ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 13:52:33  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)au-c_r\ȁT$SÐz '$GU=X}lrzß sC+KwoZǢˬ L{sgs?mJ,zՖ/?wgXkkukC; >\Ÿ8Xywesחz>kK>53=* ]ecvbw֭VkZzʳ{aQxi vS1*k,c\ k>Os]֎aCQm~ղMB #p$<_cDĐ@bYl?">:Y.ueߣRFUtӏVFe7ٻۻkj믵ŕaw|z10 2~Mk澗X}/ѻOwN{mCJȵ9?3N[}+XX-i }D7_D8]տa-vӺmqt̺(klEu>/fF`Y.WEM.cc4mcUV}Ȱ,ڮi. I$HTI%)q]S#nnH]9s]f6IH_cls4wMW5u]Cm!Eo.p3zu{l.ޝeKk?EՋl}tS[,{譮k_-k] fD[Ys2reu mx&S+7Գ).ck707 5Ao7Oe՗^ǵζ$ro綴x%/~^mkq;~*mKS0K\v8o^z[f!ߑsKӋx~Cu --mf`q;}-aQďFLX  C:uȹܬ nke1?Ve8e.cv1w.Zן^Mvzn ,?zQ~W;mm^U_cMk{c+k^~Zk(WUv2moYqc}GTZ[Ƴ'.X%pn:xαd?x{>.,v[NǬۋ* s5amkK*}&XҥhU=oslcS}4EP)wql'6yx];aWvUyo%Q)$NCTI%)yUnî^,K,0nqD$m qCwMZ"/ⵍnÚ4ooY>w}~>$csR+WR[ey-!co.}Z%lkSMމc/cc2mE'a}K}4=zEEdYY^(!s}Tce8[c-ˁȳ[?Aߥ*^.kqkoM;D+y f=n#_~?XvdbV]U !hJ=RES7]XCi,m+}ջOOE7W[pmbw^6Em\?_JCmt]u͡\vU4?smn{}hX ʟH`sݑc*9V]NM#=0eZӊZ\ӫZE͸ls0,.uZg1W`V[a4SVO?P 7L|6UC[l?2nȶk~{l-ۃm;/^L18SډmF{;u}6+=NVm@4zf]?ңe6̇UT9[*?d5qU59[t:ᴹărb)$ETI%)q]78XYan;=v #UmMm[kyh{) Pp.'clݻv9?#]3c, scE~ѽh#x;~@%IwY%~%<'WZeu݀mc#kۻFǸڡ[z[=>zn&X K]jCS-Gr?+k-q w/TGG6.e6+~u%#WWR#+̈kDWWruacxsuMr-W= 1xJ~ZG+u4z=ۘ&6]M6QgZ9_/2+meաݞ׳yp|?bT=; am~iK~YYFޛ]k9Vֶwn`/shDHP$}&ϩu$3yh$_0>Zʡ ۩ j_GIo%uw~mg.{`ka4 'eȬ{ 1Ӻ:?Btfcݓstw9w٪{Z@` I?TI%)rfd;qR _U6KuYfMFl.h3A]+v1h@n-lߏZ?8ZҪ}_V;! hOڬ3є[fl}iѺ #l l;û"FC\45[OҺ?FMʲ:mz°ll㱞fc]z99.RXeޛ]"UL}*ce. zEٖӐox[gDZ;wo!F)dis,U]f-r/Smu3 Cqo^S˳Z+a"C[Wg K$6~vΥx} XOÒ1?9GXL}'bjuWl{;ԩsYbk1q%]vH!}&Sir~wuZcqYcd ha?[gU9yG'>̿V5 (.۫nu1zֻk^ܪ?L\x;/95} RX4ҿeO72Xs kis\7*dhɦւ kh?uݵ_l~}N G'j버ev𧦢ܟW?av}:R+1,)$ETI%)p=T;|yI1s0Ͻ=u07t5ޛl{it& c1l{ne;=KUYc[,5gf`rkų!<\caHjx6}PAUm&we!?3tƴEԷzVgN.s\k 5is6}sW%jrr.=ΗzK{;ǡu{r.`L"djڿ/7ze^6;1^^M&7]DďCd,λ~}N9e6an'"w!`$_Xu,6ez83y$1km:hWdZ]uk*`ys7۾˽(,!*hcM:l=mZ<}Z1Ẋ2VtW- /e1{OfNzGS͕<ۘ19wjV}`l5XM^&HɇShkwCe>^n_mO*KhuZ^[g?9Tn/kZX?[b_X{y.n?E M0tA>^MX2^isf5 ]?]b1uc[emp!]ײo`s $K7EVoN@mL 7]ox|_70Ϲ Nn]C#3y.045ǿ僚$nIRI$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTVersant-180_PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM_ update_maart2018_v2-2 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)au-c_r\ȁT$SÐz '$GU=X}lrzß sC+KwoZǢˬ L{sgs?mJ,zՖ/?wgXkkukC; >\Ÿ8Xywesחz>kK>53=* ]ecvbw֭VkZzʳ{aQxi vS1*k,c\ k>Os]֎aCQm~ղMB #p$<_cDĐ@bYl?">:Y.ueߣRFUtӏVFe7ٻۻkj믵ŕaw|z10 2~Mk澗X}/ѻOwN{mCJȵ9?3N[}+XX-i }D7_D8]տa-vӺmqt̺(klEu>/fF`Y.WEM.cc4mcUV}Ȱ,ڮi. I$HTI%)q]S#nnH]9s]f6IH_cls4wMW5u]Cm!Eo.p3zu{l.ޝeKk?EՋl}tS[,{譮k_-k] fD[Ys2reu mx&S+7Գ).ck707 5Ao7Oe՗^ǵζ$ro綴x%/~^mkq;~*mKS0K\v8o^z[f!ߑsKӋx~Cu --mf`q;}-aQďFLX  C:uȹܬ nke1?Ve8e.cv1w.Zן^Mvzn ,?zQ~W;mm^U_cMk{c+k^~Zk(WUv2moYqc}GTZ[Ƴ'.X%pn:xαd?x{>.,v[NǬۋ* s5amkK*}&XҥhU=oslcS}4EP)wql'6yx];aWvUyo%Q)$NCTI%)yUnî^,K,0nqD$m qCwMZ"/ⵍnÚ4ooY>w}~>$csR+WR[ey-!co.}Z%lkSMމc/cc2mE'a}K}4=zEEdYY^(!s}Tce8[c-ˁȳ[?Aߥ*^.kqkoM;D+y f=n#_~?XvdbV]U !hJ=RES7]XCi,m+}ջOOE7W[pmbw^6Em\?_JCmt]u͡\vU4?smn{}hX ʟH`sݑc*9V]NM#=0eZӊZ\ӫZE͸ls0,.uZg1W`V[a4SVO?P 7L|6UC[l?2nȶk~{l-ۃm;/^L18SډmF{;u}6+=NVm@4zf]?ңe6̇UT9[*?d5qU59[t:ᴹărb)$ETI%)q]78XYan;=v #UmMm[kyh{) Pp.'clݻv9?#]3c, scE~ѽh#x;~@%IwY%~%<'WZeu݀mc#kۻFǸڡ[z[=>zn&X K]jCS-Gr?+k-q w/TGG6.e6+~u%#WWR#+̈kDWWruacxsuMr-W= 1xJ~ZG+u4z=ۘ&6]M6QgZ9_/2+meաݞ׳yp|?bT=; am~iK~YYFޛ]k9Vֶwn`/shDHP$}&ϩu$3yh$_0>Zʡ ۩ j_GIo%uw~mg.{`ka4 'eȬ{ 1Ӻ:?Btfcݓstw9w٪{Z@` I?TI%)rfd;qR _U6KuYfMFl.h3A]+v1h@n-lߏZ?8ZҪ}_V;! hOڬ3є[fl}iѺ #l l;û"FC\45[OҺ?FMʲ:mz°ll㱞fc]z99.RXeޛ]"UL}*ce. zEٖӐox[gDZ;wo!F)dis,U]f-r/Smu3 Cqo^S˳Z+a"C[Wg K$6~vΥx} XOÒ1?9GXL}'bjuWl{;ԩsYbk1q%]vH!}&Sir~wuZcqYcd ha?[gU9yG'>̿V5 (.۫nu1zֻk^ܪ?L\x;/95} RX4ҿeO72Xs kis\7*dhɦւ kh?uݵ_l~}N G'j버ev𧦢ܟW?av}:R+1,)$ETI%)p=T;|yI1s0Ͻ=u07t5ޛl{it& c1l{ne;=KUYc[,5gf`rkų!<\caHjx6}PAUm&we!?3tƴEԷzVgN.s\k 5is6}sW%jrr.=ΗzK{;ǡu{r.`L"djڿ/7ze^6;1^^M&7]DďCd,λ~}N9e6an'"w!`$_Xu,6ez83y$1km:hWdZ]uk*`ys7۾˽(,!*hcM:l=mZ<}Z1Ẋ2VtW- /e1{OfNzGS͕<ۘ19wjV}`l5XM^&HɇShkwCe>^n_mO*KhuZ^[g?9Tn/kZX?[b_X{y.n?E M0tA>^MX2^isf5 ]?]b1uc[emp!]ײo`s $K7EVoN@mL 7]ox|_70Ϲ Nn]C#3y.045ǿ僚$nIRI$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$񆖝f](4C+=wӹ xƖe~Q<%i܆Pn쏼cV_ xHurA](4ow?>]\ߠx]\ߠ}us~} +wCcJ~Q :%UٿB\(We~xƕn|1voз>һ+5π4G1vP. ~xigF0-;+=Zbߢ.<1Zvo;7蛏ߢ.<1Zvo7;+L;+\iٿE>V*ߢ~+N?;7߁iCMP};1f@ZvY'ߊӲ7ӲΗ80ӳ .s}ZvcN:KN7-;7ټ?iiٿFҟ4쳦L7 }6jVKN4ىƖӳ:a?iiBSZvc6 }Zvf S-;)l%`Zv_%ߍ-;0"qe}ZvQӦ@4챧L{ZvQ>iiBRHO|iiمje>R*c~'JZvag!4-;@>iiٚUF4U4#s-;GʥZHp5İ+b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbep ᇅi]>_H xVp®pDž]ᇅpDž.pDžpDž.pDž] 7}wOo?<(wO_ /}+Ⴥi^>p;7 /} 7}wOo?<(wOW}\>7}}pfEoc´ X xVpDživ|370p;g14_<+Noc´φo<_}hfoc®p´ <_<+Np®Eoc‡}hfoc­dfoc—}dfoc pDž p®|v0𫾲|2Q[%Y>߭ xVჅ϶W*/}o/ noL_wOoL_wOQTCpocʛJp‡}`fJp}`e%?ݭ Cs.!oc­0dGpDž] ȻpDž.φcؿ߭ xUޱEoaWzُo>G[𫄹_ߍ xVok98US7B/} e(?ݍ <)wpDž]f oc®o<*S+)#}+|ǔ?4s9}+O#~71o7,|+N-y´YXߍ`r~y_h߇һo 4Y)iܱc} -77e?߇p1aw,ݍ!i]\~i]\?v4X9us~U7~\)W(y}ퟻ qRJ/ h}ZvXa;(yy݆KW?v4: Wg?v4ߠSZva'Rƕَ~ӲA'ӳ ?ح;(h?liiن݁i_݊ӳ~O?ve~_?v+Nح;7UscKNtUsbߡ݊ӳ~_?v4ouyfB?v4GP+ͤ(ƖH5Zv?*s`ZvWucacFe)F4챤*KN~Rh:´˦+~1-;7^1e->>x]tScHe 4J-;t.FӱKl{KN@oBM1bˤcKNƍ1iRƖ5H#E;2逝l&jҵ8;tgM*~iӀ;5F4fk~i.Uӳ&ПcDžiM*ҭZvWT7LiiM59SŊb n*ثb͊6*ثb͊6*ثbGeOlaG:}riu3Li`p+CYXcvjeb®x*챊6*ثUXUxٱKbf]qWf8)o6*죅]ȕ\3`WeaVl*lPb͊(CbQ-®͊p+WvZĥ1a 㛮6BCYL>,6 N*U-0hH lt˦8ں9L Mp!UG pÚ]*4)vjPU1"5[qK=1KW1B*َvQ%· 2劷+b4c=)vX bv0SK)[#$[ Ua۾*Wf]zb;np;04Rv]8 UG+ OlUtLUGlUDvV0®LP즮,:vm^ثS ]wWevZrqCqWesWeSA ̽W—cd_|UؕJ|UWeۯ݅]-]ԥO\ h؞i]Pn`WbvSvcFL*h*{bƐĒm޸j1S(v<Uъ(5*wUAR-BtpP;.pI=Wf$ Wɑ ͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWg[\+LUUٱWf—fٱK*RPU]u‡f'le*V)vlUD⮦j⭌"pWeaUx+u]V*lR*S5Lnl CY` vbklU8:u% }cRW*nr%Kx;W Cђ q[v&}suZ)w\i\UvPo(\ 쬒r*]䂻\1no7LUdaWet—W,++u@rn2vȐvV4hv8yU]1|i[dW#HvQZHM!銻(1K;]˾vb*2@LJ7+(HNPOT6bE6vb6Iv4@bȥٰ+ A]WeSv5qWe(쒸eSl)urƮإȥ[L 쳊G|*Ӿv[SvPvWS+*v7v`jk/v5ثv4ݷ%٘w8Uف4銻05.ڴݱWeqCnQ-Zj|'jelzUtNvXSoՊ܊;kJR*hqWfW^vWĠ׾.M6NW?~+? ٞnթɥ\+J.&vv7u?OUxm۠]mbbnA"v)v9X-yokv:ԑv|V]vlUٱWf]vlUٱWf]vlU3G{`B7Pk$*UxU!/k/ 6͊6(vlUXY6s P^*ٱK^*We`C(nXRbW+qWSȫUqV4Wf[6o6vlUG + 0q˩f8Wp7L-fr,]vcL) ho36RPu$8VRl?FZtƚ%ivQZoN*2C)le Uُ\ QkFnyC\Bczd좽8|0+yvn10j`!] +Hq9]qjN VTlJĜ 죶VNKWv6Hvn+L [UU.˩]]%j`We+(q&\@- w;We]u(v51HvQT;\]A] w®&1Weһ(zv] 1WcqWfa\UDvSvQOv5*k]l4zJŻi./A!ؐ)vn4Ӱ]@ve"0V Iv*EWHq`SYɀ-/PlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgZ˒eZ' ] 2CYU[u]bi]L3Wu3 qLUp4FcC *. r*qVۦQ5^*)]\UU[\U٫iXUَ.+NbU ӯ㊻4t;,ʣwr-Pb(*>ثrUٱWf]vlUٱWf]vlUٱWf]4ʟ!*~|uw˙%2(vvjeS *]p!ثY[lUثUC ]+YVKC(CRa l*no(R%]N V\*«bf aC.>PcP1W R͊]CMPHus[XNVU1KȦB;( –;+ ' (o(m %冐2`[jY;b beS @KC*BxޛdUC]=0ڻpo(*0bf]\WIZ9~ث6xÁ[4>KxA.ޔ+`;jE0Z7wȡJ SWW* ]Q\)v[1We ]N!]\LP2V;ze!vjf*g|UiZlqo7A!]\p ebf'v7 MpҸcIi—cj;)8Alc*iWc942z &r؁Ӯ CY\[ Cb*+%kaM1v4)vUEp+lUCl6ʨ]*n5p]vQv:TClUٔS 1_aWeS)v`qWblG]qWew]Rz/Biv(+Mu*첼Gv$dA4lUD,RvޟF*!GZ+ Xغ|grX^.ۍTm\UN 828;5v])vYsBFؔ +14^Kfb+fM퀚We64 ؛MNîIenvcJu]<]LR{H hN*#æ3vlUٱWf]vlUٱWf]vlUٱW`2Ha o#8.x]*3[*x VqVbIv`p!]lR9CMVlU(*إUqUe* [#leUC͊+v]1K V\`Ava޸LU /)إJEBӍ#zbvNp+xေ.vrL 2Z D'*r`KU Qj \%.1(إ@`(o5j0+ɫ, p_|U *;a hu®U?FIV7[1V4Wevc!.Wcȡxk.)le05Ƒ$e(q ʦ,]avQ>8UF*beQ, +2>#-09$;(vb1)>m)vQ8ާWf"pP(ʦ*b~UD PbQ,qWfWfM We*pݶ)f`1K(:VW;H.SztqWeV']ܹJ҄bcmC@~ 5"v6 _銻(WbI[v>J ]"]#p Wb )bo;,|\UPt=UD* PָԓM)߮ثFRA*X*jB\U=a0+SavE b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgZ=2䥀e ]0!b f]aKyM $呁( R0![޸S fur2ٱClʸ•Ƒ ʦ*qȱ]\I%Jm]Z N*Xe*b) q7qHvn;+*9]LԮ)wL.Ko*Ɗ|S5#Wfd2JIބS~8Ua9&L RA6vQ'_v`ROõ1WeȨv_N|Ul?v1Ц$Tb)(vfPWccF]v[uPkoC]b%M6QqKo3tb͊6*ثb͊6*ثb͊6*T !VsKsaKc5p!XB*–"ݕZnjq­f:GKjaVj V*6—⮮j⮦jK[qWc1UaU184UcIhl)bfj RZxbv`|V2fl ءu­kLR W;1KX8UpZeu—W/*ᚸ)Z9D0u;Wf#vV*j-(1!|4S(l brV3\;em])]\QS+uk]\h\Һ\*qGo)Nu318*N1VvjQ4쯵]*w*blU-L*ʹ*K6UilJ3)\+x# f$U؛WcKvR[+i\rW+Z9kʐ!㊻wcI8ٹxʮ)vcRpDqWeC.˭zbefv`1We®_ *v_v76We|*X*eH<~Uٹ?يؑAb9P7=qWct늻7#] ΀W|Uٸ v5C]Pbbtg"U?G|UٕB*׎›Wv;ko*~xTcv1PӿaqWcx}*l_5v8r5=2vS]|)v+$cN/;)]|R8kPr*]ƣ[vPCaWeN+( l(Nvb7*cb 8DqWc({إB.b]Fç(v$5qWe |(:We8һW!$;Vuɲv!MMO6.Bh8W(v8:*ijm튻5hĞ*:Ue~UC]߸*pC7@kXhq;P]TbWƦاRw]x3p]vlUٱWf]vlUٱWf]vlU3G{`B7PR V*=1Wf—W,pȡo,aVb0+o!qKuL f8Wn.Wv^5[$ɼءD⮦a[VU[ƓbfREqZp9\إF(.00nVvZʦyva*Uٲ*6­Po/$f>ثUn&eNU\Ui*Ɵ U{2cn9ۆjdr'"|+aV,LR8ҸT7LWcI#lf'-Vr];6)vQ®]\i4 VFleSve®9yvQ)va],qWcDJ7JXI\2-[ƐGlm]Lں]6!Sv4 *hPKlmƲJj)]F C&զ)vn|i]j i.ݍ++ƕق]8Dq]J E*]WenWcF*wSLU\*;t]z]Z ;]v$Pl].1aU؛/jveSAbuW'c]C%؂Ƕ)v. 7qC1Wcۊ]1Sv8>U;(/v||1K3h?hvƕ8n;2aKثƓ :.8Z1?922`Z^<.ȡثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgZ9rRWL)n4r\U-;b*c*®Ǯ)Zs8cvHo5p%َUL*yh8lcp`o,m8Y[jWS+ ]o6ݱC8(⮮VثT`bf[_ U͊6*vQ5]uB\.i{'ݸ̥OH9x穌#4Wfq9l,1o+\ dU@JsT).`+t;%ApkmH­"\Uu2bgVR1![So1x7*R> y.҅K91H;ʐ9DMC㉩+ȉaN;$.>w |Ln1צ$c*E[ʦI\r*s+vQ.qvl*َv4[j‡c@OLQ4w()vX®Wcm -!p^mmy5Ƙ- %%U|o|cWcz`P=һ-v&FNbd.֬r*쾸*v5vRf,$®]وȕvP4]5+A=U1Wc(C{mvbv㊻,EA8"o@+ROثhUآZ*MHONbUك;;१c|T26ͳwA6aWe6ư ثR).N~q zu]rSLUXov5B\Uz \UȯSeb7b̴'*M*wGLR(mn1b͊6*ثb͊6*ثb͊hl?CUY%ԦP®Q ReZ9D e\le\*V)lflZN4⭌ثyWci-CG5p%Z8xӊUî*vVlU͊8]Z[+o/*죊LU,`b]e|V]qVVb8WPJȫyWf8j5J-QPWePZ˦)ur;We!!UƗ8V p7LCT+-Ʊf0o51V2Ilm V[ʡ^)vW*|p0UC$bUDS"]O)vVv^*Hf]&Wck TȔ7w[;bci)K]*i®̆pQZ_-i5UaGC bcZY;1dL]NvYU).(]vƑ\4̭ov_b;bBͽ)(\U؛) ]*82ji/S7'*dhOa]mwBS*V9c!]I#E޾Rc^ ]ZŇO.r7hAZ{o8(iLUjj:Ԏbe]1K7b nܥJڴcѣb B1p`pŋx4&f-LcMe4c KޘqCH;n)fwv'CRV>8CAK(?^*jIh51C~zbbejj68>%v^*r)7S^+bTraq 𫲑Yj>Um"AS  )c)V'BqWeR6]qJ0N*jO|UKSۥ>xD"JU٢;iv=w89V; qWbTH{rUٱWf]vlUٱWf]vlUٱWf]4ʟ!*~|u2ԥ(jq8e )vX8imvXq8yWeҸUT.8UiD⭁ ^E-fU8UrCXӅ.4W ,UW+ V)vc7"xbS*J]YUWfV(us *[6p͊1FCxki I %_q Zdv}%DIN}@f287";")t—\iiӲ8Qlf0QW ӳӳWCwFI.41VpR.7lPܻ )u3-;-ւ9pS$\—cpx4~L ZY+Vn_+ÿN5[. -B@,w;')J\:#+M5` /o џ"bC6j+oMkUf|!]\=k5{dUw®-] ]fe v5: w`'ƸTvb.1;(v6!~9$N;)&hV\1"v–҇oʻdP쬐WcWeȨv3IvlC޾ ]]Zb̀!] rԻҝ0+$c2%]|p%Apv1إƊI^bǨE+;w]8J^ءeH*ER'f'$pRqL5$5+,K57A4ڤъ@ڧv>&$uo- u]a7]_vU>#M]WbI>lPaPA۸.*K#/!J堓߶ "B7z/&?R][Faْ.Ky ; j))b,ĭWQ(@IZPTw^Gn؟3AO N)#T$6ź`/#2x^6gmAxx&/3Dޡ_pk4䄒 2@z$24E784̂,Ďao8#2V [ئbpڒlծ[ӲRE' Rƹ/xefUƫTd, ]H;J]KU2A bH=UdUـ9l 1 Mzmf 8? #։m55L 8,LC~ lwvБ;)l;Of?N.A?2ؘ+oV3ȭ%Lx lG_Տ1*#n2aCuR1k@%qzUZ`Cy:TKL(=ia$ I[\qMLF[yD$esv0cHvQ5WcEp]xҵ~'JԞӿ\Uق׮)vSS#J*i>WcliI*'e܌nľhdZ n(XvH't{;2Qێ I is]=4ڠʰf.%;O +`5*eH$7WeoJj֣}+ۭq;(ԎC=6(Uٸٙzbbe+lUay-ъ])SĊP찿v*i1KoM}1We5 ]Uؠ=̭S$cv0Ң|v({bidmO_*k Wc|ACdKS)vZ@wM~(:ۦ)vUwh WeyS}w]7UjCۑOvQWb1Wcb\p(a_o&FL JzdPlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWg[\FncNebUَ+vY]NUZHu3!.xYdW-(WS+*eˮk+ ]V4⭌U/|UqKb4 *إp.́ )vYk<1Hh y9`bq˦R찅(ܜ ZX*c@2{P0 w#`ݹI*N@dHXyf\&Ri #GՈ8f{rm+$Z?$m5$#\ϱ[r&6$n R6䭕2Sukb9xV*b\US7!mRes[bZOcjNثycj1R7|nպf$Svo*:E#GB?,e kbYQAT`AswBq_`Hpv-jQ5CB|@Ǵf#퐦jN+4 P- D⻠?pTf#3HHC3`L}ݠnR9;vhw=1CWaϔַuBVi H5d]Tԣ`A+ (znݶn-P`qZmӰ#N&i q-gOpBi,tO`⧱8$JǍ͈@l+Sr1z->\_Zݏk׶$%_G ua(;#~!iOqLHGHuqg+ 0y|iiOWsnɴm##j~YM̠aKaC`IF]Wl+;b׵6Ɣ}8Ud=+64z*cu)vYRG*nzWbeA5}+U߾*z֔cWbr|;S®"F4 j{CހҘRcPLUٍUw=JzRMFࡪ<)aWc1Kzmv8Ěh~B1K9W&ͪ򆘇OC Ev嶔OؑΣd`X%UU? xab- Gьh#mr|A bE,-ՔabE/VVA+^LDE iN2J~Hv]~*+vZ +y4Pw#28)p ku.>,PYp#ke~GA8=?+5,2~2c7\O+=EQu="̀\X+5e%|(~M yoa IO? ZcQ7 j\%Y1:6k #VP7>vu͎)lduO55'"/?W;U`sȫbƼvH45iom*WW+ͼOÎM8JjPN*jQʴ$]WbQCG]  M)q: BG7|`V̊f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgZ^/vc+2Vb'j2*Ro+k/*Uَp'$W;08G18lU U8jcБ RK5t.K%"sOpyjSAaʂצ("el`2.72M!q9 4N;'9;d!@zbSC ],]N*4|1We>X5v9M)]cjm6l`R i]w Ud_ndBh|zWb^.=\PI"ت:xbƗ>v1G^1v&-JWR 7Г] Ac(  #x3p͊6*ثb͊6*ثb͊6*T !VseKst. ͊LUٺb51WfqLUَ(vSa 1]b9WYL*7Z͊Gp'2c*.9xUr]Zۆn$2JaZ.SHz+} ׬wcr?9 s\ĻQQ4aNDEMe٥@Aǽhu v"M|Xlאt /aaBzDu ->uo-1\%L[ecLJxG lj07BOqzOrp~b^_4xfHjrOZeF>qηND # 'R>WnB*;.SH*.5:tQjs{^&>әzl|R?d>S؀ h!>90Ѵ΁lgGY)u̶T̽Ra ;sLOV~a>Fx/|2̟@+ yOZ:S/Ǒ?;GWG/.jX#0l<./p9G_>eGǯ|#ܾw Hiq2ǐgp(Ew׮G?O!sУjOѺc4ǐ'?Y*ثb͊9D4E~'6ƄOʍ?γbЈ͊·6]QWý.pE!둗"ґ%^=10W ƕ\B(® S\*MӁ]N?}Wc)]U~٫^ثwU@mVN(v8ӊ]Hh)CLXۮkj/rddĴ 2(o6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgZ%y5[a1C\Uٺb͊+ ];*Uuew—f];,ن;*Glfq"U7{>e sΰ/7 AA#ڃsrh@@1Ēsrޔ'$G}oL@>YUǚN]] vlUٱWf]vlUن*ߜ4{s+_nj!6i<6E3!&{! nP:QԄ̋A˥+P6!NygIQPƦ8KuMoi~xjMI> þEAZ>8QїEc`l,xuM 6z 1c_oćo ђQwfmNro6*lUثb͊6*ثb͊6*ثb͊6*ثb:ΜՇFቦ!)VoF@[Q :X.d᥻vZ&D+-,܀  (A-4'MwIcAW] /4 i m_bpD㔑\&>(JpSDۨc<,;@ڵósOr7#ƶ;>ZaAT?~&|?fSVC>]_wHȌ"Ax Jԟ#:p˸2Un=6ș85o_$\qGP`E;1neSBpq%qAt*rJ# bL6's3s),QB?f9zAdc?h+vIflUٱWf]u1VP{'F<ּot-Gc9;L`w]B[rS?%i s cu_nb"ȡOqX7]]_|RկOv&@U`:oLUg})v4/C t8ٕE}x6c\Sĩv=*0?vEu=:׮M}be5R0;,;. NM.~* ®Ȯjo^إ$[q*PSCjD+7|L]$}ҕvX 44*> :b o8tWf]vlUٱWf]vlUٱWf]v ??*Će 9떥.jS+u2ʮ*ثWKyCvjKy]vnWcWeWjV—feU Y]qW ثVleS$ra|ui=c}M*Oa5Gi_7$D!D(b{ԓȍ ŗzxBj#]8ZWpD_ :ci5ݛ#jP:f[vlU|ثu9Vbl)htGDQ[ EA)N?J"/)J1V4#»!$<<=dITO J9[)m#\((4#HU1a(i6C3Jxvrd8bǢapB>c)vjbLUAᙸ:R4]SvjbLU:/~Y-8Uxbeb/-BVQyΧ\\nCbw _:̀DZ$aӢȣ) ?v"msy"gQeݷRtH=N,ibqs\WrS3PIby:(?x%܆O$\S'.0T>HleZ{Oђi$KX*x_ːz#+A\J/a; IݺC<2qcXٷ䄈䅦=.'-]DՉ.5~[i) 2'̸P5TCpq "zt' ]{f~-Lr5PGoINFWe1EW-qAvQvR׹=Kv$k=03;jTvjR.&ҵD=CV'ƹ^2Iv6ڄ 1 4;(NBSo$eO;1v1-iqKv**TҔv]2vQ2 Hv9Q]k]v<AOvZ*h(vኸV=3"X0"ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgYzRe⮦l k*Uf*# \Vva]pY+[ ];6;18RᚸNY— {bLPsbʦ*챊Ncf Mo\*Mo.똓\EwwBĴ!VWZemZZBǿOlJet(jbkᴯ2bLUٸjb1vnWW7ծC7ܲœmZc6|Q̬\^m(RYs;SbŨ0қˁe6&Ct&3 cnM0ҹvfHqT2)CI$Wd56>2$ӝZaPs$09\.ʫY.nB߉äa"Sd/CpCe"ɱjb*qVF86U0%1W vlUٱWf]vlUٱWf]vs7ۋ}Mv\ȁI9Ӥ/ ׵F~LphtKte/|S"O.Uƴ!0rFʆ@z痭ſP,؃OOǔ2KZlcÐ*ziLJqp|ʦ*@-s)'h?nDOG S6vl Uٺu]3x<\م%ٱWe6eSv8)nCf?tꌛ,ƫ N8q@zmZ+˜ڶG+/9].]W b-  `UU~.WfH+\D=#2Q]E[yg>HvJnH*$Ux .lUٱWf]vlUٱWa[ =͙v98zv,+s y}.'Ak^dXH+v2O\ v7=:ኻ3 0:ֿd2#ba$7l:c1Wf]vlUٱWf]vlUٱWf]v ??