ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 13:52:24  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%,L ٣gs-an559ͬ=}}kkSg.iN̤\+Eo5Wq@ݮMM-gҮX _Px4ږ ,k?bdrܸxk…۴mkD@$L~cA48Jλ"֘;ViDÀ$@=ƩfypzL`a1]??h h9*_isNƋc,fNY^="tC7-;=ɜbؗhˣknXCI O*_Xz52CYVknjC=:+~k@oU鵝}Gpz%#+k>޻w'?1iY%W?ZeN~=BƸ<ǿ4~j} P܇0c3Cˈ%>'zQC6d1wPyUL>3p_={[cNsZv^,澷E?7ol c?VR>k^;?H|:m3r"^zwxޫYyKG qRFkkvGIʦ݉?ԉa:p;)%k' /8&Wc`co_zUm4pskl%V ]\pN0#)__Xnc?9m3Kkk{;v٫6-ƐNmοkh&Zq֜\dH`p7m F;KIloo$ODuylL6R˜I.wާve;*qVÙ[CGΘ֊nucFD Ys%cvf |u^;۞ZcakDꪎ?azEopY=GXΥ InjWnCU.K6uOý/g^3.c#2+pf}6c{~w]Ec?u4 h~wh 3u^Ugguyc48AsZyhUo9VKH<ɭtiy]l7AeO.rz>Inv56mcswtҖI$TI% 9at$F!eu,>SE$9sl̹kk 1 =rXOϪ=xeی8M?vϨ\(6 G߷/Q0HX=M9C=bb]M{\eص~-`{UWq6mZnx}*TBgٌfVAr띿Y3su{57tn75ףζVġԺZqI³lsv}e,£"E3 B3&|x3F_.=".O-zG A_=w]YPz۰[N~߭0s-iK7]Rdnb$k'|$U'$19oTnׂzeA G/Yz(Ki̲7Ciwҫb7rtm].{?ҷ>uN?*kϳZEis^]ֲobq:y㈔UU(H.0x;$ /TI%#p{ ;Rs`Shv.v\ݬE#/n>U{Y:Qtˍzqt}_[!x@?~&Y^7{cސ#qkr|mzƗ?>cY1MaX}cW.ղ+ɿ}.ebw?R{KVm禮p:n.wSݴ } Rf7z}:MtO5c>OqgPmxi9N:^LBrNT{&NU [M斒MMڮaݕu$<3 H>HѵMϩő}3S{~ঌh9ENz~=M,cw\Thn8մ\Vzg\ѝi$_Xs~BrL!,3>q9'/ъGE>iGNIΫ_h|VO@Ӓq[eڙb~nOnvi'[?Cf׫6nGX߷8 )B_=_kW6K|ȗӣ;`QUG5tI.hs&}7fѷ !51:$gD}"#}&RXFRqx=k,sge}<|C4xBrt7t슺KdlqK=~OJϭXjv|[nuȬot)Nn\$_ˣ]s+VgL:ٝ.3k},pneL׻eë~Cmߧg{ݯ;ϭ.f;(ơQλGv&l}^-_FSe 4轨n槰<>UOٟ]ZDgqj΀Gk~_W}XppqV[˺>,ԯKӺj^C~ÙCmmf׳oͿUe"KݎK˝}ۿ9KB O8N1?$s-!J[>7?"$0.jگ[mߵ>ÿyG>RXǫ.I{딻s0љ<8a8qr -ePpnDX$e6z{(l}qϓrivV=S,[q˅Vl;ckpo{Q7LE#lyx $I$TI%)$IJI$RTWţ2-CVm9u2'.BֻUtkh}wٺ2qC:u社.'j!BY}fi<Hڅ^bl1SNsA7jޫwks.]st:K?w؇LgͱS>w?Sl1=WUswT"D}ՏM]c*]h]?C깵S@*K3eo~?&DNe@qQe:$r$I)I$JTI%)$IJI$S jUmm{A5IrC[k9>:mVp3}KI6Qɏ6LF_<ȧ@0;piӶbkSGR~-G:xXy e`WfՓX25!KS_,+~fRjxt溯G~m~0}f{[Clٕg*UOӢ??+s(ek]Vk"I Ӓ?qz/,Vo-=_KIيRșI$(RI$I$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$.Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTVersant-180_PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMa update_maart2018_v2-11 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%,L ٣gs-an559ͬ=}}kkSg.iN̤\+Eo5Wq@ݮMM-gҮX _Px4ږ ,k?bdrܸxk…۴mkD@$L~cA48Jλ"֘;ViDÀ$@=ƩfypzL`a1]??h h9*_isNƋc,fNY^="tC7-;=ɜbؗhˣknXCI O*_Xz52CYVknjC=:+~k@oU鵝}Gpz%#+k>޻w'?1iY%W?ZeN~=BƸ<ǿ4~j} P܇0c3Cˈ%>'zQC6d1wPyUL>3p_={[cNsZv^,澷E?7ol c?VR>k^;?H|:m3r"^zwxޫYyKG qRFkkvGIʦ݉?ԉa:p;)%k' /8&Wc`co_zUm4pskl%V ]\pN0#)__Xnc?9m3Kkk{;v٫6-ƐNmοkh&Zq֜\dH`p7m F;KIloo$ODuylL6R˜I.wާve;*qVÙ[CGΘ֊nucFD Ys%cvf |u^;۞ZcakDꪎ?azEopY=GXΥ InjWnCU.K6uOý/g^3.c#2+pf}6c{~w]Ec?u4 h~wh 3u^Ugguyc48AsZyhUo9VKH<ɭtiy]l7AeO.rz>Inv56mcswtҖI$TI% 9at$F!eu,>SE$9sl̹kk 1 =rXOϪ=xeی8M?vϨ\(6 G߷/Q0HX=M9C=bb]M{\eص~-`{UWq6mZnx}*TBgٌfVAr띿Y3su{57tn75ףζVġԺZqI³lsv}e,£"E3 B3&|x3F_.=".O-zG A_=w]YPz۰[N~߭0s-iK7]Rdnb$k'|$U'$19oTnׂzeA G/Yz(Ki̲7Ciwҫb7rtm].{?ҷ>uN?*kϳZEis^]ֲobq:y㈔UU(H.0x;$ /TI%#p{ ;Rs`Shv.v\ݬE#/n>U{Y:Qtˍzqt}_[!x@?~&Y^7{cސ#qkr|mzƗ?>cY1MaX}cW.ղ+ɿ}.ebw?R{KVm禮p:n.wSݴ } Rf7z}:MtO5c>OqgPmxi9N:^LBrNT{&NU [M斒MMڮaݕu$<3 H>HѵMϩő}3S{~ঌh9ENz~=M,cw\Thn8մ\Vzg\ѝi$_Xs~BrL!,3>q9'/ъGE>iGNIΫ_h|VO@Ӓq[eڙb~nOnvi'[?Cf׫6nGX߷8 )B_=_kW6K|ȗӣ;`QUG5tI.hs&}7fѷ !51:$gD}"#}&RXFRqx=k,sge}<|C4xBrt7t슺KdlqK=~OJϭXjv|[nuȬot)Nn\$_ˣ]s+VgL:ٝ.3k},pneL׻eë~Cmߧg{ݯ;ϭ.f;(ơQλGv&l}^-_FSe 4轨n槰<>UOٟ]ZDgqj΀Gk~_W}XppqV[˺>,ԯKӺj^C~ÙCmmf׳oͿUe"KݎK˝}ۿ9KB O8N1?$s-!J[>7?"$0.jگ[mߵ>ÿyG>RXǫ.I{딻s0љ<8a8qr -ePpnDX$e6z{(l}qϓrivV=S,[q˅Vl;ckpo{Q7LE#lyx $I$TI%)$IJI$RTWţ2-CVm9u2'.BֻUtkh}wٺ2qC:u社.'j!BY}fi<Hڅ^bl1SNsA7jޫwks.]st:K?w؇LgͱS>w?Sl1=WUswT"D}ՏM]c*]h]?C깵S@*K3eo~?&DNe@qQe:$r$I)I$JTI%)$IJI$S jUmm{A5IrC[k9>:mVp3}KI6Qɏ6LF_<ȧ@0;piӶbkSGR~-G:xXy e`WfՓX25!KS_,+~fRjxt溯G~m~0}f{[Clٕg*UOӢ??+s(ek]Vk"I Ӓ?qz/,Vo-=_KIيRșI$(RI$I$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$v7M㊻7$LUe 튻mqWc 2Web͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWeb͊.bLUXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Z7Z bBqWe#v4ʦ*i]N*qWf]{t~|*wbWeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثv p1v8BlUجp5} ׅ[LQ8)kj;/ʸynدKG rĻ Z$'ov0v41Web͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vV*wኻ78N{Um!v18b͊6*ثb͊6*ثb͊6*ثb͊6*Z÷;0v?]ȡv—cv7v8U٪1C1Kr] $o튻`˺n? T]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*+[ W*c/*JH3G8b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث[v Z UٚP1Wbܞث;1's, Uؠ`1Wbr-WbAT]5m'+vV*UXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*b˦*Z 7'1eسRASky;)4]d NO"[U'c;dyG틱abFFO@?OLcn#SKu*Nj?޻Kc];bb ;T\M:O3٭Eǫ)rI +r ]v&U؇)vPv!Z­]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*h/t=n}2&h Ub$(-NˏʫGC;.Z3 TmoA[@4m\t9̈́4Z%LtF/ Vz 3+6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث늻 =M=1v1U؋9lRi8*~*LUXWf]vQ8b]5qWf';0]*QXbWaLSnz>۱^UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v^*UٱWf]v^*찄]"8zG;7q[voM1Ku]bXvQ\Vݕfv_آݗ+n)v_qE1U^mb۱nеz[Eʌ'Zv ȹTNP ߱{yW57٢9fja=$iLk@>&[pؔ:a49vl TB?1:iGx rB@tq%ٹ}Y쫯 @-}j~8&_aF_/ .TLbNG.ns,bIA"v'7e*xUٱWeSvjb]v]qWf*v`0!1Wb:%U#,10Fm9fμ7/p#bQXvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vi" OȔ;#pƜU®]/vUqWeˊ5qWeWv:U8#]=We}U1Wfb;bSaWeFvX|*ޒ 77xbe^?]1Wez; U|0+RWvj]\UٱWf]vX]6*vlUٱWf*v]1Wf*UXb]v^*vV*bLU٩50!٩]SvWኻ+=@]0!1WcMg*a8l7U؏LUؤvv\P}: ]b*p]v>]] E": 6"UbSjoV2[hr%[瑯2z vAO 0o6*ثb͊6*ثb͊6*ثb͊6*ث*;/)ٽNL ;7C - S3E\1/*G˥Rh)TWF.b.zf¶ ;qC./sWC8A—p+m?%'1N -u`>,OJw`Web͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثW`2񷍟 >A 0Lw2WGQS<}Ox[F.M*+ý3Ȗ֓+tٝ "ogJs]sR&35mmPPrCo ʡcNM+/s ۩4 od:Xi5m|7ne@0sH㳁6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbx`C SjkL*N*8Wevc+v]1Wf*Ut]pٱK+C%`$cp+2vuaB1KWeb͊6*ثb]6*UٱWf]v_ኻ7/8~m~ _ v`v8"bxb*=WePbvXlPTbʛbbLcjqWcbMqWbx`P5< uqKW;/vU1We]0]LU٩]늻@LUـvb0+1v:UxWeLU1WcUوqWcK Ua]F `C"w8"a HJ)\,A{w)gɉqJ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]48dzbGdU؋WcH]LUو]# +vlUٱWf]b.]b qWeb]1WeUٱWevU1Wf]vlUxLUx]RWcH]LUxb͊.SvlUxb͊/v]1WeSvXZ] f"ثث&*i1We]>]銻-R1W`{jH7=1bKEϦÉ6`;Wv%.LUَ*UٱWevXb *Ԯ*BAC]]/vlU`b*QF*}1WeqWf1W`xhՉ xP8=F6oXz xf 'B.sI2,kԲ~Dh;;0m{T3O;~1;"B^4,b}ơpBL; ^Pn Ot$d!01]?dWToe=s'fm?X/"W"ݛn jiD01R;TЊƦ-*]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]\ثvlUٱWf]\ J2̕Xr0U`Ώkguss{,v񣾎'# mDfIn]Gb1.r΂|ū?mSҽ}@F(vD1[_&)c+rwc:MٟSYg@XQwr@$eA+ xެ'cd3C꺪Y'%0pD9fJN:T4Rg5S+81~wxd`w )cS§Go>Ţc2Om>X%Jrh.|֭͜ΌÔ yJmt{VameI#çr Z҅15ˬq&w_v$Տ7^ ˆb/56F1+1¬O+dCP9Ϩ\9.e}- uVhxP:ܔe@*f']KH/4×HSSѹ0}dDd@ H>AkXed -6AU)QIoGCCH-usi}~Q_9r8~,vهjv{Ty2 }Դ3MHH;Kxu GpB.ٝ4$'ߠˊ4t'is_Kt3OJ8@P6%%皶5fR#AXPl2qcXM͇&8K=Nf0&<ul-3+~Piħ 4y7\-2kGܑBsQRZ=x~f1O$ qgb-c G .M4d7 h/J)";D=M2_PG~NkhHX&gkϏQBk#_dM|)N9+ `/iXeTTF큥nm+aߤmq2 o¿vOaqu#+1!V * F!JdPlU٩0Rz U~xӲqCWf]vlUٱWf]v^*UٱWW6*ثb͊6*ثb͊/vV*ثb͊t]6*]6*UٱWf]vlUٱWf]vlUٱWf]vlUD1)b720=#=֑W>xyiw\(~ f@Ȳ(I5h0~Uf{N]2|h?jF v'a> B6*[l(-bf/#Imf6ю˜'J[qO-AeGY$ZeRp@ <^Y+^$o ǚX#h65QCWcHRqT]r}ՐDx U4KNc|! 0+ QA@ Ɖ&n>cxʉ-LOkAoz~"5>'6$Zy㖬Whҿy~VG!}#d9hLE ƹϳ f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbUa>;)qWb$aWeqWe0vQ8ث*p]vlUU]5qWeb]v:>]aW`bjw͊6*vuŊB/]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vQ#coĻ ZfW`v\*HPm1Wci]F*]qWf]vjbLUx6*n*UGvjbWe#vlUٱWebLU٩51Wf]6*UٱWf]vV*U٩7Ut]*rqWc"qW`xQn)f "\S]X -QCUDŽV*<1CcKbLUኻt85`8bH.1, ;1&ő]Lx'׭qT=Y;vn_)b^=3rp#5+]A.42avbCU[>A ]qWcH]LU(]]]*LU]qqWb1KT+ȆZqeӍlևb!T]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]UO3;Djmcāv)exn P*04֣@Fq2涣?iË1ڀvyo$uP0vvC&>cA"1`$q,GrJ(hSmc܆yXUu1p,cR* u;9 (l)G,z.,I6 >f໱LiIBF0e#IWU)HTADjSL~$f=Ȇ6c 5v%j;{境 L(q~?.p!'I>9><{-B Ei!QGCV:z& '-c}k1t9G 3HŨbǔu8<ĪicfV}qG&M#$&>8 e>A|eGO@(F|Gݹ}Z0}0 ^-P W~yjE%F"?/Z!ĕ#+0pM p1WѭiqRMrT>l%>{¸ׇqy[LN_# pDZQ_ ~{ .)~#KIɏF[U'm LCUƊ[j~I̯D5]+y,Qicń>Y wC2\u`$hP88q0 %~i"܏IJ%!V͕aT4)rc4_fF/rp_Ȝ>hD/Nw`+ԗI}Q‰d0ZDOarGF6ZqE|A7u6\^]^?!ͨGh*OݥkG,G V?@vLv~.Tt1R0Nq %ݚvW1i3n`)t>gdN*Gy0#) &55?&_ R?%oQOOm "#WZO̝!+  yWگ/DINᏂWl^PErN@o2^?~~1"פn?V+̠~>T%f)Oc_Ղ\cBq0^3yH?/`OGX`K4*|9xR1X&FZpxK]pJ~L\rOz)FfwXxX0r5y/^̊>\h+N _ .D*BHhOmr=@82oR> ,0>n^0$ZP ē:3 PhI}x|A~#&vJ>9U$غHw~#/]-f}ҧG&EPyS[(TlHF$$jx ڀdRWW&>xҿ$@Iݾ)H|OպdZ #W6Z}4 *YMeb}9@Ԟcak≢VPKH@* )('s#O*eRo"M>c|soCLV*1XrA(o f*e)s Ӱ;aܑR3?R RM2vzͨ=B%#lRmeȧ]p۩i3Ho_',kJ LzVq(U3O0in|ڛ+/"TY/N˃o/=}C/@ J0:1jzaT`ofVƥGNDDQ:.QܥOqK &"y% Ry u~dmmgI;8DMtFGd>VJ[܎ ˆ:gm.JُI>)L2E S#)r _II.8,)cCrBN<{FPݹ~6%jS +V*^)D-ΤӾ ͏o1!dfzF9u]xլI$6,xG{wiS}9eT:em爀<:=5G!-IT/q"!ै.f),R )%%BM;@ޙ$:rM;v*tĴnoN-;J6Sb z7jiZD Wa"ǩ964ێW%'j}=2mg(QK"?m'T+:*/54cDZ܌M$'tv̄/_<\*YCPqyK7a֛rIj?p9y11N1Cf!%_l)LIZ1HᳱcW7Cd.v_-^$ O㙚}81C3>pdF)e?_)q&DQƣ-Y))Տ9Ԛ&c^ fB>,MZaNԋ SzC*NN1( c|lvbN=NW-PWzlx Q $D8 Wsb[MuRg;!Uv|qu4Pj[ӹJnk- LRRTyU)I&D$Im˧Ꮣp&AB>Hdai+YW`2W5qr ;W*tg.d2EU,?m4:E @?Z[߶i;4ZcT4h,w3ܨw /`%v*M#qvliZ|[cE*J@i$cDqpRwl<2M1º-a&Ka)\KMU[Wr@*ֆRzJ=GzW1F>ѯӓwV5cW¹h5-Kid!*GR7 0x2G bCHծ6mD(ۈt݇=F-)G ]'ædOl'־KF h;}q($m˼0&`"*<:x^Y~'l2B@-+Gwml(TП0~xT5FƧUTuQ0Cݻc"pN Ll;k]jvJ:&)C\HI/'+s;G\)tI6.II[ q X)I03еW% GL̪eLcn+!JG^:PC7{،}LKn zx{Sf.ӮN5\o8̭S]i\.g&ҿO{ K3z/$Nhl+XD$C(_SPvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊Ł8Ѱ+;PO 51Wf8*]]v^*]vj]6*Uc|UٱWfb_;C. \Uv]1We xUӊ+ٛ;]/;50nһ )YENv=,ݺ <*xvfH8*FE]L i]7w}ErK;1JӨ˸D7iLX uˏL9.SvlU1Wc*]qWeUٱWf8]b]];6*ث Uن)vlPإٱC1K@1CثKb]LU`b+c;EqVqG '*LrEZG* ?F*9Pg6#J\~ DLKvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]Z[ 6r%Jh#!$7vQ]®*PUٱWf]LU٩6*]qWe Ucvc0WeLUٱWeb˦*ثSvlUٱWeb͊51We]銻51Wevjb㊻\U.۹PVz`bol1P5)vUN*UP2<6[q'`z`RQ>f!^s(튺epX]AJq )v.-v#8EY٢jҖ[,&AUͶۇpᘐ"¬}mE 2HNٲ,ӢN0mpz혜r@^F+ŭ1\oܫF޻ .C1JlmA]1)}%37ё$kZF;tWSq/2K(B!Џbvܹ C4!}5S9&(h'50 Q৭{b7נR42!#iI>&=xZV@Mހ(p4 &C -~C)&)/q d၌6sL4$L=%f㙑+v(Bb2IL! ͍H?`F9xl %j;|EAQ` )F$ac_lQ, ;| lTF+Xݥ_5s^cA]!!/U"iwDB`ckKe)1^c-يz+ޕ7CLm }oG"W|o-_`ÇWe7_8Tw=%ͻ)"aDhӁͰcM,<'Z12 {Oq|$ U9>T趄|.Mqh~!8)y+;ſHx|d<ؒjkOZ*e™Aࢃ߮W։#M*!C)v $pX Jm َ"fhIS*Y/̵4X >!G|#4F3 {$X(i$w5+R>l aoTJ4пh_&:4Zm>6؎/[*d]֎A}jTu  'O2(I2)mri= 6`wia-0m[ɗܟe=Hؼ#i^ /$K=\e2nzfp72Բ[ajb{.BN!;bKA7vYɪES.ނocNl*ث銻0]bˮ*UGvV*vV*UxbƓ+vlUٱCb͊6)va/vlU]vlUو]CEZ0ŊE1CB&aJa XN UV l,Mǡb:B\RS\`U|ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/q?Lͥ8zU?3f]`h2|qs$pv0WcqWebf]vlU٩51Wf]vU1WeUٱWf*b͊/vV*ثb͊6*ثb͊6*ثb͊.Sv]1We, UNFlp+dq-*vUi8q$-fhƐh|i+bM v­q]E N EZNiŋL48Ƨ(.{evfKF(*qVZۜPS-0RaVWv$kZ.lRƫTP!cSM1d Jkv@0%)]]S-6QKmd/6jY-ibۮ—b4®#JHب, UآqW*XJav*KD⋅Z8CGy51Ui5\.}.яB}0]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX]ɷ+Z&@M>8됏Mnnrl,҃0|I0&Z뚱ޱFHŸ͑)'i\lS"cP=p2\B mfc>Weʟds7 E*6K(hSn-ʄmRl;|+c#I.l3M+k`G1[0zZX}w*+`f\EZKIx))(A'&/S-V;r S)a ȕFZnLQbBV$ S%[}9@4[$^ǪUL Ӯ9,AB0OފMnuhv횘Ă o{c Z;R`덪+9 #,#/&5N PĞRGÍ:Iƀx,.z8[ሒ]N)D'5;ˣ%IBx(+#]9=&7oq/L.f\KpO-`<"Oe->e,C+Wa sK52Iu4&`WPFώ_%ělGsڡӎ⿶m fg20zcVCƿqnMϫr/L%js?8c_XRN AQY#eJRYCJtFmGPcَSصDI2޻ed rF Ӧ68&^2P "4;VNv֝w27+b~C68zޣk0ElԜ=k\iHLv( {ƼI=ϖB?u+ktm@tmK3w`jN1r[Xdq0'\” Qyg?J5kʄXlkҞ5f["-@ ֘[rjf#f^Vߝ)AO[4iS6?EGfi3ejOB>sN㽔eb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*jՎv(؋aC UG*ءXXb]UٱWf]*1Wf]vlUؼqrL1bz4uqk\W SWVVЍbDb :nrQ(2i+) KDzbof~1 lh:nr2Ìtܯ6,ͤ<\|={ehak٨2q-/5;`! ہ',UǁN/L˧"8|5w*X)ޛe hLjHdk Zөf+R|Un;䂭'Ǧ-cJVF ƪ 7'-ؙ)I>+N z [ԭ[Y-׮1-}޴ AJF/4 %\y VMOm2}:i-gG;S}O"ܲIhUҞ H+Z AZe6ԚuMG;:@(Iu(nt:D~"PAmeN>UƵ2RM@ZP-R01߳B ;w=XrN\Gyٶ B(6;f h,؛-24ci]1WeU`]1](UٱWf]qWcO*vlUٱCbf];/.]Q/v]1Wf*b**t(QM"bɢpJ%1BqjS  Er3[8U͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbmE"UІR;EA=2YwIMORP ܍%( q "FlrL(v7v&F]51Wf(vlUٱWf]vQ],b8Wf]vlUxٱCSvlUxXCWf]b˧|Rءt]LU`b\U*W`Sa8)bL*Z(9|ĕ abMq1=T)+c OqKyakN*«KfopI-zb-żj%1Ku@a\18Yv'˷\z(q8 ]1Cve`b1Kc;-LJk:bS+ԮMS/u3 Wxh+Ikv| = UcA^\;mU)v* vWRz(qőqKG3S8e*.EZUqU Z:)NuAvnk PS]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX]C`l=ʟ|;>WsW5>*>4a9x,+31u~HdŅd5S2p`S'-9@g6+|)V> d+lKb*s@Hr7yy̓8/#ZlXlh1eZܹiӎȤV\۠aMG.z 쀜';aƗl2fO(LӡA%R[ż}a|qNV;I;n+S6Jw?, \zdJ dd{o}F蹏"IكH>'c HA|8B*4r- o ;A_m81DUʥ+RSsҝ@>=6_U(vaJnaQLH-mc^amrtyْZV_JU)x7-0o`؇",}(Dy6~vU$`:h :7t緾 M'V }({ 3Ww%yfb=gFQEQ ֞4ͬ\C^ 0 I_AVZV*X1铙A0qor_bX`3X}FO9rͰW|tY1x#Ae>K^S 63(, X8;Nlrٲ! " =5ijbxknƊ&t`ᤐ 5;`-0j٩k8viyΉmjSa@ڙC.ml"K՛;QLJх8צE[)Ƭֹd nWsO@pڬ^qߡ9Flq4AFj +6_k؅Ta™$- 6W(S9Gz C*1ɰĪ(H(PwUqaZw­ $+N(Fp[1}ErDCErUGlZX(XaT+U R혞 &51x\j3,Q #r1+%2A^ Z`Ygcʡ aH:-W=ЇbvbrHuE>q9eqWT%22F'C+LʙBƝ ,T8X)Mc~KƵnjTgJqB=6*p!|WAjiJJ\2e5SQJa[TdԷq)ĶrxEZeҸ+(49DS|*9C|"U{ZI@<:AiZaP &J0 c޸'Uva QzT ,쀱@b 巖0ZvXւJ>/r|c1BтIA1bnI9>"yuk@XU>dm&bCIĜq 6\m25>Q@P &Pd-0ڷ:{a=q+ # ̬dmsw$m 2Ti/MHG[!CG:f[4 M`kUxUj1Wbv id\9pZqhֹUpR0%a8®]9V"PUm86*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbW-E6}sCjWӝ_ w譧0 GҨ$ix{S n rQ9vqTQ)Bs y%lɪL)1%iNY:Kc;`wY?vPh+qVEF9_$*ƌ B_gG~j둥_"L;Uj7Y4R * :J*o@b͔h:eA ;bEl-ڽ0Rֵ̠.2TB<~7=Co|21UK qՈ{/Չʠi1)J̥S2P=NLT;c+JU\*Zb.|(mX E e]W(2x`ls5SAhp-VNQBFaCb:|rFH*R vƨ,TDt4l%V\H@zu̠L(RٓSqZ}8IT)ڴƔ.&Hzlwd(nݨo0>h!