SExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 13:52:32  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T?\9foiIpGW.`N2[sq1jxȻsi6 s՚?Wzc궷Y`{};+?b'SȆ=&YP:}Z!W[Ǜ?q"5@C9Kabu1l!ڽ4P/WnF͸q2]ഽpGOltlUt2mvPyǩDHXs\ŎF __ OIe2|b 繻6Zlm{VYkgUɥ1>kK ӻ7&b,zf?O9uVTƶFT+dl]垣EX/%h߹ֵPZ+,)eRHVY乬ƷՆ4'w[,쮜l`Zed^^51YA_GwUշYMҘs,,cZ`}\sm̦8}_gV1.59NnP{kxgn.E^ܗ;O< J$HpbeQcnlY3h}9gtn}ٻV#vk+ ߌ%kmY?_./mc.y԰g)#ynſK,v>cm0ٓmfM~/}VF-z6=;?&ڟ}S[.tb~KVNoQwQv)/Umsk2B12sk i7Sc ic?1Gm7: ꙹזUuin=7~VՇn'[WQՋq-i{-$mwY3ٿM޴>پ&WlM?2Go>Cu_#˚.8kuqL=Wǧ' g7#)m0dfY6W+6 z1sj=K+WSWwC?Eg5n2S1^ָz=WW{ KᜪCinM 17=T}ę"ևInS:?}%,籛NwZU=Fl+q嶶o]?.VxO9k`кIYK<~nn{}u?Q cu5uӰѴ{cqvg\[y4}͖_erW~X?ChȰ=[ߝY#5w=@t218RSaK67S[zVc\6*S á,5t4YUL{>WOXVð讖%/).g3wK^2x`cCvqjId|f8tc]{3'1A"AOJ3zf>Ckͬch:߼<V_GNm`$V6U.ۻs.Ϡ8WӲ[79wg&ߦmq\oo%=[Xa{k״M}?_}NbiόG 518C3y{eh@#zUŻKC2sokY;ZKv6KpuﱷG繵˝͛#DĮ'^%WJyް&Kvp>38ZU3&]Kmdtٹhg?s  =yv0|:&2Q6{'U"KO4g?ɟb'?ޱ6zax?K=c7#|gXùϺ*OVe3&lj8 eqGmqjJʯ|zrr.oqC){~C6n}8.(Z`AvMsK.sSn{3~E~jH1^B32↜xx94͖loC ns6۹sϬY88ؙƽ){]vmg_@T*F=m{;tKs\1t@hj uNGE_8|~oJI8*Tmo8nmVzߡcYc.YN@ > 5_mZx}KWuYډK+nL?{ LJuzgu61dO򩥾J@&ccŠ㯣tރeUaQ` s9c5~]hVululV>Hn3~ֻ_7ѳcv<9cߪfVΠlɿۊi'}TS\0ݭezi€2e"QPU=kC&Chpk stq,{/MqM{,d!ߙ|moW3ߍm+xv_c7DIk@T&q](Jn;jc-n@oK?VsZVE~SuX{\"Zc%G!0׺py`mۿ;ٿjƣȮ۬m449-c+l:eW[ȷe&~Peοzo"X'Ѣ(GmG1b5{El{j%su_S[^=N"kFX;k$Swnzeީ;˟ǰͭ>\@{l깷{}u?zcs> щءCGG[/~G*zşNTf r,k]"}!w^6s:LTI$Mmgnw.^=}Vde۬?%8%TڞStY]U[Sv]lkZݾ1mW;\'Ҫ01[gUXÊ4d'/s7*bܜ|FY|-ѻs[hA2ى/?R鴺`gҭkXunX~>{l=,$ R,/ы}Z?Ek-}gmv>Zjq3˶{Aǻ%7nǮ֮Y"A,]Pu\:p["]nuk[g,cK mxί o?K?cz1YD@mWmw˙Cqm-R\}/kg ~@wIAF@Lgccc h:pͼY8ؾ>]ls}?Wzc궷Y`{};+?b'SȆ=&YP:}Z!W[Ǜ?q"5@C9Kabu1l!ڽ4P/WnF͸q2]ഽpGOltlUt2mvPyǩDHXs\ŎF __ OIe2|b 繻6Zlm{VYkgUɥ1>kK ӻ7&b,zf?O9uVTƶFT+dl]垣EX/%h߹ֵPZ+,)eRHVY乬ƷՆ4'w[,쮜l`Zed^^51YA_GwUշYMҘs,,cZ`}\sm̦8}_gV1.59NnP{kxgn.E^ܗ;O< J$HpbeQcnlY3h}9gtn}ٻV#vk+ ߌ%kmY?_./mc.y԰g)#ynſK,v>cm0ٓmfM~/}VF-z6=;?&ڟ}S[.tb~KVNoQwQv)/Umsk2B12sk i7Sc ic?1Gm7: ꙹזUuin=7~VՇn'[WQՋq-i{-$mwY3ٿM޴>پ&WlM?2Go>Cu_#˚.8kuqL=Wǧ' g7#)m0dfY6W+6 z1sj=K+WSWwC?Eg5n2S1^ָz=WW{ KᜪCinM 17=T}ę"ևInS:?}%,籛NwZU=Fl+q嶶o]?.VxO9k`кIYK<~nn{}u?Q cu5uӰѴ{cqvg\[y4}͖_erW~X?ChȰ=[ߝY#5w=@t218RSaK67S[zVc\6*S á,5t4YUL{>WOXVð讖%/).g3wK^2x`cCvqjId|f8tc]{3'1A"AOJ3zf>Ckͬch:߼<V_GNm`$V6U.ۻs.Ϡ8WӲ[79wg&ߦmq\oo%=[Xa{k״M}?_}NbiόG 518C3y{eh@#zUŻKC2sokY;ZKv6KpuﱷG繵˝͛#DĮ'^%WJyް&Kvp>38ZU3&]Kmdtٹhg?s  =yv0|:&2Q6{'U"KO4g?ɟb'?ޱ6zax?K=c7#|gXùϺ*OVe3&lj8 eqGmqjJʯ|zrr.oqC){~C6n}8.(Z`AvMsK.sSn{3~E~jH1^B32↜xx94͖loC ns6۹sϬY88ؙƽ){]vmg_@T*F=m{;tKs\1t@hj uNGE_8|~oJI8*Tmo8nmVzߡcYc.YN@ > 5_mZx}KWuYډK+nL?{ LJuzgu61dO򩥾J@&ccŠ㯣tރeUaQ` s9c5~]hVululV>Hn3~ֻ_7ѳcv<9cߪfVΠlɿۊi'}TS\0ݭezi€2e"QPU=kC&Chpk stq,{/MqM{,d!ߙ|moW3ߍm+xv_c7DIk@T&q](Jn;jc-n@oK?VsZVE~SuX{\"Zc%G!0׺py`mۿ;ٿjƣȮ۬m449-c+l:eW[ȷe&~Peοzo"X'Ѣ(GmG1b5{El{j%su_S[^=N"kFX;k$Swnzeީ;˟ǰͭ>\@{l깷{}u?zcs> щءCGG[/~G*zşNTf r,k]"}!w^6s:LTI$Mmgnw.^=}Vde۬?%8%TڞStY]U[Sv]lkZݾ1mW;\'Ҫ01[gUXÊ4d'/s7*bܜ|FY|-ѻs[hA2ى/?R鴺`gҭkXunX~>{l=,$ R,/ы}Z?Ek-}gmv>Zjq3˶{Aǻ%7nǮ֮Y"A,]Pu\:p["]nuk[g,cK mxί o?K?cz1YD@mWmw˙Cqm-R\}/kg ~@wIAF@Lgccc h:pͼY8ؾ>]ls} ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$Ҹk\Pᚸ|Cu+ʴb7–>,9%٫Wf=0+죁]v5*캜RCW|R챊kWe]1We쮸;*.ZaC\ n/vU1Wf]bˮ*]-]SvfLU4]Mzbf=0%وv4m3SvZ(Ƨl*|RkSv47vQNb]#vX끋9Xw ]#zv0Uw|U}6kNv9@;+2o Uؠ~.ː.c;,PSB;aWfI@ٹ`G]b܁%؜WcXtke!ح1WeW잸$e4]RJ$R UW,(A׮*lRQ^ؤiBEʠHJ9Q]n'*]Qce3EP®ƅX WeI'!~Uؔp}-zdG 0! icB(v8Jo,]X}>.ƅX~b_qWcF;v][oUQ Id ..͊6*ثb͊'tmH̊IH[,HA=ā ivUZzoi]<)jƂRx7OM|7Ն<?5cN̞? fkRx7OM|7ՂZo <OM|7ՏV'343X)]<'jZ|jDŽ+Y43Xwdoo dWSM|7Սo2x)f'33X(!ZzoS{E VVӿ_5c´߮93Xz/jDž(_N}7Ճ7_N}7Շ&뿎71jDŽ!; f ]s/43XW۱>Xӿ_5`Wz/jDž]?ooWz Vg f z fpkoo߮9x V&*\&c+1jSV_5d%Ys43XxBCf>Y}7ՏM7귎WoO}7ՇiQrvf\4Qs?_5dxCz<`vjbUrVfRoVfz}7Շ[[1ݏhjpw|rv==/f1 NQu7Ր9l5cA]l5`w3|coWs8oVÜ/3Y.G+?eo둥w3?eo놂}7ƕc:w w3oM; g(~ E;ƶeoM6i=o |ߠlr-;go9GAOfh-:,h6f(-5: ;+|4hv?"cZƕ i?Ct[A?qusӯ\us~(uqE?p]\ZR?q:CFO\W0ѭ??us~?us~uqk:{V=~'Ji-~'JIO\4om\ Nm;toOšvP\V?fo;+e'ߣ-'v7l\SNtz쿉i O\Ve'e 65NZvW it+iiGNTqN4?Zvou)O-;#N$KNǶKNtUKNt@ӏ|iiFWN8ӱ+ǷƖl+PW\iikc ҝii׏qboa+iii_Zv;1j>[ii_UZvY!iSiߪBj);놖|uv Fᥧfk7Ɩk(Z}Ӳ]iR@Ɩk(@TKNK(X}*qSbji4P)_~~4tpzHFUnv"[aNEyWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثbO,BGw`F9{$aVCvQXyxL Uc6Ap s`WW51WW51W R]1b6vYv4Uv]ksU#6(o.bchqV\UXRKy!َva1]F)\2iN;k1*c6*u#"WCubrIuqT⮮9G) f&Nlf))v]1KG0]늴NQ\1A\3 X2bإP튵*g1z튴W\U£ ]S*a6vj`* ])k(‡\1 JWev`2LG/ Zʦ62*]qWev6][\Fn|qWebeb+[銻(i]8a"1.ȱv]1Wf#vQ4[]\8\sn+--_ l)dʠˠA+vj-LU*W,Uk[]SbLU٩]LUT®ƕ\1vlUdwUklp+N**2A]QC[80+Yxَ*UDbfv:bvj|WeCWv8UXlf*&F;7]\\ǐVv6ٺư#lcQ zd)] `We;Kɂc) %qWp˜RUt%}8٧wX1эKS/, &v8ZdL@Ȕ)w]LUT# 51Wf#]*bfva )v5vX0l 좸}]:e|WevlU٨1Wfv8L*o\UE0t]NvR.*vQl*kp)vY4LUDrbfLUؙcኻ-A`H)vRbc$~ Al ]J>-ؐ>!qWc5ʀ T;ڜXbŢp:KPኻGÊ.(I+eFثÊ{bsaʽ ®cZ 4E]k*kFCÅ._ aWb248yPLU􌪚bĻ)>ER젵j9ҘC*(]ov19Wv(JbĖv;S—fXv*SLX*]Ql1Wc ը>*k#vh u {m.ʞR0IǁS\e3; @WfY9L+ ]*fcG]ߩf CY~,K;6*ثb͊6*WcOBR>$!6*XR3u.(o0!Uنq͊N\48pŬburW{k(b1vQ)p†)lcN*aV8cF)o1[Ɠ({eb] SN#e(.81VnU٫Z9)l1bKN4Ccp+c(R8dX VdpL* U`(.'/F\▲tn62B]*9DbCa(m5o7*q;5 2} 㙈w®w1aVVU٘e L*u2 ]^إӊ3S UXcJ7FeTbeu][0 M68ٔ]aV0T$HRsʞ9)Wc@I]]WcI*+7b1WeSv7b銻7SI]F*ƒ*쪎aK㊻)8;ULI튻)KmኻEEF*M:\UٍIA]G{7ZWvdaZXجn \Pͱ߮(v&Tn.˒T8j:xҤo]SQvg' $JزE|1C#q]uE7]C0}7)b erj+tNDқW6)vQ`1We'66n\'S( b֘vl lfE0n*fZʦ*]qWebvY5]\(va]*n*nSvPj`We;lUʦo0;WW1WeW *ykp+`We] ]1WeUjbvث"Tr(vP𫲱vV4Ӯur WW1WE ;dW260+\UDq1b1u1lF Cc,1je+o(dPqWf0+Ɩ+jrIvS 1v81vn@6csY\n)v8j)K.Sbp.).8A"02WfC%{W .q[vVv`+]a+qvQ® \*qf*1QָEqWe*jqKi*®ʦ*ň®N]NثWcaWf"ٍFv$ U<vg]Hv8Ah;3wƼؖ]P R=+@WaMH]CƤbă6]IƢ2G.ƪQJqC)Kn1KJQZE cv,u;-e5WcrIv$S`68Uؘք.®j PN*E+1ߠ]b Uv\g7#LUؕ|Uث]ZL)v(wb:R*첻C.ǫm5ܨS)v8〡cNPI)]P+|)v540+좵1We*o*qWa^"X`LvlUٱWf]vlU4ğ8/$6WS*–f W0.`CYXSlf\r$j`CcsVYVUٱWeW []1UVU| X- ۳t]\mjqCt)bĶ3`Ct͊sTbm-bᚘ쳅-c Scl Jd;(e\b*xur[JR(-5r4S0$`Cq2h#zcj8L\)\ur}WW1[buqb5o15pu12A;b冮U&p5.*z銻7*ثlc a eIv4lpx"cjr(vS#l--*0+J]lU@Pw.ʡv%}89o]|_CpA@4qWe UC_!,)W`sSRi'bjOXMCAC^ث3@v]fOث\Ux;bh;qF*x$]@=;bǡ7=1C8إb:p8H2=`lUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb_,FGU;tsKQ8yU]LPvbqK UxRC*i8U`b[\bp*mp1WS6*^(e6)opAٰy}1b2*c\Rf͊nXP죊qUeW]L⮦6Lqˊ\Uf&˭p+yXٰ+VV.* 늴66*lUebjb] Uَ*n(o.pfep]CuOlUXyWU]L]LUu3UٱWe\U_lu1W ӦI]CqK;/5jqV@L(vj`KLHhRe0}V102, u1;*U˦T͊L\M3VH2 M6—S(Jck-EBer]L0!]J9e7LN4(*q0ZW\cWeZ9tv6UӒKyC\Ui9$7FvavQur)jUXUuZʮ*PlcKdUiUف=q paJWS7*@WW1VvX8َ!]L*إXوt]̓,Hvc+I.8َ*a>UvSb)EwƖŃyc|!K4(+NQ늻1ŋ18\U]1K.*8Uj)۲b ]5]Lr0+tsbiebj{CIR8b6D [(Q\CLaK!lUi*6.AmL ]d1V K ]$flUؘ)vc]cq;aCb8We] Uٛ2Wc%]]һ(Wcl!]\(v0#_ R;5|Rˊk\UQv17늻(= A]/ .)v47UMRqWeφ(v&]W)y7—ck ]$0+܎6?F*IM8RJ:1+C{PISqWcvR*6Ҩ{^GcC{Uٶ_$;42ٮ t8ٞ0hI銻Pzb7]X*N(bE6;5 U^2pB®(>R-(߆*ERj@`WcC+у;B]nf A1Wbq!v.AɁLUmGS~*+e@.xثb͊6*ثi8F\K)+zqCUi.8ti8U0!.t][.r8aÚZ"RsS fL vQ8Ɲ፥1V V:2Y%v`+]Zeb*^*m7]b]vV(u3b]Lث(W Jb VP71Ny| ثyxRI8cI[cA T;/ 'f \i4$𡼭o]p!F)hQ57LAicJGc@ɥol*8Uȯ| ho1VȦb@]Lg\W b<*bo*.ʦv^(vlUٍqKqWfm*6172(pJ +y N*#|*e+*w u%'TTbvW IƣKxmz y=C QlJNNMvb{v5w/v^'$Z51v[Fһ7M%\EjzJęxvW_)v4ثMWelPH]G1Wb<~:Ӧ*}*] WfG!ى5 [vS5:VI.C_U٩CBw8{v*`Zm튻cث5u]ӊ#`EqK;EGqWeDyv)5ƵG؜<Sɣ| lUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb_+FGHSG'-J k*U1CG50+Yxو]XUtʦlf88Vu0+YbW k5p+ӳRʦo. W51WW5)[́ Ź.]\(]\R쮸qKu1WeSӫ*1ZQ]LݱWS0]L]pYDb8RWlU@`WS#4 b1+*v^*+; KYx6;)C7*ث U͊Wf]o+vj\UT޸jTe]U*|R0sbųӦlUnl LU٩(U}v\r$5plcN;1vbk* *)2hإ[˦*L)k7)+Ń\uA.f85%Wc(kW 1C52%]bS.blRebY8JbثEcL cy)cJ<1v`qWe[IxU;bWqBUXt]^ٕk8RX*#.˦E 2Wf!]$e U6e\FvW\U٩]v]L* ݰٱWe vl* aWcNvQ8F*v0*0nءk-0"̢r n@P<1M4qE7\SNSe]v]늻vX‡c@]Vr6a lcUTv_Jhkݎ- fPaP0pqKx6Ȕ8 AIk*3MpRq!؄ |ةmpPՠ®'|ivZ KRcMK2qKzvY9$*һƦ)]0+ *u1*죁]Wf Ni] %ٓn)ǮPkWZl2A/+/svV0]bv8#S|U(*g:/LU|)v96E® bdpRr ]vR]U%zbc\K۩]Ȥ&v7z01WbS%١PVc*>;.X_2s֔]/NWe+_ ӱy#ɏ'c]/\mS|# ]8)v,x_F(vhPءٚ0E1K*P* bbjxvO1UWcN.rN+)c bIkN#%*UXPr]!‡bgN>:ZbeDܫCU)8.1*7;,NX؟*v)vT p!戓_ *쯞(vTv%vlUٱWf]vu#1De)th ' VҙC|*㗁Y;/5Ź fy.9g vY8aV`VWf8U0!cNA0L1V죀O)k+ 2LU٘m2K(o5qWefq͑b$UP$;6*r, ]ad[%Mȭ"6>?kyn@PbWS]$U5A?YTyڎ'*H+ZF|,JɆ}R(.H%ZoDvZ0!w'l )1p\){N]LcŠo,ov1lm1WcȫRz +Sj#J፭rioEqW Z,P ڀ{e=נո6] ==M۷O֝5ʁgKciO*R@)\Vc)V\0丷Ԕd.XOo.QHچ)*GU dB;vsi70·FɂWMBP1'dЮnTVN]SLUxٱC.f m|1[o15+aW`Vybl8[G"aK{b*Wc6 ^gF]Ara4_[ě ( l0*lrfXp|vQC4f42 ؓV)v6_&PW<O&Ql[yWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثbO,FGU;tc%qK銻,`WeFcUqVUN*eUثbͅ[L us]DeV*2 'nu‡S0ebeN*saWW,bLƸV^k1 pLUb8UنvV)lf (n,`C@l leo\N_ q®Y]\UvlR]0U2b F qjQBS*c ­—e,6DaI!]\kb;ur*q!i.8U7JLB';JWe]mb!2n.Š2ًW|Uٕ®:+8uc]w,cSQ\(w]F8p!eWc턡vCI] (vQ\ iAUeS 쳓d "U1Webva*v%]2!͖(WeH L]v']6J*q‡c\U`S[l]' (aKĚlp! JUNv.Pc(v8[Pa3NRX+x]}@9u]Wp]+'e®|Rޣ1xƧ+_|Pw5)k,;E4]E;eIDc<=1Rl\ fRcȡث71CIJ{ mT1.ǤS˘zto]I/LI;/.mn~^;UCI@.9 e\%'gcB:bbр.XS,]uUqKIBjbcd^q@LUk.#8v=\ƖݱK[v.-6]QZ X`\vlUٱWf]vlUtğ8,䒳*t7 \rk1qVaZ9Cy [YZ8죄+c0َ* M𫫘UE1KyG;+3VLRŋ}sWf88fY18`+v®]kk6* \qGH1O/Hz(-֝7s:We54k3 yLBUh Q_.4gR A)zaWjJUU^(L&Ӓ0K|j+Ν:km>=:x:K?gӓ /l&nP{rmm?QPշp߉B'0&i41\[;f#pRm6vc|RҘӍ!'vV,PV*R1jޝK;Q㐐d !,Rդ1.ZT!M7@pƾA\~%j lld5T󵝃4 Ӎ(4tZ\F{ׯu9IцPrڸ s2~z' ^ᮥ9ЭzOVcrn?gOIFR ,Qv5\dm Zu\M!I?"rпF_ 4䄐82Rov8m6DZA Z6ێ-=1C\Rtdv 0˞rO*\D]LXB(>UƆ %d;\eTWl4W|)k*Q9$cHDnثv0)#eHUXĭɨ[J`q[6֡_ ~AvJ.~pt4 8-dn8^'2?@wWjC+¡k(˜8Xи)@ yq?kϓq_dpZ]i^/\ihWj9P~l:-Ŵ<?1A]$jAQېw?lN\Ff2XBQI]"A.$(e1Wc bĂ_ 0mB+LUҽ[—c\'߶*£pk_ {A*"o*M iWc[cx*+nX;0:t*myjQ&27#/$z$IE [pEɚG!J?h/pz#f&6U.yO@auŏk5:M"-. )Mg hpmZ4n^[.ʥr%ynWeV0%}rKNƐqi)h㰥ٱC+]*7)ن*1KU늶11Cc51WfvXȫ*4|!\r61k9%k.,HC<&p[/ ]#lcH*V*uiZjCe(A# \ZVLNɕ[9 3_+2̋'r(?SlF#cmC:-9rU~&,%(f#akV+VU'āS֞nl4 ^ʑ>C%11J(Ced?1 PZӤ`)-%b0P7LFza kzm;7 vv:Ʊo)d]6* *8F)v]1Wf]vlUp+]0`=1WcNSʸR85]*tPWBq);b7bƕ +Iu3ibmpن*~Xmpv$匋F5Zd(`We!]ma.ģnv=d]­Mm~ثK*k]īރ U٫C]LamPt88צEKS XfɆNˡ]ʛWfS]vmK*$`(vZw .jWv7*wQWerEzaKȯŀ+ 7,(vXlK+]_ȜR8~EI銻A#|)v$zUأHH|R찼;VCP0EP(v&)v(߮(vPև-jC𩧾*i)lRa@[*;P55=1Wfmث2GNRH OqQ#.JSdPV2Xo%xF^UL2v;1ݩ8 N7#Ng\U؂/w.5dZ Cr<هZ;vi!ٱWev,wņ¸؟ N*쮽1CRJ)2vf]vlUٱWf]GIxIhHKgp^YyWci]\[튵(mrW0 Uk]LbxG 6(u2)k6*죊[G8c( Ub9T.a\Ui4n. UeU1$( m-W-hqVYb݂Sy"} e0}?iI漹/,h챽OHkJJD^jmV44\]FQ`ۣWWya Zb=1[`F0լQ(o*ـ>4cnz)?F6BG.zoa< 6_dauFF/9B)-ckϺ_KGT?v+Ϻ_KWCO NQ[l͟Y7$?v6-q>ꁕB:Cx?pET G d6H& eڀcܫ+leQ+%: MOF6jy=zjh S𪍶4]->WB+Ӫp'S.k:$;~ 9^H;lD,EE>y}^Ek,t6Q6qF9Xk|aK=8*V_Uw-L?{<, : >zmE~˰VNkj`aWS/j~U%#g0+,k6%>bq¸ rk|8SG[?폦v8_SC-ڧ ݍ:?_ckn6kp8-* Jy$&iZn d7Co#ȧ)c RKg0{d;0i%g'`];UP?u3 >ΈQb<$?vZ";["P,e8#Ɲd6n}# іC%^tRX>`bLy{Rim'`lI<벱Wi]Gj$X @iDH\h:;v m!xVߗoW+s!tn%'Y * <8^_[hH=oCo>dITBf}|)vTu v8Mء؜\RP@{vej|WccR|)]q**?4L GAyWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثbO,FGwݜ@eadnqVɮ[1WeUٱWf]`Wep]Sv^**$Vv8U]Vl*l 2VW-͊2Kyx0ٰt]\UXlf*Ǯvl*2% /W6*$ckWn}qWS04LU*4(o-ZLUDbʦ*9t8YTP]C|*R퐶-2[qȕk04UxUCHvad]L ]FEN*t'&ZjF[1PAɾ,'Y{%F"X*H8y"Ê/Jwaw~5?ݟ8r}Ĥ&6ר$)HV]/Y԰8 ՇeoWו /|3%S?5ͼW3I^[WMd,yl?w"$"?/`yKM;k @yBj0ߨ^TzrksELob=k"V"U#l|a})B1M~YQp.R-+j ʻSL*촫 T۱mm; b` &,ݍ2،0 N֣*"F;df8&RqWep?h#u늻- v9]  Cl*Bn,~"w!վ1(S]0~2׎;z7.Pv(#=GqfM[-50;wP|؜3oFŸči,05wՓq05/ߙu="1eoƬG/-HF>)_?͋ BPj8/,߆- Y]StTx帉vq‌cg$KhXUX~G:{l.jC_+_XɚCF<m'~R*A rҧ?NET3q-ʤlGhO$Ěl GoJ}!jfYW/[ nҵp2Mjl$fY *+_X< ˮ;|J\Mx)ԵxAf;Z} j:ĭ;;=r5I2k_|"5؍ &n3S;k!,"1W QsI*qZ~vjw>bRhىo#SS8Q(Z'rRvߦ6N\2q\9[滒%(T9F!r8;k71ۃbA#%v[=Q Xݕ/vV*ث늻+vlUٱWf]vlUٱWeG!U jf$.ɥI!eSaxu$@Mb~aՅwcE5>WdN"2a!H$6#}_.9AY'Pz~N>C~?ٕb;Lb?_ao8r cQA\_*$Rj괶R*@&ٿ΅neȷ$W~J|c 5ҟ6]m(k,h?76kD\4D*N|!yt O(URUwsVU^__ЩļëK%$efB60nSQ,xM2ִumVIlӁX4ݲ&̈́!H-r^Q'%uPwN.ҩAe^\둉|w~GۦUc%'/b z 6T8?!b;`|k P+d'%ݼ|7PQ>N8fVaL n#(A8R2S(u1­) mQ6`cn˯[0.QMhbfڕZNVL`(Z)-L 12٫2]\Pl0|UE*SPBN1Cba٩Uz`61v]pk(A\(vYJ)+!q[һdJe0)4qK!ـ(uqxbevb7M-pv5Q[v_$neԦ۳3%$#1LG'qֻRnji'TӽЬpÑ*Tiɂ=s_$7`?uRU4k>1:+(P mJ\C X`LvlUٱWf]vlUƟI|h …/[ٱCb–-] 1ٱWe Uu] ebfn f*8–8[VU_TW&lHW U/㊢R6"6N/ZoXȈe T*5 +(`:ʏ?gt%ZE:TOJn+_h1_R6#sgVb>9?&ckQ̥<)Ǖ+ǵ2}=;N啽D&&,2 ;oԷu|TbدvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeV|@Ӣ/}X_RȐ"/ ָ b|3(lvdCz7'Tjim7Jn6%[ 6ߊ鱼\@SjuKQ.T$SP×I߲0U[qE{amf_$o#af&kwvGq!)9q}*E)h;^Әz΃N;SȻW;-EnTR:CdƩ#̆2Z)M?#"*WK4զP0/3'_lP.=*䀤T/o>.xIA#[ H̋޵ _U">d~WdnB_ WE28c3P%tVRI8W&9Wf]v`ivifR@>MG!8.KCjXS4s,~e}Q'b*l:cP. ܃}=Wbu0H'vb*9;zvY5oj}+Tm7 @'KNKAU\jcCܸ{WcN*tƑ^bc=ա>vT;- v8)#i#Hv9~0N$⿫vb(ܪH>U]`M؍伢V^y ]vlUٱWf]vlUٱWf]*6*ثb͊6*ثbO,FGw?ݜ9k$G75qWf.͊/(vUpt́Zͅ]]n]LU\ ءW|0pK\6-;,*]! ULU2Cxإizbî(k6leb®#vlUXy+*Qt\UqKV*vV(ngW+vj\UثWeU+7Z9UnXLT]*1WN)qePi';,bfQ\w\ jXb )o/FU6\h6޵ .u:bYE-ǣhz UMAC$x^?Gmsnb R?0c^$reN J>>[ ̻jWJnx*" 8 II-rd4*\Y;l;~ޛοO?kD$VDfERMIv<.+ŬY|ƤUqE ؂ąqN鎶u@=%%!O>!&.p` 8~z}})dzIE"QtA,'T=FI ʲ0;rb] i' 7N&Mi[х-*ej⮦lRᕋث/vQ])f(vQ8aKإ͊\vQ]⭌Uo(**Z͊6*\ثqCy*bckᎍ0#-yfҴ9R軯(9Q4[mNB5dxҕ댷l\W^qc'r %CFyq1$c˵NCC,( ᷖI-vVk|+p؀rL-1'!o;ďshU0E-R5/NĚHv;t?EY_o5L5m;NΤ߇qyӑO|%ZR۷ߔ|"HICX [ZC0YUj;]T9F^?wDA 9H忔'sU74tPز1[Zۮ*]eIvRl6؝rl݊eTbeȱv3 'f8c %Jc+S1;bS-_]Ls>$ ^S8UXs23qWb$p@)]`MH.6`o;,eq]ձWc^ ҠK5jV`C }w]ivb=WcZBث@#|U؃!$vnDj/RcCQSq'*`GP7L+cK!EwWcʊCbSo#!.0Ue R@![ح;XZ1v 7®\o] 60`AUbe | XҘ9p$ؚXعK )v=yhbsrU1We K]!0+XLRT#]ZPG`]0!ٱWf]vlUٱWgO8?F\%8/ ͊bLf®8Vo6vY­fo6vV*]vjWS0:mro+ +o,`Vcc`FFc9f ?QRZw783ˉ,X<1G"qgR|-pše4av7"e$͊.ӲӲ3"8i4."1lN|Yob=ʖly&%v__|A3Rm_Fi[Ply-7m߲Y* fZm+nI}AU &~86j{ -J ''R!"+n=_&,*ƼO ClkUC+Â*njoR1e$UїD3RUC)UڟknȿVV0P Hf^=8R3sho58Τn̟-.g-)AP'˗-'^?Cyp)chjEOwj/e]?k*1/[HfD ]et vXiӲ(vl*ثb͊6*ثb͊6* vqU==>F-R< ĿUB3"F%*{v?H LR%OCN<6({f2I&P=vߵˁ?op̬d |?_)G^.qoU;3+Ʋ۶)vP ڛv1LJኻ(~J\UEwzPPq=Fw#WfYWZ]",)LP`]mbcK@6n2]vbj ]r76b@F@mF*PR]~)v(W;•]OtC)LG<b͊6*ثb͊6*ثb*6*ثb͊6*ثbO,FGw?ݜ9k$4 kLZ-,bv6Uv8 3 Uc[8i]\xb\%^E]\Rfev:$e銇eR]bsS K:c]LPRbf[\Uثc*o6*Q*eW Li58c6*aZFnٱWf8t \Ri8lur..LP]-u3b͊15–5qRXvXœZ4vY]ؤ5.