*Će 9ӲI~lUٱWc+YYCbҸ_ *f&yXck6*c+v^vVvl*qWf#ur5\? )bGP65ڙʥYphs9pӑ!]9 #ojFCCB AIqɟ1-O㎔ ](?K1$4`΃aG[8u>Y(lB:م Ȫڜ]\)li.l4rvlUٱWf]vlUٱWf]vlUٱW^`T`kPXbz)K(T|( 819%BHsPո]^tXqO4xƠx CXL%!\U^;$ /{_(F,cL9PS"YV&§*,YH\;Ys-ċX&ݏã߃'%nk=rDHR̠_|!"e7`?Y_.8Ǽ8+o+iИ|ypesϽx2!X 3vt쯬 ;+1ez?~6W֝#bjc eo~dmٽ6"Lw|0ڻ7 1ݔ=Q~muZf .r1 C;dU(=VybnV'?|6b`V4V`0C]vlUٱWf]\=p\l~R]8 .V"vjW 3(m(PXc)UG+Jb+]\ثb]vlUٱVb]+@ >!e.WE3_d?#/יÏ4stm;qu)v[b)\*aޏnH`ʒeȐh8FK&*ę)]^S9Kd`&0)-cC\5FP1_*dHBVL KcZ|T̕U1 ]SWcxm]WqEdC햂1XNńtsX_(pFup.8ET`o0>v/l4岪Li]g b7Rro+/i2?62;l1Ns7vb͊6*ثbT0*i U\\ |_ _WLxV7z`cU|#,$<س~V'!\iU윆Ӆ,Ny7}ld24Cl2NmRiIC`W%'gt:o@k%/\h2}9 ܨF6N1G~ދR xw 1BKE0晌Ft]\1KuBݨi|*mP(4sXثb͊6*ثb͊6*mx$Q7~0uTD'Oe˂s8jdЁ;g5;ܜOQV( \U؛$%0% ,8`}ڹI `I-MS(8(CgKiZE$V*遷dp056Z䘷 R]H^l*ktŸ0H3s<]ۡS]liqWeӓPu.ą+"Q6Op*M5ӽ1Wc E+Wcצv>Pv8~GR]%@n7ʐԍR`Gaq!rdKnE ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgY%Wf]LUbbXRn`CS 5p+bG/f;(VY]LWS5qWe`W mkZ̸G/$ЭJA?be6ѡi6r G'́T{.bX5 :zb*oJb=pRcIUY"WW7*Y`Wl j mcKLYM dB`6Lm7R[0#B2DZ$cTh]Nj ; cE%7iLcl=j(;e\J2H2kEY*q)]WblUpn J s1Lm[ "kqU7 lU*5:|J9a"_NP}XPu;G'hN^abˊ\*q,HO,E-RlC#)qr*c+6%"#IFD &}!ə@5-59xfLR<26­5c,pxc;? q핐o ӫZv[Cӱ1{dJZh"`;lJ;ܲ*8G*QZثub=WpSJOM%j>T;`t'))1P]\й90+cPY?S1@p;Jǩ)Yf*c(U]\ثyWf]ExLTM r,yDiI(6e˃7DRƢ?p0&#|הR(kڸ3PmS(]N5],}^R,ULczn}v1] ®ʘކCDqW`znLvط,]PP@bbGm늻ʮqCRkbb#6qWbĊ|X؝I*jA늻j]*gNv&ƝMH]x3p͊6*ثb͊6*ثb͊6*T !Vse̒UٱWeb\Uى]bbebeW ];6)vl ءٱWcVWSp늷=Wes.88yv;-/.nkGcj2pIJ%(1!~)Bvl sS+| @1rHQ<xSx!+d*M<;4q#"BQ (D`U76nU˦4rJDɀ)P{e-zx\iTH.ňCz*[ +]C*TO ci*;g0YU|8tai,N>HS8C"P!1SQp-*) ]* uQ0]BCfq. ,Hnv9(0j3FC)ecvA뒍+@WFbsY}%*jw1WVq1q)QLP1 3C(0Zs UAƲ NT­r˦nT[LUٱW`9::/2=O[`,PӠ;F8Ojeh&8-(0O6!]hXqW#p"֏8 Hr%%[d)W"R[<;BcC NΏgHC>mHŕB62Lc&B|`C8=oɢf*ZvX0Rӱ Zv0M\UIK/C*i1B1We]]"UeُM'EH0rc+L1S«+LI1^mٛ10H}e0Yusb͊6*ثbUxO'BKySQw8OnӤPW吵#9jF]|%azaKAQmu\U트-k4}dK -ȡثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgY%WeW ]Uuebp`Wf]vlPǮp' vjb—f*f| ث*0Vm;D ,Q T/^5%I]4.Fu (WHƣދ=Ŀ_D]0j🅽`i iPޠO&ý6QrŘOyjð#CleqSLke wʦ?|N&"x ZW$8njJ8"bO]ιF<I\bl)Zrc*P$~̸-TL6䁼ErdM!ܩ *Wa-)&R2M @0w@ar0cdsUiJ(*qO8)ct߭2V2ʫ* ekKbOBMq]de8`Cy–*Νh䝖P^-p(i @:K*lrƑM׮4p\SCYj{j9Dvю;v#t-ApNTVKppBd7pt^)ņ,G!o4Z*ש1ᴮeo1[Y*jbI܎yG'1m3I7!^1Kck͙QS%?xVMNt^0sWj/a{bP]kvW*ITֵ;dR&Ԩ]Ԯ a®D 7z wRF*즭kҝ1CYӮ8l ]FثTWv,浡Kyc;S*JJb؃]=!@تh40 AI=Av>P m‡`c)ҕ$oN)v|V6*ثb͊6*ثb͊6*ث^AS$0[/oΝ2KWf]vlUG,bf*\U5pb́]LU N*o5p+uZbqC+\ث U/ lWM)rG~'I4&[X/{bgPl1*)Lx f\S#"UTrڠy`n1CE6ǁ!Ilz.Xs%N*5KV|K`]!#i9J`i R^L=op*U­oQ04r8i*a#AZ^U^s_u9ql`#9VȐtjr7iuZ?.Q(t Ԧo|d%e-a'ǧߔeddD 6LBLM9*6>^GԹ,2 i y cUH*+ jas U9 qˊ 59`(pRi|U2T=SSCh2%6"|C UwčC8dRxk)LPa b`Pj\Nиz|]$aԣ" /UF_|K%p1xT?1 59hBL4Μ8&*V2bS(q2)ҵ$uqd UJW#Jni*OR42ܷ)82(hfoQ]0G.8R|1?hGJ8P{bnaWeƕ0Rӫ5G`pj+B$&jrt$C()JW.Z:3cJc&6l0A;L§= Ȏj0[Y Tڸũp(CpƝqۘ!SS_537"ġdOl7bޞ*%>9^qWQVg2ac=rId?gZm -Jy]!&5d%*p1[яN%.9)#81)FHzd ;Uet&cX3Vw`1$ŏs\2lebݩb5[TB*Tsa{%wZCBL~xY:zXO0^آ*L}qBf•c\*;q8)[9cHkcI_Ƥ|[炔O8d;c:HBn9 iZdR\M4Z({b?.0,{pt1 G^' 61޵Ko;16XB^a)ʣ p:0 Xu4Y żѾI0?deF"; tԍ?]2^nMFfltq.7'r$4[^'d KyJ+cN~yTD}W`Ku\(cMZ! 8m'$9QZ톜^?,iKd,m4lzbL:0-w>$❷Ɯ EZ4 O¦,e]vDŽ@{waLxJ]V-SN57yrI5pv݋y&([Y tE!|{c…6F)^^z'Z׆i6E\M:HTTlX;XߥwLQרUMkIJyC'o^#ɒ5HW, ݓheQ(_Lҕkol7N?:nqv0(ott;(][c#hv8U.ĸ#ʧXGi*DlGO튻ZW5OQ]1չ;e|> G_-XF>5+Q\UZ C2k®@V7 cI튻]PMh>Uc^mv-ǚъ܂}ٞJ EENbc ע9K Jjh~gs?LZwȲD-:AR|$zt'Q TeVOL U|U1ck SE&tI5'Sm+5ϼv݀~̼,kR 51(G XķM"<#,< 0>Ş7 KrC ˲وw=D;Z3ZUVd H뱾~IG&uh%oXJ­@) lN29M尉Q=J#nOFS~/6aDF,[Q%/\Q]Ƴ۰7VSPF`H-tSkS0HiUi,bKJlBw'|8ү*pR[[\`RJ:߮=Er424WY<1Wp]b vvUnw?aT(:ې%`VxE.1.WΔ8\P6Ja_S 1D\]_Uw[bJ ,l UU땝jS4ȡu3* ܢ1h6ҶTTFHr1={q\\CdcVT Es}M%[&`:Wrq_4rX,1+aVK%|NNʮ_qƘӫ*T8ӱ26ƕT H`)c!.M989 *n1"3NJTFkM59:* fcQZ]?-T xXԗ1LxUסx8UTj+mͪ"tdžܺ˹ iSUh&1J:rrOQNKY Nݎ26k"O~"zG֬⊽XƧ6Z,x{rsoI?ZTum XPWcwݶ6l*z-],Oٷ+`KГC튻znhqWfh1WcuZ)()+ 7)vV҂U]F€] ^v>:kLPC]?g8AXARu]SހiZb]Ѩ{8r@‡`i7j v<*ㅚc?922`Z^<-ȡثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgX9{4+ 6*챊/vlU*ZlUUٱWe]1WeN*Upٰ+(vQ 0*XR $ҭf9@r]aeTˈl0 ^e{` 58dRJcqd|,VbsLP)D',䂅w->8V̔㊵̌Sil*sk(&~|Wvu5BWZkdFGo|GaM01l$Lb\4{u`7C)Ҁc|2r&+,^cWoNiP'zAA"WCHـJYkJ9V7aVJ0W)¯0]}Zs}=rc{ݧ4ch>>r]BL!ӜPd+mM=t51emָ#I.w>8FrwC!$=ՔwBZlrYyv pj!1r,D*D)C4\#PC!}r)U=GяX%QqLu0(n9$2m-`W4czbNÍq-q怲xcX]1 FZbXr=>!WQIx^4#I'\2PHr_*{dUH/wYX5԰xOl:\4&F|8V̊ } +GL]Rp06@w]EF*ovh~TO׊]X$\UǠQ7Wc>*1 =QȦ犻 k4iw$m. 5bĸՁ+uF** R~Ԯ(vTjVp"*{Wb;銻>\Umn1b͊6*ثb͊6*ثb͊d?CUs$/vUqKbf+v^*UٱVbj[]+ 6*p8T'u2–W6(vVnTȫc/ lUL5 v-FٌYA_WD{ 4K_*տr)Dv 7•bCL4)cJ)9gliVi.251pZBq 7\,Up_됝R\05RƟ!6Q)>!H7$ j ;IZߠ).]ܽN̠+wF*brͱ#]H1r;xh#S>#|J+W uhzrLUcȂؿ1a)+9$QC˚q|M1(dKR1׽(k5paȳ d/Xzy2lz\ybu0I_,NLբzotd(G(` aYW:ߨJj?٬ɣyz.9/&q]DqUe5|6-Ќn'-\*0QqQfL]+JY()!F_;b|jr<)F,)Zo B`LN(Ȧd$wr* }fYI8 pf9%#x6hqZRxLk5O4JWrF5YrHl%_ˤnB5ywˬ](C i?'Q>TMr뼇(OM?J\`y<9GȜ"0܎.< G{ 1";$nifi #To8d.W3?r?Ek\;:%~XR) !O;_'ݏ"!w1d4!7GZ0.kSepC-xOFv~*^%pٚ4' }M;"B8 D?~n_-ڰTws.Hh޿LE߁ؼs:VrkR|11g^,zzDv21LiFƪl@HߪҸS-̇9AʸQEs,LM,vWBsq kI>앗 #'Ndn8]BEiApO| cp;e') Kҧ$WmL1aЫr޽QE(UuFx5_wR[^)%DhkmVuJSKZ*ZT®mguRu pN#HpEF"6UveJ0+)I]PWcB~qWc(X1Weq]إؗǽ@v]N怍1We6ũ4/+XP~UءC^>ءؓzUav݊-<1K? w]W}RZ;ӧm<۶r;b(J8UɑvE ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgX9-]/LUٱVb͊]/vlUٱCbf*ثb]UٱWe\2WS C4ޱ1oʲJ~[ }K sݗc}p%ym@& K$Z~k~-䬔$PlŅsZ-n~pmr1dtǦ%C)sM𡦓qkER isyL(PIwϝ-#ud`~e^G.'=Cm:Z.*8\*(!…0[hej9!ɩnj,pa f['D6l+9NQ\VcL{bbm*6#*9 g@$?PeÐb:I~02B0NkVZEq&Z[j1lj>_c[?m2oL%~@]l麚bgj`1VE" *֘=+U%xLn8Ek4aQ*$}sx89=i]Ds;/:Kh?ɒT\$ǁ(Cq$d/U&xUa͊a*큒P7`|6[kA"jvMsOo^(7^xQc\s gz6(x72qĝh]=,\E ®銻(v&T֠USe*l*z֛U\E+ 4\*wcN)7m)v?+Bv7C+]B]W`QWcQUz6+5#SQ^إِ$*줍G; *Z9Ov;늻* b T0)o:bxb͊6*ثb͊6*ثb͊d?CUs45qWf8Uٰ+*ٱCb͊6*UXWvlUٱWe\UXS51Weeb]\l≥u7f 4-V @ iZzX°'P*O=sϓVPI`2vTMƶcW'0' jB7Lbmܳ\|bҤ*9qhj*3bo%^DYdD+"/0%sf͑Q&iYa3A}իЊ͊Cn+cףO* qcNV;ի=: 0(M &cL]-0$v&cWd&כ}O/S>)U"1Y;+vmW(6Y ""z~Ö́5 's}(xxm?%̳e5Y(|=/ۯA2F/bD:ёqPV&:jHWF:L26 Rp#ǡgp2Cʼw햧,T(Vr^BKeԸ8!Ig | $dӓͲ ʷ|d?/'X̲#ș⫓HZN<dU((8nR*r #uO85*r*DZ̧2lU2n2%\*:_i&eod X~6s7m楓!q7ZIͅTUi(lbeI4PuX$5\VBP?NGQ ߶땥8.Ʊ5ȐWs̽%b6WJ7 ٺ5 i}! mliPzmf;*g7XC`C0٪Ǧ(vYTbqWeq$Wv]RzP(!SR.)u5\U>*]]=C1K*r P :RbkָL@#r=WeܺUج-'a犻;7* vPbbwqhaɑ, K煹7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgY٥T®L ثbe\U3PR^*쮘b銻+vlUٱWf®́]L*إٰ!َ*i" wvzxP?}(iv"?OHÔc]^)|cȥƞUV|(CK);/ߚ4t8. qP:eRᚸֹcC`Wf*͊E3!\:zcH'6̜C kL |Մ˕>o^e3.s*6āuefPeƜ.J"KY9 6ûO6@G6ڎ?m"qv;$zOoIOɿ,!!uj EYoz7 ?zЍߕ4uS5̦@VEڸX[<3REaj7ه#''K)$CS7g;Hr^`aB>(alvIZ̈́sWa9P`c,T^(k6*N~XLg׮ε\ezUyp#*7cӺcl KS|@E;2qh ݬ9'y/+?oׂFTPͅV0q pQ~}lvuڏyXRdo7Z\UتHiLU1ޥ:SԊ B0v/,*KZ1-* f+Q\Pq2H+0\E :`. IJGb}z$ :|L8dJ'nqH1CL) 3b W`h{ 9/BB<1󪰣] hdZdbp%hF C 377t>:HN| Y|o^\K SO M&T>r>9.48Nzbe{^=]Ab> Uٸ]Fާ)v9Hcژ؜r"wzcB{;ڿ.(*Te7ZfqK))7ju])Pr҄]0O >U ~; NaK<+9;#x3p͊6*ثb͊6*ثb͊6*T !Vse]qWf*];0]\ *776*RUٱCbf]vl*ث)vlUٰ!ٱWaϔm ׫%*_OlK 1 COY?U}@߲1$c`Uf8ָUNilzCbDGqF! zed/-̻mQO\pZ`U\*e6!V <|#[)5oGO&^YAc3-)aV?9c21iD%o\[6*죊(WygJDEc_OFS'm !o 1]sۯk 0ԑpPbG\nLdSc ΄$'_E?L۾ ;i -0R\h#J"#[:9gR'(@;fXhoUق]b/-`B.Q]+ [ P,(Ĩ-\`HqZ": & 69>ly-ef%G y4aΟ/,Ğ2f'I]փp}/ayKz/ ÖQl(.ا1N/0*}t#1PPue)Sv$=:c(PW#s-s' lereo6)ǖDW52|,=fm+t(feJcJ>&nm+-gT?/DBlR6*J51 楼7 *$m)rh!蹶1k(qCu+$+xŽA##Jl  xRKӠ`!RB$6E+LČ*03`˛MS L ZVUx`Sj87-*ʜoG5</:fS1#)o(Nr%ia-!@> o9"~w<3Tk8 UA [M1:T`\؅jA$,ujNƇ fGoxBpFiC-b}*!!i'sF4+dd\XR1_?iM{@KAO·,φtAa1 7~g3lMKPZ7`ۏ'7ZkpC u09ĵO-XrFZ:Կzږ6#Y?[aNڧ/*JO چCzG*NcLU\alUu1![+)ۅ4-V Yq22CX`Lg׮uQLU+\ULR9NO Uso5GEYD8r &%]^+"YI>-UfVIV5i)^*uqI_ّ}L–1d[Lƙiv%r+*5riL8 qU @V]&@^*zbָ %z?' ;SG)NKWNk cX« H1TEoJ06نث|*A<#6TeC<0(]m4sV zn:ч|N̂aa BLMvUiLVU~cov9{JfͼkkUTbí鲊dTKt.jq'm5H5"T?~*aB ثjN٩]{K:m*QPW۶vW"(qWe .֕$N)vS,vx}8ԭ1Weƭ=Wffo*oV8FoB6]*A#~ثiWb! U"$aSlhwdr1b͊6*ثb͊6*ثb͊d?CUs$0]5qCb]1WeC*.͊/vlU٫6*UٱWf͊6*no.Z!IVc4dʜcd|U<7زrk T\ U <2]n4%NRQ48R1kc-,dPxӦlU]\eH–Vb|k 55 }k3F؜ѕIO s:Vy$`<Ѫ@ePl ثRk{qKzԤs]$GR_0L?,iPje ;w0*e~!ȾkvKSw?Sn=Q?SL-<,TYG5_`%P:%fSk=Z pѩHB4>HFn\jg!azaDk WH_1FnLSl®yQ/MbFܵ04銻C:lpCv [h<Ѽ{6L}m*!.j$B QѭvaY1̶\@@aSxa)&Juѕ]@T˗t(-=U T_ fd^f%o!9?bAώ P6=)pŷ| '+ f{o6s#s> >aGN-\)\1ejtq_O J L͊ڈ+oՓ1AWOy 3q^1<1KuFثxy U8༆* $DPh9+deVd KWe4Lc ]G0Ώ%\hG,Bn[t\U؛/-|6K (zt]փî7Q:e&\U٥C ҇ 27lUФԍ|KP0 Ҥ}F(v<{uzWb~KmjחZ be5ڣveU1WboʝE{f]>a8BTvb d V(3#&%܊͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgY%XWvlUxb͊5qWf]08bf]́] +5qW ]Lث iZ%3?**Fܒf~(~9Oa~%iN(z~Iz\2N+[9KŤԏL) 0*Zj`olvlUٱWe]ޙ\ts!c);JbNYn[vBx1N#~]N2^!$A"m9^c#5IXv뗊VĄ7\)]\2x S2CJ$哆 \acKkZ*JS*\ c/2HuW™K;9"x)Lr\0ٷXRֈv:آ+3 zHmq'"#`\iU00rU؉—cdUٱWe"IH$-A,׮JݡĊ-WnsLEdQՒ zY^H&AڦI4?}[HOE$:,?ocA,Լc2Q) 4'Kqԭij{?/LC,%[$Em^.HQ\5b,!*|iڄWT^A")u' "Aqczo ȕUY$Ȫ:Ɲ*`JẊfSQ'ZqVdžq@k |qBF\dWRr&KN^(oq늵ƙuVS|x_ՔiA]ĴsPJm퉵;bYAU2iο0 A̜|vd\y\d/'(es'輇;y 8b-a1T0MG%A&NS1R&^F3d$ys߰=TuQLTưU`m0:6ʦ*/j)hb3Ll0!`X04n^˓`McmZl)#}CUU JOV<[?ljqnPaH\u5=qWbDGzx}8W~Uؘ|6ƕ~GkqWe+{bs_銻pO@jG|R{o;-A k)vb>*Tbjvn!I* _|Rf#]/ڧSJҘFCѺ XR"O )v9OL (GqBqWc]yQzxv9jp+v^Bav_-ڻP:ȫ;?9[*ثb͊6*ثb͊6*ثbzGeOl`t칒_6*UٱWf*vb1Wf]1WfZVbʮ*UٱWf] 6*WeWu2]L]pD.BSi\=t2?ʠ_9.\EI*d%\*T;~c*R Po7ȥ<}Ab4@|Aī7 l(wL`*S/o6*㌮I*yEwr)y,j=oTl8P ^UdQxb}cߡiN)Km c2CJ#0 k۰Q;`Zw($c-X.٠26[i3L#qVڹ4ī 阓ӝ7^I@iz4y*0h1 &6*ܹQȞK9`C,˧7 L@Q\7TPodSc!W6JV8N?x,%H%*e!c’^y7Up v/O,OVPeV|?hẗLXQQm4 ESFbx9 `~jGepn>Uw1]1Wfc￿lUjt_Ƅr:Sv'!t.Кjw8B1\RBj|;7*]?OLRpGb ܇aBFR6Xق SC0ShNG{m*@A#vJrJv.ub뒴;3 +kbcɉi{"b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgY%Wf]vlUGva/vlUXb]]6vV*UGl lR]tQ*`xq(-GM[OÕ, ~f?dw%͢JO>GY5!g G' 2uCʈ*2r'YH) Tcوȳ @r*_z[а5Fت0SJ-|0!5.olUsSp9]\in8Uܱ!k F z3\:+|.%8V5RlW\4dᆭ-2El@44邕ՅT Y)G\Z>n<'m"T$eq\[, sd´+^OFFJJ+i*3RZLr^2F\RջxQZsB(/*}aƖzdc"="zaCU'ʋ*Vƒ#KN運6+K*UeTmMc'5絕xN>G 孟o 35oΥOo8\0غ% 4V aku3ޟ'‚׆Z]{Z^1y Ozd`7@ m4UbƪqjICE~"ࠠ)%CSSXK>4o 8_Laꊮ=+<-KiBAB1_O/s?|wX~?kZ$~>"cɣ {R6{c{1n!T-FMBD^M>mmD0Ǿ<(HML/f|W8&׾}x-"#EDq*zDP>׀e23HnNnA0$4,VZӉ6w*1>l!wmd[$VQ]'nDS_fp14[y1!JyZnO}=s#>9}1Cx+av1(bhOAWvA64_1hedUd-g"D-xÊ6ѴΈd5;rм;s5?^3X)'NkB.ldFzӨu|`h|Fc4a0fFҴ!.(u-YGTQdI%ϤAc̟7SG`/'1@R_so .>Y6R|YsqC z,>\cXPC[sc/$/?=S*݋cBx<2#/ȥjH)jJ"@'Y A!#Gڴ'?BryڮtMO\U~N(tyaU2h1U먡q&Хm-~\{XQ)Z,ۭqZqlU78 -mf1[Džmj8îc­T51!6Չ1S0 .H~|qYZw.xƏM?KoƳ] xƸ 7zTԃ#KR~Ȧ4_oU.?<(wMG_ ;3~MHn$Ye [ƒ@,Ԁ{c\0+Y #P. (_vpk -LQF! kN2UM9 QW;p)#dH*>\l za궩hy<NGq VCgG#s^;qqF*d|)-s*젫_2E|(Z0d'ኻbvP}b#qWf>‚lU4j}j)ބ v)Ǖ8|qWc DǮv_zث)$qWe )*{o 'جB܏, v0.]#N nM;C"8zڋ1ddN?ᅙ.͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgY%Xb]vlUCv^*ث]]vl*ثb8W X`WeUo6(k6)o,xt H}Qh[r9+svA3TTӷrF|.%QlTW0[s U wy R)4;Y*l%'囎*Rf]f㊸8+WVfpj1@ \>2#@s*XRKp,!L}2!v*=&hSLZm!ᾙzKH* #N HYT,|f%Dq&Kkv\qZn]ra-}]e3.4Ҫo/|p|a+Z؛F &Ɋ\<ހ$51 OݐXĹmJTw]MSMbKnANG%oq>#djH*a؊db)5G9)%pS#L]®XI$6#7upZN+7f(vbRSoQe=A`AvXZ+]r\NQoErl &-`[`]M7xFJ\O{5FUPSH ᖴawmm*Pwl4\&f4 5짏acOe?cyf/p|ϩ@%])񧨚/4ߨ?$7qvM1H.$ʼ@L)]ZSUXR6>(R6apZ1W2Sq5)!8Kd$Jӊ Uс|Ɣ0!qPV\xM,i1iVUp?1O|( 89[E`iE]T^ث$>x gu}Jl]p#au$w3q[W&ˊbSD$\qUXa; 4ӏ!4^_dȢnwCn24jv!BIZƹn!j~e&(F؜Hz{ekLm ].%v5SSa)Wc]<v]P׮v=^ث@kWc(1WcvVvj=WcCp:b|U@x\Uش}?,K*7ص+\(v4р:"7L:bxb͊6*ثb͊6*ثb͊d?CUs$6*ثWf*UٱWf]6*UXbef®͊6*U®8•ٰ+b-fjfF&(t5B~%V\C C^YQ[gGq .%CV)o$MVcݚmLUرmrᤸ(z 8~3 B)5qUW*$:q銶v)-G,AEľ,a @ql .cduX"qK Z^X;g(\&(!#<"v?2es& drwW/]=***=rz|&ps$-N)ę)Kp@aW`MJoN>#~ 0vR6f㊻+)vn4FUh'#( )d (w98op54[0}-G5Cv9Ь^=dB'!diD708n$l{ j3jW2^\+TA36*)5!8לqt'&$xj:ST;-\-06ù-"x2 pcš0(k23${ 49ʺ@W.<|U-[KuPr1ZF`p(R>xUcmj@uL \bb TpcUM*m"Bp:t\9(hur Rq)"%[g SML*o*ؠ Uզ*%1N)\QHCR0f )4`Zr8آM~!vuO Z\ J\ L|gN`60͊W 1¸eS_W,mVrǃ<1HL#18S\O$5 ܐq2R> ~%4saʭH(P~tz|?єi(ZMh`pPl v( Nv]H\UNG]B^;)q冒?htv0+| Uڏ*G*ojaJ&£\ lشF51Mk]Cv+|qC5>fPWBLJWBثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgY%Web]vV*UٱWf] 6*챁]LUٱWf]CSvQc++vlP*T1Vb v*?y #nIvEd.لR9j1 ZਛIˀby$\=k'R71Hk XPl+pS`RIf l\a }LIk\qVٸcJ_7i[kz6Re"~}Pco 55E~y^Ƣzf|qU_'q/Ch Tnm]飫7 D:嗐wNEW#r)Uᕣby2GC'ARY']N-i!4]Iu+O;wܓgJM!bA (a_+v_zw튻v5vQxp%b;n}C6® ĤOmȔFȤlvZ犻l*}7(v8(Wbs)KXđz",)v*sA]a;2ӷv8? ~ ƛWf Qr]o8tWf]vlUٱWf]vlUٱWf]v ??*Će 9i~lUٱCbʦ*UٱWeR͊/vlUXUxtZʦ*l*T®LUW َ*UPeb対*) \U$7':kAA9y͹a"OJ5_j%UF/P,RMPw]Fe0+xR"ڍ2AlFUL[9C#J *rҬ3UJf<*ػ54lƸ)]pͺ?a͹/rIQnc霠3p͹W|J¥_7#&%jw *ȡvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgY%XW6(vlR®f]/LU 6(%Pث[G*U٩\W0Zǁ8m&v'''%܁"V=2F3 %,)Ӷ8 BsUO&Qԃū W= 4;dSYǦzΙ#W? `cF$pn{%G먑wVS ˱jlhG [*6I~D}9W-Enc'hP:ZK,iRY8p 5cN'ߊڲ̀jw%a?ْ.&iQF}u3T~'_-K)iaup+(vc& ''zHY)͊o] 9.$$%Mb@qz5Ԍa\B"T * GTZ&Ddx1Lxưhlcxbo-iY"{WGߑ16kW*&{~M2cl`7U1JҘpJ⪂C8 PwURr jAa+;2GWimdYV;P'a٪*0'vڻ\Ȣg*S"d\c1VW51k(q`v?!^szK| u1jdY;(z G?ݗD!KXa a, UO:^sk:ueQz|6]<b0ZJے6+յ%{'J}N`Agydg%Վ9czQ(UQ4("1+gWFw<-ZFژPW *)[~u̱▉ÅO|!KnrdaNP+]\i–ȡp6pZPG0Gq`TycY)6\IQWϑB05pZWL*@|"laKBN!,Ju`3IZbaso "5+HVz^5TWv`F.73JWOv [@c<݊_Y~rE/9#sثk-L+ڻ|tܣa!6!C Z5|\|k)w$oL)N8ٷah?I(M<0#T'0q+KiPu(q eR^17n@g!S'4H? [Vw]iQ1Wc{UFM=𫱭qWcP=%F;7 (vTt;ĤZ0%٪]9N$;|*o]\ LP~]JEMF*쮄R+nnrHveo,S;3lJjOq+9?91w[P=@zR~}[_qGο+VM~`jXٷ#ǯlc}Iy"-n#^㙀dU酷W :."Zf|d$b`97/DQY) >z48b]@Q*z+?^DԻQ2x~Ö')t_O%Ni=$FهɊPҫ)]A3Cqtjow#4_nyC f6J|#E6A7|1; l~D00^y*HU?_hr])إ$rHseDhdZgGwD)cTh46c^Rz); "9r\N6lSdZ|41?Sҧ knqWV5ak8d rm c.Y\2W)0\-V]Nkc)p81Vp+c,-p)f\R:B>FpOq4L"ܯSolo,kl1Qa5C]*㞌zV5z&pA)ZQ r7/l %ԭ?5_,\H6 q k=gm_3n~<mhE? \%AWyzij [o|N'#QvdQjS 5H IX;2z/D?aʏj.)dt(rÜPG6MQ6 x`v|#-5t눇R.j@$F-.҇LFMVdmoՊ,aWc튻,>];bbe$TP(v3 0%`2ԐOE]޽*71WcEزӨ®qP`n]=^QֿSe |M;3Ђk4{l{fajTxeHqt ̊f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgX^-\UXUx]vlUxPث+ UrV)vl(vl r)uryxaWf*)us]\8㊻jbWi?W$BVYxiCL!܃lvNh>`bjTbC_}Xk{#j >G2q 8]?V(gLWCR#>c~Wӷ0\ (@MqE) lra`q0¨aJu =]I*AbSZEw}/m(tc粑!