iExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 13:52:31  "*(2/HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TFE0H;Gp߼FRD^%ǂwd! J`o<>/R]W=iǘH⬏ScD(Is.=BL 5~){(U^.K?ƒT@u}{qU; ,;^I|J}ILׇOH .=DVNeQ4\|As#?GBo ?.(ڙi_Akt>=]|ZOk 8&?~(YxW}-Z!^>X@>HeO)(YD׍Txʲh0? 6܃[wx%S+ǻ>=S\Z v7b dAws Sdv܏q/Sf&|龹o s>aA;sUˌb_!o>zuW6$syߜ9 9c@v7}k$:5'>F5~l2N3{[k9yycv*XPS^Xs`H_k÷U,գs9i !ir!GH g*2 *Z-ϭX$nffY)$[C4s,fZjj`t/G7smQۻd9uie}T/v=Y3S[liRz1䍛>w({͙e~aZ|L72#qI]=Yl`868 ?^PbBSwWޝo ZO&d?y[G Ekt q?[zR4PT4ۘmAvGS׋V}8ti(X[E܊rG>%0l"vVm6=7{kOBγqvtjI<t>!̩yk}ݮwP|dx X[-~nQk-i|${&KvdZ&3j?DX 4D.gi-xYoTel6awzMwݽ\n?YM2WO_.@>s1va2SȎ=.s~_WnVult?rի_6w[.Qӯ~uБŪZbʬ[#?(Fs0!İ{q7<1 ] Rvإc>E7ְS GTc+s@+&l߽!]DO>jRl$D $>k \9e0P7ƿz%>R[Xν7y`:euV.&Sݍiv_UX?U|[0~wSW>o5sϞɇugc-.6\?[018hԕџLz+]h7ت٨ԑPF=Z]7֙=ʔo e#Lx?wZw19O YsyG)M^TF5`>.t8"@x4sϏȢI>eL54@n&5PwD`=л#73"ixV~3Oqm:kWk}dW1Ո#Kg'L;cw;Rs"CkC{w^F}oE.`睿s-~ÈllW6:GTh[m?$euOg$mg67nCoْ=J^X;LoO}i컟,}=#[OI /A+~L?%-qXO0ZRXK1%.\2F vç}Xƻ;q X7i[*ǰ=k C$Jڨ ?꾸qꚰ9s;7w^6IM|\Aik+o.#X׿ Neq]_7C ӻ>S]G??JcPcGoX9ӑUJu:hb?*~4|? )'N|O$Lk<ϙ_"EjLyIHp⹎{mt8 ntw=_Gor}i3^lo?7| 3}_=3khKO' GR^.H8mbXw'wy &6zu?=ߜ?qeL_k/=ѭɻ:Hn+~eSQ\KHs#hs]aկ_I͵c}Iqe˿HGvM=Y?:q%3^/O/pw .c%Alc]N`3{}oWG;5Gq}75a-߭o5b2a x&Hd5\6MӫƏcAiwmum|;5`cD4 L5w,=]uHG%>;fZΟSI&*қi3Q6vkB?Q$Eu2fy ޡ|]1 > )]Y[a pf絤L=TwMvؑRÖXq Z[FuUbŸosKO$q~[_Z:ZqDZ+5z^NL;:۹.mcZlǩ}n?s_J g? |ָ7a8 ?:yhI;HSPCAP[q$k{讓ƻ5rYKkuBO^'g~93\sXÃulq48$JoFml ?idWs^?ݱ~VGVǨ^.ѧ~O6/ ܏o|^SpMSpG*g}{T]xO6hKggP2wPȐ?n In\?8m|/P>?&6?&a*gͫetbo8.{s>F@?glO]OO65u2cT[ӕEa|x:H~B~Åq1ܗp=_7G;̐1@N5v`M?Uc(R>̺<]g22EΓλXf韲#"]UTݵ1e)DTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTVersant-180_PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM_ update_maart2018_v2-4 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM Kq/ Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TFE0H;Gp߼FRD^%ǂwd! J`o<>/R]W=iǘH⬏ScD(Is.=BL 5~){(U^.K?ƒT@u}{qU; ,;^I|J}ILׇOH .=DVNeQ4\|As#?GBo ?.(ڙi_Akt>=]|ZOk 8&?~(YxW}-Z!^>X@>HeO)(YD׍Txʲh0? 6܃[wx%S+ǻ>=S\Z v7b dAws Sdv܏q/Sf&|龹o s>aA;sUˌb_!o>zuW6$syߜ9 9c@v7}k$:5'>F5~l2N3{[k9yycv*XPS^Xs`H_k÷U,գs9i !ir!GH g*2 *Z-ϭX$nffY)$[C4s,fZjj`t/G7smQۻd9uie}T/v=Y3S[liRz1䍛>w({͙e~aZ|L72#qI]=Yl`868 ?^PbBSwWޝo ZO&d?y[G Ekt q?[zR4PT4ۘmAvGS׋V}8ti(X[E܊rG>%0l"vVm6=7{kOBγqvtjI<t>!̩yk}ݮwP|dx X[-~nQk-i|${&KvdZ&3j?DX 4D.gi-xYoTel6awzMwݽ\n?YM2WO_.@>s1va2SȎ=.s~_WnVult?rի_6w[.Qӯ~uБŪZbʬ[#?(Fs0!İ{q7<1 ] Rvإc>E7ְS GTc+s@+&l߽!]DO>jRl$D $>k \9e0P7ƿz%>R[Xν7y`:euV.&Sݍiv_UX?U|[0~wSW>o5sϞɇugc-.6\?[018hԕџLz+]h7ت٨ԑPF=Z]7֙=ʔo e#Lx?wZw19O YsyG)M^TF5`>.t8"@x4sϏȢI>eL54@n&5PwD`=л#73"ixV~3Oqm:kWk}dW1Ո#Kg'L;cw;Rs"CkC{w^F}oE.`睿s-~ÈllW6:GTh[m?$euOg$mg67nCoْ=J^X;LoO}i컟,}=#[OI /A+~L?%-qXO0ZRXK1%.\2F vç}Xƻ;q X7i[*ǰ=k C$Jڨ ?꾸qꚰ9s;7w^6IM|\Aik+o.#X׿ Neq]_7C ӻ>S]G??JcPcGoX9ӑUJu:hb?*~4|? )'N|O$Lk<ϙ_"EjLyIHp⹎{mt8 ntw=_Gor}i3^lo?7| 3}_=3khKO' GR^.H8mbXw'wy &6zu?=ߜ?qeL_k/=ѭɻ:Hn+~eSQ\KHs#hs]aկ_I͵c}Iqe˿HGvM=Y?:q%3^/O/pw .c%Alc]N`3{}oWG;5Gq}75a-߭o5b2a x&Hd5\6MӫƏcAiwmum|;5`cD4 L5w,=]uHG%>;fZΟSI&*қi3Q6vkB?Q$Eu2fy ޡ|]1 > )]Y[a pf絤L=TwMvؑRÖXq Z[FuUbŸosKO$q~[_Z:ZqDZ+5z^NL;:۹.mcZlǩ}n?s_J g? |ָ7a8 ?:yhI;HSPCAP[q$k{讓ƻ5rYKkuBO^'g~93\sXÃulq48$JoFml ?idWs^?ݱ~VGVǨ^.ѧ~O6/ ܏o|^SpMSpG*g}{T]xO6hKggP2wPȐ?n In\?8m|/P>?&6?&a*gͫetbo8.{s>F@?glO]OO65u2cT[ӕEa|x:H~B~Åq1ܗp=_7G;̐1@N5v`M?Uc(R>̺<]g22EΓλXf韲#"]UTݵ1e)DTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$p;2'޿N7"ӏ Zo y>4´7 y>4´﬷ y>4®x U}eoUw[e?O8Yoi}iDž[x ON<*7o] ]'?x7 y>4x mwf>Ly>4W}` ON<*7Z4´[fONBolky:~ܟxpbf4Zwrws-4Wz++moS?'?z(V~ԟxpRxqogƖ4Ir 3iiW^N4w<8iioſ?? &|o Ӄe4Zo24W|?? CuA%[fƐ.ۏ8]~cJW??KvQ %_aY0һ7?Wf7?4oLi]t(G71]M&p3}`Zvop5>c`Zvop?+N 71ZvWXӳ/oLV/?f iV?+N/?+Nobx1ZvWx[;7舼[;1"ocKN" +V?+N4R[fDGZvo0ӳ~[ӲDط1e"* Liiңڃ1e. H1e*%LiiCKU~iiؙTTWoՂN̶>[Hcv4vROSLiiK^$0R)ؠ!X}ӱiȣbIӱ"CcKNƝ::'m<.Ƹx]z Tii%>Ѯ E;7}Ӳ$0;,ֿ1'A5NZM;- ƑNY.͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊$~F{1䢪`|rX,٩1 R‡f[R:G+f®p%xWeqWfWeR)lfZ͊2(k.f]U]LRX.f]qWeU@b죄%0w,PlUGle\R㕊[TPœCC(dUث)leaWf8ٱVl*lUٰ+b8`CaCUX(‡e)v]qCL|xiqW So6*vV! $`F)qvlUG3 \UNn8`%Tz`l P㎦H-' 'W57S.o,k+pqVM mp)3rƕ٫]QciCyueWlUف)vceyWffJᤷJJlb1]0!پXgrVqvU1(‡ ;oFvb),u٩1\UGve;bZdpR٩]qWf8]'jVP5ʘUzde"mw­f 2w$-ژveVdVk2Xxb P^Z9xUi7vQ\UxWe]8cvfPث ]Jbʮ*켊/vl**FWfve)KRv[ ;vSRa1 r2p8vS*m*fNAbc~Ȧ* >3֕ }AZPˍqWc~,*mhidoT.c؜R튻 C b*kW?oNɩ;eqK$P\RR0v5.ƾ8شU Ct튻-V8v$rR{튻&RlPrT@8ER7-7oGr-]vlUٱWf]vO:1J<ҧs·LP5ʦ)v8`Bvl)vjbeWf] 6vl*ثb͊6*`Wf.‡f' \ u3aVWeb2*1]®ͅWf]pXٱV)vjLP1WS6*,dKo5i ]Jebff.eodC`u.PqCZlqWm [*UckL(⭌K*i+*ـ޸+]" 1'7|1])+3M.# ķ\i4UDbˮv_jWcxdCvEE{.H|4NءDoZbfn;b̴vcL]p)vYc{W *WeW*]*쯞*"qWeثu._1C_l ƳmM.8qC 5=G㊻Öv)v1bcW v]@Urw튻~ ݱWbekbliAd'baWbmRkb'pXl+-WHvQ&=+v8ƴ8d|=qC T.ƀ]0.\/I4ۡ1vٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊$~F{1䢕 ߰>y9;劂 -bk.\P쾘eUT[^*U1K;*\UqWvk1XV\UٱWe,aWeU6-CG5qV +*?Ue,y+v^6vf銶4aWSk08yVaU6u3aKp遊XsSfB [XUٰbb+CWvccNqWcvŋ[]7n8 k[آ`BӔN*21.1Wf *qi\*Q녓yU rW6Mf+aK@-4Ȱo5prl튭ʠ®ͅ6(lc(qV ]Li69![8R-͑bS|U,`(qeW ءٔad죶*v]J(Weq8m-1P21JfqKWflvX6* (J[94(Zvl!U®;^Br|i.b0ҺTƕN*WcYW [qWc+*)[8BMqW#m.+&ZҢR0- qik1ڻ+:cjaCc0ȡD(urA+ &\E7\܇lf#Ӳ|i4ŋ i]CLUF(v1]]]We Wfp+ biL*HL6ՠġثc )ٱCbc})ve4]Wcƣv5]AALUى®WeLUu]]U@튻Z*i8bk6*책]"Dr]:J+v[(48 b#1Wcyw.͵zbc\mve n{e`9lU؜Ŕ|UUm]-[*RZ%DxUV^*cmlU4\UjC㒚׶4PŁ]3mJ*i v9v5*TÿSƠ`K7*d;bbr/e.@ 1K^UJ ]=qK:'1We+0l]pһ.5ڍR)+]@uqC QߦvRG˜c)ybjrJi^ثJW*7*V(v"(Qv<1Uvƨem늻-F;(5) .H8؜Kx7j1CEK$~,KM̭yWf]vlUٱWf]S_-5RZ͊1­ e͊51WeCWead;/Wf]6)vlJ]VVkqVcfo(8Uo6*ث(v7 U] ]`VjC>8ᛦI]L jAvlPe0LV3r!ɋ`S+aNٻUIȘ4=p 쭺daƕv]v4q))\21]i[ӊ[N(vaE]rA.늻\sm-S04Jn2dsvƕm#­Z`vo͊Lo-]LkIZ!(pư\a*1Kj 5@vjCbenGJcho + 5:WclR죶E. p+S*쮙%v_l®6W}WfzbG|Uhi,vR5pһ/wƒm-;.?qCj1C"i&b;Jҟv)v_*T;|O)vdzr S1Wcv1We vhOZKb#ݒ aj7Uٔ  ;؍Ivn%6v1P:LU÷JbS;WqK]PPl.Lf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊$~F{1䢐{'=2Ġ0L*C`CUb.G5qKW;()vP銷\PfS/;6*7)o']Lʦ*1WeUDo5pƖN47;k(⭌WVbRbF;*UXSnP8qV哊*UثYU[[ͅ]N2(qSk6v^v7leb8VvQ[͊0.\PqCSf銻0].]LUj1KӳteV(b0Yu.1WإԮ*11Vc;N^)Ӷ(lf–\F4⫆Qx"PZ]NI.ƜRUqCc|)o+ \V٩T TcW]R].Ǯ L[@p&ۮn\W ZQ[ȡ qK`;▫qV(v9OE]ƜWcFvjo.c[v5\nE *i]]L]zS$cv]Ew4T`Vjf' f^W(Ui](튻2zdd.o5+]\$+Z \p!e07\h$\ثYvS1W cL],GF*LyDdf ]lpقs](vnX.#vPߦ*)vnٔvS Wf .)7jI]L턫0wm®bcKȥd PELUUDaKUن(vQ8Rq#v4 vY]+vjaWfv8+F*;bƜUኻ,*죶*|*챷\U2JεU.5$b<`0!O]TSZB0TT]s7ZbCƝ/ UD"W N7J";v&)jOlUؠ@~&] SvSqZv`d lU=qWf Qv]*  CS],AW; .e劻Pr\UC'E*L0.B*{{⠻`1K\DFǾ(vXƽqWcx;*g—bAn-be\ ]6vb).Ɗ|1WcM$Jm\Uٍ`vö)v8INJ運ƕO\)ġ]bqC)vqK ] mX[ٱWf]vlUٱWf]S_-*gΈ Z5qWeu.L*/\UZ͊6*aK U3WN*Rs`CYV— ]qWS+ [8\2*^leb­+o6k5qCyGvc\6OLUw͊+MOL|uiFur ]\ČwvP[9ur—cy P2=r[%eTC\AvlPإXi. BQ^ؕlnE[qWeȔ;pv4a)`CW 0Iur Uq|rqW i銷mL le!z! E]#&W-G W{ mgm[+Ƒ[QۮZvQ\+F®2m0+vWA\Uٍ++yG*hȲv4u4 »b0ى +c1bfҴ (٘aK UU Pw.$׊8m C0>-nv4U1Cr -N*7\UOՊueb׷Qኻ3 M]Z:m? zny%`'v8r1;(ա—fkbƎ$0]hw+-*6n 5l 1WeH*]iz`Av;6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊$~E{1䢪`|rk%[b +o0!qVW k(R*bk.vUp!`9xU8َle o1CYeWvj ;M:aWef]]\8be]L*SbW0[Xƕbc`qWbbeR†bʦ*U ]8pkZ1V\12z⫆a/o+o(beP;/];0>8ծ)v4f늻,b1WeeRثmTo, +08^`WcXb+-偊+NXœXleWl)o)l&Ɩ[qCYy;6v4$[l*[H{US\pvVpʮnWf]Aq89sSdCq8һ8oHv^8QNqc[ Biib\ q`U URQWeHjD`WW.xӒ 쪌)vQl 죁T[Wk+|*ᕊV MrIk:Wcءp%+g*r;]L]LklU)~uʐ]lK®SJ PRlUu|Pi[C \rVoZCma!vI.ƕ+KyqWe er'vVvc]A]>*]S)vQlcb`C9 'ebiɡ4銻5{`We*UʻdRH]< v9ءPbƁ$8ث^eFvQ[vlUٽWe5]qWfÊvj3 Uـ]*1WflUvfTa 쥨®(v6.ʭ 1We>;<)]6qKw.j]ar v;04'cZ1CZ8pi.IA"Uا/-G-xbc t]*zbUfis\U؜S]ȇc]FUEj0زKv4V>Ph`>U؟3$F)v?$(1Wca]Ir|qWf&pH lv( =qCzu5k]vU5iy*<0+)#)v%άzS ]NWcŠv*ƃ0+e\R1;rQ^!n`We=%ZO1қ`KPAw8ؠ>86 @ 8cTTnp5b+ˮ)v T fOAZݾyخ͊6*ثb͊6*8telygΆz匐#6:k5i\)u3i--+])vc f&UU+Uٔ↎:;R8f늷( RU[G cle UUv7vc5qCWe.8\2beb0-c) ziث4W|R1"PZp;MH­/[P\rm W,xbfm))$zC)-#l:dPSS$qWS(mnpZ6b oVo(U 0vY+d}2W1[XU*ጥrķ\iNYCydxR'vW,i[ҵ&cJ*hx0\(va\Ȕ(5)vU=WeMWeu]LUُSvc*mkJt®+\UC8FRh_v5vjv0ኻ20-Ҙ͸1WcO-Wen~ɩ)@WZ#q;}XےbƳB#cdLT;qWe0+*.NUىƃL v7v]p+ثWe\UCvnT]-*Y%vj"cvjaWf ];1l )vV*\Ucv]pbPNClRh0`Wc.ư޸Ua*IvW]CKh+̏|*0+$р]=*j v\MAPy{b"٢x@ثsT}UPU#smٹT8bEk㊻ "튻2q bh%jqWcbmy_qCE a M aWcTv&FثKF.QA\(\{ U^[P;drء.ʦ]A]v4 vQ]+6*QWcWrqWfic|VE1K\Pi]@68 *U٩7Uai0Ugv4p.ءَhRrP.]CZ]Pzbʫt=;j)v4lUE*T®ʕU qWcPWv_; -u.NvW^Gs]\ov.®_.~*Mʠ)p!mJo"ލNG犻4qFbz ]e ӮD; "<0v57]SlP짓)v7EvZU&EXִ])!@*qs\Uإ qWbjSSF=*kqN(cb" q[vfQ8FMI]+XQ‘׮DvdX(Ȫ|rNC We(4]-)ƀ*쿆؋)$T{bǐە U*&JI|Xl#طvlUٱWf]vlUq/E"(U+ѝ향0+t-eU8*l c0\r-eU8U]⭌5rInx\ k*­UqV6* c\2lcF)ib{ Ӏ́-]Lc3SnWf]L 콱WS£ e\bvX®2NSt[k\nD}yu,-F!'*&nP bT !]+Zbgl*1 Cc pZ[5pRʭ0٫Nr.\*\1lU0һ1٩(Wf ]"S+(lf\2v18P\3\*`7C`WcI(~*܁늻*t#4`>6:c]r![ ]P1WeJ]LB.*;UIK늻-EF;(.vUp٘q$cz145+_*좀U؛oLU@}.ƜU؝>$xǨWc)WvS"_+?qbc iЁ͵)(vZoWeIMI.ҠjKm v?v.00WnUb5--,*1K.*c_mLPsO\UؒQ|Y;.5܆ 20?+nC(]p+S8c2JHۮ)v1—bj쓁]Cl=boo]@{UXژxث{bJƧmc@qE;3 ] ]Fr ]!FvbU v)Pk\vW{JrD@KUOъ̑.+F*ң悸UكG>["jPm>*Z=y7vlUٱWf]vlUo?"G5RDjP$(l1K^(k(U*N)h hW}+ rإ(k(*9`byqPlUG|RjaWW*b!N)u1Jb哊*c\2Io6߮urV Uَ*n*bPo5qWS6*ثWau]  P{G xBfQ#K-H$(\64l #oaÞ9,bhcA|jh\F\HsbaHkMv•e[o, cnZb#5pu3\ii2?v'߉$ Y |O8mt*2*VI](pu2vlUXٰ`Cbc}*2) aS "A(pE0&\m+MԮ;+qKtXMCn>L8vlZ6}UݲlbrБCA\i. R=فWcX`P`;.a HKvX] Wc^%JSv`q!@}Wf;dR쪂pJWbc(ƯN]Cc{=K;tsF*OһZ"E"{m]zS劻*t\UT RaA8mb)+Ov$Z}vW:1KT(v4 v*_I];QtK+`ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊$~F{1䢪`|sL(,qWcWoqKYvc(o6zWf]\PjJێjb]v4lfbq-eMygus`Vb˦;66eS.PcH[@f ]Lծo,x`VA\Z\U٫\ vQ—W6;(V­hu1V N*9Jثٰ+i(h–l.a,△b\ReLRզ(u+MqWS0lPَ)vjbPW-WeSo+v^)fCUʦ6vcW m]`Wv]6*q+c(Um!d͍ݘkn1[ui Z',0qp+UaLUk W$F [vVmciS [usLUW~) Y\k ʥp9apR)Ɩj\ep!w,UrWS.k(~x . D-wj2-\F4]LKRJqWvCƓLRqCUu]]Uٺ͊6\\2r67lWbn81vV*]ٱWeTe]N*i)S\*}6m:@ vl k64o7\զ)us1 UGl(bv]q[u31mӊm]|p—f=1Wf]ثvojq(0Z\L!:]\Ȕ8YS c\ ]A퍤;2% ca+mـآݍٛcQAȥnjk.UM .]F*m.]E1Wc ]쾛.njP"U\qWe+. 1!aWev]i11C)v048U@t] ucITaK w"N]qWe 1v6Hn{a H8lUkv8㊻e8]1Wez*r? &9I*+\U؟NbX._.D׾vYm XT]!1 u(FI.H `eRN٥qW`րTΠP1n\V ʎWv1z:7<튻m*McQ.O*r8݊|CCu8ك PaWev1WbF?MzUq(dqWf*l*N*slUQ|*-8;Uث5(CU{Rk]/^v_MAEZ$nOf;WfS0+vMę}M0%`]vZʞU8bb}@b+96# 30]"SvfRo|P%>RL- dȡcn3K^—e148,m(v##2K%KMyWf]vlUٱWf]S_-5Rc L(vj`We[0XrWf 3bf*j△o(]Rp)vQ%o0G|Ԯ*\1WW(ePl Ɠ`N*Ra)͊(PᚸQmʩM;v]Lk7B[Y\;eZh])Lķ*G7,f\Y{t¢>fVߊ*ޤ?0Wuՙ Vh (72~_aC?]r1*rO ?RĂ)@o5|mfnfj>Qfo&D=*wئw^q~<;] ? | TD: m Tr_u4cVͲqQRV7O F1IVSBv#:^C+ĊeaPA<~X`bD8 epqk,czbWf*죊ebf';F* UT[\Uur* [ù>_%|%1([9#q?%?q.}ZVmf,7; ~i:Ky=̒fT@P=ɲT&47Y  7 ` 1l(,6N&F*zp/?ٮԃ!gQ aE-N0GW%H XLڛU+Ҕ2,s΢6vP|͵D>4hGTmĭ<|Mc5%HeQR82i9FzoOO~yv25|k: .1`Wcist$$aWcMH]jJo®"#P0ClUZlqWc$z튻 P|D]6z;pv80uuʤ94ψkҸr6;xVD;Um +L*>=1K*PH]w8j%^b.~4銻.g,:libaVٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊$~G{1d|n2iBe)j.GFNSԦe#:.Էr%dTץ'Ro-z&MOh<9DrB5^mpHԔ4$=`E>">?Ř9tq"x&tK6:8ɮZjH$\xɆX W,UwnA+9濗Bc H4;·5>1&?zqw݉1USWgn,ҹ6"1A˪u1 <7+(䀑`v>[e O>NtQ=*C| 7پw_!p| ;_՛w!~`t'ocX =3OIUF"كsД,2TR|6I7 |c+֜~,x\cX)Ex$z̰EfFD1TD @~3m+.H}-.[ r oQ*od0|G e9I5++;GqaZ16X"@C֟BU»0TƜK3%~V*/6 з_ucP? XZ]l`-Fn^3pY\IUV@r=i}0N'='$BWS:Ɠu6@L zL!.OˮDS'031Jw?< |& e<{]yVO&QU`cG+͗;#F(JV pMcX>oN-Iyw(ccP{~Ziqi3NODQdQPzx:״+ (C9RKN-Th:X94#0S6fGsY Y'pΊ'WGcJcvUƝvYt.DwrMq䈣iidDUQ7T>k!Tʆ}||k5Z?^uq$;ʯ>ryrsW`=Xd4QKe .cC5(V=KUcb4 r0e 9ڢ4Wp!QC>?kƪP;l: aW%IY[՘) v kfad  (%zɥyCEPޔP~n+@CJ7$$ 2@j-_j߲ߵo3 Q* r&RV9q̾-* L^ncF ՙ()[&Ntl`MHYFI/~ʎ6\Z%~iPiw:K-_ᖪ545>.{wX@g\@ھ~_]AmosF )恖X+/7PTׄ]r#Pe3"Y&Uq$ :V0 8׶di[5cB\H|yKǚA_^ .n1DDSo$T,JzT|,;u˭ǥZ۾*v^Ƒ\WcJR%vmnxvb+]l*aSLR쭩]}ؘ$R k%+〫Ń ]݅jG ]F`@ t]/iS.lPEƶҕ@{bbd3uLwo8\h(y;HxW{zb zqhvDT]VL&(rLg`EU.p!h5ƓyZo,Y(f-\R)8Re-fc0^yJQLVavV,Ue\*+\U|q9ćdhhw90ͺ# M1VJ2bKWf]銻*0ibqZv:xZ*L 5 MamF*Q-eqKyCUx2m@!c :_¨8 d'R62>_6?óIHs٧ |צF*f#cՊ2@\RƒC1:bv`v5FeC1^\ b!Q嗥ݓ v=$ 'c4DCǶ(v)]| .Ąto3Wbp*-]bb_ƭy|'v( Jb~aG Qlx\P^qWb.;,.ثKH . nv=[qb]@kv5Lr(߾)GC\T"6AŪ[`M;e L qCܵO`Z=xCo6*ثb͊6*ثҋEQW_ݟ:rĠiU٫5qCbo+L)vYeW ]L|UٱWeaKyxZ\UXRlP챁Z[8U lUTnʡ%f[ڙi1; \N-c%z;|z`ڇ{bF:\-{F/IM$1F(6,_)uof1t]h~:#.o"{dn'z b`qRqE;w.͊WS CQ΃f<1%mFoB&QS.d68MrWIR?25gIzt~#w'Ih~wӡc<0zr(hoQM4GQa!钼 )g}ߑۆJ?ԒbQ9#4o7eZf/Yxb7Sagd *BuU&^\QBaHy;aW\y6 vWr9pՑRhw"9L4rŪ0, ++|5+mlvyqH/ahUW2@?lpCP@ +OpJʰ|T}O6洪֛֩Z>,i$䣟+_ztE_g[|".A@ڤg?gj{'6`RQrg6$|% %D⑥n\Tq-E>|\]D /e%+_`?4B -ׂB))]?rxG~R6UkF>/s.+q7߆(;{~{P` t֐?U?@CQѪfHeC%▉i#؛i?vYy4wr=`Gj[n&);3|KjSlU؝I.S*փe^`q4We(vnD>5 km`v%@UI5!مc yW ]p!DV ].PQZƵjGb ]\1 W$r*;aWb(kAv(=(vU$C;bثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊$~F{1䢪`|pX8*i[8R U/:Xu0+cz7bԮ*jm!X.G0Ź͊6lf]K.WePebGleS ]\1W"eWf]]N*bSa\r+YG$,] qWf8Db*bʮ63WLp_|!.\Uḅvbp]#إevX]U]Vc1[®2(k,졓KcL1졓,9%c,CU—W6)Xf8B®8k ?L콞3?in+%p,|ݽ6)?=FW8 8T&>~=;CgWNcC]LA8DqV\m+.\e'lU3Z+n`bP8k50!`vo0S*vQS-8\r]u3bV*lecKNF4챊6*F(uq[b1WfWc++)\*lUR{ \)k/!]LrcW Nƕw\v-e U1UX٫?9vS6.p)BڻP1]һdIW`g4Nrv+mHčgLcmS ibQ*{fzXdY`8ơj2q>k35K!HoY̵ 6No#hё9ąҙ*ʡ!d51WeSvX]+vj`Wf]vlUٱWf]vlUٱWf®3M8.KO_o 2zI HR ň`*K>rJw*'oZ5!P)>ٯ$r2̣Sn_~W66lgb" up#VbUsit-5gKMJԟݰˊ}9%WK"5 Y3?&6"4<((:avM-]vlUٰCQb:?qO :N Ak2]CyN) MWcXPNS;In+2mR0+2Wvc!t—c?qWebGHv;BmB,zzMZݾy1]vlUٱWf]vlUo?"(HSCR͊*`KDe:͊.6]vlv_\U1Wf[͊0늻VnT* [Up9l4쏙lҧ+M)Y%Ov?Rw; H;PX CiVLJTĊ} R? )vP\*pMc N)v 7l 1L9|0-g<4NsI=k"I!^\X|K׶iK$cGzĖlm(Ǜ{qxdZbHe:r@Sd|9NncŊIjo ' Qai%h* OOs$8tpJJ%+*J'Jt0jBsT1A4l9H<_fdv*7LRϖw> b=jKEX‚A 4N#-w^,J~>+ȵ(j/@F<[ZFPy-MHс>%ו1تvTP?Ju,s|(MWj/^a?f&(K~J,rkjbN*nU5\~$L$ՌAR*j2?