*X\UƞR80ƓQA\0kJ{)}X '}Z;Uɽ!H S=kV3 U<d`b8I/vJ e N'X-Pְ%xmLÂ($o/-'6[ ChAoqWw|[7m*zpj~ׂ֫gr' w? r^˰oұhFHz|݋I8 RH¢Bw]j@N_pQH/n4"ZPuo#@9A{et-ftǧl WiZźS+lRm)2pu2œUip#5qCux3`V ]jbW(P~yX`WW66\*Uƙ]lm-훗62aWS5p![jM:c|Piv[S5qWS/®r\ af8Y-RΦjPf 1Krro[E1 dX=l?f3 t9Ll [|2@Q71CJO4~s|0RO|iS+9^^SiG;~ ,1ָPB$?d-R+tr7{a֋,cjPȑLVIpt/-+m0y=D@Χٞ)J_һ8l{f) ]1Cb͊5qWeWbu*}6W^~፫t:~5<'֏Xi}O]C5*& NJ8ڞŧ<27Zi#G7 lL?q^=;/vj͊6*ehR)ձH [o|Z%VP,5Ek9`RA}+9-Xn|WN,¼ZWVAxy)#?qHDR*(&U?g~d|)QګCv>NVBC6i j& XS^#nqOL"+2 C ڭ{L `Ind rrAЎxt\mԚklQM)AT+ȯ.GL LU)P܈l;d2Hi] K;TKF*쥎6ح;v®ALJ( dULpZ+pZv2jx v:6-bs#1.ǢQwmæv_\U]i]ʘ1WfgW` ){eRK-kZf$ZcJٸb,d+nx5mW1Wc1Wf*z]Q!؟|8RXcfb*RLI|XB1)LJW;#v%@ؗ~>q֘(  sK*0#q]@ۦ(.We5k hKaWbhՒv,ɯ !u;,`Wc=._zaM-Xʔ)>wv=?1Wbgfv*T0Ncv&ĸ☥بaƒ늻 d,`]!ٱWf]vlUٱWgO8?F\%8/ ]v^*qWe.T'vV*ثvlUch*jbW+ v(k/ &Xc(b, *@(if>cv-Vl* N(hJ/t, (v1{fc-2$+VQN&4bE+ pE2tKqh){Pz F#Fǘ*jv"ϓZHLBP㔥+N ؜)S#HU֋kĝ53SСĠP0rqk6-k':Vy}śnؾƚdؙ&>_S`޻_%>*yNwH#vk|'QtofXUNMo\g̵ozrGiHXHBm`~-լf^.FW!!aApƲy#Aĩa KԨ2vU1cNLVEmͅ]b́]vlUن(qʚ2,VoAA칕j0/zӡfxnAK;ۜ.0d#veUcF'&r!/O7T8&-FY %eǏ-;npd.o ql|.4xe3CM:`hnБD#Bk~VNI4[ Aţ1C3jXӶ)v%s WcMFSUS]CߊӰ!VW̽0X#Q'T4MU @ߦ፹]gnH>Nh,y -ب+1o2 _޸H?ef0]L!XJ_cEv&'t5.MJևm0H@Mj*EN> phh)[#$J?^Z1VRƾԱ9RAKNW'w*|1ǿp*o qp G  Ǘŵ@&> .ެ]~=%?BiN8 ~8gʨԽeܿ!xy8׏.i0~8&oF)*祖x|w0>ufOc5}ksMCu?okd|eܑ.C/uqtax<w3Dx_OQ|3`?;vעoi_.^ujȘ"=}pG~BGȏ됧"=\ߪ;>xxżjޢoܯX=GͿPvG\1p3c>m x(# yS#MpVԕa\˾cn:wj:廩ZT@bd3Dܘ~ Kx'Y~4m\H_LhZ,3 ~eq+fm%'"C/ܐy/WGejFn{WrFV^G]$@zt8zdZ3[8Q4;ٕBPZ<njߊ?|Q'r 7T`c꧶D}?w!ʝc܀J A'ّX+W|ZWS Zΰzv^_iiJ;Wo9܅瑋Xf:`ti[(BT#fO.KGBRD91zUo|[)>~g?0uuyf./fˋrei, };~6mνdAHҿ/>!n!\_!ZX\lƦ6+_A1e"$?eb͊6*ث늻08.]ۮ*Uakv]Uu>8]$aБzy®=/Ny ]/FLjLQu%u1cG|es$xvyv#No7g|?,4&1H>?-T%bsãRĀa~-͊6*ثbɧt#ߕ҄|欉nC] wɕH@~^+Crq=Dr1{ֿ:#jحhh{q'qU(椏0աۍwX+@IJP~&Qɪ@*)p6=w2r?'O"E4S;Gu?ܐT,$̥AdؚmC0xl%RMJA ^$~qɬK|SLD 'vc]S.ͅ]#;+e.',(vcWcX`KvP\@zWcT8U|b]0!ؘA.:b(qv[ۦ*Hv4v6AͶ®ŹBlRbVUt Kv]Wa`We+r4F(vZu.,;bM(9PWb(v6V 8U؛K@.āPܫ,?&5]E5vbb6*Ev'.vex`K@ve v0 bˉñ —bӦ.Ǧ1 qWeͺ.@ˎ1Wb[;beqvSN*i8ƍPk7Wo~9(.)ň.en`\6_[ ~>_췸 oҩJaM5!KS;);O(L$Z\lݕ(ǏxCK !‰(y."0J̠?CWWLA]PN jU4=մ*iM7S˕WppBY'gU>_m|OM!SrDž|@n%YԒv;;c^(bkM|EyvI,R?ox[򞜤`6ϷXVo/EUGx=V(i׏|Y*k3%kֽHz}B]N Bݶ4}x`eov|\ǐqo;d\cɲv8o$Z!]#'S ]e\ Hv[-:`!i`E;qWcQ];6*,F1kre;Ӑ\yS+dKHqKpy&hASb}dFENOn<W"*t&$KŽwĨ2VĤBp9E !"հpGSIv;f]qWc޸NP2v14z]"݊[,(sAZFvP|R7賻ݺ|#|lFYK<NjOsG3R: S ?OcR8iӞ],ӊSs'ga3g_Wvt$ >#=j+qGܝt=ߓt }1B_H kӮYNFͻ;05ƘSv@~% :Ezt凟kp@1pxrFViPhj)',Y5xq-ǡ _o?0XN_K^ "NGրs_}L*4(E}g?k!7w*#*Hu5n)} 2{fYtiT֝UT] yxv8B*\@ЕntS_͓5*4 TEL$c-c ƚݚav5סvƕ8cJI">li]*M1K銻5I4C8ތ[*lDb>z*%8|*_Ө]}b{w](vP潱K)ņݱWe㱥z*?(SߵqWc-Abbv1Weʼ7Ľħ5)| ثb͊6*ثb͊6*ث*6*ثb͊6*ثbO,FGwݜrRbeebeͅ]Webӆ;8Iltˮ*yXC+1.na]⭌U.1Wee CZ9DU[\(vb1WcHe8lUث`C[C|*zK^* \P"7CI Zi]0l|'cwul?gi;WS8IDGA'78wk=uhjН_ A2SElCTc`V0{k{bFyV iǀϷ1c#nʩi̐"haܞrNlI"wu? Y&6d.\)E)FC~eC]dݿ0\DěXe~0XY'F?,!Jmxhtc8\DtT?'q_L{:rN?+w2??w[3Gq_L{4qms8\&=ߏG\8 ⯪ }NHi|N\2.O<?K>KD?bɚG0X1D?GḤ'ga_IO?bGzgd?T3D9cF~2?W/\4o|bF?>eKƎ0u,-֞'2QӁygiH3Lc [`{S)*3yxmǒڜcakr{>'<mB@=Q"(=r^[KFb~}]F? z֬ǏJo8@ &muDS#v XGQVcպu_\IP^:G_|eT Xھ>Kr;!U<\N 7=OZX?%j#_[ JQWw߯ϊ\P}1B9*8"5|{H\WÍ\Z`hQ:n:gi%QʟcV =C0;/}ɶG(⣗pz=5.m)NtmnV@(aot?yLE( xw}إV(d8#y;?<8'y;: Ïro'{ (~j}~("nc!ȿv<7>FCYTtEd>Z#`u+NM@LiWN?F(Immc2' 2գQfsԜ"[t\ώ+nQ$j͊]Lء͊6*ثb͊6*f]vlUٱWf]vlUٱWe#۩oSZ*\܏L3M|1+c,V5SFܟ}ޚcEcL`*rFQA'#i6A{I#4I^Q;KMl;J~#1ѢXmL}C#|5N"oyhEĉPz g Ʀ rasU\6<zCW a"m|m~]ZZkJZ)_L2򝷪ɀGuFzA:PNkIH9Fy ﷾BRAg&oVL7{a]gP7OrLoS!%$|_Fk^NH^ߎ<\[tG$D6nӸ /\-N%7\j$HvM.6ҜOsTǼvLpzGRvv9_-4l/1@vy6oZV9\#@gq*}d̈d|]ίG㳉jKػ3Xqxqhv4n*ثWeb͊6*ثb͊/vV*]LثWeb]We͊+vlUxWf]vlUٱWe\U 5VKHfNeiR Dvu1Wk3,@ܛ2Oc㴚sbd$ .o3::rmg]8~dK"vlUciFح&ir)g\-MD8*)N&;ʄ{X,U#;nbɥ1~{پtCP]@k;"oaԌڬ HWfۡO7"%M qjyX¼tRƪR Ld!*| u#Ų%PF@{z|{WNV3GGWf(6\f POMBP-j.`_ҮOߗc;G#Ji@+RBSpKHXIVk9MxE'hdK ?4on_?Ӯ9I"@[S=QN9<0ߑw@G?FD6>?wg[hoa%)ޫ)w{VNG—s|{Ki `' d{[;^amǔ5K-}*R LfT+.Tr r\DKcuZaeMf+\L a8Ӿ*Q}C $`KPi]#v4, PSL*Ƌ]Weh.2CN8ؐV]JW;1b  ٸq*`g"v=2,bO ̏]ᴻ)y R츨 W;4 UWt's]-" U 𞸫dr6ƻsm]8]2 RrQF*rAبT®v"ʬZ ]XTǦ*f.f)ء~|p%؟6#獫'cQْjL ƛRs*QP]PS|0+AWanAm X`<vlUٱWf]vlUƟI|h «sb͊(eaWf]]Svjb]v;s*+Rثy* *㗊6vc*bc+h;n/90P+umsb;IMb3Őv1a)e$W۱":۱6B8һ>G aT&\pXDW }Ej;kڲ!r<<ԟTZF%)e$N# ۆ^_gi|\%VȍG?ˋ/j܁*|A#K1Ϣ<[LjWd+<ߨ(2d(fg_WOO?I=pP#& VzipGxKp ^c~AaIvb6*좵GvRثL4Ⱦd m4]=8coT]v^g/'#p7!;rĻ ?~3T(6i `}\|1)S-6:D[(lcDxunc25hk!䋵+C:e:dd(E;)zdXӱXma7®+& Y6Ȑtzxpe\B2HQS_2}8/v' FL$jx; lmLg㐐9O ;ԷvB?Nnv$4}l!,:iHz`EA^&^}ٞ>Zvt']$T`4e{lώ@6v ~H)'ܾ7>!ҵ>3@"ֿjޞ%G*r*kWb?/i tԑ8n 4W~GZ=J5UG_Zi +p,H)CKG hW 75F<(v06۲8Jv[ٲ DžmؙO=24v(mКv>)NlM pIJvkv=*Gd;*F\vQ)to3?uǘWBRIF!?OllQB#OUGG-9 *}YBo pL/~l9m\$-~ $HNFYzxmysA[O-ĿWm?ԦT^N< ;|rI fK oi5~&^~OS&CDFjl|NW6 tlUx镅mˮu3Tkjॲ9Nf&GVc'RhՇʟ qW8r+L {aujG鿈g?S-4K۹?Z(~:_#j|{4}վ鐽wXA$ ;{(9,ris]8C-%b cq؊*w*LE\[]#] lX+a]c])v0շv*ւg"®˭@)vb®Ɓ]vY|Up!٩*i>% ],-F(v[!QbccjؠR0+V0»ClUf]㊻䂹c2{eUZ]_O | m~uLUjAiIT)v?qCߎʐ#l*o v?c|*춋pv_*((vn$w*˾v&jR@']LUdj®-P#4f> cw*~B:a!5\*{vZ=*xE EtnD]haNeڦ@.ثb͊6*ث??#. ~Vb͊6+vX͊+v^*\UUٰ+𫲱WeUN*e\3bbƑ[VE[.U Ŧ vs1r{@Ҋ]Z57F|U;—bM,v-*{gc5@Rvn)]Ƨl4C:KnG 1[v ŃX)cY$2/{=|Dm۶\#`Im?mV;|'Q+R? z?+?΋x2 ˀC#Ș629ze)R.\7߅HS;M`C?z%LopPKBxֵ)/$ݚA38k? _qAŻלG2D_'_ ǔx/)Ӟ>PQG !/Gd-;a.dhv;9*Wc]J KvcLUUٱWaM`hgᐔmhK&a%Mn'ڿ#ZnÛb|9wOڵ;M]#߮, _NB-R-!q[v)inq8ͨRiZDNhr&*d.m PHSGw _?ICHNY nFUNb K΃MY*J?/󝖕$cͮ?x:шcaB??1h!u xGRDW -1i&d (FE`=^U44۫xƒVݙ.;?‡Eܜ]tbתkkiS_,[7a 5㓷g a'vH9 bGFaÇ:?һ5^)6o;M p]$nF${1xAOO:t ?{i; N8ixjr\tڊVA)_|]kdCpƝ v+bdZi /Jx# yѦ.ot uR~ſ_Y[kb@O06Kٿg/.$r4G}~M4n"݆ƣpW_y+r5`Z@!? ́%/S&@Vثv߾*cFN]Zbe ۹]nU KB(*i*^,UشH|>Uء]~PMۮ*J P1Wc~]t*v&?U1T1Wc&8]zlU؅oQĠhlH5lJY \+VF RK]wJwȥÙ=Aޘ7B\4ᡥ?TCMNU- EOZ֢neT4-9}hOˁe4B&(NRx |%I7o&a@X}WqhE w jrİ^V'ȕEhEAWzhX=B$2]jblr)SZ׹%2(-9qG$h;j㓯//Hs;vA:nTNfrIJwXLlbhEr(x @?A˥pBlR#p3b]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vԬc{iG$qBߐx7qHs9ևxÑztټsG.ty|h BIw-jf5)NvdԌC_ 02G[i+Ok(SX.n$d8t+lH#PIFcEE6\ :\Lڊҽ7~((.R:v90O.9:E4+M$ZI _3غ~YsD oY8hI>!Uq1)\IZ5y F֘ndUpż}FTT24Cl252rN?;h ̝A#%,Ackʱ&Y%-gCrl\]]; XӜLǍ!LcIv7;5qWf]vV*ثb͊6*ث*ثWf]vlUxWf]vlUٱWf]vlUٱWf]vlUٱWbа t#Jyb7zR١?VNէCsO6g`a 7w'g0jP-%0ʲ |&q;:g5%Q+Ԕ=DSv`D; 祆u0C$v4iL90r&1$5o(3GD;!z<3Rj2qQu"RcӘcw>N;m[;—bA';Y_},$⣽rhv=@F㩂7a5OQjAa^ؒ\$E=&<.LE``S@ mi9%i k`6cMs: 1T̀UTj&?ωg$rR6ȥLR$%v  oD~?SѪҀ2גÀ.>?O]!` yvn8g2z勬LAaoYcɢ;ŷ|.19eCY"ZLMciu+]\xlQSI'\* z>E¨'zE#evs vj I1UJA-үmȕV9Wc3U6 FbT; DI4=K\|U(֦@daJx`sF(w7'Ggzc. =e~HcZa.}y?s_hFĆr 9gǿ_YD∀ F߆v Bȗc߂=&PǏK5'pGU1 _WՖ_l!M3[[QkVT{,ƟKfnQxe##eJHj"P#!4ȫ(hdCЂqE;u/V.Tȡ u916q1ܓU?~lT5$T.Ya*VV*$ @7q $B#v^ؿe>VؐO%PG^@18Ҙ)ö\QlW|-p 8*F.+^U`hNj@ lNVj=0A=~n{d[B(!T țla:o]X v=kJ(v4ø8ӊ\qK^8oJoC0+,)?v$8*JOlUٸΞ;HMg'*J*P+Zv[m㊻)a*8ƢvPE+]rhJv%įQv8~U؅& ALGAyWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثbO,FGwݜrR죄+c*Ub⮦X8Q[\U6*챊qV.˦(jy)vQ]bˮ(vV)vlP ثYG 3u](jp%Ԯ*8.q9DbU1We(U ebU2*ebن;U;bJ*5*CU=z GUڱvEsLzd+ vu3e :\ 5mS s> &)X|*F,[3(v^*ث6(vlUٱWf]vlUٱWf]vlUٱWf]bQ])vrO]HKu ?`r?MGnܩf0S59f9{|\`U6r$~,܏fK FX;p -fjPm'ӗo"Nb ҂SHWc c-'BgǮػ$4UPXI125C p;|UiR5kQLo%r"e>_[!Fi64,zⱳ76pA>ύ1U @ C ޠ@vǙZ4uz͸R؁&< w4[Yw[XG\i(v+qv7郊Ӱ4Sqv#LX*q*]"Dbeb͊6*b]1Wf늻50һ+Wf͊,UٱWeb͊6*ثb͊6*ثb͊6*ثvz=I`)>O #_7@#Y|; #.y[OU9>BK"J޿, [ vr_͋o^W~#~fF=bCv;855rOŊ ]{dH][GXCJvoqܖĺz^K~^kzr,GM4I0c]ښiaoBk,~i 'vp/̽+~2E,Hrlhgcp/. _r̕ܮU)d%?5^yeg]걚,gbU^rb&}Qـ`WfQb]WV@jV(wlr6I嬠#_8_EiTczV;ݲ̌O{lRUA>H; c+wT\­BH4 ਥYGiԌJ[|IZ8ۀۮUK OsLqއ*VXP$~1V5 <8Ҷ02jI߃4VGpu"VHBZY@j}9ӜDġT/V,W]vlUٱWf]vlUٱWf]vlUxUeW5 %-9+R#po̟!?=kjhS}W{Pjzz%d$e*qbeKmbh+(:̮Q4o]LUר—cC1U7|U@y6*{QGLP]$e)劻Άo*y*J{ǡcRF)v&(»̈F;-_KCQv(6һd+R0ӳRp)H_>8UMň!_[o]$S*?|"PW~ؐe4쳸®\RR"Yjz˨{be7ZUB@pFvbCmL*EOvRƥ Ro7GZvhUv]v=^c4Ɲ/Q)]U+ NI]Yyu]Ov5C)v(&]`iJ!Wf@.xثb͊6*ث_?#/ _/?3UxPT.1Wf8cvjf8bb͊].b͊6*UٱWf͊+vV*ear>Կ>[1``)-6(+Q}LU1Ob{`aVHĸWe%9cWcUa+a ᔗ< YCN-ixP*JB{dq3j>qzdao|9D*)Ďw ;pnYub0R)QQDk{+UVc_OSD`mIL IkYe׮ rg1QR)xvMG 2wp?WlclTET?欈"`SDGw}_淁0 ±~az9<0M1Qa7S K;A@1M`bfއ Zv5'lCu®%-]I]);"WeLUx4dlYfxO];2D.hCt@QvJt?3 p}zj_̗H#:xCLi0Х0JXŐ\O9E)_L\<Ԍرza7+ M: ,vRv&vykGIӖWr9؎?o&Z.OUz9S(܁=k "gP}( *Nܽ>4/YyoEl/gٿ']t01AJjFd\1vːTaHj#C_c#l㫒BeV}EZ"Mu4`71K``Bԩud{X !u{NT tFCl TR]r}銻*{U`6qWfAiƇ`O}Wb}ؑ;mSLRv*biF.Ǟ] q-^Ƃ<7Ѓt8áN*tR "SWbE)JbcTq®{bRmF?i(<=G# ]vlUٱWf]vlUٱWf]*6*ثb͊6*ثbO,FGwݜrRlf®Q]\kWeb(vU1WeWfvVvjVS #50ٱCWf]vQ]b͊S/lUPZ ]qVjG+ 6*p+yXU٩6*U/Ӆ-c,RѮXSrND5䘀+%@~Y]*O7}an_.n9Y[| f:RJ;mb A'b3AL d LZQ`]\]F,Kc#.]1Wf.͊,P]U٩.F*bevU0;.;*٩/e S Kp]m |7"i~NE ^i kQ6 G dHm_R-%mLLUOxO"i,!*h,/QR:c+ iNR OPt;RM8G~s_jcTnj('V (v (TH]jI'1;#x&?@r'yW>Gl-R> q%`!W:,OъkiD`"kMK&v)Sm4~.x*U??ePkdfkʣW_c! ƫvciQ'nhu? u= _ܕ|E$+ٸbn@o ;:]q@;Xb1M 2.o f7bo :`["B# WeUَ*Ucvc]6vlUc 6vjdUXb͊6*ثb͊/vjb]v8bJ@X1=)?TK)>?oȻ..G!>s$=1?vt2]%_22 Xy$skeaP 6+5dٲOaƱqIg3m]G؈Pƻ=]Vp ><;;$aӣ[(٥$fnLkQ0Q1w+иf0Fyhx?qE0j+6C8vp?+ܚ$ 0/fzaH7]@7>N@ybnf/Wv'H4{ QD%5y0sZ曜VE+Pa)'PՋ]Ev„<•}N_֝)mxuqq;]sϧU=ufz~_&1 t: Rxc<ׯiL1|@%C~ E]&x瀘ꨍW Fz`roC\U؋l62u]?Y6F'덺?-SLX5LZ90Bf&h2U%JNzL{M"3/cl7c'oQElI/7gGx8*-H4>8a$*HڡBq8jpHd҄HOqܖ12#`7m^G}ۅccWx2-OBeiTd0G}M"f=pT-NT$(*ezvn+&:|ۇx^`V8Y ry7c’ JHo `vj!]7)o51Wcʼnlao*LP졾*]銻51Wf+NF)vf*q4bc-T1eT1M߮JSkNL@cJK{IF}Mr lxOĞ<:¡zCOlVbw7lP ޒ4'G٩ร_.0% 0OSh5o*kЏ*8 fCK~ź(7+JYv^DA{ឝ\A=7,ZCJ215] @(K]=6,r|f|=+QZ%BaW|:FT+'nJvZ>$iԨnLb=ʦrM h3;%D'Q*tQĭrYa06ƣ&+([$T}tn$WoGV|@-nx'k6z#r>N/vO|CglM)VESnF៙ fFH?\>\ OENzuȒdQ`p#_pH"C5xKY;lۮh.}R?_5#H#㓭G v{T<+<;n F׶ksA~Ib}?^!sȴ?NR]Ph7NCk𙼩@]~q _V\:߸ b0%a {_,NsD$vUy"tjX6Xf ̧P{q jxD#܏@zǝ(?dx8QmG ]Nuʅ'Inhā>)8(܉ GC@*q*V S^늩k ~Hف^@K `I]1އ2G/F\QDZ0orJݣs C.LoZ<)OK /jS?*Č8ߦI3dIao6*ثb͊6*ثb͊6*ثb͊6)e*#9n#գ5ژѷ~*{uS'̿)I]:biFOir0j'MG֏:eyK=9%_#.<_K_wSǕ ႝnz_CH];+7ǖ/0SHYMY(8S6bsr;:42)? 6LLA'_N%uFF;lv`3pnXGPp%+Ur41pvȥ# Zv`1Av r+N v1v!%WbL2JzB>#!nGÄ(KmufV)"]'-PJS "]lF6[NŶ<ڄւ L8g=f>m&?v1Ù9?1~%-t$|GL@qÇV v }9cL?;8GG֘(Ač.'ztnƝFNٕb?C~,( ڧ4&@ALjyI%lJJw7s*r4jSnݏK*TPgO9?TeSR.X NQqjtLcJ(^\wzV *,usZRySUe"ڛè;lZNCvm鸡َ⽇l*HMoRʠV(vX@(rzn)veM,Uًʥ*;eқV؃E{Ÿxrn]?O]I؊㊻)j5h_%JQSN*LًSm]7E?ȕ<=G#[b͊6*ثb͊6*ثb*6*ثb͊6*ثbO,BGw`F\aV6* (⭌m1VVo6*be;+vlU٫6v^hbWZlU]\إ —W50+ 0+늭N;1—f/Vuq͊]We`VlUcvaZ˦var)k A:$E=v.chSxp|u6ETtS!nSLu!+TYalBBS*\P0Z#ʦ(n(vU<1Wf늻7U٩]참jWWT8(6lP&ҙ7 SMzbS7 Vf+bLNsO0Foh$mNA!lov|8p7?@2.z1Wf p="AQ0+rۡiŅPAEi'zQ+Bhc6C1)1AjхQ/+'{/SR@nDËw? HчA\ G.OafB .XǯoU $; c-kmVJ*J9b\(ז,-ssE'|F2H!ڔ>'"|@uRZjIBdQwI0Mjz ⪋+m'~ @>; 7تQrJ#&! xN>o/2xvs PBT4 ;hq"04E^"XgJ+O?1򯚑f:/sKvbJ6ɡ =p⠆ʹ&$LR*QkybXX0>.cJ ^*ijqKe 0㩋*[\J!p8 acMP1M:EqE:Ҹ!iX*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]cggj\Xoހe"f,zxKtProRO GdOy>MxohJ`ӍrdHZ.g%6_ n܇q_GB 7#pᦗ X# ƴ߁N1)$+ M+p^ Q, ~y$D u' <գݕR>08}c_źNƟi{/f2޽𱁰TRLUUE2C&bBh,Im]HeEb-%j;ezG*E0&D{Zv+9ž`Qһ$;`!iؓ%wLǁmْ*llIv3`8ڻɄva—eX*`WcUٽ1Czy Wbe0][^@͌ vvRm xZgd&C]o/@*O/f3rvy\j֢<-njI 3vs?;zGQ@(\} "@qvPYk.TYb\#)H쫍B6cXHS~L,0xvm<7}pUy?LDQ?9O8gԅ֦cTdIFȾ8xq]ſ"J@/XȀS.Q)'g<9#!1|, xcbzS:s8#9 ԗȭx#2/{ۺ-'[qyIƧ>#(CļTCP#h!^F@(dPz}858~ ;I@AVوZZUViiVV<_NHBA&:SW.`ƈI+M6╶6@#Ѵ[CieDPП5o?$$1bw83Lt ^*lUٱWf]vlUٱWf]vlUٱWf]vlUٽKtմ鬘W 9vr ~9)n#hXj0 KTҸ[)V>.̤qHv[6ܻRcZ )v&c*lUj|vR[ 3A]PLUؓ2®|r)Gӊ:4sƑ |RQݸB )VN,*BFriƹbJ)M0_ bCJd] 8ؙRPi<]LUؤ_|U؛ʩKt']n^Ƕ*NTQbbU=vZF>b1C2.̌i\Y;BwŃ@e*g*U8(v4ձKĜWv1W b4\Ԁ7=qWbv2 0]-60=)]zƼRBG 9ج&(v*itڈU8`|r.`_ؚ8nOhXim~ۮ;E eS%٩WWc\W𫫍:=B}Zd4iV呦-cb$) ݋)xfWOw͊;6w?LY1z~8itrLI#w7,x;b#$6->fӵ|0[jDhGr?Nj\e8EgTwp;"+JToW S{ӊʉK~J55~/~-/P͒qy@~(pJXlx6l1TM՘lT{s Hp{(PMOiJ"*ڤpF|2cŠ]'˜Iwb҆ՠopRzacp]\D׮Daӱޘ)i؛F1bI1 a,v#Uz,j>[PaAFc%TDWUu+ߏb[?o%?SbܑU_ BƄǰ~!S,UAL]6*ث]u$ &(úUP‡q&j[iF\H5 .Ke%ft6VxkJ_rX̰i̋d?_e7y3̚_NKJx&9OUvLVV٤Q$#Y>n dҀHOJ P~~<瑑'lmWh^=M=am88.Bx|?qu _q–~aƍhPj9xV"∑}%~ YPvqmѲKz/,M 14cRMh8!S47U2EUOؑ/&6 !6D?T?+Go@A_8ڴ*5l?Ǘ 8?1/^# Xl<7'n'VքͿ)]a K~dٺ 8һv?=Gmً6'$O\^ ]z8O~.~90jֽ 5bOtBk?3Gq%>nF["uh`N)INVc] b5bc 3b9i>@v+/pJj1)J­WqddvVP–9FD+Yx%FSL"RM:a,-}8\e3Z|+[j&|"RMR,f?HA(5 {TOe-&n2Tt]Xi]ǎH%A;S{U٤SN](vW EF(ƴ'=WcT+i@qWcB|UE@$ث&C'vX?Z7v4fp1P@88*젻|Dv1G?V*Uuk%q*^r X"i6XBik/& QVثb͊6*ثb͊6*ث*6*ثb͊6*ثbO,BG%i w`ER]18Cvj\UXK*UX!XbfxbeV[b9}qWf*1CyG 'f]L 0!(k/)vV*,F(le`CyWe*Uv]1V Up!ن*c⫲G}#[9(4SQc?}'"/S5:|ˈn"Pز|J4=:ec)}NR!TۅS)}Cδ_Y0ј~ + t. ,BP `\kڹrcZXUM'-+<~_H$)SjW$1wC_q 8u?*=Ë;6 T/İ$3@\q3-X<,Q obGcuƸMd*wןk%k'?eVTaKpbJ՘}qX/*.G&=a5S-ǔ;Wc(K&f5n *oi3(1l$x35??̳@6ˏV`+l{a"ķX\L9A&*ho94[Űqq)uq uR' Wv#,vx%؋&E3p$;0¹ $C HwfxCtYD;7끅S \m Ab=*{kvbC4"e늻1XJeb1K< LUCxJLUؾnRŧ?]#Q!n>$xe);`$*ag<9;]p]-F= aȞbOӀN1È%M ީ̇##oyZ e$~O@sjeDóf2EM>:g>>pN/2vyȜ־qWf.((c@zbYÚ}&ֆ*iZW+rK$N;kXGڀ?\(Wڌ.Dz_&HUN_ =zH$s55 E)^C9ckNGzxViR>TY8RBhEz ӕ~_,. *Ҽ^Bؚ$(ŒipNC*Ek?tA~bK$*ѭjz͖ 3bb͊6*ثb͊6*ثb͊6*ثWb J⛦WlS:]!n6F\|׌pS9 2WN"C>إJi -A8|A](:V,:`^SaWc\1x&q ®2Tv9>Wf0+ȡ?|UQC$nW 1; Nx~@Ў9.̛PUت'lv#sEv#)v5ID+ ]vd,vQ\ Œ*R2E:.X$CR_]9 ;0PN m~U!#1r qWbL lUء`RdLP1Wc5;bʻ.US?ĻCb͊6*ثbΟp$2 |h «sb͊*b]6*ثWeUنv_\ UٱWf]\ ثcpَ*U:Kyc-#UDU$P}Xw2Ծ&*E;F/_&W4)m*ǓvRqKᤖRJPSƃr.28frxN ۏAwD=SAJKQIv.D8M HȈSÏӮAR"1Iƴ J~+,u' /O2py???XYQGZ.?xZGA/ňsD$X}|=Yàdzm] EOð=1'ɏ!w4T en5c36rP65ۀ>!N i=8d!FȺ62ʜSOD!!Jqf5bӠ1a>^kO1թW'ׯ4yQJ" P} n(ӑL\ek1I+|inEܖaF Vڅ GZ}/Ͱ1- OӶIa1T5;TPmB0:dNSm\0Cl *Le>w*LAr_aR)]c]]v`qWf 鷆bG+Nv(gql*T 𫲈+v7q\ MܓJ WvfZwኻAQ쥭iA\Uة;a}Zf  TzF ]vlUٱWf]vlUٱWf]*6*ثb͊6*ثbO,BG%i w`EZ^*]LU ++v8 P죊]*P5qWf]]+v8bs6ثc5+0u3u]Liy]نRˮ(u3U1KUqCc*qW\\*k/vj⮦a* P][&?/t[}a%):hٷ=qӣ)) ~99."6 <|cArצ:1eKh(blBSzۉc1KEuƾƸ*YDbd eqō/+ӫ+)sq 51Wc-eSv]1Wf#vjbjaqWWKX⋅QvC)Sd7?EyePU6cP6h,zq=ղ sfH>y҂k?%)AEiET]@c}oȺɮ!&:f4cݫ>>"9x5|1UG\NU E .m yE!ԃƿi6)X=B9wwJ,?0.U'j4?UL&]av'G-|;&`G_Dkd=E\RY۔q?d{T:Ԭb>ČQK),OؚZYw$z͸1~/zqRN)?6#aN8R&k¤{*xᅘP%$?