ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 13:52:06  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T?\_,ݭ K^%L4vHv47 yrKm5zKAD~fG_(&yR\BdDn'`b\5 BZUǤmYw<G^$wK.ZC@BIP1@9-"R"Ku7g\m {=X,;O Ӥ\K.sL:ek;jǯSjƵT=CFxNKWACyqLRCYKL/Va)ue>C %XAvG{!6f.86iś=Rc>ncz|WoC$w2ꋱ`Kgοck ̒y*siȅ nMest:6g1Z[?W]lšocک CF]ws=%)YB"Ͷ{c?/ua#];HZ{aLco 9I:+ 3!X>Not }r^:GvtY3x_o+/79gViHrfeddՏp/$w gV9iDYj:V5wPηeUI{ ոص۱u ntx}F$mLSaf#+nVKz<6^ -ɪW䊲+}vc6SVvc[,{/ok7jU34VvHܵ:UG@ϦNSXl]89Sn6ŏʐ(_~k9c>ZY ͭSIJaxM'A]Y/юZlqsD ̳q|4N I'?{W}ӹ@68L{]OB^yGmzo5\~v R}ҧ$à >*wV-۔lHh?Zj7JŭT]al8CP޿V _c(c]^67[)VI˰v6 8x+2o#K=Hc}b:;&uVYma;iuN!W?۳rؿtFnj?{oO$T`"򾊗b>-01`,Pn!-"=@T~͏8_;@.Kze㱁}G,JQSv9~w~aeֵ H=7C`AIzÙ[EK4]~@}K*$H0&?C77 #}Cgk{۷ էʻ,*g#2/XƏq[iYfoRt꾵5ď,'?h~ry=J]2c[obx4Oq٣j7ݙki^}ʙKlrq?ȧD5W.ldf>:;E KHw964}(#Xӻ;u+8E=";S, 45Ι\- hi$$?;|OAU4<@Cw nZ6PѰC54G^J8MӅ잗Q Ǎ~quoTRf>X6X#iZz1&[p!+.O 7T֒Uo};QzU@-{Uc{- wFHK+a R?ҚWK@f&W5@hvXndMNPskS Ug'c%>. kK]^vݟa5(n'ߣw?- ^fCw7&=ŲZ$k\Ʊv@!. OJo?vwQKvpp.8mW~c.qX?k'wї5Mj-&;hGZǽ8ȉRU#u[[=JnXúg528`--{*34r$jsg?[T]?GY|-c#Ru~T:;l:'v6LFK8-i<ʘ5lH#24w=e!W]|P͢ `p{AVvߐ6w6ΙK[i05ip{ƦnT9iQ͗uѺ< W;nȴ:Ź*!M^jZM0m-󽝿9t5xX}_i"zsw8K~= tvUaj'P 9 W7*e5Ul~UK4 ߡg@~S/ŦƵScsK{-7at.3.LU?ITMx;u=-m!v/󒮪sshh6VMչVP}-\LǃWY7CvK?>t#_ T M^̫XqGBapٷ1,Z1]-Tv rS[ZG9`3o #[/`4|~*ȵKZxOfIsal/:ӿcp<;dݾT۔[p{f`aCUzSo @Pw5~sv!sCUzvPُnw쬜r1_e jڻ's!~U2]N L\A\ C -GjY Z6GZ_X[=L%~@v sMLk;n缼golغ0($r羮@t%tGtÁ.#@yN-) M0KӤAH?H:?"!5EO sq,c6?9];r?շNUc߬$_QskƵq{=WeRo.5j?Y.6Z\#]?/p}Wk籮 xKΛq)M#Tޏ(ޱ{5 cA#Q=[,?/u:oħoE/ٝ7Sm"Q_lmfw{CBftG_:oģgE*=y2?o( 7h@k?+?%?)~m(VO?y5D7ǵ=/m3"=(LȣG=>=W%4-(_ճs]cwkgE/#LȡEW[^3_mey89k) ;ѫ]Q}0p?QcYEot.cI%ž'7aR+C#p%契o 958u䵿gO_ƧoEQY_Ԡ5#ket?ƧoEGgMlȥEVb߫o`#v=E?7!6`wBzOJ"3"N&-)DƆ;{BUTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$LPhotoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTVersant-180_PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM_ update_maart2018_v2-1 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T?\_,ݭ K^%L4vHv47 yrKm5zKAD~fG_(&yR\BdDn'`b\5 BZUǤmYw<G^$wK.ZC@BIP1@9-"R"Ku7g\m {=X,;O Ӥ\K.sL:ek;jǯSjƵT=CFxNKWACyqLRCYKL/Va)ue>C %XAvG{!6f.86iś=Rc>ncz|WoC$w2ꋱ`Kgοck ̒y*siȅ nMest:6g1Z[?W]lšocک CF]ws=%)YB"Ͷ{c?/ua#];HZ{aLco 9I:+ 3!X>Not }r^:GvtY3x_o+/79gViHrfeddՏp/$w gV9iDYj:V5wPηeUI{ ոص۱u ntx}F$mLSaf#+nVKz<6^ -ɪW䊲+}vc6SVvc[,{/ok7jU34VvHܵ:UG@ϦNSXl]89Sn6ŏʐ(_~k9c>ZY ͭSIJaxM'A]Y/юZlqsD ̳q|4N I'?{W}ӹ@68L{]OB^yGmzo5\~v R}ҧ$à >*wV-۔lHh?Zj7JŭT]al8CP޿V _c(c]^67[)VI˰v6 8x+2o#K=Hc}b:;&uVYma;iuN!W?۳rؿtFnj?{oO$T`"򾊗b>-01`,Pn!-"=@T~͏8_;@.Kze㱁}G,JQSv9~w~aeֵ H=7C`AIzÙ[EK4]~@}K*$H0&?C77 #}Cgk{۷ էʻ,*g#2/XƏq[iYfoRt꾵5ď,'?h~ry=J]2c[obx4Oq٣j7ݙki^}ʙKlrq?ȧD5W.ldf>:;E KHw964}(#Xӻ;u+8E=";S, 45Ι\- hi$$?;|OAU4<@Cw nZ6PѰC54G^J8MӅ잗Q Ǎ~quoTRf>X6X#iZz1&[p!+.O 7T֒Uo};QzU@-{Uc{- wFHK+a R?ҚWK@f&W5@hvXndMNPskS Ug'c%>. kK]^vݟa5(n'ߣw?- ^fCw7&=ŲZ$k\Ʊv@!. OJo?vwQKvpp.8mW~c.qX?k'wї5Mj-&;hGZǽ8ȉRU#u[[=JnXúg528`--{*34r$jsg?[T]?GY|-c#Ru~T:;l:'v6LFK8-i<ʘ5lH#24w=e!W]|P͢ `p{AVvߐ6w6ΙK[i05ip{ƦnT9iQ͗uѺ< W;nȴ:Ź*!M^jZM0m-󽝿9t5xX}_i"zsw8K~= tvUaj'P 9 W7*e5Ul~UK4 ߡg@~S/ŦƵScsK{-7at.3.LU?ITMx;u=-m!v/󒮪sshh6VMչVP}-\LǃWY7CvK?>t#_ T M^̫XqGBapٷ1,Z1]-Tv rS[ZG9`3o #[/`4|~*ȵKZxOfIsal/:ӿcp<;dݾT۔[p{f`aCUzSo @Pw5~sv!sCUzvPُnw쬜r1_e jڻ's!~U2]N L\A\ C -GjY Z6GZ_X[=L%~@v sMLk;n缼golغ0($r羮@t%tGtÁ.#@yN-) M0KӤAH?H:?"!5EO sq,c6?9];r?շNUc߬$_QskƵq{=WeRo.5j?Y.6Z\#]?/p}Wk籮 xKΛq)M#Tޏ(ޱ{5 cA#Q=[,?/u:oħoE/ٝ7Sm"Q_lmfw{CBftG_:oģgE*=y2?o( 7h@k?+?%?)~m(VO?y5D7ǵ=/m3"=(LȣG=>=W%4-(_ճs]cwkgE/#LȡEW[^3_mey89k) ;ѫ]Q}0p?QcYEot.cI%ž'7aR+C#p%契o 958u䵿gO_ƧoEQY_Ԡ5#ket?ƧoEGgMlȥEVb߫o`#v=E?7!6`wBzOJ"3"N&-)DƆ;{BUTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$'(6cIoicJG7@c´t_xV |rEScIot_i|s~}'JG1ҭ)0܏4vԟ#܎Q{D#Wr9_-I0RS2# +|rFZ`uNoѶ=$i.kOr9FZcJG1-I16mON7uu'ҷSto ꜣZ@W:}?Oaw?F4Nfӭ_I?F4ꜥ?FD7a_ :u~~]v_vQI]?i UQ?vo[_5urGzFp[Qk F W_bk(;Fp] v4C5/PZ+P~]6"v8G_aWcE=~]Cӂe}R/_b VXz_b~ӳH~V6pif*WvQd߫Zp_v_8/ݍ&֑)!JsUZv7t>vQnT=ccNO4tpc~PJe^=+l)mi*0"cU'4ڴӱ톓N`JT*־)~U^iF |Nʒ L$-;Di"vgH2TfkhræZv3@koJmӳ,xKN=N)ٍtQ U؟ҤIb & `}BH;{6Ļ r(vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb/.Bw`Ijc;F6y]Vf]w] P08!ٰ`Wf]v^*ثCb́.͒WeRثb*xY!ٱWf+aK`Wf‡f*|Uَlck \qثYWf'vW21V U0$62qKL—fȔ;6o1®]vj«`Wf] We.PثپxyXG , 3 PCqCy1vQ8SWcKS 5qK[..8W CKIv]0[etjq62xaK]@ZƝHo0\)us  p+/)hI冒eXa[be]Ci]sQqXɫc7\fE7""哊0]EqWfuL3 *i‡flY;( P족­]L ® jqKWf] ⭌kL*L*2\*1Wf*4*QCK[]Er*cCW LPddfCc [-ֽ2a-h`:aWfsثyh \c;۝KcIġ2q]j hN(vbSvjbʦvQp]C%vQ.qWe*i;]6*T]m2ctv0dw]lv0We3mLUٗ*죉HvQȥJ++Ǟv680]v#~Uكrv)NٱWc*Ov:8Ul0+vV*iv6WeRv(vP] U늻2t]a {6v5:/lUBw튻]ؤdS劻5Bn1Wcj{WcݸU؏h0V'Sfnvf4}+)e))v\*:+n*N*U]ڽp!HbbJȐj X0+*CZNRF,]X;4HT1RPQ;Q^vSb -#p]rnnZPq4=آĻE+y\!mٽMɦM;oHv'סc 0+U OFۡ.PVk]~1x vjs^.hGLUPoJ_*S;r]O;*NKh+K>'v5f8 v1CQ<1Ku}&FMm/dUثb͊6*Zt?rز ÆiJX](Kc5qWS/:N*j]\U@JceT8Uo6R4SV]qu1yU–)bU 8c6o*0+C{WeU\{⮮YQstwʮ*^4@i(إp}CLVU)urmuH뛮6f9&mءkI-6V.)\WeWv_MWe8vWW+HTJ0Uvc09WcIƕi4E7Hus Uن|*hpZWC*:he]*1V1qo,vjbErIur#hk,685]\!tRӁƓM;7l.*OL*p bc˦)va(`Wc_bj[Wc®ʦ)vQoK i8U+,0eه\ULF*]1®ƚWe] ,nzfQNslUzS;))v&RB`CF.ROl 춄r両d|4®̯*ߛ1Kq])y ޝ1K=EJ+ қWc8Bk̴!*a,p.*F87Q܂;#v[ԝ)v:$|PV] `s̎إ׌Bv=PPE!zcQfQF*z7.bcAZWc&U`ت1C4eV]{nN*|N]:#&%jwnE b͊6*ثyk9YBRV 犺C|)vjbW0.'0!51Wf[r (ur)v^q9(vlUَ)vj9!!+ [!Db VUL rȔ6jvq jCt.9Ӧ*q7],bVt^ ] o*p8V0J $;/ &lPX4] Rr1Cc[>X-m*mp7zbyeqN*, HvT{m(FlUKb8Pi\)v0t[vQjdJS]QCKGCfUE. \ 죅\1qWe;>ثxOen !ٸ<7\.V\7]`*~GZ®ƍ%يʥ1Wf]JJbfeSvn';(, UG )vX]c1WeVثT{{aWc+S=Wc\VN)v5°5 % ;aWce *M\(vQ'—bXP7]AUؤ)PqWb&ث^Y|?r)} {f:eUuqp+G7L*CtqW UإJV(q˦jU]qWW5pS5qVSnGVn*2Vl MKN;IšndWqWf;bW8f]\3Sn1Vy*pP\WU6\{[L WWW/튷\b5\i2o(0Һ`b2Z@~x]0t…DcZVqKrJc]*캜RWebƟ|V4xbaV"v7e (|땒 p]1WuƱ\P[DNƓ%Do]+`ko`diTv ubDxE. M(vSn2Ja8qWe]zWc®A"j. PC*զ*A]v16W v.jR*klA;v5j>X޸|ҿv)vSKT]PۑAƕȔfY$ CQQ;PLRm8P]԰ъPo&t;cjopzbnU*U>%bJlU6bȌ]*V;b-?do]Uv;.'MCcb8-9Wv$Ԑr#*i qVc1WcQċ !`}^B]]2Ra_kz`Wc]y} JץqKUn$O T;ֿȖ8]CyWf]vlU<?( TP\r1vQ21V*rb9!ivXvnRjS(⭌m|1Kxk5rIvV*jCY*ɼ(1V뚸.(Upgk+ LQnsS)vP_1vXPJ7eW*vZ#8`kc$bZ-]vlUٱWf]vlUٱWg*6*ثb͊6*ثb/.Bw`JZ51Cl X´VPP6ZeҘU8c+,ġna]*® V5+ ka Kyc5F(kpvjb;"PZ0!G 6*sb f6rS/wLثplcpvV*ء٫]\Up+x rbeWvU1VN*lU'Cc*"jV,R9Nkъ[;eqiiܳq)ukF)vV*Um+(nӁc6(o1Z8`㗦*8UpJ㩊V‡fva*쳊,]ن*r \v5KkQs(]\)$8MS/:ư[J U \` qWcӕLWLUÅ+jS(\N_26&HedlR !f6(8}h;V1iH^U運MҙU–.V*ƃC-*ZZʩ[8bMqC-S/ ӊ["Jo\yaU`Vqur Ep`WeC Uep+LR졅]N*kث7k/ ]L]w[1 MWd㊷qCi.ʝWSϖ;8Wur`*jbbf]\ a|++q۱m=)*q+WW2%]4ٛbe@vv)C CVqWc]]M𫱴]E:Weq]0һ6*rWcvU1K*쳊1n#+]zQ٩4vSovU*b +0vnU;*@]QvgvUؘbƘUtbrJWo*xCQTvZzl)vib9u1WcClPNS*bfRxqR~)v*C- ]®T kF_#RTPtUPMYe]"lp;/ ۱c=FPr_I]&bv&Cbؼ-x%UaRA-Wc$UF)vSF_ǣzؕ*an!Iv5@*6®ǼSM!ٕx )v2e$ b |bb7C5hlR7viC P""e4톕ٽ1]"{aC‚v:=zʭM;*WcK0$~7xbD Ԏ;k#&̊͊6*ثbΓg- @\xp$,f8k.b͊sVaWfZ\Ufo7l)v_*]\1VS Z8cbV*l \UmqVqKcwi7LQNlUUe֘|[u2Wc.Ɲb1d0"n8Rs3(4d rU16tO/`~|bVWo'eE<r^zЯ*#z=?+e3Ƒ6Hѧ \̭kH.h$*I-%ʓ(6 c%|*c pU[#,jGo+;/vc*{becXb8LUk*y]1 ㌆4TUnD2Ӌr'2`EGc AWR -55>%n뱧|.4oJO`?lxNI_%? \ 3nOj"rEWrH&B'cx9r^HX0%5nPsᴱ8_SDq<գ'*V 6 OJjN-O;[ (0R[8~2(dꦠ[i )Ycud ר9p޿,{:PمE7UjjUk,PbfY*iqZ.DruĹSl]l+2&ck0 )v5 3rfi+XE<6Ġ\R;yeqN”xkJ 돎VРv8VAJ*:OԁL m 0&hXJ(o65-򥻷VR >ԍ+CƳ/dj>q%[ ˧Qqw#ONN΄a<IJ(Zwגcp+2W~aV XILo-W(>Hs(#j +_H[݈ǔUDn@n?g%U+FP3TmWcRpC{Ҙ]>vf]Pd`ߧv5*pkኻ*SCLU^إوv7ov&:S)v(6.q~RnƥFثP(1v?%;S_QKjE:4p^+N)vj6mLUُ\PLmK6LJZ~UO^̯AQ;ׯ.ƨ'}~X-\*?SdK|'ȱo6*ثb͊6*ثb͊?*6*ثb͊6*ثb/-Bw`JR®ƞbvk0—pLl6eS `CG\UL aMLvV*UFVثYN98f®c0­(k.vjEqWci,⭌*Q8`c1CVb\ |)leLU'vVnU]Lث`eWu1ż0!1|)jS,⮦V7KcqE71Zv8KpG1KlU`cNc6)o1 eLS,.1CU*ceLU*㘌USvjaVLU*m]6*wje*noF)leA;0Wf8bvj.­W,`Z',.ث\lU4aU9HS16-m]ںm`W |qSf j\rL\b7⮮ZG1 cKN36E}sr܁®lR241C`{UrS :;(ƚm]WeU2SmKbc \s]C((o7,U٫,(f' 51WeSv^bPƲഷvb+톕L #ʦWf] U٩]08Wc)\Uٸ *}6+(vnX^B6L(JQ4M7]\)Z61 r%m})vSbP X۳r]Lű[v0We*p%jWf#lvUFNP:Pă0!]0baYlݎNW-curCy%p+gǸȔ5l!-i]1Wf N)vfQ]jbL*]vV)vQ]1CQ]v0Wfz.̢aWeeU87L 젴]LU}qWfenơ8҄W*qWf;i]1K܆vRbC Sq]SZҧ -I.W(6٘r8&1We;Vl v%Yf2(Db^sb]u iLR@ bۮ[IA Gl?CP c;_J7Z\4SI?1f=}ᢞ'~w?'0g_cEN:ߣg[hj0Ok ^#ƊGۗ fë/4QkҞv7?i~DŽ eDŽ%7O4ᢼN_U?οDžm=d7Չ俏¶[\l{0q[lN< ی1(~8&9_U??xVcjǺEmް90Q[wqROaQ3SG: O ~x˕bEuiS⍿?uB[W zt 8˻HJ J7Vn&tbV|РN<$ ?QA˽Pզ`xdꜭi##t?̸Rt:{Μ>3A'b?LJI%pѯE$_Ql*)צ0cqǕƎ`V(GԤ A)+ ,rHRp781֋=ձWS1UCƿU'鍫\Oӊ4$RHc_|2+]ӮA1nnzK}+Mߧ'Ko?ݰ7P~8+ׯb3'Fzl ZQ~5bbk?-)?qVkQ׸c-M&0 AYu:sF? Cl%̏+2t; JU@/sj1 —W/*ġML]+SWe \*l;`WcA'`Wfb7Wc}ٍkbc[;ݰ+(*E2*B*B-kg ]FicJPe+Vm_eRz]xu,KBͺإƘ))vY;.bq߮(vZK*#va*.\R@ءЌͨ>XyVآ6.CCv]}+ .5ڟ*a$UFؙݖ]vP?>ه w] ҧ;)M7ؘFqK݊F)v? M@JN*km)vWثv]LLvE ]vlUٱWgHq9hJ~Sl*jf͊6*)]|UqWf*u2yxxG*qKyنvY®͊[͊(Sl*0!qXm̧qؒ5x=PUS''@!Mcy&fH?c\-Y#?L*D-XwWt&z`(VXԨ')n~UrD}q ]Fd}Z8M}Z/_e}f_o}Z/_ej_optE05nW'nWMV0Uc߼MCoq9wYq??5Rm&mgG=k$dUzj?Ӗ5N^FPkwZ8խ~;W+lFK'9a80+/*~lRr!dyaCP~'Z(Zˊ`9laۖh>%?ҸH8Lu>_?\4^{ $Gt@b97uL*O !%vq,~uᛉx!2 ?`W(K*%wW®}$8FIj2?W%nOj "ג?bzlrNeh|հ|1<%٢ta[/K/bUpg-O_)N~/m]O G F ?/\U_2XO.F~4hi_kVCCƘ6D"Wzm䢋XHO|=iYHc )+mN8g/Iܛ8ڍOOՂۋf#ZI4gQ6r20nBA*-dRbxrd%5w4Cإv&aWc16vWFLR촯B1CSa)vZ }cbٟO잟$e(~~89Won;2}L!.=.0Mm]LUV ]90~zb2Iv*N]UW| ^;aAkvlUٱWf]vlUٱWf]*6*ثb͊6*ثb/.B':>ZlwU 1- ,b,D⭌aWf)o1BܱZ4UVb8 , (usSvQ-50+w­)o5qV8`U)kQR죶*8u.Ɯ* GusS7]/͊+nGvUqU50yDbS7)k. ebV)v]p!*3aVjaK*Uk(PF*'f]ubS(٫]L8UٱWf*]vlUٱWebjqWe\U!iFͶI]f)[#,PFEmL(vU1WeR참DR&M7)o+v]E1VX1v^)k+! jL#(.A4XkdT8kwRᘚF*"eWvY;`We )o7,Uf*챊 1V2 7]ڸҺvQ8x$d4cb *nDWfl*7hfG-/8ں[bc*r1Ve ]ȡi^Sn˥rJ1VWeҢ62*ӊ]qWf]0cHvlm]qWeT abƲ 1(q¸JWAW h7'W(burӳ0-:C;3m+/1v8{CU؛P]v&| o@V=F6c].B.pMRFE cKSc%p\$;*1A.(v:Pk7lRapR] !t]bG\{bfPIR5kc5M1WcUژq]]UTƜ ,n)H7L Rʼnvgu—f߮!/L+3%Sk])v_-v3rqK9~0]e1';)uFb+.6Wc$UzR]Eo銻*1CCv,T*`A 1Wc'XpbvX csK(atm.%cSvSINWf7*aM;V^1v0$5~ RMU.h =]F*jL;* VvZ]7*€bD@;b`Rztŋw=We|U\Uێ*la.٬L (o6*ثb͊:?L7lITbfG/vP]lf0\2VvV*vV1]v]0(vYk1b *lUnp+>fS bV EsxP2) wݎ!{qJd?v*(A8!x5–aCSurKyWf]U$(E* 1&"&L2ðB%.TK0@2nXޟg[i4R(Y{v X_1R81eyyJ\碏!UePQp9?+["O5,FyCX&m#\ X}8Xkxī훘N vSn>uCftx?awo#"(MHܕtom:wOup XUi ^vy6(u+DžF3Xa5?,Rq\o w†_HRW%]-> L̸6=2a"zh:O8P>pX$d~̔'Z*Hos8o\}>w\ };r%}ql=1W|9j܁{5w@¢?b"մFv;>9EKd;G()bߨ "vuGj߸~ HIZ#xfcjˡ3p*nEkk Tvׯ+Z"01ukl{eS&˩C+-]ٰ@E"7gd_ڭ})Ӎ!R)n<?k& Wrcbej\o KND 8]26u?d?pUCaĖިi$uSaJa> <0/BkvlUٱWff®R HODM75@wܱ,chhFPE2GF%5 b2ǿesw]Ƣ j]LU٤1CJUvlUqۡLRSצ< GMƝFæ(^B:ve~>cҔ]RpWerPctjR5Tn !kBF4\ԍ߅])>XJ֟ 1C30qW`-I+x]Ȕ"żثb͊6*ثb͊6**6*ثb͊6*ثb/.Bw`Hrԥ1WqWSF3 U9[T\rVVVS0G/5vUi(3.*KY;/ 51VSclUiu.V(.4Up' ul k7LR1Wf]qVUN*e;6UR8bW56\1bXjC%50˦ N*RL*j`CӦ*늇f&1lQm/;*u.8VL- ]®́]Fo|d쳉 l3aVb)SsS eb`Hluߦ)5x 929QɍzbV 84<0pZ-y'\1dARǮXAr+NXQMӫOVʘLkRڜR|Ak*yT+nX!eB`crgN9ӲN'+G-2 eƕuPnI][vW,Up+]bc+*ݰ]\49c}*?!V0lp@I]\ثc+o(beLP[Sp7cZݰ^R¬ҽY 2DeR5ů"T[5o zT\N-rA[`ĕkS+!*srZ9dQM1Zvn  C\J]E ];b®vb7maWf]vl]]Ue\vS W u1b2xђWf'08 L*r:Dž)j-qWf+7n|i]dRi ,]'vn45;Bzc/ V% X5_*rN*5z ,8w\kM61 U| bFqK%̭E];bMWfv8 v.ʓUR1We0# ;-Ϥ*7ƂXxKבs_](1bFbTC jUً_㊻5UوQ4ḇ)nUlv*Mә)v65ܪ06_LbJ;wN$vbq;m][Ӫ䂇ba^Gqdr̤?v(v(T:TWeApb:m1r]zP`C')v2.C'Ev[ob1WbXk;(%(v'!(M{b*Gqdq@IGS* N*8؜*x%[AdhTUfَثT1We4v0PM9bf bfث6}t]CyWf]vlU?壓$ 8gU<ثbf*2+ ]LثY67WfU`Web͊6*ثo0k(*(V`WbebUpHh dÚG,N˰ QBɡ\ n<%dPSjN7HobRrW/ VKSH+4>T3}K8]d/'&[HmXx>cq#tʍe|2</!^)O+Fz B|co6뷪{cj[)oV;`JKG_oØ#/;S֛2\ ]M+U7o1-W40*_G;,?n/ly (;n?W^Qbq7. [B`FR*/%\kS$$?Q4~ޟ|բQa厴'XZ@q8I_kJ/ZӪOl5+M䘩W/jS(0 rW#+ح7\iS\*lUٰ+bͅ]6vlUمz)=wNјJ84\3Cjzب5K"z?el]sBty?NҴ?.XF rDwci+71'yyMK{ ]ڃ\V JTإD SzUU{xbm\Rk5v0̫0(vZ@F¾8@bfzu#fmSWf-ƠaWcv]v]{PIbcEA.BQ*)*)Ͼ)vd=Zǒn6=qCXzKPH5>X")vGԯlb]Y.͊6*ثb͊6*ثb*6*ثb͊6*ثb/.Bw`H-J_>ث늮eM5q/EC Sd6®'/bvV+MbSW UQ]\b8u3WqxUfRf8c:UU0[jSvjWS/Z®1Wf8Ui]LPCY1Rl)vV*qW n*eP0+w]CaV4R2I]0+yCo,Vp%GSc0[;\Y8musZ[F*ƜU*ˮ+! 챉KU+,[]2؝f85d6)usbXf8R]1ՈQ#v遧IjmQȻ-,8zለGAZrv}9-:)ԸO?J#kK9U;Sl Ӂ" |Z]bTrwm 21RwmeLvM%1VA$TK1[\ líU1C:GqZoa+n$aWeb0+aWeWvWLWck-L)n@bٱVM:b[nqWW7j–ܰWSLhһʘi[ʩšv8]"uo7LU٫c5iŜI#:lîFNq~JP_1cry8 tMN3 7S\N3N…׮ q]LڕޟO䉥Zc 0! {ċk0 B 6|IFS ,1劷J T97B7r\R6fZ]WenpB(vcLU٩k.1WcbeZ[bfqKlDWQ!%. T ZN5|R¡q+L k1Unpr% $f8 c(vV*54]RCS+pd9[|'|'vQaLFl4-:ia)*6Dڐr)vZ\ , p*ޡ E;;| b۳d]M%H땕̻vny;, Qn>.ol ](FH;7A+i.̦UَJĞlثW$$*'We|ӳ3m*mqKaWc`Cw]4;—cŪw—c]adn ] HqWc+{bfEPqWcK튻ƠU[7~]# ^`WcVcƴ0܌PQxb%\UN|*IаlUm۱4WeDet" beŒ $T'bv-b`2z>*}C^Uذe-ZaNQcB Vݖ VݏP1Wc qKE&ՠ\U؊R~.18hAq]0 X8w(=1CG%M+N1]Zqv.v3vc؜.Z;jpqW`mhQ0-/dPlUٱWf]vt->O9hqO6*ثb͊6*ثU͊*–C*mنv^*ceUGvU1Kx UV7*j *^(h@,Y3z`CtHzcz O鲏fZ\ M킖CL)iT60(o`m]/ܲVc7gQF:Ji0@4 d#,H k\e8Y5ȍ.*n|t?Yn\+ݑIq܆Xп(ف?pqBs+/}_5V yv,//Lr{7 _gJ>:\u^p5Z݄o^Ho,x) ` b1b3>2}A\vQ:V4K0LgPVSCHa?op(~=; \m7M5 яQц^dC@kc!l#jj r!Q8PX#.aF9Y%~o%y{ˁM#> ޿mJ=`npF($x/HF?c NVwC|%v(FU ےd W+V~ic8X9!uhdK.QlUrQwˋ!<ݭ8cJzCIՎ~5diq4tLCvd/\H)ቢ E;M 4w9O lџƩiۓNInh桇IORytن>HU`of§Wj9R}+2Eq!W2i =+DzXҸw_XqI Z'q^R7$?SDZƔcsROhثcs1Y01n3ph(߁ʒ##,WMBcNIR1@XPXlKޮQyGiPJR6q_6HN C;{biv (h·^p;*2S(`8rCf8#\Ȫ?fLF ɍ(Ib$;6*lUٱWf®1VOFa9-CA05dYb ڇ(z"zңs7.Z *PF*f:RlQS\ @u‡co|. Ɲp0 ]]} #ov8%aB:qKT(v5jRQWbjUر(v$,Rj%pz|U"aTRH HqW`]H~ߐM, ]"b͊6*ثb͊6*ث*6*ثb͊6*ثb/.Bw`J-J_* 1JU0!*|)\uZzUxM2M,ZD `qKYx]]62f*Uن1]EqWf*$ƚ⭌͒K3UlPQŒWJaKaWf*ծ*51Vʦ(vjLUق㘊b̈́%M[qCtˮ)u3FY4;bƃ\U S|vl)hcI8]Pqd#LR0PeU,kv]1WW1e`*]Dley3 I[\ĺXyg.0;0녑vl rA-| x`,xM;oA9DA Z}ZpGSj@O`RQtoOaLST= » Nk&-+V]A*02R>;2Z Fn55cvU1Wur* bCyU .3xcJeV;*lU )]L#U9CW;(#leኻ, ])\6[vQ4—ev`qCܱWS@]\Rj⮦lUى*P5ka⤇E-Hjt(F|CVu<2N`)!_ĸbvQ&e ?<]3?xȤCEA-N8GLU"h?rm (}$$?1E&(2bLTj~?:`2A.`QXR>xnѭ\TxSnש1" ~]k-ƖN*dh0R05E+c(L cv1%kk]ʝqVQQ.SI(o2(vn] ia8RqsW*85# f4TeeU)L—cZ@WecCM0plcL—c \ibNoQ +dUc o0\ m*evQJIw߾V8 ޵LUٺ̢1CƘ).ƌi]l*oLUmҸvPJ쾝2@++(v8E\id^dQ|p ]5\x}3V泖Pc&#[G|Zk!+) {bCx;[+t56.c>50/u-VLŸ#6T=QuqzqH1ƃ6}3Lz&:ZrC45Ge;` Jm̫C+Rt.aɱWcRWMXtI偓rVcH) ~i23sN UL6(no7nZܗ?ǚ uj}XOo\20d=a{}É&1_ e +lBv?. UE`OøqQ/4HnЏFFMŸ";f\g+16<ض=8B+I]52_jpHă.1r?5 ~9&?)84{`Ԓבw1V :Fi3G5xLyT \_O嵶YcCUV@_LZ;ˉU-z2_rv#JU4>/aMG+KJ)\V㗦I-k\xPV(yYǍCqV2cnW +K |V"+}?f'j'XNITjȋtu8n./fc=.lhO * j>PH~ܟ ;S%&DʑZF|7)Xtj`;B Pz"jQG$^#F񌚯?$4[436K'K{F:'m߸^WAۗ'j(n,wi{?4H 4-un).DmOl-8n+st>+T?ka-SCx8M,39E +V^?Tkʫrv>պqcYXljTOF\K -MMጉ#g}XȏUZıKd[cه|ıL?oJ|iը7czhMAm6W(yEK`Su"z\Оk:ƕj׺=V pqƐG*1iDz7NP[5i'I";? %Nӳ{©l$-=P2JZ{]ϦԴmAqRѹ,H:wc꺡 JC{MT i{rOP/c=?o<ZuMjAQ$DPz?_ˊ[R~5SѲGM9x-ed;clV:cj<K~0DŽ7p|4`V3)qkۮ/OPqP$n 1S ֞?r2`(K~ 'YJQ7Wc^] 3lvƨ"wv1MNUS]bfjBk_]'#ZA/F*cn87^,Ukס Nv]f%t#]4<(7bǰoLUaj*<1C )v$&zxxbTmv>*P1()㊻3P1Z`^T‡cfHlv%mbz?6;6*ثb͊6*ثb͊?*6*ثb͊6*ثb/.BJ`w(Qq c#Gkw#Q\ gq-$T|C"KPwLrLfRTn1WP3}IwPe*i6Ri{⤺ 1CvWn_LV\x.2qV.lUiyR12hqCyeWe] kI]6*k1BCEÊ]J( —eFEaWeqk u+X|-C HPk`WcXtC}LV+NfӁNή1 }86쭱_{⭲6v9Y 2-.