@R:`&R(r/3\Uٺ]%veR6(jpMr,f*Ԧu+7R \I2 1;*\:H>4^%.c,).\v[rs}NT>vx'}j>8amAVV͊WcN*خ7)ןu?XTINYYqu& oP?^r2s$ lکȘ(rh8wo{yw2.lu1֗ҼvGyk(,I]m62:Vm8 ?ol.t# YDRebűdK lhp9ZVIHJ4 ]S=w.@LP]=Ċ 7l:bxb͊6*ثb͊6*ثb͊d?CU/fb͊6* 6v^(vUqKWf®́ZY+aVj`WW*RU1WeeSvjbW7UܲCw,1WZwK.r@5!'*#=on4 (f)9F]%  z1鴈}fK+Ş<`?Ǿf!:':;'4zGͼ߷drLNuqEl*mb$lra[Հ8*n$8֩mJi!sѕ6NSko#`AasiGVR@.i0!vrKu9{Q150٫\KS$ˮ*a^ ;e nnbR0+-HZ\vV1՜Q>96vepmT'{lp!hv8\lG*;au–0*#HrlU4D1cE1J^ɋxvQ–0Uv0oqWX|FAs@Vթu'Wo-5d^`TY*LVfGcGQ}Bcp?eGE $#, +ՏRp,P\LJrVثDb '6,UvlRb*U–jKx–jWQʋ`CHs\vn* +Li1Sf$lI"CdR: (mmBRHH KmݓXVJǑg7"O1w*~@C6+%vb[C(Ɂ ȓƗ•E8b=7 wK`E'*dܬ85a$AA0qʦ(TE+e)N̴}j9csӐ~*S:HK 8fg U`6J*bCn]qQv1]ߦ*k¾8RէQSoN7"afA$î)v5⩭+ْ=qWc QzS8ithy vnw‡eP(]$p|k2S튻-M1C27+)q­wENLbV̊f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgW̆inlUٱWf]\ Uن*vlRPsbe͊51Wf]vjb*0LU N8 9TjbjbW&D9ܕ1l1)C49X4jj⩱B pr;gY82];}miLrd1Ւx'F(ݘځ5 >+:9*0զ*б-74iR=#&xqh^PA$ʌ~ ah#6MX.v)mu-1S(u0ͧܦ̿NCΆiLws} '.a1QrƿFV." '\*mN4pw֑N @97QЇ}:ѮӦ@+˥JR@ٚvHR%*|τ_F=ggbK9OEGU'8 xr4Lo@8MG o\NCOLDJ9Vp9e"=EǬOJkբqw!1Sk迁kMs_E+Njed2AVrl{<+m W()m2co i+16DŽezmჅmޢKY]*W9+h AFF` ;Q.;FqLj1=K/ԦP_{+oa<]B?m~um ȧ濁FxœKnc}0*O!Nn#E>~ z2=k&{S"HH.K6SŕA(<{vǜD/zY2r0{iDэ`s#zFy%DDנ]'ܪHQSʟ,ϧj% a; 2Lj`ߛ7_F#_ZUC? 뾮VŚȓP1\QK Q'fiY,1ҲxcZ\Vi1M"0=I#bTTa=p3䒚q ;J~ҋdցh#JJc9>ãD9:@3*a50sJ]@Ǧ< e$q(kem)o1S_nU\7 W-kjc.1CC+v4](8vW؂]M{We۶(vjWvRdPN'}WcibpK1;K׽1AvY@;bF)vEgg(b]vlUٱWf]vlUٱWf]vlU/H{ B7N٥Wf*UٱWf]1WfvjaWf]1VWUثbLU٩51Wf*U1WW7)us\N:mr\qWW+*Y⮮M2vV|QVa >ڂ~2)3/0k,"|D~siF;JY-ܨ¾#l!\˭Manöt/[Z8~Ipytoncܑa*e)J ޥ1UP7iu*=F[¨?eIp[ T6,9̇`s=]RJVYYa#oak E}>ÅxG2ȔRAu!Vp\C5i/5qWS+ {hK8*WALNM(K *S텓ytsoUMe$)XEk:XzrIP:8*r)Be8pa8x#A[ƚ⫁ooTl`s \1q` >pv=Ypz@L t q2.Ě%x`p%`^@ɓAEl CKX(?kɳnxl滌w'JP568!\iVi .u8yT~pE\"STГT@rOA]VS!4o.1q$l>^b<ԸCԞeomZ-PN7)w#0lVeQcMximp,{){ ">&?r^${i>1>inO,{'t=4[0Ɲ*OqcM7苿|X H/`޴]G3\*,@#c\YT툛 aakYqKdmEsy dmMu8Sqp. Kl>]\"کQdhC.j\kE%@)婦rʨI#j_\N _;Ys(W=K-k l3NM[/u#O'1b}ɮ(&?Qf\4iUx;=\Rx2UxlMQqYe1tu k=UViX}'x ISkfڸ+)G@ĔEjhߘuҢNAF' Wz>4m>OV7Ppy{G\A=>{1CCƍҘ We)v9jv"sN A vZ)S 9r:K[]QԍWb~01CS|!.7J7Wt\2[@^)v_zT@=N;o _7|HZOaNA b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgX̆inV*ثbSvXt W6(usbeRثb͊/usbSnW U٩rZ9tZ]1WW/kn8Uܲ-]r`[10NrFcr&!ۉ wkA6[]ZsIA\k1/RljY! ͊[)*+nGi0CInFRomkHZcZUJ_J;ޘK\hy}׀/I'aK f9fcM 7LzaZZ-R1WtaLh!M \ʭp+`KR"XEp!6*XSvn#vb)]:|ASv?U=ـ#oAզѹqcG!$֕mu9xvnI z}"Qyv_ՋnCa7̼`{9 M,BeOr,ʮ*5!e8| ?o%њ\1zcj>ŗVYf$Ɋ0›v$p%DCFeqI)q92H#/ATK5U`!6ؔ=VlB6\72 Xbʛeal%_| /h -Q S7-ðˠj/.a虜%_!QӿxrMtƃL lLO, fqjuwXq)n\U1fZlC]Z/k(U(+D, 9tkF4=`*r@#k- 5#;aBs"K$|nzC2;q98rDyG?»ߓL9wIfj'Cd| Ib^2ULxm$orz/׆KR2Hm_ eG,qrP '~ȵ^Q6ԭr=S xebl !LUٙ{Uj)N1Wci£n]𫲹-HZի)Jr-@=:*oi;B=Һ~i.rރ|e 1WW@*PqV1CPVbW :jR**Dg(CLOvlUٱWf]vlUٱWf]vlUٱW`#2Ha _#;.d8R+ 6*ثb˦*PZlUٱVWf]vlUt]\-W51V땊.D偊tZ]1KU˦jCeZ-\G\U}>l\aM%͓]E?#5_:SU;;?![9!&qU+mVYhm+ el$IDȔQivjM.'$wO-{՚'ŌdoM{=2 ;rǦ#$ȒL`Y.=$M|?"9$ej}ҴɥSY<~A`H+VnIj3MO|((N?3(e)NMEW)Pq |N " UKP63I2'"fUi]LV镊6;BPWXVإ+ 2ZjaWW*uƵ)ӈ\4SG](SJ1ÁȚ ` qB=ǎ ,S F0 .g\0d0Z0+.^8\6a8KQȡ ,`KPH.@-y7S^D#af5h+8Eha <xٴ(ʨzp6\1K^;{0Tp@ +)$6sX6srWk!{qf;|mE*F9g4+\i[a\X+ZW4?gȨSV7T۔ŊS6*RvWYf]p vn Zv48S+4)`U8Uwgc'v,d> T 0a$k" J_$Z1{{ح뀔L=2eOS-J[C#m9-&׈%h+ )1"(NiݓZx-v \,}0*岡2bg2bfl&*-(*`II%+o`ß_ĥUJJr d ,*1hh兊_+jhL*֓F$|SIXQ"ɢb I+w89.?)Qmf5&xEjw–i\1wL*wQb)7T[b2aWc\?*ZRv]ORpJepm. +v40UrF*=EG㊶3t銻(=~PnqK'loQ ȴ!erCIŒ͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgW̆inlUٱWf]1WeCVlPlUt.͊6*ثaKk.bLU^*8 Ui9`b4N;)kXLU|1K\HF 8N^2)GrWk8H:11d Nxͼۧ) qO|,&, AJH;` XxNe *;7uܔ$}j[KK\,`9Yύ6!9t⪜r/i+ ,܊˱ThIUL. /`0ۅhm`ZNj`<jbUk mSW2"QcSC1WCm֘OXrX;`fRhS* 9pXȱ\M0ܻn m;6*vW*nl ÄT(@1v5v> O(8f$G%[8{὇f?\#]u؜V7#$6'?Mݑ.3OlOtsM`޲X%|lɀψ=[}=>쎒2;x`CzdL;hZC9.J 2EHR׶Zج$6Tn1$N$Q_wJsCJvKc<)9(cL")aT}RyF a37LFO:\.NRE#j?Wyvҳ1=NR`QE SP>Yy+R'ev`k*1تdaG puJH1V9 USj`WW, *qVL\RⅧ1]\+ Ɯ =/$?Ԓ mr~C`r \SaBI^lm[y. GC&H0?-%2t8 >T;dlL@ CMB}]`[z&$@δ%Zc6? Ӑdd-O9eW2bk2i1UAmN|U v/x~SNZn;7>wTj. Z!K~d_ڡ4I\FH^ tm "fR+Sa\Jz6 d d9;m&x|wvZᗺcHR)[̣{Pg\Uٚ) +q1WbMj1Wk ;vW(( Ŷ *۞]v o\pU iZZ9®ڂ+]\mhw;㊷  B1KRN* WvWv`uS(ld6c6:bxb͊6*ثb͊6*ثb͊d?CUs$51KaCKb͊6*챊,`CV5.ٱCb͊6\vvlU٩\ءRXZ8R.8ลZ-[dKru_jx6Ic7d ֶ٪1C&ӑkS_Q 㑻vbK~'fKjNٚIsnKզ$nEq)$+%)"0 eL(ʉdr6¯1zQ6Vf'K3tr-Zz`3=a#fs!s4w8)LXLJ5+lI@˃PLNi"}r1#u5ˉUnGFȲUV *2[B !',jA5p+YaVZoW+aU2 I9 ʃ8.50\bLإxp%vUpt(F0jM8nibnƧ2lRC G|kx֒=p)q\ZT#M+$'qe5lC kbST ^Och%)<>[C׀İ%9bu\H6ܚ) *J0 `~ɂPR1дS2Uf)j`ↈ(QYҺ:[9Uٰm*a®AFYtIpN@QSH59_<--2"Bc$֞F"ԞN[e^Jd01H酖#p$S6_FzEdAKŖ6,52bk\cIY-1)U LܱCB}2/IԢ"rT}P~TշSuU`;7ӁHsJU<<>všRF3a_4B:N.$T;.L~g -7D9{ʗU/)pMEV*3(,K*MSR0\튻)S]B:ǩzWS2:aWcInث;ЏՁ]v]J USz|\vԯcKUƸ۷|Rq?\U|MrZ8B X+njEkLUo\"WAu]\/W$9: 'Ȫثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgW̆inlUٱWev^;/h­f]vlUٱWf.ͅZ ثV]\1WeN:n8 Ui8`KUW)XN:il^PajC#!m *[ 4e5SΒޝPbCQ$Df _d}8aZmtѱN%!ܑ2fAR@Z;W񬘬F#9v4/7`)eȳԊ`IIILOU`VL[ȡcZD6u2邑xՁ6";fE^T^l1YD^X 3)(Rث`WeB/ԭ + 4*Be"u R 88)$ٶ]H銻+8U;N+9^`ƄxL0q[l6QCmpla)leWvR'~ ZWwCq^-kK-ۯ݊e>Uqx*} UaC!.&P x!oŒ(8:Uc)UEr@!MlxBiw?gB$aalrါ)uaK;Q :[ ؎?RIqvſ,meZAG~E$iMr*=0dHJ fHv;4]k*qgmv8al+k7 R1ۦ6AKr-PWV.Z2!fZl DmP#5%Bf[lUʦ*sS[ ]/\݆MLg]jܷ~rsb Y#h2G6WB\.MzP~<'}JSI*Y H [-$UDcz}8}xL7G.P;tVM睘O(r`_og* -"R gЌ*p{o\rҕ]SSc=eI튶1)\P[1r@~;[-cop4$ ҄m]'Ec2 q_2=HQj~mGltѡlԢ~e۷*n呭Z^\6Z{ & q(57UNnn?'R+vl!.*c-#$~O+qlH܈Ӑu e˛ȹzaGcU)YZ$bKŒmmզn൷?FGeMVU„|-1ӾjiMI]8٣X~(_(h8{"VqʧCLqniM;ئF$9B@XPym# beKG 5˚|̌cNC|KE0ڣlpPU;b`" v`eڵ$4 ,YR8Zuw[JKl亹`BǠUK屳KאGS.-sY{e=R1[OLF~$^?d/ݐ #ǶV  k%3g 1R'(]VĤc}20%pU>Z|'s CXt/-+yxTf#lF#M+QA 6mNU0+`51VerqcI\ԟ|S%1l .ֹYBYaKx CNHdR~-}^=2$\ašiYxC$ XT~FP ˛'Ko| 8E+ il-5pZ`pک]qZ-*j0wUUPjx׮$j+ <?&;$nF]8VZqIcŐJQq*>LPu#eAcjKDK+Z@&]g)%b2T\`9Az)m5MKO&)?]50\frP?qP4#o\ft1>Ub@*OkKu+V5;bSa޸YMݺdJ[8𻝶h|*+$f6⃃WdJ)#*=Ku${TUqM*F$W2Uv[)"(-+נ W#&;䕢rԨ>oo+~늻]72*L׭>*,URC|Œ͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgX9-]v^v;4sbf‡eRٱWf]vlRUUcsbfv8 9`aJ< R \ 8.- Ǥd$FF@'#LXbs#2|KQPh@Q v!4V˱&-bYH;LJFxV< '>)ZoBF:{wrGjwrQOဝdE 1"p%\ تNi.]HDYb ^Siۋ2h2S<&zɬٕ6µ4 }2bcm{ n ze%8.97.eFٵ9Ol;,ثb\(o50%PAQ2sKF/ ~#, / +^~9`)x<- a+6aWac ߾U&aE8SMpIš]XQNV[2bs=N[Ĕ=ĵyx9)6⸗u5]IF՚LrVPqI,$Pr(́[QK/،r#5{['"(iG/mܯpM$xE-Hk: k>xb[T+Pw^^"1ءeD0*i ZT0% NG6H%ن%]"e,BaZ;Nv~П_s%IrI 9sMp&Z_դN2]ryH1X/%e?ג.cuOk}P߮j)ԣS3c!!a,AkL}^3!i|P";5Id6Ɨ' x ep=;1ؤQ  AEleqo[ð<\ !2casG*8m-iL hZj:HVi};3zdn2Wmz1;d6.kdAք -\ϧ(h GW׿-+i/o.%q'j9 dl"ueNF=>F^9xJ7ʑl%jF4؂dI@N̮s4Dn0`vr#*Pm 8\wȥP)0AΚ EsKeT]0+^(k6hvSӑ,dʇA 6q9Vf®匘pǚ Fsrjsq e(ls(|cTX]#UyXnAeL0%r6&.30;J[+%kMbpI*((Gv L EG#p|1Ed`=Hk"#2`J! ƙ1M*W .+KM 0,kqj^fJ>1P.l$mܣli0l29(^i^G΁߷ӝ[:,IY`?_ӕJ415k*2vecAE|Gonh+ 7)΅]Fn(:$:w.bk6Īҽzȡzȡ؛YM1VǥAjʜ׏sK5Pq#J8T䆩$#vqu2|Uރ 26k1Jj"rcj4SuqqKG-(uq6NuQ*8J]d|P8½zvp8.N2F*O|zbxb͊6*ثb͊6*ثb͊d?CU9ӫ2KUxWeaKWc!\sS إٱWf8ٱWf.]v^*Wf*qk0*ӎb1UÏqET8 ,b8;x͎*cPUӨ+~ 4p֊osy~*#d L#b+׮ &B6]vj"Wu5+"O --AS|nyYe2vܱ΄DN)7$#oMTYXwЏj?;V[?hS Fl T^y;ļT nLN;-ͅ]bf' +\^C?G]DcfpPڄޔF[araM1V򫊸o\[pfUqP%Z^Su4a.Y6'W?WEAȆ͚,% RC_Y34w :zoR)̆b銻()v4 dIlifȳ[LM0;k.I8Xg-b )wo%~ [.W FYLmT qU,JBb1XmyrO;Sʣ7VL,31y[LQDrIH߱dwa%j_b ~HSzz)cL;*ax6c\,I( M`Sek퍖 £*9 rUJW /I(4d®U)N;w뎠lUmY~XJ0>T:Z߶s%nC Ÿ w11C LjZ(sz>i q>֑)}*Va^:d+[nccJ|FV|F4oH'} )L߸!Ӧ*Ci"P[ /nP(U;L(BI7JaELE73CHL:w\]9R  m+ KiM:(+=n#En@?03O#'z@abHN82W,EQÉiE\ഫ,\] xmTg#*WG\z)O\QVĶ%HM)`#RBGPzvo#+!F$_jVۑr#+yVVKyO cC0!#B0̺խW_SJD×bdPM2.\#Pw8P **k=$D+qkQPjCYScJaK>~c ыRxaZ8## [0R]~U8u,iOPqV'8VݖE:]%  [v)­W04.)LP+5@bǁSLUnuq)߾(nJNUz7^}!ݲ;I7|J[N r(]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgX9-LUxUZ͊,bqWf[͊6)k6*ث銵)hiUp+╬1 9p*ӏ\Ucb7 Nqd\ PPolrP ~Q{\R+HWV>8 c-IqJ s^at924EOQYWcdpY 8~8PM ?H]4O@PHۡ?pʑp6V3?Y옵0oj\U`+:'@H$lvaK*Xb9oGo2D*7F_#B( iakMl8TxT~{_0 *MiOp=Z)- NVFdP@ݎ#i3ys˩cl%W*r2-+~leI-Q)+e?ّp[K}6!⛓UQo"dTd?`IK^#O]GdO;ӝHۦ$У%[i4צxJ-%9 QZi㸁Zi[܌ xt&u|iƖu'_Փr9xcKm "z -SYI6$BĬ#s3?}'#Jmc~#.oޗ36 eSLe<--/SwRL,@KR(lK!k¼Nɼ~rzҝWt̂CUȟ|]Lij [c~ "Cx1 ~Ad8Up+)?": 8*ܥ[Ǩ8Na4e0a0ƕثS ]\yB[y}Ql:cQZ^o{|fZAc® \N#7isXDQcPuK dPċVG+fȲ-M Tf|uj8k#|M fbb_ `JRD(qK(2ոkE &銻3H=*%7$c,h!ت^ujǿǛ!&3]gjo=0ή ν/&ߜL00 jW |Ϫ}F֟RfEoK"OHo:Pu娉ٛ~EAqai-Ŀ Pۑl,3@q2OL P;li 7#q^=0q^G})NB9QXT!=M4c_Ym$omi5i#  Qv8Qm3zN| n3scczJ0d;*eR0UZl86ZUp@b2JD8ҧ"FblSniiyQj0-1+GL]G ەM¡TQGD8ժ.3Q(XW.ABpm ]5}miJ@W=TӥFgLP.J>(F&[#iDtiTr[W 59Ǟ.!M~YM8p$~8@ >`sQw\js후!( )P3 eyT^c88#(+O-ښ@ZsbNޤCύAc]iM늶,(lbeJV_{ad:*d0juq-F\ V!Q(()`omؼvi.)l2T`9d"G %dH (TS$(q*k}ZQ#C#l$SjqJdA|reE0!5Hı''@:y(/5Lث\UP`7G畞mcp*ek0—ehalo\쏖0yU+p6 T,r* ⫫\H" Fٍ&agMNRWnۜ kLG%[/($ RdX fvJ/ڱDIQ1ELEQ(p%P ثyXyxWh/^Ztپ@w42)p;uޠ PW)Y޸ٔ&0ٜIߧlf *gM*q&\=QLkJ} vQۦ(lcA#C޵BZ=~-Vp!kMLUk'.DžY~(+UV@*v5+S*ۯJt8cJbʩ1We]v%)܀*|Up<7bzbxb͊6*ثb͊6*ثb͊d?CU{$1.0+ W/usblUUٱWf8b9tf51Wf*偊bW,beN^*;]iDV6(UWQfőqT 6%2MsbuK~槈b,U-/.bIMr~R,ChCLљMf­V®rtO ["nʕ[Iv V%=XGqbbquun-R!^EY)pPHtku O}J\FܠK!8E- S\l 4aKX V&K(-F@NDWZ:o*Jy\U>,5Ukskmmj8[(RvH9F+Q n['v2@VM2ө9}L6#`TScIe jrN"\QC3dm(dY+͊6*ثTye9SfE9h# vc 5֋9mۦ*c® NݱW6ـMjtlm+Zby(:We08^ZV\x!9gp+W+`|2*}ErJ40i]/V#qۭqK*pPv8UǬc$DZ­e>*m튻(nث=:Wv8mqWf;v''!@w8c#~i*wʤ}[6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgZ%6*lUu]b͊6*bUXWfG.bpZ9xYc/l 6*8 Uab)\AP6,Pq@vMh1p,U,Ezc\(S}ǸÐI9-F?0˺vEO_ՉF'<$2-#sWBpgS$~?iHF钽.[oR9.xcES3٭`mBuUp͊'VV@ xelȴhvP'`LqR,˦ Vc@9P0.T&CE ]1RUU=4म;bJR n]Yp-$&F |z,1\ຖڃèr'nǃl =1kJ «I2(=,ch觎_W P0^EaJ)]F…lU-DJ L%Ku:ƀeL_P[=UIZ `M192cj|m|1ͻHdoOݬQՏ_)8H_/{v!F(cFFdp K;c6PC":oZ .j&ʓrӾ0R͊XʴcgM?khuvZ\U] V[|PbpYxŔ\0~ypB.>jb(V1)[倮#- ppfK*a *zbD0PB+%Q ,gnL "7k ؄{j {O[t5WPF@3&e0U@3b]vlUX'捯I37'QH@mqєQ*0֘, :uƻ + \45 *31WuĪ+CJbC]*'PӮ#jPCSE ov kOWe(6N%v(1KY*(*1]ylEzb|UU['j@Vq9L*fۦ*o\Agg;E1-em@«Օ 4΋xbw*cغ́]KT0qUfpR-qqgC%à Vz2Ct=֞.<}J!Y=W5>ma&B$h2{bL$qV' V)ojwd2F^ Q!1)^1l 휳_̿d6\ @plP`iLRAC``N lUqKyu]JfrMvRqChї~%v EFH%{Ow2%`>xIz q1 'g4 ;eV9-=Sįz6~wżKn;ֿ,b+I]I\žij?#[6W+0 ^0l+N#](E끈E(cYi[X)Z# ad~y6^(aCyuZZ®q\zaAq5 /N9ckY/8:&-+(wn9}1.8BG\z>|?O`r2i8Ux\qKxԣTq$URTSB;)P=2h.[#Ycss0h-;I%l '.Zi^A*+LTх8eLpتH\ NQ2SWa1rFu { G(WnJF;)?:pGᑪݺets<ۯ}&F5K^w|lF4.u 82.4ͅ\lWS 5sùz^\i+r]VqKFU1V0Uũ¤V9iXNl*G51Vͅ ֽ0hͰ#cp+yxb®X V,g疄## *\ثb+bW« |TqCepiQ"Bm.jw2F( yGsSXEFN|YBi`.O+ܔjvd?~?EBLثyWf]vlUXF<)v+\j~nk߯ GSqS*젆 r"W 4T"K\d}MFV[N=+$»Ҵ=8ڷ$ucjF"JHARF7JS`WcH-MޤinV S—f*MHSvZUjjqUj /C U*SQyED?ƀnOF"2M&B}jj2=ňcYn=0KTб8ݱQF|‰R"1K2a"a| ]Y@dg %Tu0N/(0Zֲ)WV J](qN$JFƼ٢\mZM*<!\ ㅷzv]`5HF(1 b 40_iGAbes PRU߿ᒭ+FU!5bOF[FDˑXwɶꂶro9AIlg5("6Fqb7^?țv$xbܯavYAXjλOJ?6`WCɿ:`-"OZ/u$)<ӳ&^_՜fkfnVK EYyz=CE (so#[kXH\UU+\Up0qDZNȳDe8\`1WP,j(;c.ZLUUkv!cv]pˮ)kPTeC͊1Z⭉bS$>NOJ}~ UArN ]7p8-lTƼ9|Rb?PIExv˂_?eU3iC 3`Wf]vlUٱWf]AY?YNߵ-FDi&v9⮮PAJbW1FcSLUզS(^ 4|_`edR5qWeaWf)vX®# $?1EAyd[k7, Xs+DcշZWj2@ҧ0[# @ID* NNwJ"_Vz}춻iÈ2IJ.4)"st W esRثb͊6*ثWdg͆ ~8:XHN1(#^'b0LrTV,TMWo \1"T>]!v*Z'QzZw,c!r*rX )@uȫcĊ׮*㙫Ҹ"9(+G2IkƭSQO㊷zV,-phƭvx+ N(h0.0qWZ;]| nӮ*sJrcJ73e1? JZG 9)xQ`Fl vYnJg ,Ui#4qB#H-aI5&ҭ6(v^*쬒]PIiqw'ZQ33_~!tJ$pQVFfrݷi b^pqޝQ1敄6Vp%pxwmT^]z1;qp ?6UZ ഻+-ٱWf P;1yYݼf9~ Ӱ!X~9;`cN&*HR߼S\ +Z`%#- %zi-R}-t`KhE5\JVl>_uiKogb^V-?epM 'Y " `Fӌg}g!nX9>h㈒U_lj bo0\q++%VѾ?j2`bæ(h*rx_ps E^3U'L,WW,aVSusSኵ\3+lB/k(.ܰAmp1AQCRq8ӳ kMeqE,+O'V;nku`}xHHf洂ڂKy9ʼ$8*e{Gyn,KCwaV N:K{y8_QS5 G ]vlUٱWf]vB?1?[6KNGƙOٶj'cz c^4Zu= p8&bŔw0iц۶WT2=ƞ P0׶*L6xioO"WJ ߎWc6Zm]0IZlj|)p*U wlR7[X{ Uـ)v;i-c:|iy1eįaA Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWg[^+͊.L*إ,bcVlU``V˦j/jT[X[\bW6)uqaU⨸I\RރTPzPUA*Ufp˰Wp\P(p%LjY3edTQLer M6JfE]L|-&( AD.)Ep59Z>=Ag![-IՇC򌇣IFqW/Eݾ}(sPcUʮ*j鑭jכb=tBcmG $flUp*S e<008+x1iå<Ϗ wFnxT縎Á/Ⱦ\{~vjn ڱÇ?7|욤l[Tf`~/T^a-ծ}/QY::XOگޛۆP\*(+S\wj]~츃ܭdE qԭH~<%ctf6/6cڸ[17GA>d`[f=8Z0Gi=ŬެBR-2r ?34=:c=eƊ2z ڿvD:/ۮo\xdQ%?PfǶ~kɮ~_jm@cqO*N=i?L?5*OĞJщrKҸiˍ+b9/4[Z$,^L*rC"ВJѱE1_{gxfߊ^.f߁|/>/"﬿ݛ|GMpvIe3sב5nWԣp"~?sZX[2q4vc鿃(oF^{+9nW;.U=W)l9n`Ty}:)1݂T w͊vlUٱWf]vy*ۤe؜`ҞN&g2[9%wLlur@uq)㊸q]lU٘ZA#$⢂ʭ ʎ\(8N:J(=|r%[\W0h㸂~j9W)O Uk+-i p.*)(vb7 rl)rMㄷu5.bUP0=0ŃyWf]VzQ=zN2v9 2V JFl/b2,0'! oO-(:I($CVmc2 :DG{ S͗{ByG$T㑡 ^|?Y1! OӔvw57\^fdV:a8U6glpU#nWX)JB= hتkVL*Reo͖Z2$aM31'/6.LP)usSjXMcQ7 8ٱW1ޑ9V^MuNIZO0i9lR½M0=4b> "六ʝ1: '-P0RmzLGLjCјۉ)HG!䠜ZgD  >ҜTܖH7(~2usb͊6*ثb<R-WFax3k7Ӌad忈­S.E*i݊\h1WVW>xy[)kH!pƲr݉CuƣUIY 2kr*+my0q}Z;e=?vps %ծ<.+U8.ثU Y*izR\i­P 67\wZZbȟ*_?0 Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWg[٥yWcV P㗊ZZ9`bIjt]\1Vk/*sq8มi9Z',-*b6|QWRfPbme ָw1ԮZf"Uh442V)]tʦ(\X SLRڸGA)04QRۊTn  -PqTEqYIq! }%r]Cwm!ٸlE6rQvKx\eKu%uV*v-fb|N(*W-2|إxb͊I}f&!kQn@#)2 ),Ft8Au܍Mq)m kӹ!|+Vl 2Ef.\Ui†W` Nj(u;C1!~ v$s0d 4V?vGvt7)8G.~΍uF>ђ?]OMi?6T`C)|TS@ׯSrGDSa^X]L|r;-pZni2($1r5@޶w>c)™㕏yOM{=V?'Gl*rx݌%GГoo՜zNO͇Fc5(~#g!2l 8`hсǚUH&ցlUr*r銵, UpY]igfxL)mspܲ嘮*Y)4/㔓z$-@acxjbr $]L2W0Z'W6Rqm| ǻ +!\ kJaBB9; ;^hޡ= eUt2֩)5zqo8rsҋpG6W+]o6*ثb¿2G?[Eq}!ѯeNs\,=zV(0nz`Cxb k V5)RJWn(lKTC;MUd~'L\ A*'3Y 30Qk5*8aCci;VA\BeEMI8.\HY/_y[|T+၂r0˲BCRvP[ B0nknv]0+4Li-Bj){dEp+L韕~JGzD@ZnQ7950אlmIc?@spbqPmrR\A"ZP(.*]|*̻lp%DrW NW+.U68QNɲjf2E|0pfִHw,xIhk\* Npmqcء1–W­)#,!2b1|WeelRRurk]'/?reRR9*]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWg\٥@b͊]pD㩊ZN:hb*8aU㩊NlRrǠ Nq@1J88 R&<UIjh ~YJc\icZ( X*Oъ+zb1:뎮H+|W0!@NǦ i!?rfk0-*$aO o*5巆RS[?u:M^.ۖD] lY %Pz~SY$oEu;eq89n쳭'Y0UOz#F@+CAV"}yZ] 0ӌ7rHklklUjzjA!g<rƚ`Kc6=U>L=#r´m$r[#ax}ҡŇ gtC㐓elQnKR+Io6120+xKw'!=e1*(0#UA,K;0ؑqDdp'L[=gL܈d94T:=\tHas#BҞ:Ra3Q MP0k٢([ m'|y)ђ\"QAc ]jG )&9WmrmBAOQeG‹pX| JLXܞ8k$&n~OcP7,\c,VyW&&2>j@ ,(=jbjh陆( b뗹\q䂩 jd܁,. Ba0ڭ/M_,-\/⪩8@d?J DX1-/bצ)nbqU@2QM|bRKYx[K.zxq.