`Ҷp)VMʟ^-}NW,vFM(6zu>KW' QA8yTIFu5{S3yq4YGo-\;Wd>&0ԁ&a΁S0;0..WLUآ 2*sSpWnDbp9TqqE7\i\qE7\kLXqƝRp-;51Zv]1M:1E;*bfZb;6*ثb.3iw3S =z_DW8ϏӚedqw*n29-;Pe;Sw{T)[䃃q&;̏o Zۭ@*Cw 㐌/O}7E%N` < bVZ8qpmWc 0',%ɧ zDj9.7 =(x;WlBIm)5ǖgfly>q-AtpĚg u*h{mE{+}a,5>,`#e07Mۖ^ -n\piuqS /%W2dUm1v1jdi]<#bLf+hwR]ʼnv]Nv7D5U|-gN8N$bGs䞪"Ċa;`6]|(~:lL9v3Q6,[FM3.nL~]Y% mq/v^q%Kw9ZǏ*׶vxwf1܏{׀1]?, iMǏQn `Z UHUm倱GT)ŔN75:Y^I_ ʶ;,C+Y D|KJL*ƆD^eqScޘR!zʿhxaRe $חu-FymШl#cyr0J H^])"N>5J98TzZ|'"J|Bwhn]iz.zj~%. <7(Pu}> 2_`W`/>UZ7;b鎧)v%(.Twŋ^(lU،~cC]CqC]1.u]XjqWeVSv#v8w]X7]tr)A*y*FXxbzbPv0zb"qKC]F@.xثb͊6*ث??#. ~V]/vlUٱWeaK!ٱWf].LU*yٱWeUqJ(͊2CycSlRdY[ӕsoܾ O!^ŭA8Ōp'X!>צZjFvCS'wr&B S/|V"UȡKG*®8㊻`u_O/Mq To&@nQ!T͞pLre^z'5F@IZz zX g`\n#'7uO<Gȥ(vڠcb Ky#7fG/r%Hێ_#ryt+?᰺4߷,cʀVzm?E1$ֻ;}?͈9-hʠE+Ǖ~9UzAV$֔8<ng+d8L*nO&I@w 87"tn ҿw&ȾEDj֟Y J+0# LI>؋&*M;&:n%oJ+$~|Y 0h-ך58-EVV7'æ7k9 ?.ɺ5ޠ=OIn\S:ƍlޞ4+ZJIHept~ K"\ [.D.kϗ{,.1$}?iRqQ~T_yYr)\EqOd86l`ʑ/Դ"[U}p~q/_)U3&zr]qTM8!ے[@1ǜE6p_~qK/5n39wvi.~!2}؊.'a4yMNmJZ@~eS#eǔi2 "An@Vv)l'S q_ < o v=kQdqu ~vx0cOd8l}:h=GJ{VkZ֠5+ QVoe'M~%چG%Q~Z0N܉dKwn1*7N,[`~tTUMY刂?lruvb޽ǫ(;#Ǧ rv\w[*¬ :ZhUT~za9꒒Ot3s\?ԫPXzV؄T&}_ª/ -kmD! 1\??RyMA4'*^€CR'c_a`Xl{tTI ` f79cS%D2@;-z3Pk\]|$!Ӌ_*I$d՘O%j+ژ,"?5$f܎>#'f&y@Q-|mҋ"8Ҷ! * uk#: .'pW,: l1ި(cȧqB﫨I`;oL UNiZx(Q̤$016h;WlmWĔ۱9 ]Y(H]i {\Uus6g_)+&( ug`ȓ:vcO>>e|FtqW]z重2>ri]qvX۶ث u*>XXAFث1CED؛vӮ*P%j ++WcvXءٙy aKA|+KVۯ|*W6ٖ2{NUgg6v05ALAh<vlUٱWf]vlUٱWf]v*6*ثb͊6*ثbO,BG%i w`FRv^*͊c6*V*K\U٫]LU٩+;]vlUg- :K*͊v4nqWcebf(vjKbʮ*[⭌mp!e)ui*G0®ʮ*l)(ZrV]Zlw-L}B  9Wa%Bn~ʏ՛LQ3x QQ=Xp5=2B^t­r$ L0=NKw U+:r+.jbH\7.+nWW6*Z]LR`qWc!cQaFFŒ68 Rƹxsbf8w䶸{^#5H<*?2#=}O5HM\T ƙO48$Ē\^' W823?ɻu3i+vZrW-9*G7J6P.lӻ?)rnŞEĉT"AS끇 o'x#30+3  $ǔNT%T1i!bՅ 5Mhif~n{a~fz#PuLGꅚ'+SP)ZWlm /ۨۦ3,$낙XQ? X mdc*qAa]}.4Om# V>N2Yw`?lQaJ' Ŗ*nijDB@GMzi zAqTB'8cE- 0k ?0uc'j 1M41Jwk9\E~}{ahlzu넷7\1w5cQ C `7UNMn##TIrkĐjUŒӔqCLUƶث`偊NW VޘUƲ PqK`#Z6mGuŕ5GlX5q (P\U,[(veby [)ĈŅ;0Jbb]օu+`ێ\$EsiN-n25>\iod:?[ dYNN AuͰV< c㓻(u-Az*gYaIPt]Lw*?`hm+#b ?mi?W4ɽr +Yd(cfbiO|Y#c/bq\(v СHFDzTvv?['^߫ib#`,ho=snS]kvw2h:Ul0*u mrO… OVjܻ ~fC_09-MUl WERxG}vrrt wGj3T ǓP`4Vܝd{5Wg2 5=3һ@|i1%lz@Ny#ԃ59I ԊȐ1R.NN(5||0R[I^E Ƣas(*CbGب^9Crh {Bh ӗ k+`Ђ Nul hM O`G¸ۚlߑ*zoC5n;p_yE+G9{>,A۳ӟ?#i$d{te|TR2u˦+Nn:AqZusSW(iSZvjbbvl ثWe͊Hb"1nR%Ed$ZŲb>J71ZȿSQ?f>*=dzG™%@xK/nqWc%+ +[Wc޻v8J쭫Q]CQ; +JSe늻&ŇӆCj1v8AFG@]cA(v" RY/NmWoPhh|;`CRF4 0H>C]f῎*x bN`ׯl*=v8؅Ɓc]F@(uNlk]׍:Wb1(5َ*M;bP.Į`#;*rqmCPRؕnRTqWwBA(vRc{\(v"=*)%2%vf]vlUٱWf]?Ixi^8+[vj\U٫6(v^*RPRUإ;6*r]o+ 51C[*RsSusqW51WW*`z>y w}C0~, W{/ baG/.L^&#RTF_O%.u4z2C=53Gq9*j d^1ބSX7T t.d~ooX3G)q[8?uAo IT=ߎ: RIŶ5V]$+i05`dJҿ:o:YG +҄oE!f2"1ɎqO.}Lbz1faȃZ"#}@6J/Éw*wSC~5lm*|T7KljaBɰE?^RFUc r,J'-z@v UNzrXWXP~*`d ̴БBEF%ȽP)xxUdG`΍%ִe%TF,0 GY4W!O 1 F#$^8؋1[v$ƝV*Utߟ'xտn/ۓ|<2J.|'hovE&98ARVOӛ8$~D#z75L[keM2'G/,[GͼXQ5 5 ƊU:# ӌIOH}8ZW^W se,C4/5i24z4Ycrf_yp%%԰YVBAsm >-Grm}91jQ!.j6w|\6/-t[XH '~7 > MPhʎhz S?+Veծ/E1y#D2Gl/rx;9!}/Oiw:O~*KtK /?k~`E75L2aypQS3-cPiRGq2 6fJ'͸cu},2Hx~,Ae>je{]q] E 1CZ4=0t]5C ~Xʐ5U؏ܞrT=*YvNFv$ xS]PZv&I'Bߊ;i];F;/:—c(Hc${c`r%/4LOFQAyWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثbO,BG%i w`EZ\PZ\U͊6*jb®F*fLU٩51Wf]vV;/%1EUlR3t®M1Ký]vc(b]65qWf*2 *ث/ xT:Ue9*ԋv?~]6^ .{z)k';-l}J%47 ,aU88adt–`A\0x9D`Burb7nLUF*U]\7[;h偊N< Y'lz(JeyWe⮮S )\)a\Xؠ#$_? %)?ypڌ’5J.G0/[ ckݕVj}5qP8GU\3ҞqeQ'r~g4 ثo0H~Ø%*9l&MB[5n[pc"?ʴ Kq(O߃BoZE)5$-xza۱ƴZ#{P;9We(zcNқDcJbha؏L8]fi98fWܻ_Jאo{K{v°|9E0Ȕo()uMY>tK'KHjJ?Ǟ{vB8mDwgXHdnI?L`/W'QvF#9#r}?Kzdp;e@vPv.FAH8-q_:uй9? ;m(nͿ MFoF-ֻ|qB(5UCɀ&L :bN. 4өi(Î3r*To-%<ƴrBQEC!.fIo_ˁf+;I(74##yd|"$|&_ʰWMPNhVmOJfZe`W0L+Niܲw,1Zusq8:bnҘ5+Sa𺹽Wܱ) LPaWf(vZ;/L s?>qdMup89S^@V6w"3cbp/%6vn`JlIcf }[Dj`螤2R*i%Mj1ٹWe{vU hqWew]('*~x7LPM`K Nv_@0%1WbNxxt]T*M"~@_U#ZU؜]yJ`Wc)ANv0(-˶*pPOZbe* ?F)f!VS|UЁh0+N*#, zu^.D>w!جR.*r^5Hv5I#;.1QNqKءN܈UqWbqT.ƺsnQ׶*;ͶlU$늻Z: U؜H.iYӗq]Hj*`Wbq'vTzcЏoJ;E?jP%MW"aVI"X`<vlUٱWf]vlUӴƟa/XUnlUٱWf]vX]b]bVLUXUٰ+y—W*.ʦ(v8.)j|p!Y\qV뚘U b+xp2?͐lqnQGc0ebn@R6NHiH98y=9X20CppXaL''__*RL:r\f+$qe|X- ) inF V7lIF4EGlѻ$cv̧ˋ4?=,1Cv. P8p+S, vcvzXE?2zO4$'p 4H@H oe@Wt#!oKҡ8TSDMH#(H!TJmh3KZ~4xuަW6a@Aq˪TU2VİF]Pn?p#M;xy`iG48g9g>?qqKpTz}Ql`Q8)P 1c1=xƴh!YJP|.gvxһZ NEY4s$qq;1P0}?*v5ؓ`,܃N#/-ʂ+߱գ*xQA N $irRCUjhOzg9n)r*8[`wz+T?ִO( Q]\q%OQjG\EUؙ#bN®Ċ؎ /!Lyw[Z㻒xv2-`8g,2W%8Z+:oVIZ}V?ΫI<BءR~rd^-KEM'SGo ËO.ܿ Ѐ2+@,@u?_3[/;;[!Ɯ^į?"oB;[T޿%( >gOweF|Uo#nVMHki-V/s=`6}5) %Wo'WO95MFVoei}9WUrh;{Yc–ъ,qP>?i,a"&n LVRM0ҀQ@0~6zl?~eL$}yHcb6o!ᰳDGz S$˩!DaJS!M`I'om񯩫S -M8-TeEb@kd]Pw];Sn 1LH%LU!PlH.<(ncA9 )cJժvV +J.۞v4^{bPO]s` *_\.X'.&~.xU/;n ?θodllU raFo$EJ9#cPRۊZvbK*;6TVs+CƬoM3#zvpxH =H4`siA~8諚2 ZW|)&ۉ?vAFڠgC?Ͳ8#/LX0\g$[#Zxb]$jf$|V,:bwڬpIڸ VM&t~wR>+r;;3?u /Js r*-p}Rv;ъhޙbѕ?i#ehґPiE2st8u:Η /\+wQ8w놂kOr0᪍(0dre2v@0jy8 &Nҥ ;HjUW~؋\,JoH}~XC̣Ȩv68S'ebf\T3-1CKWv8a|{ەoEA#CW'S;9c0T~q3#o ٬75L/taCZNO+fTsFO;C DY.\WV3Z#ZrVӔqKy†\ M( b3 P\qVWnEqWWI|Zl lk̸86P2i)Hʼn p0-5Y4g=U`k">Lw0M-6W`Ja,~ZDf m 2_/D,3E!%ku§b& Ŷ`m]LR WvQ.N#0Kȝ#\HVһgRa>lZE_.x5u9E -e0(iC['6Km5i&9 JE {ahj0aLiǦ)v4⭌iU8`V<|ڙ.()'bL u(.Ɲ;+zT첄tc7@teL*rBfT9Y;ƐqWbe`CX ]v1aWb*!8\SN1+NG 1c-;_$h;ۤ!}̨#'9~G1ro,uNW*Z2K9QrSU<>b 2#$[u@z oaLbNR.C?6YрW*wq $9ҝV+ޟ1]1+-NУzh@ n9)VY$]vV©24SM*$%o׉jW&ז_+Ms 0/i&4(,qZw,qCfac'z7 aZw:偁])r`cL#<-Ƙ)4,Mda`cM獥7q|-R5]&kfq1Ż~AMV`yX^FjNϱuVSQ>%+sA%vZ$ִ=0+ {v1v]ωv;v]]c]WccC] g!ʕNlIA.OPi E)v9Ԛ*XpƔ8jň*%w8(]M+/F—bl )]9dpqC6FH.Iw8W̲* qWc]:qwyTJ"daWbb: *c5 ]2h́]u(]_8U_~.ثśZ]*,pBW*w,T\RA(v@ia;,aWf" H(r)vjĻ`Cb͊6*ثbΟp$C. _/?3I+s+vlUٱWeL ]LPhP-e͊6*ثbf\NlP—W.\bW7UWurVuI/u#49*{N ڞ$dڤ0K'p3"'gCԐW1K%U2ױc꡴vF58;ԦPhqq, >f M]6 6HA]y8eIUA |AŹLsYAvc]P]q-7B}Di84`kZӮX"ߜe q:_f/{ŒHd=M:`z߀BZMzF_՚L@y WW4D@鑋ۇ2\}_VI@TM((B 'i2B)ckRXrRMv-ﳥC8coVdF방ČuQZuI|0{*~x./P cB7`l~-fj~J^;~ޤliOg$ԋ.4;P]AIЎ>kjԊӕkߩ['i>ъTV CEa_qRąf,8?,)pNh`>Š@Hъ(T|G s9XHjj l#Vq:bY퐩ӌ{H6Qq ~ s/Jt.9DWccT)]h:u]m*Q]\MvUيv7#~vU+], ʜ@]RaC\UL7챸IZZ!*fS(vaZK:j(p8RSGM0KVQX͊6*ثb͊6*ثb͊?*6*ثb͊6*ثbO,BG%i w`D˙ sbeUٰ%xٱWf]v`qV1]\ثbb]]1Wev;k+lU٪0ʨZ1V`KuqKyXUٱWfebf*,\3[#5wS,⮦jWf&v` a v&堨SY|G_wY]8,?4VDi.S~2n7c"xZm7v r-N$l3&'QI<[cSAhvȬO)Lǟ&=ՓI+GǾAqSJc&rx1&PRBKAYcT1aOR9(Cy?3 6WJAv#p̺H9x%dfEʩQմp%/l/SvH>>Uz;bVQчPPr!Ja摯=ΧsDHuZ"~~?XAlz'ltmIӑ5=OO!̚ZɄ4S鐏=~WiDmq܁e91{n99}9?_ܺd<:5E_^:m);ƘX sɟ7u@/J?leNSx3o\;ɿvt(3bZ˧?/΋"F ykH k˛XڴqDc+G+xT\Rc8XHLY- 3SSajbM;z\\bޥ2ZbJ⬸$+VVƑLPrq>L W(8ZbCG\qX5ֆ좾-X'3JsnjbmNUj克xbbC\)"݇[ͷ~?q]Gp%cpF.T ĭ* '85isS 58XNL,uѧh%n16'\2v֟hn*Y֚h=ܷS s\OJ)s;i7V=+s-:]kvT]@G 7!d;_¥Aœ\mUm[Rtp8bo&bMTKY e'0hX%ٸ׮vXWc‘'S-!8lǛ~-dl}{dC* r,].Ǡ*v*bQL)v; ++&ݛ4.$yݣ qquPD~y_̷q E9"L^F42?W/M6Xnp ie GyhfDdc4w 5ufs n 1QLB{(?l[#7on&nb%qӱz "Fò]joCfM (=x]STE4_<J,ZtnY<SrQZ'!w?4inp3 zbz %S*.*gTWN:2&/_^4F=*?@#ƹ=ƓLӱhK톕ؐ^[`!kR"}ԧh%)/#LխLu6ڃ"ܑ)J#c(I=1UbMރ%(ePF~Дf:{Ss%TM>A! 74Ȧ*܏ T$J[+Pq)QвS퓿˨$b?9}[ƵiqWeT׾)v&Ҭ`"Gv)^3uqP(vh1K? Rv!$dozbZP]?E4v C8bR5F)vޏȖ%"ٱWf]vlUٱWgO8?F\% 9%[`WeaKb͊6*P`Weء.b͊6.UٱWf#usSurZ'LRtZ_kXLR,p` }&(ۣl}iї'ۖ 2B(s>%bj:S MqFv9l v-bbґXP7jՃ!2.&e8'T`'o\)Ԃ0GCQʜld'*2[v>-%rO?GޏaEKfh|ؠUHȑhk5;Cg2*Μrݒ x5<0.,}1rH?r NIW=|&ᩢ6g`W?pmwVu> XҤ߾ @TY̲)ZlHP#kj`-r"?oᩭ . q`]n6X.]d.ŋdzUۡ9'F 4$q?XkK av0R'4- 3*z՘0)׵x9o ׊b~ˑz mğ?<#"̓ݼKF1, WnoLRҐ>C!dR_Q ^".)ۧ(MX,{ h?"֜;iZw…Ut*G}U3rAe*M<2Ԁx "ORI킡?p*j0k6q櫅V0U6#aZWPk­R:”[z @}}Vr${Hޤ|Uڀ?ip|8X)i^qE nLΣ)3/*72n?N*حWaэOo|dY%n9`_* xC85;E78Y=i=4 ܐkഩ=rtԜpJTM)IJ'+ G-Z`:3G}*RYK^n>-n܋LQ؃/xKtgB2OGIhSK1+Jkŕ+-3iw̸8B1'U|7X ny~UH,OW54`J䃓'># 5)ZS3sLKP]ijW@HJ!z7,(i^<Ú\rDeVWqʡ#늸cUw]PVWv®ޕ"nv1{er>߆*'c֟dv_ Y||Ƙ늷>g*s0*cWv?އus=݊5>W/TYL?4˒VD/͊6*ثb͊6*ثb͊?*6*ثb͊6*ثbO,BG%i w`D˙ sbeUxٱWeb͊/vlUch=qVbvV*Uٰ+;*U]u3bS,bY8Yc]]pb́͊6*n8f8lU[X5]LUibE0-r:/垛Ek7?r1#!֟(΍\ONبؠxKn%Z)c'0iOb'b:xN3\y e/S!_|j>QӼ$XT_Oq] ~]% 0;Y96h&J818v~ iC]~RZ`OJN1iah [¹ 5)Z-b[l&VޔȐ8-x Qnz~$b:b|0pR] cTƲnƸebtemcqi. TblRT{bcqWc*h+S_l4ז|>p"Al@6ua~l[K;'vOL}r/r姗LGQ Ͽrq}ίuՓ8. JМYmNxqK^>#z1^1{bp;3W%W)1=?Lf7 NF, Iɯ姒n'7󒱭fF~!.09uigob!\ޛÊ\r$<|:W Ipᐻ?>d&~> ~dc襥#.n\#|nMqWfV]xlP nrghVQiAΓ0I޵2\:S뎚ֿGjإ\%H0G)AJvu&2$MT-I$>8p(&Pa&p=k' a*o"RYyCqO'ΓuK"rolŋ|lyoy,W3Hu{}' dm&<&)&iiiXHd9EqZTm(z7R9|qV/Ze9aW,dlE"VM7bUdeiV v3DlZ#.xd0Ϋp~PJ-k'MGQrn9 M+V(ň Ű krΟ.}j(xkP'gWDh53(zf~*alzcP 7O]a]*: -G!e5PtHx*g: 2*rhIQA)v5UCrbPSįac#•ǁCL(vc^5L l{`튻$,zbuZzPWvͶ)v'3GMU٣.PiR >1n vv+w]NT*~qC(qWc Sv) XWxf^ V]G:ӊZp炭9t‡b-]xG*~R)P  O\U);37Q.Ɓ]Q)~`]r,]vlUٱWf]vt'1De_/?3ܣ+ ]vlUcvXef†`WeRثb͊]0Yc6*UoLU--&`J*8 Ui88XQTU HeOƻ LÙz%%>?q&I^uTipJ`:@yFߴ >}c ^&#5Z׬d7_rb7u=+ZoL)2Y|qS#w$Ӑ*`BrP n{/7yޝbv+LʧfRiqZbbmdaBG%#$}7P$xÂۂ[;Qy+:8VZ, w6q2 p%XcԐ \Y嫚jA J~~%~ `n./<(p}?Z8rmS]CJ0w\#ߖ_(^)p)V$/JH#I4aW;QGykր|D-~'$uݰggw%>.>#Q/ B︨0GeT"RxVB8ȯZ\#/Q;k<Ҕf˶qϩ8f<tmC7?rI~H^j]{mܯ$$SY6Vrd12Gi^Ałꑔ/,|Ul)ӿ&èCHT0é=FC@' UzIwcu'zxA;}S"BH kEKHY]ၮ&vTE0et;FOF?]$jF&fڿhkB!RƤt'0ĥZTqJHI/#AW)c[t3Z))@EjTqL[zWcf킙[eQMS[YTDc]?V^]5c2tS[kuN+ֻI N䜬\ +2)v#S}G Z'w""l1a#vo'Ьr$l݇C/ >y;ir*ʼn<Ő { &g4$ح4SfקGS)x0F%i#CliF&v0 /;JuM$nTK/ʭot<*LMz iPlanjcOv0ݻ?zF G% 4`iSɪ i߮ƕq!M GmKxOS]\ur"b}>9*VPs=k4Ƣ1 *2 isSuq0\rPWJq 3ob@Uz\P[F>~ثX6]\ WO*Bثb͊6*ثb͊6*ث*6*ثb͊6*ثbO,BG%i w`D˙ qثb͊6* LWs ͅ[͊6*ثb]vlUu]/vlRUc;/vjWe.͊qKv^(v7 ]ṕ vj`WeW|*^k6*UVM{:BIʋȨH!vvK0F<|]įR#᪎ oՒbw\lVf4Ѩ)m^.hZ?Hu`~5D[Y1G%_@R80Q J;Np8R¸k1e%1&XZ Jԅl%Wpuz)d)W=KJ%bWUe߻t;_ݏ)%eŤQ\o^;qpF\n]V\&Q3/T'q_LV* NGY 2#5re2qDŇ\r§:'?6c+=AVІbh7zft5O[R8^X|¡5/r_v^a? \w*?̿Y,q& DFJ)+xȿtVACsKQzf5¦b/ft^/D>JRH69?|s*5'Ֆy5IÇ)} F_9gloE|эo8/J{iRc\nj0 pˇA,Yhd* (5?<2eӞ'>KU?4 UbKD[qؑĻƃ"baWe%~81Wc`Wb,(v4bf ,6E]Mpb͊6*UٱWf]5 %1IpFMY1G (:_>5?Zb1O^3*E~c?T<61L{II>2猽#Qrqv>)+Jltۇq).֑-r)X-eR㚘UYt]0EZV8}kO sæ4QJi(OS/)Lrǁ4$¸׏$+E8/7zdS2\^Yt }_ w]p$;:p_}?"]NuIZ[(Ѿ@$#n~C"Z-ZaoK1= zL|}qokgpE$7\6݂g$A#p/s\#}w; G]1V1qXEiZ%&& n$xJ'Gȑkj0Wsˡyv9vX$r)VbcnKŇZdRAb狓!珀|A5ApKLL(ÿb+rj#xXRᘌ 0*r]\0![5Bq! 2R*r!:Mb3jdL{tKmeDg'!qW'n.R0ɦ9-|ޚE06w"#i>O/YN&yA]KPVjM#9~?K>xxdᯟإJ-R|I0WڞT,) oMa mic̻Lbu8YkScFETS?X ;,pԱK)@?vuX] ďS@cc̡BD*^\A_~,UW,ШaO?)W w~_q7bHʵ(x[;}Q)T~)n Gn7_],d`w5Hu #_oʖg;WrxOjBb(+˦ysW~hx삪&HhU9Wȷ}|S b_ZJ/۔rxr_RWc~Ӳ#t ;Iw%qi֪.9@iu?;IjߤMZ&_qnR?;GgSU.h3qY+Fn( 'g[~tҥ,a}B @*J, zʥ?2SDmGM`gĶeV >BTh^fE׮|MZ'[Z xDb[$Um#}~ik:Zf--CCс茼 ǚUߗn5$XImCyGm-j,Jvۏ?tGM$ByWq_?mm<% mFGgHj'>W.H޴SsdQf_l[i"'im+ qe¦geFk/:"K95ޭ`FjK⁂KNe>*Tn_[*_XJgvltXxy?9ZVi[4wW0ej-ҫHƉnŪÀzas4^TDiŞ.iX'1]tzh*svF\È8ocw?O؂ɔGOO+CYh\#4;bfñܸ?/j3QENH+Ũ\Gj6$ M},0≙JQc}|S.5ig7F?f#au[5Y /{])][ח[.j?͗¼{׾Ec @~H(mdjL̠[ߕQ `Il z>3NiWn4MJ1uزn*4U y~#oۉV䶩wj\,G@ aU<'zŏKĵ6~…7v!~?026Š=7Wm4ޅLl?)n0+Ɂ!oN]r@?dm8(+N,O zoZ Urқh79S+VqPR8Pщ; nZ/`NL0@ r)br%p.S."nUN{s#J6Ks \(,F>qV5q29h ܫ$?Wo,&F,ƍ_d'(#OgZ˾TJY1flY."n)7Lt1SDb[x].9՝AQ\PCL6 V(K9j*ݷrю=p}P]냭:Si5ąhOε AD$>q֝"*GVSB ,?ëMk Z"Ǵuj~V95™zt]"70У⟎[هd!˜ú9qF^ď{(veI­c.}Xy7< v:l݉MHژ).pڻ2%$Tۥ=vaP~ xWLi.{cJqZq4[ :wZaƍԜUV U\xׅ]QM zv֖~0KzȞTWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثbO,BG%i w`D˙ r!xWf]6vU0+*UUUن*UٱWeb͊6*b͊51Wf*U٫](vlRP죊]Uٰ+C.LUٰ!`WeUaVZ®E:'巗/A-"񽻯չB>ʝzTlT Y5+r*qT\UٱKG5qCQoSZ\Rb;𥣛*LU͊qWW+]rV뚘Yxb͊6*͊R㘜P15Ǣ۔g0㸹8 K ?eos[zgduO%"}Dd#0b\Ec!*آ BbT]+S4 FDwGYn 0ѶN/ $:bـ—bRgu%Xl Y1-mRnh,+G;mNQheҥ,|9z `pM-5mV uU+⿵γ>x5}XONK槎ӫ[t،Z8]BӤB([2 8qHDELW΋u1xXM(=̌xS7RS 2,_ ?Fu{9'/5#FE4 S r*lo5WUn˵}[O%8l97M*졁.lW6*#F( N&W!يW62b I-g 4ZjvYA,ICL A0!ym MLAUp+}qԅ?r$*nTVIޔ a ^gI­TQk$d~#W#iI;BOl]ȝ:C Pqx5Md\>7?/U4u,Nj^Ow~@JךR&4"4RX62d9:܆l"9ȗ5j4F„m#h퍭p2``b]" FEiB#|,8[DR¼8߮GݡbU8㽗UˆqkmzWnhXfl'ǤRF R~CքV]d8q럩U2 J0a}Ft/,-̧Qn*=/Ï\b<8Rm_?Hj5?o[#\r;^>#QZ_~U="EKu k).v:UG$Ӷ*L n,/u?gz`)dT\%bhq 7coj;FƵ? hh`zTZ_#3)r?/"U (QJ9mxC'$wRAoB;AF@#Č˓s7գiV;mA"U3{T_ˊv3wANoZ,^Rt_<(5d>xN/.I<~[3Kg~`B]J-6PM^%) :Tm_Hl.#@ b J(䨠4'V)YOiWo'ҍTЯk/U6?$!{kւg_kXjC-I"cOU Ƨ_N"a)T8I t[h?)Кiq\Ek:כ, Y< G%g]g;s 7>Oou"غTMsȢ?k}ow oKu/JrfY 7eE _iOǐ2/0KM6C͚%0FoJȉ$u>1cy .ϧ\FOxAz.'VGN 5P˂E0+~qf3:~Hڑ O$^4b_'jN>R<áDL HeV4MqO"`s%J#45'Fˣv`dz=;ɿ940谇7Q2oCޗMR@K昴#Fҿ3EOUnb/!T'Gcn|AW.pǹ4_/O)`y< 4_Go%߉baUǓ"~G?2|w-sDqfQG!_o8qpտ6CxC94cykC:̭o %A,* ,p$OQ&+k尃́l+0g/Oi´Zv)O㐫w8]hb)^ ɐ@YN P%=2`aq7H%TГ_ D &}?+ؚ{Sӂh4jqkɗ1yNC,O󫇋'>ԇGmtyLTRd̥p>Yi#~wop#k\K{;HXQ@V+KbJq19SC J$boUre!c^n1KaC<\P7.Cl@]#9 F&&2Yg-bvHQeG"eg Ku_)iO,Y-ہ yl?ciqhiDHW;|(k!!#Ҷ{X>l֬t @9U$G7 u[j?V7\I[JrN31iyQ"e%XLAvZ~Ɉ|HwO/[,K*qP‡:mǵFD=v0!Ռ[X JJrkF<ދTlr:Ә |PqO^x_p%P9+L%dC*b6*ثb͊6*ثb͊6**6*ثb͊6*ثbO,BG%i w`D˙ reʦ*beU\U]6*ءX٫/vlUٱCbf]bf]Wvc]vV*UٱWf]vlUٱWf]6)vlP\2VeZ9CCiyp(Lig1ĕ2wMMn6L0䝥rHc3und=V91A(f­cN,W73S ͅZ8 S`̽kabsWnk.blUrU/[rWf6* h[+vlU٫0lqZJ w &!+$ѵeU9s&y-5˒rrRSf\Bz-'jNF#M#*;NL֜ɶh7UVȰ[6;W<][9 BE[Tdπ~ f>Za$ZꖣBH9H*xuݫe٠9:`jc9ÿpsskuLb)].(.Ĥ`C.G*xo v0Mp-.1Wet]+vV*ثb͊6Wf],b8akSH5XՒ8+_wl#@-w-T5?S=1xEv IT& Mkʕ||0Ƣ\r_-ݫ$$ȇB'jɞ#l>+w"$,2>`F^4VZw!ŵ[r͉$nj\-"4qVJk4DŽkJȺ#,I2-xG}4^!cқ̯۳^7)$=s 3I9%qCwZ Ős aև%]^Ǫ}+p9,V] ثuV/LV@iA$Ն,JK: Ym_~XSJbO]#2b9%!N,UP0@*NĀ1U"~ɀ1U^UBP*z`;U=@|'}%uEi\g> ~*!BBN*01`vYYXn-:Ůs.JrIN8ҟK\'"Fz-k|FNJvd4^_✿_?d.!.叶N5s1P}ai}2Ź֢٘]rÔK1?/9B8-~!®وRǵSYY r:"?XRE+;am͜NjAWLP:-+o٣o޿ߦ7HLi\60'TSӑ2U%|~[X_jr21T]7mO&<@+I풿7ֺk7'^;NY([ȍ^^Yi׷ϘOC0KH?7 rՉ^@*+J$F}%!գQaԍNym=l g{u]86eLq>y=~s35rs]C$Wrk\T>'\%Zi#$[Ľ%-uv$»Av%\ 콱CD(jZwSEOL7D!IZwFM-0UNXDŝoJ*HT5:ȕn_6={O4iW/B:)O߈XG(HՁΝa4%v,?YT;v$h!ܐ~ZTejr5 J;+CLi„TGLPSjb0Yxc-w͊͊XAQV&81bQvʠm ݕ}TiFq+[ Z )kw"\/ H;fwݨl |qPZ/>iDE]eՏG1sMQØwK!\DbX__^7"˓xQ*<z2vS(|Ul()Ri];2aWc}>XRDdb<v8v`V]U#/0Vb(G늻3($ U*bbn9vRƬ@?kv;j`WceI m]r|qWb$|k!(vb֟]"=WvQf)LR짯lU$w8FiZUQ 5,؀3N>;d+qWba4LPN@c"^qWe9^XNv=eFmƼGU`weP]Z_d ͊6*ثb͊:nA"2'?3×650;/[vX]vlUٱWf]].8ኻ,brj`▎Y'r?\UMĹOKAOB8Hnnm0@Tڞu`*[6G AIʟ>+\PB@jkoI[/Bu'ݖgbT/^O pʵISJx.i8$~|<\HTB7j~_\ơ>.Bb~/yt\R)]e@&- /^hP~!?TJ$>d‹tx,k&rc,!?iSKs)g2m)?8/(˿PV`җ.m/x {skwEnx!~?eW}ma1/it,o%E@=RV;z,4Hs$L1t$6ҠX) :_?FV#HJQ.3I?澃rx׼\]w}b.~&?c wZ@ c 2Wi sOwl/[.x*ZIr)}<~?}N8.fsD%Ozm$$a."\?Αu-e΁_,< y!