ʎӚ'XC+ %i9c;v6xe<]<8CBv5ӤJeoA5iZu+.9G?0W61PF6ӃQzew6}fՉh7-tb 06Ypd6Nį.nb:mDM+AAEv_nTu"O>!@@.,ӚvH/,!-P8=0shbNT#;`60v^®T],We-jk]\.ƅ54K }8VݔI^Cĕv(MvW+\6cc4 Pcf6]#i+Wfjl]@ǏLUcfM+5L*c5(^H@vP ]5鄫2Z.۶*4^%'R銻4O9hqO6*ثbKbثWeVU0(銻,`Vc\2(v^)o+vV)vQ†nT½0+a삟Od6k@t !~C\sl$vpW81AZlQbS^+s¸)W(ث~\wƓKmaQy)S$3rJ1G&78UzXX|6n.>+w${?f7߫QvYT8[^*yz ?Q¼ֈV|"PUЏo\hS$,UٗeQOObOmSUO&HI>ׇa}5*71t_>!_L)VBx <__ is\z 5 P?p"jbF͞Imu}h>0?\ $7lq$쓳jb\R*,]pj2I]k%(ZTһ63M DtwA[zwQïo|Ho٣[ef),d &y\4a͉O&Xj*H0H|ԌhJŒE LH!e3V]jW mhO }Z#e ձU(Xr\R}*1M5Z8ƐC|`w\NHOLiUe D CwhĕGCWpz<`шO0.J 1,Ȍ#ί;odp])E?Ã-+ߢQ}#Gq$=O͓T@~ƙc>m!Q\W+o3Q?8i 8K?hx{H)OE=b TD B;STmd?Jw>208۹MfiN2|IOcO<զiUnؑy:xwlW HIppKۓ!ŷ4qdHgnPAV 1ec^#ps&[/& 9w#+KO 'vbV3c@8'Jl\TSnʏzNEڞ?r>h7hc29[>΄a\~"n(!JlǿC*M M\qV; 7)mO <}azCʎ?Zjuvs+nf qfXLX+` {|ԓqn)(q;aJ#ѻ=R#톒(} $/ٶt'u?]hMŶq8b0LtnqPbˏl[{ mNܐGqH_oRQ~qe nu7XVj}=[ȯ4 Zy G&;PB6UR(>/CB+#h"UnQ lwjP {g%.QzזcsUGI'bǩl`*o-mBֹƵ4([`M…yǾ1u$n.9N*ƘWi_ {:n:bWVݸ$!}иNKȲ>+QT;|;`cP#x8m+ 뷁هvQv4?N Wf?NH *Ҧ'c7>һ kLPkM*}KI+]=E*ޡZTo*X 1Wb”=!ؓJWbexO)vfw~*MkPM)vZ6;ňj7ۦ*:aC)XQ1IvՅ"Ŀ%vdX6*ثb͊6*ثb͊?*6*ثb͊6*ثb/.Bw`IR.ͅ%X6vlUى]NnWS/lUb;4qV늺)v^(k(VRU,U 2qCy` sW#jjp-63(qƸRX>9$s c)F,K<0yWeeWu2*f#c)k1[j⮮V)o6(vl UW U{b*fk(RsLUpdb4")yu]KSV-ˮ)jXeָ^ثjœYgqbf\R쾘@wvX-5ZQa %Kr?VaUǧ/a# $%/~"wb 찧i7i 9Sa[lmK>PeWR#"z/9_SmzH$Sv) ]JJg rU q$"CUɆJ-Uٳ~|F*QleW$8RVnءx;.US7,UٱWeWvY*;6*0.5\ mʮ(vQ]P⮮7uLUƁ.Q[a[jbW.`Ao(`KqɫѱF6D kijc{r8_Ĩ;b]J"G068Yb3}]S1VHȲ*s]"6`KZE;@܌e]5?΋D#њ0Aַv>8YM;6)"-tԐ1ܼCVFGl+8 v)k—}طjp׮?Iv+%ycG_X]gTWP]!;cMBHi:]&:6ه }_J+$I6G:@ݾ8_-q&op$q8OMp`,`tKh]b>q%uG$x5',N{cn$#R-en.ic>\[sʓQؑq0f6j'W%UԷFtqZeǘw,THNq؛c.6tǓř1d7<Tv=v`+]$;2t$;$إp!JHv5;6A+zV 0vYjdP4®4I-Sf5EO)nh'1!e9bibnb3E%!GxMY'?v/^'qvlnOf6'!DZ"zy_#'`j*JfƜچm Iņn<ʋTݏZp91G8e n@رßo'"di 92vݤzAQ r1 9?ln*Cc=<7-92q.ZvZ) N$c j7كo.};|i"beQ|6 r2+WfRX|Aقm'e;SzS ~G*xcQ];^إ!O0w]Wævgj,PFbѽdV$eC.Ru)]vy8P(v?*O yq#!I.Ť; 1v1Kp٩Zc}` ˞āQq*yWcPNv: aWe$lw.QQ\vbpQ*i]e@]j ;B OLU!Tӡ!؜u tĄ;[bѢn>*WFPEAڠUجmWcbb@|Cn~,RO{bCZצ*Y?RddN<+ȡvlUٱWf]vt->O9hqO+6**ث*U]1Weh*o6*ثWf5]LaK!G ]F6a[aU=|A݉*WƟ,B)Jc€>N,L)q `` W0R-( a\Zƕsq6<++n)9E1BjV18Ξ| 9RE?W}a%fYE1?m_Q8*C~Fk$jD5GcJ$}M%O'/(bjN(m]xYi"WU??kpFKf5?kY4!'^?갯_4) {xwD|*94IWF/1H>M_e4N(8]4E_F54p ;RӸoW@e_ױ*eNFԘd)-*rS@ap+[⍾;FOu|Ubnn"'~'Ύ8N. ; llqSӼbLRJa޴]UcM<,C!n `,*1nO_xon<Q!ԣ7^޷rr 8?&D7•HƄ($R+e|?U}06&-oEyG\i[+]h&m/R?ip%N[q!k#cfzp K QM9ڦOfvaƜ Ujn=2A}@ (z eW|)Q|Yʙ|rJ,P+GZbv; dTZU"ӯLڃcJ.KUXdjn "lFP>FE7G ,kοc&N߫0qn*_Q،#U-VrPhʼyFv3VDcB>xUE+V7‡r$QQ゠F?ވg_NN4,8&2mTD9Ula,1p ОĔ!#yt'1(<Ќu(EAQ+S㏳lXNCUNXU SvF+:  bZ!HO1)ӏ n =FD]VOCeö!.7Huv6\/!D{xe4m,iS uN^C/HOEeȔ9W;b&F2=[V@#6>MGO1 ~{oly%p> |.?0 3[7#0Hj˺'դY0T[o<&^'rQDY'Q+f*+]Jq)vW {v1ǀ84"vQZ|T.Ʋ}ء5)v& ZUC|U Wbqԯ]j|pd1=C&2Wf01WcV ;bbm j@v(I%n;uv]~,RQn|0] GOlDY͊6*ثb͊6*ثb*6*ثb͊6*ثb/.Bw`JjRإٰ Pv`p+tqV*­6*]\▩u1챊2[ˮ)hƜ*哊vl*1KG/+YU†09o\3S L s )vl$Dbf]N)v^([ٱWf8lUh--0%[yqCT-v–Xk;VƖi镋]\ثycvUpٰ)vQ PlUٱWfqK܎)k(oc+(Ķ3 URqV*46MUBv a\J ^J|)UEVPܓ`wmcå0^].6H[fdVyP#IO5HW._GVE u d2L]wԻ,9'\P.;oyk+qW$ xm;UPBѐ~|SU|l,3 c SmcH\2*^*^*]LCyXUٱWe(0,rA |ss7*v]xyW6#1l n2ƣ(73l{3트6Z0fb*F_/ UZ\2*bpڻ]LN@zpr$9Z\%iT4{ j1(%y|0^Ǵ<"p ʦ6Ncl!>\jh9;A!Äp_KDWtncm`G.M>*@obDOlk++8vG'b߆\KwӕZF/QV Dlx>amdli }'5팖R u;63V?vu W74vHv!e9.> NIwdKV n?O󝂑m*9.nlFַfRpp[q}.^'րYpzTӓiCホ|'Dj_[ rSN`e t]GP076!vAiDQra{'b5Cy'$\Q]L^ }b݈q m.1q8UW$8r Q^K #%crs%k[yٸJp?xxr ɨkmrDSΘpyhCb]c"ڻn"zcjun:0+BoϯlI݊\ld!ALmÃcRN3NԶqܩDŏ|Bvѷ4U+cb;H5C{z~*zK~m1㏪-毭'*L9(S I*Bzy_2V+(\n_ԋL֭RÚX ]LZ{$z֧~덷'Vǡt=#q17]^X5`-9-} 9ئxR׏{b5|PR*i$WchFR,]-Q71CB68܇j)߾)FǫrhAlU؏[`1KD-"װ1(v8'!銻خR{bL煙.͊6*ثb΍TG g *yWf®]v_LvlUt]vV*UٱWeWv^*ثb͊+/;+vV/vQƱ?~Ltc$|+}QH :? G)V<1bEYbl)o-bzxڴsak(anCf*d_͐FRp/!~L?al,Y_?kQѸZ(7#F!i*I4e#uo񡓃}&Xl8NiO"$_N錅GLRWqJvfEÚ6X/mzt*MqiIL6a2kcmc P}Pǁe[Q8! _Y*1GD@oגJ:2+?R[f1IR|K 4[qK<)xM6y)h7*1y#~?QΟ>Hɑ|SLDIsCyp+tEǛ&U=zTf~&+V[8Ņ"??[x|wS&!aˈ0? /- VuH3xH*C"OiBhlZ8TOŨ` V'oV!ksB K\!n8m\E~?^[Khѣ'ҿp^@=A5G*ƛ?~` %4skV^7 mOY! PhRE :m jr+*䖔tx r Zfkr\QjyuJAF*ݴ0 c1;b4?rJpw(QQOcgvuه.#C71u*Yv7q#WM C8[xbm㓸$Z.m?[2 gRҠSMt*p4zJ*w:dP| y܍%L \@m>0BL;of¨Y"P^?cx-,+2?l4!RS80( esbj"rVOqnzu'BO.'ᗱq9" 9 QܭX]lLA?r>ă,m7CxeyG7?6h-+rn_~F/8L?cB奷^.㏱ @$n ͊ ;$~ˏrʃ2w_5Xo`6`::-[ o 2ق Y87_pddVt|1LjN0KK]=Q,b7YFL8IdnU+㍎ǭ0E$jMx׾@1|p+Jr(.ƣS\po J].v  T=06S:R:#ztj<2|N~"fU8Ŷ-$WTƟkL\&*rm1nj`cPtLҮ>r.etŋ;&e؍GG`2J,G4T7m(X8Jb9O{KS[IR)~W6Mrc;S1MK2Vch'p/ѷ~e.?oQ4fC'zo'ڿk{2#m#O{?0l:`d;0ƙ,׬8Lwqd:?A?ɞn_(??scNi ou+a#fOl[:?0[/ػ?0[?;?~o pKx!}x%zud?F6s~ƝUO}ٍ8W+}_wэ8Sj_w[v6ErI;/ݍ>z+ ck,}(rck<}/X;bt8Gz+}ٍ: }WF*oY'l}mg#קn nAm_ɞnWN_60.a4 .]61VJ7Q+ cn\%?WQў@npqS+P]@GP1rg#s˫3pJ#Q\W|}'PT߃w5LRjPLhɄ4Z`6Ц_Z%Oo8gTx|-eȿV,fD7`Y{)Aƞ9`]"=xbe8_J`t>8ע_Cvj{&92Bj1㇛7$]N4bpʾnQ@ć'>!AVWa7F0>14*7C`,HV>NZ׸Mٰe.{t82v!,ؿ4$r 0g#QR\%/-s`(-5qV\ث)}ĆY^cEq*?&5*ba,gCZesh*SG;|vM>>KdUէzA>؊Fb&#;_r.[y<ՅGO VیaR*$hEt|g+a*TWeGK -Z&f̄S+%l~z1/J%5x[ԌxGe]ʔ'E8K~b$!| wQq+nL4 `k?]'n %'a-{?VM H.) 9߼ծ=L2h?IQOӒĈE!沆QXlG%6hyŴrBwVoAKn4ɂCJ S,$CЍLn(6=iF9aZP J PY-*׮*GiQ ڥ3F6يE3 c,JXsQx?7*dJ|[bm^qJώIcMo< HuMïbͼ-$]Nޘud5CcI?duV­n@Wfz$dm(jG6*UX v,;qt$I% 4!w >? /cӂ0G<=[5Ɣ\iW?uYc-!)pJ9!b3œKykC*)֝(ϩ [Urx,:c*Bܐ%;["b:w+_d´H䃔G H?utV ӂբB>(C֟̌[)7wkAJ{w< ,el@ Q#/NA<\ 4B(V.: X]`hG\F| d0 z62>.d UGLꖦb)Yir fKi r*ݗǸ]A+aU5]s0 UP5] ނN)vYkC;.ؒ?K8|(zI>G_ =ޒxHy{}GR?8pw}~?ŗ;O8.ߤ!r:JGwH\¼!eُYژ<i7AĮ;V^Fm,$hWҏ'a85ٺlWL8zSdr' 6KWm.OXҟ<6>^ 5ȟ+ >oMZFItP(\ic1v:Er2]$#'`]jq[%N"q:811^S^&Ջ? Л_l!p?dE pq 2u3b7\UٱWf]ڻ66l6W6)vl )ٱӳbS5qS6+M6(usburWe\U٫6+N͊6*i]+vli]6*ڻ5qWW5|qWov]X8:H."ڻ=Eaet&L4X醈Y56NƸL3G%b6'|.8%hrXنYf: [ OB:7|ǘfᓰ$e'%ビ8O1^=AhY㇛%H雱[xZcGv+qi{i.Xһ0FaT퍵`pzgƒՇt8W>;Pv ^úpHv ;-n 3,W][8lzcإ͒JmŻ.LqJKFt;oaUܻ5՛[=zKD+ 7'nHj 3s;.'!|{y8ҌҰ$ EnY@؝UӇ?'e݋CMWfӜ~}.š=)c;cp 5.1q2cc3bde0NRvVN -M/ D%Iargjvmn-^=,&W`_^\4fӌv#e+gc]]mͦǏv) w\c͔30;{Y__1Og`j fܳé)rRd\lyJk*fۯRmɧaŏ;k~z7"|wm8uxK]k&Vv#.GskxX/%ȸg=&{Xnr`=ÏNO۰sHuO z;1c)chci'ݏal}_XC'IvoR1S GAi[f>G1ٱvcenNٝ&!\)g4\Iay"I^IvnT'e®Zcmcm]K!H*R:0 (.(vWWes\ ajp;)] :v4{UؙJƒ aKNءؘC,;UR`z*|Z*26bJ}֫IDI.DZ༗lU+rs*Tfjq֕rO|=2yv_AL ٙ9 ㄫp @\RwGF;1CUNlU`iv"*7.Ǽ*zLH\*IebI$`C=ĸvQݪ{d%jlOOKBX.x7KKEIUWcٔm!cՁ7!Q`We4dj YIcI;"ٱWf]vlU?d7l•^h +BKy aJI+!_AAWh"@ʢDq"P(2NFS>eLƧ\/r`C~Plб#S#p[ ?g $? ƿoBZ[=)ׂ-1L?%V*6ᴫ$$OJƘ\ԁҹUP Lw*8ַ!i+G$iӒӳv?XX4V*FN Tg܃cKKґ]'ӗ'őKlOx|8A2"wkV_'J+ˁl< $I_gX5va\N=9uq_+IMGa‰ṵ<$#|1h؏ :n2Q2Nj9PGV?h~XDFRBjپldhi?<2AF?6d)6S SI8R;[UxyuY?Z|G%!/%'PŠO_VZG%l+/#6Gح)6x7OfKiq/(?~X~-)\[E SÿՇ .|O)M_ފJ|7դ*C/N[ JSom'CqaBAޣk J;"*@|@.)ڙ%B8-RZPS#y*HRCc+ѦEPpcԨU-!ңL |#Z?xbq E7}&xD Ot>ʻm xˁoTc1o[qBiꟓ@E%k%p~M9\R_\7\?PzdU@ou(MM/SiN%4ϥr8MYGF[jM6Mq圸IvfJjj-:}G.wjhGfw-$߸ʖGW_ݿI"=6mu~_,*8ޛx]Ww>8S\kv'6)v=b*qCqa]t`h*p;$ߖpyH芿r(!$[Rt5TbL{*+lL QaaVœytZc0TJIHrW P}0?v=lRHR &Ȓǰqݗn˷Ȕ*eEaCGrHL,%S$f4 ;i]Kw| `Y'E8?ܩSmr$^| 'vG1)ӯNT\C-?"\A9 & hVeނj!p;f1b?|@Z&:|qklIbO׌xDhۨIJ8H`-trq雳iZy>lp1/'`b 4SiQgs=g8roIjh@u[v";Jbʝ6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ء\ ua YؗmnaYqK?Iv*'| 0&?k.~^%hZF%>Ȱ$Vhφ,ێ- )m"֒il^2Clތg$Շ/&G%9X \~I^LǸĆy1-"EKCQ/U\TzdZĥM~d=x>dxa!| 8;m2GCݷA<3NĠ2XVU.N٘-ŷ>.c]< $QTx/h=;C4݂oC =F}p]ix/>+P$8'b3BRs_VLrð\]%˜F66 kv^`8x3&'bB;倶j48.-.R= mÔe5^[ )'姓\ާcNfLc8Qv'ku9'"J{WR?y5dp(.<1CS$XI,XZiWG`d_V߯qrravoh=;9t]&dY؎7&11ccW ,FQ+$2a'`I廰MŬwI+&q+Q\|s vOly&4Mܯqנ8X lr PɪPV>bEsM0n#-͸8{. صՐzۏ \~1Ǐ]Knz8ǨQ; l$;iɎZyXv oOQNC<:aK))xI``UO^<ܼQY޵Pq4`~}nUm;3ix;*P}чP+~.ϭnj)ˀ]E/ež&:Gӑ؄3dޔq xew`}k}Yqxk~n7S|1F H -":^}9ZnѸ-c'v!=O b1e,kTRŨ|2v8r/NNb'o898M'`-cH6N\GP81؅Ė.E"+2Ɇ9?l.ESbi3j~X6] })$r$t3GP8g ❌)%x3˻t1(1reQ'FaU;6`bwo:Zab,Zk;vX  HuS7cK<y;1Cء7C0@] >#vf=ĜCUbS)v6U"v&k-Ep+x)vg2^ԪiPTq]|U*7늻2wd4pظn;g!MWcIlK adl*Niv*?g1CHICq@v40=q v;Wb*6]*N{*쪂7]lU\8]"X.rA튻1ebbzWe~U0z-(@EġQbcfFÒWe,~!]7\*6=1Wc$1Wb+"<0!Ё>qKDt#~*JVLT; c#1-/dPlUٱWf]vto->O9tY 8f2ISeb͊6*/;6(vlR]vlUٱWcpPٱWeWvlU+ T]LثpDNr?$ɤ<@8o+]0!ck-sS\ءpƑL&T)$_W}CE>nNW4FY=q{XL7e_NJʭ) A tS?9j#!&H|~/1O%^B!ʔOi_})[ :Qj⊅d pt;+$4\r_f .dO>gO0y+̆;[؎N& DnWrN-f2q @;WhUKUkRR8y^F.iT@c-lICfb`V0aU1N $!R3~*"Hd5qߎ6_JzT%{f?i_oR\zSW`N䧷ľ?\n=[_b(`㤟-mBWbO?g T%|J~XոȖuoƒ|/.P\ԢNg(Mdq$d/đy![f8֏&DyJ.3VNKuUQ[yud1W4mdžm_O3+?Փw+lI\XO(z?__g$AcHu;?hp_Ul~q-:f61Vq=[^c %fNG/-C}1ʶgR{f!%[ǐ }k,[(&iEbSnxxT Ğ#lTo#ǧ)(8OB,;IU!R0uCİKmFF|lJM im/ܫ-H IozOu87<:\F>%{ %3 Џ>}0;z9&}Z*xA]{a|Rl>X\(ƪ\Pq|qK9_ LUd=0iCc$lPɡ88>6ٻ $ /~n+2%H9 N-ҾB1T;W%uvjV_Ɵn7%~`~!+|EP{J[#.inXb"1mvCqѾc@1-+*d2W 7&rip+n]$e.>"c8\Sv\]眦@+*aLL Uv9m-آMCw(s`dMR8k1D&aN@>3'Ac^o~5932Ƙ*cT7ŠF[9t.,.6ޝ1`(0*jv "aT ,W0V )dP WP,?F'O-QP; 2b)f]UWbA~ȫF5Z WanOv%QblUٱWf]vlUٱWf]v*6*ثb͊6*ثb/.0Y?92H ثbp!فZˮu3W] vlUٱWeWvj8BV,Z]wcck[͊,b*^*UqWf]KWf8 Ulk*]+ +vY8'u1¸]\)o,`CY­Ҹp++ xN*閸b \Avl pZ Ts\Fіoz ix˿Aa! F҃ZWZև*i/Ɯ)vP‡e"0𫲩b͊6*ثb͊6*ثb͊6*책];+ONH:>Ւ8>y=kee4'/XSN) Ű~iL6,öG1!ϒvneH}v@iP1_lfksa d(v++H?}6_e50!/Kܔ'bH2=XH?N?$=~iKvjޔ4_e|rNv^J(~;OOHL- r0YxFiv"hq˱%OQ;*٩]U٩+6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6(.T0^fo"D9rv ci)d-^ED'z69:: .큶"f7ݛw1?jÐ5%wm;+;]E/p# lmUit8IBG.4=1-ZӈGsTW!U[r}r4ߎCP8eG_5 q8ey;zmx~;-\큶4#<(a؅nh<][G8BX%\%~ln^HPYgNdy8z|?K~/w`ezb 0Km| #QҸY{;_G.:.t51T]n`O<'v]}hS.?KE|8q8@.tJNO'`K#An~LqG?_; ~Dc.#EHͦQ] /җ펇m5_S,$Ǔxv OR?bEDxZ֯_ Ya.VeͿ^$fEq7?ce8gTtx\R'D% 1s':qmoL'ќUzbևt;CF unl]{G"=Aů6aPYиvb'$oa(3UqjˊX%c;P^CiG:ܿi<)S͊6*\Uxb͊6*UٱWe͊6vl ثWeV)lfqK;ݺ(SFPv ^YJυ~c³#j5>Eu,= #J[_KRXW~.'LcE68J.%.\bn;}JSs00!kF V44SW 8R5}KS<ҞkcN#%;zdqj8J#T2O'OUΓVsVnxb=nfu5?lҞssD(Xuއa x**ѵh??𸔗Ii(vp*,,!UlxQj@Rԣm_}&uTCO dؾZc-EAh?FR 7ąT9@1`w؃U+hZZ\ULU  [BU؜VFKG܊z3o?HUBhwcJ}j$}Ql*wh~:Gtwu71 Ѻ#d?:z%VJ|lm[CMW\rsfs`> ;7#lTiJ 䟴8BU@ w??\U(F>xFjepcEmsm.7LFcj#].6[~{o xeEUU v,)SVb#d ]9Bp+/gPr6:d wUـ\Uٺm1SCva]] 6* LU٩51Wf8WevlUXb.®vNŒXDX'Loߣm_ķV(Cq]8"Fp|N΀0zcN97#guC`q#WWCQиYwVMI؞7Yӽ݋-dDd$MN[CT}mQOf4"u:b1eݻ6vlR`CS 51Wf*]]qC+b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbͅ ?QV?kd \Qb}r. Ə`Yï6 rhI$S(&ڦt[편\Dfڦ-k OB^\S1$(p4*-uum}W67uqREU y#4(Phbv%viͳ\8qF؍ݘN_0U1plf2aLnٸ=ok)9Cv]ݸOUvq>NĸB0eX\iŗ [ky0됓8}_epa&)wCF4ڞDuGIpj4>.(Na9.J^_j8iNvr?H28;8F_p0Kv%}hm=$8>}.v׉v{mŜf`fItj:cĔewzl3$#~vh}qO04~c}:\CNKnO^}.^%3r<1fXMDZNqei𦢾m 2UnlHXvy,އ]4`˛5_A׸ƜܸQm#Oˋgq,FzZrb \~`+^rwdof)7C0 l9铳_XPzn|SW?Lc~SRnOWfEOL `8Q]qهCnǖ93$[*:PN)v8:cӑK9871pGsE͒ Ź4c]k|.Aڸ{?v%sh֎$'pp4f,&]n#^l.9c2NA-AǓ'`褏Q^,)(nr;K7<0qCTZLY~"f&O9ty2@}xUO6*Ux0Wf]LUxb®͊6*ثvV*+6*UvlU09uM+ Ku";eI/ٮWY$} -Ԑ:9ҌTv9%[f I=NP늶M2kn8qWn8Uc(*|%-Zx}E)d$Y3ѡ9}0V.K^6@2[~`S>YF-{>j|?rb }毀T#9}z2fxcbZneŷÂcĹq'Pi\/$?,TCƾ+_*|N.*8\/|\W nMb| 8?a 'u^¡=k6COkA\Wq)72[ERRx|ySO]>(ԟz{Jre[kZ:*E7v|*cd{pP26d'oCoٶʬrB|ޯ~U?bR4$r7W 4F-.cR|i * Z)T\^WH[b6u]c lbZM~*˓diȼLk%kYR7bԌW$ RۨdZJE[`,Rd))f^9%%8jue]F>AxLŔw͑Lff&S*( ZWl*ⅸ=2ŁiplMjl.ӂ`MªSB$!YcJ[_?V(Rv Wa [CW7/(<&a=dc⫔2I(ܠıE)=Ʌ'S)SJGG#qf݉WQAA_\p 4N)A s0*K \RbTOLWb~P:Px~_%.ΉoB7;2bX? yNGr$"prt[1lJS<{Ds}8&(WYr⫋flҊP]A>BBo 1+_+( ~QT u#Qh0!cHȦ*$g5>w;|elh5.ʧq]m®ƑNU늻,EqWcI$P9 {dَ]ȥ؟_cZT׽NU| W(I%vSuڞ] 4=Wch~ v1__(vdFCR: a Z&fRIjum]2]uG6BLK] b͊6*ثb͊6*ث*6*ثb͊6*ثb/.0Y?92H ثb͊+va/k6u2C(k51VSYVaWW6(us]N)lf\r*.*q.́;5k]]٫vc];5qKW;5qL|m ㊴r])vcXUWf8WW,⭌ ث *eV *죁[͊ 1& +Xm^WH=nQZA;>r4Ng)GEh[FدZb@v` iiv'vl*ثUن**CWfj참ialmzG 7ثz avW|1WcXwtrUzeXض o]>nO}3-}/99Rirt'ZDd `qi<'v2"hwSD̓ǘ n>nu\'7^xv{VpN|v Kg8\YFhK`siTtxKO'`KbcƜqG Bۓdqh fwS,ؽy'19xK`ONK9:`_( $i{: y,us;IziQ8Qv#ixaF K\=jq)̀v-Eeqo㎨Q'[%1q pv:O=w#si?Tܻg cl4cꋱk9f_Z؏4ٓM8vUȾ,gIfqqa8M ,zi;CP(fF4Mpzi;+C׸ˈgpQv%g{ ;`hé1x.Èak}-z]Z_Bq,,pdv'wb{%>Mxcn2-;?q͖(Pd7f?{ThŘqE˽4(VϥCx4\@qgR$82;#U;,3饏=Qv/Ҙ|} mǞ9 d[ 6\YFzy;vY8:+< %[ OO'`ɭ#_Z*s2Qm:=:W ZGNNCT; A]].zSǜe?͓'I,%憾,ZeZyXL&K`oFqGT]礞¨ F?{٭mD5 \$}2v.N6ݕ6*ثb͊6*ثb͊6*ثb]CT/UU\Tᕻ uNTxCp+l)va5v0ٮ*qzaWf56iRwUe Rʦث5)^vnB:늻7jaï|U æ*znv˥70+v4n7%PqC!Ɨ v5t=aK:xbb0`;,81=qWf+]V ]TN**EXqWe1xfܓ*yRs& ]+])WebriR4帯A AbeH>80_L4ie1C=j)bqLUR-Q1WbR1)v>]f:!bwo"X9{"]vlUٱWgFsrd7lS͊*Wf]1—fe͊6vlUـb bbͅ]y+c++lf o*㏾X6N#dTWǑyZ6 H;PA'sn%z5֚ES) hPc`^X%hA U;JF|13*X^_f!>oG$ sNػj}^bf~kx?i">x[+g:Z+n7oQOrѰ+J‡?ͳ ݨ8![ oIP@RA3I J{B[sn5Љ#aїbCO#`B;+k_bw(~e é2[7/n_B;qݿoexkvE;ihG RQ,*vQwO6~wRPX{#h}Ek(oHО!Y_+aCCcb/#R++vV?YSDu=gaF"7t'o}KoA~v4˞ɧSƕ/kdv㣜HR,ИGKt; KW4m_^͹('[en`Č!.Mì? KCx뎌γJ-1ɷuGeKª7+>f|ti-ۉFeT-BA{2pB$VGTɥt=O'>vLmm UzO߾eS"dqBk>iVmp4^-JKث8b+o;ܐv?< Ҭ%Qqqq!\x\/|=t7h5 `Jz4<0)kFk`qU3պbLumbFz)v$9bQ#rUbBZc|ʁocX'j8r lpy)ƙFam朿- ._sxAbyDtH%^<rE5Rk1#өd پ@ N;S Wlhz) ʞƛa/]î?,Bme`HMKdGWfuZeEwf;WSe(4]l=We]qQCeq+t—e*DlӑWcPv5] 78nzWeMء]IQ]8TTPN]~DvSlPao*?ĵ r(o6*ثb͊6*ثb͊?*6*ثb͊6*ثb/.0Y?92H ثb͊(1Wé]aWeCG6*\3Wo+ ZaWeUq8C(beUxWff*ثWfvjbLU٩]vV*ءtƒ˶ Wc\U W(aUو-W(PU 쳅\2+yWfثYWeSnU*Մ14l-.).Q8_ `[?hcd a͌B8KD+N[8; 1Ɂ6‰+y`4I]uؑœL*pb͊/vl vjbv9@A'; ‡`F,m Qn-¶쿪`c  m׀P2a$&ݍbgWSc2?lZųnȣ f b]7,V?GCkg*ڳ۴]J0#vݳ@Piaf?S8IfUN.^ Q/L+\WX.J>.T1eT}I7ͥGK'.)|,?ؖ'YcXENN1^kiŸMkD ^1nʻvn2v۔LnߗYNOV>nnG&#apdJ8Hx(vVyw=3Kb\; ?NqtGÑ#N(UخÚ\V nU7`ۋQɎNd\cRY֝p;l9Hv?!ٱCSvl*죁]bţ®kmQ] KHvjaWebeb͊6vlUٱWf]vlUٱWf]vlUٱWf]vlUٰ/Z™Q?ʹ ! x ?]ZXm^^NS$\{xV}h#,\=]F`펇FQ~OM;ӎgOžRyؤR 7`mg ¿-m'O:+:C .FxW. =dvGky?ŷ_![ډׇw ~}NFpkȮ< ᓰd0SMKNmVIzCF.Lo#@LRh/۝=>_c%$q8}(FA o:G f$|&,jN]}o|1-}ؘz7F#t2z&ybtqq3a8Mܯ?^3X9?͓k j;`q%`zm 2E̖!~vkPNa)xe]i\-dHmͦ<|9}9v@g WgN!,1=AhI(jKӑ]%rmt `KiF$3}x.Š;fyc _Ihfӟm!=,ֱ߯ၾxQ jqno e(CQؔw-oU ^< ;?^cmypp[fr1 ᓳ*g%k\Zy[i}H$nQu?_]͸H>hŚXI+LIp=h>Hn˃pKNg|ӐU}}x>϶R _F}t8bs '`ia{)60Ӈ,r-@po\8jKӑؔsK 7C.4g,;.Wւ0qqcJFӐU{:v-yf n)._][qeP&82v!w5r04fq9*G6zثF1r ـp:fqSLU؋(*.#J ?,UK}y,kS [*YWc#b>p%زCd$t]m[v4ծ(vVwqKIٻ!"]`Q*ןC]@+]IT(ƴnl1K>a]b:vQR0!+v&TƢ`{cd`W*Ipm"2;bk늻)kJ\U^؛q}.پ)v+V;X0yǂn6]F Uؓ=)C@)v9~~Q*/&D-/͊6*ثb΍? n><+JyWf͊5qWeWf]]6)ٱWebc[8Uن*ءSur[`偊qcj<|H)0K_ӎ"!nNb>30S!I~/l`0YMFǶFR90 79t\:)48퍥ԏzZ),e8qU/_@=5IrqN lQ^O#y$BA$M'U{ۭN)gb 䧡#9RY6fQ\ ؅va&e*ثC6*avY\19bW1Z`WW6w &s }GLGi!GӊFWKgNjYXwYGQKeFk"jѢ-ї88km&3UVQJ<`pId>#\`hBɭɍO\cPI/43T`%+I_V؃WoddeJ3x0?k WءPJLaednl|ܹ AP}'e~$}ÇH5=NI <@>X;=I+ĸmb:/Ghn- eZo+QC~(~(oTpkO?챯LKAߺuf8s",W|h>"Gҧ猘`dŒ:2rZJ0q=X2t`uhn? dᕿKU1>UōE׳zѨrbv!@.6G,R1EZGz w/VnR,T;b^8xuOW׏4Q&y,U6e[$haPPK7 c#ǭ?\Fv[=}eY) )q@"!yp)ڔ$::bMbFҍ8ZM*< H f 8L0qSeSvnLPr`!Ѝh‡nnS/=icKp+p*UjK01jpZB1J9 ;9liS1c^]]q'SgbWA t2&06V(-scJZW4ˆY,.*ʇL^{dEOo7rM?DУF8L8u+H܊348 Mo0Az5yT iaYR~Ǧ*쵮 vZIRv0دQ&\i 1aCQ] * ] J#QLUaH+:{a;^%vf$a]aJR?~)v?;mk P/ߐM(-w|͊6*ثb͊6*ثb*6*ثb͊6*ثb/.0Y?92H ثb͊6*ثb͊6*GvVv:uCWeb\UDWef];6*ٱWf]P]LR`1WevQbaKE (k0ٰ.8b8UClevjbW,`VlP_lU"w!"E]Et8Em FHah Zq8sHx,KUQ3>D/527Hc mLm}2v:͍נz6~HlKxrpFweOFmv8Xx%;g/ ~&2ɄIe%p+oun$; -Fha:̾AŖ gL -&tŷ4-c_b8m?v%ktaoJNc\Zfv:Hޣ$.3Gk!