j|Bi߾6H:wv튵MC똍[VmQmBԏ(U*]ɭ\;S یUmIMqtWrH,ro*Ҕ>ݲ߶*1Q5<:[/VMGO~_[7cS>Ez \P=jH=`Fwъ) +Y\O. zm=;|Bj*|G|H+=Q˅Iaݳv>;V@jXtP*v UIU5˱i? ÿ_횿v,^T4*)*X;fBNRʪJmC/\mߡePU@nM:/늴f,¢޽`CRrwIUNi; *ާjP])mpiN٘ï\U4F#aO 쾟*⅄$wkOEG-At]wYTfۦqݏ~ٕaV+F#sAl6\T%0l XG/zϰ.(Y(;j;cSojUjCاC_aYm[qjzliM)h ZaqL H $Zt;mp+phaMzm0n[SӕSiZ>Nn╮Rwwk5()Wrr5 YcmU'aIܐE}TI5NٍLR琲ӊGzm{vUA//R(\< ѣo S|: IP`(nzf CA.hh||]6C ;vL,HN +@6:(0ISրѩۿLWaȲQ۞[w*( 7oYdWz@hҢeP҃H3Idn*z"-2R-Jֻ8ZH2 &Bzr-h)rrmۗ~辧g?5Kqm+ZcqwXvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊.FCIn~#r.#RNC&&Cٸoc}vn?ifG1ryyf2!:\9G*2iH"<$o15"E(0uO\4 .3}"}Y\Mce$s %pƘɸRaMVUZ ")l2DCtţ<nlX7=GB *4{&;$xM2G\ G"Mznr13_lhGM8bth. S)lF$ h;$zצ1D& +u$'`t4b”Ɇb``fo6eXS  )L*=ZAf$V[1nc:|z`=1JOg"t$S=Si~x`JWb(0NqhW~T&w87 RZw/A^FkmՁ!3?OboS&#Ux*TŃЊƘ@JM@pVFnz{`wx9+PkޟO\C?4=:u k\?F5S@އlj:4XPH'aڨP ju;aHCJ_ݱe+P2PvP0_*CQo^Jހ ׶3mUnT5O\!Tf4$C3 Ҍx{UUB:PvƏ  PmǷemcVS &@Or+?MG*%zW|amtLNV`(Fp5l"$J{ P:`VK ֕(ڇ$Z×Tn=:= K\y-~]<2{esTo׊҄,WRMJm1VGOֽ>tUR*! qS@:U" UhƭvQ Z1 u鏄AeQZኝv„4/B@Vnx~ҡ T/6´Uz5*M{a"`I?򲝘>)J#U?ێ ~B: ;dF[YW~<[vW(?fNASz>UH!]mj3@2.fڢ!?,pJ 5H@@Ob֛cRSByQS]g1HV8_XɀRom;.1OuC^#qZ265Ozv4L Z۶lUM-ȂymhU>/X%)Em,T*]=7-LpgMj{_lqʦlzߔ#-kQ"lS[hkJYY9ZCoVIICSQ^Q0;רٍ9I**6^Uv?Fly!kzSڴ#Ju ZTڔS6! 3Rvl=AjTo_ )@MvjY2J6bTm7"Qt2 6?=|>]Q*|CmÊ 0MF5r$ !6X'/ PҹEJP7•^GkAQ޻ UЬlG=N'9Q-e E^ڃq"2YM j;4 S*۶*k)-w6X2HƧs "˯0W"Zo˯S|U^" ݾ$c4ŒHZ0 ӾXq*S+ֆ,PMqDz'Ǧ,s_7 T#`q;w۾ZEE)HJ|J𦴩;t?-Am% ])nۥ>V ='Ǿ*ԜAWl5E}{q,g܏[vZ7;׿Qm閍AъkөڿN8E{SHXIRes)i?ιL+[Wݾ[}ࠑ$,f*}|1U0:Wb#}DZRھ'V8`U-vzfR:PZ|Po`B(WI<1BA;קr{uP\9}7 mySm]lGrM`z=X튬b*@ڍu9K^ةm_j<, jj>+$PzLU0|t۾l ƿOJf?F*BЀF_e:«4546bzJbp%TOPO/.jg|U`_iU+kxM\P Zv|B UircQtƖ5lRQhFۏ'm WإLgsnkTPJ~o*ojv m7٘[/҃n˩Tv^U0dIGus6^ Nk*k+P@POLsmj:t+~u {4E)^)S<P䝏SƧ| n=\sR ]ˈހ|w}LĀz⫒:Pw?R6*)Dmؚ_nf UрUjzWv*޻TR9l1J~ \UM@*MX8kr 4߭7UhIf`Kl?\,-SnJ5W.0L y;(+%#gbڬ~)W?FMmXtۧqOO QS=@EwGe5qUX+KB]EEޟGl^ :(*qZvsր_טrJoR)׽1a@SC'ao)[Ă uRӦ6sA5`:,{w V +oZc\JU7A@GJP?Ϧ sB~~:}p* 6;~x4*Kv)@U,~u넪g t*~-X9*-MA~Jb^iJvƑ`U@v=lqj zbTP$ 9cbiЀs U44$՗ژa*M{|Umz2تPI|ڸUm:Mw[.L \@q/e R kV Շ~V jNO9w߿(Ss@EH_1Z R5b6?t+nBҿ֦kƊ^c*Txf mNv銭=O^@ W%w# mNإǟ:+mتzWpz7V?P n?1APk*䝈e}\v*\tcC+aTf'ƃ~lUM~>+R$䱩G7SAK\9+/5wBV#r$AqU9U] 8nc;U@PN0SdSuڴluh1J*LoF4WOR Pߩ`J; Om*$ܟc{brXZ36r]=O42<ncՖŐ 8ڵA27rmiKM*un|z~cBܩ4WSh97j̬UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊Tm%^[մ"rz Izbsv<8OTd?׼kӁ|cɞ-) ;tiF䧺]: Y a+JSl.,Jno INS]!27&? I%i{`it׶@jrcq'NI8 ,Aj @z$[@jjitk'0%Pþ}+UA+7YBMHqk+NBL18sLRGFAJxkk Ы+mj6ELjȖAؼCjuɆv ydqޞ+@vXn:mN)va]UцCxc^. alBWí?cڤ7W% UXUh7;`RQLYTm)=pWv'*֧߽qUb'˧~Tۏ~)kסBI8Ud*X9x$U?16HEK* 6qKp)>Nqf'zRUTl7$uPLP!;_OZbJDi6Ӧ(,q۷IPH;Z-+ZcV^*3QR4/W.M6w9MU27_iM6늩z_,`6Jh ُSr-?cJcZߍrj{Wn!RTekN371OMV{Wr%Jcb RT ,$bB_ҴSG|@UOɈ~pJCM :-ri[4;W;LKT" cLQ6|3cU 6{P[%i@&z[J JN|#iQ. v(rx)Gӗ(ryf?#1KpxO_m}k,LAZ.zH $GO-(u $ZZ7}3Sn#<>|p-sH\kdUV0Xֻm&EQ(e|*ٌbQS VTjeSU=O6=j(:oݘ?Fա)iwPW(L*1Ҁ-R`(R,7QLZ* @lUUS@8喭?h(Zۧ/ikR=r HAԯhWN;%ŋ|'n|}{P'n qcJuVRC:혽v\ ZO15plH<{mkbr-( *kԟ|w>*~@}^N $ 02PiEڣ;~#Vwztf$־=qWmJlk‡PS`:ڟ~Ԃ;m~*6b)Q_뚻Wb I:A(Xއ(W*x3uއ]lA|}V3mTwźFaƷ!ԓ?`U64#biҽX8Pk֣l cR'#ŀxBjNXJ(}>'1 >*Y4jʥ\U|k_2qVߑjq;2}8~a*m V4ztjw?N8МUM€`1J$;=eJNlhJ JAu&0(I߯`Mi-IǏ:t܏PUhOo]+%~mƳL.*܀ w??"n5ڼ?g2JN4  ڿM|C«4da_g-zbS+ƵێZj+P_PZw–`ik(^tjAP\O0[ۯ9V#jT }t؄FJX%S75X9TP|UnB?yP u^8STT;84Q>A$$#A*)#-z˓!?ㅗ##"=@bmS jx?y* v,GpE |a۷\R4$ st~T"jЂ%5{+MwA/ KJW1$®*(8;fqVkMsW*nwƚZUQz]yj{+$M7GOo J.Fztⱌ ({|c\(Pf=ߧӍa;aJ,ZԏX޵©Om|^E ֤Pl431B$()O댔@1HV\:A\ |^UaP6ڽN~GA̦:E k1U7 ˧}ҴiT( C>R-A:xm`BMo־9F(s+b GÑ/sӰvl@'_X`qB~BSj1\) ]@`UcJAtݎ#R;u8.N(Ryx%:KHǑPm*w1C|y~SVTȀA~o~zi׮7qz PJؑbbzs3 (%?|aoYo+Q?dNWK5PA@>z6q?'}=sUíBO*H ZTf_| _JT֝3ц]5C9fwPI" -OvL*ө0`(n2ЁQn)w14ZwVe=ٛ|q[P\wz9GCWpZqBҕʭ6Z Z1W(8ɽ@x5 B`"7MR[b14ڿƿM=銬Xr)_]"no}ۿnH1ܠ;}~xx 7Ī* ZcT4u `bw޵ώn PN A @v;P}/lŸ튴$O_]UWlkQ U(µ#86*Ƭ7 •Gm))Pg</lRץ}:SX ,I=zֵ떪:dmT1cJFn5=6h~fԮ)RܸڂlyRfu?.kSq_n'|z%HԀ~pJȭ:7,e!km6lҤf! dP)Lڛ%L!Sb.z}h h7;x ة8ܬAhACCZ9!旯O/Hmuf9=+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊.R@vN8پ@\A 80ns\χf-g,GU'DrAgZ$3oy;4dKUYӇsi#AD'j%Z_ޕfCEȎ!AǖDSԼרȤ+W|j,F tR=`O :~NU()N<N&k5-G",;6Jib!QKG(5'h1sA5|w?g P3|4~#}l*@#B+Mo1A 7 ֔ ~'Vƿ2TRR9:o(PڽU{Y &mOҤjn#jcU&>Z{*d3QA§%5aQUTZƧ,*(t޴ *-AHC:uY+7(I7ZRN`CREPS{{eh[rM{@c+bS&*7 |1P˹qѱ#}**? 5=iʟl* bzGI(iM7=L R"T֢߷ӎa*xV4;*5jP(ڵS^SŸ|qߊU0ø]@C^сr.5:YfPaj^k`T|-? W3 =s B\WsLԦb(!eqZ!u>v"MN!o+PKt8B݅!PiEFo_ +HKˀw$tJLRR=}2,KݷK :{ oBw'#Ѩq yf❊ąf7틎 3RO_.VP z*ƣjomL4ԅ\iZs28Bj9 o3TॵԮԡ=}yt[\XMwQrDiZ.|-S9KָV>RcJYZ+MkޙcU9 /@v;'}: :~|zBĜGҝ9y$SBivQMVj)lUwzW&.^UFbxzH1L*J c|(&5&74F@;.x-|1WKPKCN/ x~G6RbTÓ+CT>:J6* \Pk0B@n>89|M%.X}O\Rmnonz8sg *z Mb7}+FtY N榤搫"Rj>uȡ*l=J%*)^ ;4R z{I#qS[Pcߩ]b}S18K|7~z V:r=:CVG_}nwªl+x`W1tol 6j+ȡn٫@> Vߏː m_!`ǾY!~X*Ƭ(?^R1=Fl㿆X}eAs$ʸZT >?QJSJTWjƃ0UBkS<թ) ' DGïlH= uBqB%E+֟05;{KmB}y\W(,۾jGeo$,銹[6:8t҄L:bCȠq1NU#ЗӾ湖╭Co}~YW+õA8isoBz~٫J[aZ+_&c u?ˮh_zx5W)"sk'a=GӔ;aU$ +\M#@FPkU •'E@Nc%In>x|>*~*Cr«Z}EF￷a­l~GG Wkt*L͹ۉ4ˡ&N(u,Hޣ\H߶\n#O?7?V0?WSQWSOf?dwQ# ;r؟l߱] "=}u­@ ң߶Z!?c*TzoJuƑ֛⫒M®t*7' O&ۨ9  __NIE>Q"._#8*h̢V~N|JQ(ͷB)<ہV=jiA5An@8 oM* +?4*T ֛T Rv—(wJFt8)1JA؝ߊ1BXwZR{}rӾ*PiǏaBAuc wiJW5ߦT|q+ s]  Z 9"ו6S7UWޝVajH"?/\ZT \#ҼA5|UL*EOW79k1B7f Zcµ5뙔S}cö*uuʯU|x[f4Nwʠ|UF:|> Pm*imS*gpI 8A$t>8ߵ)hQāQ_ ծ3%:n1£rqU5*I{owo(8\; l_Zվ$A; |UPMS)t۶)j?p|>X==_|kUM?{@>TbGtӵrz4(iG\uiL Ԓ+N:.h*N[֘UT7;e֝>UYvw  dރ|khT)=~hª|[jN4y|7w9WZ]JQUYOs+AP_QB1VR7 bŹnF?x]BbeWV0PvqU5Pρv)C3TTآ)=p s7 A$:}=<IMJҟUH=Eޔ8p˶u52\j;Ҫ1AGZ;CJ;Sr,S4R8rJpK7"qUD.Mhj{LNتVG ZV$R=_}l%C#Ղ(TAZoFqPKCo(oӱ>;w(VWn^r8>*mㄨR-;p۪NF湙u 6BPEtrM{))+ee *c9?\HE "_lhۦ *DBڈF㧵{W\K^?Yl69"qVUSMkeѧ*jScWrE{pq; o|+.VD"A;oȡ :Sz :ʦѳ Jm~8+UJR1$T|Z˅` v4/,cbP Qv$t>c["PUQJo:Lg}*8Ex$!aM:zcE('` ,h}bX#u*cCPAJcRNbjBaƕ||>o| ']Pp+uăaC8aB|64T;ҙDYxCx*7͊Rb9PS=:ڣ&k,X5;cr SUn SA@w2%C_kaء9Π26:J0w5\LRYT rWzӮux_~Ԩ^f# uASAGmӶ7>Uu70V!JJo2Jq@GQ¸7RE7ZS3S\i-.l?eր VIeҕF(ZMh4?YjkA\*ХIn5Ȫ޻R5BZF=UjXtZ`I~9csCZ*IdPV78"x)U`Px˾ I$oEiSU =<Ym1t~1UA8Tֈa|qqWsckQ81~XWZے?^T@iZ mqU¡v_YgR^xFqE3tJ@;nqWzAS0aF<}?N^[FSCNAjtZv o_ؕCJ€Z~+SNsZzҀcֿiOS`VfHچOn9M+!G*B:km&-@7wՊ*j>4Q+W`; qCRlrѮWl8UbĢCqJ63Nlh6s\Ui'ޛǮmVևkǶ4AQ1۸ҿ0\ i~@wªI]ǀ5(TQ;xBGqDa-t3FJ׶U>ǥkཱྀ0R(ABAQ]'5kqZFvlUT0#w^%2ޛ`Bj0$8'#SMve-\FM(;cPMwݛ#cV WFF0~Y.4"@vcJ0b~].Oׅ R((Ei('z Њ@)L ʘih@#ݱZU@V?*!