_JAޭ56K5Z)iNjxaдwFD#rQIcS5MNHl],6opJB|<<p>]%^-'p!2wRFb~ +ǣ6­튵L&(qZbga UJ!VU?,zWM:k,sjQL5GHlf!Ir8iɪy\ʺmà.Fs' h53 L$ Zuywl6H+1Rv_SL ִӲԵ8EUP~_c>O*7"?k^򀬱RI!X]/Z?([/j#?͇=#úmuqb{'Y_~eˎ Wntm)xq} r$EƔo/O/4Oj6zM}^#)yew"ߢcu4}*BHmcJm#Z2 AljÓ|_q]堿I u?Ƿʌ^["ОtO+@ĕ"p?D2D۱E7,ܰ۲abFf@nӾXie CS[;u4Sw%'o#/7O + ܌9{jGhGR:;u^Ĝ![f,he,LiLE$t81/)֧o-&OӑC9U?1KcZKe;U Wn5&UT68&0+^$r׾kkAZq1Sc]Jv`+k(A銶4-6]\+[ Y_deZ!SLثb͊6*ثb͊6*ث*6*ثb͊6*ثbO,BG%i w`EZ;6v^*ثT˦*fusSurCyDf]6vl*Uxb͊6*].vU0+aWf4ثb͊6*ثb͊6*RUtK!ـ]\vo 59;spd|2Q/)ۚp9W` :6^e6DJv\Blv,aV`Wc[qTbW(aKa9m*\LqPܫq\Y\UwlVwlsbUuk^pCseeW\3Wu6\*3WLثDwM0keeFJMvҹfkUT br@S7pv[}KAj}enN=D}%Q'(r~D&$qC 9 lxsڊMwRvTKHۏf*z'j?GKNuIp(TAoY W -xXTàdS@01hᮞ,0ܷB ĿBƨ_iRZ>0f-@闦NV܂Q5~1ɞ1+3c)c[ ޗڤ@>s"9"#@mp+/I$i=~6U0cW3!gUP_XKp9R'E\G/赦ˏޟ*+h]pAdɥLZK (>m܌AGy~"p-0_ն?4f­J<|g.ݩw贲v{}^o\B1];ab췌M%]+\v&"*xLvSJKpڻbhpڻ˜u]vV*ثb͊6*ث]劻7,Uk+)QVdfSrB$Ke+N :<T|4Լ_V#׽_͏p0vǓjSL*H=p=o=ն"Dl~ Xp ยIf@ȸq-Gl$cqdo(nZ'0Rzo\Ai`@)I'@*(2<$u8`e޴UJKB@/p} `K_+.WQgW/?Gl_YV7NMǣhĭb a]Ir|AzMWyt20DŽq^0;_r92?2xf}I OJF[‚kMr>hr=BTUqN*(%)b2d7Jf4v:o8ZfU~)ȁԫntm?S*z_Y I5-dǀbQj*`q)Kx5bz.w;b/½)^7KibZĚ'Y.R?in,:tʋ#N29ۏZgD6+pbX6" 4TX8q3 p7 Hj2!q5p%f%ZWZ'+,lU9-ҹC`fp :扫CARաo]hޛc!&q*T0d-v+(*v2B8\r> Qi>.-F{FF0#-9pKLOtukv$|LґFjfF^Np1Wf/avQS]SQSvS81Wc@Sv90%BPKcP(0JJE780;*MWcf4)v<փyv®);Hъ]V|U٩e1 4AwˮK]]Np1C%ݱPiFe4#bL*P*nb>*kv(Hv&ƥ}C  SE )(v/ z.*#ኩ閻Zj(Q&1(Ch# |?Pş6W NCE9geYWea`,%eDH݄O!*Œ6 BP5!'eakvjˮ**up|pGZvVmv 91=TM;Z!딫v>l7w?|˼jᢏz}RRvGf)AO1?J*ūs$\%q;'ECS~#[aMǒQhc?"qjno?ge@<'59bQ"2;PZԑ_٧ݺ *GY/_2H*ۏ s4+rZn~χӁ[+/zbVeֵc*dQ#P5nq.s#_NK|#Z=6k]rAu\/dȃGN?\ļD̗~Ηd_.p)%S_4"Z;gHGWr>.?PI~kuͻ?l-',F0?k ZX~Y1٣sisnB^7ߑP xE֭%eq?/&,_xsoc}0۴xMBȎUY/揧dKmCHqC4Os3|eV%w`^1s#4hK@{I,.5b4X.6iIU_gruo{!1:h/m{!B6 DV!ɹ|2|\/mvBݴX#uR0./#-!jqtGOQ/?7yEBPǓwC Q.ufc6,(Bޫ$__.` }P'a_0c^CB閶Fl4˙1T6$mJE<ke9\YlO`=8SϮiXI8oܙ_oY[W0ޢ<Y>gł59H3 R /T`4~ifkO%Zb,"$%eIim>{F6[Y+ Ű߉${4~I4z(P"Ź(05EV՞ t'@!r|_Y@lOrtVx1WK Z%~GGs~m:{rfEv q4̌&-s^8;gʱv s;WPy/_ːC[3W 7j`V튖?ȱbrs:ƥۢ7~ET5H`lrvn<uwBLW`eNg"^32_Dx0=_y`0'SI4?zD!-I3U8i<&KX; v>;:lIWRE<}#'g}S5がa$>;5r݉Xٰ+b͊;jfv.O?MkbCGLV+{aCW|Us-dk2E\*QǿLU6v5ֻ|V9#$[2/ש\}v;dR Պ(W(o2|nO] 55|*gjƒӱ+*qIZ'JZ`)1W q]v4V*i]Wen~XS\UU/+))M22>?)bvlUٱWf]vlUٱWf]v*6*ثb͊6*ثbO,BG%i w`D˙ r!ن*ثb)v]qWeaC0]6(vlUXxb͊6(vlUٱKWfWf]vlUٰb͊6*ث`WeR*Wf(vn|Weu퀠o=syK6A?.S/ ݗZ}\ ukL3!ǐj&phw_VܐE2@5 {)1zV$y3t?`%Sn|3Q53-Δib;~o!> G/x"m"C保q2k,ݖE*|4p8.k%:eX q4M 87LSШsY=<_ӓDg@?0>* -Vs3[O'쌚yqcY"킬t鬡 9;>/Uq3!+q:_'6~iZ9؊mߗ.U(p*|reo@Tߖph|vӎ(Is/ /lh#E|m"V_x`blaE;x=0%Ke4Ȣƕ'lWe,Gv;0ڻ1ؓzUؙPiR]+(*UXb͊6*ثb\UؼrڰxqIń %gdE4ørXd]^~ÔUpSд=Ft_.G8a*zSfTurwQݟeĤ~}/1 l& a37a.O+Njc<:2D2q_Wj*wkm(([4))"qUU^tTpYCl<s5zRs'%]=|䒥1:3- +Wbq<04iH(L3VJ+z kÜ2߾$ӁIK$Tƍ(S'-1v=du15Ǫ3BӐhN -H8[ٵRA2H5oo1>dLu­\<]B#={cg~)όZp~EIo_rpvjK>Ri8L4(%VF6-K =?\RZ[ZVE2Oa!u*îP^x-ֻPdw4~j+J~p竄eDW9z2pU`r+EAĻ XKM*@_¦14Sr1nTR:!.Lmܒ6ʷVXJ($dK U6Y4⢄`y>JQ [~8wwQ})1)%|s}N`>kӐO v"97z6Ɯ\ڜxGr.h;S dvfA (5(dWOe\#|rRMp@-.o"kv &rxKz?/UM념X܂]OƝM{ @>VQ -W#fv],8U@q'zG-ߔw3N n^]ϓO$Cj9 V񁉌~ "^A#S?A$.|hz4<#eFP7]՜IE=J%['XhÓ"NV)-?ۉyk.(ܤ=\?l ˗P|Y1[QBz%ԁ$MǥI= *چ/$j6[IPϪH=1QZ-h~0Nt{~Ps%}x]6>XHGxǧ2_=k}\5yl3rA 7 BmY@tpz:[ήֻ uo9!^4pk6yuq/WeQ9{?Ftѩ)x\'+lHݰ2gO,~VV֦xf^uߖW¤p+n*BCg}!vx|楉5;d=:)%E1  dY;g8Po:bkd4a4ȱq ]m6q!3}qء-V d߾t3P$+.G6={e"#Fݶ,4N N9E^uXgyFnqpIG_1J!Z|KkS Z1H+ Nኩ;cuF*i# P0„dG+Hp%نu+•&;bf* Uk⭡p+S)j(N2xyK c ݥ})(ƸiefFVtr#'7,u T | 2sOQ LŦSz q4iY࢝qm!LT,U٢uUlU٥ 1K]*l-̐68q|*x*.KP# >j6ن)vaE(v]>.R.?kv$\Alv0C]/]v<PkhKT;7\)v)$JV]¬1Hv9$6ZrW;R*>v`O\U|qWbQjhR]~*ab%Mf2 dPثb͊6*ث??#/ _/?3V rCYWf]6*ثb+v^*]\1V*^*+*qVZ'Ac(.k ¡#SQPqdUa H; aU,h |{lq*/žyN闽>_ڛdS1ީؠd%$ >zq/vβD%[/O-dӓ O^Gb$e;EȆ O#p ce1$q7?\.Fc_Ǯ!5qXػ$!Gi[0!)d/Y.P@ m׮@GuJ"3&! u/\7/%5EIG־e 31Ch0jP? W߷VBF(bG o?pFRsNu6G+ koIo t;gf EiCwdٴ5̔@퍾DyPSFbwej‚ժzo~~?Xɓp$R` };/D P w;,A-i>)M p4mۭ^-_IQR Qߵ4JMTƣ.5je1l 05-TBTRsH n&ݷڔ;CA+_l4f/ylˣjj6~U=%U F̈́NE/%8gVҼuui~v6h(WQc 7h`֎5֝}ՑK{YF?yq h#eZI+`}OK_ޯ77┱=a/<_EM{qhsynhjo ѷ$.E_ܿw y5?b 7;dP?$gJ,\r@x\VG*6R4Tpo0ޛUd*[JbG?~G%ӼީJf$/W}kNxQSW~R\[yK,-͸3qFѯ.8bzd7p߬r05,Ґ+'?\8cϓ@ҿ-J`ro?da#- Dmd{ j/qC=nK"!~֕c~1mpbQy9;/Ųrb r?_ad~ь,iڃ:_Lj^w2ao.bmmn,cǸ+mkQM QG`lqy˓yTҋ9ȵ Afgܓ\ۉ}QadQ "Jآe Uer S^`"lU^#<v}8)LFҿE,~@W;= ~- +|ləo >/1_~kd?Vkf"D1%u_ W?Tg+\3+~ ĭor; lڕ:.od֘ G =6QrZvvBwQcf_fcǿ,dv,gGO]\a#i1SF :+h tuT%Uwȓ䉺p̏_.uмrhZ=da=SƿIb|,u${_HQ?/fy-uw(T*%FWc(ѭ*ePP%eaQ$(`{yVFˁln{Kɿ#zCW 1fa5r~z~:o8JFJ̇pQ0_S$Ɨҙ}1Weu *ZT;O$yQ]?JvA#iE'ygaK,׊q4 f2m/?*;'m+@S,r3HFd87/)'r(|]8-7oP "6/JuBd<[vg"eq_=?l*)4 /m \-=U'k9SsvxއŠjN }7CcwKץf9/۱ edUٱWf]vlUؕ㖼c ~8PQMj1V]xmlRW/]|*Sm*kNc2{{b9E &6^26STS Cb 8|;x}b#|*0$PbwqvZ$lU)–f9%hf A]*|;nch7WW(.uư\0YNO#.J~!!KLثb͊6*ثb͊6*ث*6*ثb͊6*ثbO,BG%i w`ER]1We͊6*] ]/;6*Rث Uxb͊6*UGvlUٰb͊6*ثb́]vlUٱWf]1\3aWd~_mZ?vpaDZu8.P/2}@;c5O aV@Gr+D8N/a<M0}k>Onwu~EOm?+?K}x)045ߕ?2l59[ўj _xfT3 /9|S\?J[`.D*)BAk\0gR%m*o[~fOaȖo\Sb-$|H_?!qHQ_un{`I\yUUL+E͵͊]w-}6 7\Z3Kgm@L{ڣs%uϔc·Ml,!a!Zۏ3aQx]fs_ީ|}[rg7?d$Z[?LM-\X`sqEGO|^hƅqMB/Q~.%yeR?C^+tkvuqH A9P.l<Ӯu/Z:S麂FO\iRfTg?S<;0ɏUq53k:L][L(T\4/Gxr.cLx]1bR)9E;S]C~һўWb.cLF%ؓr(zG (㍢bAWfHw$`rv4*n*ثb͊6*ثbˮ*]LثU=kWh׮jɆ9Hq;: u=> 'u4%dS(O|g_*3[$ho㝇?GX_ӛ=˙ǞOYtP0&HW#2]` "{6ؠ\Y!.☠RC&p{0*zq銩4r[fI~Nk[^͝RBkL1PtWlN4 FUqeJb›k*].(mqj>iEMt$f"/}M#1(q?j;gn 5RT9QsǪ2U4l 4pG5f5%M񈈠JbeT]qKRcwSSO&ᄕ-|G,UΝ{Z~tcn^,;nȐ1C\[֔4ɖ`\0̃3صtb`${9=8vŇY`#4 $+TLW C1͎oW8WW6qr؀%tjTdICD޻Tİ[NQFE8y6 +=pQTDP= ŏ[L؆0(G,lWQhl .TYu zR 7iG9%DqD.ȳE#cFNÌԍ§?3=ߧ:6/#"qyoPX\7m1(Z+V?D{b[11E*D)w ŔK<_޸i#sMwvZJK",kka 'Sի4d &4LI?룭LЄcq/pu.I%Hb/* N]!d B .5ݿ]JAmt ddThMZFzʜB[m؍逹`F[n_(]ߪ Lˣ K/Tt?_VwΣ[,3ҫM/~FܵrxUbWo9RQ> I=FbNk!?t3 W |jV;XJT"889z.גJm8u|ˬܥ*J9ሉ&㦁VqoT); w^^Rحk .Bf=_<_nbjh@?g O)zQ? U ݏa1 F'?ܻ)/$7xkA4v b87ogZnY$;e_vVu1E4MbF}s饜yG#bV N*y<Gcğ>\?N#c.ȓePpTPzFǯŐ*ےv BC_hk큰%3 }{+pJa(e#`>#J%F%Ԡ0q"ʛ}ߵk|j(hI~|XU ! E+c[f%G.4p/ @'ǧ〮hgoآգ()k. \Daz`a!U5F* `AE3~`nO>`R~4$H-/g3Ǔp7^~S X>4{s,^Tzo$c/Gz4o*jsg" [3cdtFUiH3zM7Ƌ S*gupƮ M̭WEh< fa/ A v:Sa 9S dkօV*cI-*v]H]|]qWS!'ڞ8>yI?ZᆇnT`'2]Dq?e_Ak419ߴR۵zF⟲s]( a 1>,P4:JֆM6`9ˋ2S? tK8,.7:|B5)DO[8P5byMYӼگa[ p)}o NO2^fs1?n_(o.Y]t=A%;]qۏ,Be/}?#<4mUuzDeUZ6\~,4>8~3f_|d4ymy˸.UD$%=QǏ'ܲ9mA/%f eYJŒ~^·z* B8.x[O-Otv|wo'盯Ȱ^B_Ĺ9B!ZEzonou %[),YFD|RFF_ѧ7_o[< &jz2qe %;EV^d/\ ~>q?ؖ9T뜂{y (v̶7^V$U 9=(y+-̈́mjBo76"jVCo&MѺIOR(~cc_PgFGh]{b͊6*ثb]S3pCP?x˞=n[%w튺aiaWez{թdx|K`{w늶w8߂2QJ% SUڒj261]~ (6]CGRuǯ*1\sz[m-W04' aIZ(i]튭;NR[kj8yt5Z8 +Jc{[ z'k%F\K K|ثb͊6*ثb͊6*ث*6*ثb͊6*ثbO,BG%i w`FRb]v7v;vl(vl vV*UٱCbf]vlUXWf]vlUٱWf] 6*ثb́]vlUٱWf]vlUG eb9!xs"_>xOhc)e?Xuo'"Ӷl?a@F(R㰲Z3b͊6*l+bx]*qg5eLSը3aW)Nآ qM [͊vl ZWeUeWS6I[V*qUG6)k>g,Uuۃ1 -HebN}DxSɺ1`;^C+&J٦% ?"Tfc*AiPԨΓpEv\:BUWeS[Oڞ?VoIj* p.S̊Duw<[},?ԏv?mejG3j: { q#2|JqlgoAWS /L>R+ЭlFe1H#j僇{-dxd㌧8dyp-&MPNO&K8\ u4o_vz09T?x=_L[Qk]M4GֵV9pAR_oF}aCjbn1Av-eT t00mfKbޓ^pX?E ޒKflT3϶&`}÷ë~xv\?M?¢qjO[]ߡ/Y.œ_e\vS 4ho-xoMRNjW-GCJUl2 k/WQ#Qƴ5^M0#q_: [& w`oSSʐx&}dFd'8@cbmV H"& ](00lezx)ƺdU7eQXɆC DS' ]1ƒnݱ;)4]|Ęb]]vlUٱWf]vlUٱWf]]!6|7 s1a(lZLhGrJ C6Y<2?yvΥ(%<\ˆ3oB IIwCtO̭ Ws~ٗ'ɡˌьRK.t{d)C'OcB}X8T5ƑFv-vY俹?`9o>˯^C8̰B'%'X' Z'f[Ɖ C w^Pu"E`G|-YqqqAL?:d)%nȮgȒxhCF. H e3J~ʎ;`ڏ8 d1C 0nLMr0nO|Y:lk%洜\Qe;ŁS}#j ?J05R7Sx|7ӠƳJz1+'Sc2b7\j^7 8T|'ٔ,绮ɖXe/E~?S&ZzW]R ]l9sp(ئF({y"-X#!M2nkA-M̭֤{ !T/wxqhL ªk_ԯ`cֱ.zeI5č$>-Q7C9ʪd7}!vIw E31$|Uh@ =*MӈR-0a-V+XEX7cW|4c)ws.(T3}x?-{:K&@y]˿K R;]N1^{ުD)SMWѣ4ȣv?';[RxjϙQ R'ݛ‹ }[UZAA_\ss5Q骏?oO⒥hY7Gޭ~\sqeڤa/>9D"GRvuO:i|-k n=ɞ1!sgF_WI-Gء==JYl\ksVI}S!"#B;,7)+B刍TuWu9u5ɂ-G&Ҵ#Xpk"Xh jĨ_Q.Ԡ-sĨj SIQQM5[5>æ}*CL5F O(w6MdžV4*~(x| KuŮ/G//ˀO$S'>(`䯫? Gs0ծ[QՋ+{43eD ,|-? ~}t*9l_7KJGl%NY#>-7;*8yKxWj9v kvpwrFԪm-->R~?ީw̺MD{Td7дZX"S (,_v'9YCd+.eq8Ȇ8 ^n>vj T޸+kMPzmһlPvQ܂7=~[pjMPWpx[nb_X7-HK'#6#v?|)EԐ| N^*Z9V0M=0a8,Q@fbe)k/6* x71M%ǔMʵƔ\V\h~lai(j1WbҊafTոX`SD\aOP8]ȧ;c &OUŌ /r!NCk!~+aQ]4|׎yOgO ZJ9ht[#z ]h`WeuUIҕ^{ɵ0ЁjG| jiA*E^Кv\U$֭,?.1Wepې]ͱ]mm#uZW—f iUru.pGSGlU\w+~;)W|]1Wcp~S)lqWb۹] K&'v>3@N(vam]M6]`nqC8 bǖ.[;JF*k-Zu.+ڸ9^BCb 7{ƸF,k5O@[z WB^[b̋b)c>O\HvPI]ZȤQKbثb͊6*ث#ƟL~b͊ixٱKvlPإ1U/va.Y]\aKG,b WcqVǢWSy)vw*ir0%cl)iU8 PNX5ڸiVz\QX`BDnCf>WyKT""WrE.w!|hǽk5>$x?eJ,d"ز DE TEO?hs'̚LecV_W &Z FmoL}AYM0|Vn`1c?^~4 G}@2N2;,Afl ڝmLN/ȻfCEnłYG'q;2F5<2qEط†CJ۱£|_sKejuI%?~şN>*|01vl*J4$8zPARD`ݖד͸W."4Ğy.Ğ)lě}BlU؄}uYJO. HmGMԡkkcؤO^;i|KaYI#R?uwK}sS^OAb`ޝIꬱ'~oK 5(5;[HXth9ᗏ%x|~i1dŔuB:ƁR|%șӃ1:=f8/S"}wV3 ֛qim\%ȗ$x< /46ޗDԃIB"G'ڸ %^|$GGvRhdb.7"Ď/KOQѿ25%d '"ScoU[2'/yV2ЭGOJ=}%sSc0G__=?wͨ,-ĪɤO9]VX$F~R yO"H!Zִe)^Ղ4h⌳qα-mmMoel}_k4 %$$`ߩ?d?aɠQ8Nu;jMQZ$*Jn/~9O"Z0)2oG_pYj&{c~ę;%~WXbӵTM*#Yj_dTf6?<ߵ[5IMYc^7X`m7Ug;Dj82TNI}|>XkzkRmEhiE;㖙dž5)K/?I_y*/,km6W VYYdON+*Yxajj$:t 欁_SfattZۢ^!m'_c]"AlȜh%GU(e@jߗgӵ9%Q4I$A8ϋæC0k#O zfF)qQ(_GyOٰWvq9znC X~1'!ry E,"Rѷ|ᓖ ֻsE*H?9r]EXvW9qf}˰ c-g>i4˟ nįnByŊB?yo1X/A.WۮKexO%_x^GrC*CBO#?*̟=s'e1fI  7np^Kd6@9@]cdjG,Ř'TLygO~Ɵ7aAݻ6*ثb͊6*F|'}qP~/ch<0}aLUm6*}MIh*<o VצbU_v'zwȔ.bS9u1ثuc1ZurW"P[:1onb4N%lUٱWf]vlUٱWf]vlU*6*ثb͊6*ثbO,BG%i w`EZ^*죊+vX]LRPإف];6)vlUٱWf]vQ.®xXWf]vl*ثb́]5qWS5qWf*UٱWfL*ᕊqR㛶([ 2t9GGm%Y뗊[́Z͊6h7.͊1{|["3}Wqfl(mF4b4T[o%C/c ]"cZ]vlU+ 6*^usS ˻9)vQK?sjYGe{1*qN*쮠JKᮉ[KYYEET15pZ,zRXЃT|?xS޼V1_GfGpR | hzȜǐu0ǎ ɷ[qYS+_j W#Wz}Aa49ѵ#Դs-ʝ$x9 ƧJ&FXzs3rw_Jt<6W}>oj텸i]mYb:#F֌uT#\)<694mV6"?f\d lk=c&.sEi5m~ЧZFr1yƀ3 GN?ds/COTQ%EO~9Gz }^9cĨ!۶Cp7J&mElփf? [|st<8"`?) &qnPBy\\2h>c)l-ϯlz_ ҭ3Vi.r1K-]Lr,[L v6Ol NPP7 Ɣe6F+>8Y;EqC`Cvb؛;bb%FWcJ+/:|=1M-'36)vlUٱWf]vlUcv+  (Dr]o}s wMwI]}2ey:Oea*Х5W ?03yK OrdS/cԃɦ6?%7BdCFӥ718jZ0å##qcuc9gʒ*6_81G#agu(~;eW.¦w+˙F0~/G8FC*Pw; u5Ԙ,RJ")"}.Vn#9O_fO5v@40@6i%_2vA#GYT7jtp]m3;׎}2pqq G xeO*[W#~`լ]PjeP.w;r!j}^j$y1GBù\~Ik8Cŗ%|-B6Ns )A9z|sҡFK$ wƜ|E^.ϗmz;c>9 u-Yjbw{oLKyI:}%R lV1x'Oc' ĊT++*V l퉑c=@>|$ENLfKpQ4daPr 26x&唜8oՎRHA]Oif u=tPUʅ]d,) ?}^jEw0yMB@u r26t4}S|=MMa0hff n`4Ҝm߯h˞8e/gW&a{jH?j&jѿ6.O9;K'+XӦsO:y0N+Әs7cb21S"KvQ'qWbM)튻0 ǖ*PW*zqWe8Vݔ!)NUn8؉bfvbBI<0+=RIӏǑP󏑼p~]̬neGMXh?bst9sc#l •,`V5R#Lf##liPbͅ]\cV+6/Sa t(YZ5)Z'2E (zac$m!BPŏDbDakG4dXQLMPv-!Uܾ8f)^3Q\_9Yc8!ˊk5g=@呎,}rTjMv_]Wc$XPbc^$(v3&@.!4;*Nv'  p%FثPDm]v6#Wf Aǥvn1We~,w8HhJ*apAHaZcs.KHv`YMWc)UsSvh SbcSvW D.f1ƴ`w—cuAJUL8w]^v%)+֘zb >x`lUlY;3 h%1C"U*ʵWkኻY'fܝ](V λd]) R`];6*ثb͊6*:ObO˃ pU0nXbf.˦*㚘Y\.hV®'.UL ]0`bDžKf‡)hQqU7jbkTKbȘb8J\T UAb;RiLԮ*je=k[2mVq8ڨc‡}%YvJsRƿ~U1oKع!9Ktf`N_G?ȷmeW G[:}^cfr&N^$3[6-O@C #1|9\xO_(k-eqa>X;]L) |M>ΤN\Qq/KrY E5GT$,Q=E BԑM3"sG7y~?Fk_PB~#o8M]qoi?qzx5^(vj uoe I؉J__N"&I;FZyc kz,/OGn& Sd;/qFqbO#>H82AzثX͊6I]vU0 iaK& 9$8vC8ndMr.H 0J+dx2O2'ԭ`ѽ"R$~e-s wyJfQ/W* 3DHM}lR]ǮKi1B5eP+/j_1dJ?Tc'k?biWI;JʿYidVTG:~Ɂ0,nucյ8老*S%tSAY+8={XbGW9>gV0Mܴv)z!i2EԿel|'Ic<-2ĐH3?L+72>),P{Mvxa 1 z4ےz|$k>~7Gڲ&K :4y `yWz]֟,WoɫP<0 &0 sq.Xgq W\:ፖ Jhߕt^2Glmk8#P2mDDEHD`KY\{Ï-_Y]$̑JTaN F.H9zX柗}{Dt"{Wf >12'/|P%dm SGk(>O zs>?)>s_:zZ%{o6 j3|2b/h^Kzjnwj25h@qW-lGx2RiL*^ھ$Wi=F˔ާ~RiSOw"֌8oyC5 bOEjmVŸ37j?//)΢=>\Fy[&~~."v!՘'ǦʻK~%e"+M NyXY?i#GeϘDb+VR`~aC_H56%cӡf$kH qKJ;X/[CIn 8|_X 3(o 'AiMwym̚GVS| X G'|x8"&Cҥ:`Kyc$ws FKs0|o&#[L aXjF_nU =)4AF5m֡XLZ尾+hh1I?y_1m[_Rj2i*BOP̍;|gֵ&U&pOTEK1+Q92eJ1,E$,EW/o/TYXs bq@W$&=bU&9 $ rᑯ1oH,%M?Taѡ_x^N9&[4yʚ2^_Mڎ >)SqOLzvi5 sOQ~%_' r`bCԼ7zNWIr\["T1,He'@ՏI{Đ8+S|ثb͊6*ث_|7 lっn٘XF*)hͶZѩ]MʗlPļw=V|PUĞ.[z1]2c0٨N*eF:bP/b{%ݼ0GeU *ZZZ8Z9Z||pZ`®4 л- Z9g Qm-n)a7Lɶ9+f]vlUٱWf]vlUٱWf]*6*ثb͊6*ثbO,BG搧qtZe@Jʦ*v^*ءٱKb͊6(vlR͊6*ث]Uٰ!xbͅ]vlUٱWf͊*U+ jWS/vlUن*]nKMZ]H׻ jf1ĒpڋkxqQgT_2BQ9wmr 8Y)W6np+Ew,1J4ĕf\q{sL["faFi5bƑU ͊V|NتlqR6*fq9vV*ثt͊e9ZVvlUu®͉VEWwz~0u[{?,E8I})*DJ+1a$7ZeKTv䮙\,f4}ki5 _.^&$(^AK?X]?'By@#;0e2ƓU]?\|8ԞBE=9*_OI(eG nkH"?P:Sal\%6Z7 ,H0PjW.wyk{HFcН";:\'c.*:᧒UQ}.Xr8QAȆ?B;9+XQu/2XoqwUKCki=4">iΑrVu۞J¼H4m9CS ~P* D iep;, v0WcXcHv0bt]UؙUavQUue>cC o 8BSssSRiڕ儭Z"ʦ*\ sb͊6*ثb͊,Uu1k|:|4FaO1fbIK,>l8O-%8/J}6O+J>i1Z|wG®7"y]x;x`z/R R|–y<69$Ѯ;%Zz~o+v 3QDteue g t;f},2FH%2<ۖ\!hL*C\'-U:S76Ÿ #<[cHD.8wɮޕ@yx_ aZ GP5RG=,v?v~0BQ$Dm]Lr6aɕh|Z YanX;cթE/޷nbWӕiӋ}quZX#$52Ή~e[ v?4-9^T+5|Tm ?3crhḦy,D"9wV؝~g]Koo BG-x$lZ~feDBM+Z u.4W QefQQhDf@@7s/FA58n-nSG:@w%Wi_i=[?i\+FGJ5;,^LF?k!t/ِg̷Z$-j9L˛i;+ X%aH׮ Gf^"ws?'oAVKT hQy rn(r%iY<1,p<$́@=zuy-TEp#6riq7 ś֩; \?'Wwͷ(1J*{F|6ZѓңMpcz8¤r x<2LqrߓʉBr+ne#|VܑКH9BZaMnJ 3Q5$9(INjytUd>?ZDPn܁qN)K-?u2O?&XؓN824rܿM#2eј,X"{cQe7SI5jVM^MhXzzN+˦τqR"rZOTo G8C|@ZMlq#c@3 yvO?Os_8yMnc+3]ҙ)/giaQ,{Ē]6b즮!LPtpUح`Wf=pTݚPyd R vPUɐ+nE=1R]\dkae$ae(;;ث;sS VL qEp46XjH„TmLUZXytV͊&VٱUt)تEqko+zRa1i)g`q, U $'rvH=%ZR/i>h_twU.0 l{'U|3G8o$222*Tbɼ` vPAJqါ6 61KBO>l*Ԩ*zWeЕ 68ؐ@ 0RVviaUE،Ur~6߮**ř*좛s1WcRHb4POPc0PcQӾ;vPA)v*҃;0*@RH]OTu؟/UIS;JSW`65.ǘՀ+(v[-v'+|5\RNc㊻,,`֦bfw&G#]T)v\`88Uٖ%ce$wő_\Rmź˹tJzJѼWbёSLUء%ENH;Wa6TEvȡٱWf]vlUٱWgR?(?F\S)k6*ثbbSxG.b8U*qZr]\qV ]\qVSNX\P;)[Eªn.Pw/4q@)TQCL',o5h7/aj1;VQC(QҸlUIj-o{kmzxe8("Oě(i*N?4cŤA̒;u*8,6KtFMyag%ͤ֍Ph13]SN~ʚZnfLxjLz)e~<؃5ϣv,Xնʩ5_PԒ7%94$[;Or=(6eZ4`rNf=wv2FIr :aQo0N5+MHO<'r`O 1slxĻ$-7jvNvFW_5؟6n'Y,3bƤs37"dvPŃ;)q ;d8.y#E%#Ȧi%`Ol.:3fg?ҔZ2*84Y>;raW?ki$ctYU+%Tf] [U؛`K 1Avb ]L]bpUGCBQޛ^3D_)$(v^6vl)v!,E|v&.ͨ[؁̇ne"':3M#WeT7c/I0#@KITãG*#|;p焉½_Wϵ˻}n3yxZW3O2<@DE+'[b%gi+PA,C˃04SfFVe  W[?a冣gZN rg_4W 98/T\_͓>)*cJ/7Zߛ}#˧Hn(Adet| \#GH[QC͋r?rB^+Rx̌3??ҲA4ct| }Y6iB*"K}l_=r$֬-he`PJ_~?g![a(Wz E8/㿌 W^+l/W'ߴ]'].btbO<>.?k\`f%-5Lt0NΛwo-;dzʂSקZ*~'Xϙ$9"I޿1p;=.,X@;~'~]~P迗1D,C#TqU=GNy**cx "j\"hr: +]V.PZe"8MR{ [pjcooiX6Ǯ$48]nO,1o-e\1hjLPr1SInVXT_ߚqzq隹"Ad[0s`|fqYZ6E?x)r^3p!ҠL¢yv{[6IDA^,7 _qΞDKњ7 M'œxlŒrZJUT r%~agN""},"3p`_J+mH$/50/{NmCGu@N9p5ȕ\w`]N#VrIImkpibY-jR|ثb͊6*ثb͊6*ث*6*ثb͊6*ثbO,BG搧qtl(ثb͊6*ثbf]6*]\UٱWe]vlUxb͊6vlUٱWf]\ *WeaWfVb\U٫WS6u2]LqWZR@j9NՌ=* t۩A>M1MVR aR@bCNy5O\v)ko|U3 +mUp+|s)+ ,J{cq`UKG 0Z>QC\Y Si8Pe-lUqZþl ݲ*lUZV*sSnWW+ur*saKTbͅ\sbsnA՝{?fJ.ml{NQjm*U=p` C%`dcXr!fDQ4shyS qO ^OUْ?tR"![U'ᶹ ר$y.VbyyQ^>(nE`£LI<.t4;fDOGO6SYOQWx߉rڪ=pd*ǩ_Ïp`Cy,=$`A+a*abFDTT)Np2,?X[RQ!0Yu TıZȡ l)vSqWeq`S|RMj޷ڧ}<$O1{z{ؒcXaӦ^-$q8Rh-7ğFT7ZiQCSd}m*(0`&k*5Lw3q/j=G z x䥥1XL N!