&QpmP)J]UD~(L{bM+4Mr>eĩ."S`ljZAAIJmeY=[a;I'J$k#u 7e;dO#l^;`w#lS%wJ)%)U'IǍ-Oyqh=C!h9 z-޸b5 #ז-e!j2rxP ;;c%4PU"dr&]·.t#]'oTR$~dݣ`p6,=$gOtIHFQJNi*<_sCxz>QE ޲F:v ʎ|(ׯ;S2ڼ207'#q9uZMRMm5Ɍx,U%*;(ZF)*^E!s"$@Ed+֋#O.ok_J|#ZO ;0(#JdE9tIvc_|gqpnW?rMȴKlŴ1#UQ avT[6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*f~?v 8؛bf]8UUٱWf*ءXٱWf]LUxWa1W2"`^x4x"eI[rv5`TdFs 5a$n@Ե<1 2ʁٝ)nU!a\ }1GY+`ow̕"TWnZc WaSp e!"b_G5)FlJogtlBTʩ+銻6*ءXX*UXb͊6*]vjbvX;1Wc)vlUٱWePQWv(\Uز&[4N Q+ ˦u1TUkUM1U ##nAmUZ! vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUugIhߑ4?V`#;qWc*a]qWf®]vlUٱWebqCb.͊6*ثbf)v]1We͊+5051WeUٱWf͊]*Uc;\U6MN*\N@r؆ n#8T)?v0c\R Lֻdbp*ቝ⭌oUN)hQQ(h1Pu…6bĺ 3^@# ak # 5j[%qhTl(ZXI8/Lim"4`#,(:`b q&?@ļH1Y:;ؕ2ZӁ}FK> 2Z˜(85Uq!lU/u1*좠;b[U1rݰU\ hUE1Uk 9e>b1|Q7ƸYvپYƁ..aWcZdծڵL|qr*pTiT[h =0CNEb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث:~ Ul4ǚETX^W%eΟ7'&,Gptgq>ɍ~I_\NUpSeYZ~$%+l?zМ }YN=+U AEꭽ{3 2X^!RHfo}`L8Hxdˑ=Hb? M0B[(Rtb>=n2cYdLZvp+h,yW2,q5 l3[9qyx[KW&$mrVbSGݚ& hV;岌#NU|qUS]`Ṳ^r^=zwDJfՆ$;aUI[z; RXkv'p>)j ~{cirJ]*WED&xSMn\]v(7Z| mT)kaZ o߮2r…̤VT=q*Ԉk}Z6uBrPp* 4=j{#ub^mwBӭ15%j܊DG_|}p g=?(O_Օ2FA3o,\!hitgH%EXXmZ1=qS%PrW!M)f'lLJC+kN$7*È|16R N).`րer(PVӰU }1FYQvP%Ѫ@ڸ qH&*+@C\6ܗv#Yx6M; BSZe;>nO$^SƭnF( yz=3z7%..;Ȝ=1C4X%R)l%xTs[C)ɌkJӮnšT`?z-ӉW$-/Z~|Q") mT%ue` /V5$=8G`6{bRyv\̍l>y)Ho$Q\!Rϧ޹u\76n@t- a0+25$Zv&4\iVw+6bBAFczr[>:)**hMo#,CS@uɡ.5hw7/J fާf2HB)A47!M (^j2)U@g$ҙ DaN˅V'ſ\mFkS\ @vrv̽qVjRJ'|y1)pò˜L6!X̭㿰Ĕk)n;?@ȍ+ݸ~?ƳmZKzbdPHR=sP#jh |=kJĒbaC+'iKdP7 xRa N8WW"- \2PriG'hAS(阎R\B;T 5VUe*++r+56ƙ+|<)D`Bo"NXxV]ũ&Iq6t&0ҷ[ju j0Y&+7ܒw;Mӟ;tQIPHQexvP]Y7boted0"ZyrZڸRMN,2GI2"mD}d%0JO{@*WocK(ai%ަOP;xb!45I|U)NZr%CI _ rO| t! N߾R]2UI0lsxc@,7Sr)]L.&mWQ]")]NOT٭~MQH(6ޘQE{␛LGRdܰB5ߠJGQF JSq; Wwn6@鋪(!e)TדĻiYLD[g7 (IiIZm-bYծȰuH.ܚKF2 -&qn2`~ij8 Ph?N&"o% xde8PQxK5I7S&B8(=N :QiPH;YKT %j6w"DBaa Sxd>+bʭ#aCaUp1H2`+HMhk1=RAn`f*0p剘+1uˎKG ^c2a*VT^H(8+E -a5;t ~v>'%REڿ# )7>Y u鳘7RrJ AE꒢ 2@KP =YM|$ܐeý:P@9mCдJ;woQ0=ꬲd܄dE?(rsf^ā N*EAOCo Fza~.ɉ٨ ZU|0h91&P^x`+>;%QQ%lƆB:((K,k!ڋ("K(f *Ƥ}5S& 6X.8AOm)QN'|T Uc%zl;D'+ӮBٴ8qjM!FN2,{[Z@iZ5lnu֪iЍATo2lHFav{1190֊@X= 焊뒦@fa%=zlr+ukǠ1'mN(cxV1KCK*1WevU1Wc6*Uن*Uኻ/v8bnjU1K;51K"WvHKtLPZ5\pRmVRUn9w]9x튶2iK$ œ lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWcaɞi}Xb7]+ 7LUٱWf]͊+vjbf*إcv^*c 6;.beU٩/;6*b͊(Uap|i51Wcph# *<ZʌA;%FG0A^#HMK|؜\P7*ĘbRUt8۾*BXʼn*RW @90"\\0s6xZxTmDȍ-ծCv=pTݍ3op7ȶbEiqe XRqޮK}=G%Nۦر~M( #&9wK8ꡏL5H4?q7UVa =Ƕ5ćΔ3'_^*i"JHk7\GZxaQQ ʓ#[t/ +Yc¿vZ@iHE9ac~9Y64/d[(?0Ǩ2Ȗ ApEw4fzSXC-pk~^ whFP|FDH8+PG߶?>8AT۲鎠"Tf1be<2B'kJQro%_iW~a êe{wr ,T/=%?  mߠݐTB}YA ^M=h0 "}I+vW2높\ 'nr]wbFH%UV0:`KE[es@_bl;dCLZ1|$ǾXPF0 MӍl* Ls0%\-/MUQ-"Bly *G~(:HP me1H/*9U'`)b#GlFP51Ӿ9Vd-ԧ+ᕙRB }z|^ cL~"y YZ:7h@% u1(Yu'`KLoSsJo94~*缙ͼ(ēƣ+O QG󤣉B_1Jà~Z@2$XPV4LxxDwZnCī-T"crn+g.:VEOӦHHHl|gVt6LE?bR(k!]clTn/FتՈ_ĕeǶt^;JRPPdViiМC̉1d +Cs-)^؜fV-MѳQrڔCw#; ݍHt&Ovp C9 lc[BbrZQ>U7kTwqhGDTqO& <= 6Qy~Op݈|G-.V(fC)o7jۉWGH,'T%eDk Gz!;. ;K,~LIZ)q6\ v]kLl$R:SK0اL߲k1&[MSq7Ro *KCWebeb]b*UٱWf].b1Wc]v8bbeU|qCD\U&5.iƸaVTw«N(1U}qWe8­續ď"vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeU9֏)QQT`>KZ>ׅarcv4*M;#v7vl*]b͊+;0]6*R]0+b͊6*챊6(vlUxb͊6*rbf]v8 p8Uac@:PVäv֠8&ĩHcScҴ=6fn;$qLaLIԝL) sp+fצ*p1anQ\PN/ olmom3 HI+bw]؞%:^W݆]1JYI8ju5Gt1 ;XyroNaPpCŰu+mƕ\Ԯ*) VNF2,l5qD H*.bP LTFO0*TvV vi ]_ :;b+܅yh½V Q3r,Uc;PpIŒ]0XZN)aJ1UNY$S)*{Q|N%^.ȡ~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v^*H sˋnYEH> %:z]2\BQ;b1( [B6P [ P2BZ0.U l8w9J;cΣj)I=9 OT3kO AČY["i1G~ИLIܜ|/$AN'y$; Cn GXOT fZ"':_`3d㕆$W}vhğ:!bMB=uȪrj\r0+mZes) թ(vJ5ĩFee)G7Sos'.R WVGEh~Ͽ69}m$+hV+w_8Sݛ ]';87fGlHl&ء0M}I#fGkUkyZZc`=N6do1Oo[;.^?W9J?ߩZ8<ȤNvHdCpWeq,eњte>O[=2py}&F/JaVhz[tD]$mX6k!nԖW(3h:_"J]efU`"Sf3$}x{洝YiMwhLKɕHcy/,VjF r {F*$:o [FJ%%~dQ;M'#W{d¤JM+OՏ9%K@vڧv9 U{tVc]_I-:: @2uFS\ˑ'e&vP3 $}>zVk+Qէ\AJ C+M=ᶦ*bkGPc&)](eUݎ؍^ U8^?TS+MNU\Ij2F4by|GI,VO"PfDJhF&›DBa%8jX+pJa+xbC1V>aM5"S\>*ڤU҅\x E%}SQ,j#$w>9Uɪ@&mlr%QP]lSUkx %M; L׻(;*FжiW P7 B܆WJ%+dS)OQA(0חP G.ʑciW,9h7AV@hfw 'X #Ӈ4=\Z{vרN½񤜘+K$P~*0 R5ڹ+B~#?QA% f&ɅFݗ WKj(P zdm*S@#P}=S|(BFyS61SSQ7.U}5*O\NA[wߙљM ~I;H3䎵$cWo#mh*79he.44NxGP}bP\M24\AG_*"# E1S^2^;W5¥df7ƧH%~f!* V1Aé;[qPler,X#ʙ> 瘲 `T!"#;t-6#e^s\faE*yNb5K+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثMQO* 졅]vQ—eP1Web͊, Uت%pV(v@̨kXZt̠,5 [݆vdĨڠ@Ww YpM;"Y o5EI݄nKu ؈RJT@]U$y5^lͰ{}KzBg5gOJ(;SCSSf`c9xj10I˭)kEhOBm`B혒*|(+U 86Q /r`GU`[2 NJ*!W; %qߦ]has+eh{8&8~ NTCݩV&w<2"\ Xfq۹` yTvV[J QN8*+)z'yBK?8mCͽrq wJ&VwGwf6#)Qdr&:,H逧ԃlhe;E]*$xJ$(懂+a h,ʄj]1X@\^M|3*rK`wN:Z H!M(A}@2jTn8**[Hԯ USb*Q!oW>_S$~"HП9Iͱb#q#H2Sj:ԟʄm)N"ŤS6P+]-2PYӉ8wmG--ߗ凜D=|'G|]v$ 2C$MU$]BwrئRԃ ` )") kMRjs SvjqCKWf]銻6*U٩.]0]v8GZb擊U7tȓU|n*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊&m[FOL>.R ث]2 vlUٱWebe͊]vlPbfv]0!xٱWf*]*;6)vlUٱWevjb͊, U 7*Wb#CvXE?a Jqbؖr? {W+HRcZNIQ@cxrt‡r;$2ٖ4›i ]!T'jM)x hNMqE.yAzv)72@5JLo\J06כ$v@;yK@l,Zo#ҵ'$Q QEf<\-u%ÒC5nGbqmk =iSC@Cmxv!_w_;o5[=So2ypxxM2KČ=U m.EnFdC-((w fI\ ^eml'助دW(S F۷%ߨƖyFam mh9NI:v̘2,OW`5=Q$vA^(>isy^{yD%km܌ZY +8b #/-u]]D*nA?݄RɄ9Hz*b`'}+ehzR|A겑@2ʃ8Z超QWn!nW1q -hѵ%wn4ޖxܷW9>uDn:*:ө9d9uߠX'J~0s[;fyЦcf5PYցȨ#6nf鲶ىÍ=- m@YhQ! r2^3ixrN+05 A9\B*fQzUH꠭irmB`wF(iSM+ J m(z cGQQd c ?;Wiu6q,dzt-mr*[b~GX`( 09:xw5[I5 ,c_MgI@'&T,E4Mҫ4<-c/RÓ8JLfMjjE5~ G t4:m3AA" II8h֍C$:gVB!'eerj=WˋS,K^? =ST/"6uHe9-@A X۰?'^Zsmڜ>+2bF<'3-c?=dž@([77 O[.]Om6ABiG^&?4ֹWU:td;Ot (4Gsnnmwp32ygVꆟFNرCJ<#1He2%lIM% L"oʇ>Y>:{ :~ȣ# :_#( a 7ݎh?Qƨ QXB(e79K%d5/8 ZW Ue٤bHD'/ĢQc\2 +Z~-D?.۷O nɹcӰ \O\X31Zt)5"i^8 -[$[4q"䞥EUzrZl}5#' Xو8mT)$]6Zm-XZ0"2PJ4̫! 0]=7ˡ XlM:{b>IgF`6Y)N(!j7qȢXH5:Q>JScS3ܜ@Jn"oYᔘ.2S{ (Ŏ]H唁/r-!1sJkޒGb$M_yk u?s]\GNY}W@w4ulUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثXv8WciL*Pث+v7vjb͊0]Q]WbFF$>2imLZq]e E &O  'a=(-@`#yd'{Q2BZq; Q0_VQ]U860Czj6;{K${Pl&3ztE-mLZAcF.(BRPvcLoM dK )^8m[rHoy ek@2Eam&gcPj*nVtb YU͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbɵofrm<Vb]1Ɠa]# 6*PRءٱWefء٩]/;6*/;+/v]1Wf]bLUx7*ne[q# ]V8\qRVH =cPoM0trnlUaH J'NLzB d.2WojMw˩5(:m SBLNʦWam$V_1s 4ᐐCYKd]BT""bvPX oFG?Y#Nem9=@7]iJE)đsPE\7ig}t!L5镊Zbָ5flHQh*M!j2!mUwL\l(+ț O*aN yP{4pm\ 4 jrhnzb_[NƟg :H;Ԝ«vv뿛z w Ałhf`Y!kfQC\FH Pu%Hf_Qj0IC? xv9w q'D=t =Gմz0S(|'ODy+C}T#*o7c0\Sߵ:pîam@lتX퀥L0]c R`ap!.f]SdFī`ԑI߮#$$ m")ZTwª.6⟁8MwDqfH%{h$珃,^M nا\R7L k6*+\M1U!>b J ¼o6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,bɧS:˖6EBUsq;@bIQDS" ,+G2ҋ\3dH3) a~lD|a-)YY wSzja]aG(s*I S JOP0Xbx{eKJD7l0S|Gvh-Fz!j }4?n-OS+;Ek>,ZpHkgfS(}\LaX@3XZ@Ѱ$R_5{U[(\G ;cp<#jȅli Uto!IEڷDm w }j% ?+jq]!nvǨoB\[OˀSaw4[Mn[-Y?k ioc?F;#iYAh{dbC#X>%344\dS4'l: Q`Nv?/ `$! &E{e'/UXp9՘COz8p{ C?^B#N^V0q'{SbxLwY$F4oJ\l7Ov@'-6[J6cߵL<\oF#a+~@cd E$,u?_6+'t?9U-$]coWKwƣ RdQb1̾l:S%'ki"#'~*^z جs"n YM1A%bf%7Χi\F*|Ic?r6Ȧڥ%D5wvVz$ Kg(@\ݛ\|m?z;Q1P,<_ՖhK/4S бǿ+t„Xǀ*2*〢H0d(`*zPdmVI1Mp=ҵ$dة8X VƤE])C_je%~.)M68B叕 cdX֙`KB6 rDF$%@#~ɚB Tc8^=TK}HfF$N1L\!$ҟ?|P%*tn_ aZUWaBkӰ tVyF™M#$҂iW2Wi|l ]6_Q>,i6tkLlw4RH[t!RT[ 2$alU6;2!J ON مJ*=#,+Fw޾ bz 68t"wP$DvaSm$.fPs6?$RVreSȅY~T#n4S!._XiBT4;`y -OWe@nQ(Bλ*bM(zet^( mpҿG1^ݳ; R&h_aPv9,DY [ho+/^v8{{_Nv,ӁähkPknG]T/@=`ELM@f&nldȖEz|D lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث}8L n*1CWe\ aKv`1WeU"ġezfH`v0 ø:*)rl8 (GrX}Gl ޹dqdWp(8eVH䣕Hm'jmriv.*ҴMC%1elW2)FqX1-QS&TC]U[ f ج;,<5^.' >.iJqF́C !-צj Gnimڟ~Wj2\nM1XGH[M=,K{@g;rE5 hoZ̻4(` 5OCixf1Mȑ[N(;P* ] 7P-6h&$x[wgr,}d7M="TP-$7M+OVZ4B+; +bSᖂyRwY)DPbG*dW^]rjƘpY@q'cL)Q '|[t˶ =we \&ؑʢAM VrB!fӡ;ooBw$&V%C0۰_O5'!9#5Ȭ*ٱKWf]LUٱWf͊]C)v]1Wc, Uـ])vX긫t\Uظ\Uز 81KYRN*nj*QqJӊ/\PnjUp•a&n~H|US6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊&[Y6-[-NXXv]p+;Fv0U٩ʦ)v^*P vX]ኻ6)v^*] UaqWf#vV*ث銻51Wc*b˦*]>FLԓ6EdAюl5 չ,dvB^L)Ӏ3\_X9ZK\%s4O҈W[tмɊ$f7J'HF.Ӫ&$*[3z`TdAPQ:kLLcl%:@vVMb:l2H|Ϫ=ބf~ظPծ}"G'\7vEl^eJ's'_&%ϣl%\:NMlB9(\͉d}4䣰?A2z?,d]V wl_R./;^݇ё-St"J[Z D_?\Ow,1KMCu"▉Bþ*p:J゚L;/-*5PoB+p9+J%3]B 8,L_D(GKmFd~ %cpĢi2 V4ʼY↛pZAHMi]yX|^A9;nP :^IU偁]\Ԯ*ҙ%ka*s2z-遰+b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb/}׳eS&qSCv@ St 1=Mхz2^FQ`7)xY4hH| 5Q>Mj|s(Fe=-R9$62PrxGz7rX@HI(#Y-%.$ƧJ²pAE3A=Wd$P "5geH5+傪łR|`N~4=0!P^;5:xqDtIqsF3.k)j6(j?l3dXEwS1l9_`=vN BKv;2Mz,0~Ų43]#X^=\v؝jQu= {0z2u$.kBe?̹  Ra51??ɗsVI8ݿz;J>sJFƛ ̸,&,7nH&2T(16Y Hu1F9|*`/YflBZq=0-`"<5m|JR'Cxd[q3LM0Xxql Cay-LX|r d!_MV:i6^ni4mU>#+8[J,Pxц SJhِej7Z˒,/D*@;CԴgZ|#<@oyDR:\K-tJ9檄w5?X"&Dq_vPWYa$2yS[qx468K$Hג=Kzr$՘Q[5;h=i\TdW,|/ N Ir#쩥~Xnǯt" ?}*(ՉUqe4BZO%w[%i悿 #'9VJdҗ8@biPJ嚎2Aޘrj|ïUS|l{UdW&v\ 0>2PzcBxA=-+ǎ5Ac3D"DQq4s &BU zb1P6e$N5w*rGOҠ"df/U@$x-zcƿv'ڹdK$-*?k58-\68Q,GFƄ߯J:1'7? J@GizSĮg§aHHw&Se)҇8 JQZT5Wq;܄*-a 'C \%!mTC 'Bˍ-;rնq^Ja~!_RdevH =̭O~ SQc>6|I=k mS*HΦBkrA_ ޽+0߶L*cjV鏈iaAAԠ~x5 P F06&ZkFMቴa feR4CM6Zn5 vV\G-mJǃu&PH墥;74vz`JImJYcmؑw'22gN":DbFuduV+_mX Ml°jGcgCOly6bX9r(Z(s-a'"/4P{^5nԻЗw5Sֵ{A2xCs}[Zzp%KFf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثu|8\ b͊+ LUT# 6)vU1C銻6*R2Aal3*%vԝf^=ڤ'JզoNPwA?v SLJeE@FU}F;sdԔ65CzC0ڻEoPB7r2r)O4Ml`| -YW.`^0S,٣WjdE--*2莊J li6}:<*7*7 bK 0OgWOlYd\q $29S@pbؑ0xdAdPD)pQ?=rB\\dZo]Kw'#7V Ѷ8Xme74[L() : q:J.n[hs*0y#Y0nLXZ&A=\9@l% jWʦ6!׬MӹQôp֣2z+݌o2[ұ0>}7fPtkgozf`9OQEAtH(O.tAC0ΜAy19ݖrWTG|䝷O%!;Bc @rOv2FApJfcQ/6DIE}b%n6COF'* ׯpQL-y~)9v|Sh4S}v'l,Lq^CAa! @I8O_ Ul#5"<;GL=ӁMܱ0nM%xVat?M#o@*O @[X#pe{`_ Vp'ǾBSg t7:O|I_VC.crd^큚:3V +ӮUY~\0+aro^YP`IwŁRqvb =  `E;$J ukar/l2..ALK\*qy/xdZ8 $V_p; ۞'~^DnL06Ѽ!t;#:j8{W p[hRjRtH7BVZ]>`)d*hrrآ *>g{wbR y R(~fzF/e"K5  *Y%%{cbb+(9*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWaguM>ˇ e ;ų:P,.6)\[jrٚ IDIc#`3sQ;7&;˘VIT*6Z<% é+x[%#AS%AS[»fYË`,Zӭ ZWrKL姐nFv H|%'8ZxwJVGv{0WNev?EK/;|E6mP1vڨ2o׎p*'75yƁhic4=%W@^Jz`Yd(x N#ӎPǪ8[w44;'Z} {j:ӂQIDw-uVL)~XM[m>l<,e>WR(ԯiyd I3 ILEe  BT nM2`!pě~&.q)PqWfW)!دVlҺ,ib&]n+ o@pOaLhhxfW,)uycٳ/􄻏m%YI:+,LG=0$`F(H}y' R8˳V~-x+?{ Gl fZCz6E:z@"Psحቍe rcrҲM,iJz-K@rg e֟hxd`ҴčjvTaRO,ْj$%q]cȡ;aAБ똰;bƌ+ҙFpZD &,IT^V%3 tU^ؑ9hB ~׾&rˤFa4I?TSZuŽ0:eFHPTk]) zf*F A۷HLZU uR}eŸ&^eO጖ZЮ%+M:9O P g#@G-370>_$J֡~>"SFiHr7c$E^@I>ƻ8[>8- :W(; *~]a]PX"FоXZuZ֧ BqƄ HAn=TSZ&$H=w*7ɱI G4\x_$Ĕ^P|ej|p T(=W`{m({WxmlP7<1>\vrT}A_ޙ}@L*ȱl; 9%+$0~)jz#cLi 1PdPC0<6 B3zrFJJ۔ |jlJW)4vn1^@PPWZ 0)KMjO~پ용s jI1 M";4O?a@2I[BJck% / f0ɐ_hx& Uʹ'̞.-L"er6X_VR~xR0[M,rb9Zh:{?(cj/BYRQ?Ѻ'&\cRMIDc0+yWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث]،U'vVvV*] ]8Uٰ+SvjbA-v8U:хw,Kͼ37Q mPsGohVT)yd<rjG( Z7M %p u#d^$299S>LF(ll TQ\+qR6 b9 p[jN j\,i۰\4?F)_NL! Zf>K-]H6eg­B@qY\3I@ Ռ 6Xr, G b.~F5&)3m&䐓?䦴r @33f\|ZwKe]}\lTV}Dň4Qƨf45=2-?0RM+P\qZeJ([)Ey%c,@0{ C pmixths-d2j}\FFUb7s^c˜8Q5S QN:Ɠ[ u ZZ,b6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*^S d C *Q*,ݏ;r"5>QЭ[d#t(ByS]}YQp-"Cu5P'@ 1bW £~$TI )^ŕP;yªlS-z% Oo.!#ԀlZaSoRxf;XZ`UAJ$;t#<`(N4;nQwS<Bop(XAsAȿU-XOP:7ޞhH^3َÏ3Z@P*~4wxK9 E^{sz:ij#۩`oLm siTf,XTO FWs`8]i iq}b㔂/4"ʕi+``eBh秶HK7`Z[%d#b+7䩍wHw$HhN%_~BywW-*=r` eq 6G\{|?ڝ0A[5'/nU~Cp'(}VEx=v)d2,js1"=p$,p6 ERrއ\d8_Ո p=x'{SVv ?()NXP԰:֛d&jAIc55̯i[*wEt„PG@rǹNЃhqܚS)¡tQ0$|q.B{Rul.%tƐl)AF* IɆY 0ncj;⮕߾dF!Ҏbbx7_ p nI$b`?"k&y1eD 9-܈̟HUk~صUs*49vNyjZޠhJl@ܔw4+ėHXP;_Ҝ{nHOLm+]0NEaJ c[D Y)i}5HIRLP@Ze []">ƣ}y`]bOsp8IjwI꠩h~ ??9`6;x@)9R0 :IFA훌X8қ8?2|# F8M0BO4+>8TU%\~98ɉ R7ه0Ox`2&DAܓZddWr*WXPֹU>؛ ddfѰ$2u5}xd"'#uQ# bd7hEMPɼn*ثWf]51Wf]b͊,b Ux1Wc*rnjPx.njU] Uبv(hS Pq ZqU\UiDžZ',mZlP3^7)o'Ȫ#]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]_l| `-QhG-u#vV*1WcN(v0]8bf*ثWeK`Wf]vjb˦*b͊6*ثWe/v^*ث.˦*Pv)v NL) MVf(2,dnI6n+4H:vc->;rvĔ6q<)L ڧSN Ig2a*}@!r $[iGmat w~Wl9OōXHEbO:T2aZ\WdS F! *1 ((o[FqVcxv–0MJhҔ҄ !ҩ?N%.:Gт/.4;^W0ؖ@?82NI;+;\`~-`Z}ȳzc\xd IQv1h1 o$..=$RMM0u dHֹ*@(HP&_l*OTA*EEpMc&ڟ|0=n c:QW@ډ]\­f[pM+mH bīET͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*48D(η L7#Ӹ-F9~F)3lcd ~18&+lIocu9~Ҟc ^]ctQpw9bl.<AU J:s[ 05`YU<+풳l سKŕ@PI6PyeNxa1B䟐z{*#Z׽FQUlrpz`]W9*Ư.@ *? &XҴ ^HC|“^7STlNАmZ=ˬ8uH;a1/L J?U=lgc뤢6؟nʹT$ DIW,g) Ħ< ~|e2ww1*EiT7"nU/; ]4OJOGo8kk`/nZRR*:3 ٶ_A_FiU) d<:-E uanz`J)U݇\Āb ޝ)iK|=2:K hM~"!p=S@'ˏM떡bi[t+Ү<|{Aje mPF9UiN+i m^/V ӦE|C78Dm+}o -v\ / )7=c2*8C T;[{"ۊ?<ԄPBBHЊoTݏ!TVFtE6pנdR\ð$ wQ*B]s#z6r'1\1܀j!efjIMXPJoj̪9Vߦ_!q35H!pڽ18d䎝2Tؽ8ASS9+\iQr73IIJA )v$بGAE]$§jwk ܪSƹ^?2d/ާuCH܅GJ~T5zԨ6ArF4569 Iy-j+H5.FڲK w;)_B%h2rbCHv4͔M\5z(u?2vBuC\FlB\ + L*av(\+(C1[};bCGFcQ|2A^#pp]2aZWݻxdA[*z}|V ͺGP< pwYtVN ObZl.iӶ{;-| $6Ic@2AY,kR|zbSocN,m?|k}2Lcb)s.JmvJ2](l( ^6xޝsChhWNTrJv1&HI5Hө 5Yqͣ튉_>Num|HAs$e6鍰+o_X8bX74)5) ;a ,jd`茄leD( ֤{ mOѓ⦃K>Gӊ|6nm4THJEWSJ͹?p -|4I(!uٻB0ziM4kkC>^d|qf4郆/]IF01{F4#p1+&ّi` \ȕ6af嘤N6 vȘSHP=SH)eTmTr.RUv#b2%ϵ;J9N!)tY{`rA)mQPLI6'nl+L(GM&ԧ 6r"4i9ƕ}Gq1n ujqJ83x$am5Qo*S|Ur[ #nzD%Z>Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]1Ww>7(Xם6W9b^v 7Jd \V9fo6L"`P'(EN@JHIs:J}W@AWV1kAVNm6NSS7DSz4UHtɆhnvo_I/ƺʶ0Z3e+3 Vt-WmUG۵rpDǮ\UU;q߾bLBWC`U#c+LUTIh*q|Przo|JNSoBZl6SN9!aRb`oH(;Bv#d(!le>UV9 J#to8h7cz0S6;qZu /Tƹ\(2!j?S412~X Q̉Yb֡z抗ǡ]ٌ 0O˞hkyaUzb;Z=.YV=>HB2oܬnEY:8%m(IȎZXd*S@`2hF {uDp |g#]?(U$24|&(vq\3Cu Gl+y$P{wiLi^işA]|g\1ce*+,40f2U@UHcֿvg w\;2AK/#@*і8`֮xE68PUENMN9%#*2DD8WIe~@ڙAQ|y{NHz嘧[5,7>JZXnw7Ԋf2pňZp,dvn?