*߮0H#ĺ(qBcB jio8ۏAn#tː-qS-v .vkq ÿ%Kj~F͘C.iGs$>~1%N"L *lUثb:ح~cџ*GRn:'$^R<*9N*eqĠDCQL)vQ;3ud $d  g#]KxFZN<$w`WzA S1ȇ^Y4[cj =k($f`M)㊸e҇W Qf]:UpGˊQbE:bsc bxyWf]vlUٱWf]vlUٱWf]4o2Ha o#Ii`͊LUٱWf]bc*偁Z'*'.G/-b0rWJWW, Uqbb%b c\RF*, upXkCEM6 "ゎ~Zd W*>R"A&Tۯ(C@+BFPIڹh&'uֳV" -ENK}Y>z\d:Y[$ۤ ؕIJnn0cQPE,|$#Úք\j7A,`4mՊ7`aܜ[FI(:):I#<+@u2q3«s붺v?' E!QB;1QҴ=lv7h2O۔6 {]2|iUEƖ-0o>j!c~3XI|CGA̓Lpbl¹;CUĤ}"p3ٺtx.\4@ -fƒ11KxӊӁ+)k& JZ8$(&¸z,)+VU1Cy:5+#|Cp?f٧g<^|z奴ɧd YK&+ԙx` Op^Ꜩq猹47~ P̋E/e!RGl$i]"[ak59e"οf]ޫj<凕9RvBQ ^dɌ7.ZCO2@vX9o㽘Ez6=ztVW$9aZnywp|qVW7$ 1,URapD4q b,1fbrC-U{AU"2J/R2^iVGb2GJƸVy:Ϲ($U±#儥aHeM4) }8XHF ҔJi\x\kJMD:q­.T۹ɵgҐ761|rŋRq^ }G`c:{xcInэ9> TI R;4r`,f &6`{߈ed2Lȥ\ثb0'->g2䵍?U3p2qwH%i9ei]\{.)\s Yצ(nCo)olUٹSK7S!H\RM \N,[^UɁ9t\P<{]|)( )p̽1lwk-z*㔠Quȡ٩)]LUvj@b7*DNLJU CBlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWg\9*L UٱV0+DB㩊',bbI˦*].0aǁV˦)j`W-fW 3SǶ)Yιj)zbS;qV♹jǾiR(R?lH+B xeS86 )Ӿ*io|WEk(Mq{y"TS EFDg vNRVܕG800TWޔwvwLp ,;e6 T$w(),խM~xSyj^3Nђhy&O9kyCyYӦgbm5ThCO yZƺCQ\UM҈BMN&&0qH chqnOMD;|G&"Ao)De.ˮ(v]pڻ=Wh1MrkCUE2w"4)/bI;65_5K68k Uhî4\%dhF8®7\U1}$-߶ [W(Vě]0ؓ(v Ʌic!6\)d]X6N Tv`߾H9QԑuK[吀="9=Wb*Y1<hbA4rR%W tP"# yi6Er}K+.~!~gg:4*!S"`Qŏk[(mfqرU*<J@?IjO撿PP>~i2"?ϕe[^J-הRLKf )9m  ~wGw<Sҩuac1~=@ ~ qKBm{uM&q [6F[ޫ8nWP2P>W RX=63|P=0stPrpF1hR!$eȘi1e$MA#u?~NV`mY"i$L05q"͊6* '+YGeJ蟌㐥9QrIZN88m+mW|b⭜8Y+Fu銷l*q7޻`V9>qKw b|pWcL{2Ih֘e5ZUqV陻|Wf&WLv_UyqWeƒmVsc bxyWf]vlUٱWf]vlUٱWf]4o2Ha o#Mibb]/;6)v^*X-pn8 ZqqUN8bc]\b pk1V`JxUM(*[0EULWXUP*5juT]voZd-FVs^5)[ϐъSf`B[p6%6ֻ#f'\yv?_K  ~( 㺌+$5:oƌbkcEtBO8BO,\ޣ/f[DA"<zbcܨ4M#›Tʌ"1[pSm@ ֮M0+6DrB]\Uu 3v8\S+!\ W#Vˍab^&աC V#>4VeqOs O&c41b񌸪q2}pF`Q/eygY{5,:snRTw%AJ$pZmW=9ߑُfN<҇.H!ugGYbtY?k_cUf]y-iUbR;A^٭X"HW종 )d|}pw\vscL,$&]>eBs# ~S[jֲ7C(C4_Lћ[USሲb넚`NO1Joc%biצh8D{aV[3`HXӨnZE>fL_SԣgC2\BuO? y@o#2/9> E~hZ]Hz &Z!c𲟕pm޼H{9U~%Au@? (1 MG{& vn, Jg\AպE>)T_6%Z6^Dw&e~j= Ju ~F * P}L\1dž ǁ$y_ 14䬄`O qXCZ/Rvwcה?l/cSQjȝD7O|wjc"{k̏?VAwVUH#VIcuZ="eS]ͲH.-PR5\eQZ?ފ|9eU*|8g U2^<;yg #+nd7V7;Zĸsý<L]7AN&tEaE-{? uQ d[0ySC9HĆINDQ=#a3:C5E>G-</8kGpcybj|K*=U.1Om?Ȅ}91'|F>8Ty6EV"acۧBWyj3dqObi&Q_"E; 9 g]w0,b0u9:,Qc^pq[\ؘu&~4Hs+mi~" u(C0HS!$R#Or`>Ρd`-)q#4ڑeLWSE}2C`(Yp3V&Q3v#z7OMQ}a!A^r`)|82IZN;*f^K5zo8Uʦ*;Wc)leH0%#l qE U|Ӯ(o)u1\Z kƢ0,uTj dFq4e\UJbycq`SydLUȏ."C'&U%*~ !!S6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWg\٥Yx Uن*;,c*pbk)uqت51CU˦*ZN8b hzUcP R' )֙`biN(k2Ȣָy8뎍IݷY4Sc]2\Ui4b71RyU<;⅌@ӾY ZsPN(Ss\V"K>sBܪ4+Cш9]¤ $jP86BŎ B&<*I@'ƘmTIpV!|""7 < :]2m dBǻ"bHevp,YQ91ukyz67m!)c\,Fk ~㓰zZ'CǓ/;E5-{OpӍ}}@9DbF(^6J^dbg2ܜ@ t5JAM:`oL+vI˶NFNN6mFw9ݢze%lZ9ZxAGyN]66 0K<\&au{iQFadLr–5+bM.qWbeqbcG EQ)%;1ȖN'.*lM+X c.>?|Cr*ƃ%ߗHZ ?hͿ,I>݄n* ĸF5ot#6Uzb[9A켇ocɗ&Z7&OLpypJJ'EIQ>n("c}#A<\ep;( J5q/9"䁆0yzJxp#ΕeKE&›5U9kl->* <@''2mVB#=Ay>`XEc#$~cWӌri5(`XH?|ǐ5gSN `G/,;!ԹoZ)=1oGШb:!?-`6ș̄Cc 8-4)CPۃW'k-~{iPqT7ZG]N J)П)hZa GB~󃈲cnQ1Aћ88',[GLs^zW獯S_,eqoo%k|߬w.yLjU_/i밶LkJ՘'"ҭ""LH„ԀO"!đ/ت h?q%'|–|cKS$ izڿ0aկ`9OUsv97RG8ekGq0  t=C/.0L׬rsCW uI y 0]gl8HܣCP|Bx훚kx>U+a|IW\2덫_N="WTdˮvlI>8)6QUK m8vSRHY6#*bB HF*Qp9/.0(Gm[؋uB_JI䠜ֶ!j-\AJЖK9. @OI'h+(!PCGE?=r2<)7z2 [^${һr҂#rSEXvGYQMv~F-^Nx.؜&`uM.nl+-KWFY=z*dnObT/RxX^ij:#rGW? ø?-l#rÿ#x'X+3'r[5NܞOP?|g-|ۀ=cى-Di,ޯvjgtS1C5UA7){rO4Ok_\0Y?9T/|*>7-$OST ql!VV[Ju]y[?:7U@W7/ ^H*>Yq u(D(EAJnUqhRLjעԃ2b--[*EA [⅏jSяƘT#jc]`; iؼ#1JdV ;E"(b zJٔR6dur'>iլK c ;/AO/MlhA͜2C zobY^P7A_eИܟՖqRl< 5,qo*YHȜZ(q$dY4>K 4.Mkym,l`ă>r'E1Na5ݩ9BHVsZY;t4n̗=9@2Bid8a9 D QKv!|Q߫/{rR4POyuNg\x銵\H!]F)k(ޘUZ⡳ Zr [ڞRo]\o\UnQ A)o5PZ9JOS.#hpkp9*YvZ8QQKx<0+D&vgހ\3 aWeƵ]\ 0!r#!KT?OIJ| sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWg]٥YWef[\ ZN*TplUMTA#>.dZmBв,>Ҋ,B^H37l(s"9$_~ZR>Vq-~pw2{8^'fSQr#yMf7Ѹql mYS_I@80!v";dJc%_mHkvd4z<Jjq\VL*ӖH$N8E4G.{tqw _h[żۉ}VzȻ{i(|[gh?kl =?-5(Ɵ1Z8 cC(ca< [O{qC" cIx~f'0 ~W g*CU`voo8%zSO), _(g $xhy*nJ9| ?N$p(MOnN8xDSp~x,gxJ_GSUuv8xP~[_! cƱnk "*ix(P <~rOێ-?(?5n:Txt_Wacļ gxæf-P< 㶗PB:0jC5ԏOh:[?RlIXVjՓGO?5擮cff b FvB<yn@ٕ:_1^*"Gb.D<^0܋qm1P[0ǮEN,>&vĎ͊LثF?O6Ih9GB;!ٞprڟMp!ƅ%J\4b].ҕ-5j$u[9Fr1+rMUr+MZk08<UEhqWrثGhl\ -JZ1V.튷, U"C7]SvS++jsxטQ+bxyWf]vlUٱWf]vlUٱWf]42Ha o#HnX UWeN8bInj 8ክ'/.qqUb ǁcV N< bLk)=1B6+Ih_N5P}`V|4rV26-M[o U@hj ?,CZ+04["7u*gkl%Ƞ 㭴FX}q)2=k;Ah֊P 4K\6;b.P%hCg %:cĘmPlqLUEMUUBHqT!XO>,RQwʒpT7잇N *̧&m"B%*@tr鄒1f,za WfH!t.H|g@-_OG#z/e߀S1SIQǓ@w?k 'rp42l™pƿ!`cLEhe]YEeWB#$K}~&}G Ы=N~58HȴO =]dY4yRI:ʇ"q#fpTdm(^#h~#UWVqƅx~.HMQk c98)A M^(j=*RUtZPW q90!50@Uw-ZN1p!p(e(h{d6.,1Wc1CL1Wk({bǩhlT,&EI+h[p8튮צ*<1BPW@;PC)sIRlvoABlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWg]̆iV]1V]-9tZ=p%i(VVZ®͊\u1V*-8bC$!JH)P\eݜܠua(sS$(Xc=}9psz3BD@7w~ ]XbFAvfKphdF0;m ċYB/:ɸډЮ-M|0WqƑoi-Mh4oHY֙"- Qd%؋DF41+銻[YHi Tk̒H4-<" PEt䇒)+lbVN䆔4̦I!alxP+ :lpP=s@*(j)8uuH"rik}b0 2r(O qgQ~5=)n_vD^v>eU rNm(-ٜm4bTz[O-&#98]ZMG&֞T-v%^Fw%f D) m1UJثYWW6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*]vlU٪|NiVjEq!hcjlX|8.KG.H|lc#a%N7ix" e.R~o3sb~Krow_~y|]@-qlXcl?j{6\Q߉؎ƜYRLC с?&r,."МRLL kĕF Kd/J>(R f<903{(#QG1DfZ#5p]5qC\qڬhWZ^L6;ㄙ+Ulj1BQdhCMkPUd!5W¨ *6G©Uեva:ufZrm;e+1@H}P?}SU93OOřy5Y?ݢxdRHVD ̋3 mJ xn酲Ca $`uqBeZ?rD7cW2p_sui«ˤJe`CyT—f˶jz_6Dl+wxeUeé]iYFNeNBO L) =C~h)^D?B6?nM6 !N q^YjYL8ܧFF9'3)N90}MR{mHؘ1#h:yOFcbB-fVۡT$2'cSWt;XPU\;PYEMiCþ)urȦusS8cWlUrCYU5A®⮮Yu+|)k2u11V US \ZNc-cXW) ch֘\m]LGlu2?:M*"aAUsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWg`/f50+*`b*q8XNl 0DUi Ui9Vj`c*|UaLUM(Q+i *rjw­6!WSǭ{ Xvۡ«xy݅ 6c~lx+_lzֻ`UrqqvKf#@Nv1NnZتثb\UeTcb x|(Rh<>RhF=d M=d… Ikq,PIp5,fLPZ. Mծیeޛm|1C$rv:GQXnTa6!V`H1i=r5N14r1!1U*hA /h/J㸍g`H9+ Tl%PHT)\1 ˄ZdHioZԚP667@c9n߶n S-+(upqt; 𼏻,bUrqKz0@ SC4;Kč=:mWsS\ذ}_@jZH#?eG& wֺTyq|Ovrd.T0yu0]E%c^+o+'oFM"-4hd%Ďpў.(sr y r;Tw…PcqW5jv;,!ծ]+-V1C Kgl#j]ث@eъL(({⭌qV8QZN9U㫁ZjLi\2]`C[=ivCGI*|AUsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgb٤LRqk*bXZ8bI:nXq`U偅V51تܱZ'1UXk\P)Qrq(ZaB W-Z]*1;*T$ )O^5i)}UTOZcv8z|B;}jH*QGMBr߇J"chEj2Ø.ٜb]vlUٱWf*qUe caU(RU'CȞ~=bӨͭVbza\*1 Dgm4\eybR]6˚L7j(Ԑx61m#jjuw9cm(8UA1 0P!hb2)XZDaCh+횟~\MFk@r۽0+?~9VJ P`:aVPIv–Wmzo!"6+Q YMn@%y2T|KXԓr?8"5Y_vlUٱWf]6hⅤcdc&<! 2%q$!1mycő4bH*]s\Y$ ] \Y$©M͖,aZK&0Ë (@fT05lr?OԌ}^C 0J;SKbjH"v5s]u+fTJ䆴v_Sc-#/I!Ҽe?.k, PFoqoݹ !%w߭FyU ̨eĺ?0&Z[u7h_X2ˊvdoM^LMtk{WDuJd$A_ۻrֶ/SqkyH +:1~mc)"?+:+0(#qf1<;>ȫ`S6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWѢ#*@vjij+?a(6F@6[))GJ|ǐdY q-bqhk\28DfU޸dۧ*w]\a`ֻu)X7[uq׮*z`W1jWe7axxbsSl*R`V:Q!|JkѾd{"ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgc{4``V`KY`a ZN8bpi8UbJܵbA­\xV< UL͊e1VLzT bSTc*1V4b^8ze*Eq>\ St«6a˰Q\UhFF(4 ⇉l.U߃AܬfQnو홮lUٱWf]vlUٱVv^*kb 6( z](A1t9&)|S&GP&,Rw銬5*!{t_@1D?|$0L3zKg:,x [-Ŗ9n-kj PfPVa$Zm`G\b1eɩ[̡p  0; 0Hn.>  2թ ɾ:n(n$]4kuEk3-CFCޘVD>Qd mƸX(^ LzWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]F*i]O fN9.Qkl&Zp|on )ޘ(:Z9*lL 0*iV41UqV=qVWeeo*s`U3]{q 8&bV2n?'vlUٱWf]vlUٱWf]vlU3F{m*Ć& 9\,*U%D[toȪlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgc{bHq`UbNXDV* W*ثC1KG/sbeUF*〦*Q+8SY\xbR)U\U c1B$:­U<1VxMG V$2Tnv[ ZE+­K" EvTX4 TDtU ՠ5F1URߊF… Sp6' U>NF[ymje?mGj .\q]0\Uy|N(kn8ٸHk`|YaU6lP (*.آ(C.!d|Y\Y0()qQ8azckJ"IK|q6ԡfmԇ`):mVxv$p[* pGj?ebWf]vlUٱWf]vlUٱWf]vlU®́[͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثR=rd힣/Jظꊽߥ^>ݰ̠ 2m*@6I$lqW|Fp9C 㩁 W()naV{qWxUrثyd x u*zfhW\(N-k-ebS scF/A]vlUٱWf]vlUٱWf]v ѿʟ!*oΦs4s UinjY,881BqbIV.el0.XZ8bPr)qVbXVe-LQvªNkaZ3ViC`銬+VMSpN9AiUc|$Jtˈ v8jhİ&=^ 9 c-ԁHT$%+9L/U_3 0ҭ2ҭn>һcJXf+q㛎4.ҵp\(Ry+Džª&(OA\Jp°藲􈏞־3GՑO@Hu.Q]h" 4Zy&-&Cz`Gn_Gr4 ׁر5¨HBlf*6*ثb͊6*ثb͊6*ثrusbͅ]LUylf͊6*ثb͊6*ثaV͊]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWfZlU͆LR1WW6(usWvlUٱWf]vlUٱWf]vlUٱWf]b0n,Ckꆌ:dWҥe192 ! " هQ|/=r{ le$l)ur]qV`]`pn8" *VWW-F*[]eL*lj0+@f]qCYt]LUզC|GI*"ף|AUb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgdS6$a PV*beQZcJaCU/)wlw)[\Susb8m+XW/ SXZX͊(2rJ VC TXhv\{bvA­T)b@߶* R +rmA;ciU5;joLB@b] ʲrrsA5.0JvLUlpLUi,G z~*.1-1ԨZ&rbkAI(u2[9eLͅJ9eqW­7vjS \4î4 b˯\Uc튭#1ܜU1ء)k51We\UîrcFA]vlUٱWf]vlUٱWf]v ѿʟ!$,ꍗ3J0\qb`Jq@1Jqb8 Ua8ኵ\yf]aWi[mӦ)Z{zeW6(q9uZ8bHǁǁT1U3ت`aULP5szو튮ZmqY*^ـ=Vة;fQu`K}e-Cr\n ;2^ jѿQ5AHKu&T#.!U|U| !kO4X뛍qo"mRk2$|D t9#^w /F_:zK#Ԅnja:Xg?.{SM"R :"47~l\xҰ'o %]Z4'I7=Vm#}m JW,e8}R}݄DEC "M)$ثb͊6*ثb͊6*ثb͊6*ثbͅ-fƕٱWf®́]Lثu3`Cc6*ثb͊6*ثbͅ]1U51VV́Wf]vlUٱWf]vlUٱWf]vlUٱWf] 6 W͊WW50һ˦4z50\l C6usSusb͊+\s`CyWf]vlUٱWf]vlUٱWf]v3=˱e3aM ][BO%0+DrP!Y' xd/# ;wqCA]\)#U#|*厔b6 A[0vmWj5­]\p+U&|W qU])k!~wzC$TkѾdw"lثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbqWgeQ6$lvǁVx«-'| [\W7\+IJt \RLq++Jb\.'.ZCZ.*늩8*qSnUa/ЌUmO^EF㘏aVը:|Uh]O|Ÿ3XSQE\xw \ IAZ5N 3}\jNNFhd&ؑg /JrJ9aqhsqHk9|qVR:p$ĤwƳ"eJ N&1 ix$?l*: u'cL YD?gUk@1׮*6*lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]U˦k5qWeW7Rf*f]o6*ثb͊6*ثb͊rVu3WpXثb͊6*ثb͊6*ثb͊6*ث Ui[51Vf*sqZ-La/1KL皘VnWW51WW*Ur*UٱWf]vlUٱWf]k51WW6*lUٱW` "+|//ZdӉn6UC-rDZ̐m&6`1 oRpTjb8:ZjbW*=qV뚛S 3SZj\F*q)oolUٜS劶|Who*r銻(}CÎ5K\? QbxyWf]vlUٱWf]vlUٱWf]4o2Ha s˛9'Q'*xa8pqSlUo, ]qV׮Zf*〦*8RbLaKMLU )Xۮ< %s|K];b,irXW#~ڬ-CQצjWڹ0)a'8ޣcUi qDBOevorGR@y]1U­rcO~ sU7~S[L=`rilw"d#Eq )lvBy&cEQcIj[Ʊ# 4R 8p'^DM?9Aİ#9OIQ*E[͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثeCb͊6*ثb͊6*ثb͊6*ثb͊6*3blUثb͊6*ثb͊6*ثb͊6*ثZfǪE/4z+l1w +*.U1]51l>Qp|bfoQ`b\1Ku͍*f]vlU͊6*)vlUxثbȋ"pNPrQ$ EBצEc*< 7]j\CrD𸳅.g%#u? @ҭS$\F)cCLM6 yqWZQo, n*b1WW57[RU٩)SbcV]OR b'ʤ܊b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^vv2ĄrUaG1U688 ʦn]W*fp%s *q`v]1Wt:V뗊RÎ-cbSsn1…rS7\*Ш^*ӷ\+{7cZ~Zb]41ڽ1UdjvB~xݩLY} p]ؓ]Ӑ'#4URC'gb*/8!a49Dir#nOu7`M""docE0ZQqii'DG@U}NlUثyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]UL  9F)bqU&zexiVٽ, ߭&*.UL˘(lKW 2VWʦ*,.U1U`U#vV*rlU͊vlU]\ثyVb͊vlUٱW`=V@B CTʎ6BA(@TՑ4C2˨LC`P!*6ʚh7Kq(_cl(k1]q9*ᚘU[)-ͿLULUS5\7[8qU*s)p뜺X9z Oo6*ثb͊6*ثb͊6*ثn[T !VOVuvk4Ne8ULpӎVZ[EcqdQUrbr\Rje|Pbr0­\Um+W1:lx1ii8$d 9pĀ@ YZfۦ(jnjw­xqWB5Jh q5j⪑ 2һbJZ^U (I ;\N (;_@ƼCF?~rj(Jw?4\Y~"|?NVfz2j7rn$P~8E۠bXƹQ)^YWVoeGm;G\F0T^pbOpICر&*B=PqPUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vl4fb͊6q4F4W67vl4LpJ᥵6,4z7 im`2 M8DŽ' *LQcR-%ҌOEk(Ǎ& +XepRኯY1\iR0͕L@r Flb*k[qVm͊Vb­f'64li]\lUٱWf]u==/0>ռdqc(nj)-~{g>{i)MΖ22)sIJ -@Mq=æPiY9vWLU}Nvb05)(lҘ偅FvlU\Ru._޸>U$E??2;BlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q\ǁ-X͏Vp1Zrv"R2i_NRl NU^]]]bf)w!LE f0i8̱Z80HpVԮ(ZqԦ*r«hsTq@i QQaCGQ8XUJr)@>8 I, ?qhPEsr ۣ{XИքn ᱍslc Ʒ<->yXLJVqvl$|l)w'.ԓ5_eb3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbLUrK"a͊0Z&|qUU0*saVbV\*ccHSoOVq#«L('8Ŋ-%XQhvŁmx4]cKm`0lN1p*eQd*.4*I+WDbe+LUb͊VXyx`V͊XUٱVb]vl O\Hf9)A"ՅBv˜YƝ1VYFbqkCu˭p+WevW6V*㚘6(vV*pZqHh坱W ثc9uyBbxyWf]vlUٱWf]vlUٱWf]tO2Bv՝hZؓ+eZ-U+I P[\v(XNq`U6;"k7)o;`1U=v«cUr0!pĜ}1VV9M:c助v2)#- 잸SSaCYVc|U{ 1է\U`ZG*;f*[EvvV&{2ن0-LPo\7O%ZU=\/KwD&y튇1$t+Y˞G[i5P+Ĥbē=R5P(lLRl]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlR㚘iVLi *&XL4L M Ki?le)Vl c2t2I\iV,¹U`7œx]k>,G~OݝiοAZKmW~U2kvnȉ4zOȃm;XX7r@ǚ07AC2 |AQTKtĚ,L:laJ.;qF4gc<Twe0& %qBjdUP>Qplbf(pl`K|`UٰWZFX -Lb\6)n!vyI{0]GfEZrFXab{9>훷q*zv lUqV+]L\U, bWePᘌRءvV*pŐvXV­<>U$Mo!vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qL LbZ퍫DQ >ld|0^+-F]W:ceR~<(9Aܰȣa@c[Wn]Z#Hqd3y4%S_K\Wѐ=ͅ帬<@?y`#F|^:e+cAADŨvĚi(&aKjbmcĚ, Tw5xZ!fUVZJU᫔F*beq[嘮*ӁWUx9WeUic|Ui yW#*u͊6*6HĊQL c( uhAVF-ZBp|s:2@G0yt515Le<1Cc6Z=1Vr42qWf +\Rp.ه)銻+;1b|Rq raVYU9]y0N]vlUٱWf]vlUٱWf]vпoHa O,fCe)h6jShءDo[<0!imzfl[br+8 XӦ]kZ`jqCdS7bvǵ;` %FR/l%.Y\ mSl*,bvEVҹu­0ӎ Xl*:N@e Y;X)^CR58gizSN>l(@KO+kAE̍)8F^s'*J5zIʘr)VT+67vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU˦JiqU\pL4\p\!EDŽªFLa|p\*_!OjUc͊~8U $8#U#qNF1+biWviTd!L^S+4p\iTpL*U«>;\+׭jv̜zs.{!oaqsFOJ,eq@G3 zx^HՕ{s&#XiDe~I%¶:j{⋪¶O1QCָUMp)b5V I'ҋ.C:fv,B]h97u$tW uǖgK&Ф| 9'|8Y%5ͫpp>VH J"ڊZ! XQIz{cCq&di(uzI J2;{ yTTwIVeS%x*p|bcDliȪ9+yUkB2W0 T b́[͊@aC_i7>i3q.~g5n:begź-f*V*ثYt1WW1b1Cyx-w\Rs(Zr??OIJ* d͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qLW\)lcG|f9T—\QpZU4V[JjRo.+MJ hM<1+v5s\m0|l qc*LUVpVY8UgiU\Ux*rcj%1SUPl$ *EP >d~(`[ +~P;.r-8iJ!F0 \a8(Up[Vb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊h10Ҭ2eƕkKU\z(')1qULPcJeZiEL(CK6( !@f\imh#+zr*bKcH4\.N`kǬxS)v -Fj[{oUOd-Y@M4 4C n5x.p4vˇ6}~Zd "\o"k)mF`E=?;b}B;f0F{<@26] yt>>'Q4IK %{v82MRS@BZ}l0Y?Fv@trynQHݍk0\m+x.Lrǯ*~X%؄48X%/&M"#h124ё^Wh%q0%YfW2VW#+cNTXث# c\Ueqp*|bLRUvlUO.CTt=r<Ď7S2;e{btk/w8LRS Sm``Wc%ҸY\N^479ʮ?t&)|*8aU/*[2ZbR 2z#Bdv/ZEğeE{$ͷJzm}&ErIb85D!&r,͊lo6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*إٱCvl4' !cJ1 FI;8Pf*aU7i ~*ƹ |OR7 r10ҡ|1-7kTJ3« |5끛hL8&怢)KQ8vgpYR ɉ' d`wEtC~k5V6#{hh~s?p ֫qu9l`#"ѶTQVip:8umpLY咏6%V(fS!0 U&8F1]?3 wKuORf8uR l]+1.jR ]T-&4oA JDW^48S:;r$ƖQj6h(VK\MDu2`Ě<%0xm Tdw@O`qp%T>5UGUdRU[͊,61䐤L1V1UᱧWWڋZCo['DwqnHcqB:ˈXpTG +}ؑ*D4]WSOUo5qKثYK}0[aPZN:ZU1Wf8 b'ʤe[G2Df]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qFZ;b^\Us1m #,v- Z *wbeUU™l orS++l*',0\TcVXVU1S5ˮ*9D⭅~ULyo`:1S+~OBf0Ij=wgb SlAJ-qUc*1UP *3b]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUثyWf4aU6&LjLXcaB/Uo|pLUMB,xϷ\PG sKkMϾ=c$3fኬaWz'7li-kDU-,%!j$#d-UzyFKyT/vܛFXS>+cȔ 6XorbM>xiG@>LOTkl[?.K/#+.J UYɧ`p_8G62Ik+U1HVFqƜ ثyWe#(SuBΘ1JliiWo6*&8"\-jF*j$4ErPr)jB ;o6*X.qW Ui sUӊ\w?:>X*lUٱWf]vlUٱWf]vlUٱW`:?VY٫61i8pW'50!