+WjΆHN}',lWlhOC#V Vjl9W}M +syM;U291̿Ɵcs?O3 m&r4K̥Ẃ]vlUٱWf]C^\Ep)*(q9aGD8bU,&쭺 v2+]~/]jRI1Wf {8s0N+2('Uُ={bٙ\*`޻`\UQv*'~ؚ.@*ƍŸ.OR:A㊗ej\U٣bŒ71CFW&GvlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊$~E{1`|sJ 5qP).銺 R—f[ӊsW9-ebe]b\r*c2٫Z\*ٰUvPeLUt*Q&UqVl p8SMW;/ 0])lci\)oJbyDbf8+X[ʦ*N)nW cFƑ]iWfœbe Uى]N(lf\Uَ*8bf)vQ8EVr®ʦ*qC\i])vY4]ó:|]1KG(⭌*iM8DDci Pq_|i fPlUPPU)l!Ij1mɅ7hǦ_QExa`jc_LL2S:\X#w":7/U_}Cֻ"CoT?j`qpR>KƆ(TvUT+gڈ7n ܾ%ryaCB-E*w&s36U^MtI,iӠWd2Gh$cbH;YN;B>/si8?I ʮy6\8+w'ԴP>)P5Ebsv#c)e0;ǿ|_#_L v:SZs?Vr{ܙ*V9PSxߟxo},L+?~.F )L˵D،- X@7\Ol&m\V\cZScmD'^W'if|6Zbe + HE%`j~Wп[!⥆ MeӠ`""#qw61zKVMSFfך@szZ\H@jWl&+RVOr1%%l̜8YTnNs NrW)r߶[,1n$F⃕6U~f%r?o114P#8p}a|{fo2[?yo5_nAMZ28A; 9o.c*=3g |"D Y! 4#j`LxeP/ }v/Gh J4Ogӷ|tY)PvuĤ@cׯ]G&xː)ƸS HqWbqC4n W.Lf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊$~F{1䢪`|p2ĠaKbfHvlRvc1P8R1CYk.;ƜP0+dl 㗈CXp`cvU0be-ܰqU+WvQ僊cirIl튖^*^)k(Xfo+lUk,R죊, UxX C)lf ʮ*죅[][9p!*c1V>إ(WsPP[˦(uq86^*]vQ]#62 S1.a]o3 Rs)œ*iŋ*;r(v9F)vj`CYt)usb +Vq+`█Pghl*F4zPwaM4W2+J-}v환aȇbEs&i`Q=ce =DQ]/j~.sī?.\њu\S`A9&;= 2-}1b-*;( [aVRu.0!\UxӅ[*UXWvlUٱWf.b3Wu2V*Pvf]Wf]F*ثV`pcZvlUv;S\KdfՏعNfg0/dc+ ;bs)Sd{6/H98iŷ;fIm2ZPHfxe|icvkg^g ؙSӲwr4^J09~c-#vr fvٰݡif&5I5ݘbSS8!Y;=Aͤcշt)YUOL1DvI:5gMѫw;=u1Hz/{cΣ~?ٕዩ6үU'2.1TMQ)x._8wCm3Q>͔yi8c=)daI) XruN8+/c8gXuƖc+輝Lđ[jn=F +Ͱ3F87Zq5H,}A\eMiF(vP52vf\T)8Y;'4jp)vQ5jv]L %)%J 0ҷ}$+S|+vm&H&!I.dQe9̨vnYL1f9s"?6;B b>?_؏???|ݍvN_LM5 Nqv > #~h;[(L .Q 6"b?Ȁ`CR<9cY;urA۰c͉2O{؛xf;cxUukPpal UF)]$,1Weuv0#l1QLiˎث-]N#lUOl*z(| D OC]^b4a]G]W 1qʴv1ʲuĔTPu8R\`CclU"`H8ʵpBGbeGb7Ɣ+SWeՀ"aWcM ;v.IVFv1 )M!]>.z`(v895>X i]Tm\*ԩ늻A튻,* (pت(h; C;1E]A}+)bB֣;u758CS4j^٤]@=~UU;ˏo~,UMx @ RQ N; }6+[#Y[ٱWf]vlUٱWf]S_-4;t<(ثb͊6*)v]p!U] 50+Web‡c0+Yge]b8XW ]l b:s}BRۊ\2PƵ*r[iBJ|0R/4>$ź#v>yI@E +|v#Hw c5_̭y-mi,2Id܄%H@ 'qjԽKh+sX笻٪M?C4Aٌ ՑjG+I_-?,8dYղz7VKYy""aV$}\g,IOr[#b=ԓɑ2Z}}5b$l?f~D&k9>b^IiN2iR)Cbڀ`ZYBQïnʖT눵&݈0WbS^<lj*P:v.Mw"bQTqa+ H( sL!2ik35Vv}Ԋ1I5~ N&>>xU?>̌8U}&0pbAhZm Få3TAC__y/cSm;MJ*;2i O?hWmjR,)`ZWM:G**rPmT|7?i/9qq:=j#u5]ƹ#)) "P aQB0؃2EWl^[#_Tđ_g5YG b]F!'m}8#]}j<83@Mlp<36/~ (R*Oklg昤qVGm6Ik/rq2Ӯv>Lkh$>XKboS)߻9zBP(h{L0--9ГՐÇV֞{~Pf]%Y[[F$Ih;PfrC_D] SĮ0}\B[-e$>9߆m)6c[4hU>&X9E)]#MkRԬ!'FfVmRxny?*xP\[NH(H#f SĐ0 Ҵ׽X!RIҽ\--O0 jeDc$|'vߵP KI  ; ST#Ԃ1"բ+gKdӌ(C"j>N A>O1(Z {̵K3FzPڃbd桻-AZW 1uq1(׶<؛[$ ]۱&lm.̬ױŽnAQɣ]"Eh@G_3!. 8 p= 6ז¸U[0v9N#cƸR\WcdZcM=mvRv9TQ{7]PWbrUHm_ Ib>;LUءMKъ]Pv2"(w#v.|XA߮*_ |pnVö.Lf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊$~F{1䢪`|s% ]6(vV*^k+vjaWW+/k1CqKCUf]L\sUFnv]qWW1Z' [\(va-e-7u2늻/*n .X.Q2*bjc;/)u2*ef]vnlR rV*P8ڷ(Z9KU͊+vel1K@ck2,[\Y;+vc07.;*Z,S,S8,ci3R1C{G\P:4NXj\ثYiK&M2!إۿ8) Zu)fㄧs>ʆmǦ~N.\ M @\}9.:9)#cp,6u2I-6o0ua]0/4˦ko1WTf[2m5F We[UqWS\ UAվ'7,mmr C2C3]A1K2~ڻ*vnxLu]UUqWS0lmmuj1J`Wel4i5u;Fzܼ3?L۰U6*1=v i1;H7a?}ٰ.tP=zPӨd \݋V;䶭vkAJpvUd<2?,hEU,)v[U 4+Ќ͎=p)UJ[01akظ'4 6 ʎ8]!.D;-V钑1I2L_Tv1:9 <3\El]di]C#S/ ܲ=Fʹ`{:fUk%Nkڝl.$^~mx[هmSBfrib_$sN]xKa(ay[W?eEH"cΙ6}/M nݘb~#Dp7`Ŋ?n>^K+|pE،  dqGSݘOrF.0AEw c|vd' 3ANō܍Ԋ d9Q]K#>5L[O9-QSY0.NILKIvU2 ti,#I b){f>FsRj4nYvn!4 iBO9?]]'Γ]U>/Ie̋v{&jeͨf߆R  9eV?bj+dHJPܺs9 AZg`GnNӪ;f;1v^vWK WezuJ쥋}v:beaKv5Wea jv8Unl1v9l*g)c4 |0R/®P~ثhv;`WcI4®HPixU늻) d [q] v0qM`+m,r*\ 찧 "]L(v4W`sXOk\Y;NUqbĻ#m+@7®cn]KQ-ARB'ŋwJmiٹ!fb @i<1Wbr4*;H_UDov'Nvc*C®\ 촐;*abJ8= 5# 8n ʣ;)v*) oՊ Zݾy.͊6*ثb͊6*7tbely)vs@]vV* ],`CWf]0+YT®*lUٺ`VjWo7LUnQɱ ' +C-)>Ԇ:f&r4o7g9RD6}؜WCTpS" ,kmtƖcKmsFKa/+|x$6Bl bثQ,:;W_Å"Ԭy.Π&݄i* )P~CR:q[rrƤ1$S_sk;fV(cpR3f3"G_Zs0#jU3|?kŪkJt"i^x,ǘmMT$Xz5hG<#9b>k) /%j(OaQc1X&]UE55Wo:l1-X4sK3uc/qbԭl,pIURÏl %)zz*aq:EJc@//Q!5*ٴ׏H?e&SG~AuIMA[fkI@ zcH`˚zCma a^*C/4M[GeAD֦ۊOu\6 I2ImI0xΟJ/`|_ Hey3=Kf%yRd>b2KۧWo!?h% # @Diy)vcQIOЏ7c]?[ AiVsJ ؍՜7hbE차Ff&WTLi4.M=%+?˾\F/R !n.1,Tx6M2}oEm ߧ x?c tnxeJɮCzw,F쿗!6SkHXmc,rT)0t= o,vj4JZQvHpqTG6\W@ȝywKQ@`Y g8.>F)y ;;}\!8_()+5O1kQZWZ ZܨtR|v87CΊ ZQӣe%s [uzj ipF偭p Qh{+oVzjIy9I` PR>YqtMedte$lA5X4N;V!jl<ݫZ|Rl)>8f|4vۗEDU[gO&k"zea$ 'v=gJT-S *@铣sGj@VfIET8Q/%oܩyf@iWe i2/$4Dfaځzu-A ;i8'x}C_SUHђm2g1%#K0_S+j.,FMW#ZJ@;}P j7VY23Kue$dȍ$VrNAڠ[zbY%Ҡ|kP4\^D2wa_}O +M"U.G}UKiѩcհDLmHt-q POUݲq,Wv 緶naĔ)@ [dB-CM}D` mNjE<(lb*0R^X4G|2LkqAzɩ rN e*GC;&Q0]&WژqG r=)㙎lcjm)MWexcl"XTbcm\U؛Tm߱]Mφ(vn^8QJUُƼ+J@)v.~ثĕZv0 GB:8UE~JƑFQъ*^/ S;-]41C+`ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊$~F{1䢪`|s%bqWf]2vlU]vV*ث\ nGlPثYLUlU, Uن(vc,`WcH2 Lu<0G6k11 ]1V*l*\k/U5iVKP͊͊Z8bebeW1]⭌n*Y[qWflfo/h Nle5ieVٱCfݔN63 mmn"P[˦SLDžiܳq' dZw<Z.3ps K]7RZ..;7 &\oIl|)-“.迆 I-9~ߎ\4=pWѕg>x~V].tSp>O [mZ}[#*(HH_ ^k_gܾlkP 5'܏ O8MN}#.e$v8C@C=Fv=3RN3hT E6Th.(G|>iNx]AGhʟd$9ZKx AʄhZv vQ־ٜ&GYN=tx(+ciL.K\j.FA}3ICWn<'NH7!S!'G3-=l81}gO?ia7Iֿ% C?ɲONO ״.n-ߟ.I?2]7cqn:Lz NzhG&K|z ?1N=7MmCOz7ëo|6:ر3 F=ڭ?Hvl{yo13!'^ {7cN쟧1Nz@8@(qv̐/OP_|0ߠ;\'ѓ5ý~Ӌ1;~oӟXL}ߍ:c^~Q։xzOrEވ51>s~:̇v^;\i$vG{.a;/݇;.o2a>7鉼݃w7 WcL}zKb_1'=7ȝ4pXegA|0Hc+={~;gb)c3Y5P#{w|qp1h% [(Äa)3*^;vqxv5>93ua]d#Óvy=>Fs V JfDsq/}`9rm،CTS;J8}_>Z(~uF ؋R>Y -; ߎd.وڛ.ƕT 9)aV0Z XenưCswcWaP2 ;m;݈!BkvsfȻD$5p5^0އKeC=EulwFʽnM7a]M:b]]+We0*W U]2J]v^(v[JbL**vvWmWchH ([xbfLU]S˦ثNF(v4U؝ *p&ݏvu|k^]IUqCA.G lPT8$E۞؉cJKCvȡاjPaWcZ]i\U&aC[Ov2㨦)vb[ iؙ |\ v,MkcS*+]/Kw.T `JTQqb] Wc ?@]c +(EqK1)v9הfzbVс]q. ,#=*1Ku`&(vW4;7dN*U*Mǧ߫瑜ثb͊6*ثb)F/_GBg:ZlUXRثWf]eb]vlUUثWeb˦*S+v^(vU1WeS`09 : i6B%>5ҕ{p'=N?gnpqWX2oq%+If+ +vΡL}8Q3h~O$* ;ҭVd,2M v;Ŏ " }(X_VV}Bꔙrd8norm˛KCrC^۹ߗk5YV#EW#iF;l&ne= H}Ts#,DIGޢ;mΐ܅Qԝi1RƋ_<*gNF^BFy/O8OTRmԺ].y]#df"NWٓT1%k+j=+Rp?3[k!t,h٥)X+]uMIU:3QJؗ_o-M.IB7wᗟ4+Y쀡\?rFD3=Sp~`)r}푙PwrF]}gZh,͢2?mNccr%Vvk,^|NE#EOt}J+oBU, bl!jvm7M#ö7Wך=|4PZO6t$\Ȳɺ'Z9\d5̳%SҭP5Ӯ5HG5c-ZAEvry}g3A$v?q2tY6?FښF*'R]CV (׶@2K^%TA,"Z0ysXz@ ;Ið̈́`d>-)XL9Q7syrQd^9ҭJ(߆=ʨl &j}Nu' sl@fs^B[¼oIO0a-RE{km8Y>$SUFl 7'>gk,g# f&3XTKIX #z8(Ɵ?\wUֱZWj ^By+=̓vd˚piZIVD 5٣PZHPNB5]'INsa4a ]9*# h'QR4r̐:ޕнG36TO _ڸC5wƒF( J51FU95=V^[(>ՊAUVZՅY=rQqr[EpoN aH˨'PS{!?|MEreW nc2*p\*MX.ءD]- G_UؚQw&?8bϘ״C&4P  U8#EV_?S*}h@teAVO|ʟvAUL[/1#KbGA0xrWz 1'_w.I1\c}܇t+<[<2ƥr?ݍxr)2I8zI2pݏWv__~7rT8v7p|F_ SnƛY8ָ?N+n3¶GWecznijTq=\qn6eрFeH@*/JJLA 5 ֙GŸK'hmK?bC65ԎNzƾّH2v2IЍd'L ؓڵ%̊``4c|p$Ea[w8~%7-[aqj#xUٰ%xUٰ+aWf]vlUٱWf͊6*UٱWf]vlUٱWf]6vlUٱWf͊6*ثaWf]6vlUٱWf]+v1S7i9p6cևYT6n%ؓ9Z4} 2#4Es+Le2HZv$ߡl;.Yn+che|4ڭ]){l2۶kLhv%;f>3J6v VlOeN9{Q'b0EꟖc1]mㆆ.),y.dN۳8+nX#+K;aփc]2ƻ+5{ge4 y.x` }PA-c[S@AvRD-e5 N^bPlNae H湩ؼ;X٘v, ̑*ݓيq݆ *S因"?vQtșrCN=-مxvXP~9݌kG9 LIy-hiaU2h3.ƵޙA.zz[voUr>![voYO߉.]pw'"r v W32[-غ[?~ K0)5E؛]4`(0LkTq;+2< ;=@[?2"s}kGݐ:hj=wQ3щ]%*=cq>⃋UsPɠbnv#0eQQv0eGd[@. UlR`$Wbtm]t)v3Z)®ł*hH8U*+]Jt]b 瑌ثb͊6*ثb*F/_GBg:rH51Wf*Uٰ!ن* ®]*b͊6)vV** R3bOI_3|3K#m^=h31*wX,C`f2\qW ! 2lLvŊA*hv`q5qk.yiP:vB]#HdsEPI'/.ͅk$D ܽ6j9l7Cϭ<"&Wy)f'`Q ,:qrv_s&<1meL-ӕ*GSl7h.㴐cVr ӓiW! CzAB;S9C+MZZpҒ\>Wg21a3銣K̎*ǿO%?2zRğ}OR)RֵwooN?JB/^XM36U{4Jś| \ѩߓ}\Hqb?Kěٖ46n%a_e^_,ɥ?QM@[5t{_줡CC{/!wb(zz^uyg r-Bi,?P.Iz'(N 7vZ*'MYkfNhKny/??jt ԪbU#9VzN%QnLһy_oqǏA#*6I/Kˍrzo1`+NIV"H?OX0/z)uvџmQܤ1V޿l|\G%D)>1Fmk'Ce~[-~l41ۭ2{b}AQ݆zf2s̷+ 4E R+Uez;˛ J$HOH6%0>]xr*&B~OcG>i(A26gxِ>$b['6`*a75@Iڅפ*G:t%u4) A|@\_0 Ve;QlnѱMm§"@Ò&\ՠ[VTk0rC-!յ^Nbp{/nZhd` JX(F 'ƸFGPrDykU63?fB=ՀKSa- /E ;.ݲ1^V#* SJ=%-5cDz>IqC k#e.A}*<Z)uO?G mb!`raП8pWEVd3c֟ۄ.6h*nAzo!!{-~5*{-Vͽ7)? nHZPAsW#66-S:څ%>6t-f=H΃u(z~ h>\Fڬr%slte5"7 c+]7K_(嶅ria]#D6Pr+G)Hڼx7vLGmՏ_?v vP߯Do벒xlπ N1F۰jɡy lS>)!ICj04Z7^fP)M?l34f8Rn@eaRYӢlw@':z7E>yʕ$;@Ӆ>l'Y, Sƿ.>IFXN#`%ZZ sy7XLS08\*f]Lث;.*ثb͊6)vj]LPQ­beqKLU٩+,b]vUp`WfZn8#o(aKC vlRv*UXqN*UXyVP]LW Ҹn!7]E2?A0(ljBpͱΫC"cYs?3y);*T-*bcn®͍+o]6*UٱWf®͊/ 6*ثb͊6*ثbbi@2aHQ; ҉\ɇ$cL%5˃0a~L1e1+f6d36&ų$Flr`t -_a-Z`9*6;1gcc)U+k8(؁>Q6GL%[+=4z >qðu.ͅ]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vQ`>@^gi2k&_5y.ˎ@G`D&v `G\05H +l aff}N0uVwb[q\qZH9d)Tg]3Zb(f)n`,BӰJ.kyEPivj٩%b#eqv*Ǩ̈ b|;O ]@<Ϋta{9lJ{U|Bv>)7]y)v I3;$Ki؍E@nًN"܏8ڻZ9f~u9g v޹liNjH;adKB8.u;&2<읈 \ ;sRn]-DZ̭9L]'*ٳqzQ|`Pqv"ivP®vX/43`AD]n#a>jȻxf`iq˱[b͊6vl ͊6*r:m B_:7lHf.],2s AvfXLgJ,Nx梚iL P@l v=MqC\Uf1K UK‡b5z`Weu(-ث o]@:bbMZ"v4{K4K8;w]"m(r; PqQe7찴޿F"PY*TPN'vي2LP;WcW'~8([˙hޘ;h2hvS.̅NL%ъ-|U5;΃| @*F*I be v35㊻]v5‰81=+E C*2Ļ _Y}P UN)v; *"}0+(ؐEMzb}Wbu*In"О1 xs.<MG#$0*(?:E$_Htt|s$b{WflgoRWS,jI_~܎JwAT ?נ~ss3K?T 9 >) OR*)Uk;ѐǧ㙽"[^:Jb ԡݨ~{p..^ޛU̼w͗ͤGl%y[ (#VPx>,Z4On!әZ(G /QOh7٠%w/V}H^0y jé>NRpg-kG(Y=SMsY(TR4.R-W[ZdxO-[05fh( d) Nro9jZ̖!T9ܙ8^_ixs@2].CZzmJ=ݦrzMpA.D&7M&!?W=X<!pOBE՘q6|'V'22MLh]M q_1.OlUg]XmE&T!Ֆ!;遼:g_?٦U"?mADM8'kVcr {m H[i{vZH.o ( ?g1c*U,p$Zܰݷ2~W}5oa倮^0SZb(~ TD6Hlk-M)IPi ݃X^xVLd# i$R1U")0*Чv/ՙS$L2iKGV;d^/ lGZ[6"$r ]sjV?S`6JUONmLUn^(v4֢Kb5 E‚ƁYGu_%_NT|#:Lz&*zR2a؎=>X{uy}2h }=᱌HlᄯBT3p5G(v5 '=,ULS`Wc@֘UىmWcvWc8Ozbeҧ(vi_^855])I>]mCuWAb]X¢m]";1^_a)v#v) d 0vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊$^G{1␡yG'bPCb͊0]Vbf)vlUٱCb͊6v41V S08)o6*ثbxU]UXUٱK(vW|RP ˦)vV*Zb͊]8ٱWekQ8نo5qW *^v4Kc+*~-qWet­"B3bu:HQz3i0q㠋. \8BvlԊܑ40t߮h Qo+:`CJoAM؄VEG8c 㕊ZC$@' v:D-K&11.n#x䁁v&TeLiC;/]B x3(ޣ7xv~#f{kv"bD *hvlUٱWf]vlUٱWf]vlUٱWf]FN!14ʷ#^eQx ?r򁉢᝶v^®eli]$ 3lEqWfV]WeTzWe Ӯv51WcydWch]:bZ1CȪ`Wbbژ2v. ";b7beŠv5CnqWfa.]{ DJ%NZv&#RKڬhgvU v6D+%{Sa.#Wǭ; ۜv8($aMK̀' ]bqWe)]׹)v' 7®[|T4Wc,]hF!JLRƕpQ"хF(vPJeU+Ɣ|Uتkv$cb*q<;PyH+N8BLKG# ]vlUٱWf]vO:1J<9ЎZ(vlUٱWeWvlUxWef.͊6*ثb͊6*ثbʮ*f*]L®鎍y0^e٧MiBv 5(R.%T=@lvZ' HO~x6)Ŀ<;d+mrռ^;5pOI-P+\NO,FݣET&W֛#!y1P$)\b\LfJ$.|27U0mrIOKӍSNaZߐ_[,@`w%Vsm 8bGx)"z  `"麍ʤp@[,GċϓsIuy!_mE  v@5C|C.J/|cs_Tz?i5&*,\*SjIr!jm B9*ҡG캊UG~l$GC}*n=Yajqtn|q"Yh}~fӉ 2bIU%MJ?dOΚy~P0@gq֗vH =B2 fVŏ#Z]p_H T<4̭.DV; 򍍮u<@<.mu3 $^M)"57v:}ewwv兛@w0on1[+|+%o[#ZHJܫҔ^J+f^1?R5crh!WG~W&m,$zǯtKwAI&kkM/ KrJs銪i[݁$Mޕs廉L \9|?msm"8dy2D$ޣ?}3E?ufCa󅊟7Cˆ>)&CPv"kAcӋ_1nֿ p˦HY-c+ӴT*л]86HtEK:,Hf a[Ҕ*-͹~Csgl-o\Hr&c~# ɎIÔ3R9kϋO㝴6:I"JPt:8[ EPoر{YzF#s:mԢ܂#(?7,qOJt]mXTҟAVa圱2-h&??fy-ym*,* 8Y3̷H+EQoYr8;V|TGf}z;߱}$|q}pTгp&)bgR)qE&.$GZ|22pT/+^`} os:9#x$^eLk*JcBQQK!EuRZE7sVO(Z?\%:>Yk,ZyܷKڝF@<PxfxBYj-T&58#-|G"X,5PGA^n!ᾬac I#5X:ZU(z8/G0'^Fx{)]$roQ.-ketRŨ"Ty*MM$?mg8fjӾm-,X\uraXmkURGqP?doy7>ZQur%c? mtL{D |Ʉhn}eGspd Pc4 _s5:DKmj&Zp!U y0<92C4↵H|m_7-t5.o0DŽCӉx*3%-}ǁT*6kbeKʼVS+Ap|(x}Uz<۽XrL+v!M:oH`[Y:)HlaNJK_g@tY&\k]Ox#UtZ8p:1WbN݁F)vXޤxbe ucVqC 8 "F 6m]-(v3}]|>xـmөbc<;D#p+]ǥ}Wbl)cdhăWdw+`ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊$^G{1␡yG&bPxb͊vlUن*2WS*;/vlUٱWfe*ͅ[p+U‡uqd^(vVv^*UC*qWeaKWf];+6(vl ^*P®9dbk*4q.b+]\N e)[9\^*ثx\U}p+y–`CYGpƶġMqI`WpV16bnm͛Q8bΫ̮\c'`jd6;51 ]#.͊6vlUٱWf͊6*ثb]/ 6*ثb́.S ]j? h@\cgd'+"͡-V ZVYl` #Zp0W(^~*Q ]\'~I `fE3k غ[ev;1Avlbq;;C#ד\LL0fX b1 P-&8cafCTEXՁ59`tcJ5\{+ cXZ#iEŐ1v3 fٰb͊+/vQ]0b͊+6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWeW`7C6 mKƪِv.W/6̜8(vi8%8T۩'@B6xpȵbT(bb̬0lq8 AB3g]:Uaqln[1f+Li4i)vP86r]wa%2%*_9;()pF,iپX6F<9%M.HI]F[r\4Ns`We4r`^! ( |aٺ!X d";%VX9ێ쬂 6!]6rN-fM4\v,Tf]NlUvQ\3R`CHJاm!=$Nm> !/MY Gd-YӮh.͑ UYv-o3SfN!b"o^#9Hkv5vbtJ)em77.M)\&.TA؍3ӲӲ-;Z#34 v q\FnS3Q=Dv7SM;D@zfM %;2[`VnLLlb2nN(|ZdG+`6*ثb͊6*ثb͊6*ث`"jMFA`Lqf0q1͎Xط``pݏO~ڻ^C"&M|RuqWc\7 v]!AR]j07=(v:0WcRCV튻CWbjqWe܊KUEw]ʪIȡfm]+L!]݊1^v5=?d;f?h'b$cSLX,MFزvYW^Puy C;bVHzRP?%vbP`Fwl0%l( ulP ˶vT]G-1WbjZ5%vWYy!]Ӊ{bG'!jRꆏv+Z~(voQTzWvo)Ƕ*d(T/C.y,PL 1~Rc@7?/<mYA4h+}CU kwERF[9o\*B I _\!xYl3aP_gD|i|7_J^GEo_',3>cHb֦Ӻ=H?y~ B\*хU}9ǩM`ܠ{WZ/|} ?{*+%?*]$:6FT·\|-Cg#ɖS;"H;WWOqz` 0:6CL&xއ>io_/gXx??%6u=v{Gou[/[c4Qf?fYiMmÐ5ydQ&Hۿ5YL# _-DYW­b"2v+C6{όZ{ᎉf VIAMFv]S17FOj_8qoVsl.Is](𓲱 PMϾE5+so3!s>Q$`hIrd u=Iǩ`x9*Tbm/BDnET'sAl(*(ǐ'HrTFT P}xV=3$7$(N$:rJ rFaJVU+,yl;djIQװ̸ MaA'sO@OjKj ndIm;R$)*WJFEv4Tke؇47hw|='!&W;O6rHC"_ r͎aY\hcN /kA UqU|RVƁ9cjkBJh=YK*:|#(O甖h߫FQ&bʔ8S A5j'uCx!7G\UNǥ> vQZWe m%]dl J1Wbf":K|PpN?)S*K6S|!!_$dnr%5—f8]'%XPUٱWf]`Wf]vlUٱWe4찘Yp7 Q1^f7 N ]MCv+\pYb=;abCF[-җ^-ulǚm [2Ğ_J-pv$1>-;(C_<&]%3 b#^ٹxĻ#"Do ]%9ɗ}-$q2?(v U3>"m;dE\[f@/CY#IGvLq(Uv^>?oɆSTزvlPثSvlUٱWe.LVF;6vl ءٰb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊jH+yTٌ0W694rBڝ r)vu<|1V@Se@Ze="N +0!!mn<`!)͌Av ˲r$.8 cqYX-hna|Em%L32T؃& A"vS3M3bثS 1 )d1#,>i'7#-nNfVVIx6Afe`Kb-kS6Ѐov(^eӍ].ybݦA1ݎ 'f-]q:0E؇cL`SHvbXFʹ*Ӳ銻/0HHVqe!,֕S6fȱMLC(E;jivjbT,BDI4-f (9x@@Hυ.bHߑ'v. wNl|%cȅ#A ;G l [@.N5k=Ѿ$`65~Ͱ ɵ؎RxUٱWf]vlUٱWf]vlUٱWf]vl VN-C~Xv"GsQ:vGUÙ4EE+0ݗQ َؚ]] zUٖ>5vm)v1c# -qKq*챰b4;/6]Jt.RC|ڤ1WcWbzCܝ%C l)v0P41Wfi ao\UWҌWsC}0Jrޛe9{ǖ(vW.] U:aWc9Z W2鍨78 PcхI](}* ~]Ư`WeJ bjw<8Uزb찔`K9ƌ%bbA#v4BM:bbTt]/X5nqWeBdB(.0eO2Xvw+`lUٱWf]vlUٱWa/d!N-J6*Ux*ثWf],b͊+v^*UٱWf]p8R-ثG6*P'؁s,:6[q!;`C1]7zaqGt",E.nЌgWMpSw,iLUقb'(lU# ]*fS1?>ߨو~,⼺,R"oo6IWحrH!vyp0LoBeZ7YM~êܣdlx5XF[K=3p=lXCɀ.߃-ۋ fd5cQy>̊џSQOXj'ՂZ~< (]B3!ȃ$0 WTuۖǸ^~3ȼc\/T++M2 Hv؞?ʫ6o— ޲ Ҽi䵧!'c\P$}<'PMYcWM\S4 gZLJi$n6*?qbi^B iB{fN F;q;8rVxpVGVrW"*Oo QDv5sXzEii~dyg(BRtqj_6oPK"&I-CK |eX֭4xM MO^ŊYMD+lqc{ &4hE,dcc7~ͦ=0bYm&IH \{5 { koƼO'gs>b& V`:ҽ?6k*vs;I=aO##Wǒpi@GxAyy99aO?ֵsb.H ѽ=#WlZ3w/ hRN(&rϖI%fUJ򋌟t 0ך.&|4|>l2Gd-FE ޝ~ͫ_ xixr<~sb1>_npv;T#q_$1x8I~;kFjK]k\jFQ)Zh8n ϏÙW?,m{ /Ĕ#A/_e^X#CJ8BTvbEea< N(|>rˍG#(꣆2 9Y?[anZ!|"2)'G +CҠmSU}_kgxFVV9Ѓ# T?׋15LܚSdԇ%N;[ۮ AR| zu핁j@ͻ0ھ pvzEQ3s(y/`}N~NZ&+3/* %SW\n iJQG.%TkY`"JV;▲-B UEOW0M*Y'jOw%6 g!)