˛.CelEA ɏ%&IRlpɿdd;ox+([eWƕrxd&TιC0+!`i+!UVrRc3 \,Fa˛j r b͊51WevlUxb͊, Uـ]LUt]*pbc1Wc]qCUP&)uq긡qUQ V*< *RqqU#lFፏrqU|ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثK-:DYG^U>GW%v0e]\UDWcN(v48S;/vjb͊]6*ث\Ut]F*Uӊ+vX8銻51We˦*RUٱWeqeTrV< XL:U;!&_M|I98Ac:Ǟ>}N" a I"1 r,,% {.,qAըP+R8[%V*Q8N*DbI|*NE<'|%W#6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWgTl{|Cٛ6l_pGOGz~_7˓KnY>f~v,8B rSleb-nh5L gÿsiywZV#O ? 9| ͱyiXԓRV>(`U݁M)Q*{cDcl6 1e&u?cL[bAk|*>MU[ xr,q id+ C ?CR>Z |pn'I "USFiT;iJ"DSh:4i?umPPɭ匈`*Jdnmekwo"}e@Kk4EN>#oUY;fH5_SQ \vN?$;Z .JrR ROkpuvaͪxVMuS¶Q1ʬėFm8[5 O|>&O;v^\T~ׂ#E1%)tPAH$ COleUوo YƱn~]r|1A=Zˆ#SCARZ9uhmF^R(h~0u{Cֱ8+2~HI$?cl#$ kZ,~Y   4fW"!dOUtۨ n"s`[rXP('sK$@YE 5ČMP~>[&(5&φP?pRm^}L(&jUZv@һ؟ؚT,.QHAZl4  t^xckaJI&,Td-Uz99,T5$Q uN=6R"\zzBAE f̈Δ (r1+*MVYsj{V*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثKsI犻 [vlUٱWf®f8Wf®\Uxb͊ZKˠi; L4B1FHIC]\CD ɎJpZl2k܏ ˛آ`6nvSĨHQPvLI 6| I-=Dḏ™!tշJ g./y̒\`[Js-C);Ҁi =r4mK[q5kjdlW^XuqX;ԦE'7bn@9ewB_>&+(T|T'm=\pêFQOFHUlL+UZ퍒3Zc AO2sd'Ik~$/ Hf@H%}jY 0OM㌤Im˱)?@ՌF9r彃-~"*-*ƽ5'1廂^ A*hqc"\0Q]5YM &Ӏʥw==v$؝-+#*jdfZF: SD\n26 p Rۃ5})QDw~/]!'N6)% z=$ olRl E?:r'`dcDt&:~^#$V L㑯TCΙ'a%|hf60Ou$oP; C0Αw,NYl5qVF*lU؜ \ypq,J!:a.7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWd^쉿 egtpz5I㝻LZBA;O9'|;}z"5WsazI-}Wݔg6ǒzԭ54ر9/5(kU'ZYܾip@aNUîR3FȒ>ӦY `U_H`ptvXԂ>yӾ4FcC+b*b/l:~xx8 =F$d?9nh*(Co=}&z7LV}DUiBG#֫q pxL4UIֿv?FRe3WW"i`x B*ٚ)C}~F+pov> TfӞ@&JzTV}>2B;dﬕ+އ*w3u&-1TT^C(r@!yk@zWzLj̬ :PU* Gj[NHF"ʍYΗŏ CL皶҆* WOPյ~Ց) H,Zdu;'(vZǡapVa(-M+9إ t&Zwgo7-.PJң 銕*dzoĿ HaTTq'R?l>.+NVwq`KZƻ3 i <FyB۠טeQob?PjV$V(e$͹# mwh z|rVmfHdu?rf N'u ٌ[Ix "7 ]Yb<9Ul M}C b!G;1AؓQ)$6cuDhޤ)R{a( d^ >8hzdo1ۓDV,m5d?Z PH}lj|JJM5-مbrA b%Hڙ $sD)8  *B[?c2_LUX銻6*]LUٱWf]1We]*챊, U1C],v.h꘥q@U­\UX]hFXN8Pep*05[pzuwU\ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثe{/Zlj ˇEJm ت+]{)Ƶ ;ᝫ젵A8![˧jj |$8vZOĴ-x\d\'I_M*n}1֒UQ8S4C}Yo9=iL'~$=J=}ƕ#J- qWqU[aV*[<ı(8lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*' y^](;(Oo2ʗ'0M oWTKm;,Jl (UJa,OL Qjɡp1VhAZ >9A Wiw%jwI(ڄ|U:ήz3#aȐ(WAؓ m&m#RMJKRjvō%M3;LVQ~ĕ(]RC F?uv\`R=:@_j(P7Zn+SGjҐg# 6Ji υ;7HNi_jbMN1vRi,*_mHӓl; U q#힤m׶-|_@O\UKqڔN9M6U;Y?x}vūʃJ%HTWCˡ.$RY 15r 5g7SOiL=8ē# ص(|B9jHj`tˉ1k"6/ۦdą1Rָh-5C7+"FNg8my.q"Mh28L'YS8boY$,7Ye!Oǟja~OZkvݐJdt2 #USLc,!,]#z *6& kВiJ#  d U`yKwdHd LvrdToap$vȖa]7=^Ms !m~U1Web͊/vlUt]LUcvlRp], U1Cbc]U]v=Wv.Y1V.UiW)k?U*8X-updž…Ɠ|TP:;ȪlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU89S[8CχRhH=r+c.Ɨci\UEqWcJbS ]銻1]6*Uن*v*͊/vV)vlPvjb˦*UxUٰ U]SFZ0 'r~/5 GӉe9$Ki\u9&0>t1+jepڽl?lA#25{x̚Ug0P iQi#l^7,ۯїdԛc嫖`zdZ&O,w"UWdyj||q;b&G'kf,b{ vo|y62lzNiTeen=%\:=3d/ibWU-|p='N @)ו/Bj @S|ܐnI{M0j~2ŷ4}Pެ @7Û+N$q kioSI?_r5,G5'DIB:C >/,5&iD8%R˻˛='vOӆ07QRWW-21\-ijH\D5znrjMx2ȰGUɀKUgp:%C`W&t6eҔȲh∤nwfv߶)ܞM3Pb5T{aNDi +h0] C픑OYYlS2m;84H8wg*$R~Tf_ؖyrp' »4b>oXFXIy.ӗC,cɶBqw3bmLPxas t0+,]I]c`W`%7㒙c[%I4\aE9mqP|2hz`d- X▎m Y^6apE{dK"Cƌ e?NHsMH FNJ>&B#H5-!zqԱaZfC' *6dO "șFX1?V z t/, 0Q\_(1WRǰ1I"ȅusKts")F 2 eUF&TJ< nU6UW)1+XV%>T8.2z){ VèyW|ؒHm- SՎ,)x*d>xkoeAo9m(|2Jo5jNvoAF6yCu-FNS͉_ p0?˒ݝ6{tVL{ (uÚ*]rw(10G;t+MR*ۢѫS%**v r G!Z vIAj7Fjld0TY/ |;vz)9 VJD:)քNF'34l c1gF JLf` ԁSWĔO("*;AM! R4xS2`*J _Q|qEci\/s˕ \T%xӡ\m),=Nc;ҽ7 \ْ m;N>Ƹ $7љ8+GN2ʦ:?Uc8ݱ$AbrT7z|GʚNg0mk&d#*m ee =Siq "OeΨϨ$Bm"DBDဍ-$a!wÍ"[PSwbpц `Hɕ0o/؆xiq`0J(RK3Ǿ@Ou)QAM&z|W7jXobcO*04!h14{ us=Wl>q0({pkٍkhk;lɸÛ[NNxǔbHT3r48ė_P!-D:A q#.ORd.y ,i,n^/!Wx QVhkmƆ8ʼn-ҟ-akk<`w8[\O딐ͳ(k0҂U: Sc){:et2w8J"bC f CO4ǐ$QNl LبN|Kl_C5.NkQIg-O@B|kka}rE'6 WldT;(bfPFUد.%AtxÑU#zMnjiE.blRLnMF@ $zZmsmp@n1Ҡ{)-W\v޸2ZvޝL\GbsjN[Tf4+َ\7wsI%)GL  UpQ ɓv$nVa|r[bIDPl1d !pC5LhZw+x&TdzS)&*e' u, 'M"l$ 5I4,6Ʌ{D yFZ4mTThNdX[ƫTRXX awHgtRƦ]9<`YM}?f`w-옻SzdI(fQmhzoi8ʵ:i$RunN1X$i*0Ro퐤 PP`gɨk#zlۻ1w>DP HgA(ڸүCSw 2#%RIy N S% iɔ#pq!-d5 o@?^'VL %ID5 )DX85S 崶hInTS)zq Jk熤ԝ9 []Ƨim|V\HO_a(0J0BFAJ-L kXQJ_Оإ q g Bksqژ7i#=vbM%IYG; GhPw1'Z % @@ s~u |=Dy?z >1#Dsj{V*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb8QO]p+*1Wf®͊qCb\UٱWf*ث銻/6*늻EtZKG `*Pi+YuHĊrx"muše1;,cxS/Wz0^HU^KC$\/֙n4Ƶp۷@jNYЃr`~hڤ5t#5sqv=[G#9=r!>: V;eV: meNk(C8(&,sӾ*֥h|QLH RV;ȝ2ET5 +>$ C8fy0@ËucJ eƑZSsw]d1]3G՛zn+zQ'|B]F3[|}\^ g*E:vsle6wD\ Wi1R1D E)y会+$צgc]Sc *2l_HҘb(q N? 4`$&9k|@zK%`zbr%7(UG1rVC\Kʒu)) &}a^>ԓR3_v#f;%T.˦*bf)vV*UX銻/v]1WevX]]v0Oݯ`+ELɶ2 qr鹰AdlB̊I۶H5I(;ţN+\ _GN9I&m KYx|ֶ-r6SYeOr|Ur''$HI`)˲I@t=3[$+-Hn/6gr,%Wb(0P20q0bߔ,o=OӾH."*@,Sy~ djŲ;xඑjJ MLS~rR{aԒ\oGʋ`)Z'V Oqc+zGy$ƜE*8èFfB̺ DE 1Z*/Zb!Uy<@G"zoATl0J 8Ho孒yc\d9'ˈ[8DTmA,I241]Z8!\MvS;v,(?Xh6) KcZ3 -8+٪6=*.Ed ?=c]KT]T4(`EOsE(M|kY .` 5ʋPd_$ #" ʭCR+)Acʊ]k]3d,9 I$a4=2 ]bzdBN2&&xZaEڕn>#Q^_.BqBӖp+X] *;;~s,qb0>vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf] nƔ~ei6CK8M*tARBew8MZts^uz8/E # vVtyȚaHچ#l]ǫrl+_Y9v>8PZw}&zUh`{f]EcJ ,bm|q6sh{8Ƒ^iJqģn,kfS%H @{W{㌜FPq)(HSn#mC0-JtoR/E>;ele푢@:VRiA#$2,_eJXZ|HmWAY2n*gy#`/H1HoEV[prT%ZBv |0dK}9ӗccH$thC26{$49;b*4<1;-ZR%+$Vp$`h|Z~쬅E$dpH )ewL'µӴ'/Ӓ$Wӕ Y)n{O/41zfN!|I;hxfSt5moe v9Glm]\6cv8)vjRV'iZ8kf+;2 n|zdCI3fكIFv+RǶ ԤGl RjVrӔ +W~щm02iaQwS+6| ,e<6VFpC-O(ʂLZ \a%.-n qኤTܚ`wZv피R MI 05#+;( 5Xt~IPqt yv!b?xbv#-"PGSc% )*d/9R+ᖇۧsZhĐp|j@婿zqxPS2_\VijșnBh4ĭv_〆wL TCeaS xp| Hw|' ߧn-4MC)I$ez*+S܆UF#K܊cj$ W݆T'VRWr$uAV9`,4>FLU ┣LiG˧A׍)Ac۪s?κ~_gKk<Ba%pCOl]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbcX*RF*n*ثbʦ(vU1Wf]6*Uن)vlU b{nhftZ G \صx(hS'jb*z`v, iUQ)-O s`J\לĽ:d=ajK&q py1R풝}1{ ΈđcMXgFH4-v ]YsĹ[qcډy-K~Rizg.HosnCQi\W)j}ipt22&YT"2 FBPɱ)fWĚm$$*1n{g$Uìae]GLW!.<75X\&UB7HKtzVwio/oIii~7V3@w|-mA GNGiң0/Ͻr"X|$mڹd]eAĊ3\B :1PLѦjy8%R'Xd `]$EzSK+a >O4l-HIN/)SQLɎ iH°ژWuJ=&cvaj>zZosn&M2+Il:`7둻dSJ@mٸo b,U\FA ][";JYIl c6F"03bvlUG51Wf*]b(v_Rb˦*x]]\Uآ(v()q╧劵LzUU)h僾*㊌*1;bͱ0^$(^rULثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثɧnظڑp## &ԑ?yP6Tb'6*+]㊻(*b8bf]6*ثb˦*]b8ـ]1Wc6vl*ثb˦)v9F*p]G XQN0/nN|C31uܮwc@ qp"Sr.nd92}%V/J:u5loPg;C@<+g=)Fl3H T"zBX79pjzҐ">P>2UQ2E7ɇ(638}5! J H%NZМ-SRiλL2T'Cls&=y,>קͥm!Sj|d=`tP{4֥q0HCJYh2 jF#~Վ U܏cho5I?'( \^^o]C V#c=f K5@Sn%i1Plpl')2yZK}GE|U4J|c 8E(]MWo4X硠:XDu&:0쓸i?Ѐ:*g(*{{`ʔrC8ԣU_\2npS,HMw5+M:S ㋁AC @ڛvƙ5U ɀ֖)9%Y-7i+YTmBV)H<$;@Mw"աS&дз2~y[hCܸicYiS@2cR}fC IȚ.Go$23㔂Zl|AogbHbMvDjzGg:uŗ\8( uXR]+GLjPDz Obߐ`<;M,yh! I'$6qo\jу|x]nI58?j E Sa"SbG)q!|lT-;vԥpڨF)& 7qKi_|@ƕ-v' tō@Ū:brhVPv2,Q7Tt8-U0T h7ǚ+ @ZEHz}9_Bfg3[r:һ}s*!eĚj"sWA'lj M(M=>mR0Ē<&鉑&I ,K߂b@n@A ],x`{֟p*1`mjz g$Ed, ]Gmx(Nph׋fzZ`hm\E9`bĀGnһ|=pV˚'~D#L5W|t=pEjr2 Qȏu.)4$v`O)2/)D.GnEyRّeמkpƅ{&I7fcep.#9bAJ倰D9wZ\ cl ZZ!lH&צ"֊{el 48YalqK`d+k|n-KgEKeUضa4Nt~n/ 0{VQmbiRa|~3Pk" APZ޻v|[e>k {eODq؃27c<{UFDmHPƧ|(?D3 `FaS@4ֹp+NJ@Y5¥۠ɖ崄j^IW'y5Poj#QdcJӹFr:bAJn. Clu5Z-@.֬c$2+7:yj,sNdxme/b2w*OPAZjfM2˩ŀޟ,_N%|!-ɠ邾J:u %&]\@2LIQ&h3TZS,*ƴ JeE?ȀTd$kkG@+% U~D|U5.cEtbOഇ]h"Qs*E ڸ6~ XtԋĖ=qiUH 9%";zW@d@Ml-ɐy7OnSQKCTwy#lW^D WaV]׍-N;G+ -^IC ;U%{ xr%,WQnd@(A \aݰΉ X X{^c "TVn q岕%ꚯ˪T{43E2ʏL M0x+I[%! +N-R(1-MQT|K3  ]}!Ubɦ3(*&QܱezS cKKCrj0@_Z^̤MwH{fiTt]" )3&y[N[jO-r0iepF0N&gd@}>i*j倱ZF\gRtњ eE8*Xd d~m㐴uǨq%+ nN4Zi#rc}H^vhpA/ɶp;$O"U bd #ޫ2"Rh8]&hhT"$z QhU Qkr7mƔ<{b(4"~a H<戬af'zdb6o.y Mjp;OQN4]H) H4MjO&jh(yx`) ďG-!<ɤZOݎx}@Fis*Pxl$8?knTޣ R "&\Yf]yQd1.Q"LKR`LЌQAelUcvV*])v]1C]*p)v`1We/*zǁ1CE8,RG)kG.Y]LuqVqKM03Wu2U mؗ8ӋMrʮ*죁͊66;*WevQ]U٩, Uو]LUن(vlUt].®v^vV**Uc1WeU8>6>g-9|>MŪO3ߺhm%NLٙp2 /aD]\wɐOA=8{Cu$ n@3*Z8x,zu0CH0,˒;qϑG#{peڙ&H:`_/ROmmq ]N9Ee:-A8tmڢC4baE64D788Vbn8Sn,}!i;uck s+I>X5`dZlq=S늩(@I5S$rro+%E\BEl!ST nyvUK۵F2(ى퐞y[Ҋ@l4ˉ}BLfrqL/٩㺌2+HGсg;):#KwcHzG݂~w/kTqiآx…L*&l`[W9\UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vI|)T$fi L6CSE{wVJ|^j )sg|FܒjA٦9%WrVV#v 0Ҁ )6%n6 ^X}cL w&sn!QS"sjxLzɑ=Cw3AEEW)\nBr&NH )m7K}jk':,dq>n}?0I xdUŜw1![WU۸'7݇ߕ#( ,$v4ʈdKKKzTT71"Mf(+RĊ`ynJzW?4BV -PwJ Q&OLɼ`.y>'-b>9$\P+\쳚 <+jadByt߮(wBm4%U?>/ kMPnnOADۅ`vThcf;TJyGurxSxwjTM6[a"9xWjWT#ҹ[0)cNVxrOidJYB|ac"}s' -S BKx9 Hd5.I8֎2@.X =XV&rT-09sKt7hu12 ;v0ɱ/? 6I䇺R3c6㘇w_[,\BƴcF)߅vu#߹S &ֳ54֔ PBM@5q}6EScf ]+45$:4)R#7Zu3hy*o t ;alv5[+4;B3|clX[+-ؤk83x(tY|; 2"ZjzKrGՀˌ-52E>HF *@ Z>;h 5mS A"$krKG5[geI"*xro #h[~اiא0RiFH[`E11e$b4JEuN+BF8RܰdLuy@K%8H鈬Hr(e``8FLc2P33(5ȥ7+j''me.1QJ,0DnUBZ~#;`4-XLBSȈ!/6Ef |KQ\Xi?2;5^\_fҿqrHIt Gӻ'*]C]2M kЭUc./j&g~ZCORæ%l"M -^Iud6Pӡ@М4=S[}.G‹bPwa{Ioe0)| Ga˧A0*`q(+$#2?bcj>pHs8(Du _ڂ*{u&g _$A<;r䉆^jsEؖ#&'1 mWi.)vU1Weʦ*1Wf]aWcp+—e, *챊LU1Wc(vJZƄ#bӯ+_nm^KlJK>#pZŭ&NYtvsϷlfPk^mLA)jBp59`* iUCk"B-us4U "+S-@iu9B5S let.'/W &֖Ǎ-c\ii>]\ՠlPMªL,1J{K M;p:OCQȭr@Qm% ~C#%ʇpFDkse;' 'fjdK0@SRiQ*%܂ENF^H@R7*D+_p0 DZ:>;bT3"]Hh~RC=rݬ$YbǮ)v=0ӊӗ]MJ:o#{CH 2Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU(-@jA4R&3vTQ/<8Yu=N,6S9&4N(s*i9SlMh9 lñ_q@iTM[q cȎN=8TenB ぎ~k]"Ps_ M!R*LUF@m*idY*8m8UJk\c`)h_a{QAݡLf5 *C]iTyJ ]ɶvpվ%fg#!ͰnM<|5!i1ǦJpa4Ewa[Z^D)SH'A^Y[C`hE? ! tŘ-N+OI@X SiPl ,H i튣h%6!CE6-8d9u9~Y Y=@Ӊ: WSOl t ~Z\r=j_WKP}8mz445Zm۟2ƈhԡw6tqV<)^Lk"`QH8`_Aqq[}jt0XOm6r_\a:P#%kn-Ң1d AN+C(oaȪujƦ gUԞ=ݍ+]!EY7 @Wgqr-֯%q~Gy* Zry1(ÿ"W7>`c̎A$3AJ#@ƀ_pp㌄X{e,ݙIEv`?VW5AQ>E mIb)J\ IcJ`in !M3 p &s̀2юzt thAK$Bޣ>jS\[Zt- .?h{iԝLdu }-g{-ZYR +8R}s,gmS"CvڙRZ$ִȲTN Bb?:H(զߐ;LRFҢMQq8Ӊ. Ep+d1qAr&"YugtBORzG*ьiͼ7;{.A:lBmRFm L@ZadKDN5'ljm+* RܑLܶPcH.hkZVƱP$Ke3X|SIT}cs>G@1LTUi8 Y-njOL*S(oB8G պW[yDZp>h:d@EXhFMcj4bGbj iL-"WtLvƲA\;cbh$IEwӎ .oVA!AFS$9"_SoHP6V,@nC7H=W+% "oJ3ORG`Vr-al#R(U|eޤ)FTEbwa/RW;tBLP=đ̳7C#Dj:_'_m|0K^:~Gsιk"fUP^ kjWGK-Oo]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb#v.Fv0Uَ*Uٰb͊]]vlUXb͊/^=2q1.kw$W2\8*-赖(F&$. `M,cLMH-W|N9dK8k"*oͩYFM'x$$"Pc۩,키Ran᥽2-@OH3('ibaƟx-OeaedG8 4T[QZ@deBFTu&*IFHaCwPlm\FZڸӡvţn:!cmcpu2Gߏ8 kv% pje|A>Ɯ3 lK@%\q~)-Zrmp[;RR>-'޾CZ[ 0(]Ӣɐr* ;x S&Mk7X@L݋u*ʣa57 L> 1ECf w411&S('|M[֚05S( 95sn%wo]%SME.v;d_H{? sjZEΛ!6fCxT`>8eq*qK(˦vjbv]1Wee ] 0.*x]ลqVT Z8Z8bcZ'r*8򰫫sgJ|US6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*;c ?`E`[]vV*إg\UٱWeS 0銻+vlUٱWe͊+vjbLUcv]1Wf*ثWf.1We\Uٺb]1Wc+b8_lbgQj2% d &C3uyyl xj)f$t`z-~rw97/Qyo|#LB{aitw@P@vխ]|K;d2`Q XP7\5j"ƽg]1>̼\~w~]H5Kt.uYvV,n:ሶ,Zj j6vv2mq^%/¦'-oyGktn(Wd#YcWk\lCLIPdv2SF)Z3ڸ)Pާ #,[fP (]ʙ֕ȫZbX(:H>IKTƚcXS뀥ծ8h o+Z\N9E7m*8UPqeHyX\:C ? =@Rh~E Cwc{9ewij L_IHOQ02Kw48|8j7 B%PfW2(G 2ȣdX$w*yqhXK9ӭh;oV* C.ʺe #S_u(z~pm)MhqmNW[PaUqQ'1Ur |'G c|Xf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWdyv?ql4Go$W6[ϛ:۬I]цZ9bE(+c.%SOBRv([{D$TxbDYRըK_S߮ 18- 9O&Xu><\@}&v`Tc*`% 6'o,m.Ȕ(z޴=2)^iJlk8Bg{V|_v>BNY`v;`VYz|^9 W(]g?}XhvĊԁVBByes,@iL>%Qk3ڎ "#eM7N^HH2 }NZSQqζİI l$Zbo^4]~GɠoB%cro06Zw-km͋(nmJXJ u'̄)9k\IBnQiغ-7mT˜׻: ʼ12̯%AMoS"vRm|7""55G}:Hܢnw;Wzuy1iG{x.$ .&nBE;P1lOa7TT5}`ɦʸ(7햃mV_z`7JvUA6źɆ$x (.qP2D6 %c=B+ :z;EȤ87]۶L`*p7M:f#%vWpDlxEB$2 U>+!A^'l=m Ԑ2e͑u7%*֧0Ԝ$0WXxTsT:mlAF>$mbڻbS;38T֙ fI aǝF`'& c/ӎ1*<|r%MWYjiұY XHV7'q$(h)~PuR!'ģ#ߡ)vs]8AG]%1l6p*L[D[sژ<R1a{펍< ^NH#k#텬doCwPvWKu N@ 3Scj樂P2ǙE[%t8PF½CN-V'SL'5i¦z.}{qDjR$|ڛeTPb:nԮ;&F<#+G|Z Ҙ-í#}HV`4&`{cBRrf q'c 4#Ĝ`%[Ȗvz*S:&9LmP~"z^saJVr~ѯOYbJEs}!]jGX.ƽp; ނ\KJ};/鄅Q qAN9Ff㍘l^ c@Ns֦e9(g.O[PnfaŽ UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb{}qW`(Wf8UXb͊vX]6*ثWe튻p`h;LdCGZe8Iӗʼn-S1`V5\Bo@1NeI ȺC*RJ" gʀݱqqL8ӭ=b TfDcm2 .=!F zcOēlUmڪ>X.l2Ʌ͇Lgt]+teli/ V*Ph)uSe["7X ~9<Š3C𑿱e\"$`x ӶB!L% 8p)QJ̄xx kQ{J|*N@ʚ!My(*x Uyac|2t(4yk=9#c(^s&c=e^B⇨SE1t޵U e7M ~XPm#-UWj‹\|s*O| WvaCv*7Tq"iV;o)R A_򽖷 0#b>G(!.n~W<W);uo+ Űm:T?ld`^Aڱϴ3tAtt9);V]vQ®́]LR.v8m] RUxbeRpኻ=Wc(v( b().U偊bh1KT'7'vVo.ba$i0^"vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUm5AO: p3v^*Ux͊+ 6*챁] 6*UٱWf]v^*ثWf*Uن*إt]1Wf*`WeUxU(0+H~\zgIbQ Z?6ˆ}z|vFٰ&Hý8updN.jW4d5v1E497*(XZW8NOUK!BÁԔҟNM"le"{'wɆHH;0CO4SC _U݄Ei?,21$;X7ic:ٶh)ӟO2 Zs !l>|`8R#rAJ߬-A=uly(9 GR $^ˈPZ 8co#QL!m'\,FC 闹Q*Fn;{b2Lیe(8PPŰVC|}+Da \P;jo^i(푥plF)j-*z )57T,l9' @)+lH` h|[*{mDWč?eY%Np^wGifm$Sl6`SڒWr0GfidxclRPՈ툩!dL[ep@b)B+\',bM 3hz0K*w4ҿſy%D撁=\~X@ '1^N* caU5Z8W)__Xx#Bثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Z2iÚKE-^'6Qs/g->T$S !j=3A>ldp=7K6,|G%^#no7HVy\i^/"fDMdžtKĔz}9GUԖBm ] e Ay P;9݃7NJ2+ᑛg&uZ TbM#c큉jOo^+p`Exh2@bf8_-_&ՖJą)003M{{ ^%hg Lz"=|NTydZkcp?d_8Ó#؍a]ikl\H4uaع9U0~ZT#Vmwaĝ Y0<403 d%`r5JWpΝ"S+xAv ڀ u;*;GV;hn )(Gm)$%V S) $T풶k:IJ KtȒc&2M($^az|߮Iau)<6 5YB+ㄴõ=4/01eeP/k@k(onKApNsv7{r*h偽Re$V7($|<0L3ﷶ4E$⢣[@oN0%=$h1)F2)l!H( !Ni 'ES%E`WbF{*qiQكN厶>&  BɡcrvLE->#Gd-[ A=}DGS 1FS;uT_s' ¤ʌ9*R4a;z0<4,ubndP;9-TmDeVn }9VWhEwBVz\$F-n}&'w+Jr%y!"!_HQ&s-^ZddoM>ĚP~{'hv[.HԗBjƧ|O tDG?iF'4mH=1V5c 2{ >I&{1kx%NqC+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb6&|*F*iӊ(Wf]vlUXن)vXSvjb˦*];, RfS'e4[6Jt22D -@ MplzK DUX@_|<#WYEs6)R*%T)eP7OA~IDzj1 Ɇ$cLxׄ|1KmdҘTu+'W-2}"U,fe8[ӢLU|d~2r=+6e^uq2YLd͛`!B|;ove [ EyJDH2 d Z -FC%=2Bہq0`l٢q!$a mYgTbpYژQ5ۜN>qlzU$vQkQҝ&L{Tw/4M -}VP+\0c߾!IKugbyx#ͪ[12d܅@Jf@h%Z ,7,~XXBITc+; {bm8] e2Q:%~20H> }9~25z_n-hn]٘ z55Nkt0$  QȤl D-Tu;J0|(E07e0ָQN L{ |4%rdSLi-;ծ4:f4o㐦N2(8"UIz9o톕Z64+4­#s){ %1V5>-Ud6(^9`^Fza kӵq2>(UoLdq!