~*Jtۮ6]֔'~xwrƦ4hv4*k  , U~45Hwޠl;3tm‚9m9jPS+nZ7m,$U44Uno$נ7,olUA~ѥin\|Ua۠"e1VmCƿ- MR4lqkLULBT]9@oCs¢ڻWaAK]!ORۿG]T$h+ ԁNҿj{WySI? e X۱;VWZ~9M\*?똑J`Uejt*1ݎ mwɈ7ڃz UL$3]]W3 q*:,oyw”훵O݊X*CJW-qVzoO|QǠ5?ZP([!Hڝ2 *=c| B QA߾:| XPЎz\&]0)ڇ(:bD-G*.z?Yg~KED ߱bIql4 jR,Ө\ۡ=EX'LV?QNcu 8lEwvͿc$7t:o^S`kiz\/ vʥxjvj?xksۿ-|_T0Gq |y Af$ӦE3kXSx6JwW$8pM⧿% * @"Z R$mrNN-9 XS$kH+_l ؙl ن%. d`Z "k-Ƥm,iQlPt:ץ; ,=Kr*(O l ؼ~DӮ1VQHyAJ))WӉ# A{cO׊B4튃AAjCR`:ֽv?uP]6rH?*eiUl Zd˵s.ت9۩iq%C={ (*fdچY)btH$r;|x)[*a rJGq'I$փr2)Z/>*}1Q*I I\ԁF6^nN[E[~{g伎(?`)^ Ƥ zY"s tPaZZyRoJH@M٫۾6 >wV|;ԝ0+mز G0)*AQS@VeCM89j|;aM)OhiE+(3N\ZG掕Rvjer)0j)=A RJSiEf5Qڽ1ᤩ~!GQLdDM{`wļBֻ;>Ȏ(m4*S&XpeOϵ;lP-Qۙo|q+ۍ6GRqU$H:}H[hCxf\UtbߏNWzċU% 0ƕb(*vPU RW1تSrqUf*/Ϸ՛ ]h:W\r u!zn>f BDPR FX6U Of8 1@ՍGƶ#`z*&۱{mmWfQ(Hlx¨jHR- OJ?%RV?wpt[ OΔ(B6 򯏺OQ =@_|TݘaT *~?2*4"v>aEO)*uè?'IB j{6*չ hl=D ҧqq8+;xn2SSE e iu H; QX޽Hۮ]0ҭy*)А@1\驩zf;D׏R`0R\]ZS1|IǠb7HJFfqV4˹3,zZ4,͵=*" P2B4C}qo"s΀q(55SJzʈBk]~9U^%49!Vԃֽ˧VJըݷ5pCTjEEG8m $Aؚ^€fbr['q\d>w;Zq~Ug":e5# c^(L #~0ZtV€z?-o{e{1=rp+A:f:S0*zp|)*~#V1U@뿿\k["p; VH 獥LUuC}|0XJW+jԞmaW1t/co*r"ա[@N: Sn}rO݅[&BҔ5=ew+WWo b}Y"P@^{- @NO Uj~mJ4<()S\cn(w(ڿ?MH*`p:{eR 4:\ːb3Cr7]@6?F*v$7AMuckJ WA КqCSCt*+OeVw WukoZWVVw+~yV?-%[hv|W*`VCvg,u[q קolS=kVQ#%W"АM||?Vfބ⭥Q_͘WZ8UEqc ╒8U]Ha`Jq Au1BΛ ;際 [=IAqC2QTxWcӿݘ)Z@;T盯LB?rovV|)l׵*{aRIA]߇m]**O˧)Sv'Bᗊ2@(̠aUPIïUo=v;bdi)Q]VݖsJރoKeBe$o81JGo0¿/jjƍZZ|?\$59P)>,`CO1joLxn@)& ne!yQ]]&NzSӕ}j8VxM6mAW1ZLalP'rkWMޢ7ZbNP'r@>r;ƣ}؃tNFqZhjF=Ϸ7 1Mg|G⅓k)Zeӯ|UcUu; v\cT1UVAԝ)CޘEM7閦<*ԫDaGr+[Bq.XZXO!^0"t®HfJzM5)SrTQLZU*tۨ1#W{+ʦ1ڵNFjS (FfV\5)ܜA+DIޡ@Bn E: Uj"VP bj<kQȐTWne >;~c^▟P+Ms)8 _@S_zPMH\(${S||{▝~*(v)׿4e)ۮXĨF(SV`6SG˶c@7,)1kT+P?#[cr^}3Tqޝ4' IjI~uZ|?/*6|vZc4V:w5Ce,m}~`nGlUJG!C>0=%McZ~y'd|6,?qO)~ ?&Pk!ᣁ)+ UO׏.ѡjD|E,+`JB-ǵՈ+NF4YaEj0]GE>F PS""xinClᔊZ0v"Rw Ȳ\1 łᏅh:jv= ;["v4pv)bė`G6Yv Hta Dhv${+ z d@E޽Y l $U<7 nŘI A:afnOhwCAo`SI&=u0@ɰ_l*JZ˧u=1,܉4phqP;9_ҝ\xbFrYW+HlZx#G Z#ۯ29Z)*?lpUT h6n ˜ MGL=5hR-ݘGX}aAS\Bzu>,Uh@oOՅ)<~=weT֠}8KK(SɨM6y0:R?,ꤗ#'',.RXcj&E" [Q.JW6(꠷\^PT$@4ƭZe" ,DCO; l1dimqW}'Ǯ=T(풥BN\W U YI| PMmDYs&O|낕Q!nu=O'F?7=S| o[FjulUq^ vzJ ,$BۧfvUiPilk`w"-Q_nVwU>T6H ZƙGvE_XT^BcAצtƕOd&H6vUs*,z;Vx=HuPpueu?HB\=YTbkPG]_|إIiEZ}sbB8}cNLmS2lp**6EE(;)Je ;mJxc8 ?p*20*@NzX!(M>e\OQڙXmwޛH% T{*An'S2JN& #zZVJV H;ޙy%B? fƕT|C}BrPVoݱi0ev* M^9cU[ F䍿q9%,x5S߷qʦ UE6W^5V@xu_;4tL*}+JJL4Ss6! !+e%&3{}_L%SnN~'*Vȡ/ TXg$B{2%ITtmMd#$r=`J={mm.ک ;t8d$Zk,dYPMDiрH<[ě+`mP^`{S*#rjA$Uv qOcJȫ _fjeYp!BZzWJMEXm_ m󒘢͟T(sA㷆4o(kOcM;}jՠ뿏o|H2 E={|"5%+튯.F1 n>vRpzS|z کڕ#> j7:RnzUmcCOWzޤ`KA^|m1xvEVO"S ƭ֝xcjju*> oR@j6L )̏֟P^Ԧ,P 7CNڀ n P^rr5`3tN*-w>@I.A4}.R'cM5́0K$oBi p*}•x44;-ve~wn@ @bw#pNR~ 78Bժs\*xl6ޝ/n~*c]'b{͹DWrzbѸn|U⻏lݶ 1VE}, YzZM:bAK ~zcG146Zb"I=)<85;t- {\kTV?k/j+Gr:ЏUi\)^ʂ5zm+IB@gr1ChH|c[LUZ29uӦ_(ڛP>Y|@T(i|j1M,R=9-BYTwZT3(VA4e 5x@ ?1^W,ei?kӚ+awA>'rծ)^(4?с !D­ a# O*oJSwPI;SOi M-4\Ci\Ū:aC|~-ʯq8z+}B+ژ IYib>{+S`6[i fS\q@E (%ib-*)Ҿ? =*ԌJ_ S_LU@[=|Y}7VsY?v~Cb? hKCMoT㓊pKP?~U8W]1XA#}tV4;AR2zC>~9}wL@ \r0"*A?.U(E(>oE?M+ʀy| T`UWGeZq5#ҝ+b@އ} >xPj>CJJjK5ku1)Qgd~CmaVٺCeZJā^zӾ)r"QNQhqW+ qڵX9UF^_ `xbY-Zx?㗮Yw`4\l5O˸}]JY$U™V\=N1Ҟ/M*E-<|?_5iӦ(li^ N5G^wx ajVX"i6$ZR>wB׮® )چM0&Q *{@8RuA/|*ؐ0 bO=T%w~\r*3m׭)Rʭw)RqTeP u'l-$lGZwPBo>ؙ;l $m_*^HGА{xxIW0P})!Sc\ Pi=o኷q_jⒶF*O<wTdUJ@OPbCRh=|&-QM^]*k>[PГCPGM]րzfU [fzPSm_| v«8IjR}~8#'n)Ss͚^l\plUE٘ߐ܀~i^`J , ;1W;eqU?ڡ&Oa=+L)WR`k-+V 7^{f\UR(7C1Bق ,6ۯzeW)**:wF9@(SMPﷆjoNRz[6uCNTvw)mڧƸvXxXVma֔0ʆ}5hh1KAj97o}Z6uzm-5T} @6=se ;JՉ= e^ C횤~8 )咣>UH;0brw\*P{?(x Uz|iߝ{6?lZIJ҄ oA"YUփS*Я7^ahj1U)e) }Tz vmǾ+!/|UU۩UcA;u)u4~^ه<ҦI)@K>9u fE@‹CF:Tl?P6=i񥩰L2Ih+%55_- ]kQޛW~~dbLlCO5gqD"#0)NiI!h-S`w>9 Mܻ>GL*x̬GMZV[QelBF UI,|g}}g,Bm "T ᚴȪY'azֹ\EywƓnwQ׮:P>=+r1V;0>8mU% ~Sd;c I'ȡ8;۹n2*ĚnQ'* կ9`ݱU2h>-҇|}J^M7ˡȪ*M{SiTr(ZӹaU0kQPنnSʊ&LqLJ0Sr~Yu = ( ƇYb;{*֠TTO2N%QÆ{4u8Sjý*EreH ,kN17\Q, Tl q =XI?st늩UUYMk1VjJ훕U[-/qUME@rje&ƤڟOX,V/ZUvp*i]m^Ɠpׅ>cHcQ֠zp*H׸ 2v=iq$i GŸG, i(i_Ó*&:7U_(B2ݶvq1ت!;b$9-N4P( Qڛ6*/lĞܫHhQztNʵzlH ڴ9*JTI{m?\PGASZv+ xC߶PByCo%!ևzn)tJR:?9Uӱ^|ءpG];ŚPX0$st[U4*QpPFŏYA*Ts\fRPuyڛn1YtJ9x(闒H޴֟,تE>-ǀ͂-oU25o66ƛ6c6.+҄:Y(dg&JNkly+N /ŷQMl%0:m,aI"wqdCJ!Aa߽k(BkΕ]#-z-:pX¨iN»SS.%E I޴cA/:ֵ\[ZDj*ͷGIq3ɂH>n̸ct4NˡIC(R)pLY{vƑܝ|?C7!Sg)||XQ(x뜖NmCV0@OՍʋ_.cAu(ʊcjV鉲׮@")(zN0ZwUVjuAoIr,qlaz}9jm⮒ZMܔS6zvPAr*j{m6 |8c v~)OzKa{ 5، *kQZWnvo4Jv#KspvըƩ zP8uO_Aۨ}OMO뗹Ugµ@hv҃?~E]ޭ~A*E@= zbu~ZV~OO땊O1BvƩ `POmb{O}vZ&7=qViqN>=UbQJn+\i:x[zzJx׾§`7"<ծ*:駎b{R4jV>6xoeeUccxJu޹wZ 54+=M=0Y*$֝(Z(khGB G|RMpٷ=MTw1Klk_^8s#e?uP&vZT늗HRӮQPkzm%SjG:U.%_8>gOz9c[mSsUO*֛*;LUi#zN9zTuT~,T.{=%-x{ iMvc}9dTS›_k qJϷYgs Z5pkF^ð>lk…MVSn{j @zbTP|;q*+BҼM8p|Z`b;4?^jx`UR¬;RߧLR9nJ?˘t_ЊSa\qV(׿]1B,IRݚ:ᤴ}ďnٺU h ZV k'إ|t }vG.1UB5(ܺ=†;6 1B|=w\uM@ĥ ꌎj[sQVn x :SdE|<h7OaC߿|j6ijuƕg ^6IjRBu#m:.`SŤ<ѷjS 45ۿWM+U;SӶ)SuPFЎ<?f zҴ kқOl tmLTX5mnǦL2 6)uer`7jJe4I_ d6 ;Pn?jPuqVInaFWCQ\ +B8*qU@*:֝r~\*{fCz(\;P|nl AJRa?5Ii֔2)LUŻֵ|* M<6v튭-§WBۭ1E߮#{l:{cymN;/„}#ZS)1T}J{w@7!~?1k„Hrv(UգwmeZaBǾi_ lHqN @qAӮ(_ggArqֵfLU%({w>?v_lU`DG>xU7e?l"m\xS-B<:v̫Vu+^?<է\)Se ^&M-M%dks R+*'@B4\)_TV`@5hYiJT펮EK-I)LrĮ qꝷe'\U'j|8nLg$v̼ZW XqB*)փ7N[HNSX4bƵG( .aVƆ W5? 5|*ЧF-GLծnhPnzצνθ)Zzhzb r|F =+Pusnv<1KHE>?F]^55|Uo"Ay?f6VӱZ N)ݕ^*ǷrkS`U/ӵ>IZvTslA5 w*BwcSV);:8ȟ*vQbf!6oj-MEI=B oE-d`T:KRߕZaJ⥀;sY-_\PPj1"nOj70 RbU"<+fک;+ ߯b*6[.A*zֹSjmTnC}2TZP0;oU. ($1˯$PsA^78O(mqUT{`s叓9oOScIS c6J V$l׭6V &S9D2AM45X8(?v=;}F偲!UW<+X5̌Cw?c`74s-YEzF?Y!X{ѣ$Ss flUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*+ W`lM6n͞]Ϡ"݃`HuΛM.L v Tޙ;151CHe'q%IcR:SUz1v?' ;2\ xjbe'v=d#光őţšU$)b!=Mq! HP7Vš#IWE-+,灍-+`OwA mpLw$(8. rĄ4makӘ+JݎͧN 1NQ,`h-kvA#ִ 6>1<|NڹVE2 .B¸#q[@ݫD~Y}遅;#;,-0!آ cnőGs0!V p\]=`Sl]AN8 D+ڄ~j(9[ pDC?[K2Zwi.V>9gP2zSm1Nl+!֣|R{QC4=I)i5Eb:)=ҔAl B3~x} 0jڝ;+ޟ,62_i}.c᥷ T|cU2djPڞ}7JhzmԎN9\mTŀ*XͅU"5_Xmfq)I;`Jgljңʍ7SqMkJ Mr*xP҂)LD:7 6ڵ_OU==1*f\"嗈"Ŏ8Zns!ڧ8͊!<ʱ ;N*PA0ߦ*\p¨7o[б`oƵiMj8)T-Hk*rJSqU2(sГW.ުiBA>N_j{Ap :{e 2+RMk^FS6*S_VF4L \FP51 *c8-F۶F|PST*"7`mZxUJ⻫S?|y!E cOJRqQ8 cJfIAo,aU"H=zQ1* B G64dUR1@N^zaW5cR{WۮX«I S^IPۚ/ #/*-Pi`Uq#݈8T+܏qOo|PΠ)(7( o* kp¨fNX% "SaN6S+0'nَ=j@OƜa^@xW A^UsHMTTaHC;iHӧLXR*iR^MTՇ.=1ġzU צYUB)Jnw+ $v4- ʧ.n«( ͸ [b>*CƹG Po#sPweSUoXPwۿNl416۩,bNPJދl Yǧ08AC3Z{fƕzl6٫MJڸ_*j_52B*wkUqI^뗊9C\Jd(W~ R@CN !BizN % I%M2RyhEfªlomcJ2 !