Օ۩#6ya~o-9[jPw>=ͳP6UՠӕB@j#y*v<ы}-`B&DH^T;X1/ĒBVzUI)PK#epiwƙ-kCԠ??TC,#q"($1ެ6f p_QL|j^j|[[ɚAOgpmJIC$E{\Brz(˪kND40#H- rǗ㼎խG!JP3TSLob}6ip?~IYJ&;-E(ϫJT\R*FƵ7b'b9 ]]rA.`*Pml(vS b|')vG2͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊$^G{1␡yG'bPWf]vV*ءxb1KW"f8R]bfxR e1­ ®8 Ux*إٰ!ن;,RL ®́]vj\Pإ+S\*2]LR®ʦ)nLX[.8UٱWf­]bF2w퀋"O 5n"uL|1s d|/Hv![ $/ N ad SR ;66(v0Ke`CaCaWfʦ*Uxٰ%٩.|pi ECz iٽ-;7\iiٌcKNƈza^dF =*y9'hPCh!U?FcJ<Jሕo+&o(F{nHv&pZ͙Z|b! xwf;'fb.(!R٬vR}|Aށf̙DNVB@10vUujc8n jH#Ddm] 6*b͊\C u2Lݛbl2,v`1E;,Ӳ!`cN] 6*ثb͊6*ثb͊6*ثb͊6*ثbu>d,81)7KNˍِK)dv%5os[c5dO*z0fś+- ;f{VI]a3Ć젆ȈӰ%Ds{#r`)ة2 (&#s޹b{f0l'J)_$e iM;L[[w61`ųS1nvUrĻ <3_IebOlF~K]ٿx }M`쿩92CK/$fw c3֑Z5*8F 6l찪z!4-QyS#=,HSO?le'Mfv$+!$~eI)ȷJISuE5i~m$1ۯ&z5S9qw-3r Pf/Zo7霮m{et|.YxބXyb#h#AFb}Oj$(|1_?"Vm!Qn 'ǏMSRt k􅮨N»K~lpa"-"yh}Hث">M9B]{F)%I9OGc~_m0'T{iz6G[42$JivϛM!E!#|'܏yc6WAY9/,Q[o(%OT&sZmǍ >te4_bg$z37#Rt~q\g.#1qN>GnH{2AGă-]M''~ɨpC3}E63 @I.HE^m֝JSît*7hYzOึ 9dڔ'ډ/<_Bm! JW`xY`3gM@\)W;>Z,V^#\C!$ZRooi0V$ަcksRbrjl~Ӎ?єtua~F=c^-Հp,aM_$$ǖloo@y%ES6`^#)gOi>eP_1R 1J A!q qy uCz|͎R[X+;}i f%kIkjYH55EE-M<|2%;${U>ٰS,At?slUT) ~tQ}%_8>~'Soy^8J5 &Ppd%7\2ѯ !7$l* SF\ T铛a%sՇoț(c1H^^]'c9nIͬcB-bı2Ά1SZRk:뉉l)ZS&:sYr!FjFkH۫g-: q$xf,5E{Ua֍igjr`7Zz~\!]K9J#_޻R{} †6(hFDm:eECK4v<@%: 38aRf(gTv6H-- 74lѐ/J.wm*|ȺNVE 'W5ڀ/)nby3Zh)8ea()KL'v*#'Z X.n$|u83,w-4P*,hOQ l&jiCZh'LxJal錐U|lS| $>녒&)}]0p}UAf9&v8k>A61FyėӶ#1$Zpt:m獡bӊ qWf"Gp%0+=aC.+0+I-Ov(T)o\12A%"!* pĤE+%Nddn`~=MZ bFnvq659YĮ  v42*C5#af(0vhh݃@S[M1qa<ؘiʽp[smniظ_e0&ݙ$ (٥d4;`LǕ!;F=B{cr)-ۏߖTSNƴRba.,8KFyekZt4a={wcBO>8]F_`2v%q=1A$ 5gE`6m U`kÎCag; v SL ];Ef"^20 u?vr27't咏rHv"WS;G:ӱ<#ء@A1$(=޴sBW2Ov1^+8cՍ;bPv1ZvWcZ%?N*`EH1C9"cni# `C!dJ.r;1U]P1Wf})v5j5‡bE+!؁Hmƈ,Uؑu'1K+ LRsOv3ċB|XU8zaKX"ǁM1WeTfj44n-۶)v8M~j'i4# b͊6*ثb͊ [%i w?ݜC.deb]vlUXٺaWfeͅ]v^\ح7\*l 죅. nT.U1WW51Cu˦*qaU b1rsu5%Lxfvb'%JSTVj3*W!xOzۏ ThպNAx،ƐvqB]܋m #c#sLJg֝ B{YtT=I<g_/86>^Qq,M n/%t&oi㭪TQRASr/+Ãdj?)g1 J][ 7~ΰ,^DISR8*_z7ˉ躤z~KDYy/CUٗ\9qتdw#Wr3.>(LÊ(/Oڇf~D@z/jP66Wv'o?ߟe.;uޅh*Ÿbf$V){pkP+p_lP@?0.V 7'0 ŕ'#?盝?颖QxLrAto쑿vͩ;`Ң:oUOt9vl/?GPK13vRG";OXk}eircӪڈ; x/q!8d鐁OO ڎ{0oX[qc$jhz}?ϑ^^]`bJҽhUov_ kgQ4~%4o]iOꬑ9*_+: S""m| :QG5ΫgeK ,q(Ptvs26P&ibS0@Pz*{|bMCbC !} _ܱqU^b3 MڭųXm7HQ(,)CIu*$H:EP~m"4{TԔ9^j;)6C? >.L^}.ec\>4ȼG'Ƶ _L[]XlG*{fW^Jk֒r&'OyEI(2HƋP{AMr*a.c< ݺ9]їRKq$qoi|<+}7;4 :ZMjίzas,ll~s%agLx)/.D.xܫ)?Z;gYܖbYJ䄊/ʲWSB=R̭iŅ%ߘК3WZz;r|?c5g(,cV-BVKk9.k@ʤ->W3}ͤǶdȭ;_*m_y"g4wOU,kYNrWw6!HUaQ[j}rdXc!4JrEjZG(+K~/=hAA"J@-G'Xc5]4y-=Itb!Hw|?liNMҭ0 D9)'_9m#RԜ\L6$$ߗ%o6 {c5IDyvJb]쉰 ]Omrp(UJs1ɋeծʡ8lMdU j+O`/LӀB[bOZisM FT'3e9!Ŗ0j<~ňRkardR+W҄޴H=EjT[{yѮ&=zu;--^{ CCM[!_\,W\%q]xw\䶸%n3@BS+RI^YZr2rU-WSTEu*pr^z^BRSTcB mG h ޞ,/ [I#egűJ;G2ـ}+No.*X5}dF]}Z"O@6H[xY*%UQf wBORmѯ O%z_6=EAI"&JӘ4BY6ʥ'e4‡&z9 #4ƛxV f*C?%G M俦A7͗*Мj6n%MGј¦ROh6lb"$PSkYrf2d⒮.>"]2#h;3g.jm0BXoNHl-Z J۶dpi?3뗲!+VU4=GfK]>Ɩ>uv*RErlUV;lIiocL)bKuty3?.J-wdo\ʼM2LLk$o OkH_ZxaLap>;vQאG,DZq\q$|tU1Wer#*xeWva|p늻cʘPL-Zo, MM\UƄS  !qWcZJoL v\㊻+N1+EMA] Uٛ•]6F*]vU퇤Vdw ٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊$^G{1␡yG'bPWf]vlUٱWf]vlUU]WeU`b-f(urV)vVv^(vY.ٱCWcqWeUxbG6*\U*^kp9t]m٫]qWS*Uv)vP8G3Umptk,b˭1WS* rf'M&0OB˕",֤hIms(bHb#­n]|{pil1;.ӱkc 4좸)좸NʦSS Ӳšvjbvjbv]1Zvjb8SN.;rl݂#BN,KR. ]v7q+L6 qc7TJ'9/ً f.˱ R)L\Nixx-[l#\ـV9b6*ᅗ؁+C.\7G2H%Fyž+d嚹$ H hN5%/݌=2Ev@Z|`A"#,Webf8b,DGNN؉%h=zOݎ5aF0I<[~#Q`@gm85<.sXCc09] G·&e.- BCL7ebfӲi\qSSN+\iiٌx8])ҴƝ.Si٩]ٰٱWf]LRX6*ثb?N_S6:Hx' ng9Dėbi0bI8B3U=lpN샰rӮflRsAj i94Y-v8ᅸ䢇n0 ӏV'Iv#lӝaeI0Mr\E.ƾ╦,x\s4#Sj`wΝ,ԍ:y1.|MQ4ӕk!йh`r\q<["T6)bԫ1ӑ+cT+gcvT,#E5,3bfC15>qe}nAϿGD;n e,>FCdӰH 嚼3_2SI(N9]n%˽63="fX`8پ#&2w-ve سv4/ҳJn.TQ+ \#y+$>)U~ra(m/BۊEzGdr?1@AهA[ Rh-qM5P 3()8V&mQVC2Ū@\Dz#'`~\uUF朣_ߗTs_H)5!$7*G'<J9hnt~<˴W. $J}FK|OЀ8 j>Y{$$7`NH㶔ZQO* "FA,ߡݐO,/%A5f#fZ/lk q$?j{/,! -k?#^&f2Job>t0Vr2H??R=iF :TeB`Q)є 'r C>0^]4;62FmR)&e̖K}=GU9 'ZL|mM6/$=+HK{jjԪ-_<ɖAoJgy9{9b1{c+ N]Z wg_q~.?icUgMe_Aru?O|z5R'%QFVj :b".C><)#0 @eP}fe VurӚORkk4&,ecĥ9UJDoSؤ__jߕQ D A>ҹ$80E\Ƥr=OoW%rJ"d5,{2Mae,(rj3R*sO>60 ~~?HdN,O+UȭFۣ\C˿x#Q*sj o_k-exA)Wi-i%@JE?96- ."S*36`b,IϮQ[[53]NJvc81?Att~ywgG,21 ̀)Vo2ӂ4>]bAR:ehєTH$Q y% :oE7 |W}1Cv̈́#),m@ՙ13 ?ƙcOEO6EIo1ۭ+8|[%X jf\J[CzU#%BBкK9ֈv;H]v*w+ɀ hۧ4?jsZCF R 'qʱHҠhe3oI8j7'2|*jÖz#T5lhN_jpTD#f4X?9TCˤE2QC/ZԵ[@%? {q%Yab.LnvvDfī9EHd l*Pl+j ?mG8MF ICPҧ,BGV(wߦy)d*WLnPW#|ro)7+1caޓYAB)L˄Aisdܔ7׿/2W:k lCw\%d 29Via:yoJZ ?)E6Fp]5Y$I)btPIa@gcu*+N-#{rBb$1=?]rMf]B壆קZ-Uϕ/ ćPwfO9$$.#ԏt[kuY)BM: 0̹* Fj72Jc!-_MB7fKrMBuu5HW vƐo9^+M:8šVM3np vj^]]nkvR8H8-ޔ p%|(v0)وv=xLRezqK;3> nѽ'Wds+bثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊$^G{1␡yG'bPWf]vlUٱWf]vlUXSva6*v*ثYVثaWf]]vm 6(vjWfثWf]RK[Lvc5qWf.͊5p]Lbe6*qVqCus*qW ' eb:%~8L7shu;Z䞪 >( &v̆LTl1P\RlUز;*~!۳—b8Ӂ##Hv4PإٱWfPq®ͅ.ǨIv ,Sn ߍvQE˦*kv6aKM_B)M7:XpG|6XKfݏL>etif@HkH=D%VqWf\POZ| qkɉ\0XDl7RGLivfa@Ooו{5krC<(;rv*mO}9Q*\[;VVk"oy*KaW`{Ũ0u1kvfyNp͞<`[@v,6fC7f]8$R $VAa`>`8MlO'`K]jhX#5ҁHv'*EӱC䙻5p,6(vQـv`i]Li.*0R)],Hvhǎ!+CdXآ8]]A$;*vl *c/ ;fN' F|0%'4җv9)v+;Y#mfF 'i =3kFbwZw=Lk v8ǮD=K~@89Zf0h`c5T91b+K8!CE#fMk-ؼЊf's7am5y`K,m.˅09"6ͦvns;)MrTps]cE湃b#' `zc=slv< 햍KP-He F,k,2.9v4 aC"C7[\cKobIro˘K%{Z\Q/#4t]#"ʦ CSr#Al@vP·1Ae2bv |F$kvU+E;(ǂ[Qrš?dɂ&ݗ"pnC!)ebr Yjt8pRP3,iv1JcJx5һ(Wf0G#Wbu Iv)CZE6q'8We":i P8o\ jjUrnzbĄG K ={b<@vbԥ7JLyT*xn"@j‡v9*튻)@z1#*Ect;צ)v*.؄d?dY;#Ԏ(v)Sv]Gn1WeNt]cثbe|VƴWbr(v5֜[v)SP/=1WbktH 4Wcµ/*Nvnbؗ%!(v+6v.ʌcdJwM:HN*kTv5.FkbZ=yطvlUٱWf]vlUo?"(HSB9jP9XRPRثb͊. PrWثY`b͊6*ثSusbW6(vjbW0\USjti*q]\|c=%14{`$tmӘ]%bQ^}#iVM Z6F\ 4Ezm:25%ךE]=˵*([bIf˦) IUbf4IM`x.=(dmӆ9]ZPm[0V4e.I(Ԧ[bH,6;VK!#-ZTakc>kric=ǣ_ORQYA4XyNFYd&((M?i[F1qe 4YhwVqD`lKb#S K/'}?_l? 0 $JO-O HP+E$3[I|F0D:9({a{ߋOn_f폄K+rvB"QU7LHZBjʭc~~؇68Q&~?%> r 曏)1_-yk!I=?ߕx`Ϧ7ˋ!nu3~ v[|+Wajmp[h讍ƻJ}ۯRhm"D;*i V H2}509a@"l T1<ծm^XQ͗b'Ҫ|3I 0hK@iYP ~q >OS5?F`s<__?UGFè h;{rd˞P[8wP85i(>`mI 65CՀa>-kـR rv^ek?daCԔL\ف!ІOgX;*Ԝgd1hIEhSV*ξ.Ѱ$HhO"ٲł>Ny̫+ piRI^L[^_/'*")n!! cOɕv`PfdBHof!ǩ9˦ڬ3S FY tW lcLkmM>T?m01iGNMĞ )MwD,zM\IλS>/vٺ8Pɖmohc^{y+NӒ/ZQsvğ'_>s&KC֮Y9҄f>Ns rxw?8X2H_fV-hRӦs?SXR٨ߒU4ˎx) ~>E\Z,,4/l]4 R$1eW 7ˇ%[ sBG -m?>{kGgRmNAD_~?k9I,mЄԌWo/aaOIT#lO_sY,2>LRk.x7ً4vsV ֠Ӫ'!BO?%5(wk9f\j"e "( 9Uy|l:1gp^kQYY5ڀq΃* A%x} fZc҂m{,4r9, 8"qM?oi]*Zy'c8 "XTIJ?N[Dӄ/Vj\iJ{"]4efBeg+qg7"6'Zeg hTnkEHékl² 5)}9|?s OؤӴh>gg!F ,C/FSЏ )TnJ=M#У%EC|L :f `[rp)QSZrYTAef*!eӪFLf&]XJJRLv ͼh`~"mݱnlmY5=~c!ULj[/X¬U]0X;Nޒhvڽ 5Y Ŏ]TEŜ[;?g N\.ykRKIʥv6J_Yea癯$݌%4 PxNFB$l%*yv[}kW(PQS(P zV ֒mBE<Ӓ$S{NZLrEUa ڙ&/.1{tHV>W9pRǪ){S~o'z7lF$;[tc#rNBd9"3*0bcw9TB+*GAJ8!I+x|?la͌<Ҽ0h:J/6"Нpzc aLV:4_<1t&nqJ؛\Wda(.*1dUWN+ZDԝJo =1.58j^T(z%RC@=#qI f\y:LLvIكMqWS3|[1®Ͱޕ]kWbewۯ)vjLP`wߦ)v0ji\ zF8U7ebƮrIq]J늸ebek)v8-N%KkNp!OKEr.͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊$^G{1␡yG'bPWf]vlUٱWf]vlUٱWeb1We\U٫50+\UGvl*ث`Wf*];1], U a\l!.V*>ث`Wf8/vlUG ]vjf;F*O\ qWf8WcVnXUi]J(#l Vڤ WFbƿ~t}# vĻnLB,aKE`.L  ]00 +f# 7ci]Sv`]v; ]I]Ļj/B2%JL p]8®+Ld` 8vl:jAi\,#__4b] s`VW`++'!b1+ rBጆа2ÿ0Uݺfp $*kO4۰ͻZf6 ωqv0v8QS楸'A;'#'}[I;GWs*3݌e9؃#n(Yv tKl]vQd1PWƹ9<9n:4^-!20d&݂C 6PM;<E;KleЂ6xghMib0;<.IJ.adث!&NPUcvlUt—eS($"Ѓ~I`(vWi(a.ǠL]ȇcxƝeq,ijX6NӸgf/9v"3v=ZSnǫKUmHv[753CI,m=bbh%0!آɁTRlbḦ́K !rֽaab% { 7ȫ P&G YSlٜ ?I#Xتvц(v[CZbŕ{bce0#vhM;AACLWb lzbqWfd$ԟc&1-7oGr [͊6*ثb͊6*7tbely)vse@1®͊6*챊/bW/k6(v^)vlUٱWf]LRf]F*brZ'LUmrZ'/5/)w,0EL}e#{|i&7#38q#$ C\/ iR72"vuG ؤ4*I1W Քr1!1Z8oֿ: mGmS,L@턷:; 0 86BڤNAڬkCFO9X" \ۡ DS&={O<(;Qk~WS'P}}]s?n#~\C/6I55N<ב\^~jt.Q7dv-S !G@ca?ͳ2f}_\=@oX?!Zǜ.[hPG,Ď?]WW>9N-0,4m M#nZ"p8>̓T\%o/Njr?S8NVżMi@%\UVxtB hX|NmxgxHPBiwiיdZj-6ˏfRVY+C[-G.kG'.Ѵ"JѶjI5$r(b?9Nl:,:ĠyH2¿[6/+$2Qx:+E&:DadbxTu<f5R 7Mk#nISԓYZVwfjPx_7gƼ!?>Dkڅ1'uz=|y|?g&XP YQ7hHkb.B5{ m:@aPz~1Nm17Բ;.(ǭ6UkB0MS6Y?oz6a/JPgM(~ҽ1ޑ2?KXec$/ӧMn(A *Y$f\ e_2J/L8h 5>,2oOX n*y,n :i~?3$o?RV+P9 {`{w57Srg\5#/nDd9"aB\w;O2SchnjJZ)9+Z^_nHj' UpUԆ FDoV#:8:՛$|?N_?.Le-[ ]>/򳪬ǕG޻f/&M? s xߒӦHD>pqoV4Fڃ0D׏a_^u#k)A}<^RR@qz IJG8 dEx?_&Qn~?8?04tzW* #+v l2RqrUAӧOyWH.'_3cm*^ki0鐎OI$)e#2jw!*5QsLh|(̃SXEJÿp[Do6=8)y/PSm˚Q&=͒, |0NI1 "e8"#WX_*uL#_T'XYOm),[d" A ?>dw1"y9Siï/6 &U3Q^Aܳ s$SSo,w bnU@l*v9yyE$&ϖ!-4ϊ[lM1J{bf|UP[zث~1.*!#% s$C)SwU~,mnbdM>Hc K Tx]ާ|v$d5a;w9Q_0ay<[~r }3 _)o(]銻-˜v!eu6:iWST־ُf%rX³ 8IP[{f6`ih,oK5cj%Cvv'5r] J̩bmk3bdmCROLL]FSCRFb;FU싲Ԇ;xش)X3˙;1=ȞED=jC`s|+N7`7;6vo;+9 ˀOf2%eяsQv"2)if91Gb%vaC'c]͍+lKW 0]1WcR)"+N+fゖLvQӱdH`CG֘أ&L24ƝF E;+ Zv4iƜiv~j6Ar쯫6?+Nd< & qcrM;qrc+Fhզeg(HvW͐_2b3IA,iصrx*HXLx5*hjl'ӰCovukHX$H4wһJRpZͼNHԝJ!.9.y[b3 IC]SMݍBH41E3q nvT+5t'Ehhs"ic KŶ=S" 3;xz$; 7l|KlfEFe]o73W/ST%>0ǁj(1KTuͮ(pLc2wv(. 3,f$.8N)e5\&֝p*3} 0F]lz .]]57';G Ol B`WeI/V'ܘ+ثWNث |)* cc8PxB{]:vf0+GaU؜ ˺,Ȓ"*P|@Ӿ*c*bcGsPFW*t>UwUQU}ؼD6ĝCnp@)v$b?4acqCP/ VX9'ba (vZ5*QhU٥Lk]*ذ~;6*ll v:3K\>%y7Uvn-/)4 _C&+ȱ̲(*oG__J}Y cU ǏKP0!īo=W˺R*f#/*<ɴWZj:c_n~/e>xU/F/2ǃ.╻-[ j j?3dN-ŝy`͚aRk&а*Ӓ?d_"$+#PL|(F32} ǔer#/Z88s;[Hz?j@y(quY@Wׯy4n1|#mĕv6_94}Ax\ }B>N>!((;KnP Vv^lҫ9 Rԥ/Uƅ+RGJks]j+TUWIa//(^T$QYj-2Ҥ)k' <|b6Y OU//Yvb!X`@jWq8wWN ;H<-5)>SsVb+Tg`P*||>y"e8!iҌrjVX"hcrH$6wfU cf8lKan~#L} : a]>5g,gf,Z+$!IJ ?5Ⱦ9}]*P4r` Q7ѿeLŬ??[L|FtZ<&ݤ 3Cʼն_P(/L2-PTчl1?3k`Z_ÔЋn(-e&w`țXq;UYM |;Pm3ϤD<~&~L->l@=Fs9GX F5"GƘ&C6*EAbl*[=7( ߑMekW'n >mh]k;Ĉ].DB8Ӆʴ١2HWM*l〒i|*k/?w֤i( C.[D :|~mm &Bdn]?\"U]8l[HEi1 D"½j\65.)}'(nj >9*Fndpy->ْt*bǿ\Zt-ak12 RaVSJ#QJ$H&2lTܝ;vȹ'Y.l8toYZ?DaBA7k6!=Ĩ o> M4W1-w!HNlFɣ^mAmKe!z+G'BCT$zdgHT%`Nbd˅T4INf6UP(Xu5NFap&+2,B@Cwû[az AߵW5<,' oSPwXZ1iv4I1HeI&QĚFwcS^Sk(I?NM'\ڻ2C)O*9.wci9XR+@3߭c7QQJo@'i븍wZN 2544&KnZIԒIs*#fǭq (>X…tyUti*6*ً%…,cɁ+:`ha}“P},C"F~_@ORBd7I,nH݅J X"5W-h~ŮP0͊8B`H2s>fF2a-l55_N4Fzmf*F?!V.=aKU@6r(o0zTT+Up'r<1lfxہ^"U A]܁]!]Z_m؛JSp"ڮ<):dJ`CD/\Uم A.|Pg+xſVd?)UٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊$^G{1␡yG'bPWf]vlUٱWf]vlUG ]6*U٩LU٩/vlUU]1WeUَ*s Rءo\UٱWf* ]ZW,*qV(jt*r銵LR­]vlUXULUqWS0XZ\U u:@ lc!j]'8DTA|#[;,a0xlpǝ,6*إ"ʼnǰōuŰ;c$;Î(bcbfSft튻b.ޘe®i bl] Lf*qM;f$F-W;|o[([a׾lbq졅L4^j~ښJo݋y9)49HY>#l"w1x9x\d TįH;o8wl``y lRo $3rChf *.KU}@'` ~*q9?M݃5@Nnm'c AdEfiU54h]ȴ$cb ?쑻L R&xK9c΋(+y#.M!E[Ljvvy9sr);SJR9h0W޹fw&`ӛ6ebf]Wf 7]kNĤi_K+."ANbB|wˈ5/bc Jf SaM0xFثaK)v:vYU8)#'c'v5#Zv3ŽcJPj;UPFM\Ļ1v7".ƑM=CC99xط fHe;, i-,|he *E;R.t*2B$`n,:\ӱxcC0[ġ|ʺ o?{1궫vp ώKdL.LðA)%rTEڗ`h%1vf-` qs>2Qm >%~A ֵ;Y[홺XY.M;ٗbF4^@GeƝddcSebCpƹ4e-;$ҙiv80;ckn=-݉-o6k^ݗS1MGb]h;.=zcZf6v#)9(,)v9TnN*m]$xbeZTbCF )c0+\PwN?]K1/7]XuCA#U؋PbcwW89n"O*rG(ӹ]|1K([ !6)v,?] d'e0+Hv*츤f1L*]FF*^@lP=zb*;(rQ7\R쵍YC>튻3-cRUJtp͸&8؄*hCm'l fY!)ppfPE1WcR" k튻 Np+7}KjpT Z.ˑGm1v4oho+`lUٱWf]vlUٱWa/d!N-J6*죊]]vX]͊ͅ]LRٱWf]vX.9xYcsPbw r–<-0!a5Vh8.)X[D(RJ`׈?#T5pS`aP|rW5FyyEOcN'A;VpE65|6Q1[bEX7FB)J ~.%PA'#[5yg?UDcSM_H|+/6`"xK-BV9Kˏ%,X9(Gr5G}./5[۳ӄj<*9ː2JK([&Aq X"*.UɫIx?64~PaE[Zx@_}ɱJ>+kԳxī_k%u͎`NnӬmB>\j1B: %BB6)e%9fğ )-/ `J}ˋKLL \q"vQhk_4[ţRFڟ`-3̷}nC@?W?9nM1M$#Jo{ybqUda SoJXu/0\&򷪿}͐ۛ &,7 A QGIc<6q;y^AWBPIx |;\7,yx ?9daWД[kF#P 5}M28҂ P6QGo(ǐd&mFQ[ l݅@1'QCGl#E7RqAۧKXx LjKP+N4co1yQJ|pE oU>?eͮ C lc_ROF. _BJNDאb4-ij|A;rlmUm$cS~ci4 0PvWG)<_P۪!ל^;Ll (+O >neCFHj!a@ =Ng'3yMYXrN*zy#)P!d?ъ5ؑOs ")B*E!o RA^*^<庬T1d &+@x:SzXO X=Cֻ{o!6SLصeNF'B+ W%:YA\F9ꞿfRdh+.$ҁvW5L QPN_Bջ\ F#a$>Vcl*P5oa(-Rݕhڠa<vG"O}`Mtj m#:´hgZ$I>kQQMzneH+Dg.[׋NI^<#2H'jQwr uهAjẉM*sDw偤L bL`J"⪁28ǏF,aӦ!s-Z*|閈qB-XHVDaU<K\8iKJޣKuexV$dx$Wq*V۶Jf`#5n n(ztś%)4 ht',ԋ9FP_2VԊf8w*J+ȷWS.O%؛ JE Yl߷^y2:׶ WcOBGs\i.֣~@V RRP@Nw,u?:#qqǧZS)X]]Wc#jURJq?Fؕp~RٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊$^G{1␡yG'bPWf]vlUٱWf]*aWeb͊,bf]vlUXWebG/k6*ʮ*V*ثb͊1®](m)k, Q®͊*R+v^;6*ث\2yT[XV\*1WaVz%\p69w7z }\AZyEf e]\nqKWf]qW`ҧ"smfYp1cf zaJ i$;-@ k.7vR hWfE]"p1v*lJ+*}h6®+qT;Zo1O%w3S.؍¹a aԮc$M]x#|Ɍ6TX XN!$X\^c&120'5ʮ}e}͜d `-b2 闂NE &wctVC"wZ廱"pض v?.Kv58 H"݈IiјsQk0v$"R'8`,rv[ @{wRu/褻zϏcnĉx|>%رzC iҙ,wHl7+vlPLF vy\wîJ8 LK2[bX7n'P/OYFN3R'=Q ǩXT(s\G6Nʮ>eWfdx]Uu8i]v;k1w]Kq! C\pZ`cn,)iA=STR:o-;xx(brh3txgA1e ͤr lR?P29'B»_N?;-nF#PnŖ !/z]RlZvT_ lH+ؾeg;p.+@_TASAēA 3k nř]f@eԌWfEU:;%òӱꜾpزFL+F)_ĸxF(v(jHpv(r1WbsLr>,R`$|Ccģ`:]F*ғ_;b!;aYS'~JӾ**j5if'qWc{UGϾ*A🊸ؚ* vX`v2W QZw]ZJث.u8\@ ];zb`ؒp"ؑ]kUn]1dxA®#%˖:C;fo{|=vlUٱWf]vlUoO"(HSBjP4]60](v^hU]]5qC UٱK*2KYck/5\1VS9F'ZN=F*ǨV3b.` ,銁_P&qm49) F%/őO;R?x9>nM%D 6Ȼ[ Rf\s_S5Iu?/HJ}_g5Qjy5^s Fr_s #(TŇ/AsiƗǔ5H6ޯ?DDΊxN/IYwV@@G)mFeVCP[^JH.|]yћ_Q2M$?ԍk ^\}vr "2kV31~+!0^m07}ODKz6~<yMnaaXFn_RH,~Y9'ݿv=F':fW. EkcQT}wOQKE;tb''4U!%;+A+CjE>ß݈/o8f7Y~>Jy!xt'?̿k%2Ȇ1mČ~єr2r2K\\;WU{$l%~M8DVK,㳌CzI,Iͻ1ldlS$3$; EvUhY?+I̤&^RZ@|I󍽅I  џeٿgri̤O|5#9YRyPoǠS.oYC^Dd<d3H|R؍|NEm^ L4(, 1/@F1KX֦Q c 5Rj nxp5OI/w~!=lb9!V=f[hL@JMClf%Q)O./.&[ "pw*5TW+M:HcO;Sڠ./G2; z+)6Cֈ\9HB*VtTRr: ]$˱ V__h$Pb$ $&g5x` l )R%MvL,/ Ңt;'V4 =8\J <)׷\,v o@k$WI 2=Ys  ڤVVvQL/*De, i/ܨ,hcpǷ]UE p~^[6]ބ%)\ɺ2Z镨i2#TWc%rdq0,?l$J;@rg 2Z)Iu9l-8dUH;PP7f.ĔiJoC\) cEV幠_öφTŽ2͠s$YvYJ^幧(3)҄||UqPƀV;R03[y1])IL0bWDqLP&$np&]ckN-Ͼ(`]BRifV"5|\i+<}[cQZУ0OXjv8Ȼ0ʥvxqb7zirmqLƸC2vrpDiR~Y=3%Ԧ@"jQr% 㸐E>!.]>|JJ}` 8$ G2w%ҸS~5L'-1WeߕpڇW,:K9SV<pANS)\1hqUNتܢڟN*3ˍiurWl ~[B.͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊$^G{1␡yG'bPWf]vQ.