ƓUt9Ca;lxbMUfU)uǾ* qi9Gp~dSp̾8kpv wS)hN V[qWS5*qVZ7V;Wl銴@b ]5+Z]iVjpi*=W\ meB*1W< P*Oz/yrnv}GHPS~WVm2kmL"J12qJ-q")9V%-lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf.͊*>XL4Lw*ɕIl|spHҭ3 *?_ iZpǛ /p_ imgր#Ɩ7c(aBKCJ#H< *^WqHPJKnM0-ib+s*S 8e.AkMh2!?e-=wo~ՙe)<$,(:"7Se1M|E/P~ O̭QWOQ\OC?nF2=15odw/^|A?II 1!ܼeryCO^/IW#!>+F1&2%tZTbAC_2Hc1'5L֦8>@c%TpWkUΝX8گ_CcA̍9*譇*"M[TH||qVoCo)pz)P[p.U. Wq{ 8\R1t*ҹЭf\|+`ShqکI6/IIh 5:%GsNJ )R1|oN}Diu͊Zf[늷B2RMUS*˥qBk)jG/G5qWSSa|qV4*&l mZFIP% I-YGⱨDx2,xmrYMXF&NA*ȸإYWNUQ=p%QrVQaVb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث\UijcaU3 «L|qByEp%p|ki)Ua - pam\cxML4c,iVdfcJ*aEcXPC"Ɩ^cXcxPCy9H˛GU5aSDY=@1CQ_]JkLk\UpkŒA=VmJZ۸L^'K|FWn4C H#v^EB.t>}:M-(ڸs\V^.*ыd*ӡ\|ҍlU1ćh8K+Lx6B\D"e`p<&B#ƐYb\Ek' Dg"mp>&_,¬)gqH^H?W5u1sc#Ğaה9Z3r26bjQgp&_泀5cJ^qǁǀ\oWVPF]$H1h[a@{ͽ4/4?KeOჅxLScKf/ixLFAZ54i߃irSI݊ӹì´ђ*=3,0,iZe m\xdC%IwxVVk`ەxP:SƟ/82//CQѿ cW+JPMB/}tۨd?w`O߯#өWC؜DضRBN$-1╾_<41@ zW vÛ=jq_,q0cs?4+ 2~ˣ٘Sf-N-]an'䇸T,RUأ|GՔV[$lsoxr1&"Eq\IJ2)kD\nEUWfZ"倠cڣrhB8aZdiQˉK LaȥXy8^&0Lnq@A? O\brߊV*[v]qWS6*S5iw]*銷\-S*垸hmM0RAE[ dP͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q:eH8f+KuXqwmԌU1^[`Wf1Vy*\}0*ƃ XN*30ژUh/XRo0ei-MqW:lp[(N*q0Pj ' J:1HmFꉰ4#hI4iH`c|pl}I;ʢA]3|v\1ƈ74N&Ye߂fKki&Ʃ74Zd9]~48xOyޘƐ|L?]+f[G ;uZ9D3pXyU]WW0=*cPUC6(o/q,9Wf89UyC:'vlUٱWf]vlUٱWf]vlU?@f$0$QVvbkX͌Q\lJ`kQ.㏥z`U|rOZ(zd@e/JaK87c(;tSzژ¸ 9JqJ2UMXbO\Ǯ*4MpVJp+0 R5')B:ῗw3J*xd9QjnF|ninDQ鈱Ȕ&ؙ9QqÚ Q8\ÑJqV4`JᗊvlUٱWf]vlUٱWf]usaVus`Vb͊]vlUٱCuscJJ!һ' %c=bR-E(E&8IYከqqU?kqj[aT+~i Mz;e6^WXU& cyuMـ$Dׂ¡1 ,pYthEȈ[Nrq34h?P~6Z?澋<a;4,xxHG>=i+ΥԝmO/N4ˠwsE-WWW$DA_ 8k%iִ,o}\WM$99p I( 5OTՆG-~w=a|SVc -Wվ8p;dxyf+ sa `S"sbf+*frK-f®͊6*';)o}A8g1ͳlUٱWf]&$>*?VIӊfvXb1Wb1Ui\N9f3҆獫<3 qZm \䟘ZS~Fs}5I; UDp?0:s-po|&ԛON`O8.-R)A{`Ҥ.7\3$PQ 0)dܗjC2 hJld _0M}8~ɤzYZI&qhyZ՗\5[b,TZ3rݐ=FȱM9+Kmp1؆vOh|)-eE(.U~p4GQLJeA;dSvZdʕ*3Q)M*q0J9$L F5qYd2# p:9G|<1nڙjVrZV囍6sZ, U|qWW6*Ҙ+9ޣ*/JeoVebXr??OIJ*do"NlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qSZeVǁQ+kP0!c\pU)hx *+^;v«Jq\\Nd>XR]b2*W_lp83 *{f;QM*zQaW9-`)ss1Uhp1ũi4QS6,1>cȻ 0i%^v* ōv܄t)ȥlqd 3UlRF4U+pWf[͊6*ثb͊6*ثb͊M3SusSusb͊vlUٱWf]jWW51w!e'ZLQbJbEIw,tH,0 V\o SjY(H /q(6E58Eڛ^cXUI1ޘqB]h7!5޺ӗCYY#gXۻ8ۏ0j1'd8dA3酪סrRy>?醡K"u'M/?y>\'.OD_tՉ9+sb u9NCn Ke}RV؄ <NbD`Ɨ8گQl E.6r9]:"?"f3~)[_㜵ȷVc p+8FQl{ ڦVvlU͊+ˑI\r2t>ojvV*ثW`;9o0̗dثbˮ*bm(pIu2'm۱T#J݊tG|mmج7zb#'P5 I#+\6PkgxrcĭN;(|$U; tn"R?tQF*+]`۶  :dW '9*eHimb+zPe"T@jZj\/8bޠ@\'Md:uu9aM#7xw !kؚ>K~!핑NDd%XT1Gvm"1{Nq)M6E(9XثV H1( J%&TSW"Y#az~2\mOЊkRiFQ[OU:)urN]X*lUٱWf]vlUٱWf]vlUٱW`:6??VY~yc63V2V,* Wx{ ^|h4%B+mVnzf9t L+KJ :`VJ헿Cq1VǁXND<>J(]$!O !P;(B5 4_͆5M'r-3rҝm6*E8-]iypo33Z}pu2~f9S\Wf]9B?6>e]l١ٱWf]vybrK8sq6a7vlUٱWbUpǘc' 7yXb͊6*i[h#$-8'vlUٱKb΋'SdahkdPw#`2QlU9ڵej[tz Pė5ވ>-3掲c9 um6^ Cz6m6}jm63hvC;r5 fML"&ѺƬa یuǨAL k8k!/袩+TXvсSs(-¥Wc,*{1Tt¡vOMD6b;N9\䀗j\m$kxdmko7ҍ~Lͺ6thԏ S› -!K'C[J#6*ثD ,#ڸ, C/ĤL(i,&T y1VvqشWF>r.Sm LWZWon>8uWj]\8Rx1Cc, R[\e r/?OIJ.|-ȡvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qƽ)Zm5+@qC@~PRg'jI-|w{f&Al ޘUԦզ4F 6 {{e7Z?gX~d )*'%~cp Q-)~}ҭHd?o"jsncZwTё)=?/̇Wa-G̷Ƴh?W 8=Yif)o)_kh.Z',jy Z.a#Sd(l.1+beZ L3Vey99zo ~[vIH_ʮ)]@:e`Wd?H:dqp_Oz9%զWf]vޘ_׀c2UٱWf]#Ïᑓ#ivlUٱWf]/}_adGf]vlU؝'`,'Ȼ CvlUxr8r8o^6U֑9T0޸ mOL6Sx&,ocNFݮqc)rj>XM<(|WlFIPSiGt?g=PB"MQ|q?i:o@nOc>`9P 5\CwbZ֠lr FB, Z m X!FQŅ8[+:g¾Ö$2>6"x7VәNe7X`6279˔6I#ӷ6xbvbm"r) #8 US8Q7Ɩʘr)U6]vlUٱWf]vlUٱWf]vlUٰZ'0«Xd3S.\J|B+B514;Kn70cH]9Bli6^:0 A4#%LPGR{cJ**q<4Y.Rkpג8]ii'=ѭ[0 cӠO;rLj+.ͼ8zaU{[3":3H$jWHW_^Z??y̘sQN8Iw[ۓɜ˄SO,XZW?. ISS3SYYE\ײBpQ+llZTT' pҒVe#5&ZD|d'Ŵ؃\f8-]$ ]VX oggB+kb͊6*!󀭼g}f͊6*ث@zɿVSgn9'&b͊6*k/0WWg(qF#7Nn*ثb͊%3r0YWf]' W4lJs\C6*ثyV~sQ^>7:>lӜ6 jXbi:%^,sC5-2$zf9@%3qY)VqavqC)"M]oq[ölpH[!*љj0Q;W &12O'#NX9*DXxIFYK)#cy‹4} x.` 1Ր~Bl7HCIǦsWQw;y d±UP.*f\Ri>8iٱCE TfZp{0ZM0ڮ 3Wq'6S{O/4&!vINlUٱWf]?宔qq5_J7HFruIV*ثb'p+zaWf]vl ".2'm qvlUٱWbޏ˱sr4S2b͊6*R8I:-I#@vkHSa"vl65* mZLhK$9īkVwމZ+(mp&CwYi':N$ru%j|1Te^Hv9c ZMXW"s4# NG=h׸oNY2bQyb.y KrCXo@l$=8"dkbLXc[227 O "Hn>1e9u2ƳbFhq *a2R J"\FI_NX,LnhpR 9Jsg0f5(n@bUqVW \Pbek662]\ap9T['ӗLULU9EyJ$>X*lUٱWf]vlUٱWf]vlUٱW`:6?T?VYH3bw4 )q8 p*+P2iBTKU`i፫\NUQ:H+U@lev sثErxCE\bx튬4*S0v.Cb 1ݩV7m4|rE)~e'5%:? 渶)ۮU3#" UթmUTA'"Q+yWf]vlUٰq[J̣(i\!ȪA%IXL8i LapҬi)EH!,r~mzW(G-$"(KBKl*TڍX|ij;mq/ƖֶiXвoLyFN,7"S,+e)r]=߉L!ҭs i$yN-N*#yaMH=wq.$z<k#ft)+@LtF&e:Fm\]zLORkdsL Q `ipw늮2cJP$Ko?WOg6-7aGk clIUKz Īd|ibr69b!&g辯K\"@ io7-(ثb͊%"r[{8;'mvlUٱWf]~n3tW],!ٱWf]vhfI?*7f {YWf]vZUz'<㛈uC$f]vlU+ZOaYWf.͊˶FxHm?-,f6*ثb]rO!ОmSE[FNlU`Wv*`Ky2q^+~!sGl]\1a6 ](:VF;T4ޛq*q2 pxi\ݩo*Rӣ FZ@\uQfH}4*bɏ}ѣmv9E+#FH~#_ P` / Ck@JDĵEj>!2hcWkJu#cA DG%匘s廨}f ֮"|rR@xdsaCh=aQ4$7L4B+Xz3Ev=F R49 $2 )[z%l0Bxq!Um9FV/XfN *?bc^=_F@hA߮otֹ|+tڞ8n7 1Wf#^)vU1E;+;6)U1[ur.;k51WW*du|T,~F(Df]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q閶1/E;WSaCLVWa]*rbs#.]Zl1U6\UP0S,V_ Z()bqH ]ZH`TmZU;̠r }-M3^P,ҍҿ^8{K ^Iec#O!c\ b* ؙC#UU&4*ѩĉ TXثb͊6*ثbW/*,Ze1B1lH7]\lw4yV1ª2ɶ*#Ŋ({b^+Q .x;d2_Q}X1Zߚ^%NVe tx U#*^ x[x \q[TdKYgkjW{ {Kr4R7v= AKv `<&*d1k/?vس}2o9Yo Yc*`y) J[}j1 ˸dӶ9+jQ^8:aPFd8&:86>ͭ%19 C+[īb<1pDS-MqVQ*v[J)vlT1ʦ)뚘 LU▲G63zה2O>X*lUٱWf]vlUٱWf]vlUٱWak.) 7<7<6$]6 !BӦZ\)i{e*0݆,(1V7C}޸U[e=UAˮZVBqCUߦV|Ro*jPqF9ovZh5U)c+| Y{eC튶7I ;U3y2:u?,$ C_\}^"գuE@@lO6Аۭ7;ԞHJQmLk QќLULa88nr%(00 UXfb͊6*­ / $ŕ+ Sc vJhcx&aBq3Q&⣮=b4hN(ElPEAJҹu*w)m5MŒ 2hK.\(@=qjATcK]J5LF*'mN~8xraڸN+7YLl*?F dI-+٩ j3 "O^1Qx_IpxOuqv={\=]\^7]L^&bQzHi.i7_ﳚt׏o_ﳊӽxfu;0u(w#a~pҮ#@~9 \#SIᛎfTfTfT`=M4"ѕ!N[T5i+Lߦ?8<"AnW:Mu2/w;0b!A5\GcŔluODŽ7#S}!q7#S}!q7S}!q;ׄɤ?o/ǖ3c?vYMP^'Lj-:1P}z/cH}7DHY^(OACV#JL;?:xc9oO2noxÅ[78N~Kxy]Q[iahXzGٓf]P}\!Zȯ#PUOeGU FO*EsY`w!~hcTpT풤Ӳ{#)9Xg=ӲFI䳎AarG\ Olk4UN8\kG7(D H(dF+4$|HpZxH=SF֡ўj[8S;* Xڻ[7喆"[#f؃#~F65M/·QρWC$WqQXu6)5̝A u´sc)0,&(n3vrOI/@A330< PYZl~X:&#- X֣'0H4$ Jho6됏7>I6ly jfZEj-y!NEi&Tuˮ5p\PL&f¼ݕ˦T⮮V* N(vAGGI ,~F(D]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qkc,l`]o|A޿F*fsq*I)[(aV,?b1V WQ)n WU(kW)a|PQ\k WF׵2QU xeS]|w(7*떧;alS͵EBE %֮@욟|AB)6dGa(#+lQo6S#US+_vlUٱWfZLUUilz*#ȘXeEmVZHL >-pԞ*bP - Vi|ކE3}[&mOlZ8)ch@p@LPIpk\pLUH{c*7j-M܅*9LF!X(xMFZR5-˯1Q)[P~9.Jy'W!Dv>)o#&jiտneeB[a-ךR)\ZTC!-6S>$1cēad|P/Q|?Fkr(D$UWc{ B0NeQlR2[0Y|rm2:aLl iv Mw9;*SvI8G >SMe~iƛ VLS Y4)B>5\Ň'. :Op?Əzt-#ZSǀ~|J8xol- WǏ{F>l5}:K;)DRZ0',-Yf2W)y0s7ə<.ܙy<+y;/ ~8ߠ/?Dž/>cЮéЎ F юw8BBYC]~//o?͛-8R}~oзc?;?ߡo?!ԼN!~ 5.SҪ{䀷_aIP ,*W/s/_SxW  QWJ"f)\o201f^?0پ?v6ÅŒh۩#Šh 0,$ ~XiV4 f2c>?}e*))7)|k+ FX7CFcՀwF˱TGq0]$79+A_iZ|h}HSMѐ̋FFw21:7^K q mȶ'/NcZFCq"!R FHH'@t}:qSx9!ViJ|SӼV"08qu6răA7v WI6:2-6Uv54=X.!\4,soL>gaJߧ\qJ\ِ\U(h2튵CqLҘrZx:ȡeiӮb{d6ee}~Ёc O?XxvVY64忖<ӆM'ݿ_{~ci*R|8ڟQcNQR\E4,m[/4`{pEY`UufE<6Vܙ bDd|0rO q{uvy\H5vW>R$~hN;A31FW=Vųp)VSe-uPn> [TSw.2XiiʆUXF$(t(#5IXBsg;!yC5'?p6~6`]u*ۘSI(-&?WX ݽE4#$(&΂MrEIy>GsApo2d(B3 &XS#R0Y!(hpM=13#LxfB&ΠtF|szW7M ھ9- p+}3]+;.Rl ثu]\UL٩Z˦*y0R`Qe#Y"sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q 7#DE8f7$-6e)ZbPL5 i8;kLU)\*AuPӦ5۾I.'\Z f.6.e\*zwBk x*>ص>$4ag]|DE`2gTn|kglRC#J!0%][}UxN!&E>.`J%N0Ux9Db`U@ق-Zd q#HRi,iT'UYrA9%7EO\k[Mũs$mowLX[]$weA48E *(# Ut!b3({ /|NFr4F"uWč88)—S-C1H3yoAڜZq6Ԣ*~ k:¯E?N@ gU[sT r:;}Nv@ Z΢MiVH'06\c"=E\hC+sI!O|(bۯHbÏp;/DQ\!S((p]l`.#!nqڻ50+Sv1.¬b͊+vhF9(r4L٫6*ثc\sfcث6*l*~(O~uzi'qG20LU٩51WbWB0YK%٩]/vQ!5#&}![e,DZ[[|im_["~NU.ӄ,Um6 Z d)-1tjaUMEn>7ڔOt2%f7ZЍ#&:'aGJ6a5%727u >5@{00q(ї;*cpv1P047_Ս"?vFD?15?ʐz--=H˖ZGt;[xUqLp Q@4&oI۾\!sG1)~BI ̖\ H1[$Z: >;wM@G0b$@GcIibr8:^I=7ҹ^h??NOka&p)\Aa,f "dZCvjN CBW:!*J6#<<*6sL3:cAQYL%YMA)lU͊+li qxUqV땊]\ءxRV*^j|qKɮ&G[͊6*ثb͊6*ثb͊6*B3GBB߫;8)ክo4A.lxP)J{╅;Ҫ(7Ȕ)zqQ%њlhUk<0*5WoۦUwp`W,qV*m2CGqJzqJۮ6JE)]P\P,R-7*듄?gSeYg-jкᶊrnfScLWF0•uliUrdR0B62SXZJ-3'W}bb,48E"Ԛ4 "LU#|OS iT"J%:bBKaT$ Pq^มI=TR0P;D1px, *~Ko?|ky_Qi+pmmk™+s'zuQo,Y~N>ф=YF%]kh{9D^OLfJm[Y0RӁSas1]vlUٱW` _N¼[b͊6*y_.\r͊6*ثmKYe?[kh1j^WkqGqd1cnCV;?_--f2b8qsfs@TQL胍J>J5~a>en=*ì|UYf@hª1k+\\ RA[|씎I& ھ0p(j:"5K$^̋mq@eot#-I椼_:/k$wCT#%Pq/c8]Yn/{UХ {=qɁ|޸ w. P8l)o/ CU]1ٱKu `WS+ pNAGGJLH(?7dk"vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q [X&=qW"Pĸ߭2q\BZOQAl>;cl q|mNđl|_<ݼpC-VLR jcZM36ǥqW.*[^NSRw.ClæMzcĜ(T&V!ZPD*u[zQ7ʤ\y؏%_88nJ& bP0%Z3\lEE23*\qU2 Ni6߮8E-k\pZ] zņԞx8,iV|p -c]p *S(cH<Xв]P&(CIq^ส{-S$BUrFP.nP(!ͻ$jƮ ݉N-IlM) $L]!`/8wɂ[;SۿcʼnL@i%u! } 1J&,Zu#%Qte.g6#p'= (A-PB >BaJV3@¼o?VdGei;wI4 b4rytNb1Cb.ʦ(usaKV]p!f &^4ɮ&G[͊6*ثb͊6*ثb͊6*B3GBB2߫;BeU\Ԯ nE88#*ڸޝVYaF"@) '1Ʉ;gCVVlLڡ^鉼N V“Ah\#I4dPJ.VϽOje91_6Q.끧ng4 d]L ,bX\Wdm/.,E]\ UٱWd?͟`P~}'C3ٱWf]vN,&+ɵ6*ثb'/xZ.ſ7lUٱWf]W4_uoՕeJ7_`2FlUٱWf]o 2F2orZѹCb͊)S8(f6*ثb͊'>_5g4aثb͊#^q}fGlUٱWf]v§N¼ٱWf]vDQ3%7Ys͊6v(q彯S߫+6a.Jggɝ3/Ui s :.+0m\؞, گn~% @Pj+WSmUA޸TrC7vol%w GXO4} Vx~"} dcS19헅f&1)e‹'ߓJ|QuO邤UuHdxn(Jʤu+ǚ9.K\?n-sIPRO3*|7TC0qQ!\{hP`FPLr+brK6)t+&CRdrɮ+nL*Wl ↈf-ثWeb͊U0TQe#Y"sb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qTkkR| X5 EUVҝ2}ZITT Qbp=F9wZǸ˯p+T>Yjw1VM2*(w ܜP:mMl n7u=qVA' l7͊N7|PJb 뒈ӊ &<}qpm0*a$n1d`)D8J,G#KjMq&U&Ljҩ=8G8(@:lF'8@V,d0\rnmuj⮦jbW+7ZbF)[LvV㫑CC95yK>bXyWf]vlUٱWf]vlUٱWf][hCHRO[gf61qwǑƘ$jsBƥ~NY;K*Anp ߮9إj)N[- 8BQL|jGw?-Gnت=:uuޕƴ*FO)*Χ(!p W?IZ `@0+o?NR[HnE}ክLpB5a){8},yEp*mLcR&#,jr%(1(23i V4þ8&4]*dY/LjIn#ƕDpL(Q{TbwLjB@u8٦ DIq4N"F@Y{'̈U9N{`Qr[Qӹ$iϹ0ɑY~X #w EŲyQiZJv;(b)Q"ĖOnLybT>=[^MY/% Ooc\#'$5Q%kL*qEOiTCcZDLr7l"N#4X WQ0VQSEڃlU¨!2\=nTT l(vĿ,l2 vlUٱWf].}?S ]vlUٱWd;gsqUOhvlUٱWf]5j.?%̝7? %H>[J;6*ثbn c]vlUٱWf].1g4cثb͊#rB #9Wf]vlUV~y(,kvlUٱWf]T4bel7[1qΉ5ث Q0+G |i}/Ր&t?vϾMs /ͅ[]+똍Z M/np0m4@K~|H7VOWf%װP}%yr[$QH~aGV+ e~:yfH{xȯ/kݰ]Ŕy+Q3 ZJRaCO [㡻x۸8R{HmcW+3zYG[qhW .;kKjqOfnUV V2R;i"]Ry=E„+mU/D֧6Y\iA.佗L0̶B2LUq8O,[6\NX˥p(us74vjbZjSly0TeoEثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qN5iSLGqLP{tqU*i`Bv•5\&Wrn1mUzڧ +D9‱mt Ah O,@K*ꚏ%WG?4"%-ybHPG$1'vWOF(,G czlE݀ؑϿ&-̲Ao'BA2J Û]8)x*)9Is۝jI=0PeTk5NVk^;a%O/qh^Xr6ro09-~MWSR=k \iy]\o[IYߧryH<^Fo9^_ɮ}@ד,תIvlUٱWaG?k-}(3'KMlUٱWf]7(^Af/6*ثCLyyc ثb͊ Nj60+pvlUٱW`=P~N,K-`ثb͊y .-kv8 zbUقTß-@gcisM-$"|FX[ķ[aB3Qh'& [ f|AI*~.xQ<2m[SoO߃|>"+NB0IPA+YILH(&/JDn0VWV# Uy jN ed2fo_ciHpv3bE\cG[p|}K *CPrl1;ZdQQPrg-քS\9f7F =i(2q4]-x,[e╹DSn͊L reS .F*᜞Xhd|,Uثb͊6*ثb͊6*ثbt-4!HR4O[gg ٱpw8R <| ?\`)VfnU\PLMTW0vrMkPy1ULpȦW- :wFo05®ј6*','} T Zt Vq4́[C1PzuZWtɇbj+ܓQ|"5C:T~p،f 8U| F@)#TlMLi)(eq\b˦IT]!⋅T >=F*Lrv[id.䀵vTD"J;lw9\Ji_3@sD8xړ퐫@er3S][]HDQ@P` &orB(%P(;&źeOvt_&tgƟiuFY ~9BP1:GSUl`i/ +RO@7]-U78i7R#uY6]K U3;[xt͎Y,dei =Ȁ9`sWvlUٰ+*B2 vlUٱWd˟ O9e.,Wf]vc!k{?㛍/C2ٱWf*8TU%N+\H七Phׇ/d|A޼%ݏW<ǽx ZNPT9d&(nٌݒҶ×soֿܼAZ~>:KZW×rS <-dʴ߾W d uɯ/}{R ߦ=N/՗><iރf5eOZ. |ɫZI\"ʥl+x06_.;13 (?uo ca]C G5vZJAm^<;a?_`G?_cü&}K |xww#ak/1 }"ApZKf\r.((`£qhOe_r8yg'1;7L?rfП^ 'oRqZS3tܶ7դS%6VN<%m'xJ۪3}ZO8xJ-KPփPEupkQ|?ݏ<cǽx 5ŏzW]s^kkL*w"14klU]S?/r\.l+Z\jz86)lTԦ42ϓs}>G%}KmV[s8^&q&IJL 8F? &ͷw' t3%Qx @qߚ#Ԛ =rZF2F'ĝd&~#LX=fѾ_ C`!7M:XTa)TuۮRq4})7=7}!#A.%@x8 Ҽ=qøe4\$y~)Դ#;К|bhbw6r[QFߟ`S%OәC &.^ va}rME3`iFƑCVTba –LUYثPqWf[9a)2"H?7dk"vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qnck ;QG-Lln:YH۶ՇR7^xV{fCV `V| ӮS* qEpE;Bdz pȭ-'+>9:P _O@6 q ;j+Pį8S|Ԯǎ|Z/ReSМ,,V1Z@6v3Urkb>)GCĈZ51p%YeWUޮX\UkHqaBaB!lP UPy1qU6k:L>{$b(D\ъTе6u_I[n0v T; 8g4&{[~p#ȿ: {ak2%?l?Ò pZ-UI[n?tE);3+/73Svc.~P)&߼HƸr rr@qkBdj Mh(0*&8uȯ&- lfh' YmzljYEk+ƽO%Nd1rqŹbf:e?_PPڏ ~f &lUٱWf]if[Q_A̗Rf]vlUɾ|)… 5ٰ+WeWvc{`CG`nv]1Wf.CӰ\إv60pһ7!1vnCcJ a?Gʼnve6*ثKsI27d]CvjUt8olvA,G}|nV>]1WfurO6dCs.&zQOȮ\\ثb͊)~X8a*A!]\vFڻ66a]z@&|YnMO.U;75*8\_|\ _F ׻/;+v9qK>?H1(ib|`*SvyZ2+7z WlϦ#b+~S+n0wEA?!L)mļ!f8ʝ#j`*hFHuY~mt-QZ|$1I(?;d#Pr/`,>_]Bd7uLUx'lr24=0C@-PѺdcu9,úȝ!~oنIo9n"E9ї4,)&q[4G RVtmN$2 /K@#Ӧ(\`|1WSKiXL)j\UZqJ(usb .Ms^P֚',Ko6*ثb͊6*ثb͊6*ثѵĆ) 7I~c&͈NTY./b6(iz호VUzeiWrLĚ ڨqJ8L=2 kX|ra\-E60ijZ*5>Y7|0.SlqOo,)^@#*Zb%< A6cr-/ϱ.v| 9JT*$2TRi*su U8U$U1T$;BI%{ZENd]8@'*_crґԍ/_v,Dr *eGݴDIzw/Hyvr[\8dN!ȁ?9/VP#DٳH.4Ꜿ#UQ!mZnpϑ9qWfvl ,~l'#YlUٱWf*y^O7d5CYWfvjbES0\\o6*ثbʓ쟖*vG7 s-QũZLUٱWf]#?;( /'mȞe0U͊6*ثe/pk6*ثb__㘺ۏ5Cyt®͊6* md1' Gu,_ݻ/ә qoE\Ć ̯q4y͗wmeG u2A廘弋`۞6@@$ݷ'6p+ SLUkI-<(}Nj}.taP沙[/ Ihv̀JrQO$v A/"{zHp–? Ϗ!qe_[YɦN8%Ukwʼn{>~0 ;hGWP•4U1dx@<*R* Lv87Kf^zeY1ZQҢ_fXR=lFwcMk>p^9外R0ͼd$,4S61,g8IUN^)k|nT(n–7[#kQ] 3W 6*m1VAGGI1(9Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qPvl (w+rqUțcXvv덪OCҘ_6\\wRrX9SlC|O|ccw0LwUH9F -9`JҼ SL6Q'#EI5ƨ]Wa6]-SlUQ&D1&(؎ؙqJlثab b (BK.=WCI.U6NsS$0F?ȆcZ_ ɛ_dܼJ.{WA)oukIɇE[oa -4 {o?l,9{dG (* 2h/s9}h1B?h?}?cݞǵX \0|r#i{jrN}8-4[d[W,\H?t#oy!\yj#[ֺ$lk NvmT5ᖌaĞG4I1g .Ю庼ivIw9t3ȴ@)vlUٱCSvwD9~6}&t{+6*ث]Y~(3'd?2Rm.~*c]DX`өYSQOl5$~T_Nc9=&pd^@%&XT )̍1jҟ~?''eGa=݊,iп{XOsmٴJk[F1BqU; dp(JYxr@j䩧ƟyVƝVx.ƝF(%]7cQ{݇~[z)J8hߦmޚ:7]S_b!nNylB?_expo7/1ބ_ȿpƗwf_ȿpƗwfʿpƐb;^x0̋=7qf=7+{ݛoQ{݆wVT@!kJ}fOo%xGs5voI85voIDŽ#w;voIƂ1> J0 +㐘jl(Y1o5O*>'LjT"-2($ӐH3=ө2w#$tW!}i?LmxCi?L6!޴yHi0Zz;}9o35RU8:Al餴 Iuj_o7EԿyx{}f_oEپ'q^";әBZwxX kk61#&\IȘ7k)Wq uZ0AJ]J&PآHZv8G\C yeǟt]l6 u9kI9RAdbWlo>S; ru:Huv+>\L2REd^n~tO踁;ޗՆ:dAgo]7aA!VGV$aS 8SAJaVZUL!QMqB1`VMׯF)U_kl PqF6F*+؊L?vK4b;429 l\ E׬pEdMYcYGh_\ ;dS*wJbpƑ 8–usb8c5qWf늻(LU?޿ D#b]vlUٱWf]vlUٱWf]v?k !!F?o՝,lbf]lm 49'*Jǡ=r|UpZ qƴTo銵E#~(Tj6*JbLR]LZ V W^ ۦ: j}-mŏ19hEN:by b)Ԯe>s:.':D5sK5"LFGVFCV.kdO@hn#Oּq)iB^bgsdO*$6_U5/2wt׾l/cSJ$9-LU&viXt;#/"I#_4+RpZDT@U鏊D7?h4ucyf0U͊+vlU)Ef8evlUٱW`+70<~' 2b͊6*,ey' fkCyWf]v ިy^NEy%rͅ]vlURyQVJrvD3b㷛vlUٱWe??,Uzcr.ퟞ Ȫثb͊8Gw>Q7_4O>}'lsb͊6*=Y!i Z͊6*ثfW?\05CyWf]vS0\2!ث]i^A,͢2wg]Z sZ` q 2@udN $C&0lW+b$AZ[9%YI7fItɂm {`R8UR!`oj ǚIB#qFjoca΁B^IX.ٟCK?2o?G"_31-i82 4=O!¥ Ӿ,Q W$l 1J='dXЫv VMb$O+kR0znr8rRmJI ڻa}r(cqVʨ[\Uxu2L*a].͊ }{##%&U&%[ dP͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q161ZU^V V7wv*Ƈ +\iUjby|EkZ,s;bV=VXSq$ |qE8mRa)w^֘U#X868c5\EvII4d +_TبcUScQqa*2`hq