@? ~9 qk` ^FZPfzQz YNKCcV-v.zKX~ky'E2^Nw{{͎-P}4?'FI0P=Y=ƾZ6o_.LH/.NGd~xbaC3. ? @ܞioxaat\5-Bzw=2b "Ֆ%^&Pox܁11[hL4;lT3X/[fK**XWTpP<1VcUR1 J;헲 c1hJهW|xjjpZVoLVj-zS%^i/ʵ1%LcVZPoLT0{JH7S펉(?<%(^d w#"`<cF,~-WRWn2)3X@ A Zh,EY/ר%e*ĩ4PhԭpV"['V8dd9(r:$ޕ8L)JG)-@{31F@lI> {N[J-e޽#s۪H͆-LJͰk}Z2 ٝLKH"$3Z6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*08]*aWeb͊/vU1Wf]1Wf]vlUcvlU`band}' lprcgfB6O?Ucepˑߠ홢4JaͥK N 0(CֿK]k =>YA]TbwcwK}/'2\gmЅծ~BHw>ra'A_n%v%xfEjvU6PiNɅNLF?H쫿QwWbl R } !$̭T@ `GN8%BE4[IC\|[7\=Zo6 SPɸS@Tt؏lzj! vʔ&}'2Rָnj%l**)Ej7]CriKtp~@鋛HnFc Ē]90ܰqO9,jn&~fP5 *`YR+$""}Rᆛ尌$^.=DB[ [C!oэqq<$8[ɇFJnbZr;yYa5'|e6.+O v2%q]Ju*N3ZdaˍԵؘ6|x+6{DDIPe !\ |㚄`[q]+mڹcî(]LzS66J \Mq<hu`1UH^mCۿLUmȖMrPt8Uq4Uvk|s\)i~L;dR*Lw)L 뜓7w)lg=e$A6T0f2va.L* vl*ثإٰ+oʸ`Wv=TWb]\0XbLR1Wb9`K`Wc lYF*|qVǨUi9o]\M֘p9A<(V^I[͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊4A908;0.͊]cqWfqWeS /vjb]6*ث*إc;/vlUٱK*Uٰ+]6v>7\U`1Wb;aCG: $0u/'nM!dnLxO fTKOb3w5"z`ȈM--> {nTТ +OZ"rJ!NHmuF9E9auf V!FXP[FZdw@(,|0TdS}rzS{ ImZ3 D@q2Æ^GuS!;;!N;C!Z蝇\Vb9=^}FReiQ*MmB9(:\Pdv+j=ac8JYͥ*;X OS+nc mrHޔS,\w Y1VISOq)T2OS`l1iV´שL; QKQZ~9iv*Mko4eNCfFx-W@+5 KRޡz kRG]kz@k!R*%[NٝH"v1a 7妞j V-O5u6"0":vRP!G 42JGL HB*2eJ96tbuۦ.hfeS\U1VƑeAM %EC"/͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb_+aԭzS$0QHۣ#)FzN<'3FNPk-"b V"Ρoa$`#\z$h*Epf$ʡ$N0?i6W+''q r2m1#|Ua`F(P \UPʯS]eԑU$MLn4ߨL<0UUqێl[eәiL(Z=%+ ʛ iYIsQVƌd>4i d 2+/5IoD뱢b3ZaHUBD0uec#z;'W 59廜zHhosAOOJ?dGZg6  cCDc^NTeSHڣ ]J|뷎I]d(u1;CMS\ `rkxሺ2kJqBpSew$d;D>Wߔ!N$VoUjF HFC|Fܐ kVӯ)×k-s6KТ5if4$eMBHcxK*WM-OL3T n >~ MAAއ'|&mBL! # 1X w0֛?1r=FcU۟LI,HJҿpH@lFCá9WPpEi+]KvT rK#IV6Թ߮XE)dI'CKl$#bDPXPq;Rw1u4&5Zș2@_ٍTi" :wŹv;PH?l:9)5`ǘ@BYܒ9HP AOAgiފqאzql2 P Ppy*k 0ʬAڵ;N^8|x9IPz<2Xԁ!O5ͿEQa5 Les]r Ȕұ"z :x{f?{ouR1Z)9 4c~l脱;0}:N t]xH?(mMJPW`q3];8-Oj9حE1sUըPzV9`xbCZ28 /m q \भlR64LԨī)L ^œdW5IĬ>-23Q8YkȣO [~̒coq=s\zQT٩.®L v^*be]v<Uآ.*qAZ®lUٸWfvXq1ZZ'N)jŊ[1BӏZnT­S1d3$GĪ| lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUqca`K)vb0+bqWcN(va]vlUٱWf]vl UٱWe]vX] ,bc!٩/+ /vlUٱWeWc*U1WZ4@NUh*snZuOͺL_]-?Dz{9%R kgά2F_Xju%)<S*[HFbqvBI~/ѥL1R!v]&~JId4#"6)oh%jJdˎy]&8A$m <8g /2?]LO'{ p)ˑ zVJ :W'_ʘU12]o9"ᄱ(ȡS6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊inR&^ԏHi 竴SgjǤ90GM)i )¿ 5WrDMy仿@r:Ƕ!LY^OaͿ:R0ȋ#VH~H Ky;cLVJiRVژWq"W*4튪ewqUqaU{PS߶bNWjh qȴU*ia-JeTkZS 1f3PS^ ; lF`4ZkG!UmemΈ>=y%oɜ _70XU]K*Xbҭ(|*?8I. X%^ ;,wA覻ݲ ^5RgIݼ~ %PsVC\A1oǎv5~;`K",VX BBjZkΡU J%FL4mA&Sn?!QcqY8|6M o9q9kұԦ TejeCtasQfmN~QB@[_ &cpH}4g<'?R7S+ ٬6 7LIkcZ}9vwI0.]lT@'iVAoȶ~"SrFJ'6y\U5CqCc۔TNcqh {cstTSUf4=Q\2Q0Z+ڂԨP)^vP~oH<729+d02A:![Z]*49 QSCkIpߦDLOXJm48e#NtZJ ZL xM(pDMB 9([(ObpH5ҷ1>?-rIլw$dmMT@TuP/clZ#OX$"8C-1UECxq(Yw#N;dКNKcL+{@Hr|I,=LʪP!n* @ v}_Q~?g"vX*)jCxefKn ^¹|?]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbm犻 Wf]]F**U٩(UٱWeWvlU٫6*ث(v ӬZ@m-njȸb˳HTtp^Q]=s,:J݆VO%%2z dpZW#l7+Š:+m r1[g16xH N& К 0M 8y6(' ocJ0Qpyg,wܞEskPԉs2خl"}T2u&)"`k8UA^d{8PK4mCZRWBID]^Upkʄyj8QJ @* =p21`@JM>{im&-a4ZH JkZIW8EiZ\2S(קPrVn8i ڸYy3+;ٯNQCzw{Sz[7v׫q"bo2vqd7yεhy9*kd+dZjw 2П:`k L'fBmgN Ǭ#Zꃂ+Vp<}YzpZ5`&l%"QWz`$+&9CJ3.YĊUĸ:~Y~LfS⧮ lZ()s%$ -!cSbm#'mD&\k1ƕjw6+1'nl`BN2@h(=2%kKF`˜)*Vb;v ZS2wǃ%4s_i }9M8UAør Ivo+`!nnv4 Ȑ[s('퀯.B*~#rևFr= ξn[X)k; lza{kcA1-`r3 5rkLe;e+ц$u%Gщ2G#0wbi~xElemF|µȶczE1\h~C(BA;bSإuHp@ G# /+pêK~~ zǾ\"GщR m+(v^^Pr;ٿ dO3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثkW"HqUhTu5 6zxMDrzO#$]BPAPv2pտ#PhrDc;Я(6IJ+KLĔ[mh6J%z@r!1zY㐀-7' bL%"xʚʦ0 */(UM뉍aB0(|e)hF.^AUIzcYli 0+_IR@?〠.yXL GQJxoC~Vz@sM~X844X>x*er4x2YdE((r)(5r5O$p;a»PԑTS. -No!;S|OM4X0,⻂hqWaЌTjkOc ۉ;(`(p쀸Fv#])teoESQ#h*ZmuLJՎ lloL*u!4H1TY!N\Ma9ӯKJ z2N樣03,HF#I :W\Gh\YwȔ8z. 'mjUҧBGkҫްP8ETTӷL|HjMr%\ʡWjx>*&6=>X .Mi AM$pqRY<@$d _78sKkLͲ`pn$ri=4jM|o()<&նi`jOceT%XA ~|E2 U &vR~>4j8`ln ޽l)VI'}8Ԭݙ ã[cl lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb 4uUjF)vj`WeSvU0TL*ث1]+vlUٱC Uؽ\8IF&F\ ,:tDQ^oa!'# t陴e'a?v41%Ĕv?s ZIENiw; y\zs6?:Xh[~$ao-,ajοhތPگG|gxP<-$2DkfkvĶ,NmLC }#Tqg]ZַD6@F6ʞ07GjeReENCc-ީd )' 1@DlXzU4ބ(:Q\"b>UއoIVa -f/VQ";|B93ͧS+兣Xd۠\e"}w+kLMz6 d#sz0T> M6. 4Z$?"m%m0J9,$D&`*0/ S]I]T\*찾aqWc]QQq ]󊵛v8 UR8>i'PfqWS7cS0;⭁Lg,(o0| u1Ejↈwc|Ī酘ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثECyXWef].͊6;(ͅ]Wf]va]]vX]]L*챊, ثbvX]iy&nӑpі]W53,`E#_wb=R> y|EO4, urÛ>&_l%F*~ziPKmjS &Бxn %rP+)!/p?r4[sws둱n#p9 R/Q)ġ-(h{<7_A^j>Gn tHROg rНa BrC j1uRC$OTvzm*aT.4]}֡Y'e9 /: FB+Sdž`,bMd#*w+r&E2 ;ц6wtc]䭬JN;f;b\( 9c훽pV fKR1'(6渨+w' D9g,,P2 t=1l&wJ~*xV8j)3CB ˓贇1 SIVw€nzט=8c+$w5NoT8mkwa4(2r7Ĥ4;d`J*A\M^H>| Fw)(&"H~C"jV6UMiO\^9rP 닔Ƥ0YA\XVN"?$R{n &y{o8b`W8-0q+-h¥%27`f% ~E Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUЦ9o&^+Z5 ~fָ9q;E&7%h$)/LmF8D (N'K zWzer Yo! f,n8SƨKw9E5ZƄtīTj>^f`Uϰ^MԓV4A B9@;YR*Irr%)Z;{&}9Oƒ7ߓ!OA#n$qTd _LɔvHQ̌qt! k1ˉ5#jxfP LGP)듦ؓ 嘩o\*媁'A`WcBzPb}CDq<@-\xw]c/( BI}y̭j)+HBH=CǴ4ߘ@7TyDщu`#9[$), |H$_L*2lJH),|⟜WʺcfSa,xR55=s'EHeҘӦ*b銻,beWcpצ[͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊tO1Hv8;51Wf]va'vlUٰb͊];+vlUu]vjSv^*;0Rثͅ]`Wf®́]1WenjUiV {:½biBmbi?IΡknT$0 8 v [rmF(Kg5_{h:.fA&)j3j7-r QO-T}nSѤlI#s8$%(;eIn\R)ajQU1"2$ѱ=f9`i-h2]#M-:c"_.i"~"=c&Ch 'ۧ t8}RU\ `v[*V[9 p^6!TG*,$Jʋh*Ow~m $ # ,A#`T<~ ,QLY*S D4xƕOhcńrUYn<.YE@ګ~:"`}<_&)c;xbz#L=ƅ%vZT{f덢G;V8'ĎXc1&*^C5(qi0Lԕ',Y@ޢ!*,vu$+$u49̢TJV,V 0 <*oxGLT+2lK$0r&m_|6 QyrZW!=Iʥ>+B!*5ҭCP8O4R\t^Ic[R}J,kJ׮$h"B#FSek+q[W*7;-Aƫf;Y465`T#dKM,z21Elw]3\b>|ޢ8A6\W8X›T\XC5=f' `E(,pR9Su+ 1*؃| AW> W6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊a Yk &>ƜkȬ?}?:ui™w137pWMFa%[ԑʦ, UYM%>Xޥjoow4h1Ev jVURxZI[$ԃᆊ@Ũ[`n\r; #=w!U9G*&aTME9"{dPw 2V6…^UTDQҭҘJd.\qKU,AaVom69nȪrL{uJ@dN v #jzJ@+dxm2-h\2rOBլk7XE䄸G4i'v Kx.z ח_홑Yd W#j`y9I }ώ*r78UiWr*}U"- WB2j킉Hc7Y_3h! bzZN^"rcepq֪ؕLVY6-7q(jҙ&Ca%,yP(Lǜ3v`Es)Nb_Xtb"Gt`Lr@LisȅnoJ<ǣJOLNF[E,7u[}WLS #qHL4@m?VeZ 4ʙ=5;4N B-T{Sʬס, I#%sl9'Qwd48 }9aKlqNe_+d)b6 2H݌te?<#vaLz{eȪdR+\h`cny-fNOy P 5@@rJݗ&f@90*M- XS|[}`Xǩr-P7Ó۾*ء*ݝ89'pҨʊm7̓ZB]F6CQA nOʘẋv':eGS\hLM)76)sTtz${~Px diTf+ꚚOlYB҉!Aҧ2#q$EܕC;/sE@ JĊd)i/J(RDvB =0ZAUS<`YKhh_PF#ɒ~*[jM=gZa拤)~v;q@),F&z/gZ 8F(Hnr2ea0 ڵ0J[ Y6zllErJccJqCg43Oh1J·_߮w5T|-،g_pz¼s^**~C:hW'#N0מڔ wHXG^/6݁8Llp18I.pCQL~dd,O2ǁpu'af\MwO͒ah`ֵ5_STۦ[$M&}_S܃p:})na() 6k1M$wT'r7z$$)z, ~iPWl^wJˇ[%B[t޹]K7zSuE3P^U$cvmZ&faW|sC|V*wƓnEzmmb9u2E<0+\զVf}mNR1KrmkLݩC}we@U -&5sW:&̋Kyde|\NxN,hu΃C}jtڳ@{ۙz\p.1 T}AΎi\e,wjLqUqHTBG߄^kT즟>ٍ^,y~խexdd$%>|`I51no6+vj]R1We֘pw*bL eu1V ~*cLu1lPปKLarثt-|+KKS65cD<0(DdQnW2Ȫثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbÍ?b16+ 6*pb͊];6*إٱCWf.CWf.v^*ث+aWeʡJWevXن*z'lU'VEsRW5vbiGQ7ٓҀ8"(̜p|-{uҭ`:}ޚtp٤o݊8*dgl{R`TM;W*rTE}GF(:W#L-&wbz!(7'(ld=C0mqENVJh624~"?^N!==i"B^Ȳ. rj ivb;O^ߛP#jPb>H P~9KP)LFpsaEйRE0тLH^CxwL|ʷ<׾w (䆣29t&=ᓀ#Q@g,C/~؜(VHk!o2ǂzb%GQNߓ0 Bi[m:Ҡ)lm 2.P[>$'=:xp T٫LLPr !5tmUUsJCWEY\VR{b6Ƈl(S8cJ`[߄TY?'ㅳ8|ZLNT^FbSJ`x6UC񒕦el,1Ҹl@HZ8`FŤW~*ZKzZwDjA A€Mɀ)$a?v`Cǿ|TZOq :bR6vަh9fIlSw]r)Nj7?,m4^l&ny=+P%=YHLk>A,7:WZM1"( zӨ7ywG22ʑzUЧ,S\ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*7Wv5v0*n*p1]6vl(vjba=ons##2F# 8^Qwd˛TuU)^&yijkNVeL$%m$ <{3Haƾ4ڬ{?O OE^ԃ-D1`#H1J%,rLtkM/X$\TZW7ۼIv} VZ~%GJ}˱j:/9d|0RhzW 1DqEVS+m-E>u?=ZFv^>-W(xN­c2*:`bV=p5Qۮ 5S 'X$6+zolIH}n+u!)7}&W>i?7`Sۥ{Gl2gƴ)&a%>,Bp8Hʀ|jjOL u:̜f?.4#H]Ǧd`Zdl(r(W*7=OlZH|IRIdr6.rW ;|)q8$bnS9(b8b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbmb2ffUٰ!ٱWeaWfSvc]*U٩6*bf]vX.͊,b] *`Wf®́]S /,b(vhzDҎM*|p5L%b|tMKI.7[7]'@:)g {(z"e@Nחu$vBGdA,Y1i ' і6ƞbƥ }ϰ:lL4/rBOe.'nFan"/Nk ,'%i5*{Tvl)l4 >)џ$"5B S+xw+!Ą j"% iޙ`, G Jב#J,%iXlJ@eLk ,IDž O 1P:"@P>4 +ǯљ#OsbNGTƴ5bݩr&+j,EyoVɗ4^1Xm'H3|C`=ņ>dSI`t}n 7w, oj1-=pxPC'jv0LWڐ:<~mrsM_4+!:զWc 7CE<dv` =!_.V Y-yLVޡyZ٧{'€3CRR{bnUQq3fqW`{Ⱦ*qW) xf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWevIfj?_͖u*sdJU _R%z[;vu+ gsxמtoV?(jmØe3Ew$n?gJࡡ_IQN34{Ȏa<e*o( IIe\ƃj9ai`MMU~'s?r^-#t͹C/&\-F<\Mֿk:B+Aܟ閁{'2t,RsSP,)̘AqoIAAf$bQ^#\1;VAqX={ ̉`WLYo"BvŤI1BB'Y@w8$d@7\XRT S=Jق(i.ʥp%نv;v8 v< U`bxc+)va6(vbqWeIo0]A\U !F681FZ'ݥ>!a^9ƮP]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v)L .XaCKC *ٰb.8bf]bf® UٱWf]1Wf]#+;, ]z}aぁ*R9/S/zvE*12jMoաGwU՛5Lf/v614|-R.;t#1&;BO\$Ե=5ެsEB9>2q<e۷?mVEoa*֞8P_X*+a;9.9,i@O| o\C2j$il] N ĥ upBlrLcS>26`X5nYAB7*/QLJ 4KjUvb;p! QuCWmzi ,/RB(4=kRrlPrTM*Pd͹$Ub|3VHrxd[K#St26v w&`jU"4_9->TW#H@UNŏR=II;!9$BOկ\kK@GP{b+)mLL2U6S kL(Zԟ,GVK&[kQl裻g7׵9&r*2$7K%Tu'RǓfd0GւhrLW bIm\1xUGA.91aV|?PTW= UM > 8e؁ |!i#Hƌ~&4 `D|LHQsLi ők(; 8ҝ’ӓTNͿ\F_ef|=: 6ȕ撊:mK%:vS}rAv# ҔY>ebYjBosLBivnDMӦQݏN; ۄvOt@"zt Kt(V<<.f=1k[V/U!P6FVA?|Hl h,DmwcHfzz\#A]HZu82QSQag>$rtB@FzPjd[_a+"IJ§<@Ve=aVԎ0Lثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbV Y+1Wa`Wck]vQ8)vV(v^vU1Wf*th\^ĚR說U7\"vCh>^^sLZZl41% {xY0T4rx>ؿ,M`;s"Rt~1ORwba?% 5SȿPe1o "R0DC-]c“Qpz ́H4s HS `̰\bʭ4׮ brVb-A>;'d+,1Ht4CiJǯP0mG'riqĂW瀆#+>i?ĭožMͻUd4qzڞƇ1NB;2%Pu"n8pdQ8M"ZEqه_4|&=!~MtQ8+Ȭdl /M'Uƅ|74(~_d%Bq tu A3IGt?$ :O#vR+s ۨ󸧶e8`xUiK|9?:4ib`*cz='ad_ '=Ka5Ƒ.ʡck;LUx6)v_ 0WfU]p!d.be`VX(h Tz®8KW+XbskҘPڍ󜱩'"|n*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثD?aC'eWe7\UT]]+v^vl*챊]f]1K+**UٱWf];.ـW`bJ=Bf=Ĝn#Al=d 7ה۳>~! o58f*FdVYm풉b jS,_g3s-]~#j]׉ xh Ȓޜ^R4!{ 8SɁ81E*NqY \B_1X덼 O#NhSɻ-!Eq =bG@? ]wP84Qh @1-@ӉPe(Y6SHkNn\M }))b⡫%D'÷H- '"B >+*pIB $;wYT\IEy )qM>=rjSj$n'mjrALX:j{kKZXq{&SS{^{+ˇzN6z@}<ٕJ0(﫲Q_|p8i^ HpR@hn*SBS /[gNjz8Fy93Y;Dr;E(G #7o;rs\&>%*ㆺRnGŤ=ʖшS>8f^[rP*OLj?-dؕyA\j8ri,J !oک_je q㈤E&#OHUeUA@ h7c;5Ix` ۏ &1'트bw8Urq!:dmZ:bTr)ksr- ֛ 4123f6W%$|[H.X\;b=-[lVS -fJL W-dU^;LPZGpaiqk:W&#LUE7#@)8//"AޠR6"Ǽv))\Dma%皥ˁlGlZS$eR V@F_Zt#S =H0{o۾AeV,|h0Nأk!Bz iVT1eHЂo?^;nUNQa09`hE'*j<;^'`NDϗՐY? yzE diZZ"qpHZBoY1)nG! l0G uKVJn*Ic'n*HwRd_6(_rJC{sw%U7VbI oZؤ\Y!b<½A|0Ű3-Eɂw#5}3xAi/QW͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbpG劻Uӊ*ٱWf]Ut͊+vJqq {fItvu#LXn&di;[]݀ #$[)y q^+y?|X!;e$1Fa0Kwi޲n끵MF;}`ͤD>7? щy̭>4*Zjx JVmt{J*N"KX|1dx=mڮU5~\QpuJ,+WYG0*H”\M+ !u: M:d8_(8\R98D.Ri;z߮dCgS ٕjH֒lb⇯\ˉustTƼI1-׮eFN4,uB8BN41j4ʂie75PY*⦵1Jv3(>LZ$)brIq5^Pbq%CcwB,PmlU SXN\ Zd'-) d*3zkC"bL岅+F$֨OJ|*:$3#!nvc>80˜P%3ɘ{a8bA͸4[^LkN)_Ք(68qQ,o UP:ͅALaphjFO,T2M8o b𺊐GL( RLkb_lߝ:oڊ R湥FooYn?Lת= Mqfz2a ]dSO7zaۮn^5+-|/[&vEXs b˟Q*Eojg?Nn?:5VQıe uaJzv:4؀(}>/4v?R&(OeOO뇮1L5CGW}B[CUꞙOYcLOQ9?*5M1mވ/9dsc韩*`(|>fa%Rg2skKpr <"M]P3Aྎ r3 HE7R2u8ǥE+Qg?edqLY!/vI7?g~SjBГ\4?6N 7vƜdPRIcwp js| 9L۶,"ڹǃѮGpP.%d4}馜u5Gӂx qœ0.(v8m/,bf늻/+vlUٰWeU٩]c@0qR)U*q'kw"9u#p \ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb=aNL b˦*i]L*vQ͊6*챊,bf*ebef]1KٱWevlUxUxt]v+TUp(L ec6[di~,˘ō)@T#tT] b:-<)dDz58ȶ b>;0K&뇓pExL6]ᑦ%)&(7\۶)9. AKFS$t|J~2)jcQ%AY\t4n;bE"G*Td"'lHQIjatu߾XX]5VD5+^T5ٛgQCb%B*1$tZ)F_ӎWXʪQGj` ,i&.H޵ń(K֛e, V[9/̧ "P, \SJ X6bhh}PjW<5[a* H|cd*~䝢<Ќ{7A$$>1:m !~nycJ\UHgu1Zʕz=R"Z9mR?Q+0S%I{ZyN1z_w^'w z]s=21m=6iŘm#g#$l6RN$TtԦظ5Tab;7̈ŜW;^!{K)^zr/%D|";DhM2n4 FF|C\[|yPiM?Sт>ML Ȁ/7bjpuQ2n,Zfqr9f$;0뤠EU) 0){8P$*8!1w.?l!zB=fQZbWli `UF*72-.ϸ07vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]>PI+tTƹf1dqԉґ׃Suk:FrqtD蚓MaL>Ccf;:c^}K5& {~an3[ x«Wr:~8Oz1mo.&*)$FcJwb7k%zNzXQЃQ6^fwªUTr+WŶ;WƁ]*Rub7E ZTW1'U#Ɇ˖W¾l*T^7Sҧ1%m4^@ +%!萈>QkӟͿg /diE@8)ٗhѮb>#Jewݹ,[dA$9PN߈_=D 2cYO}݅9&2@j*0;&+WOS]Z埋a] ( ZF&hm' ZeznVQ'Ğkz`]'S UsS|GoR\&[SgWC*fNݱHm܈w1%ZgL7@ )d$1!Hq LV.i\K*i|ekɩ /,=)SMI %7Z`hz| b UڣbG[L yB`z R3;cKr&%#slT5K`,C h+pψfbʙA&NIkAZl2L)>9rz6SZDQ)  4 bmCeA]@UrpB9Hur,z,XaW60Z +teuˮ*"Xƛi6cN}9hf#is4:! 51L ]øµ`pzRW~XUB8Lb7|A Q0+ E6ڴQPq#R1(qE`v3Dv=0€ҙK"Qe#oTӆЗ;73SC,P/٥7'|,4XhǾj60(I3@nXփ& vɆ6B1)Y }E 7* F*3- %1$)l(i${ -@;R0%y.y|`X1xPNYn[l\m3/Dn1'`qJ8'l@chk-"?aA8[D[R0L"E/cҬM\HlcB(X[M2'v7`Hޜ5CJ %vlĀVPiztM&6QPb;a^vif~ZReD$=)jB:r?/-ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb H8N*.#;0]/0]U``Wa0ds'#fayEF?_tuIYq4mQFIq%aF!^9-,mzZQPknր(GR$SHTm5iœ"Mӄow*LK-<:0P+4-ZYtdcEʖiI*/IaS';j'SU* eG#lA%$׮:-bdWcWY)8Ha+.۩FAqvfQ,CKw6@fDɒcdq3"0L4/۸ڴldl.3$+h:l?:n>w~**{e^[3taVmpnqӿ\h훏/߶]1UU_Ͷjw8J40>^A햻 *54>ءxS˦Q;SI-Gu>٩@qK54Zq\ClHwCL0&&,ry +Z~9 -FJ[G4g6h##Y1G4h(\Pv#~dA(wt\-ݡْlo,).`}:A҆94q- l#bދ2r;MT9审-jMRP=3]U ^qq?#/G|s~MLߚ ~P?W'|"F |wȶjQJf0;m4q Jjz=ޓ/yE']ǚ x l2]X5 wxZrRĎ?O-XMQѻ{fuID{7v(!^qE*jg@R&5mmXjcljV{WsLztdIݛ ncsJ4yczc*e%zI 2w"7n*t#eJq~% PT>|b%|*L#Xq>["G,#-f\Yx *b2JS+PTteFU.gPla&,\16VbI#rթ.ʣG)Ӌry^+N~3!H3d6 ѕŋƤ(iN, `)̍{>׸\v9D}"1R Y`U`*65P"R W٘k;a(rE3S*Tqت%MXӶ1)]? C0j(D?QZQdLBI2"0qgzpF P afԖm'dnj]I=B..jٛSnZ?. F4% N(njqVa(qǪ>ؤ4N,TL :REq8bF"Pǯ NqTj]ltmr%+]2 lTWm>M)4˒ӄTVң<[)(pq2`>O5\V7=pOCM e$wz0aGuY # !RjwW[ HU=beU$҇ؤDCBNDŘrڧ5~#l sk>C&&Gj:5n]ulYF-W6U5nPC"Ђk3F2aPw )S=puKt<@l];e3aZrTb2% dU,ppKbC2PrBC*8'uɖT:rS6' 2 @RS֔y ōىc'njxCMb.( : QIQ?)ӉR9nKO*/IQ^Js/|I8SZՉĞUrq-c"Zއ­Wmߊ\=!)i5vVtraVSm[(UA.bYqUǷ^gs\Jolupv\mIUƕ2z|qr5ą\wUЂ27Sec[#PSmI;9ߞ,by^GutW^-}ڧG}8? t)xȂ3W6=Qf:P~B՘+*Kٿ͖ OI82󭘿nb2G z3$=pyӮsn9a?