®`C)vVvlUٱWf]1WeCb͊6*ث]\UٱWe/vV*vlUٱWe͊]vV*Ute]qWe͊6*ثbͅ]1VnGv^vV*p]A !i@?pT}} )c#m< 2ܕZ`68،pؙ0+ U#Ê.TAv L$;L)e-E7mһWc`fckn_lm])+nŋ`We(*ui.ʭqAvh=pHq=+.=ÐM\&xU \EQRڊ`*ZMR% k$*F@nK3xe2J)pp3Q1b28"1@zv̈ˇv`JYʼS#ܛv2XL]hjv [F`2?.ų-f;/].|6p}-r.Bvʄ/S9=4˛dպL4nS쫐8Y;=3({f®˦$mL\#!M)r>![v7Sݍ.硦Le#Av)o;TfE6YW6 vl3Sza"SưLTq,$WXD$Vcbٗc#T^ًv- #^$:7bW;0 kbs8/PeVC.'`? îln!lv)K ]5y(mRv3ҹO66]i9iw'.`N8=QnJx! ,%#@݆ЏMhͤM٦{ɔZ vI=HdIn"&N!|)x]\S%[3bSP 0e6 3pqȻ%xMVb}!v(=|1aR43ob*kdݝ;\F><2j.ęsvQ8Dc@v {Ne-[$$<lͪ7V⪛Bq)j b0IW bvXBqWW .ʦvD: Q`[p8Y=\.kur$5J.v*d.XWv03z rJOpL1|UؿaC'm.6Q F)]*s5pO^foؠݾy7vlUٱWf]vlUoO"(HS:\ar+aK]beUn]1Wf] 6vlUٱKb˦*RXVCU1K#1B1늬lUEqU4p*b#N8m*E -ֽWE phz ?bdK2 N3`WabDk)1>.?S|#o ^"a_힐b;)#Hc@OD|8}iO0x4Sgj]2Sg-l B.`K1„[cIՒ 9fjܪ(ʣbÑU ΃)dY &=9:ʪ6s+I=|r3g1Q,+_8_g~g'#Jqg}Ҕ^S˞egd!fPLdG/ ϧھG=RcJQXZe6g>`խ@Z#`>|:3#r ri۔(ݾTo&ou8c 5TӐ}W#,SJ}Nhc+N9g<(66GTRhrO@0jG3E'`;a_oꐉ& W5g^M*uw y}_$#Jg**TXOır~CV ̶ &1Fu?f\ȶ7/4GVHJ)~q~帇hpZ7H*JZuR͹ 5k[*v'JrU ]xFUe(]|,8Y8c~?Y,85 zj0|gQ^S Nꈿi^.Y6?OP+)"2j~-@ٹُ C'-n+NG~VV5ƮB!h9}?/ccWçM¥xʞ&WUB+$ZBfFo_s^eMCTeA9IpW[%Z'~Pʫȩ ۚ%\eA_yr̎$Hh8+dҐEcT 4O8* (r+q-J##Yz ??g$tȮ*BA|ygw?Jo Hj,n~_쑾Ϩ)E$4Փ$ SU ŗ>|ۇfCHץV)47G4ek[FҔHnJx- y!7S*N'! * QQ / 6"vWsVa3A 5ؖ6 |tPz(/~do.Y%4?a_Xs}g y$nDWp>݇/QL nGUګtw=2T1b-af܅P*Xnr3Η7È4λKGOQ$oIG_x?}拷NL=Ȏ9r奄Sexq/ :O#tH=2%͜!1|;2=ΟAW0@5%JEq#mZ#-}̳Nԃ_B3+_ t WArօ=]ݭ tF1MJh! ITaGy:ۡQVڄcc[?A; h>X@EFo bPl-3J. We?F l\I f jG[kڻ9R*=˙8زA`/8z*6M"Ք2`K]OkX㰲$`فOj|[A{蜩) fc謉4IP0q wqc~wj7!3zkBĞNXPEkÝfz3G Z#1njJS}uiQ?a!رMsgHeU-:li]^TaXƹl֓ 6O`fD $ԓd"NI*ԧR;(R~:;Lxr9GY7P?CQ>]&Vf5Dٱ,Ju6(cƢ9̷<^G=A%%o˯ hE. Lˮ(ȣَ\qD "M}4'1׵6!EĤr {%siQN`%d%&F$:J=f-*sy_mNwB60q!Ӭ F3ᇟ>rY8KJߧiR:M>]ZhrK=O?i+Dv(zN!@DSaw|^ r,yWƻ6ᬦ  `I´&26e\eMFc4ci9)أ8x̜.Z9,m&Md:ֱڦ cRY0hdHy eQ (>eu|+XN?sT݈Ɔ hP0f#f쳰.~>8l _<1nĻ0OS>JhܜŇr"W/fءx، 'ckMr*c G?NS,EؓPى(_1ļG9~@҉}>v!, ,Bآ7l)v(v^R|n)bJZv.E!\UՈ+W !r(vY@qV/S|&q ݃bO i4hUpͽdfm mP#,; c ow6;5;AL] U8khy>d`NG̈́{v{ {5b%Fc UD2ޮFl1zf8,!{o &\~q00.s ծv KHp`pJx nrjPb\0=3ˊ\o*o 9`YnG^6ʝzpM25RK&좸C' v W*E\Ft}=M'.nĞFE,{l0Pvv;ՙqjv*cp&,=grpY6>ݳh2^>Ai*F*x5iv oS3q3ؠr.W`kL3Q%ؙC3=[v2Krd sN$GL.!Mwa=9-x]2)Rc8 樛anB]C)W̝6N S C5-X3a 4׳SX8—br'A j+(.O/BZt9ƅGmU|6Q-U锰hUE2% #*\8ɥPc)-*֘!XRzJ8a $rM $"K$ei٢` tXr=EW,T~/vJ-۰qiجp$LQZkzv&п~Xp -(u cNUa+MKTbF%Un^;xN*8U~%Flaߓu=Es"-NJR卾SL2( z )aUڔ7rn]D@C&#F<֒B (@ 7яmO7[CpU ~Nk9bvXFev WH;ЯN9ծ5@>%+E>_7X1 K#NNBMk΃ϬP10=|?9Æg^o^Kqn3 ~omK J`T? }gO \bI15>-קbW}nqƂ@%7.\:Ih}_Rk? =Tx83F Prqiqտh]\zeb VLOxupi'6>WP+aBƀ}9 <̚[kyFykɫ?vͮ-?VEhͧeVwkK-q;z֠{xR_X7@K*'[ RzKZ5x#p~ [6hqD?RGڙ8!߶m#Vw3B-)G/x) Q߇Y)Đa*w}\}j&eewl?P_k֭^4W6-cꗨ4|?"f]Ҳ4ƅ2Aj3Aw-ZsWqIXp]T'`>"ZՀѷĤxٝ|AYvn! ݮ$X}r4-('QSJdԥaCB+fI/ !ؓӠr)$3I9lq,J6UF^M|vuMBnO\#mXǘ-Ŝx|=u8Im(GE=e`=LKyS#XU-+XJEKylm6Ƨ;￀\6̘C Z%Rp&XV oq bvjxey#)P906A)D |YÒtV1 mp\jL+0.Ѿ"e s,*M^?Wj& o@#b@TMCe2MzӽH={g<ȫud#q{0S&1ˠT=E:ZxS|ë'9|DR?d1k 8GSK\4ˉdOi-ʒiޘ'n#Цƾ91󖘺Ҭ5(|C58꿢_-,xEZ|pX=p$iP-0kWf]v̌?\U7ڿ Wc$4|*9U~1 z[7{ܜS4os%]\d6Ԋ 〞c_ftErfq2dpKpGyFhog Hpx3*;A*ɔA;?ݘR5ݻ+ #Hn˅ųK^b vlRثT\^kv CDf;D ;0ټ;%ٱWf]v's2MKE)Q`G%ٕG\DsKа#FDrFڢfL6;DZ+1P '9=adŎG};(َ!4bx'tv%B0*)LX۰J J-غ .DzCp.Z(qŒ:mVLPŶ6 plD-cVul m 8AnuO'])ؓ%bdvQ5 %ؠ\ zJ 18C7b9|"9攛ݨ/E]ULUbR 86]|%q4l#;k^_sS v[f8ji|ifGԏ fq,dNu\œALK"F!U٩g`- u3b )hK Qv D2odF]\*dWbCu=$" jȧb3myV5X' b 5e, iw—`H=Fޙ&@; QNoE Nhi+)v{fQ;s.$B fi ;ٴ6 ˝h#|sHsOmN]`C5鍫(kL)upaUav=Cp.Կ^3\wvJН4'[;?݋7b1r@3clv /Vlq2bn֣U)ot[ p}j!&W1z^S.T[AA6ͯQɕR>hNhQZF(AqS"j1VH6•p+J8Å[XZ9jk6*v()fksl0W"Ĭ-+L$6rR) ;FO3dVYb6 Tɇ%ZXtl,U~Y*fCVE;0A'8)"Z~v=@]v Z/*rʠ^qWc^K @N*NCӉ<]§vT*ҸRޝTqWbBw]XbƩV^]*rXÊxni]랇 #;qWc.*쥨.SŢ*|X#Y[b͊6*ثb͊ [%i w?ݜC.d] f f.͊,b͊KWeeb͊/vXG0Z8ኴr+Y`█ fqPaJYE0*.8RsS\ 8U kߦX5pF* u!w{c\7yY?EN3~TR5 vhAOv,xaX$=02i*|'">` RT ?ly~|%la ݐkpm[HʆRG\vo3S6<JBXw2 F} km1`. ?د-g.WJFPKYi5Р?wv]2ȫȴh⬈"3'-o)G4 W\46+OEQ[g(%mMnGYG9֤l̚|n+^J/*Q+3sf=Cd֍-bKWI5ŗkiaS7Vqd+x9V|8G EMF 80s^N^$)bH $O"? X]LJ]_;iGpH_O}C'֭hU>22&$lPWztXLyn2rO6^KXGm^,LwoS<)ؽj' y?<mTnmF0IH#~#zf*ݕ9Om;uT~m#ɶ@%pSFN 'Οk1"O0-5y[2?>4YTA[e5s*k4rOgeh@(ڎ9K乺3qm[V M"4xxdKkk]^C*Ҕ)/,UۙIaV }Lmy eu̷D}xr%{T6"*ף eUN1ޮhiN¬r7B1,:u3ruOu6'OX Oq]sFyth'b檞Gm>H~oUF/+sOM/Q(u7;n@i\ex;cS\2?nr`oSuY'9E@B։F3s9!]Kv*ǹ]M; IJ"<2p/b}\Z=WNx2JP.Bx*t}m⸺qmǥk_23YT eԠ=)ZPV\LɅ-)~!]rk\U)\Uen ~Cc0 ҙVa.GBqd᩿1U4؞j; u *(qWp)]\zULUdWvfPv8qW 트`MA?7Up=21T͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊$^G{1yG&eWfv^*Pءٰ%T]XUٱWc!GvlUن*ˮj®]qWSqWS+u2CyWf.͊+vjb]vlUٱWfbf*إٱWf®͊6*ث`Wf]vlRUGus6*Ra"cscq mSd.z@zmT=rm)(.P`]qCC4/vXW`bJ.۰]A F8`ff^\,.`C*죅.v]|0!ـ8b0=rAvd0QԚefOha)sx@h未Tv\r;X TmZC\PpRiVJpD_lfR<3;ibZ\R`in|r;4'[6P1OLz[\i._WcHp\0fb|,I\3YJSjzd \_LSaDv܌Ø<6V']u̘d4`_7̈aE]LLQNӳSS9pn3&s51Kv(=WbSӱ4j4 ]LZH*sf ,zf ]Ͳ0cn+;4偸n0\\ñX=T5qXv4L jy Vk]TӍIRIOv5銻~ثb3Tq| ڻWcxlUi!,1We~p%أ;aWf̌ q^|XflB0h*d=zbJҸ`jbc E@qWbQ$Je HR^g!v.]1WcA8Ԉ/1KEZ݆(v"˰-Bk]IBk_v$n6=0ةF8]Z.x{h;P)|I@pm֧ a])v3]('E3~eRvg ثb͊6*ثb*F/_GBg:˙ r銵\k6*UٱWf.͊)h偊/5٩6*偊Z˦(k, UL v`0qWM2yb*. 昺 U ! *ak=bn@48Vmۮ\iVFM[|rlUc8C0BP;ֹ ‘| `ϛ)6)NSVOZ+g˘Z ɤFluŏ-i,qEk)h27/hfɓU+X^.Z}XNk^RrqH< RZp+/)t6>e M#f/+t >qI}i36PƮdK)A<1 v\X3*֜{6s=:kHYDT *u%T?{8RJˮm'`3{G[SHWPHF %Y>?r<6X2S#w=vo_ki|,jC esĭ![^Ջ @ӧIJ" #BYZ'_sQ{?I'aQw{1vHҊ <6_gã2[pCzO圳 q|?~Et}BT!za|jsJy}g{e#Z/ՈޙΫ~D#JsyUV@cv.~eOM|7C+m.%CS=T6lVs\)ib:&'>giΔBF_Jk~7^@#^:ϙťBS?l8DMj@X5]'_sLաuIEr,X+76 ϒ$OWl`d6_}?ՏH+55ݸ+@|?8)X3弱6y1//\ŦEm#50&@;I&!ʟ~ٙ2yיTdv{}g+oGY5rc\H41 qvG+SQ#M}5cO3VހY"*OFdcP8jGu[{rc˶ec i)݅`X <617F;hʳbPΜ.;udy3sEOzن ,1ˈd5ffB.e摉g$6q XbAt!6r3r5MiNbj![J5N4P1r9~ev)]"}Ygu߷F&ib<ҬyhgtݎQV5eLIORxunEfvCVbIGB.ʠt}NKvxRwg+ MN;1R<}e~%g A8 Uұn8A)2 wrR54ͤb]mnI@|V4xVԦWzJ흎̀4,ZRdcB=hw_lŒXޓ~] *|@ ͭk$zE[EV>ڙBF .OKD6k|S侓vQ2c izYݏc`hjHW!"m#':LVRTunP PuN ksH]H)Nv *?ѢDN/ 5{S[Ux"l%0Fd\^Y4r^j Q-x5[%2%-Jh.bIG!eAKA[)W1doexY6MVTљMIA`O*J/ŒR5:T fZU`Wf]vlUٰUIzyv#EkhvImcנ-eaC]\lKPȮ*5jjun;Mi)o$ӶEP[5La`(r6ks ] ] =)p=E6• W+\R_j`aCثҸk)ur]\CQyemJd(bvlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊$^G{1yG&-d͊/6(vjbUٰ!ٱWf]\R®eUX*UX*];6*ثb͊6)vlUٱWf]vjqWf]٫6(vl*b͊6vl*ٱWf]vUpW1vb1CCj*~[MjQ B`"-6Z'd참c%Ŕ]]]v 7= A."@6,7űdVH0cwɳv8e/\UqWe\v9p+!ٱWcqWe18Rh4xa nDT.lXr kw#[%)YHr+\Ę<_Z1%j"̐D⡰ԍ I``:2D!l( -wWWW97+9r hmHlIZN tf` vjKbƵ{b q7cL,DH\0!c2Q۪9k ؚ;H ;̹+vw8I١a mزG k+v(TeVcC ۱9ֈkK3OMTQ-̝+G%v HFg .ǓrWbrD>!&7 H`Kr8E(S S`6v(Jݥ2b#n2J"Ϫ,v*+O0m٤&d &cPCNffͅ]_|'b1)_D .Xmv6k@^]8/J[&D>1rc .AشWc2|FaMO>{;O-7v5&wb+bjNR"Z`VL+bc'&Ư▎1Vępr|@*)r~YJdC.D˒}Jro b6V[I?b]d;VдiQ7aX2J(MIwv5؎JIڝs[v&f~ sb mˠ|UN.z2v)a u8͡b#sJqcjes"\tQB Wg\tKXI) krdż ]t=s>`)v2HzvdE.iF0-JRbXVnsyh.i8-.PU tE;"+c\~d2Nf0hFTab6zd쿪E)bK =i8̆ SB2ݏ{42"ݍ6(Lb:vdJֵ4nӱQd w'SRfN$ ݎU?k5UPhd:fiSs9W"@!a9)uraVIFH*AJ\3\qˁCeb.*죰.ƣqVTb."1>yĩС3Fm?NY2ەV$r7|*ƣl6Nx`c(*vTH;n-OLjp;.X V8ܸ !]@iUL̬ {`Wf㊻]~gw{`KEMc] P좨6w®*TPƆq*ѱlh)]n |]qWe6늻ԓvZaCؒ:ĂB89|RqTZc()v'jYRnj )vQ7=qCSRv]]lPaڣ0U)v5׸ĥNS)v;r#c'nR칗kQ,֔v'4| 0\R$\ =1Cn|4vX`~;pWeWe2a3o.`bkoRZn/9_d+X0(D隹HBI4LIO&=NAi[\A=(ٿ~Æ7~^lCp]N_.}_U y۱raQō965$F3 -T_~+8=puw40"zeVOe8F ^eSnMc0G'kh:XI</OeW4tZR@~ |!Gڧ)?k{ȋhL3 _N#/V}_JQ-Ez'rXQE k)p֧ǮC_g5_[Ƭ0"dOc0f_p8L,k̒kt- E%zk#ǻ?`@KҤ2uv"d}1n:ؑMt鵋&bX}f$9XV7j}Ȓ* f)؀wg`JsFA#pNJ<YT^͘z R3^tP=) zO~?+P o?d2ГPc;Dصd֗XdQz(/ĄZ?mkS15hM=H"Z#,Wnߴخ]]/115Q/Y QM)NKw3SD֠oP8,0թu"4~@NIt{"v8m0T*CFoHaMו&4~ԩf/p67hM-j!\ʢyg@6lדEWfx 5 B8O ~s%2CпQ_'_)T ؋h !+?~E|ɦy>fCO*-זgbhWh+jmҟriXpM[WlpRB4sH5ZBZR1 [_1a IleXeFuMw]h=ӑ.f Sb}h?H7:JފKzJz{P:>RXV{Q^c䘐JKPpÂ>ߎ?QWSY-6nD/NEVڹ_F\QW6 []"ZҦq˚ Vmq%8g؆Zl~: (/%J[XE|A~B{|4(K>"Z`ϗ/,=ݙSM}N mpʺTjR*I-BTOV/6U&S2ہ/01-1´x֜>f&Hjׯ&=sf(ٱWf]vlUrr|]PQs8Uo\x«NWV+`;bd=*`+\Z̵dO47F\:3lثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊$^G{1␡yG'bPG/ ]]vlPثb͊6*n*챊/;6)vlUٱWf]vlPثK(vlUT]/vlUٱWf®́]vl*ثb0+b͊6*ثb͊6*죊1­Uxa[F@e`%-Û}=Ldrz~DPvqGD(M(qb˨.ƑSKbR책]vK>'"y Q\d[sJB[Ii )v-(Ȇ.mc\eUٰ+Wf]] ]6$Uh1C`Zvi"mS{ -Ȉ゜ۍaPb1TMZ 쩢qRɥwpR%w#1!\1x+ <8ۙd(+$u_69aM5@4ƯEDq]dKG ẅLKmq>4,aWc$Rw .16+_1΍y L\d è8`tE%}FP ]\qjnf$nXBMOF201N`p.9! جwh6&3r6ɝDV 6bN#-gke;(-ba WbrA˲ F&;QLf 娴2 pR|żd+Vl wvzJxTĞ`n e]LI0VI$ݘv$)j#rƩj7-{ݛՏ[۳}j55~[vcFLj :v"`q;7JvUчQ-L(2e48[vzj2ϊL HQa`mCr|ٙK A34IGʱzwb;-ڻfAėadf\?9=A Nc Tv"(BBp\Un8b8ZViVBUV~U1Weq]]Wf1Wc%86[I)nθ܉cD<н@""^G&0RBŏ½@6J¦ !ɣv\FM0W*NLVvG.kZH=kʻӗ &dمO)%zu#>4W@?Ak{d_ 25Kd!eRg<͒]jĘъ㛭$au_!vf7C+=iltS$[5n4K~HH5]Jk~sG@+ToO#/t\\»FyZ^/o$DSDh\Su`x\jFRJs ɢ+RHz⚯`c< .+׏ N"1 zc~?,P+qQ\ZIqt h@CE/*2ӏxy.gH 8 STJUH5ok̟B֦Q(+#0!scI:yD}PBѓB[L]]K:_/͡~dK`aEbW_\Woph J:UINQ ^X٫l6Sc* i ⲅ SFH?v~'q?2]K^2\Hr@? Q"sƨI >r+'*W7h,ORPc7,;s >jo٠!>y:I>w%dxG}*|_J,=> =%,7Ř3 9R[gk`I!v|0Ğ%ܭqUL?~>%bt6AS $$;Ja_;h6?FBiVEo%q?ĥyXsa_~~CwkbR_Fto3%\Z_)j:lY: (u++LW~?-YOIjU^ 0($vRUڣǗ7ǜO;-@>(rŒO2Y\'~ O]<U-K I^JYwD153CS1 칰NAHN|?]uTat /]؍>+5~|d&F?(rF?a{ <aTITx;)'t.y H zw:?W59t2$zlI`f,|V%e?4_]\oQzm^Vq=Ry m3\ULƧOF"āP:禌`|)pH02,ce/؃Q1y$-9Qqq@2&ٽ7Y\j/ф QW}ISң*;ʱ@ikb_%P'.s鶊]<g5R"bzoo So9LƇ_kojЉbC#Hucp 8V'c&mЯ%&e8``Q 8~h?}%|_*yv7R7~ $iЕۿdNOffw6pkxY؀SΣURyUN|>T;<6"PkQ3eE k?w2C4OFJRT1*E*عSKk"GIUbS`Iqrȧj(YGzXԳ*8&vu1'p:mF"ERaP]dk6fI5% PFg 3՘U)J5_YEy,qwo@S6?W%{[O䨍no@䗚AD[j0j DPmL]PO*IP3 tlBv5=ȳ)SC2Xe`Wf]vlUٱWe3;g N,68Y-#mcME ­e*:b)5N*5Zz.4 47*7[}Mޟ,4ƂkB({`Cx+bVRiw—Ƶ}8Q\)ZN: }0r®5džoqVS 07Nɵ 9[6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊$^G{1␡yG&bP٫,`Weeb͊6*ث5qWf*bʮ)vj\UٱWe͊0]F*PإٱCWeebf];/vlUٰb͊6*ٱWeb\Uxb͊(p[͊P>mW3Pv6rr¥N$cxGk%L8q2+r–#hX|KV5df~Y%X,ƶj.8#% T Ea~6'\w21L؄Q W#F[Nir 7%E.C7mv#u]c0-3[Mtpl.W ,0v(-.c=Nm!F6Κ8@CTNk0-:even'lfcfNgmt1fI-).Kl f&>Űp)AmR&wȔ;.U4V)Wfˎۑ;Mvȇefw-if<1b]K ֓mnƖCH%'b`@fG*QK nc4b- w%i؜_ js8[Dv8ج$ߦ[TT`W6_"N{m6V+Lְv&djajLJ,o {knm2tCC=6Qm^#2SZf^UؼNdZwL6;R ;Dqy19qi"֑Hi EɩJ~k]%i55AVeCT USh`yFUSdU3o1],aWee Uoġ M2 TN7OLm\Xl'eñ\wdĵI $e6 Sj^ c?FMkbq,2b$M|k5ظq &~-l\We~وƕU;v%ّIRq'|UEkS9s؋Qc.Wۍ6p3 ]QZ0A\UتlUؓ= 1WckF]/v.+{ Wev6V adwP*аc̞(v9,{] [.ऑʕ UٹT*{WvY銻*Wv&q vXZeOlUcߦvi*.J)b4oMbv5q NvT]qه]0 튻&c!bdU+MWf$cJ;dlX{|3o6*ثb͊6*ث?ҋEQ搥w?^tR2Ix8U⮮V*챊↲KYWehpr銴NXZ'.._Uq]\p\UX1UⅅELUME*bBN>_pm Gqr\m1JU,U\˹a[mۜQC5|P+ QT5#_oNgL@9@jM6y%<3<8byaF[YI9x}-tdD ooRjY $nQnh>E?k!핵-ABeE}E5͖F!?[oWnu&q$`˽#SԂG GO~3eQ 1^_QW5*~Ne/WN F *~>i5Y\b 6({X`MV 6Mt5XƼfMVM<ǫ!.}C*bFAFhMo_ 5JJ2. RG/GOsP76k[Fj=^AT(&7ye` 1?>pmbi5⡖4fy'o3h@2=/+Y~);-?|Ï(yvh܅B#5P)3tgx19@kڼrA^L|uKFBG#}[xU?xSAC֯ltR T2s8rj!n v#jz1rhW (C7}y# dJI%+ [bi_,0Fl9@V@jrR5p;*̖J%Zoa_yQoH%]OZ+||B{uZ]YWf)E;[kK²H; -_(|?_MRۿ) ~?g8UFmo,MUyVn/r3D*+[I:z O~iqʑNŃש YbtU񑛘P82@Fa@v?-(|^2]hr_:+wdƟ@8JS ^A+ 6@Y%ެ_qOJT}aH#`tlCKF?g_??gDFwÿ/%5ArX7.5j?r[2KĀU_쓇yπV?HJuM1䛔flMoo,0`[ejDҰҨ㌄>8tr-- d @w>F* *ՑAj8qԏݞRXN+Ɂ P>^ulСci_| iwqo{˱e0;!@{+޾>#9ĺ\dxy3G(+gG9g;&zH >+~H [8Fgmى'v[(~% *Wv2[#yIdhԖnlM|~JOcZ1-7×m&ZBDgfZvp6R7dKh*m惗Z~l!K}(I :9r5`)YQ%I*)97"vs6o}_S|%*@eX2 T/oYm-C {dS3Uai+~}TXw8k|;DjA幠(R6 zMO *jG1D6ޕQӧRQXϘz |zn}%JĵzտKMUd.AFu9lnZ@}Mˑ@VxP 0"s_8tQO,Z^5$8`? Q^]HZn/..wڴ*%*n ߳%{w*Q,ChM+*-^N-~5FOh*/K0!fM)AJ /ZꌐyOPe18-ICч՘XʒԌL}닋BG]{9^*崆ݘ) }93YH iY HuNiߧI"Rj?x!p*M醪?jw޵ȭ3=Y&3(,=?&ʓאXjHQ:ݴ^SB6c^bjm\6%EE.&ƹ< %2FC|-Q_qyv65R \@| V,hgb I$ҝsk2ZI%AQimnfu{Y\%i%rp2ķ]6*ثюLi6 ʹyu 5RGcZ'-*=0O8ңצ*fd- MTBW'01.9+J X֎#J8$8P5Hcԃ] KDUqVMCụs㊴r-eo51(vl r*W*Էt7U;@2+]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊$^G{1␡yG'bPG ]1Wf͊]vlUGvV*v*죊6*vV*Uٰ+;6)vlUٱWf]vlPR] ]͊6(vjaKb͊6*ث]C\R]b]L*j`W´ە: *bTc^[ 9 Y;LX/F*g mmجiȡ J$a]uäcլ{dxÅSv5`]tH.hvWm]vY]vlUO )dQӱvȱ!&U",2#wa_1UΎDMv(6J2\pO[\U޸R` C; Į*{IXbmcƎgcLh2R`|1E;0k#$ScPQqpb _vbrcQ6ؚI9|c(%(vUnc_NYA B J9 ݍ*kZWSiAi`K'+\*[22>ـH,ZPڇ2t8Eo+5j~NBn$W'Zv 9GVAؠdZA;:r.K$q9ݬ Sև1xlkv Rצm4 6ÓzfccwZv#%McOOE3E$GmX珖Dq7`kLbvatIsxeZCN4ވykoD Hp™-\1i.=JrTey0(#KN7ͬa(3;@; n5:f,M6—eq5(KH<|Tt=3u7m;G\sK&huL k1ݏT;bƤe,hY8c ~@&rMV&fI]rz#c-3 2:5;:aحi\Nr٦dl.F5*3ˎ@2X8bpG3 RȽB8EɄUcvlUt]ٱWe+XJ1(d1Ɲ*,,0t Y'$ɼW"ĻÃ0#gcd 8 \_BMl|#cfXd ߮UMn*1Weؗ XP*]()v&@bHZZ *lԏ]WbV8ĥ =Wcڴ*H C]x]|U .)vZRMzm<pbƲ@bǕxbe1{cZR(Tb%N؜qGUؠVcWb!.#|U1؁v?ȩ]t+AWcT ۶)vR/3QFWc5̊zLUQ* *N?y`WbRLm4c1!.G* PGl ]Z;ѩzx8m#";dPHRb%Vثb͊6*ثbß(J/_GBgyюZ.XyXUbeeR8 RX8bN8.)ZNXDj)n0a9tZ_)jap!k6(@1Jq>q܍iqbVʦW9tZR~Yc%TfSҸg?u%]qWoYNQ?,(SNݔzMˎƔ~-5_ZtHC2T)#pW?5/oc7w[i ,Z+o/fh0eltօ_/%άʎ11#JLc}XNK(_lID<R1?sIc TbR++_YB,` kn<k&/ DTWE~e>V]IC<->i@Io-5$LARJGf^S ^+*Пk$Zްm#hLT*/XxR2,Z?_-jZ65`YX-ݏv,/ >kplQxg`h)|e~\Ò BPt5FFʤO+yK1pα1UdI k-lҟ]8pc_YGN~":zdAUHPW[6 WYΈ`N#r9!pDH;z&V?CI!(̿)ΕNAvNХBH '=/DQrf\_\OJV@pVDsQd3HTU(KY \;K5y]ӵ+ ʥ\+/a9:?Jtm:􂤂9!obp[LS0 =iƴWrL#4R}^<;j]UN5J4]ڃ9 gf '-phչ3xg2KUgr > 8o|i :z_/zǟCE^;?r9y3۪I5?fc\)VPHLl:@?6ˣ+i׀CP+_:0%ĿaQ1oSFZ+b9t/u8ܑb$t8.J[3W~,O*Zm{[G]H%@T٪33A _Ӛs|[;0(ysX|*?^O?T+58l t=8*gqߊ_CfE1$ZӺc R=IX#o]~Yn?ݕf'ĢL9KHy ߇&O ^Ȅ֌h}g"Ms e{Z" 3=k2 @̥_ %R7G,.nN_] SdnL$9 s|kƑs ]id#$"#\d:Bi=AЂ)'WM> n)DÐ;~#cШ;y&2h{)i)+-E6W,d$Vp{~X&ڒXpBydp*Z'Pw؎^z&F9?Ͳ̰ЊfT3pȀcj/߳x Ҍ:%$>;5?:A :ٍJ}a#Vʻ(IS˱yaۏ_ՖQK z ZNCzZMr JTqV㭴QjHdPx qs X7 c;`N;j/@ ayϲ+]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊$^G{1yG&Y!2Wf]f]vlUٱWeUٱWf*UXWebLUxb͊6*ثWvlUٱWebf.LU٩]Cb͊5pWvl ثWf\3`VlUf]Lثu2늺]boHZk\,"US:!cԡ#"'O ԗb"JnFT2W0݊M;%*MDU.ŬɡZBw s9Ue`b`K=ȈSl6*v Xxwf}U_Wbndm/&\6^(cnٰ vtR˱Kf<_F݂3,60®Zyw9Lbd we'd쥣8"Pf<;̦e֘ڻc'ce2|pzS2L[;v 6nH1pAJoo֢'&54{Kp/Lep=02hH0,8C}1NH)|ڒ!