ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 13:52:30  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?T_'G?96OiD^%Ǵ0.Fʘl'M.ORWӤk3hUs=}@;O#W[{>̣g4ލ%ѹ5ļTCʛYc1%ݖKQFԖkNLOBIP<'EU?+% = KC/ؗ]APĻۭ/M~d7vJeW$"ujȮ.{ JONaip8pGbcVYKL+JaxٓyV>cZXTߐ+{j[r3*S_"M~gSz,bvh39!KlQ״vkl)wrN `u\SɈ8;)mWcSSL *y|noYexk5z~@NܩZH%͖TM1{u^~*LYsL42Oe5j\܆6uN;#>))9fݎVJ:]yw^Ni-}}[bQ,}guOTe itphiN}moH{Z籬{=* ˷Nڥsg+uA$@.korvc2<;.me~pUEɽ}eĶuѻfV:Kh̯/m6wv;[6uzz8 w|Qx{͖esAC-C+%>@jV1~ \6{7 vz7sM] X'g~k9d>ZY^_~r}w^6c~h9/ͅf7Ow^huV48;n/qvt93[U@NoiG11"ukˀ#Tb3~-u=RaEs}]vpT7؂-i/kݬy-a] yN(.6H-ix(k\mm41 7lhj21( cR}mw|\VvݤO-:2H7в GN @z-\|s?Ꞙ:8TNQ{X&{5cVLA$wU,QB$%\[~`6ZY 47p埚|{<_HNpK-gZޕO?uuV.2?Z7?;ܺ?kM;?꾵5ď'Q$9`axكg=֫ <>}%uƬKHsZn xL!q]dk'>)у&VŹ->t&9uN;$ H3k)mmUG3ߤ=>?Nfv~qs H2:{ߚpMwe<|;?ZC5tOXuOSoXF5[Y9xV.c]ϭc^.w7Yg?Zݯ]-sA{ߥV}'>XQct:Æ@M@Loo;_u6}gʿu7s˿7J&_Xkk1$.!E3tXƃ]۔龜xk4 Gv!ucO4ENNwH;^`a?ΰ{n=[lFywjzL* {^4۹~I.껷tg~F&v>5i=b[O |u0rѴ80 V~?ޛF6*Q{Oѭ"dGtޅA].qYz_GgR n Ay/dCg ?+?KH.)wW ;5l]qYzoѿ+?J<0ogh?ޢYOgҹwUC?xDGdDc_%g6~?$@̣g4ލ%ѹ5ļTCʛYc1%ݖKQFԖkNLOBIP<'EU?+% = KC/ؗ]APĻۭ/M~d7vJeW$"ujȮ.{ JONaip8pGbcVYKL+JaxٓyV>cZXTߐ+{j[r3*S_"M~gSz,bvh39!KlQ״vkl)wrN `u\SɈ8;)mWcSSL *y|noYexk5z~@NܩZH%͖TM1{u^~*LYsL42Oe5j\܆6uN;#>))9fݎVJ:]yw^Ni-}}[bQ,}guOTe itphiN}moH{Z籬{=* ˷Nڥsg+uA$@.korvc2<;.me~pUEɽ}eĶuѻfV:Kh̯/m6wv;[6uzz8 w|Qx{͖esAC-C+%>@jV1~ \6{7 vz7sM] X'g~k9d>ZY^_~r}w^6c~h9/ͅf7Ow^huV48;n/qvt93[U@NoiG11"ukˀ#Tb3~-u=RaEs}]vpT7؂-i/kݬy-a] yN(.6H-ix(k\mm41 7lhj21( cR}mw|\VvݤO-:2H7в GN @z-\|s?Ꞙ:8TNQ{X&{5cVLA$wU,QB$%\[~`6ZY 47p埚|{<_HNpK-gZޕO?uuV.2?Z7?;ܺ?kM;?꾵5ď'Q$9`axكg=֫ <>}%uƬKHsZn xL!q]dk'>)у&VŹ->t&9uN;$ H3k)mmUG3ߤ=>?Nfv~qs H2:{ߚpMwe<|;?ZC5tOXuOSoXF5[Y9xV.c]ϭc^.w7Yg?Zݯ]-sA{ߥV}'>XQct:Æ@M@Loo;_u6}gʿu7s˿7J&_Xkk1$.!E3tXƃ]۔龜xk4 Gv!ucO4ENNwH;^`a?ΰ{n=[lFywjzL* {^4۹~I.껷tg~F&v>5i=b[O |u0rѴ80 V~?ޛF6*Q{Oѭ"dGtޅA].qYz_GgR n Ay/dCg ?+?KH.)wW ;5l]qYzoѿ+?J<0ogh?ޢYOgҹwUC?xDGdDc_%g6~?$@ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$XW(jm/ƕުpw92Xw97eR_47n Wz}/ƕޢqwweһ\2\i].o7r ×e)]f_Jc7r Ws_2\i]fJc7v w1;{_ Ws׿ew1={_낕o42eһ^Jc7v Ws÷eһ}/ƕc_+ 43p+ ߠ/?pi܆o +N3O4C7z Zw!\ii܆a^ӹ 2\ N3~Oapӹ 7 ?4C7Zw! ?4C7 Zw!-;yKMA]'0Ӫ2A] ?C;pGDŽ:1~#:A'?4cݏGƕ?p+%~#⮮W[G]\ߡnus~O\4aG_KG]\З늺.urB'?WW7kGƕui4{=~#JߡC]'?*ߡvo?놕_./=~#vo?+~O\i]E~#J?+~WeO\i]:UcIe_cKNs*4ߢnvoWVM#ߢnfs;7蛟Gi_?;7軏F+N.ӳ~_bߢ?;7諏F+N.ӳ~_bѓ/1ZvoїV2ӳ.~1ZvWˏF+Nqi_g_bߣ'_bߣ'_bߣ'_bߣ'_bM~1ZvoѳVlVlVtVt#eӱP+N:|•^쳦 #ߣg_`Zvoѓ/0ӳ~-;7Ӳ0د1e #ZvYӧF4Ou_cKN6F4/1f:t-;,541e*ӳ qF4PcKN7#ZvW&_cKN|ӎ1-;r ǸƖ,&=ӳ -;( F4e*G1e ziiߪiia3t_cKNkЯ1cGOJF4oԥ)cKN6^?ƖX{Iх`e9ARӲ7#ZvYӧZSqVC5e®oݗ#+??G"B-)8]?ö~󂕾G7vOqoY)M;)r9_??yKNsE?yƖ? Nq@Opr>_M>g | Or4W(V~A~%߉(us~SU~T +U m_~~A m9*M;(~i] mJ?yƕ_ +C[) Wf:5i]]8igH9e6n ӳ߰?~e"v?yiٿDxfo ӱSV*?~+NT?~+N.V:diَ`~Vd=ӳ .:ZvQ!~ӳ~e#%If:dSLIf:dT?"4OQv[ia׾4vSi<4M?~4v4XӿZvQnAZvftKN{B_ KN[|iiَ">#Zv_{WƓN~iiMen-;,b$SƖ 4>ӲhAKN{MءًPbB1We)p[Uى1pbˮ*i[&UGmV]L]LWfīl1Wf®ʮv7qWf'1+ZƕA`Wc*a\ULUv1ze.0-M2(v`dUC6*죅]M+L*ܩ5kUbi_ ![9d.̣v[ 777be6*좸G劻+b Ug;0.me*6ɄbGNГQzղ64esqle0++. e]Wf+*v[S*1WcNQ\(vn^8j8d]2)vV+v]++ ( US (u]ȫ6* (0]qWf#vU1Wf" Uu*~*vlUنblUـ!qWck]1Wf8Wcbm+jWl+@*x\ WeK^ءʞRxWb\C-;C® v1.Ʃy!]ơE@Vv5ҿcc2Ov??C]M8P]܈S*y]]C *M;Ar`vJxʈR>RPseC W I*{2߾bkt4ȱv\4œ!J v*UvR6ێ-*mbh8QW B:xbc-OLP)\e H~.SNǙv=F*bONتqb8Nŏ.M7uNURi9];Ȗ17U;dT8nIaR0b͊6*ثbqWgX^,N*9p+G1 f.\Ug;(aWe͊51Wf*ثWvlU٩6*ثbqWe`K*6v7 edUpFvVo6*lUX(vUqWf‡ إe *ءٰ+WeCg0\77pư޸e5rA[Tua\ 9b8އ [&7˶4' ]' ­*1"`V'Q5+W"vl(vVvjcjk 1 CoΘ늻,vfRLKr)E@]#zm]q]pW| Ҹ7KS-1p%Xӊ+*]®=qWfw]8(](] 쥓}2T\وWcAp@ Pă^НӦ4cP® 68?WeiF5KAM\UGc_א<1Wb犻sF#heKW늻1^#lT;1w8ܶ>xbA R*jQƴmn*JS]J*V^1__׀4d7vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb)J_GBgyR7\aWW(bZ8͊+7RlRͅŹ]v^;1]L UٰٱC`WeUXPثbeUٱWf®8َ*va6*6)k6*X]CWf͊—eUo6)vU1We͊*UXfR[f8V(o6)vVvlUٱUٰb͊]vV(vVvV(vlUGpͅ[͊]qWe`WeUـ]Lk(Kc( PVq1V)vY@#\-c[ͅ]v[bNI.+,Kf4v1, P)v:M1W*qV™[e!R'&-{T)cjr8aZ90!ñ+y)v?b0!؉;K`cWf]8]V뛶*qKyWeW J eVo05]LUDa l*8pʦ*QaWeӾ*ث4Ɗi]|i.X9\ᄫWc_l #,ZƔ0\[`P=%]SbqWflUن*Z UUq4#c[8() k2U0!mp8o1'(]vl)vRvn&]lPmp+A.I%ٕh1*p;(Wf)*9B]\1 wM:Dӳw!ٺl CN>We2rN8ٸU*kaWcm\URqWf®LULk]1Wfvc*ov8 Uv8-qWe0 ]8*qWeU⣮*in;UM1Wf-bI)v:٩EqWc'bc*ivb].L(vQ W$cKPvSث Ck|UR0]4]=p%, S @)߮*lDlqC9.)v=1CF8voHv[Tl{b83R^{;-HN*҃bf);TS78W*PU RcP)e(e79;-ɰcTme.8EclUوS*g0M) KT0%٨#Vv1۾)v<6(v[8w\UE@]bʎ%SָԡhF;*\*ʡv0+hqW`pBXS—bC]}Wcʫ;+Aq+-k7$H- (o6*ثb͊6*vueJ򩊷\ZqWfRl ^(vlUٰ`WfpXUٱWeWeVbCW+o+ ]UXٰ+vlUo6*죅f)o+va.%v]|02u2ᕊ9*8N&#Ջ0Treg5|0+ĺLq  \qWu}Cc*Su1*6[V)o6%]dPv4U\ qWet—W@;)+Wr.W MkE[]lUъoKWE.\Pivo)vbp!G TJW1ZzdU\6+zS$ʝ}f#z PoإEze]\](*h]p+va*mqWe1We}WfUN*쮽zaWcc|Os*q;WWb\2Iveؚ1C_ UX08j54'bVi#* nԟ.ːoV|CRzSv[0cP7]#jnM2łSH+;Twivfn:We>׭ ?*Nv9UA]m;)]㊇eF+.ŭFNk 1iXvlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb)J_Gv~ם[iK`Wf51C]vbqWfo(䕼qd͊LU٩(vlRث`Wf—f0+WechvlUٰRثY(o/k1]vlUٰ%xlUb]p J\ 챊Ɠ4f.lP–b]GlUeWnL Z͊eb®]nVaWf]6*ثCCbVo6*/®`WeRs UءU9tk6L+]7*cfbveU8i-L*sSC"B)e3KtPdKP0-C[Ѿl坶+v9 cN;c!\!偄O7W6 Zo zb*1C[WW(0[-wk.nvU1Vp\io.`Vp+y CWvbpvVJn4Wc78 -qWe ]ujc[WeLWeąvUqCc´su  ƕ8)S|;IlfWV똶<*#JծWf8XvjWJk64AS!ڔrIu3tX+ZlDž 'VU6!io7Q'v4RWe0vnFָڻ7\ \6fp+bF*b5A|r\LE{km-MN6L;l]\i %v=+UٱWf]+i'f6ʦE.]]+bFUٺ UJk]Li]JU٘aWcH!]Ƨv40]Wf )Ubi7mWf*o(( bjb̭. PqvT٣ZcJP+8)] $;Av1>WbgnRqޘv1We.ءD]`]H */Av>2F]viF*dnlU2TWe**HTvUG)vRqL7]CUנeqWcA'sv[ C1@OŊӲZqv$c2[u_MiLQnԑP:d]ZL*g5 @)]%푵vd늻4M8L Ol)v0Qi-]y* Uq(_k܂h)v**]*ZUئr(v`㊻ȡWe]KdZ8PjG|v9@*P~Lq.# k)9'm0 żثb͊6*ث\Udž\%y͊(RU,b+bLUٱWf8ن*8j͊RPثc(d콆vV8[WfUG*UثyWf]8U+ vZ2*͊F*+xp2k*u:Uɺe[LHpʥ0m+ )ٹW %c%pe1VeTƝVc[́F oƑ U}qW Rk+_NU1WSqV&Ƙ Wffm]Lh94e-~x[LUȔ73`E8a\ WUوWf+5—fqWf51WeSvn4|*q%vk]r)voWe]cLUٔaWe]*i,튻P78vb+MKɡcE2JoZfV(qWe+qWcKԑ1|C" `1Kt;7SZPE+ƸT;>q]h _*Hvj;7bi\)v^9Ybi]A]ScqvQ?I.ʪ]Buȡ|;ZA..ƪp"Ul < R#(*zmc/)vf|'];P Ʃ;aKbiźoUnFÒO&%a&Vżثb͊6*ث\U֎{$6k6(vlUxU S1\2]LU٪0Kyu:*qHhf)o0®ʮ*eUN*@brcJqWf[UqVWvV(vVv_\)vPZus m+o/ ]EqZv41CG,트eb il 8[͏%o,!CXӅcCtL6nV\`p8Cp+8[vb9 TVTRqdP8(vSB+ +LRc5 w%٩ᆕNg/ӅZvo#o)E6 +x7E]\M.!hv;6c ~uSlUc->X}Tuq![6cx|*S;50+WmUxؐ<I-37*pN9v5vQL*#vlUDnqWf;b1WeFv4|q]G)v4$_*hJn:4;1Cb`:.֬)튻3QvQ(j ۮ*z6t]|bʍy[*R?F*(*?UB1Wc]UPwvdcLJvYE}*h@1Wc{R]K@w0;s=+ޯ%늻nu?F*첫&Ǧ*rGN(v`k׶v&x=pccT]A7]7cKrء؜Jw.ǎÀ^v:Wv$RRQAq`We?*q`h;401Wb(vpxlY;'~(vث#wۮ*TRIU4]Wc9+lx]nثJ`qKebvc]:Wfv[mPqWe4ĥaHleڣjh|rHoqWf;UU)vjbe'eqm| q]' (RaWemv1We]+vlU}(v2U lRhPNG5.ʉ"hE0:ZJO`Z=FdlUٱWf]vlUc*yrRbu8BC_\UG`bP^vP Fhka 1C*L f늶3Wu3)p\vjb6$6*c2qaUDbQPqȡvj%)o(!irKU U1Z[[f®O Uن*챁]c-0!C F*CAj0+xӅ[[A."Ed7\.P Shst ]*Q8tʯlRL]]# &uƖ+p+xҽ0p9x /vPRث.c+J2U'qKxoSd Cc.N㊁qScۮ K8)` p1vb Wcxִmٸm1vU+]LRA]ٸv7|UxZS|(Ut֔®jbƶUw)v7 *q=*QE k~=@7]pA늻v\U^'Wb@hCwB zbb^'LPc.bj* S*Sv<@;cvVڦ8RF*.v^;zaKva]LUWlbqiWc;v3*x銻(dܪ C)7#]*Ɩ]FI]6#v^v]qWcqWeSvV*u6*]mv]\Uu>X]k0|U٩/vQq$vQZb ¤Ɔ} i]S)vPRlRIC 1C6Zv@(T7?Paj5;,&q.PVTlU؉.w٣]銻) 8~Ejn1WbJBHހ9Q;.#^ bRF(v`UI# ]+1C`o]v8Rccv( :ܜRlٽ$^ا *xWv"pBV8q8mZv,+@p!]e' E:`Wbp*<̭ǭqWbm l܉.041bz(cQ*Jbe@P؊GأqĮ$xm`Z=FdlUٱWf]vlUc*DYv;5()lf*㗁 WLPq튵8R늸㩁 WqVu]F*dnX2KlUƜU*\F;犵Wp͊7]v7(o/qCW ثlUثbvW\*m+Uنإ7*aKTfU1(\r f# ]\bTI3pL(\\6294F88)h0zaBYS*8+5W$ɼ])vU{aWfo| ቱ 5|rJ8 2*죊+.]f WcI—fثxv7SD]p!i] m7—fz]AqWe[(JƱ Ɲ )V&c]7vb8e]H#.LRqWevl]aMoO  ]#îvf銻)1WbdWc@pGnWN1CzTlO,.iB1Cܛ}+_A ;`(._+ڕK:Jo UNDn; UҢ]?<{]|Wcءوv5;fm|WcqLPX~R}:t=1C}GO P`bB1pђ#8D]7$9z*r[]6(vUp%ًS Li=!٫Q*e{dz!q*i›dUƔqWW5)Vq M6v6bc#R XY<7-eSWc^(lbrTҝUMw++S @=2*L]C|0/"ˮ*ԮWfm; >}8vb{Rg,UO =B.ā=WcE銻Aer5)vRkU~UؓZ\Ro.4'`<NoC*܍ive5ъ/nF(v1•R.4ǽHFo!w6]wU Xb;1CkB)*]%bnSGA5KM#[[yWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb)J_J~RqWf®L ]\PZ|U@VS [ʦ*.8٩Z8bf-ءٱVV)o5iLPfe[sSk52,maWef+GtqW o/k+p Wp\U[\)vP81VW;1]qCc1JeZ' V늻14]'Ebu2[bfZ')*z)k-w]\n*Q]\Plhen7­]%eb.+k6*Wur 1Zb7 j cIo,Cq+N7q+*b)c(mmى6d㗁Z\PlMV)C[o)Z]MوvcWePSyF(vP'N˩R)WSO/7L܎hL6Sefe6c&\qR ” f8Rʭ0+Z ٷo3!()qC=++\*qƕٸˠ]\T—W+-r)v`qWS/|UvRWe֣‚I]Ԧv8p+XlV5*jũ&N4˦v^˯l|Rb͊pc6*j↎6:d8ҷ$*쾻Lp*tv86ؕhIʐV®1늻a%N-v`j*qWb48gKY-*"g†R}*{&v$ƧK{aWf8ʩ]jv_"1KrZ.;45]A‡c{LTebv7vjaK}(vX8.8vl ث=V劻zevj* "du]{b0Ƶ1KvS'!v3;w]؋CmӐ?]ERV(v8VLPdroRY*1W`y1(B C5 ݇L s1cؗqCa]q5v+ȫZ;1ǾGWb p!ďѩ')vi#nvT9)v)_LPJvYvSGDs4|Uث*qAµ®`3Kv"2׮v[(;AKH]DAPʠt0?6rC*N^CWe*To+zl.Pb`C|Cr+)6]50Z-*t|ץzUtmے ]d7vlUٱWf]vX늻:2yEpRL)l PLRa]LPQbX—e`CbaWeK+`kq)1ʦvc[T s] Kyv]LUqV |qKG7Ut˦us\2\dr ]K´6С^Cd&2Izpmͯ^+nC[^ޭO|ph 5?Xc*`b+8TϿ8]< qC5"d^Hk`…C-ArA!ծ%.85qVp8Di!aVvjWe^W, nD8U*ole'=xi9nňA(OR2 5jׁp޴hE7=ql`?BMFTa7a탈QMOld n_6*CP82h+чk< Vd'Vڛm NOa x }`=/c<5G2h"7.v!\Vd MN1R2:~ء~6WHꋰPqu߾Em}11e +IvQ=R$+–X +Xђ2p!WvYuƁIveFcEW\z[z#Wh*"b&n rT︦WjA qܬQAu톑aH_&|}0ry{O~nbd;^]BWF/`[F(v; be.wj -*ISK]%1@XPiJWc%R8PrK0fOW0@m^*P]1Wf-*~x䕓튻,C#lṔiLY;4q.LUM+!w;(6)v)-);*M_6 ɿ8RdRA] Ol M$&V;QJc mƮ6&b0aNvSm(vaNK7ъ\ ը6—c8o*o$'߫q-$bZ0 żثb͊6*ث\U\®0+RCr!إَ8f' \2qWܰ!:b졅.9xvQ†bf.=1VV*QqVarK|Uln(o5qWeT\R2Zu-cH ..˥6SjN4$dRo*{ev ND(׏5%8Vm/L(S$[RB$qqq Tw ob)=89#m$R&y$SVSJ>ָZSI+ UF(o+LaK/–zW*$b r1Wf1Wf.ءB]2A*ݺҍĴXtc{Dkk,exjS(ڤ0Ut.*$-$4cxy)G|h~E5tV1p”,PLiWW27a[h1 pBGȑ5c}aj߰Gɏ4xaw&bmz3l]H7+M:A8vM)Hh̠wӑ¯dt5rQPu.T5$LX2j٘b41\S*p+1V UTusC e`Wc—e Uxi͈Wc@dm]vXJi]\i-JaC{K{CyO\VݖEF8LoM1[ Lm]L1lel2ve߮vYvUiƖ=We)钶NڸڻM0[eVK۫no2 f ScnF4bp$tƕةa\!k-aI]| ˱m|ƕٛlULh~x).2W-m.Mv6ƕ٩+®®]M,m (0+Wc1;1o]Wl `8\1CLUو]E0vP$aWfjL ֘Uv]6]*MW ]*p!#b>LUْ]]s]+PqWclRo3Z1CWc9|Rd@[DB(vPARNv*jW]Uؓ9)Q]5H;ث¾*jECM —cC?OAmآJhrAs bT튻 Ubp?q`qC&a)ӎ)v;p@PMk]Q_IyۿlXG l1KRxuWbiZWeFlR FSlU؍N_:b̧v?`Ɛv劻#v1Xt`Zv\-Π—c}Wfbi;(z`Wc TaKП U"4,zd(--]vlUٱWf]:η\)^Up+ *U٩+6*[N*UqV陎![9xl rIvjfjWS1][늷\`VaKPb7Q[/)QOBM+ॏ+ηb?Ķߤˈ7t4Vq[o L bpq!I?]ߓĮ_}~-:$rX+xq$4-cl__[xcى̌H]C߆h0`bX>!+Fڀ3ƀ( 09ULZGN.N9lW xr|dzTOOr!kVRBx}6J;SXdr>GK]4JY jO].WFf??Glj]/W %w_K(+j;c׽#%wEC%w27_ʟqxޘÏ*I/rM~Γq7h#nT1-ڰ'ߏb0(I9 j'V/l: G?!'$U?FI,~B_~gV\Msbb͊6)vlUM鲟*a>J֦\0љzK!NaWa %T"~{BZ_kyI3m&h}(;Ͼp-W,jOjV;d\};İ۱sP9v+nƓ\64UJIO]]|ClUv0;Kۡ]#] ]o|UjbePk=.