/O׋f8a>da~q V~i#q^;bq?8 {7nȒBr[)uj/^ds2pnWeg pL8^u9 j18e)sgl9G>C3[ k9xeh-C6\iLgKvS%px gӰLItXvo \QŏcnʹҌnAٰF9*z=a2 ]|x# hń$Q(uȷJ#P,m\Ilxza,R:=x;Ɯxx;\˳i-{y-N&)c;ox \ nv<'n-j=A \l%N^7ɾҁ70j# -pUkߦ4CӞ\$in˂9ot}^cݯFAv'5Oź{a&x^Ӓ>mu".%V Xd0pgS2vGH*hI`4]IGo[~M08vW (n6>'$c&<<4ڿJ mۏӾBAw(N:GӓvT? F ӗ`-^qP?q7.xb|'8rK6alͦT7]J=XC'gbWv"$b0yc?Gx "b #7xGbʱ_.Y)l#4RdX|=8,٥{Ovk+МUIMڅByǺ#M:9lo`;z7[ ~@'k%^daO Ǩ!eeqㄷGR,zfF-X(zPq#R]V_^z@ޘHmͧqG˱ и=`|[JBjb`po }.Y_\鉷c0!ٱWf]vlUٱWf]vlUٱWf]vlUٱWcmQ]OMCQvmr+n1xN#t Wahv<81Z]œWl*)*WveJnqCIv9NvS(mWbW_UOE1K:!Rju`kX9.84)aNPNHqO1Wf Rޘ` S]$*iC]@;#PX94V];p!ˈ:RF%y0ت¨1C=qCpEk]UYyt*R:Rָ@ݻ5w]JI%hRb̤aWcOO|*Жv;m]NWctؑMKčc(?F0AU%@&PS*wA5늻:j1K<1WcX׮Z$Ȗ%jwnE b͊6*ثyo9Yˣɐ@}Y$]vlUٱWe\ *챊/bW/v]qVSvb1Wf*b7)ur⮮jbW51V-W\qCLU˦*レ(VߓOc?<)ZZS, PӚG[+B/Iť8Z] Tn*pk`Z̞á&1ZPqA(|*Q~ƽh:{:ʿr(dIѸj )V?xs̞*Ut<2ivc6*v^ن*쪑%Mq*;\F|aU5R{|,Z)>5I^؟y/*2I>4yp~>J規 N bJxV\ٍKg!+עљtms3&#?I(&fW5ƙUh|)W];⨈7%ǦLm-}2 l v9cF&1҈%ۋ|?X^рqTf$48j\W+(G[1¡R&NG ѕMS] ^Q?H#Mʙ&WS[ٻӭ0]T)]aC1Ԏ-cwfIAWfd|RhqWe 7|UVPG튻)) %ڕƕƁ jH5qC3PP nRc:W"B X~IICyWf]vlUٱWf]vlU*6*ثb͊6*ثb/.0Y?92H ثb͊6*ثb͊+vjb]LU٩/v^+mf*S+ ,be5b\Uxb͊9x,G6(k)UX]LZˮ*jWf]Vo+vjlUU'u24E3`VbkD ܏EnVqHR+/yp A"!?MOz<)RG}h:.$b7Ul xKƒgi%ؙLR전഻EWcxac;/w㏕k]ڻĿ˒Cb8%0+Xp!nXƕ­FP|I־]{Gѷ:}@0/SKVʧfqFo?5|D-فĀ_M&f>5v 7Ucr w#ncQsr{í1D]ڬ=aNB3c(}_\64D&%*WMJ7x8VdNq:3c?r]߇ԳpktHK/wv#`x[?j:)L%]3es;`0N]_@֓S`-Z~ԉu+Ӿ'W.!'ctIvc:e?v6 e~u¹b3cT~۟Z2XG̈́٭-q'g˱-)nƁq z=`zbV5?8Ĝ?ů3GX σ<6p.i!Y 2G7Vjd׏ͼƕ '[<5bh <2Ne%]ޙv[ i]@qb]\ ]tm$N,AL.hBPm\Vݔ"6—bfqPmb*B+LӲbf+NLVٱWebqWeb͊6*ث(v#pYW\uELthy/WCċcK 56>;Z.ғ'a.n]j5ap4qyE}̈́iz> W,錶&zx-Xqd=.9sD֬%u;YA9bZGzTar2>v%k;@}P Xszg*Մq(.1Wxsvi%|[{u,G*9>ƝFd=;Kصͤwi@h.nLQ8]ixϺZ1j =3c8Q,zp ξDZ2Ŝd6Nd&0d<ðJ\Ex&?cɆhf~9٢K3SF~-^)tOK`;g r(sk5[6|Zqg82]%޽@,kPv'gv`rjXԘze.́s]#K碸d2G8?;1b_~㍸޽4;O D]3֫޸Ajé<|݈Xp[LHcIꏪ.XTztSq!=ñIaD=Aqrv GPm(qrT9?;!04ĆIivUݒܯ09y1G0v2[yEW߶؂ϳ! z0ɽ S 50+S 51Wf͊+vl*ٱWf]vlUٱWe®ŖF^tcft0n+#cL/0끉ǃQ(v qKMZ 1We*X؟!J®NJ*6*첻銻iۯwJǧlUlx5CIޘ䩥Fv=zS]dLMkL*SG w`wT$w.)ȟ*R.KCҸS$W@I((qC}8ؒ*Ö]BbRp!@p]qAL !P *zOC|U]&֧Fԅgnp, D`U;U[#J?0mKf"%#97ͧ4mjhJ.C$N3h8V\>},4wj6u?N$qdW)AZȶe^'C\*YfN1^Slm[q(@BBqev%uZxe\/,_ڌ2q?;ͳ۷_i.3YKsp1Ӄ,r=&P$6_o1Ήd^>xHhߦ,G`+J }.0OeYP5[uw ض1 l_IL>k_ۏly#c4żQa 4tػn/NdZt|)Q]{*Œ:|:z7Yӡ0&>;q,YHeAщmRAȥ5]i)(8v5!&ƲF0A, 9z C/(bQV&nliy;0f)*ZԻh8®i.Ͷvjbƶ(vV*YPUؓ P—f(vjb́]GZ.T} N|^$vN֒d=_ )`~ QM nb. ';c>*R? H329vw/MZ<2[ޤ59qg?KKxH032n+ti,%)<$8,2M/072(Z=i+w_~&9}\E3OoR-ȣ&?GLkFI\$686P'% [ϒ)2խ[}mXFܰB4wtLCI{'l,2uͪξ?hu[rLq!N=z򌃂W\$2YI_RmڭzȘ28l/z3D|>}2oMbMWi n?KlMpܜya>v,ZvȗP ;4-06sx#3v'Z7A\ǔ<'v)wf&k}$8v2N*Le[i==FlFKT-@qq|[.9;ds9ib,wb wkCع雲 ?T{aeՇprLiQv7|QPc;ؕP#:FNc֗*Пp{i"g]_[jcL2a.>wQZ,[IqU8ms?wV`\~T=Qv+m:\qױƛ1OD;\ir[74{ v XG8tD0?g%Mh1aw]L4P,mؕYI7_|27:z] 7d(;AxqUtP?^m-e_VdӉ(;iq|>QP>*kw~Qش䄰hbNl\(͛^k*kL.<'<)yG0pGsv#fZ{\Y,}{cC e2(;ez$.,^ť{6aqx%a-LZz,ӔLu#NG`@f9W1d`{&NۛO8?v;N VTtŒ9]{R$q،џ *_N]*9#p; K8m^8[7w:X)㇧v۸vl6ˡivU1vb1;66Lm]50S;+vlUٰ+b͊":W`kևobbpz~/nP;wsU7 zmu.h@;40ؘ,-z+4P:ƕؙƕؠ4*M>!\i]*4**FjIj{`Wc)C,h+LR*: *Ė$We Fv2W<@cj5=vnaa*U lP``l dȬO.߉u)v=db({bR"RBz R&áLJW)v#`PPn91#Uٙ튻#u<ڃ zU® +]*\*Sm/f1v:ƣ 1l v`k튻A?%D)v8ԜPH/] P׮*܋O.I IvȖ r*lUٱWf]vt->O9hqO+vc.]vlUxZ͊v^*ثb͊]LUxYWf*q9xD偊'LUKe.kXL*|0S݇\KYNN Q̣,At@NW*Q:f)ٶЏ0xT}1 SCIp@#\Pb]c .oT Ta|$2/lDN)U&IxNL0N+IUլvl1vev?EƓLd$e\PvlP͊,b͊,1WcKv."fo\HIIG[&UAsFM(|?1>PZܒ?%W0ܻ0^8"HI?\ ɐSaqRy%?߂ˀGƇUH桇x_l ]9>Íám {0QҔt٩ʼncPAo? |w)/)RA¿?$9Y_#l %բI$JIUh7F`.DccWXz I^)|!N=QPNhiJ߉`Kx߮*g7IWH8k GI.L@rF?Rտs&p\xH?o, ,SSe(!whWxhIn^%4'5 2$sg˒ץ?iadj+V%^@37c|èD$0Aڞ?,K~Wmkq 5r;$c9V雙6[fn"|Ud#^GZ+#?pw`%k|RZ-qUl1WW0bX;e↲vlUD`KSnT\&+$_*9ߞ!0Ҭ/\eW*]\42L Xu2)lU$.A_`}!k5=Fv൏ v57z +ѱcJC;#HI߱ @.RO 6qblCVvS3XRNGjU:SSSWW+L*A]\o}VNbeIPJbGN|Uz`W=WW)WðW,up"((~r?ثb͊6*ثb͊6**6*ثb͊6*ثb/.0Y?92H ثb͊6*ثb͊6*죊]]v^*vjvnٲJثb0]vU1Wf]\U+Z9aqCY-{VV6u ]vc]b—f]jLءـvc0] .f&=1n"'V(U~  =neq8R~eqBC \<-FB(v`\qλ̸Y;uj@ oˍ@fxUؚ1KbqWcC*]v=H;4TCS ]v5KyK"-y}iݢXM4R}5pS eYSA@ F|<2w㌴o\ۡjN98܋{س<lp2X  ȦңG|V'I%Vي?T~`]9V7mdi 84ƶ\P;hc؅l8^儚kN#fQ2$q0RN$PbZu9/T]HäwS?cOeON[3O"ĔO}xrv#l恺|iq_k=>Si9_v8צ:LP4kv#˷ͫ"h1!]G铱qXYA8,9qF_Qiٺ$ckN3Iz.ֲ-+a.; #ͽϧp*nqKAz%b^#e=0n\'gbِB_(ve;sI+Scрfu WcaLv4Lp+C[Av% ,QR`cviW- ]x.aCDuSI3be0TG;q`}(v'.878b&C닱}b#GCBc}Ѷc `axeSjɫ.#V95oJF\DgChmaqV.'ekIqa(2SOZ:8rӚH=8c Mٿ-`kN XhYB<$чSôQv)=O!91z{ F \#R/ ̖mza 8 Kg7IɊ9=PJB>zs\X,-tC]ktzo-xעKzaban""ۏ$s ba%njji1c[GW`j?7` 'qvh0Xv% ܊y=ۛM`9t>br=;9x$!e3`KWQ>F.>HK ذ ~vY0Q ve~~R]}XSsQvk;¿#\-xrrv2I#5gӜF'`Y_Nm6G 8e p#MR;ah:yT mŊ#sqv)guSnmacQ^Iapq\sqO"/0#ApKҡx&dn#Mݟe(N~Ɛvce2v4G+1 cGWcxU@ !]0ثd`Wc0+bf]I Tv[㊻LLO׶H!ؓ0O\%/mMox#Ea@h{\wcPQ8vW_I]EGlVTm銻Ɵkv*̤1KPAqWc6:`KP9؎ZSvS)1WcbT ʠZנI@S] beqK/]dcYH Rkx̽*4\qWc[bQ)?œ q`8*~!_*kР`:y~XRkw;-E:bc0:b7 .Dv1'ƍv?F;*@)v4j*l.YAzbŸ~gv:1Uء#Q].rثR^]CUXPt#]МUJQv`G*|p"Z^<-ȫyWf]vlU?壓$ 8gU<]]vlUx˦*lPa]6*ثb͊\rYx٩\8fq9`bnjUUZ'*LUcA&R--Tp7A@YjTwVBneR۠_q%; RkUqCf<`+E$/ȍ᰺n.%7g[ZSl,RI3>8)V͊w}er#!,NDRǩZQp+!Tiv`<1vX780PI}[Ǿ⫳Sv^*bƑ ٌDt8uZ|m7ReT.VQ =;iJ\@BOhmV*(Vɸ׎+*V+O&j =?,NpcLg~'giY=hw"qG/toHį'D"$` J#QϏ,q4N*Ӓe]Z$&  + VIrBh{JRO{0>(~8OVA=HT Uf\29.l*^(vUN)v^(v6+)nbiV"srr )\ m&2h}񥥌ǢGcꕊ ~Q.JI4-G\7I!p*AkyDG]^.";x䮋J|CIӜ^AyfdF S"G23ƦӮ1UR I o퉙Uu⭘1\UL[Hq[;K퍾c !M4]zrRTP!p9?, FoQƣ0z RXT ȧ߆/EG XAAb:)a,~"X.W8~CZ/ + >?hƦlNѫAZn4qHvSӗb?4_CLBL;%Z"; [ CN +U~[#OOՑWcBm]đC+XWsi)lcLU~c1 8TW]劻p+(vBvaBJ7Vb͊6*ثb͊6*ث*6*ثb͊6*ثb/.0Y?92H ثb͊6*ثb͊6*죊]]vlUu]6*‡f]*r]\jbyWeb͊6*q.80c.YWW/urKyueb.͊6(v4VثY+Wv^*쮸WeS|U1 ݖZEX ¨#Lz1%oQ&J8x`r?( b])1KLXq`cW7bt)v䋈.>,?Sc>6AQ?}4D{vz}L`W5h[Td#K'j}Hyៃ2&.-_ƸI{`ɿ&n>l2G,GYӓ];rN5??LQvk[}#Ň?v)ۥš8,5`NBJ;8.ؙxĭٴٖhNlbG?gctjiW Ӂgsv\n?j#Gr [cֿ~%ppxO~[q:eoٵp-a,Cŀ?v6Ash>!K^.#|gei ~npK蛱!w_q%v^n#q4aY\C闩حkxųQyq~ Q)GJ i.(ya), YzKMgMqv)krޟ./kr0a<2kS#)P£~Y;|f6evRUء0@U)]KRL E.ƴx2a높˹,-5M-n6Av$ $~LRjAv2H:HcO;9") ]E^z}!;z} $8f߼~-,u0]+:zu<0ۑ XK=>cFNE42qniT>ݗ!s>f{+ 8ekeMmasth&?qİ:'[f6S#&1$~\_V-n*fw\WMKpr-Xs LNa$g 2 ާx\9vA%ѾÉ_8ŚL=h6=Hŷ&!1NIcfrq&7r꧶VCYK 16 p=X HÊ݁K}9=2]}c}ø[t8[pf݁g{W.Lr/"GAI- NoP+2ZILb,ӄ I-y~1!!F̐qn=zoc]X1-8.Y_ Bp#OLc.ZչMyKeGN]YQ>v25GŢBX%{C80aqVzrn&Yn;[six9Zj8 []4 v>r0Gv.AGqn2"G wdxK! @(ĖRj).$2KtlJd펣&xqm$%5q?O]Ӗa@k][rqA u0Fe\t 5\ OVzwL= qk-zOLՓx!PJP rv? Ė\i3T~bk2[aC++[D«~sbՌN☵`x]74cv<8g،Y0?.|r09~l݈wq; ޹7cn=tv({bvS^ح0Y[ݗ`+n 춵n͛'Q ;"0ޅF[aؑQez*6=N;5Bc -] :U6wF裹ؕ.mۺ~(]ycKw1 M;uqWcYH]QW8ñٛP|qC N)vYc_lPc8C3];Sv6!!#W 1K89'q-Ǧ(vXRWfm8 Zӹ.ƲVPw]u˶Ҕ*첥½)"ASZV.huGL 9n0ٝJӾ*P5N(v(v&hv튻OM]Sv4x*U'f*|4~C#@*7)vTr kN_"T ;|UآZإխE]#=pv8mvb+R]@ pjv]$Ɂi{"b͊6*ثk9Yˇ&Hp ]pXb`We↎lPl*bf͊6*ثK^k0]; U Z'Vhp\R<.,-N*Zm(&8rN, 2c)/T'&(keߌfCJgQ.x"+q*&j`P޵Y#(AZfkG2.o=VM5p%6 015()r-יImnERƧR2SV Jf5|qW{fL pI:~JD]+2Ul-Fw/NdT}Vt ֟ ?{$NLkSHƸl+$t /_%U'Mad>?-Q8\mIJUDE>_{yPE۝cNUz$-#rI;JP$`oXMv&S[6+Ҧ)v)xلaN݂RN!]\7equ+ZWImX%?_4)R) '߱ɰIU[ۡ1$l|_*ضH[rc jI>yVxMBB4"=X5k||JR+̤J߳Ν^2GlČxbdd?^MDbZt$vŊ2IT+гT A2::qii9իP${0ƕU^/z*"琬sS1)H;Kjx?m| # CW)_4u ٱVOOx8Ԯ68rSPqZL(qUثbur]\Sv;e L < IQi̧&SHXӂ+ Vڊmmkt2/N'T`j ngyN@OTçr(^Xi3 R7 ]xO, ZڛBck a[6V@$WK+.) O=F3fSK Hznت"8|UfLUTGX6*\V^06raLm#&AZVcaҘصkypk[jAeKN5(:OhG$˜$3zBSmlRdmu'@;`{S0LZ&v -V緱ӡ6}nV҂8 tr6WfޣU(vxR-B9tㄫ;5%v; [vWCmJSaCUTzV֝qcm0Ҵr#pM2~ث޻b4(V1C>;iRoUWb{ v?>XMF(+n3۱tJbĻb8ˮ*ULiVֹ20Tcq# 2=q468ݢ;ҙb1psuGŇCu)UEՔՈq\Ů֍£y:I \ؕ}^vcD}ɯM? fwha]XZ'ضTN߾7bc!>T~c*\DK+S،?;.}rJ7dl<mͳ:~q,v3H#y>) fu׈;3lj6Vq0Ddr5gEVReRGс8'0?8kOݽE;gkY]\!석^~koFO0<'Ve{=DM+KmO\Yq 'b t{!) ?;47g/鋍R-u";a[8Ŝf3dž_W$zaq9a:~6>eׇ8ȸ KF2%6>%gsrncl[b|' prus]~-N}=z-ne0O Ŝdv'qf:e⼅po2psqm .L2Q[7}+0[˦XCc!-<}.L+x9P-҄3(fdB1qp8e]?.N-Xěg?K2T[\ͳvi6X("[Wc>Lmz &\lI`r6XNφ4 [\ o*p t ?zӖBpEX%1l8.D5‡e>銻^v2cj E1v5dc+2Ivb*1C4۶E] WeZ\*찔#lUelRFU*])$ceK* G\Uahbƣ$;4Uِv'': DzC6d ˅?0+^+{C;fÃUذm銻#|UٔcĀUؕ~*b`銻aaEeAhjh0HrRث<Q;nʬnѫ隅d2Bء8؛=1dIڸHWb aWbev5銻 c2`Z^<,ȡثb͊6*Z|?rɒq3ªt]LUXRUtWf†.͊];5qWf*إxV*]qWe 9`bN< *pZ81U1U'lU$pB UUL)\OC%mUղ(KzצDi)u(([@f:e`kS -]ڬ~ʍED8*2p3t%ٰ!QzBzb,hvBN_ҩ*柳3t] +t.qWSMqWf"qK"(vbF*i4.ٰ%ؓ>*E(v"f8;/\SNdһI#W` @Cx~U%hh5& Re`aJsfżJ E#nWVWj|'G,~}V7C3/~ɮZyBwbIrlQڭ)5>@Pb!bB<1ӑ%W:q;.qUI7$GaB\ IIPSGbBqRяǎSy9v$V~؝gqn=*H !U%rQ*vˎlF*L(JaX =Il{`~ؐ~«UxHXSBbrTTR \3b͊LRjb.‡cޘ|qcmghuSIUY{1 U G;nt呒 (C%ܼd>1{U"~$=0)i9+IzKG. P0A\-h⬇6cjRKzkTSj nX=_XA;WBV~ >h:5kNH'Ρ#I+L:xwQ1ǁL 7Ӧ4uqE\i*|PL(jpRLk\FbiD[Ed6kMhՒJ'k؟FrВ2է<W7l;O݅ٳmyS wsCN-dK]F+=mnCqlXwQOF-:;lMDΝDH ݯ֠Yv]9HˌLsܹq6_TnG#}q[Y7F$HCjp&(nڠh 1peh'FxAF`_ i%zqJa׏k-cBėu9YcO/]2][>C`zW 3NNG0*MյB)"/cb[Wbv=cE ] W%Iv]q;/v[&ثpݎM=d<^'La ]e޸ ;\ q S|jvmءӢ#8&dq`Y-U q3O:!`R<$_clЗ읱i<2e][i9;,sC•0E<arI67=OT~?{;Q>y|4߈Dkcaqicͳ[7%'qxfӾ 86ϒrbFWaJtFG \.HR9dz!1b cn .&0Q6HѠĉȆpݘ =q-gfW|5gNFDW+pu7QcK`kLG,|91sJ&Ɍrni3R\Zjʾ;4zq!N'izc̻ jè1xug:S^5D|lb 0?Wmĸrzr]5n#I1pc9b62"ގqiN1ԋJtq1#NR٬A~lc.8{Rnŧ~~e]ZH/wظ}Q- ^/&:[!f2Id2aN_5s%X[Lm EWpf8%nၞl^ܛ|(']wdc[QLs}Q.kSSL,:/D݉\=sS Vl'd ^/.䜬yFa?Ԧ[G8,2`K8 P(Y>V ;y .l2Xf>,_CCl{Nv =Q[.ҘCŻQpoIl:v䄰I!&K#gr9 ᓱطX-9;Qڨ8 Fc v1=pݚN@6&ovk]<(ge,/fQK?-M>׆-1 Eؔw|OqN,8gvTbN%i{d\NGdFkkTҿ^9;&3կ5A[dk=M +n2f0mަ$S M/¶Yb,P,xCE#,8)+7 !$WbN0)xFevqG`P)^đH٦S$p̺"?x6lHh:]a]2mU'q`p"݅.5(Cy}~.tvCu닭.+j(v 1We5m\U4 ]b-I]PA.",qWcv[ :R^-35GB1WfZvWbf!{7|Vݎ M\Uٷ\Pkzc]v%)Aӱȵ+MLUg!8WWbPn6]#v>#;ʼjL): 0-/PlUٱWf]vto->g.$lIT^k/vU0x!k6*U٫6)vlPإ͊.X-eUv(ZNXYx8injUicXqQE*."1L CJqlUNqU6ǓتCcS I|iar%R!X( n$?̦4KXGVJ'6*JoE tȓJ5iser$E1o5{cs $4Z. dUf&'Q>*33pA6J-A9LT))CXfFǏb=M$_ǎkh> +aqZTcDx⧹f1,})+ljc(hhUD>ŎoUxwa⇡iLfQgRiSPK eIj9 ?oG,Gi j…#*ZNl)LlU#lQ܅GLg\UqusSn®͊N*mp2v1v&ͅ]\ K #NJbv/m]-m]Cq´2EQM~^\~ uj?'H!忞r}zGJqFɇJƍGR;LB ɝ'`2b x4N_yɜ48>hܘ8OQcٜcӔ};N-ePdz01!>Nv H;uW8C$[?6&96ِ[FIp*PI$:b-&)U 2UxLgw&+M\)OPҩWF*[ Zl3UJCR(aĊ!(zh#o̰f7# ?^+M&Z-MRFĤw \DQoֹE;酓{fVȖ.X%N=;brNnJ{QKDbqݐ(kJw u1 ׮MYb;~CŸ*V4])a**iJle㊻@Vy[[^л6*ثb͊6*ثb͊?*6*ثb͊6*ثb/.0Y?92H ثb͊6)vU1Wf]—f]vlUٱWc!ٱWf]vlUU]+G5qWS1®lUثbʮ*ثb]/vlRء+ [8R],bf®[L 9^]\ 6* uȔ:⳿iNV]gĺ$e+@Q 2AqǸp2l`v ]8%v]|0+{rwf`ŊE2VVqճWlmVJjeZU,#\Uۦ*⮮jxWW;0+Wl*5Z9lثƟ J^}]Qǎ~B=N_ _T@pgOoqQH視 ^k_b%u ڏ\D FcG Olp?:5bjqaqO~+f?inp1CkGm.07m?*ʗ@X`0BiH@8QoqИ~UOLx'G[+4_Q G2W?\- H 1/Rz0DZ~1nr;2, %o,ʌ~vDx6 6.b7a،eY_f2āv'8G{ii6G0$q闣cc\;iat+eFm'-xQF|gN/݊jr:kd8v)y|?'Q;ZU.Va1g=:@me߸7]$.Rv%ծ :8GΘBO_8?SVv pdz%&,pS豈r\?,@>6*,b٭]Kgꋱ"F= 2pZ?ddL7OcCk:|b}ZeیKfxS)zcV@.7\i#N\<Gea?v)cKVZc@< nk7kj-lN9p(5Ti O{vCWvŹ#'N},v9 ;F Pp Vƛ⮮_ێǔ,'17—W.|TKЍ` \ iuV"\PS0%M| qjMq@SZ#ߡd59xFa:+tr̸'f :u# ؄qvc펣Ycv6MӦb~qٸ7NZ67kMާhu\7Lep-ZI/=1a ډCc!-;''^,5*hZݹO^Xf]pKJZƵMbR%7ܰɓp Z7㑵o,mLVjqLt9.<b0O_L6Œ9%,7_v st_JQc~<(t,^rCfRnN5wԋqN.;Oup sIj7Ncq!&KE}ho vLC']N=)#4q?L݉g%]d,EcMDmxum%0ygc/ֽdJƫ2YC3_靃f}Hu0hF ܢӋ1xd\I%e5ivL ș}wC(8g$I-ӱl:`G|;8ZNI#lKbGx4~s(up$3lJd\\YqimV}H~q$#qChNrUqa=}.6Md>[ɮm=zꋁwaǥ19?q6Mnޢn8fq bMs}08g&NNIQ . ~7Q2.TFcmL(NCkDcotjĽivT#Wev LJtS]nP^$GLP[*c:Ujw]iv5 8UاF c.EqK2)]*v&T[I|\*쫀\5'®P ſ*j(vic=P쨔u#q3v!끓NU[QǗM1C ; #I-ȡثb͊6*Z>O9ty2@•\M{o%) ,M-_l(Ri+][u5~I8(j#']R=Lʱ!dr?/"2'JUtGtZbd+o6*ثPpJT(rhmjj; TaCR*|qV2t%mkƽaWSQ[jCJ)m[Čgb8AU7v1zPE\qqN=:dGqWƄ튻5' ]jǬtɫU˧sk1|6]zp陆ek트Ab8~la0E>!Bh+F.͊6*ثb͊6*ثb*6*ثb͊6*ثb/.0Y?92H ثb͊(eaWe Pn6*ثb͊]6+nLPUٱWf]vlPإٱWeb]1We͊6(vlUT]L vj 5qKb͊vlUٱWf]vlUXbUXٱVa pYXx~E8Li!&@>yxEk㍍i\[^0ĴqvC!M2o=qd*Rqŋ4.-kra kqYd`CG0®)lUٱhfƕb˭rJJiZ9ni[Ĩu* u:P 0 I2df_qb#6qKbێv,wz4IzqvR~HNl{]T[qI]DT/Nnw6أJ?Gg6VMQƺ|?G\+!>/~1+sp&O?ß*SXN.zNxzYZr+c1piCC2e?Zڞe8Im aᑴhDeLb6mz)Ώ)[d텖) Yw]\A2$1- p}xsLQv?P>I0T۫>$A;/- dv"1/-LgvN(<\\?c4.anA/W'b:}V"ѥ1Փ=B&Zx3v;X<[?K=d7#vkQ->4 Cgc,!_L#&v}NS.kܐ> PAd4bo[ Snŵ5068\L|X ccQueOCSKӲD֏Ѻ|]&A0q],6r?#8X2xs`˵\'b݅ eJfn!q<e~Xjp82;".WgMD旍L}pv Yi$`W"9<\QbӻP؏xtZ9TpB f$PѪ<0m_'cCQCXۖSA cj;`CXi T%F(Zq4-1Vmvs^AZ'rmiO"Өڧ#y~l. 1(dXc' Ot} 28~`ENKoFh㌴ 3}F\(8MWC$b:y-D}cŪf cL1epK Z?%=-SOҷ[\Yŏiۮ-xfcnPۿ8Ǧ-y2bJejr2u1p vU1Kl >#q,Hz>c?5bqГ d׏)unR-6x+'_Foq :Y5>9lrv<8\9p3G%qx$,Yd0I؄w 1L*yL 6IFDY0.+ׄ?cc,sm/۽rx oWӗ펇*9Q/eI-l\9XKYoNPmS|%#q)a7M];aT/?Ws'o}O\ -XצN;=HMPFl)\/6 8g 4%-3ӓl}-ŖHG6G8/:RTl1q%a.pi;, 5Ǧkq[&Ţ3Eسt=Hvnl&J>0Ǘ'cv-. 2W|pǘHpw>gnشl9Z.ǧ&㋕8Ը/N 08єJ-nmC4[0l("bF.(*?Jˎ[SK9p! ;m!ْC^8R5ӯ)wC;Ovk&a<"Yq8}.ʙ!Ԣ J?[hHnOn&y#_V O?9eE;opJ6+d⪽2(Sc(%"a ќJq21J7ŊӖ͊/ 0P\rW #8Yr] u©<ZeٝEli"xS`WwBx>TŬݼ>X[A-i(2.*ޛd;jp2~2~݈qbk+p*v0>—cT֢b#jbbci^Y;]+dHi (* p+~)vW6ĝn/z qTө8U bcZ]v[0;*U%]I,|-OR T4]UN.s"eE2T qWfB Wcv]mb0v&]hp+] jF>[MR]!]]w`m.HD"8ثTW`jxu®' nK0ّj>k.(bO&*H0c%{SPџUqcA(7Cnfjh{HOy:YQsje/,aѿ-[ Ry?w$̕_U J4!R9y#_ E6̚O~8)!hh+൶dx>*{s!YX|/Sc}P[S.44wkv1ʿ KWc=&~[bY.43q oToKďo_[6«Yڄ)Gk2i(`0F0i40䂶2*e a].ę`Wblqans—eiؙl)vQ8qWb17ja vZCk>CEkr\DGM6#EHٛɖŧ[=̽=MwZ ;1쿴JPk,$In%evQl#@[Gè#b,B1I <~̃lV'ˊ~ɐ~}=&N*ℐiGF͔ˆ17zn\ ZRA{lWTOٔt#UAR*lΧø-\bG+%-,`ԒU[ 9Ql 2cGEDX~8ioZKqCZN(qBN4fn9qCG꒎)rrtOڏW _W|P(Yw1#W1)䧤.Ƭ&cO8pnp!pv/P8ʽW 5i'H:j*2 /?,*2Glm]Nu+ScVŸF*($4Uھ8he*ㇶ*j:⮮R bhqWaԬ 9\W/\eh_vlUٱWf]vlUٱWf]*6*ثb͊6*ثb/.0i ':=rH ] P쳅.ʦ*0+WvVvlUٱWf]v^;0]*]\ثb͊6)vlUٱWeWva/vlPثb\ vlPRثb͊6*ثb͊6*ث] [ˮ*Gli -9m6Xlr/):8~LX=N$=D l0T}0SUNIk-&-Va\YӲ]L*znG%;5q,ƶH$63.U(ZFi *ፌlJrUgVVWv;cFlmlm.V!]LM-))OBQ+!?e2%J 2Z!QYZ,X~`iP\~[1ڤ}a9+§_Gl\<}2j3k7%bf=jbڌ|$[WzԄԵl%rsUJ?Ԍuպ~lŞ_(NcDbޠq1[Hfm1\GLsVjo)Kc ;cl4 ^O| , cqNa{9[:3iw.4ݛ1p55[_FQreuPy.j-RoL]\xyVZWƝ'703؜$]ژLip?,znqȜN);> :QJ?dMFRH;}n-VX޿:,#?݉6f/n:fRv w?~FӚG.!#2݊il.!ki;G8zc?;eH}kFGMvT*W<1N0tk]oky?^%<~gi@$GOW?ُm ?>c4vyZ?G Xh|?_]钛yRlb0:,_dձ俲j1k.-~l #Lݖn7hD|\?vZ_x Y 8v3Li-\9v6F17;S-xfpd?OF3m9*Ĵj#Og`.a[ssh 돦Vܯj=ĹPH8}Qv+nLl)·$qDrD~cƍvV!=X|\qmJҟ8sm%x^ѽHW6>SE2]Y&R%Xثb͊6*쬊\ئ9682 ۰z?s ;Imƣ1g"Te,Fk]Y zݲypm[]O#z˓x˛"}ˇ9:.E⫅>+M=F\8ɯRqN9vafA?˃TrbHtgYu1ENDv=. r(v0I)u]̯L)vXjeO'ćl\ q>٭vȆܘ}p~ ^i7v9hrFo[/?, [L;P0|qpqA DVmCadCW0]*^hUY8~p 1[T^ȩNl{FpNV Q〵 o2%dky 0ݗ-;xd[bm1fQF]l-l> |b]n0ezHNxy㳳4a' +Tzʨ&].J( U؟N*N;)Vnٙ=0+/(ث0* mv^#R*Y{Wcثsˏv'ǁzǺӊ5i/].Ƥt<$ )bqWc=E#}ثErjPy.+A*c e:W.2)5m]qWc6xlev'hJU!YW'#˗`OِTqzcnQ6 tl9~ ,c30?Q">ЯE_,V B)f*NZ#\-Y ƾ_7xq 4{>,JNJjq|.u:K /nHu?థkP& O_r6w 9jq#.!?q(YF# u_?pE_/ U i{e0#56xtnSӐ$epګ ?s ~ -E;WJ&c@8_˜B]8Ue]؋U؋6,]3c b—cKbʮ WeIvɄ86.VbJOmato?d},TdEiO'ɬ$Op䴎_[/R 6@Qg:?zbf0dq=aU q֙%R& ?m]i$oE*O(޸R0~iOZ*|d|K*Bz7\8Q=TUG?j>hD