nnN,1U1=(p;*cZ]NjVm f)}anjLMԯ';eŔ̹+hBTkT$N(vy\~dhLX]\aCLU*3ɿQr((mG?^KfYW@/"i>-YYT#*c?~ o5ݫ7a ?WM% ~8_5‘㖌颮LccƳusW}6LEQDCgF7##V?~S]b2ʻ*ڻ50+V?]^?99Տ\::m6*ثb ˇ'Oyb?rꌏu|ثb͊$>U'ъZ8}vlUٱWf(r4Xp͗;ٱWf]vlUJ3'eWf]vV*3~י}!ؾMٱWf]v?<''S ;/vlUٱWcO1.'![͊6*ثf\(Vecu_RsoȞXb͊6*>ڗ俯q)[vlUٰ%c.Fƽ~i,`/dn[>HUƟ=@{}Nc6&+yj3bOw?ev_ⵎmrm|1:[$/O?  yN_l:'R*E<=0yg=}F}.Wf_l,R(oQFALP=!ˮApAƲaUx9ăQI[QUqf,wmvcUB%%[FK yl{ {Ey~h[9_mqY Xߦhثc(e:⮦P5.ˮYo)Z*jW ]\rk_c }ıVb͊6*ثb͊6*ثb͊& UJxdUVvnTe_v QqKFN`M*Vi媒kYelm\_b80kSJߦ"~ ʩ4e@*GPFǃ]EVXZslhed"Z"=v R1YʀoWr+R7ajt,1V W0AEHt|  G(!rBٯlJ\IJ6 F&ـ(\^X k LU-1@,t%^ v}0Rk^ZV*n8An4EX!\GS\EP &#ƴ.!%̒lNR1*蟕C?Vk5 'YJ6*ثb ?O:fc\ثb͊%>_yG$bf]vlU;JM8a`7vlUٱWa_q˰a>N9lUٱWf]4?(vK3^5 6*ث>~92o6*ثbn劻;kec_՜O٥}S͊6*ثizAs}h4}cȖeU͊6*ثecpA)k6*ثb__3S[qpL9-]vlUQyP1' fo6*ثv 1?^W>E{%Zí_{JE=ZǺfBxpQBY>%ٿ^II)lme.U!Z9@^9ӵwv)7WCGR0JbDeaU ]zmC;?ra`w!gx2E?cK6iWtqSZq jGS^bJ O"c_81Vr,TM~yT Ca>Vփ|*׹Q׶)^*Lcp .Q[7W*?%>G)kb[w T U\I%*Mm\UE(^*TCTa.HHFN1X_.~2ݬ*F9?akrZvHb~ݰF\Fye9 i0ى5'| vStVu3b͊t~cs>anae͊6*ow}-7U=rrX2Cb͊1[5\?P̸rt?'2n:lUٱWf]/+}>cpk6*ثb2Qi.w+b͊6*vftŃ]vlUXgc?3aib7!ٱWf]v?FU]6*ث'vuGrtƓ쏐]vlU32u:9u9T^lUٱWf]UR\rEV]vlU95 (.wKQ4q̊ીT aU:d$nm9=RO'J.NZ|1$-ap%rM:,wc&5Ya5 ib1|؝sJmnEBEvaGuQ[7oG 俛?Oƕ(4evp_@t.5;aWPi N֧q]3e+NQ59$ 3b*n`VQ80 SusSk,{f T[fWo50\?޿ T#b]vlUٱWf]vlUٱWf]v?m !!J-2n2l\5z'+)]:m5ln=qUfJe* e1Uxbjz]LY؟Տ WJoV2mb4*M*TSǀiJaI­M(T*3|^;bv9^ăT;>!JPpSb*|i[%FmDn%1yEgQOQSrPd`J$59F(S\UW U)t(l?ȧM/lge} ;*WO;IHm'ƽ2)p+KIux7`ftҔ|6liVKh( M"#GnSw樖y.X1wD%;[oՖ˅]-uwK9'_]/L&C o,L*mRcU*5#g0!/z'96lUٱWf[ԏ"3{>m掵}?!٘W6*ثWdA?$bf]vlU?IFaync ]vlUU/?]\29-]vlU3Izy9Qfk6vlUٱW`{OOCc.N~l\vb͊6*銻;-V4>/ퟞO6*ثbՏ }O>K2*]vlU{厲8C avlUٱW`/c1u?Oᆙr[͊6*ث>~92ظ]v9N*ffCPyrHqɰhrVupXlRXC;jBjPA9;fTwRb/0rvVJWӒE2q+QNCy#{@mJrg֨?*Oe.u)_ۨ>xS8Y"5A;zL0=) W)1PMr*ʦ*Yc"S C [8 !L) O/Iz'VA=!z2_rw-܁Դ.=:T=);Gz}IrkPTt8D|]]^?*sx䏑8>=E> K]sz+2eJ\ƙ+#q.nlRp|VdaAv nw318.ACllVˊ;ukTcE? a-D-y%5' dKA$nN"f+.ŬOqoabs%ڻ+ 6*ث='?^W>N>vv^*ثbz8#x?c<PY?m9\1+vlUٱWf8c8Ϟ ueÓChW͊6*ثGaIUثb͊6J<܍?3evlUٱWf]bcvl ثb;ә;]?_,r]vlUٱW`}CeY98[xb͊o?^)7g]~g)wLi> n*lUٱWf]7:1G+'S/_~8PeRu;[ZJ8UvcfZ훶*3zה0MS쏖%vlUٱWf]vlUٱWf]vlU?@f$1HQ ?o՝*rl`neK+j|i׮(h9c4~`jzaVۓ@)̫ǦLܺ훅whl=68xwyWla#Pď=4c]l~S,\Ro]…:|51o&d5?N*"M=^)Z;,VxƑoL^+Zv ҸP*bZʕ*w> W&h1TLm*T<ȸq.'{r, !ogq{'hi{gTfZ1Osk`K-Ҽh:r?񴟳+f Dh晒ěef5Yݸ&" 3bMJ.[HV XBM~'4Wq)Ap&F-z#9 z]b ZBq?'|H Xw&#ƾ YԚu%@یuF pjsۛ2z ~J[̷S;bVekx]; >?%CmFi(|o_۟P"$Z#7l(n,< vˆܙPla?-퀖Hz chOALUב `vlUxWif8?;6*إau0]00[ݛvjbˡ¯1qG20k' PcKyqWf]v T<'"<ݒ'5CY *O*O*BO&߲VJrvCxظC5* 1Wgq1ӭK9Y%ӑoev&?v67uFoIݍ3j5?I揵}9̶ Wf]vy\ecpA'$ɬO*O*O*߲XMOm 8 9 |1Wf|1Wf]/P!q͊6*챊`)*fZF<U``K&efFms&~lmǥ9Ǖ*U%$lI|,h-> 6{nI-#{w5# ,H"Nr/,s@;ANޫ~/] '=c Hq [|J1/q*miWj Si \|6eF%VUƟ*8bi\)lVC}3oL*5~Uن1KYa)21(;7dg"vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qh£-la(hF]qK0혮*jZfq9\qzb\ #A3Vp+;LPd%0b2 \`qWQjhqJh8m l]F5jW${He; U]};╈8<26 O lQj(*2zc$Al1Z>7rDoU0Cd\hxBGuf~ .SN jKuDx%Y2yHitl!,ɑo"WbW „f[1VָR+j´ćUCsU̢e)qUĊUNX+XWl­+evcNثC56]\Ԡ6W( (oqU0]^U.&G[͊6*ثb͊6*ثb͊6*F3G(q'ReX2Mb c~Mۦa^1U$n3ShTo m%c;\(vժ7r=|iZb: uhp*еpe8u:O\SIZ2MU+A5늩>9[7AA\PIju9eGlXZcB텒"OhV[4W?FQ\1H^p`h#&9mc뚘3˶=WCK.GKm Q%(އNJ()|s%GV;rYS5TIYfo5<3g r |gg`}×op7Oc;S!Hh&H#Vߊ8/.ᗈdK`Sh1r1~+Mi}+nLp V9 0ǦE8zas0of']1]:zSN4"5: >d0k6*ثjAq_m3{DOȝ318D?v*x#⮮(]taӫVZV,WmW-n>ʱ0m_# ELE)(׉[G-Vt?).m. :v6UǹcNpzy;˱c8xB۲y7pEҹTD2.ŽmrjvngUٹXH޲nzHdÿQU67~h+zƂ7~h+1# ?ٹ73qWf|N*ޣxi]KDIG`(?h$7N-ߏpp7~?DŽ+}noxB7~?DŽ+]<w9|FJӶ+$W7>Uuszi]\%'\>鷆Ķ0o?~-7~Uu3z]L=Bl]1 ߍvoQһ,Lߍcnnq K?~]M6p&;MVQև ;M\~ .7`;euj:퐔ven3V8U R5GZ8MXs)6s6&E.y wڣ2CwP)B+2D7y&?F(P\:J\[9me2)3I2ȆT5V' K(!m n"}6@fZ~Uj6OSs@Q^ccLPMsH9LP](qGF)u)*'m|U2-pƕL)]\+;hd qWW,1 5ƚCc,7 \_?*Fr,QYWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q Xsw'~|G\Uo3+] Uhjl{wZb~j,p|7LcP~Umc( h ^MM;cIhs *ؖWmV эQ⭆d̢JJ+;Bj8Z}1wU\.%\oRq)sp g\%[By?N 8iT>X\UkɊ*Y½{6z,ep~jjjA~jPJ۔So99DMRXceWfDE82d}7Jz$biD^G-[[rƿhҜ ۀz}`jG:| x6+])ݕ#pbv=0HW. 0).Zt"R< 8:L"&KZ5d-c"7ܨ׮Y\q3_J/`H[ٔ!ځWlKF J\H{`c]ӏ-N>vv^*RUaP0_PR9ӎrnLȽXH1"څc7GlA!#&`jx_ՆU,mӓU'!z鳞o9ֻ>}5r^fLv!)X۪>S~Ԁ}$֩\U|!*Xbثcǖ^G]_tvZlr5;]bCwsnP97?F*8u,16g|GݑK;7ץv>)_Iپ/JbN|GݏWvoM>|R>ڤݏ n)7f)7 nRocݛ#DŽ- Bfr:xvr!Q/xvoK>|R}z_cĝ$ z<\L2faOIGݏqٿJM>xB۳~}f)7 nEEA00+f]vlUgt$aAb͊6*t?%2vN͊6*ثERySsb͊6*daGAvG֗f]vlUٱWa)QnKb͊6*1}9ty1-_$Ŭثb͊/_-]vlU;IXI]f]vlU؝O]kKb͊6*^VER mji@IM;VS,%jn?M[*Jb0s#݌:6s1TYgFF? 丶U#`v/LUP2UeaN?Lj%%dS$]lOň1~*&?S- ! geuI/qH\vb(V1S?,KJ (zT*1}[]ljJNWe-+zeZJUզ5VQ5«v+k [r—69|1VbS)iqƱrpm [k[)21(?7dk"VlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qAK ysV^g*(C pdSaw4TQvǾ*9eE2(XԿ4{sœaЎ$ #~cc_o9yBw6?Nw}*~U?NIͥl,E~uȒ՘DNXy`ԼɆRdՏMJ/ClE48Tv L[U ;bIL[ēW'K#f+$jv97dW$X*+*n71%az=M}-Evy8r%e=h.8i8iZ'6]q4'o {A2w[7&.sF2|pUU"~?/}Nvn͊(:퍠712!HˌtS?lR@+?0܉`-Go2ō0-icSߩ-NlUٱWf]V8I͊6*إ޹>2, qCb͊6*3:?rgaAٱWf]vտ; rƧf]vlU")üٱWf]v2o# 2֗eb͊6*ثeErv+.͊6*ث9ty1-_$Ŭثb͊/_-]vlU;IXI]f]vlU؝O]kKb͊6*e?dNTZ'(Ў&NH}`}) ًnJHm ZU b#ٰiUa%y~J*@G|ȈpT)0oZ֛.toZ ?吘y}*SXoųOHY+#ȒHjY$?IS ~m3G(0Q޵ˤ)N|p(}+0zĝ*0Z^UxU6aVmÍ*qrO+NƕWW,pGleKX*1U76D)o)b|U.㊷1d ◱#&%#9"b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q훶X•O\M zaUAB1rU*UĒ<;~A M:=\U nqԮ*Q *(; 5;uWFavqKӦ9pY7ڠ3m96M~ hæITT>ـ޽٭NmuȱuM7tH[^ 98ce,aGÀ2=cTaRh!$JB"%vH"cΞtU{[.܆ŏr@w8rq{?*&;VnSCyOzxDwGifS/SOpo$WҭE8*(?$ xWni'INr/؉U )Zt=LlJty&i'3g%2F̬=둃H}j͕di"7Jn.-R.yD%\eyYԚ 2$ b 7\e2Fi^p-p۸5W\"&}VtXp\VTC_a15~ 1S1ZuaT6nV9Qm^H..Lf'p|UilU›++}nEprcKbE_@Jڌ+Ua,mؾdx C(fRثb͊ -_^+͊6*ث5OqCkyWf]v _dJC)lv^*ثb͊>C[b͊6*9dr3N͊6*UU8.lb͊6*r}]3(lv^6*ثb_IXXvlUٱWa3 ]vlUؽ=vHRY0U7Tߏ!DW-VQU̐mbB›.`%5YFNn7Թzbk4ᦏxm$p st܊]Fb=OOM 'Ut5Fs[9Le*Ev4FYZc՘uNg&w lPj}d (܅#BB7Mu.Y&,&m˵5ȫ81GlmwaNGn5)Ӡ†ZF8#X5G18u\1~d卺bUv=2| \}㎠;`VPOӦj [Ɲ1U=qVWW(UaSr;_c }ıVb͊6*ثb͊6*ثb͊?жĆJTL;{╌v-`Vwc«;ѻ`U-7X@=qhh1U^Y&AG\p)"r«y4 [ڸo㊮cu68mwU=A,JaV0ƕ;u|ZW W `B1JDAh)z E~/s9ڻ+@3A5+U,*eT8yXb^I=ڧd3+dnWRT;}N+UAfDmKn{JG31/l+Zu^RmUU([o`7Kd;W$X0Zdf`+7x3<օr2@}&\M:D3XЃNv~-_IB}IBk1/y?N$CzFyr 7)jo_ E򍽋,,xi*j^`eh?\YUk\m~ud| C2`Ă"l,/Lut9 ~ʨ呻*/?pE9'u{/5 58 oNS!y>?(0hDUW⿲_\ nNy6'v+6Y=@,<[XպqvXr9tykUX#,󑂨r($ +WD?vz&Q(rTywJV1{b\3N1,G^M4NX@|*kWpZHA|j7&f]-LU؛?s¼LV&AF';$YDž݁&SJ݁‡f]:8 aTٱWf]vFN,d%X;6*ثbߧHv ݗ]vlUGvv,0+O\W vlUٱWdkߧ qVb͊6*~O!w;/vlUٱWebdrO~yn*ثb͊tOeRfr vlUX2qb]kf]vlUC犻$gP vlUٱWf]%k6*ثb/5}gmr;͊6*ثN+:|)]]aKErN1*g \ZYį}# ͧ$ʹ2թkqc_87" :]щ&zn+H%[9oC| |0^T"8s;S5Dra1uѺMҞ.Q?YnI\N35?i@GMv m7 wr:MG/*cB1Uq\/rqK-w v9bv_vU1VV*qbe֣lUh#)uq [b:ڹ}1Vb>x`nʘ' G[͊6*ثb͊6*ثb͊6*F3GBB߫;V)61:qsO Uo,~q"T*_FXk|ʴm,40$ \SsQ<2'Un0ڷ&=)SCwݷ"+c`^Bic\@PԀ)A'b{J#WJKb*4|U=Y1j:/Of1o6\=i$},4Gi(;{adt0cZP)%ZfcL~+OaZ}/ eyfX6fMnØ#T8K0-VQw g♍} e|04?!TP[#SyXIJ/ƔeR2l{%_ªHL*O!܎YUNM/>Qi\G}Zp$`*@3o|rWo1;B;)G s|Z' y—`9u4]XxX;Z!j{ p1u1Nŏ @:d'.ƓF>S˚]6*ثWa" rv?]vlUٱWaKG$;6*ثbdK[z2, qCb͊6*3:?rgaAٱWf]vտdNœٱWf]v/e|aTثb͊/o #sKb͊6*ثeErv+.͊6*ث9ty1-_$Ŭثb͊/_-]vlU;IXI]f]vlUؕ/]9kKb͊6*o2)ݒ[U8ڻ.$)0cpPm&ƷN<Hd:(+jيFkl CG9̩68s?X_RkfkH;I&)npI|)7*:BK6 Ӧ;q>OPp)+~&@SJ %Da9x8h6Wv+E5SfZ'Փ(V2ƽ!kޑ5@Aug]/L{[;oa7'ں\jp*1yty;]8 $6O ,tj,~9s=GCSb͊6*8??23N͊6*UU8.lb͊6*r}]3(lv^6*ثb_IXXvlUٱWa3 ]vlU/K{$a-\6c)vb(*;.^aS[STL(F%\RltƐGp9W6ALUGLU/~8R5׾*=*\OlPm)a*nʘ'1ıVb͊6*ثb͊6*ثb͊ѵĆ{߫;gMSjoJb]qVeߖ(li]KY|Uþ9[Su(uj rEі %Ӧ>RAѶڅ~-jSu(un֘ŧߚ\)objGLv' \')qCjP1~yԘn>D}=K\D&%. (,*rA U(1ϵME+tx ʈV]iqS_-V'wn@fv>Ld6 Als5/exhSuya,VIǶD!;fԧ0R-h n枥=]G$/.C5k5Ē^Lh}qdž %ĴP<L34̪w5^G/f ֗vQB2s[Fb1V<*֟},br^r1 qó:KT-8`vy _6i8vX/W|GvYNI]';NjBb]YkSb͊6*U")nvlRثb͊ __L ӊWf]vlU޹>00+;i ș̭;FmE?YQ̲.Tn\: vU֙6ex2K+j*~ W7QcAmx}[us}^?v4\^OlcX#w,ٳK(̀H $ezAï, /iOǟ|kNwE1/ӽw?~o, |y]O߄eHѢ߲=/("-c]f}GD>4!ٿwE>/vo,OK;i6I-I BACN.iIJ22ܿ~mݛr;}[voAmپ/ߍb#v%XЂp]O㐲τ;m*#Б.Ho`~c8]0#ʂsm+85nLU0m !W3S|k^PQGlmzR]I5 N]0j.E.'6*iSaBFaZS@p!)+;K٨usQQaK}s )vjU/l` ^GJLAL47dcyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qL9WbA*AR1*T9@*$t c^]1^P|Qt8NE=r\Uƞ6 EqHPT1?'6-M;x\UZu LPT 2:dBUi)iQs˾FE%Z8|SbŬ!44b%[Q_MiIJ+TS L!fm'$E)V:*"7#偘Q:W݈jZidmAod/o!l^)s)#5Ȉzp@X6JSG7-⯫;Cs<9~lsFԛ\ne}1cV01@@ ?WILpH s nX<0]W x{/^˞eX`wic_rpQ8|+nß-#U9NO\ژ(UQ~| mT% x8/B ZVx$w9I0WSNFc6*L*i8)!^UٱWf]vDɘv;6*ثbZ?N,K-`ثb͊ߧHve ݗ]vlUXeZzPxp'f\uX8 ^B̃7rtO׉ w|ٌ"ֵCzO')idCP0yR_,6T nZ<+nZ<+nZ<+nZ< t\hwE;7|WLj-;7|WLj-;7|WLj-;7|Wljx]^*~='#!a3|ُi;7 -/'f/?c/ߣ'|%5-6VQڲ`EaW虼Wӳ~~xӳ~~xӳ~~xӲJj|qZv k?dx[\/?cY/?cY/?cY/?cXwyziݿ #NDtB ] ^xG S)ݛ)yX*{R7R?T>vocwH}#G. NB`dovduxJVhu lcMO'`qHt.&O|)/HrvS7c)v(E )aEӃ;z}fDXz,߁AvH[o1vZoⴌ}#?X˓no:nxȍ׮SR)&cOrq,^o?jKЬ;?ԑB*iQ\NԧNSU3CmI5ALè_ *ݼFS([V._dV(v11USM6WRv0jz}9R%E{Jv8&/Vx׹a琙PzpH»Jj7{#yY @}Mؓ;e{?f'߸$Fx.! v%)f2sc (a xNgw y$ЂfLcBlsWb6` Nµv 1aٴU@}H=xcsV57S*:͸f BrR]@]َl[:3O[}0=QG=&V4*Iȵ6t$M)rhrTj:$`'Uo@gQ?aƉEkIRdRmB0 c]G=*za!;;s%a~9=P/İ 'TUu 0oXHeQnt%A5E1[x$jGPd4>8yv鑏MI/1DdXcÿ-"vj}pJ+L5-XtƐ#_ks\ON** 죑CqG<;NE. v0qWbF99(AvGf]vlUٱWa֖)'*0dثb͊Y2vvXRz ݂NVszxx,?OpW[ Ws~~xVr<(r ?3ۉƋR&1)%w$W1#n@{˙D81T2r#7$)SU]vF'//YI0,J76*ثb1 Cp&M7vlUٱWe_a~C(-Kb͊(aX\9;M7v 9kثb͊w''S]ꝗ]vlU]%jp\n^(vlUٱWeU.?r=0}#)p1yWf]v_3(?S#}GLaWf]v,𪬅HE0Uv‹}\c /`r;WcE&nn[ē!vU 2vJ)9۪J]Bkađ~a5MYoQrR=I~?a$,Hɳ(|>%7E^5C˱a1DW~s]rGj#_^Rad](²t>RwO( MN߫ SX F*ZlL**z⴨2v4Pmb)oZ X.m %Au2r$cȱqwlbz c]|UuE ;? >bXyWf]vlUٱWf]vlUٱWf]_g$0$QVv&āڙDbY#j*NelT+LTnQ W|8-jcH-|izS\Ƅ*<lcITـ9`CiXM W]r*S߶QԜm[ẏp~]L,}U&/\iO3E$F6%0Zr'c{5;(nqÄS2=:-V>$8KGLS66{}GSMXA{z&%~zؤ+z䒔[4}bhC4\Fz~&PGQ\"GgoU5Tq o56"Ǽ2f軩%; 7Z\pJ r4NP :qL۔9T\+PSdy-Z jY 9@sk2TUFfȋL` [e̢|Uz|2cdÊ8XUVj" ; mnJF*OтNO0qbi.H,@qO B4I-Kڿ3 n("AG݅Xtmg :4oğ9G[B_~g r͊6*ث+r}b}cb\ثb͊!=mOC7d+6n͊6*ث~FFL4]vlUٱW`3qK(%ـ5vlUٱWc&Gb9vBW͙q]vlUٱWaKɂӊaCb͊6*~IT_?K4slPw_o00(]vlUK^|5eվ"ثb͊#Ϗ3/E?EYjvlUٱWf]Z| !{7;6*ث*4Jꜧ7ݒq idW\_ln«c2!ùr/Df3aMd闱vH4 pi82ٲ*s)Co;ti`nQK(e#NkFIfWW`))'9UoSɫo2T~ZҠڷMpu~`;%幛jDxdvkP2A`O~%MuĩU^C*8`1Ucd4<*W% 3R|U W gq\ ( +Mp)r Yʧ\Uԃ+\ReUuى텓/??Rd$~F2,QyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qL;Sr(Xi2Ȧ*^ۉ•U"r0qp[̩sIGL0mBqӦ)Y oPrh)V= q5Up ,)iLFX <,t{8FR}9EEj fzt\ڕD\;_?Lo/=)' nr1h^)P\ń|~Cb8SArKga )2%͌91-GT!2z뛸D%< kisΰMXXqzJVJLC&ܟ>x-Z@,(ö <{$v27#0ʽ6[N 4aaTjZbkɏ팣כv]2WʸJv*/D8N@`0Z6*V~xb8k0[vlUٱWf84zdExW$HIo 6!b͊6*O?__ [a^XnlUٱWf]bx%cn>?ɺFb͊6*U"/e vlUٱWeP1?ˇ'i~.'-rvlUٱW`{dj~1SKb͊+C˘-͊6*죊%Uy.S~::Qf;z6*ثb?3c(?S#}GLaWf]vy),~8zȊCXݑ) ۰V#iE}Tb݆^&3ZmNf@PYI.6HDlzqr# JZ*YIORGJ}$้!^ib>}7w>3 1?&u\6cYO6cߨbڂ$%^ZZ@ w }FؽL a ^FRDx퉞UmH\+#W6ء0qV@|qCk`SoCu]\o b-lqWfnث48ׅ[l 1CGpl ?*`,Ko6*ثb͊6*ثb͊6*ثѵĆ) 7I~6 Ncnnr޸Uxm`CTSZ6w+Xr}{aKS߾;ʽ1Ui_)ne\!a c [c\oC(+劶q|>Ug SlUT"+ I*P7W$To'_wEञ7S]rS"QhvV5߶i UW$kG5|qw2VH'rYRs(lk>*Y@8 $XvVvVv>yH`<;TMI]!_ԷW sZupTzԝT((g( K~܀|@O>Ƶn,L' .KWk˭ dSe};\ ثר 79nlvlUٱWf8ִ!M>)ЀퟙJVf]vlU_\GGv0*vlUٱWd''Oֹ5 ͣ[b͊6*x( 2f]vlU+Lz\d2}%]׹ f]vlUoOsA섯A276*ثbKoǓ‡f]vlUh5~ؠaaQ͊6*ث̽"k &˫}EyWf]vF?0f_~?L'γtثb͊? C*nvlUٱWf]z YNoyfzƑMW#lY2vn&̼r m20*һt^Vy &/i/Ð![B8\_JB%GR(q]\(#u3<HR @xwXOo6`'a@yzt@Gl5/Cя1˦©v© O48WLPM1JwW qKDul>qC`*v[;9 1"|!, c.aVʭ6R[U<1ZlfqWcþ@?0C)92 cU#(ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qMXx{c~fqHp{8R뚻S|Uw|h[߸j(j-P\ L?v*`늴G.rnUt$S4ߎw9Wk\lyS yAR{S$8ʆ"b%Kkk~R}Fzb/>O?4x7?4hڍp:,,ne[9D%ѯ\%~/l/PiEQO_F)d2Gǥd<~dăojUdf;|nfvaсl`UA:.K ?pE`9`9Ć_5>#dd-@1lm'Wf=qC1]z^]b=6s4W,{HWs$ YV,j~z-(ܻkI.߂}'0\<kbO M;M"C#ƚv*4uƼ.KzĚv[GKGLȈvqNNvl*ثb[JcONPTюZxbUh\9-1KI9T;n1U↠N1UjzS)GRbܖZmC-0AG3q<+l2 ȔVI9xh:3z<՜χef^8`J64"4#Z7or*j&c\I5 HP"@:!ZƱ U@7$w-V%SrdkiPf8.@9uV?/W#6Q2'` IFcQ,Z1SMUc Rsl>;[UQLv!!f526p- 3Wh" c_,]`0Z8ّ}-#IT=NVIp%%PzR\t0cj%4d"+3=:"wHvV)vVvy1I?e`ӑثb͊h|lءٱWf]:މ[$Yh@KIYvlUٱWdWZzc(Gv?Ͼ Wf]vB2z|k]_ZѭٱWf]voɔ][kb͊6*Q2>.vk܆b͊6*dݷb9vBW͙q]vlUٱWaKɂӊaCb͊6*~IT_?K4slPw_o00(]vlUK^|5eվ"ثb͊#Ϗ3/E?EYjvlUٱWf]z׀;f]vlUa]? /g& '`vf=(>C%n:{c7JR%C:evٰ%ٱWe8G5vv,6;6*ثb_rp\be͊6*R], krb͊1Z=2qqs|?$߷b͊6*O?__ [a^XnlUٱWf]bx%/Hb}G\2 t]vlUxE_ cثb8cv9NM]NZ;6*ثb#*?anb:ef]vWqG90[vlUGvK\7Ow;HuJu_G8vlUٱWf]~gͿV[cuo6;6*ثBGMWᐰrnUp+dv ȇIJ}Jzwvn_@~3&&]H*Qd!q1DnƠ0-]$#O|Ǘ77OVB|ɞ$TK 6eaZ?S3mae֙hq #2P{b?/ITi lUTS+M1J3n%\1dJ®9c)mOߘ~8`aCLPchRp ,V.9@-:-h䩕6i1^-;-Wp?QKXWaV=szה5q*6*ثb͊6*ثb͊6*ثѵėOgm%l~_LUᤸof.D]kǍry|6m)mPW 'zcF UkRqC;s1C«ۥwu8-mw|UOFw­TMfJWN(P0(H&J/tB-+mɠm6TT st-.ƀ(mc^1U$H>,5:–Vޝ 8|>=J_ [HGzJc֧MMoatm*g53xwvJ>шqܟ &F=0lbf^>,HnYZLHH{bY$;Iw V .` Y)aV;*1>93v0KYXy;6<~x94ϛc s!ٱWf]v:?>cWa^nlPثbp?1'g7[B_~x7)Jثbfȶ X⪹Wev2IR?~f!y+[ˉJE.s\ݑ.۪#6t\Xyj~yiǏ,E4,p iiܰE]BHrc-]N_ _(9gi%UmW}f󇹶?zVYwc4 M1N,K4cy-5_7?<V.t%7Q9x -*<~ W#ܵKg`6_'S\hfx|R7S7u3}Q)^7S5pm?%fd5lsgB`mrx` n [w,POLx۹fxckja\ R__\xӸV7~?29qֿڎ ?2.cdG!6ʔWeOh3OuC oʔ'7L?@˓\/}']6?欘|~\$YT t[gasgwJICʿ:eD$ J)iD뗢VXX# ]|^Sąn2Ik.Pu^#l c]`(m@ĝxǶZ5d( 5@eA4퀔;-\D!\)'g.9NzS wgnkr |Uٰ+yV9ALmW&nW11E+_^ ު0/vUR m-|1vn'Wf|1vS2mO-junn-~i]\[Һusp5q~k>-oQ|G߅i9E~+N/Zunk1E:%>X;RDSX˔޽"QIPp?1rn_MٿHc^ MٿHc^ MٿHc^ MM;dpuj B;JR TSaa7#[8zeH~+aצ)vl**0xSBd+dغ IvHC`vxéFE0E vHCGjbI\)cWurtzI|̴X \@nXkF8\u<*б,WF}Ybo`l0e+J!H${ %Zz J@ZӯL%Zn{V]j^nj|in$.C+Y[ æc-81P|)h\Rو.Uı-E5]\k' W VHu)ђKu+X Ɲ(]8yCRy!b]vlUٱWf]vlUٱWf]vy:6?