ǫzy+$TӦ6yǯ]g)v)!].:c+Jcd$SpFU߲`ZW*UP Y;kO?ClyWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb)J_GT?G΋%\U15)u3b8,`CӳS 6vV*|UT]LUpZ0gp3blU6*lv]1K:*vcndb]𥼢p`CGM1CYU*إ٫7\U nl RJCnXt'ZFX4Tʧ|)v_\P X cN\1M62KN8JjqJᕊ 1Vj08( UlUqV5:`C U٩]\.e銻0[]qWf*r銺]\bZ9XyWeUu]]Wed1Kc/eL 쳅]1KP-wMq.k|*8fV!3 mm+tV0Tpq'U$LR|Cyaƒfƕ90n\R|*b< iƲ- W+SlU֙S(pZbULpk i*׮heU܁]®ˮu3W5qWf +v]]뀫lU\e ]7 6*4®,b'vQ]@q@[e]qWfQvnًb e7LRV,]18+0]]$$2fL)v`9 ]I,*@ 0u2%%ur1]\yJ`C풅*qn9` ؎8ه(v1e]$}iن*+)vQ'vZ̧v8ءؖ)vX]vjWf8 ,J(.E]]WcڸBcQ8P쨞]k(v]h>*W* IUcJ`Wek*Jv3wbc@b(.#ozeNA i§v_};Đ+SU*1)]]RK7p evS1 +=1WfbbL]TzaCၧLvSG-]vj6] ®V@#vRU`CjWcL3+%+qo0 żثb͊6*ث\UrInjCbeUCbN)o(]Hp-f[ͅ.'5p!Gvl*6*쳅]]q}3]\vK8I7ȒH.h;uȾ,E3SJ ZF*a {VM،cNٱWeb͊6*ثb]: hװzI=:HpHF*hh3D W%H h=q)mVM2*Ac6R2lDX2+GLh"8F#|plSK1=݃EFVC8E/+&hGqг}^/@ iToA5=&MҺB[$E#%C_X~lUٱWf]vlUٱWf]vlUٱWf]vlUٱWcЍZa\=Erhl7Ho!hd)dɾ=}IAS]FnLa$D${/É#KbY RI.#F4 "IW2e#\\Xb[֗h~$/ }9,ȶ!k6*a͊6*ثbߞa"ퟖZ D3RűJ];6)vjbcxVN׭N;zl~$K^UӠc)_au~8F$+ |Ѩ}GM@h8/mUO,! ?9.Z'Xb͊g˩av"B &n* 8@Wf&aWe)Q(|]F*m65ew}xPဩv[،]_$fSUQ׈xu lN1e0jbbnJ:u|U{; Pv;62(vn Ve®*vV=)(v&+b˔R*Z*제zCFhvX44 v1#v[VN] u8U\lc]UNP=w)v&V~RWn:PK! Ί튻i#PS(v?۲]ؠj*ǚЮPm*J)ָ٢%7S)` lOlRQv4&ȅœPp]?N(vW752|Wfv+J6.Ƴh*㍺R-e$T% [͊6*ثb͊,u]g/db͊L f]L—W1 ,vj͊+ ]ٰ+W 5kvXRwUSvaUbjv@ۮDn?J\.{$|;5Gv 퀨_<ħM@؁CTj1WejcTWf֝"h)TWIOQI\m)# *UٱWf]vlUٱWf]vlU-vwkڵ -ժHy3q4K!4YxdgāI( 6fdإكI]#_|Rip>ѥ|pv_ W|B7v8UƔ=G\UٽMMqZv9@S|vP$:mNp`GZm߾*Qޔ$W)v5ҧlUUr 3JLU^_';hZKXkDx̭yWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb* PJbË,K!cQzcIlcAk+M Wb1ƕlHWb;)ڇc ['e<(v8avl| f#;3n(v^b+KL ]vX]vġ]pL WbR7K(.\BTR|FL![| `We#]50*@7'v6CNn5KA—cOvVcA㊻»kC]F*yNC|Pgt ];C3En)v\PEG*J!Ȧثm;/b W}*F>޸s8?ƕه\;+Ѷƹ~mV`;1=LB]UaHv1#C®Ŝv9_۶(v5WvSP)# ]u*̎w1WbV!LUس<(v5#jRRNfJU;bb%#v9 beG'8FOEB;|*6ثثJPv%)$֘;V0(vS(bƱv1ڟ ]7\r^O〱-wKblUٱWf]vlUc*9{$6*ثC]NvX8Ueu1aVWf.]LU*F*͊+LRb1V6yXU偊N^5\,ȆՓsSrjW@Dbυ2!7t Bhv ~V،z`C!]E\+ 9;.8bar2auq|1:*5̣ 5a;7CAG/prSfbsē/ 2\U|RX hN1p̒(CؒA_?G.B#O2,Tjj0p*~eޭ}ut,j _G4\1 (]Jcon>ߏӓ\ۊ0d wB! HEkL >%hdDk8bz"D? aCm:@ˆRt(H~ăI|nnPmQ4aLj a]ϖ?Z&iQ걿 pXdi<4UsE$fbC銵6VUقס.e[FUWf'v_*b Q/vlUٰWWeW]](v[`V4*Z 죊 5pU*z'*Cp*q*6t]@j`Wf¡u-S(P[ ba®57]H[AWzdنX0qWe{ؙpR  *:d[bbhqKA eŰ]풊]\(v9[ p!Fnc)ُM!GqL.2vjB7J]6*콱WeV\], U٩vQdJ)mWc&mCWc;.SK$e0]—eƵ)(vQ4v[GN؛)+'&~0miC؊s] \v;Ȝ*kbo|UJ7av]y RxOLP*ݫ*M]t(1K8ZF)<*`""{|`G{C 8Ė1Jd;(JTWv=%Un vQfI8'Cv ?C]Siu]& 8ػ^0D]emS*KrZ.ˊb1CVn;u)vW$`KRu®ȡdءDjv(7 v9/M*Ԩ})v>= S;*gPǦ*g)v"G*]5_S]qC2k* o6*ثb͊6*vu[vlUٱWeb͊\U6)o+ 0Kbن/hU6*py`CVR▩ Vbq둭fOZoDTVTRJ%|pNLI?w݁*eثӊI=.Z\A.H4EST#+nţ \)U0vN{E!ݷWT[%r7)5?,\ C8v~FM/2("8sG7N׈(؟?KdK &G2 l^QVs6!^? bc܏񤃘 bjl%GN?K\ /l{8ӵ;mEyڸoG ĭNDhL£nbw}saWSjl:㪟6ر!17z㐭O׶V+7Z~pAoRMxGUb)'þvX *T|,daCA d;(-ؑ|Av&O|OC*F)v-crmguվ\R -9SXXTzd$ol~}U9 2 *ԟ[Mg.ig?VHdYV0b39 D`J|HAU6VIwRQXkُntk-I+h5\1WfqVͅ+kWWʦ(]7 xM9T#$rD~/8'HXjZLa2Rg2S~ Yqwʥp[LSV1($$v8i^aGR\Z r%&r5Iwdq;i_W' UKC-ZLU';!)v%FݻtWc] GLUgSpqWeA۱*T#ڸؑ5ߨ]?;oVثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb)J_G]v~ם ( 8tW զ)u3.ث:4Cv5 %|pJ9+YCRm1Zv;qN*f eR9(q8U a*쳄%ـ]Uٰ!٫+ [ͅ b7lU­6u2*rWW*ˮ WS18Ktͅ.ʠ]\v(vV)pV0cvcUȕqjDTV$0+C+63 Uى6PYZʮ(n{UClR4U1Vb-X8B, %[Xػ1EvQ-fYCaVur) YS+ [(HĤsZ qJ6]!A n!`9>QpB$QuXDYԶ$2ᡨ=q07Md]ޙFEM<1+v8`e \s`W f'lUZ ČUDӦn8oLvNjS| U*f*f'o(![e# %ecKN9D;땊U]:WF*n UӾء.Rb|1WcS!wҴ12i+yC .ه*4UUَ]V gCjz=`n0]]2l$qHCO.# Kt9n$TcvgFJBX.jSxCp jSe3-,O%hn#ذaZ'sX` t/: |n#ag@? !"tub|lV<|\i!ƅ%yzCYB:`4$\n4_EqC \U9Vの aM\<6$ 6V_[PE93ZsC&".iy[x$t‘8DZ~c~+Nt#>BbU؃'Ma^@{%o/&vX4-Z&O 'bci_$^ W| bMqK))ZS*;tO R,waBO]E=@E'v=HH*R㊻ۆA"?q\Rx@'qKB c{UسpubȾVثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb)J_G]v~ם,J/vQF)o51CYWf8S]M0͊1Wev4⭌01\U5qKWf‡fٱWeWfى]1C lUY%leSo2Wc%njb͒UU]Uv,ZK]UaVb\Uَ)vlUqWfF*`Cm+(Vb\Uf v`qV)vQو;1- ip.)h튻(1WYG㊵\ǦvPġ62%A–Ȕebe 졅.ͅ-k(['MBR }8VMҕe܁LeXq.v#A_dd~vz@+ 2r$;.. ݏcPN&\[gӾ4;q˨)(s0'VA)CDjpq }s]®E2(XYXC18U8b2J;b`vDLU[N*;EpJ]l ]\UX+[XZt\1a;b ]07L)vV*ءXt͊Z.5pU]Wfi-  cN?EGk12p~q9@Ao)cLl O|%RQ]'dN VnF!LiUWWLULi[lzW6Bթ<*~j_יXa'Kӣo:[AshXX! _XR2 h|ƣgڟJ ;>?9hJz*)p@TbVK* V_> Y S-z-\1N+u`wȕu3P#j96kW u0+YE*PHA"+Z5`#)?lN=;GUfF9[Å5$C^4D/J)MM2E[*kKF0h^=;"īT%S ]| WپjҸ] +@2@ >B+enʉ6#vY\mِaC MNvSĵ]|j;ƯJv]8UWb-4.ǀpjqC?O|U :K~UnS W&]/%U{ʆE$.vb"ؔ7ӏSZC-qKLWb2,]De|!.1M&cO_U#VڬqWepe-Ěuv&u5sح LU` pRTN)v6꼻c:b.H=v<1Kkt] ̂v&%R}5؜YSY@gi)zӦvyxW`P6*>8Rj.E]jqW``C(Fik)̟ĭ=F6*ثb͊6*vu[vUqKbͅ].UٱWfT\U6*lUٱWeb6\qe.Upy++| /*lU$-|M9m8!( 0cA.6l(.cX;:|' %;cHv7z 4e5ƒ⨔Ɛ0W,]L:yoEYK8^cR.>_%ySbFrUcdcR~TgeELB 5̟ja,bզS O 2,6D'"p1Ju(~_,MdPƢ%qj'򭴄KipǶ?^9 U.l M $Wֿ챦ZGCEFM[1pb!zt풠Iq۱hc |+5]#Td8f!Zp:3zQ;+/*!kbxB${uT'%F2AZsVzU9)T$H2mxnT\ ihA5C-NI tȀؔ qJQ]JSC #Xa**H酞e_)OHa enx ?O5KkCPlL⶷m%[?hIe|+)V,c+i"X 0Tnr-?^~M#>+'"(X }$wܪ12ZgNŏk.1)`B}crJ.%-Gl x tƐѓ\i_@qKbaL-WP,KK0R 2wk%+խ-I۸8˽d\1 yJ tlVjz NƽkL vbT0L3G_aWe)?C)v9 {ֻW|Rǡ;LR`$~8\v\U)Zo_v Dۦث˿;Ga[jn C]wRov5 -JkN]\1Wfh7C1Wb}N4E ]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb)J_G]v~םbPCad]Lvl ]1RvSUU v;51VbebG|U}CY)p &a0­UءTUL0le(qj !.ZlR $ʦ*qCG6*48 K e*jbU1KyXو.ʦ(usb\ [b08t\UGk5+T[1Cu.LUَ*]8+lV)v8Rbc*qCKj(UX0.^)vUqC]We\*7—W,rL! XE^CA)f/x `4PҹDWt)Z)ܧAX7!i#=JހS2d!ɄMhKnx8O3YcfFvrb0WӵnϦ~ U8SҘֆXwlYV뚠`Vd$*c+-`VU}p!LUَv770l*َ*;,—q o6*1ClcJ9M%+*l(k6*ثc6)qʦ*lUvjm( PvUٽaE)я@r1t`gBSN|֑EP_q+A,$< !<^cW[| F.n\m]Q6-Ą `REq*1LP7ڟ̬\/S4R(R&rWeU080>9!"j?QE<lq\8ܴf-QfyKnF`\YiD\Zvo.^/EQ>u20,8J08fS0X,zI 8X;cNk-¾JGlmѦ[y^n<@0ȡSN0W"΀46l!ӁzY raGbg? |͢GJO6^JNV`xZQ7sT҇2w*e#4ZqX]~t¥BK<ƻW4nj0Q]I,r;j- Iyn' U-es?VA̧ZS`3r4fuɄ;+Wfw`*m E.#qvQ^*o.Up;,WfN%]l26c czbĕU)v:;v5괮*qZЦ*4튻&8R~=Wbm PQj*4))vPRWcPVMI)]=WbNQEqK8Wb- v7`~#l*V_}SJ 8;" dT >Mvj`r޽WcV2\e91BG' U؜1VD69Z;PԍلjQWckI.eVqKoA;3qWe. Pzb J;'b*i`ĩٻ'cf_g`p ;-b,@rzPq?ٝw*1Wez]C]_;z7=KL )` F.8DJ ٱWf]vlUٱWe[bͅ.p+be]v^*ثWe͊6*ثbʦ/6*ᕈVjצ*dJ[sg)(P*GÒJ 0]S_=b`V>X=Ļ@#e%.J`vX 6߆vM|n FjZ(LcWtɿ8k\$%3aUO)_J##۵~H0LtDXK E:(|ǩ$r*v#TLRE)QUų6U|a<p"l`keh?HD"evn{nڦʱ m4HTG+P0M@'қ?jepSh*l05,Ux;hnk/ AҩCXS g|Ld(5@0W{>S.wfO*krMuHo"T;cPB rޘSMYVo,zFiioh)d6ВpKXB͸Ur 61Ѣİh3XpOVllE, $a03JJcaU3.=S nj**xnU1Ku#l NFINۜ`c^C|Ǘ5@K"45L6*lUW3b 65|6›u9{f\G6* &LFݳ4҃( ~#D-L\m}a cK^!cE+%?HɠϲOLek=lYX{v=~3Iѫ:\EOr!]`}؟>?Ipd965qyB~@Y PC}k)ӉM.q aZ[5%#×r^*=.>_-}Ju~ Ma>.jNү߅vW011\Feb<*Ɠ]Wc)\i]iiٜmWc8T1I0"ݍ4fw bƙ8e6H!|h$;WW/zdQnˎ7Om#No \%M#^+/08bS}BIYAnI?N@ -$4w?E? S=+tǪMڳ}_#Y?}1om/sx)5?oRֿI>)f4S:t7K5OՃ,-,?D%7 䤏 "3dx? 6 bqRd"gvNf۩ilc>xҪ>ܲVbO7l#帹d~:{`$ZO?%h89$q9[*qOJڴ.)Ƽ‚mA%RPIwȟdj1N uGpU"dm̊p i\ƕلc%l+C"*lzb1jl*ivXcĮ-Wރ$ ! v6?v;;1.Ĥ,;;9|8^vY')v4jEqWe$ǐ.#s;72=k]W5-9M)RUm%٤REF*Fц*y;o]eT[beE\lѱKo`OMp~ɮ*k)bcٻ`WbdA˯C {EPڙCF# 5X+We= ČUوSv0d8*;1N[+1Wb$hFIE Tn;AvS,~.Ƿ(vTt;P즌Qv9TLUc])v]I_a @ۡNg()?%aAyWf]vlUٱWeS2``Wf®́]LUxCWf*2*lPUXxb͊6*ثaWf].ͅ]L.ʎ#Ɵ${ec2,xa`6\ ;]qE!h{eݎlv`)Dp!.pQ!E}vd7Y44T~°F'@|T[HҳH3Fp+]r)ZaPOO(\ـܦk(5?# iH́[qBdX#X*Vґ6օ_?\qH׶qчunCbCYKўHhqUD.*0MBXvj\5yK@̈́GՔAT \J"/ZZF;}bڄdiP 6j*F t**tZb S\PVh[<||E)ל-x2`MmSi>qe?m2 =rJ0\FjVnjUMxflUMUw K |@7K)nCo/ q^[0܁ HW? <2;jNU97M>~ ]zt]fN @8LI?;*K) r*Q.Ƃ@#vf "im3]犻(׮*6^nءفA~=.PS/P>UٶVv5mM$ǒ 97vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb*J_9gyFZ R]aC[CqpYWf*ثbe۩W;5;b*U'Gq+vc.]AU pZIcI .0+G-pUp+!v]1b]M𫲘S2WPqV*ءٱKWcqJqbL lf8ڷUT[6*KU*#2)kIvcvl4`WeW ]һ(Li+٩09t8Yx2۲ ـmL)jteHDcGMj1^%wch MnVWU?hOߘ%eaݖ}-Er$VcB&4\HV> dWlUc6SS [4(pVZe3A?vHSn" ȽA(!? v3.\B.[qa(A*FsLu휖r`K#=-JM35zaMab`hk# 1K_<ثʮ7j⼝lmmX7ˮ*_`6-F8ڵxmqZ.iC+ |7'Z-_)|1Z-_q`EfUzbZ,;hxK.cد w%1+]r'=Mr)<1Mr~xbCb Q[ ^ӹ :Pc.r6=ZvnU1Ku8kˏNDz>SXo* V%L`jlv`۸>I=au$]4gISVCr7m54A\Y_qH {LcJ7 +m\(i7b+ tQqL~SgDȄVMGģ1L81$Y+ᷮ$aڹ Ļ, 3S /l \Rl(k6vlUk6*]1Wf]0+AR;aZth+932"]'g@*wÔ͠4i!ẼWƂ`oN?'xALVrfƼ#>G$|vVra#n>3"}ǔ]buo $SR14JӇ ?+%Vc8|ؿ~G (TΪ fo&~|`..?cFQ8|`rjەo-|-*]~|`S[|p(]~LmAaj}\>TOY#㶍Qf,|?y>3?Ejܝ }#zqQJ9[!al]8a1-'MG -Qa؝j>%A;ccS'9 IƛakªQ.qqM*}V)ń͊6*ثb͊6*ثb͊6**,^ f~1GT0JrP|2^P8 ءF9 480zRGqc`vȱP}#$BBH')c:'.y}x2lRh\W[n"cj ®JK2lUa)0+dJr)v7^5v8/(v5Wo]p*ڴ]WfG/aŇ^UوQ*K^ /]q.ovbE{ClN*J*r b]]+N \t| TcXPWWbrqb aKCzc{aWbn7eʒ>*h;|XJ7qWcCVqWe(blcʇjMFv< 2(~ v(qK$RǶvR~-®ŶM|v65(w8ޤƷ*P`WcR|*Sw،HǞvfCvX8F運B1WceF']WqKaZqbiv,%z%ڟ$Q9-]vlUٱWf]:α\fvlUٱWf]\UٱWf*ثWeSv^*ث]xaWfͅ]6**lUk.55\#-V_NVVbs`f4䬕PNӚ x9$7FܒZ8.\]ȡ٫MrIpƨ VÏ+UHclYE.ە=\/2k1ԯ\Uzmdl@Ct֝+S>\X-ړ?."+̷ ?l4҂(aKxl6^ iidp5ӷ썽i*4,]\(Dry>G݂Lb:5[:/Ç06E[6Y&V+ˎaJYe E~+$cr5[~q>>է]9$$feیt~t8Z|i~9eX[7cpZ*m5_6?kp?*7v㍤ir`2MW$~X;n?6Yl{g]ixo|a#ӂ~^-[|H?-}U{F~^.??鍧UO3Lm> [;~8׮Oq鍧s_.}O'oӗ_> n1 KjwGX? W;_ \+1?<X'lW;:ckc 6Fcy/mĝ@ɑd6K!Ma4َ"PL8_p#$≅*'v2)F*t͊o.YWf[lUثWe͊+v_]V׮'9ЊhGgi6R_l4RW7'2KٱCsbsbW6)qlPNZo0-f͊\إ͊XR41Cq9 e>#fV$S <մ?yF}+hS lU|UٱWf]vlUٱWf]vlUٱWf]v#-ՒR"^Pre:W9֨rpE3њQR[MF%[ˌm׾:||OC8| G9o5ܓcᙱfL2Kl#Ujjd3 xRni81smTQ{\o %y/P~6W}WeӳrȕvjUGvb)&5$e/\Ujփp+AJPb&W)v5!ٕh7®uIQLU\URqKFPc0+Qۈ1WbS;+?gvj5pJ iR2%]sv<)vY_S=2HvƄSl)v5՗| v(P(v6_܅T5T1]A4U"b*1Wb€!]K0OEp%ؐ?]9ENb(.֤aKC—f2)k{cI].;n%RiFcZy10dJm.ʊN* !شj׽0Ӯ*d)ag`{bŀ8H1v` 8WfOOAثb͊6*ث\ŬinXf]vQ]Web\Rثb͊*xٰbʮvlUeWn]LثY.D30f&7.8xKF~2V<8n02Bjx@3Hi 1<1a,qX=ITbNGߖ+wy^W|K\S+_aKyĠyed][p?dN<`US&ءR6L8Wl*u1K U!Tsw'B&3B=>~_|@⬂0 >G|.RB~L!ظ;m%N`Pj7uWe-я*ڻbx7cO2/!CZtR.̨F2JB>P&=)v[۱1C$w5])vn*>[*J#[v[/:v8i]BCڝ+ZbBAUޘ;/m]4`: 9ʘ7vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb)J_N~R^*k++ ,bf-:Vb͊(͊6* vVnU]qWS*UZ4ͅ\3 * \)o+*hpo5pUU[[—eCWvP\)vYZ]p1]c0Y*`VRp8.R_\ \rlUٻ`WfDg銈'?q7Bh.v<JAW&Oiے0?g88{hX7KGG~`'fxESc_[ljؓk'r_ 7x}GU;oi tQcpw20N6ˀ7i6wƛOi@281qWf]B~VovQ߮N8ٱZvlVӲӳ`Zv^JN$>I=F">uNCA(MNSD52mrrr9]1EQ165]6⪙*oDK`9>ȠHajzpzV"ibJ8,ۮDGphqJ L.`d"`w^{2!Q6#˱ȑMF^+7NUx۲[vV*ثbLUٱWf͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6)vlUٱV'L=k_DfFbej0ܿ)H e$L\(Rr+X(\H[mn2N"_$Ʃ(w+MW!dk0loo-DNvK<~.