0!iP'R+ҧ _q%-PB>3BByF~ăr>xUBXGی |;x.:#nCr۴-Z\B[uX x?J!Q([;O?`+CqȺ|2<^5!ya}nҰ$_~咛R)Yd>i߰ n?6N HY:B:aZS6*lUٱWf]v>>P_j7,B]# Nn$\ p#T®'.iқKx Fs@Ķqڦ7UcXDv]*v`:2[hI޾8è$eZ]L4Q-p]UaJbf qV­cCurp%h6\s(qO6'&k"Rsb͊6*ثb͊6*ث*6*ثb͊6*ثb/.2Q搲s.dLU٩/Svb1K51Wf®L *ث;0]\ 3aKb*ʮ*^)vlPb͊(LRثWf͊6)vlUٱWf͋'fͅ]6vlUٱWf͊+ ]+bU+(urB8-֢(ޫK+YDE]}970Q7Xv!!Ől`ZT̻X(]Kxv\ \N:H=(v,Ixe`kX1$0n*v*lU@F|vf튻+vlUxWfi$'u/t}' F|%7H_E)Ej|8*p;~,5}oQcX~cZ'Gzѥo`d՗l0ꦇ 2Gt;}bH~<ą5?KN(Y`a>?q5,fԩœddyj`ƭni\?߾2ͼ48L|t-IdCaKz7wiL.ۏ"bC_Lfd䩎$Hr}׍.;KĈ_.}ne/c8z[GZ>ر&/Ap8'܂F4JD`{?up-^OOL5eD_NOOLd\oPo SlZ'ei9R}O~;wn*~$4sӚ*6KD;7q7O8[`h.޸)yC'bه_^ 2ɄKerFq)ǘLpO3Tħ6F.>\N [7rAqpK3 #'0e!K(wF9ŏL݁av2`|&09ŏNEm^ьrŮ9NLSf_V^ckVS MߦKxۋCjv⏪.+ot O fѯLUO'.k\)v9@;ˉ]Ib (1Z6]IQ3 /*slhqWc*w;IˏNWe.*o qWcT8n7.j'ڸ@LpL}TѾc$lRU؞ƼbF0@+BqWcNJ mECv*쵨vTƎ:w.)9GqWbr] MO| v\}t‡b0'  L 질?N+Tl*sov&L ve5OR0![Y?R`,J¼f]vlUٱWgGsrflSlU]1Cb͊]:KYxG6*챁ZL**VqbW/j\NXUa8qUʘc=1dإ $J R2Te)m^P@2wB+׮9O| ר#*v! ,BW"\%T hSOO#$B: jʤ{@Lv_ԑiA: >*\"JWWO=3R>:{H:ݙYpZF92ATM޿?x)늃*_n]Z1dq߆#r%|$Oڭ*Oڌ}Ԟ?Q$)L<UAD>0F?rJ NnE5kۄOHwsmF=?PTv_XT-271lO~'m¾(q4>8Tx6\o﹈re0u X$#j||Czo?M]"( 3SAg XL_r}V40 v%(.) Q lQ*h~=1aKx0lUl| !%،.dep-6(cZ4Ƙ.*IYo؀PۯUiSIWZqӉKi!$uQ\R[YN8@E$4@Ug7::[`!\Ax濙i1\\YD f#`㌋yƑ‡EM?;kBȿ=XjKoM(/C9dd20,Z{ یvaF&6ħ:dEiC+ ( +.?*$\ME*U8?ZↈbvY|iS(* QĝV4~7(WZ$?eB݈ ItBXFzثdeRm'VF e~:WPCԋ!>XƭzxHvW;? 7 ˏؘVze~OV5(v=e21`T1OWpuAu.ZNJ8~>gb=STQ\`xS=KbAMqJZ*V~tajP MAتX W,X$88*cFcٛ'Z^KLiź9bUhIM$es3*GU8 O ,v^? N n#W$BZ-Z!'u#Hߌ_Q_61/Ǵv2H䁡F-| $ .8i AjS}Ў.ipN,9Z|.g;-^ ?Oԭ-xK~6NC3 f9 ظՏdfс灯I0oceq韲M! v#|M4~Cpc靗5MJ.^qc{ыtMV/ ?v65ͻᒴrc:ct; yKӱ(+cp ~!n.)?vl#a4cn2۬.(v9ɻW8[dNlW}B۲GрnلxT]?}7^X=q8?v7K8٪\ 4S88'`Y ZU4\I)'QwF <*i[!pmki r}04j\kn'Ԍ'}bثR.ғŷQ/ۦ#뵱dZD+遉.+b 8UXٱWf]6*ثbf"Ï:Მl8:J=)c%XI,ުj`7-$_V-ƙ˼~;k<잠N>,2ACſ.!!Kkn~9Ⴎ-A&b.}P=IѸNq2hZ+W~qW TJO^1rAokzN2Z-7R2>\eS Ջ?\LVUͧ(}.Z+Jq,cmN{gnqGů&b`-'AJ9 n0 %ظ˹prJ\Fp6"[`qG Q`U/)ɖ(P_u05۷#ɀы)DZJ).VT0p(5kw_ϸŎ?MncNl<N/mv?qnǜK?i3dIXW@F\&Ĵ7LkA1m,Ͻ\Ri868ZC*ILv r+]\SITHClKA(F~ם1H,rݾY (VaV6*ڜ ( زUъ:c*8U53SoC.aP1Z+FJnQt떱?=Iv % Ԙ\YbZfrE䵘|9mNh9٘|)vS1*txbƐJ beh@_bb` Uu1WeqJ8+]BqWeԜU{!qWc;bǩP)-[`WbaTvf P? *RRcqWbS/ )v*fCV82<)] P1Wc[PLU~KqWc})vQbƉ8ҵ]ث켇\PH!cJD 1Rz`KU=qCC˥v2܂]KDB8bI5;Wb1/(cNHZ!C czWc*B5Uا\*h늻2V@;a vk#&܊͊6*ثbΓCg.Æt•<]vlUxY*jbeL ]\u1VUͅ]\]\1Vr˦uq1UqU\UEiTDPIአTem <0*O\iS«| XHf^]zbMW=vDbR: o)fH'FVjv/!y}KhXPT>xXo8P WWJ,٦>XoPѱ7anH֟m[UX?#L %&~u'!Toտ sD2_7j҂Y5loa:IWn_ߩCdqya_66xl5_'2ΊUڠ0a1Vgp%? [v%@X @ozRz)=aQd~?{r91BڠZF@1YBBko*٪+J:?%fX[n}czTpqMJ?0U"ڏiO=eBpPReW|Zߍ>ӡ|?\|k\x|14Vuo3 Tpq+6q`vc: "X}iiJT<X#* ߠ7[V2a;w_ۀ*a)v10&I%AvC+ӶNc{o. H-3mO%HY̟bfhLsdc T_8QlG=Ȕ܎kҭwZ~_u+VFvUUx?8dA/t5ѿbNث[v_N(eqjAI̔ه*E(vj?4 ,R~eʈGA gkl8Nj $BHrsC#qnهZ8tA.;W3!$u^W + <ORsP67bd=;p$Q|3dqUxzW?J1P~_b>HwbO,*{?q,ǰGfjaRAѾg<Z=W wY?wp:,[dZrO@z~'/z@p~~@VXN aS ?_t•!ۄdK{ =U?M7VR6olq7%K]>DZ.7gTJ-`mJjlgO3RQ4kpkĊf>`7l&|`=?.脪ֲ~ٯ^_c4`OȣM?\'bQ꿲&ضL'enK~>֭o]>ˏqfuPrmix8oĝ}Z XC^'/KZ&AǪ8N /2vkw&P C5*=OϾ,UqnͩD&nbSFHK4kшFý؎s蹊OG雱X\ńt/b7PſYy5kxhVA2yqſ{h~{8Nj˱D[C^wp?[L(Xp1je' F21hrP|R-5avuQkJxd1-Qn0|J{ $e?|6CR1D d0«Wa^:c:o0Ŕ񤰚 F\_hjԋH0DѣF,a׋'\2XFey%t(3.`0FmǾ-xzeX;bӐ}-\HI녢] Lx8U1UxٱWeqKWf];6*u0+]F]wb8g\d=rC8F  }3v"Kg8G f-1 ;.Xݘ[t=c|5N=[s_l[aC*]@TSÚ\h\X%̷IMv8 8g u,O4^ `zgS,m7`x.ݸ?O qf8?KkEzo-pq(|_2NqU׋?Ewhb&eOb}9~Q?Φժ Gqɺb׫t͋(8glRT}\pTsAX^GC݊L>f :~;pNxHzb<v6?ҵ]clqWbLhPwcYحF*` (0++TRUdvQ8TUAv4MWv(kq3;D\Xv(Av4]^Kj+v$ExbA 1CC*ڔ.!vN&`=3|)vh^*U(vg5]!*>8TU(j|Uؚ,:Rr! 8;*ȤF|)v8! v!Zt@$#]Z@OMZaWez'ѶHXqz;0bhv=]l2]#*鬱$Ɂi{"b͊6*ثyd?壓 \2%flUٱCb-e-c!ن)hVqbbW51Kkj*偁VLUXมilzgU*#v)CXZSXl;Sڸ]̵; !M_ T=w'!XlHQVdݕOwޛg>.fkڧx>2WXsm Aӊ+' [ 6aIcju/K8R@GrJϺ+!H 6٣?ey"Xվy/o6ǣȏǫAGT}6VZd/8.+ YGe$٘9;זlSi<chhr*GpwWblp]6(YM!UUVT{bq9o?%cӃ/HiMJ?kKQWP%?}a @%OL,V 9 Uaus_/%]BqcQtE'hF4Ǩ+<(("kG WW5 *~K>s4mnb Ñob'B}Y\p>8TS:W]k%Bc`Ayf<|L%JQGݓ%y%ؗ%iNY^C͛^G%ܽ;]9U܎ҖbSˌf_MZ,A?i@^~M8 .Y_8UiW8GGWlUX8J~ҞO9R'̃[Ǵ Hzr!f iֿ??fO ٱUsrՉfWf;;+´ (FʟolsEp0d?iVBO:7EqXv V2@ )Eq⫣'vp!7e N~*|KHh+n>q_?ř?\ t ͋/=Xz?GjoVT,KB>8*ܘs4? I[*p%Ǒ5Z-CW5Gof­ ,kVroJ8XiUv߿̕FnMAC!IoPU[p:vo˔ ?ރU貯mZ>.ƹk++RCݘѫPzF^r*i)٣= 0~THywFJ3eƧJ:vlTfSX.EtÅdAS\6*pe]͊6*ثb8WcCKb]vX٩(]vlUٱCbeR*챁]vlUٱWf] 6vlUٱWf]vl*`KSvlP*o,bo|S["(k\1QWo(;d\Qc酁h(vUk+vUخ) 2v d,%lg j/)ژl CkEX*jP+M+5WfvjWfvP9%u2­RCݐ18sK$pQ%w؟qCqZLebXpjiF8 6!ͱ^.#*%c2_n:fKˌ)\[m6?, x|LV>nثsnc'N9xn~lb;2nS?V=_ĚiN%jm7gc3Oe0߅LkW6w[u&ra97lf$Oz[:Je~qg<3qO fG1C\CMqxVQv9"19 $?C\_Z'L_luU,м/n1cxnB!ON["RNJca&ėw\vkC4S#KMe2`"FY`-۰)z'IF$0Kuʑ>pȲ'ae}Za<aAj!L}?T[RVP>K`󝏺Q}l%ă7M!/~?v!DnHr&WVc$N3ぬk93Кt<9QpoT\Gy5dC?v+DC\$H]ـ tg4A>[읍ݠ"LcGsni:]HDSs$*lAo",.)?!SS'FJ6A)L5Wr>/<.j?Յ-zeŎ ??v7N=eXk ,I.Rz =oՁƌ%: Ժ,*p`H}2vkV:T,=83&>ezdOj¿ #i=ޏ;n}'6}i2 }2;#2_؅ g8aҵ8'cb~Kķ $A_W݊/y"[ Njvm&W7{i'?Wk?9ir9t=CJirer(־z`` ?+vsrFF$Q,,q9Rr0]Jp/uTo*CƸpb(Ty0y䷓4?NIN|R1(w# }6\ 'rsZq0',DG]϶(跋m(0H ִ6`p05/xJwq[֋863~1[įIr(g[xӦ-8pde&ٽXË؎3'wx*(86A#큁oV8aK]VSZb®]LUqu1--pfS\ReՊ\.n,dF۸e^\G/orNen?LNPMnXSA qWL [\(;8BTAΨlޜq+iem~LBcۮYUpR~{Sj8)Lg J^RLi(r5d0ێ%,dޭc*Paq oN]Z!<']?@jz`lͦT9;m:3Hv׏Pc闪 TO [3`\~b@F_1g?s4Մ -#v%N%m3}q%j8ۍ37BALx8iW-1CDRĤU8*q_8f$ٱCqLltȰ(y;5rɰ­VǑDxʝ)dlDEOCf9W Fk %d 03%FWqL^}4^!_ Yb6-DHq  v'$-+;àvTEz zUԯ#]^$٤i?!Fv5@3 We' ]^KLUEv.Qƹv&䟋 ]7qC>F3Ċ]7 ]Gn5jSvc"HiNث݋7k "\Uٙ>Uٟz045vci,R銻-=WeVNH1WcCքm]ܝf`h:UBp+8 aKSR}8Pw.mN2P3Ț0bb-Xu.$]QL ]y8I 8Rq6݌`BT; ddĴ r(o6*ثb͊:_?rfO+vjb+uqءe▱`CDVp\RrZ-LUmsb1U/qWrXZbyf Z-U) 1JlQqU68RcJR;wV1,+W]hT9[oN)Wn)^@7WAHkH %P0I I^80Of=MI!Csu hlZHRA'iKKHYӔSN K x..%`($gѐvG25IU }|iiq%*Қ>S[J]ߨPH_c%p7dRJY?e%>5@:ioU s>*}\,*ГV_<9;cZXw[=J'Zyu"+ƹQ,w%LRjW U9'6aXB}9p"xx!rF_fJ2d槿%.dCE#"OKlHw?31Z/e\ jwR>_2(*[6Dy'*\*y؃зV"U}?gO~U>T)^aVj=w@G֨Ò'jcfK^Cq0}wtī\8'{)qYqin@Ѣ#e'eБ?i~D_-H[a%eU&&CB~]icCBsF|PcJ\E~xexvWq_9l*>5ݓo VKo8)NXWWBXImZѣcĿ1^MzoәCT5cXS|0-B,x_W {eCwjXf=F> T{բ(h:brV >SO2cI 8 @[hQGNm?r\*g Bdjv87˞K Yރ"ҬoS+흦 d@~C-/[u/'YXxoB]-yS9xI G Q; pe.&nC\4RnbiȽI$/V0s-Fn3( T<Ah^|w$d Rn"qKB~W-^DYPz6:*?fU_@ƀ&1Imٽ+ecXe{6Z(hꂱ⏺4~l@ ٻh1bJf]QenB>Z0=^? IG~5`h L HԘuS0*WFOqч/R:rHʼnzsz7Dsؐ`\ ?, qraqT'N_ʒ?c6I P'*Pb!C2!q^-؏깾oĤr$n;vo .;RN}-OjT Ol٘nmT'5R)h~8!? fde\sCaObP&(OOF4֫«4 ?,TVzn;8*Б;C1&_qp!r㑤8iMkGIր^=xIB*rz_6\W$CN,)ǗX`XNut;|Z#"T+o6*ث`W` }W5WO@"Md8y *dP㊴q튻+joS7Q-EW]wڙ$čwTBeՍ-7 Uf:4eHus(b7Zb8b Z-\pZǃ](})Fp|ZQ;Cyu]NgqVZWW<WehV͊6*ثb͊6*ثb*6*ثb͊6*ثb/.0js/d͊]ˮ*UٱWf]vlUXbLUx*vj͊,bef*죊5qWf]vlUU])vjaWf͊6*]vl*ٱWf]\U\U\*]vjWf®Vk@~yl;}=~@v*4x_ ZtW 2xbj۰hY] -QMEq) N m8Rc5+*+ G\MqJ쳍`CU1]] /䕺švj2+]⢣ў

iRzu#ie?䝺i78thKmr'hXj`]1/OҸ0=N 2Z?mm+#g'hd;t8ק*?7\ѿ  (KGX(,)Г 6s:QNXSE\\.ܨGсU\\A.SP?Z9gv~UHr:E尗c9Cl]R;#J8Ra)iڠӾyy5oZXN#|.l p}Dcߒ#4l}aƛk[?q/;ai×%LJdk9C'N3+L Ux81 Z ثGSW$iUZes7MYϩ %9pp[t#ҟcL_LK6qcDnM95KvS-;3 :%}ha`r2G>⋱(.;\LYNؼph6F.NL18t]O&Ҙa>5S,zqˇSVONqQ1=LPbKwc}Ac4bH vWbF)v9b. (1CN̕/Qy`Wec]|o_y=h%tupyTn0i ~Y[.@U^O[v,N p0=WeJFO{`K#j7U#T.HQ@p+QaWedP:> 늻ZJw®]Fv'ROŅ]إR1WcŁ銻$N̆8We,hǗa]ƿ |>ّM*G㊻Jo\Ro/v9JR؛F bb\R*wM(v2f+FqK!*8nVw]OnqCC797NxIG{Wc~WcnP0]0%j lV8N4%Xv.j*Un ̋`j2Jy]=%؜THvk’#&%=~xYCyWf]vlU?壓 \xp$<ث6*Pإ*p, Phr╵SZNlUَ)n .Z8 Ui8\UIS-Lp+ (U-aS`K\ +? |Ƞ b<,?)ڌhNjWo Ux^H:jK^e @`:5k;Z\sH' ,A8i`0r2y5`+;UP(2mI31.4v׋q;O24[-`y|9'ޟdOUJ&K0 ƹf Vڬ7dmIUm*Y4 9? U'5Shp0Qf^H|H`r{sHZ)% Ya_K1?|g U6(x4JEr(|["X$*WpnTC'>g6?xop<љ[H] |JWjEcYB#R;#q\ܿd.-<,`U&LVw 9-=kcF}/MpWD.>珒(fVu>*?Te«C5|J7zYs`z_u ?gmt}5>)O[Y>, k/N;?}q}+Rdd/ΌINJcS|UigtZ"J}^{䴳o!3 < |?h" P^Ƕ4Gx'g0Q4R_iB\U6=zv>ă"إm6bR~gn̋G?iF)Jf:+-xU>qKEqoٓPw}W--Y)n7/~̃[!`Fz}ѳ;qb(?j!ѫ.\QD)ѷk+RȆRȾ?􂱐^#OUjId1̪c.u\R^sozsx=.Xj@#;"n G!q\pV`)icCVF_;>qht݋))lF+T-")^EaUtU4V\mPyՙ{2#VX(PziT:ǫ."qq 7##Ҝ תfPI? SGRkcOI\V-᜔Nĕa?t_Z3~רZzB GWbDu!> A+GƫvU6Xp7.>uq)ta@76ݽ&eg#㏐=å:6M+*nН?i?gPgE+=QRVY|Mmॣ?i}Պң\p$`uG{?8٭]'-Cfd^-ZQ;|?coPYG⪒P7$A+iR1鏎&ܩnQ$]=RUccXkU~|BbȂZ0N[|-Ǿ(mBzUAX o+I\(;<'jJCٓ|!UdܷGFb@lPQhBS*)܌\[CPJyz)##z$bTUث`W z'!4Kc koU8P@(k5+ CbcMqV+K!FeG,Rب rZ̘ʛ UqNB8Y-®eN* -xf'|2][=N**2y 檑uE2*]vlUٱWf]vlUٱWg*6*ثb͊6*ثb/.0Y?92H .]\vj]1We͊+v^*ثb͊6*ثWe͊6*qWfWf]]1We8Ux`Cbf®͊*xvV*ثaWf]vlUxG6vaKLkj+.AKq|;"^89E֌*䕼ԦI']Q\F%xN9p# ,*,~iA&%N#@AW|R)Cc.E|i[W*ٱVWfv`0$8U`S]JBĞ9jrpQqZFJS >"#G#d_p/PЕg-B?Ϗbqeꋺ퍿P8ܯFp "c{c j\BTT5;6?z ts\Rd .[笐'oniKOj41ܻ(ŸuM,b_eKcVM.:Ɋ?3O&ExNU' zyK_ųtp-frV}9<);yR/?l LשiڝL1īS"j+` Ldd.;(ur21KU 1Cݏ>x,h`S$IہVScqҪi7UMj}ض珅>82b:~6҅m#dsb6o9%<|D&qb=Ȇ&N`iCZ\ppo.jYזFNNi铱{u@7<|C'G7bV}no?6@qsM~R+g9Q7M4f7-{mz,?v:o]d~FƟ)NJ#өdoD3"](مѶ%Z8r?ES|^<4jdAU# c0?T=Q3|yw %djkZtY̽5>|F x{>9.&"d7kT\;ˁ[>$m0Za0!1W.g_F_Y8Fkw(.!"ԝv2v]0+m]u2olPxTǫ u1KX\U.oj;aJc{ Clzɶ)hP9qr 6?KEq{^j&,Tֻf&_JolŔO?Ρ}ݱj8pG*qV=8&8gln{GqiɌ6  y.P ?S`)KGL\"%N/ꦠ[i|.ps?[tG~2n&t'e ևW&!bV|qB9$ x'ɱuu՟ Ǹ]\Z zSqnd3LbS[dՓJñy=;i@oP?.KI#l\(Xec$Wԋqase9'b]IjJǚXv哛r=hĜX;0$]JJQ-9*b㊴Q[}U(aU?ۈ.<|5We>̟\[#ܭ]?n8 ۀ^ ?ly+HAZ:}٤?+p8؏G.9%^$do}\S{ik,nLFzޭkI˨߹_⫙BIF͍E5_jܑGؘurQ['[uɯÍ%>1Dhlk|_?؛rW]ݟNl+)*:X%w)]O5J@: ~RaĶiVHPܯ5u\J KɄwǡ'> uGQ|N[v?ٰ (㑯Z/ʃdzbYHrRxrƐj„~mm`!UF콼F T(ݿs8?/Jt?얆;M6|'8RUFt#$VdLvryG斢ݥ;DB+Q ثDxd;]̉MCּ'; jXƵn+UJnLuՖ ,eʢ3yZ:A̲i<}m-xb:B5DxIS[.̣FYCaU!(HZۈ>&NI"n `T-ީ!qsѫ/Ӄ !fB >kKnjs |@9 bF+a'ܩ!k8Uk*i.Zƕ6і+,W`ܗ1>jE8%?m!p`ԡ#)=*Qޘi*B;B1? #ai;z;u0$mX,2zWVW?chZ{+.`HVb׎B*?|WR=4~i'F)Ô՚x} 0UX*8+чZ{)ْisڬ&XRP\*G/qTZVE"5HO *i+H:ZF;:RvC4B@v?;ꄰIwI}r'#jek].FԷRێ$~&>Y ignbF5}\լBmo%p1J1'%Wfį>%Jv$uŽXEr!!TaVc\Ua:e8O*]+[4*;«N bk],Z',q8\qpզU8s*,R×,?1'U*0%rBI߾.D%xgYG%ʈ5<Sj,һU.0}ĂpG_j0!@TM*`W 6UT[F*Suq]\aoI-8vckP7VqK Ujatu]Fvhkt\/ڼ_AN,1+kWНB0?]N\[4'!SVԩ>wc1oq뗤0tqSzc4ɄoqC, g7;۝ xfq9fţ9F:k=#d#>(L &#/٬$uȮc$N#hmqF fsQ8xK݉jGm5a.1^f"[}@sg9\))q?>fCa/NġWB`/ov)xq:}F8Cv>Nĵ{FI\Q f=ӓI.myӍlٖ^6./v!%kG1,\5mgw9xK*Ju$wlܠxv1n1W`Pra8IZ;,0+[46SLCWQFTW;jJ|*qp* # bbw :'b㧡/Aԥ}R2F2E&;cP˦*`WW/hXaUy,.RF)]\beWf[9`xȡa8m oX q9*q(^b90H>2j[ oҎiȫjIOQ1~8 S'Wsk@:d‚F.ͻ e 東y׈)v[ *n7:u]b+ȫ*0؅v:4#$Ƭ ؜R:Z*q_0+[ت9w‡e=)v0v]#UhWfXU1WfJ2 b  )v$ sS\UE@ Uؐa-W]̍Wcא4aHp+&JQ?)v_1WcoS*UM0*viP>®(OS*zbĊƸ[䂻L]"o]D *;|(v&V`*O? ⦽N*-cI;"ٱWf]vlU?壓0\xp$yXWf®˦v`1VZN(VӎZ^)hrCY, (ZN8 XN?*8 RPbM.*(S];bVK]qozQ+uA|xz(4ھl;xҘmVF3xRk\w|R}C)b Pql݅O^|י- hEYi>s.*b&*b&*JEXELR(zc%u)*+wJ;wY"ԥiCt,C? LWo"C+M-<<-,/O-?h~S#›LZ|=B&X'W &+)F?l)8I*t! |U+{ ܾᱴRv'4*ﭾ |S_!x|lG_ۉ5r9-& Uf ̊eI3ғw'ÑWzE\6Eq3nb")W8Zq__챥jV"D|k . PH8nZ$\\_CEHZ#72Ọ ҢB_r$-ه'¶)hHTNĔ0!i#lܫao}qBv[,)]ͣ1u(kK#S/mL _邦:4(O8hi,PR܎^nJ!0 mW)T]W?#5nMP])Zvj,cH[<ʧ^ܿ#W*S?aW?m~-^TRͧ5x>5L+URAfIJS̘xيx[ґ"Ά6HG.?y:T4aA!-H-Qu- PWm0/5__sw$n߆RFZ3Z%T0Io4f~OͦjmnB93*~|=EQ"p?ȲFZ!x>ܣFT pD^U=V5FPVЗZ\bML$)P $Z շ${cH9ճ_E ̤[ l4y#҇j_eܑ?w@`WԞL?oe҉>bkȥخ•kYt (L Ziع;~ “Z"0RVzI˦*]* 03Ub])8u+' ƽ :ҪŠ_I@u16խPU@4I>]sm"˘\9 &4mih=bU&8S*W#V:A4-^wf{ȐU6贉4HُƍJ_X^^|ݎ'oE[Ro._u_d׬i"/'N9 vFEՔۗ@!`*n_[l,Xo4 YQj0FżR_7C%/zך [^B=4svܴM!EZ<,8YLw-&_<_/<+ě-B<3W54l45!-8r,,b́]\ l>X)Ubk \ rLUEpJӯNu—f#l iuq$V+V0!6:Rei^\U|U〦*˦*s:WWWMWW(b;@*p\NYZb;⮮G|?h*HV͊6*ثb͊6*ثb*6*ثb͊6*ثb/.2Q搲s2@eWf͊6*ثb͊(b]/vlUٱWf]vQ]6*ثb͊qKWva]vlUٱWf®͊6*ث`Wf]vV*ثWf8RV(lfٱKbqWeW/7Jf-[uXb0@FeoRM.a;TȗكQmRbyn#m >y؋G˿#+Śp;6q`\zaFuEpz`V 3TRjS'V0+銺hli[CV[ Ji]{vW,4;Uлs)®JM늸e](ZLZ3(_nNLh Lvmi:1?Mv>`17BHƩ^㊡6w;9Ĵ+l,ѓMd$N Id|i@J4|wYE`02ͩ"Cp܏#nj8b;51Ebm*S/Cdm]Wee ܲA!y6NƗ]lUfU?LoXVjb] /q˱$sjR)@kyM_և5a˿$_wxsuG2\(؊ n6+V?O3Tުe< 4i710xxR`b/JqpeGݍzpdL64Zx)[^GNj)?]awoF88kg0j\Oß q9Q$K n1@狑DdN( f? fc8zdSVc_vV ^CGϦ(HHgݻ6 neR#3\L ,MisN5\i@_.u?U0tMsNQݩSӦoQ+KMZ} $q[3Y\H8Ov^l`8 =^[}.wRݨ"lN',lBg뇥٥M)}|i>>>!? SHۗAQ 9 xm$ s.҆ (.e #$ '](B0&nqޘiuxx%>2x#$#L1/--L5{4ӏzOnFtUƚ2;6n1}3[{cJE* C (p%qWC`Bb9tLRnDUƘ!MF) U?](4[b oM1-d !.C0q߮*mhZCa0t%09s(_k>qF<\uޞ/o"./T?Ҷ!mw28seø?Q[_ͺa\/{渰riFoه4f8&㙢{6nh%h#\q8${VǔX 8]\ m;Z\|y# !؞4[. jw'iv[?,v2sX1[v?H+9Ev95h(o=q>4ȕv1r (%KJ;o\*L\U$e"w銻xGɱ!u_2tCҔ]f4d*lsS"˦o*UsUq\,Q\Rlc•WeP*UqE =F)LW$b{bSJC%I=+nP?§&XJUԗV+SLV&a+;y0.S,/)$x?~ F5),G0v5J{u&z`Wf /C˦×\B3)$d+*r"nAU٣N;WeN| J9 >)v*ܫ@>9'݊hTPWb1GiQbHbc351CqWe]n@*Jy=Wb+u8|UQ{צ*Sl(v''V8Qe* ‡s$c*2v0U|~2kvf`]\v]Eێ(vՀɡ،QqK"BجOQ\4c Jޠ銻hN#]8A¿0}?I;"ٱWf]vlU?%?3*sblUtZjbc I˦*Ǎ%aǁ80*r]\bk U e[\pV˦)jlzNqpaly*5,cZ$ZfG]^MwqXRW|'SclV y*뉅L/csOGYsB*´sҋs Ok*YT;ZتǬ[&+j1EI,`JX덻8L[>nsOSNN9br$2hkK oUC^g!oImɨ?}ɑ2T`7=g\hP,T0Ҧ9+ ،ħ?8J8ebeTHC!l:3%?i?*%-{0Jq1DKmǃhQli[<*aXPUzN_ B_Q'8$ҐzPnyȝ5L#zrx=+ JҎK4ِڲGƕp.Ë9Lw$t'kZDt'nVvljƒP%ʔ5 튴Xݢ<;?W,*JWZ9z? %)M*? /"XxmC1(pOِuV^?8m |7't؟VZL_f;*?ޥP ^ o,!ѷ͹N/Fli ;찥}ƜDVK(aR'.?Xi-4i'q#Ev?(({Hd$꤁Ԋxזt[^(dQחUr/͈:} Vo 7MPoBTlxª-\Ur(*G m| >":TחF>yl+N$'v_Z?4 -*-Ie?\r Jq5W?0PqHD朏?:Lg}͍jAEdOWpxi4h/X?10xi4~Ŵ_J3su1d~)FE1r_'ۑD,jd]&qc⮦4=p+b]vlUٱWe*zXjcPH?mZ<1yV'[>8U]Lw]귉WoKSuv"pڴT[@\(6)Nxxқi5|?/ 9/E;bAPWpGiX$ Or>*B!%X;=aaZT[.?emq|@U>8amDOmɉH=DB7.hS,G:}#$=G# HU7*X5Z9E aKWW1 p!ٱWcHR*=v–5p!p"oCD8dCy|Mv—fe#\j1C8zeU5m9rKjmDSp9HM1PbNYءٱWdwcW5U?ё Wf]vlUٱWf]vlU*6*ثb͊6*ثb/.0Y?92H ثb͊6*ثb͊6*죊+vX]6*ثb͊6*ثb͊1]vlUT]6*ثaWf]vlUٱWf]vQ®˦leSvV́]vlUَ*Uo5qVjf-]Q˦[_ NpbR8U{$5t$l8Xfg.n+ra.cI2M&WͼqCY`Wf]\ u2S|iYaLi[be®#%vl]]6H(v4dGlUEN*rbQáae8c 7S2c}-bf V, S{nkKsnъ >.*,{[[npN/8K雱GK?&czyd}&R#ToxP\Y;jIAzLNn +dNM݌Vrf?[LI0Ftx'c \MXpd'e^Y[|i,)NͩDb.E=]\xd&>L'cP-]2,12qؕz5+9q~?һIbх)1Rg[;In/ӸtՃ!=ݗ}';ۜx8PvVl$Qs1N#N(7ּS(7c49I]=H/fqm;[˺ɎC%ؔWj>Xɷ.5u"EQ@pD gwVb~(1;6.?;+N+u }\BO3#taJ{r"G)v#k;YNClǓ^K_\A~l~A!}Qv7VҐO 5d'v)wn'mEf><k/-ч0?ܻrߣUNZ4sK.]svחÓnKF"b402ypU-GFunVqjzs5פ#4/󝈫'jqj:|ض[6N[~ SVu&72q,1`2JZSS/҇. µ~^|c烅_L{:8fd 08uҁVUGlBM.z<+5J'֓`Ncb0FuˋqaP[D rc?nM~w V.A-$7ZHe<=* -fb7\1WW68c)WW,LUư]\M(lbN U-M1Wb–⸥ui) rq_ ŠSr~$e,Rn&LlɎ9G~يOŖX% ^/x`r>-Y_q up[l{\G3tūzOGqj$}c xX#AydnKhqay* Fse7p틎v\ ˁ (. CҴƒLi*R CUA. Z9eG(vW*l1WS) q*&z*We);9v3*Qc\Rx; E[r@~;g^f;P{), i兆j`Wm UČb3Yl0zI +WF4@F&ˊWW0P1U, Ui8 B9nv«Po덲^-A6Rtm52&#*LWC n遶+9{bn차00QYӂ i2=rE}JJF;5nUal m.jbP+ȼE ,v0ni]>jaCȥ=v[PaUWeR8U&Qv;Nv%!)J8wa"'®ęzt]}q'vP+E)v5 LʸX9WcQB?W`(p(vT74*v&ث ҃-!)IA(v_re]%OLUdثL0Wc>> b ]+0‡e%jz`We0;aWf+zƈ@Z،**я2bZ^<+ȡثb͊6*~Xt?r uxUH]*rVSZ8bN8 1ǁ'*pi9c N]1VZ[, V偁\N@~hcW (hLxZb,(RxR UgTZY{b>*%.bImtL BK \R\Zѭnu'Bj4T6"bmnAaSOۈ;+K+7M80 "oD)UCQ_az͸9Э ]`g?.Wbn#b3?~o#ibP=5?bE'I?Z?Qa&kw0>1Շ?rIk 4p_7գanMy`Cc]k_H@&Ӓ} V*J(N}?kA2H ,kq@iݎ&J!%&V;ȥr6?ceKD:Od&仫/ܛ^ 15U[%kPC>prHaΤ BDOMφ,n%Tⶍ G斉kP%20제JsgOA>-S._~v[( ApS?n k{9od:5'Ѝ"uV܏;Lz #!hO8[?uԇV4+?5(Z]lpqbD@! \Wf]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*m&np;#x#42ـ?<:Qnbet)SOu0d𿰨-oqqC47"MhWxq%78*z *kM63C$;*وlU`m1KKWcS8)k, uqZrî:НK< i;#(j煒V *my?W5VdG+U|ثb͊6*ثb͊6**6*ثb͊6*ثb/.0Y?92H ثb͊6*ثb͊6*U٩6*UٱWeW5qWef]vlUٱWf]vl*Ux`Wf]b͊6*UٱWfmG*R챊\Ubb]vc+lf[1CG,▲LUvUqWeqCY{UnQ!0fACF;E)-uᰵ\Y^l҇[|U.b00-7L2jH2Cv*\{cFԒHF,Zck>\1 I] *sq7U+[|+nWV\WlVdՖ1:nЗ 'jc?j=˩#6F]~pq]9"`Y Q8 ~)@v9LG{Ɔŭ2–]0LKWvcӊ\]0+aWW56BӳBһp*v^4͈We ueƳW isttxؑN3f\zm${cIT/]홭n8J4ӎ^ ?V5%c:&kuwH1/_]nWVV=l(~cmV B{QAؖm zW1n̈́8fp󝗨[ -;OGc(xFԡ?59\x~%ra*ݾ688i=+4i*9;tkv8Q9WkQ;>/z(6=L2 ȉuepod 3b}x݉3lejd3-N; i d Af` Ja?t/-yҮm_geٰ0>>_0ӟ~?]L_Ѥ5# m;Pl.(zxɀOwbߪ=QGchCdY#eN=^:vQՋv]u A+B@T?v%H"/mӥ.}2$mauOC$pe}v^m8? e!!