}kqGe,r!t^mʇ*l춂+Tam0Ǫ]a&eh,DpHore6%NǙ~)6FV{IelJ5M0{+R)뙼 N~T:\s59FGvFV*e8%lz\|F78G*v(g$~yp2`Y+\$۰6b1vfZC*kIv p6\h`R6G&]Hμ@ygĻ IE,aKLPS_c]N ~9JMتN@2ᗭ&݌YeGq b l:]xhvRIWbA.21 !بQd'bSTmɵ+JFوNĪ[ Q]g,whv Fmpf&4'},ivN$qDxer_,㯆cAi X`9xCSY*sb^>H%UN $Ɯ(o0*v1PǢP*,saT A|[䢡]zcn$ɬHgcdwh]S٣hvcn;aWfNv[ xR58 ׾(vf"n0ٹ@:*Al+PTJz?Z؜qsʅ{ UF%$b'AALUR'p+]]\R쵠bO~bSƤ]'Q4lS&r=Jb#*K*j"WcÊ߶*줡>v)̓v4яZ]ޠWc6PJE ={bMWec=*->,U;|C*QP|UؐZKAxĮ]B#@®#&ڣ"Őq!r7U`M8ZWbO! :M;M^₵|3]vlUٱWf]vlUs"(HR:)Y%6*c+ 0Z9cv8 Zq-'*r╤LPr]\p…[\v)[\rqBlQWQf6|1UAUojeUfV=\*Ӡ:bb+]w)j[J|VrONmb2 -B_N`Va kjng@Pi_kN1.e; Z#b<%oNZ7ƟkYjNnRWy+Go/9Ï~~=)fM]Y݆ﰭ~5Ӭ'bD4( f\1$IQCj7j;?>/0(dF"KW˔˿(VzC(=:7|?í7"i=+L +PO~??8- bKp TT7-ˏſ̽i&Lyy%^My~?4c$1uT8nN}E OSLI?dXiavu3'acks n4*T)?2KG٪Y},mܰFH}|r6*3(^}~98/$_e"j]BE~5Or mL)P\(yE_tSE#kƆ8{Z٤h#&Ŷ`7k77å3{ Z_a\31`^]Tol*He1FF+5DT_J"r>r E?J`+x0V"_ kv F/lƬQI?03}`(YWf:;X̳DI"dvBxfc{dڋaBaGp>'sƈ~/&c?bWZ 4z$eʻ[tq( .vZ!>97mQSV(m_+Ny(]wXXmVr{r?s/FIs/ dv%y,WWœ 0[YYH($@~/g5)w*VY'jP,jryxQ-Oɯ}2rcś/ `.Iº\l"B+NI$h}v((B۲'ff_کd'tPfOA~-Ox1 e˅r^/QŁ9{o4{LKXz-UR*yk$+Įݥ-痍Ā%BM" e[?(űbCAָ}C0"Q*jAu 8 ޭ 4?꜐[sƻ{||a$F25)PҢK/O1h |Gncv'(N-9|cd~A1{(%A(C$>񕴴v#rE,0|тyRx2KE uABi((o&шˤ _xTײ!?ۘ$Y~vDpj oԸh+iH8Rzs1$}3ArvK6$d%7ށ^'C{usS=Ȝ;q-MK; %P>9)IfHZ;6fk$)8|ghZY g/Z 6t~dQZֽ~ҹErA`Ƅ mE[vp@+?_2XaC@Tﰩ'L#tRz) C lI21C"c3F,uHB(Ie]}0*CFݯ&:*-̟C̚UE;h/L&Mƣ?p|X-`~@l&Q@fKbE0v< ͈yBAwM=UngWثg0Zjr[5+Q\fp0+yG~ xZZ -N5L֘S*y$adnUw*P8yUUL' kP,4(t3B\mS6" <[w_aǥR{$;(F.K!Zx2[I*>ciVИeSәEN%HB~%ӀWWN+x\KM \sН9 V5e#+_\6Lz͆=)ݴcOubؒ}ʌ4 FL4X;2;x7pl k!ֻؚtSfژ`{jٳ#reJz岍td;l|"Oؔ ,K5N($vY #r]?l8v{pv9]hH햀_49."؃Y WeS(vS2ҕ]phw̽>Q]z)6Tgx`U bfxckJm])VKt17ʼnZݾyخ͊6*ثb͊6*9tely)]v~ם嬒ᕊ/vlUٱWWǁV>a81UcrZ˦(jt\NXqXN8 UilzR(*ƘUE]1B+N\UM; b{fEjV4'W«y5ҵ--ƕ z;fZ;ԦI;4l#WkA@p:L2-G1E)B&*T1a)nj3H&qJH?FP{z+D=T`utKX 8FAm  vܢA+dvѥշQNQ?TN~276Ƶ_&<=ِP$h*„ x:* J4ܡX}6 b.jܯ-x+TU}[+3@__Jf{`u:reGS_y:ܑ+^'z1tW iR` Qv4 gER'xӧ?H (hjbxڤӒpVӴ";8?5QNEFx.)*M+za;Myj/\wֵ'.?UUo|!3K8/AGo+8㆜v/_fTI%Ro0>AF`:T (1'ѣ1 Id#c-{2]ح[Esm?M"~TpE0[J5A%SjcEu] vT&1&+G> j*4$z2|_K1%!Ąm6K#lZ y|G;jQ: đNsUj~#Wi~=,=o vj-H׏_l7NZUVGSH?YNr&q!".$p bE$>ϣW$9 ~O5G w:/YIYHz0${~h޶߰RyqO#.X>W0 3-7,z_u&^iKqk Ro2UU~=I-?_d^hO6PYGɢynK.q{v?]F; !a%G 0У-l01lTo>,mlAA ;Tw+4󑑹,X>5Ē|R=Hzm aA;P}-yzh,~9ȽBMs{~͆L2t$|1) k4W3AM?,9|=9<{dolAdZxkLeͥ鳼!X:'"mnhE͂R -=[, m򼜖z֢֮BTR]Q^@yK?r8G6ISOՒeI4-('->Xc >ƽ>U<[&ѳML;J\[O@=xU64R q4M[ r-{t3=\Щ7V [i+(/My k195TT | )? 2ي$:oCC_/Uև{}!z3H((}Ch 5 [X pIRGJ-JVnTE{"[e‰և"q Y;6v9 ָP]IscAsQLvɵ5\qL)hcN~*,5Fj{TM78c l*U;WcSl*W\RQ sϢ&ͅnQfثvY5"y-\}͜, p:EAR7E_lcYqWe Sv6i]cKNƖA0RB1 `+q;V&N@P1W`,Re9n?m+DLC ,]h0 }#epŬ(h~[dHiFO+&?fN`08[c`)#F!@v \r0vekHy .r]-^Sa(8Cx&JzI N.k2v^;/vPۧL pmlDrr5=A~ IG]@9.!Vø˱~S8{nhs&X:ؓycHv"AS17݃4; J}b2ʯiEMؼ7@CG4eɶ3k|3ӵi-ZzrcI=˹놗fpoj\ė5B؍p.2 V+qrd$Qeg)tJ֧l1A{-a_lW-+eg*h@cc˒8>A =GEVPZ3AS5ڈl5*Gr} `xsDžPbȂC dJdcn9,WPcNX \44嵘+XDӫ vU:.nBrcK j0"N* P99f|")+ ] 1|O4pr'KbS0O'e4ڟ,IK9|*s_ ėc[:%Yi RU'5Gf% dC;,C^3'6Y .{dȩvݔӨse ]NZ4bjb߁ߊAߏ+p!Y֝ F|iӲ~-dbŘv,:2&VNKeeԯ1@Hv6 ~O؊vd 8(&ڕٲ$WOQBM f<ė`AZjve4&vl$[ s*8 HlBvQK[x5'o_ R;|:-ؓćЎe :#V#aM*30FGN S)ǹP)@SY@c\N]0!٩LU`bcX`K`w\J HRO0[˦*8.Eӊ0*Bp ь"v"U'- S#4%n^'~y G|J @֙_2ѷڸ3K2vv%&[uNʐm퀆/})]Jʡ-`WelU v֔p75—cP m*yE*`CF*B`WWeņp%g{Hv`vT,|Rlq5~vZv=Vv%uU#$^+7u0{WbpX]ASvT'sL*U6Z+c]3W)v+ٖy; *Ď`=qC4!K]]4 v\oŷ, v,\l~*F2EP{`WfW)]9톐ܸJnCWc ȫڭqKdh&X%kv_*b6*ثb͊6*ث?ҋEQ搥w?^tRrIp͊vl*챁Z9K8 P\ 8*bZ tZ'(XN<.)ZN;*Xi8*G8c olR9cc+]kJ æs5 xbA>*tf Ulm雦ث_k|p5V銃@}ʑnL o"0Z&ZՍ mpr#?5RYi e\yڥ EKEq~lpa/keZ@'?>|+x;ڛ'7s)Vj"fx(aʴ,?raF\ mBHDh[!)6_fGk%](`rà^?9kCLSz*b`ulGERx-ͪRrt.9x?때@/@jp3YO#喁HMfDSqD"1DGتKfga݉?,/ޝ0oNR%cHEEN%8 _5PםBi@"SR4 o=nQiGPO#NhQGl?ƉGwUN<,NX^_7x'a|ZjTG~?^<,*o=A{%'/6OxXd"o,  ;Ep#?.Oߝn_n<+ܨx1r|kO~E>$ xXgR?!ikF?6ˏ͝nS:F<S$T^Nt?(oO`Dž$L~^5KxTbklt.T;46/2K% P5b֬7'Db5k6*st(,9r )$};+tq qEs2)ki׾NyIt#l o`h"#ᇤsam>?c۰[1%h-jM|rQEWF38m9-(6emm~=d;\.f-|Yv%oʰ]݂dUMs6ydzs28R]LN bW L@fO ]\JXvRb+ZW1vZ D@bT`O2̳;!اxSKC؜r)vYURFTnrhv&Ђ:1.Ƽlr5%ؐY أ6˦ tI2՚oiL]n4r;w8i()flNkV<}"݋4L ߙg fTkFUtB]r"n#2_;;F'tb>GݔfSԏQ[v<l I]S*체5ђv‡ew8xv..+L6cG*I]`*.ărWc“ )Jwe;Ӷ*Of@l ۀE+]9F+cCUp aWczo/b(pϳ1M;X0w=We]jl)c^3yx'`jWe|/]vlUٱWf]vlUsE"(HR:)Y%.`bjbch k'*ˁVvjVhr偊,RbU21 VzqB1Lqb2ݲ)\ p aCN$q|zR: 6V߮(("U{N58+$uM0+gc9wwVQFmǨ?N*C|N:swؾEUnE:^MŒ)i*+|(6%8XғA-iaK(& /o#CI IqT,WY޽,f $(+4CG΋gcv24.cPiP:YYWҴEfLi!u7RGC7fX,hmn'c\![I#+Ħ.ML`a]=ƓM]TRPxep(օÈq!V`* bV 17@ȁ+xF}e+]lM®ʡ]Y8M6#QU+CybiN4/faU;l>#Gcn)۰]GUfj(vW~1N ݊z~8"ݘI.3L6d v1rB ESQ B5) }9!9ʎJ@c.)v7C '(ceّ*  б+e=2c.yX&V]J vF-A4E ش6ٕOԳv ˙fa)de$ <(kk1cCR '[bPж2Ysv8L`(H&تNC(> ӊ; 3ؽ|ɲئd3vlPث5E` jqUC vA;3'tb f* ޙ-(adu}P©\Ю2?ؠ8ޛ,I Nn $lKz}I8!k$^B$W*~6duS\/ d%@kQOѶ<L4$AV(eO|c3-H­nC,@`g$Gܙ~yfK]S&u0$Jm#Mc(Zv5r0v`ƽpq[@84rq*3|]Je aF;3"Rm)ǨkSX۱1.U+M'2Kd B|͈LWڙkOze7gLriܳ"L lbM#r]e|gmتF*6Od z \ɔ-ؔ4vx­\,mHmlq,GD;m i]"vA{б험lݚFYec"D`0v`p!à8CZHkMgmv(Hڙ)]pPu9t,/f &!^ j{|ՁzfFv_m %KFFhԚ˱02CcJ졑;h\n([:ш$Y,>KV VB:d/2f e[\LbJf1bzPcje\|cG\mW<*>&Wn8UAus+1'⫆ RPmŹAf e,Ak wC@hGMv A+j.Ԯ^ Ԝn4;8 ؗ{`Wc:Udp%ٱWc>PO\*͊RS| 쪓.ƫS\UlYMW(v]EqK%2"#vnDtɫ٩C]4ZTPv z`K5ob!J֕]%78#v( qWc t"fUث(S\Ju+?0٢V 4(*p+6>)hۦv2F=WbALUب2qCp+#+JSI.)a𜒻) |U{t]hU®ۍ+9-ȕvhXU0+OF_ ȮVvlUٱWf]vlUٱWaǔ/d!JgF9k$f:DjXD+Kc«IǁVܺberVÖ1We jኬlxQ*&) F8uV˦k2χ*GZl 11⫸R )-mˉrԚVTLi {ちVqHdUBpWߜrmR=EGg  r ܾGWfqWcbbqL(`cM sKJbuLQK x"+,iM )$2+P6 qO6uÍ'[ؽ ;Ur b re5VA%ĸunxuA.|:!HT!5IghkV r/:v[j)@uQsp`~,UGAr N Nu6J vN$G?^#//3k`7|o=L.CTA-ng.Rx#+ּf$$xOIJoB{rpb Y*ECqAd5ds h_2ʄ cV]RTiڎy,(lvpo&epo7ySHo-u1J71 @h-Or[oK6YCo "2^;m, qpG?MTꛪJ  qC H쿏'[CE3D 7aSu?Mޚt 9ɴc_IZכu=hd7. MUͅw%Dv$i :Q\z`!zZ0+9ZS M5==dQCQ;&{q+D v50 j BvQ}W,;I/2vbÒOl< N̰Ms]Ta>pkҮ$DFǶDd;KQ_2mؼRdDf&nǓL*쪜UC\6Av45}L9hkv S0 A GYftfXdH['b2[1gVޟ1v`At=}-$;,?aho2v}C[hM(>/י0wBNŒu~ʆXɕ@S,zO2O] -`Ao'b٩ӳ]X`7`hWl0y0`ǷfXoi'V}(e&Năjc _v(|'c.lR ql y;M:fN*ޛ"T FMSǚitP/nmRλY1t0Afmv]2ie iEBvȃk k0vRs9Lc!9;2 Q{e?Khq{pFBO&nP@xP?B)LzaHoFiJ ɒ"&Q.#t ۏ#z挖@cqVL55 \Z>?]TS6F|Ap[nԊ6xuREZ\*p?gǷ0r5ߩnq(x c<"]s |rIvZ Tx؄;qͶ&7l bSQ! F !Al`>8-5XY|'eE,7[UĦSCt[\ҵ#j—e ɨ2PܫY@\ sc7(nEN6p¼j76vlUٱWf W;ICeE:sbBҸ.)Ƀ"Ɣ^!e gυ mͥpt3Xv]vK :k(Lj4MQ|I;r]i֪ş?cl8pĬ= $pR CP1GSM/RV5i8'h˔7?BG}u kZ{pC P_J3)FxAHI58G]+cO5`u_s\M2! ^+YԆbIjT}*T3~e1_Ȳ0B-j>m̿~t:!py09G#zq#9<9'_Տ_%z?db"J~d[?z-×9JU*#Dڷe{6q~8qΰt uI/7I3?U+%p5Nl>'9ŧ>N<2ao z9$kȜ<ĚKI()(vV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb+Dy!*ø4]}7#Xs屒ARx*j2FC)GCZRL*lu A 5Cd_A nqKG,ur]\թZO*qثc,bphOk8Uf'jb*lvjb'joߨ*:9Jb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊$^G{1␡yG&!2Cb͊6*ثWe͊6*ثb͊6*)vjbf]vlUٱWf®.LU٩/\إٱVb6*lP*إٱCb͊(XyG3`Wf***ٱBUن*Z+beq9xUtMGf>lG-S{c} EX0\ؿ(*츖E0Qz9%BH)*SagfRuWԫ>"n _ rTmNQ6o .3]'&@m*r59&JfU-ZmlmVz,B-] Qm1[w1ckn3z'123 ܲ!4;aJrjyYΆ7UʼnjLq8` Cdp$des6k Ww%0 2\u0S;&0Nɰ;rhv1+dM҃j$I*4 jۉ;L%ɑ3N<$1v49 ] o˨_:wbLyLcN 6v*Fd3vjb4r$ ̊2u[ iv"_ry1%"&; {[bv%%>cM10v{gQŘR5Xu6G̝\ 02uىܮ]\pZ`CT­Пzfn@h)3bR6\dN 3${xMpW`dl ĶƤ ,Ok v \`eWvRJ!:q S7rmݍ@˒gka|)\d `]*COQ6oxgbI陆]˱<Taq! Аs峫lUؗ#qv[niWe;w]L*i*y; Uو8qvdq]=C)LRi(q4$aK#0cPbƲc.7oۦE], )nv=WcՔ5vRaQ]6®]A;iv8*/*FS )H$۾ Fv=(;צ; 2C]P] :aKzbbZCm+1We{ddƕ jFA]ҘM ȾAثb͊6*ثbß(J/_GBgyюZ,bˊ8bI-*xUZ[LUo,1V'/\u1UNU0xbSf&1V\p5VNU <1A L2TGLv[zRb]P *`H"'sO-aUNƢaNVcw:cjndPs}?(z(rzZ}5݀2,9+b͊6*0®رv #aZF Qp|RaBT˅MLPm>(ʧ>(Ol4Ҽs1{WUe2QRIE⹡pU첒׍O ;/yqOe/KgB"*<f$Xg[ȂH5 +roo̶%fB\l Wh>_}m]N%2F$G ݹR'\^Cx"25҉d7Ee!?wl?6]BWlsa/ٰedsY#͐FR ^kϏ.ro.[9{ ܈&.SmCũ7yi&~g :ۍUJoʣr;Irt.QW"' ㇳDz?ĸV M\\swy +hTҕnMcV<.94`u,&) Sm?VKo)HGS# oZ%v'2+'æAn識u#K+uwb~l DPq'`QE#\(n+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWe=Z}=s}@ҭtɬ2G:,d=Rv48V*SWlfWeM*\ʻlءV㊻B:V\qc2WcثG,v]]saVu|CUvV80&?&m~!o/6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊$^G{1yG&k$&X͊6*ثb͊6*ثWe͊6*ثb͊6*ثb—ef͊/vlR͊v^(vVvl lU8Rl ͅ]vQ.͊3So*٩1[—f]r]\īͅ f-fZ's  u\8rL-aL21J be\ LXa S0Vf#8ᓬ#Kf NBS#~_ 3g՘l[ᐇz)HO:L v1KL~>O`ܦABkG/s\xN?:$Ru4qz&aO?x ?czZq9r d'H9P"[ߩ];e\ q?㔙oH2+$8,lx݈25ncEv0x;f~)Xf)ᖂvQl0ڻdf"\[v P^!; ]raJhWb/liK.[2u,5prN[2mWeg(afK1i/:rӐW bK j2b >a\ӱ S؍89&y46*).>x3O4X-._2bݐJ23%;]bDEd=k\) 6 D7%ؓ 1vnDU}Cߦl1b YeMc9ڝrF2;+Ølb=3٫\{WcJ Wc vc*ѻfO3! Zр~|,^٬B-b1v_<[$;,͑ӫIQS\nU?h,,E~ u' d Ќ<&];"C'1ÌHv d s# 3;ݲ2+.KYvSG\BErVUؑpzM;/CM;(ayjv9F2`3qkfB&}7Ta-OI* 6 C'S{Ff$"ݕP;^2n0 vASJDUlְv VgP'q K|k ;S}!ِ{E#_EE)[*,x>PeVC76澵9>#凅:#X$=xT_n?8 iwڂm$t%2z&y9@y7lD"9'$2x@ﲨ~06Z ثWu2Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6&L$K|4^0y2E]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊$^G{1yG&k$&]qWfv^(vV)vj]Wvl*Uu\UٱCb]\RثWf.‡fLUxU͊t-f]vlUٱCbɺSusWo6eWvjb͊6;1®V*RSurVS\qV똌ULU˦*xYc565 $;EvgYcVV/PW }=EcW pb]0,V?C0o']d{T\r ii 1醺@>[CG&w+$BH{`!d8T3,&LUNE (*Î!Hf]S5UDiUVzdoEhi_uH\w#= '' V#\Cl2k/vܨ=7YTܭbFTA4SxL6ᕑ0{L Wbjn=S' ۩Rj@M*2iu2Z08ڻ_* Qp"G㘤Wx.ۏda5\Sl-낑N@2S` (I=C~=w># [:l|UqʹkM3\[P~ PX̡d%1lL ]4lW ʤ~݆ѯnme (zal`y-G?]cE;ZǜHv0KJE]d< \7㤂2Fqқv>kU%H-K(eag1!2It.!#gezlvSQ?Wf@҇,DYP3+0[;d`C3K9aGSO0G\s Hl`Z;[(͖"W޹u ݕBA[\R;$#q4,iZ9ӫ%AI9@ Aʵ?6T ?~ۺ?4-:K)PkE@ԦZfO:WbƵ#rƬNB>L QS'j:WqLF;; 46Z]'7;.1_l!T8׮fАt;\[9MeVĒzeEH.Z}-*5A;>lpL3ttiÿ\-h<6 UًcJ؃erW> 4dƖ0k/%TALi|UQ`ƗU޸>DpvcԍN;$lSM0IA %)goȦ&3/F;vC[UeWeo?V*׶!u []v.+NY&Eؼǰ0*Z׭7v+g!Br'zS0݌+'vaU\R즣nqWc)Ӊ*U\*xzN*쮝1We׏]׃P8UEF;0]E]Ce@]ƕ;X9dҡ#Jʤ[R`Fs.$ Wb;. ;7]HLU؉%jv',bv]MMW2b쵪CGĽq]CѶ渫ٖL)v` H˕#+](8vY4*2$%ؐ 0+`zMR Aثb͊6*ثbß(N/_GBGyјeG 0*ӏanjPVZN^*.偶h4N8b`WN^(klU偊N<`JVxlxUM(:bLh0 ⭒a(hEP[Ux02 p'(~.}Z%U؞ O̒?os-ů)Dq|݀:YD:?<(6u<K8H,(e@0g5rI54v7.]vlUٱWf]vlUٱWf]v^vovlUٰb͊6*ثb͊6*ث*®LUXٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeLUt®vn8]]vlUٱWf]vlUٱWf]vlUٱWa>%MZ6ٗ䁥ZdxM C߯rHbO\Tn1CUW\Uծ^w\ߦ(p)vX8)F\q\ qScWu\sኵ3[Cov:T&h 1CG*sbD18 slQWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊$^G{1yG&k$&lUٱWf]vlUٱWf]vlUٱWf]v^;/vV*)vX]6*Uٰ+*تv^*b®́]6;6*ثc6o+ ]vlPثb.LU٩\]\.X W.TW51WW.usbb=[gSoɽ9XJqGBgBQH7ȫG\Xb;ab1c(+OL|7hX4Հul݉$"1C gjC.#8Rm]J7%y؋pb +m%$;*ױʌxvP {1Ǻ]:T^wRO_yQWa͈&cp0؜#l#[`i&3y8 `gP)]Y(?KQv+.9 7Y* ό93 !`6N$+j#TosgEǓZeݚ؋&1~03 9q,`C$FlnjH7^v ݜV^7Oymv H .g""D]8Rҩ1W:04&`..9\CnqT7JU͙vSWl4zZvR(AqnÝ.Q@h䱍0+p|Wڛ> d `J 4:t^V6̷qr1sz,]Ri,JyB%zwĄҕ I^r9#myPo]+us%fTеv)zf6N"Ė3(!v+ ̜SK ]crP GqLe^c|ˏ[HGSB!5턒6Kj+dq7L~-F-fF,BLZ"MkdBn5FU*Pf-rw[v8ł+Ԍt9(J8F@UY^W,㌹۱S'6B`>bKt5]?Rrӛ8OveBv 2H~*`^[0bM6;4s$ꂤn{dQ;SƧɍ߮mᎥAu2,3x N#z{s&Xmn3ֹ ]MLfƛǩr'.?4XvChkO@'`xP֟,>4k̭F[[cj,22W{x>?2.m˶v)nqqi;$ U+PzlcVFLfctvjO1:'-դ=13 oͦ[1;N[>=;[0q$Blj1U'1|*ۜa -2v+eUƙ1UE&UTML4DvylP~ &+Fz0s?7GtSՀPsU{f&U=_ZLAUU+Qk14qW /ACx$ 3.n~0!ح|pHҞn8U| s} .0ݬJ v%AA^®TB0%بPpZWv5vqCV<0%H=+ʀkWe%jX|K5` k ~&]ȑq<];%A.JPV|1Wf"]IW(D|~#]1[TPPOven1K6)Pk)U6®#v1IW BvR0+x<).8!@;U}Wc|1K!q5Ib~XA,1V1bb=W p N?k,b`]_{IqivlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊$^G{1yG&k$&lUٱWf]vlUٱWf]vlUٱWf]6;1—eb͊/0eC`Wf]v]1KbWeUٱWe]vV.٩]yXS 51WW51WW51WW*LU͊*1V˦\bW51VSnT.lP*֡ghRmhBU| ^LQ\LTśxG,Kt6<+NqfX8lp'ˀΘM6 d B.>x= 70  WV6Lx*8I* 9liVOWi+bԷlk]iWc]ᤪ-UU(׾[z$s^m:ㅆ'ܝOt&*$1A=vQk r-S~fYo[)̟2N8*Z,Ҹ=A l`>[M[&%PF*y)`V^?Hv7Ad h$4p_qR5])r|7ʣGr02drԵZuPTsݿPWb(a]ǧZV= Ų䵖0|Y#F*8V41#"\>2.#LK qP=C#)S| V#RfFƫrA>v Ab!|qWfl.(vyf)L!FUZ|Z$ ׃KDp9|aIHq8-P ;+M7Ų.~J͌NNM.N~+NPAS㘳F8A bϫDž#r@铄ov(d0 EخevcƸNBCf.ENg%*٪bQm'cPrI.\nL^Av9S했qojU|A2ؠ@x KOl) qby?U.LK>`f'~_ݎs!G~n,AcBF?,%1v@b)H'3wQC-m&d636&JrCl0T~% ڄZ޸ogvIy?@H$쥎uf \F[!%#526mX%O5*]ͩB {ۢ jz{Lb 읅E9 ݤil!tނ[GlnS^v^ٰ"F y\sAޕx0ZSq4Υ-6h5YT`CUzbʕG7bl OoD.͊6*ثb͊6*:tgly(tGΐ,f)QN()S'ÎVzUcp1VnJ -18 P])]Z횘X׮)jͰuuV֘+&มc5rJ 68UIe‡L`1=pæR*zw˯l W, U6wۦ*wUH܇N|d?0KI$T~BiVB`JR05Xh^EYewp JOчTylD0ͷ(ۮKŞGp@:aDrzg'T$̷W [b]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]N**v+)"l4š8i]GvP4>+o.ƘN C6)iؑ(*Mv1v0v7vVvlUٱWf]vlUٱWf]vlUٱW`PѾG%EZu (s:J eAc lT)bm ҙ1V^vU0+bUʦvb qWWU1Ku]1CYluZ8ኵ&&WG9RvlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊$^G{1yG&Y!3Svjb]v]1Web͊6*ثb͊,b\ U٩51Wf!ٱWfUx]\ء͊Z͊,b͊]vlUٱWf‡f͊]vlPثaWW6*ث`Wf.L(o51VZLPblUbW.LP)usS Cs#N@{ufj$bl;l&07(̛S$ jđx`W ve"-2K\s8eN`6>@OӦ[˰3]Wa?igX99ֈ!W/(ks)o4ͅ cIT[Ipbz0Ҫ lE钤kUWIR~U̽.>)qF\ֵʹm+o+.cE; }Q7FZ斩k1 5)oFYG+|đ0.f'X׶X,`vd)laifs\IaM᭹͜Fk.KdoQNfuWAr)dW}UE]ʏzxeS^wP>|ۤZ2M8{2]"LMz{N1 DB]ᨨ9pKGH+YWfһ߆)l`)l'b]LkrU~;ǟ[ SPOAL up\v~'9wuqVM6y2W :06YnXfjxe!j+\p&ΊxVxmh Lk2he4j۶b(Cg{ d;$Pe6 y;d  3n]+k"3v r*e#$Ӱk}Qs[2Pkcづhdp&YnIPfv?,N®f=' )iCqv:/9,YG Eڝd 9 IA.-Yk׎_w̱ӱU[n2cq;2Իw.q\;@bKKy)AFkۛ v%貵]lGW`ѹol0   eZ-M4;9\܊me`zac0r ,b^ccc*,n։g~ u>"FkMi뉚b|]MNiiؤG3ƅ]+h3q'5=S1i.s]\6czcinEzer DT9[-dNUl A.X,Yo6Rf&W`ge!$5=)M`{3*f^u,bt;<wpi9`.ٮBqWc*RkSKx>d;TRfW<5ff;0o X.K/ž8`4an#9ev`][rS|N<%Ǔxʭ\N,L V`Vq"4fNvmb{fV3 bjsl4|o5ern NcV ou! \n-\S [CޙPŢi/-.HMrP 9ܑ H0ɭ7Z;ehYUbwXi(ˊ-\i+eƕP[ӶQ .UA4͍*zLүipU bfL* cI,xF8qFnheoN/z`92 UfIT툻qH /QחPuP}9elΗ}4,71Z7L 45•!+\$v2Z8 ..f_up+/Bzg*5Ԯle,m\:bc`5*kYT$bcS\*6vfPWc` N]WcMq2Cj]H@ bb"A®6jv\JʤU]pmCvXjٺ®Wv0[tɄ]Ƿl u[9M)Q&#vW07k;-:FS]AQ_ ]ocf]\1c.8!1>DBȖRٱWf]vlUٱWf]~MRGB-~lc4[,.*81UbqaUՠ zkmZNfR5U-fރ*4–Q#VhaW}4W0ZK0*þ8 P'1U2AT=ھ֡{ aVU=b{.⭰uZ6r|UE>{⫆SPS^̧jp*Hw#-^AA3w27YoFs 4 "V*zv^Ub?