{ZR01Rp),`d^f|^1Ffek9>VCLp*U $&لXA?aJ i#āOwȝT;»|=MAC^X(GE*l T#5vd TREkF2;tB|[}"BQO^xSm*޻du#IU^7~UG)=v+)*h @%K2I?~4|)]ȡg2>~í34+J}ըo WmӱJM_r{ ZF={CQ GOVi^.lU^s?, Z~NN(Q(0߁-zf*kV tu̽Ī;`HiWo|:WTTG|ʾ8JZgmQӧL6>:vr32cҵ®R) HǧEwv.@@۵?|*};H:$RևRPއ~kZb[zcU밧ݘO*b)aKdlwC*ڇbAbAQjm⫂5Y4 `J!=?{]#8T]BRpvI&Ed4-?ιT[]_\~8b 1Mi\Qfv"G]ҵTU9*M#~UBޕ=뚤K#.2wWI2BxwҴ'NJҸX|GOCV  ;_eOׅ Kx=?ҝU'vvSæ? ƒ;UdGċОPj7lUyWۍتuEz0*R ;Q߮B*e~U 9Ӧ)Xrd]S`w)CO+lR5^ul(Xŀٹwqw_R:_tڸT (8in 5}?/q\X]zoU9bC>ǾX\UFVV_EqUI= Õ Whh #(Zhj)LiU*rv}aUe*hXxi(rHbw89SZ y7=,wNڡB˸#j=bUo޴QJO, aJ$wޔu> V|[jiuͷ\y*USȚ_9V*5ߐ߮]vMDd## *mГJ樮%`]YU>BK 'j)Y$qAS׉5fi"\ňv;nw$ u8 sb !RMf^(/N2N~SZP h@ _Rؔ RwmB~qRv5(7銮zk;uUUrD~7"zTUQcN(i[SI`Kp+Zuq•c(Ml { T;W?jo\ myS#G tZ'>!MF1JRB:b@hH;ס۩ZA2OlߟC-4*jV=wYU) @wOsqڸUpO~~XG|PJ#}sIZ5nqAĊ⫹CP+ek85xj+NYclUNOD?kx5Z )SM{m~-Wn7fղaV`߮*mJxUT4ƛuLULhG*FdZcتu~ U#im|UbEA="Udl#4pr2,I=v)\,RӠRg4P U|H)Z_oV(CVWzV̠ >Ek+D )_/Hhjڤyeק)Z@$xw>^BV "Tatd \?/JoJjVW5Wq)[3>ݫM?ˏ\WU@ڞ u6/RQ+fªd8,Mh1 Ze ;T{_L/PhY])ā__ͷ؀o|a2l͋nC8E:SolAI⥁5ڞYL™ԩ$G31}鏹!EaĎArdWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb®Ţgg(%:5:/f̝ !ɁJ][QNm+1mv?;0s ӱejM1f)-;-d-;(Hح;CZ ,i#(v(.S(&a TŖ~xi CjIQCTZN#xi-#I=qRҸs1!w(0ϕą zd1 5!N6#Š@]Y¸>! Ԛ  lŔZ -.ݣ`⼶N[jiszK -jȧI8Vœ2YO)"I mF4Zr~ KA^iT^i.)0v($`}Cz YL]7ȳRf-Ē8,ޕ'zsB6 H@ QQz"ēPyF* JuODjbbPRQhaRkUYdWsj$K9R}Su*S@n9*(߽?9GlUY=Iܮ:50*nKU}W_ v 68Uhñ4mȯ2mlıONF^T @Y\S=~_͍q+F,jǮ,AWp%2F߈cӮծQ=\!/8lLU(rz~v98C*"VmXQZimM`@N;PNx0U9IjM0[ ;*;w•D/]E7e"5׹xcɡ*|J¬6VಘU{bj*waϿJT|{ҟj5= T8ҭ2SM;}9}F*ƛw]NثR?#BN_4V2ڠ P6T- Y<>\"QNVƝ*VMxרd>8UlĤ(XjZ`JNb{vQ5+>;cH{l:nj%ؚTE! P`Un^eYs8aU$R~VF1TOVTE n:"UR^ïӘolBW ;$)<;cIPһTMzTxevGzt;Fjb7=SQUR*G+oD{/_4} iR~2t )Q}?(o+\҆m|*5pzm+cJ^v=l `?V^XJ<ΞNE҄Nƕ*IRi*nW/U"L+J QJQHBPY֦6R*-o+JeSWd2UqSJ_UHOwT=6HRy#;i #Pzmr8r&Hy[F_zQUHQZl+/*@ tZ^o$s0 ~vQF#nNԦ:\T#J{sa #;\*~ɩ fVBBrs`W'^ yf* ?ιUwƾ c5(5bg"KZ}nXRo?Z 2]Je'}Biǁ٤rLX/C]tVzWjbB|@M(i ܌uP3 WKp7 #ڙR)mv|ʊ >*R;'*5+ҕ5`)\P 뉲tmghTeD!ھ"फD4AaU;xcImO~)[cZSqf <0%k6~eiክ[s,rރe{aV}ͱ?q|;fAql LzU'PG˥>C%j0?qXkQX۷۾U b(|[צ)Zcq`zaU0;Wj= :@?Ujy}B7[],׮*(iJq>ܓ)lJC4ƒ6J- Tڻ}8ᰠȡkH$uڔڞ9[ Ñ1(7 Ts,cikYMh*@(UrޠVO+j@ I( XĝT-q~J~$c{)+㉱ Nت6%P q:Q=6큉nVTzۦUà«Eb)Ft3W/NBb jWڠ–P( b& }8kGn?|inVzfcp+K'Rs) rl)OI5v;8xS)~*ME(OR.GRu&?]bD?4$+߮0 *%+^K{S~~O\Uu4N*AV`A;8bOLQLr kԏ**?"z#{]V$(TI'߹ /RPJٶ456!R=(2lMwqjmŲ;4##R|pTG'zWmXcXw#o}y}k$xF79sC菻Zhӡ,|Y.lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*UؤP4,Sv &Ntnώ=%%Vnj.yƍNMHvV5iN̸Br.-\v:!e!uUe`ZvP4Ǩ‡bX;,>v<5w8QNdžɱvѨ& M'Aw|q9#&^RצAl 42셡cJg-Jg^ UWv3b' kzw8ͅZ4ޟx$LUa^ {Wc譸;PF56ӛ M64&F(Lt;?̕' јԊqUb9T/B83 Rh+1~ZQ@ O |Tp{+AHcW"RNS%aPjvlp* J9F4 JW"lU>LP u9D1nk}1PhhGPiۧє1UƕcnݱUlӖk OZv^~iTxSm9@˔0 ևT"ƻҾ'orHZV1㻚]`U޿n*r+Țֻ.mBT|4#k*kPr#A]eSƕycӾ`qUJ(59$RFө?GW;קs; `*EO2:Ə`J_Uycpטle$!7"< ͅTg]҃jZ4aVjDGSV Ue#o[ęq=zW-EfUHA/pnu.0|zTA<+AAZSarI k^STglE# dXDj˾AޙfJ`bɘO)jUЎ"V_N& {ee Iu2)Vu4W«FAk|'ӛUn@W1(8yH|Usl}RN1§5' bvR_`|~xDw|bdV9[M>RMF;F-_$xC;Jh +Z뿆)F5I8RԡA/N\U)V:q>(Ez;P [E4)NIԊ-=BTՔ 60$ja!VӍO*֣m+֘VV;S0IO*1 mj#aZM A='-8KW˦* ﹯O㗻uZ8\׿[ ޞ_*Uu&j*iҸprINI=qU QBMEEzq~I k|;cT"j~'LRҧЎ=[PfjViFݘ1V瑯_SlR>uǑQPӡ,VXxǾUSO(m\]ɩ?9{U6[Ol[pԓAJk|Zw n L[F}SڛRTªБW|UU4#{8MT(:0, RN\u(j:#uj@a VqVǑ RYۦ*_u;ت14U3KZWJ>,QvSAk.$wʮ2J1U/;lVa@v[F:fPS,}1aW q, r]|CW$rᗷ|iVpFxt1WPE$6c+aUA5EFn1U&VbyP@$ӶX•9O=;5Tq,@W[2WLԡ@>.[.k:x |BB֋(]1VU~Scik0 Mw3۾(n$*CGBOJm4"[$aJێd mP:۾cTˠv ?Br(3 )Rfn'c$ͱֻo-L89_5r+QO vը˓>oS#6v+JelY^KEe?϶(>v"OۏPnǑD]ӭv ֆNc4Ӂ++@XGZuZӥ=%vǁC^U`TB(74~UP\o?ο~]zUI z6;­*Ss|qTQJRzQJ:P/+Bՠ?j?l!V[c_%!ȕLpmuq߳J P1ȑMcYj*hF*O#F6X 6) =__*UkUހ~`B(jv)O/\aKPUGnق5.iKiރ8B'W(wZbb7ǯ,)R,Ėa*0{:tۗDZac8/}4׮)QBEiJ/e1sk7OT56c%TMHxD+-R()zU*i_2nvJ Ƿ*]RO_e:䭘QWҾ%Wb-|[Bѿm ׶!+ɍh>40UݱYvX饂qe'}`ҸkR*ntz8b_Ey.iVkSثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊Xd#A] w.M.j*1bfy ̀x죑* r6c.,CD$.$DUh2A]|+a®€bӱ놔M МX,=zp$v= 0 F r*EPԝf*ӍA5ZV1#;ӧ/U wzj6ttU*G^rWF'~LUQhjP{eȥcGAT5ޘBy O\ BOP)Je/ö.S-L Q{m֦mE `69YJ:*rl NLCZt$ǽ7'ኩR'3N!T @Ne;w'(.)]΋ŷL1*ܓASQ\UBX$PM+{[iALaGPo}V]zV_lu{s> qU h? UEއ{oNVaN*UJ* v`GL*ƀ1;WPo֟/$9w&KPtRčPƛZH |.ҮP lhsUHPlo'.pnjoqVwc ɋʯo r$hk(0rڞ[r%Yҕl[К5<(7J0-}sJ٨i˾KX9+T & ȫh 5'ʸ^Q5o⫣^oWWzO$ВO,u(0Fm: !+'떪ZW4 30 af16`ۍDUPPSl$9}J=w`)Z{VzG)or=>y=N![vW(jkZR@?ZPcr46>SژN7m{V`V rvTؑ]4mഭZ١68 Ihp%jAZ־9ԕ54´N E tTֽp*tOnKJt"KoZ|@ps&wX߽q)X\T +Js[ So2jv5Y9)A(n*v+CA_rTP}QZZ2UI ҃N|6•Ď&Bzxf^労dݩ\ۍ^%Z,)jVǏ\OSAykR*"oOՏlUER+\:n1V<$5: ާ ȴ/^N*J]w'1؁Rzo4׮@OR6篏Smr?+o^ء2I P *2-W(ZMާ56#3;{B?=iԓOqD,*Z|imN;&$ Zm׮n{P};)S ScnUF5")Q*jO8wb@x2N*Rbi=}Sz R,NR5eT$UZE*%O%هZt8l/Ol=|1W"{04@WS7o 4«Bk_טtߡ.Ũh MW@O_qB$nn½rwV4d64Oj`$SmWFIB<~LUԁ8[LU=5jVE$֠wbZVaZ?PҊ-ԃuOl`H|r7Zb26R1)mըJ7o_ RqH[CʿeWqV5ncPR1*o,RUПTb33WzbHZ)n}qUmJ05IY2BӥEpRV; |v?.ܺ [UjN0%rE7 ÈVia甼yJaќ6ɱP}^B 2|ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWcⅤ4K1a6!EL v*lbpˢ쳓Ct%ٰB]2KvV;:e+F٫ٰd턡فvX5vR]Ʌv=v1. (f-AһPuӱ$;$'ST3X2 DPJl4G@k2S LW*:S#K}2srDc-L[nvǤKԝ,-ĜtRP aO Y(W$E:#ljB[2 @M;n B@ i y=cP_(1MS[*[ )Nl2Yh:S ne~. Ts4]pL OAZa <6S mO-'\nƆ.@\j϶KZ6S| $%;v+Q(S3;₻;#¦MnM:w8vJmy14'߷`AU @ f5\Kq% iZVj⪻q4*:dCsORũr"۹#|a\~FXB3A}LU Tu SrO逪bLj)V`K d?nҭ$JR+_`["+Z\UP^ZѫC1QW)OeUV2A;Q mX"sF]Ͻ7Xc_ B1Fve‡F 5Nڟ͕ƸҪx)UA1,EnMS~9Q Uj=iJ@' *rU;C\ w$PSΟ2z`UT҄~ Tum_UK >{UzƆrثD5o,ˁV{g1 7G*Y=Ƒ*ZГztQ 7#qUc ~aJǠު<6뷶)5.>~YAUGR>oUQTv#,Pl;aUƮC3Pmn隿~*5j)٫*Ƅсޕ`%kD z}~ շ? ?cZS=kኸJ?hosF S6*;owV+på+]@JmUT vF`w45ۿ^ /Zft8ڡS}޸ʚMGQY«fTOlpTԏaUq{`UMOlV*$ Pmxv 9_o%v۶)m!]x|J)mH7$S.΃#X@Z#hſdmt*hV% }CĊ]TӠ2Zz$o{|]r乪-@PoZa؅iȵ?=sdiWQPz(⪨8teRVSΕ)ڿҬ+^q]_YUoq$Nr헅T٪8ЊM$(zPtov9 L#ڟ6*G4Iآ 3Ify!w;~0afHw>>9IJQjarΎy6'_b1n)x(R)LUS@a˦ W]3SUPjm f*2醕Ie"ok/$DDl? ث`*)WBW㩆!&vZ|9*M5?/+Pʦ VԊw 0jy~&;^M(s'&bPwBGn@rz J0$'dzק٧e X/)J?F;IlW#r%WۯG(<<D*JScȶPMUiC]Vuw*r˹f/RXmݔQLq닂 U,b7sA4[|nPGJN*B7SF;_Ur&6Ħ6_qPʥ'VÂ+C<0;1>#cCӧEU |ǍOᚔ~Z' ԝ5?~E†2aҟ~n?JcTOr*Wt+E+[iCZ_|!-0 !vmZ[S~ٙIUt,+V5nDZ&JjdR:N*´CfAQXPvGQ)YF? ڛ Ɲ銯 o3~Bw~R' m l u {Mw#|4Ez4щV&i'ޙKnkBi~37Ӆ[EC+Ns#a"m"Y66cRFءx,S%FMi}ʤZM"oǗS2B"\$ekҸ-+uЗHz,GQ•W~=G훮.j :faK`1^s&SQ^~Vrj 'UmE)SǕ}Y@k_LB#q*(C_ƟaVޏVnZ+0R$ׯ\UL0*YJ$QI嗁Tb@o,d¨LNM-.Lv[fb n  5镂i@>iOUPR`;n:Ǟ&nݾqrTOZ֧Q"ܰ1Vُ}+1U66\pcA֟R(ڠt*s&Zg~|vڬZB*;QGO R0Mp_4-P(O_'[KAOzu:cNz?