␡}~ޙ&lBT▲U0ӡc+L *Z튇li*l\kS iߖMp*д(OLUw]j+]𫗭;e-HO As )L6vhlU} ;߾)tǧl6>?Uc"w+£SMR|'| c_W޽imҢUZЁA,/~4wͿ^؄mJS OW &m Ko I]|bU5#ZI2LƦSad[%=2(]7Z`*?m1aZi甇= JZ8r$;T8J۰iA#|b7vոӊ8R[ͅ]05nQ~o r͊6*ثB sb͊6*h1WgNu { uȉ*Esٱ?Qm$lX#wZם1 巐~pmO/P3W.)gZi/͊6*죊czaUE>dzxL5HDb~)Z$ `6 z?Y Sh;\f͡S`c<ج$ 5EB}Rܛyڿq\S@Xd5`7Z>?T0OΛziQD^*vrw(\(,IE8aUޘk_*2=p{`gVrwxVaNYMzw;aJ6'^_F/QL|Y5t\s\ޘ#p8 Br] Fإwƅ c^aMQrlߑC9'?#'&@)onlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qJ&Aߦ`v.eޫ8)R7Uq2Ӯ)Z^49Oqq'e V8:TSQ+c7ݏ,Fʔm†mo╒! F9v jpn=UZuޘZ۬1Ӡ̫R$nMS"Cl~EW^0HI߫"PUc"g X+f6.+o/]FOv4X9JMsc L}V;.@:Qϩic TMRt(? f%6Jo)&+#.í-i'*0dثb͊(v Cv; 'f]vlUQ N^NvWZRث۟ާ' uɰ[LaV~+N0D?kZw}ĚnӨGN$d0u2*k7u~ˏhxg½}" ]{P˙#\$!ٞT-#5MrPJAvjcj٩[MOY( rֵWf]vQ!Qc>#8 ]vlU?2$Jp,J36*ثb?N}ひnثb͊6If."A5*T]L$`:䘻5qWf*]:>C!&Qq: ٻ/C 6iت^L& ]L||SzoAg,BalYOX{rytqu#Ղė $(}m1 kGȿheA8c~R^bfѯpxG6ʅUPc7DOـFc~iqQNa_EBH'Zu+ˋ>y/ RWa+ν» a,0nYdy: 4?F3,A5pfks0*Q8R2Ӧ](>XU ˥6–E*.lǦ*volU0o*s",lVmmXw8- v;8ySZ{!bb͊6*ثb͊6*ثb͊ <_IqHQyQVv$͆튻V)ow8Up降0'*Pe&`6 }n$oA7+;e 5Imd.ي8Ҹ=`6s<^ت}PC~Tªa/AM*뿶:)U9-lti׮*$,Eco~T#oi(P*Q1QZ((ǗڝqÙ*ԇz PTxq޽pWhߡL1GTE$U ~npdf?z䊲;$ywl'f'|lf;c)HVh1xW>N { [M#;mpSaʋk;7RCC9l; 19KcCqV ]6;"ѭmؾso]A\Um!%E]R(W,>2Fx[uqPǍic݀7La#VLMvWS9hi.k]vlUupOͶYΥfc?fk"N_C~5fuPz^j1kO߭Gm3)0vj^Sl=a N'd6JwĘuƕY F9F*z\*E28q9阚1bW|pVaVU㊮'0Xšj;P9`}B\Nb)_.p4~Xȫ[g?*kO#1,UvlUٱWf]vlUٱWf]vlUٱWak.) <7CJdZ@$@C`+ ]KӶbScbNzᘰ,UʤQ`m97Zv vQV:eڍT=PC_ [ݛa u+JcYjGL(^Wl Zu#(ˮ8M3//#<_b;/ִ`bU8Zm-*M)]Xs UCPiSG|Pr%}v[8Hߡ鄚ף"ߌL~LbpFe r2匲;Y(PtbrшF|ũ;|Jᔈ`x4<!v0|J݀9Ks%TqC$Z־,s 76rh+*lu2.DqS,Y@ܜPf2Ūd|B2d_RiG7{ZN"#U cnaWf]7)pœثb͊6*#CIv!͊6*ثM|W&v ȲvlUٱWf]4Ge͊6*إ){e''kH2rV&lUٱWf]?_*U-#6*ثbMSp> Ik[͊6*ث\dUٱWf]vj_߷j7`\f]vlUe~ѐ8 r ͊6*ثM?/㓇4Z͊vlU;BfOוfJB>gZe/͊(U29`V4`}ETaBgQ q«N9z([Iā(GVJ O!\M3)~.e-@BM?'^9|@FRڥ m)v~UqxkŸ>#clSVNSW,ґ=5O6ȔrܨkJxamiDY-@z $JsKԮIFM%?Vؕh|1BUpmc\6uaNثyj+ت޻3l R|1UW iPe͇vH[L5ƕ˖(qVsAKɕɉLoUȶE;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qm”W)zaS(Zm?Θw1Um\o-iA: v'lUhH"g}ڣTdXZ^Rj—POLoC c,\<[o|N5p+*)N@Soč «C)ބoJw\ <oVY_1哹̎.Y=!(87P GXT N@.\b#SV;ɶS 51We*_ՒU*'L(n'7*HCv7 ](٣EPI*6(ݲ"QQhwҟ >eH{dx9Ou]A):ݘpq6 *MZF WGc_O\x))?/>q2dqe R0q2aV~~>+ꦝifq6CWf]vlUٱWf]vlUٱWf]vy{:V? <7[zd]l0*Sz,@sT\PPf&z⭁\ [;"-LV fusi#TPzi嘓]"$1߂2,`Vb͊662OeA',,f]vlUؕspOţnٱWf]v'?o)P2v;6*ثWa Yv!͊6*ثG\?+dثb͊>rqC]vlUGgB?0&?'?3`d6*ثbߘޑmAy&WGc0-TflUٱWf?N. tf]vlU~G &^(,c+b͊6*&?!G ;d6*ثb-Bl3ʙ/vQͅ.bYO eOQVQF)ZN(XNI,MioɳqpD o@9G{!PWAձD;uFr7o&]FLy:!A~Cj* N]AgYaBzO8dɭګ 3m|(E1/.qxH85CqUab:hwLKZ{wJ}Tr\U+bFg4®C+jqhC}CVg?)kO#1,UvlUٱWf]vlUٱWf]vlUٱWak.}ğ7Ambxc ]~p`PS0oA/S;Sl*KQTz_-/ RW:cKNp>qošl<ȱX:MQ?v*W+[P㫋%5)RG\Us 5 Bܨ<1N(XA=/0+^,Rxzt#ژ5$-="0!iJcwHRf "mi /c 5!8GӍAs࣯f>li^PqUj:P i ȖGfw96ME[I1)vTmd 2rrh B0jяYc%BK]>%6dzn嚃8-RH4גQ+{xc۪UddlFjqL\?V(LmUWpӅ]uȍ9沴y4;6*ثbOR01ٮ͊6*ثbKI- % vlUٱWaƗr6/"ٱWf*ثn |TMq5m0o xKXc1迎GǏzx tNGO]LpQ1O]L1ѵUܭupEL`'Zl=?IxiNh}AO|3o[ٷoɞ??6/5kO)6c?5}K+V fɎmRIJmͨ_Pqҿ0?j-rZnU?'?࿳,Om_o}͸@w-o}͸@w-o}͸@w-2o1Mv>ow~շW!mflkq(?oknP_ٍoA}f69 ۸˃P/ 5{V˪1׽7??vWĻ75n+W?8{خȾ.?S|?^8`.G ~ / ~ / ~ / |>~o?Džxc¼Nc1^'f1Gs~hˆZ{N~ql?#5KiHqחھHqחھO?Gc rUS\N~ E}HRALm0FW5L- ᥿!_*89Zaq\UX]RVGPF(8STpr+tfu(+iG_ƁVMeVV%Fl rj91F5Űu䪑92 ucsRvxcsNnd.Ej)Nf­W?X9,/FIZ aj⫀.f *ƃ\݁.58|gۧ߅Ǟxǖ' ͌2W'a2Al`#(XSU'6*4W mp78UmE!AJ.C7oq\ b͊6*BיL{}•ٱWf]v%qqp>MԻ6*ثbMqHv/L]]vlUXXᬻ‡f]vlUov l\bf]~Փpֹk5qWf*죊C[t՘EG02[vlUٱWdoHP~ˠrM Ff®͊6v'?9p6MӵvlUٱWc_Re%]\5qWf*]2a'`,f]vlUeu.1ثb͊!^f{/֛vJvlUٱW` _'j$ٱWf]vHb?$]G/v.n98-ثb͊? yd36N3y`bǡ+q(v.s/GaxBZ<0T:t1*?D эOP0^V ˯߀#!꭬?Paݮ 1M$\pJ[\*_T?hs'\@ Dfeq)-ݩ،TIFOPbhoC~N\t`oqXrh;[[g'<$aibNy 9cm2PoQLXV Fp1>3= *\ㄷXpUs@%)7"q*TQ9z9nV*"Q9#7AI/ڗ2-$;ll"l2@N{6Gf*^U.n'}LWc2װwh*]~\ㆮ@Y 0"ԍ%?xF% "6 D*hw'8Iv8t%i\rpe86Kd;j uk.7|Bצ])ZJelw #li;P)^Br銴zƸlxXٔ'umJdUP⮮8`Vzו*6*ثb͊6*ثb͊6*ثѵė}~w2ÉјWS SUP Qv4$ oZeib, חL)\WM1U X5܌\Ac]5e@;up߮])+A+|6GaUG9u4̌p+i1V .~}÷Q;VEߗ^#OL6-I1ރ]] ޸=7n$vz%Cw8Q'^jP"~Gw诼J xƋ'*ϓ;(M4{my~џ$;Չ=sDؘG"? F9Y# ȅ-X)BR.YpY ^'JH_;-(-W^cO]):sfWf*8 F2qbWH]Ism~de)r]\&lrL"\7bU%QAC."y2$ڻS]vV*yRO?7+̕vlUٱWf]zG&sv‡f]vlU/ٸa%5vlUٱWaO?Ol̵io6*ثb-_ 2 sb͊6*dݷb9 Wf]vlUo3{xv vlUٱWf]3|fM %͊6*ثrȵIWbثb͊$~F{_1f.Ż7flUٱWf]]tՄsApflf*x]U]ݯ䀤pR  mFX1xI?sWJaE+Wcڙ?Z3e|2+!l2Dcch?Dþj&r7 '0^$b,3eAa35jx PO]swHҀO3`yF6s]r⬣JEN TX1%C6YqmiĮu#$'¸V1i ˦?nLօL;ū|+]Jo| @[혭kqj}UރhL@b}VA]LR؎C>80gB iWOAMf4eb͊vG￿l>oE٩51We­c/-.ɱvlUٱWf]J<܍?;6*ثb1Wa;u?32Y;6*ثb`; Mk6*ثb¯2[ ]vlUؤ/<ݝ%a‡f]vlUIQ.S";6*ثbk Ļ 2͊/v8bc'ZI&/F\/{8=Ol4"\֐(1pjE"US(Tß+|Rq\A?+Ly* `3H_}H$T TJGyflM) 'lfv2Qt" Ηv'K#f\%#wQ^c`+# 'r=|qf{AMmVE^!; C)ЧTnL+Cl tQi SWk|pmOd* -^+>}(l5= &X||)o1^PgQA+Mv­rc\RVLԡ^\;G\ =Mq_cA!bb͊6*ثb͊6*ثb͊ <_Ha 7I~$[{f# R!p+o"Sj*ҐMqæ%J"ci\]ʝze5QW( lrl ѩ;+@kU~-[z AZ/S1|RToPRƐצխq*XR2c N()p!C|\/q~_~*ҽإ§,SƸi(1*+c^1Am+PBǪ`T'>~sTvASM)5 tEuN X,u<6zl&6J "~%⤞3VTf끋X`6`r6!gS=slK [ۡvTA՘>W*4(n* oDZH{dB4$x$ۯ#j{Q^S ծeG ,#7wLO̜C#Web "sIXBNEvV*ثb͊;@? '}z4UٱWf]vB?ӟ俨fK; )]vlUٱWa^rɦ\݀0ٱWf]vKoZ'WflUٱWf]>d?rpf4vlUٱWb/ P㆙{Wf]v2SW dX.]vlUٱWg[smw?}c%ٱWf]vBI_՛7>*+̔;6*ثbO"'a^Ib͊6*I_\rq[YWf]v#wVApnlf*p]LUkl)bpJ88UihXu7RC)؟ SP0dP9 j0QQK;D%~gXnf.ځxcE)cgH>,_+dǯ/=W',ޜv#kI-K?4l=JQ9@B֟0CzfqCIbU3`>&45iNOk{amšJQʴ ^*N^F+NKN+lCJu eTbli^D\ژ8<]](j{7ƣXA TQOw;ᗌ`8#$!Dx -qMX~O3CЌd*n6c[ Se-`q$noAgf\yDa-ȺU't{n[ o=ޟY%4I>uOFAaAIwGb~IߩS4ǟzAPNAG 19dz-KEԮsH6'c{׬HdOH ck0F嗵9xb͊6**'UjWf]v+k?^,;:Cu9k+;6*ث`Wd~Xd}Gr-.͊6*ثXKb l]vlUٱWa7#Od.wN͊6*ث*&ns\+"f]vlPv9xAiV-f]vlUUO8c"ثb͊X~YG?<=YXPثb͊ 5o2j~cd\gf]vlUX~ydaFXٱWf]\UآƒbTeÓ=!\!Yqb/b\ꉦHNs4vxZ]G~1UDdaPG|r3,f&*u5V+l7JS\2Y6wEn#wߒQ5Omy*nZgw1J oODϻD|?< a nL %Lp.)JQeUc~,J|Z#ӥ&|/@pMzH({Uf}>4'i%4 A\Us'#QlPvA=1BuƟlBzP^hh2lU;Usq`ur0!0 ƤR_Zm[ ]3]zו5( K]vlUٱWf]vlUٱWf]vlUaxCHQOglɶ h僊F]p+t \RS5()޹@W8omq,▅@`p!eKg|UcqJaUֵS..\P pZQʘ)«yTP v \Q:c\Ro>1 k/L6Ն;~xjݙH~–ʖׂя![K a7oA> |}?0bQ2dVAMg Ԫ7>x1;tcq2p*HuȕT ;ecj~Ppi|wyOvU_Si!SQn21{6j//eGHz"SO?pk=NhJ@?ZN_ttBv1瑻չv\9f%QE +xdd| 1YpyY%v4WeaC H$?RÑk]6*ثb(S$2IHvuݛvlUٱWf]4UVntB9͊6*v/-e vlUٱWd].?rpqfa f]vlUQOq20skG-ثb͊~xb4-͊6*ثv#W dX.]vlUٱWgZsmw?}e%ٱWf]vBI_՛7>*+̔;6*ثbO"'a^Ib͊6*I_\rq[YWf]v#ziG' o6*x8v,v(=dRn䐰)ZqU X<1x*Ѿ c~tli~2jW .Z+FhO2-ʠ4|u=\:!exe%῝:K"U%| c،R8!^]FEQŠ;N8dOO*A'}VUy"qәȡ*i_Յҧ_y c:d]~6튯Oі'hTcc brQc8UpAƅR |.we{V1 ʟي\mG|U: )pLF* w:VL W9޸w*o0\S][5\dXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qW&Nĩj^W.F$lG`C 5v­kk 8l2dž*^wZ.i5U|d|`IT1/C\ N)ǿL*;/Fإ*l51,=6S)z⫛,S^ R 7ʭM7 q R`cL JW[VjŮʚd|%͊6*ثb͊6*ثb͊6*0tm<!B'&lU6*f ɢik\:W'ö/╄Ӯَhfo0;,KCw]1azcHpSVSciv=r߅-lg*>SwW(5S(IRazbǠ.Ɵ*(;BSJS^+ P*{WM yԟƞ&~3bhh]u+d}ٍNٕ[lE,5Z!^2i ޽Qc#lA1#+XSLEuciHl jPV2G^9R;mwf5*evVEmG. 4, VcNo+$Ɯ (vZlU""vV*ثb͊ 4]BŋA$;:s͊6*ثbw/n4BLUt]VuW.n\O.]q]n؜*KaqH\?_k:SL v`"]1N-c}bӸ ssش8tK { 9Zu2tɼ3#0-7^~' urV@OdfM H7aW?9Xf#~AٿH߁DŽvo07q+#MvS#GSko?4Y@](ӹfwcKNO"yz\* G'a wsn=%Tnjo 1W?> ^ Gf _ x5}`}j?j 彜J"Fǐ;N@y2 @ _͵ Ohc/_+nR#]c`c\4Å˂W 8«N(b[#*yǹ!3葚`y24 HSC. bhثlAT X 5'AɁ7'tw$lH*WuDy`1@F=@`posؚ)q&Q,M~S|FZC(߿+L YUZeQj>L.낓Iݠ ؊A5iNkA ߘoWnfjA6W-h}*F6陁SC+HAZlRF([]q|Uq'-)⫫=qKMt\zp!i0Ħ?ooSvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q6L\–fU.c@7­]Z3lP.8@eGL*z(M~xPۘ(0Z+ZmB1Jz )q$eװ;~=p=YҞtaKU3zWIh1FjndWq!j659e-?f ~՗`h]݉vȏP ?g[2 X5넰Q7SdcqlJvخO[9T1{f`>˩›-[1`9uYdGvi1?NC*x7dݺZÊ8UӈKxL}%/]9]6*ثb̽G$s0[;6*ثb¿2[ ]vlUإQ[е 6*ث`WadZ]vlPa^vdػ6*ثb9;&{usblU͊cupO~g0e˙v6.\U٫6*0?rDlYWf]vyd?*Ȯ(o6*ثb ~c<ݝ%oDV;6*ثbM_?ꌁuZyٱWf]v?_Y%S1vlUٱWeUتb8<V\1- G1 #sjy. 29ALg.O~%.^}.0 fY;epVEpY9 ],=A}or9,G$p1/;WEw1I\'2jHs5GzJ=k`Baa" _l,>\ Wޟۅ~E$!iJt;lqT`v#zU\Wq$cIF(\V;aV~H\i[Y{@j:bSU8ңlUh:}Uq?b/jE)5(V1'«hIL_޿Ml?>CWf]vlUٱWf]vlUٱWf]vy:6?oFYAMC23/irإG ~-UHjeH;-]*n3RlJwۦl lor+1kTӦf|qhWb#)H|i* \'i"Sb?٩~橚6*ثbWIN3ak%{/gJ36*ثb+q:'}ο{b͊6*TcsWg8aםCb͊6*[~Oȏ&^Ab͊6*p,Kc 2f]vlUyIC avlUٱWd0I3_Ft6 b͊6**gq_˰cq΍LsbTcӋR}ƭMO- Q#ab95E*+n^?2?7 2v~?iei햖/²J\ЎGvڻTe@Hp4Z) ƟBIƘ nT%?߱r lѫZRat2a;6u *m)WV*ȡrRLe+U}iZ[Ez}8uv( p \*PF6x=eZNUb(kLR_Ǿ)\2{EQMc銬wy)}`921oj6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q&\U e0J 05`bO8ijF8*ek`V1تܢ WZo*5 pRH16V\N=j1|PW9@]qB|4+Nt \T"Ze3*+ӱčTLPebz~.J%]|TP: VHz ׮+#`;,B{A>ʏGk[aQ*4N™$h-b5hHwߑ%4ɲefIWKxIABh+pGtӰcf8Yv)j+2_׈L7|ߵ=0+ ]‡cN!-7[D,eɧ?]Y6*UxG\ַ6*]vj1C⭌b]v)Qv=FQеhz1a*UDŽ5_—)mx}G'~ heRc¶Ұ+>vf6OR]-wq4XdŪt*t* ⮮ Ѽ2N=AlK+_Ο؄/9?鏎~NoΟ gcK7NO-/9?鏎ƎA4jipRܣ?#SyLG8/LGǁm{0o.NN<' Z# ~R]frWՏ6xu3}XkIwS &ۊ^C6ՓN`,?郍o777"K8Z@vMjMO/@e}e|>WS7u3}a|>WS7u2?j)FPu:zN_b?o#;7 xٿLGcNb?ov9":)s咈n9dI\W#Sf*q˷c]\C⮮=t+ܧ?)'B4lZ& ewy ة\(.8  zwQNSԝ×!ie =BA1! mn:`vRu9~ib0'ͮnKo D%ӿHyz>/A6gV2:1ҕ޸o>'V`ҭEG`KD|{` 2 Dx~pv4Bwd@JgU;*l)G1U|{ol lܫh +Q!CoMqAdOVߡ5T}jch2j`CHk|´[b+ֹT[5 ڝy@8&1VP/u^V֟GbXثb͊6*ثb͊6*ثb/F3$QVvff;b(̕U)|1+LUhjeaZleR+ b[ +ᖣ*l=Wq8k깉특A9DR'&G|* @޽WiʽqU)qW$e_82]qJڄקkQU#|=XөH\Hu`Bd2A) غ4r˴j}#!`ZFx%!YJ۝Confi 6Dq\2;D;xjebCHj ڎ-J䒙ޥ^x1U uKW1}H%7ȹօLz>g"-)ՁN Ae"@jNF[ G:mѹ5=3Vu=5]ӿʿ3341k }Q #S=)+UUsK*?ҏZ!g7(vlUٱWf]v ?ޘOc/sl*ثb͊!zqě3ܾ..nmSCb͊6*h$ KYWf]&.~qNŜPן5LٱWf]vA8V: >g辿XO"}stЌ͊6*ثNnb>!>E!\[ݕ6*ثPF*}םCUٱWf]vK4?`d|y52n͊6*ث!K>*68>/6fCKb͊6*:4!–b͊6*^&k@S8΃FlUٱWf]^l=K9vX1~9ѸlUj1Wb)v Ĥ;;Qݏ9-8$-8d\=Q$ni[F[ ħ~lj/HS)#d-3dXouP$ZS\/LݕjH0 x4! )m|qU::ↂ FY\Rḧl TmM*?R)^˧{c֟, ;([cCW[Ʒ W)M-~$ )YBs~dNLEr'bf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q$FeW68bpp4*E7#䒸567 0+cE {W,-~Uzf銺ߖZ (X3|;l*FZ۾E :q+ SNaUE+ J㊯ʿ,8{mARp-)֘V+L`Cjn==w]cl445ix>E1a $gؿ`sZ͊6*ث!qu?O60 ꝗ]vlU]%j:zثb͊6*ybTFvGf]vlU{o/~R,UnlUٱWfآVd,8Njo-;E6t8\m*$rM.HF#&.k'pB1뒠߁«*k3FdFbK}鍦4o9-l88.͉b|]r>{ᥳcx92p v({ Y>T~XNCGtߎD*DYahpA>d2R۪* L6Ȫ5w54V4L)LKrSZS*:8>؀S,EWq8C0Z'*4|"F1qB=1튮O›WFe4GlmᛏbpǶZGUk!4 ­GO1SZVb|)q1UqmEQR1E^*ƕ`C\kZX"ıUٱWf]vlUٱWf]vlUٱWf]_Ha oFYilb$ vv8x;t+Sl ֻ& AF ilUz4CWqUE0+ه\*C,o '_(T"nF)Z>yJ@®bIVq:6Y.Q>L…>BzIUaPSNK}8 3MzSlBTңb7'B ֟u$S!_Y/i#- ɏvr5ŏ5ZS%K)0pPwF5 ~‡1[Fo+Š0l>^rc,)5jv>tѤ4ǺvV+&%:a9lmt%~ Sj5}NC\H %ď؟%LIv%\PcU7AA% 1$;:yӅ]8UMWcqWaGu'Wd76vlUٱWf]v ޘ Ly%rCYb͊6*ys;M\̶f]vlU#ˏ4q-f]vlR?˃?lk|Y v:}95K46lUٱWf]]m/|lfvlUٱWb!(~$;;Cu97+vlUٱWeQN)#EAdٱWf]vJm#7ǓGlݛvlUٱWdΫK|PfOy2=-.͊6*ثG?#dlaKYWf]vI/? ē5[)TnA#b6*ثb¯6a?.Kk8H&9`bqWbȴ—`W_x9ܰQpӏ\*/71Dz\זxG_|"B5֧2:sLѶEƁ(mtZ>-- cݽe̲+Jޙtͤ3xП7!nb,5KU^"3?ثt80ևN1RaR{ z: Y%jp*qltzdҏE;I*)&V~tk>*ҟ9T]x4ƓW;´C M2ٕ|qC>m\$uV*0qcv0b1^Ǯ;튭R U,> N_>xh$RJjol>u[e+9?`(wp![{t cĝAvZQSX[*}jJP}'e|dʦYzQ$dbvVO͵~DȴLm)*s6,CWoP0KN78eušc#ȫ$9Tjq&PSq HG}?欤=-}aP>{5MIp>Z=*/",giI%~~`EȪ5cZȗdt*7Uor|uIlUٱWf]v wuxq}C ®͊6*ثxmGᄹ[o6)vlUٱWed]YCb͊6*ثrK` ͊6*ثIcCbVb͊6* __׀ hGSTHFV*ثb͊3k⚍͏'G>Aj}Z]v^*<?tI.sYWf]vտFS[Ief]vVáf{͊]vlUٱWd[̿_ʥjaNAvlUٱWf]VR.9"V],b-V =~[qAdNt>XrbX*LqC PpX\dͲ酢Sbk v&+nH$`Uƚ؊1ec$5`k P ms$.~%fƒD1:0G؎O 2艁 ,i"tu <#YfhfތPFCs`JalRI!|R[[/=0 {3ʻogJdXP ['d];IQQcҸ5 qA1VI4CLPѠmev-|kqBĎ+\U܍;S0[j\lqJw|)q W%kjp*DtjS|BZolUUk*%VIָH銭QQq[cG!bb͊6*ثb͊6*ثb͊:6?F?o՝$ Up4SC8+&ݺUu2ኻSV?^_@߱NClUd(NnwkNPXӥhzE_|(\\>Uܻxbpw '|P7CTliNboF8V:8 Jӊr(*]™߾l݆f~ Z}Mw6T_ɠtQf/P" y2(~xO3(] i^Z1qznjYˆ_ vx2gh.$/.kI(#}!08 <"ŷ&*9?TDoyc/IK7O9NnS,e1C0+6O(-N똺YsmvV*죒Wc[]k?`xOvmثb͊6*12R9&5KYWf]vlU G;Mȸ21m͊6*ثCH=4u-f]vlR\{'^8: 桚6*ثbgq2a>H?~YxЌ͊6*ثKaKCg.ثb͊-z]Rym b95vlUٱWf]G9~h쩛b͊6*R3mnN.^mfSCb͊6*6?a 6Ipk6*ثb?'aof]3<9lA*ͅ]iZ_pC#眂gF&Xv*]!"a,M@g2ڤq q늭9W"Ϩd7=mNUhjR1U+k_lln+L)q^YF$o"Q|T9hM-(j55߮s?/?rd i?a lnlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qPSeMN!.lv•=iSMFتZu- Q0늴T>ت;㫁VSSo⭠q7;aB uA0Zuʠ–oMNثJ8 H| Zn1imTlpv* ԌPGETw  WEIlr%[71lJ:pv] :Z:a=Y'YQv@ž$o?FAۊT+W8I&[x]K0Dr`R iz-,V邓GN$kţ-ES+.^G_)On>OoדE$f]vlUVmOL;/vlUٱWe!])GfxwqY;6*ثbȷ޿+K}'aNAvlUٱWf]Ur.9"Vـ]'ZJ׋f?-'sS|w,\c W0!MX*9Ky9p5S%魷#0B>֣l= cɔW]`$ӲU„|H$)A,b\\مƬ gH&} )'^haURQYx`$vڛb|BFڕ)M-԰Zat ŒDUCS`)N'6 "ݲA)h:L  Q*FF2pcZVZ늹튄TCn1Pت5'ĩU8xaU)\*ক4*@˭6Z]eOu+ڿNSW!~hhqVJ >VbXGGbXثb͊6*ثb͊6*ثb/F3߫;p$ÈN*2†qWLk)]]†\qJ>d S^)_SqZjfءcSNs:⭂kL`aJƑqUs /PZb7-WS|p4߱Znw:tȪX'+nNTj Lrit4ZƼQ]SNQ]XVv Joy~0%wOk谉&i鲊#z| nEOrR܇6LݯAGlqG\~CS`NnS^%|H9);tk4"ziȪq7\E3+Ga.H?'9iLr\(v4 cs 3 X}<ݝ7h[]!Gv4Wa/O*9 W6vjUٱWev`8E7`BᑐR Ju;a_0|9w7:v.]Qm}%WOIAcNiL>:Oii:(!z|rLa'u_Փ>pfOÿfj5a;'+P_ÿ(.]Ǝ_/Rwkcd ~9wM-r x)NoG wQ0Ӹy+l5p)k3ԑlq+k/>\ACx~Ϛ ܼAVՍ>~?ci/wդFQ>q;xdo~altDոFé̝>3W-}\djڙ?ºƏ{ rš˳2\|x._KQ}/NJE-D:Huˉμ4KGyK)w ?+N~??]Ӿs cӾsjw2s]t816Q~'[Qm+rxcV\Tq+noK[upL!bGӘy1[!N낿LU\Af1k>:LZ㏄W:LZ㏆W:C=>}fTOS*qb;b/Kr~o\0j.? 0^Sx?3.? a޼%/N4={qEM: 8֣aXM-s}j?ZwQ0Ӹ/ZwLl/[$17ZƣJ5ɟESy|A Iƺ/Cr'ߏ>˕8??L?ri^ǩ?*`r+yn{6QAG z׸u X#N} |ne;}J ->3mplq%N*D+AljI(Jl~ҸUxo)v6eb LJd +Z⫔ UNo*I[ T{XU21 Tx~|V:Wd)UY;`lN6\[jcZoC햻V Y/3b XI4>"(ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q,ma`)z wJN+o4k|*S{6|UQBv*LUYU\ok [La #,(E=3=qVe 1ƒEeVB@F*2tcR{⫤ڸvvӁVG1RsڧH*iH뀵r}HeNxٱWf]zavE38;rcvlUٱWf]o3_W*7Q9ٱWf]vWx8䊘er銺𸥬z(ZN-Χb7m=ACa*qp•偅 RK|~$ѭ?r8̇68uH# HDD˒> vł G[ @ L-35qq4#mH9M v X^:|cFoS\!@Agn_x:f%,AJ WFdB|n/+p )#9\IiAOi 68.%G}#k\(Uִ*5w˿ъӖEv*Р',}G݋ֹmf®͊6*C?^8F`4xb͊6*r2/J|$9i{:B]6*.)6Ap2)vlUٱWf]'J?5a.kٱWf]vf34_]ۡٱWeU1W`MU+X~ rv`PE] v;Ӧ(b+xσ˓(s5rX\4D\Pq@ڮ=WZNO 0JBI?-R%ԱAI%O߅UU~ >T3RøLB"-VE r$_*f/P9j%$tcYzOt)Vg0?:04l6j9`j[|X- 4?#,ΰ/?5)j:r^cđo3R(y7Sbzć|J :`bp*G*PTu|09M7*(qb|s6:bq=Bc]V<7.`*G[]9 Qҿ-ޛPv"W$pfG;R:⭰˜"8aqB&3V<{e*}Ӯ*"ze0 rp+b0ĦGmjȱGf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qZQ~@۱7«׶PjU;˯|UocUP,5ҹn{S,7n>Yt*4|R5!W!k .+}'|R4;PfF1K <1D=:qsF8<~I~D|Wt(SWz~9,ƛH*M:D#QZWYnn^޵ ɻ?m. ۩8"CSQ).=r;(GɁ[:Al)\ y7|.ƻ[v"8c$?䌉J;aEVf]eV*n[FX1WAj#o뒕\%%c|ء핅-qCGo9|V#8 _DG |sL3b]v8#v 1|'cm=Aā:e*8>w6j/_e}?݂?M}rn8#alz 3m2_0 .oE-hckEؼ miC#5H'cm6 u4ܑL NcxebG?VoX:7x b?~bw?VoX:7?я_Cmei+w2՜_TsVi]1x~[HOP!,?->Lߠ/?~#WvW1+y;$NnL nnfħ49W$g_s8aa" x}vGI}x}vD\ptݍ>W ]>{gC' )Gh89b?T86]/'=.bms{VM̺i1T\xcM`oF0R$% mwpOqXN@0");4T]~n $E s!N ï/T\O!0hI5N@yu p .