_ˑ K͗a;s_vQj$P6d~k%5ϋpӎdO5@)bXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊.S +8һU،;v3-Ev® oWbRDWWc)]C svރ%JWJe+hk `0#izfk,RϨw#0RP rVC*wDy|p[1fh+f b-v8Q̭((sRȮէW(H nj=|3>SrcFUcغܳp{!L[`Ŭ ,ƴxRɍ1"FgloR3 l6n$i]xi hY议$9k_H,[y+{e]Lm LPZo4ΚN j)ceű́5W-4pV^f])n|+ӹʧ$61@gcze`6caw1Bz|^4@VMijE~`*HO LW V|eGJW' \S'›dk[FvoH{)o+Hhoc"P'/cr ȧcJרȘ_4;\9|>G(4Y.NdRύبkBWɗ7f.͊  (횙dfvaAndUQnrÄlbQ@328S>FK^|Ş01va&prwݐ.Vn;ẄVQ.{6luv md%ɘ).2[>jʵ>٩ZK{uZ1"f^:;;w dqb[0cTȒi1VU|{eĨ<a62,.;{SQm|dd 'PL-sLUʒnyh]+ 1bIL6űV򩊻1WcB [9 R U@ WȳĦ<$ek~hvHwXk6o RFGcH$;m"1`v b3,X+v&BM0%q'/ËvĨFav6G+N{#&6ʛ#H6"f={ &~̋Aq;T*EM;9oM$-n66F$.ok3mː_5njdHPmҙ7n[Hm\in|f8 1VbcJe4iW0ˍ*c تƙƙҮ1\i[+ƒ2cJ؏_ i16>ً!p aN%.RӮaR:` 8DY(C*NNx#%70@-Hkw#|,0R\I%p5»L2 )؎8K.UٖnE؊]` WNZ0S b4銻,|U]$nk3mLP|vXMK(ژjlUQT튻)r늻č]ڣvR$]|C߾45ƒaL,=0Xc]7#JPU7&'SlU"4\U@be}UNث"Kp!B:mŸ銻,L  [=3NyC1 ?oȆRWf]vlUٱWf]~L?-4=-~ri7,a0!k=2 [lp+I8Ǩ78Nl!`TS/Zs1W{e`VñJb\*GlܩV<`Ua:$#vTS),kX,݊(m\»\Vze*,// f)G26ɇ8}t/\\ nC%p%VȡWcp+b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbU'a-I]-], %ؠi] 8ثX1W`I'4cρ`v ڽrKnI`HHv"4^]WW lP,p#w,QmI\[Gi튬2`l]U$ y2Jo0_i>\%mB7!TF G22iGad#—r&;X{_TS$•ֲb؟KӠA Z \Kk%9m]20Rdȡ*av4*좘6 i pWvQLUb͊6*yK[K\%!F*cYICeN(ol)qkj D5]ӲݱKR͊0] eZ遵Q7cq9bKLvQ|8_/yo. sz}Wn=rܲᐵ!٠-A[Qrv+N[qKKv"dS*$}1<[;FPMhs'1:*~Х:G{+u1 Ŕ8A,\Lm<;;Q]?"oQUo$DTxfgC)#~_ ;.*I )1!kayxI݈+KSZv$oebA5퐵Xƿ 4˲MYY;cl|T|W27@:}kN%Ssp>!%6 m]r$qtEc0 H;n/n߾g eN -AL䖰fk3) t8 ƝTxJӳPǀ-;,ppcC@9n AHk+9ݱٚum1-7\04 X&; 0dtE;IeN |!!hZJei 8HjFD$W1D؍hs;5{w.Q's7i!u>˫&-g5312,Kcy!%uszMM<]\ӡÒ]\ދun։*^>E)#6p;P9 |ɫ%_why(NkxN7\؟1x%Ɲ6?vN)(ʁA1n=1+Zc|2ˌ[5Z!V5 b` r@b`նcvf-݁渒Maxgk N)w)j2>۰E$r^F\ 'ȇ`x 95v vlc*N#:U86PSnJ93^oSlGaK~oSwd[ 2b:LUpd«xS6^aKe1VLU Ӎcf@fxi2cAA S zaN=V- *LKj$5 rZB{4j1;AJaL |]pvVӱʈL -rXSM S7wrcd ,2܀8'*'qI\qĄZ*jQlcYMF*쯈l)v8|B`C@8"wv:vbC^]zrVs4S,]G—c(?~-]'j 1* 쪩bfjcI' Ǿ(vR-A]\J]\w$bR* 6_L ቸc*u()ҸcB:Z"'F銸⎪)^; .̀b,j⮮R⮮Y>Ua*SJv8Ȃ'M]~.cM{aK.io1Yd3*BlUٱWf]vlUٱWa璅uX%imH?^u>96I1VJb0®pv#}  7 ]`Jң:JL*~[(qTT*z/Ls{|PW+)\[/j `╤cn8aB[JPcW+qJE{5bl;besWتG5y31bJ}hAsr*觷{4dK<"`gp+Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX]XJP[4v/0K;bc.~]EoEm-- إS};l8GaLU B1BS( RSKP1V!-&<[Wi*ڷM'$%rʆ~P}zҀ?h]-"31cOLY?C mn,f5?Q}TnVD`2|}f1oKhjrDw@d$8tz=i<ƛXz+33$.!Ԧ_I)qA5'zfjxVa-@q Gq9W_hU3]4r!)@N9-~en+ˋ1̿o3Z'F4JrR"- I~~*aC1LQZttVzhbR)#>,,6$UZ©|+'z*xӑԚAk'2a$yRUǮ^ Rm aMGXB\g4'}21UU/M#4rS^܌bf,xһSK1WbS+.X}J_lPJHi]pcH* v9 n]-P {iI(j:78R+(us*]\j8d偊)`bSqʧ*9`5\no6*p\R'LRshs7G ~!a!0͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊$^G{1␡wG'bP͊(®xRثb͊6*ثb͊,b0+Wf]5k6*إxS ];6vlUٱWf]6v]0+Yxb͊6vj`KS;51V P告]\ثg,brZ'/k51Wf)j0+DX\RsZ:ʦurX\Ua58BlM|K,% V،zt ;Ui)]]Ȗ-zKDTaΗ=iJuQ4 a_ A۾rRgbIo#q:?3t2RӻjTxyH>#l&|*&H\ܖTgȔH@]'fvlz&d|cUvxv2 763GAvVd.Z\d㗊!\v#-2 vkNgnXd2W#Cz|{.-c+ **+܊e2894bbS"ZёErIUc1![o$7rz2Mb(Zͣt!b 5 иbvxbps7,/oXU <3gWS20~ڛ0w%v-iԠ%eҐLٱWebZo\̈n(;욂:e֛1?_8yPZ>, 2v2gZK*Pr%]vW֍i$2 AtlB|.ǾbSצ."5rZܬV2l&bU؜NFGdA;\בKSae'wea3m؋ T1(<,v=n]6qQ2y*FyCWlːL`K>Y~x1v ͓{aWeRyB {I*;xfFkvn4,G*`R 6+N@x]qE>1e4HiJri`GsK X\dQ;dHzz]j dn,͔cXI7|t/cd-BBmQ" fkL8~WNWԾ+S]ݿeW \ƒ^\~xZ5|*i噂L1+цS^Cx؁sすb26@f]>.|dSYl]J`_%e'z`0# U+%@Mk+]9iv87`j2^q ]2\/qM+ߨqWYφW;`eIT;+uCMLJK9jQHh`5ẍOQKEzˣ.(69<%v>K,X̊DFlhśCIB2@K=GlR\k֙G:WHL&-"8m]\R'-wurُ㈮]\*ܕp8@ܚMPv7&ȓ"؉|pţwȍ432&'2'k,Io)Py ``{/*o8 pFcfV!+e3oH آn+Fu%f6岘A.īޙ HvY5팍K[krƻ!/if|+]qۓ>0X&RbM ``CqpHTW4zRa$l."aUGL9 抿*0O%Y3+c8_{?xB8 ]-ʹZ P96,XP mVT-FV?: eZSlTDG *rITlU>p`з @9sSe`Sl- 4ȥF"Pf* ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWv,Ri.;]aWbm]{aWbmLi]WbCk- gV1hɂ 4VZ2ŸiW".qٴ1ȟ I'O8AV4fkyHē)ػrMA/{= x 3k_U>od ,|d2Ȏu9ocY'K3P:^C:)lm rMTW풭q4u(&n&lcC+-aF7^ZeʝpFq8kޟ9^IPiGRoS[4*CHHSorbʥ6Y9GM=+Sehv +_eӏN/4ӋA4?K~KluAjPݟt+ f?쿢b٫[JVd$J*' nxn)f>?s'G5GZ<ge:(^ .K$(l-[Fb2ZN郵HXIT媷mxT!W* j?_ Ԓxo Wjr2?S @htj4<*qymo) ,b;~oroq:}peg S^:=JԃֽdKcеhh{S -izO\ 5_qf1B!eMe 䵦 `Wb2Gu.%0!ؖE]vX4]-06a]<}Wb,).ȦvV*c0 ҴPΓo(4z0 ('I1R8\N6bf?,Ulec[e SX.wO 11݋HzF_ `ven$cK*Jv m"Yu2݂͢ز]sab]2،ɔAA#1rS|sdǟ`]Dc?p¸+ ;GrC͂V[dMuO=`~.`f~+/[ZwrictAL);CQXJ qMۏ|$-gwYl;h1N(Ɂ Yv7ǘ.Z)e~! S^;|hgI%x̹I~~?i|ٯ/+["K(3Ti\̀ 5(I<4fIޘשFlS0]{eiKGPrd`-)%q>G(bQnĚ=/(0@;-3R#v&nE@ʎ@lڦ0^kAdݱnּ~[zrQmS/ +n,LjEFY,7j'Y5IƥglUaS0hwZsOlVh@V(qdR;k?hP4iGALӦKA.)Wqx3-dp i\¦u:J$Q~4HWW+54ZW;Yj FhlsL)lf+pR*EGC.1Cj~U٨+urb]PMNv3 ) v;bE(O|i]UylcMJT]R*0 0S~J[ʎ#{ iE]/Dt4Q^VC?F,X? 6,!3O$I~ ^ѤMW_8PIPmdrTUi\A[glDC<>ID*JkUS_XVڼ u/6y4ᾩG2z)?R S٬ 7 7dN<L]= w߸nFSͿk+++2 H#Z ~oAr1m- +Nk.|F|hzlh$&͈'#c+!.EPZ(oK2߁s@P0>+WoZUfyG`w!;{tYwXbIܚ|>xU֡V5HoC_[ Y Bi m"PATSo_\o6rq(~oXf\%?Sh B54 $Tƛ:ۑ},AoFye\%ir{n<ԃa{7yVm\4P.=2IIjEYG!(VN)yZ0 PSzO ԍ2*K\kXM+01\V\p+UVh Nf逴6V:[\ w"iNH KcbJ0)~-C2pN0[ ֕Eʌ6ݛ%ؓ6at\$̎٣-;[q<"dvBm6aS8>y! =42r6)2H[$ՅOoSrTgU)Q% PITЀD3E X]_i|s;ASIΟ/-uֺ곞Jw+pޡkD(Ԃkfh+ EI[Ki@8lۅ_c\$bҕޓl`6nO 紁€Oħ˓zE.zקOMȿ|̵K|wb?M8ؿ_fYx{%UnQ*MAڸkjk?k[# nŸPG@02E]lȔ9v4`W:7e !ANhT0k_*b1Wf+Af+o0]9`NY®VxoD0XWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊$^G{1␡yG'bPWf]vlUٱWcpٱWf]vlUcv^*UٱWf sbͅ]va/]RءٱWf]vlU٫6*쳊\s]vnxŔ]bf]v]1VSur.9t NXqbI˥1WW6)uqb˥1Vjt I9)`odż}7jh67.y^чlyq;0 7H}a͎Y O-^sێ38>'; z\?d|q\ _R]]' KCb͊6*8m~9bیcB˰ɹ]*8=8zDTqƙ;Vt2HatfN'TeI/9wHn{f4e[ۣJhq,]A3V )Y! ARQ;Hn#ZLCڻbh$j\%AB8$ )_~3dbl<책Zn VSv%G|U-ʢ0.!ql-f]}jl%+Ol• 4(dL-Nީ㎫btQhz`Vݐ&%/ ͬP}0- [ khuW o -gei:ܝ@?\Z+6\/L+Qij.lL",015e /LTvU5ra)\1'BnX٣E?˩]]_ c[mUĥs95eKwvWVPpvSmv4*F͒WW2U0r ȒF*wS̼@߲jy6j1DZaR[8mؤe~(GJO54 Pbݏ":`9 'od7^YT&}fyyoZ2p2o\j[L҆ _̸ψ3"ۧybu/OjQM(0hJ F_hc`I߿OY^9ll :"-w'3-<) vP%Yi"m2^ ,~`rs5ď+ؓץ{f`2|qP]_!rM֭#`ORU?߲فn'!!v;nGfu@4YwT4\Ó{vGTwC|#OuO2 5rEƹ!We#G_CŋP2~slƄ?x,5éA3b *FH[hZ%ꪠ$ mYl)Fu=[q?@ V ܷ1 "6w¿UpΏ? _QrÎ4WonLb)R5'0d_$=bߐ{>wS$il%.iF1TVDъ ?HM@#ViZ9=߶̍Y?ĂYp&.yW1 P,H@NC_!uE!l,1niMO-FX+Np O~ !KJ&0w+4Uy(ԃaa}23g1c҃\A*CJud2$ XKf)Xً 4WXxH\ mHWo$"0C2APmȜ@|U/#䄒v;T!ٸH^D+ǏOyfܩ ޘӭ*ۥj0}m-JBt ~ٕ~5NcQ*Ҕ'~\n%EpF'%wEv}*_X_g#E=\Hv}YqGw zoGq1x:T/ߑ}CIF ϡ̈KpNy7jPxٱWf]vlU)vlUٱWf]v]0+C*ثYWW6(k6*UٱWe6vlUٱWe]vjbLUxَ* UUٰنjxbf.*PXZ'/jCN:i8i9tZX.Sk0_ U*9t)h0*Yt† YƘA"\թQlp+ &Wc_1Z8Ő(k=C1'י҇Vc)%iO!mhԊ[ L*[кO\۫Vci>Жe+^ sRǾvzt?d|IRWd bK69 ]vlUٰ+Fe`N24Njgd%D>C:Qvtv[_ns*'^d|&JdoFy̸*Yj] j^Ɲ22`C_j28F1O !ix`C1V^v)3,iI$4LyzPU9} mm-^8d[کm8iZQ<]Xc#5ʌ(lB_ 'wT;9(u0LWهә|mS<Є ll R>v!#żhj 3>}CR]L⮦6.O .̟kc7ajR@znv`$59 $GK*9aeb;Sxo BKNdwA Vv-먣eг..2R`yo<;e29+d(^D._)v @̑͐v/-Kq]pNF]\Fl|r㌹.`)F$o* ?%1uv*ẗM;c_ B)`yV mUbXfJס#Ge%i ]E1Wb2}e#XFcVj'bx2MT1$ Y |<وӱbeᛱ>hD; G@F#`W{ vc ʽkc!:&e%}A~l $8,U ,m`&If;Վ:לhd=Y˚K_Mu?0?ӗr?:qGP_ٽv}kkh?jh4xD ?Н2:Lt.!/A jIe,8&4N - q.`1pybF/j9'H-F7*c8&/.%+Nz)6 Wcli]ƕ^*4cNaj>橍Rٷ&0>fO8qahڱ(-Ff%ɰH. >]v8XobT^B&\f16n#4žqUΑ<'s@&7҃KZaTJ m]k$\\JqqLa<˕*'L-I$㋬-sZ[`Uv MG]E t(w#c4@*pG)[<v%,Gz`HlcI䴮x4a c0aV'[I"Q:i.HT'KtE5:MZ 68׶nfE;cLjGZ-ɇ]We(8)v7цU4rÁZƿlU Kx-ؕo* w8)튻e1WWO^CcLUBH9hok0HlUoW )zbǡ$`WS)hĞTvWRp!+5}LULSURO`*ʐ6*ثb͊6*ثȦ $ 36l| NBLR;O|U)"UkM\!V N׮`\UG| 1KƵ;´-^aKLS\ a1BޘV\l eVM—st\W*1m+T*4q+˩:l\.xޡ>_!ab餮E!ÑAv&lṔ.(v7]vlUٱWf]vlUٱWf]qWe®ʦ*X銻51Wf4fN4P[1KNvKN/`Òv ǎ[aVMqZk4Yr8tbZ`*fzb 7[?lUiRνqM,7=t'݂EK>Ÿ1j!e8%$_"O҉)u,@{ڿ6㔍\O'&:N/hz1Yz?(P[}zS-Y K#3JmX/-PFҴ~}\.iG`kQr:Z 0W6mg &~Lxe@m0p'ҧdr|%O;}>:~?r>%?/ R PFނHw^ ?dNKT1dzϙl~$fwrIcQWɲ_ªB݅8=:Hԣ kl + L8s(Sd36݆[Ȱ#ߒa#_󒨑־mq42[N?NcnXQm\Zv#I k%X ;_[Thw/Q4}9B%T(TZ 'yJj>3/߳Y44UPS <դ}v.-Yh=?VY?τQUxE[=@J&&8Qi-S''H40-- RvFp7S90VsgBNHO"Iԟpy)wYw*-''JZ{P*.GrUЮQ|vigp[B 2!0WgG5tP_n4o6Nk:4Rt@$>Չ7Qœ[~z:0xzrV4-pǓDv#s1N\Gc+o|A'%[b=>;lfr29Ri~$WZH30Tz7%o\YD@;}WE!E`j14H5p?`}K лmtdJKOŸH  t}yP+&m]Ycfzk@)O]]%U\ExEz~dy5> ˜rGR Akۯs7+bBEiƿYK|$ڍPM@Om/bgd1m0ޟE*K|B b,e*vO72ɜX[-WMB(z;Tѿ^BpZ% {'RyOrnV)f:ɵ< TWSĹahqO۰[+UJn?Yjw1TVO i#nYY,xGW&pr*<3<3V3vd|akE\UcvinLv9rj;]*&Wdrdo8HC]p$|qZT]\u9\N`1WW/k*8늴V1w(^@T:Un^5c?cq,G9~R0͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊$^G{1wG&jPx6*ثb—eb͊6*Uٰ!x*ثG6*lPثaWeY;6*ثb͊6*ثb͊]qWf\rVb͊\r*X͊6)k6*hbf*L*pN:í˦pi9tZ8.hp\ULu0+EVǪb%1T+ɾ)PE1U3R̻m\VF[c FKSqCoc*˺4R<s+H=ay^r}dOv`2/`ؒW ėe`Cbf]vluvIęXWͦ<>G'Z0_Q r{`j e\s3'(-asvkQmx")xEɌ;v C5ʸČhzjhe 吗(.hs$LX&&eUv ;>x[ (݋x> G#366Ҹbs-[)y1oH#yDŽLY ɁVpoa)(~C  tڣ+5OZVr e;W-ÓBmeq 6iGS1cmE(rHE#HrLڦ5%Ii.ƺ+0W`I,hjx]M'BCPϒ,I)L۳$m#8" GnWsfRJALƑ5+CKJ)&,ons"ٱK6ħ Y ʹ!Ǭy۰>$;ݓDk LCrعfH R]Tr)w`]EDq4l[ Q ,; Ü̷X쥖~>%UǬa=Q$6@[hSaQ&cgcɥ늻$ =n7DĜPyeA*8s"&;*JMl][=3]L chë LIF v,9!gBԦn`퐖Ad~UjPi_ݰHa=7^u(SL,gPuS9+4#Gg>pY[@S̚͜]]3vgYCPW4V}XMSTTf/-Y@/L.+5EqZ2 l=0<,$IWSY鑫B869l2Xɾ+(pR]Os #Y ®N9$2Ǯm4*hF\Z?mF3,]OQe sZE0."1`Me+MA\r C`[X7WfZ9t'evU) hX*2|Nl!8vnǐWb s$hhj:ދȎ0Ž"l v1d,v;{eQ 8zdg-`٪ Kx2 pW$N(GLG2h>>, n |sTKjaE;u:S$\^&xFYZv0rG*aǹ̩0fNn :@1P7 ,GSHaŦ`Q#F@C%k DߚF. ڤ)bX9mvHc/Erp3;2Wi iCL8bc\ـ4Y%j bI2v$dU'vW+*PU6*p7Jv9Nqp?a!jb5IڙfUj(| 㐺N31Xݺ lٌ6>Uuc]ai;&^ISbBWɏ6pM׶L3kLr-`I*fs(\`v­t~H~c2FUG\m"%Ͱq)Rȫ`n tCtbȩh׮8ba* 0q X|Ba*,E:`WezWp]*qMBpx qD |p7*aKXqJᎌqRW"R5!K/S c ol**_gol k0N8b,Ilp]w8r⣮(k)oڃv64|Rymv cTb銴qثUIb0[ЎGqKY`mLU=CyFG\UҤm[HVvQ]Ǐ*p~L*إحj0!Zm,>Xqb=1+X&M* P6*ثb͊6*ثȂ $ sKg?XάE2l}ZTuk[b{x(Y#aqUhx卖vQ5;bT, hP~T 'T|@9_.UkǍ*ViZVҝ2Ɲp­Zb ;⫊W1ipӴuGsHJ7ۑًI'rNI$`t‰URobA,݌l #b%%Web͊6*ثb͊6*ثb^JW$a]t]\4v KP{dUֵL<)vZS Wci ;cK-:quqߢ\m튴X`쇆S2bkY╦ap,3@S{OЮ/6+AmdVyxUY Nӗ~?8 ҞGQbb[ߎk+趤iXRxTsL5j zT?Hl4 S+<~/.-Dw?nx[MA\=j#@Hp Ҫyzi#s1DtMެaeoYHoG'o@O 06R&GpQ߂'Rs-qּqJ/ɑr۫S#0S?~iw` _+KԪ\+)3uwȝIV]ʏ!{2X^>N\%GZ҃ySKK0V4~& ?NgnʓdeP_v83ɞaȵBJx>\*qlQ!c˻PT}6']Bǘy`? pik_PPݣ_Mȣ(n[$FK|Df7r @)>/O03<cJ (M1eO]<1!RJS6WMi2̤OOÖJ/51@"dw;x+)Ilۃ{GPfu7g Ě\hszNzeYTƤ cz}'c ZSpm#2EF;{.rF%lE%j$~w[Y4!\7~?/g^<~5-74++_sٲF:_缱oꚴa SVNbP7hܹS2Oh7jڤ~׃|9>!lpvt7PsvJ9qeĖP33ScIW2>ēͯ&H((2K%s}|?ՇD\R ʅ؎ +i|Ŝ*n17}98)4; ں#~,쪑H&-,thFT W9_$%!Q(sIO(^E"YL" Nu?e4O?Rjqu`(vxQf_N`F||*8fZS pV ?Ycb~.Ͱ!=&S'5rirx=[0L~!)Gx.8U9l5Yڣi[#9ȭMue5-%2ICW+**q]\Ԡ®U1VLPrK`iQW Z'Jk p!MXWE9~T6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊$^G{1wG&jPu]6*ثb8نv^*]LUk6(vlUٰ6*ثbf]vlP]Uن*RUٱWS6*X]]^(k/vjLUUiZ9cZr.'/ eU/;\UoLN8RVz 튨*2I*(qԩ\JU2wZNjo\ B;W=xR=q`p! §l 749(sUFXs_ɵKcr0S N+jXvlUٱWf]vovI;E(_:!1ƃs`6;WfAġVV &92z$4S]6$,l;{G_j<NX;ppTd=(bq-I'U|wrlUغ^qW%W=1tum-1;J{` 0S `cDJZlW$CδrWVUB ӦkHX.~Cff D`22cbolu)-Z3P69 Ć]fv<(W=2ԺSݳ ߎ K7_o@pǘ2O C.;r$~R];fK'fvX9|*y@E1`A6?g/8GLɈLzAGzf).ĭ䤋QTeNٜer\RBKO>#Vd P 59PvL̪E-%iؼP* DY;[-K>U9*WcI—`[\V؏ )^1<۱GnroߡY?iwcdxz!ؤP7:exM06; ,Fqb8-mrD8) vzf1bꀞd֝1'جnd!TTfT56s#$ظeEg ':{W\ro~,%\ζFz`i_j*?Z\N8["tZFWʆ81h1q!/Yp;Z*+x1eKW/$}qUseuS,}t#HhՄ(0k4$2qr)r٘#LqjTsҗSٮ3t8XHٝG+p8]smCQ03 vRc^Ӟɰ:1&$ +Zr2 bl21OD4rOL Io#RyC#;pL 3QE;c'aDxfU[tq++Xfe4Q3qTiws'\x4fѣͶN"JMhz u9r okUb. $L,mX--n卭/6knˮ_*cl|7}O'`37VEȫYVƻ|UUǖWaviᙘ3G-C%^ p( 3np):aWe̤l*<[\UيE]zrߦ* J[lXaVL6œZ+m`R*P qWe)?;Uf [*̭GÊU=We}R^݆vQ`0+.qǾ6c mZ1qC6UD\qPZ9LX¸Jb xqVU*kZ*x@$[HA -4o1KG銵M*`zm fp*&X c2!S6*ثb͊6*ثȢ/ BBW4kJV;ðƕޘUrcN*Msn:W|$|;zW\ )=qUcbU{ns6F!Qש FqpvǯJUM4i0*;oثCl;aUЃ(=1J]k\UgJflFmzVk R|E.,K1;ɡ aUWJ|a 6IJv_ C1jWcp+b͊6*ثb͊.We p8i4 S -; s%qIa ,~I[ ziu+FP2H®/mP1Up -s4s *cHdx$\@SPcA[K#T(|oב EeW/ŘHo?$+#$a) . ܵ[gS ; ):3 &^_, 8HѯJP㐨Qn$-Ƈ38 vQMۉQE&^pKFiN[pnq̬9EuAVue;;IT0/Oo+*0M @{fWBEekRU'~?/B߭rwlֲ/^#YwC$BEsygIхI,jZTd/Y`bE9ȼT/&y%rX2hGMS[I*!<g[N/VI~\XG9\48>Swmj1 d q:ӿ VH* OJzvT 2#rj -}5q V؅ܩjRe <ޛD-7CZc([n^>'z|~#]jиXmU Y=!ཊ\sZ=2ZYSC_WJ2enkM>YbwMe`M.`=S*#:;}]#GTu$ %1-QR(*^_|.iVBT)SZ-|{j\UX&̌;6_4躕qBL$T`MɳH(B4_T֡FY<"Q%66E;+Hދ\O)̆NSWW(nv;"#cn"~m\SًGhd5*;cT361A%vjCzƇ*5Cu`rDU`p3 ٛ I-ؒqJ%WuNB#GCr4*/ J]@L c֙5v& 'eSj®MƄ3Q! ~S<%v=cg][''o]CJ1N"ktbtW;{e=lY ;Nle ):d]%2&m6Zd$S`*k#!a;[+C$&p(#|"#\{bUMDi]ApNҬ*>Վ`3Q2-dж/_56mB傐(*I ΃$ka68s_TRu7uPi.T8C[";6\Eޟ .nt:Gt8|,Ҋ)=A6V"#|N1; j:f6~+u26e7\LLٍ<Km7V5t^'S@ 3*8ҴF[ {% nBbx;R-b/wN?2;h7Z5t¹oCrӭ`x߮׶?pw#ؤg)_'ѓ4P7.vhFf( 2D}CRk샠SA.n2dEKx13fEn]'@0N]ץOgl&Un9\g dk.bE阴c.$i ;&Ij(.ػNE-E5q[vjܰ,Snˮ+ 'cn8 ueEZP⮮gRW|P,ˑ- svBPkfc`{fEnbB{Pe-ʶ͸rQAQvbDeAPE\-C0rk^UJa|׍6j3je97ƣb5\aTV@E1W DS7fUkqK\i—q#j:QN`$(u1Ŷ{b0J{5Yv87 5\qL]ml S5)\)jkU1 l]P6=!ծ4F젤0‡cؖf.UNJs,1}|jӯ| ): ZF:$eoP~,)v*iz|Pc1VlU'a\ lUٸUlUzfh8ƁQLUNm\U*qWQ[Ǎ*mEN]7&S~Ja2W6*ثb͊6*ثAA]bAijuɍWQ|)lu۶4 ToWhq`J1銸q^|rF1'*bhFLA#bqVs%~x@ˁ #UmߖYju+Ujv܊*hhqث@(lU* Zcxau=&JcG۟ᄓBfeUpV4| vkC$"U؎vV*ثb͊.ʄv ޽p]O 2Ttq!iełNRۗA`XA;.Q c_L>һˋL$V$i0`,bh+KZ3sWKG6^+Jնr@6G<QIg ]87ZUJr >*Q|܁V^xȱjwCVV2`;0P<՗~aU)-L+ۙnROe,Ohr6e:(s(̶XV0VWveVvyٯMrIPO_}-;b %j r<}ڼګ7,Gbʓ /C_{ӎ,Q hD-4Xt5Qkcv$p,BןG/_Ϛђ~m!%:*haZKmyk+Fz)z,qOz]Vm#"^~0@s/ Үn,4ku}B3(Z1>_e~1y28C o9f@zuyD"zn xbcP:O] _s'rkZ泠2_5^ihe黔,Yiϙl@N˜U+*c=OeiԓN15KV&DخCUQd`hRF~"r!+{&֧gb2W |L+{kR?j_O ~}Jt+[ ENȢFrA?ksr27I$pO?ۚQ%uxL|3ޟtVYԺihyRy`m#*Ɓ2;5,j#nz$j?d$_Ȧ"P~rhвtb|8Z7OoâӿGS~n5{B8i]e ɂ0tR0qr~2P{ ez;K~$UzW"<]AeoִYfAU%\965nS]7 )2!%E<0o#V\r].[ZГoV^aR3A 4p =k6U,BZX0R{{`[=]A,v$yrELh|EGdv\UkٺV!}7[KUiO#v3B8/D\%,b)Prw à[G&*(~/_ߗ8)+SEܹ/Zֽ6?43–4 Wj'ਖ਼x PB6xW(5Y-[m L{D$St,i[rJ̬ܖjߴ>#F{k!iЁ) {{PZv̸@Dhذ kw&r֚P@p ^?&V=LwWWof?f$W$S#@fv~C2JjV 0>g%6zs eVz7χY^QHSt9o̕B~LvRV Z/^CpycP„fdbٶXY"DU7lz,J^#Rߦ.Y>`d~d%L1ӥ d»&e"(Q+ Puh޼?hVxbXVY}:;#BT16,*0up%Wn@w8VӲbŕ;.Rث+?9]Lb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊$>Hz1䢐wG&-J6vlUٱVWfٱKbL*xcvlUnlUٱWf]\UٱWf]UٱWf\U٫6*ثbe]51WbW6)v]1CYWeUٱUUٱW`U[—e 㰥Fnck8ክ8b8 PRN=qUqD]Z,`VE1U*<Dw\UVڣ4m lV<1T*W>%?џp正)|G.