ᗐzrn Iu l[ӏ jC"{̷0staR!75}ɗI{ ٕ7n6w_ɧ|fTnfl"aR0G;[ :w>Mz}ho4/d"@F+^B?%?nOͤzOQ7~_~sg'ט #_R[ك?KZXJ57R[Fe GwO9psBG#):HʮZ:Z;f6?'WM9#H>eAf A [IH;,c -n,5cen 3 rO rb$ҿP$v('jB-Z |fi?{ a2(;XJW)\|%O`vI@Gîx{d)+\bf]0وC qV-k\qU_U(LUU1Jӏ­e1W c(lb 1B|_ڇ89ȫyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]1CdY;6*ث*i®8*n(vX]vX.LUxٱK!XUt.v^*챊6*1Wc+*xT*ao0%4UX*m^ت}0 w9K[g" Zz\m sl܏\AP1Kz_ RP $}V銢= HR45H\*T鎒CZ. Am 0TяYՑy@$Qߦ ㄰Kt)%SF{P  Ծf.$nBX0Fj%a`BNESPGT-J#.MHKN_ߊX6ɀ ;S|azUK~?#Wj1u|,)-܆5ŕɆ)t~]:dIV㵭iJcKd ؙ5ȳ^#,ӶRxCv_\a48D|,(e'iLc[cLn#QMj2'V҉wUa@(F ~)LPQ)1)uj\ nRԯGG[~!'|odPS!AVZ|ϡ o=2c&;qNƝh;~(2oZh5 ALYa8m-KPn\E޵rV!L mr1ȵ2&3 =w[L`eZjpSPiMbZ;W e<^:b8_cP)T[aPZCD]\iUqVȷV3ĪLBثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*R(l!]Fq'[Χ%qd! Y~ryk>f!`Qhɡ/p|a)>pqHZ`4lƃ*3^֋ԓ2RǗ'L4pId DQCntr2^ }2ۮ!Vs:eJRFw8;U@>PC ONGjSlXxWJ݈d Hd=q2oN ndYʸC1۷H BiIe'rzf6pP g%s$1E.6 }CcWW>488UnInYvcCqFl; Zot2P=1@l)Si8,dU$P)! A\R2h1ejr 9׵0DZ0ڕ˳xHԮ FSZb\A6we4 tm)1j(]E(OjGo)L§a)M͠+EFL!"OӧM| ]|LbxcP(;Lߏ_)A۶TB$Z[zc%D`:vDU@xQU:lQp*[W߭i̬5Zz\`z*椞*ڢCHQ*[2 \Uix]#t4 M1 Ӻ{9m{q \Hog9? -Q9k*'q%LAK?Pj)lEa'c1G@GzU&xLq2PS[EM;P2ahLŔ- ͛ -^îRR؃'=XiRBMq#,Bqa&d7QJ]vo  (k(7)U\ӦH: ~&~KwvJ+,K.Xa7pH% r4ĵ먙za!i#1fF'¸ 68.I S!p) GWolxt]!/,A' NZԥ豑Χ6$6T#g?bq Q 1W٩/A ZA:p%{c%aĚŐ Ŝ:Њo {+F˓ P"Z;w3J ȭV[ ʒ?/jt;^<ƮOZZKO6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbxVv?+v^*bLPb˦*^H#|Y GV[=Oo1'NB}QJqIyjRL5c>d㳷$TT-+tTpcVu;mīɴv?5~xZؙ߮V&ڂ1 *S6΍\LCAfF{e}`lЍe88RMxP퇅*Ojy#~<2- S 2 NIdo]SJ zܨ6G`>&4~G`O Z㨕}Y8f.n7KSȸ8ڔr1|5ߦ u1 9Eiؔ6Lkצ6:o%2ӛ+N : ftR_^N*?v•ua(nOӅ- kLzצfO|*Ew޸ToZ%kl7ʥkW+r jk^7>n J6)j2+"y33 m8%;}?E?=Fp1yrAݩãsM 4: Q ztoN0 >QI ?P6%>U*s{gOcA'5o]DZݼ! Ekq]-bPofW 7&~Kp=tny~XtrQ?E O8՚~/jѾY "V)nЂ<2]LsF#uleu~iXwc\24c8[%Q@Ҵ[V_B3#R"dh#.x#¶i!tO-jzD'fiDw8"DYQOly~+y1A\ٌ娙 '(F_Mيˎِ㡽]RzZ|xSL.·XHڝs M' ̕q\l$j±_(#zR^(]` vb.i-#2acOJĠ%zUœm+u5R넔]4h;aW]l[!T⨑CB ]PVG/ϦXIkR1D|(A!Cۿ|]wl@\ZF(% BIdӽ2L,jҧ5^ $S:iTʘUaQ銶rck"}uk&R"6$miͤ R-L*3qTCڃoЗs,*vFJ |G~ZWn0ġ>1Hr6ay<0Hi:_ՙ[r|N%PRa0G)_RQ-Rkee)a{,bcW#Ťmρ! b 0QZQ yUFmӦ)Nc\-؟|R^*vU0`bX\Rs®1."o 8PU鑜 W]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWc9,I4J/7sy;" wnRxKڪceC<姬ZL6>|M 551zXĔyVn둾T`D7O.2\-ǙԍxRس`ܟHd&eLSm*6+VBDws3r4^**zcjV j'Nz8.[8Q+)e6uq/ʩޛT 4 ˉoUr!|G'M%J'#WUQ\ȋQM ^xB8b^G)aC^8AZغKNZ(jCs\ b%m)-P|BT8 RwFlz m냅*M.x,:m W+JtuDžX@@2i`nIڻ(RhV(-cXцCqqr)I0D2Ёd r RRh|2-z6֘RMbU;a{jQ@<0dgq\AslMJl~X(BK{mE,}I;dz:x@/frGٮjBOh4oS=7TE7VTBI6m EWkE)ndZV[@i;!7XTQZ N]=BSJzȊ[E$X[M+ˀlNaӊTͬdop[V(D I3kH'aqnU/.Z S鯆S=^XiCSaO%L Dibq8T2&p\SƘOyfG]P XTVb\a!(mM@ ty7F1Èu}Å˭{$XE6^ 1rHj7h ح. †e{x*i7 Z\f•6Qf 6 +WH/lP i)׮*=eқ`J߮8oVCQ5.o7-޸i]mVצo|PkӮ}Cu_cC8)?{lveS ]OLPؠư"Uo@9)NU Ua1e?:KN.\h{J9Lkkԟ;7q w(֭`~ͦ\:Yx哯0hRYMPn\|b91 yRFky*F&IŒ9cOcu:ϔ5 N[m0A'D+L`ܢ|2+]iⷱnqI-ؓڜ[m:)aOZM*شH6C.ZdbRI% &V4=lAC]F#aE( J)_, a5^8"[l2a ,$["K %H`15ȥ0xJ8}O|oCUg$Ӷ J*+A's)ءA<) [*ҽlK瀖HȣLiz )T|$4*i\cdY#a٪2aSUN.x+ Q8$}߆pp=FuZql-/q.lPv*1Um21We2ȷ#k2LJ".Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUcq[hF$'7mɀb^q_N2sXÛS37o PV:HR ncdq|5*BpY5znPq]ag#wm*;$u8f wĹ+f>ze4%(LU. 4)BM$kዉRir+2ȫ¤ +]JS^Wl tȪx9O8OSd M'V:78Аi]@I%Nہ4aNT ҿ6WKp;єT )23Mv|BkǸ4o#k[dE7N0s]W/ USI酊x9$\jT@ \Z$ZN)MJMڿZ;WCCSZ8iǩV\I}]L|lF`p~y8)T-72pd2ԃ*! L§Tb:ȍ 0ۮN rtB̨-)%͟%5h$ u P#"b2v’Ӿ,,R;$%ŎҹKkp=-d|,Ooup)3|olQH)ϗ ]j>6!V$_4Եv_#ud j :GZX xv=N6˚a&#q& Wp$kJĚbujz_ra=NiE}) A^FI95L%% |+*KrGOlRi(;BSEhF/˿AǥsBT߫\, /M:m$VĪakpYy@!PUܙZ 7-a=#lez^Q>xa5$腰%h=Ͼ> ) 8'QS0GS(#XWK!Q֘Xz$=Ư觧o\(Ewȍ$|KJޡ:ܘ&S/16S WYs&N *BZ PO.¤䐧q(s4=+I l';!o-D:_`j({vUFw5G+Ju ҆*ŊRtGB?4 211%[X~0̭& UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث[aY{z`WebLUXٱCW`2% r@h͔cgFtĵ".tXNCein U̗S9;'U$Q߮SзWjIz᫸OsW9ۻÃgוH|AUۙc}c<};Ɏ:l,m#˅S2Ҥ0N `h|XvvQejG>ف@$5" As1#sĨiGa|uZ ;c@ާ\vktˡoj)|4Ň"6;uȦw"^oDz ex/olͨ2zǦEi8 vO2 $.v +(F* y3"'a!3pjD'Ghhu3CAљA0cۦP^t9FjzdjnP9(w )stIf!nf33D&Q[jbM' ej=X끥cZfp,d2 <ŁTn+J)kT~-&9{9GÐDm6y fV 1, ^*쳊]*qbb)h-4*cK]LR$労Ƙ$-1Q\JQAW)}?9*xb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb7F) Web]\*bcqWe+vP]//vU1Wf]x]U`bجPjaF%MLo7‹C.5ټp\{ YCB;ZFjձZQ+\*I,C`F#lTqWo IsɂodXڃ;+BizŶFPAP PzשV1(qU4>ت-Fbi[ A/ !L%N @Tҙ``BQy ,榸i+9ym +dm)t!īpOj `FJbuWS7,Rf劺r\*☡Og  s 2/]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWcT N6\(U:z.zLS}nB.ݒmx*,nb^sp([ x l&r~mO;sŁ VY&^6ALNjm16O"h4MZw>qf),ӘmZ''0`^B9C],T(jdudiX:bGPـN^=5: $* QM(7}0~3 )GJ6l#dp(HtNܞN~j6N<)Ot<͹6vK)F(>#3"!65!S!R4pv[GA+Aw]|bኮ&V,i[P9FMT_8医 h0E,VQMW8 Uu28bѐM*+ǵr)Y^p}Dr#I&Jo5 U  xT*)* aBHZᵝ2 @hW[KGcAIY2 >xik8 TQǨ0`~,Hc% >U}&1N֦hN,7l`ޯqIvHa/%[w8(\A-;J!DPN@RBZeV@[]s~>*vlNX> Q.])lbLGDܜXe"h[&5N`y|$⇜Jф?8LVYWL*_zmF;`aOQM^2VZ@툕a^^F7Z_zo:q=kF|ŵAW2);pz,3U)g݌viR -TlAƢr钴5;@ݎ^0]@J 31*Q#zӦT֯lDm5?F i8'l i"nF6 Tt@Vab V|G0; Ski:0w [2n@E[dN"WEs 1gsCn>{j+`Y >:|AcfFC>xu4%Mgq#LXRtborsnk$3#$_+EL$6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثMQ*4bʦ)vjbb֖u 1V'% '1eҼa`=No:M @Ss=xQiZ&&pkOo0KҿtQZ(nsZ7w-nM޴"s7@nf_b폈o|kB0X6V]*Yv+&ܸdׂ~VAN*+厳ևL1L˘A,'W^EZ5MԒ֛ ŴQڹIRj\g鍶".@ 5A,6BZ|2K!Hqgf3($m]%7^9/4XA'aP2gb# g2^ϡX%VOGLR;%#q=)Ð7^ӦPZ v[\ SWڹK9qCv^bzqۦQ#llGW Pc@S/2JPt;e*pjlvS, *L>8+1juR ->ym.; Glͨ.Gُ4miijVmTD$>1ģaǐB]}Mb~<_I{q%Ħ#$Rob!)AO]Z?^b;brqeͮLjԏJkȢ4f mLYڝ9xK|*HsZƩc yP=E|q-V/ f?,z?JBSo̾OLnz) JF]:9kl녀^Yf_ݫg9jAFxd cQQ|ر[i5k x>m<+2W›?Q#g,BpB%N);S*0Cۮ(RcpU+\Qpj6"tAUF+ L+%z d~Y׾$Tfs"Ȕ(@u'1pF4xq娴•j~X;*f*rvolYS(B Kbڨ TszbaO|%ARԐjSeI(* b[@>#Uy-D1.d>88o* SS*g 8pD| y2d<6ޘ9\\i#p> E/oTR[?oRA/HG E)'nYuo ͋۶YlRmҭ41*ݔDK׶؏:ekIYv‚r!~qUmǨƳd9^( eiZX=bQ ěsE J l B1ր Y"Q8޸U]+t U1Eb q)ħ4Z䂅Kt:uMI'Iwe;mhlUpEWS)l.0*1V]8L1w#X#>m&%Q:a7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]O!u=ZO6˿qG8 1_ nwS:C`*05$G G*͵Z_~ȑrRX`Z5k&L.lOVVl,ejp8`:nv~;PaB> cȶ[d03>YQd [P+(I^(iOy$E9JimGq';DAGW[UPD\픳V 4QGK~P;[_&mAeN$!5A^ >/$ e2Qat1. U ]&ra!S8ݫ,věsA ٟi׾.̡TrmWu鉴­4V1a[*/Zq[sCFbRqWq\Z176o:KU0!Ld\%9pLrwr$!L YK(s8䘩 il2(1JQp]j<*6Ew`=;6VC0jNj7\8j|2(,nȚ7`\Ta1]SO?Sl퓉kbz?jb|ylP1(:8ۦ,@;N5 J*rЌPj@޹~ 7US Y/%]GS;id"( '٤ MhOḊQ;[!QIJ4ud]E0K^'v͐ū|*1;ZUgz=1ۮr䢝:?Q0T0D8sACxbH``0] צ]HNRxB2_-\ `uVaQf Dn Xp X"iM:x`Q$ȶ8,74Kcu *>g{/p*lcFo ia_F\M3+W,VSe-a"gs9KDe~+T,GvT%ZDMb|dzarKW]d m7g-Ot~[T(Tb 1N3UlDV@UQ Y+ݖp!\}DcTfTgظ`d#q˦A-7m" OHvӉAL?Bz?2%^X"LXܬUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث^>3]8ٱWf]b͊iWttWcH~Z;MS4&&-=f#Eqq0ד3uq}ȡ'K#+Y+ZWf9촡ߙBw[zRv_W|f#3&9yz{ S^T4Xvʍfo Fr~]0,iZrmE,AvV⃒ɂDžcC]LhbQ\0484!tS]UA@tsQB4"B\~D*cnZ 4&;py%Z #g]aʹ):ց Β- ދo!1e59:dJިAE-GI @ 8;J´=GQ8;e74?,mRN(YʴSKi1aR5­ 6J[zoOͷC\(rwوnæU*p wȏ[fQI|yat`x~cQiΖ$c^ylfDƣ޹}ۅTGr?=[mW,x:4'}G.ons q%wcxrՠY?ݑNp~Ƈwq{XDm]ATEa#u3ob4s1qI$iK%~i'|thQ1_·N8b12Hل8|+ONDR9V;`) }Je"1VG?04O R==Lx;/ӥ(bv>ir/!l"l_CH9);Vpt|bPҢŨ{V1Ͷ`U2M*rF6k2޴(X6E!AeY# U C0UB{jd YZ撛 ,7EA\ ,MbֻEĹ83M-o $E(hshk1WcWeb' v*VU`S߸sI1J"[6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثvi0b=`We4]8UXXٱWf(v`1WeUt]Sv]1Wef*챊, UZ튻Y $y8Q}9&*DsتpT1SBWLi*w˩4­qq 2-hPےqAo`1(%DMVR0$*'%-+)\7?,E1f\yBzUDZǚ& \9Hpke~)-MZUqZbtN-+@*Ǒ9~G ΜlIC:Sgbsz(ª1vGVmjتV0oH݆ (_h>6|bv=j %Bxhm QAW\O%N9 |r)510E}ȠJbT@/k"ؔ5_4d<=N4K-*s\ U(j:epN9dŠRn``Zi`$oMqW"4=Ql=_Wō(a.UFjh鎦Z69"@FmƹJ%>o,RW^g´YxF* Í`T Aq9H!}@N $~8SrMnY&ЊPO8G&f^Q8Ɠ[ƒN*n*+1V  B$a,JtŒo6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb~LFJ>̽7-̺Q+sկ6txO-=-FiZُ avI F=.xlͻh:E1RdH Տ|A4*vvVĵ 15}LO%XV4+',|z& M4Pc]Sd9Ale2t+uJofClX"sM~L8=1sMZ" Wa=X0*!Q=k<HTTyipF-Amr%  t !wZT!wd&_Z0UŇ`qe#(@Uk@MuO+m Mvx޾qAIvYJ04jOL3%0DP ma]ʪ%IQ#G.I/m K'}! EpUӞ F(KlkZ`% %hH C^퇨~_Iz%ߡ'$1@#RppڕiHbv FMJFvH@"-NnoRrt/0D;8 ~Pmd;Ezuc{MK-q[zT Pj(<6$#v59`-dv~E%[O㇅mmDE냁Ƭ6ľ'‹_@ SoI޵DŽ"lz«GAt9k%qB:b~P"bpp@.?88V5N~X)m%8.Mέ\3LIhQpSQ6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثn>&b0+b͊51Wf]bɿ~/'jFۡ9f m>:Tq鿿nm$(!i%B p c5]E,a2>b];ojEG36/( eoWw/PIGZr! [bpkLc`)pbD% r`|54FlP,˞.mwiBlOӁQݔ1VC]7,0;S#lA`W#mP=40lܨzjُ\lGnPl(z`V˒+Up=LOJ uHW|\#?ZEӦ Aٌu1{;,4]{d9Wp{H6눥R('l!ӰBw+E~9\vJKa(r#瞴;yV?cdsv843}!$ OM󾙭G3SC X>&Z:ƗKYS+qG, es\~c|.5.e_ivg,Դ51Pz:HhqxqeqE̾QQ8Ο[v[jNn##e夝7S:|yɷÖ<%7i/=-w̳ Sl%ʇYiI.&EʟkY/,[1u^:T1CB>l3#ψ>PP_4NmQB( ?SDdh9yt1GCҊXWuOL2ï!w5ƺr="M+tDPs( sw;QI=2EzWxZSfu:szx⃭0a\Gӊv=3`d͛l'jmmI%`iLـkF/"\bz}8 eZ]p0* p!ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*P0=3/MͷѧWavU(NEy&`m!gm|H2LtՑG<t9ml#FԺC㊬jxert89횼v5%>(=zxc}Jm|đE;Ćb:W%;> Qii 9QcF*P+A\M4m vSJ/8;|%M ƸlNHc~h`.U]_lAE$'II{W6iУM{PJx' $ JSEYe4'"y޺[(A%M37:^7>]A| u_%ooOϯ r(X,xR/˻)nHކl*lF&ZtLf!+BZ }LMcZgg䨈>D7Q 2mOI"#aw^'}*ä"0ޝk hR/ݍ[M<0!yc+DıϬH]>sv5*Տ~ @bc~*)'3Jk>fJq;cxi\VA\c1!xQ\PJ0 2),kӅ+o\$y|+1nUwLs9Uo*qb\Y[T㊭eEEzQ0 d|' q? CN$M@rr hUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثvվUa]bLU٩]UٱWcר5AEvv7$NNl{S@pˈvE)6;zT$;nuBh;e lt,ƵcZ!}L8Bƫi.#,p,#2E/L91ݙd?usPLoCIW3;K/7?\qe/mB0FǮt|w ^n]$N{o*|ǾFk(^M"QCgGF|[|SNfXHty.82[O\mBqqB\Vo+cBr*ƴ,q\]Z8MvrS K\JeiUvUHԎY|ĆA9d%2Mx+6m퓋}:w!N{MtL kj[H!"xq[˦*rWWrh]VX,ZR*+L# b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثuBx=? `O艀gfFo 0v)nBcv_8>?aw#qO.1X[T+$SP1["۝v\so"kUhhN&eaUƵ;*V혁0=pkX͋)G? R0ҭZ~ Tr%I90W]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثK]].Ut.LU٩ U3HnB,ǐqc]7EDw<$꽫<4؏Pװ$~յ#}3LkLG&,|-m+} MJ%\rEFXd5!hS/A"{umlN.76Mz+k 4G& )1H܁D @wn*Ըݍ>Y85S^7xm|+J$+%@R*4=2&)6MA|iWFk@:t:4S:?F}9i&$"&U{WԩݫNqgj,0;`bIZؐ$?F&Ĝ-ΧL61aWm,R 1֓OA2@+]/z ڟ%#WX+Ā~il ?̭"<0{[e!)" *w홢QEȦw^+m+la22f^.vA8/گlUm m N19e=1"{Ks'l2w9tlo(h2@9ZG2W*5ȭ5PW: m.=ڗ |F7RN -' !vLi]J`vUc U70*e!8ljrfACMB48H^&8ABWV5į"EMzCA`i^ثACUS81إq ')wjpS-ֻ*`%U8G`CE(raWb"wբ=0ZNاՔu)MSF:.P62e XR91V.+ΰoZڵFBV֯6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثLF*FvX6*ث.KsSs+& N^,BdVCWlVSC*.R8՘4rE$[l2WA40߅+ Pm/*}dž!HZE[PrB-Dm>؅jmѳ݂oF=HLc'vHE*m=SP5DW5 @vVF ;Sde=L|~jG}^)ԏZo Faty,f Jکdrz6[) 1l6'Oo ~`ܳ&+Ïf r`yzG$#smS3X*ъf$=].Mҭ//s~\yn̑h 4\>GT5]=#,bv5<q5q) _lߚT}W?&1p_AiWX~%ߓlHyFOcr.R t|C)6Ncʴ#7 a $}I풻E-L`iGRg>K> x89>[kx؈95׈ң;7m;^-A0GAskx&ZimRK;o{֋q5u?A#4pgXE?uCPjojƋ:JNqcgRސ" [Fujndz'1ev8{K.!@EEM._@bjy Vaxf ^6zL0j|1G\ R)w~|Lunq'$o,*&%A u>Eb"3x&[ռ0`$xZ) Q\[-YdWjaKarRje=a\U+[8PZN,ԜRsS_ (f58*pW>5N)!3UllMH]~qU|tʮPoUPeؠ=LPv9Ao q4늫֧)<{p]ĥ%MF\ဨ[5qI"Y"8*{\JO2QAQiɡÐg |Uf$`߾)Z(aC1hkƸ r@`&O'`T@#9Di\sbZcLW4nu]Čwү/s< gC 2ܽ,.mSdI)uaҿ b*GߚmAB^QH`I$ OXR 7$}٠˓}|u)=iթR:?յVbI1%nQ#n&=Qy)鉊rB8uf\Hfӣ@ĥi < "b&Sk!-uW&IN[Eu*\uN(o[vGÊz @dUy8k0*߮0;96ܐ A]'9,~`Bta]cLT6Wd'݅[ epq6b=>Ȧu2Z⭌p+X Z8NUzmV ʔݼ0c+Т'jx ))TCc-QZz`Ub-+T+82هRiVR2حV$e&Bt5f6 cIV Q\0Hhi$u+ SGbiU,t8-.V$XqعaZ06 m|BVR2{Uplxf`@‡)XWX0CȤlNWqBZqHJrFj0tB(\Ϳ m%ڛ a$PZTm⅜5j*#R~ߦo,Z>|5aJsVWR IWl!B +(h o1p鑘s7IZL\pilqW,ȯ ۡr95Xb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثJvv]qWf*]6)v]qC RzF*>P|JZ޸MȪÂ5e mLjmNmJ!Jk"2@IS^_t 4ד Y%/!Rsy;;#<)?3312ӌc _&R|\:/lɔ=v4=zd햫AV넾kk2ZKԊ#b&D^]o<4SERx[n 1ɔD+̉%ʚH> :^0LpLV5ڛy8>XO6`TцR)!lhW5/c}̱F9)ݛ.c5$7 >mB?ŵaڧl '>AfݣO-⊥[5kPz>X4f$Q?# " rzM_ibɄnSJgw[P֢݀x|̽Hr0 |o~(i|<0A(oqU~qKD;eͿa%Pn1끐BHn?CR*17 l2"!%="!nH Lݺz׭(Pl2, $Oq;J+!J{TEV$2nAF,{d3P$FiX{a<.TBs Tp&,Ea޻`_ZI8p$@_U.l_~26xݬߴf!6|Iգ^h*+.hey S1;S $ߛw%#Om"4-@{HT %2N(|d{|22Hペ|4^[0@wTh|+d%vѺi߹y e+4 H31 ˶Ԯ[*VCj 2VqnE)JA爱 ( tn`Um]_>)>9:m'p*}*1#U^JWlo,UwNإp!K20+)78ҪS7"׶_kf;Q $ml$rLV`A d0J$QCCzeNoAV5e\UUV"ʸal~-Ʊ–EzXD]2+Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU;Fk;OAek'eFӞY~̊}9sCu[sM_+`: |ȶ(Iъ49X^C p7pw#l΢i0$Pȿ5O~&w6P^coJE+K 4vKc,*S'+x V||UzdLm*|Wjf ֽũ~,x#n,j*W xM}e'Z"I5=0+)6L!X/ >|HW\Qa^r6Jm#j_\M$bL+$p4:u«Wz뛁=1CU) h<:UYT=0ZV z`, t-6X am-qKP0%iWn-chN]M{a ҧ'ᆕ}35& Z**0*̺b5U+q :Tm'!\i'&bub)XZS8)V miJ†q8gl SJdUB@GӉK0]THsH +C|4jCTƊLP1F(Z|J4*j{䒽cA\Pbb0q{CT$2)&>1"$w)jf8'. V4kSL $[kk횴e@x `!E`c\MA#ȮcRw5톩3R25F[̈J_tG5m lbtM#- R|F S_44|吟 H֪\{b9ZsF7|r;Su_E#8'Bx6!GÈzMԜmdcew޸ ipp*Է.QL vr<.S1IeܜNWh#`tDIq"nF?多ɼәC?V02ᳳvxgk!м1vp= IjB~;*ڧ=(|`Pԏ9i7u 3wedAYUqОWY. >mO[R1,S6S4m{9ZW. +>:ø(ե)AɱoOQ^Ҵ ҝs~qW^l~) ٩caWLȼy=;#i iM-NU}j:;LTǶ@ri}lY,ه1Lm[w#5GLEW~\iA6v $Rc=r .v#ol|)טi/y)HP nrѻg"f%~7MlrzX' a2*VM9Q ݲZn/^8 O邢?b,גsȁv ~d6c.K8'/I=7'f)/3B!!Gń ?V6WR[ v@-'* ^5C-lL'!1-B̽; +?&v—YsFF*M#Ša@I"%n즘c W$5 ̳%Z\ NoT,ٶ%5Ү*NGk[SPpUR]V8i`Tfs+a&t%Wq`@¡/OZaNMz #>YQrbt`9WI')$-Cw$:A( cm'4YT5Ď,Fj Bn8.E҂P^[e\UʭqC{`V[c2PSRXUUn4*ư–/qVqM(XeR WZo4RV=6H+M*jWScSsr8U3sWld)V?Z LjF)\WlY(۶ȱPpWP5M{b&Zl;h;blإP k$R`Vk=*;bzc إzSbzb胮% a«)SdKp‰O#d"lLbhe+`A k.*.## *N*hUX×\)jPFF+g YŊثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*2ڍV½OѓLFmayƥѾz;IOUhBѝ E;z8Hii{[z%`ֶɩP~y\gzW2 ȷ%Z\^XUlj+xom8w,-1[`4>8)6f^2lݎG6zxcZztopM.J+jo| ֭jn挱ih5: n m*k`7\&RqUb:Vf4]|LՏŅ on–<1`Ff,d~|G|ړ$^-TfnmMRz䐎Jg#ٻ Qi*x6[TM1HcvQket]9a{uFk[||$%0JsWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث~劻ָqF*bLUxb"48ժV80Y\KMMq"'lJfdLMp+˶HKHʍߠ! OV7~f4b3"2!f7g QMq;(dFBI.0o܎3 chmBĴG\Z%(RO|%HZ4Ĕ,өRFHZ#92rޚ8T[<^ j&2A@SzGUy'' M3h?QNeNU|O@wOU~^>9 6g>PD}RC>#VQ NM#>EN7Pq֍YxZ~AQ ᩹˩`FZu9\Pk}6=JfI8~[Oj.