-IrH91o?# iE}䟻):>ic' 9IfasNקڙ"Zլ!;-39*CJoLVu L:q +^ĩ^UX]Y~c|oL*]U<:W$t9n 8!2q۩­ӶUi늶Ev8~"Ǩ|qUԨˑ=K#lgت0zWl5 {eReuA9;xC7]6ۦ]T 7_޿MId|%͊6*ثb͊6*ثb͊6*0tm<%!FFYA9&l> p]16늪JL*Ic_sARiW68L48v>>8oCLbǾ4NdbiaL*oSbF4 *|y:Wz;*f"UZn1CS1O2J|+`־4e10j*(% REwlVք 0;SmVRgp8iRCHGcOȖ@'j_|hIoq [LQSxbojd6%^is GU?Sn9b>~,ĎKMP ߯ ѢdTeI?/8)O>g 8fCIJqH10U'\ĉok_=ɜCX7RI70vPw }#NQ#ջNG'E_!e4KYXy['ʲ.J7H1@eb8X*ȿd}GJh7mhٱWf͊/oRYC5ٱWf]vlU(rY%!z6*ثbלseWdo6(vlUٱWf]O'vdݛvlUٱWd·|"?sS߇M^5 6*ثΌ`4%/k6*ثbYMRgE{:02Xf]vlU_{ \مRثb͊$N? fY.kt]S ֿf!t;,.*p\VT]jQ8'agӱʕK(cXn |y&s[%/ZX\USZN8 *rwo?V`˳ lٸ$BY8 TZ@:VٻҞ(X&UzJp@vٔE&XFrGH$ng0{mKV)]fHF9}\ xp.ݟj|Վn' mz2ɔP<ؒi'};!>ù_"#nN5#iE 2uvlUٱWf K5܊] 6(vlR=?t^MGb;6*ثbaF~5 s /ȸN͊50+Sv2SA\ثb͊,bɆղg.'u}pʮ*Uٰ+CbĥE?Gd32JqvlUٱWf]x5L0!סR~xP@A5' |*Zþ1aBM1V'rP<~R Vt#lTFucTmNUtyTJf)M0LB(+FI;aJoZcrzKP@U;b=NUOv=qVڽQ=*49ƞUxZXGGbXثb͊6*ثb͊6*ثb/J3\R/y?o՝|NM5v.㙆\q2 CW|\뉨^MVT;v4ƳPaBPsr5rU6SsI"݁ی)\ 7\GJen}S^U8Ƙg !?~9SqKtlc1|*(FfJFhFL@6MiяYAJq{ZP~T5VSLTIOāW.dkɱZɉ˖EAw2dX^,_PYJ[⦀Ե7oYI #Ģ"7E*pL4ʀj+5=r)vH68bGsT۸bwnއc:lZ_`Q'n.7o3@ei hQc"Bu=b~8dߧU>SA*)#im_v?zZP88 qN?u0l'hN.ZaW9[Ei|pLVUO OHɃ[Ic^+h016U#gfIq)l1m_9(2d1v&̈́v&FvVv4'dX~.GȻis ];6*ثNGNE,fXlUثb͊k_9O^ tlPثb͊ 72f+"f]vQ]_οO4pVf]vlUO('O'[ 6*ثbGavGrf]vlUٱWd@xe]NMaIvlUٱWfmט1<H `~OI Rثb͊ |d?X1.6\?D߯3)ԧ>ٱWf]6v?x<\ٮdU٩,.*p\Uy'O,vzoc0 88XL4႕XSb1q+G k!Pq:b.Dž(jGJtخ;1Wb,WaH\rtԣskp|N(#crI.Y:t»6[2$iž# eqɥh` >yCűa$״G"yH99o$iz`{Z\@7U]L&SS1R+W5j82|gbȬ`^ ]*mtx`IQVT56®E}֝0Ts7*cX_Uz;ǡDu* kbqbcJ>* N cA~)m&qBlQ)R7Ʊ銶+«Qga^`4bANb4*mqC~m6W8yS["쏐ıUٱWf]vlUٱWf]vlUٱWf]_g$1HQyQVv,lb2W1PF)8r1NUuv|lMmnثoSl78UxAb1B 5w4R@-1W(&NqƧ)ZክvPab"fu銸T`)Q(\:ePOar؊S (5c2ԯ}J݊rTӾ\-Ł y!.sdoƙ`䬲Շ:q#'4)j`67,Pt†oQ˷Jd5az`V,6E1\Y;$G~yql#0[ ٪®ƜU92IF9(fA w7 1~aVlQ"J֟h^c+Web͊7.S3]vlU٩6*y?5za.Wf]vlUCiPfz6*ثbc>Z-ɰvlUٱWf]"f&o&5vlUٱWf^1WgG^5 iZ͊6*ثc9֚%Yi? EmLBlUٱWe W@g͐mq*8Uห\8Os V6 qgե8We]\(R?Sf^+ȘCzCy~uq*Z'"6W1Ķ |0]ゐi֭5`(~,G,2<*ɘkƕXSi|駕gR=xi3PPijW[9Uza-h" ĸDjU?6`B0EpO*9#Bx54e^>e[$nM-t4SRv RԊ*Rb2FM6({W<"ɩ$0rYI#?NcOb[\L@ ~'qnUm`H+椐5i֝GdRX^K)(ȐЅ$:z텭zl#@zPV?gHےp0O@*vvŚa SS&J:+_ʂrҿ0q%OJewn B¿ ǽ;lpbVLt*vMRJo[q'U9pqZTcO [97Aq#)aqKNo k][m+b=VX$쏐ıUٱWf]vlUٱWf]vlUٱWf]hCQOgm-\C*c.Ӿ^޸Uu)l7`|)hًWa Cˊݳ#|*=mb3b,6تҸ@LZeosZӾcrUr4.*7lRiZE޹Ql;SۡAX[$|ONL⁆(ҘMb;|!To-M8j,wY+Pɴfx##jQ6"Qx]7>+h@kREȥEǶEMpZ]#)"fTfoĵW&橎\*1S*oL*:?e9y0QG$f+(a(ↇ\' [#(=v⭌cMQ`|D0n{hBlhEHDZ jA cn8 DnLo#?v0cMvpq/ܸ?8{i*Z&q仂)]o4 --/LAJ<2Cϧdi^ Lㄿ򱮿YgcXqekGvXǟ ";xݎw_#4Rj_}. +ʽ̬: sHa/Mӧ x\?}JOV\ {]S4rupƢ? ~Xx ӌN7sy'dpATli66RS D3-*S/O0|F6W[gQ*rll8}x]wO!5.27Ljw/4˟̟ 1k_ut!޴Q|Fyr2hU\imO;+Ѓsi#_뚾~Io,O?<'! U0R-NyAQQM_6# mUv8&Fժcxڻ q;ԬF8ݖ i쟻 r8Jz#}-88^>o z>id`QLnG_0<"(KߐT,sᐔr@$2Ydxݾ"[MvQ䒧"ʕ)u@Nk ȗS+Fv' \ي b‡a^e`]ػEp+qWcpMq[evOX浛\]\*v/aא"|M֫͊vlUٱWaw,ecKaJ'N~Րѧ9Wf]vlUKdWeUٱWf]t?ϾZ0}!nvlUٱWf]\uyٱWf]v'?mn͊6*ثbo1b4K&;6*ثbÿ*,??s7$[%t4%jaWW/KU Y8 msH O\t=' \wU X\ upU琓5U"W +Iuq,PpHGc%i)N<&6Z' yf+D.SL=łV 1!Ԣ+#JXi rWW,.4tv Ul4W#ݱuql4!(KnG<*lq] fhX>3 ۤ_IVeaS!'[źЃW]F`U}˗CWf]vlUٱWf]vlUٱWf]vy{:V?␡}~lX%'h>8{ ƻbŽq$bx5|qVlث#ڑ.񻓊emVL|UL1W)U W{cj)c= sVUm*NFQZm-;cx1U7,b;UcHkN%H効CVmQX/jbއo (CoMV Q"H;QU7GbO!3fqZ.=7"^. j̈́SRE%596VS0P{v#GNS)̩K+cޞ7KQ܂oW1[a 7ᕌ%8ycL`G-)EyɌm[]= 8|(.0˚ؙ%>xl60(Y,jVbpt[M[GM6"A#$G+'1?3WSbŸ1(3'6!2ݔF*R좸ZHMė!>嶤'}Y\Uxb͊9Ir6l~o4e?8)]f8fNmSld~3x`Wfኻ/]*6WdTPfZr⮮_R)ur7Q.gbZ%ͱDu˘7 Vݖ#®iп+"?m[k5pRP}m~H@7ZXeo«K cFW5l0Js:_՜DEi#*QA+]Oߍ+B,f!? +Epܲ 4rdžbpRGAEFU,k1pvvj܊[⊸|w"6JrKc,!C:n.MR扁BkJxbTlU=BFbetHt'ʩljyDž )ݖdsՏr@"|#v7—W#xtw %3`fR~uۧ|M7J6 SbMȝ-,eI'  Sʪ*Vl`WTRNT3d+,dojȱL3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qwɶ F*lS 2- k˶1J/j+ )Zb36*̧| { xm\ኴ}4! L(T AL]E|2E6Rv[v#*|qKMu 4b-k(wuah4D?lc]La~Lj#Ə{x LIa!"e*:{N܏}wJEMVâe=H~0,!e!F0C0>mx;0:ϙRȭ kAGU- 9V_uoCx|rIq^qH)ljis~^ -${tNjG_!.!!~vXu=߁6%ՍgF_W둧٫5qvj;xo &>x..?Z._Oݍ/ voEf_Oݍ/ vJ< Ѷ,m݆y7.\{൷e¶s]YCWf]vlUٱWf]vlUٱWf]vy:6?!FFY[=rlTm#W84ۦ90V*qh0bǦP'Ȫڙ]POLP f㿶H"Alm[/,mZ/6&ءh]?5'?,M9i` sSn+~tF04e?<癱kDf]vlU%0a$vli] ttbl0`7:ULi]\' ՙ8.CLiv]0qi|qcw1]U]X'/*r:|1[ur7S|gbZ%z\rcM4v;Ius]\X&9W? |sX`㊴rZ&E]t9%_No՜DFNoY9 )!jjGlw &@7aMLrFs>)lchiµ\Ѯwm\pbRVAN--+r[|r╯ul* S*LA㆕e(alm4; m6 |mjN6o˦*Y\aKt9lU+C*!9O`92IޅD1Lsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q rGLa\P–Uxc\\N•ʩ\UyeክC\\ƘZmmM{eڸ#|)hmZcJv^$^;a7ʋ9P.iSi @|UuYXߎW U}튭5-fU+1V܂ Ȼ[#|$z7ȴ #2)X2)>"SӅ#b]9r 7?g -c,_ w1Q=Ž&LFD[rr)^rſ/ė0v2\.G{|vécHܱ˶t$f4uqˢٯHl"::ӭƃƙxq QSe9 rpucޤ\EŷcxݘĶ8\p+я~c'l; kjVf]v#ydeɣ?]y];/vlUهQ:_a~CeE1G^;͊\ثLp9U<*urn6Ŝ9W7wur銵\]*.~6uv\gccU۱OV݂ljVYm7(pۓxY|Xv4epw;_eŽM|ݖߏHwvȭԞc5?~&-c75AN E5ANQǹg鋾ҷ2"l.;C!@h+S88`j,͹yvEN~~7ߖG._e}vsƑ{,ynjAf8ix<1~#=OAa [r;#Y Z.', v)k0-xx2*T}hAWF*7?~oa~4w?~Xָ8ܷ نo=:Fi#{=InM: 4f'g)nq5jEa.Ԛ"mBE@hb;J[&8ҍcG{D { cx*C# HoK2Y+?"VHK@A_ fPwM8NmEYq* a勉(hH`ۂ;(H LVPUf) t1T$r^0eo`Ww5jNAaB=Pu!L fv—SlrBQe@U*W4qkIBjv;ֹ"@6**AKK %c%~x݀ צP[$0B1U@w_?Ml/>CWf]vlUٱWf]vlUٱWf]v?k BB߫;;Rߖ3b]ɡ+O)TVUsHiJcm╌;R>ٍ:⭃H(l Ǿ*S)@d/o#aU dh8=v\mZ+ ujA[k㊴kP1|UsS— /?XJ=r)]F:co*lkҖ0ʚS~7`XJc"ўlhMdArG5SzasJ\To\HM)^Cy Hy5Mz2-];(/\NQln9 S$ aqKyV~aՙ9ͱ9M-be䂻(۲Km7k*Ć r*9ۮs쒐M2yX~t#o?wƇ>l~=Fn8q]*hd(pژY5Yt]\bi#ݍ1-vn8]d_Y\S!|i5cwHg.嬅 Pvc_oY?K /tGOqpb{Xݤ~O&C'lkfMgK3XLLJ$@xSԯuEFF*wu@p|&I W?D޹UNWژnkqNzF(BphEIǞ׶##oNª%q]׶ZJ(tl~{bFIhF1V5cv7Ң$ɢ167ª)n_b{z⭍s̳[ɐ,d"=5\XYWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q@5X[H oqJWr4u QL­lOlR3~Uũ*u| 0!qbXVTWVUL1 A-q`U8 #EkV2TZS}"qB,ZSB*,ծj`Cˡi@ܢ)۷:H#rX 㑕]\ɕs޸P9H*{n s2?aI[6*ثb__Gba1KY51We\r͜,.^eƐqWcb[v@|Q61K찠aZv]0& +k1rcv?Ph\vkuq#up7Y'B*WԬ~8AI?l8`¡b+JC)*AT#MJ-=*ҐðƝWE1H;aR:1߶;(sia7.2;P\Ui, Uj<1A*j~T8cG1zaUH;$zOlkpvq•Y[ [n2W+q-8*)LUS-]|ו5x K]vlUٱWf]vlUٱWf]vlU?@m4!B2߫;Mi\ZTDžS[ʦk| ʦ*Zvx4; l  P튵RFn^8阷A. Pi$>l-q]G f %t]aj6p8cLnnxY[jbK[fF\&̶|qK]g &1 ֹ!H-cqE\w@aVG|e.jeWf㊻I]1CA7+? ԏBBSC5 *«IͅV/>m72XDXO8vt L+ ++N ON(n"0+dX8m]\+n͊q:W*9p3T4F]p͂v[L`.wc.JlF̶E2]LqqJa/ 0#9FɉQNK_|mAdž«qZ`{5Be`w2۱ZҸ* Vڧl̿߫4op(YddS%fyO]SoA ]o vbjS3*1+:_sSfVTS -U؛e P"%IUث`Wf8.]?I3d˰]\2\6aKb:~#y;C-@9 Ri\mِPa =ݵ#vV*ث+ ?^B|}G\0LU٩7U>x>vu#?VR}8 rt]\Ǧ*q;_fd9O)?Vɴ+㊻/vX\*l? ֘]\p\U WØp8{_\urSau@2Y!Ln|pZ-SVF6b=EوM xKS8 Uj|qWW/*my>n7WV]09y%+(')vx} qmBbha]f̜\~yD T( =4FfpN)p*X|P2I`CT~6X2bp\rbqŢ};ب97-wr*CL7\PrJ.W7?%~*`C6pWƀ\U0hu/6T ֘޸ڹ½RE!OCbrC-/}?W1*JZ 0?_qDK۪W+IX-Ÿ W-*H#| k i=/ӥ=65MF+wsqlzczֽ)ƄPRL} 0Ua4ª|ulUw!w^Tb *6*ثb͊6*ثb͊6*ث~_Hb{ğ7E2$ ?F_mU(b0%8*tU873xWpsVn+VxC2W[ AASjw;CUރY )iAS UZfnAؖ0TJ-HqKL H2jMw«}z *"ZGڇEh88iJkM1Jŧq߿\h=੨5UrS):WmO@ñaV8R$ Tu'%>/7O.kXms_|l&hv .؄-!fk:?1%97'jEl*1#h]LW\Rɪk[͊6*]4cK4ʲrXid0EHJ1#]G0Pj=<%l::"2A8]l\QXJB#'Rw?vfpq݇x:cvWeDž࿎^7eū:QPAb`n"g@o#~N#m8O7N~B>5d>knxDc!oQmW!q<8X? +pvpT18Q S2? %J) <3T僆i_x'XW Io00M݌@H6>̦hAf-`-G6V-L$1tClIy*H! Bۍ&)bKFtO+i7־_0̾d_T1#!YvJ}ZDq(*uOA*ТwaJSaWGenR"--S%p(ӊ;vq)`92ħ:!oW"x9Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q,ma(rhe߶*tXD5za -s5qVH Wj<3M0F=4tq޴8B2@]UwGޘJ*O|Ԡpqs\! tZ F *v@:)Rbw N4;AWۨom#}4`1KLo^'X$<,S|e }1be1s0nUlGW<#@Ӧ]Rwm;bp*vƔ$UޠWMr,VM\T>9D TdKwTB0u哷–Um¨ƴ 0ZzC\w9*(<0"lxjV2\mk &UPEX uI늭oN:r1Q?)ke} K]vlUٱWf]vlUٱWf]vlUaZxKB߫;s(69L6VLUV,`(Xq*eR⫇(VaKm q+l:,kҔ=@SE MXՎ5SebIN<2bTmԚR>~piۦn UKNZ9b4b Џ㊭ ؂zllj]L i0H=p*@|#|UM#W-@^֨=:fl,վk튴/۷Ӌl}9._x՝ހg %6c!HG %YNٔPll#ӈmܞcץ␧pr F-u"CANɭ҅s_ !]9% L\J8Sct(kɒP)NxWèv/ccn[Ubǯ4],IIrmv0;1\0qvBal!I.jv;;+7+U``;٩.ʦKf፭X `ĭ|L +LU͊.>X >Fr,We ]LU`b^NW&QvS aWeJ8һj1 >dN -kv8!*Ova0-}lƧe$X&0ثU98cS,b'vn'vX\Vtɐh82krm]bxbPma-?C혁>uO4ćG1Vx/݊oYP)B:U bZ8N/v!鯀}~ow/fv鯀ƛɿ/j^*<0?~SmL7~~h+귉vnm~4f']";PuW.jVNI.,{WS0Rb3~C0 TmP zso[SRt,~mMsi2lT]ʊxV ң"|MiUTv1`wH0SP0ħ?G6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qre@il}p\Jqs %hN VPNVV"z>㊻7U|p"\l~_@Y!À0&W/M:һ51WbNd;LN*p\Px\ JrW/֒QԏRCjbeٰؤ;:G8}C醽1)*u]LUq7@2sut}1bf.́]*lW٘~9Yv~1]pd[ӛ ͊#/-# ߘK!^dbpu<$Ri5˭O%jo,18a];0r6 fںQ]L F1hlq`˝-1i Z#,##U{K\ł7Pu. F)Rm=ȾxdV`FԐL Pp~2|:o}2NDYu_bVcg=*n: (V/KFz5J&N-ѶR>*;mL)xU@A3xeHJ9(G:=>}"Kg+&>1l᭦jՕMt鷪?l. mNh~UH;lq vX䎻{5:`BN[MI+Bf>xf1Wi`:*$ 1SlWޙ`mGbCƒ&ɺf^[4 cPPFت&c8Vٛac RqUNze04ޘµJXEGbXثb͊6*ثb͊6*ثb/J3\R/yo՝ɶ0W$Ur. p!q&ik[=qG|U|@*v늮Z{cM1Unr P Qm]Iۮ)s(;_2)QLiZ1 N_]z jiNQ__CC^3VAB75VW3Ifb#i*G1^~RȊ>y]AJRxb _RB!˔7;Wo 7cWQ]$}, Աw8Bq($ci6)q ssևl>AP Z{I)ڣ/ᷙ=7CHXӹʕ'yL dViA/I Y*|9]x:#rjnOA\`.䝅pQ|m: [VH:`{'aߦSɳݍ#`WanlZ2lp*tg ;]ofƖST]y#c+kSb٩]aNLĻ51vDy > eTŕ;50]AY`eY\jbX\ p1V7Ƹ3GBb51K銻/*`d8lcX-`k/؍rUE i5yӳS+vjbaݑ+.˦v]0bO'2la}rl]0+aKEүHqÌÖ1VKb *9 0eUXO(_Fr(F‡e*i"f]q5Q[ )R\P—eWvja]L5D5żͱ.Ik=Y)*|rѪw늴F(qUbp7T4k*`UM1u8L|ثSlVL9б` d1:7ɉA]DU5v%9P9fTD!FDA- ?u8?r%qt%MAS(*`!nXåi[Mnc?/iS©HRÐ2XÈe\APG@I+ZW|U` {f_Kj>eZoZcM*Ӡk\qt>T; :W=3tZ18 •DRW}Q|i Qg6j XAZE r#gvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q|lacZuƁCW|5® Q4׷lRO*v=k&vATn=qblk0 4Ǧ\MGJuCڽV :vƱ )\'je($⫘mCEHl~)ۡJHըb\hqX8*MMFnSCbLc<0N*1U2*@S1;bZƴaO獡z߹>ڏUQ{`Zk-bc (f;֋Oq-CUm@(Wo)|ԋԬR]dALKHB{aqNOa6IM/g%f̗R7 Oѐc"P]\Q,'sEupXR(WzRI[֫D*>acb32 qK)buwc]M..%Pru0ɡ&b;R%Hyx5;*ƕaqWf)KA;ݕ EpM/eNኻ74+q8VErA(-إ0%͊, m]LpZvt`NZ6bTcQKjq%=T}ӪqU܎0ǬkbG 5vkUڵjW Ưu !/uVߥ߇wR]xcMv7ߍ%F#Hp;fM!v_z!O.s}j_|pqjW)9Fv]c'Džm;ʿ۸ qH5IkoԎD֧U(9򘄳P_UmNe3y6~a 2rDŽ?0p|'~ ba߇R8xw +.?Ni@{[M9'Č]40r3et7Zx ߠbf?m2@LU[o /oa;m2ba@<ڸ7*Twٺq_w vo_-}M|Nc ]49kG/qHkKp5AdcPrz -A~0VzX+Z~RcP@q U6Nh8ģc`qU'qgh|^8q! N2E!X'&[+Kiԡ#Tw®3#޻56(ֹ,9ƶqfO1gBY{!/?*_?*ND۫+eAxņkVRox]\rqiYk;P;W's]: R8i4~~q/\Pv[D7\EF*to0i?Lʴk^>GaO|Ɲ0!N8;BbV.'aڙ|(v`*FNBCJMN%rKJe#_Ls8uy[[+/bXثb͊6*ثb͊6*ثb/F3\BB'ClaAmW,!cZB銯뙇1V4Mw(0+}sup>JwAT1[t\Ĩ"4r~xR)ej)sӎfN(oUs`U~FkJtl *z\Ֆ\ MCE1WvW#)W(yoO4f5$b#AGdzQ␊rY'3K!Ǐ|OfU>)U=ZEatq8I3EJޫ{*DVn/.ɗdV{(>fw-5`z36ƓYg/drRY~VUb]Gs;+MKdXkvV)vVN̛[*p® aK5> eVnL)fmtvP8m]vʜIkYv2P]LUXSvY7(TS`v/KaWfƒ,~#'N2m!Jt8ҺqusSWWjwqwȿ rb] LP`x̾~DAuLrZͅ]LUS2)veM]6*b}4r4pVEWeͅZ8S'hc X`Wfv=MU)=0ޙK5<.ͅ]*c zCl ^*UNjW\B(ibQ8v—e]֦,K/\Un76*ثbM>%nS'%z2Lee]® 6JrCרɐY K)&,V|20\5d鏍$Ŧ%^JEqd#Xt$-AXTWH T=c**lCdY"\2I呑bTf70rÁGLB9rCM둍[G r%ǩ fru#E2Oo3 6}vp?2A,t1ңHj;utI)3*5AśQ2$r]zREF(m0*RkJQ8]mivGUz`qV P쳅.ƍ'NW $1AIrJ'ĜNZ$۬jTCc,؝5d#t oZ^/PjS$K@Spr1r1(mH_%Jr2hqK\*H-4 iӏ]JaU?^\u+|zo("BdBs T#lR|  flB~t•C^vb_ ]|ב` *6*ثb͊6*ثb͊6*ثѵėHQyQVv&)\iZ wqW(LiWi\qW#(Ӿ(lW/Fe]ʙ@06›I)x4u•4/Zj|ss9e&mT(H uRtaBiªC =KGzCGtŠ;|FEEKȎ1NzZJ#Hփ379TFGdS]GKbnr_lKZ?kSzw?yg=IfwXy.)+J|}51<‘a_+Zs-Ϧ?Zv?ِok NP7 (1N"a_N=a}ϣ -U9= r ec*m"0nãe v4 _2qc'aFXƓNٱWaՙKhv-L v`ӳV5U;k+- d;ŋ1®ʦ*Ԧ*6SE;`K1WTc>t5f#`~4U܆ Ӭe4,ͰoTE I8w{[݃?#a|cwiG_so'C&$E}%'dXZ)T|BQG*TPƉf}EeRPR0HOSpv2ֲ6**ث֌G˚@0!ي0\*b-,Y}W -fUـ]QZVd͉laU2 銻-Wv8 bŭ_)6)6*ثb͊Za,ABF^(k1] *ȽpװcbAiL*vl*55{Teg`*o8V)vc6*f]$%%re嚌Uن!]Zo]YIIGBI ?L6VاN*XN,V9ly5HcCdb pR*dbd8A#SbB:rGӏDGܜHB(@`[d^^OC|ץ:VDŽ.z?lڄPV: i\ԮH2^6P(l׏E cF[SJ9O +Ss59oæE [qC b59To!{S'j 5ƅ9h`92)痍aUȆ)lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q}0*+6Zo[v߹i*59*;elw­#l<;m(hֹL*+VըiW֣/+y=?|UGLtcVJ{whqXUil=qZqrZQV 8RNI8jrx>?,@@ȭ!qj w[>CpYnl8AP#<׹'MmѰ@ G@2?,UZ1ԓhCJb̑[v۰@ʥ́AF]>9YecO` ł, cO(+e8,B`|rcIV5sbDt«+u]MWb OJJC SM+ ]n8x!K{[S).8f#vjb}0< ;d;6ث]0#^٩7*p!tL?9\]2 vn8Ua*pLv-$IJlHb] \/דR}Wͅ]vlUxwfyBڙT b eCb j"AKo.UنvX]Cv 5́ZLUٰ]uOrȱ+dл6*ءٱWa _ei[vl*pŭ (\}1C8R vlU٨ De^.T$aTi]lvb++ ]\\L(F?2ᑁ 6هR(kZTx㖱Jc`aǩ%*v4S +Z{bbfH%PIZ.~)kop!iAE*+1܃*!&PM4qT7(4qxaVSQUA;Nk*AP[mxPlbC_3]|ו52%͊6*ثb͊6*ثb͊6*0tm<%!BFY2l؎lUS50'nƓMzaK`S)* o:(\RQb F*PE2׮E 7M2PPښ5 [ZS~B+Z-޴;cƦ 6[Ȩ_ Iszn0OOd[N|)的"|S7Eʸ_ &o~yLl-dK3Uz㑩#M.yn0In=j!Tۑ!](Q$qR+!=Fײ*NbFXHo:bXD*.ȰWƶ*?<(rm;FcY~`kWI >Yc];,FVʝs!$7%پ7^'Z.í/N =e0q `S2-sЮO)-z,zsԨOzZ>r>8OLY|ڐ zShqE*Lj~,AK B~xe փ:(ZvX?}2@N+%)S2s] Z9Dw2dSW| UXe-t]--LaZ͛ "S'I=(a*aZ]\i@~4Y@zƟ#'{֚nG1#kM6ՌsCR\WU#|A56cR۱0 ۱R~+cJ xLZ;z[}Z@j7$ļ.|>Ěv8Y?gӱcV,W ~ 9dَ#p^"J_NX{(W/rJ{(j6ҽY[&ѨSGݙ*9ݍW(daT>' ;Gc0whၵ_ P{f(}`}پ2 Vc:;eaR)/LAtݿ -ļ+Lm'ҋBz1fb2Ƞ)wBit"aC֤v64#pr%(:풯/y蓷|-k_o٦aGql | ު !; 8$k9D*,"Peq8) OZARP0å0JKc"5o>ȣsRdJ D {V:[F\ٯNI+=2(X|d+޸2UW;:`S/rƫ M3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^q\c R;eil>W1W3S|kb7[PM޸RmLbƛa0=U˾LiEjcI^A̫ Zg`cV:V5і~krO7Bnj%̧F4CAʃ-Rvbp`7_o9 l`=㽃iXinu=I=QjiDSD5}3"Q+Cr7qp7#Ӱμi%¿~LT޹g+n6~ՓtJJ쮙.8UeJ#-$)ɱoFZ""9h7…6\L X eOc(+܇q8piM%hɣ!5SLxMHB0%ϖhá _QA )άw`ĄJ] ,l wOQHp'2rNP!L_ gpy~? CG1᛿|VgZ)G]vmP5ڄ{QC(o7!LCJ媚T#_PŁarS*jIfQNUtf'z&@떵PV]zQ[ʟ,q5ZaJۮ0-6!yo Mjc$WW\\îʚd_a~CWf]vlUٱWf]vlUٱWf]vy:6?␣}~ٱUT ;lj%z]`Krl* pS(U#aՆءh*79DWs6+r%V7B'-—$96ޔ튵Vj׾`-ZTjm隼+Zbͺ_ykei . -[6GFJYkdyeE*sA}6!E[݉?Q3i[~S? .M5Sm:߁U1QML)lDtm pR]Ȕeқٕo >JCAqǝi `(.Ɠ!}֬N XabqUU '5+ QO6Dpe5'vXʦ۳S,#'Y/LQRw]o6uk~HOP~\(%ң8a\U٫Zc\VwW©Ń}+, PԦVbwKP.?݈?ntf_k!홬[S,NU.mi vQW0C@?(ɜ9sFqVثYCx˅8cK\hDZ͊, '-z *)fCjv]]\U͊:7ۖ#9eQxof2 WU#&t /¨νsjo rt~ٕMw\5'05]—efƧ+,› P VWXSo%Vzt}+KC5rV[C2A m[~ɮK#2*pDcՎqEr:a)2WlorUN%PVn,)iS-}CjߦאȪ& `qnԕe5R6 \7J(](7\58*g?ُ[49𲴇RdT _nOZ|8R"#+Mo#eٔ"VXU#zW+K&0cw:MBam8y7ͤQ޿Cr\HN2D|Csv튶=EmB*DLLrqWzPjW*5)NMe xЏlIRZ7l7-sڸjdekE_ɐ, N?W"8yWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb^qk6sWSS\U6PW B:o: WC\S.D5aO <2Ih!_ `5&:bh7{T}cR\}Jlv*jj(CbW)褧`5=W;?,aC3写^6><#it<@%>HVN O&s݌(;Pe\jE9=Hr3}s?. Ui2zLÀtC66v]}QROpyX:JJlup#c؜!U"=r=AL(T]L'c!xwfܢS˛ Z|U`P'e# %"E -oLrRz\ o&=h>g+N *NpZӲD xN4acƚv ¬×on,\e<[xAƚ|0zx 2w,xur\#O^8^.»c߮S=89a* khG Sy_V.釉i3OV"@=NYiR@ 4cةHpp 7aM~tRx֞?NL8)\\dd/ v@t-6~' KE=~o+?N oo\cynw[U0yy.]^גƵzїӭTw}ʉ[Le_g_}O.ޱ)#O׬8^>m/Kɯ]{o/g=]1eS\xmH$<jɌڿ>?`7~5Ze~~?هm:¶f.}W,_6Rܿ ir4 Z˦"$q'%EP+~+pJuGԇnOxc"ZEt 2ZUUb<;e8*jé˯9+@kE7g!{Ja\\rU6ۯ㖻(su˦k