α[͊6*ثb̠ -^ j{:QnS\L;-iv*pkivYvNBֽ_5;n2fqC]aE3]0M`9FӾOؠ8অ[b)<)=Wq1_&4p|3\]֣ss`DKu9[7u=GLv92Et/KY—W6*`;+|)/zv|y00+{! [\TLN 2Y-.; JlN8eASe~oNVl`RKoNҵv As2D2Vpd®͊6* rYklD/ >(&6<׵s# `KK "Gᔘiv"dz]»fDb층Q풆H.+y>3*9Yq;RpjdFW.à+$`[ނZ#ja7`2)P濗1&`f. D`&3aMSCu& ،ҙ,rbb@Z9kv9(W%v+o]bz{dhǙq;,|,)ֽpʤ=%.D߶aыc1W$.:gܲਉ'*,ik.@(ᘒ-u p~Y|NӜ˸mhfrpSGj?j쬪$ Od[9dLFg?h)ᑯ7Ȋsw XC!{GSɡ?3^|=ȷB+jĞCt฽S68$HKP8+r` $8M%>UEe>p\|W\!-ZozxqIq)i^f~lEy%XƖ#Lm9Fv=s#M 6)w͠ kH~] *B6X[xej]mٝ;ĵw9ɬ uzfQv%żWv`1WevU*iW`;rH9b5449d4 q//f-`q(o/|*VA2 0 )CZvͯ zрlJq9(JcHōNi#3l e2 8ZՀ$g(\- F8~>U_QcAhǫ!B]q[ŋRPNA)A sBJZ{l>9Y 6AJz ւJ<4DF@S•yd1NAizs.MQݎaR6Xve#|tsG5ZarJCB$T.ըf_0 h. ½w w _gw75'/_Kbiob dXwWTb牯ɾ?+xeZ!ېE_g&6k,^%Bo;@̲}5FI+#+%zOS&w,-diZTӐQW"/Sn!{t= }iVm@xzovSJD9CS֞ L&R%~m+U _Y8M+[ZDYʼn-7W#rPwI@*|w#Z;HJ|?ȥCq!ZUM҇ 5+u1. ;?e'KvNGǭjzuԶ2; Z> &"#ZӸv]ZCS#X/-bU0R^^*kZTFj-+BqO5IkAFvٴ |6ZAkkrʳ ^ӡ>pCUBxrW\Nqf޵6 Xu+szb!v`T~+ҸiIUTR{5tB`TG3R΋{`໅x94!?qW%r[}9I|jwZjHW = #%YMA$*Ǧtؕ|ɦEp !Ͷ,ԟJ ~9̥cfy2G\h ].hO9y/ړy}ՑOG'i՘,ƬMI92F 7/IB+\Nh 9а54l܇Sn;NGewBPc6̑4&#Zρ.NIu2v%,(OSJfX) "Jq?ݡj]H-Hqw"/{fHG?b:I%ȲؕU+jv\Cj6XvlU٘TdHOj-gb 5̬^`ٞ{W ӱ*0SE?~?Wc>$f 9 ycnbPhI#V哦ecE#`<3\F]Bͮ Cti#zfId]5 3f* \Ie 3Pyh́׍pf4r&UwvKxNG#m!ٶɪbr&AApjsSvmqWf.ֳ^'mpeEXqr\0ے٭ȓLKcb!vbp+ָ$: K|9n;$RCGZPDݚӉ"rHR ˱4!lP`9 8R(FI.eJ U^nƽE;I,kE5c3Ķ۰QiڄUf]s_m.آDrb-OOK[㳰Pl?lm #ce4*pˣ[b/O|%6v"N[Kv4]'"XٱCb͊6*ثb́]Y(7aC>.#/l`4Py5HV9@ثXp:u\qޠk*2S]Q8U|cb[ql;bbDoژp$tU؜U`V6׮pxT>,Rqq ApHtk+)m٩]\F,]c+-xhijAKX}®ċ'b)#*q&1cqNL~,U|`R*Na  fH$;Z8 q]Abj+LUi]1We#vQ*pbH1LUu)늻LUj|UٸUEEv[doLUM C]^X&V [d'(BlUٱWf]vlUٱWa?a M[Xae8`jA Qqޞ2m^PPBkœJjn:VߍM!ԮRZ|UPf-5{P7߶c)r–h~(\~!cV 7mE}q 6_'6W!]OL(8 ]1UpiUW g\ upƕM=R)l=0һK6ƕزX]Kli]\Yt;brX*cUA"#7`ȭi(-T\VCi %7BWQտ8|1J\cYؤ?.ǎ?ZѷS!u|wsaxWm#7"B%ߔ?G\8kgs0W޶+|]_@,.}F?i?duaUy`ǗQ~?+VWY@vCߗk"yB]v_Ui2!J`=Y6v<}d4TOnCuUrjVKM=:r*A?PCj#Xb?f._lԷrrg,JRr@fY Bz"۱aFw])m1GMM%u(sAB~l}ǘe汷Td@|%WSJ:B7޻j_:D S_H].x&(4{xBcCQӶdI`TP#,Q=Zڲ*[?(K,x)5!/$q^(qZ_db iB>aw;m/U[ aїN̿vJq!ZО@K",'̇] FkbH_zwނCl{2d6R+PWP\9P*6j|7ΜKwnL¡M@|b5:Hx)HTtQyCy m  SZ|?0?\%ڕ^cd*¤KrF^]OJ~uoyԐ78 by.?_D%Jh$#ztWӎpPjz\BҌ:Y4^N!y~/]%RABKɩŶ=GL\CRKTPM hЕfhG;e(-G݃2L>FŒ=eOڡW9 䶵0v9xGVFg ~C+Ǔ^G^`hHTU+SOx?/Fba p0aq_Ց{'_[PLЩ&6XIJ+t݈,\ǜ L?[ovJIooKEdf x÷Øֽ Dѻ"[OMd}Lz|.Q*9A~I^:cCM`Vjq(\Skd2ޯ q3;>! o2X=F.`|[? 7_ӷ?NA]Gh")v+1~N\ d`9PVt]GNd !W_ݯ¹VDɓ"DxBO'as4j"{ht5%H4F 8}jUzUke2d! sSc5}?ORU[ UX*|=Vh@*_g1RQ%ʢI-q`% 9;wu*+_ Y3{K&෱̚T|!NQT.?#pRq "iiOFJ̸5!r8r_T.fFB\MVQ#QOOujKfHpoO\x0az\xHj:׏Ņګ$ũۊV Hu~u`J;LVg<=7a N-T?X=²} 8qK> U90CH5ˈL[/ Nu2 V>DU֤uN[)]l=wd ѭGZ;7//jo\POP(oޣ2%>,H>)ZWjd+͞Hpy&J?is'o̓q8bmр"ah6H昳ț$O6PpKqż1VlP㕊.bf#;6)vl*ءN9NDƿ1)`]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊$^G{1yG&,J65p+WvlPU٩\U͊Wk6*ثSvlUUXb\UٱVhVWf®LR1Wfvl lPثYWW,bf]\N^*LUن)h`C ULR.#0-bqUcVpZqbIǁT1Bx)S9u\8F1JDcbS `0!s5i)mh:S*>6…+V-+UGQBPՙ1s D腾~?oz2t*lUٱWf} SN8=T-84)d&b[26AP. %uAVژ^A'ʙD02U\lb٩!oaшsҭ4N {&S qWc\TR =XĽE-ZF?JQTlˈ%طZ}bv$W~;qHq;zr5ΟS*ej1<[Jݺ߆e3v+I>.AM]¢,f`[S18cbfAJ9Paس=3&NƖ%|qCW*0.EG!:Q n1DᏄlʝ1| {-<=(v6VzReyL]p FGb`ubcbOtaI'`YsYY.QMy6Gg`J̦n+l¹ I6TCGXS2 sg+&-a`\QOAxVHp#pcSٲk%.o6CEPOݝMޙ2ҳ4>P_דl ,/4?r*$I#ȊۮKB=N^0}Wjzbrt+:*.m=4\ FLLlǦ.#:mrabKu%aGLF3k B֛],e.HpɁoFTVu̐;ť)vKQ˹،75<)Ts u1U5CYdbq8HW.h8Km7P\Zeypq bC497.ص7KG ;͘ɬ{u0-\BAvS [*챹,һ*Z/S64q> O5u1|đѕrVWfن4bEF[\%jgAqvKN؝AUmq;撘.X]`w-8!e'ޖ D;_*US+h u]#aHʸz HPٺQsD5NVCnNv*L'brLD&݂9*П|D une^@|YSI)& nv5+N6al Iv0F۱X۱Xebebe͊6*ثb͊6vZBchjzSV+!qrlVV=V8pxƈ|]ǀ;m.+@8tbT*h|G­(]튵J^[銶6ǴF)urj =qC[S®QӾ)v5 zbւ/p%M1WoF֡tieP^7jNv8 jEl ko)ShWsCFqu1E Zˌv'| lU®Gl*xMUjnUQ\Uمks5zo.$P] kLUف]w]"68yq֧h|UZ87S##v8EN*:E)* UE3}B7զoՀCLz|B*f]vlUٱWf]vy:6տg?^u9cc'4˯LU=ء˵z)mLPvT® {UGlqVvi8|x}JIxyG"}'ϴف@\`PZ݈ ٸBP}p_;RY <Ƨr)&p9!EHQg1e*ʱ& |qeQ"T׋r⿵v<ĄsDͷFF(_CA1 @"Ēf`DK8o_o!z*9!ZƴHJFm-jyDμi~G0HBVnFㅺJ`Lw=X_&c^3Pʺ{V?*9*"ޭ0\#YΤCR o9IV0n^Nx#4ЀiRy/,ܿY4>=jpO^wwZR2i8QKUU|kc"Wa9kB^FڦļvNvQK k(8SOqgҔ^ѐf?r Obpaca#Xȡ;闝$O& m0eK /@@5~aP9-9lw?I,R@ UP:T_1fUsMM>D(#c2cCޔT)Fۜ#6o2i R>Nh^L;}C=F*8>JO-iηNjd֜6__er-ipTm:dFO;9 (j>9ٚ4pĦU_dK\{q8#~0U?!`U~@ =cMܑ%y˷̡Ħc3T}baJo͏";ĭ4,#]>Yuq"b|*9ߵeb gbI\CΚ} vEHv #p>!FeqdpjFxdRV'?Sm҂̽7BCg^mQ4s'OJf.B'l 5jqK [v/-`ukWl#-S5pUqCyL 'r5>sWPaG"~%ev v|ǎ;= jBxWH9L9;jG^e>PBKyz:4gWE]4w_\R;c_9h}_͒m̋F>5NKvVw*Fv zR2aة̦NFءp:Hĭx3vVdq}8e"7vֹnv1?zӫ,[G߇iO<_-@޻Tɮ/KT3ڐkeKnն|5uqjy oڴZ8D:f@2 WHPumL9 q 0'8mgOela[9xv(n_ f(̱1@^4Ɛ35F5GJzu}0ʍ=*9+f&Lǐrc!MB7ޫǰwo3^kNskĖmɍ~OjTN*rJyrB/RJFQocWr MFYs˗̐[K)vA>7eOv $E .$iܓ׭H\3ѥMSRB5?~'8K&S"c~>B_q䶖T1kSgV{r_f@(ZF"@'>iR]ED "v<~/1iKhJ&{Rh_naf=1o PS?@y'_,1ýɕ+[Ԝ|kJv6^]3kc1b)|cF4=?J&`k`o7'Q *P/'kp$/D Eܣ9$IUK'db+^,nPgU||?fb b`v#c"v*HG@+YĕOmSHu}NOW( ON_jƄIpB8Y=Bh+R1"=jţ-$Zާ%0qm|jvחΏ/^ OWx%Գz*‹=z[(vv ^eOU[jlMFIt]SyYR`8> ~ۏpP$~X,.䵚yx,TN9Q1C(pKGol~]ijMJ ܟu;U?1(k&'ݩȆE @p(os#(YHUZ J›+dzn"%YOcCN-x:=ߵŏlùtfTrI>qAJ FrW,I-R޽k0{䘤}EYU7>dP}}A(*W`O&[PI 8ԯ?,OHK&o9m&%>OڴYi2hg0/J ?v S!ȰƜR"ēJۯ>_`-Cvzc̤gIEjVkl=xf+j|k8QĠWnFNAaqc47Oo[BQ2]/Lf%WQ{}4tM+;6 S=Z@JF9# bX'79)$$N0j5 NGf.s~cbqu ]`?Mc%h8|?Ń. իksI5'#9|@7O^"X OT_h|AU/_LxM(;zl.m5)o/Ƅ^@zq9BQRYl$3+j@,@V':խnְKU]q$m[1_XR7B Fj: B\B&10wq0&0y=;(dAjV+߶L|[6TٹFP@⬥bmr_Ń{~?B+J0b}s٥U<C܏r⊕;&^y AH)}~\_-<! m"GnmFH44:Wgy|9Ւv J1R'YJG!Wy4iWdۄ(”mMEdB5i]#/'!PFO._r#kr?KHצB}@7R] l .l˙AѰtٔi\wίfbӽ[,V@fHx_._fU[KݿyU<o#A(a nl`EGC~L2^_Icm>}A HkK6XnV+jNC M#G͚3CZιdL|BBP}5*`q!rZ>nFt ׌`|LIi)UrCLJΫa.`Š_UŻ~>i1@M=[ԿI]Š ͞8J64w'5^fBT2@'?Z1uؔ=`(`=;V-&]/#HA?i=6T\CX~?XR՞b_R?ysr3x2Dԭ'/;r̼S"`;0{MK70wqDQVH~x9 m5y%I#FRwƕOM3I,(8)LZi` ZPn_,5LV΍p(!bߊIcmcQEd OÖHqK? 7"5hp@~՜,Iߎ}eB@$DS'[Bߒ63|A=k |ӦzLU3dW@-k[ݍT@+ac{; &RV~ IޫyYIG]Lg9`{R* Cvyv}N'4||;Mf))W.G OppA9 HJj0DFW)+qEk+k(%pӾ(v;urKYDb 6+Nʦ)v]1C)}K6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊$^G{1␡yG&Y!3bLUx jf*ثb͊6*쾘 UٱWf]+6vl ^*]6*U٩/;6*.LPr] UxbeU0+W +UxLUnX.9cZq0GQTnj PP )Rc&*1JUNU|p*Xq0mXE7Wsr6`k\Z]0^"cl4KbG|$R>2BB?h>|9?\N3zםIoz*VU٫chn$죩̽>_m2BTLb"(;CY&TA YA¹yIze;K?.jf)*SZm0 .d ֧~huqnHʆ]~TdG6VbriZ,d1p;WcKmO +dFޙ8V8#!{(vL̦N7L)vlP 1T;1s ]@ڞe#(QnўJl͉l݉kT|2s 6+]N ,,YctGncP+WbֲȄ9 d R#flr;v:IUrr4[<%ؑls!&.(1^L\>vmsī%َWbO^D;Ӊ;v02K}Vsc C\ثb͊6*ثb" $!5cKf?/3wSmָjǮ)lҸb1؅\\%j2l|](0*_5_lBJSo J{E+Hdb́[sW _-VwN7z!9׮*٨RV4~WvH*/GyiO#6{.MbL0QN"" E(WhUᲄt9VőpÂcM qUl^4)Qg040K5 --ƥ܀ 'M@oIKNVQ쪷 9LLO45Ko޵w?G,6o{qJjչfP~.0ƃ Y &'8++#ce3(oC7+k6+'z|P"ھ>r|0vf?|re']}*yپ$ FjDۯ+H?p ]! E"ӁP^ R_S\:Xgicyw<.oSXČHMƌ%yThcAAޙWz)!~<4aR~|.kMWOZk\r zJ}r{K)͝ZMŹt-~F3$$%6̑=-ckp Q%S_ UuN~Zj2M?rEmI_dZ}怍d&YwqFVR{k0eޫ=äyxGyNyM7ޭ#}ǩڊڴ7,@neOѠv% 𼣗c)*ɥyL*<%V5ZܧecT%T)CkUКYz|7I[2e*U: >Aq=|dyQjOo݇ΠM74? ~y9A?jegT{-k^h~gcѧ҆2? f3~yQG|0<@¤1<*_pry?t"$TO|G~\Ҧgfp 3kZ,e0]<gpY;NhU 9+ -BXt>rㄈIODcpu#jӒ-rޮd*xl{dDXlR'rx1!g?+0吙Z jR/$CpKI+z$mߩePGI6/,O*5ĨT<#~+-!jn6}?JVܞG _]R+yvro9dmg tqTߊHK?:?mxGQ_=., JO랊wVH4{_J$ЪVfH%럳ӕHS\T,#)B :?+/@LWTbJ*~VIWUNgVEJ>]RzGY -К鷥 '.IW A#Z$z6A#V5m_̨dUdzI'7ZZ :Pi~Y'[!ZBBy>9ڨ`y/5!֠/pTz:{mwh[VFW@+rύi2I ]bhz;+(56h*_/e1B jc;^72zK_so;Z [gQ%ol⽈|0T5EOq_y~8ܠ!,$(տX́< afI)6$(0(PK}rmjE !< ~ԟ~}0gCq6J,vzaZUhсOiχWƹ!)KhC$ v9fke^F)Js7L6̀:1o EC, 88W_\s(j?Yҟ8BiҦyd_IZ/X~4 V^r |EROu^Lg2(AՖ%o\2b4OH*PzJ>$j+HÞ^H :Q;`=fmqZ4ۣFDSk҇ bcPAo1. `kH` ?LQoH)Sn%5 cܻ]TR[|%66(vNK|'J Cb5 ]6pMFgfcX;9&N0&'W<(-C3ۺWIct~,FQ`e`LBB@aa tsb Cd r|*ܨhJB5ڂi[8&Fu^&+Jf^,јMy>[v#<$ 6I@.ľk14O@lj#پkG2[vo?۲.?-29|yKd۰uh!\rإHvr z易ՃyG9aþg`RJo| dǾc &)qDz)FJ7G`3 >EcAlI]L֏fŽ9\@zd.솕$r+.đe;$ڦoUS.۩;v'<̬-PZ#Ŷ}ٟw%fS5ڌh o,mWn*3e|B qiԪT)-*pm "dNtO7sI#̢ۮ=fug'3s492cl BsPH7lqM3ǗycmwAֻe~,VpTSE4yDD;zr4R]BpOv/tW&25&"E\0 6)vlPثb͊6*ثb͊6*ثWehPI| >9M 3FC늵Ӯ*g>'|(vRGLUaiVqWbS]LH ʵ]y08RU؟%,TpcZS| /: 5­d6|R:44qN;bcX[9Px8 8cYARFv'٭yWcbbcȍ!>銻e-l)]Q7®8BƠVt=qWeQd'f]qCT@⮦)< pjq]R*(*U 504q qKYAjv®)q9L6ZT,8Mp鏠lUم1We)WqVjb2W\`;PTb\qv1V~glUmp>?ѧMJ;PvlUٱWf]vlUOA BBXl:bsӰ%w.+1HiWnME;ImE F(1aNUMr֫7Ǎ\Xݲ|U+8fQ.c\qZNYV ua#HuFQ8SKUؠv#qWZ$QF3)GER~T& Wo`>_XaJf r`f #]LUj㈜Rσ"hhpFܪT1%bOo,Ðrܡǯrm~0_E9LyJһo`n ƩmUFjV J3* 0ooox$աA`IdĖ1LO} Hn m/2Zǣ}^uj *%xefFx͕UI9էNˑ7O8:5HG|+Ǡ;] ![K* kRBq1șdcccf*Ki.qWہtN}Xf3".w9?"+qŏzcPvc@rl_;95M$\ڳLNN]:VDss])Ď8hVUn %R zPX|+U=LgX9W N`_$HEZ?󪎑}O2Q)mc]/0jHU-T;Q_fn,B#IDP 7Bk&"+!c@?ɕ@+.z׵0K~lԷP+Z~/244F~_s"99&d&8մV*Qk3rc5XFrzK_#_2ڃrOn?ِu r*kY$й{_\:B-HW-~]==C%jUL +S#ŗ;Qu%En_+i 0ᔸ$-Y\9g",ؖy(Y)L_1P/Xqax.ݹqC\EB81\ ]VTHG˾G<态U'#4?) 2i(xEA=jLcad[RrZ/m1=WV[$M2yvaD]72&B-XJN1*4lJa̺Ņ̖SHcW3ᄅ 12QFrӗx1ZT oRUy?JdLUd 6;k_RCF~N U#?oWA[m tӯMN+E?LjS%y#:sm|sum`>!R>'^oPX287ѐ4y[ sokM)?^<.,0k4sn#ǝd!}iF P?j1w%I=m@Hvk?YroPz euNk )ABܹ=o1kKRf!" :yUc#V;s|ϪBZ 68bz$>G֯*B:: gsT@*_ t>=揫ߩb>pG2Gjw3ݑ-<9; 2Y`CrL-cgj_#s8?9ҝz7y#$jSn]!}>;:X_ĤK}u%-]>_'/-kiWmݛ3??k'/ C촯9ךKeVv-EreUGٌ(ŷ@Pxd>aVӹasnIe%f$ zdb4DO)O yiWƓ N25 ӛÃr\8rHD[@$lpj׃w{U}5e٧ICԑ99Sek1sv* kHc5_g+bBۘW`:Cm2P (aVE sq/wN&bFn-k~Vgd4Ó Uxxкf?8 THګ0I#*xՀeQk'ӔRU9NƇr;궺Bc\G]~?r~קRV7p)ZdBK)pVR>ҟHXT\nC|=mxG?nT#j+ F eӷZx.F<ͪ-(bR~)?o2Äy"m_u H.$pH#Gi 4(l.?drtZ~?R R_["}"E?ϖ&.4͡4iH$aR&R $$T!|*2#TLa7TF1pI=d xN" B{qMBuW5¥J@FGdZ ~!Wf]xiFHvȶǒĎjcgYEFW,n|3Bي2AhpAMYpnK 51پ@L$ivSϐ#MOCc$ ZW3u1R;hv\t^:U8).j)\NnUk6*4Uˮ*f8տ) k2)lUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊$^G{1yG&k$&]qWeWfn^*ثb͊.ٱWef]] 6*͊[͊k/va↳bf إثbflUL)vjb銺x͊]6;*1U*R Uqt. Z'Xq,8T1)RlrB,Z)\:ݩQ8e1Wp ªeqp^8^> NX r1Jeu0e^[ܲ%T== DVl?m1T=j|ACtzם3s­J9;$z ovΛAÇK˲vKoEӈ4e;W* ;(Wse4G:j`-xo2E! 6*lkL@$݃wff" 2U3vbG# ` '2e18>\_VxG4 "F?j\ؠaK2dO$-)É=i^R)DUQ㔈Ĭ=T2E-^L$*pҎ7r\{nZ9 w+DWц9`FK}8j|*c& %*koY+A d8#-KYWf]* 6#1 bW0|һ6l0OnyS09dsG1v&^(X̨rlvX%M M@˅Ӱ,552qZ̭ؓdra ǟf`D]lebˮ4FG\*<1B`.,Ιr?3 [ސA#;z`"/梜FY.̭,pH$D5>fW4T|mnNs\FˌMoT?B_ɃQ'܉ kǣL݉@~QWҔË*uyfYől`3i[ثXf}Fv YAXd㏗p)V;~y<1f;z7Q` @a7QNl˒!"֛r X^CB(sG(kpo0]c.~\E-Qd>j8byJvZ&D.Qpse ^읋H%Z!+4b9pk.7]`)|.]K )ٱK7:"Fخ C1]9N14 oA+q9QC+R]L O|ݱ\2`CDc(u1H[ߡ1JCD`BseђӖ4ޝR쮮٭#"ؘQ)W*'A yB9مMD8pF4f*0ɀɼ,6W|W) kR8H/;cv-pIF2ىe.N9-ͅ]vlUٱWf]vlUٱWf]vlUX*5A(?Vi;R5f@\8ִeWb̩qC*w> a5;.*r *xaUbpB~:\P;Uo\(h1nE!#(|pq-\jM⾩FUcu`%[g|8A]]&D$7jf1}'O[H衼F9l$CFSPG̣%su.D ^lz|LPJ,N3¼/o?Teŭܑ jI^D #SL͆pE|ҺQ^07iZxB۶#iH4M`9WB_Fݢ,oP!y%ȯh5W\ɄxE%V$c4gpԅ-CMvLjR֢vm-֔&ZG'6o^3So6A #T%EKsY;?kbh*G}'W u+v#zލ?rzY) ب›W!9J*<6fnnDp$pUSu-&ksd4?bPE կԗ WmmA;vGS$LhTMp.MWd[}=[qVQSV1 {gE|˧>XJRܖ}n_Y|QB/.4{ ?g}Q k RP\kŐgXהR}6ab>ʡoGmz)B=\܃l5ɗ<'ub"-Հ*$Ø:Gߏ1(kxZni <רè߼| !sRO_\ Lc4[TeOwL'ҫ kc9RwaJ|3SZ 㑦>~^ܲ'T['-_KM0c]pR؏4TuPBʋorZRLhi;lKD]o.>u~jc_LPP$J/r-[LK{9ʳiH*GUeaXf$P#ÿ$wHh|!-ͺr4>'H+.}M4VP39#ڟmc_84I/CVfs)( YG[麺Ԋhr &(dщɗm$m#b~#\?B i6(;E=Q9&d$MM",y;SP.k9ˎW9Xerԏ ZXK.qC|?oY3edrO):dڭvV5*zNMI$d[ NeS͝}BlPO+3|m5/RK,\q;{HFHܢ;AWgQҵ&2K>._l/l|EԄ}kPdc[iDˆǚu R_[l>(DA tJ{wƱ[|Gݷi>+N9JܡWv%w]VC憮A--< (Z$}fݒ? <%ڬܽߏSOo^MeNw*>#v,p>20cCxs|8y"zyxeK/hb? om"}r?ry-73U ;Xc=h8/vޝH%ǖf\1:`ݞ>Sm:90o櫣/L =r$>n|q4*P-?F ol(xi3.aWR #$!4WƑWcUaIU1{{r+Dl5So">ɮʥd!\o%"!iMPS0fƓLP *f]ZbUptL f—SQU|?m~c9fR3͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊$^G{1␡yG&Y!3\`WW/56(vjb͊/v^)vV(vcLإͅZ͊Lf]1W jaWW/jWf]G51WW0^7LUbvlUإ1VWLU]K 6q-ͅ. Ui e Z`1Vc銭'X͊ MqEO?8…'5阌 ^RiEV>-˲RNwW`[ |is)21.=FHpGAW%ؾۦN.։0% k`u)+VGݖ#}kHvMۦe̻ .^ff4Ov&Sƽ;}( :τE3v/^b0m]Qw< PBz ½e*kCjyz[ [ܦ\Yy vԝD"`MF0'v[HkMHˠWcSTe\]L=re'=-+ 60-O9,bxKjr05L03Y5U EB;.Yĕs,AR:G\3;އ6O;!ɚed,224:K 섌XAl5>r[ >xK*=7x<݁"B$$e9$;4'~v94 :)JԌlc Ne 2#̭Ӱ ԊRk%ؑ׮TqoE;EU6@cNM:y9lĻC(̓X_0cr LIBiݔdyzO*8cm.L*RC=āB2% xwWد!Gd ݎd۫Hm3QA4`0(7yANIo [h4'ƙS77 +IwÝ =pNTwּ!d5o [T?68wQB|*=f2^onu|B|B113'|UˌՀ˱7L|_&m`Y#Afy٦%\bp_|ULV\lK|>>- TTvO:vfs0u3+q‡cW`TfL*;)e EC5Y K6-WeE2qKX6D]| Akj7]Uنv/k(2`so[/5K5پXU2!C!|q ,G>+og\JR vʥE #P63L%[eP |[͔1ـ8!X칕jVW59eKq*UqV M>䵃.=mt4;fY%GHQknFRcLUR/Q!~,Rp:dҷ)MI*㊐+^UJXu4 *v]+㐞u+-G\Uie#|)iwr*{jxckbwQZa㊷]\Z\UP0Yu#vfbƁ][Ҵ5qV[ҵ8LUj?$VZ=Gg?3b͊6*ثb͊hHBj;}gVߨA+L 7½;bmZmSi 9ثcnF "sny5{ҘZv\hWWOEL {cqJƩe\jҿi₃*yߎXpvVN2+ [ @Ui둶+XjoMfZEi\SH#z@OZɓ9 ."# WSb3*2KbdG*l5NH-p}*3f6LxG?.V,[eZY/&?7{(YRD_i~sa;vRuAh'fn߶kYy]-'~ɹ¯#~B/cy,'oWK>~8 R&U<$!;%&C#rB[ ~|Ypx( X~(!CI?،ZH`iA'ʯS i7z&zFK=B񣴊iNGJ~el\; ֑doN67 pN? ɜx2WuΗqJqg (P`x36fm>ˉO xcn#[-uvyҋPHU$m~kJ8FN5]ChJS?24J_+QO5jWQYB y(^ʜF@+_M%!H4cyS?sVO/W;԰7۹? yj%"*Afʼnd) }Hk=?匲-0^:-?EXgu$Q ʢ!㕄!&> -qX"ɸ.Z5'[^.޴8}M5( cVhvUJ0KɀKȵf΅d((;M_ǒ ҭ19UQ2B]UluXzTJf&JX l33z\ AG5HBC@UcӠts'%U ' Sn\ l袌?f2 ZU 64̖;bjƤlz2RhX o!wQLܷ(WH??fsRvby+XA#y*+rڮvGėֱ@LѩSʜ^.?f+2s#ҭű:vQ~(`015_PƄ5ZV@j1g1Sn_rKIbSSėC iۗ"/rC~b&#;x5,yYo_s2F"S w $PL*9>/v _\}w5Z-&FQOc͙\R0[EOo'T!] y{rHfV j|?4ϓ|r~Zl-t$e׭ ͓+&KO_miߦ*/H:네P׾(dCSF?Tj0!UqVo, vZ&tߦj(lck]BǾ)jxYM[]L⭜?bp__WLb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊$^G{1yG'k$&^h f]vlU٫]6(vlUurKb͊vlRءٱKXZk,1Wf8c 6*6/7\]\.jaCY+,b˦*jbhUaWeCYq@1U\bQ3⊸I1J*w*nVB,1JT F,_LX#( l0b kCh+cMSj\‚lҙW<7U6|^8J3tfُfqurw{+U[yX~bV6q _s3Ma#KU@uq#;8d/Ӊat]b )m9$ӰQ2ث,Vezf4b]CĂ)v2딂!;a̿MS)j03NʸĶVjFcJ5ɋxeqB@>ȧmqUUi.1PM*ed x;J5v:(=cUٰ<^Jmn#R9|`"ʝ RH1,fQF]Qd$2v0W`[lk+y+uwbUM?bwv28# DG_`&˛CcYTٱC)=2 b*9w;$Ws*<5{؉vc x(FORd]OQHlBv j3Arzf|@'a{ #ig/U-i^9;,lk0rMnח|lSDJsB‘n\I뚃eLksxU#s*qA@qU/ ۮ*lW!E4Vc)-~l|6Up%ئh* AVJrRWCFWJ60qV86*yL{%VlUAb7* DOMnRN8#唖=J8ҵF Uّ+!ڛah\B$zRiː;t!l_ l@|*q*q6 7.9k30;⭌5]Lꃊ(k1 +s];0]1=Ww*0K%w!Y~*71 `͊6*ثb͊6*?/ugl!!