񢧡,µGfc!Jn +6,ҸS+X@ AH^QQJ_NyQ;oڍM5*nҠWcHڽ* >8 HVimjckM)\wC Sۥ1U6Bzf]Zj ofJUn8=LR*oJTUGҿ=6߿(S;ߦ8 ?GsjmY`7AJjKL#z1]pnc3RG݊bSrEj esW)zPaLURW%ڻT+qU%r:cW xň|v'M특 ReS\`ebqUQVpzS0]:⮑9%: _ x<잟\ǰU@5ڝһh!vRm 3(w3JV{u݊8VQ5T4?7A\UyƙĄEGǨ$lXR:U'Ot϶X\ł=^N)j]ާjo;R!!jۥ; XJ)]zJW n|ӧnتI v>Y` XŔP+7]kVz3@Y})vr-mQ'cqC8ҵ`GSQPާw;wg(zaKahKv"G9@obQM6Z}q튬c~p:}ib ehD$b:۾UӅ-3zc:&m)Y$)Sn;HT!]{rQ :>QW4ė]| FHzCJ?h)@7/fmO˭qU7N;cW1$t•6HڬXҝsuȥE؁VژT"ּ.aU XSbNxsإHIM܏ jiOcd"{ZdJ15:Ƹ]~ vfg5ie :0 Vs/}1/ dR SLs?G[B(h90cV<ʆ¥}E.6 w*$&y6mݓ{͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثMsƏs]1AA,(0c5v8 E]JvcK|6 KI]r+P + ͊6I]6f*E;,!T!| sA1vYrݍ\M0c]G˹ 0[JziLH2J{*Åbq24Dž1Er<(!bs\j\qh4l)i ҸsゑK bq1RƎ\Sa6quFқpeQ<`i-e 3SW=S tZ&q\M{rz沩d)F4&4aA '/[%ȠRӧ|YdU^)d?j}5?,,IEpXԪָî&*XPn:аE?|6Nu1JzPWqӦZG(v!P7X۷^'wߐ+چ?W(in4'j=? m;B1UtR䂮6!wY?ZFĊ1?痉U~!)"GE?s W~]E7ˠbj4'c qWK5j A+sb3r#n7l@|C;(ʥzJ<uتiZU$^fe[]OP,*iM?˙(_n9TA]Ō#FSMr@\ƽmhEzĶcM+aY$C"H޿pw4vo@8Bju0%P|Dm*]4UГ۷;uVAA훧LUhs#)CZ_W>X@Tt;4IX(4xS珮ȪD:x (_|VSqZrj1,V!.1ޟ >A;׭6O*8ܐ}T=Uҿduʥ~g ٔ{ur>dM[rv¿/ҴoRN^ iZ9d`rSQN!\RA!XB?ocJPӊPd ?lUfBQ!E{ULJo$Qz1WH'p:Gˠ'i SasUy(hH'eZo+;ޟG/UE[IaU6&9{`UDf֠WjvȪQhTV0o>[+ߧgKjPP_0ң~lsT#Aӯb- ԧ߻YE*5cMLqP j6\qZR{F ܝeš[%DaN&iZM*no'*Ujb%B+eK$w]^)PY;MwxdP#-CR ߎjcJٸnPxLBzo K(v?FXSZZE:dm z05?~*ӂxW)Uf,A&vЏ PҖVlr*7=)hN)l /JM=1B45/zb 闰t«*cn?pZA;Qv#/ ézf- kqO陉p*QN? Kwwȥt`Ɣt=+np1 Ct*6Wyf:>%zP3AL*ӒHq7LR횴)Mk1m5UG-Q▄JV_aYEEzw{犵#ևwӦ*!ǿP ۷;})QW8W+)T,Zj͘UX#6 T~'zT~%m;朢p%+@?Wwՠ;`U0NqUDb~ϱUJ7ׯ s.FOSJAZrdžRM7J?˭7ªKm]ߡMJQxƄmҕcxTf;S쑘`%[5*1J+JmiӋeUO.zr#>q;RpSo0VIɥx*ƴscjHG5SUPGP7% ˁ%FǡyU19l U%*Oҩo2kuVd*BY pK`c@4>|;7YIڣ6z !nR)S k`ԍN,OzR؁޿AM zҕaAC\NإIGpn P7`I6n+C~#|1)ӦS}wPAT5Ҕ=Jt=Od̞>ªCAB7>cxATPT_o]H;wkmo&ǐ6GAm֘5O(LNNj+$nHLWcbMNq!Ij=SW`6SN…'7J|:U`Cnڇ\1KEC=?rMW%Ӷ!YöjWa+ETҾ9 *\ylO]fo6M%~|rf<(G&*1vd@zl_w;튭*'ߗ qծ߫@vUwQʾ#z*~FåzMhJ SozVUUOUNI[_|vS eJS͸b TSiA銴FQGfW.z}ZEg3S:|Xژ&lyxL8b1Ujm?\PEVln߅U*RӚ+Aþc=-$G6;ץŅbkG}*]`vkZn:R< U byVW˶*PGBXlx*s!֟7|Uբ'qֹlRAق) #+?r+C ݽ+jYjm5'6~*,zWaSіnRgb97VA0*˚tGRF_1G*ҁ˿CҧH ,Wz;\VZ4؟_nH5PzN6kDV"j\P{m1SZ(s{exf:o z}' jsҧOvN`S:va;J!.h@vU1WfDv;'feLWcIʉWe`Wf]2vc*mv_LWe6vlUc$َH1.͓vX8U~$.jgaiO{TcLIq8[AN}ˀRJ/r(v*ƐjaWb”ŬJoTp:b*㐦1xĆŒA]!iOlQKx69 `BҘiǾ,JdRƎyM2AQPudA֝6&MFâiƲט6Yn*7YӰKz@"|]wJemfFZWLxqBFAzxS,Hw; 1mֹ^l Ԃto5i1סk*B P:T2M_}81Ut$nv9UWMW0^TZ20̛6#k$kCSn8BgHQ] U^E54|i*W`7θPނ}=ZU~Jw7^; uw>-ițo~Szt銬boC5,H;ר˨­SjqW8,jGzo]p[J>ʎç5w6E(Ar \ƣI{[$=zLg|47]J▫ԝf6|MX%OB?W=wǮWzWlƬbkv4]xah(﹧zoj5~TWWz ^`(XE1WJ=)anl[I=`thJrkߗjUYw}yjms S~U'H??n특dև޹ክ-MiZs1ثq5n$Y~U DpM6߿ol*}i1U6ac|G]+xQ\aۨo UƠ7R;v'lyCEx٩\LO51i;Pՠ$&5Fp4ö[|;l64/7[J52!*5U2bl QjAFæ|rXY FSS;fI%Aw496nӕ :j`Z~ckM|T\ #VoP f&џ4[xoHN T7 >f+OB4{f+^24VASAQCJ5?(IbG(sl Z cԞMJm [-os&ڸZ^SOV 9ScPq۰r%-;mXzqzeڇ| *Z͹Gml?UujPrnN*2b<6/\NZ y\T­)ZV2ƒ&'MfVI5rXuQO[sAE߶9vJH*CSߔOӅ+;)ocXS Fj1˩iU"TmBj@5I劭@=:P|c, UzoMSRZ}`U;6͹߾wASݷӔZ UWoN.`V /8Q|~yU$7t˨늴zydq1慀+P)"L0%tfkoU7XUuzwoC\ e;Rse4+d-@R>8 jǍ@$~]Ffvh0Ǡ?rN*R;xeޘҩ27w=2aZ x|Gv[`A;P?՘xR4ʭ1W*r_S{?9 8bit̻t;aV5o51 (ZʕP@'rv ?˥pQZW\U^TڵTW˜ڇz2@ªqQHl0+m9,U-j4g,m튭B߳xS% PFAtYW ƣVR8JWNU" xTnkקZ8 An77+P>;YXm>{f0RVCSJ WqBʕ*¢3 lGrNUaRc0@۸J`:Z` 8ֽNn^fbT9W:U;Fֽ˭7*5kЎ=e*FVVe;eNSCjA޿1\`h|ثQCv'2U8KZ6%T\q(&=2yoS/U7RGoa P woc|n * 5N.QSh{5Ic`{ 8Oa605#3+ۨAO׌;B=A ZG˰oQ1 J{øVHT0Q{:sV3E\w|)Q8PS0)A^Ԇ4'cl I>8;cJ]$ç>E)rª*)k 1| d%WA{UUاRHc*"NTv$GOv3E)ңXbdzĔR6=V&榆F(G۠QЎ=10GlUP27qL eGYV)+M|}wV@QǮXaM64I؃,( U6wڇ}~R@SVHnV$c_|kJv銶ZDlÿ]ZScCn*jSlq5"1B8zzS0<(mĕSb)Mv# S$+˭2V*ܟSA PrcrOmr*;[(Ov _ʭإqcSJ}s/h,))Ⅷ:xUMjS޿Y6;Bm )- %BkUؒ?9@C"ГԎÿy}:oZ_ (1UhX܃VE+,Ԟb)NǗ}RG]Uߎm={V\ AB>#X*C7aThzf늭 U`+zm5eثZW嘷 #x)[nRҐƠo:犩Za?\uT3/Sw)Z⮑SVo\T+Hp|"w0#E+kUCmfzo TMU7;+SkX>'ju9{ےJqR6 S/} k*q'>Ew TyPQj|mi%͓l"Gxo c fq w{ )e+@xKIԃ] iP`o^~yέLyL8qX{奐Ӌw?r92[vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbsAbr 3֋@0 j2v/j`9vX)㖩vUqbzbeҸӲ ]1 쳄S]E$;50;/,Ɠ\Wf '"J6*®ͅ]`vQ $6*ɄP].#{郰Q혥4poA]V5b,Ua4zqE;0"LV9I>!fޘ)5LUeCaN#iKJcLHq\0) [2xL p表' ٪Pe(\\m FǓjԪZZ\kQQ` P=p5~]<2ÁƇ$ *:l+i(jzҹJS4玠׭ \^5É=2aR=݆]HT|ITn-SO 7ȔZG6C~Lw! 8lJkT{ep𪨅Xl@V xo/JD`7rvkE印='mvȥkŎ|;SZ*HƄ?/Y`l*EƵYV0HjS+*V^?v]ǃ+v}@T)lAצ: '>q˱VI#-H8B)ZlIr϶ʴ;un8mB4Jģq>k1P(< =qBbHsփ߫ !Xﱮsh<{U$N w/aU>A6n:jC:aUV>'4`UւT k^UڤJW5fZZ k=zz~8Cᨮ0t*rXVe֝78ҷBWq㏾)fRCZ ~+W/}31-Ơ샶rol! nif;Wr#-Ok+9rPx]{(S 0|Ȫ w`h(p-`yN]|1V@{sH H \iWtn;q;_r 1| ]]}Z AҧGo7/i ZГք֕?]N5뱦M)iZ]G …QH,os.dUqR]X*G;S<=«YvkL-pAN5:1M(Aa5|YTv†ÖsuIT8Ӡ 0J[=y t#ImI&\i _#oa8aT#u(?_l| ԧE*_\TUh3wjTޞqvHRYG *|AjZ lpϬRt] iʀSV̕^tJ$Q'sG/Jm^R{H^teP*NaԈ;-.YO$v 9҇?ϘFyWϮ?%P<UEѢTlk8픝A.L{<Ǜ$RE1U9CRo40sf'"r`sQ̗.~A\irw̋jS1ʭr'~m(!N~/iD:~T `R^`+?XnEt'`I`F;픺zudLizH*`A?~PQJʃnn1P\i(9n )aO|R_kmp%5nӌ)MlUh;_aTWM۾4ִEWAL)E-T{[UZZW${㗭+sE~f3ѱ.ߍ<7˯naJ@S\Jڿ74ͿLV_|N RO7~i-ֻ 8LNޙJٶJ狏Ģ$5|N W(xf-˯y+Jڻxoe={#h$ߍV4=6ŇA4xmS_,"(EB,\(TZ?*]>tڧqǧ^sH|1+Wʅ; Oߊ32P;ڙJ_?O\_ >Q0+IE*:vUx`WqAqіV*Ҟ2F%WmJ VJ7Мj**p*hO3UP S #צQ=VRP50>]1*j{]r=p+}L~U Ƿoq#P)~plqU'$kֽ4:t،|N*PJN|>Gl`pI;|*B(o1q-RU֞fLU58]ZYõkQ40OOcj`JLJkִph7­0r`:$ǐ3}=ә|Y3-@?+O]l\UM /w9dx׸6o AC_o ծsJR$ZlqW2)z>¸NCFI~w\q،6mx:m؟c, Z?he*פN=rL]k1WUXol}+| IH'qQ(FMSaT8 _ћъi n, S۾X8U9{?e r#>SO 65m0-*rHIRv Кr&CJoA K>Y+AX]UW6X7`*~aU@'jC@*z͊E[Jni*! @zS偄Q*%MIan+lj]2*Fc E*7;oOZW=xU{o^`p*(H;VoJ, u޸Unv#ӏUFB\22 $̲HhGJ`6Խ98Hmt:ypL r* \rZoR?M0maY@?ʯNؔMZsahΡ>#LIXZZ ='#UX-NǭpUsxc~=ǀ 銨Hx:fuJW4(7\Rӆ5:vX*Lo W`YFj? w UN*}CN8C^T=4-z`C#瘒: SB^Fg5Z GlUsB; n{AԁZƊXX1UiۜU6_+^59^ޝ):WULmΛmO\?,U%&ewo~@R |keГ_eUNqU0~uV:^(YN ׮V)w"+RGLUj +_l+Zm\Uw݁ooe7@nDr}w@hoP+oޞ4–85rm$KRw6ۧJerJ@q{`U%䡐+{euwf¯S_Lb#ze$Ti?l)iUOJPP\UammN V%9ɠ| ;I=(|?9aT*O 4|BV9ބVoWL1A*sƮX5 {{e]PȪڕ\RF @eoL!-vߧC9%"j|R]HKf VBۚ^پ` U"|BTp~})hrlMdN!Z8~{}v2@n蓋W.=8~vmpo6C!lyUq}>ƣM*Uham|G~]g9P]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثh~')X-CnhQ<]fѭٱWfǚ] @lvcCv8`d.ˮI]J)r1 vc]NreS)We*죑We`Cbvl*!]2X6* $*eTv-S\ف®rcĞ8QNǫo\XV0!@W+bb-:(TbƝL]&T1N:! H)6DR¸&) ZW=0SPx - JwDmR49L>d#S4Z-nڽn/mkpG߮jA8}7=~=5v÷l*6_l][^#_*VUP 9uS +T,kƇ->t낒Ve 0CHk|UMB")w.H u2~;o=hL N¤˭ T^0WqErE+-pE$e UVNٕLiV~@Vӯ&b=+A9` nPxP*{aR(UWlB  0RV0f45GCX#_ §;$PV2*'ܚ~bC1ڽF*VATkLI48kE~\0*Fӧo7* юmɥw Bw4}ܵ9i#,9[@zo-7!VEx7s 5{VdFrlUj9*k)]h5ȪN2m*nzU%s M?kLk1F!Z9$7aZC9vlp+QZ((NԧmۮIZU@%ܨ=@ n_adV⹸c+|ۏqu!Z C(n7Uk474|OC/ !`"|DƾfvVوWj k8 9Tހ,݄Sm#qT'Jeڀ F⹩Xѯ/z˖X@U:}jJo]^f*.'jJfvhznGm7HAڛxv9ti;mD[l1]y Xv^JAvnB59}EO5?T9XiQƊ UP b4^ңSLÏTJnOlި5X (o1sy]G7ߓ5䞣ZpޚƟ*\$*koU?»