{%POOi  eH;ϚF#fsm/^M,sX0Mc?lsf͖sg]r[Zf#XfBtdW'Z^9@)FU9{SRpb}Ifzm8:1?QW?RZ?KHz4cרnc#C{a(Re\JjG_q5}f8`8}Ӄ`zgLU%%/S<(9&-a +v\VG|Ut0" v2Tݺ+8UKזEr%Vr+s(ēBTa\X8{d ml  }HI=SmWwO7$ME*}b2/ӕ&)=oǮWmc> )դܾGzA ѩF!$ meK&wb319J" C`TҽBoƵ]vÙpZA4ko>&K]*[|_jq':cu^jT)\^M +/!&x֘;,1]vX|Rܫ8UT]*]We˦vZǢr4\pP W H…&ztBee `MpJiK5 rgzyZOj6,6dWE,e;8w"L Jzӕs6"T]ub~odN"]T4ݒ 4 [#Ds,c^oJb ̬]J(LUSM)\cmI\A\_8)<* SS ];fg!\bY0P(1X袽!LVuh)el u_PbŦ4R Jci]\U9~%k֡+#SL[a6&zcS75CVm =A2(n+p;aT\zj(AyUBXm a@ W\ivix{1]'\wU?yXēSPb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث~~& U`Ͷ*ثWfWf*]D\ S/\V,J=㏉w@ZSLĦQ 0;PaĠn(Ix#5;gP&6Z/5]a8dxp 7)SGv4;h)LRe%m{k^|hwc=FޥJI:|W^lwDJNqRJǔG\<4֫~FPAL oM {d5-B}I&1HtBٓi9=0<$7ƣ/Q"Aٛ\)Q]&Ǩ[qOJB1dFiZYJP~{մٴǂJ?5D{YXzu]IJ{,>|#aPM2ZWdBKcE dPn]GO|Qִ¡~ԩRL_«,2*msq pJe;ĔʂLv0*Vxa 7]4~e܊ciXNt9wXou(VldZ>~=\I)-JnbG+A%&+rZG$)lz槎ѿNGPD$s4S&\@s*/Dlj޷p:"$>,|O F!SJT`̏ڈiMR)'K 'JQw뒺.X?]0Fg={ ݊Zҥ N7 ҙ>Jqb)ƪFQ٘ "q[(`Oa0l.4#s HĀN[)Fˎ]TߨژYdhhq# 镐%h/l|{bU&Kb{W, IQjev r ‚9lqE4 }a Y_2}[jeR'hZ` (7%5ؖBI邴k([VSM8q$Ti  n;W.h:B.RY+58R3K]ߋοe\CS}R-=^TD=NV\]..(Fڙ®&bE1U4a^Ԛl=)Z]kPs\LQJTĘ (–Ȧ[ Ҍ9dh \.&-( PWl)] s xMN0R `Ոq]B|aRkZ+$iZ ݎ%]Zc3\*o zf :,ck() 1 |jcx⭖EF*ڜis 3`V€7k:wLʡ8UƘ"qAX͊3pnqU50%w8U{56 yba;+m0*@▁"mA 3os6r•j1CLⱯl*! ॷ}`qUnܪ1)/@jfO\=l*v;6"5*6;  =FDE[jF4tuM&L!_rލeyRM.&4E:g/α^t+O5m2 NnҷC"8NWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثK~X~vlUٱWf]vlU~ث eck`fH`⊴Z&d/Bփ֐d-Sywv+<2@Wn\^ՍeO.l&7Ɗ߸Ui߮Y]]PBԔY¨;dDŽRzH Nz7qm;㶌{w6̤Q{$?ҳ}8W-Ca`RerP(Jw==1FIE,:t UhlklYWOjB>*$ -5$QjrN|&iLjƂ$٨ƔY]:BOm[{)#.$H⤁E=u PұzxW9槖~oJȅm=D:pLzm?$yW+ܷcmt4+& Bݡ}*Xm ȍ(I۾JڈUqZBi_|`\e( w$9aZ%M (A9F8LE[S87?./tkh[f5RI˄Ľ֏a5#6gkp _;f~HM7b!u] Bn5{QE ZIj*nmʻc]9YHC+Qzty3 e489Ir"R֟34x)-#^ܘWQDҘlC0ޫ)Mq-/]l֙8` PR'緫KhOlmU "m7]@'5c+N-x0];h#\Bjc|@A!J3QJPN?y[4-zɸF#ñ9|Fuyr!&}?FϨ;kvp6|2%U5<24ZSlz>[e`O1dRaM̝o]l ゜',.(n튵\pħ6Lk&oPq(UW]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vNs(>8I큛b8b®˦*a]Uu]1Wcv^*USNH젢1Ĵ80ab X友q0A$MM^9FiGvǮ=-ė-*jP.#5]\R:H!ͧ'$`ñپ,6Ĭn`%0nGI>H4?ɍVv=˜ ~j}9PfC:uA3GROaj #.m,nJ oT59dl8):6#s](XG-S)!as Z1P0: -A%\,iw6Q5—|U3W(l`Tۮ562aRӊ╩SF)]˦8…0h)N8Yh c)q1UP^*/|UWeS ]5}KY G|+f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWa8WW9d95#R碂~Ͳ@NXx68t3}p7D?JJ? QLAIJcև uy۰fl?L:~aJLבqb3PKg +3},հi1UVnUPc[I†|v]$"®o(-2(v< vjK5®͸]LRJz h].{j 8&+~ZƋymofq &\V9L-d+r Sg#lEF)rLsUfM(0fe=iCQRzM7c/"S›r>VU P8i]c]_c\ @fw<"jHOLhp|Ui˥z⮭21CLzA 5N]6 Ll*aql1VPƔ8R1鞧6\c?Ui w(Z_`<1Wr:UׯLh0Ek\ij呵N*TW2q늭W'$ \SLO$.lU%ZMZTi ,NXQ*p85hV265ejKt%r&HCBF1tЌ6PZbMNإD8еpU?22+Hin޸$@ReHc9m@g2CTRUV9^|Эz-/RQ$"gyPt[Lp,x*}3ά4=FMCvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثM?>4ؓ S%gh݂B׽pɴ9ܛi*Bgo%z~857 Ud[NmpYw4i@r벑;PzɶlF: yqmJɪX׿^%2I僽)3Sq+hn*c^,&'. j)JSpO:t}?p4=G=TMJf^{ᾓui<ɲttsq2lrO ostn\ ͺR}2N`cLWO+C>`:Ղ8O6rq xnO0R}2)l'3PNݱ,*V1cV'(є=\ˈq$-TMEytjm&\gn+|f Zȅ 3lVEV,i`W.49_)rF Er8FTUIZE݀j\\RN~ }d$[m߽!l F5E/L0%+Z',*sS V1W /lV3w|*+S!3BйdP]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]:4|ኻ03vjb8َ**p+aWe`Wf]vX],mv+%M}K%e0ޘY8⮦&Z<)^ Nj(E|PZcQaŦI>$tA9NŁyhb_xo>02SMUm ۩.(31LHnҚCaC8J #voT,{s~#I/`pEFG"lKgc15޸[+TTy,Z٘pEꍽ2MNUű0ai;e3m .DTad1تqE녊T v]u+C*\5i\uqV14F$)MqKt­ z)Y08EwۦJ­u1VokLSr–ɦ51UyfP(q0%y\P˭0]ƹdb@CjEUKzP6(paW 3r*rW3uf+^W5Pk+0l`늢aMGL)8')^3CYc *(qU1VVxUS\B9F…g6uJ``͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*U.ӅD&Cq crm7Jxm4^x_\QpnO''/nKfjh>М7r|EF e)06 `{#*ɼK0n}Zqc_ѓEK"O:rZm ˅0-"6L - 6+Tʨv8L!]ʸUp] BmM/ ?L dlv遒'&cE•⃮nqqjHӊ :叄R١Ʊi=SS/C`|`F.9k)Z[0qC|f*2b uqԮæ([\qҘY\+(']*Bۜi:e>(X ƝR hR-*iXRh1E,LdQȄ4 U2l1W.\i3  M)$ Q1Zo=*mڽUX :(K 4%\rwTJY e$`my$]q銽6YwZ۾X )QobʣŧԚ൥jx'*9˃ + T &qa>R+ҙa)-OӃ[ӽqH-x{IU<5c+G׍W,^bwKo#QV㓺K疵E'yS`YZ"j2/WӮŴSx¼P͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثO|*]qWe 쮘늻6*ث]2Z2Abqxԝ+I 6{f@IQv#P/^dZfC S d`vT`xj.mD#$T'+@昒޴pkLB?|GLe$MԂɯ O$SCX(}Vjv>*Pcbm&;_љ^"߃Ia~6%povkYV0e#do՚0ԩ? E҂_M'H, GATPdId2ZիiFƙIUF?. :#L$ۥLr8Sw]f$陁ue"^w$HI//qۮ@%IIZ_յHW#۩J\"۱c9$"=2+:oļ ;-ܙ8z&`hHR2Y9RNT dHo.yY!=8;l>2bJ52dvsy_6[~Er{8jS^K-`BX8϶=+׶Jؕ'+Z또ՍY&rȖ<#bnlT:oၥ~#(>TB`T3h ń6湂6T-h\UUN*qlUa\*יz\$ TS\Bثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*8f8; pNʦ*죊+ 6*+WeUcvjb"NMBda-s( Bz#Hh9@X}']If1J;o (lU׮R\Tb)jzj).\נ]͗l1[zƓlNmdI6RkpU|M~pR{b-l@):|S{#TMRq *r?do,Maw[t^~ړ+mz;o /dt=MMZSq:o) lG(Gݑ@I`Rj755<|URĭoD%>>c"֖Cl[y@!l=Q +t#j1G3"v`sL)\"s$ Cb^J8O|*`Av)lv`A.Ǡ-pKYE 9Vp0!+p9T8We W*銻, TW6 Udإm \qҀ{mYڄ S+Pe8QZ ㌡­1Cߩ5Qp߮ Tb闽@+Nс Km(kq@0*0Ǣ8jc{J'-T+ETVcxn0o,[~XPlo({`(hnF\xQUije 1t-NȖJDsIk1QmcJƛ,uŠmi?Pwhި,-φ$ґ9anVMszcjy~=za-i7/%)a킬jd$5ܴw+q|#B+Jq7ͺ ${deKg8:LR./;|X-)L$!༪ֵSihB׶HM*k|(Ewc-PT 䥤o19tșgE؎>ySc)R0A-TSM9csI@]&ҡ1l|q.;AUo6)h|1*Q7|rhhpVзu8!tX%7?\iJMn?Ä2NC).kQWl潈צI_s!}{~otKiOPW#Pȳb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثR]0+WvQ8X UqWe]*Zʶ V|̉kR#ۑTTdKy9Vs*$89Пs^.)=r@8V0}dB6VI-ϡ!R .pўc_o:crd^.A;6SCG袠n~)VeGuu^d%~+N >dxM\ [谖\`r-̏ wPu=`|: -4SFLGvN}CZ쏋ڵ'SF]l']n.VMb5rW;J Ԓ~ "I-ȭ0l dqAnMAQ\ 针@TX=(SfTgYKhM9 l$x'!$˸ S8|U#Z6>Zbnj`GR=jX>%_H\O H 'ՙxu.W&[Ch9Ϗ10XUc~tc\ g2X\3s1q^ak.Gާesv1I  ^{f%hp]=e +UZA1a_|mio"v rV߶YN[ ze 6RwoտV5Ach^D ZueDqzBƔsRm[2]wZ 69۶6H=sq0ڴg szA4JXyU3.# * ۠*fFOL hvv«>="Y<Td6\"lĥwv$֭JS`i2N12Ӑo,1Zo`\'ɋ@G^{U9v;ل_uo'Չ~ %O/gâE;*ܰ%6*Uَ*nvl Uنv8bLUcv8 Uـ]-  9e Km-} qIg$-nMN$|jU0p*zCLb-l3b*an1BWGU?,h¨'m_2p^s\7"$0H䨩;צ q,i1s#К(gCƭX95[̋1HG@y6vQ$@(;ݐGȸw2957#$Ab#l$PEk< opU`$ef އ72NF兽Bw؊Ẹ[o qVbxLzt߮H*sW C]M3E*2W7ol4AS\mv+\PUk ˾(QlrJ:b [sAVUgp:3VĆ1˧q8Uccr,Tg1*1W0u[I)Ə RS 4⫆Qp9chC£\*Fjbp*nDW0%ṕW vZaMW,UcȲUoCA]*P`nt)DLa pfu/J:adaU\(k)hVZ9xG ]cc_mv>n\ <.(jP{2T&H3l*OFJeZ6Q,ӡ뉖8R1lU~*ndW+v=T*9m1V2EqBv8\UVإ1@A.&l)F*1]S+Sx;iD*!eN82(o%6LSkZ1=0§;KlB6>͔f$nd8,D",oJJEjMܪ԰G\l* ,IKp"*MN$E-uR9eRo! vLܻ䩂vr ڽ~wwJ&}Sݚ<+DE6=KEݼ+LBlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث~~Xl `Wc]LUtvXfv9Mإik( 2ZZ -#ap0*.+~ClZ 6$9"}E w~3DS,IQ(1su;H$F 7aw7Z#WnL$B'`6˸+%JZڡfB^pE?zTw\}׊SL=~X=n?&Lm)m7bø!pԑC톒6G206j[ӨwRA-)Q vLz er`VLj+SdJ燿4ep:ZHűviI Kf%(ma- l(??V]jW4YbBB6z +T2wҒAClxtFw?v9zA^Iu)Ai2CL6TF-F=6[S#߮:pU`G.,+\cKąk(s_Š^XkZe6A-79$bBAr)9ѿY #oLAl@CVe \ K 35)^R=M?kaJW(wk("K`)lO|rA 1&Cx)d)4]Voހ; Weu}1}"]4k"9cRYȌ\cNq&TBUw"J&/tpRҷ1'R`y[JϞ 1WcDbثDcV(h⮦Q8R1W7ZcJ!fN7EFī/L(b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊za"aB~fN(9q -f˄ZT7hB6UA&(2H\*Go4B-+9c50b#ID,m뚵abm52qW*O=k^JƦ(L 1C1K޹~B)!9k#7KET|E"GLWoGH "dJbN2$&4oUBB w;oZRk -}/R5qeW!Yy/|HpZ/DqXtr@&&,ZM jo6lIAj5?5;|VsNj5 uPouEv#n8N-rS9vtÛ^-FMLQ=wBV"Xhj2HAK QRMzS$d~ q SKrYuWS)!=BnMam& kv녈uO%z(\[(uĥ(xsЯ$ ~8/ӖĨlƼL!lV_8U?VIO'П?<}Ċ9&M]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث~~X\0]pu.ͅ]0+K!CHR8M-eI˙xH$&JR^ciq•rNLP7Ps0\*Rd2@A%|1zmCr4.3'ÿz`leSL@=jqAzLh4Vc槩4kM\"Fbق&~5z8WcjudĘkKM;w Ap)CbExʎW(>l-e 3qkYBhAr[l^^w$VP Z@PUw+ځ99 0k9Qd _Z ~f,gmǸX Xne21Zպxt>)HOʻ텁D"Tv3|(m^AZ3S),Z`{1BBEkl,{Wp iNb6 omzUƏ`KLz] $T\wm=x&$z9tB0lņE6HOׁ+ԞzW+KQZW2ci~$5=; Y';wT}Y;|)MN* ZE}phOߗnkKR|ґb[s\m4^sIZ[v8-4שʵ?1dK Q@y u&}8bĉr:Ԟ^r1DKyI;;k2C+{Xc_ 9G9ɣ]I#jLJXK&[jc5kxLHdU -F;Cq2u4v%faEȈ iVcAspF8I1<{p}IH'n<-U(2R|&DC506gNHcLRI! (XCq ٤58UlbG1Uî&68MqVfaWö*qV\ bQq\ukW\c\PP8Y6~ b9z₱٤ьi8rRǩTT+H(RM16ĥQVE+7| eS W6\aVӦV*2늵eKG19`U[JcYk+Ѱ蘚9[$ V7YV^#1" 5p܇0I⭕ʓ}clO]vXX x+qfJK8-1VaMVo㤪 , !:a7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUؤ?haW7]O|qF Gsk9<[^e&id7OcF@}% ͠q0a!Rc|$lR6fRJj8SM2jW?*:"1eH G6J `;3&kZcԚנe24MR[uw2/2aIJ(pȵݎ*8ERĥ^[(! bj‘R8R`VM16Qհr=VZ\B *RQp*Ӕi]†.5$*vk4aWcm\Ui8:`JrxK؛zcm 7.8 l*+QR48$'4ژ}oyh(_&vЅ5.l65crSJȐG%ƣo]%KoQqc8,h+CBŻа)%4.f+㓋 i5:mWQq!n<DlqR~,m/J{p۩ą߭OP1IW{H.WxLD;d;!KƿcJ58Sɍo{G)+zmՎ+M#X+=:T &ެzP{;HbO};qÁrWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثxRR0+6*1We08+bsˡ$-p'q-d(ฉ&P09:va[8ier0FYMe6w,M:n"֝rQC- wbT`֧q. A՞U'A|-VC+b]it9U3\: g&!u H\U@+o^ą,{ŝ_'f4ǠQ'畒QQ%H ˴Y8{˨=IȇO*%rU0]Hz$ur+݄?eJ|$ ڔ%Va%cI^aM8s <.&0^F0qC Ph$ T6Aޙ!&2|)۶ ,XJnǦԦXjZ͸銺9o|p4nuڃ\xzw/AE64's[0&2PWn:mbSZ˯o m4ȿgFQ4)1"e 8*sNzlj>Yb;`-2ZNhkcchY ~'5H&TӑZtX [嚦ٜؒۦP' M-' S~*3ZZҭ*;&v9F M,3{u\R]|a5';lrrpNJ@yui}i%=9OP%rz2lȄ [ql!m>8뗓jn@ k4rs> e-b)>fM.Xb!ߖ4bWD[.9iiyFI@kㄷw9ǔ"Ad+?<-9Yu N3Eژ+LS ]Nje#zxW5ڛ)4b? CNUJ(1哌Ucɰx@bI6$x4QZq)aVNVC iVwK#14&[q2FÊR:r ^[UXN9RrIZ[Jb-LR\L(\1fW?4P0vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUؽ]p03vYf.͊®qWeSvjbvX]1W`>{!)aR#vp]V[ 柑=xm\iZJl(h1Zq<*^GW(UēW)L,Vᅈ5逰]|a,I C\\aRFKː2O&sf/0k.] i$Ok#t$3CsR1'sFL;J(㷶2HTvelVR^[̎h ZSӮ1*oIʻzļGfm͒C.,$m`iWJaUa !EŌqla58Up]BME8^3whF`qW6)L $'<!aإk.<6{wǠPT3mLHafze \e9[S*{|Sq5ˮjPYq6•H=2)T|m(k*ژZabT sAi\18mx7jrW[\.Ue6ؔoK\*O T'lV/)jpZeeQ4iDJW®UUer\FlUk,bcq 8+\8-W1aWc\2)%WF1]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU~ 9?& %>9b3g.V>O$+J*ZnyѹmL̦ǔ9sMVrf#.wAS#@)l ue/|2JZ 錑({9x3mFuOEɦH1-\iھdbNtfU`ONد%i^:xdU*Xhh'IM*NH,6N4Prl*v3p*Z&VU橥0S--W2Cbew'ntS Szb8 `Vѱ'W qVJ6;e=l>"a*XhGnUc6 i% !ƮVTV.lV&# ciX?Nqez @,D6C*F :j>, Ht!6$&C &W-b~X뒵UV's)AQ_}3N ((s{Li]Ƹf;c渪i8U$gDŽ5UaD8? JTQ,{UHC\z^ڹ#sLU,r;oEfzy%Zm#%i -z{0Q&S֪EkɆjXO1F Sc JPH[HT KP1s#~& Re~/|idQ\YZxcBGoՂ}ESՂԃޙ{)YT=WOᖒo( H ֧`1@6?~RحY$,](1ƻcZk WKi,|HmV]Q$SSCl\!1`JS.z7&zu4# ֞Ĝ[ǒQ}p£! $e>ONUJ5ӽ126liB2t/|`vn`c$=4R198k`WO)1SbkԚmg9T GAٶrA jw;rHyIMQ_ {ԏ6q`LUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث^*\Wci0͊0]]0+,b.ǣ5q]vS̘IX a}y Z89pkMrOL 2"d0r]]r+j!֥M9n}3 !tX MŽ^BV M{}St8O5DN,leX I,Jo+C &#jЌdZ ZMe/ 1O@`!}lwۯ0JDx;W+ 9#iִuҘ;ɓ~_y^Ed$Լ 1B AmdgV\\21CV9Yߛ!*#GA1m/1k5۾( [WkJ-ZH$%eȴ\jhpzbQ|.XQ㆚1$<֠k׫Hxa4~Vt:e91{1@cr8(KG tSLue_B S&&C G/ʰ:|rk_$w] fLdu9{&CSu'@Z dͶ$Y p6㓡>|7IA!\, cKi\8\Mz,Pu1JKm v8Xmig{~MҞ @Z&޾8`4ze+KDxn@9|( Wi7~`qM)mZkgöoc~s׀-iӶWY,F9 "$LUiޠ;(vIZ\uxb5',+M3wդ+v ABˇet6y2N1öYXys/*@ L`_\cK|&;mG\"zZdfE@v3 8M2[z5ߘO[ k<ZuԯL q 6Ai JM܇2Ѕ ȼ2T쇑g*Dݎ$$ᒠ1F;bBXdnGr",n#rTĕ#/P|z?.E2|!FzˮU "brWA*RzNŝ;e9#mUEkvCB7 i(8j]RrV ⫂ `BcI[cG<_A^A ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v ӅgO*쓌7f8b͊/ 51Wf* bSvXI%_(%F!'%S ė#{H-#LZ:jrHZ^bz nRu>8U\aM eA^,cN>tr@$3J @ Hnĭm bW/Tob;t*qL^?$- u^ r6&EY9@@sZr6-B܎ &v.~*tM2gp@ 1r7E^[cpF'ъb@SUl mVCEMv*)CS^þ2WvxB̸6*S*TCL`«ɨm_ Ua4FhHo?Z1Ⅴcn1b \QiRqrr D텒f-jb.0!cLk dv`Jb0*roTrO ,T$銠)MA<Ŭ*jN5r1Ĉ녚4,>4,ci٩W\E.c)N[wn$H(yٰHz,ъK*G 6*v*pZ Ux…lRuF*3W XtƱ8dgo^>~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWcb9ʸh0vvkM0rx攂]~`I H<(K?1 -Jl'l #X ׹r$_&ut\WzkI,щJ5Q!lʰ\VqZ40rnK.zwӊ0clLHYJ5 櫥oj1hZ96I?d`/DSZUySx48F\қdipj|BXT ՉL(]сci\IK`⊼Eq^\W L(o-PZ'd| ;bf$.̃.'msH\l)CuqN qeFڞ8J+at+}2%Z" mUWhNr&KJ\ƃ Mii)Vkb ~9&I%ϝRy0rhai@<DIϋ5O&A$}8 BZD!v @aU%U/yrR%m_n؀#gzs\ JB;cL\hFE:oЊP^j(Z#)(~:PtR!UiU=02d xJ*N|C IVgE7qX}ZVG|oԯ\|2%UedU/el`P(wVOݍ{S@n%T6jLT㐕`{Ҙ,brJ*1x°R&i׶(@Fw5Ƈ95Hót ?"~JկNyj{V*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثN|*p+Wf*vlUٰ+W.V.vRP'Ĵ£fPe2bmTT}2 ǔ"KMC-~ݵ/`Pp)McYBFipqzW'Hp3han;ѿ1B: M5A1+=`%z ]ݺY9X GL ЃfY$ 6Uu`9&o(M-Y~]vSKLo\%ioMs:kM}`?,|J)etf6=7 iyrV6 Pr6hW}J ҟH>l6-IsbHNo1zIM-@DSK;{dZT/+֤"S2=Q,;'PSMpzXIpП aM֣Fs2Gw#j[>؜t,C?#97l(TQE~Xl4%H*r;">MtĤ"nl $xy8r4_vG*(;{eOJA6k@vɆA]+Z`&E@G?!CZVG-k*U.'o7$d`Jkz{58L:q3 l1[%5ƘצVB @TSiw S+pR2`6wz-]LkU1Wet)v4䕱dJWlo6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثf_vH,ݗ]WcN*ث)vQS vl ]]1WcZb8ăҘ L1B´5PT BTPv؜X)bL UeW)jb9B@h0RNaR_-&iuSS/`C>GA;XNdQ㖓a^hVVz`6Rʒk % H[ N+P#*$V z}8T[H &@[&~6wOztr3ŏRp7AE&AqJ=3aY!;  8 Jb1WW2HR=rVbtUƺS]X@+L*Teԝ7镙,W[v챮pDH^&'e~nppQ%# 5-Z@]zT*[ZIaSR}$U;Ey!ki$MUWsV' M*l`<`m|]`CpA!S,:tWx ?g0EZ]XZ1q4;ҢJTU6n- x!JUG)\UA]ZJ+H%l.㒤 $m^,JXJD 1v $[{"Q+/ZBnGrA$ޕ)5=)BPRnDi lTR&XV4)#nvlinUGlNָ$do{O6tYU`(p$h0SK% ?=:b[ktk*1nڤ-jݻ+xJ l>~k`HsK$w7S4=6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثM8F7|P]͊6v^vlUٰbcBƠ7L9KYk׊\ɆZ`Bkf'%R*aV߶+}Uc|oˉNd58ۦ,X yv#5'~b7I-\̡im`зdyL8-JdlGw5=0SCC9r&9Cm7C4s1n 4tĚN8:VS\ sbʝqO\im@`W(ResĈ*Q"\#lIP^&-a9.O=]2$2Q7<:-alND%dK;팺zdf*V@I,/Kum ,ځi%UjZdEJ%LjTXв9o}NV,i b*D 4}zNr)*1'54YGeX1~ ۮb{zǥ+f낙҂<17@IpYq:ޠ)!zNGv=3w)T!;אdۂ̴?.ڪƪ  ŽdB#QL| *.="\}Sp$+ڞ]zdEWz?鑑bS\fQqBp伇O +W*SxW qE\8\Y{ RHC`0@q'{1A ?c^18fUzv#Y 2`<,PK m&D&6z+VCڙ%r f``!ZVvq'ZJ"7`i4-%\XÓjs Pq.4*HW n*7Fv`=>c|Pr b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊HU  ݛvVvl* إDaC+v]1Wc* S\T: YKb|K.8ZaUŖ=T\mAP65:aK`)W;1uN#lXW*MkŻ *P,X1˃]m"B@]-~?0^59KdC hgMYdeVa+|MS&ƒ3Bqˊ1(‚ڙW uSmWqAQcCp*C\ m*hq|8j]QZ 6̢R5R.(tg/*qW6FSnoACvHz2M"£Fhq52U}k\1(\| UcA!BJlڭ#,⭃L n[ \PDw6CMLZ-[5wZm8Y*L[ `d1J#"UUgh{UA/p-ҤtĪ&nU0vpa09$qWeU/1Wc XUh〮hV*r*ᄞiNV|8*'*Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]u]vKQۑZwWGԜlyuA}>FDd;;f ݩޤv ]{JT܊(2 *Ìr=q5Z PeӔyX^N#2Ӯb1ҥp^E2d+NXujۻ/L,\E&VlPa\/~H56_l- #cHx;dU;BݱA[y() 0-4q?L(1Sz*aW*45†ƧnWl*:u­reمh{mN:KO8,6bbK_7 \F8s=늺*+ҽ0@J^rCgkU3Ajw-(iH7A<ПܵWąE`gĚ=r4"?t:H({^]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثL8+LUx]ͅ]p+WvjWeUcvX.v=&e4 +t`yau0tz ^h”pt:nzˣ0uc|20! 5㪍BKs,x҇& ۅZ0)4,v=rtPC\mzf>IQl_ټ{{dzO( ;c)]JTC)­FeRmhq7pj7!I\[lr׍;d-,jVGxU'- -ҫ +t93XZqZW%ւQBWCAfa!