ص/-n b(z~eis ͜o~؄h?].M;k~(5-e5?.4qO;ꇚy1%Y#\u Ehu?͞ 1?vUo-^2~4r,1GcPGv3J|v Nx;Y471*WpՂ^J?Ok! oRkOcq.?ߧ/) 'ykqdh 6lOH9O.$6p_|- A& &I)ڹYȵi$_ĵj,EZ텪j^]1a&/\ @pRjF)v]p5u] P@*:aV*kwZ!$b,bUVgv?~8'R[xPd/mbKb[ ڦnc؛tqWc)C]u>:0+5]ĸWfgA*]%®T hvS0z`K>*b*@v`j®F]`B)Ħr*жvP?vS3Uؚa@v]VZLUA7JblPCw>T;JVvXaP;l*Mc1`Wb+q],*\ j5*C ң,+aWcPɎ*짍OZ*wh2A]-$cGv"TźTM]v2v0WZSA]u?F**!& S *6*ثb͊:_?rd IS9ck51Vur銭')j1U*bW.ZqءibWeZ Uiǁ\UM銩8bE|w PaU,Uk->ym1 W̵鄠4z9nZSsP@߾*F]WqCD{Ԟb*Jצ=(!jBJ fͅ]v]qCTWYid,Pl*b6*i`1υPs[Wت kS\Sh \ K.l.7vyzxp 658Ml|Oe3%zG5_*i#\! //`ZjJr!0QRC4&?3RX@TKПِbRۈ~ۄ_;`_AɾĀ+m|q[~QDhR#߉VU+qv8?bؒ)eF6*Sz,kqf&4z_XTzq t xO\IX*2ǒ) *4=oat'#?̝Y76*Lh<WLQ#Ԅ')ąw"OQJ="OךUQKn.vJRk)#|>*7Fk) vaNY+sKߊO.?ɓ(kIAUi EG2,ҴW.Z?!{;nk8o$F;UM2Xw'o#{o*$pei8jk j|x$R7)X!BAVvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊TSB:kcKsFc" *֌R,E)lhI>RLU޵ƌ]pV dPmZYZbW..1KY]0yak\\4O\U;moDe2%RVRV,[d;5qCc5qWdsuc_d$u2#lUٱWf]vlUٱWf]v*6*ثb͊6*ثb/.0Y?92H ثb͊6*ثb͊6*ثb͊6*Ǧ*죊]]]vlUٱWf]vl*ثWe1WeWeU٩6*ثb͊(KS;+o1-b=+b͊+vlU7vjf8yT]bb|UmqaWLw}Ra#]Ҏ#va%* b8c (Ckt큤1tb3TeX ,e낕rq0% Kf+eqR.4n)]\qw,OWr銻n](LB[FKؕSRVv~æU̜sD'Lm}Ք>y&8%g-FN,Y6J`i u2|6b@k08K$ثu]0x|Uи㊺N)oءqZvj׮)f ͊64(vQ|Uc )vnU-%0ʲ )!'y(> nVxO?Ik/R5ՆUj/(ZqJsĘt<x&'? Wf'P`-JIZXLL%q&ՠW} =\ljlc["Ǿa`{ 70IlXirUY?z>xS'>}'c&SCT&0G/v3RCe0 Q]H8%gc(@<[uQ"2u'cf^+F8(}P4VWݯJxq]ݬtF O'fr^o gJ<3mu]2pwBN*z7|1О4C1O\)VR[ wD%nNsNMxclJw35. ąu)T0Zb#ep*`H^^YSe HM!+n^ Y uޘ`#p0ʘDvqqQͣ߯7"ay}n^)pZl.PPu0]+\m]h Wc] ]Ɲ1We WeSvjqWemK78WfU$!Ob ،*saWcױ]mȯ*c+.xm]+]0^v8p]]Eڬ7ʈ"RpC(v\jW=qWeƜjz;2;.Dz0Q֘5]xO\ vdWN;N"PÙ#Rj:bUFWe<vS@=a]em .`XW1Wc٪+vR#*n*iprv8EqC_G#&+S *6*ثb͊:_?rd\xp$XZ81ULR:VLU8bko-˦*bW.,bV1ǯ*8ªnqUaUbqءO画܁LP=:t5ȡ=VkCWA`V,UGZ~pE5W)%Y*u?/}pQ t,M6?T1f@774s qw?AЏVe\~8Nҝmr䐂'pxIf[ƫ@$cEWx|9KoBVZ,hһ,PMl٤imѽ)#Wz@~_V<\Ö7[h8Moԕfm=@HA_C2Q H0 +u|z-qC#TE߱t͸_[h[=n> 27bgܶv\x_찮rLhnKܭ~ЭrHu҇IN҆8]=6:`Vip+t]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثH'xIuq2#ېjOrJ%@AVGC*(qq)_æ5˶Z\NQ4Mb݆(pq .8)Zq9U[ }ثUư$⭃V*xoU2ڔb{Vj \7 b(VG| V}_6*ثb͊6*ثb͊?*6*ثb͊6*ثb/.2Q搲se̐`\v^*ثb͊6*ثb͊6)vV(v^*죊]]vX]6*UٱWf]]1KG0®͊];6o+vlPUٱWf]v7lf͊2Kb͊*Uٰ+c6(o6)vV(vQ(j.', *8UbG!.nz~X:!x;W|]偉k`TPWvA\>p#^:cĩ7`kl.jMǾhixvWzONE0Qd-aKc`[]7۸v8D|0ڴe;ҧlmV=W|0ZkmzþXwP"zm\K K)|>9U8A[_ -n}]Z58"U59 ׮VٴF0-FIᄥ٩M(v8-FRgvjͅ]*uqVbv\1vbث+U8R8\P죊][W(We74cR2ū)ݓׂɈ֎k)i?LN>v2Ŵ'-U?z?޸[vP}5fl`F c1kX Ŝ}yc@vv!#t>8gzWg x!'$vF^e^;WlQ' ݎUEq6۫? ũ|Qҿ#JG.e7}nۉ?t~E؎_mzY _JٞMSh;\ƚ!>bڤ+4b=hq%DN#$zv92c;Il⥅Gz/݁[q}ӁOGeWe^ڛIīXl,c;ԭÄqVXS}mxWd;L.#6ԞL' ~?vV ZO/I(ۯL bs1+$gP%b`.cz ݳY*Ndul+2vk&1=iA+mp'Gct) CmA4irpK3v=c6W{t=>G2IZͻE/}%:|2Iv+3-]F܌fPǿ;.bkWzpVXg-.mLX=28n J%'TitӠ ܉b V:dѩ}_L˱BulGƘ,ٷ QC,q˻?E3[yCtJ&铰uZPa^ pbFeQ'y) ,j]PCv9I3c鐣!}L.$B/Fw\7Lu2+0p]0+1CGqWe P­1VUUc&lDE-0  Z9tZ)MV˥1WWY^qܻñ+Y{u֟u,Gq?w& YvtG Fyp 6"zs L (ƽ0v4cN*i4 |0vj LU٘‡e) ;B0cjg!y1vV +vn'v'*)MWb*qWfh qdV;Vek~\SolG=zn)3Ee"9mD'2o2)04OO ~4FFqELNiI?eStlm|h,m?ۏ](#P khA^\k8cb~a>#̺T?$䬸܀oC튻/ov'*o.ĂʚKGBa®ˏx;E5aC͸S*jDPǍփ*N_|)vZ6L(vW\ oUҪej(0+?'bL`;"b͊6*ثc9YG&A.%H**JVZMr)h ZLrU/k@p*`VsVUc;cRcUQZb:bTF*q cxf;U|oˠ; FWp1V,v53s#r1U0;u{e8Q}D\mTC2GMD\s' (i5MErKy+aWfͅ]j*Q,a6X&ţ$)(BJ `$ R\U.غ́PXUeTcum[Ao)$ԆE2)}-M 1ģjgBk <ȑѸ棘q<~ŐVMbC]ZMo*7Mw_eÅ8/Q'''qd&:汙G5+ .?n#»=B6RCm^4IVSyq*xoC'dx+m7ծ]Y c5 tu0^Qn"1M{[~i}pvӔʏk G{',Zqd8e^.=HSJ`2\ylR"ǭpV}1e]'6?f_u?Ocm0>5ȖZ^MM>Sm9J?ݏԢ[>k"S> 9ٝ~fE^=^<,nic{fc8w`{Wk9o23v [>ˑ+%cKv7S(?Qx~`n u(~a;P\Q}7ح/01|?F NfLuR} z21;'n~{bM xL2 ؘˈ;/UOF6;٬5! /q\y?;خ$sq 4@%f(ªƇ,RسZi껃->[2]Q4{5W\C韩.-̰sq-zX5i=EYv9ly6βₜǮ>F`aQ "Ax`\80wC7#zahU8sKϊLc8Pb7]vZ8p *^63`V\)hci[1u e*-,U|j6m=bߋ1h`K"ٻd 7t끡x <;bc,e<+Jͮö,["@jpc1aQ㊕e}!\ ,8­MbWS* blKWc+zb£v4N݉.kLU9d)`']ecab=A8[Y$FAy<&% Tsj}JXH>"Ԍܰ*$u f-\-븦P8((3W CO|تA1JBQl4H1TT0fQaEH!F'n9bʬdn>)E;dDnI8^\U#Ӯ5ewtLV KqM0VY*U6~ U,:2 ttSzM23v =? kYv5Z oU"8aBNt]Y8n|Uv]B]x !|Uc8 p:c  zU@ ;b)v$v08Ub@:We$W;SʕWcebv.ǓA_UI$|0@nU®aWetኻo.Ɖvbˮ+68(Z]YM6](qWf|d$!`4]"*'4ebƒzv®ƪl|RT  0+m]J+^Z(M`Wa_ fOĸ y]vlUٱWf]3·SZ93 m ITnjUiǨVpqbI-Y@bW1U.8 U^*b*ǩ8(XG|Ԯ)he #]B{ Ug]0JMi6.#ep,kB AzG%Ѻ׮rHRzӠ1U'0+kq|0*Ml*WZM*|7 !cQ\puP19cSWaO7)w, s[w<ޞ*W쿺IaS &א#TT<#\ UٱWf]vlUٱWf]vlUٱWf®́]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]ZDA&52@" |$He#b rЕ(i<1(i]'aKZq+qVA]\aA\3]\ثujT\*eZ78*NB20c4 ~@灎'8z΋=z7J!=_v+} -ߏ'#>?bQ?WgbZMպjY/r3ِإ݃Ʉ]0U?v!3xvV6t}0I/+'F^<5}R<^d1|QjP.SsYodvcwo]Ӥm U%~c>,3hn%6[Ɏ|v>?] p]5Be.-)jc̻tYYМ~Y 7|uo0Kf|9؞d{Y:|rTL8pvCi8,:v /kt' O xr&US|-f>Y}K\.d.Sz 7LCzA"n2ʶpǨZL_FQ"I>|`kKvLnо䑀pKn^Wr~*Ŋ_ v|g1$=-MEr]1)\72]ZaWc(qdž| )A5[k,U jaV aKblo*٩0ىR츥hbHǓDe;5;RI1 qJCvUkG,Uv?(j01v5[;U`v`{Sl E82]&7+ꇾ4T a.8 jMb0^d[  ,ޘ PaK!*uľ#<_)wrDڄE%~a`-Z(s!+2C8XC /nXܰ+~Ql*G7<*[_JƕP[eU_T[b1J";sy0PvBPrlIף-θMu&dvSsaL,k4( U6SQLRbA6AXal*`TavCЌ -aЩۉ=BM \.s!OQ]=Wf˱.vJbe TbFbҘ9ڽWcяO*v`IbĥPnWcP찀n:p%؏Us0\ ]V|PBEj]Vr_v5ف;be (d| o z v1ՋPK58ي^VW`1Wc勐늇b+#/lU‡f1@=)z*}i*P jٞR1We -[8c{c(v50~Cn U V8YSՎȖ%jwf.͊6*ثbΙg-02IS8ክ8U)ZqbqbdU[\ث=0*ާ56®lFX5-jbW,b8`UcXÏXN=FSsb/_LPJeUaJ`VN`kþe­Uۨ˨)Ze|p!y(>[0Z]nʵTA]28]OǛ rA\ DYcS:1,U.8EF;­sz8^_fV\KoҀu8ν78Ә↎+hvG\Uj|W>.)BY.ׯ 2c/z509 r6,0+)We]vP FZevjb1Wf]LثvjbF*]ve8 #WcLƌ**죐b챁]Kzm7ms4x%G韣3DW*[f,iwmQ8:̛+ iuXecmA{o%1nq$Y4Vx%h_B_Xᗇ.}.D:u^>ZJk$n?U@HFض #2OnqNsO~?usYb2eX5|!:iq_2ֳR !Āoئ 3CſU|C韭H,ѬC\[5gĈc: 'ꃱ , ŧG.+͝HS}p0R]^EK~8%A/FMA_SB2]i l۫վvm2An+TdYhLv%N q`L/ea?}Nu0Ʒ=r4߫FQ@|3}X}Nb{s`҃8bvY664i$qΏ$Pl&OC 2~-'bA:}Hc>ӻ, sMPgoWb}vחWM%IA6qF'bqer+|j:|5حծyS$[2-6f*&] <5{kXhvUѦ̛xW )EkYP|iJJS~$~Y9wk6sU#XR3Zq@.mal+w!G§G.YN r26ShW%#mkȦƸT;a%x[WLUD ]\ 1CE;bvl*_lUUqVP6*죁[ٱVV*죊\R+vjԮƲRqc|UوZ8]ġcKdPW̔\"\ "N؟.Ǥt>غlm WZ--*ሴt-.I8-AM8bIHk]~slZ'(jbG Sn9>҈&99hܭҲ*[x.|ܱUp|UMbKlrUW[Ql VH2x/xƙ1UEƗ*㉙0&;|IŒ6(F9oܙZwe<r<2A=*oa\Б2 c,؁1Vkj  0ld2lHPW&| .~MCڕ[) CUaybWs]\)t.Ǒbܶث0n6!v]C|KWeR0+`WcvRlQ p‡f UEe%؛XS{by1C_IqWcxTPUً 1KB1@v4LY;0n-8(vZWcc^e]sq]*]E4 1WcaCS+Jw+MOLU٘v®#0%ؤiQH2OGv\R츛mCV'lPOC,\5`*l\*K-[zm]z 煙]vlUٱWf]7͇SZ93 ej2IS'xa8Lv->8VbL kF`0+lRxaVLU*}0*ܠ1K#0\U]늭s\UIpǁLUM H8햧VUzKя_|tԿ؍e?1qIF30.=b- ?V\I`&9.ƀݑJb6 gsB@L|Hb.mr48rxsd xlwڬ\gN,ǔݛSs:G9$C-PgWdc?;n"kv]F:ZfnMZYS_;gk[TȜ3ƬuF\\nu\ LHl;qulT,qb&n|u~,_?v>rbk\O'gc$kiJیiɌs}b ?s.fݙZn/$Yx؄ؾylԏF1c#SHJI?~aφuGf`آ&pB^M` &7V5Q ?ԧ#TS_[q2}Ŏ R ]8"m5al.(JE}3j B7aɛ_dbN68ZYPHbCY|V$"@z`Vɶ)lNy+,6v_,UW*aCYXb.*ⅹxٱVV*㗊I®͊]Wc@]LUt c⫀bo.b-LUʘ11Ub,{`*'\We*z1B!!5 k:SlU?+^BZ&O]mtvߦ(a:z*E֗ZQz`d ;5jNDxy%gnͭ.-ylXɷ=zу,I{cɍ犮(Ʌ+i %Y-7iUmF4ɊҠ(ˊU izb-Agi]!gŕ"V JFYDFŸ)H;'ͫ1Hb_H+@M`+$@$JW` B'wȔEl Sk=Jbt0FVPC`q1e#!%ɯ M; `Z *gԥ: be'lPqȬi^v[@RjGN+ـ{WeЌ bP:̨T}8RQ~Q;,w]We<Nv(?hKZءTA`We1Wc&1Wcv߮)vU j|UD1'v'(~@]]U-ˡ]"ӯv[]\UT*hM0]+c 1۸銻4m̑bWuzo] Psz(;V6%lB[ʮ *s; Rr6jbWv0ǎl遾WaG'J* ¬f]vlUٱWgOqYG&a*??<3 V(TXq8xT/,Fbկ\^lw RjSˡ_*hTlU@/X,-+ UMrOLUtqژƣ~{7">X˒&HiSr<vsK.fjB_bpRQ7 'd֙YHј]qMDQ rc^E{k!E]Y+HN0I^CWbĚ1b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثʤ][vWp=pһW`av+vQJ،*y]5)v4Ğ*`v0v4*L*c.*Lv6b́]vV*ثb͊6*ثb͊6*:ޮ2寧%ݏN2T6퓕ecZ8U|RX S\PWe]\s]\[L65+LUZ˦* WpZ8CYcߝᐒ _!Z9Wf]vlUٱWf]vlU*6*ثb͊6*ثb/.0Y?92H ثbKb͊vlUٱKb͊6*ثbx)vX]͊6*ثVlUUٱWf˦*ثb͊6*ثb͊];51Wf]vlUٱWf8UT/usaV-eWW51C銻*ٺf*aK+q;aGz}\qȻ Ezd[䐵hH1+N 44\ xZAtzoh5n+jp$%:`S pE+ҸK س1pr.īr fZ⭈q\Ux86)jq6ҺZIšU[S5iUm0`O hr7UR {c_5E[[yb:d]AWf8L'cLCC, 2R챓Pث U`W 1#vlUG5Hjr֘vceW 6͑(v_\ )+aWcqWfƜ4e `WcLu۰f7'?}ӋR^QW;}qfcXN/5p+LŮO-ğrr\}ջ@58ؖHv8Vb?L9Q*wAȦQnW K"p$,CZaqj)_NkMa],c~cc"ۺtb\f?lcl)qZI=>c t"qKo" ne=$*⟫]P083UmŷW\C韪.+ķ),DL }N/?ĝiΒ[oˉ {ץq0FQ%k5@hp>Cnnɴ(\[3~-);6[ŻWL /ٮ :PbW4?dꇋ;6q 7QȣMY`q?;+N&L2>(φF]d"INF,W4޵Nh9,?h3A&ԭ=04i c͌Ŭ."ŐmMuz7ݒG|Civxz'#R82󔛮/4E,3%.h Sp}dg1<׿T^K8W.Nؗ-2-H<.j)(k5 +cS[qWb…S(ǁ]\qWW7qWW(]\bǩژG.PjlRsbeʮ*P6*aC1bNhqV4bPbG*bf銻CcIWbni[8Wfv -L<4 .AV}pZ#v gc0!Y\Fpam4Ā F1SXO!*K Ui}j(%{V]"7+9ib:,ʣ;FPPE<YRݏަ-?oQ7Z6|%es]jp/[1p*L&*&)T++ƙqZ^-4ɅiU #dU,a|RblSX@6KpE'0AFv$r( W(Talgp1ABRGmU|J8,R۶U"b]DzC^_܉<-d\H[Ɂ(kȃ\RRҵ.8411҇*_.B銻,1C6j̴8 *jc\q7 \2ʚTVyKI '¬f]vlUٱWgQqYC0^7 BJ,xqV'1UrL(hrXN=Ep%k \qh7K 6 WYj`Wt L(j7plUi5'[R)1 5@' P|zfXt\ ^.«Ws튶 {f&qW(Loj Uz bS#nI=1A٥Vh0<@( GqRS%Ȕx}#z̴[D%jk!m6򅵹-eqз@FDuvVgA"XqQ߿߅ ĚA*Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWevjb4qWbV®$]vDvo$oF䉜avԯl+BW +Ke]a ʝEO:bc~.1bqWsڑl0Ěl !%*튻xHbLMt]+]++*]LUXٰ]SvVvlUٱWe'<B;?NYɅZC|񢵠Wf1RƏ P+\*9\rpY.ʧlleSusb**kTrCy2U[od;+B'6*ثb͊6*ثb͊?*6*ثb͊6*ثb/.0i ':F\;6)v7 6*bebf]vlUٱWf]vlUcvjWfvjb˦;6*jb^*\Nl(k6)vX1Wf.͊vlUٱWf]vlRW51K⮮V*;+50W6*vjbe˦*]usSusSur銸t8.nJd!6h'E3ċq\ aV/ Ĭ8"#d7_*%<ۄEID*Qp!3||p^'{] tߑsr]dW,xKXbt) *Dd>qd"ǹŗ 7 0R'.æEv7Lu1E`Fau1d1!$;0ȱvc ó)8tf;/ (ZK]va"c+]RzWeS6*;*һ18B5qWf]L b].*w!`Ђ:V˰u7Ai\|L`3kAyoy)<`f~;J$߯$G!ܹMؒV~,iC`i8'Eئo/FWUV9I7"~f(.9wQ?zݶ4 p 0Lxa1:BCOӥ.ҺkKK)78a_!{?՞'rV#CsM7g,FOΦhJ\Q1 xEtYTIպb].KOG[|iu1vV p+ };eAW݋_RZr78s ؕ<-o?B*Kwb0^z(ME1c?1?LE##s8\h˄v=.1!܃\ . R"%wOv:Ddv6Ų:9Ke\mCN%Kf`Q:=5NrXЖpbq1[ ܭM~upG݆18_Ew1o^F 1cIa6|I;(8?ieZT}']?&?$`;H[fܞ%BNthq H$Ƚ٫W ȣm"B<:cN KygcFVek3l78vnXU٪1WcN*bU+G\k6)v`0LF*be6(vb6Kx1WcJFnLUr\U01lbnH[&϶ث`bO![ cq|K` UalxZaUzm\ 4rR1tŗ'`[P~'hۭ{cj19? v\GVS${oghR^P\M2]ee"%O­o^Iǥ;ᴖ(*zP2>@_bd10Z⣣ z5+6 U1WzLUW2bm2aUQoL/*[d*eWQqVx4*G-+bU+hr$ ֭AH;`yOShw+ɉ$$\J҃"\RwJrefnKYZ.)XŕaZ,NؖKlN/Rǀ'*櫌G*brCPT)uq)_LU&*ޕUؔo|Uؠ 'v4-A1=|UP]*Qe;NaK}WcL|| voD ],+-Zv`늻0@~XAvfVt.i֘(4 U`O*@K|+L*5;f%G\Up\UaM׮*Uj׶*rԌP`qWW6]\)uqE z⮮\@w1CdW)@c\Uq qVn@VRtZRCQ*Ȫثb͊6*S TLK|i3|.VZثD.mr\(sb0*zȥc82 WlF_ (7\I;eqCU)FD5iqG0*Î-8 VS|rU7);8pkWrLP?,mAJ210<:\VV׶#{u-q1UR o%T7<>d>| 44lRc ^lPr%]e5"]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWc㌱® [qኻX=Iv|KR6rI*?N4ԌPP87)k05u2 N*u1M;+(vP\sSur\PvXZb/kF?q!4kCC2"b͊6*ثb͊6*ث*6*ثb͊6*ثb/.0js6*—eb!G ]6*ثb͊6*ثb͊/0]UءٱWf.͊,b͊6)vlPثb͊6*b͊Zͅ]+51Wf*V*u1V͊0V˦)j\b5\®jbj`WW51WW.Un:iW |\w\BYCWf%I_&,V^-  +_T xY׋:71i+r^'ZbS*% ҏBw"cзUF劮O-1M*8YeH3]S`"c` w 1P`)+ޱŕ;7,z c}BWb3 WaxdEbc8Rw,UlZ$ !1wȫ68B6M0\Uٰ+5i]ڻ18ٰ!ٱWf]vlUDb1KWf͊]LPaWci ]t/"xѓ&TOM X3v;S ?G+.!^c\ij6l[5 ._mKƙ#43ϜdSeūK. Nv> эV8rQFNq96w&$շݓcrOJ6n $Nw[ń?s:MHwa二g?Ż"% p۫ǰ[Z3o>=_Z\[#wZ>c#.3?k% xnhF6|WfgrMkrnrX򓱺XN_s-TD6*[k.11G/7i-qc&#}Q] Wz.?K N,Mw5HqgxrLjW3XܜP7jצyqq$lzUP L8Z%#U2bS,6sPfHu2ȡ*jiiبF#n[0C6UK76PEǚ6;]q e*O)u2bS-ث*p8Z9VU٫K!c 6*죊7l lc@[˦jDb5)*0)la],[Mk*ƕl` 1tW--%alv;Q8p%Ĵci^kE+2r;v\ڏAL= k s?,xxRݒ~?r5n^< @.źcNx9`KBݲ{0 9ƙ bvw ذ-k4+oEǫO2}?VzxdI Hbb 3.X1UA qUiK bs[sxpd*c0,4p]`YJ.1.H"1%2=s:zsP-dALE'$F BR8rWrJ)*7!E"aV9r*gg2ُ󽡏wlDrDncYh]U@)v$7_o$lUV6JQ]z*zN|U_ˮv5)]R, vZI UylF*Ƴ`9NR_vUA<(v=*iT:WeHt]rvgS]1Wf(WeJ㙆ҵ\Z $$nFoqWPm*PB qDF#b¢[Ub;b8Ɛz *qPG`Wf qWcÚ6lPRO0E1WcBN0>0+qNU0F*O3 \'c\Hj>3]vlUٱWf]_+Ta"=.f [/qKc-A X)v%8i |p>88 Z&2VTm\P T3Sð w=Z1bZ8{Bˮ)ZF8aU,*8UL.8P1jb홎*Z.[ (kqb<Ӯ=_m,HҖ=eo#2Iw9K4C| a]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]U4V ]b +u ,>UتA]}_+XJPlT튵}?bLU K!Ni3Y RS--트H=UQoV1HOޕ*ii[ HVrIh)ʒnwyHp[0W% Y#;KjQKCXI,D4V@9jBl?dmCW\QMKjjGg#f:f/g`+C\:͙8,n'_KB߄lTVūZ#KTߴ+C[,l7T4$Sv?TF O0]pRZk Y.JIO/܊i_|RڒK@ \IKRIl5.p,^Ҳ\W==E*uz UQe˧̎ .ČX)iOE;(bRG0v76*raW`v[(v p%XH'xI*Ќ!\EE3iz *!rm()Pt80U>FKƀI LUt#Z銷C,iqRlP쾸 Y-LU!i9+^V^lUٱWf]vlUٱWf]v*6*ثb͊6*ثb/.0Y?92H U٩]b8RUٱWf]vlUٱWf]1We;50+銵usbf͊6)va6)v]1Cb͊6*ثbͅ.9tW/usb͊1]6(vlU1W]0+ZN^)j`bW50+Z]1WW51KU㊺W7**▋bzo^qd+'EqdLm.}T펣2M{⃦!0U$X^]pʁCL>/Fv`ğwl'b+^]=7V ZSNp&1q|.Jio-1UlYDq/,D"W^[TkMvrr6vWLm(KxbՖ|1%MENva\|bv8d켉V `e㆕ٸAC6 ءX٪\U٫ኻ5qv`NvY]Mr,]]LUU]ٱWfWf] UtC.fR::۬v?epL1а'O)FXp bZm`7^(&1"{zJ1ڜ񝛸qmm1_L}c쵒\/mh{Ȗ3}X2ZV&q\0oИ'5bէʏek'J0d5(ܐ-L<9mbg.;|[19 2vh\]ڴM{)l|'ꇪ.i'Sm'эC oXm9 KF ǐ39yX\; +f8|T={e9ˋ ޮ+4gxD$l6Ť v2TPvR eb]1KUv< ZoJU -pCT4%u<$J7,5q3hv-_Zn=ǸcG\eDsq\ e|SN x4ÐTZ!!p?E М0H9 D0᭞R2SP?#gW@d ׹cGA-'q`q2E$ߗZUڍ}kd5\'Y⦸KIgHYUiU\ nu]Lh뒵u2"N ʼ;bCZ83❫t'cKiMOËYlrlb݀[QMen,6ɌÛYC|--h,;(j(*Susb8ٗl*f8C ](vlUٱWe]튻(b5p+YGV i]\v)[o\U g'H4STJij 0FGJ (A^Jp[ k;Jm"U٭\n'EIF䜈0L=k}π6dqk XC018YӹCi˄ړ<avl,KyEi\]Hc>8p_9E7x̩Uŋ A˾1@~.>qCy?rWGp"b͊6*ث<??偘cHW*ӫ\|U +XEcbUL2v;J !mjwrZaLP^*lU[lQuc\=\ 8m0+^c$N8bXe 2U\U9]LثW/5~IJO/((q'#N0`iZ"lWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWc"0һڧ|4`+d8Qi]1v,һWW [uVkN)Z2`IzS i/ӽ\p +Ms'|qZp|o,B+t'I-ƨ)Upr Ji|GP-$ -C%aäOp;XlP9߲(OU?e5hju%qMt*WsRF߰iCS^#7?(^-~"PTSuQ'_&c ;ۧdcUצCiUVj{x, !Pt&hUWZO'T 9(( _7ʓ}c\T.='/FQ+j*5RBK:GrX3 a[P5TsP`&*V-ƽ+U'%܉M2qW H-e_u3q;*E[ې? <*xJG`VSD?ž-ܿw8Ϫ!(+ ǿ*CF$ Ԩb/_/\ 5 Q/Qm jc~Yw^HM{oV)>xbh|Xj)-)[ޘ'eBӰ4`C9͊L(v ZWcb^:bęp% UcjN}هd[*ZqVDXTclz튻,Vإ*w8N7lUc\n#SU*Up80msS]\PᐚE?,eHEf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb/.0Y?92H ثb͊6*Uَ+vlUٱWf]vlUٱWeUxٰ%xG6(k6*ءٱWf.beeb͊6*ثbͅ.8 lU٩/vQ1V]\UqWf—v G/k/vX9(j0U˦MW6*ZN]1CZ[F%C urf(U4,Udq%P[0g] |toC(+]{͗#+"]^-y?EkL|j)Nt$D'z/i~y9s)(Ƹ Ȗ:lp<ʕ<q=1 VDˉ0ik`k)vUr(vV*U؝rBV?v](+L^=Qs.8n؀Ŭ bR켴rKfɉ%yZ LUَ;*AkWf \xnƘ-51[vX-]C R쳊F*]bxCb'I8B+*UN*쵐պ?LC >߾2/mje9Ũt]Lڔ")9pzoŶR9qAZs5>td,@tm g؝s #^ s5ؔm.9.µr8Xo pzgۋ6ZT~K{zsuqla1?#=AUppkN"푎 F]kqVSLUـG/aZ8Rءx*1*Wfl 죊ưœ7*sq8XV4N`0+Xኻ+S:)dȪ޸'ȲݩGKYW+0`cv1ú [3i}Q]tߏJqɀߋ?g`k.Oieq ]/[gQpZyXqsɒӣe/wJWxXv %w2be[ 2bcLx2ⴹc4RG1J VkS>mWf* $ t } @P:*iǥF-1y~,d`܋c\ Ezqb &!kt#i%I~S1blFuZ&"dm\HY/nĭ}>9 37%JFQ}q7Z >=Sf_-jZj;D4#k/LR*8JzaK֝CqQ,]vRثAq$*φv=5+1CX)Ǿ)pjw[ʉ3A8˒j{ v8/\]^v9.| Aw톕bGDž\q ak&銻/q^Gcb@=1V|RKR]~#ƎK  5 @Uhv]>`zWe*Dbe P0+=+٫)(qބk]Œ͊6*ثbι?偘c<8' T9]1Vp!9%^Ǡ1E`U6]+ SjSa^UČ\ w\3qV˧|Ui86I=pcUlqCa:i V7…;X(r]qUmY?v* o3FյHY؃) A(:dkfvƧ  : #`CxFĥsC1͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊.SvV*ث]Wf4,$JUm+mg%յ=Rɀ`ȭiV %آ[4 Œ/g튭ipBb تY V4+K Z3v,RZk9TkԮn*(F #C$O}`an(%U: N)$Բ)WmGA^KɄsR1ȣVJv_+W^ AȈeu?E v?\@WGl82),M},ifECч&^"Vǀ$T+^A銒a͐UHg+\Kea&r"ِx70IWw@>$>+OcO9 :{X9*wQΔ$e$SREoeݿϖ(mmB(;MWr⡣dx ƿV VD2m?e_1WS`QڸARB>nbԫ 7 ?¶cjƠs7- NG-L6z+#̿b5N4aoⶱ供% @TmUɾPO80$?V'k %$2#n?OR1ނAcNe_o\ {Ž5T灾g EA$o4V_pY/wD^AV,Ai;'OM{T,zm[+ }ˏ, sf~#F@C2/S)WMlL#ul$| 5qB֘)W #:dJ7b$S"]v= #j*s&x!؃0%؞vX\sۂ|2g#t+s U\i8y*ݱWfqVlPT͊0_ P늻0]Lxf$ꋱ,qcD?.ʼ]B.S1Co?X7\B0'6psE5 0iSߗ Q&wr!'a|Btu]iػuŞl!.YCiv& ]6vV*iUXt]bLB]SSsbUغ a,N m"И2mL46mF9[h a2GmCO 1ۮ-7!Q!)5jKKfMGH8KJL*=F1hSaÅ6uG ,M"?#,f.*Z0%XRW1)$V&eMw銷*F #c9`jǨ]ZlU%Z8Kxqqmu0 cwKb2v_. P;|FK=zS$ct8r 8ባqj[81!-"T5~4)o.®azb̀G\ H+XM )v`ve߯\P8`1We6k[2qKxN b|!?͊-*F%q8oZv=c!~-VS銷[\UcQb˨N*< qWe 4 ϶v&*mjqCo\R2?s[r!(Ȫثb͊6*O*SX9 8 ^Cy`U)/Lƃ [-Xf/4sbf]*ߦ=EX(q[ N``V:3aVXsW5ƸTm*Уt8xƟZ% N}A:o@5LrL][FGJ*I ]!S#+6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbE]8P)]kqmAbiL4i]i]Ƹxqk\i]*⮮ ̌*xiqiii%)XeVlқM%+JO8$r_Xf!rBAu5?_$n >㢿W (FzjÊHƽVAU|XֽHI }?̫OUADb2KE]H{I~ĥyKZoFk&fea}C?