{Y|=P*kӧf;dm+ͯ!; i~ڷ@l;|%Mq*Kbz峂rpB88|m*u剑z T ]QR(Ep* I|YgcNڊ !cbh)p(SP*Gm2KO}Ī 5E.M<+sBZTWZ•6B-?Ɲ +hQ2ڃs[ E뷶]A<0%[Ǩ>qLZSsWe+U$V @)BOlpb{Uab(w@6\ _ \Ut}צZlGo+4bAv͘VDo훅;Xҕ|O-raCњWh=h)eVnxonثn7zӸ ~"J`klSNRl? CDsk*׷pZSjr|jW*m_o׀SuA>+W;8T .,xMZb@ R+A_s }?\UM[~YVTo#Ƕi FP ኸ(_l~UIv?P6.c]ǘ,wu9 1)V0#\UE)n ]E >Ǻ&p!SsAPOlJVPʥGf(޴,V ҵ~5(Ȕ+$A$meV@MՍzv«*9;q6 EI߶?\Ek6^͖N*4ʃqTZ`JIt$rc x%/wJxPlN1EG(jj>l(V^ԎiĤm6-OnJkB)^, * b*ؓS PDTmׯߊV*we+Nࢃʥ>*5S.5Gc}UJA]Ili+Q@$dOPAmUVrޘ܇:W;qqVѾtʡӾ(G]ˡ=!h`()*{5g ?Zz %>]V`«Qсjc܏Z†+^\TU0vjw`)|Um֕S:b:Q|@|yt=O\Ue;~^t%tӦe4Ҳh|>y1VA\U$W &U&5( )sПl;bߧݗM*L¤srV<@nӯ@;;L*~<IJ\ RE:ye.Y\U*`:*w tkRc=qJ*C?Udޛ^_~8)WcAso\ X~u5V5}W3n0ZS|KԊқ}uxP |]{v(~?іn ^J#pTTA\կS4 jW,x!+$V=𪓷 PM 6BTfO\Y55 Q }jm*]7kփɤ),h{kӥ~dOޣ=9Ev+p +]۶ޒ|9djߗ^ϼ]>yBVn4qogG-`@ӭ>,bIf6f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*r)bc{kauEcYj]#p!ه\.X٫;+"e\)8;C vbpvX+(kD+6*g$U9 +|R(vl!.,CJ+bzXWLFӦDWeWF*ukC+Qؠav9z~(cOSwؠoa;*V7Ł*ĵn phਥ#"X]%ȰqK|bB. Zo`Bv| wg k-A^cd$4iZnk4B^{Oq۾iyA+]~\D 8)2r؊xet#m`Mv߿ę(wo+6ݾUh4KuGC|AZaHXGbh1T}߷$,e;wők 'QB ڽ*=:ReП%"*6޴RzU]Je=]Y2ؚlpVjIV]{n1s(دS1?k U?˧|܈qheGmJdi\#EVSK_Ƶ[tU=|+ߔEzR4 ;2𪔛*mɸG4tqSf"w"%J3AW"uL@reƽ7*I`+ߥ½qV,h{޻͹UW*t?(n"U+_㛽?Kĵ־ eOBN~xд5*WjwX_|([Վ# *)܌ HR< A\i\*5MA.eP{b +Z<3l~p%wĿ6=l#wjh1$x2߶*8v&o w;c^Dkփ\#;l|;c$2K>5+ Pi\XsWݚJ~MQZdVI~iX5t?v|AE;n? ]tc ,/ݍ*.Abֽw?/0ҩ梀mr*-/:~.Qɮ]0ZiJKfe}AWjSsS4Fj H`;Qp;Yo KH5F\|ӶFQ۾bOYˣ?2!؟; ŖCOT)ؓ׮3֞NeB<;?ܞ޿~4,J\zhÒKu]m#|H@r}j|rZk,RTf9dljbX##I79@lE7O-F-el6 hD5\ -ԮjM(JJ๹xbҩ=v z%Lx#L~& QaރoPa𘜋؞FOHca,ֿԥ6?/|Wv,(SCGSk,WlU+Pnz,W8W}wW)PzzWj6,'VNM|ALz`BZLKw *7k7 fW$PCN -␶%Hm7\*Iޣz+mA(S>L*I6Q'V4Oݖتٞo* d۾as1=)-/Y9 +M5l)hf_ol 1 H_򇏆xd`wћ$ jU75qU9v ^dӧo*Re ޿6ZR;Wck0!k˩ !Tdv @ 4<2!Tp)z"n$ׁTo>_,Bn L/%D8=>'kdr1_7;|!:eR`z/Jϣ|U];ы1#۷M)nR@i6~PT~# RVHWzţR (.|F>_ZHerSOW6X}׵O_qzB:ͺߧ4N@,JucB7LFNk1$a-"Z$70+b4X•G<ۥv,O26~rVx{SSN^+eqQE42~Uqa2;A *qTWz#VᚤU:;PNL܁uU*kژuHI%N iOnga &mOI)_qjVZ t)E5mQ߯x"BՓ(>/nZW4#z8/#P AٕA_.Zҕlxo)1ZBKu6U J~X?!v _`~i]ԊSV=~%]4kǃǠsa:`KR+~ѫx8ӮRUrh:|O݅ KQ˭hI;  56߶mlՠ-q,>"2*-* 4ڙu*cǷݾb<0hjW_OlTxUWju]V|.kZڟE\a]p`!: OcKKMh?c7z,ԩSR)NÍr7 d[ ;bN(E2H0a}.k&()A٬5"ݧ(T8z*m۵uV"qSs6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*2 K{2,ñ A݇ѕƘgLi\0;l-.;ef8 'eS#L]KBJpɄ(0P졈WflKrjm@`NN%]6L!َvP b-JuWb9U!G|]L!&ٰcv8Wf0;/pڻR 1`zc`E;v_:jY\yuZ7ژ Y `~4G"XM^7#~ b G"֦F B1B[] ʧkm55癊0ۮin絚>rwi~'Z)Anp+ֵw E714ml;u] HV-ԕ=L` Eޤ Ju>TZR-[m( SHC=A޵E2j iVߧ]7U6PGBx9`W J&=h> {JjHcIhc׮P<~!Vy|oXWcBMN,i*dSĚx=rNBMh: cN*R ]*Z5h zeR/;E)( ^$lXQm1c5)U[u>NSLU[} WÉ~&׉9 Sc 7ޞ=7$2@*͉$t9oҤ MQH5Ef=N:4v*V7+}3˒HEz4W~52SNE׾$+E8桥BcFm2H6jWs+\E^V0iZF @AޟـaV {hjw#&/Plr%ISCS"UsP(O_aeMpS@Tqނk>PEWɵ|[~阨58i\0!vaφ5bNMh)FYd-GJ˧Jk]ϾPZR, c]+_|iZ2zoe֛h.%T|[ci UBܘon?,|T$ U$H4ZRw;|qvjDV34jJmWi %`4p?SkOccUi+l}iZgֻfX8iVO+!o=Uv qǐ)9Uehk㿎_C=H۱ڻu9|p&r*/ju?.Hy½ &5Vn8xV\9$=r% !.51ּ̭< Dĸ 4a0l%~c OG}7`rwx;.0ܰ_WWUGqEޛf?2#1 ofN6}-Zc62 -iZu$mVҸ9ww\6kZu^?uv6ǖ cxֵ+ p9|i #vU!`;~>v8hM+"%ʚv u\*[,|;Aw$"qQXa0qX*$Uۦ0eUr>8)"ɜ}?1\acR:e\þlmWHƼdqĕ[FֹڄlrqŽH5V4A} VK G+ To&0JveE 5/ U<)j2ӏmjIzPkӮ *jA1Y5EEhIf mkӚ-qn4 j & 4i40ۭ?W{$ZӁjT{=zmawN_KG+֯~F%r (vOl^!{ZvGLM[^ڴk o >ؗ}` T* ?2܂k\>5xl'1z9mPBbӐ%<+Sz d@|= k UiȝAIUʙT$xe#Faۧ\9﹭:f;a[]w| TbNֹ|+eR:|iwmar~6Ϗ\ 拙n)V@T>m/Z>h V,hOJ ކPPx*$7?O\7:׿l qmAUB¿Z aU@NXSy-,UE>xUNFc1KAUI&ޔG« Hڠvߐ;W4@Tn+*ev.TqBBr鷎]yJe!IO27M>Y]kVQ7*NG" ͹}RZ %*~`@n~_jS qWOP2b$jT$wڽ7e:tZsMC˕<QJm+bXmJ.!!CQ S/FN7X[sVާV&X6 tRMhN=lUa( BOkǠ5͊DsƝ6*g Mߛ$#~A]ڿvl%V4؟l (VۗN]X5JB')J|D@({ $߾X6JRvbiƧ}r!.!"˛5򴞔 oLMRX Mc B6%n;oCQ9%*!H4$-v 2zU9 v>L ÿ^첏~إեIuS|*7 UHӵlA&?\}1,C1ڛ`BiYSVl{?v[%UU ę텊okjЃM}{bm!5I>+CJ,dPPJLr@#Sfe.oC*j>#q^Z*nz? Uw~52p E$qmCK+? )hn튭ԡӶQMzJnFЃ|iUEjvtbT!V24܌RH 4a(h{6ۭ>ql~UY7^z {ZuڟԎت&W*⭖Wc_|Ǧߎ*$vaSiؓ(`VK ~YbҸf4ڀjZ[}Vv®+&5o$L};e3Ӡ«@w_Xڔ⅄jeGъT+]Uܸ4>b|RB19MQ5v H4rp+e4{\Ȋ_j[:eSby~Tb4~æ9h6=IV?#VSPSjF*[,m9lw7pV:V1L X5bS@}6{bM?VP,W@LpS*}\OC x]~5A\WMRن<*rkރۥp*ܓˍwA犭bkڝǎcjj *j)Siپ 8>=kr@+ޟQqU@N$q,8Pѷ˭S#5]Px.WV[PY`ԃƾVT?雦ث\AWƵׯLULTcZpWq=׆P퇒x )]:WQ!pZt6?\TJA6UiIND1R9DPS%*Zoo߆f$Q :u.܏&Fq޽6 P w}Sb|P@; klH2 #=lk^oE8zoN}5rAS}򈨡lO(6b2j. Vu?,ܬhfe54$t'p-<4 qMрoic=6>]7Pu:;--odSe)tӡ25\FF8Tb W/֕kJ5iVЏL*m~AQ ikn~N, NB]tq˸l4IzCJcAQtӗȑCȔb16(;r^iV{b2*7',1ZaU29u_.w=2*U hI9|v߮BI`I Jf!V$,%7T嚤SM?O ҨsZqj(ojo}q*p?Z]!ToS'q)QuEiݱ )NoĞ)-lH~dEv1Ux|[s( 1W.b;|Q$:⫔}2Hu^&Zur4W>TׯyTڽr4 ~OLpS d#cRz\z{c•M9w)e*CB Gڧ#$UxFNm X@{rDK|$rE;`kUbVcXxzרqm[pGj t;}_qfHSP˦J?724ްft#lpJi E:'#ąZgjOZ{f+_*%M7Qu?AI߾4tm鷎bTJfS6]|aWo~i }l5=L^W}يJ_֧XkN ieq>;x֐_G\6Z, q-( \()% Sa`cĞڔlխW1L1Rki 3ʤ*'Lv7")A߆VZoZ -R E{bemPl!u;fߕ:;byZF#oQ"S Ccs tQ"$%`<8VUK|k\#a|ru5VwKG wȐ]dQ\kH$L:'$:1 ^mӦ&nh)ԎّY`WaĚ~\ X$$mprш!Y-TMriLqS?:fb|@1(P~CMm& -Jo\o][`>#xuTKp%6`ƂUⳭI!v~?!ݲюT{c Kjv0}r2WOq7a%tS7tJaxUNb+CNƽz KK 'ƵLa ¯;1^Hj+}O>O qf>-zЃ} ~F06êƛDzi` +|v [QL< [/Z=j `ERI=0Nq8}p v(Mk$Ҫ9D4@p^4|`4R%O*{ ?vVPH;*#TlvSnM猠=)\IS$zEV-"W˜$uU:^­ڽ1Ă<0R`=­5h~ .aSC|ӥ0+;֕•ӕ7CXҽ1VZr+YɈCp++ؚ}4Z,AbAjT:R۷:;vǩڸ9*Qӥ}S:Q]{]>8q# LJr.UorF;u^]?^Li 5'sVZ7GMZ=[Qe(S,ʛf^M%+]:xf^q*EG4LG/b]ɀ5>#^A0%N :xW-vV=X֛9c@2EE1U̪j{v'0*ҡjv56\/ȃ}j­ҵot|hZtFYAiA;M62k vOכ*oP~<*4v2?Vkp*:eԑCL UnT&SW7ھ٘oA)ARǿc˦vV܃jQ3[~;oFJң߭Go5;i~N >_9g*5CC]̘Pvl@0qI?|p!(@ x UB~0jAˮU+\pZ6&?UaJ ^8PͰ#qIS>Q^0Ԓ~{ )]0*٪~ier.EKoQ]J`Q45J^B74?9FY1,B7nWăǹ+RܫVCNQl*ڐ`: m޹G|Ug @z>lpn]|~A 9[n8JD<zij *ҵ=Ron=~ծ6ljAɲU6_VYD4W(|3b@ d=jO*~YjMlUH%?L)[Z'qovH^| '\N1g_]q2:o&Bہ7Pkw„|lٮĊxSYUp=)ӸqU@C+B+9:⮣n?P]U" zp$%S+.Z:WŔefLbڤ֕?k)*]3hEnہr6gT޻}p0Nxb^;OnFңq_`@`ق%EG` X.5snMqJ`@_n9@miH],+LЍ;b}|T3P+:aUw#'z b $ؚl2lR_Ƿ *&LH.T.թ w =+րaCOVZV'vW3 |C!]< ,\Hƀ)^qbR緾X= PӍ}NHƢZvۥpdОGzWlN| һ ҤTqSV(?#zTRNCh֟Ƕ*5jSme VmqP> #cNN튬j|z Szlv\āPOSrNQPY=pBH v(ޔzSoٔ=)\嘒zv14W~8jZ6>ԨVsCZlnE^tOI=<1V k㖫8ǐCetۮhÙ؁Qܟr) @Z 7-1( alP{ Udu PuMO@Er1 Yc\0A~.D_aQ®` R1>=*jav.y t ~HOқrXΟVXnҜ@JNCs_ ]'5&8Bh+UkBv5?N [yVUcmmBM8E:ۨx*%(zZ+@1"yOs.XZbT%WlGNҸxЁ0*U554={d)URoC|TcV ҠoNi*\0 ܨhy* ?lԠV`ZJ>ٸiVABMz{|Y; *电PJS#+n,;қ4*LUP6sOrI  ҵ~dJWfYP?T h6{ҝprJl…*IqƛLZTwqsPo~)LZ- kS"rCC\Q(2ȎGQqHT}4borv(Dϑ(<2,%c,;ahl؍ɭ>XǛ[]jxv>Xm bJ-4`[fq-L4O{mC{ )d6-!@Pn2`2J)*7g, TzR:mc A8j«+q[0pXi@t1?vDž<*ߣP .G / 7T1e»af'o_Y=p-.:`#(ܓ#´Pwr}1M)3@|w*+iaӘ$ZMR!؎ٽz -OJ4p+!yM`mu$w^*+-d$&ֹ`rĪ(>MvbS鍥zUQ :wҙá1dK%JSjĈm%T6SсVۥwʧn\OW Oqߧlhq2IUPV>Y`צZTr z759SV-/V|U6ToV$QA-r55?