/Ēhj[H⿎'tu^ƻ \S`qa0"Sr`K$PqDVz5o 6ˇ` _:H*EFGypë8]=<>/J6MAR iĄ<߆4r_1^@iCgY ? O>(}#;ב|L8&12+0*mB5zĜAS_1lBG*qۚh>X<`#>ό/WmJ=&>عذrRdHۑ?̏QQEE"~bz\ت5S㔂9M>Utnc9Re*#ʕOzb353JIYIWj5hUh{I H=eYHM4lؒ5 B8Q.IQ֢q΢l,A(vux@/bx9:,_Qpn]Pֿ{rv @)k?fr*14jЩ!Go+!tQl"tgjxdAdX E*HvYZ= ADZ1Ԋj݋( A ⣏k\:>=xȌM:[Lm'(:H+M$UF,|~/U0 bl0%،J1@v aTZx6T:I?W=aWf] J^خp2;W8˘>&o)[:G@~w#B?AjաyHQKioK @w{DP4Jyof{drIZIH'jV3A5GcB曘ӖȌE.o# Ukp^g"w?֤zd_U,ҵ's&Yyf;R$Œ!xʑw1N+.'O둑%?mG|?!*xA\$,Ķ NlRrn*Xo@_LsmmZ$\שM8x-mi|wL<}plB &Y! }3BO[LP_!B9/yyyT$$R>Wz(@w?[qSmgz MLJ*e?pV iO?Y'٫Sپ,8_0?<߭g-d*FbYGh۠O\JsrX<) ht+pG=m8k6}b4Vk!#B#oy6c 5JD?B?y9QrgP~aFul^;@uGvtE5w%ԦkZf;,OGGCC|CZ*? kL!.vq(47E=dH"uNq9fLDid)͗.HhosouRE_; . @ '?o-+Tq9L6͈ (+JLI`CU㍫ai,lQȀ}`"Xf42 +0o++qo9b턈խX-(/I5GgM|GK803Jf(dXzxWM~Yԣ/*f=^:2>ԛ%Х g2pi̲!|/\Nx<CgGl>.|~WP 6'%?^6>ZӜqmMו >@>$Ҏ'Zy^5`$w$5|sڋ?G'}9w^ >OǗ-5(>x*גRdoLqٱWf]|-9n/R_sR$i9`P=VlojV5`V.^W#%mq2iF>xR½rT8Һ{t=1V:֣=V9&MJbc4r0(Z G*lp!U]]*챾*첻(\k|M22䭯_9P͊6*ثb͊6*ثb͊?*6*ثb͊6*ثbO,BG搧qtl(ثWe͊6*ثb͊0];*x/;+0]]vlUنvlUXWeSv^*bLUf8VWS6vli];6)vlUDVh:5Le!EcP@H! -SO!EkG;wzw:y.Qfj:Pce85\_N2;j1:vB-Lݧ߂,|a} ; 16Z%MqHc`;P6$LC(ɦ1뉞T\N)aF}E lI"MrLUـLUeh2[jb­f]͍+ʦ*jb^*UsSnZjbV(-=>?y }/U49"Ͼu2Z9xһZ PmqWea1כYqKCv#};j|prG_Ƥ+ Uf<;KcϧK`tXrC;.j-gFÒ0O  2B=搷P\5,6τR;D'R;SdzvUSPp._L7MjsnfoQkŁ,-Fg( X\-hw7o6*ثb͊6*ثb͊6*i7,UȌUlj_;YV9 bM0KdPG*3[i`Po4&}IMVLV-HTL#$|;waFxx"Z+hPHO,#~n8gK ?u) [i~Y=*iuw>?o%Z~p[ӒEQ>zL]za U5f '*y?Ej+V9&4V.4Kƽ xY,ycɲjs'mI"<>32KxjYz}/1yAC<7W/^7=d\/bҽ\\^3Y Rob Qs'I9~W"i*l2mVĬ|lv Z$$fPcbc튻/L*fmv&\ ؛D|Uؠ^#v&\Ppu*c܅.܍F*e3NXz;׆0Q iC; [ }uLy*uV\U|Z51Kjr h„\gl DbeaW5N^kh횸``JC*LFY) S>۟Vb<`U|1+,$[|ZCLP6jA98l݂{b |qfB2U=U-tL׎FW)ix`8j3}#ֵ LfV)?Zc+^r{0Q]i, 0Z]ge]s'*9%vRm]f4jrwSS%~v\UQu]> k t]X=3v1>"Oo|RPfS2XTK#WviQ$Wcj#]8ؒҸmA]Qזv8-4qWc^&Tlpw -TPUe1WeDFی*젫Ov>D8*A!Ȓ0ZnS Ěu]m@?k$; ENI.'5|J B2vP0\(v0)vFGĻdPثb͊6*ثi?#. Y/oXUnlU*챁]9]pGتr+N>.—c(Zq`U [Z͊TXbqApU+ eq׾*ѐӈ9{b,-r , $v `/+gZ O oНH4DxS(G wSnjeկkқbm$VfQF`)Zl? R:=|rw9ҢwƟ6qgCS1!ˆ9EH _Qdf`xOF v ?@YfR'܉zm_ &(ⓩ`օwT_3З4r,LDB!şㄚ- 1]gEdE+h[,>Q8N?h BY3Y^Ki8<@`Bƕ <$r[[? [F nf@ÒkH1:䇛1zNx jW^tEa#r!j_P\7in n]j#.$li ȅ@4ZPO7V9zpA$, q%[խIh3GBy(?웟nMq_B+ŲLߚPcv1`Wbŋ\)t~me5lQPZe\_і,RIwnnjWiD^UHc/lX.s9>_}?[=)c=i2b֭veS]pTZBᠣU1RM$ rD24Ƙ%t~2XSr$krؔ|JqyRr+1qeXvrG<_ҏ7Ea_}R&;#l~k_ѓ?HYNv M06Y<887^=LgOB\yO'WgQq#]Kqa2qh<8G+{v&n#%pRѓ2GQ=1 YkԎPu@5nP=E:erY,O?oȿLABlAld$7H7Pݯ É4? _hY ×G9Ep8 d|j ٞ~ix5߶6L;d_XZf1beё8*l7}q6Ss ݆d$quk-f! Spq?Nm<@ʈAX6)vlUayTPpLB\z`UԉǪ8a[jr>um0#e צ*H[()o \-L`!Tłp */®h↲{ VE}L)e\)wLHurlw®bh1Ww'l ʦ* vX][jG|U-8_d%[Q/HDf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثbO,BG搧qtl(ثWf*ثWf]vV*챊6(vUqKW+ vjb͊+v^*6*Uٰ+b͊+vV*lUG 3b͊6*Ux죊]1Wf]]N+MʨT]OLvAqqۜm7|ڥ:t84n)Z(S{K2P,z݆e[ͻg9qE e'/gɒ|%mEvn1#"­pz,/İűn 0"clUa˥qWLm1UܹeVLUSntZjbLiS51WsnV(vl aKD*sbW5+Ku9b=J~ Z?#v?g\})F WcC(2k.'c,]8RlU`bַrZȳBxȦkɌLT*ck![RFƔT_9quz $ue/KP .P.YѣPL|m*pZ~D* {ػ6h .]"K)E1)xUOA8iocK#5Wze?/颓i EFyvbc8Ke`W R XraOz/ &(~?j)}W+B|̚+钰kۑ^NiGdXn5ջwm62[sO[ZR? ߳]/䳃]G\) U؟p" lۉWid(V\ BnVIAev5R>8j3 `PrN>87E9ݰ;4eG z`[2[]b# ]m.e#Ji\i8ݛ+nݙlMp+#]z;\GQc0-e@ ;,~pHnG z B(_~G,L {akESZM,VPu拌o. SIU8?0D(XPB *S;1Xb͊6*ثb͊6*ثb]~^ЧK"]25;}2ݮcIbgrHGOQJ_[cnQruO1PG ֌BIU^ٽ0Oʧ$a~("&#h;⪭oh>G#G]-#r1m,1Ŷͩ8e&|G,cS*<|t#J)}A*:S) We{d1NJ lTGjbC $PM$ ?]JaB)ms98W8"1l He5؀}Z*(یor0Jܨ&8ہCdCj5AES!ȎlQ)"/oT?B{`R.^?ѐ !:\(GWJmJlQ(_c4uюNQS*އ1SSMoAVyH=K(%ZqVv e D†_inĜ4*Y5%"U.X<<Ь@(=]yv3v H@pZQxtLS2h:WKFZnhFfd#b<&W9c~½jē_9y59"]gm#ƔqO)P_\-B|GUvgڻ5‘s)745޵e'@4\ۑ\ĊOLSmЎi-6+H栕S# W5ddsS2Aq%]B\Uَ1CQZ L!Wc[leƴi]vWc&mbq/zdG6ឦ'W6qqҼ>ď:3$+H~/ג]v^ǁI8?^_+ \_Ɍ˱9Rԣ=j<$֧Or6|:y5!®W|@i]Ɲ4­4=qPyw+~')F VfIAW!9!,)EG3VK8z2G4iqv'>߼~Ѝ68Cے(SԽYPIs t"h/5e7AJr?O%i#t)rU $nyFy*|Mk%5ꋽ6OB2Bۗ/xX6L4\4+"ʬyp}7ɯ 8>_`+I*%BnUI_=fҟ',uv,FS|DzOSCjmi?e?i~ (U؛]>ؓ PC&Jk({ ?l]ǎC?ػ$Z-ȹFǜi;+R5hNjj.m+v`UvZc\|XW]be7a'-q F@;xe<nČ:IusSkZ,|hq._eOSǜhW;RQZeBR7hوa3l?x˿[$ژ7N<т;P##<&R?$M셻 ~|xbk3ȎO$`bV#ǁ.5VmNLe/fG }_.6PK};-jB[jncNf8{*܊ueuлGBd 1B" =xvxt (~`޲9}3B-$(UE*X:ՑOO- tXpKTKb up-]iZ|Хz_ٖG+vlϊ&*14 5(5ڰ#uϖ-%pI%7unނHe?„l-Se9!5?NijK仵~DdÎtGD/81sSۍ{v)*цq'P5!I68 }= R.+~c⪆Qt5)NJv nC9G݆2 XPtOPwSCj js$ $ZddĎTXٱWb5l3e8{fWɔN(2I[\— N*]:WcHlUi`N^㼦_|p>+O#1ဠ6!1WfmA.7vc-f0*'N KNa>aleo^(讆 ɘdr\2VrZO;i?! K?J͖̜S%V\1XFIm6szec4r#?WP`"e2U؀Gm0[H_8ZaJXrj PRmNŸ)u+^Zm-ьbƛ=>m`ZniћɉF bq-e]#@6%Vj8s fsa8} C(Ez5vGyh W-OlBH饎^ xeN,IsG_J@_ ' >Lܿiph9`+CG{. %xxt WMtjI8㙑p$g)^Vl6ּ\+߭z{f!}&D^ܖ2m]xᅡIYQcȭ95nHąQO M3 XB _ב)RE.Ko^4%۠9!=(#~EFĂP4+ƴۯ6ɚu)obr<+~*KGߊP酚M)Zᅉ U~#S  WW=;o"e*i¸يS%؛;.\1=e&Pc@ MZ\-H $6{[7jST`7 vPCNMX*S"tElBk6 U ?Wve"nna%i5 Ny+uq丂Q˞dM _m~FI U A51We*Xb͊6*UٱWa\,YXY"/RsT򝏓4qIg#j*;Q<o檺F_QEG>rYſ1<&~10!GӖS9[t "PTr>-Aw7E rz M,#k|h`of5fe].tFMCY+2 [FnuյfNCLi `6ʀl,7^a`Z{Wl󇘼u=NI"pfWyc@B1-D/Ҽv8[_|<4s ֓+-9<'탉?dַCXNh$4(`6ɐH4F8&Ud1A\hKo:OiAw$XPܲ?I- IO݆?p-zњ$zфB ~ҚǓqԓ8?%Inu^ o!U/kl#=x\iDljB=U-ژIyL_R݀l& M/loޙmsSpFô,9H~?);4F7|ʷV CJue<Ƌqn?p\3^$,myEE4"C0nD(9 ur؈1ǧaHKS"@T!i5EƙՉ'YY:bW4ccFb[o NxІ&Xă; t)b~!VZ%9኎$g^ؤvTT>lL0)m&[^4(#LY fL+ 4.Qd^L* uN4]^~"t>Ә4u;5j|#pƫ~hϩ +C 4v,Hz 9:Y2p> (ZZ-վ҅{~6X0x\]_kb0#|W^`eѴ7R~ !MQ0+x' |?jaNv E ?} e4}!?7$weFz]tX. 7H‡@ObX*>#\ ʺG1O5)!1TISB@hN!ˇ$Q-yZh֡/A,gԜeR?=KhhZQEN7Q=)!)}2~!c L|Le>j꺕Ƥ}I]jl6M8^8dHZS;-(Al] *+ HQ֝q!5BM\Wu ,~M=w>)((Ks+I¸#-J3a% jc 5 o`G\+늻H1KyyaKx AK`Wc(v%;ث)5]v,QE)v-Yi*NR_#%㞴aOU;^T~=eoڙ!V/Z$WE2V\ӦlSM S*.4,UCW2cqUE}bb늴[+'6*80*s6*ě mLBAGh)PwhyzbSe/LT 8,/n{^9m$q[~TniraIW ɏa+QE])f:*캩# vfm]K*o,FUٖlUWvRNvQ~Cяʴ튻SB:]+*k}L L-K֤aWc=iwP`Wfi>|1We8veUqWbFGMk(%mFl*ho(v[w4m+n ]׶;7V4]H1]kl>8oZ- 9v®ʓt*[c$zP d$ _|UlmWfW*좠 $և*6%_Cb͊6*ثbΩP$C. ~| «sb͊6*Z8bVL*W.U/.UqaBqWV㊭bq늩5qAY]b', Uko]w*IQJS"9u>8m ;Cצe5n(խ+OX؜Uk),n1J48FBA8 Pڐ*v=2>l*w@?E{LLY]0dwk1ZWGr, V|XlX.4b\QJmeAj4sE/u[N~s<UM }?$0,yr4Փ/!_q1M} HBFy//ۏ-#B\BTOaO~_qޘA*Rw5G j48s=@\^-2~DD7ky?Y%†,2k _[e`=) F<_ǐ6V7]8Y$R8ܠ8GYeK{dMI(nz [# 2(9 b) n?|_챷qJh:r~‚-wGHj(z"nqaZt?V"U]/7|KWcJA'ϦiA_a)~'_o71BA!wC&J @#,c0Ȕ#Wv&S7đخ{KN ޝO\ŇqZvJf3膁`0O-JVO[ t_Βo1KUjTFTUiGwB $vi$%~۝g:l6ːVcV$*a\H^Zz働*/,$|X֙U=Uh짔H*>έj$ n(ǒifxq!G-*!0z;NX%Ƴ[2ڍnv_@KTQY9(xSݯI>S,=I 2g(dPIY[_Qq~%tX^)Hޜ_ʿ(jy+}ONn1۵%_Y?v$# !grגQ(܁TfoSֱ.&D[,4x!9Vދ+VTG G~?\I Q?,soi9)TW#<_uLAGI%yi-WPxcQfVf.Mu_Ka>;Mo-P1?z^ɁmʱYaj,[?+G [o /<&?:7?1Iʼzp)b~dʥH86qlfSOU+"¡Yd&v.lyo}/4h\" ^9Z|tCFOO0N˭ З#GwqPO>$<(99?5KW:e+™eF_O */燆#3Q12m q $NO5iARlb6v^l'S-{|n.&8dc*+~iSmsGVj\M?!93M_.ph.jj;o/.=OO9eyaiv^ >qYq!1vڴ·c4MT_ה;#Aelji|vh95iQr-K<1QM)JP|$? i0\qyL8XG>D1nWU">L햣)!{bzoR̃n\qj8 g8UoFACJ~g]mYO2_Xr=NOfa:t8Oe@uKTզBۨeoFJ`j[?:2Xt]"yN>ƝapiӢ8eMOJO܊ WV"K) Rj0'H\2YrJUj!6"' J)qRGad5='b9| cHW*1MR& U +Q$˵M|rWyaRG }@qF?EJol Hz63Uq+7J'1'/ PYN *VL}$3$YʚP !}k! :{LXq>8"v4K]5죊)p C3Pz`\ݻi:@RRg|_RBdKFR9}_ݴpAv!b+B;͋9#\re^1uo vI 銐'Wgy@Z6h$^_g-%Ls̾LYas !\,_Y$,uPK)QJGme |_i. =jq^AsϟswhJk㓶f\\LP4AaWTfurebpvQӮX˞K5mbcG&i)^[ #5.vFyo6^ZT @A<2.":9cE{U8o4܍gdHПW8vW{ s@ 6x LrdeJc@k᝺+hGPכ5;ryq.U̹UKm,sUS:!$ŎyF$# z}pT 9EyUǩ!q>j:\3_,(q v1Smyokmzou9;3qPT:^^=825V6#ᵯe7[/iE—``_OrrE慔)́aO>Jڰw|NR)xrl=~ _%z}^M=)4^e3`YoIFxȮ0勆( h'h1s0;?6E8cDB+(xK,sTi<ry7_?Fn|r^B„T\2=07\ђ8%zmrALit3!$b2=@rT8{bRW˦'+Ll /"v V% }@&[,yGk> CƗQ\vҘ3]KH"D7?jA^DH3$U܎0r]Yэ;>8RbƉ)>Ȑ[vvRJBׯ/Ąȵſܩdei;5~O-28eV*VqGeS\)T PXY9:`ỤZ|Os TcjZ_RN >t/-,cA% A"m -C)$ MrvYLUa#1'*EzaKyeVl Ffvs^jG|v>vSCl)v& qAqDz .m5 BMs_Թn7[ε{R2~m]*0 UZUB2*֦l*؛50!r((Lw L`TGڸҸPLUw,*z-Fv&0 ^8 ?vXn$U v]14*CE]j7M]H&WbģvY>* ]"Wu]?1(caWbR(b ;`KzmL(v#$]A#zbͲ4]{`Wb`lz®V%d犻?,Uj]qsrJO ]A v8Y)]NUu+Yʧ͉v!ٱWf]vlUٱWgS?(?F\_3]\U\.injR㩊'LUN]1CUhxZb*pVF?ȺUf9aF D+,x6'ib^//?Nz {b#/< XK}ϫMQTy̏ĦPyGNֿ'0̽v}/iŗj?͏,Su!L '5Sqk|C:u}%=b\J6?v-&()DJR+,JYI;mIoqοjd4I\ex!y?S;.U`}.A ߓ̋G#ݙ9~G.]>1KsZcmw-4zjs:Yn/vꑣHYd_BI꼕[,2ytA'^dx?<gԧzi63~F>Kq,X%Ž+tlZ\JF̞5UT|0Iߟ1ӯ[ܽ7Jҁ]?ЀnQ:=(+\9BE/Nx5P(a"AX4=$ZK-2ۼg :9OE{O{I'[jmBxm+|[9F],-$޷/ F~n_v#O@,Ȗgc}*YcCH@hW Uʚ2yHKȽ+,ĩn6-B%&(li`}2hy|A h%{bc}EQUtC7Ob*@=ぞA,}]!Vn…@U2) ?6S p;2QB`:RIWjckèȡEvaKU40`lonؑa_WZHyB*2in`XI$t&2ˈ DhEv+|dE!^9U zTi^I$JZWɯeut4B?XbUCf5z؀'wGbx__}f0$jjvil3M7z-ċ꫙CXM==MM|\&>Rt(-*6ecd"ro/Koi=A#^H @5AO~k7x#z1kE4jUOVf$߮ TB,z V) m3ܯHcZPZF;LݐM.#nN2=5Q]%|Q&`qނ rQʇ5=0$i~1|.ez+_*M8*3F|D T#?6mwxѓBd? 4SNH>}Z u—L,iTȴĊ ]*MlU(v7v4ƕؙB7!W:7-mbַ*]ȅ@n|ϫm2!`խ/c,9}`=3X[Զr؍#5lA( I~֞9?|פkMb0@Đ 9 y:br@'C1^R{H&V? ӯ۫`8Cwɥ针57∂w4fcI4+0ڎ2V3U@֗ny<]JE2A$א~XaVFE 煕4ƃlp mL>rW \6 o(xS"K! A_zz8HPg䨈bjE(} crm6~=g?m(QE I;{lEEwHqw^&-:+XE#VÎȜMa+FdK0W`>rR0BXJZn'APӠaC~P$b5\`hezP&)Kf&qˁly$W 'eFho]QwGF\ұy7ch;&% t|8 #ԐqV*ȥbMKwX$lJsX^2k WVqBziLJ)Kz2!a5ı231=QtY"2Ȳ(4%$2A:~2!a33"Y7( ?2[7`pWmGgaQΧ s=iw1{!ܩt;^F`82fbKfvZTc,ym0e_NC`!;WI&Ej}ZeOtQ ;\:{g!/)oV԰e,nTGrJ],/S3ŚvŁ(U Qn&*(m[S榸pĜWbLpݏʊNv'($bqWf4C#7.ǥ\U*\p^oN!kF5I7DFog˒~k-hNWmZq!AV>Bn8;5+4VizvO|65O lQG 'i (!jlݕ+®0ƖQ+oӱ;ch!|WBCN9|pSj(l7+LUpn}(U(JҸ!1lPĥʼnEmŨuiC{micd0^i5jI҂8 aUJ]U(cF뀪BxSo ثUGQƀl$wلwƙ_%ULRc3&ˮ6nݎY)MJ֭";Ӆ J_b)z1`b U\WYy ZaH9`Q͋ Km+I2jҙh8V[y帙OqR:|J~/ytrwK/85IbVGgpGhi_x JDVW5unq?]\RjCCys#'eD|NhZZj2 y[-I蠪f ajgq /c#V`Z.^Lޢ˟Ƹgy= V Y qֿm0?啁Se~Z-"%n l#Bw]~)3n? p4[`LBk 92'!%Ӟգk ²/km]fni|9׃¶z-@ ?9\\ّi:3O ~+xLk M1k\6m2lcH*aL a#JMƕ؏~Gj`"f G]O@^wߠb fP?cn9P@4ۄghRKq~WmbD <<7)#d_rv)wLRD[ʱ*줜Yπ{;iF'"?W -F82~)C~wK?;-(ӟRq _ĿQ~Y[Zm.1oe kD/ؚK5hB;>)<Q|AAѿq)G_?e4 */omd::R,w_lue>HccU> !yRyI!l;bg/\qV ?zo~w9f4|Q4vp_/&\e{gL=rW7cNMi$>lçy'*agimܙ6+|YORbd,ޟW/eViU~r=/|?Lpcxn^W\ʒ ;oFBA%ݍ|QX</mIUpmF@/ؘa'/F>. vg_sɿcrO#K>;O}Gw,ǓEɀꧨO?+_#.'`2rNb]vlUٱWeM*gҕ xQ,Zѫ+0ydq#v02i 8dx8?'q<~@$ ˃ZIE?bF*ѿWȗ?O\~sa?Ur#(S čxV~4U[wD9ʦ3laS/0%Ɲ5__kpn>],!|G7C/v6+򣄪$Z7V#*CďXχw"yh@q6cg ;;R%=KF䯇_Kyit??8;UٱWaIa&O_+Y Fݞ]-4&;4M/6iD0QT /ԅ>><.Z>~4`H]Tf0?.)cx懝)]_ȖjV~C[e"2<7k]O<2l. PBg)O$%hr6.&v9B"2}<>'>K|A{GsuA4r/' >|x\GI[Ǜ<֥OO!$BOMeqd3 XKcV›*1nC!I9Sq=qW {`CcOpv—cN)v_(v8Ӧ) V;B:Upw< `UrȮ,Z0x閫4=0%1Al_O%B\"K YRsb͊6*ثb͊6*ثb*6*ثb͊6*ثbO,BG%i w`FR͊+ ]6*ث!xb͊]vl*ء٩]SjxٱVaVus`WW51C[LP] 6*죊+onyK]vlUaWeVlUءٱWeS;0q`VdqZ#}-9cq*WJZ6Iۣsc|w[[-TxpS*0%q*RA ()S[FHj$v3$awv9Jsi1B,iѶ8+ߘ*\/̼Yy mn89( xUmF2@17Gi(.8_uEWiޟ<5̣Ck)P|,Gocp?7G_^?J<_RN*3SSG?^I.c>&V@"qʌZEcɎku(8HiWTPp*bsH83eZ8 ăqD&8 HK'm:(aNKFJ8' TpT^Ikmc{؀ O|X&|^N/zT.l'⿲R_vt ..9H-![2(|Qk!/G*7&*ە4or Al/PQFWIeT$5ޛ*~:<ʄͽ7DE^,[bd۶.:j[Q+0T*C\}&_puה40$#O-_$Z֥qYA$ucZz5yzd/S.1FU`kVG΁`wo+yR%I"Fv1#K8.qȱi|8}XāpT( LBǙtW  CRc[91ʧ߆6CċK7/ގ&c]?) |$N.`2X%ɏTZ~Cv!\Z>]P 2DJ j(iV#`z% W_E{yʻӡ,EC௧5/,K fVm#WA@M3:ךn5@RH^.&|<\؇?2_)!IZv܋}2~d;]'YiͰ$o|l6`ƬY_^ԟA5 ž.!$6etԵ㪆-GXwo Ef ,O/醺Ƣ}Lz:`'yrO0-Wy1|5 weeS##EorشOt=J-bH.P L<+bjI8tۍ6j2A8Fd(C%4 8y9 :[-l*h>- &'DۢHLPZMi$iՔyXP+dR%y\&V7sڑ )CRqBͺmJITP0CFF&U? @GlSjHejqf76Uu 6"zPx4SZ@A&ziuނTV_[qHQTu$UPt@ewޘaiEVCTk Ӝ }?UK4sI 1ZrP܎)_U{ٚML%ydd?|_藍_`;pd$tRs\^MTé-)-@Ǭ 1K[SE9`bl=HnaOZs'/*В[h#M*Nf&-n:8Z2잘$ځzZ @~C˩f0IR68{:v4j܂* @n. n(Sm"␒7;rFU6*:Pd,y´湆 e[}bUщ ң R0 JtƓ6}]sQL o.Wv!2oQ(G|UJ U``8wָrOOܗe1pjj2 x࿫6^/tdhA1b7>˂ 5zl$ 4'/+ԤQ*{ ǞuBveCrŪxa )|_qP}Ӧb ;u®b`d$vEl*i]v<*@o]]_]\h>X0ǖ* 7(vYW#l vX# 1Wfv2AP v"IqT-]](v(]I]($qWe+ɠ®lP]Xt]=CǦ)v -Tm* )]!T®+ p_*ȼ]] ㅓWvW\UE|?T.;6*ثb͊6*zGbO˃ ౅-v*, Uq9``UV)hxi81BrWf** UaŹ]1KG0!L*di8rXW0M늬qW(\zxqJ6`HiUj>ت$ w[х  =p*ݩ}|V0FA"r v |߰OO*fGsY&lUٱWf]m] ݎ 6zFLI´ `b>+ZTd6)끬2)0Ҹ2)k -0P o8 >ٓ쒻c:`-C8i#U$q.? ٱUby{Y%%a.-Gjq6}2|rqK&hsV4$8$F>ޏp-ko ܳ DE #S 45 ٮOb0K|~'n>/I! q64V%5KvcGa[ǸQրT@(] 1a놏VTo(uq X wÍIp@WZۄ4*Pi-Y4FFKN 3Kn{FJ@͑eC$-"EwɖOe}+@J>*@~H%^{ucC⿳h-~5PVUk6_l Z)/f2[s]~_q$Zj\cZ|?d6CMGcb-+KO>Gn5T6A e$_7wޤ#+diՈ 5yPn>`~ӘW%N^.Gk"QOa_,%i_~OX\ f,JP`Yi+TViϏ/?'8Mhb "*VM)IWGa,rk?a#D,@Ꞩ fc]0Sn⼉v03zW;u[OHUP=$XDZ'N&?xKxm:r~z"tI7,Ѯ/~M, zE<ԣɖ_v/oz"R4r2%pMa5X??IĶ䱏yKnFtEepQhiwe:lTM]m-eV#n? ORۇU˓?JB䒬bZ \DGU𴜾g`'/Wa4ܼI!6ALC?O&O?ӱ3}f!SIF?Dcd~;YGv#44̟0XO}:ZڣK<EK14UQH YWR,PDw`;|*iv.,jhQZ3Z$]`V.TVsZ9nG?3c<:=j(FjW/ƿ s| `!Ǩep>'?|?Nv 1\ıXPe f[vł_nKlրSǗ2主ih2%N6?#|G}-q측 L>C<|_v]^.v q{2G99[..?!<v._eQsg',ܡXQ/\?s5ϕeU׃4%,x_9EfBO[qccSI;'@nyn06<}EU|YUg1r'FDŽF_~'(Y>/cy:%΃zx,X"QLU ךz:5&ꃄlBQqoOs_A~sT~?c? '}U//5跞]{}?RD֭;ޙaOޏX%XnG6]j)m.Ӎb!@*YrBuoVH#ӫQώ3GZξծ$P̥c'YaOIoɭ5$kg;#Yjܼܨ.Q8,#I=DN矪ު"HBd !{%_Lo/?Z4b02~pƂz4Wp=kɚ>ehfx9+Fw82GM`KhK|ţZY2YTBThOhZ>lۼ[GnY,bX$m7qZۧ| M{F)_5 )MLz Z>`m(q88  ԡ]- 늶N_*rpE:v]Zq튵Lը+ES Vp+G+.ʦ,`q(vm+W; ?|i$Hڏr!vlUٱWf]vlUٱWf]v*6*ثb͊6*ثbO,BG%i w`FR͊]vlRث!xb8٫]v^(v^vlUk51K銻50C`Wf[Go0]+ 6*ثeb6*]\RlU٩6o+usSusS:u eSG, *rWW_,gd;ފK kzx`s!EZ`KDI+SCVǃ,f8=`eڐV/K|nIr P%Ln0G("I'Uy$ zHy/æuO*VQ-:mgbt/a䄑aQ㒱eۣCɨ!&I;Uy;q9 O@0ކ!Lh O7f#$xaa͠?7כ{~88 ?yU|0C^ck7n?X#I?aeirW^c|` ),/[h1_lD$/ӗs>3蝉8ד=`B |^DSzR!ٔUue (K!ɥَ*qUo|| A\ ehr=hZQ)~OIu>,/@`\%d%_,?LJS'bFÿ2[4 H6i?llqrp҆$!3 j PZ{{vϧi4e.E$/ŷ8)rHJ՚ۖxùȓnLrЮ7LXFƘҐ!$'~ŗ4GGJ\Ydn*vRŜww|.H5=0F-H8+w8:]qȞ)dJu H$ a4bІuQ'@Y}cj rIO"s"Eb+3Tf3Օ651=rQKxnK^V\qUś/+:ؼQxT2◫>d/Ȓ:_VGc{9n 9Ŷ4$336%`}-Lc`N |{hBrG/ لaiJf*ѳkmh78ڮu@9\IysNB@ vrۤ;ӭpګr(`TRJڸAرĭWJ@*7$Vpˠx S) `M46 f^{nm;H%bSl o3b74ԁ0=PPF ;Szs|hK1-$_@"Y$P]m%do#Fy =2+ڿ˄a.#(1yNB#H^~_^2'v'(P9Jr|GFKn;S ,tvE ;me`ۺϫ( #P <:r94JX!t;z13XŮYfU <2NSGG+V~٘a/Wyg=1Kr K=;dZ 5.lG?NqxN?!,GwZWIyj;Vn'jOD~>mt3qq6,jb5ۗs`B ?>=r\Cc@ /ȾqYRr'<1;_Y *OGoyiY|2y:PERniڂ}jl+@r]BČ*@X^р`~gY l>xRע"死t1U'$%Am]9?b (x/{33H\ȪPj+SW;ZA@;Z018Y%WHBӏh@ |U4S)QVVV Z8ǼFO bŠN(2=4>#25"IQ_ UHvZ` ޅ *6Px넎hrLK(9Zp:W]]ؠ3  ۫1mu+nĜ'`Y$v:w0tgkq$SJ2J3/)OF0m{ON!GᙣMȾa'To׋hV͂YQdQ6 M͍-z#6\a\'7#;S4!*ԥ7vQ,E*u~Ucuv( b^!