{E~ ) X`𑀥|u/SQ6usb͊5qWf]vlUٱWf]vlUٱWf[p6`b<2AU-3/pi%2mtW3BTUWf]vlUٱWf]vlUٱWf]vlUٱWf]vV*O:B̌E(`'Z}?rU+0)BZ͊6*ثb͊6*ثb͊6*ثbL bʦv2yDaumN ԩX~ʟҩG'\kVbe]V@vǨ'l6VHţQJbP&Ќ nm-$3#zun1erL0,+MX97$yhu2/jen_?~6X~8_㍠S,jw~8ǭ`p1OR]PmZP᧫o qq.%-ъqpOaCI7q *p%؛VM*pTb\{c\PԗS ԮWfhbm*OզUDr8NUٕWf-b;\ b^#qWcW. SN;UA]*q!*r7$# blYi-S+w۱ gIv0+(zbeI;u]J)f\ƅcJR ]Z]|]qWe v:aK^TuY;,5'*ln½]#7/UفN]y zb_ᑐWcm\vb+!m& Tf̵^آD|wʑ: > x$P>8Jbc8PPObV!vlUٱWf]vlUc*-eb͊6*UٱWeb͊6*ثb]vl*ٱWeUGleb]\R=d-Bf5$2$!Qfq-4qI"x»k0*iCZVr$%^ ACcW?a?'dh P.Tx̶?OƊ8.qx/,O1](;Cdݟ0v7 mz~)(TMd}g6#oS +;GƷ?ߟ4ᢼAr7?떾aog+LhhW}x#-kW>#n#^EqzC3"8HLdUiZTr\aGe>?O8EO>rǯ3^0>1AKdxzs2YSg?'^ GUx[6CH^ $ UAHx]χRtƍ+zUL(>~XE*L v5I»bт )iҸ2қWv6D]jTSث OE.ʠ8J CG ~"T'j Z~"Sb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb*J_Gvs,J6*ثZQ\lUZ͊vlUٱCb͊+v]qKyDWS/;51WeL 070]qVU1V]F* 6*죊]1CWe`WfͶ*aVKy]!َ*책]́]v^;.]3r*l qL*[]0q9!+T8er8-@:qKp(wg " Lf{.!_j 6Xd.֛ )vP4c'f+b͊UXb͊6*ثb͊vlUٱWf] '&A<^OqOQGD_\|rpV[{b8$[J&1E*ʹ*)& *z#/L:߮|ȜS i=ASJNوv?^9"b͊]vl*ٱWf]u1d T9WTb}8 _|Z'I1< ɀp6`qñ Pٺbv4)v6)vYƾu*+v% SQ*a*z8;bưWcG@=+zaWe M)v9xt8|UQJcqWe PlvT,d 3 ثߧ0Y῍rE]Ÿ=K5Q;3H-r%] #b5bb)Wcх8WeqWe=qWf<խ;b!{aWbLn)4v0FҦWbӗOvpŀbIr2Cu;;lB] d\U!H{aWeR8ا;]P=0+ (v=V®]+5:'mz"1o6*ثb͊6*vu[vlUGvjb͊/vUqKbe͊+ /50U͊(Web)\2Wf[Cʮ)o-8슐H*IBGz[ VKF:Q$i!9r4%Gm%@q\UBqk5\}$Jn4 ,Kx 7Ӂ$ر:t-amlF]W.Xm*3Ci[KSڵyMq')"8$D6J =N/8:AQ;W*®lUMHYٴi_Zo@C4frnG/+ev-Iw1!5+o?$j2lY@Adǵ-;Bqe~88ByHSzdГzizVV{[Kv9>,"[oK}ٙ&>? &+`H~8ivԟph-:v7ߔ5u.ӆt M> e@^۶H&,-phԸ%X?6fK`MTFkAy.OI8hkAM[t[>.+AU~alm!x̊zKൠ̺5O\ڜp>Gk#P@ %#*OLOB-gW0SR~x{+ZASlyߔ5?FjWߏ=OE?FRs~}'ݍ;ߔtESKݍ_?FDҰ~}L^0-㹙}fzL AP?mZIFU*aV,b#*H$v'$mvB8Rl)G䒐$i 6e1rc;bƘ y-po A Lher(ZƸe8-CWQ[9 Aٿ S7kEZ'2oNp"eLUl7*`1We튻79%vRޤK>6ƻ늻(*]l(E6]߭kaC.5Nnp+?*9n)QLUA҃$sfI]QACopv)iutTDr ]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثbo*J/_GBg:ZlUٱWe]]1VlU*v^*ءٱWf]qHle-僊]M}WS1UUٱWfZ[]R)vaN*Kbf*bKypQ\2Cu+k Uc[7u2늺Xc/k(UWe*c!]\vj"nbߦ'{r-iԪC# =cA7sS50MV,bV㕐ةa C]u#;.ͅ.p`bͶ)vQ]6*aWe`WfٱvlUٱ;66f]U7#AvLz2-B/pe*4_,[\:򉁯nA\KnH}8ETlMUHH1R|IAZeZByзƿ10Ѡ CE_l} ng69w)]?)poVSW"\XfjU \~l }Zߊ\ -_~N31M9일;dK[Cշ~#2#Hk/|eQ#LU@L4˦*n;/51Web͊6vlUxUٱKb͊6(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v]v]1SUZZΧ}r&!II}Whp0@KSX\P0,6L*¹U*`*^wQ*ɭӴjdmX)F*JwƕSuȐ ĸ`J# L)k#+49 U7J`J88_ \U\p+b]Lث`=]h:4x2嘽k#2h*:v 5paWf͊6*vlUٱWf]vlUٱWf]vlUU]o#^u_'ӗJ2ã}+l>_r99=)B®͊Lث銵]Q+S ,bW51WrLUܳSqV)LPlRr(XNY#r9 :s(})NP2~ s V@9x­nwVw_. I1@hQg. odA3aAœl-ɡS6(vlUٱWf]vlUٱWf]v^)ebCaDLsj/o{.>%NT 켒`Wc&]NqWeӮ*lUفLU̦ULLRa&=Weƪ0!wlUNcqWc]A_**a]J mLv5AUةjlzRk PL@diCvP)v`()vZb)QNqWe *w0}{i!L̤d[]7Rx]C5NKԞ=*N48RgWvS'`|qWcVv%P+Co\!EU Wc((vP4Q$UTnqWfC^ٕ]RWbI*qCM(qzvR.qE % [͊6*ثb͊,u]c/d͊6*ثb8xUXxن*rKb ®ʦ*Ur%vU1VU1CSuq)8VJ?_dd(#+J;騢>MSXJ$+|W]ZPD i4(; ikH\ޝp^=2j&o@t:;a#]) ^n YTY[3Sjbl4\RɍƓ3E'7#k5drW7AVKf @jGm #ߪ+|P}Z\v ` d4`Ax Sn zN?z"ڔnďZ'o2\Hq6 X-Rv8B5䂅[F^Ōm_|ه;~ G$5qFUH4E'P+o/Ot?e&@?pRN7[F0)VYE3\HWh8[, iZ-][ ug)&~!3I^WH=!K$-"<Ն\kd Li8r\5Fz0iUUU<0l5>Ʋ`JH12⪁둿' $Ø"(U,`ᓛk&U5׾NdHkr MZ)U?iU~朳lQAU2Aypq-ߺ?S>z|p*y~Żڮ)QpZO<:[ 摉nFaՍ(cpUӒbC dVMj^²NfbMFIp҂Xc`Wq#]ҕUXAz|v  eq*6 vCkM]S^('zoL*=H4+E:be']CMWeRjQ]P+(),]Z@`y/c$ ӱI®HSƕ7®Q_ ]E};kQ*xr_ו4D-]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb*J/_GBg:ZlUٱWebf*U٫rVb͊6*ثb͊]LULU:\pb)vb1C+b\2o1L*b] 6*ث`We/ (]l ث ([7.#lfu2saV UX\UT*UUUXP|+T[';+C#Syj_HP 4Jwĕ7 1 ^C^u>Y~Z:f*kLUٞ=J +$ / 6)vlUٺfvb0Svl *]LUٸUT]ٺaKجh[a8EʱA$1?e1L' eZ(&MEE<2!&(o-oPk/1<!,}ʃRl;ALJZIhx*9R+)W@F102DeRScJ j~fTG&-|XٌMQ%.{"AʡK`fʮ*rHF´ $*Za&ho-[}"L-ue @j0hTX*]1Wf]# LR bLUXbf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]% oFH>aZ+%O ieŜQ̍C e@*G1^m lBdT`V'lj7e i E%3 \UTʦ)hJkqTT312E +%r\c.^LRl\Ua)E&$dU\I`V #i\4CyT\lUvj*` qI#UGFF nZOG~RM2f3/ vl ثb͊XWf] 6vlUٱWf*ثWf91XP`voy<82!ڇA2A5\00ZR:cBk&Jpպqj51:50(h WPc .[\k1pj?~ˁScXGd$%T *;PlUK-EFY1*7n2A90D/&򑏋יSxP6*ثb͊6*ثb͊6*ثbf]nL}w'M up1] ָm]lUؔQqWet#vQoL*F*#\U`dܻSL(v:v9d P쩨W® ص6H`8jGm\R$(SMۢ02J8>+FSऑ|%۱;̫R[gG`!apARkG>څDeK3O|V?Ȗ{ܖ!~[eiUHUh$hbf #v cpgCrSK^MԴkn\49-Mrli]&ƙ邐l+i],)8:aVH%i3`Cȭ> ezbXm1)m>ȜM!\e 6VV? w09x>*ƐilU٩*q$ LUٹ*}v1:]aC3B50 ;]1WbmT$m KU L(vT)v5ԁ]⻧\U)\*B‡c6Rh;vR+oኗfjl>]jI;kVȮVثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb*J/_GBg:ZlUٱWeSvc0]j⮦j⮦^*fl*f]Lإ]vl*W,PU)vjb UWf­e1K\PإCvc]va]LUٰ6uPV:Ur-f#l*aVeb`WW6*8c+vlUٰ^*a]}V1Wc*]|'կ=i8/\1B2>)SLmTsNa!ŭ`][4֌!ᕐ̮5;7b:jA\A]e+0وـ]˦F0SAI4.]; ݏ۳}S۲ŮcMzckn-HknM{aHܬ4/uX֋Lkpܓqi!wZEq>12iOl)^C-·qh}X Txe`oi[܎$9v`h ;㑖%n]I {abc 5 xȥ`e"mS )DGH\>ѥvS[%1d{hKqmbEqB醒 R,p!u"c+*UuP:QPpkdO\Zus&lѶGr)r\msRp*UD`WeLUكaWbȼ;1LWe]cȫWcNUXxXbf]vlUٱWf]vlUٱWf]vlUٱWf]v !3\$KՈ~Z7~Pk">iGަkS\]'%Bb xBM|U5oBpQ5գAJSzR0ܚv"'W6R)%=FVq*P|{6(<B?E&CJGXXV7;N1Zb.b%Js#&k*rNDuj72" !3B;SvѨc@23K8ѡ?:\>\YNPO|-$ND|yR*![]!+VbpP=H Ï~`lQIlJ@w-bLPثb͊6*ثb͊6*ثb͊]vlR6 G$!a&JM;/;-bkӡœ]t~*=DaWc`Wcv'"n31t.djaC3v4IQ0+JCq $2+NQz ] UNxvejWe?LOS.YjS!z.=Wc |Rdܽ`LUUiv66 RQ6LPwŋ/'cTVyV LUؔ,zRQ账(v$zo]Wv9# ޠ]cY]*=JbCmH*I^:G(v2uvS'5R)˱Af %I] ׾(qį4ڬqy-]vlUٱWf]:α ܬUxWf]vXqWf®0+VXZLUT]LUT]U*Susq.8.jt W7USurqV㑫JL1d|6ф*6WeB\ 7ݘ E!Wvkjmr\Y] *<.z3 QlS8]ܘ-$eؑ}?ل1\/.4kQkiw#b6[NC$)ʮIZ#6usbhW a/fHROa7bHz*o; ^z_E&cI!qnqӡʵӯoZ*}?9fņl:5a7Ւ}& td~?E3 ;V.e"4GPwE"eJGfbI'S $F XqUU_ WNT\ث)~^cl`v0a0`dC1V^(k6)usb*iL i/L*";c& IWCxJB~M2)B*Q둤$j260+\4+je5'l&էXc%KukHS۔9nD!%L7o-SnaJV#΍%f۠|]L J'ŻXry6PJ7@bN'&cWM77x،c a逮fW~F6}"OhV0}8W̠vıFNiDwBi:OB]ԎHVR*Hzye *9u*\®+$];bcaC|U~UقkvfZ (i\ v& *6>H@:튻]`c즯i]NC v7nzqKhi*]ce=T=/ƕ~YvlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb*J/_GBg:ZlUٱWf]qWfCb͊0]\U٫/ͅ]vjV6c0*͊vlUXٰ+bf.\US:KyKWvjecHv^)us U↎]p%*RbLUb8U]vX®9``U]1CF)nSq[.Y 'Bp=; P:xkbO0;f\V? ]L.dbY;01*qKpv4 7vb]JaWf*W"޸]q!ؼpW%HupTvi 15\ƕ!4I_/{=3W1s{ `Vo\h۞N~j9(ijvq":n,փ_nPY% m!o{s_&VKTq># }/(#Zyrk?m>jN<͕A^fnv퐤)K`&'tr㇞ylƇqZ ^إpʧ*c+|Utu+BAa&崽Sqj7#N]m.Z?^!2D9s%`cYx+`S-Vl c.إJ)]ajدц%j>YcT3@P+ 6Z`Wckv7vlPثb͊6*ثb͊6*ثb͊6*ثEތeզP⇾u25\#&:v oSW%hZeeq?UPмz60pҼr\eW R~x1/ҧWӼV-@{e>!BP5ن0z >"W0:]+qɌ^e#߉7o*XE7?%*yݶo.\? EG@0_vv;a3o c~lUi=H9-@v9 \$=4>QKd[sj}kcmnߨ/ `'cشvƏ2!U Sb"ĎxNW}R/u+?m2UM~T\_g?FFCTbZnc^ tt'%h]hb.ޓa oQ@c@dx¸F:ŗ7^NPaԣ+??P@ űxצƤ=*=(_VJ=s/ֵ2݃.0?<|DMw1f5|x+?Hz dcuEh_sb6؍R_^"sb͊vlUٱWf]vlUٱWf]vlUٱWf.dc6w;u\08& bXft8٘]qWbl:bƢaKABX® ]z owZWc}FE&!u|7\J~x*V jSv7[‡cnd70TT`*CȥجqbGn5vi(2 Tl(vb9mZURqWbq_]"ƴ]Tv! Yb(v)ǎءS.F& ]Dˮ;T*߶*w]1 *rJcPiZ0py(늻4`K #c7[aHv& 6œGŃ2v]qWf,TPƹQ@qKJ®džL ֲ8=, ]lUٱWf]vlUc*9{$(K`WeaWf]vX]1WeW6(usbWf]v^*.jbW6(o51KLU㩊\bW7UY|qWrw,.m:J2%QVSuCTT%pͨbL\XD8++HbZse;4`M]4-nyb\!\X&Pz-N`6KuY6S4;Y$ W?N\t!ktDX\?WM/u]lr ? GWێI`U50ڵ 0U}+኷Za n,ͺ@8ݱkᾫbFv fnqWV/ 0**昄ve78_EUߕ87/11%4gTjh.; Fb_*j(Ea-qV,㑽YO?k%gG@%K8KFߦRֺW%&UbMwUVqvĞ|PJᘞQ9 d#WhO% q-G-.j~@SW )q|o E| p`▜'r1]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb*J/_GBg:ZlUٱWf]vlUGvV*Uَ*UGvV*p]]\*쳁]U]qWeUU]5p+Wf8Uنv^(va.­fqVsSk(隸pٱWeSʠUٰ,%[͊(*Uv˦*9LUk Ǯ*b1V L!.-Aud h"lKOk9).K'o$LQlڑ=< qZnz1rjփJ}]|r t8Mb,ƒM We.2Bj-.We6 v`0+2;-IhNP Dab8*5Ĭ'usHZr i]kem[jᷕ\kChK<8J,aג83 J֓nmbM+JFo-jbcQlRp -] ;bA8AH.Ľ.>&Nђ(0+) f %v%ėcZ2;cĶoxٸcćci]6*إXS;6)vXLUXPثb͊/ O:oEr~@)K1m`eB.<(SeǃTXeCYVE9ܖ̌=|:6*PتܬVEp*4H•`)UWү)+uǒw$Qwn:Bd`J!/$KP`*.~"t+CT&)d*Ԥwdև?Up'-O٨\5C1p1qTy:ӽO߃(hQ^_\xVM\-״kH ?3, e̼&Z̐;BA%ZG1vz)Md!c]IaBOkw-bfSҔ1V-ڶvg|1Wb<1KEUCusbc[)F*㰅ZrK^f䩽#&6{Ÿ.b %xewȥX#jbr[%،>7Ȧ HG(إٱWf]vlPثb͊6*ثb͊6*R>=vTǽF)v oAjq O P]7e)—e8<vn Q.,)LU;`C48^vfAUؚ v!%I'z`PWfeޘ#v>]7E]JlUq{ 0®{\PF8"RUةWcw늻PHQVzaKerA®Ǒm(v&TxؤlLUءb1Wc%V;PBh1W`S] Ryӡ=C@"35ثG]We1?gv"AQ;*>GrqWfE^v_PGS ])>gvZ}Uٚbո*d@ 5]mqm%?'mAhGblUٱWf]vlUc*9{$*b—f]v^*P ͊͊.ٱWf],aV+b9Wk, U+kN;)[\|1Ws,*\Jin QǸ>#6K؏ {o/Ǻב)b~cqL *G8@1E][fY~!:ECKQ'ȒA=9땒 㝛V6a+},=FlTy1C\9(EO ЎWQkQ~?G6H`767b;;|D~cdY% hci|m]ժf WSjSyWR8H>יP0?D6v'(Tg2NG'Kcx ]qWb_ 8#I2Tcj9y%TL*$m O1FH %C֣}NVC!Ebb~z.ZUu?vv:W\"rw,=F(k#'qۮ)uq .N(jTb,U|uqH0xOO)Bثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb*J/_GBg:ZlUٱWf]vlUT]Svjb͊6*]/k51CLRV)vl*v^(vU1Wf\U٫5qWfvlUٱWe\PWC[^* p!pʦ)us Ud`WfRCT]LmqWePMWeWS.U٫LUf*2h=k f'*7\qX(*FDaAekkr; L(;`x#p2Y"db\51(ZmŊRpĂb6IE]X‡4eztWe®8\p;;-LR츒|ZdMDupR&M mq`5W E F+%^353!͋k>#*mKsbٱWfZ͊_ 1W`=^Z۴(46N^-??q3ْy\)Ws]NP$G$-#T4^F/%9ٵ\9{ҙM{x2D *E~X{))0!PYqr#+T=x1[p{c}< [&*R0p-I !dsr qŖAQQ+YJiC|h޽${fD'jGٰMN\X;c܃n;"v:@{`C(v cXHv'W'f6xdK@2(ʜ)fE®Ƶ7ƒtƕhNM.<;+.Jj좴joUو(vP.Ÿ|5Hvjbeb͊.Uɧ/ -X:$%RBcSlvI L2!N3I/E=#'%OG=sX\UU6P^*Njbp8öU+ olƕU|a\ Ƒ\i+UVA"zi\iU ¿1LJ'M` |-~nP_W)1/CuUiZ,o]\U{fU`b3SWs9cWz%z4*S50Rl43SS0 V@ƕ܇V~!%{ k;e9%xԌ،BR@Ӧ*w\*eaKt_ъUi9w!E1V|qV9:`f*+11E¶PcYij1-\yR\6,ӛd(Y-{+ܜO 68^k@3E4 a})# C"[p9$*fqWeq] 7*S50+b͊6*ثbe`K/TJacnǛi,;nchHS@M#ta]јuŭآzce61Wc@.J8Po]Uؐ);`K vYbdaȅ>b8Dh:ƻ]JT5](v%xK0, SD>%v=WaWe"07Z%Ozv Yj O|U  `C2L,!$;;銻2W*JYbZmr*t4߶*A ~"7(v6 bcĆqa9zQF]S\U؜7*qlRF0;J6;,(^vi)v_*lqC'ZWvfWe.qQR G<b͊6*ثbqWgY%WeaWebf]/saCYWe]vlUٱWf-eWe]ZLPuqb+k*1Jqk >ޙ"^2lGB:Rk%G5M"k6GtYg(Ol5nr'Xa iג$0W3ssSmwFq2dS#s9LdKI! w'kebRh*Ou;}b}1RrJҊ8ٿఀI)ӣ՚C>1"kI.-XڝA?۪C"vC'HRL~JP~g0e[=@}>)(ZcsSp͊[͊6*졅['uŧ>۟a5sI /+͇ʁU`03Jً͹&u3W 1q9|F6w#1 SVSkĹDS\^YZrl9{@FX2ȩ0JӵxE_sN"0wf;00jv= 0.4~ܠa ׆ʒQuSQ *h‡`qJaRy`x;b9_ZoxDo,i7},C\\b=zWmÝ7NKHw7>'p~cddJgygHkkbݾ57<iCQN?4/ 5KaCbm m 0Wjlxbɑ=(LQk bgb),o cIjGty+NjRR_@j%n $Y.0*LjP.a>6o k͊UE+@4qPlƒ`dR|Y*R OZ$ u LrT8S9*P{S%v| XH0xU'r !~lUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb*J/_GBg:ZlUٱWf]vlUٱWf]vlUٱWeb]v^*\PjU]늻*فNvV;6vX]/vlP˦*Q4xUG]vl \UٰKWj\sP4UvZ#vVvXqݰG+یY2Cۄ4!~æħA\Ž4 `ckkrapψ-I](hUX65\۫˵1K`/\R3ev5WȔM*p&ݍ qWc+nư5›v8q@v:G\.:b҇'jr0XN(L'1V;)KKkss zFEFw3 7!WMl3 w9W U /7\U4\e]db];u&YZ}Z3FP7^A%|I1J0=qxR`qUtWjfOW-jl6}8E:CЗxԃ"IER)h7Q'tʥB]<*!fwŨk^d鏨#BbAH%SG Wu"m]L0+p{ӎ -j%ina.XnG=Gc W1.#>]A9x(\wqH@V`j݊Ҿ.qC(v.i*ö*K-MF!]A 1.̴Ƞ;bON AU#uqK )ݗf.=:bhzbe1]۾*k;]^@S̔.