+R|;e$j)TqYQy.m-G'(r) B A;dR@To߮*|T% N1&ː)TSc6Rgދy Z[FS7.a1S#n?gB{z X3wۯc[m|Ji\S=#yѭ&1I<**\O֣3NXWE6ejt8نX&)GFJT|ظM(Epq0o%xH1L sp iA ^/S|ܻ VzPJ֛j{~ SK: p4U ]$Q |t=puo mANNGQW#rEN$RbpA͉K!Q\Z( Pp` +_, $B;┎CaUrhWBYd~ؙS!EZ}=r@i)Ҿ&Y(WUwAc3I 1`F6B]41;edB0{;=pzmX\@RTaZ2bB`QI' GZ -V&& P?gEUB|UX8RQ[PG\ L(Hȱ_]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v_HUV*?`fUٱWfَb͊]qCWc]*b9FXi`jhT1$Sq7V|*VJh)Qjkၭ#P|r8cxo\)lMd jtP,-H1LSb|UHS\ U.- ErU+"52M?L<ζ#&Nsr;M ,p:҈mlO95;Ϯ h= ~朅4eENQm&d\iNar«zch=RvƵPiCqdHFb)lqWdMo)^bgJL2*zbj`TEқuʎ"# ZrL)v^*Vr]Z8p1e\Us <;9=qA_ xV͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/ɻU@GI~i9x4,5UӁ >egSqb(v5b^7HHB]آ͉ca&{ ervY/VHsPG ߭F!Y+)#Gi%)q_F]ʠLA75r'ʮe#/zx{Sƨ Ioo$nTڔ-*% vHclgE ,6-cC5J'eV"0* NE Ly$Lh1R5=C=)ba;U_*VZ|]0v݂`p%+4$~EZUOU%׋ =+~8RoǯᓥBÏ:WhZZ#,ۮ4J9@4cPLkqrA0=Fң۪$U1WZƸOdL/'!B7R[ISmdV*q9b*;`-Aǀn4܃1BrA CF:[~'Jq@: ~kcVݸzNw;wŒG/swB#RcJW H#Gߊ׮% D]Nmi-㈆ BM1צI,v۸%'n ,/RfZs|mE ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثN|*.vQT®FvQPn*ثb]b]{b\Uv87viM3'\a/ALD*|Ė'%='&vZw#:f ^׼wʭM 0`54r)&oH/0 >AgZLr}'ɌKˮ^ީ#0&ˆB˲yS̷>p%hr+qd(Uߎcϲꍷ ̟;S|le7*I㈗Zt$^D=P #Ud tbш}L"C5-5Z"%T)L \x)$6a)jCB; ӾV96j>x*[$3E٫ ~"Prd  wSͰq "6mϦ$ TP%oTۉI'Q0_qF"Qܰ dl&"6J҆aU] %[)niՔp; 飊߾\@e*3"AZ4FWi9/q'G.k[-ȯC큮`22F]=*2*U.q2w TnšFvěd!/.%W*?Z#i@=, Rcn[r:dbɜrB{b\txc5MDhN r0<]% $Q a&5Imudm1KXk51WWq\*)#r,U1#4ɈaKhבf ]ӑMw&Z i.DE=EBK`9_z:+}>*r9$Y)l zetbB\qUWS 6Z!VxiUĸ\% HxRn>XMFXZcJz H8m 3ǾdU}qUdFfF*<-W-f鎊2ZJ7-CHB֘#,t^X&jL (|Lmd ryG4+*X¹+tYZIP]h]0%wlQN(S}Z E^QʇKCNѰ 9*Si)uq0*!,Tm*,wȔ fcZWl!(k 5qWeu2L. P%Mt۶^#E,HN4UT^gp%gf *B8N%h([v5@Ju v* S!TH lNq K&f+_7"࿑i6`I4qAqR;mn4aM#bm rj~wtCvk1 (2A V-5qRJ6=ma[D=T9(Pm\E*.і\n ~DWJ}Zt0TU֞hb%i'Iª$CJu{(5P =hWَy`dvz71!+lj&KA?ˠ:x$aـN&w%FpKsȍepk8Sa*H:!|(;rT2Q [>:xl^5&H @_o?Ჲm#⌠ؑ -i\r#|L WR~ JwǠ) jbcH "0IPh|O&=/-ëZ9>7l}w) s_\J7:EEpEIp>&𒰡|FI[%+ī0-'zcIˀ`J)?fN0rTH4L <v̘ES"ϓjps<^7۾JsJCLT2ᅥ.>r<,OJ{K:85m"%k9a| |)ӄ3vC{d[E銎6R4no \*~#@;׮ l]ӈ+٢7ݻ(DD5]A O-񴀍ذ "҉+M )  h|KsLdwʙ*>`(]nV>ɚSᕴ@Y1!! 5%hv|46&h,4(<Gt&}1w9E?6Tw=kvC9ټ2k_.(\S#eV]Dn)~r1C~VN+?8tʤZJ{`FAe6"P9J!\e|#eZ( R?,Ƕ LPq녚l½ lL\ cLAZbeR<*ثCl*dxH??"P`|UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱW`$>Պ$0`K P책]¤u]b Uኵƽ1WeqKH$&pZ--AN(BW mkJWlCa8AŊO z\QZCN.9z@1U8jILԧN{bE?V4W~hSJ⫘1uzu?HGlUd#,A9m9]Z Tt!AڻOWw_LȲEKU':Y/?w {SMޯ$rCmk_}YVRF#e OANE)@{\rbOAi(jH+2 W$USU>9L5GL!%Ro@q*̆ "Ӊhb.PT'n"@žb̔#E.yF I6gn#Տ\|kVJEfvKƫŭ!-l &x.SI! J<5{nr%)G' )6\Jm.&Jݳ Ul1KlqaB9`oAkJbLR;,T|ԮQ8r (*sg"R~,S2q;yVal\fV#VqH\8Y*"tDao  o+*b*be]\UUpP (hRc]'4enđq`]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vXZl/>l\ؾqպ[yQ R"Wġ֟\pV+.=SBznqB(Ȧq;}r$1!EF9U&% rԡ!j_J[F9X S>ɘv8?*IDe$.@zVCrkZdY+93 Jm۽{aB1\(D|i4C`W,WVJʭ6 )^C1J"M*vHI+F\ t LUYp4v=r`UeLH'jz2jTiT鄕m|r]6ʕa9mmZg:\zdlS[Uc\m 7#*vLIM q7^&4CQ\Z#T.= IK$~bTbJa1"l^c펴L!Mv  j޸M%40]p-朮+ǔi:켸B:0"im #FI,ƆgO#FRV-8i_O5#AS8<2qrsbiGPXPar$BGtc&)ۮD( h}"F!%}8[F'=rB@2Lu4u<Lq! b")"j_~d~x*I뷆"!jw eeROq&sۀA^C8z[PL!^z -:ㅷhAW-d e iA?~gTd`>U_5?&^ ߮izT dK'9Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثi l qWc*]8S(*bLUٱWf͊+v^*U`beUqW`9]ĭTaٮr bi!2Evk\*Wl*(NdP0B-6rl]x( -D ajP|$Rką`PU8s/^h^,5 cTH"-w0֡f7F*(QPX\*:SqY T&>?\$K&dj~]RCslFg|UbU s\ Au+;+HT( vҸHݕR*K-1?ehGn-MzJ$F;7}酗Vq?L@ /v 'z;G"1qm^ʃ79D1 LZ4d=1'x"괩13h)xVPn\H AHM瘨0Z~$AL4b5MzoP;b(X8hz~8׉Fd$^>;S;4^\7H4^y( +PW : 9VwjӴn>%$c ̑6Sc2B,In8ęˀk%TW%$r$QvBQJ2;\#Aƛ3loĜ^eHo{ *;cYxJ2; d#cv=z{ j1TDr/1@2m3?\L"] N5 /|E=3Ȗ퉓Q)D*{Op]$\6R?8<Ҙ TbѪݞH?$up' ~X&!Sm] -m}SE RE.줯SL4m94%,D[yo2H[4&8`"d},j$@|x@ ZeJ#m[Ezb4ad3Oݕ6IBA$uʍ`UGWþ8?3C(6*߸Ő)BȥHL(DZ z!+)2j;ee1+JLȔmd|B*kA”s'dr&r0Nو؛ f**p\rZqWc\m[׍ԃA͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊h~\Q#AǦJ'OMx>85,PUك`Wb(mCDc޻mĩLR\qWcrqUvo .r>ēV`V2G* pj:`>4(q'l\qCm`B~"F(E6 M ţJG kw#'/h @B Wu ҘV?,x(S+V;I|)S4`qX-Aӭ0ٸ&N\N UNוɜV\H"cRJ)n;f~omMtj>(;ˆ#sn_q ŊVȡHI0$ *9(~N\*ŌQ9rHR|m;U6AĔoU8;Bjc|:Jo)]^;⑷ bTOS|1cH9T= F3bH-֔PT/Q68htB^uČ4b<1M1ڽ1()ⅦJ.=B]; ȣP,A7ix+AL`#!"d2RvAʋ$+cB֧+ZqHdaj~|MX;ѮU؍aLח =#OG.KM\*TTȖlOLQA1Lfڽp$A8mp5wġ;p[ARt:lx?͊ተ%6&+PPdRTA'*Ip _;`;@Z$U'Z8hq88+~'qBpZ*J{䒩||C,b1U0۶N֕}LaCa따p_:,WEaTcQP)p5'ccrXyjWc17dz5$ {>e%2]zXQj;i?g|!RcO)n1>ɭ#"2L~/҇"vƘ!1B@8P< Bma*zlzP{`81Z9pd5^嘁#}_:ҽ_)Zo.\4jQsVEu]N\{m ͍hl1b}Α1+ZׯlTF,P#guȨF[lwTJ2@쌺 kZ`ʁ^W8W7A`(k` o)6a(KT>$BёB%AXPwR*B # JX*UԟoScUP:|?TW|4O@lJat%1d]wQ)<2ce\ST< &b@ۨ0 N sU!@irOBTU%  ǮD*7Jls*!x \IhI mDwsJ1,90hn-ޘmQ1D|z8V6,m#)ouZ!`1rZo % ɉӦ%SaD}[;TtJ5m >X$C%z+|??k[H`,dG}8=kS5Ub͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*1Wd <CȥxUqWf͊,bWf]vV*U٩*\Rwvjb]cj䁥." 2ѓYBʔ${aR4WW(~GhZ4r=LhWsl`3V"I,vmDbdcE&%iAO&b>BJP'#oH+Js\B(Y?`k6H@_٣Hh-Cɔ2=Nu TUJvZՀVGZd5̪v"GcpDsr#֒˫!+ԓqr[ 2u1zK+Abp q$ ?Č(֧f ߼Ӹru - [gH(|FX"Lj:әldj -ayڎ R8W,.kCvL @S&!CplNnr>a0c3e FmՀ}|^24vTyvژߞJ?`S2H(*Ez3Wf4K%%QiQL! HڣTS&2l)1Qw_l׸5ƛ^]U貓ն5⪨큚LDJң|1BIVmBV2 ZQuBC{'Vpx|$tڧ"YL$vG[۳@V#(P\+){> {aid6,k f>ݰw9D8р[[Wv8CjZ0ӕ:&m>9dCDWzƯxB)ܩ4?,+ԖYIjrSt@ id%6x$eS$qeqIZflOcqf%l ׭r*/88mJcj+uG`çl)sz@WH* R|S aBj(m$"U3}3GӐ h1,-)JIc)VSq%egd#b`k$|G!6QDTtO-Vqo/ ,bP إ! X][͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊`:Py8N攫a-쏖 vŚˮ*.#;m +e|qb1e6s[AfP'lQvl3b$펌Kei G_l $˿хm^MJoT,Bژot[c)ZU 7^ٛڕ8ɾ!ZSR<1U~!dB#tqQ)R[½1X;! {n*9S,T(ɦW eE'zd/ 9H@tdJU*z[""D(!A*r@&~tA!YC+ >XTaBhr¥ݱVqJ/6 )|v*ڽ 4{6fL|B, 텐n>+`B@>#`P !$N$MHPk$&@ZKEQ; pNUSS W0 TV+4*,pbKoܲ銸PvǢNEGq&+\Jy*H*:|A%97(E0-<UbN5q!*=1 b3gq#! {bz,HztUTOOFI\->(ޣ|Cd2uUp˦k/v8 * UnX⮮] ­WjDaK}Gʿ``Q#8ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*g}?uh٧k6xsrƞ%e谿m2daPΐ#f뙟Ku˚EQ;b2(%/2CjeEKٺtȱQlw\PC\TTL :U9S5#NىdY'sc yg)b\ )A$@8H9 -4/ & :ы !|C(dX gM |kWmzt!zm *nzb9hQ Rw۾6ySz N^l! q"|%\\om$W6=q4I+ co-oIWƪkilJH #b*dWkU;aKMFƾ|**r *0j'S 0zz26k"=x^i렒Ճ>`& HQvj-1΂r)_Wq̤(T䪩ZikZdJe :I E 5m88]%N\D[m4Zِx4dB| sq8E@; 6^vR-$rCʜ&r  VBWsn={ceKzP}BI+Gř*G\i`M8N5Qb{eЃCNEJzv0%~ uKz,ik\pq(@ ^=rڴ"I"1v8)&0b8>#ToȜ\ЌB-;5+̪>\Җ 䦤xg=toR"~"rzW5 M;T29& UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*rn{e ثUٱWeWf]]6*;.XWfv^*챊, Uኻ!rJK]j0 @̦(F@&WUXLUa|oɈa"^5"s!$ErEIZb`QaHmM(9a@Qo;JEp 탢BܒhkQ("jK  oN ZcZ~3iI) = CSU.KEEڰ[JJAFZ 1"\O(62f?ZFSC_X{D옞ȴ%ma1 m= MT`(L쓀 St4`90PWL޸[A źc׏s!M̃Ja T\?mHT[폶(,^0dL[huʌY_7bMՇHe!bN]10$̆Suv}LIMcW"6 ZToצ4Tu}9~)fUq),V+}-4-"_5y PYQTP*If!WR;.)mv `y6a0>FYtpIeCV0\1;҃*2gIvQI `wߓ KR!%}:rE[A]`y',~#ZefV2+U|"&؇`@K! ROfb|{dwkiծ f?VܲD e1_,hFjotәjev9[tq!WcPlrnΙ^XSC5UM"vBg 2aP2[BȮ}")S 0| VF1Lb'ȪJ(0Mj*vJB zli|L JAڣ*uҐ HpI`r<2^;`y EĄwʣa]"E2Lm Ic\*j1W*`1WW51Wf8U1W kWvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vZR1Wg@W)i:/E =P8]Ẃ]vjˮ*k㐀wZq\a+J[ƤTtł邔qaS/㊁0Jh2J\p…Ƅ`GC-e .9/U;jy X⧭2rAZVS[S5jэ~N8:WTrAT٤a.cʋ_6!0?(AKN݁n!lkQ!$w}#n\PY P:z-ضsPS1BY=82~=D%^XNZRBzddB{d&.A\"h7Mqpgv%hr[Eʠo!;8!SKe&z4,”'j[{`ZLR᚛hYe5Y{`bBl"A'sb_k{jIZ&Ea.tB،Tt,UR/ZZQ9 `KNhjr+mT19Â;Br·aAq5E; c\vHI[U"3\UݲL)UބL w xPPpxY!WfTbH=;aV5UjtG1?NI]ȂE (PaiqQ/GLkFJI7߶3Z2JkZr|fRk}8׏ZeE&mӛIQ@G*t)9V&v0+\]p;GjdW"u >p?)R-b"z~c cq]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*RWQ1WdKWe`Weʥ1Weʦ*]*8UقLUٺbb˦*b](vZ42AL r`@L…IbM ¢ưh j/A^ǏlDR||!a޹5Rpw>80޸L`j v')RJy\(: ْd5,В+ b$RV*V<n0eh)$D A=R۰qƒyJDS"NlByDT́Q*ֻb Cs'JV}ʮ.Cȝ0"u Llת⽘_*%b; cj~1e!?||3*k3 Sc)XQeOg`رj(5HBako'.g^&1kn=2SYT}az9'+&\KS 3b``k-F*njUqZbUq'ld;FmA 1Vb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb" (=*YO,6Ib[`+QĠ@_,ޔƜ ('a1p"Qz5K]cĴL]tz8֙u8SnOPjF4%qGaE^A:Aû;VJ8PYjɸĤ)q $܆ )u*q–Lw l pÝ@֕Mvl4ItmW%{f Xn Lw%MV ˎ!+wnۦ,sS@0ZM~ 02n2B{D=2 ZW=OBed鍰Ga+ 4NfQ^`a^y8!nƻ]XȐȦ>DCJZ-+N>r 24ij /RkhJNIe5(;cTbl*i /('*142lU(2,c|F5Yy1 pxTo|q;`CCWRָguH>Z V4sLfk\r&$J! zЇ{Xr q2BLKҨQLU\50ݪ[vJ਄`Վa({CHEFD<~ ƒy/EW,-`1/U1AYA}/O:l*ʃ6c jx+$ɷ)bTWnR@uXn)DIQ58 ,Z {-W(R\F;J$bJc`x3 YHL =0 wc*0 ؠn#T hq"rJoY\ tg|ca$4( Fa Uq)e$Eqjl&.n+i\6|e9 6*7۩ѕwq02HT _rkCA2(wZfJҔ$p#ؠr 8H'|R+Ȑ]9f}Aj1y Ui̾V *\xh,UJ0rJ{c%2J}|2IlnV wxiizSCCV=t"UE: []dmR@Ph4}MspJIiI8&|> eO6tBnj)2Q~m+T큙 Fڣcu8ZbFU6#6424,R@JS'=E[J$qO`pa`LguKe"J %9*D;vŭ$n ZJbCT"ue k]Ƕ_|6(HTaZde5W& )Bᔣ0IxaW"1x`I՝̢?om8 WvkԜ RTJ`c ]ᣐ7w/ú\!rzI7qUD< |¥tQWoq>%zU!-Tux7bmVXp~#M7*U0o cn)JT)s>58! QN y55] }JOO25AAdh6v*N()5"#UFG9]v)_sQI'0b 6*T59V7팂h! *~!%q5 -1 n29O1k6,D,S]`_4&(D7)\UGSL*D/=Tetu~$)FRxEQ5la]3mɱ)TKs;VrA+mGݏ {ʽV#Jkp4.B9IH-5$m\ kRvh4j@O\JS(w 7eiG:qV 1zֻxjfnT2zևd|^KjX/v(N!jдz|Uǐ6bch|0 Iϩ'ofS E7Zb:S>c2•mOOllP iZqK 5JE)iI1ҌmzvZnwkP6&Jis0Ox``Xw^6Ҕ,y<@& uk>J$;+mK0'@ Гw،[4ӵpaY4wK6a׭'biM7B v#POAq$Z{ J'TUbvi XG=1=6>-Zb,̜+MqUrOjoŸl (AW8C G;b]-5484%(RrEG Yw};K`M-V)ʟ0cQS;C01ƘXlp 29$6)vVo/k51WeC 1V^*9qWx N^#."qOFbȮ,U3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbY'a JKhLqhJrA|>aB ,|$]~q@ejx٘T|@:[!$EJ)=9*% -Ok*h{(mXݬqzS` !x_Ƃ9-ӧDDԕJl\O~vZ2 ;づMI /"Bx-',Х*+LmsH]+ ' .&Nz4%j r S.H:V[sHr:xcHP*0޸i[ 1/XwĂv†(3آ ]$K7Vz uC`w]TZ/o@~Uň۶/r*/EVj{8Pv(.ʼRׇ-JmĕQA01;-]\]iAMĤ*z|ܩ4gdʼq6] 4@TKGU{YH$aiG}`ʹj~d!OlPolAJo*-(,wJP5T֘@T&WP n)VD4'qᎇ zz *+v'Z:nqAjOPZҘƩ؄(?PK%4NS0kB;vM ,u51v*cC*N#LǦܨBUs[YJm qh+w BMA;U xdᚡN ~$aZ ~cA*?Ow%R5Q}RͼrÈ9O;[Oߗs})Y!G/6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*^ʞW*?6)vPe50.vX50C]b́]/ ,bcWc*bkbVJvxfE0­BHM p <[M49Vp$ZbJr-^UyE5 &fCBn'V?N#HoVبL)SowZnbOQP/0Z7 +$Jҧi֝h `P28~*; IgbT؝TǰUiu]@+m>9R76gxYU uŢ,ZA\W/,LE /lxRKR}@dxc<nTUZߦS䠝~(Kt#G O RAST5gT-p^3CHp$UQ1{8-a(! 4lB(G'L$)\["mzg#,R[n)@v8՘HldY=`iSb+Lmda`:؄C)pl@fCI { -4Ԅ㌆\ FocgS*!@e'FC"y5Fĕ=2Djzee|DЌ:mx*6 Xȑ9jVu=q]cZ Lw8%k)mZaV\^?,N쀥W V*8- A.@!Bzx n[Bn'tMmjjwQNSlH$Pק5(~0\:}%I`ydHBao'=G)&e2` 奺"' ,L 5Ye+8 S+@s7Sn9WrEMw޹sVȔ"1کU6˼DwbOD}ȓy=Tt=wu(:INB$BP+¬fG}^l HkZzoq( c*)'n TBBrvPPflNIF뀛B4bF UaAY[$#T;`g(H(J(G}É J/#5I(RǶT[6  \ LnñuPNۊIDs)ANDN4"V4wZr3N08)M,4,C# Fdf<#9 )U AAEN(%BY4qX@dJǡCZwH;~G@1~(;{c\w!t})ƿ N, WF8Y"Ҟ5«BUJJ!G\QW8 O:bS]T'JjB^&*(߮Z$VI|:gb8W$ y'໠2;?[ݫ?F0=FT3qܛ8 elط\{s edS 4p#*;J0\Tn8{bRgUlXFib{br=qc WI0l]Ҭ+AA=#?F1ȭ#H$ T%~@L,VoPaJClMP0(צ6 (Fw錗E!lhC& 0r%&v5TdK$m| c;%(We.] Zʮv^*qCZqb7 eZ9L*7m8G%^Xf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]b'=A}"zzmJ|% ro4tM^7*+zv겷2Uch` T7Q\̭@~Yݴ2NȀOR@$!Œym~b ĥY#mإ G+ .N0[yywXBo $ ӵp$ɷH*66a~- dɂA_v!mLW1Cö'(NAbCvLJ᷎ CDW+6Jܱ'k3X GST|4@455S|G2`m%~ڝ:*fW049h)]VtĚ"wj\)qPMp^hqwH4Sz`U"8V+22Gjc1eczj@0pTrV%E H1Ȓi\%Y7da YN |BZ$!A`%jN|y$%JZ^7 ⶫT \BYgL)_l5PI>φEۋMڧ%PV)h~xJZ$$Aڽ+ZY}N-VW $@FLc1ۋ!܎*BE)T8u'l#dPXX@AIU"x? :`IbY"/ SȷC~J ).L Ssw ]lAIcn8UI _{V X1ۮ%"'fIj7^W~zexƿ" lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*VݸȧU$+K+vlP.\Uu]beaWf*e 51WeUx튻.WvS"톶3`-KSdGIAצpb3 +,u+EZ䆐bsJ6sҭg}Q ov B?|ִ'!t>w &Y 8w59 Wӯ|]Ti})Wȶ]zX:EN S{wG'n  oS m3a*qNG5m͘ J =;6smWY㲄; Yz+䱬g=|^bwr/J l>O~YR.xnV|/LŲm2K7[x}D؄ɸȝo7YHN؛Eɨ;d)(F]*h>yk$vGN1Swf' vYAqLTV1⨴35ma_e3+k&zo, p*-bF UJzPx`iQL%GZVx~BҌTdHp de! gsљ.UZJWcJV/2.Ϻ WL)]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU`WqɅKS%?O7bGюjURcHlᕱXƱjX,E>A،نYh1C-W⻁)HcfblT`Lgmiw6hӮ*CRF$iN1k MaLU!؊V&7BY$Fƃ|P|ބɩ*^18ɐ(k[o^S8R(k#ȥuڵd+mo€IV[ (Ɔ=qE(+A:/ߊ"7S?" zuqGI$ A+$;ɰdZVN7#.&He q(((R~|q9 1!CC׶v (qq8CtnڵfD }e!ic^lB 嬂-qLPuy 3 "IfPFCL UTNb˽s6*>A $'lw! CޘbU o7,iM!<:0~#oc,ʾILeJ@ $|_qlє|S0S{]bU6n' TJ`J$nOх:|F ɒiR)ɼ[\*^hBy*S ГlT0JPWf08xZSĈnPw8;U 4Tե:vJxhcʝnر-7_U7*qjJ* Rw9˙|hql~%P(1UlS5QLg %NKm!Uߡʚԁ\ ; q-!]$剐;.\?E*$4R2펦qC!C!mNT;*!6j:zL;a.+HoLt$|b{8rAXFH])Ҵ# 9"3^d$7T1U N@܎\qAA䊑, -2Cu;x吥H=EiC ~5 =y C`]bU{"iʢ0+1ToCB71ccӚ!-aj`#cp2ߠ9rB^oG;p5qܜBS2S"#44 ?$sq!_ĪuxP~,BRaU.:׋d- Ixr6(ۧ|'^?v!N-׀Foa+hi42^[`e| O@RK䲏,{a67ʜW'L+O|*j#tn xU Ic{#lQʃ& s3!rT,w=7^[Siux[mS'ѨE2hT CihF`oL~m\M֘2*dpvɅn999Y߷Ӊ*™5]%W<_ h"ؼMm#@}c֝6B*R8RɠKv;ȵO `9)پzMؚbS!NFyQ k2W̒7>MpMO!Ӝثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*r0>W@v1NqWeWv`U`We]vc6,UxWv^*1Cb)]v v2ĩ # 03IIeSldGgFN4b*zf)K Cƴ(ꑊT g?Q`Cnq+-5):W}w qT1 0 c&cRPԁO_jr(C_e9E8X 3j}1Or\%):vlו0$Pj-}&*8bIOJl$4F喩ARΎ~z%PzPRf`"aB(H ow*3lck]v8#DA(abHɒ$Dv2 @rQ4frx֔N&V¡]%1@ItqQ U{Y˓QI逘oLؔZYA2kS|FER? `+LZ| [Rw*^(Ʉm؃s.2qdk[&@[U#㑏C+UQ V|nWWӊݍ![Sε$>^$+ӾVUȉS:MfI]jhӮ @Jjiʾ35F@.2ƅN_O&0b|U2k4D#zv KrMsA  ]ޛClΣU~%>g&yAuw-]ڠMN Y>]ѹ큥\ se%ߏee)jeD#XoSF! GiM&)?E(Dp=aPD]zxb8iˮ]q*Հ@B> ֔nlAG_(V4LJ@i\60jq"O=NN1ؚZU0 ^mP(Eȹ\M\ "޿leFۯ|)d\w ur銵;, U1Wf]L*#}CYkKA#"F%%H8bjG?e\ع(ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ 4HD*Ǣ|_H?ح[Hy%YMR1vlUj'"X֙Bö 0ҩ>.M\2׾ @;S$ \lXYtǁ] nbf,fkrM. I•U()cLR`D0IU0%q*icջXON8ҩ,^9j *مW908R?dΙLnyN?ój0^vAJ'킘SPCs2C9#u;aKJ{퍙$*qXU뿸¢ ]3li$J> KُL|Qd{8R%(bLQB$FvlMFJ eic bU ÖR`p%Y0ت$cS|=8Y׸!(Y>To6MSR7Jei*FZ됴F $7;dJYz JX} V#&pyDWvP]vU0SaV<qk.P,QhkӶ5IR;Fw&zm-Cr{6*!dwir(q+뒦Mqra5\;SBNcP% 2I +Lxd3356q~dUB4ri0L-Jc*:dTa ON›L۸ހ?$jzTBbVƣ\SM:ːק|!9b`bw"FV_lCC IƟHw?^BJuhAȰ=hDLPp|1mcR)Y!ڛ bA9($a*똱B hþ"\0%w# 2G"+N::$ꖄ?g T((7 v8G@ kZS 27-E-ڧ*l,VS1DBzP5 y: e#lF?kjer AE(lW|7q s{e2H@\1`1p!mSVnq`+YIn/ JE *"rI0 BVJT}*bAaZ1ڵtdbO3צDilt=Aթ^p/h0(9q H #hWu / HU04`H!\EȪP? BPNU SVP6‰*S6؏AS* 1Wf]aWfS LP^)v5lbi)@Щ,$,^K+Ӂ!S]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU{t,45]1WebPSzCdb0R)c2WG5p*/."9$)4'*f3-Uc[Rd J\^ Y I.