-|U4^ UTxƑ\ROqWcT;5jqWcdcyb㊻LU؜FݱWfR]ۦv5CӶ*Q6v\|+ 2$WbPW*q4]w.TV|Uu*bÁ]qWblꭰ ҘUr(+Wb4!Pv95beƸn®5me/%[(v+ibh#RĻdثb͊6*ث?#. ~| •*8bkL ZN:Z8 Ui9tZXZ'|ZN8bI˦*n5jb>i81U{JÎi'P1U4 k+-h6 (6@h@'}C|Oaöm5;ey f(JxcՀaU)q`~-Q0s{2ɼm27]vlUٱWf®ˮ*6p8m.ǫS,.FŨP\j!M aQI6-d%6 |[p\s``BGw1N"+j[Y'U=i͐M{wv@wJȎ@y~7p?K+)i~eXP _ {ksdʴn;0ˁty1K!9?mUn|F'?(>,З̚t[F$ wQpg'_ʗWm%L|YqF+qBI3_Mh\ҲߒoOO5yXYVI,9oGfo։ޕI*hɩ']?saW,c'?̋,rLm#XDYmI]'Ne[d =9>X5ǚ.Ir3hHۈ,rcoIXcXLh1ZcOpzѭԄ<&ɈLjgm(m"xUYQS:5)qL>]_8^"7R`pkB_$明A{!;dv"?܍'_]^e%B)g'nv_ܤ)D+rffF`DMRCX&7xV#*EF+է>T`Ij Me)T5q PlUٱWf]vlUٱWf] 1Wb\w!OkFM!)Hc*,:3///_.7ly77O'}@/Wrxr}.[BՌPV#q⒎UcZ^KJ~pnkV$-f_FzJzr=\~%yUUTN=37q /O9I=4D{8ߏhuZn OS1>_vR!=Ԅ~[V987*B+6*ثb͊6*ثb͊6**6*ثb͊6*ثbO,BG%i w`E\ʦ*]S50S;/+ ]evP]r銵®́]vl(vlRL V)vj͊ͅ6vl*bqWebLUSusS\bjbLR\[ʦ*v*lUj8B:r]AoӪsa|py FIݻt02:fFXa-cY!W"!%93zz.9KonF[ MNYS' !G;`}QPU*+=lٗ̇& t(7 %(ֹyH'\p94 +Q0{f4 Lƕrv' sa5H"^7 :HQ<>mZxaHg2sF%Lw9 5ue'8`$bHJ&fb D{AW),tr#}-KDb~Q[U6( 9pd8%` ڼW=w\v$j7*H4D `||o"v܏*_DZ( \z'Ĵxb\Ąc(\ߏ {@i-yeRZޭ=vmD'OÔf6<_:"J؟EТ#1#bV&vq՜z%_K:>|r O[+Z\3Ҥ  ~VZu?i5jj(vaףFI=`Ƽ-ݯ&gqp ptK &`Zb-YʭDG#`cƃ}wªU(8ɾQ]n*1lA^\ Q8 ĕlo£uk)\s#~܈xԷS-JJGr(i , .-P`w"-RTu…n,² ~_ T CϦ>Emw9-6rs aRo]N[x}j2MD&pKjzS(1Vb2Ci\ a\(v1e,\ 74%H0RS%X¸ґl-1lHu'ZjwDuߠ+]yCW]%RM Z|2$ i4vE$ cNI'XY/4A;l 쫕Zx{6 ~lJb`?G˳|Y&"ɂNzQ[Ἒ=fَ#.k'#uPmj^@?#f#miXMRu5避Y$~haU .v]N-i:Pq_ׂ֐ڗ&7$)=,F4vP+JjĚLJ|a8*2^yZS r`eKNN*a)S,.tH!Y=q~}69\䐓̿VF6wX%b NhːSSQ._騛e֖qZİBQE 1V a$w F:ESB:rA֋P6RӹS "U>aU ^"T{br\~8^7 [)h t;o@6|5$^f7jY0?NB4)%nB7N)s8O=cեvIOjTuEqUA"Z1Z+,Eũ OS 7_l((8nG"`LS+UMHv-rXPqKc)I]M'M; L ñ#Pb`uŋʑCW\~Q/^[jȎ9R_R?7U=տVzx>ZMkzJHP16)'mٱ[\"Lƕw\6" *W,imxl"U; "lP*${3FN,S.7)V.)I~$qYIsiq"1qLqm72zc(ԮV*AVV3bDlIbS(Zr,5{⎮#z ~di\eFbjc;=}*cBb&vk_Zу.l)v&A][o|UٖFb v=A*qC)vi 7]#(1WeTsWb3ba?v tٻFy?_Wmi fsV,$2'a@ NnWeb͊6*\UXb͊6*ث[{i.]aKƁTT$XԻ7$3?Vj_#1\(҉SݖG/$Z~y,_go\[`:nw""DS/a>OtCNU[.7M({A-)Si|ɮxCծUKz>4y?[^^i3}2zzLy'Un:u2ֻ17`ĊPÏ,VE!A!'ljzUΙ;Zbz/Ki"k[Ȯ@Ѻ1BlU-[ b9L jGObZ4 l,lh~XԵ6(r8%VExy7liw4'ԘchT\ݸ.Ux_|oKT?/yoř1F]NdraC_bk{ېL>n|-gc( ]X?ܢ'~+ZDKTɈ+K~m/?qlj#ܿu<5qUb-܅<+[{xW B^&?}?[yeܺx"Sl{ nJ'U/v^[26ؕ#8DF>* :P7Z=RK4M@=1kp 'p,Y8䜝d-G\꣯ _ ϗi(HN?>J-IbE*œ^e{vc>'[KZ5pU%"d6 /BGn>&e_c?C&1-ņC/L>N͏S5 ,<ۦA-(7(3%#_+C7*s85O0ӝYPJdYZ@O).=9&vԾ!}&5[T<. G4ޒ4E.B-M ;zQZi_uIc'FhFq* TJ*r'}Dnwrd(=oGO$_2H# y##w2C /i6O"\is#~ ߼(דzmW"N9lrQQs(߻u>+DеkuwiLcҝ#qq LR2$|S%Ozm+k/TľpEicIZ70ݳq W*\U(w]\x8G7@qW⭁\lbbX4v;YqV/hU]1V:5w¥YZ~ƋL(__9ʐ͊6*ثb͊6*ثb͊?*6*ثb͊6*ثbO,BG%i w`D˙ qثb͊6*UٱWfͅ.͊0+b*ZqWeaWff] f-vjbeS ]͊6vl UٰSvjbW6*v]1WfL *]bܼy+jigK@GnfFԞ# 5ĖIqэ3l6et )[\pV*$̖wa,KQltY<1_ <6730n1eAm^dhW>X@ B 7h | 42sBв79Ps㨇3?VG XPk|$1-i^Dw#8\Rh:HR>B,&IZ269 obm%ӣReT)t9vFidRXҔ8Yo)JDU}LId@ ̾|ekrbߊI{`u8ª)4:3 ƍ(aZ)Zʲ6aj(F*Fvʬ~NU;מ#l*͝bF1$r5xC^#=urUC(5$+2;Ö<{mADS"ϵ+: V?pe~R =򰫈X8[Dت+C߾Rb+tzeI*F*[[;RB*br\4jLi+ (>xa|[{`U`1]6i&  1U+P< PvWUJ_*Jqj9' '>Y~M)qо¸rR(WIi`늬CBZ.RD(Ia2Ԩ1ZV5a,cZnil*~ b$dڧX&1D犫QiRvŌRAEq j*8uJjz *44LA"lkNVEr'6 QͤLX~9%\K $J8+ָ.h (, l 4qw+ &VQ#&Y|2(D*Z(.*zj_Kh5sS#XĤv'f ptZAuqd>+4e;A\1)+dUk,ei6;HCA]Zg$KD+1*\ޒ{ N9?4VL|C21 t= >_%@Pfu>yo s͂ސ僅*2ZªbKUlq}XfHDW+ *e^ʮZ@bp-$*B0 Z(m ;b x2Cpj1p>ˁ_*EZ $f {b,)kN獮W9c'/X(B>,J6#YE!-FYM7^`ڴg eYێ|?9R# á\>ӎ\QʅC-ۮ*i1K$bI튻*֘tSv:E5:ba|U^Z!.1]ƍӰ;,UٽJmv&b)vTMETbb^{'\ RF4ve&]CUؑ$1*6\1KlU5 HjyxbDM[)v8InLF Ƨ| oÄ+O]e4ߦv5)vQb!Be(*;*N2L\]]]U$a)8T\];6*ثb͊6*ObO˃4OpX«N<`U'*xa81Jq I˦)jZ',`5Z,aKD%nXLU51Vǎ*q HjTVmTe5F(Cs]Uٍ1K`ԯN6Wc]W<,:t« { U>S}We wŸ&*㎽b(*س Q/==2yy!y=ڱZ a'*rƓN -;/<)f㆑NZvn8ӳqƖ %2`%ز&`cŬaj%i8-YPUxj%Izoy΢i:<"R0;tCyN/hR+Ԍ(ٻzUoB@82IKhBg?DK~Gy/1&G(_a4_z}t~\ >ʼƟ_;\Yrxqv*bZ}of'a$W~ܟ\Om_Ǐ +J>)r~I#~Nvq;%8LJך£>s7!dC??61GaDŨ#MXXɩ'NG,0#I'8d۰B򞭯ZrwƄA"d4(|٤yMEJ_si_c0\YG?/rnK?)[f$TC%kn?qD힘Es;Od0+P)Cq32/2Z6VǀlM'[eWdy~~q~o)"ѭ/mkeO\"_rbhI$!5$F%8{NJ2M  T~Gdo_8Tl."9Vp+Hɉ9*dq0+o6*Uٰ+b͊/qɷ-q '+M_,-|}G1~I^ :kt]?D谢۫xϩq5w#*VXhʂۓL i>v44mR_ AbR䂪iSO٣~8cU6ت7LeJ^? iejv'=b@UT6.6K~`TOqU^q#Z_̒܎zZx$rޡ%P>oھm40 |JOkf n ֧b?li̺ Ϡl*ǍG˳/ Qf^V0ߴ?&̘~P-47(xI6cg=]y3Y)Qe3BC:䭄nӍ7n+ ˔iK8[FCدҌak?jomydMi:gΟF{Vcr{Xj=+򗅜 mVy]k7pI$o+vlUٱWf]΋g[OWL>\y2RpDlI^t4)kg+/0̑ZӒWÂS_{tİ^rFG%c?9x `y~;(Wԭvd"ˏ%Ncu$E##$?V)PF3o6*ثbN~9mtجCmqƾ.ES"y%24Rw"J~*p%n)޴*, 4tx#- du# & mMXY}2߯Jɸ7p[U"[JTGFFJx2ki+E&o r/Ai>^t^7#Zre w|or9?xM:LHےeE:tMG 9"G,*O|S#5`(cŸ*0e('FƊ|l%+:1V*b_VLJxX[+> )˚Y ;os-`vE20ҧqmE6*GOQ.mNilϗNnܾe_G,@mB9οZncw}u'5V W)#S%W=?Iѵ=P$R/nF)R c\ \wwDWLoI~NZ= F n^z},Ւ4y/ͫe*][E+A+%=94Vgynb_]-K 70=+MD.9\z#dnN$nKxdFMța(n97EN055c?E  o,)u3('|*LqhU!kRF7|U#vjo]u Ui[|pZ)jǮp6W Z~e>#.I__9ʐ͊6*ثb͊6*ثb͊?*6*ثb͊6*ثbO,BG%i w`D˙ sb!G ],1We͊6*v^*تثb8 U٩51We*bLR \ثLR*[͊vlRb8]\qVqF*b]1VqVLUٱ[w|^^)JG~<+x띙(E{ai0I9(>ُ=X)S#|*U(i9FQ6Ø)e|=J`r(J4 J*vYDŽ' Z4.F~0AvԮ89݆ٱ|0W9c P2P2T]IˮD4mnX8VM4rƑjr‹VL- DGg񩈴d.3Pv8qgY4ŋԸ<5Ϣ Uv1x*v;e,&N]N*0Ҡ Y!Č …ˑ@:u4#*9pڂ: z`R*z17#ĨY%+A-Λ4i"h]]fS,z@}3s*)Yf)>8'ziwI1#j%xښoaO8Q2 07?1Z$YOȺW6Y$L|,FQI$}|ҭQi Q%UmDjN$` CQM$%c&4XIm^Z\ HhWqZf${&Sd~@6ȱ+M+[Kl r}h=7<]#wSmU@v(LrLL=Dі21"䬨cOLko.Yj6dE~Ѡ}W~9CYqy9E6,w2Ck zVG6ď򲛷q?QJR\,TLGz׶D6GHDiW]^i?Q{2U2TmAvh_d6ܰr9F"a  : ^/q%^u@g{t8Sa[:0PrwHtLsA탧Qj~RB,X1S1y)NL(MGCgRԎS #\+BIO/o *5PB(TZv[`1[SD2M_H54ރBAlU VtF* wi FvL.蠸5#eYRąŖM|0lH-\t8P`baRg cSF*i`C1C W`;SHĆ@bYtMe[E@W5ʌ[FWa{I `<j*(/ .0t~%o6"hߝZ}i<(}σxT %B$Iۗ5V4UЂH1[=zͼJe~nhOR?SCVs'T$}%z.q* *(˖ӠET<|XZ~UYX%e'N wNFW`ADL+N*O- E 8Jb` jVr`KOnsrVc*Up=W.9TKQN4QmN*nr*n|3W *kj1l *"; raRuksshw]VYxDiSq5QJ˜8P6*|j-Vk!|X#ě Rc,|X,5j](AgYlx͞\5YamMUsJE>S$j)10)v&$c~(80);aKx%jG\UJ\ yvR U^MS/u5{bҍI]E1Wfc\P)v2t$Oo|Ua(vfZn:J"Z‡b\R6cB P̠bc$m ]LcA|UزBL*'v`T]Uv>/8 iqӶ,;/ UlOø.y+S|U؜1 ]A8UٟTbǩ mQr vlUٱWf]vlUtğeJg )Zq`BÏ\R+ ǁLUa9`bkv1—|V:m3uZ'0]\v-r;lqblqªL{cR;XP|*զpVw?,j*1U('Ƽ_^5WZw $Y[gC,Y~>? ʎ:#n9<b.P,i, VifY/(yzZ8X_nn8ܱVf5ޟ6/T A;۶# W +vl ثDҲ,@nI=)iK\W#Ҕ^^{3%Ʉ+ּn$ ,\3J@_N$-9+һS¨n^GP(kW,jLj\⫥%VU;cH銵EOPzWoƞ ̵^ߪ;(RݾϾ*qe-⠯+82bOD ;Ҁ.YIއb+`U, rB@aB >D3g-_/X-lB*Q[ Fe )BH6(⌦e.-aqȇ_JW] T 8eN_?,ïi 㓥CN\qϠfOl˿o.|#{^XZ%Ywzq;]4w֓4EAx{ĩ#G5鴜yg|}tJ?NB;.eq8v/Vיl<˧ëR'^HV~O]03V*ث銺ahWz:^$U_pB@&uI6^G GE_\sK1#D&]6I "cͶo-湧 啑g5qEUjѤT^aF_5vTjr`74XJ,.%J!$^?jd# Q0A~ߦN~o?R|ZK0I $/?Qk8dm͊.œU-H\ x|>[qjЋJ$Zvl1r #`A'5H8)OApw'G/f7D@7ߧثMEGQAOqE%"ӯ8cd%V9|?M;FIǿ_\ sf8;ƵC7J1VŷH׮oFxv?hbE-8ҿ|GŘAU]P)f!ܒxg2~aA8jՏGFXqJ?+g &fy &LQe6Wr >_+(vlUٱWLbjblUo YRנaNeq-ek<3Zq>oo R{w`"6#5c$?Ĭ1ӧLzq148 ծ*2ur.lUm8ˊ+\Ui[_*㛷*cW\*,mrUc(h㩊4,0?i%] Vsثb͊6*ثb͊6*ث*6*ثb͊6*ثbO,BG%i w`D˙ sb`CaKSvlUن*vlUٱWfYxk6*ثWf]vlUَva]0+bf]vU0Sv]0%aCb͊]\b8 Prusbf*v*SusSur]v]0z`FWc~}mJx ƠP3o YjNq/qJdUJb0;c)CɊ&, g} f 7bf ow 2L^=pL6hi T<׊':x doV-Q܏:Yx?z\)QjJ L@ۅ=WZ\[WK-jɦcyHtGQ -1(殺u: ⿟s_;ٸٔ.h-[|f{:aWf8؛*ṕ] .WcKVvol*5PCJ)b tw >Bp[!M.+774'_-4U4:>/*=JJrZ#cC[\gdq&G$/JeVx?`~O,UaWyv^ÔtqɤW2M/n eT}!>g {yPt5̼=\%L}?c:Ep O*BVxؖ5P)RwVOnog(O3 GOčy^K dV+$Cؓ*vggC$CrbۓߑB)c "xN,*ӾJ:^3N9pFQLRBpצv4)@+V5r_F^g3dr2e.=(Hxje~3et|.(~垘zһ`IY#eCCZyr;+;N.xdSD~TH)ef^dRa PW~X)@a_גU` M yBBqbA- jHZiJ1 T$eMd0 j»2;H hE{(&"֌jpi,0*(z_<3Gj "b*n%fUFJ d,%$ȣQZXRA̸۠ߵ7˼C%.`oV߾^:jF[\e"ZjⶾF`6 >#!N TQP>5n[Sۋ>Z׿L + s#lG)HQQ4q2 ci]5ƚC]*il*i.;]8X]A9`aK{eӨr) <9h1dLk.(u }dXLC]>X%-t#&c؃+bt®ĸXRش;b}5_ mPNJaB00L``q%Lwv 7VcSki‹A(}3JXk e> PdmMm{Z*1!G e! RP҅fTbid7Hhljk-uALbApW労x)r‹IZASV2 \PW*OlPā@(qAQJƤB&m;\ \U;f(ʮ%W,(U[@3W *x Ɩ׋ol.XbqT[Z!^;1N(D%\qB"8rqpPQ9!4#rƜRvSpr9X-q9n(hTg = Bt#^+2QJǞI%I;c`IR@sΟ+Ni*Eŀj2ZoGx}cꬿ\P^bW9[HJBA -*S] *k.W]v+Jn1Wb֤C|XlU؜t—e \)v]↩ LK~튻(ȫ)v86Wb%4#|Ujܟ銻5^.;W ö*+lU56]d$eP|g]uVJt.ژc;u\3+ PöeN;րm] (*$lT. x8r![Wf]vlUٱWf][I0$C. U/8(bQ'QǁV\Pa8)i9g\\sW-n8RsSh< Uc)pc~mqKU/hxT6T늩S 8^,1UY8Jhj:t1V;?F[-A/qzՍ'\2Za@iT!tkLJ޶]a.XGOK˗~VAvPm %yzWS46-cv 9ާkHG8c^/zb?Ձ5*ǧÿ qg:SM?Y(+?&dj8.NkZ$'uPK,I%qi..q]{yHѤnV_i'Ze9Xգ?z۸12:ļR[ccoOy+[>(좛˺Dz.ݬ7z.5jsuO%ƿX+J9bI~ⵀ~(> B< eb͊6*U+p56*ثb˦*迖^WJ~>@qyUrQ΀n({{ocF.@$$zt튪zB{W9CԠ܊P'i[qnF~uܛ,Dz_ E1%QNW9! @wUl<FEY]~?}c$mJF w,R$ WA7g?ۊL(K?g,l=*[LG*{*>O.=@.v^ҧr@x97>TR~U5 %4T'!%K7$l6s" )$ |?%-jEd  ݚ~NvQo^ k_Jƹ֘_~:nOZQn!IV<8YxYB*4O˵MUteiTf|F?U)"my+Ͽjs.J |I Dn^ܾe^+<5K_w99mkLk=XSA5Y/x@[-OU鿘V-5ZM^ "4z~Eoe_D$()BWyWɨbfi%Lw'~%k_4^rr73EKhBMk1cZR0ۯSW0LO3o4jiEt[Ua HqSC?Xp@x9ǖUŵ3bߥeNUD_oM=Bi㏯ϩ~Y3ڇnk>}V`3\ʏMw㻍>=(@??++siUjoTԟԸ@P~NmcA$̾򧔴)4>\&mؗr^Fwj~plُ@}?^Iq!8Ҥf BAG 91D 2#,P`^|rOxܱ'v UVqPMH5&ї&$c)F<2:Kh_JȂT xsnD C5H'Ɗ' hcp?I("E[TmU>qpFXdsʹWɣNe%-x_gċ2J=]1[%ڄM!vߴ݇&łe[H߻Wx9|#C 5>8qε^h?g7%q +P]=cEWoQMM!{9>Mc\5@vܐ?fe{}|sZ Sp=bV'QһZ<\@&e'{+EIm'bPW|?>bФoF rSѸVLB|/!YOU4>8W'6*㇞LǚHt{BIEUڞ K[(LjC8[y?Go USe4ZiW;ům"QܐBF?fŝ/y9^|}99_)u5oRs͗nF|8i]iW)zPq(x&gndu o0|^cZͧ ^%$W"Ô8m%FXVGYHꬭeSmn.-dE2䬌2JؗLPTrzvo6ĬqWv ?_c@Samf,8KR{0o[VbM> ,O Jr(~yqp#-ALUj bW.†p+ygk+o1uʧlR-uw"[jb WWlrⅧ7]6-,?s/M22 SflUٱWf]vlUٱWf]vlU*6*ثb͊6*ثbO,BG%i w`D˙ sb`C *UXcSv^*ثG6(k6*6*UٱWf]vlUo6*إٱWf͊6)vlPثbͅ.˦:xYKSurVbLU***us]ZbyVE qk B)Sgt򶪺H7`(~|(Q:se-Ӧ1[7цfSGcH*bNX`Ȱj\UdƎh~=K^6Ȣ9| Ӷ*군ɎF>'. rL65z-owr`hI푈vՙ Wԥd]dUTlcY[DqZ[6mgN8)XrCq$kD+LT]ͧJp,:|I\hە% }/?MdF^_Reeu<((د/ڧ)I+ñ8Kp:<`i"IԞȔE} XKLh[0ўDD)Dzƴf~'2I$.˖?9Os=rI($d3T҅OI# Ki@q?W|'[zj޸+QV uUC2lPG}41VRkGB494( /O)xwl?PP\Zhʔ(G-++R# wbDS' kFi7%V"%p*4'7S|q,#ه\XBzՋ~ 䕻QeS)B%ې 6(p*aSn-h Gj[bv1g|PHBVۨ5 7<*\9|;KC%5?J؉SqJ棁ro֠WA0*l̟´)LU¸qAv&ˊWvQ+50+aCWeR`We*]a vQƇ*j0݆x"[,KRF+U%$*j0һ+fqB8#\ ! &/\#Nplp]2Y5榱[ߦD"ª%VE 4bj-aiERN2vJSQLV/O>ت($+O|i9U([#vZM_}ZiF 7x]֜l ҃ĊG$B2xݫLUkAŁNkWQp }Q-bF]A|ªT|Jӹ j];7I{MHE-xZ[ Zy)l.zu.^]1H]ignrN$,gLqxV֪ʹ}2UzO)G#kk;xf8X%^Y`Ҝ{c|LQ9 kY23'kg>Y8>!k>:/BA$Ui%W\iZlim4lKmq^UHuLܱ++ji+ji\Qjj<2٫-z[eWAoQjQ8PJ" 8;Sap!֙QuƱŊ2*p41kM8&(x&-PHu?]2i W+qo,Q'(Jrs~tP7 ^TyK|ܔw9C]  `VS%(Q `(v=kE)q ­eU؍+y~UȨjk)v_$/'x{" mD+2"Ƶ(W #2+|x,:GkǫOg0=[P 2yzrGz?w,!)R?'d`nmAa2ƟxoGx|K?x@3=..!;`ict*<1PtIs)~/kt$?sp>_MCUIRf'ф4g!fD~ [{X+nܵUt)_\ꓷz ;&vz>2Òbʣ"Q !Q(QN)駫!&]Uy|X'$b1 Ԏ7o U&l? me`#R&'~+y}žu!m7= #@͍@oOō13mbڜA(h`&AU[c_[ rڎfsONF$2Wp)i,?dv8keʸWfmzW(e`09?̈́x]MwY(6 .H˧֔aLUr9)yރJi [I#{id–y˙v! C\UXUo^48Kt Ooo>N\"!"2y5aq_'̼])| MZy\ZHp v]㺟zW.dDq?9p!iv/mwX;QE#Mh~};(,KIwvlUٱWdkWoufk2KsB5En|k92sm3'~iz_%t.QdhYW7uo*-Z]YU}>lEXC?߼oUo^rȚm2;jŚoTDHU>GE~QqO̯(En} ƔyJo1<&PMxTXi ۘj}y+tp?龔퇥tyˑڛ+ųz=k;>kCNAzp*6ZU-*GTlDIպlTR[@mد>/|kqUٖhjqMpZb.The52_?VX\Vjzիk"Z VKYxC+)nVO N72 R;7-aW,;#7mNNy7^goek_UYh$sW_?¹5+i` )+E}~?6af<ҷ)y\uͤ]ICRcr6+,ݿ%WU폓u_:zW(KM3',e0!?XljaM=W5v[7/?ɿi0E^aqO3]| r7͖C\~\r-z+Ok$'YkW ĜV$҄Qd~</r j-3up2@yR}<~1w3i_kFpږᾚoEc3O4-_κցe>*9cO{p1{S='v.ncOnm#j$r:N4.jWZdM!1[-x74ο5ܣ_EiiCU<KiJ'jp]tˊb?W<чYupddw䬯O{;A{$_D#u !p~n *] NqQwN_}1urK YHM)G#~LJah`j p-uhth k|..)b Juv,S`|5'@ 1:?ũk?&~?hҝ 횪#5$bKQuC;oB&Q&klUw>A?Uj5ϓc`zw?VMRFu߳o>ypjs5L>~,//!a/WG2u+/OS8Fv3 U=#8aiyz^-W& }CD*͓zȈa˽KR-յXV VO'*oO"~/6y󾕦I.ТH yDaٰ`Ae]uIy* e!c_M%c'%)I@4d<[#=&,VhW,]ռuk:ލ VT?5F8>6lM%0i0#"&É]bK84ˁ=آ|z/ 9h̭ a0<7]LU.n%u1k Yc (d锧%IkC鍭51e`A#ivop-T% Zu4LYJ l2B#>e7iHIpȱ(!\~ikU>|FZ3Ǧ_O5GʉJ&OL^ 7<#hBM(5^L[;u'$P/݊+x;Z_8UR0DIޔ[F-ԁ\ZE[7 pޅӗ|%w|_:32dS1jGlyG0*ܚ{>ocٰ=^/Bz3x\ 7$ҹ1m)5I O+Ҵ̏ڮɏT1C(?>%SF3з,d kʿ&XU%bh+\F&U!z*ȵ<1KqR–BM-Qş4:q(zbE az"҉1J r؜Ҩry3mAm/Jx㑭X V)'$ cah߳ SN0 *#QS@|F4Uztny)S^̡ō)n5 Տ.d}Ue"O X$&rK'(GAT'@\/ՂJl,HD[:-(KbGvV*Rp8`aWf\*cL v+M,T.-}Zv+.[l݇V'l"a }*m ;kQ LqXJo%+t[#PS$_q% {!T,~YZbʦEJȤh\|t%lTāԮQ;  ed[#  PWw7Á( ' dhjb74C`Bq!23 'O )q n~:→1冷\MmrϺ+lXZ1 PbU.$TD!@8dSF\IW5~CUjjI<6<")pӇZљRx)q`2Ntq26 !Jצ=cҼjaUoXP8|UQ2Ԑ~RjI=Jo=q۳O\U=_ PiȣڸO[a Rҙ$Zt`j<;VrO{;.}!UhQWx n#cAeS]6/"szWlimZȟ<*~Ҙob-ZSזm1U/Ll*p/%-Im"h@|A&URtbGpӧzEɡsT9{/S&VoX>HS3TP9n4KeuB?guqB+\q튵EO_Uc?U@zKD$!@rث®ǖ*zAFLU*6;W(uoLU؟iR]#d$eze~xUe(v:Jfbff'a2o^i.i쎘ҺDwƕTRus0һI]4MWW㈯\*5.]s@v&潺b 0"h1ZvY$:aKP]\hAh7r,]xR?Y䭌-ȫb͊6*ثbι-lmFZY[cUb N:g,v*‡qZS':`$(.+N-bjQlU;AZ[1\T Jci8`U 'b_|u@ªT- {B96;劬\)*[e)[|UiRFaL; +Ce_pͯn6R7ѕz1̲GKo?Zں\r%6kfO+#3dD!#?j/R9?y+z+#F?fl{L&s6oN# ~%/}|ԟohA{_kin*I :bniiW2#p=_6r={s1J(~n?Haر,Ēw$/QPܖk0 5+Z}͋1*s-zlp 1¦c\ˍN8JՉ\yJWf_qI7^`~!ƨ(pP0wlOc1Wf]v^*q'0~ܟ ucو֭,E,m qZ?axA\L"̰*%:l ~[jvnxQ@2kA5gBYaxUPEI2 f*lUٱWg"=|6%Pw0rYYi^JO~1q?Juo[|j$=8YrQ%˿e+c?8_XWռ~Ȅ_zv?mm%_86q%ә&Rİ;+(,K[TXB T UGABlUٱWf]&8'b=1Uʑ!BĚRN{O*N*mHOP74 ]E#5 bD>Fbѩǂ|Iprj-u 4',j焼fYp Zo F<"dfߤ~CyOCУTZD9w/~?b[hGR(GKSk%$Rv+<gV8!_3<#E~.(op\-Wwk%8v|80t}}tpX~72}Jј-U!jKrr9b# _#c#m@',>eʼO"4$(;Hn&X_Ozd}?L}[YԠ }ח_y.\+T փ vx5?ӟÓ_/?E³ !@*ao]v)R=>8}]8[@m~()<$RVU\B'>=_?ePm]lu !2%hX}'alvh|'#W{G9'HڲVᔶ%6\רQ|j+. n+ֻBQFЯG/)ſU[N)RKVuo9Ƽp>nmG,ęݚhV.U$c^[,.pv  d.ɟ7<1OZ5Yi࿴[)Ɋ3,ϟWg-n?kO%_s1t;p][psw5rh*~M,r//9Od~LǷ9U Nt50ί 'r3"^ac*QȼɆ1\PMq u9:di9ywK%ħblA$J촘V/D*qd2HF`?IkVƟۀZ;a[hjA˷jF;/QEjX qVLaƖ2<1w6EHe،RPLzi[T C қ6R\-nO{Fj&܆UJάnw57c3s`j/|}B [8 )pzWſ!B:'>?~"gOr#t@ɝ~co2iqj>6ѱHl["+QMjzu}+3K;eN16;M`[KQR5 䫶gگ,֍Q% Y`oY @IfBG#^/J^A/ҏV6_GOl0DT?}Rr\¼ygu&~ *FG6o 2-eKev$}jٌWNiOfrGkmG$8SEVk_75šGdՑ˪zWqڼR|2r #c=i"X_=4jGb<H⡅2eiq BB+ٯxCx6#v>؆5v f9GP%GZe6D}C__T%~C^ VW^ئNDS-\šhqn]M((pL 죊\3b뚘Uuq1d9G7g:o#.I] {1Ff]vlUٱWf]vlUٱWf]*6*ثb͊6*ثbO,BG%i w`D˙ sbC`Wf*ثWe Un^*ءٱKbͅ]b͊6*ثbͅ] ^*ثaWf]6*b˦**sbLU`bSk51CxULurLU]\8㊵\qVLU(yT;SXZNe|3#N')_#e? ḿxaAױ$Y/H*)RTcR *6_DP9ϧ^bsM1ENcI4|NGÀqt1^IH`Z3-Oՙ^{E2r䡤(3)东yTXJ덮*efĔ|8bJaGyqk%{o%YPbM&Ka|X7LgS|iٚf_39\bz}1KSv\f(qr#Jhv;v)lʣNMVprR|6 %O&w\\.1Rl>*_'G' р%|NK<%J?\ȁ^x?%*|74A~\YXEˮ Qf[:8t(vy}uJֱ3+9ϴ38̏N PT:k+/ڠ9<2{/b W|"v^Ԝ2wħ.]J P(iT1$zaDĬA 0= 0&P=>CF@yrРӐ;G-&{RIf^2|B 'ϤG o;LK: J׫6cH'c01Ӌtfщi8/v]dJU[ syq)fGٝw\}t?e2GCQù:S,#N7SrF|AX]aqPwX̊01Ub1$ Ec +Uja"U8[V hU!i#$VSVzUq՘_"@qW4~;7 xaUH-C0bcL@v"=U~$5 #HVfa@w?˷J⨙]1PV"!cf(ez&B 1VEcv$}=8xrp'ZTE P۲7#TؚUE@U*cjF[E1"qALS5[ 6 " 1a(#kR0rl`jR#aa[W|, ui,x)2=1o镅HF#|񸹺 hB?3Nj_ <e"~>X|{ɼO_zw]A}pɶ; U-eU*T( ]pҤӶv(v'-Hv0H:w®ҫ\s= b0EGlPMXl*jVqWeĝb˩f!qWe+ӊ)v<-^vb8z|Ue d-6%+1Vۥ1WcPPe++튷TS49dѩkhU=WW-zI!