Θ%\A' M1BE %wːSP;㔓bovOmc4YI#Mi㗸xo#nohPO_on,~]irE5=+:zCGH5_m0n_ E:(0bhjXSJǩj)ƾV@R mLh:UKQᛧڮ[eAY@Vwpp4 *nUȥhZ;S0޵F21WrjT*CwQ>aU4<gqW(5BN,kW7G GRuw5rQq ֧ms.jE`~^ٛ;V46?}Oc*6*ƇZp+$,6p:{,m{R@m ,AAn5f]'G/z PR?, 6,+uq_Zec?+Ne-Ph*?٥)~Ԯ*H`h =>gxbU4AZL.1iݏ6nR,tzkw\ZqSAB؃0ZV 8@Pqa] SN*HG]( z`OC4$l:ӿO,u(Qbs#'jBW1S ~U4[iS Fg-P|O|m+ I TO[JPݩJSƿPۦK'>!b9,z*oo,`Ux_}/ A4V++w'zͅVm*^U0wYX [_Tр en(ޝ:sbhs ԍ)RB>Y*PvaMXE;vaH S?k,a #}12@RTeb;S`pۑH5G2Jv)qK<ѸCoo\L`ۨ|GNz{cI޸uuOP6* j`*r>xUUo`:vVP6xxcP]}]M(HP~ت-1c$X 44fX-TNpFn>iR2:UlPxA_ P hi@4 [+$gS -Ow{H*Cƛ4u]]k4GU@#S]He«EzvW6CA w#mSMķ|Uv7|$UlU7:{eq2H(~^mj>`imo*"IwfUĝ,|v3| 5@z_MZQč5`* iZ1VylMzbk׮i_Jm^,||p*ff*(J~dmVt c'sQ$,k0ZnQ5,UxAE =^k㷎jB)Շavm*kڛ⫙n:6*hliMc97˧aV6-ԥ4H=q卍H׷>YdU5U,(j7߯ͼW\$Rܡ]m.H+teANتMQ^Cv]7SGr h+׭{e >uRzv@Rnϳn|J{CȚZv̤OOׅ : j=ߏ;OOP1N↻+=W,(GV(7~qJʇޝ;-U'*Ӂ>;bܖOQۧL)tgܝX_m5Ag-M~xNaBPEsRhiJݿ1ZKK'&hi߮Jԓi mK0q!!4^tNOSCOssv;oYDצRT Jqpӽz>c*hJeU.(ZR}JUE;~* Pw'm>׽?ʠ'Z;-h J{x䊬fSjh7`ES-IV{3tO\>J"ƄPКy6L$5Nv'R2Y#(ZVnOJGP 71l2 @jӧ_ז F_&@r`^!u[)jѐ7)Tvq{4oڐvV#Sx;?ȘC_@y͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊Y]A:yFJ=qZ[@l_+ik꜍YjkRGM8v~FևǮnjzLJzkJmQ +|+ZR}XCBicj@SZ֧ެNn4jjǪחk_kMT% "ڹciRml1,^Lmx\ur܏C/$!*I}`^6UEf).<̋) }7|!,jX+f!z2x5:f4%z( (a#CLJF7;9 )SJiBZ^X<<W+Yt2+.<)V}0 8<{l% |vSڝQEP~`Zt5iW](wqN( u޿GՍd̏y@,Bzl龏 ng nK{4f& K$Dv0baƉK b-rA2!VCk2#; g;W.XR,XV?bMs *B> ' >UĞ t1W"ׇ,O 2=({εF)EĥHyZ2Gť*)/<tؙeHқcJ5 xVK( M}3vIO %4AnF"+M#b6Qc~zv&N 4i@qT+־qX=RiyQPma4;#֝*qY'\tQC_&žҦcxTZ̞}=Y0R8]>[~yqWAlWu |z\1!I؞|h}G|K/' u8>n;f֢Mw6T\B+#ߔLJ)v \e5 )Q@(Gza4"U]T0zLN㑤|+ON6s5U M<3P@[Wf홚үzWt*zYKJ`*݇-#-J(ӧldUo$tNY 6|N Kgz7ۡ8کr;ӯVw;QAS~0SJJN޹I^ T(8܊ʭM+"?d}8foXSю U㪮z <2Ёsj Tt;eOqVhxZP͔׭)׽q L6 =H޹AI؜R8Z,ROmO,֛u*{VR:r? EzW4  ڃ|P =fB8U 1ZNU 6ֽ[N|r)kM~k+aH4 ؂?b;⫔iNl35kV̿;bH ?+|°'si/_%-Hv1B͂==kJu8Yt&t[$9¤mVdeR0+4ԮB݇+S)uxjt+CL! DR>ۧӛ*OMz}[&o\*hd&{ CJ{4yQwe} b$5'^~}8Ҭ~@T}wc\HKނ,vQBSXd µlS=ž8m_kLUŷ קSe&RZ; f \ 磂iA_p*2ӸYm[ZxGM`7VOڧeFFܪv+ڻfS^R@GSqU[=3 3 s}0Tí~a]cCR/[AVJҤm˛SjR?NNlR7S69#ʤ~c/j˦Vj+]2@*ֻlaUZ.~a*9Wny*V+߮~T2h7۫ "7jI}k n`>L *7=w㚘+(?qZx( \e~Zt'Ǯ%P7lk~.< JnDjY)\[f' E+CXza)Ni V-L/MxSI;Y#ZQ*Gnc*%jA߿|‹ZRԅ5۩7qQbP(+VURtq)mZm,MU7_װ] zқ9bV^()٩]W3HoT l}UaPEj|)^u#j NA߅W'zT7cuȕk'e^'ǫ9[Q]5N׾GG,lk^V|k7UKTrwpRW<-i]G; dPO6WT }~RB r|{*.w8JJt늩MClNWZ*T/f#ƃ2i(tX=STd&;|덥~R@gu6ï_UYW{}1`~.ZֿaA؂Ho7zlp+("in+hG-jo8OLP@f"iK`R6_jWqU~7>]+!ZTqUR':OPӡF6i|)\ݗM5ƕa8H߿ߎl|;ֽ)Y@ W؃x R8B6N1j튶GӗB2w[NK@6cc*I Ox銩H\P ' \ZTq4BOC^^ [=KïN@+Qs? O=]ңQ/BY~6xaUŪVj}?5)TIVǸc⭆ Sq y%a~,9E)n?FjPL*9A鿎%VAר\0%I7POzx.`kVJ*:o_kw"WI5ieq)Y&{<XFYhN޾$^٩^UbBGO'14+@hZ=jr48JT}›yn{REh{ߦcV:5vP C障U!^J=9aiZ˱x(@%i(FԥZW V8& "\(nxwCl[ہˢjOQAMw.ZM#Qƒ>zύczڨ~sʳR1'6K^6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊l,=8s,mfɎ04훀i.˥X6L!j0v&AL Ǿ%]]Fv>6jī ;{oi2;1aWe .̸a d2Ȅ;3a*]9YvY(vU0R5)CL*쬭.ʥ0f+Nvc6ILUٱWcvbF(vX4]v87,]TC%ؠjbت>SU`CXއ|XbH`+(Ć&4");`B0Do](XG%:uȱ*ek"ߦDE!f <;e2 [sipiA6$ (nz  ( ptSqk1Jn"Oj)9Q -,l*plw8i8A6=%` )mK]45| ʥh>~E*>;NƙQ :7ASBNm*v8NGEa)^{Z,ZN24k-Gz*0t` ֥k#hY Rz~*k£&Xm'<-:`%i ")@`Z]-Bjy|qZX/ EEGZ}֚: $@۠L9l7Q kJU w~_k7kz|[ʦZ\תj*w6]0ZidP*M+Yi˫EˎjckNkQ;~kKƦ Ok+N:CF4"xpZxTF#5m}E0uX:Qf:ck¦q,IcY\K§…Nǭ?ͳqșRxT"c 5>`O Z7)rƞyw+8 HT@~mP$`OC͹/s9?˔0\HFON>YD_)idPyC|TzPO6' 34RA7M@V)lm|t'_:?wm0/!qa%vxP8  v8ɰv|{?n]V7M Z,UUIPsx5cQ(\qWq@;}`Ȝ,K@w8l:x_v:cjvى!(E}Q@)Q^sݰNocZЀ>Xr~@?[Z{VN%1](0f001IG¤erHSkwp{fH8hqmT֘ ?:dIB7UV#Iq'T A׽2DJo&ըG};!rOCo~ Rm2ՉGh+@{Ҹ)5jҽY#WG(iMۧ  MAlSٍ4qdR:LS9֞zx\>/2;R8OAȩ1fHD"j@ JF[UP(N-`Jj~cLFؒX*xi2 iiˣ. >;"|Ɏ&[N'ĤWdG c5ҘɎ4_5JOuR> ߏ]m${ DQi_ 2GåW=SҸAzOu8pi TGzMp7Ht's&Y4M}\A2j:4*M+fP@W-"ʕ w48'놙ROJO~Ɵ%IV[Mȧ ^ҫ].6G MeȚ,OLVPWoXwՅi剻)h<2J|;bр/Ԡߦ+K n50'zږ`6qoOA rM1!Lچ5'^YMl+7j¤:ԕ"#Ewz>]uEz f&(EG۰=2dd"{ iت*&iM^* Џ"J$*F#-4Œ2tJ/nlxB9Vb9%E5NeO7Ƕuj*Ooq>VЃI'؜U8;o*sҀxc@ JC/ؐi Vt,*@<*:ti]U3B"lm+\W NAZՁ +iOrq P)o,9zlw8R?P5s֌7-ԁOnٖP튬YT,\ (rm`*%~#2ޕ[Q׭)1}j0<$t cB)Me߰Z;EOQ=⭪t? Uaщl= XnI6ğ+~Ua$P91 `܅q*@ZnZ1K"FCri]OkJPH5Sñ[,YCScM9b+\P=Hoƻ1J)AƠ”K/Ƕ)Q$j5;qBV^T>4s6mɡpv,3:v-;*j+J?  J#ʛ͚BҼH1Ҡ~xU)~ap%Lp~JaU!,X7gG/:piӸ9U\ 63b*Ï6~VTU2bz1تYoZYU*Mc/J[zAO™XPO#헊A;bC`N-VԍeUݷ'dZH=M;azo}V(jG˯j͉U@~^ٗU75߷?cI!0-)U's˒´==\J 7QkNPK8iSi˴[#T}q'T]S}r%+a@)^:Jeتq5EjzlUޘUoJ=Ei2Hn7ιcҘkGաrȯLUKZmZ Gƕ1 EIo Tlzq Vw6j~(Oz UrHSA`)|*9-lf+#LrT,v۶j+1Uū7>n}ՊXO#C|DP{rNKP|YmZ vSWH_q U3-;~8 7'7?,0 U΄GaJ+Nq /ӎcJ=n]ĝ1ہTSєöU,7mYc߮(YʋnrY╿djǾWNv*9 V+:\H"G1BĊwM{aUܸhI1ap֣)`(X~iEw._lYndW*l)QEq] WaMf?ZO Pt}Džz R$n L*ؕ ҟti4$A]%Ah (UQ Ё_Xjۨ9mNYU3(ڞ8U##?W}+UG~~lI!`):n4\\޵>˖A al֝ArmL)[~` N\ݷ8\c4_,b$ƭ_oiVP۾*֣޸[b*´'n"L)\EM>e  7M*mZF &k(r h{}XR1JyU "۪QC\*g!_L bh1Vs`*GmoLUg_O@63S^MCֵJX 6<^bj1WT.N]J t޽6j\B ѽnJ{njVUhIR=Ƶ m~⩧>s7 1oMcymNi-a]mqwd%6\BK]*wW`P,7+&ُ*NGݜ*åܰ3ym{ +!!f~>2Li/{^93RXe#}ڌRBڇm}4IEݩ$J S{ iAuROmRƼhN㷇ӋG6=EYq] .cKmICO\qe& K`ӡ>%u:F G*'ՍASMu)zTt*IJl{D4KD%U#`6]55;"΅gUb>o(:a- zw1QpjWl'dj2>+IzKlh5ƴFro^Fs_=ɳ9P:8]VIMAczn9_Nh _6k^] og/yI@#ƴ5\?僌;Ϛ&`*zmDӶB41}~蟇6 oSA8)bڵֵmO&ѧY;e SO|CNO[VQf0pȨ)}~? UNnj{E/jwgKnxď>/ 6i䊮ٽ}QkXP>Fc9ָIZ4qޝr4IG78,m[A^aA*ҟ˷7mriL+AW -m6 $cN= iŔ63z+i74!PvN_2'9- O 8&d7|r+8&KzelrO.,Ciw3n?/yҦ7L"O//Ox勳:d~SZ(@[ "Ǒ0LBK:ad"9 {ώ~"$}|q#3h5iBX/rvRxQIeM{c NK<*/P1#r q´b: ޮI}ZSI㆒aq Z\-Ȧ0MAlrrz॥UPlqNZh"})iKvRַu=eGL*مOn[qWqaΘV~Y~| уrsK{ 8'1RBN V\D kSJX*}۔ RAD"S=LQ@cY"zWcILUE6q7)l1aFOcj2)T CƂzWa]צjPnkAZ[mj+JVVa8/FaqA@)e߫+1CMۑޘU;2I]‹E&cN](X m|l,9NjǷ`U3ӧrՋnH܍*P |On\Nj ڀ?˛ߗ)Zaۏ P|M^$Ln^-0HMwW-~G\ Sa̓ LBh:bUơC9ԦƸ׮G| sӯLqjmF4/˯VJ(R+`MA5mNn]V#~[nWlhBU ?#;jS8.jJT;RH'cڄv?]mn2;bUڔZZU„P?:eVcNm YC ?͛\I@׶Y0@sV6تVsr 6qR)}8c@h+ R՜ҀO,:bP!ARW\*I 2[n#z]?P5{J܃#cM*^Uvh}ʝ;mVze$&?3*mO6ԃp `)M87Bƈ) u'oc^qPD{iJqUT֝I~. ?lN\dUNI SS#RVGG1\ w2܇@*|Gm`aCR6z x6%5_iƛwĕZff*=zZtZѩEvBqVm=s%CQɇGlJF!E5pRxJn?,`U9ZRw9R4`zu ȐY7#f\}:PU}emVƵ{S}MQSڧOR.CfWjxP۫jC6%*(A5Zܑ֟fƕA XV`IN}\ƕi4452a ec(*<>YIX^嗒U7ҿ,Zg4'q 7H2I#ƽ<*.KI,սniS"{1ܞ+mo A_:nN7 |\aH48 wҽvlbP_9\wU䡡  vXoJ]=Ǭޝxpݱ%4Hj#c`b@(V0׶DT|{7vȲSiWn4i0,X {x +VWcXTUP@=Oι[^ni㺝Uxu6u87"$2U}U><\0?DoT Oa֙`T.GJ0}uU?)~i# cZf5v=OoW.'mU}AFlV)U ˧O31Vr_zjVzaAZrq@1U#rY QNcȑCtNbrrw*"7#ژƻuC˘!#i$584x {eV#|* >ޣ=|0!I߽~~ bjr; r)ZG'nrw JK:,VwQMtbcB8¹[qoޢ*A|zTW0ZSV()CU Y#+׮P|+nZ R$n­H~"6zmۖjb0*œzPhwRwX@ Se?dl7S?/sQX ĒGrۡсVĠ0+ ;wDWs +q5*WndUgSCn4\FCE+I16vk*G'QTz+NT*ːץ?