*:cj !c  Mɩ8ƔRb0;l)WJ.es>;Ӯ(kb[zbĕnUG\]mzachfĚ=1HWU9M6Sk0/;u­rTߡ-8`JdcJX7S8؍~x-UzD1d7Qb)_0[`EGiR26EsAZa dะ悆c3 Nr\a3}1|mB0L%X⭗ ۭJҧ5)Z\;`Uj8ĭsluk*~4+ז,N";P r ŕ6|Or(F$PT }qqU1'rAL mۖیr׾6mUd\TRl9e v&$(~? tHjl2 -ؑp24N@]j(2kѝ7|Ar aRpZQ,f%(؀h*91ҿ e0|_O3$+£%Ĕ(c Z |W"HC1FzcAXy3Fʜң<ǺbR' w09X2P&@`!j樈 !>*4N8PSqC-(6=w=*jNJue4Lī) 21߈b**r*FGPQ**Ê9 ei:鉄0sE7FD:PS[ Rn`M=\˅1Ҭz#mK`@Ph[r|p?UF* #=[SzjXW̦C샠BKD s*7l zw8U=% Pc l04;b1Ne*»b|N09;᤮`5ƕqRƘG[\"cpSW=4e242%e#HC" JVʓmҨthAoiW}[WKJ0aj{VԜIҾYZ?&I]pP)PC1$tL7M^GF,T|*@JZ^ (SӮDJu=,U6"um 4 Rµ[g^@mAO 1RS-(̌ NBKfQՉFHF@bzUMӾ=$%BP9% QNXcNdF;x+ 72w2f*zV\ %M$AC˨{a!ŧ=JuC*I%tzm {ԏkBI؃_,•Ƅlr튬 Tsz$;nW6$J- RzPB?~#)!\5,;din[Pf # MqXf? @ VyO 7*Oq@6AJ:li)ȴ IuU1 8bԎi*I| 8ZqMpƟ$- :+aB& '|IU )Wm8ڪ+SH0&A4܁ZЗV_ǯљ^}8fW9ۓ (?&wBiˏz& T^2Ԏ/ߞցU|ʁل=fr-f=Vu?qiz8]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*bWj Dop+u`v?Np؛G]2We\RX Rxv9F;, RlU^߮[ $ `P7L8s2TEΫ'0~~#:3Kk߳D_5NXg2|˷|QTV+ P䒥2mGPuON!G )dn kFvQAKh{SVB "'$䏽zoL %d"5=1_PQy x{홢=1MJ֕ B'=OlV5蝲́IDLo1? )0H*AvWgJ6FnhM?7vyù.:y!tn)єH1)AQ0:U#r UjaR1qEUcZn2QB޻9>7[쎙URO8CӮI"%\m*jNFJDB)ޘɽqH[:!)N1o"ʑ0X)j7n20<)FQS_ *$.QJ{i'Fi 9()NB¦>灝`&3PMjqpGcF]ը" )r<[= VԚvLG:mIKH)ZWlBVZS*5=;Hn#QY:cካijw«#le1LR5"i\UԮ*ثYXUt*‡ek**(\__6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث[YĽ?OOQbbp̦زqV* W]++X*)9bVo$b߾JM)T c(8ŢZ*g}Xx AJ mղ;WV8/5r)\);/\-Ԓp'ŷ([g)ZiZ<;ǒe>Xn^OIVR…ʾjtIZSTn% zMMdX%EO> LB Ƣ«"nB;m_ij(6.(Iً=юz#&8'يSoJµbF(q40K׋Uߦ5 JUG,&)n) $`RI3FݱVPꏳ!o}CbHd-P(N+ W(AM#Gj|qJW+J$".L@*( ϾXsbN$@'ևfl Hh ӗ1|Umf9E*n_$" ӾLLf|rMJZ#ظ=AǹE2**>=)1=NѩU=w-D K}8IB dVܞ8&< 5~_vM5d#pOӶec\;p`JArMQXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]Zpa_\ 5K&j}6]27|1o2IpW(!/ hn??TM%%H;}gj,bAiG^.Mk;9Ve\Lܡoexqa4j9\v(ĸ%v8Xي] , Un(r ~ol rQWsx PᲹM9\oj%2C~QQn•ӧ#sRߚ0bxLBBi"W*S:sF;BHGmQОJO!7lZlp*\/5?=tJPSMA ZboTy}JY6bv<'!prʵ*O)>!tdv-!,=>-\awՌ^#|MHQCv|Ef@; ($|1Uɪ(eq" <!>M:U]t|N&058-۫-b1m*@Gwa҈шqh (^)a23j63ufpI;pO|dSI͌`t1 Ik7=0q2VAr+%is>AXZ2,bdYVehw'o1Ҍ)ޙHkwyv¬v޻cmĵߦ2p-D"S-1$cA\k"PF _@v̚cIȶ+ԌSm V@B m|zFP +hkٹsfҝ1 ,3͒H=00Mh 1lM(9RG`OKNU5&<Ă|FJOڧa: " ^}jq52ZXڠ?gK[+➳,?/%FuWr06.Ƒ\H]qVv(]\pD[Ha_AINmaƗ. f >y|۴k a".9 HC'՞x̐8Fmi >-eկԐxh"b:{a^ Bp݆W0/fDl7oSL6nhl#[L l9hk0v;Wh(|FL` < /YPvJHde`)ңCq\ .0銭fA`*D<\BcSA&\H0Tav 3ю?N% #,@PĊY6^^ޠ]ȼqJ\0+`PRlqjq+P-4$LI1@ZlqANwN[B^J' lR@_Ta˯=2@nMJ*:aWAo堵ïtx<9GFF1ނPi K#M*qO BǷ\䐘v9&HY {`vj)p2oV%{Zt1LBgO> ],6.2ClSKi\wX 3O|mmPWL6l q)FX_lVzm3╣w4AUXv}8*փq:U| fB0 ĥrRB[pŷȲ`Vd+ L*-W+;6*busW (ZFY­b3* Zr2+ >c!p܃2qU\UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeU='Gf-oOg'?Iͦr].a4=Cɪ3#0=b(0!!ʱLb;.F^,ޘEv19.iT$OqhC _'MM( ON$E3߷Rdȑ#1B#+UMBNfc*԰A7{ZSp$T9H^+)<ѭHft¾?s1> BQvZ}O_ݲuꁘ,dQ7?f5ʎ% VN$ߴN5Oߵ2 7Rev$DOY7 W6@'SbYZ~}rj6yˈѹ94?\Pݸ Tj1L'koL=Nw?Jtj (D(pƹbCwzo*lWltM1+cLX(eQk q484߶IN=|UM9‹lsTomWƕ~lSmz`^)N:t8)mMָC-J\hjr}pҬ`bIҬh-2 /Qb4ק݊V*+W"T`{j\dQ7OiwJ@zTdUedB1%+9gd<鑥iV؊: Vq V-5#CMq#km,1َQ $n|dl[OB,ѴNcqFRA,{8Uثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWaI ߰zWc,|Uf87ؙzbbǬA .Vv7qWf /*1Wc.ǨDžǨ)v(k5+]*Z3C-0KI>ˉ`PMǦeBMd%70r0’m4ⵤIr5k2_^af mvzZ ?e Ӝz-M0sAF)*NĮZ.(8?D<0*SL#*P}ŰΘ t0銻*xv*챊B/} HZ˃NMbi#8&7„4pZ0p"); w* -U׮dj ~ ݷXVUe %PS !+bĔZ|pOVcD4ȱO4jr%{i_yF\+z SO H"m;S6ŗ;sC_%˰a_IbA$uS,m鋻ryPG]dƀMMRt!e&$"ȣӖ5BCՐ+` +XY!y9#& u[jZVF1)? 'mx)!ɰnjcy&0O"4-Mc2UH$Y.J63DT͢񠩮B@%:1 kVRiΏK=bd8Y2eTem4tdQnҳTU|0`Y6&]o5ܑ>9a{w-S^ؤqJYwRנ 5q=rIBIv(p 9 ݫG,S)߾* ] mh|r ĕi< IAJW-  Mk~#Bu*$9nT*52e"cpBpQ@l넅X#6pAC]L "'q48|{$GaT},J}H>>X2㪓ac›R"!b2 i&6I3@in: E,JdTrJfNJG|T'0Ap؃;2NĻ-X+R_)Z:C(I3#Sl$,/}9 R{eȪEw]Ȩ *Jc5=4 6WnpsO/l' m&" ?d\N +S%:%ۉUԷ›C |lJfUt٤W?iN&Z)PWc >o/*i|p+_U5`$IA0V&\A68Qj˜OMJ@TCIdێCN/ء,iWlRK'41S&UkƒS~xmK|1nq!+HޝMj: b :$#2mAPIxi\|=qEC>cJW| q~[]hLiC.kLj;WS BJo#ُڲoT%^@8sj!*oaFeU^rIo}њ{+t+yĠPbpڔ%1iBz*#qBI A,xJZj}/DZr߯LP-lC`폎=2bP7 ]~H}N Hj1(޸qf t.Jؠ.g-CSR,qaMp h(|1;3q*kWkGE XȪ MX2(_85gq KSJWm13(b;E.x!>Nh,yҡ#Ð_l卪Jz{PtţU>ܩ@bI!bJFl+SIPH1*^U)hZq UcMqjiV Aች+Uhp<1xbatDGӏXF6I!>f:Bb(82Ru_ 7O4GʛG2ccw$?7:i>l{:(C9g'zq8q2QO01Ce~)3M'pGM%ňʌ_C&ܻeR` ^ۧ$V1hkV0IJ'%a_?\1G%<J:b`:dB,> j1E#%Kh7MOAEmAӾ_0{1*F1xCh ~5, f, ߮ M.M2|DAľJN~Amqj EԎ Uz'mL 9(dx|Qd7ČBEB2XI]"؋6" {c*׮"SH!hNۦHDb_-/N""X‚\m+h)b$R0A0bj_S8ebGpG*챾4rKYWc[*4cs& HӖ`;_@)ZTdg'ԥԡNM- icM ip5vܞ%O6 .J3+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*9XfJS ,ev̼IsbƜ*]vX.8Uث(v+Nح-e ptRYb2BD`PQ&fDž) ȽЌa`O4NWlD-'"XoO׊}aʻ6C&) !CҸ.)ԥĖA^qr) Vy:0[gP\?.q0*o8lTʙZ,-BQB uEO\6!,i >[{1;_quqPB~y_nG F5RB?8խLo k3}Wav[ܨ%T'{OP>{ab|ڙ/u6/p>@WlAVUgrI mDAiUP:NwSZTfӈ(R}md%_piGJHeH>&6$AI!F=a58UQS#$Цe X`bJxu81B|m\  `M*o781XbPגN'TEm@Mʩ~-4R܉eFbHƃ#ү&vQF;(OJ$s$ Lj۶"JKpjnh%;tOCb(<0P@ 7cnam Lw-OK5F#hzฏLl!OZB>X>ZW K /p)ǼF5PW#k[r.g sW  rO"UWxan:@FqQ O_&)n'i"ū:,ZL2ҼTၽ*o[L}ħC]!\GBvɱSM.Fn5 WG=*ߵTR2)Fߖ-YaNM^($oCOa+^Jez ;b[IkR1R)ݢ-Q|"[?Wt|x|1%[ƙB7J@r-xn j~iZt'p W" >lB@kɀ} A\(^g"( %AUvQ[6*ᗊLUt]U٩,-1V0XU5z %qUA bqk1ƽƚ' bڬYt:Ãag㐲)ح6*ثb͊6*ثb͊6*ثb͊6*ث*OWmXVbٲOjrI:`բk>-tUM7{|;v#wJ p_ yҍ0cQVmɁl:WJԌQZV'S0qF؅W ۞.֘0Zh&*j=*%a쿗Zm>!HzS3d~V*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*+8*0+D=!ػc*W;QLYf;lUث]njRzv,*UbH[S労A3)wōh# q3 ;)]\qV]JKmLUEqKc\R8al)@P|5S̸qzH59'Џ 7X;`A$))]ÔrPv˿ѣ^OSc{(h~qO҈sǶF.l$j0۱Gfi7&75BzjwCI-pquv%Pn=N1t]P9 }cVc_mONn]YE9j08 8:2pƠIX UؑOiF ZTR+Pr UPR0g`R ]N >9la)1&;K D&G^C,8{ڼNm^pH-K_+MvTe`5,9TpR;RѼAhVA~,)ft2 c=unQlF:cЧSTf) l& WyO>Œu#v.<;]N d zPj*? Y5U9 N:.(5=)Lw QS%So(J?`_)?KgLLR*jb2C"Am>ksGSA,Aҟ~5rXo'v2 R6 Кa YNPz]$pnle3"I& qmjxlbݑVj6EH*7;|-$c<._UwFh6Gè G؃R1R03Dfjl;DuȪ)Wc$!NM&6'щE>.QvJQHnj2*[|&է]3JknunW~.mJimcjbMAg_jڦWs\/ĉ' QT ;L0J2^ɈݸC7z 3ESN`sY *G &(&&%0Tc+[8v8 *81V8*l*]cAH|N^#%Mp~qF3Z_F&r @?iG=Gdd]cϛ> .#aVS¤+ٯŀqgu{h$\SZj&-vlUٱWf]vlUٱWf]vlUٱWf]vlUؤ\FI]SPmNlb{JZU٩, U\ RsSn\+Wf *pZ8w `ZSku8"=E&C.)jw $պ޸B PhJݱo!1v>c8!=Tf:1lj< ɶR>Y9^ٿr66 $/HW!,xgJzKLQ|:#8˭2bL+W|Py88 '^ *m<$GǸySb2yy>ӱ<(O%֔[ƔO8xQˢB?`fx _)|Zd Ԋb7lQJ2hqq3 Rh샾?CS(d \Չ?<+M0@8ƪvQLU-XrTv>HA̚ [*clBwQ$78m/'){}FI^o_Q#F{ı_@׾+a^ҡn5$5Iĝx#uݺb%GoՍ)UY ~"1Uر$)a5Bh l=*Ўuxn%%ƿ~1cզ(!^YL$rd6 )wijPB*VnRLq$0eEV~-tǔo @6JI>1{KX%aQ D5R& T) 58#!SS|_zߣ4*ա&r[iyJ[o8l >Nˈ6Dɗ 6?,2 QnE :ă^Yo٠Ǯ 4Xs0{,8$WT^pB pn[.,6ߦ>F *(]e⋔!R0D EE+%f%BZ}IlUw%ϹciH[5 km㎶II,B"mz8E9?>vE[{%ea)ig&|t5Ѧ# kkd7DFN+ı9/lF6FY`6.1 Dɲ8$BZ%-O1J>;'QӉ"~-|!"_n}o!lJgiyވǎ@8M"E'< jzۿ1 3=ޮdlE L-r6&qm\ T͊6vU1We u8U1WW51C*be*ͅ])\(w,`v@昹XVuh~&1)-[ +9&+ qVb͊6*ثb͊6*ثb͊6*ثb͊,bξtcluv)P?%eIgƀm%/Y=j͑.Ul-qJWQhQ7hv̧ɝمYT%9e@G$"S}8q>d-(?׶bH0K$B q)!(v^Uj9]Oa(o j)-\ZS`*gnZ6ڋ2-tmּSUHQb24>ȖA=ѥ$($ i# UFǷݰ='J$u%6JTGnS闃HR`v"8m]&'dZyoqQZ/塁(螢 ltR"ĭ]nbB: *zeӶk>86 o'S1.;b7[mP0Z68(i(C XW$liWeAI ({aU6@F*SULZ@UEsjlcL4\%mU*GF %V5n{8ed*jqXd |0| ZJ<; W윁M ,y֌:d qR=NXjEpĜjz Wu1ZW]~5um)Pa(]14ɏkv>#F> WȂC 9 U]O&3+A-~"~v=: Ie;p]Ο 7[ݫn=8VC_ U۾DnB3Lj~E'pHS*f^'C֛e21;ciU$V a"5qi\ۙs"d$H߻QRKn8}"`=ĔPSM)A c?QN0R)!QE|q+풴7R=Mt푴jOqm 2\ڔP=2Ah@ @I$LKCKlQ :f BKWiUS!lib ȟwؒD&Fn^?߈x}8R sV]wl1;B.kP$ :,+Z([q^|Ybb/+Evu&^ Q,T|ddI׮J6P+>a]%~#;WĵZ.>FJ;tǛr7lA$ER:FC5aqO^P}rrċ ^r+%Hos'.q2Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*^/RP; %]r*Pv q\Uٝ9 WbAH®МR1Wccǁ]-p+@ Z'] p )v'qKZǡ)v)JcxZk=c)h U'69oLHBImEl)(9tx%<TcR t(^j<0H#=9ZD@Aa\p ~xˆ7_푏!s=jcone\:fb.K^cO[`aLS'hH?-Lv2)mƭncżO¸0T?IB)/> 8#A9p‚o-\ޭj}Qxa Pn%5nzŪKJ7”4Z ;3 X&O SALT1[ʮJ҃'޻fH򾶨GĤj2GYkvRh|Pʓ{]j9*n6%+IJRN&~8ILjol "JqJ (=2QISa8#*'E;{`E+|~<\DB` Ĩ5ԧ`ĥ d`Aou1')Kltvq%ʌ( J2#Tc*1yj`VL*Z;a6­Z͊2\0+xpSJjzaE"QinX~:RicNE1dثb͊6*ثb͊6*ثb͊6*ثbÝڥ=8B.-Z@Ȥv[JLp%aCbǁ-c]Ƹq*j`WejaqC`bc]\rbc8VqV_3Nr*87'o\:e-jqKDָGU Y|0+\­44J?\M/NPCoj p1AOpRkGP68*?118ټi!M_.=]y8pf& iQp!ǫĸ$'S-uX\mx٘Rzj:c򚍶r,'.ߡ" `Z+\m NV~{k\*O"YH Zr=Z]yz@ T!V#I%ֿ-=\qQa7j>.%*vwvxݟSؔjL{m Ll*m 4~bGʟDޕׂN.i7b嶪%"[C17s%e@`OGi&_;p4ğiF `&VQ1Fǥk¬<1&rpZҪۯ&ӷ M/XTt}aK "d'aiqVbWf#vlU[1Wbbf]vV*0GN= g NZҨVڟj卡aӋ+cZ j17v݆6E.xUerp4S6E8o"hO~bWsc11Ge4#$Pxf*ثb͊6*ثb͊6*ثb͊6*ثbZuKIHd͔yukȇqZTxfܗX)!GiOl*c%zi•#=v8Ǩ튪C1CV+C=0䒾)JA늢JrHl?l+$sT(\bY2m)ȡ c*DmS)X@OLPgOFnT-vlȦ(q!9Y V")\SmC%2,82) BP/o@N ]" ő؎"UMJēqEsK*(XG]mv}m̠֞RSPG|6L n{ArFzX֖i֐?biת*:JX1W<0jTN]5,wP+G%Wr!i(:I8ih<1^adP|G#QnSL**N8!y /lm_j1(DjLEN$/-;xS#Кj1rE 4x㔊 D$oE=la}2KNjA8启^B4@ZV-(AɅWeheFi2Ey|X6xB@R ޽<1lTv'1PAp(`d>lEn+ teR>XvE7I*f Ő())XbvIm*yӖ|)2+kWvfoW31H\EOIu -py*04Ü!GmUr614 7,M&=UEPvƍDUJA7G1KchUK5\I6U$#hJ"2ܲ6HnE6l}sE;kySZi*cSk?lz Ua7RXz|\,kLt0_V9\-VK(_Km`<1}^ |6&S/mV/HZk=F;NJjxf7VE!f*U17"X4cTe6HwPG& )R~ ]< ڧ$2N1u4M}e3IП'VO|&`ca(EG{n ߁['v4&:$_8V8*:.Ɲ߈ǾEz==NmQK``$n1U[Zc EؓUm\*K "JU)⫳bʧ*b(k0G.8h1_sU4GbZd4+8U XMN*bkkRAan$ "[͊6*ثb͊6*ثb͊6*ثb͊-Tu8eif"c>!()-W2U8uq ǫX ]#=F)q8'CPU`Vus]\Z8 b/vX\RqpSk/urbDžUn\qWW,.*Z -bKcbycxUi  c*]*_ B0%W\Э rBF*DU*[+#8 -jq sz1ZkLGiޚt7(/\ӂym P [ T8u+-2 p2Uc,DN(qe&0ڵ]pcb>î UZc2TTc,*SWRKއ!%&`8 *ѐeH­ oF~Ӧ6r eV"'-2e6Co UA LqUWqVf-j:L#3z' Ƙl08`XbU1We*3rT]Df4`amReX[/) QjK<쵧Gr1P?}4Xm/&4UyaEE/@{VZ*=1U83O$7\GŃAPLꎯ~ l/[iљ OȘ8eroͤA Tw`rǼ,sB"oL-N֝jȣP='FJ02A%]+!QNa\, Pݷj:jU͊6*ثb͊6*ثb͊6*ثbuO$Mūjz΋/ıܾeNd.8uͥmaN&ork:?*tmqufYG2AZ*+-qfو7~qk[V#K;*'(ɫ&579R-7 [}ĩVOM껩s*Z|_;6[xٮ=S sAW$trvʩ-wqCKL AŐĒV0'sʊ$ -nlpNت V4*F% +|rZPV⪱1mc=:T!~ (mE:uը1Vi_N5j^Q G ](%9O $lq/VjTHUMIuZMF4VG'Wモ龙D)HO ' ̲<"Kx]OFƻfDf: ~:oL*15ӣ;JLMB*0ڗ`D}閄>XHq: oV{%mlm. ٓMqv^*z*USN=Wj/ P8O \)k`°#xwDžgԏ|?ߍ"z(Hߪ.}cKk& uee_郄'L>j}3q^% ( ʹcqQ5`OlmљNO=0/҈j.k=x$wqnXdzxǁx9}ؓdA_݈l<+4~cf<+!´cIauppasd!CRჄa҇W)&“vObyH[U'(mlq:?q+ĸiƳ#|?q/]5igvnv^%UubNqxQļY(qnc¼N6`}KOh߲x (o6*ثWS$?V7ƃ֠r<1 ^}/SR)\ ~sy^ƸΐM `,6n۝p;7+c4F};~jه;6G/o$'<'$6FW`0>)]vlUٱWf]vlUٱWf]vlUٱWf]1W/.[#}Œ>a>G}8nסa)qM 5)`:hJM@W=Ͼ(V( *J)*ķ8ƨ#ZvbSSuDB."4-2AnPԒ#9$%nN9aIiTUZDCI(i'S8hsIS3F0PPe&,N(DSL ieXjZLl0o :w8-$z'S<|q.WJQ64q}Ll:む=UK?L *|hP >8*N\DW\FzsLњ>[ۜN0^5#md)ص%Ѳf?d18W(܍pEJe^H]dFWTPt&/07`{az (*m Ft4fFdhd5'jDxتֿ}O*ꪣ(4zhC,p4+M1H|$$!cMqBf*i]o)6(nuk维tIGʇiLOBF'۷`}L)S?ᙼm 88>}q^&bП 88Wnݛ )ё~k4xSj~?+ߍpR۽ZIv~'tw} &h0iG>o[[_G~a-p?$h_)mFSƏ6c 2T ^O㇛)mi}Pv_W}:3KaIy4?ۆ59|Wƿf9[6K??8 7iJb~[a|qeK #Qlcj~g <ϨP?cHAo`&.Xեr}Kj.̺Wȑ mJKH5dR|H VaCp߇I+EO0jjr1YTF:(@Vr#_4PJጟ F"?@W6J,??qQ?ρ Ĭd+ySTeP?cK O?Ar?h~8'1^%O?2ϼ2} 0D~|OIT[ og7fyJ=LI M+/F4?[,jҥp`5IUf"2Z_Y]XWXVRnٌ4Sm쟻&!0uw2z>񍦜$bz7㍭~šZXx}$N=X}$`E:~㌒hTQVO݀tGi_Ձh?ܬ[oГh%?[ ϝGDjƑĻ1'ͷcK7_=V8qwO~ۂbG*Ɨit`~1=5G%o 8C)W8fQ+$N] )؎_o1&V8,7OĚ`vKn'Ěo [ li6ӛ4ؤz'ٜ-x~8mI?Q1U&"C)~Ԉ? PدsVd V\ɵ5YB,(_qmR .+$xvHn͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ -5A/5تƅԀOE5%(gn1_K،L+OF4Na87cǛd?GKL`|:}Ux486'cK9ܟ>4K%Ϝpqq;_n?Ɨޒ~9/Ɨޒ~8yu~k/q[ O^;]$qǯnGX?ƗA|N=|/xP'^'}\xwO^&'>K𣉱g&xۣ(DŽ/T8Soy ?^"[F?db-}I?ߍ"SG݉6~gKmk>JMNO4 FoIPn*ثb͊/vV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثblUxWf]u3bc=~Dv]f im 1X|}ؙ^4|ͨs4צ;rp ACb͊6*ثb͊6*f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeUlySS5nF'kd2rlH7 H ͓@Ji՜ᒞS&~#$^];*p@ؒO{9+=BWCfiΗ8<i%qrLpE)O%欴e)uח$Q%Ac9 c%夈{`}r[&Pƙ0?5cc2|'`O,*anw? rGmX^ E' v _S P*[iJH Y8)B_w"sm n42VUi UʈB[ejٟ,V^C B1KbzCF{4H ›T3@Ӯ]AiVCZinXBO| ~xmmg.Mt(w­MpÍ, B7 FDALa DSaR4ڂC|C1bhw;mm^Y 7o^?whL(5:\Ff"GĚsCPE+L+`#jSČa$[,rzO#p,mV\FŘ\'|ɫߑ}6ϴ-OMu[kK#<Ҽ~2Iw_Z;LY}--בᰖO@~g$G/,x5#TdL%R}Xƹ`ۓ4|:$ky(?bTa]o2Gۖ6$CV z;ğYM~UQkQ>WqM6 |?kԽSko),ҝ8ģ55BMc_^"QU1OZJ(ƛ+M8 ZBy*;okZRĚM#*FLEׯ)5Wo,,H {`g1?382Wej"-B/umkWR;\׊x]"SH#cPϺ"Z{ST!k_՘y[.? Udz~Ki0p '+3_j`?9u_n?.Y߉%2=q>OՃ ʭSP&Oeo\0#Z=,|A#Pm9VstÚxatORӐY +IA y0T+_hŸwKn^ rCI~t?O~W͗qD0ed͂c컰3Rʞ*Yf5Ԧ-NGe[Ax70Jiym< '-kh օ0^5Q+ppJmj-m+{5aL-1|Kӑݤ04L 5Sko*ېc*:V%?*08~h#Py+C`5?C~/rq2,㌶@aC* Bj|_˒MY#qAp)B]q TI:UJL_W'@xB95k"o_35I&LxBZXa@J(Oc&Axʩ5:eGOG4f?c"j|-ʻ5g_ӈ?&GW:&k}kk#-4!QGeP?Vg,jēڶQ b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vj9ai 6*lpRZbS~Yk.Po/hħƾz\+eڥ 4w @ϮMo#tٷbOS1Wf*rá#ZTM"\Sm2)+S̺ -ԠpRxY@ƭF+ZZ4#Quk !X~LQ|(UOY9ʂ~ٌ$Ӂ-O$57V?Lr jzk,.ЩX?8(+.:T;R.T[?vNaLϳ]\$Vm.t02{O1~rlupM1EF`dQ.GlhdMl>qr9w6xQ;ܜ4_ h%?1)G 5]#~e}޿lgvxCشݷntݭl%2g,Y̓6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,bγ\u}C|PO$WPRFovvToF]ҺV0+`|%,s8h 1[/PԌ%fE# \oL4Vczw˱éx >[&X^2(e[g1i^EAo?59#N?K |wVPת*GNs; 'C]sdn^k}g6ƛ}ˤɋꌇ69c.ES1]qWeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWc` 14 ]=wzKS m) ?.jv \ԑygDtKG B A#|pHj4/˭FZYFÓ6s:ϛXz\(vZ貱%3Jℎ&ぬȻ:U؏a_Յ|hhW)`<ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX]-aFv"ASC]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]'}Dt 0 ]JH': Dz ^\&h<,iH[jp{Ɣ]2@S*WT } 4~TOLGu=1_±ڿy|r26W(%8<6I6bN A2&L 4n>\>+~~śU8r.kaOFhsvXKٻ,] z7׶?Fiٹ'c,2@I\Gqǖ$y_J<]2؊"*ٱWeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*R(fĥ *O0IdBAoxxŸ5O3WKh/L/JpAq|ch?c-~i".Qۺl;qx)oOR t/2#&s9fkrgf_я.'?Y'T< PCf_O?hn|5s7V#dC<N^d9rߠOq5bI>1DrW|9'}Z*ׂ DŽ4x+J:cG\>=fei~``g7 ~Ǟv ?$~0V 8 3W=> _S1ΟIx8%a ~|zfQ1n=at>lO??KM.?nUdijz0EJ (e0DQD29e' ᗀy|qH6uǬ`tDXDE$wv C kNDF5Rs7K9 =YoAU= #bǹz{͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*R|]iv"}HvYlPmN*¸QN܏Ӿ-gOGeCY" r2vo钟B^jmfG)F_׏CL>J-oDlz,On1zy5q}X\nʽU? &}[q\;#75健2E@N>TovlUٱ