—e2We*oO,[ߠf ~Db y/z|WaA6BSTc&RL+QGY{̉B{䢹\*W,*ဩZE^(R|ثg6lb/ nU1Br*NQȪl0*8DbdFRyV5B+I>P_{̄Fh R%`cEr(Z+*r*ثbet[Z9y5[b+-F]+lUA ڴjb0kp?%j+(,b ._lQn0& ĥ /+%pcl^H)ƐFҘ0\ ,- *b1U1|1J9T8i+1X_15VeRҷcHR.O|WWz16 %UfD<ִZx )֖Շ&cT~|Еj&Up2S*d +Af49]ٺ;))C;c(ŶH2dUن*~Zi%}IXDYاŶUJ b!n?᳢ wjSF6!x45o-C&_(,ȹ~=Ͱ(!pa~?#[ ?Y6(zHYWd2du(qo△b͊6v5cRﲁSR*&ח3j6'*$Zޙ[Cv\ `U/ %?MʽԻ(_\:H5e@03@ ORI?37-;O&)/qQ0;0~D"m~o!οx­ jq7/1U> g~TmkZ:Fc2 m`jlݑ.R)o9#ɀȵ/dOöI}~fS9_[PѲ'7נ)]NQ-YSa}BNo6-?9HScKm}? FC &t'9HS`qu$uIҀ{ dѬѕEjH#8{vѫHHĄ\ȌV 'l?ݩSa 4˓o+~il7.mc[T~ߑ!l/MmU*il#t 5247]i*1?]LxIWZ׉~9{hu!AO~"IωrTKzsI4:$(9T%B>CXڞ|>%^q0aR:2l{⡉=)VqᆐaMpl ]6*aL*+|ëFso)g :1S2l y3L"R^\XY#lvӱ$s UTvg7l'cs]V'R='((KTǮ˦!-9#1d'* W.  NV*;lU]7*4隘AS[ʘLUznuqHh\*O?Ojg?^F7ӗ䶚}9. \T10 c]24N ҭk)\iT.G]qs iV8)[ LW7 [\*Z 5r8|q«r u9h :2L/yZG_*4%"cL0]A=ZP蘩F2<21 !wN410RL48ӳPxcKNm.m] jހqv"퍫2)ـLP쮇v,Fw;ce?Êb/紆枲+bq$?ݱ_H'*~ya܋MS^7H%FSr&7jƭCWs#ƿ2X&+lq@څΟ5Z!W >ܿ~H2;#ks4*n}hf"oJXu }2CI­f50+u͊(VPWwKkN¡i 3RpqI1QLh!Q0$~;9h2WcboUA߸›-Ǧh?_\6DQwTլ>8qjnaB,|,=3:bn$f  NښTpP[KxO' ^_7|"_:'iٛ~GKȷNr#4o\ :G?N6ʞ<ă26f~g7#t !,u ~ׄ7.Oڧ݉GcqH.HWjz#inGN?v4jӨ k+.'kµr:qFţu`}0*O8 7LSXL3[p[.0\~x6!aO#pZ8Bï]0oׄ5zׄ4u#eOcpZ~q?XЬ?Okfu'pr56ܼh;Hj7܄;Pv4*kxtJ@Ru[n4z(;  ϯׄ!N?2ƉiOi.I薟\.vݟ}ω@]VoZW}g 欅#Ʃ0'i3!pդCbyWOClxTV~P*a7+W2*cW+{,Ҙ>[Y'BEyӶ" .$v;P@R:~C{In9O'~8i@Y=1]9KuU8]A2+1vɅ 6lc$SZҾcHG#a^m)}73%~|(qM .gʼnE JL ܔ|@KTͷCZ!]LYI78eާ6Pdm\i[dwxnW|v8'.)]1hk+mk.WWTVn;W,7\1lU(ъ6WSPyd@2*Wf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb*J/_GBg:ZlUٱWf]vlUٱWf]vQ.®͊6*Cbfv^;6*Uنj^vjbqWfʮ,*챁 ]LKyCU.l*V*.͊.8o f.́]6*bqW [ŒA M3ve%9Gd> AO F,KG4P`f b-Zӌs,03 , o\RǪb= [leݍw¶Q4VN+E;+þHNJ]!pVE2Vi8.XqlUWf;ƹ$2Sa #~&LkǤ: ӆ]2X%c|Rbf];6u{`-^жcJ7IZybۊ۩?'F> 8ajk&F)UF`)DFq"7y%]q2*q1ª>(knʹW|W10Rs|VVeG5EAGQћ è^H"D0a;icD %Ixe=VvT3C}2((n1R*8`*i+Y­퐟8 jy%k=?MۦWvi)_HweaIY|TeWIA>[aueul{}e!HVDُ1zWs#Orc".i"k68FZ,QQΒ U1C p;,-2*P P8vPWcv6UƒjWAvPQ"f Wc=:Iv0mKY31i2X;+\ ̽*`^lS;Kyf[MC2r*ǩ]VqL*q@Pe8XB0a++]\i•َ(usSj`Ve>(TCq(/4+kF~')ބ6'ako_/5YR*T8S"cWoZZe. Vf9h\'|QwN8bL*ci1U2s]+WsUpe 4߫R?#~Y|dd䩾rZ jv(RVþ1`JzbBy \i dd6^}scJs i[c\PZ`WW, *\*ʙTȪ5W*kU7m8Aȩ ƂZ e3KQJ͆Bky8b dYǚ8h$w͍1,6Ɛ=!8 Ɩ\Hi6qjOLim7A-7|2[V+t㙴ra"MWx›lc!;)w#hc$;bv0Ĩ9SlWfL"KI\blqek&E MT+aO}pƚ8NMHQw؞%^Qƀ&u®Omv2Py W ߡ*B)vR1!5#;JWbmv1z8kA.>1ˊA'$PWe@劻-+ It.UUPumlUتSv5ك}RYCjaCWc%ȫ;nqK6]UjL ߑYiq(-r ͊6*ثb͊,u]b-90]tefZ˦*ثaWfusbW6k6o,beU*8 UYc▛7V1UqTFF`dubv5)*n1i0`> ˀsoJm9O1a&YK3d">͊&]~bjF)ky?[ǪW^p_VΉjQJ`}F[[I3qSOAҥfIUDW_!ڛ[4GffTԦ36Fad"05­Lxl"r*}[^n2l~!m䧳T zklX?[4B'V?f_./ozw`04IY.[0+u-N%@1#q+^46vNMVI*b+"##m@ m፦nx5qV镉VQW 244ؾ~ܘP&Ͽ-k `I\CՍqW'\7.ƜRiR8OxΊH| s# Ѯ7( 1i %ͅW%aq *Ԟik*i6JH'zgcqȬ9A%CFTd@a (rWLK|>\$`֋3_ٿ\ o #md%&ik:p^k%ެ W_Z"pO;nI+[tB F(h2C^ۂF4`J._\(S5\1JOWCӒêo4Y$t͊LءxYbf t0G |O$.Iw_Fy#p g?PA8\p d\pPbY\uspm 0'K,i[+N4$x,t Im1ZN*Ui84s]N9QQ޴ɐ˛rJ'I%肙&4ǫ \Ƨ08 PU1Ne-˱ NVûkqo; m)=' Ȫп6UCJI0%]0J4޸Tm;W)USaŇ {nz-AxGhɌs@DG~ɳ9,-ܼ&QEq=;αHԣt?Tp`- xd^pa~{ݐC2b#[`o<[́Į3+Ҿ$cw.6TYZ*6*8U\U\f銸r«ˑV㒛bGK` ث` \S*TjrW*/**\Ӧ*#<*޿/U4ѣ{`/6?*7Je?,2OL|S\^QKd[,\"KzkdWH-X|V1kƘF*8*xCRqWf{m.Ğ%zWfVV (v*f)v"[`km'BJf]5;XvR.ث8SLRlgv91C ]Wb~*` p!#u4Ҹ-C bء\)vXbc]k(7veR]JO8سzmW;qރ*$P˸GdҸؕ J.̟-gUzCD]i]j6*Ѣ8Wbإ؋?l v5A;I߶8{Z2 QY ]vlUٱWf]:α\[ ,`CVk6*ثWf]+Y.]vjbXZ UiZrb(qcT+ݩqT,C'm⋾*fX߯1 "4`*kak}b9' Y[d"U#rqHӸ@YT>:14OOli1ҼGoGfzޅ,a%[fDOsI= AB0®eaVZF:}p+DfլF% M{| JȒnxm7iK][HbpQZJ8[̞SΧcAt?YUBeitBcٶᱦBVLv^Cw0>2Bc[ 2[ʮle6*DӮWju;5")(=4MVHͦw_j ]cȶUq\o(*eWj⮦XlPSXIS$$%(6ޯꟲ>xyYZ ~ uYL b6Ld^[dmE(Ar`T8Eޣ|LH֣J(\>~}jq%Kw-~77wM ҿ, R|Zڹ=@t ogX}"ўq(T B9*␹N0J 0,8EB}[$90<ӫ~d,3\bWUثaVl)h_ -rA&['+H\BjT<$&]0+YDWi)VYbJ*݇SW)U Y 4nSL i} $KY] "tfjG#"YJSoF1V'2,Ǥ7_#,ǘHkV;|/"\ar9v36*ثbÿ+Ր984$P:vɥfYpcv5D ]Lg G.o):le-\qoǁߦDPocq8bh^lUEjO%ФqGlm]Mqv9VnU0n(aZ9[])-_lU1zu]z⮮Y{O|UG UوsUOx쟧9cU͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb*J/_GBg:ZlUٱWf]5qKCbʮ)vbpWf]v]1C UٱWf]UqWu1WS5qWS/pGo+vlUxb́]]vlUٱWehc]Ln*f-.U[\ ]pVWevձ 0TF*콱V⭁F2乷5F%8fȪ㚙%hءc%f\ dpXԻ*V9ғ׭peI?FTTVk =3Z1АMJwUCJUddRpmP30*g */*|qihzf"nl*n:&K{&-B##w6C.$I(I]f^K:'#,]VIfv5m~4z$sJH^>lTB̍Ew=eťb?,F=eepV-V(v^*U٩TmLR⡆ޟk~S?䄈M,F=0._/ZVYZ?o%sVɱLEqU57 >#)lORTUqCXU*ºd*7y_uq&uœĎjF(pRqd 8JR۟ KmWH+j`ix)65:v1}uIh$Ke NjWF y} "՝϶deBe5#$1БVh­تrLq(T\c)6lUnc\8m6l`U\ K^EqTI =< E|ҡ2q tCXCN6(~'ǎC[ LHU'Na+ɮ5*ڵ21VUDpFP®;Yb|w\P41U͊rVXe*(Xr[\6VN<Ҍ[_/7OzYx 0ٰyZ#5+ yS/l4UٰQOF1zIv+իU TTe@^xjeM-V&E1USwī(0͈f$: l,5mr!Sᒧpi*n͵FE 5d W[|w{WH17vޘ\i eS/Eh6_¸,1Ws L*xLP,cQz`i- ,UYi~f.x  @ڢlAnc]5ĊdAo\5\}]vhZV6ɂ 3G!׬ {uĄį0ܲ)P78[rN>xqECcl.ا5aC9K1銻߷.˅~*PָBZؐ^ثB6ȫ:h0+2Wf#ƀ*A6'G%(vaZWf&+Q]H}\U`qw]d.DžOU٩zbgfۦ*{Jj \P3'cfKQC3ElNv=G"N*QƘjTblj)bCqثJ qoژVT Rdr(1Zveb]wFS| v=Pr:®`;v,X#C]AXv Kk]ܕvŢB;,c[/q*Z0+`lUٱWf]vlUc*-1Wc!ZLUxbء/51WW/k51Wf*ءeNXDe 㗊 Z(X1EP6.6P|( !T]O|h*zaUl:̭QQ PƦU,;.{_"Xlgv8ȡ<':|DBj5ܪ;vbB4v"$?D~K\ )aJ0O뺔ӝؓCX :?B84{ӇYHb$iˮjckCTo4ݘmDCc!78C L48??6->oo@R+l ;L;*?<s\]pR\;6*{)(菿|rV!iD\Xe{e18&3ҟr+绎w&z{p[8-`@\;/=2Nvѷ# QSN)C\U9u](\\Uw0s U&Op}&8ӦVY1BثU\rblPl*+d%4~ 0A 2pU0%r+C51ENb1W+o*q LiZ2\ۙ TEj¸AkfsZN)dvND\*'*S-!E"} W"FYO: t(P0j~<֭_fF91970Wf]vlUٱWaϖv2$42L9$qC\s;U))p8ec-q9bRaxZ`*d~ȡF${UT`bq}&\PXW>㊻et+늵\QA%S \튻08j銶Y]`I\30LU?^*ӷ~G9cW͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb*J/_GBg:ZlUٱWf]qKvlP)vlUٱWf]v;vlUٱWf]\U͊/6*®͊+va/vV*]1We͊]]qWeUٰXb!G ]p+yXٺblB1®ͅ]F_B؁ʺ9|}[ ,Hx KN QAhQ@hbS& XaWf,NثXA\E0(n-)ƘO/L%( )nXW6r)lʽWLR5]\ӊjS*U]obb1CH|nx3)˒G9S6* ;/Zr)wtda?qʦ^$z}8k{PIѵ0d6P\\*Tثuƕ*ؙRa8&8x9TUzJsSCD$:ZemǁʷBL$kuWIOCqBQvOPn>;0̑.%GG*˂8OoDsON0y*ɬOcu;U[Y(DžU!N#: "5f$*O2[sRb͊6*ثl",168SkYj:THӺ^iڽX#mhۚx| s^ѹzɎK樸1fOl"^'-X69VAU5ƂOL*cҽCU8US+ N:ɫ \U 8Ǭ}50ҸSmB>*;``bq8BB4=\2_ʸtZ'bo\iW+ᗕȾ#1Ű 5#x0|lR;*jaUMY9>(S ,˳*/[oBHNjaVL*9T­W/ZN8 8 (RfU&9xUa^(k1]\( k\Wׇ+̬|@39Uޜ0 BD7|1Jl1](i[Ua\JW+ecZN^4wˮ*|Uq64嘌! W(d\ dQߧOI ]9>Id?dȍ$1`قWq|USE8bƲ \J|Xz-2xcƐe*qJ2,J&W,/|Uxnq5x] UGy >n5L4gb~S5"dBqH]tĵa6eaJS*\#D2:5;1BW\)Y3-:bT\R*c8UǨ\4uso[NU!:"-+ՍpZG!@0E_#>QpC %о}뒶lTWIhQV)w{aRkvkt'`v++]A]ԓ"P`I=k(c٩Ȧ]l*Mzbƪv]IR3 )kܜUٔvfSov[0;aWf'nU]zbsD|Uʉ H F? ŀ裧]sMyu*6ޘ7]qWer`Wc*aHЂ1Wc]C2VnإٕUثTIGlRR&(v UN;# `M-~\PEW|R챷jc+ X,(Ku*/+Yk`(]d7vlUٱWf]vX늻:3![Zjbb]vlRث**xٱKSv]1Wf-W,be↲+UD偅-qVr"tS8NǕ8XSc 튭&nC W.XF4v2يpIё`Ywׯ==$y\/nE-`@v?V /LKFx•P{zJcWSP=oT# gqiҾ.g[U$pf>2Ceͅ NlUeCT V(h^Fڞu9|GŨS{wV&^o欒d[jf] \2A;ln* k1bnOi1L fQI؎ sLv+Ԯ>*nï1 )\r4M6($g)`+MN`9 kqtE+[gw3 -E bdT*UwS6(f[͊~lhŜC(¿r@0QQ @Ҟ;r(zgF }vq|ͫm%cQ˥: 5ɆĤi+Iۥo\rQfOS^p0^5X\_LO_LԢ2ު߫3L-,LYGpAQJǒ?Z 5ap2APfSk3t\U;eU6L(hmNt֮7V"%'/5\U͊sd!ثxU3d&\zO[/ij@_q!s| #.f(waUcAc@N*N#eg*B8Ǜrd2C#paGEASer=h&Wr9ͳ#6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثbo*F/_GBg:rsW5qWeC)vVvX͊.͊6* ]bf]vlRء٩Wf*v^*ثb͊*bLUٱWef].®͊+ 6*`Wf)vjb͊+vjb͊+Vl!]qVʦp5 Nn)uȳl!=0QpW*."2>)sF:C ,Rۦ*14v"إpͅ.MC p1[]$J ,i$K[9t運G3ثc)zad͊z8TZ9}q;*m.n-S)o0\h {u`aLIbZÝAuІqWS6*aVCTى =݈V :O"HڕB?2+)O؅OAE1RŘ9-W.1E8 UUN4E*8L 1)UJUGUʦq9y%hت Vc]A+q; 6jdk͚]6pf4̔y +P2-mOrHSC㗙Vʋ$;O֞[_%IMrQIO9,d*[GO 6-e`ƩeO*c=Kn;RPTu®)igmv0Mp+SWf|Uj+]!hqWb m϶*Fd@=Ks$\A#RiZ}1C\UR6+v&QZW*y*R4E®TP(vc7\UǨ]`K{w]-@)—fy9mrxb8w,'mz$0o6*ثb͊6*vueҺ]ӳb͊6k/WbbfSh­W50+-W0㩊]1CU˦N9WZƘ\ [HZQLY#3IZf|W [)I1*oVHªnA1E n{dmF@I{~aj†FXو_ eRX᷑؅S'Sa40YBG(H7Ð!JwzlEbXGH}# fS6*;6I.͊\nMgPJn?ˋ扲u?toi}-*Go"%3JŽy#4ȤȎk z7 qs?H+^XT{o, P+\*VbRW#zccR{_Bx$+kg}!߯K *}dRx9O'sԪİrfȇb)u_dqWbOsCJޫ7f<dB"^wk{ Sq(\V8=܈Hp˛"<]JdY%LRY(Js jca9VXop?C\:CVuB <ȳI66I.͊s`C Z͊́Z͊\)/?$6 ?a ?VEKﶞORl*˦6W, m-˦-<1S^lI^ǂ"7,d6d\Hߐ\O:+B*@2Uʗ45V1=by+ %[$9cb͊6*ثb:q !]4#| ,#dYWT5QFm⫎-+z'n*b] iA M.ƚbz`bw 9P;K]q½Jb 8ZʧgXZWFjL# `8 spcWeE,g9#6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثbo*F/_GBg:\lRثv^*b.®͊6*챁]1Wf]pq]];(be͊6*ث*UٱCb͊]1L)vjb͊6*ثb͊6*ثWeaKZ962Cyg(-ҝ1Y[[ն\DjX9eI1ƐŁ9b቞..]E*㏐qM!o|sȊDl@*# aVjWc 銆ĤgD2*[\Uqh6eWKW&m!3̈7X$vdy8&) }/3]@" rخ* d^6Q/dW-[1ՠ$jJ񤢄W]7͖TIQ,|*͓xt9! #+Uz헁Z͊LثblUثVS.u1#&U) Y:4v;\DǨ$&B3CRSl-RU}/z)*\GE4Oö^%lS8Yn2-Cu;W]FY\Up!cc®0\PrZa)l p*.cX)VG-+J.*\kaUi}reVNV+ ;7?#1RfJi|cJYZ- Vr\s (Zr*XN^[vlUٱWf*إs`C`OYzeÒYKH+T^?3T]jq$U0aW"Xplv"0%]Nf]Pb@͊LBs(ZsW [=1p!MؕG[dU,ey?2YEO?&%bT[G0]* U1,F**ڻt!fLU@Ȕ-B{d`HD&6%T\lmiUʧkyVv>j8*mսl|BzFc.q k2U&<ü<fb%,PajBm\p-'XaV7•X 6urdR챊rWfZ9dUm⫕mROHnkSb0"To\uբL;m΍Bj;5bQFۦ1@\LN؜ G\uMA1-B1O!t~_d2LjSgj(:)݉t|4 Pabf_vR ]tbfdm5ntvUNmWc]#0lv]x}݀|Wfp%ٹaWfk+;v]>{Wci)v$; xWex| v%yl(CPEE1K%wIw1Weةu?ob#|Rcl) ]U:w®ߗo Uj("؝x v.4e1Wc@Wc\PjFqWfFN,UJ6.qvbkUث*i\U^ZaCb~˾v1 ibHF`]L vYZ848 GAyWf]vlUٱWeS/fvlPث^*]1WW.*I˦*rVLU*rK\Shp]1KUXL(Z[V;ȸAF +`UUq@늩$혏U\Uc犹[flQ w8UBU»z\Rpi^j1q1I%/fYR/l4ʹ?&lT'"7tZ=Ha 55J^ʋ}qW[!]-|XMKMDN(wE *P{a *KT?2-mw͊͊6(hhUakYJd\ eQO, AŘ@\Hj? VWk/vc*tƓ[MLЎN1ܫaa.Fk6PW#D/)l@V$+  ~0c7hE[ICQwOKo)'G ,xHqKO|t~o0-\6!(; P+C0PDF)[SmGv+$EݰF>-Rogp ^sb6x̐ǮH*S[O^{uI_Փ`XԜZ@# \Iȅ©=Ϣ+TRn#Q y2BKsN^C)zQ#,b@Ȑ\wtxoiHaNY 8z偊[51BrVkYm?e_sL1qբz"&L)jxUGc$_߷0x2@jD8 xU▩h;\KA%82N|35ָbZ=@' .zxeD3F9}B[qUN $桏\Wf]vlUحqׄ+h,b$cBMLS5(Kj8Á*Xw<1VS| p>r4d-Um[lvO^UA%LTG':qaݪN/h5QviRt @ҫG;WRK%^;-:~9oQނ>=+CG}e *Dv OK=S,drT$opePсLt͊6*ثb͊6*ثMb(1t޴呝/5p4a28UEuP k}2bQO> "&G~!-1sS",ӸƕSjjpk 1BF&C|aW:c.^YN'BK:wyH-$ 1E-F(S̫0[Uh_0UO01$ Ua͒JܼP.jbf(vjKT*1رSa͊6*إٱWfqV)ߜʂ$pD(hG탋`AYR@fA )0.lUG.SV)_ZckUd$JDiW4 6*9xBd٩6)wċy?oՆ1K :㊔54 =? ))xQ@r$#[ //%D{C0 vn"A.t/U=H Z8 @$s'G @TSivW w®o]͔]𫲥SPiƓ]p%ؘ}ծȨ|v5~v1mWe)_|*gO]EvVzb!^*)v&)\U!;4kEvZvSF .7^,v\}\U˕u<4V:.9cw{bfv4qKxMCtޠ&F*hj85S,O(v? r+|)v(ߐ$ WI]$]]Ou‡e؄Z f*cS늻RUEzS{-k(=?%hACyWf]vlUٱWeR1bW1WP^)k50+bprVw,bkLRWj|qKe…qVǪ*WAT\1Bڣ#^j|p*l2 k*`j7')Zv(FBa*43ͱ)T0 ެ!Rw-'ZEխPVoGƈJ6ƕ_ =4|*!Fp=H6*J0b=]osdk#V߯Ն؈]28&5iQcxH\/nهrpk+}<<(pE-n4ᵦmxB f=냄$ֲB PG߂邕DLU܆lUsSu0ڗ̿p ڴds(Fvi H.#hFXZ˦h*}VǶFt4k!Ova,#P" tT{$' ڗ EU\OW s(t=A#5]F<1{9 MZwhaG#MWVE/b3DA!sA`o:h9C!(y-$N܇wjGz1U-MLv-L@lktj 0N8cȍze _4-kkuP&r󼙏w83dEتmL&&=RTεY$i5wVqdW,bNٱV*Yt…jSKy8UOtN<qߏKfbzY,O"B:Hj~I ͆+ks V}F?