&1go.8ZC2-dVYbҝg?"\n%YT$⑯/N? F[NcO(gc/GOWO\?͟/9Zynܴ#ƜYRi}1xy=G=k9,Z/!Ӡ}arXtQ7_?H/?O|.^6?&s> 8ax|QG13Aj^h[fN?+?R'.dY#}C#+&CJ(J-q9;O M?u .8t~o]R,+*@1iioqp-;Y.&m[['vw$;mm"A ,Qhp6V͊6*ثb͊6*ثb$l,MI\H&WԪ߸v%rj{MmcJ.< G3\p*GcA.~/<i..gc lO8S7o eBPS`doŪj _qHٍ6 *.-*iaTKxm *NbOB~TA D/p$4Fd8h+o6*U٩g?)mj&h 壉~k?s1cOα3&h7/3C?\07ēǝMc"ҩ n@~g Q|//Ϡ܋¿Y ")Y?>1O4[ooĆi$ӏMN_l NY2T/M,4gQI -;t7+9ͫa P;v v='jOc7aסiV fm+'8%e?1?ԏ]KRj]0(呍: whKU+!0_v\j|V@ki֕?!`85 xP9,rH@?~ugi` {|O|?n_ P V+K&T(HAљz^A'5k^?R FCZ2[hY; lFQWu8>Jivs/)mF~?G5' bݭ( Ey) d ~-V?[ f3g{ K_lEb(GŸ/U9H[sUb <|?XJ7F48iى.㏫=9s ~5=:Me`umWekVL:.G)482c>?V)O$R}cLB=*Kĺ2jc^']\IXԁUjvs VE7O$Fj8cCo:f w6̈́mb%p̌xҤ CE?Yƞ%rMIŷM1uq!fF WbZCV 1uq1%. Ҹu y㾥 JcJ<8Kz]?rgCGzhN6'8ew_*OFꌍ_x]~?z 4F' v~Xϫ]둒)^n,H6D?-u8 n?+ s#ڝ\3aIrѹ  #\ Z1>;pRSY0tOeIm|C~?*S&Bm@(jN?er˽:AZ#^U<?4rrQԮŶ?οO#i>Ƒ n4:}W Ǩ-ՋӗҼ'{ B1 "J[\6 \.7Lr=>scVc`&7e_(x#$2;L[T{gdRW`u! r$OoӁ+kV v+eݫC\ rP6/7ÉOoj{uVAt9rd gH }61Qw`( ~exNZiq9_M94܁w}_|Y5Gqܔ-SԶӜ04 4(^زȱ?$c̵@򲬞seqXDF K-/6lS*W ]Nq0 VR Ђ;(Y4K2 Tzq6[$)FcRU_c6߿d9'F_iϧk Lv,/IU~)'WBpY}RCcۗ?a_PB6)AfrOO\[Ga־渨4%O,ѐ9*ִ=+!ԏ6x]Pk})|=3a= C}qㄿ䛈 xaTo]fC(JTbv)k*8Uf'"1V]T(vjxW6(vc, UY4rZ8Yg/M0K~;Xb͊6*ثb͊6*ثb*6*ثb͊6*ثbO,BG%i w`D˙ sb]1We͊5vlUٱWf.]٩vlUٱWf]vl)q8YvlUcvc6(vaZ˦*\2CyWee R8beUi8ћo0^*qUr銺`b'/*0G,.5\p]늴[wXL&j0 ([O _֓SH~ÓbghiT^նiS2ZӮH2Rč%텴A 1> PNwS<4y$S$LE\Ť@q}q }(R'y4./884$Z;I5$$mӯV/ĔyYRэ ߾@0Kim]I! {M; ZCNJ_?V}"rG ,2w'.CPn eWB­NR(6=N,9) F% ۑaJ!ĖDP*>#.p /TR rO}nZE;Had~&Ϫ_BK*jk$x թo4rDH}48~Jh! @_zeʳE@WjRN<2pbg 0 o_3$Ca?9Qp}9(; ӭp/# ?(xx")6Vnb2ozvKJm/+񟆇1 ؅O4l;T*B9Nh&+Fn#O]jVW T5Xc\33\Vj.~'aUQz^N'6SPۊb8ٓriS ǧڕN6"(YGCr)(V]1(v]0Zp劸㕱KXOPaűWN0۶;PHC* l2 * hP5~e@QC Zqu$ݰuVLrHmNӧ~ c~k@=VqxciC|v%&VFUSBDc0Bw~)`o 1AlSbF* qQj+Q +SkڧI4VSYk7+r "v«9 zRQוIRHߎK@aUؓ1EGo PP~<وW;Rਃ1n4qV:cKP`UިuA844^$b7 c4Wu,OZࢾ\ʓ *ĶNČ E#R|Sn!K G"x$ aNZEW5`iT(–R[P!r[o4ġ}yva3_$P 0~f]zdIU0;ˑbUܲ) :b(NI9 !z:צ $;ۖM8PMXN 1)fV+t»ѺdJ]BTD 7UПǺn}/vxsaz@\Ndhtxf\Up*Upp*CN+$Y\UQUqCbXG.F3)zxqBGN]M()Yй+r1n ̆D6B3\U:o syb=B2*=B U *b9c'Mj [Eڟ~+2%J#Jc% L6 ПWa`۸6T7ZqAj0 d=~D V1S瘼b-!;~G4Q}Ed?)'l) BIL6"6ܷ}L*Tn-Zƹڧ)lcd`.ˈ| hءٹWe 0,z`WcaWf*O1Wc5+]LePvĝHm)vbz®nI\Uؤ|v"qWbEG\**|qp+Yd>CVeW$($0NkW)lf!~[/qzNS8,<1V@+](`C]G-*U:S*gbnv=!)vYZ0:Ah둿0.?~ ,ȫb͊6*ثbǢ/b"2a7^+)Q # 1vT+NJh_M*7++\\Uo ZBb} [1M0!M[|8Rj?\U1Un8aU6|Ui]V|U}lءgZcaU 1$|$[#TZ.nT;均\6i2.D1]p(?ya_dPMƓa?ƿΩ_?u#Jç&&Eː6?Ks9+Zh+h$(ˢpZWu{eS+vlUٱWf]vlUٱWaזsI/ @g"*?iͰ[8Зڄv]N3~Uc1ZUi1k1 Z[yfGEcn)_p2X'hՌ:SJo^?䰸T ߖHç'%UׯUZ+j%u<7;>]QYl-JBߜf.]OJ(nC獨 oaӭgcr8iNȭ'LZN̫sYoY<|!$ፍHZԳSn1ÀS>"I.[7;| @6:F^ؙo4G CYjz:J;%B7oNjrhc?]frĖܞ/xIܻaDoPpp;5Tg/P*>q 8P*Rw\a77nlI zn=eNtʸ*a5&i~%X XNካ]F+@jK1OPTu¨7`ʼn>O_Eר6 隖:5iR;^_]?ᤨ̢eiF|+,"?/1i&21LLܬk bKjv N]FpbPh~4⯋5fXo.pe?wzezFdknOOh~W_Vb['QmŔe/X}\CF⠎{\>SZl!WJd[#8'leA"(I%6I5[*o"n(pDTS.F-6WXjh*~҄#Ȁ/%ƀ'eEHZV xfY=b4x7mE8H>TPkOŸ1>~{N(Rh͝vOm?RnjC|Y) (|?ܱ|ꏣ9c|[ U{v#㊵*yoS0-gq\)j~mfKV.<~{?_Ozŏ}kCHT}y|-ó@UB:^G yʽ'i+XP0 'd K'~Bt/]/U4YB7/xeS.?,X]#"KΝL4rBq_R5ui47+J hy .ŚՃ$lC÷/5aI2v?!RA1B950ZJ R.E%iPzu^0#>??5c7(}!7d[c?Տ#ݱ0 Iښ1$y"CԎT:VUCx1)ťݠR7R<*embف阺n߳sxYD[&}9ʘQOceI_ԅ%;o $_ s/ @Nz3t) s=K-Xf]k% 8Qǁ5LEb͊(bg5钖f}9%Wg&;ffVNHhk,o.aʭrCevl Wc*ءXtOxbipi”;m Ϊv1:Hԧb<0%NUd18GjTӜb =0j$veQ\4$:-6A4VU9c/AWx<ASAC1M02L_Ǝ'MmLP]w؜O#H)m-1Ä!g䪥lzYr ڬIJWҡݫl-Q$4$l; %hBDާ tFkkS! <*l!kC4F9_J*wr}kr:lV`A?7~aϗ ~,deIy&?RF椁צc=jʀ!GzqUjƽZB«4?EeΥlm 5_mA!A}uR"zt8!' *j+QAu֔4XӾEj]4bv ;x`hSQД2"B@0\RQp$,xK⦊hT ;<許 5 vŒ!,Xt=:-pA%XmbƐ*ǓoWP[SȮf`{k(v7sOju)Ku ?:|Hw 6!6ƊֿR=!J(b\+J*7#tbWWpC]v8 RxQ]ӮvZ\V݊,bh[dA5զ E`Y!RFg?郪0M.gO~2be\0 TaƩaKO]G(]žJX{kşa/]ʻ arj) S}ɗc$74՗2\#?GJJz&H%z!ѓ>)k.bF| ;hs(Ĩ3x:e=mV@R}ύȌ9TxƠ(mH֭__(s1ox=X柞M߳ yŸǰS}2=4R/=%k, Mi_O;XPIn#FԯS4N RGe/P͊0 c\sZe*eLRw!Y_ڄz bX́i2= U'ŢP UNF 9dZ\-V>xV犬*w9ji7j kMqW,דu |1mTZ'MkJƕqӶ*T+RzRo1jclܲ-1T銡䷚]Jozl4_Fz l:ॵP?q߻,wƖ`0jlOLg"}Pܼ;f튴$5=' q;RKuolq8_),2ZAx[Pژ{.?ӄ*RZSacZ%⫑j[UZgGB|{K<)ZYno.D,45E JU3—f®ǟ{CX TbW, bA#vRr,U٣vY]$(k#0+0.@$~ *lUٱWf]vlUٴ1 lfX•_u˜6?Zr)Ȝ(3?빧\_?q\Gzz<cJ}l1-?7"{x个-( pðk֕_3PIc+O*̨ ƿPrVFߎ*=&hFdr5z 4VW^LhJRk@isN4(Z2Un3Yݴ Ѭʸ>u*Xʹq1`.O/&~}qa*avQ"+}sp}<~FI$y'coY_Ȳ&#}ooVm2B=6%K-Y0_96/-yļKe5UTvVN/Šiab72m4QP77/4j?m)%D*tM4_7GB-RF8oɑ#ErMʟ0F0}K5C*@)k.̹%}<ʳhQIA^?rʸPeL[[Y-/5ydD$Ȋ9__`Dݏ@eqh$@lV6dcRx?9?:ee"'bhҟ.??Çɓgܿ?~\:wONR*1_@=Os :e*%{.[#Aa)}o\{hn~&F75G?dvEKM{Cœnf]FEٔ\Esyc %»zKVCXa:m.J.O5AZ_T?QV ֟%RF)kNr?>&4cͩ^$ӂ0BҤ- #C~׿[SM,k)֠V-rDUд_p;ۇ˅W<#~v ᘜdzrFY &=?WX__򞎏ftBPlx*6/U~ң*G"h6)M+!q%xT/2<צQd~"9qYr_g ͸ O׋b+eij;Vj/.T/H6ޔ>تvj][e.A3ox;{Pm哈j CJtZ֧9d\C#Γ8un= "GEg_1M7݈]$Ҥo+zW-78PO .?dKI|6{,ljzUEk,>R3D_eeFW![H_ay_򍏜ku1P٣8raa;>\x?[}ȷjN89+UZw'a 22J<21N_Ï6D PFⵯCc67Oh #?P閺0s#(lWzbzxbQ8yኺ.#lU,tZF61Z'0Ә;6**Gsg/M22H?_g;Xb͊6*ثb͊6*ثb*6*ثb͊6*ثbO,BG%i w`Es$l P—e-ءUٱWf]]*Uxb͊6*إٱWf®͊6*X]0ͅɬثbeU50ue Y8pV\N8 Ui8b*k51WeUr+I P9xYj1KLbȸ@늠~&+t?"~"qdSN31t:ʆ`kA4ٱ֛΋aCxjר͆h~@ HJ9\T0)s;s[P]KSDY:_*ǥ7OU ȭq Q}3#RhӧjY?ի?1jFl;qfQ@M3ºhON븾llpE\lGo,툠MB8+ zܪKj@O2o  nP!0L0 O\%'riRl0`6bC ֝Ǟ؎,(o>l ө:)c]mc@xdԮ$|fZ8qV:Z8x@ )튪pR,H@ZGlRBcE%+z U`M4dcEiSei8$Qq2ci>JMcS]zQ?96B1'Xhx7t]H%*m7 U㒉a!OG7K[9p*6t)[G{ Q"nhRYO&u4kLJ* }MZSmhxp A>m8gzFuuW.xTKtoϻx47kcԱPY*=$>J(HUB*alGGfV`?U,>hV2G eM2)wN7W. HCe\Y-sVT wo|D 0[;Ӧ ЫZ~EmdqulL9Ca=1tX Sٸqr =<w6Ꚉ.e'v#l뻸àÈcNKyiЬuk? W3x3W/ǦST*wUN$5 ǺfCvw =r2TW | S(8űbbԩfHlUL-:U߈8xR 0%!#CG'LBeޛdhlB[B:J2q *㍫ɫXdv)v/b'96q'%$\PU);dUǮ! X\> mqWe^l b*ӡɫdnqV]mCGiXm[gR=qWb\Uٽ'Zסmc1YccaJ~تr kw(^ dPn+TcLu8 VkAq/1URaJaW\`VU(b<  W,╹c 80>[3rb\8mBh*I6߇ .HIRGF9;~]-)OfEGߧ?'y>)SVܜj Vj`?ͰNUBw;OQSimƫu'"fDзT^GRq4996oU~&[oյ/7ݡsh%RUi+qQW|UŴ\/9qu:iB\7(f|+[άWheżpQ_,ii(!li?eI>ڴX;xŚ4(kׇ(HP PWf]vlU'O{㵈U`b-NyDH7EiV=1Y9SAj_yg? 膇?ة1ާGAO)U;GI$|^͙%B"WXR \5AʽK7ݶU*W(-w8w (GTZ뜂84??o.\0KВFvV]\[X(cRēMC} T}C^էoJ [,QNolgz{UVG" މ_lQfJ|TRRHȟ|k3DJӾ_mN.GJ~Y;ӳ^NI-H$zL7fv?uuke G2ȿ__\8N<࿞?+K^_+MApDrrN^~]Z֭NgAPj?5"y_L`k[daȟq]oݬƬ~\D4:Z.lSȃʺL55zmG8B*'̷#Tt ž/aP*5d I ԷR~l_9C;?-Q?̜zyKɪY^m8_. %p={yU1č7 ^SMqÈg'G'4oUʏyY?↑:<],ےr6R26w.c-mqv.᤻U+%pI|G\,i Y-E6 ؞:'`c~9]Sv/XLa tQO_/$R i}K7V? vqe=6 u@a2v uR*u+o@7=DCnZ|TRxcd˥ iʒ ־+R5&)j)!-`HJK"ܒJ@m>H\*RX ,K;c}(<+FޗW?0 V4+"Ch&?W2}ۆ\Q)wwW (!iE_7HfJӠl;[Nc!?e(GzƉ 5*kiaxcq#+KLc$QOBvgoIZ:AƗa/?_VF)rբQH $>_bH~S,w5dJZ)!\(Vo+m4ܯ(lDq2\0KܳR+n VQ-;(OlHplsLDL&Zd H20C_~DX1mO^qI!ē!7cR[H?j]=jzM?^_|.!Cgc@͸](U6=?ٯ{iZT_p"?Y"{rc}j^hx8&jEkzsޱAW5,q#lC\,c%qD&~i̺b-> T]WF+MAm\iNUFWݍHHNbm?kcD^41]ZcXZV>.Ŀk Ъ\6Hdžqʑ]-ipȺ&ܬ˹v^g}x{[Vxte >Xӗc@yX>p8dk囝GLkK7R(؃'SxaoQX7ح4>WȽ6 d+ŀ:?d=zbhez? $-2R?h|9>o%Mt@Q#(ٔDR:q/dKy VMo[aA ǥy|b9.rsPW&4H@*II焲CLP4N}JЁ5^[[.@A״[mr}.y8hÍUe#~|YBCˉ}cr2j ?ΟIuJ.0n[K8>RdZJ(d1!dyMB%dT<DʣN ruexߞ?y0ho }-Smoa{ͮ&"ݝ)c<8]8̮I:+򓗚xzpR n*N$;Q%؛&4b2&v]Y̳/U;,QCsp AA=_aB^ῧJz2ӽGkKSCp^Vi#i>떆>$nrkO|i?l햺S\R2pθy*㛾*wQZ)\U\ثثM pڴF]1CY)vy9&rUKY(ثb͊6*ثb͊6*ث*6*ثb͊6*ثbO,BG%i w`E˙ r+]\ء6*l*ثbeWf]vlUٱWf]vlUٱWfmٰٰZ0WfLRv*jckxSk.LUܳS, P. 81UZ͊,bS,bLb*͊N9W)ZJY()45&1HhAZAm4f-.(P 'U]u3c䵽%!׵ -A.<$0sa OO?m_ј~Ð੮ZEJdQ]~Wƹnb*zbOw5[M:?rI~Hjs/7'0h H_6o oCoĕtgŬ*.' p!ٱWf]v#y]h B"ˑrDuvy/=z+M#fii B>C0`iœ.%xeS|"vDhv_,PإىpJmÈ>(g: i P Ҹ ZNDңhu f;m?0uTsCWsJ.a_It,FG(OrvTb6NTzo*U->OO8b(i6ԑHT|me8 ޡ*EOl(V zv8%`0ST^@P<{E Osz@߮2Wɷ?kDKz "4…rM:}1U8)ۮ' "1dY-Sʈe'fb*udʔ ΌGR݊)pEҮ)6Bz}$ 7hV-$SH}mg~_y#!!Z{VkKGƅrq|}9u-Q,VoJ)[qJО;vmCT[K8$$Tq3ojҚ]=0JÒ[G$1K7n-V@>atMO3NzITo8g% )RGZYh6(f>dJg xr6T2l n'n"kD6]5ebxbJѿ' :AzWU/Y5?Ië_3G M<#2BPN Za6\QxdϿ>h)-'^1ыKu28opv=P7`y5vj#Бw`Gd ʺʶq1ެ 8:~=8cHVq S5|9w:۸I)IpVt+0C!k#\"fYc#q>$!jLtʍ>$\S/RvYD}( FZ ޛbzn x+řF9 bsovsP[b迖-܂QSlWNI3Jx`̏} !Ԛ'O:d7x/m-#6Û|g+#SPs/ȤtdM$*)V" [-L`C⮮&Ruq­pr4sRR[ j:RmzpqS゙Z{oT׷\_`M-q8 EqUj$b.uu3wqU&B*e,AR.ۚ`U9M]s)R`liIr$9"-dpJ/Jf@ zaB5$mAv-Ɉ#v튭'ۮ9A$&M*h1(ndT)Sy =1NY ?F0\q_IsCcM~(\~yQ|:W:5x('p] R^ѩcU}Be8]4F [kYRFG\U`d}KWNzbʟuc-2Hv*I4• %Ѧ)qQ&44owSZ6olw„U2Zi]ء:"BIEW%b 0R]\ < RpU0aq7+SS.;&=@ Sa<04#f%ȝm,*oޡ|}qk=9~aNK`da@ؖ,cP,i3I]M4](obC>k0|qUELE\i8YWN(TUƓ '2 ܰ-j[qL֘bZc-W[l%2>Ƚx=?[1';2Y5 1>aZғ⬰6 'bҜ9e2z'$t2,,Up$!n*< R׾C1 -&m;V-k'T֝/I' mޟcA SR_& 9-A4\(EF)WINjIQjU#GV槗c= M3-$v (uiaTeZ 0&Y(4 *T1V:]\}kӶ(k,Bٔ495h+*1KȔ8 f*e;VJy6jwhur5Cw tb1Vj^,~*T\i.Uo>(k04n$\P*ۦ4N*z)#lP쳾v1\v]U䬝3fҺ|@vU\-LUBJyrsbLRG-QN*UUإ`Sצjahp!Rg+\*ȫyWf]vlUٱWgh4c`l ^o׃NSU]mk [2VQ'1U)rUVʯlU7D'r]Rq0*޹Zju­R­:PqU-L^w[mG-رK)I"{vSd_[ՅDQx?_'d K_49lv'YynD>,URwoqGc.)l~ZYѲ1~ԌWc9ra'~rtiߖH/5 WM+A_Z24~ Cio'Mڝ WwWzqNۖ]C`ZeϘ<˨iUyR0Gƶv?q^^^fVw޴YT|.Ks[K[? ?rq_9> .Ssekxq=^vm$k^֦Χq%̿+#y}J@rq'4o/?UҭcTV0ZqBa/usSuFV*ثb]I4rvdd߈uI|uz1W pކʣ~BæoqLDO)ZzG/ٸ4eՇX@xw;QϖGϏgxL|ST4zGb9oiL]q;mȃt#f,B_B=nL<7 |g;-M?֥pS'HjjVܧѫ@;?!|ۧr+Pi*G'pX8}\7-9m܂۳G:/+a俙fBW R?ER[ď$?9#mƛ0w+zE ~bCXS:ҎP;t>,dzƘSn`nwc22wky Y?`0K.0B4ԌxӇ;  E® MEv[Z®8X׶4r}K<x_?F-4}B3=:hz|C hԼu RBHk7Z}Ikump+އLjwBTTڠҟ`KOՕ0~yP Ǐ AM y.9WvTNlYG?r(3ƕewW%rʼQ~e ㆛#w LoAשǗ900HAVY.>Wnx֫۴?-Lܴ 9 kb[fMW28A,QKw1;(VP o?\^+ϫ8fI JҼYGcqyC]=rxHA .n H#PvDhwSwwSO5vѽùh(׹p'cdvGh ʎd*#wx׍^*d.P mpk_SYQ2zޗag+$m쫃UWˍե(oZ[a"֎ѐ#~Ê#_k T;K#^ۃ+7,),ZҒޤ cU;?5u9Apg-@omس}xSel ͮB Dw5uCGm+JE?œp{WcP+_ s$e9}\^Gܫ 58_<(}8W5Tz:`)!P6BmiWdϷ~H"hO;:ޢ}a)ˋS8O?MۀݧmpELouAJiw&'tGO yxOpn6gy{4EөY!u >FW}WE7ߗG^?FyTe!Uy/ؕ'u|o Й\%g~\akߗzZj6wV)= FF?&7}c+Ȯ&^v5t&t"취fd2 qߗߝYqXn$ K=A=#%U}Oܼܗ!,jg <M) ŇF| S~}39+^`6C,P=H4܇t朸rɧb^U9Y:3u>(pUQ{I&.>I9Y;/JSW,MϻLH?y{vrq)":SU"K2*h?Vx܊W~qG׫Y*j2qc'o^dT}1?== riשW5ur\UثV*91] Ujb7]ZFXV^hl%F\՜*b͊6*ثb͊6*ثb͊?*6*ثb͊6*ثbO,BG%i w`FY sbfG/k6*ءٰb6vlRءٱWf]vlUٱWf]vlY;/5aWeWf.Df)vU1WW6*챁 ZZ8V4N]2*sS Z',bW.*rV)h8YKcU&Qy1tZ`JG>8.u9`>mgB*"~yWiV1/oLpX e,>'%ʩj9&I4mdi1>o}96bT{2QOȟ. eג b>.]@;} ^a:sh+ZXYg'z?z?EVQǭiwtH5O㘯W"(- 'Uwt+ZM(/"A(أ!TW ui zjk-3Yƞ2ڊu^4cP6dݷ<7QO-OeoupbMNUeQ.)9i80H~¨2òN0W11Jп*ۋ`}]E? ?+F!l3X/Ϧ>cO~EsM"[Hʲ +b"QL6?ZVvi+P+ٟ5ļ!hRR *n?'K)G-=b9'*<򪹚`'J?ۓ.36#31OJ [z2k~iiZ &OSJ8`GTM vOqkKYLehr# ?*WG0XrR?,zON\di>\O^קfſ!iVyZΗwasZqkOVյ~ Fa2F <ޔcМK%I )]{i67Rom}A!jXaU @FE'u\j{F).Xv] mդz+ʠҕ"46^fE0;.RE9 {Q?hZMשK4\@ Wz- ]iLjR~uXD錡'ߞWU pD[F6.A%v$s6K;nP&Y>/G7^Fڰ5<=LZii"ld j8[xEϚ\Z_HBǨ^!:{ɷǢŌD~`pQsdص6#r?CC5L觉 ww85Xᓲs˝Vo"iש >rxtې?vxh'wv[ =M .ce%۹ ?/q~b2%!HN!-e@%\s(J>Z[|0MKj<J}qOjA;HYJ[C-{cS#8(j#QubI;FwS *}2 ظdt݂(g(đhZ\bkr/ZP,doβF z{-Қ ^SCQO2 Dmo5@ flkFDڪָ嚇$k 8lUx|E# 1\xZF=\aCT[u21)l^‚FE <&2QxpO Jb"W,T UD,mEN$x$WT#;Le{$ڴ[X8T(*e]O<5>PJwݕj]XA o倊H }U-E51AԡLUzRjs hO)ibE(2oX|:V}?k\w+B{b3? oǬ1!o_Sy##E[EjrrI:b(2(@Mx7mٶe@[ꏳF4SC#qFfULEʆH+BHxs^E"N_*>p$t^¸e_PI;ef*ءَ*q21UĤ\= )a,@VteDl(iLЗ7ek 9.>;?m/KDAijv6ܶhve(Rn%V^ Mwr4Қ -HeKy7OsA VrGib|T݉;anFM̀2<$5k$-ùIsmnߑ_I(>뙏#La57PbmZ䘣a((}~vs[k{=)̋N*~P}!&ͅWW]F>3Z8ƕeDL*5xaWWjƏJ\RrTv(7P*Fl60XWuqsK`f@[sLi--EkDs/&`8cjPUHڪ*r]Q`Wf`R] Wed˜qܩ1WfSv'!)pFO\Pu*N5$8q?F)jW+]\b~xdӾo*p+Gjw.jbƐN(o+J([aWf2\Ud]^L9t]? k5`Cy'?rCkYo6*ثb͊6*:q?c«i*oءoKZ\[-@oZ>«TSW5zQWHҧ(r*cYOlPH+lկсZ2lUxJlqVYLԡ­Q4[mm_*NYkS pY$b75P]U8];8rh2?k\@X`7*/167 OB>&mu_G1?*iЖsJ/u}WPi8Ԋ;)7~:v=?x~_/x1}qMU@:-ƿAقfprw%pJ\"˥%^k%tkP`4Ri#^__qʋNҭ4M5+sr~Oeg/&_6ĚU˯Z:={HRY,h^? \|p?^NDXW$|* C6?q'c3ŮV۴qP};5?vV?h_z;~I.iz0WcN* ~Plԣ[۪s4rQq)fM'wyrTIԲX 0vaċO17ŠynmV e2E&2() ~.W_CQ*m8h0o&Ua9aNdQ('DXD=6oRVuxNeWe\U>G*zTn_S'?hIX%,RO&,5&o_x_ΟS?> g_Nj(-}|\ž,ݣkH>?Wc,BWo_#q[$R⥾6z̳ R% ?=SUndx֠QM?xAdĊR vJe}"Q?NL?/Jԏ`h1ŊŊGIQ֟p$1_~QjĴXfdliS&4ܽ?O<1zEo !8(*Qw_ d+?HON+N}u/@TBdɉ<0g?qK鿉"-Zg%hTV y+~a[V:H'Pe~ W+]ӂQߧ_o( -hQmCOϲ. Bjӏ/,PB 1AR ˁau[[Wx0Q _݇4,AtتCw>mebkY"ҭc@R `e8g,ODԠ{kr)Sř")"2RɴI$ȊHb?DR2K|y*؟A|XŲ?j?jI!/ܿ*12^)qؗ*cc`; T^njZZ< >Nĉt`Q|iyD:[]|^3HQ7FWS Ģc :Aҿ)ukZEK\[M.!j_Vڇ Z{4p5KizV"L?@#uIgYgpd;)IiGHVJ${r VX,2f}˩Z#fGâ^jqΰK`#Rj)cidܘ"r wɉXZ\<8SU7)k%hMO^Xzδ ڔ5?ɮ VҸ]:HBhE?ߢ젶wޣv{`ە?\"FShCmv*T~?m)'"El}CA?\6)^xi8٥7c=.;Y@!,b _)uZ%^Rn}cN&;yu?FkٓO*~7¼XլS;KL=+Flh5 т=Z/͔iW7zUQA׳%Vil'lʆ*wD$k&,ZtF=;6)_ w7)$k&#>^C7]Fd*ƕMiɃlHAjq*֟}֕S (G̲N*Ye^b}d5],3- <;K/yUoP݅[<\qoj"(z@`9mbOk[ 5'0U`^.D$I"S&)eXן/٪)b9&m+Tn:^[7Do̲>2QaiLY$m~H?_'#@KEbzךt2֦S]I٥fBܾ7h4%ӪOf nѫP^j0Z5F1gd;Hܣ3pN? 6 i bD z>F+Ԯut\J\yP^BN pP"U/(@hyi Eq"81soٳs:¤q_XԼjL\I,I<F_E9|̒%N' ɏ/̰5c5#|xf?}~$=|CҸUV*\mqClU.YLUGl늸?l` \R₰¿4?i$~gYS~lUٱWf]vlUٱWf]vlU*6*ثb͊6*ثbO,BG%i w`FR*Uk6(vl*ثbf]6(vlUٱWf]vlRvXS/k6(vlRhk,bbf(vaZ9c`aBsZ]uqq`UVXXӎjt &0b -rǪ╎ P!bg|1WZM3\ZVsmZwE:c`!(i!(j1QLBU`:d{7?^fi9w~JP z1ŋ`Wf]vlUZLNoes'M昀"~}.s%ܦ5\V~ p@@vMܒGGe]Lx;db]La]d4^c"P㗊.+bʦ*Z@)=+iVN !H'Q h9ԚnHM|pv夝tƆ-B~98?wqy~>¾P)W_ \#B#b%<9Hku}=5P{BwẀrY1J~8#ڂ:X9xʺ|{bi8.XG3 7.>$'z@ѵk+(d|MJedž/dͫ3'd8 TotʬX I?6<wХ.+fsV tDbGl6;n<҂$q!Nř\0ϯ1ۇO?RT'?!d"6jjt/[" E,lH{*,e@ߧぉF#>xT5=VEX$דʨa(:V*ѨzfMp3n}A*X'N(TOH?G(֭jM@v߁-Er&xӵN]ۨ+EzmNL߰i|1xHҚ Wæ @x-5rToB"w ٷ• ɒ}J)9O#9%q2^] VcrJ*kӋzR0j<;H ^x\W{Oȏ;VEۥTm܁NYA6>R׵~[fgbA$)$ Vr>dXb\Zewʸ+8m9VPZ9|{4zJ\jHW¦9Y|y[//cf@v_So7Cn֬9(w.5^V5 \^NAzc9`Si&T"|d׊r{@??MB™YfM=AT0G3О[~ai:OVHHx5~rȰ6ʿ2ym4E wf?:nT[i}\G'yM?[ZaVB,y|ɨ#`ҹ(Lj1ZUUA> W' abl#4 65LjAgQyFєD~Gn-\ 򆝤X%łXORW%qd?|ǦXgFDt;ݓ=kkuYRr&!E>gKy/]X|nc$n~.-4tIXQ4a3Q M\ȥXq·4k7*2˧ˬ^,Vz\~d1;HGcPL|lsq|FU9zEy+z!Tb yO"=r9,g{y ?!(&YH£Ak4 Hd^['O넸e׭+l^cQO4"x.ʤ^1_[uډ3)ae(v&uM<-jI+-8H>[1y8O_Z'IU{96p b:팛JQhO2F"9b|qClT)U4ڣ Dv-<7!ܑdؕ" 9Ğ-KG [yRVg)87q<0% IX6\NgN C '#K^Wf {t1;ErKJոV^VZJ?6T6p U@b-1U26⭜U@8n2H1VR0%C1UG)CPp&ֲ86QPxa٫ޘCIB8\hA,rS#nkN U>XtH'}*#%8#7R^sҸP.Nk IQcKxW&BxP w'؏!ƚa󐗁tۿJ0BrXO`'K[`e5e__m{h% oA=rH m4QxfдD)4b M>vjByTpȧ@$UӒbC6<4n+4J0#)bԛVTBàc)wdZ/JE߾CxF$ `HP/6ōߑC edr%XA 4kŸ,-@( #cIQgZkfP*OLH17^MΰP$b'-`Yem^XErƶPF*Q {d+NK\Kyp#q&A=-A;hkTMF#1 [LJmeש JR;'21aGkV;b./"Uuq'q-!8hFkbх-eTE [7j\Uplr(k*P?ddPvdeCYaALU'uq0„'z {*?t;R8܅F*i$ V4b$pآl0+´]Z.*quZqڸYGlcM0xP9MqVkZQUAqV)0Ǧ*쥈Zy ]\ҕ)v,tqp!r!p¬6*ثb͊6*s 1u߯*Ku޸uF= U$0S=v̪H/(7*aQNx{Wl``yRؤo%*R&9l. Ui \ S[WS3u­֙)hmnW(PָT VޘӾ(\@_ծ= PZB F+R|9Zs5ŖGa?WiٖIaaQ HO$ K C qK|__W^0,rmL!z';㮝oWfMU<#VQߵ5IVB.