Ϯa\ÙRzz픻. !':b-v\~-[&$xN5•(}SE_W7(YQ^]홇O|Rځc#m(p|7`G.u، ,TۈS,1T3aUH#6\4G;?luk:Ҥx.a-6' kքT 8Ijzr<=~Yc=N= ָJ1S!V IiZHJָLXl~lmVRvߧje\@R@'_k(o*B_f>8Ĥ4mߧjE mbǧvpoד ̧lAN[M*+LuJer ,niO]_fKzl~U!;j<=6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbUh2Qݝ6EnEI Ban_@+];5rAǮ]`̀-v2H,w 21B2jHKwǩ!)܌)v;P+@6\Ĝe%ن !ؕrv9h~y(;7ae v_NJ*rj]+k.FHfceD edUٲ %vlUDaAvb0vlC`Wf]bLJ_l* pjd)XS4Q^ت501.Cv(L,Hu1usZX5cpS#F cZ+ 8%@ zwlT%l džUTƐ7ӾVC\OhEOp 4bZZS?]Z=i퀖K-ȭS`啒Y'IȍBKG%q! mբ'D|qJ{@(Tl *$#)0E͟!\ip[$*ۃzW8MLX"PWv-׏[t-U ToK:uԅ-9urޙIMv=oOo eGxTނ˿l4z8ւZpte)D+]cN+Oe}H35@qMY]]odfwƋ=OObrhM3^"!Qm5jWr?V# /b=Xڵ@w9ƘWZQ~5z[fumMrM źQ{e޹1zXQAJz$Z6-:m7l+&> {0L-Yt;Wu=r^H/n9!O_)@:n; ˣVJe}l !h Pv'ae}rF;5NOxUHzCzcFZr"'10ri޵Ca{L+є_^¼+FTo_oCG_9:S/낸 _'9jixZKMs}d}WFaOI!7(UЭ9T1"7 P2HES?1O5C2R;x@5;SWo$, |E!zLi_lI -luX%p@328R6+ZBIϐ AbQCSoՉ/hRV#LHLP M2b&68m$b=\4Z{xNvˀO qkbC]4d&ֺr݁|$#(l^y⵮Lkso,O aJtj{"(}8qR6M"U'߯Sy놙R6+N;xbfz|Jֿ!_Z\4Wڂbo6aJV?,L tz8SlgAQT$7=Kk(7֧lHiC4!l%EI:t1~æE]zk-;ъqY7ߦRx ⾩"DV哰eK*z{bĩcъҤ=I'zWl/'چ+fQd0Q@+휻Z0nTAZWO֤erB(*,OuڸjdU^^0zUuq|qԃM%-m~#iw%P4;![ov=k51Vy/#MϮoq=Jt2P~BqJD鄅Z7R)OMw#rWqnqUrz GCZtSAO\p ScҔ'7.4>4%hBV\ji 0`i\ c[  VڠᘑxV$x6;w_iқ{㘖o ǶfP`EwrvZf'&Ӗ}Mڝ_ "e߭0D#\L(Su -kֆcQӶ!->`zON%mG ~MUH)^'qf>ت$;Pى?+aҹTG*M@&a4u?5?5)^­ZGOa)ޣh\|& jh68["A&as"Q\mw+4cN;`(Xe^߳ [joQ\&*cwlz?vw­-5v|2iUCٶEFywª(Wrzs0+bAn$oJ[j?O nX =y$Zq*EA6\=㊜2i_UU a$| rTt4?-^=Z.t\PhH+N`yWISx`W6Sᕿ BВ>}>-ȡHZקb{乥oM*>9| Z%$wl|(SjWހe,"}J,5{uV ĭV^W~*偍T7jVpsQ̲#?Tud:R~"M oN`aU6=BШ1FQlU0 MHu|­I#`kN=͉U(ZZ«zzcv8'<2*Ac@Gͅ\@:S~/ ĝ‚6*7&<$fmڃ50A  -Glj2*?)SA =l ZrlsV'6j^x/HA;^g:\|2%(Cr.wr رE~w# 01)/J/끊aSMU1UapBt+E ˷~*qc\%ؐ(jhIf(%[L c\@J#bd2*EmS|+\SMvj N.N,R *>iJSeTtW),z5S$PTWc P64"k^Y_E^iGʽqm֬*oi`)\)TZ~}9#?v?r@kTBi>ت5w$߮[׾*z7 ODRov#S]Jh oBjHRS.1Uѹ`h9db*;EO\ ]CCaNTZ#>{ f !׶mˮ*FknU1JՎe2Cq i£>?.,iJr$]X&|;juʨ"bU!⧖E:k);WZHW"I-_vVT K!cZxf]늮$t'p*zSo5I>5V*nJdwZBU뿏SEzա=6 Zy ?,L*zOLUIGڡ44+i\UY^@qW4jlkJ\늴ѭ kS>l^B>.gVN5QAۏX r:4nco)P,QJOݍMik CVzPW wf ܶ#zkFDhsuj+ j ˉ˭1&PkCCnaNتI#keoZ#dPKN$n}Wi5-T *n@)SR7n}Ul„?A9O^vJB ︠U6"lt[^-.ztvƻ|[ 2N{ǿcc}v{mȻEǠn)CJ.rM(#s ]ʏ\h5so^?Sz$m3^vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb)N6ø::L,~fv4sKWe bU`և2dTd:0GNiFbv:)C ; v=l]UK^v2O;%ا.9+We= ǒw%k;TC`Fv;`z$+Wf2cji%bMi iT‡cpvcŃͅ]U@cHvcCWe*#jACI]p+6eWfWc ]l,*Q:cLHv,cNŁŋD|XӱTb qbCtj 8*'#l HZpB?o L iim"QKG%H7Z H[el 2ڸe`BUwfN59Rj-a7zr=ppJ׽F Ivm0!-ӑ֔۷IvȐ=SQD59Ӓzdž*&~W *H߾x,9UvK+ĻDS:gr<S 0 ě\ #HKQ^[HG ʀhFƑµp|W4(Lݍ'g?1'^F S+=Hk@k-ntmSQ]  ґx_aZS*Mo9o wDžU㷰2@SG&OClxICAO~ewڽRқh*h1Dž*MWe#Lƒ~%]Q+rP){兛n=:mǬ2;fQ,H.|kYZ#*"UIqs#ts%w>L&A;xS(ȭ"< (7Ҧ!+c Sj)4=AWױ鉰]H([|1O-> td!0q6\ɉPֲG'ZLQIMj+сDYv=g.$,×_,.HC X0=7rK!HN- NG|/ 6 @`+3ӧL<(!-65'yi㒤Rvƒy׮ ZWކiQlL: iUaq7M*,t3;PB]2LQbcq e-4m1]֕,xT&plr6J$ubrhp;lqfMUk7*q"4}U}RSiO޸: bT&4&P#"v NNOt+)ױ>Sx|h~Frt戺_L#hs˰޽?GzIW*ר>ʋ¤Ss3-vE[B1[ zש r*[׍<6ȥq}uȪF~8Upb@"i qJ /p;w#z PNYOݑK_hPuʇQ(?jvƒNqW P†{*÷銸|cb@~ʴX>k4](V֘UMr/r&eqZ\ץJeϾ#~BזzuT6'^5kz cAJW#Jۭ?˭6?*u]ÿ\P0ȍ{aKf5opzo&)-_ +Hv+qIې$9Jܪ|=܁ƕc+ eSgav▅vJMkb+Jҧ5#޵*H??l(qBj4|`ҽ֕'AY lU$רۯ_,q*jƛVƛ?뜠ڧ.$Ԃjk]϶>54Tç ~~j.jv(M{KqZ \8׿Yմtۯߔcl85zQWjFpg]RFC|Ԏ}NY}UeJzfn{bT(]_}3lh4TnGk/TzQRcŔW-~Uz ̾h5 CRۏO HBH$}:KeE<A^k%B֘D cO sS F‚S/*"ԦiB=;VMRzf#*q1c62Q#T<+6lNƝ机cjGu ryW~ف'S૽X|:╅ŷ'>y*j@?saU RrT8!RIثb((9^=kfV@A/T0**Ifªr)O ؕsJXw#}g/$|ٰ@AZt2`!aZ t0[S֤ГҧL٫Hz}i1M 4!ӀxsS+%_TJMʝ>켒TL+Qvīvʯ5x־}ؙ8k%Xz@1bX*bj~[(#I[<M+? R 5ƒ MN$(|N*ڠGi]V* T^*>xG4I21V3ScV+rx*z|ctUrhJW튯;n$_ YקC{zo*OO \~UwҴv q5]Ϧ4#bвiSE;Uu~*8B bzep7BHbjGqVgo rrщ߮[Y Tt`0LΤ{eRwc5?nG-JB (1CN1#sɸ|1Uj /хV)5RF6nG:bh5?ONc튵`O:銩$ԝ뗊 7vW˦*MqjWjwcOPu#ZƊGO'1`KjW sb)kF>$L=),LUdƹ\kqKN'Ѿb\U66#؟\ƪ7W!Ia66状i`zIMxR~|*f<3qCHaAZviv(D G}SozKmʽA#)^hR+SE;~^!xvx;8RʥBUSۯ1 \ M > f UxWy6?f/s)?v)Y P|Uk%V=xv[ܵGkQڿvazVrc@~]|0*#rC$Sl"ӓ6@?/rT;oS?lROZ |Ә*j}cRv)Y' ]5ޛL4-s9«:5*@9Z4#f"^*2QAƔ=^227{W *y4h]%cU(I5N?cs㊩H +srIhҠ;f4V1"ǧ? 5$, ,CRe8.zaj2b-J O53 9i'"bmw:|+*AaɁU{W:du~h%K٧Mk%=,#,wDS޲Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ tɨ QW1mccK]Hĕ>I.~-ei:*M$ ٷK@qācxl5]ڝoRlxaRraZm=+a(I5mracLmN~Fa-O\[{"PzҘW}-pթjmýѬ;֠ӎ4Lt$ezrlcPqxB$iMZh"6mpYoe*O0S iZ='z۵olio 4L: lc݃ŠEã #"3Z- iRitzA e1IxQ1$wĚ 2Bi,+Zx '^-0mc{KM>cZ1Dž< %^e2UOuj{bf\ +t7qO4h7#7\ (UM<mN湚¼M-h6)cMzO ᦅV ~s|q-NƋo"i}oq:~u W|ө^c];x~|+¸G/& `9Ze-دP0 oJ}<(t}Z/Dt^P֠xcp)MZ߮<(h,TKiA=7#;^EWfկтP$~ZczHR6[X/ a˧\s\K¦{Cb#M}>wk4DžOq;RtjS.v뉊m?.iRm4߿LxWM;u?\z;H *)LQnLQHy4um_XWuxBC)>[ o/b@ŖFG( <EHnl^=TߦPt೉!&43ҌkI'ii+`z!nŔA֙mx L,r4 :u$U2BE3HkjmOMQ2^OWɬ]JR'ze/XezqYV=iS15HI-Nv9p (kg BJ3M˩؞ԦXeOloYνpր *ez}?ޔa\CS&ClC8*E!ƕnU)Ӧ1J,D4cQfY+|M0) 1B:]2 \l.4!-;RPlpBJkbB®ckz$ٶ9Ȧ|VX|'8hت6T*k1X퐐ل>Լ?+5>QSxn4 ܒGM|;4"WWs _Ә7J(^RMI#>$Кd 6POBlڹiM i@Q[^ӍnJۧcUe,6189r!Jo kҴWh36#~u|p+[niURa|H{CE¿6$vUmywzƞ.r(?0$m[`B{l5QL (e<ɮ8P'+-taO )h?hmSYN!V1E{ l r)%h  UZ )MFqB(*wȪM@)^W!C]WLUMW5aFP⭳ԯі6Sj7Gі=銹;4pR].aU.;fSsY1U` }[x{URGoxP0*ǥj.6#QE-M7t|h:֙Lzb&;2A߱[7",u `U2H GMǯxCט\UR N,`U%/Ն9j?`B\>Sm=@wU5Ns«MnZPj?*m('|ArX);)0;b1֭J:}JZԝ w:b%z*׶Ҝ=X'bHۯc܏gU.%ɨojk+ԪX_Y#+RAO朱UkB v??튶fܒ~"}, ;AGߘbr| P?\k0= AپxB>,%aj _ql +CT;5*&V,ΠfT~U= =LUiĊҝ~\U(I*wY*; ۡ?Ϧ^?\l~=N+Vl oC~%R$,o#+[TSqL *a^HZ;'S d4)%c0`TMj`qT \ X(?2釅*^jfĥHb*:\z`-ŔU,-˓@=JTW8ee,΅?V"3c (H+B,x}SV*b}qdT<Tw8HA(hC@H~>r,INlSc 8ŵ;m%iPU)KFoV4 wsM^Pxt«ԩw(u[%TWz+iتǐ_ {b(z 㸩e,5zm^•Ɵ G; \taUD٩xx!@[15 *Nr?7LU§}ێ:8PH{嚻{Cl\]ZSz>)\^ءfQCJwXG&WScA*j?Wj6rUfI;hƿ/jԩ5OYn|* _?W|Rw`xuڕ=vlqBږufu2vjZ7+2­ z+QV D.zw`Uߥ\)®vzSYV9xE7?,UjI @FcZ ws^UU@#W+jul_|4+; u$cN(rޔ5y{@`~ :׊bImZ xe *((rA^U#*EӊԧF:tYTv;v@NvPO 堌GWSCLUj A]|aV (To7fzV!()O1̪Zof:tVԡo{u8Rcȷ]\oVY+R+6 wxw\劭h pmUǩYѾ* _Cl69gqLy*݃#<4 mPA4J5*Bzo늹 `~}|>YN{JVj*7_ۗQITͰw˥wCMO^JMZoB?r2nM*AkF4?HI<25Te#v5;Z&Wjv6+$rI$j?|*BoO,-TU}cA:aKg^׎2;cI_%@c^MHzMٯ^8i<*H^$֔yFvLJh74xUWI4Gӌ7C<*Hى7i !w$bYGV&U\*T7gO i`$bmrpDǧ}y*O i]zmqw<*Re4Qo%I^416pVM?Mjž˧tĚLQ1Sj|i&ǹKJgP ㆖:n +eK(S|iشg386-F;LM. n)ϵ1Űi -\Upw9^qUWfz.1VӦ(@ثǦX=48M}Pe' ރo_>8)4ꣾxն#|GWI`)M`B1@2Ubޣ@aD&v&NWVԂ7o8P4"RZb<;`W@mlw銸"E+y4$mAM0\Gkk׮FФ0۵~W!BߧRLi[vkLrM61cRz[W> YAqJ5mM›zgomVr4+QLzR1㸂vTː(7mӎЦ s|>sv]`Kt{e+Nǭnf,OOYc[NPwd=)Oٻ HB* F_]pڵE0*MkM:NjZ˨'SqA^bO|UkӡզboP|=cm qO=1$ rq" ms1;"}aUk?YVp5#s(Gs\1UJ{e*6-Q:)|2)n45r !TP vlo%jBVs]-Z߽kr1UiMq߮)6Urw&m\i>UTQSJRL)LUEI֔m* F?Xŏ)_%r㸦9V׮RP~(Tax$%i5TYaJr'~އqTb;^?,`JsRoo0\HQc1L*`5 Zmd, v?wŗVNޣL*ܼ*3S[?5qVd 'P; 欿S`W]sS\%^߾^*BSʔjS 6*0*EB͊<}g/S-*kJU_P?VlJVn@bL,TT ~ HZ Q] jv;u˦J@5aWr"Ww!cq? +`1 j؀|rwᕁW9OQ2JH&N_l4FJ||0ҁ%jT"Ezxܒo0\T2'yHM|i] ;o_|ibB`({װ͍*r@*JO WMpZf4?F4, wcfdQMqlkZ-q!rȫm8J<*jy>5[VEhwڵ6\Cȏv?