+m}B'1C ;}oO!eqo>6\4u? Ÿ0]<*0cʦ,c$@ YRwzPF Myc4,iU~ 9n~.M&rKb[_.JړOQq->mankOߤ-z0~?s~.OㅺFZhkI3ЬW2!_Б޸aFSdinWqbK A"IΘ&E o[k3[I",4GdN-UQ\KnW$҉Heb͊6*|&a !\ałdrL)hq]8]njhp+g+zƐj{ RY58Uؙd$p8J׹ǪdP\xPقoh8'OlUxnn_l)ZN=v­P{`UpҸf4ָTʮn6*Tb5V҅}VC!P&O:"M*=qUpUʣkUv济qIT0DvM5/%A=^m֝G̈W֏鄑$CG0\3nx])C`8T% RW T>x)镊NlU6ZWf]+:}͕֯H y8 j$q-_/2|ʔVpCJv _-Snӱ 8mp} 'aG&zMKl{ `8ˇuo-sF_L*0$7l,Zο~8|-W(Y+ag#/Q~?v%*ڑuH9eV1Ct\*2)u3bqڴr…21 H͊vlRثbf8)ߜ˂(R8yp2iip~X:RƹT+(6 VZfaFVcZ/UƺmUe*VeW y r0 [~1;΃ȅq?~ʗ$2[HVNS01lVf,rA-jVQZ& 6X89{aVs1W*eĪ9e(mWMp&U1& \mk+v\Q?M~zJ' <εj{~QCVZ`O)[/45:ryS]A|308B3YǾlɬ|g=W|¸1U$ɢ3b# UPwYNؙ14[ክ"쒻(b.ٸ ڊ⑽wd+Sqoqm =za]&Łdd<_wm2FZ<Y#k^U :5ab U«C@Ɔߕj8XGS^p:ۮv`8݌Sq;]Q]v&TNi8V Uؙ;1@=We|UZC|U0 Wc4]}*MkJRWcr*hVUjlثڌbRP iኻ4GP2O PmM?^*T@@v] *٢Jcw)v<(Cv&k:fOC])\UP;0NdbfV%Wb`>xRt|U+0]jV)v) CtُS,>튻;2®  +mWcJ42%]P8_6y aVżثb͊6*ث\UN^ؔPY*bPX-p PUmq1Jqb1VQ[0q`U˦-fqB6< R͎cqU=VLp `*TN-pinlH9|qJ!3F>>T"cڔaOauYE]N\ A9[HR8汪 x><#+)Y5#Pd^Bv+J`uxG .F h'ubE?m[ էGo2“+T{nsHU>BpWJ##=JgiPA} -8٬d1!EF6 %$7yNQXkn?p^6_}uXN}?F%6#fUm8h\uw 販d:ar,$CЍȳAʞ-Ǯ%{r-biI{cIT?VET3Gf'5l%Q:@IiÌ TZ,d▸WUckWȷBÊH1E鰙nz<ѕZZ8ȣc]}?;5!0%%.1*# UʦE L*jb|yOiJv?Z.Y$RVg ]0> ɵi?k%a']Cjž鱔=(j~}ʮL zB%J1ؑO<&*E$d0 7W . V6+vlU1Wd#ˊ L)ZN_ oZ9F)p9`lU6;VU+®ƱӮDؚ1Ɛ8>xҭ'ZaWe*|v`mJܣ[{ƕv®'wl;7LUو[1VOߊf/b~yVlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb*J/_GBg:rԠrWf]b͊] 5qWf]vlUٱWeb]1We͊(1We͊qKCb͊]/vlUXٰbf]vl*ثb͊6*ٱWf]vlUXU+o6**l XNpGeBH#td\v+N? k/vQj튻060)~Z]/)9 CEw0_d`Vċd0Z7!*L1q [+yFH-p!*Uvl* 2Jc\qkH̒cz'd;Q> @tQAJ aعƿ~8B– qVـ[QpGҷHiwqʦ1L{^R4el1a_S$wecl f]Lثo6*ثUƕ8mWĕn_8m]7|mʲJ-(^ygՊviT?W$&BI@o6(|~ư}.b4n/ ܁2ӢL72PÄ:]&VPLcA$[H}1+cJwG`Y+\*\rb|P0q7WkKLh2RfIE7eXd)ق`WI&r2\3pQ2YPFtqU͊Q83Wu2]6whզ*\)XW,(XF8bfZ͊]vlU٫ȶneC[ :ѿDIߟ`;إ"bf銶7hcY|1Uƌ O,vI*LiGoQЧ\NlUɸ́*sWB¹Y%jȕ\jD iSQ:z!|n?^e˒i]7da+1(*ZurAVl%Tv l7nb95qKtDf*GIq?)U0[=rZMSceU"C~bZ߯,QNO*baQeTNt%6%"|Rsufr3e x?8F$#\]V7\ qSQ\m8 Ui;%RU .E[C+n;9ڍ =b E~%?1gVE?lt,5S ٰZZ:b2B'VT|N%c#4M uIo^HIȖ5mxHcnVC,dhl!K"GL(o)kZ+zo]g ?N;(%O^YhK銻-bm*찫]GL*0oj(68G; §vXz®ƔG*Ѽ1Wc bƔ (~xZn:bˍjoU"TlU/*)_vybV*ynإqWfv1* (v?a*<\RH 0n-ĞUٔprp*:]\F(aH ;٣f:; *T*cqAv\Wb_%Iv*\iȕvS>k~(#y aAyWf]vlUٱWe6^)XyWeb]h*p:qb-v*͊Z˦*-,'1V9FSc*D1U'lwUg$+5KwJ81QǶ KKBM+xM[D{i b2=6+ roտXi#~]GS_OF$Wd0$0#ri5dO$OkYڂE;Í+Z( Y\! Xʿ_ \jAi @L*6%57c-EFG|Th( sÛ8a[hE?Y9cK{ٚM W R+U?␅B*tʰXEZC9F $mP`UU 5LbS}ORJ Y%qqU3&= fTH,,ڛ1T`, NE„RGDSIlpZ0(J 6JǨAKm:3AqAo_6N*\VZ«/6-'Ӏ-bK P{ ?VNez~]?XXi*L@ XH]S()u1+K.ʧc˭F!_LU?UFc Cl,FewM9"qOo# ^"5)+o׈=O݂HuivYb0֬A#1,wkK׆a-UA*U:3M \A 2/#fY6T!ݨ3~,NzVE'8]`Kb'Q:`q ;rH;+N;5£MWf*bƕlث Xq*9g;)v8 PZ k_NYZVRcWVU1aWW6æ WcZhqA\ qJqثYXҷ`CMs,B+6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb*J/_GBg:Z^*ثb1WeƜU٩/vQ]6*UٱCRUxb(v^)h]bf]vV*bLUXWf];6)vlUٰb͊6vlUٱWf]vlUٱWe*U6*X銴s@ui'4H (+YGƮ{8AEXqbW,Y63\}RdfCV?xJr.IB>ƹ Np!jmq\t|T91 [9gJr2CXC*ثbvUrIle)lbf8Bӆ~_ԻMݕ(-nNah,a[7,u!R]1Wf銸eu8s52%z3qƂmCoR7m)nsfʤzɡ6? 3dU6.͊6)jlUXiW$lhI.";`Be7\)ui#^تCM|2qМ+t{.nVlrKzXDMTrˮ*/|i\cI UElWF*a+b[ r\OlaFm\ /gs!@dfUqKʗ6?(~5́1-QqG7q=?vd$ȃO6J%8 d̖ <e2B$t3lTS/uYb/Ť-3Sa U ^ Z6zYQPfTL%n @E3-rIolPVsSv9u$|䕯 H82-UӁ"+4\y~&<홭akz9[MO+ C桧\/csX~c՗E&j6K#%9$*  I;ba(Y$O(?՘ͅiGD*HWW ٛnS!H-9v`O.%!5k:R ⪁sr[Q4[Q\R *PZUc VVP5qWfn+|r3̬|ᶏeRl~asRxmsbqJ9b^(h21J!a8 lUĜi`U1VW:bW6pZ$b1HG7iEH<^2)ɤMY>ل4e1blc4waYFU1VojbƓ+WU)vuVkէL6\%`MBu4Ɩ)^#囝qWzT8QSKF?/2xemPn=yR ي)d9N-$&xٿ»$cɩf*j btYiG/5\MqU8d8U9U0+aWedPpZ9mrcZ`BXk u]D\mR6 -V凓aE#*wMr[fAC3!#\09*:e\ty&)vb5v&c  Cث (v1RA}%؂@Uؠ_v\Njm9 jKzbL[0eFfɥؠP@E}E8P$[J'Tz!1o6*ثb͊6*vuӗJFlUثb͊eU`Uq8bec)k/5jbI,')[, bk.*ؠTqB,b0%k )'(0+"*qh*:nÕ:/QT6]VتcRzy^PfƝi{d/"O, -Z;ڐa WP)r|UaL) ]%ŕxˊQVxZ3 `Mj0=95wo)んishQ&3!%9ocXϹUZm:ʋ:~#+HԽVыu_Ąs)2@y~۶ n..?C>,S:KkmW/cO )EM噍Od5yuOyp"1`J#(Rӊ5*Ď)UT6\| |gĚT?QaGo4ǗgK{R#a{{n>Ȯ6HVdi%eT,g$acKxrҎ{1ۯ0ƴx851ZbSME2IC]F]( #z2VJ\\Pv |2KNcniVeu" o+}cncue7h9F?p#>kocLV".3|'i0Ee|T]1{@?wuh{T8VO/VF5߅UWNr>ɧrԣt|E|v> _: ԿFM'B|TmE?#"nbo[Nj⌑d6+|QԣDVH?? #AeHϩV?`UQ4[/ {WcWCn+H |j)!_Ev@44e,z%<j]?IN1epcX}#ZX`dJ]r)vlUj*qWgDO'2N NYLR2Iv5`h>t]%Kjq'|)ur튷|UÎ8c)@)np4b-Fv<cxoZr')C.+Fl坷 ኻ0ZcjwLUq8P9 ? ՜1آb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb*J/_GBg:ZV*.͊6(vlRثb]bLUxGvjbf]0َ)h]Lo6*ثWf]늻6*ثb͊6vlUٰ+b]Ufu3Wu3b͊6*U+nxX>#wȒیYhvk>;IA; N#~]maRrAU͊1\U \N2H6fo\Ra%9~7C䐲q늀zcCaVh{ Bއ[yĔ52(ur*ثSu2*o|Ky)o6*`qC>j\ 6GieVK)ҹY֕j`4L>;3Q4[$ȥa*6%Jal JErj-_3.Ёq]왪P1,IسI'/k6*\ ᚸ U͊1 4)+_%J&W\R⹀—f598S0[4$ch+AKW5^ɂw9nj2 mPTх#acS %g'8T U|‡&q^ (+@dUqV4UpyuTLQ+煚k~ h+Fd*3}ȶOȎKTd7jt>]i^5SXe $#ӼԎpo6N4q62B)vlP T??2qGb⥏S Jf2攫\8a%*$/\1BCfLUnXҔZeV* kUQqZ[eD8W9d lqJq*f$/LUxU+[8+o !VJ:.3|5LjU4t"kL4b"3+@8J]#^Dq=%iv?Cd C?hC`lUٱWf]vlUc*/fثyWW6v^k, RZ8*prV:UZ',-qU*8 UiT˦)[\p8Nq(XHSiؔ-,)^lrqU=N`(0+L=1Vӱ aUV!f8,z ֧eJ]1SO-eycOyhMpTwd.1j8cqVW\+k Uix0EmaKVqtVb͊mAp Bl P8kH8>/pJlJv?D(t̅2Qfb8ȽQ?r0IA#fCLuZ\T{޸@ց pJ!_\;#&Q.OXF/?XW5oOZ)ak{OI#'c, ,S@~54拆H6i0?1c2F)F+_soil$ Ǜ0c4#~Ѯ(F*`U`UᲈƑ^aU-nWRǔQ[ \4m)2I +Z"(gHVc߯|0rȼRJ*RTҁdoPU\YFN\ViHHUhwR[Q6jqd80A1 \p-$ujof`E'F#ƛ`i5(qSS%Ll:$϶#mYFI‹N<.%+hjE]f Z˅onԇ H՟Mbd-'-4+QZM?jz!R*+"?م2k/~/Yh+x$}S%|z5R;l". _JSM"1H/2?a%с.-5ݕOESK!Zn}2(2+Rثo1QZmO4o#1̼,T\PEFy.đZ+OdȺӉm'bXc*!;\`mC*ءٱKSnjw,UiPzgyC^(ݣu"u?km}TV( x a?eu@.,&5‘+{ۈ O$C^m> oTk1EFc^ Ⱦ M)ACАxvlmZ|8i,+HdغcOX-!nٓLu8.bժ1Sʟ >"ڌ>kA|~ϪS+ݘzmBe 'saJ&vB+I+T% C"[]y9(c.$klhp ߗVXh >,nU\UآBÍmڝL2኷*8W I}lUj*0(i]F]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb*J/_GBg:ZQ—eb`Cb͊6*ثb͊6*ثb͊6*ثb͊6(vlRثb͊6*ث*Ucv^*ثb͊6*UٱWf]]]vj`VSvlU٫5qWS5pUeS(P `r(8md)٦$צ FxohNPv]+ա1$ E02^2bVcC`[$)Dz *0Tck$o,h⑟9L)`Vb>06u͊t]6&죁-UٱWf\k=rGXG1` "l$~bFSf7~\rZ/ݷiCEr_=ƛukLHMb`'O3 38*Ǘx#g%)Q0ONت;W=RrBʦ:$^$l֕f}9nSQcHf]q́]bV*b0•JejsS%jq| W$s _.k p_qZ'TB1vA*ew9V`4vy;lV5N[*WF^c[aWGqe`Jp!2N)\7N*saWW(:cJrַߠîLHTK"M};}vkF,`|r _jNnB" Q^xPI' ?hW\}!QGI38(W0ATseVb͊6*ثb]6*죊WRŴlF$!nl7í4y.$RWw(3F?V,7X[bC)q̝>G ܀ > cLZQ?pS'Z˱J' A}GK2iPvߦ1$zo\ Wcx⭃-0Ui9XUiV*1Z+UiLXUaLp8¹*=1UeaLec䬧D_z˔O-%9K$ZiE1U5UqVʃ*2XP b]p!wD`e\UJe6) A[#,*ZIW2)\:RLi\R>`)Z-^I~1檶X~¼_¬SD'd=~C0sN,J1Y\i]0XUkc !LF:cHS 9XҮrƕicAZ5LBƕ뉖$J(p T⭪061TGo |8Ȩ\+&f9BWPSOJL48xmcтzݳ`CU4N;hUilUrFL |)VS%~VE *˦k*6=F(XN*U68 V`YFqFH%U 4%|rfZO ,~YJ9puCсKXe?bN8 Ed Xbwq܅vC!F;7 ®(:]/ 36StZbcKW4] )m.ZJ6P](*z6^;~|*c2v.mvZ 1CFMvi E48 p'p:z3k /v%:v=XWlUٚBT]*+*`#sXUؙDPv8cź5^بSp6®ǃ]C875S(B*x؄Je(v>"=q HM.J+۩—b'$ZUZ]~;-AvhSvST*IW`K2bZ=FG [͊6*ثb͊,u]xґ.銵\ث'1JqVQLUi80*×]\bN8 Ua>9xӖq8񊩶9qJW ɊNo X4҆lAVyDBbd+O\:5(j#P=[QbStw(!vp<*,ءszkv ZZ-$sDRUOq_+Ҫ]~}8eǜ,VryyTT|D<kH|4(JǶt⤪ꢠlPlUٱWf]vlUٱWd}da_;S1  EZܡH06)f f]vlUٱWe=dž*+NtDm"7N'r云_w_,Ѳ1WoLnE"UWWaVS, Z68cw`Cy[Iq娠(v;MK^ءj늸–`C\Um2haWW[\kbRd1JS Sȱh9rsb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثbo*J/_GBg:rHثS/;6*ثb͊6*vlUٱWf]vlUٱWeWvj͊6*UٱWe UxG ]L)va/vlUٱWeb͊6*UT]qVptʮ*fu3`Kb͊ͅ]u2®b\ieµn졝E#Ɏyl(p6Ib0NWh]uR2ȅEZxGs( ;uBmkA1*[<\T{0WϤqREOAxBY-Mjj~ TUޢ'-JANffm`P'zaV, \3 UuPͅZ9GKP\6dNlPY+G|nM-S6*9[+A0_}by4OZavᷗ-PշʲF:m^ Uָx\a*8xpr(\Yb\5 Wrʦ*jUFn7 #""sJ( <LJ7SL+X.DvąSX GxBOA{ vUVe$὏J~3uHCc]$ԭm1^)1!P $UWulUef]nWW6*lUٱV'j-v6b\zJj [Ë e_S; 5-%>S 83I]%Y2r3*ki")"ο >a ԦFC%"Z \@p:BDrOi|Qo"tw?Qx7*Ml7#NGXݮO*MnyimE `SQ0 C|QJhT*«FViZS\lsuVC|)lP6LplmT36 uuL|'z?]j6eÒ jtj TOR]`9/ ).nUW/w?>B)*5MV*Wܓ:NxqrNEZm#OCG\ ;u=M]5䠏aᑓYg^[p1PSU3͊6*ث!m]#hv Kغ])v ;wV 6W @Aq+BMo\1 i)- G+ROJ{jIVilBX-UOq3GYrJh㪞 <? AL3ʱh~_ ]ӚՓɏ"}gj"vz!c3?x.>*i}Df!q!Q,Ke%whCsipkP> YLwc[Kpi3aK {5s"ƾ,@.(sZrAKnVGgBir6FqW]I]i]8\xKyĚ 6%K@2CG6(nKvlPlRlUy~wih<&gjC+G{w܆lzثbZ͊k6(vG| H"i>j(~ G VAє0bMcLv(vlUٱWf]vlU[KujMXρ_! n?Nw@SZ:r ,K ou O )up0;Fe7 X?iӗd_'Fð<>]&Vm ~Vn X‡7JJ}?iڲ%Ȱ6ɳr ͹u'7w}3dCc~ۮ,k0\K|c\ EEX&6 Who4q\6oإ3;Cu.U\*창*체銺\~U@c\F]qVZ; ~9(.**]Wf7LRj1V9˲F]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb*J/_GBg:Z6(vlUٱWf]/vlUٱWeb͊/vlUٱWf]]1We]6*졊1.®eWf]vlUٱWfٱWf®́]vlUGlebpP (B]*죊,b͊*UٺbS17L\Qnm␶شd2Hm:+jlaU1vVIC{BA,< K*nwĬ~euN$I'p<R^Bj8Sa\u+ l4U's( 4J0R(ƕ٩Ni]+RP\*rʌU]\;UU|/6c0T&c4.PMivN#vkA&%R$wmMCq_l͑M$|)eӞFJaRA {2G/qlXwȲHj2J^6m^kl*ث \i.;4(o0Jl UzbckKI[\{w4 EVXBakŽSi􄲙E_& aL&W+K\Q4[ `J9[J rK`Sl !qb7U[c4UUpbQ8Ȱ UȼB31M؜B@(,KE3Җ1.|}Y JoȽ i#מP>z-@y*+}c5݁ޡ+M{duw+o9I TC J+j_*aWf]vlUٱWf]vlUٱWf*flEZFVzj}Ͼ/@\+H[.+ Cြɩ[>#N/ا}DW,l'S#%C>$"L-9m2=_.b+S sFkoW2^L*?ľl>~X0\|%Z<Ty T{_. i$C?>Uoa,>E[_._?<?>VϗeaF=| 돆UM)G=돆Ua#pqʴ|=:e>?*`\ #6w?>V΃7cӿqʵoLoe+@?Go\|2/?a?>BàM?e\4 G1;vVU[}hW$QX#pR9R*W̒,*{5^&N01'ғ6cXpjG+MNmpЏW??|4. bSN>'~o1#}ۏـǏ3n>W>'2ǙVSx?r^KGw/oqз;'1Cc˯eO?*|IЃߏA<$?l-GdUBrϚaU+Ա_ͭ<^,c"o > W~=G_G:=qJk`IJkڜ @aiT&ٻ`ث5ثRCMvX@M;"OzG!M.J8.p+1*찡0o++^\ bcj=Tv,2e|,+tu2 WԌ2xw%{szzcvR v82$a$X'Ŝ242l NU[/w[/aWX|Wv뉘Z4⻷os?1]> N3lIq_W?u{IOݱ??f {4?(.4V~?nQӘa6#쯆*l_jF~5팢!8FVMN[Ӊx1{V3#&:K+hS 8vGG1*OiO.ASC-T͊."p@?UWa,khiV_RC֔'Ɵ|06)f͊6)v#wif |Aڒvo,SW`Df9pa#dU~8XUlv"vA_k\@2CS߼m7k+O-Z)I04ۀu,֥A+ji]%ɵvjͲqCv.xb8^d\UmsP UckqVኵZcHkjSlU=V'*6f*^pt-jSn̋\c-vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb*J/_GBg:ZlUٱWf]vVثbecqWeUxb͊6*ثb͊6*ثb͊6*ثb.́]vl*ءٱWf]6vlUXRPW+*)]vl ثbqWebaqCUusWo6*ءӘ7]J~Ru=2%ŗBOH{Cc]Gj+㈧E+8{Z,J ň=aUk{V :dQVS1([сZSƸ⮮b0+LULRUp 1WW,6RT2U̟s'6ɍ'__0`[9/ZrCX+ ϥoo1&:&YK0-&nBOf 5xȠ]*F7$$L*3o ǷQ v(<{XWqu*?r-0[+J&O3 bT5ϗ@8sow Ȭ,ڻ&$*Q=OՋdBb|qW`I늸z[0]L'lfo5qVr44zan ]=RraoWݧoj~9,yDC?(kꒉ3pȕ]fWƑxlW㊷1wLUsS"f]\ث\bL qqVƑWLRq{vվ}2?Պۏ2qdS~"RPdW_B#IJf8T 9J؍Ŕ@dU3Ǻj^J,XďYtr"-BH0&sBWj?e8waf܎vʎ*Xg ) BlqpZ;̈́sf]vlUٱVusbf]vUqV 8i:(UtI0k@8$`O0z,d{ӣR%ljmJSc4´//v$%:zs^i }ޔ1lQJy8=)lJm,5"#w:vjcobOm䶘[ L.6OCwyŵ(! `_ _bBxbD:>)ȔFX>'G̒.QG8W1cyi;9*y8y`?v>//r*HiX6A,CВpx-ǯ-׭)h)/~'J]|n{ ˰* UXuYH$a6v-O/& =*"F73k~q W0OL_\VO\{~/9kh#/7k8ʵ~}c˶q z}f>['a돈P̟J[aݷ>!W~?7vt__\w?-?q(h;-u'*.OFğE?