[Wֱ:J h ȶ7n*ypo$_[-,B+R6mh'>'`}}'Q/͗YTi7 ZN4-zU/VFlq/_HV̷``y|RLCO)yhhDۊy/},$cXWGA Vݒ7ޡ|8|^7~m@4Mw)97vD,U L3fl/pIjsYi @nZU5Hd ZNbhD^LwD(}8ky?2I{?g[ R[i>C?&Y/mckx/O/I᷶UQGµ#~O䪝&mVLxI?0溺gݶf4!cko_e ј}bJFC2HOޟcB4^r:ևnU_͍9┥ QrO^W~T?dHzjP80yZ!A'":O*v6M.^"u1[!RϏq*&O~ /^8mT5@=rlf^`H <O8*ǁ,rCXOo\?DkK^Vw?͆NQٌuhh&$u<( 1ҏLӥzΓqyIJ8w?|_6IbU>c1Wsf No\%RqYodPuaS9OUnYh$͖yً[Tb95|Oń_Uc6+x,K{JrTYp N/brƛJRTXb-cKbǧdzW?Ҭ2>Y7Zg|UmqZXgVB$Zgc)"\b>U 5W(!/Bِ C-6x9:IF+M&RwFt_Y$#zwn\O ?_d_" As@7$:J1m)VA_a.;WH/U\^qYo{ȬLdujL™Sjr,^fx!%>KlsrE-Yh|Act(IߎL ׫<.IZBN$uą5!BXQj7?]w/::OE-ޝry#Qz5|>K`cKYlY"#\^r/+K y}8?YЄ; /f]ҽ~*-0UɿVVoq Zmnê)6GDSbA\Og]Zj~GaO/:p\`A٩b}9Ed(Fإ兵DU#*l[r] )N O>b,-K6#qSQmNHM. 1 QW|1SWHH))HW׎SX^OsM@ ~z2DX-fNԥXo!wwXN HX MS&E> $]rV[x58TXͲ2-XwVeKY(Vvqei__գ]>YIPaxzodU}cLѮ S|YO_ta)!DuY~^Fj\Xu@MSg"?>aӉn=,ᘎoXм#j; *r+ ;<h|IBr$- EʎA'__j_)X7Q}X?Kd1^`vQO䅊$.W'h F5ε}b.dX|Yy̟2CfmFѝU /.o0 ]\FߠEZoD_\B3BIFffF#|?ˋnqkg8Qw2+sqx#_SC#^cZlwlU\qVf®b0+UsR®q.h-%11J9x ㊻ <KLJVs?6*ثb͊6*ثb͊6**6*ثb͊6*ثbO,BG%i w`FZ^*Z9CYb͊6* vlUٱWf]vUqWf*͊]*\Uث]1V^(v^*Ut]G,`VZ;*1Kk,U',R8Ua9)hx Ui802SfUqB:T8-}0*r« #|Uύb+(b+B%TIȡc\PאC ys/).[Ju#6ALؾ{oO]Do\PٱWf]vQ)v@?9/L:ZBIBY3 U-^ټ/<_/ONVg<>Rq#zf%٫) I] ys Qg$%V<⟦!1DV:1ͫ$QL("8e"@錤L_J!5EGw:JDZzvD"#qdkE*d<S=#f0늅&|r/"Xbݳs0<,V@;,U_xVol kZ@?>cT^4޵o UN$brHa egY@θ!} PkclJ#lz␫v쮪")x 1BJ(@qGbU R^m%~%{z*BHxq:Z$Iۛyuor.:hL Ӣf=x+/6f{{IKW/XQʜ|r//ɀe,2"4 siWRU;+So7p!g*);T 7ߝAtaӾ`W=qt E*zL0*9h"IniU7N.x7~,nIZT UˢCYy?[]kK:#czgFϚ~eoa/)kwynV[ɧ~Zj:ui"Px.μp]Jf#!#` AwBh[ͺuW_A"ZJ%!62J…g+D#I?7oUTXUdži,>_7Sono4X*lQ.-y F%uI\̼8^ܖcGŕĽ5:p"F^+NN,ű+[UVHJ㛁9r2'y3pX:]9Ts-uRz=0O1Z S|1-f[)lAB.lw RjfЊf>L.^$r/ }}">\`(Ew܃'S"mN8\eqqG¨C-jU٣~ (5! rrI2%xo6H۹,ʧsv8p19c2Eabp/55ܲFU"- r{ Єc((rr^H|m}Y%xȻyoqkr>08j<_\eCϞnZDڬzh֣eCku3 ?Q{l0(.{.5Kf,pSn W.XNAyq4ncS׳=2ƹ&oU4U01v9Z4FYR) ⪁]w\SS Z1lUq&7t-G-㙔lJH0*kʮ*+.^}-G<ئsZH*+QOvd 1/4~bi_;N*AAq o,C-5*qG]~.=!d`Mg!ΑfQv?̉.%Sj13eK3j\?U܊^_d^w2݂UkF"푘 Ϗ(Z m7K#d ]v?"XW|+ Λ2m6 C䂄lF-́=_Kߛ_ T?%]gs@,kw9ce{ >j }|[e[r`AZW,`$.-~—r\b:UNWtO(K.dG?мi  DJ_ kzu-fobܫEJ|NزU}/Gi*]T_> >pXۜ$j0QAx\)q+͊(2A. 166&i!p8F2)TQ˭BUaV`w[2: >$ђ(r69lݠjƬR"Hnq0WsA s!vIh2Ei/s[8 Tƭ+kC$w1R52- tA,UV 8|K0 Z 76^Ov V?z#2PqB4(TU p1U\alXڠ\a| mxLXU8X 7,Usr],6u)iEp%49 I9ZS^4զsRjpTAJSc] U4Q\T(=<0*´/m4sBxA  C&'#R[pk׭D7 qEs]M+m[z'L\w̗@Tl`$|F4Utþi/&Ň-(ٕQ.AZS0&Ixgq/$]Kx"Ps= _)BcәjY鄫P]\j"ǒ879*†k1Re7! c,Op)q(v5:㊺m" w8͕ s T0a!zaWc`iZ^89N*hC"i8 #\UƐI6—b;`V:bb1Vd' iQZv$k<*LHCzUdzx Rq)Z'-qW1#QU$Y7vlUٱWf]vv}ialG?`c-MaT2\kҙb-rjkV#"1BoQaVپq44>4ˮ9$O A`W3\UN*+ZKTV2S [U嚄|*_,UXVV\aڔE'G_0-( 5 ~W6U 1ۈ)F}7>Ŋ^&sV+!M0+`7”2P'j}? 0'z?\2)-iM>_9ө╳*\ـjPW`+8ncmk](pޥXoEZRG$(_gߟx^YODxb ?L$ܷ<*, ^%o8JTZ'/m%`U P՛lA[5< E8N<g8V]N35ci`]\w Z-…LWxo%*͂nOQ X@C^jkE|X)\D8p[.O;Mq&oRQ| _+,(?O ~!v;)愱aivPVʱ6ݫ༲p8WgI3Dk]#2NaU^5OUۗ8,,}I-̥Utҩɩq9 Ozn,$}B۽Uk(WTh9eC3 Uh+$;ŧ%u5`ePSGbS4j^q%XR^VaEZ-)S2v*Os=)|Έџ5?*\B" P2k|r&I"ˊ2U5☢c 1)?\PKP[7C,kr~*7=VЈQ SiR+ z#Zv+MJ_p:5 1ڝF[~`EU{#Rr7rW$->U4<ܜmF~ϷO,QĮ,QB Xʻ㤚[޻"I& /Z NAKzDmM>,;BiFY z6h4&F)_',O\X2Wcb9%*)AIɯRq_>u-CC RVR aUzl&_zmkK4b/Yƨ VVn[- %򕗯/JB1S80:>z_LS nݒ92Brl.?CT V^SzoCN݄3&.MO^gLNLzA,ӎG+1bVA/5;k  QOk7?O5޷@Gf o{^sÇiwzZ6W8sӇļ>Wg&] 4!S-2/)ΦMhتGΥw[^Kǖ aswRfV {MbƩe.mMÄJGX>/HD%cIZ Ԣqb#]=~%N4 I$㦙Wbc`Cf9&AZ/ÖS(_'v@蔣)yO!V  @?Ͱ[Ĩ x*#pg]c IMԂ9RCu8Fb&$ +@?.Dy[-&_P\IW7{R3%%p55Wc~,q?ʦ>J9(J+׏"W'6)=ğÕ;/kfo1Kl Q8T_*=Tz hMŅu䏢]znʉHμ ,AثFQґ~W5-G,_LQwo`BiMzm?˃$QX7l# )Hx oVzbZmM%/ . *6?_€zܧIކc-oGSJo$朸?=TҨ``*&綷RV"μICf^?Jn,FӷnCn`ӯeWeF~tm' t`{Eo#M|zl,};Κ_\«RWQDBD%]PfLVjE+l7t1 dK'I X21BFv?iO^5|<U|$NDT>mX~7g?*w?ݜZ@p9@aWW5n4[b1WfثSjDbcO*W|U;Kf5\u(0+XU_`U-Vs?6*ثb͊6*ثb͊6**6*ثb͊6*ثbO,FG%i w`GR͊bf®͊6(v^6*ثbf]vlU٩bf.͊vlUٱWeU.ثG/v^(k6*b́-f]1C+ip!qCDfqUib/Zq'c(*,qUPnYS\0%bN]1UМUj6\wBYX 9t!h{@sӜ/W}μy:dU^kx7 ٱWf]vlUٱWf$ lRߛ7g r[aj^y\IgHqa_OK(/lSWebP쳾ve2v_\*`Wf]?*Cb͊6*ث^jW)l~#0@n$,IY"pW-zK"Oߒŏӓڝ41_DP c:33hse=!t^-N~278Fu&j,ͤ5 ̴*k2'[9I77iJF@*${_˚D}GK#ĉ5Y֪InPܖoJ]I)2# 2$⴨Y4,E~-@7;cRG"M0D[Hȷ 6;O#q\Ѝ}&wv*=blʸ[$jG$Xvx3 ΃f^9gv}ddlcIwl<Ѩ.PNt#'.,95kɼ6PO~1GBGC9ŇE? Aw593 jA[۳BԧҫoMVAP 6.GII={>\զFPEO"zy_}NIY*f?f ,2i.'1R}u-G]7mvQ+M?l/kdf2$n*Lp/,*}7#z(_\"TD#/BtI n&Vgx/^W~C"MFͷn$=7\yn= KL2W:r_8@^^߲ Zr<VЂ}NDl8:喩$6Τ$nMM|qak>M+;{f#&r#+/TǥPp61tn2-i?rc4wgvG2~D\iZYK$HǍhȿ4m۾[7$Ը!/?W2_:"~*6+%+?Dnk*|7g93.>ܗy͑yMKR\ //8iJ-ZfIۛ1i48rLHj0""8 ^V!'|*!wt]T~|9)xQxP-20Id =HdjOS#}Xٌ+[_75=vGW_k6kMoZ}522W8HJSl\k oXF%L!~~Ϋx'p>\G|u9YsOv&T.報m$lj5ǯ}#PGמG6:MD|Az~8UQS.\P[CCtV Ğ:J| *qHU cje*;1WSPbH\(u3\ `­xlU*5Ld~X$4*U::gr)!M)YY`|nu42 HjWߎG" Z 풦7;~{$z&P[kȎY-I6TW1d_(kI5^4r T:㗶N&?#yw_Zmֻm60\-:6GdE]FsO1U%1fD^[+miRۚ xN1;)~_~^M؎<RğoDڏ'7p!"ܯ弚޾7m#D1 $?d7gP휺]%zl>yDeڽNFĪBʄ'Q4H'r S`w[17Nҿ.Y7)k})RԚ푋_˫Xn}~\kO9aJ8^Xu@.>fdlHEYAr0RK F z!U7ĬOѱ9l/ʭ KyQuѮDL|̾}Ӛ+\˯_\yb ƞ?d^_0"}&QF87FpCL)]"nDS|DSV.͊5qWf1f2k1B|ek /q&趑:jZ:ƕ>4픐 umQ.љV.V>QYMaƻ¸S )@D{c.]Btn)ݥM<ɢɧ*Y ASc"7g H(B{ ")2M(ږޙԵ.

^;9?K9ӏC3<'R=<2[_u6*pLa8PfʼnTUٰ1UUʼn^4.((Ɩ2bvnX7,Vݛ+nXlSn;1MF؍?X/捇2O*?ҏ޲]X}cWaӾէ.Bc{*HҔ >ۈJ|voO {S*._>xBIZ_y 6#6Q6,>S( ZL{H74Wq/+%<}?*A#yMD+[YJ_ܣӇ =Gs{s'~?ZfmwZ54bqs{].qQMZb&6*f1VJUe,Zńbҫ}U,i)lcbn@,[ǂ>]gV+)qpFTCX ={dF;aWeC1BWn r&sPS0+C']T0*\M%.6m1•!v>8PrJ9|j1Wc.ƴ8 dZ7]lRzVmKCxbqw]jPxUاG.*ܾ*1xbcv]|P1#ʔbWMqVck#dzG\нzaNA ]vlUٱWf]CZ?ɂ1{߯qiR7ưھ440 TKǾ]N)h\*N婡Z¢eHn64߮Yju%rQL*|Pm5iVDaKjS[ {W[51V5F) q80rG5 &U¬z7=@oqχH7{#R8jIM k6^:iK? Q1L+~I)lR*=^T=>dډ5gz7熲to&j׈Ho4jTЃ/:piydi4Oo}:q%\xw/ZMȺnF1\KVvM'K ]\GwC^e5ӫx~_[>z/.'GVo)LM*𹼍۰S2տs#szӭ`9O 1ޠGsGgl<\]wt>߷5nunzVF˳qu[_o<ݧrTA,j=ُo3e*mhjCN_oY> N=&?SԧcŹwdtQ0Ǔdr쌳rr&ݍ͊;}4H\| \f\En˸T_d%-QJSȶ@AiN1#hw5ª/ : -~.E'?.i .p(5`Fq:3Kt? !T u5Mj߳\ EV1*G.CʧÕR71V*$RROen?뜒.E)ad&e5$v_8Ysi+,`Oÿ? z,zpK1Gˏ/N32~Iga5;Xhժ ?x/ef$O^"y26{DK'o:me'fA$*c!1^i RյxX~%9SU}?WG0W -˯)wu)kD ?%>2Cm+{`X_Rd!Y+-[מ?Js_تgjZɅm# %׏^+h3;&vI.$t!CPGŷO-64 S1)o ǙYaN #|l\պepI~ @J\p &7&+%CP~?e}\I-t>0)1}HK{BܗeI_cӥ]MHFdS[&[PO8o;[]G+D=nDIU ,@U样7I*(;}l渆>L)%_jc&+# Bҟ>sj,{D}w>xFNkm1x-ϯEqmbL >*7^?kUOMŜpqR$"5\,y9]X`ӕ)brW^F-TTxw%%K+?'_r1S½) _\넡bވ䏲>5Yu_P+eʹ1\^sTHjhÒh*1eZt<,bvKVyeefN7ĻmslNET=1)?dX Q#S+ܟ|eaŰ0)'һ7 /$>!"~8|?672 ɓi7x1?'o)Jx -O/oU+;ҷ, A5SZ!Ժ gjXz#Y!7K SZqX%9}?hW1 !ǜFi/<l(c,"X?]QR ֠? 7 `8hKю82sT'տ<f2ZAX<}7,걯bIA7?DL2}=5ITFNO \vlIa(IIC߱,y fRiG'׮c3X{⑛l__\ ֨ېĉzOo;<z@R mW6mvMZ'iP.,?hr#Bxq6䬄-+7cFm#~$ʌUO__ >.-RđšUSh ׏c%\0Z}9r2)ilw+&U'ne~ ې~/=XVo)' ^9aNیBh1Xewv 'p?dSص*#ŀ,c(. 1?R}GGIʼv3J]SNn<8P:bxnr\% 3i˞`dUNª#)_?[Ir濷B8 GY#6*ثb͊6*ثӣZZ^>=>N5>)ukYX` KWf®wJY;/1`] CdŬx9Z/vlVݖ\ӳd+&hT[>;q:G\R[rKE܀-h>yO3/!Bÿ-h'Lyvo20apuEQA~Ժ,8{tp ?3}?V4;oZd!'sUHcp}*6,pA J&f&v>9VαUZ oktі)q[9Rjzwū$cacDj7s>Rڮ:p݃˱GTSZ4ry/?\U"x*O풯?yO4WOMPWo9cK;:ɓP҄tg7uNk<חс_£uPAoWPWnC UjN51ʑB`y| lSۓ&~|1E]IvX%t+n}ĦYqޘ q@q}?ǥq{ؔJUzbNٚE$58bef<<{}8 o]zw8Β\-T/_,ORqUd!0Xb>*4M 8˛C]J\>C9˛"g֮lo._KFrː6" R#! g,'>zJt hWcR_)}$^3q>{Y'4!my,B! W/c-ҽ3ӈ\JrW*1~a꺻i=8@UlY m'da#Q;r>N.!.K-kf 9ZBLx~b\hz"kYr']ïb?vLʩ,[PdtÓ}5O~t~`Ƶ{hЎ܇_i~%7!]{ F|oy~'n؅ܨcr?D鷗'0rD@r RL3q>=^RqbWS"XLt.*aJL0*ҙC⭩8xxkL_ Z8G5<0YFv7ybJS:u튴q0_VֱlI6i<{Tlǔ_9nfCUNFI_3-~I/, Sd&ɛMԭc>ubHFNr_##PQC]]ûC[C]0 1ӅEwɗnӂр"l.鮚1¥u ̷9 DꟜuXT&Ρ떺jHǦ|R o3jl0Sl< o;_/\\E@/ɆFI=|pJ@H|狿7$U⧩o6uۢMX {?-6:YӡrUom3VZKXSg%ч JOW.Hs%[_ln~OX5i_V #rjNmkZ_ӓPkL5_Bʾ]IEƊ8u![rt CZ8CK4Pe aV MdǮHLCjYM֟6G5Ȣpxe_:j}i.%Ku VUfGE\,ijUjV}Ϛv8%c{HoKZ׭bx]<\tܦb<D#R).)$xպbwz LR4P U܇\U~.CgasPz URalS Iu㺟qǺ š6[ƕRE1We'㊻EG5.ѷL};Rŕ]uȱhc9(+}$-G\W d-E%R#I;xbŅ0!cኺ$b5;`b=!-rLZ8ثYbeRZR8,O|Up1V'%qVPR> 1Cʵ]*+,]V[']|Ue;lUٕEh1We*iv51Vث-o?Yʥzœ͊6*ثb͊;^?ua"0 R~$"{cYGQ\JWVḦ)ZFǦZ:Z[n4qUr­s\^ |;⭌r0olUcG C'(إZCۦ*ꁖF*װ4-i;|0&[{:Hw*fogͼ)}<^!ˋRlNkx>*xzJ/ۀ|(?a[m:^<̿/??q#@7mθM:uˀLUvL%\A+ʦE9Es8_Py䍯|˅'E'|89k+1i$e q4?[K"8He#B ʚ4n֫1kqձK{i^X/M6J]#SGZ_.߳{Ki,u 'Ug3[" O`xr>!tmqCԏ"-f>j?M𗵶l@d@X|T>/rk/_2=umah!*qf?S<6%|򟓟7?Z֒*x<-m侉e{a3c}89eȎ1o0>iW}7O!+q,% V.fe!n̅Tm~-ޞ~Y|"U"i$?c .??[d+sbȶb0 7>O<82OE~I]c_}fS/!wIa_pG]H!3zͷ.N$ fo R4*GUQ"*z]72 :Q?\GN98?8<8[#}<۰\6aT[K0һM}5#߫*%-zPv'jC~±& @~Ad~̺ǥPK~fq?ă_Pk! (;~6#-j`:/ĹYq=X~2 hXGB.Y 8%$, jbRyWY $WڹYwn#Dx??DE5Үby">NACքP.DH%5Y] W2Үv5_6\=f:FˏP#sEԂۂbsnֱGr[$;l-hxe>󒋭<(gh}zۧ/*Ms ]Yѩ%+IbdgtkmZ[8QJКWɿk'!Y[=M{S@#|_dwk$p\;> 5[M1`r=]i0y;7\MTu\ވb;s+H(Gc)V[b3#6#wz O?ȗkܳƬ-Ex8XNY ז',AG^94&Wb%Ƙ 8YvM43eW59)q=Jt9wc+`^T'"?W?ki#\4MNEUg2Si.KCI2Z ZP^0MR6#Ts %RU~C&K W޴F9uB`rznW |x(SB:z}ݙmYH-lEK,LlcfVUbP4L ^Vs?R"XfFWYU@C$kQ]+o4 35<3,fCWƁ75߯1t69\*js|EH~+@\JU8O6O!ϯ*^z]ibuz{v͊;-YD0j_*+km_+6>?V5V'Ɣ?01[Zٝ%dBOֿOG$Qt#Pq8bExK&AZyK>M%e?b -X_o^+o|Mџ[ oE#q!%”QOdnδVF\JkK{L@~06K]~[XF9%O,08Cv5&b,t|n#H8I"&4ȀH'<&B%̺Gjw ı$;|,ԑb.tEl`k>*I44XW}TYTO컿ߵZTҲʯ ;GSɀ952n%c$ZHCU2lפi/I$'*6L%3K]:/[v={}>|8&vL0=3еi*cr(kJ\Z͉KxT"".4L9[nCŇ#cǭǨN\98?{rJKz|X<$&7c.+:mN՗O&X-dS!) Opf=N>k68^-EN0%~J{dt:SVMCeqKu;`VءDb;50XS_d$KoVsavlUٱWf]vlUٱWf]v*6*ثb͊6*ثbO,FG%i wݜjRث Ut]LUٱWe͊6vV* ]\jb˦*bf[Wf.UٱWvX]jcjtZ͊=qWeUف]LqKTǁZ9(h〦*rRP8qBÏccd+qU8 *&Z'Q}1NPTOv\ wVf[ \dkNPWqBb)]EVB%L#vxjz&~Mu{灟 ثb͊6*؅v:MG 7L$Ez],WgŮˬ^=܇Xm>;`P&.|75S)u4=k*uQ~e3b~. B+ܘV N(-$s'L a9QE&dfJDwn xŰ#9mg $i+NJo3lx7Mm-x/W<>i{rR=6L;#74%aX#݇7JyBd c5pfT ,<.M7\VbV&OM8]?!yT_pi[_2ڮ+9&Uߣ\4PtL$w `* G#_9]A#*h1dl d>-XtHu_\$w&\T`j)ƀ7īJsʿiM' e+&eaM?-?T֔/.K@(UO=5n*sf4ލ!hMU˴lHc0z ρ|qT_Q-9?/f2HŘ1P +O{/=pCHY2=#UyG&7==]'V EOs5>`/>d>YM[E[9K5_OSv8ڲ|#`f'vػOKtrZ7*1WCRa[5jS/j 3ػy~/#x<901l (ZccAG<;[9p0i@W2lj YZ1Ȝ^>Yr.ٺ>0wM~ϞLZ$@QWikQHֳEkNF>.y#yp->a(Hd?w-Q{F=E3f@߻Ury|9|5yn-?kg~`!/]qtt?RFz]ZkYIJ#ĸGi:}CvL.!" Sż`WW/ 1'vX*SPRURXUil*2CR8Ѷoh]ڴaƁqe/#j(jE7bO;k`sqM0}Cُ՞l@CH'N~k9ߖƠĀTruّ*4^/:7߈G^Uܳ^jXC5[c'˗`kM=K|FiMi!~>`h^c0=&Lg!S"4o3B(ɫo_ֹ,/GZS,&R\ڴ"Bδ!6q?"i0 P톲yn~ܚWelnȍX؋僥֝0x1R:"#+:I9Uex!!oz;KGu| /򷣬6ܒG^DwQ<{g05Q/Ȃ 5{ʺʑU>Yԑ E^(TAD>kPK6dV!B༰ZRvAݖ~ZjoG֭(20G^5e,@fzEVSb)O[,mx0OAq$^^wkw0ĵ?VכmR%2(![{`'"'M?Ǜ<}yvgқ屘ElXQT+Z*gyXo2 +imS[ߵMeU5S[>uvPv^)k18$e7\#c(RU؛BdJ&"nove1В72lcrg y@f>rѫk(!Eψgjam j)$1xVDPH[o%-:r3gEucLjO܄Rd:ZNK6v<ɚx o=u;ܘԜZabɱV-pZJ2L|H-waT@%.9ֿF`JP|fWޯУr6\ټ--x\c6,Ulر^16l%plXN,]\PWf®͊5p+Wv]qKv)(a#Wg4}Q1~FEvʃcv:m(|hLgպV늲Dc늵i]JAҹ$Q@ qU-+hbGSĞp⇦ڔ(v58A pħb^6YfCdJ V8MC8وvn4ʨᔈ8UAb1VT. (iv*8JS\2)]V** ZȑraL r-zaCGk{bU9VbRH8qQJqWWČUU88*t\87[6]\mLUuZ91劍LUي2Us%qWcxx"erA^0 b͊6*ثb۠|01+ͮ߯u*}7pBqzaU:[ƣ/m.'kwZ+hsj'J0Ϯߵ6J2n]M0,\7…+k_Kنe-+C8)'t/WVƿ2o yU5-,b9>v>N[PԸ,$7v#rV7pZ9oe?R_I%Y8;3:][d^_ 2s,` (iKUy?i%K @es,3֔MaO/2d2H15cgNFUےE@6漙$o3>s̯=; ҆#jWp_21i-3zDZ9iBA[y*%>$*bLJ/-jڥr=ĆI?ؿ䏅sd#\"m&YeB#P()^hvq6A?K}~8/Tp13tј[0{  t9,Iؤv N x)]׮IZ-{R%Mi+$^]4Ƨp!*J}Qdgr]o(^X[~ e1[!cXHYU6 _9sc4 ]]ijF<>OӎFFZc¢W`tDdOoݶpmp#d. BP<ۮcbl< ĩ'ń&%NÒ_yG/MeLl۞QۉN=P8z5ZRHQrhXoX+%KqKG&Uhj($mxoYrfKePj6o}vh0o5H!TFc(ȊY)Ī:cavya@*H(hCVn'VDo_y%ɉSr-rAJ\̾iƐCB%>cca㣨N덪88.nck9m+rzr2-:R;̃-)l6?ѡYX$ я#Jsj̊)BXnX>?GHKV?.v nS܇Kv4ڤQm*)iݳ)㜶p )kJ}V#o7 rSңcLN6$To2e(o褳sO*$ݹ{`5V}?(e%_Kt,̀v=O5\^ı$8@W1ht*ⵧ-'{xᔎ|<Ƣi$+UQٗO~8 \LA$OcG ➪\Q+|M aA%K8'5ňZVA$mSOޘŤZtuحXdXzjiEOm֚ϪExnJ(Z;5-$nJv I.ɞG7yn' wd PZ{kxG~ydd˘?Z;R7몍)Ǘ \=QZNXL_jHjqˡ@\\/`)OZwV8?vAxd/:lZU%Cn 3\I$)|\dS +$¨^_*UO4ͽfaGl^VMIr=]WCQ""YW` GE|ɄiO\up ^OHC2nKR_zq"3w't9"5Rۙ$ GV?Q}Ef8*HcZs뗭kps SZ"&zrpOߵwFCVcSq/ LK7vlU|VIK?*֠z}9Gq)p(҄tN+"\i+yqbV" @GSp$rZD1,A֛WWKj: -v_Pwoo⦬CԪu>5ƭqێq+@h,piHwiZ)NF?R;'Ay/_]Aˎ?*s^4 iV#e}(kRxS?e&b1/'K?B_(>Ǔl)׭L~o:I}e(#*I}WBVlt+/hZC h0l]tE_ FڣupT3j\[jQZIi_ EP C4#5n[+&1-**ȦqH&2 THɆ2M*ԍ#hܡUQKllfWi3^ \:cA+uŤ۹$L9ki[^'ٕƧ.X.لQA%U%H4|ĩO\JXHRP@P8[t %bFo$Si>PRs!ZTNrorAe16 T^<{2ä́zͱ HP2#I$^H"To~ >مu}SȔ.(KX $26ɀjWZ]\vԨ'˜OwbffS5Mb\,[kzPą~䭜Lmڭl2"b8t[GSǿݑ4%zhj~{k',d&Xzt=իQq3D`O'p|_IR~9J$Wz7?oD*A$LG{9h0 t,%:mJ*3ł -%;U4ƈ$yp9M!PF i>M@Aw+o6xqp}sˀCcRG>r0k5#*; ֿr˔̽dvltzx[DE Ԃp:k-M:|J2#ScF!fr@41D ԨNoEkitvh,:̞L ./Tʱp ܜZdG"jQ]$2^q*nH|Ԍ=y+LJߑd@U|x5zFFbSîT%@ GLIW ޻}Utf^;2uS|%y(D*NTWUoOKmuJ#UHڭ~_˅ *ﰦGpxvvPwSQҸ2Ԟ ~HxY]oӹX/Jf56v)+@R=Z\kUMXmLV(5Ǧ*qRiZ`{L\(UO[ȁ r'/N_p9(=۪# X^Xt\ĬkJ_q)4vOη1 T!4` '~i]ZpR? +e(q<_vQԣRV?$,RޠƂFVwf ڥϞuY/`$ @@^8q^ikJޫ SOYko9!ȲqeAyZ'͖#k-d~Gi, "("qkag4 MH ԌpϣkW|cL`FFER쫐1y/'-a:#ÖWk''e֜/q3H1rEW~%7ƋYA> 9"n5r- yOs!>2R/O`0\Xvh4P%EYT.ȃ FO/~q^ }ff$-/ h޴#iKBqGmijŷ55lV^k3TPR:vcD?mv>#-/ Oi30T R0ֱYMY/"Tv?.E@Wގ/5d RKQß-yZFfQSշj{qlv`8G_]9aAjl>r4 P4w]M-OoUØ?ɵjv0)֡ze+( "+r61wy; x)}\?OƴoMԋU$!_n_9̬zC1v:h~(L>`:dUܚ ĠOov̏jB9bx%(''/?.4Վ7et!IW0BH/Q#KFJYI':}6'On7!Q0(QZ Κ/-.W*3oM2G\F̪5&J%NmFiy՞7& Xvb~|nмw="@e bV^m-t #ƌC<L|٤fJM3/)D~XdT|)?'#JLDYUOj+R6y4i=^OF)Sg#w)H[w*X,ka0Ҽ')UN"* 4yL04V{26 `n/㼿Ոv5ycեJW2F+dr] |^0X|6fg%ުƁ~"U<Ϫ<VVU]L!֛w{mȒG`iFY&o!}3IqGrx-X'4MFc%$OMf_n/4[sтFǻ.Ju5$=*D̼Wy3qoD ᰿Rm|n$ 8é~U]=5 *ӍA"l$ӧ(.%A52L+t,%F#v B |3K[C/پ ҄!5'[{i&m©4ˆvaԴI-DkN6Cͻ&L#%J F=%K[l u$ UݏAؒ!-gwt8f޽ nѧ/E9;Q9/-pP L%q`JcPث`Wf]vlUٱWf]v\gRwUe_4}9b\dKo)*z튻h76<-EaV#rqKc[a]\cDw1p0DA ԍ­?vVt^# AKWWe5)v`](vXi\ gl*젠I!S\d [\A P*LSmf#r(vXJ MEGQ>!cif ۾&cB vb^ K5WavkLuQATQYIb:M7]2Xצ)v)EqV1Wew+8|UrWcrs\MЯ]]Z <Z#>UͱZ[)8xv9>#˸]V a튻1jv1'uqWvZߦ*#*AU>h+Ӧ6*ثb͊6* a"2ଲĜ*c[劯ǁǩ+ W{(Y#3V %7c[厥1Uw;**^)iH*䕰xi*.e F9إt똞ث7'1UQ]DkJ⫧ZWXيVKQ"') Kvc@Q?_eB>(G%,\\z,mMzDDz/\iW4/KdrDӢ4ce!bF79* CM) - 0MKzY}U kkƭ__ɿ_3yR{%Z~ Qd^O}A^MEpz+7kɴ3"k[NcPֿk5=F=Ó'Brc/PEZ-In#J,8$?߳m>꾅/JW~rrGOiP&._ 5_/vm`ͷc8ᔺ ߗ%|ᯑ.=$ K9ϵɭИynFoݥVOLɎj9|8e]\ ep?iI"?nO_>lr.f60Cߔv 1'Y B~_Gyc]>MrMMY%Qģ)D/d9m ˩?ioM-="GB͐#a8)ҵEp,i,nYaKETVTƕiEk*M. KzbQiqSjlVzf[%K82MyUʵ; ⢿6[#%47Ug=sz(qԴiHYU@>'S'OSobow$yKY4)H^hƪm.?'yGLJ33~,Ldž7ϗFޚ v`e?e\^WUכo$3/~\F޿Ib|\cBT/!" yoz2+KD>J/M[$/L$R9/ZHž(} mHP` _ߟ"œO79^?HG>[o6p9,ާ9=Vw}C~zxWZXIJRh~,9bDꓘӏSeoOMaĭ?*~/6Uǵu 9K&,d[n>ic4^_Ü[iŜ\kƁG ŰZ-v n rk{ 2 Y 7c)F0$OW`<)b|,