+lUUebŀj|_/FrLjE>bdl@?M31VN5#~]=n[[֟ 9Ol qz%{ >_S*j~ʞSĿk/~1U3@9ڧZo( [$GހO051J>*lNTaS*fR;>xc2*;'Q;o|CoB朰 08-־taFZIw߭Nn+rz \V;(5޽)_jh蠷mץl<$ikG ^Y:@S]+'rioö0P|Kª%Jin4SSjmቋYpʕ:icT[75R=,9&}ֻ4LUM¾ƹ8@O z~D,g‹[1?|c\/ )c&5˅Yl@tnh~XPY5LJ|'Y, a=LU,§g=zS -/A8߬Wc M.ݰ/߮4N+La^ 1jaJ効FmböWMiBqsxWq\iV޹FRӽژ1F|QM|q4oЯ/'ZwL/q b,޶(B^1e;d०dfI|=7) vzάR@~p"#oWӄ~bjE-1TmJ?ծ"4"; h)7wLqЄ~9Jiv(;ҵzvRJ}%"rl ]*kါEkݖz[Q9LHJPIe&%[v |W}%VMχO$ S[~EWcJЎWSZodѨR*)A P Tv?7~G|y+DqSC]V)RW#ms ᅫ( |{v I OO7*T!,= VSr)ZJ F7PHڦR GM7Zb7vܽeT)'CXQ}2QŸZ(V!J&;ֽ7V E sR'\\ ;u(NU_o9zW0ZN}<S<`P~̧zJN4>SE;iV mۿj +%QE ۓ ma٫נ9Z'g/&7WH܁7>52 CS@k]1U&*zPl A,OSaQ|saU@)֦ÿӖ0':o UGRf;i:JB7bk,H> +JqۡN #ᨦ629«ANٱCނPe!*S5}ͅ*f҄ ءpaӡ۶XAT؊sxqadШ4v,Є=h>{nK`Ww6rVN$8L& |Bʦ !;51@ֹB1֛T Xj 2ۭzҙTUBj)w?6YpʠqHsޟKvN(!=ǎWLiUm±ОNPүfU z{e;CVmT?1(U\G~<*y j:9Ga!C2О4(BӯUѨ QQ{ؕC2Ml aZʦկ\P]jLRڪ3jmSb ߷nltQ(G^qWlRrx9ۮ* _u~kUAՅ2OC튴_e tV1xmpya 7Ƅu'lmLUN2A$=\iZ~`78cJSZSSAnln}~c56LR*z|b ^7«lIRj>*v@bp*Z̒FƓFإQqws^@iٷ;v+MF¾9Mث`N`oejvUcQU,kZxmY\xڝs hs?^a+dGo5|Uz|=E6*}AũF>#O5(Ќ트0p^n|hƒRUR۷.`w+]C*݉?<¸Ui`jS o\6Œm@7:a)Y EOh61mr4="\/읫J+OL4M5.A;'8Wz4?jHl)iUi:L-yhz䩹7X:bF֝R)sU+ঢk)%7`֊=#={bʕ~M^آ8咝-MZr`*on7[V86d5o8(ZQ0HTl'R3Q;Ӧ$ >y k]9 1Z[@ݱd 녉BGĸɡ $%:WR+QL0U-8 *0mkKӏŎ$o27*9 l0lHZ2)Mil+ j>= u$v5UIE-TzO]6…%:{g.qJœ=]0׎懨ˮh?~?*wkrv8ahN*Tă?WmWQZlqU9 f'ڴ7vVos[Ps_v0%bz|[wX4aU HAϸƂ~UqUvS=bGNUE۵j4>-9@m^UsDzEL cT~vorJ=ko镊q#Z|e)/EMjz?f6)ZCy(0*ԅVrXZH嚘T 4ߦeJHI@O%J~!JTFj`\eoͅVr Sv^I (}6XYԎy%S+5a_6P˦~{5vKOߥA;f« jW2cϰ#;׿($! נLK:Aс#omN*,?Y!PN,lDWd *z: wĈƤ)H`HJsJ/J~(V aFk4bSK5X֠؟jcH;6`viʦ4ٯ|7=sSigJ;z|T镃J9T@xbEB)~^JֻfWp<6 PsCPUGRNV*fnG|+䀰t~xE~0Hچ`UJy.Oo6m#SoL]S)W,l`\k S))mY%zWj⭬^ U)qUy2L⪴OX$`Uzv[`TA=qc*SJmrS*~U){BӔH# zʯA۶*'~һ9u5iSW? نlUR|wlUc-GkNJ(b^[o|UkF jm |Ubjh:PcԊ P cU;)(v\X|=|ԯPA«ñVE(qU2HCz坷늶j~JSj~3=~ƕl lHzMֹ{ ‡e}ىPXwJNbZ*G~sj9*քtNZԣmۡ(~^sj$߯\009@ *[%$R7 ]*3twfaZUy1)\vvl>N߮jnث]: 2U` =ت4;JևLA2L]O0"sZepA<~_q74;~8TU}QM*Ї}1UEJ SJ*L^b5ڣݱM iPGީiސ8'%1B~UOϾ)\d. V247ߊLSp\o: R텓 8fHp3SᆒbҴSlQ&cEzb4s$-LO\62W~Y*pM6jA9Pi!+ԡ v2k֘0pGU$[x8qr9KH1Q+ĻvC\Rצ5>G\ck0 Η|[Ĝdn=$Z-k۶M69"Aԏ5p DtSOU&?: NVa*rXr&QA1U Ƕߎ^*:-›LRv*Ì*|ӐZVJ^>/ JԱ#ƹ: K6mc E =JΨ =q*ՈBiN.$,kGsSZa ~Ror$@h;saUFxʔ&eZ o\|)tK{uyPPli[(KJ^Uʭz[]ޢ)M|SኸZw_l}nJVaߕv߸ѹo\ÈU4];oNC vHjWrh*iXpH½y];ڪ)N8´))Aj{ ]EG4Uir.4ٹuV뚕JjPZl?-E68v |m)hJ3 `kUFJ>Sk/AA<@EM)><1B䎮;nG|JJ)U2qW%XzlUN`΁7q*ۑI v#(/݊`>2j{oMfR 5?,bkSOMƀ>m[f;S,S~-׹f ZN45bEM>9tژxC`:>CtF,k==mU&Ә\CUL\ڻtp*^-ͶZPSLS$߲r1Jڑtʠu,Ćn~p>1*S}mU;yMXރpvԧNU)<>u/ TVi]$*>YR~ _ rB) Ӷ)i%~Sb|Hm¸`Z>'/cҶ$}t%n15iMªi%*n,=F/Bj Z7FAaJ mq#>0sJ וA)N)혵!%;oq_M||rLRD+B}|Le,hSR뉞dݐiFvBÛuKzqvs~qҧ^o/svlh^Gf[PDF?s`,ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWb]4^3a 6YE :>9pHns$; /|F\ +0 +Zf4JH®ē4Gev,`WbvfUjrA4EdUTX(/| +YvU]N;52/ KƝ5e7W-ٱWf#vV(vX—f‡e!]%ٲHv^2LKbZ,v.2,]S]+`pS#`Bӊ7jXLzF4 H{█Jda\Z)ȥr$2 o)=;ZC!.6ޘRK~϶ExT p4 8\ ^ljcJ"ա4ц™ئ-6^7&8;ö3֦\k@rہlVZozcL4*lob-s\)LP=M7zo~?<'miLaҠSޘezWl+NLr7ep1CJ0K7T:CEqbNN-MmMEN:f]U b01;TZ HATu9BW -4clj4hǗoZZhآKS,hOzDTB0\`gZCKQmCB9 6JN9WW!JR>xYڵqH_1汔 C2)´5T5ÈrMIE|\~"rQ-ci5E0|р)M,K>SD ?l؛#UkLRƿXړ #j}TbvȍS]7RAOzcR` ;xqj}C=xwj(*o$4/&GNlUmx匐VzlU@<\Bf5tJB?HY$͒ S ;SoT])?@.bYΦ=~wYR80dB }TrE=86獂O%Ge:I(FD6 T0ƚJii-xlN*jL+ʴ<jS"Tr4j#o q;h@@Y%Аz4*~Ԓ=Ȓh4\mp!!؂> ?/|R)ZPeW+v)! Nvj KRN€oeW"IA>•v?$!֙Sr]|W<\Fxoc0PDHɔvUcHPi?*@@*>{S0c=E^@ƶS*"E<~XƇ,QĂ)߷q}kO+nS^F,:u`իƝZoǶU#V(pn75I GLUc$}E*ѻat+$ \ ŸݱBOC֍k =}KN/"*hE1slQpŁQ4|Ca>Un]qUNG14ZFu ok$RWNriҌvt<3r#1sJ֟OϦ5EH኶hw'Ď8~wV1'aަ])uiv;zxPсTµ)J~%bv#.85*6j~ANU;#fkjS}*{\¢yߖTd@?>o\I1UQB7k#ۅT*7ƟsWjȥܐ}z6]z3VNTHv26 bF+b=2v^' 4ӳ.؅v6t0va.̛ኇe6vWe  .hb죶0v^HqR9iL4SjBoLp5*7Qν:cJxҹLAAWLX㔭WJ5 A oF6? ,),t;K8AeUNfCr`0VTŪl[T$K,q]a!ɋ),1C\s 1Wq )ciLQ&-L*֎]$_|%+r ;aXk4Q^Xf׮FBШ9V)i1[:s\9?QySZ_j+(i6F${adJe + AL6jl1j)eȩ]uE.-o3 X)ހR dZWISTvi;%w151RvZz`J&2 ֽ sAcKzT5W\-G-8ҴkȪʄ {|:Ȫj1 U@- mkSdP3rރ6ڹ|F>9Z\ʭ{lAcKrvj)J49D$~x;+ƣ,wp!hn x\n$Q7Ua5۷O|#*$PЁS.`UoN(l7;u75iS^YS 5jj@mSJadQBI Rc;U66R=e0uS~KE0!X?sA\. NS#تPk\6VﷆQJu\dYצbv]ˑv MJڿ/., N|Z.]s[j|N_Oم] 6k|k* ii׮"*gƹjۊv= if4N)Z+PvQk޽l $0C<|[3Sr`G]+׎fOs S|X =zoOv–qf ]߸ƨTpn{$(=s8Y_\h1U4M ;WRo F1էLP#|%\)Z?^9pZ:\8vWlUa@{770onXӹ-^?e}i&lxfJUҀn;)qrvsTָCE" +NNa+Hpa4*5+A.S;u= 7밯cjrH6*.CZT0ZXت֔5{k6+Yw/RRĖ#ﵗTvh?obv j?WS/ 9Wk|s`J BhiWfa𹰪S6ZI jҽX+LAj1Uc|;T,aƔ|ihzxXp$7xUk#oU`nt p` yxRx鎥z R隙ҙzB{`BLBQ.FJg14HskJ~9XhX 1"C4?.N p$Sh7dA) #1\mvA`d4ޠS}U=5ٸR7?_XgJ'qPWZ$ZcoUOiOiTZepk^((z+Zerȭ^w\MՀ"n'1zdbjhEji~,[WM z?˕[:GaZ[7|Z|hssO^GP|Y-mg)zң/vFӀ=NA SnWq)ݙm[tĤbj= .h;WV\#,YOnUlUjcK}O.̺փ[zu=vliZ $Q4Fjn٨>xڷF}y: W%Wvޘ| (ӊZڧb?jhV*mCl;aV޵`MҘQɍc $oVP«H<ܶ0%jGޟ1oq0z ?GMo]k,GWjVֽ/UbJľw8h8Zw5W0XfqAf;b( F^T>׵)*Wp}~(S zvjo9VUHjw>9T=|qKa-SJo}*T4{|_늭kZR1*(;|T%al*Բqf U T˚Pt{=2ڷ6*:u TZ$ ޻ /\{mTTHm\U~j"5jqUJ5BZ뿏le-IW$kƽkX d!_߿ʙSa*R$;VĪRLGPettɧ w'à3S@Qr獪/SǐSƙ\5ӏӧ4TS-9V;oA)N~J)iP<*:t )1r NNelߦE$vtE>kt/cy}:ӊ<xie+fb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*UجOᙺ}\8/Mtts}ٳ.PXd'ZlƘeToLU=V+K%klqC qmeVbK;% Hk',һ.{cO\,d»1PhȀf8 fqvQīavjdNf4IˮI])vX8AC*Q ``UN(.dž]LQMYdN18IS1M:~:~01c4ɾ,d1UaLPLiҭ1|p*8IUa) U,qM5ㄕ­$#orN~Pzb2aM8&ng(f2Sli-zyS|1ح7™^1b<ޯc )wƖfLiix(I$aaimZn튮}Wbe[]G_vYҘRfzbS7:|V_:T`VzW 7.ثY1WfzO]-M+tƖ7ʝqWe (WcTw]*p+oZ;b N٫ҸrZ]LT1Um1TaZ8j-NDN8FIU@}tv*M*{hp'| 1݆FKJ L4/c88bŢqi+c9`VdZhqk+T !]Ļ M0b;e1q\AjqT8e!\ݐ!ll&uɔ#d}r qp cJVWl[#-:bw|0!i\ \4ԝ(poO|2mh$ǮRdW.QBr VHiKxc:߉4+ݤ\*uɶWdr\P2eBU1"R۵LQJؠ7 #_hoLퟖuL6U A T]Uۂr-dϝE{ ,*T*р1AJ:Omo_s탻vI5%). _@C S*,]PG. C떣lz?sP+b+CM_tAU"fU;}:m[jvCO^ҤOdR:+i۶k3ҕGZdUʴ;N´- Nc'l ۀ(+ZP`nAkKej )4r$W @U2(jmf SP:tĀzW0R:};XANnh1KDJ{fjos8RTD3WΝ1Nݎ(STq\r*QRHobEkZ !+jj=3Yώ=q(A60:3nk-aM(Qf W}|6ӮHp@t<:c"0ort܌Rv[m R}2X㉠zZv r_Wˡ 95nz{9L) B*|Ms AWV l%SP4NxUmG.]G?< rJ4o׶lUkt翾^I]mփ6RV$q^;uɀu`kze\9TW÷^)S{E*Gᗀ M*B~T7.4n(K,îcfKt ?>F$ا4KÄCӵr*Q* <Y?<.YkalFRޘ6EZ[3oB؋Ai qא%v}cIŁMJqbC!4'psAF[ ÍkA$Ԑj{Ɠ- 4mE)  mkU=vXf J扗zPoޟv07NP7ڟ>FYn*D ! ա*ٌw;Z{w䆢7n޹*'0nFiJVg)qGߖZUaz,0hYmۚ|%mN2Scj,o&W׿l*0Sz oE.4$> ;\AhZ(Lֿ< q)I,ukX768ۨ*P坉lUjt+4uqU1˧Zt¸ҵp%pOb;aCCf#Aθbrj9r11ZM5wB{RhE MҼ9ݰ+e4kaQ-%h Hoc $T~'lثR9WomZ-:&=QAMsV3֪'ǦUWR7ǧ_f ]7v>$u=?9)R