\x%TԮt+3Onj߀sIi\7Q:u9l2gE A8rIoWX1>7K_ys$⽖CĶ{av{jwY,UyuS@# 8`s sq8Uي`Vf Z-;W+SuUV`J1UᱥqVf[, U˦ZN=qB84XmUhF,.3UK J`N )?F@@*)l? d%2aZ6Nc=N' U+*zuv2MW*}l*L]e8 v6MMp+?v< *M8l]]qCqWcVM=+(6+nWe2إ؜RZ (Saɰ%SH}O*hjWvRlqWc8#:UآSNث.aWbvvY44lPq*ImKP>Uٕ|$`WcOı 2_ k :9]Uْ|B]&jNTC')vW04p+AIu+Q*M'ǭ)U; !KIOH+{lWf]vlUٱWf]:μriH1VZq9`bShv)[ZN;-Dr銴q9`VQ4®GlPxJ9m@7I'lQ(zaU)Anj(S'/*L㊸(o[jL1V"f MO+aثmk^'S~cjlxZcjƼ_W/PeK(X(:dsb͊6*UٱWfv=F;ZaW`J]I\p ' !:,%pl3PS faz+Pm > t9d5D>ǥ>,?]M QU@.@tG&5\pq-*/wqOڅzMjN(<GH&v99ԥ]؏+&kR9dp*)tD0=ŒHƤBQEXv屢H>9Ǐak/`da^;/ä@E@x5?׎.͊5vRi#_(&P[ԃjZ΅7PIRƘH~@4~N:(PI,ȲE1cxQj˫ܝXV?rpϪ˹GY!o21[-0'QO+%{EئzOͿ8}$wr¿1ha ~Ԅ+W; ƒnicn$Q% -Iqu8ŒLy -A䘤mxK mAڟ?i{X٭i~2eTI~_N d*^UǦnji]q5͹Z6[8+180WU٘6*k.aw`ԜU٩\U6\}0!uqPjKdٔo~G9fPثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb*J/_GBg:ZlUٱKbf]bfʦ*1We͊6*ثWf.LPثWeb]vlUٱWew—ef͊U͊ebUٱWf]p%ٰٱWebU1J]6*ث]lf[(hUUث*n'jqV`nlq# ls*K۩pMU;RX\P`Xod; dp%=EŒ"߶82(q51V돮4rYZLU*qqWW+\0uhYLUܲi[2qh8+X; ^OVGdX,9xXȕk ". e!i! GrC^LHY[ez`(J׮^Zf>ҹ@`+|KFd㐅F[j۝W%Ήsj%-x5k{P|RSx]-GlxaŶosn4LHJWsa= a\Z:dUj|2+XJsrBHƒ\iWTfV +rJꌺV'9 '7W,F  ˈ6ڿ%:t^Y*u ~3?.NL-* qw,`Wr ƑW+^b1nU1UT[V*RV*8`qUHsEq ȅ^GA }9=1T:: l3?yvuGlث]/>jMF6VԔNE'x1^_*";ҿog5GȁjFZ$$BE.N GO2'<-9$v:` LU n7n2 e](1VSvjd V*U٩l|=zQsqEQPnSLrVN:1SkʯTaPp}Аp}HI U֟nrzoO6< ,z2ŵk"6aʹ}«E\N6zMʘ564إR~5ei@F0RU-すKG0Z94R|a\qWR/ؘv\;O:|S.jǵ@VO Ղ2*6*%!4Us#/*rV0+jFl*#lU͊ L[F VS\'ڨp38cH<1qU c%| }ETZ8yy!J)Y1]>ن9)c |qUӖ=%i˦ZNnYleU¹DPq*|R~A -ğ)Vm3*Z c 'I? 4` <>>,B'#W1JR$^?)zv*;ٛ0,eըAp&^C d^%6˜޶)ۄ+lVz2X-(N"FUxpҩS 0)^ C\I]Zƹ| &*|48I )ŎL2Ur[j!8Wu+) [+QHa?v69mVa RnEZA=ݒtqǮI9${e.J KWe*a;a\ Ht—cX`Weثv8MemLRy`@6P}#ju—fJJP`We EI;6/;kc RV6 ۮ;3v?4#4®ʉ=zb,7dž 1Knkv*:6)d)0+ܛl*xQ]L]mC(^{@WeS&cĊaWe0 vhҢb *kҘ^b|=]qu?J2[ds+Bثb͊6*ث\Uכ/fbx[81U VS--\ijaKUZˡ3]\Vz dww­V aU9gۦ8ofjenn4ʁk2R, *Ӊ1/U4jJ`VEyAቭ•g8ژ@k*EJg9uk[Ѩ>쬵= JPp EJNjSk+Tһ7q;/]li]-4R,4QEqGL4W|* 'e>k ?/ ?|X2/r6b ~ހ}fḐ;kԓ\cLRa- *,(“xlqYeqꇗWi? /7|z`[Hc#^`d6q5%*lUٱWf]vZbr=Lw#zq_<%;VqUȍ :ɶؠXWS7?v\O8,4*6Ng.fԉפ v]vw-c.=>&&Vy%k xo S*w;J?(ijb}ٿ62v9ZioaGJ_<$,i T7={cLIq<זzc+izD_AX+1;P 5\*1^Rru,x$և\2b6vjmL x',׮hf=WtqZC|P*2h(0!O+vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb*J/_GBg:ZlRثbf]vlUٱWf]/vlUٱWf]qK!xb͊6*UxaWf]vl Uk*c51Ky`CbءٱKSvV*c]vl ث`VlPlU]LqVYF)o]Q.f7 0 #J: ]?169UEpBÂbC%& r:׮%R*(geol[._ C)ᄄ\2wpҷ\5JioO +ezcWrƐY^:`(hXZuaFL2 M*Er34̨_]13϶I:l:(ݚED)-o(]\P婦 \N%] [w(>x6Pgnn%T+":MX'ڹ#5 iI(2lلN͓KY+ *)vj|8N*{ʢ)#RE۵ [y9> 1é]ؚ8${6ov*(K_1C/ NS,tmƅ,;y 3TV6{etU-&JክXU^*r+aVqV-fZ۳~ d)F¿ew7@n.A;A?~dLTRAS&EcVLثuj`VeҘU͑(lU~jWf.ʦ]1UƑ e*bl UrUNlb~jԾ>qQlHd~\MyrsTV/"#UbW#l>6T`C8BTVv^:x3b9YG" Xpc㊮ qVlkdD݊8y O1ՒbbRnƞ9hmA[r8+[$eªmp%ٱC͊*aqW6rφE\70*m9]_5!ZL42mb^Te1|U_)bKWûpF_יZCEJ.F\KOq޽2AU1([z8Db_#1^=7$T3bf].LUٱCyK[d_umb85GW??QWjn8ULj|pʦ:T®c+?9ia>J֟} Ma)xq\RMMä|$A_o<+Kq'PocӼ d6H9" &֗^({iE>KWkH*h|_a԰OpPb˒vu>?N wCbF)uG@h1|UnlUdkVkWNdJ~R?)i^ݎ:|D1ҒT_td nErƲH=2`C|Uو\3N4NQ㩁 e-|UƟ7\:e͊\q;}81ءk51K(1Uv9r&Wf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثbo*J/_GBg:rH]6*ثb͊6*ثWe͊6*죊]]\Uف]͊6*Rث`Cb]1V]k6*saWW50+y] vlUٱWcN*[1V뚘]L*Uٰ+c6(o6*ثS5\ˊ\qZ9c I>ks| xlF oNd ӂb5Ɇ*Li^]8ZR aq"}OAQǘUpOd틚& A(q2A\6ب\n[T;o, 1J2qEX卭ž-miep6ߩ_fEezxߪnzo\!63JÝׂ4ekg@TXn68lJ *+eW*YdSDV[qSUN$~+cS"֞a0 u>%#Oتez6o^g X.p5=smw vyIRI`4H26uvWmRqU܂c~52 YmlR7m䕕BkbSsjjRqf*FjCU.\U2W+SL VWʹX_*`VUw,ث\[.ƕ+l*|Uw\z"19F>J_"P|WCq(C-၀S`3Xc/jT8|jb$­+\l p!zi8u1p\Ui1`2⫃a8R 29 LheؙDߓw7Ϥ%W$3/rr%R|^iXQo31j3/i}5D nM( <0zx5>q=ܟn8il:8/;Α=yۑm6Bk}ۇ|A͹>IGsƐK͹E6-|W=,bEF5rΑ_?_!M*;؜J!<˃!C5b)_lMƒ8ټǩ8$0a~Pwo쪏li.elN%qGF]LJ7L rbj}< ">*NI\wIW '')hp;8RNnp).xwmV1RBBJLJ!nQJ+I*:63Q͊v.bF+C,a~5PCNZ|W#87J*~D-ݮBmDAIqORm#۶kkLTMEq|U \½;`Vc㊻*Uʧq[R1\3SurqlUinjU^1KGQ1L3b͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثbo*F/_GBg:\1Wf;/vlUٱWf]vlUٱWf]vlUٱWeUXUٱKbf®ʮ6;/v^*ثbsbf‡f]o6o6**ثb͊6*b͊6*)vl ث(vX[lU͊lR«NlU㩊\7˸նut-I(%kvI=c qWQ2A N S&McܓF_s_"mQFLh7–vb"`+L{l0ҸGmdVX`A &*Uu8??D=/R5ݯe ^43WS y(9 ¯@[{h O>|kF^1an$_XŐEvv \\ASp@1y"N0l}5 zol[r2%it;NoV;d'Q1fp!Y S%}TM33v2*6I]LZ;fhfU/[V{bq7L8Uq ү=%˶o}eTu4;M8QqYqqD R x~ *x8JƉ _ ëmR 7RcIJ4`?'r:#p5ri]PD_MqZ'Bͦ3M4L9UGVMn2܈Z ̀y?^q!SqߢCKH袟~w*!z EFIm n9.VyiFr:bB"| 1AKS\\Rغ !-UlV)E?n7҅mC\ Mpf>8ziUBTV*2銴579 8sm#OyLQ>c TlPءuZ jb L`Uޥr*]qVF*lU▉uq ,bKTƑWlJ&T#QCy2 P‡e*؝{ Ċث@Ǐ|*s߶vTgٚ ]fb$.aWb(Pj-+NG]޵=1Wc |8l c*aKDcNXl(vSָB~cxIObZ=FGo6*ثb͊6*vv6eE9bٱ@1U2qbN:1Ur8`VS \eӜu*pmM2Ȧ*9L w*0^*8 8 Uc6?Xq+ ; <{b79{VS/l ]Fk뗰Vf*H#l]V:oQU(@`z4 CJX6L!p_kTlđDf];6*إ_|UJ^ sb͊6*ثb͊]?5,#2 C^NJC-2An#EUjR)͊6*ثb͊6)ldZz'Fѫj_+vlPثW(Uَ*E,e_VP>CWo{S9/Xƛ&;')ZeTFEwK/RA[@+\mf"F QW)#OKĆu ў5>Iq^N?,(Xh?1[';4ArC, |U8*4YD:L ?O[nۧ?Z,4mܿpǁM*.1WҸ)+J⫁Ƒ( 9j[¾.O?!"*1&E|6ڠN^)n+\UٱKovq*.}XW+FӉ鑽/P} S)"|Y&h4bDN;?r[o#$%JR W .$<;"r J8~V}Ui{ŵ=p]B#QF=pFUNFrvyf!#M#]Ow\#!HweH˨8.RqWf8fK6vp`e[6*9Vb0+`UUٱK`b(⭃hOA_o|B5wpT}44 rK}Nk*2(Jt]dmWWp!r*81U6o/t‡VlU,(b1(XN91Bӎap+]pP1?4eG4-Ϡ_ JLj]E?7`o5(O]O&1a6q+7^P[t,@UGQg1c5n1P7|Vd ۘu\C|Y.LP<P<ɀ9c6B"4'l,P3PUClU.ԁ|0#1cS)H^XUPc4Re`VWfZW\P8d~ t/ϚIX/ :–XVqCclbb0+^*͊\qusblUͅ]\*\ \sPZX&Vl.`sVJ9?^F4Txȟ%dڀ vb+"LUaV˦*Chp*.0׾)WA8m*Qi- !k68aB|PR) <\mF6\@68X?N8 ӥqK"SnU].ءDK K@*j~ؖ%aA ]vlUٱWf]F*v˛Z- -\Pb哊OȪR卾x֩ƑWm)Fl vST9jpi$Vo╧\oJ1xQZUy?ߟ?' _OLt>!Vf6(vlUٱWf]#Zb[$[ Pڳ0 n~XusڎSLNթZ. g`)ݺ)8Zhi,&܎# cܼ\`֮+Pe>&dȷh{C⾞[օNw7$l.hV~MPS23}'8m2;ui-ݓa 2",,[~ (]`f]vlUٱWf]vad{,nnIi)^8Z^qTS5 ثb͊6*ثbן _58C _mC$(H؆SQ_PlUٱWf],.*9|0b#TXd٫\-2P1=1I$c8)UCińg%HR2Pvॵ%p3[,jƖ#V?Aȼk])<8mj&xmžtQ_BOm2PFhd> oO-I;Zʞ+Up8oM5OsVp E rrl Pgoڪ})PTP/P{UcJyUZ.Ejp\F=K-~GTK65Fr_sgJ%иiO%G%N {+S l¹O^QIjo/Xu_,kBh˯~ĭ,-"Q2rOaM녂{cJ*k]5(pLR9T7\UˮvWusv.PZ`b.) e)pAU;ravlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثbo*F/_GBg:\vlUٱWf]vlUٱWe18UXWf͊6*f*] ];6vjbZlUZqWeS 6vlUٰ`VlPœur­51Wef8`Wf—f].U*T^*\2WUxp#q`p^`b|gb+.~Ql lmWBq)-W2HR -G-bBΜ%aT#5@|3d2|R5&K0r-E5 9늮!S*ǫb2E\rLPWaS3zܜ(W-ql)WK@0V.7peY6 koE?A9̲v́\rCDe)u0S)N|9L~CmC):Xʒ}9L*[*ӚUٱWf]vlUٱWfZLU]\ثᕁ\w뗊f1[Er)*H*Cq-Nݲ}ipR*3cd(eV3%Ҧ=k!BIShM~gir+0T˼*a;ŽW} B[4[(2Tob–+*'(|NnXp\ ]LثfƕJ9\2U6u3bN*0]v@YT^jf7Ol6&3}5˦keNuYL:vEH߯|WWL \U1Jr ʦ*9W8Ui]\ 0Wx ])*S^)Z,2Y(]^r ~ llή@}"uB|p%{b=%j~f[*)! T0%#U, ":c^-Q\j?Ѱ@@!Q7Ʉ HR$¬~[ kl6RCSM1 d60>'6T*)8PeS_\0%V(u2V\ l dm2q!m8O}/OgRMckՂ*&͊[͊'6*eUa뗊W F^*aCyVbp+͊u3US(Kb* -C:>A'+"geO5vn%OsWqŊuc9SUDWVU5J\i90X\Uk51p!E 0Aol*`9Slk4*DGnqR*(@딨[S, @^]S#lHA=+*.zD'wU:v{exbx= Uh?:ԐݙN9`m EGP#Wpl!JvPX=E\o:adNVUQTQW 3銻(_| kN*r*ʻ]'\U|B.1/*Ǖ5]ƵWqKM-TL K SbQ-OLjWbjkא *s/{ۈ8v5 UzUؠ%\P܊O<1C (v8P%1CWf M7*a]w®z*ܸWeENv*+Wr0؅+Z ?M]c]MG!]kch)C]P8) U\hȫ!IGIp%d+CyWf]vlUٱWeQl 61[[*«yv͂ս) xLPW< A[-G\6–8D7. \qV_@إcS*1V8 تkUiǩªR }{b|{Ffj+o*{ i+4,SCV8rR>>umOQ!qi)`1q nm_OOՏ|f"?W6mSPPÎKi՘u>d14H4ZIfVt?l z5"'qC XƖ|SMoX4^_نqVܛjDl[]CG(%jOi y SڕW*Pz?LRː#\|&*#H; { |1t`˓KG.?pZi^U@QB+ 5*אٿ$sMV|#0>'*vWJ- أtmljҼ@N -B#iJja hʿIOFVnq7+叒܌  #rk30rG׍0o $1?}la'\Bj )lY{ ?~\M"BLAJĻ|?kh^Q҇1q(oN)镾* /)v7,]LR쮸͊ UҘhN=z«X~YsevlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثbo*F/_GBg:\vlUٱWf]vlUٱWf]vlUٱWf]f]v7 ]1Wf+bf]v^*ثG6*^*ثb]+ .٩51WebL*s]\]\]\bjbb1WeSo*rZ]0+LUF*SCb^*9\qKdc.. U~$h@ 2qq`+ VbmBZ r?W *qxZU H6JIh+Zcv( \ ǃ Lءa/)Shk%VcBr*lk7#T[ c]aUUbc4G򜭐@,|64r(hثYGRj *"F ׮K`B3V93xP S#,bcNH*Ә*vlUٱWf]vlUxTf*7Lai[HsB>ʋһ+Am~ủ 5i Ƀ/!Ca*K]~텷 H[&2[)v{o0RA[ϳ 1rqlx\/ >N0y+WDW_ Û=r`xʌHTKjVU kC(J-횘F]1B٩U-W6*U+8pn~0sVr @\]6_̬bizHd-m7zLTSe+p˖VP3\UebbƜ* Q]Ú]\]\pZƑ*qˊl}+!M@1ERpJY)#k VN- 6m=VGInv_sJ+Z訄trDRc˱˹qyd*=ВSOaBmc/zA t>#NūæNĘt|@8kg04y8R--+ OcAqc/n)1y.gJ_Hf#p-NðȪ}i,)R7”Ga\RUm+ r\jbLi«52*f]Uߘ{fF%d^pIou|Ғ)[>8PȴlUnlPf]\Unj p9VhثyG4rLU٩\Usb(J\RuW <|Џэ.= /SdٲQbf651C' 'kQZv K¹06Z1B϶80~x` !ZLJ28"Er)D7cq|#KL4Z\P`)EYڳзsoSCF,I*meƕU1V'+ƒ[dUҘSҨZ^-r\*mq%1JUT؛I\* I튢b6 aZ>4t=pb$4ĎE N5zN &qJ-b.ȕTTi*RLBw,ٵ8KR?hSQkcydQX}7 TũbxN m !>8sE1V(v-\A<\U`Ɓpp+8p:`Wccو#lRdِU٩|Pp4]\Fp8׀]+]2iL v6DmGMT},E[c>J/OL@`3~t@MݏnlUٱWf]vlRyy zrj04C}2Nz q;6*ثb͊6*dƈՊ:#pw$]vlUٱWf-CJKj y6,jyy}:ي쀷>li )n',}li7AN[nLOD.K"cmqHumrץ88MKbRJ/C )1)uI.nS3_a%otM@`#.{Ҋ?|m<rk/  bHA>,I8,!Sl`M:ux$UQ4u𣪤NNMyZO$\vLүTOsx↞mu |xU3>Qpa ;b58OR7t-qZe˪NcRljL4XԡaycB¬.$_QW0\:bgv7Rot0X8*EcR6^p} yytLOYƟ~JK9"N]cݏx> '|*XU@liUH=1UU_1VOJa}{4?e M Cᐔ`JL5F b xO?+P_0nF囻:I]4q?ĎKg ?Íe6GWdn2)Sik"ȝ*_ueX ):֮ b 7Ut)!32u͍w&py%5\Sk_@)u?*"i6B+մL]%6K\VRe{84IR4Up# ؃pz|3rb0RV2Uؙ7]!9kw*WheZOSrL!)LV tw $uxXܬ8VqoV cYұouHxT-#c1ئyWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb*J/_GBg:2H]*ͅ]6*ثb͊6*\U٫6*ث`Wef]t ء͊ZWe͊6*ثSvlUٱWf.͊vlUٱWf]vjbLU.XUn^v`1CSusSjx͊\bW.yDw 19Ep -[pR7q$+0ASlnh ^Tuȸ9}bpZq)J{ U߾E)|ڋ=@4ҁB۷2rEqV%EzhO[?3.ӯ:eRJAt5"9G(0ʩRU6"s`0o0i@ywԽO^ /ſj\~1+*5­s1ͅ[]*͊]:b&&P^+)wrVChˑ1n<3+.^Ý18(5Iy`*V8Llbkq«sb͊\⮮j\*lUxU~j⫆Q8qV\ oY8sTfe9*$Zx1V0UWiUcF)_O ۜ$p\Pi6L(Qg;lP/Ql*4צ f(Db-E낍xaa.]@&VZQ-$Bx !fuT20;6xj0;&,IӾ[Qw2x\Ov-Gؑ/k^ ^nr⭛lLVY}WbcLUmdW1LUp^^cLU v4Ō/x|R#QbKO݊vf\`nvI%dWw?pD)\GKVyőu܂5X.WT^XUj YSraWeKҸNKն!.H[CTٱWf]vlUٱWeQsr']تxYWwQcqmU3_.إ \\Ez: Z*N*vl ' SZ F*J*UUc ib0W61spe3S*4]BL"}#,OӇv#v_Vؚ**9i/O(klUYF$8 ]LN{u|X?X~$d/E%Km`kgb6P*Ƭ?L r= A;zvݿώ l$Tvnvҭl-j~*kƬ~+lPثbPMÏm0cH큱Sփ+7vlUٱWf]#zŇ8Z0Ra1C/;6*ثb͊6*da?0R-pwTlRaLU|l,[?X7oz}oo?n# sx[K~ 0Eh<ëB,oz!'˒i<ة4WbMqDK>=4"KsLOQ`@JJZ:E"L,!^V?y()5zP&S2cxUcMf! OsqU&mW ~Y.:~5@\:f5X-7UDžTrqޞ*3p1UtMMr~&uڥSyVĆA)'9m ##H8ҮյLVkҎOW_R¨/]BfB/eOtm)$n>'n{{mloMN0QjQFAҝ~)\,׾]p;ez8pfoa([|0_Q9 ?Ò O4#>2oXj`jÞt$0Qf4/g]EC1E|U$8.FX UV*Q}{+ͣ>N[,o1z~4648==+i?ւI1׍醜"U'ҿkR'ӾGu)R_ ~Ju~&l\Ԑk̈́V45;}>9"E?յv3`bTsĤs>O\x{]gnQe:"ux4\h-ZT!#o6/m[]mQlӑBVX]0O/t]%a&ˁ >;BTwɉj2pX'dj86* U[ ™eqW=WY";.EAo(TZ{_/_iY*+^,WFGdEҕ},M!žeH߲+VqdoRS;8ǚnCnDxuqSaNS|P8ӊLUUt88P\qUa\PqKGbǡKS,ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb*J/_GBg:ZlUٱWcpcv^;(Webf]vlUٱWf]vlUٱWcCbffWf͊Z9CYK*ثb͊6*ثb͊6*ثbbS3SvV(vlR*s]LU٩\bW.SusS:|p*(uqkw=sj"]eam7p6+bќRsB9x.>Q]z(-! g8CZby]-Cl.