+f5IW?q䭈eOFǛz%_8h%1 Ud?Edb^KZ|Uy)o'/ %$gBX܊2aޱfAE?ވfħ%f#KFĤh|T/170yq~f48ScvkbvOF/%(uoO-ˏUdU Vu2ʇu?n?1VHB~іBEU2ĿlmT}uJSO?Y*j.k4 0NGc=fּ9_V6m Ï&F}O8Szb)JH3֟V6%?e ۯ?0X=wRpF&l<Ѓ1Q4 :uⰒ aM~\j(jP4gª5>* nLR0yޤ|CRGC]ؿ'* PJqރ0otj[5oQ©:tMzw Ξ?G mYVyXӦUإup)A㑥v!dUXbŠWa, lS $y;E.͊:^4V\/8$-:aKX)u.9Go51WW6*졊, bb█t«rV`Wdk?<_ Ud/+B/6*ثb͊6*ثb͊?*6*ثb͊6*ثb/.0Y?92H ثb͊+vjbf®]vlUٱWf]]1CVb]qV6;6*ث%ٱWf]+v^*ث6)vlUt­fefjWf]bfZ]1VShUn]1K`CD+ILUb˦)jt]\1V˦*(ZrVr6 iPR=q\R},`BI>ط/:O#%]2>`/_q)n[odK7bdX+6*ث+]\ƪ\^DC0;6v4ȫPe ]L(u1)!ȱk"ˠƀ ]6*׊]\P8eswPia&ܱX֭n\yh8Z1uewlvj]®'vX8bʭqWf]v8bhv`<1Wf(*6A0ɺ7ir6YQ&g*#o٫6uĖŀ[6uȧ `~e#IƇ`<@?Y؅Y}SF, <7'DeLRk%xݍx}bM"e) O;vQ݉K6\R' (;*X;0+k%دFءؘBiQ]ApA‡`H!ص Ձbtāg96n@c"3j2ubRq'Õ=Fغlt08'0aL[RҔ:~8 'S/B'c@u3hz*i*=i` gVY |$MƟ_85U5|ƐE~Ykdw dO`hzE^:c \6 ª1VCe,|,/ehx4N hgG7-|%078 s0<2\[ypˇ[Lu&qg>'oh.PڶyVefoǔeLxj2vv.gɨnoqqX%_Rb&!LTc"6*XAى͊.َ*ʮ ];0銻6*vQ[ʮ*Y] U`beҘ1KYWc! AWd Wc)RJ#ӱi!j:r`8@v/ ݯqqoh3h,ċb(KVv2}8Y&8sCjž1h4~b~'윍g%R[%mr _W e;Q_Uva(̑50DڽFŇ&#iv-x'jr%~Yj44N2G0Ӗ5m2bq2iWq6| \/W-+]LXe]Lx|Ui\x-[&$cb+֘ݖ.> j4!nBB0c\ Ve!MUv4v$IpT)ҫ4ȮPOGLEyLxF߀Ga\I>ly) 4Mɮ6mjI*W)G+1ܜ "Ss 0)YsyM9u73V3|'}bģ)ncJz`bKH۷*m늸h*r@PFb*N)YNpeV4)jRj}-Z.jxVqJt)QvYfp@u8+KAI2"UyLr *2}9|k]\sʘgPTooCqcQ-W+o7 ^ثp hz%[qQ(ԁLv0),OlU%}Ik o ÉPV*3F_ZSMb>⮮(P(t]@a^\0w]\z[Ĉ&aWfT*>#iĥ®C1IkIVEWf]vlUٱWg^rm?0Ƶ?xnlT=|RBӗ\PT•.u)PE;S$QStzaV:*aCMF)q^#s`U:eId1*;e u\R-ZNhj|ˁ«DGY84_T$WZlby"~ʎ0 [ڛzTo_ܭ+c{aal-bXc*0gڢ0bX*M;ɀUX`Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]w900ԶT‹v5*oՉmجvaW`4 LUVWW'+E/Zd!,*ˊZgYbXkiMŖSiUޜTzҡ=Hu# @.џ>Ƒj9\T0_ɭG+ *Hil߼O ZєZe_m|z|e8, -JpW3׋%QE@ н)P)-FUB+)(vt>=x?Y>+BP+o)egxb=wehVQw Ub^Sj6JJEdӕb (4T8rUdX"&Dge{76zt?gH~+|,zu._)Q-n7Ԁ\uA_ U=qH5W5] >]}'Uŷ^Ǹ%OnJkn]j>?ōڻ:r#H;s?gobJTH=T18ؼA\ne0Z8] dͰ/?c{+oDZ_JSWz~,*{o$x]"HH~??S>XkbHZDH?eqYCjhKSqYk-z}W?UI!>mlW cWRB+Qd=c52SBBY,N 'i& T,p,8q'qG3"%ܨT%Gu+XUUp'~2ܝ{d4GV}8AʀӑNf? ? mHjG諒ڤ,@|\⹿_r zj':ᵶeFH5/m1٫RQ֘&-ɪV׆Mņ;N]Y?g<q[[ݫ/ lşgqf`gů&#y:e}96|[pl@Idqd%8)/&-泏$MqaL.b8X[yT UuZ9LUUٱWc`CvlUٱWf] ˦*)usSusSvX]1Vb͊(⭌M-.S|jM)"W#=vNxuqg{VSV$\|9|?Db7crN0͋!4z.$d70?)ŮfWJӓ\fXHy{PMk}ܑ.xq@N<3=b2i 1tA}ص cW1zM\&͊[00)$i qE:.+MqZwWZw.*TJ>" r r!):&5\0, : 669~8 jET1g{b+bw]Y s\XभhرPg(g}Fim=p7VZSlRE pҀդ#YB :N-m9ŒiY>,)kv<to1y\z u8 Tb!oc2bŊ-\'jT)q8ˮ(p­bnnكצ(v<L|q[kb#j1RN8 )js~['*0P pe[ˈj| e2r]ٜ?4Ɵ8rGs!@P]AZwœX1Uȡh5W|P_nvZ Uhm\UP8qb6) 4­?sqlRxA]Ԍ*Kobdž-sm]j؜LUîy'b\J]g 2(_vlUٱWf]w[O9`fޤ?\ 7*'+ W WzbQ\r XN%h|qv˦CyeڇZW鍦Bj)V*n8`.#,VVVLUe–ٹo:b3rl ̫ƸUܩ1U;Kh8ҮDh*hA[溕c;xd[aj,k gP;œ"؜v0cp%ٱWf]vlUٱWf]vlUٱWevjavl UٱWf]vlUxSv_NHv+li4=TNlRb 5\HW»*ˊ1UlUlZZfV ia|Um+KzbX3*7ƕF[Ս}B~߮QS_Q:m톒Uد%vZfH7e\V״R{W4z (]T_K7KA%q|*jn?ԐuSI^cɨ(P[PbQO !_(AjTV~?%4d?j#ٗ/%VĂvqtaܽR2]~O?jQRG H~%փ#_O-[#`+kIi T0e|Jm{>Iv3=qv[,s:oO& ´*<0\s;(?f@:5ɫ[S~ęXlݶ ?/}U?xGD[`h$_-)%/#,?}e*î*Rc&3oJs9h_k`U]BMkʞ"̖/I Uo|o}-ĥ(Eo_\V~ʒ4qC]-~6;+mP@=|sHV1<o I[cVobxt$CL?eY\F>FA{7<^"~$=/J_rh1(OЯW'cYyz ɩʜYܩM&rȫyXavL7*dJoHIVHSFL5SIuSΟwI- YF̞z_\cJe\$8d{zH7hZ=qYJ/*m/F߲8IA'W*¯b[z>D߳cj^#{'~F[B+]hY?zS`}xWe0;T-$k^•22Z(Up`1W㩊ʠ[Xt bNw 1J J Ӗ1P㑯=2Rg!YZyWf]vlUٱWf]vlU*6*ثb͊6*ثb/.2Q':>\L ͊6*ثb]XUٱWf]6*챁Z9CYb͊,`Kb͊]vlPثb͊6*ث٫/6*U]x٩6(j0+DZ˦kN8`Ux偊\NX\ pUR8สqb\ lEhҸ,bʴ늡 Unb+jZ2S_ *QL]XLBLMԧJ;NX)tp!G]vlUcv ҒGA99eHcq Z)YCc|!]2Iv^)v^*v8@xTl3+v KV(Èd|}\-iT=~Ob+Jlu876ߡ9æ2S;J8Vcɳ?Q \nضj`Lt..vop.XA5L-<'xc$qx̗˳N9EKvF.LF`Db\`CU+.jbc0®ʦ(v8b]v^*죊,bUxٺ͊\.ͅ]0+RP]þ8Բdq bFѐup9xr铉'#sl֏}V\g\<^A"D@z/A6X e 2\hG&m3}On .6jӧclGp[Lm r8NFW 4[rW.<?Jǔ \ǧ/8<ћzN$f5mE/ZR_2rEjaJ@酖50Ⱥu7/ɷ u`eh1\9=6 ,{-M#(*6v+YKcg•bed1Wc}\SNl NV& )v?բ(!0bmVR :WuzbS(h"\ \kբ+ ̑&XTm < AؒA{uK¡&d*vȖIƜ)U}<^3o?bsxI)!WBOF=q#F $鎏b"RUv)o,=G|PSrО'd >ųKcI!zF↎=5pk -HK`hUvR7Zȱk\F1V%SI\2i[8rzW03Ƶ­^C^'u>4tqWcY* U\UٚD\qJbqlUmLUPqJb]7k1ZCy\ ;b0Rkv2ʣ*=/*줗o)kqS\uqi®; U?ҟr+8QBثb͊6*PsIg, އ 7 RZ\Rq'w-늅mB'Al[#IۦnT8{R \vߨ1UMqVY*M|pӎylRE NV7L|)lxeW*)e5®;fM+\b?S(/|NL1%:ѴƉyhVEF x+3].5q)v%\ i8+b͊6*ثb͊6*ثWbB,p:`Wc ᤻6av'sN + 4v+ MƖ# 4^)0Z_Z1x}UAj|0WiZZ T -z SKzu9;**w" |s$¹ h~Mp3)JT|c>!$^IJҿk ۖ9NDoqmK}YA4BY6SF+sf DP>n$zA%R?ekP@EMG"f>9-పZ| ,l#H!)d5yhnx:c}^#nyhڿ&Vk%WQos_-[ 8?r&-_aEݤaJQ] 4x &x'2`w=^5㓊C;vaώKޭ}#Rʿh#@:*.oOC>X9Hݢox?ܫuͲs7zp+_k;QCdK/oKJ¨̪dcBc+6T TMG\zjHHf3~9ٙk[?j)J^HQY?+Gqݕk]> |,wI7/?Z?IܝG2Voc%5:[+!W+v=pEWeb],,d@KE}jG*F^ ^XԴ4د<7$'U$K͉'3!FĿLU"ңbUo|,+GjL- w]ױ0z'|8ڵB6?kHܸ-)_?KlxS?9 2So-8Zo1EӰ 7LՇ*=G|,Hoq_V\[Mz?CxTP0_3SoO~#p?KV Ip VߵS|\gMF&ӿCL|T |40Psg$?FVZDԺVD?fQ4T -E`KwN_k'k( YXWOۏd_O'kh ؖ ]?z?qtԸP!%)IJQ?D'Hj^+_.ђ ;J:1e( ~)BhF@w4?oMfe*zsG]R|#yɫd=gdK6leXvVvV;6)vlUٱCRpzDN=\ⓨ\/Jrų a>}N=q+ȽHVqcqLV_Ӯ?O 4# t8(q82q d wi2ؤEl1 \]O_0mG26q9oNch'";⪠t #LV\ymM`0IWD-׉hlߪ ׯLR;zSl|qg ~›k -Z%XrVX:>iRbi;[?pBg cnlVaŞL\^+[3}8ҸYRa<Q ?K1𛯎Ma$Y%;bx {xK|3}?Z$KW.,g,R]8$46Qŏ٭^S džS.K:{Ot1gpp8.Eخ,~q S6 Mp9956(vlUUXb͊6*ثZ9)va.ـ.qbU`K+S|)uqkhcň݊FL{w&X$8L07.ׂpjkf.}2;(-3m.`Y#OMO'fK]D28;*>p5`;='_s8FYhxC:_ݎI(__9{aS 6D2'_JM2[Ax>8}-U֋v2$3~;%@n6cÓfy\SHWmN5 [fdY/ɺb-&)bM.,ؙc SNM;0SYE;$pl a|Ʀ^;QJ\uiRkӎiXRVbX'WlNQÜ(2:e$C׮bB6 ipBpc";lJk cXz)"rWc]Ԧ*/|0+TeO*q \zANQv4KFxMGL(kď*qqVV,*9z⮮0Uҵ[7J▎xgzt˨;f,ثaY:f1WNr)늭4'*3;xu!Ⱦ; hos/==U7L 銻,Ӷ*~W W9P6(w WQH~Wpdph$|5djNX'ȸU1(URTaC"`Yf`rȫb͊6*ثb͊6*ثb]U"aW`Nii֋*O$`at®a R⟢1K56Ci^# ֔ 0]0xaB2ƚAYqZi miIE=,3xb@4S{<7zvRf GQcJI%CXAՏmTZHHo0PڢD ץmoՊV42!VLxؑX@C׍AJ% iA:)J #~c}QOZf2F6YSgC<- (8R쟗`d<z7dQN6ruikKqF7*^B!ꧨ#oA 4 ;08p.?vnuxiUWz] k54' ]J=>de+ɓy'%r|=/@`~3N2Wb$_,d}xl˿Z nE?%zpm8HLkS5BlC*=(wq?HE)A1*G?. V=G_ +OJQCJBVE*b2 ҷ$0IuɀK}>88z "hH\xė& v5^OduXĿk)9.EG?o\F("/П J~&j{xH}<:2{տk*zCB#Tmi?gqW]^"`jtؙO?]J|V20BЍ偾3, e|Q^1Wo]qiQgq)G]I|UveN$"uOEAA?q]~44lM;k<ϖ]3+ t/G%W|";*ITVkp?n??w!J=IQA0S+,B ]A/FdwHZ|3EYYP# (üɪ;;JDGxw`h)S&ZvGQoݳOދsM?ݑ 0+t}ݢrZ4Go/?rxFw_1AeS|=Ub卺 ~4S]p;ZU}hj׌rڸǧqF4"eh+&hV*3UJY'O/ oҟcF/&HSZz?R-uF8U@j~ ǂ ׍M=Tc帋WVAv!$EyE 䵔RajpzFFJ5>(ddouV_qIA_In'#פ;|R#X܇ƥn풍;VIJO ;}M)QPo]ǃkYc[,悔T;q!~Ǘ4O?kiE5 #憛LT-mܷT?2'iXӧ2®|2?Jc͙yw_m@x_'OteolkZkPo-~+F;x-NL Gғi@?.NRb6Rql*i hU =!+w'2$!TǓSK0C(Q]VSururŹ Sa\Ux9*al*fw#U?=W| lU[!9~B"tD+ C'E9&V͍}le+6vlUٱWf];-L\]VAv!tOv찹$e l!*ᚘW*V+mˋlO@pDIEwf V}B?JE=xݞ<2DW5{ N m+8МSC,D ? .fgJ1/o=~F"vF,H@rk!F偧|u5(+K/ nTI^D'Y~;6IxdצNnhEdC`Mتxܺc3o'eG?; qb 4ke]\UD$-/\]\t]\͊1]\UX+bp*K]'(Up6Kl ]RH.Ƒ]*참@1C☱v*0b 'bʻaC U٣lB`!h*Z$ aJrchkP 3Ӏ~P~0=+i7A O9ӝ>PS:N/T 5kd;qܝX=ex҉t?sdAƜR(n8"8X1-10\RGpoA/:`I"{F' V]'5w{6%PETb0]&)zt"G-zgkgjapţDs}[Q1SLJt`:bc,[Ɨ6~9B9E jǔD ;Y⃺,aeɦNSژ?{p,f뚑ݯ78 KW8S DBv8\8L8oCqqXKT/]R=tMs q.L-z\|؎3 I6\ءثYxU/k1[XWf*ث6*^*ث )vY];1Z7Mp-L^P=%bۊ-cM)qdSuŻ.TwsGpҗfp3!prpfZ $K TQ.QuXl"\#m+ya|2-X }-iV lX] ҺW" 8gLN[Wa$br%,&Fc/Ǯ :.8Q+d.%{u?SQZpe0<2V|##b5SFY{TzOdg xY #m8'_OWc0\jrD>tFbJ}49`vlmj$Upث`bR=0dT $ŕ;i|RMœCv_qWcU.*V.|p1.HLn)8[.vZF(lV#C—Oj yhVA,`w`R]onbzH8*XO|Xq5h'_kB]vmh%#9.H꽲QP,[J/]V!,`w paMp+UjR*2TKT"[5$-Pv:8WcX+=pʕ_o-j([;O^$ SQvUARSQL*첤/LUЂ{dd9\U qVʒnȓ L=Swcŀ+~1e,k|pdž+KM;45j늩4ӮTЬ#c1mCr&S$UwQ\QGep.hкZm_VRa !P$(XڋQDïآۊ+1.V@iϨ<&D'aREj`@/WKvU-08⨅CZJ;6^C$` zVm["BUZ'f^6#ITR*!m>,*i0ov< uv5//#SaDoSq5\'ixY8G*;)6(Z VuY\>4#0y(JF Tz_W}; vh~ _ )Lf:S^x1t`] oI58*cB=ժ"`/, Qxk})A0FudDUv ڂ!kSDU?̿ &~}{{㛨#|T[Wvu3/"#Q>%ی6] Wڟ"[$~<WPe č襼?wH/!3)[kn3BuO*qFkvoڈWV[Ĕ7s5}p_H oE⟽8w;v8܅!-ރBOW7ƫ lvuޮuF+"9`fRu?+t?YUGR8D \n"fnE~}2ĭR⒂xx; Oq Ru_Ձ`I#WU\ ौIB]eaq*UއN1^f>Q4tE늸}>eylNc+o?{DZǯ4.z'g\?%jw_ k+,,R{~_Q~]v81j zh]oRA_ t`?aj?å۸}PI0p7Okn;w%4ucj3?/aV#㔊C[$_ՏH鼀!::_L]{>XUيKߟ?ߠ#eydؽE_j}~?+a*$kۭbn9#;K~/_τ*Gj>;+-n7\LBFܙqa? $@5ÝVOB#%v_?$/ !'A}UGc冶sl nE ׿/._2¤WsŪNNfUcCR6d?k7ϗ,dl<85O,޽ƈxΥVh~J)S/NOryh/?LzjGI?o#ͲVh~;-rypBk`H\XS -Dzs\4;_.6k+A]=r\Zʹ&a (+>tšr\oL `QzzpM~8J0o 1Jэ…ـ8ٱ vc\3S(7R〦*SjGᐒ6_hvlUٱWf]vlUٱWf]*6*ثb͊6*ثb.0js̐9b͊\Uٰ+bͅ.LUـ]bW/:Vb͊/vlUٱWf®f*lU͊6)k6*UXb]\ثCDPsbٱBܼU͊``Vb͊]hV Z82*1H QKXVzǁ*lqET\Sl|UFZzW,`Vb{b#( zMUT/|R֋^*qeUN T3Bc\!tŗy%ijiZEffl ثb͊,b|XJB"˱/%r;5wĸu+JȐG|Bf ㅕ;.;x]f $`cDuqiQ&S^_&x"$X. -b7ɻPH _q5o-.Qg wxܵ G"XQ8钇N>EY ?a5eN)sm\'i|<{dfCgpj;NX3q5cE:6[5?zl}[:# =S3~k k~s·zlaO|xO76q  ^gFU&a"}9LH}?T[ڥt U_M)l. 㚣0*®SvlU٩Lm]*iRrC UٱWf]v4']Q(RJNv4*a8Ļ͈C6L v7 ] 08dqe))زɅ]civ<\o|'cy8U&+bSG9nڴF i o´=T !~9<3NRak1\<qe2,R/}Y#V]$Ҝoُ0t\=[5{NLG9kr7ߋv< Doo%sCUŮx[Ҍ\a5As3q-P'شg|H{!6cx[L\U,Ev^*f81]\/usSck, R찵ZjS N*SX J|ʘ$ ~6bq֝cė3GQchlp,Wn[pqq;J[ WրQ\%}aLp24ˋI-_8K r.Rn~8ӔH P-pnƜXG+gӖLsbݗVbxT_Ndņ,pOrv[f-vdQx.'nNMi*jW;(p+cI&\RGVTU~lUٱWf]vv&&SH3 [Uz0aJ*mu _IEw }8hc]S,h=WG\[lUvo+4*qVB61Zc wGnp="qJl특^ءu;r'*x VZ߬W/O<=(8_ol*|,Sr*$/ʼEqVsSK+r(vIZ.t}2lxhF*]邐`0dze;aZe. ֛x=^cJSi`aH 2G)C<ڒ@4UA+#&[ԑIO@m)tڃƧj񹶬/J(%\@*BFZ VY D|J>ڟ_NOd*W>O[ϖ1UgoEпN)UXR2]E)ETӡkW_GqBJS׺b[?Y_G9U*Ji_,aY$dD?cc[ #O vY'wc (j 82$w6kBG[| MgeDcqW_͍nq#(Ow (uI?1VWnpVNF<,O5)(*JjmE ̰dn?i4qcv8[wI(&ӳ28F{`Z@YUDW zpN[re~? ;D!?n#O_|U3Fz u}ĭeVOS?p9¾Je34J#5ې@pO U⽎h4ec儚du:|_ҝ~cbf2RT>w]b wpaN/NcKl&ĭ|׿$= ѡh'q+'qಔ2JG6uOoE\EE)PzQ+p2/"qV۱)n:c ޜ~*Q~.@8rCeo\]@2s"; "{zSq?􊸊}fpKKfqOK^;79$녹+bUWX?۷N⪌ wժ שszNZw Q{beT]=~ ~]De]IFsm]ӿch#rP'5&*OQwFz~ 5Z<2H&faȧ5cJǯNZ4*eb ~m~uwٿ^*>R.νP,}U2iVVe  )?O7PFՌQIJksPTۏ]cWW8$|>l-X9U]Z,}@O>Āmg'Znn<#vcp5޵8X Z})ip+g}^a1r"fS V[ju_ՌR6WSJ#?k*s#2IHւU=V9_sVJnzBȢ;!zk0WPPXB6zzy:tҗ#OWROQ#sfE p[:mY1Vc R!S-#/WTٿ-.\)N&h71dt,#DwY147Io1Ԛc}xQ>BsT~u->ZTx/mJq&.$Li|`K޽ i\n88Ӳ1%kM4DL~G}oqkP#y KOJiae_G4'窵r+Yݏ./m4)'c##*Tڇ/ˎ+`L3( M4!;t%RIg2*5Bx$0;}uo'BD/,G$.ƽGqO)\,t_ dmR"}O#r(_9SQ;!i*Oz~ˎ֠Q6|Gk^2J=coo @fX_*L/ E%am+!)B057#&+bd(+pqN[@TjBE PB:CGQTOj[ 0C/k7L AvnB5).+LV T;6ثb9~ᐓG听ثb͊6*ثb͊6**6*ثb͊6*ثb.2Q':>\vlUtf** ]1]VlUث Ut]SvlUٰ(v^51Wf]\ث銻+ ]vl ثk6v^*.͊,bfVj*o6vX8i+r!bI(VG1B8%&8R4ǞUL|&ʘxJ1U&L1U[6ث\9S]Bv qaJʣ}*"!r/篳<_! d9%ٱWf]v9G"*<ݕr p>.G;8"(v])va;6, cŻFm`XY,ݏe-WcL;9AWv!?SCaQGVn;8ホ ,}Mʳf*n`k3[\wŋ K7Xo^EiD큧QWZU>nd[u1EхLr{䩲xWcL04A#4 c4!Z7RrYC38gΧ|PԮy/%7Qq*}ҘQxɱ-tun'M a?&ޘɺՐ☓l헧%Sk/C灆 Mh1S؜mx .|pe].]]*R쮸PUXbƓ]8-(*il i8UqWe ]q i‡c .Ɯ)v4*Uٍp+8q!] +6ƕز#vv8v)gv ?l8cg'&;}7OvQHT6S#?8?0xH71;%"GO:dF.[) Գ}~U[hi`<>xTR}#:uSp_|/z=2H0bF(7H l`j ?F@:sGC2snKhZXlZD[Id2W]P2o|>bGm:sbZ%i${j`,r0,KxN f\Uـ]7Z*K*p.LRe{v^1L{N {RJoqi8W+88򌣆_\"~\yXWqqrc雫LK7'ȸ _|eN;"[LqAz orӥNҼmf*W##cs[~8cn!jn F+\ݛ2[F8J 8.:v'ŜHpO溸a'(cx姕`Q_Q~) 7 v-bZR ؃4qediJO۶Ir\N6SHEvdrG7|mSyDMƼx$,%F'x97ll MI%qeN],NIivV Cbʮ;5qWf*]vl!]`Gc$ܱ![&ݡn'`uag |K*㍩QBk\(le*P\qAZ8U}!ؔcpc- [ab{2[*e /M+jМU6qCɲl1Kf?nb ރuq8)[Ɩ1+v,40eÖ* boa Wc$ŇhzqV\IG UY߉-[ lU:bcUJʴbe.ă@q%rlVCYkuqN*v|UQ5E\UW|U`urȯ*sPkljVZ'#nUƳRy\Ul1We08e;W+* Ali8#~hzW1U.h-6*ثb͊:^U$c:p :b;aB׮1 ()]+OӰ8XF=Zt*nG|D@;JSuZj T2bUp!LS[l1b}=18}jWSzwWۗQVA)cp_"$!Zq*>dyH,q ,UTgZ)^ܵkW.bbdSN2W<8] +ҽv=,H=1vK4cJ^;JvJ- YtVMŐnR3m%kP1KZ Ǹu8)N孲r+?o0Ҵid;-}q*SHnI8?գd'ZHg&TUL|d r\|Qՠ>_g◎HCX9%WUP iK)v6O2%7Ofb~W#ҐCcVHNz}4O4rVeX- Gj8>o;BК.ܿdX};xb2\T5&.ˍq_;WVd_}QO1&r$Z#X|\FǚF)orFowҤQ_eXmZ*)ğfCNkԄ*CBMWw͉I\NPV.D7æIGFᰧUX"oB*}VO_+t1 H?u4߳W׳~ d$p:8#}U)cc.ڢ;w{ BDK~$J–ECS+!$_Ėu212|nPjҵ(7SfJ 4}qVuL}k'$O*ǦRVG߳2]_aYZx‰TGQ?*G ~7p7Z1U׸[HӪJ_WWoV& zjhMOwr-Y)WNͰҴ=ZNzq$DQe^ )@wT CWrhOۉ<~kC8KMF`ݿiT~_-uvԭ*CV>#@£ekWR7R+5,'B¿c+C ȳznB]JO"Ҝ^ r_U(+"9i{s'#O~cpHZɧҭw߱|ܫ?jĕ )o$5ZADW@$DQdSJ>cn!sXrƏ%ozqgX"LobTkC(BޠrWG/'oޭRxbDEqnA/'EJHi4.oտo*TO|[u/.s G'-U]'E?ݰ\~Ff߄R7dƱdڧKQYJ0:in3ٔf<RLVS`x0?8m*GPO| v>7r?+{T t^\m^=Y:ޭl:#+WeA겭:f_b?+¿H1F&c9O?GHÒJ!4}#KyBDW$.X\;N-nRw^O66ܵ>,RI 'Xƿ5p)&,1Qo^_ !pta{e0 «!)X~/0ф#zmClʂ $vB?A+L zT?˾)zm۪G#ےƟg5kHPkס[&+ե) I@Axٕ7qcĶ( RJ/O"Hi-w7k2PSxhP2?bbK*mg֌> ЄEc;?%2D6$vh|m4$S^ ,P*~d2aRB3PSW,_v;oIP(O{hH7ʉgSm^0 4S10m#HE\m"|(' WE4s?=j&)3h rZP$$c_VQ)yrR*݆XJ0؂2)uaPA#$v$M hp*0*׾,egF?"9Cbup͊ (l evlPjb[–`VaVlRyɉD}9 أ3b͊6*ثb͊6*ث*6*ثb͊6*ثb/.2Q':8s$l إXUcv^;6*]LU\NlUٱVb͊/vlUٱWf]1Wf]]vlY;/vlX6*LRsSk51WeWf](vlUi9xYxٰevXDw]be╃sc**VXN=FZQ TXEs5xr((Sco HNRU(T *q#lUmCt|IP6@ j"{ZGzM/(iC;VB2Wf]vlUؼPKpg qK. IG)32/Z5鋮o-h7KN+TKؤVJ6^R2t㘴o ۦfH?Y~2a+l<韥p\um~_KP;+~ ~% s'fblyɩRKҐKwDBWؽ }F ~xL* ! 1uh[;Ȕbe?nzTdB4ǎ&֏Z氘TIZ|]4Ŝr/KmLN5k;^mkЕ>om 'e6N퍾)D Yg6;(4ZR9`aT[mؖpbr}05irJ/Is 1@> g함yB)큎p^` `+U ޶0m]]b#$͊]LUf]vlUqK+bƓ]N*i8+WeqC0!DWck(C ]',U٩\Ut]xbv_۱®\wشj\Uز We,bt]\1)O%& ,ܸ1Jو14;&l>>zo))r4l%$j/ov!//\nAkI ta_:Qㅸ~HiEӥp =g?c]{l  UW>ZdnqpDE%_Il7n\%?ԽmNXez}2bowA͸_2<{x\hj>- `hx(}jC ,ޙsPp9xIl_DE%r~P" vdzuaZF69Ѹ?v- k.J=X>< zs (ŞW|2Ԅ}F\5>N/NqQqSjrZ>&+q"Jn8ǔLpn_)- \ZVxզ%kvОՋ9-Ӗ֟{bٓ(+O>9=9vYc0}Nf\kGv9G@ع2㴝$BŶHh6XvlUx^*V)vX8ٱC늻6)vjPu6i->2MceC;23E*1IV- /*ј}8<+lFѡx q{paZnWҗfp902s^6透f?d%,25&Kb4#zamɌdGjbPu8 Y=3[FA۶ɇ#QS]ȝ:vq#IaTP_V-U 38}_v F^Lq\sٵMqa6Б'/ ƜLhxGT6p?EWuh`?Wm]7N.Og2<25M\52S$1 *vypv ρ.ĘK죁]6*ثb͊/ 5hpv yK%HgcuG%vSY*qSN&bf5=lc4↎SFƓC](:`K>HpUt­P85S\2"yus|@e\UbQ`B$ҽ|2 R–yS|z=Uc)SҹeJJ)LqUܹuqԭ;*iU{o Q\<)ozerYqWTTq I'oFBj|ҀZ)dV)p*Ѷ7zx  u)YJN}(Cя2 ؃(TSb@pڃ&ʸ*`)b&*rۓ.Nj.XB۱T*],1WWGaL*,CKh1TšZf%+Jmp0Tv8KJbRkSiƦ:ƘiTVY+/ae'HWW?}<ЯolnJZzsRCq_%܎j)jH\(ԝ().7GhSl喛Pf^ :؟a'7|8hޱŸ,J RPDK7*b*k ?i6a@ ){![b/W9F u 2B0^_+`}EU :0؏|瘋rm%x쵥~1+we|/?ȭ9U l򪴖'kQHoG;?sXUsi@N[aWz}ܮ`6ۣixD}h?Sf찏%qF7AoH=~Gl `N6b1+q,sYM?o**7qF+ 3lTG?G]OfIa:q~}~__Z*;)X*?n\++1Vm%+LnJѶo-^&T?SEw׊̼OZZ8_da]aVn4~F~ģ|vqf707~5?[A˙qNk9'ޝ|1"܀GtRjǚU?SxӅvڽ/a?­Ҵm^Vjlz_ZV߸J]7 UWcޮuVW!' `qlGc%{.#R6Bەu?%l8%X۝uqO/%h:\I9oT|.~_>!ezi MP1bInUfaec Uqc9ec61k&5 o_kJ>/9uC\ƴJ2e\@#-5ݺj%o?k=D䢖kբo?W8Ww(~8'ZjN:_pCo3VIxMu Q)V>ԣ/U#ِ+}y{Sf8-ZS2aCRU?gil*nF$)!GqUǨ߱~>qJIb W~%®rFxy}oT87j7I K_YZ8ҔZ#@+w_+7t9lbxB$+_ Jz:K\4F>%2w#tSC)'l%:#~~^Wx-?e­G PVr?N_/R|_U0O_Qr?﹇ؓIh 1Di"%*Odep+T #40O+Rz}$xDW%Ox}W'|*VH3(Jڄ9.ޜ줇m>m/ԸtV)+R(_[j%XopNEc,* CO}ꠑv*O*/|k(]?/Lbj8rȾ 8ds"~oh.,:˝J.SayّC |8DkW*O 4|kOk)D؟"x:/h4 fo?dY? a wj~'x]scGۻ/ aU&AU5V_nFxO꘢a('6A 4uWあ)\R죊 %F(hebC]\Kl \T:chgϿ<_ Q?hF]vlUٱWf]vlUٱWg*6*ثb͊6*ثb/.0i ':=rH ثbLUـ]Z͊CYKb͊6*͊6*ثbqVbe0+Yxbͅ.͊vlRثbjbl*/hN^*xUcV51WW6*o( PpVr▎1B9pĎث*CEVclpO.UiQ8R( LgF@Sz%v'.C0;G6*ث~+wۘpu98X-ރb X\ġ n]F+TR8˰^iG`mkNaPr# %H5Vݾ\S~z?SW>E 'vV)e-8 N>m^sL]@Pc뇦]᾵l{Թ Ŀ?S)ݎA{ xo)|?bzKsnz8qc@Æ3QЛt4`-:~9}Kfgz&$D%/-~ Y͎=}ZR# St h}?\v%ۗoqhox8IZ~.6p0#[s|Cno\6\,2mhm"a,e`e"xɴN^%S녜}׏j`cslbɾN@m=@ߥpK;;ʼ]8ѮӅ8٩(]' ]\*͊186*죊qK+*a8qWec]mى(v`qb죅6i]\Pi8Ӆ6vjCU|𢝖Zv`r,VbKnO|Cl-QtAƃnL *Lyϼ|'Nh<}B49nvȽTlmB04q덲xjѨD i)XkOS |ZϓE{t# fK.psm/brWOLVXR}Hvo!G~b1\3SG7pˋ6ŧ6#GLov0[q (,j2oصKlCԃfŔ2 v8 4oqiǔ4ءIՃ[2b#op懧ūYc4 Tr9ų`m#mtos7>5?(%KqW/G$O [ Faq')n'.<2Kb[A׸[LqC+Yq\Ӝ|^8OL݁KF؃S.]>}4ֶu6eXpGz%|j#9Kqaؾl8O &["Q.;K#0٥:N?FFW{Fa"d,2l xjK^ 7,Grv/Z`Z};_83MKLlԨ㬒!(7L;inb/%p؋I]K(vUp!XٱWf]vlUٱWf]v^!].lv-n<1tr֝.ˠZ$N610[nqVNbk5Eث`V_سUjkU$nzJYX }ث\`n;VPvWl*[=qWb,MLUvn'ZyPqVM(إ2ư{`CcR8إ8]BaK1Cžm\$ "E..