ۧՍ LnsAqW(S>H;G\U`(iLU5[b;`V=AE6ĕSv2aP2(hnhvIk,~y-j*vA*J{ MVvl(X}&"ҧ7*/LNثIWb{!rsW8&}8b;m29*p,8c&S:2 „Lg\ 0bPɃmBIM$P77Ka揢nWP+ϳysz}.v,5JmXZڬѥP=YV]JM*V~ Q_TLk E+NR?B/ث}j@Ey%ԫ%fv^.?kWq\LVL+<=X<-uOQI5|?R;/YPKw jV4?NE5;67*K;Tz}/qSdf79(]BЛ2/V ?9`r&oTjNd^вqM',"1ۚOH#m-ƴ߻Z&,⿳$U(Us%ON: wT3$6߽II } ¬IքA4 grCv|>Wp'c3,[uRNē~^ <#j*&i,ؔw+Jav_yqPg Ig ,x+֙b %!Oٛu)ZxXFsBjDtT~/ViW;:W|@m-d//*__DW$4@_$l2G}^Mb$$^i^$!JG', )R!#{di?rjR m(k߾z`u['^[ lH^8EM61Šߴܓ 呔BS]& ,% 34{fx,o=JVd-]ʥ1궵Eo/+E&lH~=oeBz ז0;y'K4 *wWd1>[+'@nw?yUNҚV5ClkJ6UumVM"/ޅRY]G~*SWW*:=8N"FyfPcJc2u[e njs) |9=QM\cjg.{( z!/AoLqq%hR$ub %lo.dW\i:jH8FJM*Vd;ᯖo59$oֈ)O8_l,D(S(u뀼4NNc Ok,6 edcѕ}>_iS6keW_A=r@Ͼrw3KRO6W1Kjr E  !u-~WҨjߗn#V k2N4lPӦeHqlRv.w}!Ra39r*1Q?ݟg4dAW1K.kyV#I8`&E6CǛ}O9Æ=^mer5c"^Ba^rsPSeMVP8):?zkT?\ ?O9)y {m9fm&4=HJՍ 䏵_!\!VhYNKH=?OӖo8i\Sol(Pv5d3҉Ωiq,yӍe~8}Yz 1)}z w'ƘA-20g YtY"`#S<)UHu͂QTέ iKh3v?i4ӟc/cn|2XNIoʹd$,2G#PáQ Ec+Ul<:5Y{cqA' /zp?}]/\Bw%@j@=l"(RQJ()_#\C;2ry(@4^߳"KGF@: h*GTܷVAUen?nOelsb6+^;{7\~\D&s0>t |OC¿?]؊X%#?P_/RfE M(o|_\q~"_R=#o鑜J&&H#8G ZRd? bYYb~\~B?! r17k <ɩ˞ A? $x~)s#8BXj} OI$*}Xq X)Qνb{藔Ax7! c?eyڑݙ'O>)ar֋ZsWPPEW+Gp5i pP_$RHbR "E [dUk[)W ?AYtPޙ!(WU #*ۗp?jf66'Ҁgqzm7 dycMW"W* AG72΅w98vExgQT$ro)Ìݟu@S jz ,vS۫lL6JXиUģCȌh(v.+/RHw]IR6<_ogYmbv:͋IRz8I&c̠e:ȕvΦBC& `]$ȤnErHvf͓F^IFq79Ili& LF<ӲWBF[(!4=W6'SSj2Fdo2e-W̮8%o~Q64qJd) tU064Q˗b9V?HbZ^_Qf^<`8дt̞jܓ'W ;mM(X7_P0=li2;\7H2@zXmI1Fҋv>>G.daFŀ v  ;NI].JHCNVNF˓JjKhfԝw+[})$Ulsmv$Q< 0ٳP cNDF1P€l 1rˉز] |c3"[Щ̸HX3`{^&yVkXmP׮S ]_hsGNg.>Ӭ"G dOT۲A،u+37sBሙ\9"e$2._d䵖"\J4Dzej."jkHhw,Rɓrƨ-}rHH .䨠FA >Pѕ5w!a^xo dmxBQ '|11 TN Hʬ.D$Ԍ`y(>ٱCaWf]vlUٱWf]vlUٱWf]vlUح_hCVA -#72Zr bfZekLU#l# &ژĀ+ƱeLU1PTb(qWYSV2S]L,A]Lhv]fZ"OWeWmsCc#7]ۦ,ʎ |UGqQS](v8VlƘbx%nS2L6CǨP lqVl rl+[8تjTR˽;`VJVn]F*<qWe 36v2%8ZV\(0+X]졶*I XbIPqVɡ[d4®Y W*i׮E17˒=Gd1"3b͊6*ثb͊$D4>l!! ڿuncc*zfe+9k[*qVl4­TV(.{ȫE 9tCӨJkBzʦE W-v•*Q_jCA]kqV{44ڃ\\]qlUIMkеzxv8@t νbYf(6u"T#EJ`%! =&TByb tQeTF?i0C\JZ0Ib*??%HX}&QKUNYx`6-j)[んRڟ7Ud_R[AQhܜfn,l#2142`>Ճ[@ܫE# i9V̕QҩOa0]>a (Wp7@'}ؑH4%c2PEkߵ0EpQy%:QP~*rkdʣrv4?GO"wZ]³35(gU+; @AHhKS^lj"Gۚș @ԭW'gCҞ#Vn ߽M['$P$qћI9:mI 5uLJ y/fܒjHei?ћ##^ٖ|KX,R8j_o7ޔـGB]}Ƕ}RQ# :5ߦu o{fqsź~>_ ^_k-K#m9ˤC=Tsl2_O/N- 'Š EiZWoUyB[ 2ab)mB5 hF喋O򯢊N9Ϥs^͍dRMX-W1yby[%#'cB#|59aMh`T{)<^) DWpr["`u/BVw_/\Gr -Erl| _˖*(] @ S ^u:R4%T| y2~&f^!znΜ~gU+5 ןb>YZ' |K]'5s ~B}PZ"YvrG_eemzJOփjU +\ "ץQ~[B0Hnx)܁2 HatIdH*@Yo0ޤP|%',4!M칄ER[AF`ӤX|SO?/rGۤ. =;x̌3m?-=ITGG&^TyBJy10e^ ڿabjIrG! G~ OJ 6Ŵ;`犚L) d"$ JMZњ)J7ּFC W'_oPzds#jE5ug -Tkj?fÌweJ\>lXսF%EN߰>mx~?2d>L.mn^FBP0.e/l2E+zl| ;cs* Gz ;̑C5reY$u h(doۄ|…B?5S\Ecq%QH34D ԁ-&MOlxA,24Xq/"Ök;IV7@+2Wp)4,(G%3a(Oq\c ֮%,^!~ o&lhtEMsq^e[E:"K ^+xž~Yyq^8?_ķ,ozCPWr}uc?<,lv (ӆ{Hml_ TmOqJlB')$kfY]=*@NۓF#ßd?~4GnyT6?$+܅?̖)qLvS ]ȥ}o+p{n75h-$;S<kѫ> o[n^Bsqwu3S4֬yp,uX}=>8A JK?:/mf 5v!k{>k}Xz1Boڙnr+F! ]5>XUy'瘎s#v트-8am5 mH=0x̧*G51 6Zo5;V\-8xJ`CaRU?bTkʲ lUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊$~E{1␡{'9bPY]L*]vlUٱCbf]vlUٰYc/;6*ثb͊]v]1V]0+Y[͊\r銵S6vjbLUو]\blU1V`bvl(o6偅Vp\qblqAZ-Lz1U6kTk)Gl X8tV7\xT](UrWzbͅ]⫑|qCFlzcb/#\rFO  ;φ)PZXp;`BhlmZBL,ite.CC_ RZqrQv~-+w۸xԎANB ϶o &JW*z;*C/Fv S]-.]:flU PCUl b]&v0 U!cgh G3aH̦NaWb7lUkKuj0D`;]K'WM^( hv1\QNƪ5)烄GҊvjYu 8ʻ}e,OTb9 Kx/¾ɓ`]WD=Hv>R ݘvQ,br`CXG-dNKi=FR3 !żv4s!p(*}8I5GYz]Aa9&Nyzq;&n- 5 #>DSc'D[v#֥zm2L-.ك4`4üEQ/OFv] A7b*C1%ȳe-KWe0FB-*T.Š@:w̌Q|;*DCm;,!6إى\@dElVT;zf!1%uq3߬8(c̬Hce!4O_eWBb1Y#@{o%$5#&PݰLo 2'ǜ{;$*欴P{bʹQwAO5}8a̵ f/=Ϩ߭ jO<8Ÿ"v%e)QiL` ێikdexqJ{;WndO&mc-E+n˓ZxoAe-NYSn=;e۲wd-6SeZD' ۳;EeR6v(G}uC [#6Ļ}7͎C;)grW`ik~ Ļj}3˾]n]eK%LIErgq\-I99deėSUÉ82f,#Y3@tEGJqNɷe8F=n[_x.͎Souw]L9Ќr5m^W&N1_2s[)e1FY!l*l{6HNDB)CR3h7-L96rzKPz0o+OOl$hpG)'t ;8aG}r bipFf8ؠ#OE-}td*ҵ|$5g]͞嶸 &d|yH\qq;2xy< qYWR Wkg>2J36xWfyr` lQ9`CEpi`zY "]&^s&2t|p @'ńe,4LȱvlUٱWf]vlUٱWf]vlUٱWf]v)nhxk''JÄ8{m$i;bˊ]k jSlc& jt…5:lb's]8Ꮕ늸nnU@u]A+^ ]ܝb哵XeR!VCu Sl*R)]v1M>}WeЏv291t S*bV㿺Jӑc]WlU(*c6/*R}VZRU۾)k,!]\8Y`aW bƢV<0Y]VY—W+;1WcR CRbrdUiUXUJbSiJ[OddvB2QWf]vlUٱWf]D4 gl!!~h ɶ14A *}KMێUP W1=1Vǖ1U+xr?NY4mA!շER.ءQJ;Vm~X(QRTe -КZ P(Rw4p2i"Pڢ1%i">-rIDiuUݾ#VBOߖE$Dik 'k+cw6ƼPWlĖ_bәnPof gv`GO Nr ҼWG]w8Hc[TA~ked@]&djI$'`~]fXW1̧}N-`Z&Z2U_ս?#⳺ۏUT z_xqQ )?NVDgx-7 +yX 3jhÓk| 9}1F=ȅDd`)j/<Y0dFDmeM/g<8G)q4*e!PJ'!Ⱦ-n!\oLD'ڧM'ɮ: {p ` TO._go(z>S^o!ɱk~ISf4%ܒ*Y?cSGZ[y%V̗uymrd_ u- ˎJQΉl~#L1%HR>IÂWڠ:Z<:mp(?h fW'W!vtPle(W(IzSN^MnO;*X6!/_I|iIIn"r!<-UuAF{ "HIPy5iOY~DXو-u[EY+D"Q@?×S}-{eeH' ~X]>mBWd/ Z T|~Vhvkۍ&9V8s#9rd7$`UJ?>/9\PZ[cZq$s(F:|YnDƏ.c`A9ĢNKϤT_N>>q_*IxdE.Ė&31m"*jċZ |躝OUA E OƜj# `?@m4XsAE4)LDHei5\=y?\BG,4Răujw 'kMreD%JIzds5ǨbӗY JjdYfm(UXշ4˘1h!@Qh7+ u1L'Vcz ڣ0,@'1MTRL!kgsr3[2bX.Q( []LM+->!`WATW-eSp Hb#/ G)~SFJIih!c:zۏuO t8u0Sy[ )I'_roUYoHpVNs[׷\)\6),d oDEzLiGUk_mܱB4p{niOIeI^HVhO՘]8R?LsǪӯ W}Igm\zqVe^/W8f,[ K(}mq<z` NH4l(iF/~9lq˸|^9e52B[gZ4g4dVk:xeGq%G~&6C,S+%m$R(䈹HI*W5#X-=VNuac0IeIi fܜkNRXHUwr~6_cE,6^BuXӟdbCrce?n,+zW@Q/E3,D6f>flb%Zrt<ɾDrT"Ѫ|YG?_w!n8†qCSҚ8$XR#Ł4WS])jSMcVfHƼZWf]\ge[t**zxjZWRVC^nP~N?J?­pe}cn![hJ #+c(^JөXVqdVb^~wFoUFC6wBZgW 1Q]?RrURV\;?v}n <ڕ bGk- q_Ģr#ȌfV'{W%^KA䎯ot+mUAzl',Gxged0Ľ^T_z;zDOpw1h8<pǯ_{dFO'vEiٜ^Ҁ3 H"E,o .Qzǐ_V_ 6;r@\4K:*GC zP2s02v^%vc(w9NYPA.a3_o  pQ+r@K>Nki`E;x.n!RcNƈN-;jE|썕1@t c)E蠐V fy*Ӊ)s諰#T67cE];1p&`OP{ 6MQr`@ QC@zv;l5MM}qv=nAٶ9tu݊`s 5]c-7l_fn͊6)vhs[Nj\9 6!쳿l4 ӱ6ZǮQ,B[9 -ї0p!Gјb:V+f@r2)ns"ɬ8R8%2+NrJ2TҘp]ܩ jqثNq^5)&|U媊 bb#)ur4L˷*p#hӱV)+! he; VvCc)7ȉn(؊ev.xcmVN5N8ҷ\kF5*q?,b좸BV_UqWefrZ)rBV˩N%k+c⭌*8Ah❰Y;5GlUهC\U١aJ;a p;eVpW[7:b,Ujur(k/p-qWfىUG}ojDZa7y+R|ثb͊6*ثb#Zc:vi3c]ҸUʣmmPXjRhWajJVUܺcFDmAY8:呅+zcI8cX)1U>55QPuW$6?\|hUvQ\p!GAU6 |p4ִ | 9`d)H0"h,h0$ QyNH$r]X&nfWxbʄTr톷ԉwy5c/T`fL>uma۟Gf+rc,BF E}?6'W9<̗7{+ $R \皮EM R*{TlrAF2诐RU+qrdMX~\$zG>)~?;}crF/&f6]C ?g]vلs MB2s)q*0Bpn$Ҵ;t1䊳 %*X'1_Kko/uRy2 #wqmk{Er6*>&?w݄Y[$Grrʒ\? -{*d8Q|#Z:?DFJD4q}bn~ǫC-D=C嗗w*oFn_g5Ye2~)=JT&̺!gF>iQlHGPъ a<(*M $ *Wv 1:^[n@%Gj\2o){p|v -MӠZ"¦,?̑7_R;qgPEkIMۀ~/oO.^AeyVpkPA'hU,ljM7$W7Z<3A͋nv-Q#H_a= ȫƮj +ukfU `TZS[ܒ~g3LEy;VK+0=6V.hn2UVHxrx6#?ɘZxCYƏ˫GdNmY#OƇd%㑻67<$bzO'&1c*9 IGᄸeI\HƁhfɷEA#f^CAUoSG:,FX9S?ى HQI8*r[@AW\`9$w-;+iƾrQIh vg#C.FXtVW2+=In8Kzh ;/ !Uy?PenJ9~/Ã4.fJɌQZi4E.+Xh97GynGm ^lw~%zסڕ̈́pE*H:kpޡ<)M~ًxgd)s[UM٤=@̻ ˀURvc_חI_@2Qt'tW2Ƽ ~y8Lo(({JWo턺ׯpP8b9@'A_g~1CޕXè8^PSB7-UgP5k=Yb̼JCĿZXI]εFqnG@ m1F 7vs\N)2rٷʳ+guUa;зUgZ€"eW1ޝ()M#6 Edj%ԩ)F\V_0𹋜;Tnw=ْqnсA 8Ov]rU2u{q-ORT+ƨxfR+v% yփL&wސ x֟iUcsqw!VZ|jK;infXiX x Ux#OkiH_jׇ}hKX=C4h*xa^?1Ljٯ㉊*I;ӹ?!>Ry'úۊ[7LvASRT뒯?q`9ԅu&ſk~ҐO?fV3fɒ3to*m4YZARyG?e~f7-A|o"? z}3I/e'606"5)bA$75*r}(KDH6.AHw/dXӟ? |? k]c?E Iw= &Q_HŜcԞƫfH):q,F_׉\ꗋO76֡FH*D+&iD[x@#K}P\bI&9dg#WVZsՁݓoӟ/ RAvA އ1}dMk  ѫVI֗ӓTPޠPr72rc%#FV3'ᑩr/?0sO}1(YR8_#n 1!*k~o7k2DŽ%^4t=LLjpA7BcO~vU>?u s1( Ե"'fOHJ0g_lqWiPx%P@H ՏJ/r>f5Ե1I9$Yu@jNhk;jf' v78hr ?s$)@)@{rCk/g$Eߟ6<`M"EvFosܸQׅzfLXʼW$=KR +MoOB-Xԫoař[8@ )O_4%*}׍pEԽmAĵ)v9ѷ,$}?Ԥ*]RGB+탬-FCSˆ4yef\SˋgIvU )b9z4B 9_M&N-k,׃xĎw7e K/9dƇ̜r$-gp D~/8öF'DbBd?>K8ODj2,`<]YDu$OGGueeK"N8U7Q\g^(]F8wƑuEr}*1Ԯ*U6]5i|J1$R[-w-F}p*]L;⭃vjbn8K)N~c9NV5͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊$D{1␇瓪e5͊V*rWf]vlUٱWf]uqثYCbf*rV[]LULReCYxus U,bS/k51Wf)vjb˦(h- *sSusSk.th W, 81U `bcb2q`UWc(MWR9P8F1B@Jd/S'\*ʦ/ VbOL*ҨU7iN_g") HLyo *jW(pR[U \x%h:4)PQm.%=чsؐ߄z3VѯD7^Tb])mءLBeKV jiL Mb~2ےIv=Sv؜Ej90ZKHێ'2ǧLkT봩.* W!K`{vB;REqȗ]3Myʐ|P`T4i'Ry.8 P/;vͅӄ'Vswb?s]^̻r^j(0S{Wꧾeal wyv9Mӌ$W`(sTvAu055dnbr34p!NG^DQ5Z|%l`jxf4KJe,P㹊ҙo' +5;f$ehv]0+EOf &[X6CL%n,˨2u0B|i5sqK T56տVntӂ()KPzfF||'dGbo7 UdmZ>8jzeupPn666G( 9L!C [qE7шvFTRHaϾn!l=P IN@amsrOLg7+`Wu2]\*f[W-?3 x'&*,:ԅ%sXXj`CDw1Lj-^!j Vd*׹!޶ʙXLnUpZm W0qOچrF>РoCq՘k̪pM T=)^pYmupeج?)߶]cw؋ eAvV;6*ثaWf]vlUٱWf]vlUٱWcC+rs Eqk 8=p[Lt_Mƅ;=qWPT\jqVآmi8Ug1VlqREp8¾WW2qKae-fNثuƚV4z *jC}I\1"r,[8PC zO)u36OJ\ dt+Tep+T-x|!V(9Z턫\lإ]RX'ƿ,RRTxcƒ׶E ֝)Q=rAֻFIzv8m*mNBHzr7#%-HylN'6% ! ){Be`*Ni 'bRhTGOry{SS;,8Dw-K**Bq-&qa>!bj =oܷ9N 2oj9% 0^}?$δc^g_"FPqm Z]8<^-QOqw:v0z_l.Nbc^S=ϛ!UKTy#g_Svn|s]V-%5*Ba^K$F:P|YإE_$~n*O|u}) kT4%M.!ҧr}}xnS^:K?ҴLɗš:rxo8 +B Jr9y|SL9;~_WFYʧ+SaP.~*EޠWŞ A"aj7l& zYZһᾙ+!eKۊӇe9}Jxң%S4BN jN=(0;R vP6z-$m ԑ|g/Vr)j;85mG[+~.-2tiU*Bw'Dn-  1Gp}6#b 8VJ/ĕJk5x2XoFi."m#k?F޲W֐Uz03\ j: 7Ջ hW*C}r\P/CþG--d-=*GYJQSd-1/r,Qi0cDۓxdF-Oo-rE?o3NH6BG߆/SoF )X5^|*9[Zn%N.a_MZu;(%?k#Y PPRq40>Uk,p|-D'.Ś) Qx-2Y ȠIϘ?/qH̤QjSjN;l'E&T}KWGtߪ˕yt}_VD5]4^IgMA?ek3:DoCtɼZTk[$@| K^RW/cef?7ޡ[z'|nU//_>?_jSnOQ9w*[}_'յZrh/ic~Pgk!9[dg;WJ S+(>+1 A(G/C$H7J_ċRǧV=<\Wp3P }oW˗Óe?&KcۚX5I=+VӒa/$zR0QOt ;}>KCrT+7[ޟ\c呑P)g`z\!oJ''/g̜Y6Qp^c)Q<߳B9$JZUt "77cMOJ=?3oU)\E'#_!enzIBŸra(z!+֛dm,l(ɝFh ّӛ~5tw$!C@IhK_, ^[trgp~~XOml4 |iէ8 S'`#PO!:\Ne[0˺ r&ܒTb'. ž䔅PL$@P?͌W)@" ;x(F+ǖ9xlujtĴ/ei4ҞMB@@+Vaɐyj1O.C+RUQXcL`ejzl;&\InլlWqCg dW%N6Vg;P?0g13(;9rۄ_V})2\Ρ.չY[e5߉25yAWpdTw=ëzhP$J߶'$Š $9kF+LL0 f*)d8b[K~v]Zo/m|%fR#mCmdҢPՌ)ߗ4,eʦG\<$O(^v <whO5(ScLr]F9a}1qm0L-lLgAw= |}SO'ZorGqS{@s w&n0:zxwA6\N['6A ]Ȋ<͉v:C)bInu](*v#*Ȼ*6•$ )CK%p.l[*WvjwK}ܗ\9S%f\HK,q5faElLǔ.6=b2Q- 6@)UN'kWr׌2nMFQ/PWq[]0Zl6,"u>ٟ |1A'ߖ_T\)3fv$Vn0So,MJH[4]e2v4bgĶ0=3-"-Ǐ8b03DE~c6lqh:d@4BxJ*vZrTn&K+Ĵ XVM!2(o,b'wJ +6XdeA1O}eߒKCM$xK (yr!4a!Qv-m2cQLCP.)])Ӂ͊vlUٱWf]vlUٱWf]v:/>x\pgQ>_>kqw)PP8bيk ]A`)⌵UE؁Kxa͒VZTbn:Wq9u# eW}W;*ɩ488S늴q䑸ZKuƈȐMNA Cp .q}d8 ,_l5}Dž[i@7Iv)'0JZSVW3F㊸f.0j7zVZ9Q]]إnX]SژD呾*z9D o(8]\tBN*N*Xv3E2)۲)v5be.b˥qWf]EqWc2/&W>g#Y~>c9PNlUٱWf]vlUٱWa?6?W֨XƃsN\,Ӗث7b򊞃rq| EiPi\PtQLm[M0r[1Sl)SF$KS)p{`b*z;b]+JB)QӦ5۶)\Eʼф>g ׸ہ (Pd'jpvB̌OZoQ\1ZE)ʛJ2{M+~ҊmxNh̹;"jo]G /uv֌T6Lik-kJrm'̜ns=;*"~G1B.63ܻ)+K* (ӷ!tvR$Io4*|.L~@n?pd7 y^4E=mqӮM4o-nX$/:WuO&~kHB[7ӧ|=I !ӬlxgnUhܞ<4}^hIRz(O2aF6z*Rn$qi%4M>9gyLvMFVaѫU>>_DeqVxiQ)v=Y,p?+qƍ{eT,aܸO9&}J kڎ*hn {8lH1*̤Gjդo9_k&cYۯ)`jd4d}ى$";׫e NjEf+(ҬK)'u[#"U؎$p5r"wbZhN߮s0  fHӓ.q%'Y5f+yCݸ^,DVn!w+k~XV5?,haih"c-~|Y(H$,\/npɰ5ɜs1(']Ֆ₆΢tKUE@ur,zK6KUnj*>!U?}ˎW22m&l!U;[yfFIqTEv0O;[< B`9Oe촰ڗ.i~`UR?cg\Ɩ!f<$H;='[+LSJuʟDŽcd%uoރ TT)*y1*^1WR##8mMr- )-AB-<"-F;⟘Z7 $%i` !5VѯEHQ; qd\ yEGJgDJk#&sr8?o7 ׏w#X|jtޝ:S"agu/%õy~e〘$xYW=`&k]ݭ+H,fJ5yC*Z*U@u =Knj5Ψ/xgw )ZpQ}țQzrd_櫮SudYyPi#_ıG.!&؇ZSzP}=y;aQWyR3$\J"8QfAR+m"jfync YH+f."w ݏJP)|#W4Tߵ`Cvaf1 e-KvxU[: |wwB)?Ň¿UDI?檝hV+ҽg5YtKɹV9Q~c!>>AϗŝN7ظ>$/Ǘ/,xQ!ӧJ [ۨ'ԏ#z_h G/xT:S`jC֣UlC1U2)`[MlMǒAj_ ~C$ )4nOy%KITקٗqʟg̾9ߏd?6c;{K">.D`yuFe$ Oz>a%)b%65g$u_E^_(hE #Tz_ O 1`lE?*n$Ch0 3sZ{7̜qRP0Yium,EE5Ns'TOÏ ۇ;o"-&|~_ k闀pHVsp1d?iG I:uIK6ԧI[d##.j"Lĩ^JEYF$ڲbz }ٹsyzi-akzV?8'0&pzOLIl(UsS.V.5bz`UF7;cjouNvjW|m -Zt({iq`Fl *9!S)wLmeq"p/w_OMb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊$C{$G$8!,d8c6*ثb8Wf\3bva/heͅU˦8偊N]1U,be▫LULPqTZ]1VUC \qZrVLj0Ӗ¸R( U㩋%;c d-W/Zr)Zq늬c*1U*C\wZ`U`!]P3TwZܑLh;⫝̸*:l1V_[se5eHc\o+̢UksU-*+3 #'Hi|r ;*st>sBN/rc׵ rq7ɱ9gh"ZflNۦ&hR.*9%I4Pu;e%s[UFՁ1I6v¢%5Wvb®ƴJh HfGe3|]7CIWo6@v6N(*] Q(c5܇`-1ҧ2!N)nFCd,CXU.<^CDR~e; 2<$ǐMQg!Ŗ!uv[v}]& Zb[3FvXvn8mt͘3hYx-P{>ipAl`FdbZQ9^H|1TbPF'rXj9WzV-N{l6AFDIv 8a8r @ T̰RcnzdpPf.k`IJ skv)n8(zhLQNm[˱Xو\b2[!Qv'÷aNۡ9Xjӱ4=C `G]4^6v"k 7;j&ؼP M (TMdc:$5"fYŨȭ$eM Z|#sl0k%'uO<}L6ٶ3c#{(W0lPbǫ(Qx8a)i~ʌ&3ż/մ!O 4FlqL v3$bd#q5Uܻ&%l*`qWbP2pd0,X!aQ\H234:K0ػ18صdG2pd@̮Ik)2r)-f6lf[.#öa[W2`\N %XvVjBs"Q$N!934 `\}Huq-ܲmrq-^ّ|6!}q\Ins 5WICY߮)hPtjNpF#RC}.xpi5Y/P <_?F*@(`翆\1LpX}$[sF;rDZ;@)OKo5=פkuPƪk.UF>!SKͿk/$mf{h}% Fs|_ tHGguY:_.yaqhO2xHM!"IdTT ?d6׭vnD ʟ?M 'z[H(*<cE$Z,+CR⑛ +3G+%5Kj{8c/x1n%=a>~K{E>#O1?Uw*~GZgpIP O^FoOk?vP90W#Z59#$Wř9EH,m&DNIү|+x3ZnhR C]i#ސ> z L%)}4mdMвTv$f"V |s Qm#kOgs|p~2>5>f>YV*r쎸3i@(=93"mic4/VZ|D{BpV2<\o+YmWn¸gQQu]Z'΢R>t26+Ydfr cN?ݣy/ݓ_!3V>O9`>ڗǦLKn aT6\c5 n=: 4_3^h81Z0"|~H"R)P?E]识M<Vu{:v p`稚qMޙo$5.v6HP}kFĒm˭9Y6+g^KҴ΅ 7+Ļ!I?#NkqGqƄ)=O}`2YI-YuyIR:0AC"%qx:F{7ߔkr:c:А#o!DdV_yHE(Wƌ[r/<9L?2HB\n%s)$ڦW3A(׈;`lto"&lB R"Wuǟ?^^j7_G?Ġ/"y*Mh@&jmn 1*7e?E_sa XHFD܀8;Zwׯr#~UEv_ˆ*^ɟ͝Šfrg@*5Y>-3Ç8oP hT=Fٶd2O"; 4FOWV<=DPAPHܒ0ucytmҋ?kaBxN_ glJ;W:bn81Voз^kӎ?3Z*?WzLPYd*OCsvv,&s&H3$CFSPGb:cVl3ʩ6C5HKEV_S% [1@2z2|(z_oѣb :fkJ|$=HQ2VvxJ~k\T+ 9 +_; [ х9~`R ~<}O^W?%ݷQJf.9򎚖[VbO3N_?#睚 <jT|jړj7 pÊ쪿ʣ',̈́xE2DF U:v88*TpySERSXzIrdox ZD׏(1 m&o$(Ԩ# ȉd zbM|JW%؍ qޑ=pZ5ӶBShup.q[v?ꡏ>#ԶW`ˆr?jdI#mW q#>1CIEN\J]\@iZSʎK **E z VVnz̲]KN-b)k%\)1:lWrbr7$aP7*eNU[~5b2cZ6X<ػؚY㉪ F]Οޮ#(~뛤uPE%؀]QſɋG3VV\U4|xߘ٤*[S1`u|| 3?Î,3!-SҷVv9Y MbG$; xDe(C޺6(G_os0N[ON9T&$uʆZ4 @38@J]C{B`۝eabԮ*cȨ*\",5ɔSd-)TPV((3#>>i݂gu;3\]aXv c7GJصg`i4dK$7aF;W]֨xKzT6u>3җ Y6a^yvY}rpϗlѴ1- *Tm:*I= )W,#Ր_&DvvPP(G!xZMeͰɺWfY^(3oLFvUhqV#^!0]cc%h m+yb0O.1&-X!揉f4(!+U"̀fMbG^yZ5 ᘇ nJZZv :X-GQ9Ih?hmc4l[JQMW@L+YP$4kMh>^KMV'QT5ZVO_Xے[M1A\˓l9f `Aző!k8qsa|$j09<5򏪐׫šMgp얽P{Lbrq w3R^/#eW̩Ar[hlOo#CWbV;xJirzf@2+oL,+[Wl ܗs%Ȋ'tZ7w! a$他< \#kۮf6M+Ĉ4d7\R ׎da7PZ#3Y5\ s&[rB# ՙ)ZN[l6C5+er@_{ԗW-P}nlcCw>Y0 rݍgʻd vY!CYF)lrܟV?Irh-E?]S#3)'ߧJ'[ dԵm qIЊ2ki?kS*"?-:;y ٿ teBz^5e~%,!ouO36_~פ?v"pޫ MkBkǯ Bg7O֝jǣ9?k/}P* ExE#y^e0/3`9nٹQEFû%+>,OB% a»7#%?x eUQ-@cy<֥i@6ʼnZ#oƣ( ~r<3~%AO Asy~Zj*?EBpėQċk2GHKQ|kC]Q+22;3cv7d-Nq ܖ}~z_erYnrM5^b ŷ?gM|!oĐh ݼFyE[km/U`?~,K_o)eSчV7VT)o#$$Dh-#3?rD~?U7Fsw=H󥤷 HKxž| \SJqizfi. nRF2z,dY߅wd4]:?Y?Ò91mYPTT)ʇɚ(V7މYN?US⏏&sϧOw%@S]v#48o-vN.ѝ nJ>~^l#Yo29mV?W5q  5m?Qh$x獇ý yO_YTe()/ ja|q%֡y*OnŇD9 IDJa.y!QhX<|<>F< iR;q=G]&8, H߁_rܟl?I?<=]?$Ѕ+2qm,͔H ӫ7pU畴Ja49r?cƣ3/GiDtJXHzPwni