~IRCz8.ٹpƙ1U$b昪! Si] {iPF14AwqŒiQrو޿)]OśShs Ū)V&,-,4!%23ybӅ=\cޤ;.üTZxp`e UBUT$^*͊6*ث*ӛ.eSfW k!wM9=! 1iAW&蠌vSbKu qWe ,{fƒƼK aW,h}POG7! [k9O؞QԁSؒq݊==+\DU )G80W TW*8T}:x>,<@uL*]qVX8UN*r*ٮbqUi­W*+?3^zJv΂%ޜ~ 428rAk0vj}@CV ( ]\nnXc(UṕW pYWf*p8٩Z9ep+UƊT UNH+#`փH-^!u;ᯗ,8M#K||YIuv~QJUO |g%pNإ1Q-cӮ!VDI,HÖ"io3P/ K56BG55K,(6`)DӾQ*2=U9+`E++;(XW|4W5qUs ]qUr9lƆSGiX)4Q* إَ(lfVU ͊6vU1CS50+b́[XUvV*iJUx=6oQzDa3#'%d:%Uwp*UWngWqWD 51@$S Tf&\H,Ŷ1RE:bbT&\{N1ZRťjp 棦@`'IA!iEmd9I=%,N"# 3/n^䲯 Թ d'-*&G톚Lawc$V;iר%LЬ- c⫾s qW}X0kmi1UUA2.*Ap1U!d[cL0_Z8 *n cUrd!.D +h#3ҟ\ 즯l*ib WcхvU?vYVN1Wbt:b^4P XR[ITbqK{xbˡ`hvZ!|UُC Uك0Z U`Wu銻5}+a^VĞr?ث 4W Is[ȦsTb0LU䎦 ]dk`Wb ţ=i`Web:u— og!)?F\CTٱWf]vlUٱWeQs>kc**\iZ 7޸Uژ)S3`U)2қncVF*9]1W:|Ukz⭂)Z S*51WW0R= 0:Um8x\l (O;ҙ rތ ޭHSa.aZ-H:G6(vlUٱWf]vlU?cě s s'1뗊vlUٱKb3\)hc>[xwTQ+ɒ!& GlR"}&ak!A`tcI"6O&agbOb5"CF7 4J߬>ۙ_ R xh> QLks8R--*}_qT$ڂh?/ҙRؠJ|X V)uLK)c#$?+\: 喙% ¿W 䱁#7:~_~%E&x•HI3^mgJc[-< Vu~g—~=:UA/ kbmH."*Tx} Xv<}q+»\~ekF Zpym}i]>6h溶?AXY۞ 0^y&2j W~a7H'Hu?kO 5`T5ղU>͸!moK"ᵢyI}0嶼"kEaYGoWPO27O=.XW:2ؑv;#u ZT>5R4}"s>r:=nߕ oY?.O$ZW /.O ]?aC>a$UX(OɆm*_Rk[NBH.b={#:tLq6L% n o`F\wjU#>,QVY_LVGo[&qh#_/W|w3rM?R6 m9!d[I~4oqԆVjik $:AozF9`UU<_ߑ!Kyo9%>H{ƙ&ȳP͊e,[ˍ+z{Km4А8"~𯳭9F>,d;pkRmN?w? Y UMG[f9/4Tv$`Z.!S̈qwt"4IC&*S]W0w8զV(nXyg)k08]]\Sn,b9bhp…1._>czC6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb*J/_GBg:ZlUٱWcpcv^;(KWf]vlUٱWf]vX]0](UءٱKb͊/vlUٱWf]vlUٰ`W/vl*ٱWeSnchثY.˦)jCLRsSusS]1WW.Ujt]\v´CDrttr2t8֕csSA0 4y5 mU6 % :9|k D958\q}2QEΣ' Mf 𪯀62݈H91>$哋S*%q˥vՠ+"b}59Pd!mkPdF%f,ͪGw'+?2hQW +x]eb–Lծ*3Su3bbp++]L\ 3aWebȷfrPUžRS5|qWK(l ioӦ#up-i[pV4 wr ܳTD쬙ȷ "@RƙX9`fW o(V7 Q8pR f]pb́.\P­fpjcU1o8?FN*!v-f,I'v\ˑE)m caW(V'ryMbj01A sF7pV'%Lw%JXsMq^ݭ8yEg#~ ٞBݻb6T˚J}dP12qJZ],6)hsW$Uޞbr*\*\U8)S##alœyu=Hb`T+zءLثg,bxT\U2JPثCb.[́]\إusS5\b UqnQGdQzQIOy6>IdFoJb+c)U^a0חU6HQyN_L*WBq-(b[AkJ0+ ?Lmjp;#A\7WƑjS]DC뒪,n_[yN@s#HNfF"$ Hw;ދTUY>h*w_lńv0]5Ikf`9~ yfcYM1bYFLRE$]f2`WLUxdJE2bX&*E God\(*&0*&To_[c(;fup LmQ( +pU7i@)^vYJ8K5{a=0SXP c%LU|mL.(Ȱ2dNq\.ڝk\}DxUptkLr0+ի ]LAyRaZ9En#vU m[1K|PP/ ]]C]8oLUٖ=N*b | Q wI~)o(J Lv]˖bZxbcC-7@u튻) I—b|P]#*aWePvP52Iv9 S|U]v2ƽ*wS트x\2*l*9lV`WbN6w.4 1us)fqWW('a cՍix@UhB+;+8ũ¢q9'Z?h}9ʐ6*ثb͊6*1WeEMq 0\q<["1 \s\[LUeq<1J>9db(Xj xYG))llP NV*bU(r);morbq`k*?6« uʮ*^J%VH.dے~ӥ?gfmFw-CՑ![/$8#.*;r##RǻY+PPtɮ)VEW~iAnS?[傘R*7r+sSԏ+>uGSchᢏd:J-P! u'p2ic_g&J\?',!ʶw|1ѷWƤqlUثb͊6*ث57cčps 'J06 f]vlUٱWf]qi,%+Fs%< 2B06)xثLR㰩Op(P[~CEǜt[3J}$"0 qJ0heag.US'IXT\J ⿲+ynmBIYI*Vm#HQ@=Otڅ&9D|? :7!zKɎP| M* (~cҲiA7$jkf֛֤e 78ڸZdn놽 :Wqfm[bZwՆQ8-iU_ X>8Ws㍫kb Ƶyu?XO#L$Շ67QO [#K(f#q A햲=qd!kpH¨u&'(O^&WhGb2AM;{{nBo. X.r~Jwv(6jűGUu yx1O[B\y_Kՙh>̴uRM1K?0\7 ?x&).Z4߾_Jn+䴶Eʄ.FHKm[TC☩b#0nV, 3V!=H%,XUHU0w©EcnVZ&xcHPR~X_KsۍԎ#KbǦա_lKb :?搗?IDܦaPȳhPlRZ& Lƣ$7.'{a000*[?vE[[x%G2 p;9Nzo 싙#zJ}5'/< )luq ~_2#Ɨ6A!~[WpQ1V U͊ ث]<1V*[G(XsbO>cC6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb*J/_GBg:ZlUٱWeS7LU٫.͊6*ثb͊6*ث*PxbW51WfZ͊6*إxٱWf]vlUٱWf—W6*^v^*]vlULU(bˮ*V)v^*:D▫;50+j`KULU(ur▉j]\p\UҪj02mꏇ@qdU,cnOL9(r퀠lTt LJûF |@݊zsST(Idw8VISH;O>< M`J]1 ]Nj`V[ ,bP\2늩vj͊LU͊]vl†`W ?$97I5_xA(73=anGI,Xf[ Gl1UqXPc!H\V嗊V8+-Uuf#Jcqd1㎽qr WtS %Pآ]@-K-0B|#$P)8ۉf`'\w ?1&w[[vUCx\uKs)>e%ۮnXWLUFL*؏dW4.*&W bh_,Ue[ϊ DX~B@t}'zýfu`+RǼvd-e^7"׉d)Tx\Dzx T`6$6X{F=*%h1\ nN@:#l;T₴ u:$ʒqc!q!uF̍wrUMukʆ#Re$Wa LJC^qE:$ӿ*{ƙ\U»b̭}9UӮS >Xh;N=K—cslN(vSRc8ِPS*wJaKz.(v*8ur0`C ]\qBzdmW)'Kb\G)o/Iv2ńa#Z'! pP)LU8D>#N@ƴ\Uob5~xĚbeljПqCxbƻޝ:bWFR#$_}9п6*ثb͊6*1Wk-lbH24W+\⮦XnXi銭ۮYZbo"NbJ[#lpa]] o]+[}o {m •O|q8m2VYt[RNcUv«v閻}ثMLOA\-CVkl|1VIZz/! {.njJݱ),K-5a -=k Q?"7ґƢ|>mV >vasYjd:FooI| OOo=ai(Kx)u?7S 4I86Wi+4v"I=GP߼Xy<ָsbf]vlUٱWf]?0U%a R戄d܇XyVb͊7*'qs,Pڂۨ'o0jxWXdwg,!DXW&JSھy%,6o\iBѩW i5y?+οdž4GޔCv4I|د ~=|y8OUZo^ѹE(?V/mK$nRK 7j =BNEH9ٺ#ژU$=:bTv ?l5iz1H{!Krr-d`bm!E= *^{ҩÛI8J2Mrckw~Yԝ-(*&0Ɋb[cJ3 UU<7+E58v(HUكq\qKo BE`*NWcb:Jz *Pv)o.GbR@1Kc[ژR>![КW WnUpR)v[np+UPxPM)uqg*c(vgƘqC*zp+XR\ [wlR#%kӑ\ b͊6*ثb^q|2&ʯlUeb O)q5F91 cQZ#Wr?F(lTf mHB*8¸OCVM8 Uqk :`$qV{eSo(U3Q\v9MsZ"2 #:IV5,SHB#K0Be|G`6%(M0$&\i3sgy$qr;*'_k 06UMZ"wS__o2 ,?ڑ'?朋`y ^vNE-c [NT[(⫆Ga'#OoFUjYVb͊6*ثbȦ ׬l!_PWO$Ւ5ŵ \8ܩhc_1A5tupo:iW4UL8°s҃u+]:̄۔ƃQzO뷀^+D[ꥏ[By,zi5lW{5h6dPhzkWB%i9cR:d ȲDz:m6;me0-.c4R!mrLm %( *n,4TdXUL &W >ZWit`v)Ye>fy\r@&:LjqUڵQbvVMmEHEik(jGv"SZiCɵvA!Uyqߋ_,!XBQG@1UN#֭S2J`y{Ӈ ccBymLU0\UP⭂2㊺aWW6+LUԮ5qB)h}1VS!W n9&P6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb*J/_GBg:ZlUٱWf]vV* ]6*ثb͊6*v;6*.ŋYVaWf]vl vlUcvlUٱWf]6*UٱWeUثWff/;1–q fŐvXV/:*81U jt]\ثY`b8bNX-p kLR`U7l^5(CI%0E85yTtRij7_D3Ru0[_֪|1sc1$Oaj00$ob0lv>9@dK?^i>N-SYt8|R7TC" ,׾\!]aɶ%{`I*EAP /Zd؁]6*m-Gy&ط§-!h=R{71L+W1膖3-z?~(1X#+pڹ 5A2ONۮ_ahO8}(LWcfʔZft鋜S5phU1V`Cbf]vlUٱWf®8UثLrqS y SF~.n!=ՐObW:2ydo0 (T9Vbfvj`V.qurb)e]ePALi[51Wz bbW\3_%~YtXTM(s"֙t$F[-rEQ(qC,ڤr)VI\,Gڈwm{ W) @Km$[8-#ϒ(1늮qJ8pWq VhRlUCX8Ui',gzUoǾ<аMJkanevs/hYTJ7V0Z@ |GrJ]j/? ၇m/tI(P-LT*„#ƃƸgYzUMy K-mutC&Ajhgj;aAzCx5ykwF} rEE)h*'aJ*7wLUSncZN:P+md#W,þU1JPew!:*F.J|>/ryc V)*j)u3aWS,bjYXcvjC6*f;+[xw&1?VHsU{*O#09t!'H,Vr銴N^XsboRؔ;&cqV)\4U120* ./o$=IYn<1u!F,PqC&`"`y$LJ>(3 |+6YL4/e17S$QB_pԭ?2|K Wl&癍I!{cKb\P.&_ @IW1UrLUsz\F<>-#/)kbءqUbg⯍ 1H-탠m߄6IrhqJ;#lW7«@"8m650D!PqAR9 =ıH+kSӾl*7*7۳|z[ݺUkOaj8]k#Sz9zB\|Z]Ǩ[ϯjC=v hd]ʇa]U$F MyLM9F8Ge 0!J$3!:aKn |CsP}𫲚AǙ2IvTN$x)n;Fq〡R)"$Pf8U=bǴn'VU0|US]*Y*{•-X:p+Y[Q.C@WcMv8.aV(kb1Wb&uozn1Wcք`Wc4],*܁`We6ۮ*M߁2P*/%g%??FIqCTٱWf]vlUٱWeQtZĒcDUeA_ UMݎ;WЍl+ZݍOLvqU=)WmU*v=Uc-Q05rITLzU1:eErwBWCL+ [a_t|V* [,I;b@%f%o ML$yOHEfiО ԟqE@3$|R}e?ɭ"Q@cVOpÖj}`Q\IUB+WS6(vlRG>0Vt?$sbb͊6*ثHFoCN-ca2D_Ngn#?H4HDiBեvL>X(?sAě 3y(<1&нSi^hקhc]e%>;Vv?mD5h? -tkKcXaHW t݉%B:mm[Z.Ŷ+m5g~a"чӄ"\u7Â<"w1! 쥨R\8KM6I4qoLPkXҡWR7\UF[@+KJ {W/pY>3 tY#s2*o1M?YPLߺF{,f}5:BUJQօLg*XwU_T//KoKHr^ OĠ͢o[2 &+>u>JxTYXy3J>!VMR#(ӅW(Uazb+i1UE2,JwTgDC5[T mI[lPثyVb͊#[T,#̫d5 ثb͊6*ثbȇFuZ YV=x܅͊vlUٱWf]vy"\mOľx)_ÆvlUٱWf]n׈J6v]ˏy1 -)]?SKrVF-{d[ ;G6 HݫЧpڨIfzU 6M FNCC|W RJIw~o~)5"T0 i^ O, Vx0*PӐX&Wa$D@}{Ӏ/lգ6*;T;+x~/7 @ nkcO'!AI6g-k^{zOq0.֢86U(gvw>uI_ZLWtK!#>%I]b,kT1U`VUT]o.UXn4R81UZbkJ`Vz(qs(M3b͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb*J/_GBg:ZlUٱWf]vlUG ]6*ثb͊.!ٱWeW6(k6*UٱWf].qWf]vlU٫6*ثaKbUٰ`WeRlUٱCRf(v]1V˦,X r銻,`Vn:Yx Ubh*-kT]T`.A4) ~e)G121RI愣ѡϧ b?z?Oק.ާ n{Q ;/0+w!VH0I Ʈ:.bn-72FvP|^dj[C mR̓arb0QWM', `9_;]͊/v)kO*ŸiĚ k=tKdXzuڄ1Rjcʦ:@km:;x&8.-KN1$!OL;GXxr@K䵥Gҝב_3ASkvF? }=W]E1|C*ӛ lUٱWf]vlUٰb8\r5n!!w&e:l?V4FJ"Xa7XyYύ1|P8rCR)ʮ*f-/4FlPc[a] l eUpƜ[[UqJ1@WC;;Mss>=TdDb۬lQ#w $啊/|oqVOG!Uh5bdo wekAJhr U H9sn};$Qw֘.j]")$OL?֭~q9DBo9x 9EqK`HWҷ\1Wʦ)\ r51Wf;, )hv*( lH«SN^}ZݤB2 жՙSާ#: ^˙HN5Kkn@EM阅OS qPjP # %;9vx={VxZ)wD[pz43NEkme7 =ze*ؘ,ʦ*V^*1WWsQD`J1U|K~9/-S|29ykÐr$xflUxG(Wf]hfULUnV*ثLUxR(  :{Y(TN?ׄ.$2/0[ f:XlUuVS 61@F.RLaZdi(c*L T LqV\QFiI S(rg) $LSHһb&DHR2<ү(MgO2'jn실Pbnrak*"'^#1ͅ[ٯn4@l|nd2|!Jwo aJcRtN gW+Lx\L*.7*\V雖)u2`CDcV㹜Ue1Wq-[qAևmcLJoJvqjpXv\(*[W4G)H^/ U܀ţBA=$}]ݷ8kq, oVɁY(=cmi]#kj9zҿV{(N$cvn R۱uNkEGїBr$P vB=j10BqOMkA$?k(nUjv(U5Z2UnV1ɰ|hWl]v`p+*ې)*:*clvSMK1&5PxI۸[8%NզpXƄ`Kcnhx>%8n:c e+Z&eL[j]#|UMS u5-(1C+:veKY +]+ΕژB∁ ،*h0*aU~]hC^v#zV]LMp+è.VUNJ o0| jFFvSQ;bkJ2#9Rf]vlUٱWf]F*ܮ䙱۝KtӶH*i^|UkMJ>:`W/&*UN8U-+jz7 ˧i-Ft*0!܎h:wmZQRe↉cl oB?y۶)}0rm^omBpvmJ@_??eb, y?Dw/S kCl$-+-+N!bI$_W+FD Ցm=,;r%UbgUlUٱCbdy`q? __HF%#^rƃ8Ҵ17>|.c۝տ_ٯ6lծSR+ufCH++|?ˇ1B|F$i&[PC0h<@[}{ u)yRjڵVb5PHHDqc-Oo7bPi-^u#1_#.1/ }U}O;r4}1 ,$$[¡#P:* @{b[qx yVB]_a bWᎾ$}@צ[1F UjN&鍪പT mvGo7 'Kp]W_Ւ, 3b͊6*ثb͊#@^Ss*t#&}Tx "KX.-gQ?vQ,D!s|I 6BUMFVr]q9Vԏ75*,p+|LUS*ـ\N8 Uij UP4[rN)ƽ:R%AjXcԪoQ=Vt Qkj|L23+Bp rO:2M!Pl$ZnpP9xߖts1vM4ͯ8.c&e6zᾯ]Hq`8e&ͭxƧ25yxfbN$ۓOjlKBu?NJ+;$2Y#%B02FV*)ʸ!R26*p]%ƐF*;(SdLpl*UqUs[N)_LUv%d[#ytUQUÑHc(XsaV`Wث1VWZc`1VYG0‡eK ثb͊0M^P8$y*aDg#22rC!F"T@sb6)[L*ewLثLUxjcHȪLq6"ը++ ę\Nfs/LUjn\SHL,1@; d Uu\9 'у-kCĔQzw_-%59wNtUi |?p$(+P3!ݱOg$x2\$۳%-)4Ux \$͊fWW-[^9^n~($i9LUszpz(<ʜ ,niK(-uP&_cM5gmX\%yqkbU 2bwQwuܘ(zXǼ`.kRZc'q'. eI奩 !Sb1qT\tĸROLގ.vjES5oZ8ZƵ@633ro\qTSk +e ?̟#%qK[*Bثb͊6*ثר\zgzj~9&ƭ0(|Z/S栦?F;jpG@8=*OlL*,JDt'-CTClTWzt-\銶W|˸5\Ă)bR\luocS!:Jz7 7ŚV)ɟ#SRuha$@8ۑ}o<ӈYg4hGOe؏L"Q@6v%嘻|':H~?%h$G<ڿOP>f1b~eq20%x9XثYqWTd^+qfF`5'ӇQآbsIkP|­]0x[C G+CO ò=MC/͸">5Y=nSS)=摇V^Vb % xB }Rj}|}Eb I֘)b U=0Q L~MrCQ;-l㹩'[Zmv5=,ig/ƕhHcUj\*]8B=:4a =J4Xq:+-jV8E>?𜱵TS԰Eξs0QTqGj(Z6M5oOY8ƿ% -էR O$+y'g˶jKyaLaVuji^B\ב4轰1)ΧܫZD D?p[Nz`m%|LLmتہ 01•͊wr?Bx;iZ⍾ȱö#m q&bzm @Wf-f͊6)vG^^`ZͿz5 Oh|ثb͊6*ثb׮Gf[M,ԯ'+ ء;6*ثb͊6*+kIO͸C^NH#F#$v!Q69q\Uثb͊6*ثOW&>c'Zr; %9*}3P͊6*إaI\H1! *&Kԧ**-d#bI}BB9f$#+K<욌t5v[Ì˶/܊C%tAϧ$OO:,3bwT4S4.cwq4vd>TZxf@Z£i&j}&X[Z^J=XYi,_\xdu evF{G%1O,8} Q@H!U|8Ah7 ;j m[fK5`^^YIlhc9ZYPp{Cld-XE-9Iʥ'n0+5. h)|/+w'.G`)兮)_c *ű\Fc8DX^j!S%&Uʮ8A L~]qKYWeW7L-X銺XZQR>x8 C1Msb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثbo*F/_GT9в䠩ثb͊6*bf**ث]v^;,b͊sbfͅ]v^6*إٱWf͊6*ثbf銻/*ثbU/va\6*ثZ^4sSur-i`Jء1KLR8 I˦hIL*_ 8.)Z_+K&.7PŶ9*#/VQ0+LrrqFz !\ƕi$턞so?a~ H{3ۜNXc ]];/PInqY>joS\&LgR&ր[O8o(h yי-|6TAGJ{~)`+%)=^m"8{]^{qƼiqly[o0RA0/Í]<'R~xZIa-Ge%:IFMVD( =#GV mZ]\ثb͊ + 2vl m\r?曺N/NڗxF7V;|9e{*7'X(RW*6*] [l *Vo*V)]\]\ҺWVһ`07N-21 ΁lV3+ 醚mg(=V֚W ?y]7)ozp%p+{%DQqTF(jKx.>8~FB˴£ PO$}~%G,^ux2J~"NDT4-7燖Â|;&$*[I!ji:bQltR;o倚Ul~J$=I8p0"dUg 䩉K.@Ol/+ݛZY{{Owtx>Ѡ]:_9mƔ|_2Mi 뗆{Nb/.ƿ,/\%G:t@z^ wRQ;P~R1}]`,]iO윱wHS:tN;Q0V ^3C%^qUTQS2 *D窷ݘ\GW=uSLxB1Qh^qcPr@U60T!H?]eOTmBN bHÃ*xeT3@:x4O9 4s}f?)])_0wfCe}n!C>~~쯮CG!oa04+w軓7cPw?~쿯BlcUї?f#<%[s:=%xJ]"aA*v_?`*#vowۏ}ٿHKMܟ[S]N$a N΄( pG"/'550󌣀ƝR~ǀC!:cUp.Wlx ̓@7U':'\+:pxEWqy\U\x͖ӗpxe+'f=J?o6Z?|"D&"ěv)T]&@kQLhM߇EWbGΟƥḳkf d2iu7 Ůe# g)O!.Mj%&c:SΣi8\]H&15PLSU2Io)7(v.Ocb2NRoՍ>5^⮥s!<`WS7}$a|*rQA[8pR;,ʩ;.$;F"/cb7$} c!2JcJ *i~F1Kcv]mR+HZɩ/6®Z8ٝ8:bOVmZ4W i[$þ(oX1KYt[)QC\kB(1V뎧|UAxG*W.7kB1V`WW)Ev]br]'r2W~r+!