~X,d]6`Mժ=2NF*9 Nǒm] sNv;إ/8~"kОf'Z\يu/M]Arޏn{eEI'\z~8 wőzEM/?. :vFp܅#N2/?GLmvSQ&˸aؽ:@xcr=E-uad-r*̒H EI?<UP OCՐ[w.\wO~(8q$}ҟv;^fNqob^9r)kI_ʁ>̃9ya<”ۧhvxvhݩ|rHi_Nm"!E̖d>gXƿOcpҢ]%+o5~uv4ԕr&?߉O?eƕ֞OLwZq1?X:y+}Oǚ#>x.W'wZcU':ĿVGcሟ( ף'\ F($+ȅ#ث \q仩덎sˈSkO#_һ]"$5Vj6kn_ʵ$~8ʢJ?w/ʿ̛r`z=JJB:5?U2X 0hq췷/y+ջrؖʴ eol#tSmăĶ ~OK|GCZWxQI?sp4I+J ğ(?#JZ<|0?(~Ϊ^ݛ㏣Dݙ[E]hzReQmO7|KCIՠw4>̂h&Znݗ+a殠=,/$#?hN94Xf=(P+|/,Uu,sI)co|F}=|o Pn"Bxo+ ԀGC9c)8Q|?$OؗIg8m3c1 o,=i]RUOQ# $x%DБUa/%ϪfOݬm/MwSPF< FAoGd?VkTtKUYҢx:_t!k~*5uSv,պoo+cCOqLMDZȫ[y{8?rpҴniĠJ5{ݷtUm1ڿOVI?IF(3?cgjrK\TMnaL;vrka oTnYxkU>Vy#۸+‘Ut*l/ ~G7XW&6%7O\XU"Eqn>݃2+=zfI[~rEqj|~k01:̕JxN?UGLWn0BzqI&ߏʏ>hhiN>ט^$ Ԉo?c5Z'9 4,yBTF~.'?^8vޔ5،2V%?!=` x*ko 9MWS]~o ~?2id_b;`ᭉv7AE[.k//ygDM(ncҵU=@?mGjrA݋TS-&-٥Ivi>#BmfO N[_YCZԓET?%oePo|L}E,zUe޸[XPW&_io9;+%̰94`TO??M&d% m[ԓ -" x/?́##H6*ǡvQ;ad"Ů;b\ծ E6ɱM1b\U-eS ͊+vlU͊iZ9+G吜Wf]vlUٱWf]vlU*6*ثb͊6*ثb/.2Q搲se̐Wf]]v^;6*͊LRثb͊6*b͊6*ثb͊YcvjbWf]vlPثbf]1VlP6*챊sb8Ŕ eUG  0%qVQ8lU;1U)ZqbEBva1nѱ.Ca~?6vedF-:\ᗤڸ?.kv-^M%[G燇11Kέvpz8걁S鱅潲NNvQ®8U®͑C`Wf]vjbƜR죁]8p+e6! 5F*CeN)v6K]ʮ*콱Wfv]1K=C+q;Wbperz]%oPblg^`6_逖0^-a*?:5d0EjEDy՚}"֍E@[< |#Mn;(n 4?*6|f5۟j]=3cBgobP0$׾Aߚ%1gı\\a;zr `S%仡a6>2;-,8v7|u0۶,!d\5s|q\#qu+7Q a8lwLF=`høZzn<1g>8$Iҗc,yD,AlTbBXNb#Z7'WoMbjNd!هQa.Z#*1^Y-?[NLF-zx8 ŲoO5l }KG)2 N*yxGS<Kx?T~~;8hs?Wp02=:b\ɼaK-㴚AtWS-xpgsbWntzAvFoً5VՑn6#5Z`b1qeP㗊.xVv+NbjbЊxYghYWև$8s-Y=e 68`ټ0"X?ҭjp1c wni{-y1f}F^#lmCwn6=pBgþ>SՇXGr7'*3}"yD]_ s=GND6hJ~8X׃[} φ W_Zߧqn\ ()\zWqZ`Dח (*a5AqddH`kGi.v<)4>:j-5_G~~_.Qd~gw2mYQfNzLL v"ρjnEN(vVvlUٱWf]vlUٱWf]1WebTIt}6kba鋠+qUZư ] KbV߮*P*LJVS^dt.&IaPzVTUGS jbf \U؉~? Uv=Iq@@*blqK)FtM|s^ oE\F:nYj >-DZ‡b7N9QCk[E]O~!-ǫ1䣎]R{qWe]veeWc v+^G \]k 1K\qE;S #()v1銸k)~=6Z8>젤b8bf*v7Xqc*P⮭1 qWbMo1VT트c*U1VךޥkK p?3/͊6*ثbι?偘c1i -PӒztң %q0!pI7­ ֣dLiW{,WnGj9jAif +LiZ*xǰ\ \h1W;WǶ,aJ l׍X451UTQ9x1 m\Wc$Ȭ Q+^5n~!-ʉByyW,V@|oTϾ(D&`UU8(-Wr";qVqB*ςQ) ,ŊTUXdR ZTO kX)jpH^X7fSm.ho\4hNƧK\Y,IlJm*AZW 'IjK& B" ص3'+ZtiO&C2[VDIo1?!#~Od~?g6|VEN$[ X'iJԧHcҭ<%V6EU 4eyFҟb T-7Zd4o­@W!⇚ U7cځoC8(ɩ8" t|񷒘3Frz *`C~*V0qQn 8n?[^So.u4xϿe-j(|o8xPK9؎J> [Hi_'IR7m[cRCͫqfPkl~v#˞h`o_[hޮ|)#v +,oĮ1"_[ o#ul?=q/W|v9DHL=K N{7W:dTX;#oSooqW "Xq}+~1[ Rn<2/,G!?eiܮ;}8e#F11=jvchDm?8FZ^wYGw LQciRl*xo[*v=|sG@+gOo$%e?~xo.?Uw(b]%`j+2ֿ?t<227 ZX?p~ UqĨ4cX'TG[bK5}__X~v=='xfƎFOGFض*]\q#XgcWTAqI-!ABz,_L?zMWc^I]j3'$2N9ĉ#93R3o-qW|8YuB@_VUa[VO{e$DƟ.-Gֽ~(؝e'4Xz}v?_ SZ#82E;pr"'r<ؾjt<UR4ӈw/p+g'q)HTkse%]ʧn(ay-Eb G/F`~jr?gػD1Yv`6mpyǥC -bŢc]W?Rc]zpg{{HI++L>_;w_VoQۂ$^yq؁T?p*"&KYODǷOO[b*ez_SmC7, hzn?FfA?g_XڸJ8.SF9KO"?yOczf%D~[B6<)H`RxqOڏoy>/qՒ)Jc'*$8uۯ˷%c c$S&E-?ljmc9ۯ:Yd]-ʨa_&BP_-r$P0bOe?8S\})ӯ_a_ߣ!@>Hk1C!$1"ݲȫ9Q(/]` ESp *(l*=`=3Ŕ|;~ VH5Jj=::?ڡ~)ZdTa6'DJͳ:ٓ#TUh |BxPH?FB#Rq0 Q,,wr% @Y)-TS( U<0p4o.jxRث PrM;5+f*]>2AEY}9 أ3b͊6*ثb͊6*ث*6*ثb͊6*ثb/.2Q搲se̐`bLUx UusUٱVb#o(b˦*]k6* +KaWS/lP-f]bLU٩6*ثjbW/;0.˦*]k6*Z9k6*]pZ9c ZV;6)uqUiǁ*ӊ.XT8 UQTb'1bs)\9GZLyULаNY-.⫘fbq99 e*zR%W6k"v~8ًqz'<\blUxffRҊH9sJ%oY?WfO.F_\KqՉ.Q@~Dc0p yql-zb%n|mC v c'.}?L¹fSPVy4wԭn&[|WW "Qdw8vaҵd61!CZm76#M(y`cϥ.Љkw@}. ;6 q7# ]R죊0ufvl ثbƜ v4]'v0)v0 mUŋ|0;)qZv4 il'er'vlUDXٺ͊1We v=v‚T UqWbH-2%k6K8 ;bT!UK¹t 8YۂG@YQ.O/2vQT6R?l S). w @?\4]K)TS7wlO^ 744ȠQROZzYI;uȱd踥+2f,C$|tʷtp3䴎umu8q[{Ÿ ;qbD} [eT97Ze[ŨAH oN LR"Ӌ/Mfa5\)Rlck%Z5|8DhqKՋɋAt~Q7ͪS!qfV#UŎLF˽rV9׎-2 -qh%nh~Fq˴4# [JnCi5iʸn8 ^1 &CUū&qɾUܤױŶFA?lJX^/Ǟ3۫QCyGx[wB&Ldr=1J* L$q}.`LYO YKNYGp>/A1SlbFtǜNct\R;$gY;1%qm9%qgIև[aQ8W1M`jǟ&\:R-P>m7|TvlUcvX'b@wpTb$3q)XGŴ{LIZK6qjMb[-l{[eQJڒ0*Hlfbl:`ފk6+K36 rkud~#UK^ȗc?b06C.R:bJY8&?<:} d(/CN2,F,qHp;^/jקcKJ{PD]~83]o#`x{70S AՒ!q/=GZHd*mqnv5eV|ED睤rDL חFq1;-)Gs)%?_I\q ˱fwʕPtWm-4OdĻk/qI-ON)\ ч:|h'gwxh?f@>Ө؂2Jz DpHLYlХ~(z%݋VkN㊺1% @%u<طaq!4ui%*slW?V(V'%-a!ZL~ ?vKB~|rQ(^U5u_? Ԑ:}#A%RߠqR*ĸk VBv?e=-1ۉ_Ň2q\<0qIrcIїy_j?Ipޥ~Iy[dr0?(??Ivc}5kMu~' IC=V;`fl?e wnwVQK~HWk]ӱu=6]dUӡ]wxLJrJӻ&x}ʵ~7ఃV8=Gӆ#J7oeU?a/J/$qhCqY]QJxz1p9^7B4E N#!d|1p)o0rT{Q}׊JF_y6݇6\}%9v i>īD"UjJw_9QLy!%Ҏ2} ݓlv?de )D,s__KH:אb(YjѲŊKu݊ G#_^0ZI@HIoǣ3R6hgj(8Y:A;ՏӕJ$9'A,dP$xdkޢAFA5%|XGz½p53~U^ ۵<1HQY{׳|oXHɓNdc+-:vq\_sb?U6S߼m2@1T[V߳*I!*9Œ: Z^'o T|PE 8NoqKżˊ;u–jbZWc[DbcϿ<_ Q?hF]vlUٱWf]vlUٱWg*6*ثb͊6*ثb/.2Q搲se̐cv^(vlUـZ9c͊0]6*urWW/vc\rV[͊]]p+^*a^*]\إ͊WW6(vlUٱWfœ+*ͅ W/Ú]͊jZT[SusSaU+(RlQ0*8UM< UDui 98֧,|Uͱ8oZ|qUI#ZLzU'ʑ1UХ qb^D*-SC\P,S-0! '\5/UYwcKËȳbTngJbA+La}pm(a"3hXmn~<_Ktm?]0Xυ9Eo! H#za(ͷXݔ'`lr%۠Zy7˻q"qm9Gj 11Q5I# fp_KGl֋k. K7m:|,A:l:s Q׀{ rV%wQ`Mbj1EvPIѺ ,Q(?TZգ?/cB8)nItVƇ ?]MO+i: tǜ)i]piWpǂf㰮#  3%åqmI Le]0>!~wnȻN)~-2Ï8u}~/@??\~9Qr;F,`Lf%0ٱid;-K/&KC|Re+28dK2zM`MNҔѾ/ +/r\\FKvQRi[ŋvl 죊qWcHӊb]'.`HvQ8UUDʯ*eW*be͊(vX8bY.Œ@zW`l(ve"$4W&D)צK8GLrظ5Ym`eNlAL=XX 3'W/Kx, hOwb'J#e+~u l7WfI p6Զ@14f0Ȁ͐J` =xxbn9.G v~ DQRZcoX,&kQ";r`4=;Տ1|._;عU c_i1d%WVѨ<1jXN ǩ ŲXM㔗ߋe;518[ǃ|!7ffTصD mUǭɇq88è#cd;YTnǨڥI`1Z 90PZI.しsl8㉒HqEW3ڥF.َ6y}998{ Ԅz0WW::aL2f)'JxbՏ7_K."hlS?K%z0h#0kvܱۯ<,߯%A6acix Mt\,yN2z;dcnQŲ9#plF9ӜV#<(Ռ_Y7dH9tx`"n 6$ -q݆8ceUٱWf]vlUٱWf]vlUٱWf]vl*2 Y=vk/4e%z4zEx0WZ7\ lc?t=S«ISB3vqUЌ*㘯SZ[lcW[o,q O|xݏ׮po*f zV.,iY A]+ I}-j N@=1U[iA8)2 KQr`!zTW9SJ--n?:aYf\BCL(UAe8P1 6ya+{bqZ%xอ* 0Tz  JJ9%Ej{`;]FqcqjCuS TCT€OweY%P7wB-jۭDkӎ63D  u ɯp],lDMi`2*:wzfCYJ0*O.1V6[9vl~-T̬6/XlW dyGiӐ8 CP&_&;TxǂЪcM_,uϯ*FW>'\~>@ڧ85ab\+ 3?Wj+Ӗ4عDH&OeA5n5?Sxp'fUFUS?ARH-j[pc3#_YGp9|-\v[{ȗV,#'A6_ ?\[rA+Nfls)|?X}GVxxƻnOv~>u [ٜЭH(%C\l{[3ᝌѻ퐾 }Cz7g=@e_dzw'>EgoN]W2^Nݛ)U,oU_ǚ^47Ws-HOkzqY "I{IN?W|8÷׆5RoAqj ~6/CLһ⁓0Z#JVʸӾT!naXnQN]F=oP+찧Tk?+BʈH& ?iQp%s_AƙT 2Yj6?-櫀$IOq8)~Ӊlu;K(ۄ&[ޭm~{v=&Dl-wp|Wn*U D7lÏR 3S#90{MԃUGX E Lkf%y?:9ĨeQXFO?JiѼ|qEW OjaQJ9Ph2Sq__OQ˚cUrjmߵ< AC'_m m?.)vRꪳ"=ypg?7QNi\g(atXjx:_Uwv8"4JϱMCe?mF 6V\Љ`#FEb<~]eP{58;|%[ܭZ~xǟUYRd` iZmFu8kIZ؃m+sweVhHuE+_>U2*aZ2uxX˧on㌖E̢N!|>?1;%*h:wUsrfbBUWǎVM]~R6p:z2UMҝpMQTr%_U s #j}I8 >vCl7}GqTsɽO&*4YM8?$OrIj"k$~I?K d$9X,ڒGߗO!=¼뱩 zшuZ=(Mʡ*ꌰp.#qU2+&QP#,+ZTA+m[0i_qZ xӋ?O!5YWecOV[U'>.,~~Y}*/F*=6*늵b9lf](Uȿx 1(~Y Ѝ͊6*ثb͊6*ثb*6*ثb͊6*ثb/.2Q搲seWf]]v^*ث*RءٱWf] Ź];6*^)q˦*lUن*PlRثbf(vjbL)vlUx`VX­ Uنk6v]0+/v^-lURcBܺ`Vf Z'ZN9qUUTˊTc8U4EpqԮc*1Ulm+J8S W78,*٩*`Bb$¡a}$8zۙqz0F]YfUݐ|!!{/w F}_4u'.Өo\# ʜ}j8I@q,C~u77)9߽%G3Xۦ[qq_voMoc(z':|&#ǷՏM,ց&|C a>ctff I;?#?G`,qĴrЙS^O/Gػ#kqCqk|ų5H7 §>^}dw\SB3L9s)oṊ=?G\$5<o8Dxc޸+Z~bw\e& t|9m򩳜H7Bk)uU"w۱:clen83\`e济K\VhdJ3VX8eۑw~ڊ, fj~eSf5/Nmk.S\Sr:51rF#AB.ţS闫+LVݰ~lGv_b,WkZGb¼\CֹQyOA\[Ջ\lUٱWeu2IvlPbbUٲ(v4eUp%qWbm\a].'\ ʮWe];50"ݛf'|V٫z;,*] ˰E]\1w8BNi{K"7~Ikb,ڇH2ʈMQXg)ORir!˓~ OF~rqD˞ؔMO#i;[act`|1D2ۦSڷ H8ǓxRydzwŲXX`X{w# R[8*[qp}{\CXاYқ 12p8sCQXymGs~ Nٽ)Gp4g<|Mhwpɇnؤq̾{ Lp3Gu?$`?v>[dٻ ͼ~`{y".G8z\bMܩ!@; \|yN"WKnԋ"xQ׆3*:bX#)%OۚŔתKAe| 0FH|E1$j}{x(S,q.;Kϥ(f82qqg<1N\5'.V})8D3h;V[C,osj#Մ񌃊.;c )Ǜi6z|W,| ;q+-`q=XKcmɋQ 9$_](?Raf:cvlZ0ep6˷ 1;)۱גd N63?[``d}8K u+ ej8 g}mV&1KqjǗ|tRhÉezaVr«qF8R$ tsmv8(hUbf)p8UulUj[|U}0}0bo]F*5S[X NZAur#uqi*ᖣ[͵qV\y_ƿ*4A Wf]vlU|i[O9`fަ?$ <-H/rzt[FЏ\ ݲqV) qC,6łr߱*R؞aV=q5 늪bȨQZ4؜Ӯ(ht;▸Ӕ ⊢,J3 +@S|)\ME+)*7?mH獕=X3SBތ*?1 Gu匓ep=պ`i[ #VŊ3Z,-l)50TVcP{" -0dOnqT ܓEKaqmhJX_urc1U8)PO6o s2\7 n#7#,He WȊ7MGp<~!FHlrXq&8MxH) $AG@SmŷU_ \C: c##B_gvdKwdcVnO8I3Q'|`H>O5©Rh*B>Gh=Dvr%.WbCmIgF?`G#L4c^r~۵G xîJMkq]N( %+ &G%]@J|?p_'_diw{H۽.#k[D~h˞pMW@~ٸ#LJ]dڝ6z*ǯx>}+=fWP%M46>6+q6Wq 2A\ >æ$+`Z]b1oV9nZO$+Aaxy %~YPfQաJUGzc7,Ј>ޔ?w wUu:'LfʴSq1|=7'୊ץ8+;E0H]^_*;5ՑHT R6 W}[+ӱ."qp=J!'Mލ/w|,g4ILWNUٱWf]i׫:z7_U/q)ӐRZ4jroS,?تu.i#- SP@D@Cum?o.?اC٣f̋[MxT>jg/cT]$|t4?ŇĭmK2ȨU__ʟ"uq&z7q!xBEHr?_,Rr;#qIrpʷ,CC8;H<O~#VR2Iج AG(]#zw;ǵR4A ˧n?'rII;fhٸF`\Ǯ:qBڮXmP:$*Uu9,r rzMF#\qvbֱ,$}(>#3Z&>'wBo.3eL֭R8CV?^# n' }ZOU8ıInz`e7ikv}*so3[CQb9`1$$m'F,G5LmkY?Ò s1F՚~c8&(lJ.`)$l e ]_ػ"Fۨ.201ȵjcu㮁fTqNQ@K}۲S?siV~b,q˯e6Әaa>Kuˌ6qx7Zze].xbk}[MCo۵ @e6 р;`aLr١ZVJ(7fӦ 7 Ӂ%z)8қiZM03|9Kkn_?Gl&!4z`Ic{)t`pu/CW1>mb&,!n1c"n?L+WcNRb®8PbƜR c`Kc1`]cC8v4K8ٰ+;1];7 Ѳjg(v-sd"ɱVNF\D* r7`r3%׈uٰp=qv +ᒥSwv S%IöJ|f3V"\>;6ż筭OdȗjlEQ*vCH NS $%6_H\q[ڿ+4RBoZ"t({9#*O: ҈8")P0ac/ɰ<1mݹǺXx|Yx^VO|[MiE+۟NQN?L8N(ɎQuqt_gg3 ?Sbh \wRCԏb,c(ůsL델sU90zؤS-٩2EKs[đz0,'~N--w#[7ql k1Qc/cI`}"X}Pb0oէ\;ظgp`|\;M^2Zzb,2uk9Gx( sFn;o},lzu@c[?q9wK}%})Ge8 1V0T>M ''c|QT8cGfkq`^mDՇ (p=my8c5eɲ;t=Djv8Zⴎ, h?`xѸ ?.\h4sѹn3OQfժ7.9bp51ΗK˳8P3s\i%Ťq`.]1KUz}#-p[CwOL*Տ=}-7]ũOúb6*Ex㠼)ُ8n 1@ T-1g6(pDrgžKZGI${Fŀ2h.^AvŖL68C6 WҟŘ7jax Yp{T7ctd3ze-oarx@~x&h}Xq8 ?4jq;[~]קYk/̴򧅭ے 2699@mIx6-ԦAn9ը;i9#Jva[M~,&ec<_S3 ָ|#?I-#wȀ D}`EֽpۗcP7'327yq'2*$ 7# _/@:xhG(S4ȵa_r;g:; `}Z䞙XٱWf]vlUٱWf]vlUٱWf]vlUؤrSbvI.#8[0L[C*4;u[a8bcr>kM*Ѷ(j*n])lMhV덏cCbҀGqrw+X 4,fWWtl64N``CbU#|Uhb8 U0nL0:C)q8b:dV$Uv[2b\4H^"Ҵ'듥lZpRKm3:bW,VŕvhPǕ8G,MK'{⭌_ U7늺`beC]m]\*Ꭱ=r*ƚU2L*X8ٺlc q,+Dc_Op Lثb͊6*PzY0u[? GħHucԳ \UcQv2֝UP6ۦSZH늯Pz~sL*"M딠tMV5AnL…`1B #(l WPxVpqUfV5+wv8ڃO )\NE72(\7Q)⫚%H=OA\('j }`JsWŪ<7rIM# WCu8yj 5*/%0\P{YVO$ |aA`PbR:-asnA/̌Y!,5L+Va+u0TL3owVxWj>ORGIm$,Y?~.Cz`+m| $%LƳXY0Zp |5\{Q8# u߉{2p_jG7>zv4MǏ877ܶ45}wĢO;Io% 9y+2oѵnbqhA8#׳&}j ;߯_sQkST>!Qk\=r/dvlUٱWe; UbuC4e*ԍׯqwEy7 d+[Y)K"*)D/2 =;f(eseI?eWt8Ehr5l{.Z- ԿJߪȿ%qtTȹ3Z`?;SWq`S-[e}}d%Ll~ C[6\}I} |ʷ#@08K Zq1lKX?O'"M*+;a95+UXb͊6*ثbZXp6߳jWT+MF/? )Y,_3?ʶ+gqVeүP=%?%h +et>׫K?apa c-?4rT׳x&i/vœf^~?oZVt@ECE?Ky*Q۱"L+Ě~8X?whV %qvmH`k:Sҙ?i_~bM+akסK!*Ʀ+*1ٱWf]vlUx~x}V蟪U?rq= ȿht8sI))Qq}[~K!a h2#;$<$m =~Ŀn?Qt;|>yQȭU9Z 6/y~ܭSzF{C¨^\vPE0? +jzZ=sDoOÊhi~elc ɤ&c̿?)lv>;#(0\ u?ϴҭ TZ>NcHHȧv\WxƂ?v 5xm~Ǐ[ÿ‹#*8ztVM0*)vlUٱWf] ]L;R5=D~ũ  ЦÏNƁC>|JaJӵkӿX*#( ٯ[$p[;|Β\\ثbf]/*]vlUٱWf®͊6;6*ثaV*xxG6*xaV^*VvX]UxV0+*Z͊usSusSus *X1VǨT㩊jbp!c6(Rf(FR5R)**[,`U1\4 UuqpU\Ufo50%iB2ʜPKFa ԇz ثIY,k\UBS|Q`{c mTֵsEy0ʔ?^z|OUsy2INad$u9 2=ik2;k? a~z͛xmn}b!diYGG ekVQ61-::Xux~r*9Gzet]V1׭;ch*s_"!ߣS$89mn?v?,KfcOx_^,ǿёp"[ci#ǮQc<OeݾWXP?Im1~l}p'K!+/u٬%m:yp_I&lx@HrQq˿F, qdj`#E~{V/cvK0$W01}.7uzʘYWG"h]6@Gv>Ź<6O=9g`H%6W`Õ4u4 "l.F5!1c[gJN 02~7v6ZZ˰oWM>xӰ'$8 ;b+v RqCdwPG {mZ51(5RH-ʑK6h d[d21kCHP,TVKŏ<:+ȶCCDB]KEjƘa{SɇO7+8#i1' `0r "!r0ϸ8$6v^'nIAl6 qn v?ŷӛn\ n%Ҙ!j\F>{qbٗ(8{K_Nn8clF{Vۡ配2ʸ=X>'Pl'Q/W9,ڠLbvA3}1{F08Kpփ|-q8]=8ǐd35؛%۶.4,Gg`+z ㋓?%jqD&qV-%z|_t˜e3u;Fՠr=sCTxSG 8{^/8~9v}7^ţCbŤ =kc큲xc[d.6)X3),ےN,;Kmf1R?zW..)MxiC㍷B^0,K,R\ pL.T񌣊?R4;ZϷ?N9Ncl~b1iˌn+zے?_rޯ] [3cՄJwr)ǐd* VIԝd qc8P3EK&ҎaGP*^"{9*jp8J݂. [h}Ɏ9.-#I OvH2ONyӱ 6*ثb͊6*ثb͊6*ثbW>x\MPqv/J beiǧMlpfZbzWfkA]aCrPU٧lPdP;⭁n 2nqV ~X>`KǖUfy(ڵL'Ƙںo UԦ ĪᔯN23C.;8NRh54]»bePxӶٗIToWÑ&(+Xq+xLUOaĚJ1P *qMDv튵!]\+!.8;d{b.qVYG,7]RW]Rh\U1V]0ʮ;.\ W cDGQ]\6$_A]ɱ\R_7k<+~g 2T͊6*ثbνߢ67a= ]zfZ;9t 6늭SLԯS*":t)LUu̠*Ӑv\H5AQPW#jSA1@(k` =rnY4b"8I_*קNSxdڭծ˜SlRЩw**Se{58i*ǐ#TbpWOraBmp(2IMf\WVˍ0L.$4"A&+,eCBGӄZA ! z@H}{;;"H!SK/m)5 k7*l]^h>~S$1$'/1_փP|D-v.=AA^\ !ǧ^K#rl9~?NCެm r?CQJňz =Jk OomRհҭOd[PxaLdcOڠ"#(aqU ~|Sq% CO ZmE;25-Z(mp=idƑ.6\+1G'Z=Ipߟeh2~+Ŷu "/VlhmUCl%{ށΟ1Ln\>on ;4K#}s ~G)MA?`WJUq)O8~SQ w87u{uEW:d}vn<1R~╎e-ʛ]b2$׀ 9k>׸^7J ֟d??Wǟ )N!51NY@$&%^VWf]vlUٱWa^F-n߁A=o90obH#\}Nk6K q33AK'Ԋ0LGԮaMu=ƆJ 5>q8ZȟO&?˯h']LjȦv;䡍8m_Vt=I #K T? m{ LH FLo!r䭑SlGCHG&z{ѐ8 U_·vsV$|WcqWf]vlUٱWf]vlUmgzn800=)?a윰UqǨFk"xH؃Gt?'lt bno~ܫ_*70:$_.MvhlTmߨ8&B,?}g^Ch?ip[xEbEk-5qd]Sfx4WULi)%o_ƒ`6<04 dAIaU?S~/ȓJ-z;)& Wf]vlUٱWf]vlUacjMh:t`*_x5 H"i7l[~G[EV S-,ҫ,L">aĮ_4 cci-Ph3Dw(Gu\_A&hݏ/' ~Q?M7i-PEh:F';}Z?Nu>6֏ܮ4X#pN``|OdhΣ'OWok^ a3 EvxV ~ ?i`>jC ZFJscSAJɵTU(:bvlUٱWf]vlUٱWb8 VSPGl*+GG _e'";Ztx`Z)@K1R Y8oVP?$:F :kjjZ?Ж%A~9!| lКo adE\1U6.6%a&0@ש q0:PޟWW~?ocGJ߄O5@ ?8ͿdB;rmDޅe :1ig6Q9sE{ظl=iD̿tbZ0ȲM3ߩ}٫  ZGP*zcO|Uq9dVǪW͍tVղdqȡ4*;b U*sSlUDb(o(VWv^*yᐒ &B2(ثb͊6*ثb͊6**6*ثb͊6*ثb/.Bse̒eaWf[́]vlUٱWf\r*saWW+ur!إLULU]vX\qIL*lU``VLU­f*sSWW50Y1ـ]1VZX\U:DaWe⮮X偊qbIǨlqԮ([\M-3b6<.*͊*Tى޸;bªMb+Ǿm}mUޙV8q>%w0M aAj1!y7)ǻb62oBZߦ*Vw#l Cz{U抋bdd"{j 잿<2Oie$f-Z (r D\ID_,ixMc/#Cu`@LV_[5EJPpi nFMݩO`O(7h{gb1~e%P<,48]V6to+%NUeky>m,Gv6ܛ[8%t]I;d}.eM~d1!'fOBe>xbC藭}=pU HE A3Cܭͪۏc0d>60eؿ"6br2@<ͦɭn^8K8:2[jlpX+;kҠ~9,y;.1،[uf` C!Aտ2F\uPoӥ18t8 /k ۩8 2NzL]SxW큺da~&\JIGԌ6+/خ lË_|?'RqN Xo[#|T~Ǐˆn7˺cx??O!6K> poo%b,'-6#4mcs˰;{-2SQ;P}Ş铆,bk:KUPS`KqK3lP]8ؓUؓo4netǛƖv+5C$<'\[XȭqruX?ص.YPu.eE+ӜbbKG~GMM`l>xQӱZpF2;-m:/FpH8 ;%n6b9W1Xa^L3ƛņl\"@*?ħ+QB."lt{ Yd> 㭮ۏՊqe8l#G,ra1GxܬױŜ2 u)d]a;rhDKEpG~UzVf#*Z.4;tva5S<8~qLTwsIh1pĥKlѥsgF&B9}3o=qqjL]\da5Spoúzb%mXp3NjX31XNw5hR'VNwS^,;*1ZŔWK|צ9'KCDM퉘nKJm6ظEG'.A?&29ٌn*Fg 4@9r,۟,HqC'hnDѸN&8d<1#ѹ/OZLeQ8!/Sg7 ۏ錷}Á^L3\Zy vgN zR9}96qmE818qI 7%cMɡn2mxXc|J{v,hS$qַ%Y$_V>?Ni cӋ|d"RԶ4o؟b(i7أN.@\\88J6?Sq)`BOB哿7Smor<"@IPKPE2Vp8. 6y U[#գ?HG?fqyF1N9Db̘oܛrn"İQ\ @?y RV#*}\r sr(ƭ!m % s;ZLaF_`l:'Fc3T'4cJB2nW))]%҉`;,7??̃Hj~Ŵֳ&*ZnG-x\DossAɇއ($7pq ZMG? O ׹ ӑٻ]qVxNOOq[p6=$?JSU;p$NZ]vlUٱWf]v]qWa^Z?CɃ{ZA] $BTa4 $*ѰٖPK_OP_+Pnd@BpVh|I1[;zȰzikf5z|I_VA,{C(;97BL}@*zl.;!^2($r_xaj)Zl#b *ULn*ثb͊6*ثb͊6*ث *CoZ'_SukO_lX不H6^/>­u& nD`c&6x|zy+7*P7ɩ_Wu1Ug>b*X#hL+~/* ;F#Hܒǩ9^1ٱWf]vlUٱWf]vlUxum.7r P6_\=MאC.PBu? j+&yB΀>̏$aM$qC߷$ǯ wCbp:z24HZٍ&g%F|$\A*há) /5`}e5{|ݣ }vhr̤3dPGU`]Iq˝t<Wn1#=2̒ⴉo|k lv *_m:xem­;m]ZS*ljkm銺mV0 f9Z]7ZQʗfqZui4vQV)We) ᐒ &>VvlUٱWf]vlUٱWf]*6*ثb͊6*ثb/.BT?9\.'1[XbW/vc+vlUٱWf\r(k1—f]lRsSur銺Weh`V͊51We*sblU͊t e.㩊jb0+Yce+`4N:.=qB81U68M< XQb*.|0*e8q *0*wƟ UT QL**׎X;Vn哅ZR364kVcֵVR]aB)Pqp*C^Anh*;bD8\* UY+͹0S}_y&6y~ 1qo!zԚ_ R`aQEZ[S i$KcX\gT3Ck.ʪY?Jx0lN9vU=>t^9;cRt5S"ӄy*_Mv]kkWŷa8ɲ!v5GGbJ+o lρ-KSЛԏ`یZu89X/ضeec n6D񵌿c4itFs1_1[2GyAoFcvT`[A,qe ki:qc<`_*Ԇ&mf0~Xa>_K7 g5<:aqvѡNq~s/VT-gg]\cǹ݉UbVhXilj.˳OJcxvF;q#lڜ<]fQd;mڸ.(L.떼ݑ}m??h:]?^,W ~?k.Ռmd݇L |HGc%wyiբq;Y $׈9(?d6S_߿끙@Gås\!fCTmaNX3L2K?Ȱ2G^/`IF)0`&>;癐w0#Dž;lOMI[g1jOgp)SB(quSyX@ˮ*hqK$op% a®68.WbMv&jwŸs[:(f źXERv-557r078v/uۋ6 a->S{lV3HU]Nf%~',t/OHb6ذe/^;!kw|?}089O?Dϧ`b;y[=&'F;RFH cRЫ}|p3_LJOgv:b'0v~^` Hv<%]i"a;dCz۱q%J^_gt s|[qCހm@:j!P}@wnVGTUȩ)uĦw„$t$U-syZK3̅6* `:ȍ ^ #_U7\a~p[?-.?R<-:q7>8g}Mhy-O X2h-KjVoWҟ(^/L'ѽ曡LN#cp.5_r˼v|~?{ń2 ݔ=rMp8M4gŲ@fm'c#\rpeN8~Q텔ת fIpfqlQprDھظZ");F\t8(MVi!s ( i\dt>aao G qL60M}KS=bP#cWWkO'-v&Ijd_|Z3k-=HObxD?Ҷq.0wŦYǩ^"x΋M+{rnV<RVˆ*[]zR8sV[MG{s[-ꇨ-'r*^xb,zfڊm\O8~9{S`5_lW&? CH$ -s s#| IhP;ͰK*_-F.wMԦؔW/j$_38NjZɀO/W1筧ꋈ櫋)c8P-Y09ޜ $Fa4\Eqg.Շg1o8˶2_~ះ>N+q]ͷMArbT~l|lAp7ƘdŦM}VHRzGyTa88雩][=zj<*?]?&HGvVIXٱWf]vlUٱWf]vlUٱWf]vZM0)ء<1/ T41 b%}*pk(Np4u.+[؛npص9Pq1j*H؎L(jqWcqh-WJU;uPhN59W$7PTm[ж0شkAC cQJu–=V.*YAL2[-kO# 8ЋZ.UeJbSw«NqzUA n0%i4 c_pT;()[/LU(usqWev6>v(E:bh$qZ#vlU{bEuR\P8G*Ǧ(o,be0'q?6ݯc_IWdPvlUٱWf]ɠ*ljg&3_@5h:`7רq4 V*FghFvU/(vVAXP0h*WK$| VH!(;aJnIQ؏lP UJl7 AbOlx8PZ3 [C V`Cuc]jd=rL,~>f27V5ɡGkE2bS"գ&ifyJʝ#J PvYGA5턷 G,IT6 H+#6ƙ5򿐿IՑDBU^Z~ԋyg/: oQC^ OB;_jOَE|Ֆ# EydwL]ѹnufc/??*TQI+v/r2pT5;?,mjc M? kDTn[ RN}v\;9l&o6I+c ䷫&U[C͘)\hBnu>U\C7C o!hQV/9;70dO+iOlwD9MnO_Ókщ4V5Z8 cS4tW5L^\UZp-S&0Mr\^j`j4\Y۴0N?'kEpG;eX*,hʜ[UͿ^Cb7.~9( l6^aջn@mӍ$=8c?SoZ3oOi֟4E~?1+bK-ۤ6 w-/-xb r[mO%1/Q6SG]6')zϴS?;&qqb%X}gVV˗$7^[F16,$Og?Tm#V͏/r]ǑfJMrT]vlUٱWf]vlUٱWe[+|i3?/ʰXo^ILXNtPRĮVCw6a\J<WR \(0I/k߳={Nъɚ܂bl{ī`W2NAE|AjT/LGvlUٱWf]vlUٱWf]vlUٱWa+7 Ɵe,MZVDwIP8?keZ)'Ƥ,!{Y %C2ǒEHQ0pG Ex+_ҹGSJW—rMNVPPcqWf]vlUٱWf]vlUٱWf]v^*+7+ִC/dUMגmw wR?e-kE_ٙ*NŔ|)Y}zOUiO~?z@QCو m [@"~(^6?>GjU;á.J⤁Zd ^kl 6*ثb͊6*ثb͊,bPW ]zk$f9ABj6GTR#(%sa1#3G_!Ho}~,Md*/s㓦VҚ:'VƬP8 ڼ*kG6=btwfO8yQԎ:/G.W1Ot(v^GMEicǁEGk$4&)WM'ߎN<5[oT ߡ߃~r¯Hպ7SlK1>_S0uZƓ,Nʕ>jn;0n͹] >$ ?yZq~T|+8}?v3N4Vl,4Q+d6?#Z\5?#x_cc5lbC韫7H'>X>(M wK@UG1ئIK~ 8P5lol~ YbL?7%d.>'*=~CY?0~,X̜Y, |/NeMPL LU/󝎿EEM> 2MdY"p?^2DŽChSo)G'b0ʥsyw1=Ow,,ꋱ{(u!DmSx1uޘp#O1r6_v>֍g"q0?^?iNm- jτK-O٩ۦ,Dm]רX}8sG˜Sjc(D׏-\DӆY~غ]xƚaKW ak.ƶv0ƶ*H(c]waAH#rR҅fL1;.HkU1GZoL`_\61%#@K<\5+4/"=ͼMժ }M? |O_;⍰~XqHQ;{n=D#q kڄBEQZb۬ e)z]V;5+PGq\v>j_AoLe\>f *Ԩtxi1jqR2李,rDW;؞erGN/}e}녫T8(?9pS<݆F wʽ֡_rl)Sh?ͩj`h;n1-E%f[M:iv@Qen\\S ܕJmǾILS4?>Hcŷ9mJ _|-Q,gMtc G,aۊ n7^2zdZbE%~K^h崝z``do ~8\qň7 Gz:ׁ<95QzQvŦ$;\ZKD_V -(w*bnx..[E_ 1'EB1Ȳ>DZad36KKe'/TVؤk2uF- &8զYGq8 ^K5-,GʴRrd^>Ysg2f'{WkIn>0#E3GlMN`CS +vl ثb͊6*ثb͊6*챶ǵA $\`㊡=LǚuZ0cV]\z˜G3׍*4nDf]$TbBǁ)jWW( \BZ9AqK!®DqWwUJVB2uybCq_cwp!rlP:b0r+UtV:raZ˨qKzҸP8—f|=qVP͊"SǦjhwWW0pDǾ5J8yt] owZ'+7—Wl k[L*ثEr(k6*Ͱ]h bE1Vbʥ,U;|UKR59T|c8KULثb͊6*~PKYɆaj_߱o凛j*I*nzQJM6[7a iV{Jï?!Qhz1U͸B"Mኺ"UkqU?F=(6IUSTI&7hEjp [nM˘*Ywjm6:}*>5bA=Ņ"/o4HyL Z1=gV;zf]d*bYO;[;}OĝVCǼ2P(2?4qj1>p:fDWK(lq̑[jW^_GRzb/_LD0-O ?K7*NLvۯQ>SSC1"6k?kilō>_>i ĚEt?fZu'-0 ۆkurIfKk*ȿY>C,,¼p+\BII,B x՚:tǐPɢI\a$KaZe m@C,3eُ&5=1:oX+_NYުO (XZ{8k=2CnKkHYa'43Eҿ̸96 5 -Aڃ ߍ~#opsBLc5^o"@cMb?<ﱱ?2܋ɕaSJG+b +cXոHi6\#}Eۛ>x28{7ʂ=Ew\@b'fp_Pq?dpVRĠuAU36*ثb͊6*ثb͊6*UkopG2mG[,U8۸qŨFhSl= Q;ױ [ȇj2i1W)Ǩ›RY_M PkL^![͊6*ثb͊6*ثb͊6*ثb͊ mncK4ZJ?j0mTx>R)}WS$\i\>jzaAS+vlUٱWf]vlUٱWf]vlUٱWf]vlUmmpun'?U7J  ,s E?im;sUTSw)U@Ove&Qk*+vlUٱWf]vlUٱWf]vX늻`Y.(CrA-8#TK|*o9?Oco-PqGU<R__c) 'R_hjtqw'ǿߏ-Ѱ`|@#?́&zZ} U#P Gol/?w.G0йGc0BvQ>mA5VHd t=XX#$(z#7jydB͇x`R{UJ`6H7^U6zzeR)o\Umr*[YڸU§15[aZ8v튵\mEk\3u[Wf­W,V3S6O?22RG|nlUٱWf]vlUٱWf]v*6*ثb͊6*ثb?-BsgL˙%#lb+usblU͊6)vlP챊f͊]vlUu͊.UVኴsqZ嚘u͊\ث\pZa\N]1Vb˦*U1Vk.`hbkl*P9t+NX\Uǁ3cVV\RƘa]U6.eZApN>f7 ms2­DW]%)0!l<0aY;bQEhq uU-AL*f\UzuVBw  XmV޹pooO I%͘},@EJPt0f^uC)L`ɏm[ ŘDZogŋUq5Xֳt?8WL 4/i/`QWs wq2#[J ԺuX%)5MKq/:v' }jc3c87L5>I+~8GԐqp9PDV'pZLU(aec.#6t#LNA )צᓱXO>88%_Z떬l 01hty,sCŸ~b잸zHhu3Q]GQR6 1Kuj(2f铺jD.?VGo 4}Pmp0;7jjap$p1vW,*i.8Uc"ƌR]#Il4]\Z<[w { r?i*pg#b62 $q=#uLr/}Zc:ySzdP+N(?WSj#pmN1Պ?_bP i\%~vRj-N(H7J~r{8-bڮO4y o,}A5q\Q{em'®GfTSRL%a_#;Պ?Oq8I|[rBp䴚c աA1YĢ6ҔUNd82u+5CAz텞\|-׶+UZBa7tۮ%lޜgՏ!xdMՅrcTV֝wǤrgqn^Yn2ZDb>Kuzll1/T*7$O'0LIչ&T,&bo)OO׈m9fqYd<uo'GQ9cSc'EJ*g:bn}[ 7@(;eqe '"mgn0q߮.לbxbPEh£ T2&X,`8OAXYGp7r+ {M1Zݹ/pdqo8W 0e3ZM1G%ga69.=qVXE~̸ܽ2jOV]l(ܓY;Q(ndO3FLOmpXOW{.G(vaagv5ů^L6@폹 z}QZ١Yџc(e .&K7;x<ҐxӖ$3sぐf>x\Xa`-}Xvno6*ثb͊6*ثb͊6*ثb͊6*ثb;$⮦7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf].H ]b7vlUٱWf]vlUٱWf]vlUٱWeUآbvi teu"Y);44Ҹߵ7dB࿈$T A 'jv:_KBI;r?xwQX`}g JoEӏiV$e/au 9Ƽ9Gd/F@)T:e^y0"w #x m)ǘ;`CPe{ UCʊ7I[D#l<ި{yZ]{\rq˯Sp<0FlNN4קpb ;c<)‚|1Rj)8}G qQ+013,&&?dp6OY?ěħO\~\Dž/Wf*ֳ˰mӋ ׏'gZ_Jtl¤6d<zӵqq2}^1|C闩EnSyQds[_V7l9`&~z% *n- cuX_3[?4q=Qv3Na[ )֍y.>40.d1?OL3YܷAȏWW`$˺8߉Nb1LweX7#MZϊXJf^wv:W-{,md"5b>4iqeT<,9~$wZE ~uGoV+ ?Tb懁;8U;ŻTMFkyDSv4WcN*0ʩLzx`LG7bΰ֝F.O88BDvRX" fd?ܻ'c(=؛1wDsbEv86x}c?Q\upHLR~8]cX6[iO3 }?EY87bn! -18}T]ԡ !<8}3v: -j{UccoZ="^6"?v:nm:|g OՏf٭laCORGÅTKOhg~ [\8hN ▓F"Gr\Yyz2jF0hS~93򮈓QD_0/>)$hGڴM L(aw Se^D;8i* W#J<`?vz' VA,O"U-\說NGq3$qGkS oP0э68h~7 Ő8@vn.*;<',f'܊OC&.T<:/2lJ_n:380v;YJv}P˴Eq5 Z)a$+?vSꃃˎ'_Ff_hZvKF:v>8H.$AT|2~.MG8@S29*cqe5FUŗKFLU1H=)@g/iqCUʼn!b(W 녷9ŏL^'dzvq3W {tLAًr-xd۞]2I? x}QZ_84w}x +cMbuѨƹb-V[=.D&6LUzbx}3jq9jɃn(H\[#қu¸m/=iL_{S . ㏊U7c0*_W|p<ֿHŢp8`+^-iC?v;LSnX{:=[pm84w8,m铷^2YqiX ;ghRÈd!]f\ (ǚ3]Jn1+ 덵dq *-Sl8 *N`vK7틎c,R wRQ͚kC a^ND?1+Cd-Y0{/r7ct&2shm~hXee;"]@eQh~_|c4½1I I&*A嬋zXRA$ٶaGL Yq wQ&Z-&1?\V.9L(zqG u;iaQZ% b- Zr,gwNn C9~n[|p3Bu)<8d/6Hф8J,& GE_Q6v ´ZGpz7#V9D3L#$RYtzb8K pȾɧKwRՓld@[JN-`&v*S\v"Li]8Te`Wf]vlUٱWf]vlUcv Q&O/]==^4уC#r{ߵ"'?Ͼ5PXҽ>/[u*y/0*w#IUSUUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWe]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]LUXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/v*زbb:^$)rxl8V ?OUӟz#T+Dk ޣ?QprSO]JRvGeۊ||w\:2)_`HӿՖX;&^Jan欳wa+\ҦҿɁr@;WGSd7 ^ 4XB+{.4ǝ8|1{bf㊺cqX5 7ˡլs]JozaW)P*l lU ­W"4_ Qzp.AavlUٱWf]vlUٱWf]*6*ثb͊6*ثb?-B!NΙ2Kr*͊6*ث*ثb[9ck/;6*ث R]] W0Gj*bp-pYtZ97\U]\[\PbeV͊USj`bV*偊Z', Ui8b1U&Ǯتˮ*[\sTcLXw뗊jWeVr]jaJLTaLUI֧ƪb/LɢBXv 2_LUr.qU9c5)ʽr4,\ d(7\)X?Xd 3F_¶sIEAqÂbQ/[ t,Fxso>`ю*w';IC5^pPE`v9tўe+Fzך_9FnzbdL(ҽf%텑ulʧzwƜXcVa\OsjSG#J$rb XHVn-mwE3WAohV~q~\0VCc$ [saKic6xi q֐;~~F&œ2ք܂uW-4Ǜ7Q0M PQ_SůȱER1L-b9ゝ\b5Q(qFxήZQbcch"j=2 c<v7L}Ŏ }thc ll ™]#kIOc, ]A5??:A_W].oMyG1KkݿH[q }H ?ֱ.001}NͦVB֭޴"զ6N?;=lNIߘl`QL /ث7m#؟,v3&i6Sa\hV[aF.Nm;Y/@8bP?8m7Y[?Q~1Q Yw ѬSP/ CoN@$OwR# Zz#bӇ Q^>ڌc;3L&ٷI>+~qP[ Q14W iō7l+N {bp?nWOp688wnTxʍg8}?v%~5"& b%؍9v/z>>\ؼ) v3RJ{r1P⬑/nʿ_ 3Ă}rߍyH~ vki6 }8Gs }3쿅'-U5FH3f闧/j/_}2 r~N_mgqV+.~2VPOΧ fʾ v)p^l-?O雲I0,l|sNgG(;Y>?OL Z\|9}9=*ku&qN9~_-lMd-LѷRKbg_",3J\0q'~xZ"~!*a1L =ԓz;4bt(Z.+.MO=jH_ 1v|ܰ\2bZ:wPsLkCzrqtL08ڵ(Z9d%u4?N27m6Dz]"I-d5K ٕW),_v7C8TK_SXL[]1[=x>t,{q.6t8 ŽnJU!8Mh/̌YO:G 8eͪVK7zX,%i!xG'Ŵ9tʂSnF4d#?ɬ'G)&T\rráŰLe-2If K ݏN-z )=Qo^4C\Z0<'uynbZm",cꃫٱr$)Xih7l܇O4l68߮,c? rD]\<ٷZGs 1202>/Tz9zs:chdT=%p5+C8]$ӘotrO3ěԳjO|,jXN܊Dzx+>}Mn,F ؔa V}-'sja"hb3KSc%Ѷt+>㑍M,aCVC 9|;ǓVS4:uȦ7|ÏV9y,ޛ`w Xp`vJ`KX ثb͊6*ثb]~>5?4 ȗLZǨL)q eZ^]\rЁhs׶*ᔤlUf5v`k(-hp!To0\Uu銷 801'rBƓp/]𡼰V * be8UoƂzaV<튻I:c b#s*Xd4qVUj\b1WcIl1Cc4f5Y;*v88ثc>W*fPQ]b8T,yTU,«rLUh-k|UoU1[PbD/c_KW?3y*]vlUٱWgaormL6/os%:a|)BRr\FF:b jw\=3UzF*=p+CT)b‡8I0Vt5mPGQ ɵLR\Pp+rAZJ3TW*ʧs-AɊ#C8}"~!C%l Oх(id߮!~H? mQQO|+276^H5p`(j'A^IIPu (P@a\ 2G!%>&ѹqI]dAI g\{rKĶ 1vG#qZU/3EhwFx8[27I@1S5O/awXi].8x[Mz+ $+Ai2*V*챊\ Uv(1Waaf? SL8R=3cIP?3^#'"d4YTxE*WџOK p讌hf8ϐ//935:0/.*RL܊T}9zMl1BiA2T64h~ώ3*v< ڝbA\ [9G|*Ɗ⫍2݊݀sS\ZU0`Cxa۲Vt\6ȧ_ RӍXAr QWf]vlUٱWf]vlU*6*ثb͊6*ثb?-B!NΙ2KrlcqWcWf]vV*ثVXZ͊51Wf`VZ'1CYWUna*챊qZ'. R3u eSlRfQ\q1U/-9t]\`K]1KbW, PpqV1UUr銭'.ZwV6:8;hb\ˊ8:j­P˾n Uxn#|5M!pjbTƒXf dy6ƔlEG\P $T{f5V ᖆjm=1|c wuj.`ڴg{kYܻ; nSo|VWwkvq\ד)˚!ql*2(-T(/-ga~-X*VFp-mC#7rF)#`['jXꓚ? Z1H{VF[;Cta_ wm?>Z58)q[żSPOV5#Lx&?/;*UY)Y#4?-2bG=|r i20HпmӈF~O)]dg.%Mc&!;%l$[/NTH\ Nf&N1x]-^ugk;ch˂u/굉ΆbjtՖ']׋%OdTM\=ښnFUS'ZiynGl}z&ZբŁ>.+RH6p e|+%x/}/j 0 ^9N9Ί6?%NZ-16? [6⺊b1|.Vx8mͤ̆z,p@YFE"S߅ xGVN4[l 铲N>IA~dScp$Ow#)Xmf =t-%s 闪-u%Yg^cꀘ;/LJk&|,t; Ig(ٷ ,{ 'kyD7~ X >Wc +]X;2l!xxsY?;+QOQOHj$Hge\!9&wȣ5%ϫvkv `q?v+c0?\=pv]Vjj0./c0?T~ȻiS F'O])Ӯ>*`Xޛ#[[wSFe^^8y;/W$s@"U g'fn#[;,Y?2Z? vإ}~A |xp>cc (>gm">.*(Z^iT֘-hܺɱv;$ 2p䵍9z (YhSܡ:gEAg"MNg]G\"/ ^*c;8Y-@'[0a+?J,-o,0Qv+"3G ,q(C˺ h X(:WL',ӗc2 K7-&2W]\R-źPG~ZFha7p,2q {' 7SQvW~ųӌdQuIVqL(`qDf'7)%׶Uwc{?B9Ec9]=)FdLF*{srlo% &mQGl~j[tŌL1-=H~2b=Qpj˷_Ցc %%.T~cWKFO)MSLEVKW^"ѣZgNO2>c`88эA.@!5\mLG-bz[12XO c@Q5GfŌ1KiXNؔN֬QǮ,cX+wv@z✘AQ\N9/|,qg~1Ie)a1GT؝DxHe/R]pae%{ DK S$&uŤsg06J&S'q[>jCnIPeQJ7J]8pJ~[2kp,p.lSlp xm9*yWlh}9W 03R[4~޴o 3PkO@G'‘1im&qo5[7*OKGJ1.?Rռz팷Bu8-ze7"2J)GX[Ÿ﹎'*0]}9zxe7v;f5qZ8Mw˸SyZȡ`joWsaK}ENY\;Wʇli' ׅ+ʧiQH&);銷R:婡m!Qf;iFT0㺚u•a^д [f$}ƸV~Bx;~Wv!Tw9*RUCN˯†Maz~ ߃Kr$W$#ٶor +vlUٱWf]vlUٱWf]vlUٱWf]H׈&kxa?ε0+eeXI=;u'rⰃ6Xz?<)$G~[+"QZ<r*lUآbr(v*Wbkfy0`5XH‚<`W?e~˧+J@V8NC: i?xWY7ɖ 2,v`َ˔#Ѭ%A7=1TlUqO_l*GߍE0!SM𥿖U66`2 i`Nv#ol*H@Ku;bű ˾"wj};d.9N=uȯ"B /Ng\ ثb͊6*ثb͊6**6*ثb͊6*ثb?-F!NΛL[qVV*ثb͊]v;vlRثG/vlUcvXiZv^*9xU̢vV)q UiZ˦*UY\.l*qءi eK1UK', }1JqaUZN8.*2銵ʹt«IXs lU˅\Nfr:c[|2JLx| w6(ql h>MZ[E8Jϋ](\Wv1W تBF\cBժp8(0WU|/A7S9kv/`U#.}'8Pp8cF;ZFX82ZN[(y-ol'2BYNK{c>Y0\\'آp;ctXJGE&w? ~q 'X'1;bC3y}%Ƭ9b3u'I2lVdZa'S .)ON>R7Ð}Ru{ejEg.uo u1㈘cM.j>[|,q_qxswlaj>YLx!T$i&0%A(j;4F>3{}?u*GLTl g>c-Znd9Iˊ2evڌSqX\2Dms9IF^$x%cx'!$ ;7F_Ձavԓ ra }_kOc-fGlf4֎>2K7? LOKґ#/|f鎳A3CH? <'%hW1Iuo# ur5 2פ \߯1Y5C'#ӧ47̣z`~01۱>xtdȘ>&?縎v mh$6aFL_l#{WjԢ0ʳ'mu1ᐔ~;QLsp9|e2B~i:br9q9VN'_H7큞c,|9YIz|i}@}\0A'.|GA~E9 v'Z4QB}~ zuv^uc&>}ؒnm)Zu,ci[$ tv'm16VŎ~e ~?K0<7`H\WK+$u£̑'bz&70dj\_v/9ޯ= [rlBc7vYU Xqꓱm?aQ>bzdvm J&.,ѝ}?_y'9FMݎ} |.LcsVqnK v! aQF22v koUEZ?9 N^.;(8oZ^oc݁eY,?PX *sB8aoָyOs ,9u.+\(hQ DUXOݐJSԱL>}ɇ/_"]: ` @;Fs$\,L?T~AE-sil oT~@،R߫Ĥ{F#=l}-Kz* i8Sq9Q1`pIi''$jǔ#aSd9v;Mq_|8k -F}hMW$&#Kg%$n)a4Z'%N9׸XFM^~*1kǗdmg{\-uǛu]b2댄=qaŦ8-i}z=h~׆-ҀꊛOC G0$L23,F;Ga(0YJQ7J2pj@S N w"=3[3~B"AJ!+/^@$d,c#q%--u2GBGX|sp.@Vw ?Ki}Ln[H̔$mem֍5AĎ#\~p[ΤB?S`RѨJQ,sJ9c-ѵIw!ufnՂd9Gm7R'n q /LY˵I9o4]+Ӛ[JO֢Un'0It2 G E.glnji ۨd Ѿ2<ǧ3 VryrC?ÐX1t6IӮj,zN?O5C7У1ak 0eİ;P T>Jׄ8RYcqKbAv\^MFh=$)o65C^dSŶR>?-QMeoe zR&;X %h3!ʈᅉǸLm9_&+s𹣌[FaԎ_kq4剟/%*G|V9=2R{Yp1Gɍ[I?DW+T8b_JtxoK'˷%~On?JbJ~5byv[ʜ_\&9IhQ$? qng8l^uz0O덽u!Uk/5ŜLC\AxXpq9lHWD69*%ؖJnW֏1l?qG* A=11\3TSQ\=s]ר# \fҪ,8+xmtŸOӹq8KFq)a;XrW~<؞/ #bzcV|+Pv߮ GKM ϴ-t錎v&)EP##Ծ'qg,2Ty..ӛgqe(}_Zv;`~=gŨbz[7qxazKXIQQIs DnTacx# 2Qst8fa*rphFIZ_<8K`2'cp+;+6*ثb͊/F_hގ@Z8KYhإ]Eb߮*q$q@*=KYEXYG[Y5銻6k;lqV똚;b]\q \I,vWv=CUKUt b'cAGm!*lUS058ǃLPk|+O *9D4'pP:8 aKD*Fck,b̴=p8w«j]1Wc[f[eV.;6*v*JW5)\ aL ]*챶*告T]bImzCZ59TRp Wf]vlU|+[O9`l [T$]9uM(Zlu V8[ȡuǃ_lULLHiܻ啦-Ɣ zf#\SScB|0tӠ`\}d5 |T|oޭQvFC_nLERM%Wr~xL]É8X+qWe6;lRHؙ‡ebf]vlUٱWf]vlUٱWf]VVj&Zۿ\o?ɀ^elуŞĝ?~ҟ_Ui~a]儖FOdRUQ|Qr*6*ثb͊6*ثb͊6*ث[xwF*'3*p}88d;\[ڪ?'rL*m!H}kbc#yU]|CgF.R/<;~ҷL>P#'QƶR~۰؁so~4 MhI[ Qlޤ5'$_eg GrU#rvaF9_6*ثb͊6*ثb͊6*r/"aSMW6fHJ_c4| B?-U|F:A+"Aq `}%)liOc(T,m06t}~/*|5\H.DZbF_];e[kBaB?\lS\Wb;7b z ,Q.NW,R~99L!ug?&BٗG[;AQR=)zQM!-[ՒOcĈ5ۮ*ZaZ*ڊcN]Lk1REr.Ep  +.9TQbsMWe7[$ɺS(Pf'dSᑒ^ (ثb͊6*ثb͊6**6*ثb͊6*ثb?-F!NΛL[F(lebqWf]*®ebe6*eS0%PZ UZ8bI#jcurWeeUث1WUbfv^50([J㰫G7\ vX *8*)[\r6< ,T.Cl.jb-qU銵aB3\+4ǚR*CV *Fj7T?F*䨦>pO.ى0* V?<p!RCx 0)\W'm Hت5zъ+$Uqlx?ғӎ;lPf QeJwh\0ۑKػd ,\Ppl(kp82­Sk QM7ZGcƋhOR1mib6=69=X҇Sp5GOZey~­ od1Dn+Bvh'^]4&n_ƼF|K1m|$XBO /ndnMMaG Uu8[W<Ƅj/z/]%h{ c0?*n%alpUzdkŸ̪;eq?#“/%@«qOR#U=05dz_ج-o]4Q8k87Z=g/k7LPt`x..f#*zn}4خC$ yZ@ e*.`}J\ƈ/F%t;,uXfc"6=~xQ%8m2բHh~[S#k;ˈ?p6(tkg'qɆ:i0?5Ǧ_vp@KqP Z:iH,}Z;b7!ԋFso+yIqWk$302G&kNf"4NX-wBw1b 䁏~tO|]6J<2dXm>޵*D~OdYa.(3o6CR@=L+雱;\.n6l)ԟ"c7\f*+i>ˍx1;a($-4)v'nZs;6ƾ,%aq_c_9+H읍[γ?YHbc藯:f,)\rNYk##cٯc3,C&?v6*[Y:|,/b֧받vkkpfV7bZK`Vƣ"գ> Bm. G~C؋JძWñ]J.1oʇna-#$RwǹP0e,A}9?غ/L <|p?Z)Z4"R+6.٭~:l",`?1JrbG$$N)@2?tCmqxA݋9cT?Ҫmx݊A7 N)ZL*Q+6kS5\mc'S-YFq*_SFesd$qe^'5OEDy4tnSқdQ.m=FٿO|ZEk>ؤ8 ]r2o^&m'/L,q潤ȠVb،VX3qRҸKCˊ9y%).-cP -0jI?<#uk7hee@%[9#1RH2tV4,@?ʆy~MOebw߁yzLهyC-Ta8 U80_2HD}gJv, urv ~d!TBՍ?^5&4nf4*>c~N?:=. Du?3p[!Q_r Kw%Ȣ5w냉ER[>2J)¿,*s@E>CcS@!ϕ4Kz,[!o2r?G#`i'HNұ kiCrϛpy;[wHM Ws1uDOK$uku }p wF$y#)ҟHf&E ?T;A6]mКFt$r(Y'!?$?Bk&F+N l ɹ!mo C^  >-cG l,cRn$t\UgߋWJZ!Pf͹pS#S倔CM>EUoQ'/*_0@(Ll1CVm,Soae 2o)[^x> ӨlHئIG7 8A:)4 rJZg^.o{1ʥJc8GBlUٱWf]vv/&ol WW?/uPPoV RڵsbӎVVXԩ7.aK~!ƃq 㘝K|!i4˥F(ZMWNNفއ*㸨fp@銵<qpVcT8ZGQ#RVGc֧YR4Qctwܺ IPգO/m8ocdIfڧ@ZJ/od4փp`=\A ԝrw8BB*;Jv8S pzW$4ۯlR Ҕ#"Zo]P+%_9h;0e{]dFON̶cԘl}ܨN9S<Q-< ܮDib?ᰚX!1>ߴiTnd#8](vbp"ݍr(vQƶlUؓaWcvV*ثb͊6*ثb͊/vivʼnxd2!j c50ꇖ5S#hdXvON`!oJ̟g{sCqe_ ON0$ ICQ%(п~oz8،QW F1'?ȫd_,1q=]OVA*^تƷVEjQFTTAWb͊6*ثb͊6*ثDH,ƀ +D - 0ۼ Ej>_L U6jt+'$LLnjtx?&OIUZ+Rz8;uӕDo?mp?R|$;TB``yFߑAYfi s )GAS ZꞣGXXԈYyv??g[ C5vaȥ^\ * Q\USHv. 0vX&R;\|А U9W;oZ}#;C9ES\'f6Z\y%96,^7i=:bA߮0Uz)Jbqbq|Ur횇)jU'lbmV`kE1 VƸ[`0%i[ʥ+Hn;[lVqȸc_%""ddZG&AavlUٱWf]vlUٱWf]*6*ثb͊6*ثb?-FsgM\-86vlUٰ+We͊6*vc51WeUU0+GLUi81V9}0v(vlY;.50ZZ9xU:6*k51WW,b-W.qbb*81Uqa9)ZvǪBqaU69xmr]\ث-e֘ӛv]CE zFft5oQ*Hk\](| y9PeT\ZW*q}kn)Z2Ǩ-Tփ 9xi t }jc#| qm54K;vQ_It_K$\.$.ő+-#X|U1ᰪ1!qUcհap*1Ⅴc\PFX81HZc銎k[؎jwcVLA gㅫY]tOVmO8ۋҙ(ũ0E_iW& &3a2GҮjrM΄2B&GJ:Weuk%[0Js+q;Iu lq<9Q$iH`2$bC闪-caJ]nS#lc_퍾\ēP(F61n2q_rdV~} YJY{ Rt ujQEI}(F[kIxx\\U\[U.[NN\l.u:$&rͧJNp1pK'bwq~c,e Z+QWK*rePb63iLmNdZO™v:/N~rGSTUn#.+lpr 0u͌Kq=[0^Ŗ23CQ)Z{?_SbcUMOL6եLΓUˁ>lqN2/K4b+Ò&1lN?L]-ŪNi>bŀDlmOm uƓx1kzm=1n0-ZIeOv(ld{ v?Rq:t$cᏍꋱT9 .h5y8%yKjZX]('O!bd_&I˨bC8A6v:|g5Gi_I爌u}u##aA-au&s~rHA7TYrVT­;Xs?FN.Qa\ܔG6;vd_Jq,1ۆlC'$/j׮9[Ea&/MeuS-3N8ҒZ6,I_T]?%=XMuXPlMO])G1c-f*o_#2N-Ǫ-4? bnl 7򎸠Eoc=86Nzrp l5iK3KagFx~ǑV~m^`lrJnء7뛯Liir4ֹXl6_|ثצaP1]k2K)lGUwFUqK|> OHʮ/Q]5kF=ۏq$#j$Jra~W#pHlXq2D8" AZxW(aBA*NerYۿTmGL .3rNE=_LoNcPt@y~A a-'qE[*vv>TĂ  J$líPT0 ~" ~X""C@*0튐Kج(%n3n!?S\zrٽEJo'iaZq[HQ~QU$n (CjS2C*틱 F dŐD) hU_: `vqLv7vlUٱWf]*clsL:./Q゜R84­W1Cy`Pb \UmKXu[04늻LU}Vf\*.41Wf4]`yEk7u].9h0kAi7 'cqbŮ5qʧ!C*8 \XgYt|UٗcXW j#Z:U2\e[#lrR1%l*]Lp\U-M0+jUٱWy銵[eLUZ®flf48uȇ o1ʥ%RߡXA Wf]vlUؼM$l WWz_0Ac)hSPڎDwB[/1VfflPJu1ծE (4xaBZ_z▆iһq7OpG\v  Z"%iAN\ZFjZvzLS4%5dS[T@)ãjdU$J)uk| z1<1Wq+(J]3LJZ-OZ :B`S_>b:< ߱[Y3ʔ( r_#J\qEd*E>+gORwm*{rSDz e?I>'RRPLmU`V;sv0GS -L;WbmN-ev1K&؛aWcvV*ثb͊6*ثb͊Z/\@9 ;k1is O)? *;t&EU&u HM+O4|dUw_ X3MV5vS|?6r5Kn![=n;.g x/L UhA삯]vlUٱWf]vlUٱWbW xբuTU@O[, $ӣ~!'8S=?I4'/ɇJ $4ա׿}ڵ81QY5&Mӷy+IaĒUA, }/-Y HQ?p<"XXT.?no#p|~^X -i#>/ Tfq«3i)K,:0_TE%U߁*ثb͊6*ثb!NJUZl!Z-۾[۴+uC7| UnBu;c~^ѠIiI@eh_ԥ;70HFiAJMCd_pWoZqZXYI*kOfOUh /' =bT\X=UDz64AfFg%/!PXq!gv oop:S*oV#j+_XI·),GuOe~2&**g :?k+i* "Wf]vlUٱWf]H|*iZQr-e I/~Xh:81O*鱏J+(~$uJN;q_R{XḶOT?2cCtkN %YsBǨo(߳J_F*X`$";t7[R[Zqu=1"<[XՔu?.Z MB)t?h q=C.H6 VZ 6F*zEUA)l,v; hG|B]0NR0&_$[(7GWzDϧZ2~Я7ёeo3јUA4ƃl^ʠ'M|P'8PnzbmQ*+qaK{fȫ}ݱV,P,?l) Ev8iR0ԮٹWl. "+ 6WS3o `pnj@VcO E9\@ lUٱWf]vlUٱWf]v*6*ثb͊6*ثb?-B!NΙ2Kr*͊6*ثb͊6*UٱWe͊/hUU Ua k,bqZ]LUxRP\rk1VlUf+lv;[r*qتrKULR*9xӎÎ*æ*-qU 3blRF*e\zpW,-WRQU͵dc"8qCOSZ);Ul u⼎YB| zH LUhS VǪ0*-Je)+P|9|H銴^c֏BlȠ╲ŶS (EHZKE7йܹYiΦM,F,($ q 1VⅥqE-+W Jb bq@aLplUo plUi\w,PXlUiS\UiLplUc&=d#aB6Ȩ 7\: 6IIUV>u?*f=XIqgutH]]'<\Px(qPzwICE>e2(år4 ^ZSqXdm<$`~t67"O<Uĵ50LxmQ+/S}F>Ru܅lcMq)=z`LOpr&Sn?#hc e?N@1|2elb75 9)S %^;L\/4PV:@e#l=؞}Ӷj`'88n#?xcG60T۸W$)\1uϡ!Mp5rNI[ 4`iid'bWqp)lV RR.G,Ā4Iώ(8]oZ)-d4?O7v2S Gj#40dD3ZO^0Ò;Ao2m뀶c182;`0 uP\~3_uF-@d/vU Z@Up Lf;Ȥ+ņ|˔ (S>,q%K2}N0N 'N!5Y`¿~(蘘/Wgfb~P|Yj@$Ӱ>W02SunգxP3'c4كVSpL\Vl#u;o\es8vN`7!ydIJtw"t?ػI+U ;Ui䜭v]4F@x`.=:zx3SHӏ H!L᝟5uCSN*n/3iVbS hj4kȲKkPeWV*_lpL'^P㰻+6 G5픧H?,.?Tҽ;V m'g~ў#Tඌyv?J@۫)ւxz̧b+\\F.֡I8mlS2F܁[qOJH]S0[NCG g(8iQ0xcj007#.:k̀a.h+8[.pN&-|)-26Ҕy0?UJ?pNhz`r;1nQ?r=}36\mewk)'>MW{`v l(~eO'oIp%z7 P3b#6*saVbHlUcL^P&Vjq\ںҘZ,;S[xGSeqe^ti1Sɰ7Lin iWzLw*~W0N4㵒MowbcKE^-*S8ڣHꖣPcLJ yrzG瀟6heAO8Qy2֤S+[v?4