~lUٱWf]vlUkb9ĕ9e60߾Qm+a{gT4ZJN4{ei+W|UǏ)b7KAF\ N)kN)LLd|7nMڀPY#f"nLòR3iL CϧjӉXW˺KMO2ClVI"ߡ <|"z€SO.6m-7rHYS#SMM㈓cT,o毆[BƕȪ? SUqՒJy#Iz>ژZien$⶛Cemm$( be/3\ↅ {`NinN FX ?i^F畍|]cHF.sW@ßPC\6*ںF@0Z1 Uߕ?-qꊺ,`lC͊6*ثbf[A5JG?؇lU͊qWW51WW5*5*p!]eXYOú jҌĠϣ4jqnQ 2v~?hmLH19F{x{ŲZD[v2^_Pۢ[By,SO6V65dezŀR>$Pim"U#+ZI'>JId=?ٯ`k[Ҕ taO Ywh8zޜ,o`>1RՈFmS $oyKdz&M\KW(o0\r늵XUUثt])kq7C(kMb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثbo*F/_GB9в䠲VjeKb͊6*UXRث*Uـ]͊sbaWf]bf]6*ءٱWeWv]qWf.qWfv]qWfY*͊Z9c51We͊s]`Wv*xDR8Z eR9u-c (hRpa81J8;QLPZ`XE10%i8aU㩁V銻 aUD  2`jbuL R|#e$'K_9fxlRi8XٱWf]]^]fu呖#˔v^1A`9aB f9 ` J iK"u In7+L;E,; GߒCo*2uqt巎aI ҪE;yF-2Txzoȿ ÐY&{byERqHGmum扡<.~ܪ>_O?x?~k6?e •-. C\ B ևc6*ثc6* 3b͊('[ !w۶#zl˪e Ka1CĽ3V5s9B0*s`KVbS5rIvUqnX[jC\U]vV)usb6**]\U{岅=GL Z,ӈwȦl#dHVC{pmd̀6LĴyXdol إcp+`eW|mW;኶ ;c v^-+J2+cڼ.a/ _e(ҖQ?.InKf>^i4G!.,F $!HB^0R2c䂭2f㒥X^; ^r/+4̼qS"OQï/VHmʲJЕk7ެ1p̥wo#51hҘB*5`BSrgO0J(+#ђTΏ9 r䡦aMXpZ[ 5]EyA'En娵jy|9}ܬZl}ѬKG[~h2F,+n7x4اb يqcn8Xݷf Uh?c<,yych?8_V3蘝֊!ʴ2ZnXS`,#~o gʼTc)С(yW4'oyc!0?8=[ȕ)7g|U[(S|σV)Ʒ[P/80V_3EنDïFp_-\1CHEs؏1W ^/|IuO%paěʗG`'.e+IEzw.SD\` *M8De kwϕgb~0 u4a݁yZ>_(2wRr(r:'q~X͔,iǵY =J ;-"Woc+`blW3bSKA+ĚLR13.)u1*ez;+=Zv_Ӳĸ p:u1܉$n[&Jv=~UޮwPWc|TygU/aIac]uņW%l`TxW%-mU|:%:P P@E8%*yRO W"Po  vp+X䧘ܓ {llUقW*E/W J8$81-eАIҴ q|U+Nl?e 1UZr :Sӆ:eOQ>r2߈]8끕^l-v !32`0΄2䠳aWf]6*Uَ+ /v^;6*Uk6*UxٱWe]6*ثb͊bf]vlUٱWe⮮^) (bc*ءk,bWeW8)Zr)h0YtWk/*e! M{t8mazGp(|rK1{d+X5|Q C)qQN ǁBƪ=^Y[v8ʢ4_^îEt[3sVPX4_\}Vnm{Af76,BU$0f(36*_T$ҕ;w=+Nk2LKh@FC-F, c [#eKwt+q)퀼2-Qԟnǻ%}ef=#J%^\ЦFT5h3x`V=z̧4U"8*ępeؙ(4 F8UiZ 4y`DyQ6­/*Tf?r>yn>hN<1/ D7aR`aV⅕͊6q«)bpUٱWc%ثc(aCKbf\sbaWV4l5G"kO0Dj\}vNHO<+jO&b/LRV7\ث͊Zc1BcUcJ"5 %~y盍1K k ",jz`*w>&>K>kt1^L.y d[N/MʐqCO !.΃x/f (JfLj(s#݄~{F9}\fSZt[8 Mژ.y;J04%`voi0%av4˅.p+ĸLPp|*pz >o2nR7 nQ8A]2;Tb64"ppkw1e C=Qi,\'U%$ꛓ,*,e5ƥ x,+GjNkOQ܉ CV니dJv֠Pk>|UEʅb7 ׾]>kg (qK߷^8:SA9l{We+bc#CJ h➧n$ى]بpru-rA­x\3qCvPQJ.v4"|Pᔍ7nCV(Nإ)hr:w(8Ad2 N2:*Z1dj1CLu1W kPV|Wc‘^GveS*zVSWf,Ut*YP1VNb?1We04 ffbC{W_9?O㑗%h}O+BlUٱWf]vlUkb9݂-mbc+zc\ 6L*s߮]F1[6-!˾Z*V>*18VM)Q6'oW=j:`UJS`@p! ~-E0*5PӦ%KwZŭG~RM;}`i+zUF}iH ١_DNm8#7wUaVF؛ PHqJ.#oZك Ma4˧ ?a 6(#Sie獧qBtħjGrpZx߬{1u枦E^6׮'J d_鍦XJ AE|1JIY\=7X^_A?Z̫\dblPlUٱWf]vlRGe<|hO釣_+9"vlUٱWf]vlUAVO sw6!bf]vlUٱWf]fa eRQ4 cTb͊6*ثb:y18^ jTMrS vlUٱWf]vc]7;̼-cDKI8UOPwءqyfo&iDk5},@ſ[bˆT2/ ۂ|nOxo(4 ~Y y ?IU 2`fޕb#$$qC?_v$"^CU)&A$+iHd Ȯ7r|1-t߾\M$ۗ}Î С-?CkX_d;B)5$S J[6޴9SlFKGY:uƙ%zj .#J %{[Oby֍U5 EoR/~ ?cGѕ?rMEZN'& vō⡮)-mMqCq"V(o6*blRsS -:E 7CCMsb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثbo*F/_GB9ІZl*ثb!ٰ`Wf8٩]0+bfZ]k6*Uu\UxWeaCW/6*ثb͊]\ثb͊.,blU6(hU*]\ hp]1KG\*.1Jӏiq1J8TQ*m.تb=NlUXN* LF*ڠm U7qW0op*ڂlTqwv,wdO ?SaܙGMˮ@r.k)!ٱWf]vjW9Ίڥ Br[dz΢`6NيlUۛUrbX ٱWS50R>=t^LȆ ) ;(YAܤ%Y\W#jW5rHZFlRs U뀫Xg|Ua*S0[V(C! a]v[!0&B ,Mc_xT-BqzW־eu? 1K!pY Kn4Q{`*7*J UـǶ2-;,0v\;a\a-L6NCe)nvde0+TeUHo.Wvl*VvxLU8—o+cWeU6o6LUbwbi 1/uQ.ջʑQp#MdW^0c]qWeRXp8U2W]p+*ciWF*st­jVaq}Ǹƒ8 YmsRxd!QF(Y8LLIKuVpx~ ?>u0_%5ƌGجR(>9+Itt¹ˏN3TazV1Ai7셴u?iAŜnLjFg LC^1UzRrLJj(B &9#K*F7N1amJ|oWez>n3yV0V CAoafdt%\k%@Rc FT&Fi|E9lFqJƱªJ('0s[cLUL{flU2br.)(I6'Q%r늭*{eU^kVW* Lp+L:ج#;L|x=H8˯.K"̇?^Wl,|U+Ͷn*ܬULZl b˦* jc+8▲CuLRlkF3c橗n؜).W. 渼$f+&3S\aWW.+LAK *ƶUmJ)1&EF`JⅥ+iHX}% Op7lqwA:x% 0ݏlˮA$SWlUr]vf_7* >y,d$>vPaX Nԡ/T5l%)WLs֟ЌkKiqI&, $E 4ؑrqWcK`Kb 0|V;$.N(.ÅoR2nl&*v.nn\zF1%$)oJ8Vn1hdu4ŔrhaF˒Y>}KI!ēV52qz*m[|\IZXFTJaz}ءq8Ik_MGNo.Hk'a!u?g%mkDHm1(OŤ?)L|Њ$h⿫IfWkA@~mW#֞d/f2EOO,7LB}m/E8D/kI%[_pkrjr60T*Sck㍪>c|m XSN),;yMmKxFltrO\El)}~aLJр rJrrxL aAaE-%-\n??Oxi*-;fxKd=o\½q^*ثb͊6*ث͛?X˒Ŵ1prV (9#/Lv#!'QE!1ZGdjU3"%5L[b9<5$$wʐ?/ORJxNH/2Jz|jyt/ G_-|9d#Yoߩ N|B+IZ3AE :Њ4{1H/u?4=>+4m y1jw=֟4RM/O6 mQumw]ْ/8:xL(va?WL AnY@54 bLU͊-z)s}(kMb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثbo*F/_GB9в䠳b]1V]1WeCbͅ]٩/vlR͊͊,bLU٩6*ثaWeP`KLR*aVbٰ+YxbثWeV*lUck11KWeFXVWpqbI Ui8V.)9FMUNF cULk$*.S;S$jFmLUMj'|(_+]N"J9jC2Kc6ee~L&2lثb͊{Yi+d`jgWt(/ju9eedXF-3bLثr@Jvȝ:?p;fDVE+ K0;Lcc=r\M3S ӕL*e, Ui eƕWehծ PJeLTU<ׄ>Z?[!זKmv)> ~w& $+amt*acRR˝hMc#2)@&jKgV"gysEW2ՠ`2kzHa)br9̇'b'|sS [VvlU]vl(vjbf]\UXUو[] 3W[j⭀07[ݷ9n0kɽr6]Ͼo+؅OY3.DKoTV\R3WnU[*3bo(8ᕊG ]LUr\`VF*scVcBi4KkFN-2@ռa揱ɌĖ++պԘdYA o 8A{^oݷQ4-%M(GFR{d8im,8YPP1h,qLygJ3&F2* E[!#;E ӱ&l v6®]U٫]S hOA$e2>.*@;l~Z;0fiToNA6%Ř늴FT*a5p ]\ G]\O>' \\1^cfJ67\|)r8qRٸ®ˠ-ĕp̔`H둴GQjˉ-H®/!­ HvqUnW|U7h;pp㊷"l*r=N*s8urKUևqǚUi\U ^ثg1V:v;curLU(F/^Z9D*ᔠLUUBveSAusqث`hث}^Prr䆇ND*f]vlUٱWf]F*&Lo %UіڣVO^Upt TlUw_1hiPV1i\CtڮI)F Nuǝ%``U5́ OlxrW `C',£$4=ʤZ W@O(ZܙGc;/mű/ءU7$Q툑.H^fR9h{ $S eB\jx6+hF)35YH;.q@CLcªNآ*#ʸIG\^(ZC-0* +e2Nu,hӋAkۅ me)K㻽<P n-*a]]L"zu'f&xKMڊvEqW6aowsY7%F8X0Lɵ~bBELҧ?^CU'Jǒxdp%H O\+k@:u2"m,&%%"֕SHōF2U/]_0qlO?aqa Io5y-dd^A28 X?k$,V"OMwÁiMxs7vri_Qv F gާ8< B8" ؓLUثu͊͊_bO>c_ͿM%KdvlUٱWf]vlRyDq|-Pꈻ).>lPثb͊6*إj"`>1.+Ǽ .>lUٱWf]vlUٱWd{?Eg0舶/!3b͊6*ثb͊ |@fc\N)uJSM\xG,RvlUٱWf]vlUa,~Zr>db6*ثb͊6*إ7U ̜=ԬŸY$ȶ(F<6(XW,vP @ږjBM$Zfhuja|}XHHv]X_Z`{_ 4[0i%RS;h~`YK}f*)퇔̄1 9R-PHbBWQrt! 5f1%F-R9~ثb9*!Lfwd Uڝܧo֡ Π *8'Pa,,É]ʓ(k9 G|ņk7eZޙ;?,.I[?6Mj\KG ޛj v V#$*{W#rT ;m%du4OJ}s[ZREƕ"BLk4Ƒpһ5r*́[9*rWUeS]6*ثD p8UMj`W)8ӊWmn,yp#ߎdOmy[0>+s+ v,+vl*lU,bHͅ S51Wjjثb-f®͊6*UƐ2|5H'- in}G1Y1?luqVUqCYubqWeaV`V1*x2)DS*W1VA눰'$Td)$c M V7j=`Ji"M+*ADczFBoS;-2k@Tw$e5dH@Qb.Ú TS4cEm x Z?9زXup#ɒUYK]H.\ck+6(vlUٱWf]vlRUc3lpCb4BsUOl vi"qWe®9~2prK11VLUo,O+®8 ʔWn4Sc(8R^bf u1 R4* U4T`CuǨ PbS/ k,(]5F(vPv4P3vWcFr)$ d'z—m$u]\u v88tZv.eH$P⮮:`AqCT—e㊸Wf ^ cw8U_lUwVo"u[9mSqb̦h㊷{bǥB*(*\OvQ+/v9Ԧ[*eFp.7Wv~O㐗$NE2*f]vlUٱWf]F*MX]hk7!\)pZ P+brA UqZzp*-FߧQ>8Һ1P~t p!cZ,i1K/Z(;8S,+m=i-z*֘j-pzhj*|FPJ%OWNqB&%F $+S%4iGF? iV {+ Gj⃎엮!H_II%<[esz7/)!uʾOP8BqT,`4Ku@Y׶:H,R#T]?e~mPD&Ӣa4_ZE}eIͧ]U֎?v?ԇnMyRHF!@my좘۱ċ8+U  #D*ٚN?؛8_ՉPy8kڪN7sUGARO^WR4^~H>,PM/6 pWwS4I?<7ޠ`/SK(m,`)_)žѮXy&ĭ' $EB(vV(vlUٱWb<78+/~)[rӐ+0ka,!R8{lUٱWf]vlUٱK/~|?'Z̢nl`lCf]vlUٱWf]vF/,$f]vlUٱWf]vFn,?)?qa>?H Pثb͊6*ثdKc>Jֿ Q\?mXrj~8ŒlUٱWf]vlUٱWdG^ݏfZ v6lUٱWf]vlUٱV=*4aJHȶ(x8i Ucc-8v+`aVر"7ڋ7N,N"m$GIn6Śh~Ŀxw-RD UɝhA~9zo;|LY"/ oܞA,(*&x^5rbdR}W!¯y[Gw6´*kZaWbUlRQ 2Q`uPkE%yc­s= ȯ ӈ6M3' D8gc%Z!@jpV3P6W?FHdEZk?0~ 큣VATKZ]n߸;_3m2>#+8R/2m7rm4?ޥ1\6V*j]%ٱCU(b!Xc6)lf~}[f}YO }~vfBY\6JN m\U2*3b6*ᕊ-\1 [] 5pˮ)k.%]LXYEo; lZאWȾ^\L x :f(XQ&ݎ8Pz]q6ۃC194x'5QŽArZ֧_oԦXZOj%y?4D YA_Jɵ1-5MI͊v́Zl*jlVbnk6*UX;/Zͅ]vl*p-DQbTʋVvBZ_lNHGyHcLNTW 5*a(⭌VƑ+J m+HQJi0Re_O9~4QJ R]zUtB0{`,:N֣9 ORX2'ɓ!H΋kmn1XlVNCU"?W(zDu~vBgK\q&zbZK&8n*Pثb͊6*ثb͊]vJSNH8Z#[\ 8j:v%%rp1eG|Uc-s<Ǯ*5F (q>jlcYGPv]PѺVM1We"k]5lcL"VEXnn#-Cr+`CxlU+`Wf qKTF;3G΄cD̝6TJVm-9n) S0TZ$! (7@V :,hqWe0 hwLUفqWc.(k 8X$U…O^0Q*ZCviP+PqVbv]\c튷*참;~*q7 [:늻+2F*RqWeO|UZb)1&!Oaܔ؋PxM+xMl:XΡo=?E4K*`JIYg%z 1AnAqc^=E j+_4E"OƤR؏qÐcQ dRǥyNʬOIPBkl4CMKZ~)+eYUJid|α}jA)T`?R3~$N?Y@nnu >o?e%/Fooåj8r*caJUqp6q*8])Z|˒:|ZYCOڟ`%!R ұ8 +_4~@;™<l/q]R?61a}ޅ7{u84ۻpcS V- R?`]&RԱ݉v$ igݍ}}(d47 (w,8\p>" ʼȳQ8|1V[͊6(vlU؅/ W'_xKFK%[Ϸ fvlUٱWf]vlREkw|'Z̢.llCf]vlUٱWf]vGֺ, ܿd5 ثb͊6*ثbȯ[G1^N1P!rU"ڇ3bf]vlUٱWf]^i~c.J&ؕ'\xpJYWf]vlUٱWf]'gfZq lثb͊6*ثUH8?ʀX?؏ג@╧01Xq88Ucv(Y|̛R8~foxQ}t''&Z SU?do,B[cĿydRXߘS EM+8mj^L,KNHԫ/m[?N-A|5>ēˑ(  "sV#(d(=) )+3 Ͷ*LUurZw=1W#.*ثY]*LUP jaWW-ZcgX&Wf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثbo*F/_GBg:\vlUUٱWeCG6*lUٱCbf]vjbLUxٱCb͊6)urVlU٩/vlUٱWf];6)vlPR͊/6*챊6)hh↳ Udb1V\ \2V뗊+NZUi ScÏQ *O *c|)X2*.X8lbXqU&\[04;B9 ֘z 펧݅V!Mb2*R:[X~eH&.c'́͊/hɾX܊AG_lǜ(u2>}rFw6C-/jAw6Pa W2IDQidWM>g| Aݘwjǔ~sRsb9W(za ƌ]v^haV*9p+dUٱV8׍8pՕT=I d:˱S~̲h+'ť=L}وT:ߗ\ 2XQG W ]yn cJG'EkԞ(vTvb] TH[ ]1Lg>{0U\UC~qV:؍V@FlbR0CŅk-A"8ܦvcD܎czUzQ X`bleIȔ}t®ݽ(v)Z CT8c;6 &E*waWyNo ;mqVBp r\wc]o58UF*r늵 7]RT57YIZ|bGusJ6 ;blUiW|U?v*qثYu] F*]J bh[ƿ1VRϊ⭌+N[E!.Hi~r#!W6*ثb͊6*1WiQS q޽1KfM\UOtqݎ*x`]+ߦoۮ97VVglUuXp{,{dX$+L*ؑz8m)RWulizq\~U#J[H⭠V]\n;S2\)sG"4 *T.Adt_J}*J jMP o /J?q,BoiF.f ŅcC,ǤKQTP RL3HƤ "`U)e1TTb?)ߩ+E*2DJ? yU޴l$ӈFy$ 4al^Wt|!~LWϙ.]> pc !ҰMZ'>v=F%c\Kq$_'[@1rFz#ىg+p3Giт忔mpD Pq|0`N(MVǨ^=~.qHW4aWW1ZwHV<Նt,fS7b);bTxUqV=6j w:Z?O ce2EhpGlUUvlPثb/FGr}MFKrU@jWf]vlUٱWfWKT7e>Y(؆͊6*ثb͊6)vGo)o6+'/rEG6*ثb͊6*ث'?H5EY amBCb͊6*ثb:"\!4uO(p6%Xs%,ثb͊6*ثbȏk˿lKT9n~] vlUٱWf]vlU~>`Ba`~jcd`lR.*⋁V6Ux~Ԏ,F %o!:¯sꕅkaC285+krJ( @aV\EVԌ 2TJW"cN\1qCd㺌RLaW] 2*⭜]q1,|ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثbo*F/_GBg:\LU٩/vj`VCSk51Wf]6*PثW6*ء͊]aVL ]51WW6*]ف]\إbeC銵 *hRqCb\Ux`V*^*Xq@1U.S8Toq늩< bj+ lq7V}Y]*8$cU3Q/$l~i fqUCf/tZD`I햛J &‡0T`(C-Iŋ\O|⫩hh.g->VӠns7 ,rzeEL٨:dP0\kaW Uf8AVƌ^*fUuZ*UeCX8dUٱWf‡Y+Jب 1eQY )c>-z*7R5_(uH]3`We6ͅ\}۶Duk9Td!+HP /<hMZ24םvT{aKt-)][^iug^^Ȝv[.jО'mu;{1z&$*Wqo`$u*58AW %w^]3bxqUKsLğ"eI+`fh)L76,JBu8⪔ͅ[U[Up+`eb\2cjqV㊶3bQy]v^*XZD=^Z[?h2qUV֗n":u^#R40 $aU6D1yd,kXM$U! 5:`„?xƂUcsukS{vD4N/ bpi)UKӭOlKAzW^/9_ ndTe_^',ޥ@^z~xrlR|\|*T͊1Uf+`VlUͅ#5qM:B9bF)\ 23Rs KW 'ri9ˑ3{SSp~Y-8ثYUlUU͊WbjCG+Z‡f*إ]vaqKa [q6с|6O*<cCULm]\0+YWf]ULusaK8qW *W iWzt*sSjtm^p(IY#(@QbJpܭ:o:5Ꙉ^噎NbGJɮa0KDwj7}fXO xAr7 Ug1&MQ8+vVvlUٱCb͊6*ثb͊6*쳊 tN-y94%wɒf7+R ()gh: LWZثX B3JĎ+."([T®Sbe ~$1V[#s]\Ov*1`7u튵\ҫ׾: pur0I &-J@ -,"I4C1Ku:KGG]jE<:aVe'e=qWRSMLUe트z#l\uG\*c*ᖢx\U;–)Z9heثx=V"W RbَxՊ0jDSur@[ʓ:vhtkle6]㊸}+bWl,/'KcfT[6*ثb͊6*1WhNZAeҸxǎpmbEEVlUx ­s tc )#qBwڬl6;UF>I~:4b, UM)cl)S &IBԌTqT1EGA\)S4#|ZBME+4(|(CȼNupĬ1I"־?alKtDPKCA_O$#tp+:{')\/;dNJWK&EP3ɵqb@?%N)ӻҰZg|U~U7sFqsGa :)IdK}b8?~Os!rʹ:;(G  RA7(o6E-bW0׫rQd,zȿe~o@b{ m[Vci^e;jǎƟ!#=KE2 KVe1ɖ#u#G$"[͊vlUؕЬ.Nd_7%uчX(]vlRثb8c"~Q$ps*?a2[vlUٱCb͊]7O0#3p?R?db8 ǩV #. 9s n\EIKTbfowvŕ­UXuۃ'$иaZ{w?Zzo-\&ѹ$ 4ڛHHe_xs7)`g! 27qWhIHp']6*\÷!W)5a)_ZFJm|UvU–fcN<1 29csW*ͱ8C7SLPQ`zaVL ru!x  7X2}VhG^@a5f⁃e|ҚZy)~A-JO!4LCNXVėeVZ>y{IXe[P? +Խ{d,E"; eB>h]vx{Je*+*U+\Uf*f*f­S.qWu\*3S4l \lUsS  Sݏ#.FtKR䬧RZl*[6)k6*eP^*죊] vl vX®\sbfͅ[aV͈Wavi]\0?flEDyU>u\,{lU1S5qWS1Zu2WY+S \–`k# F*5s.*4aFڸӷ\ ^[|.(m_%hM?ZZvԴG2S#WIsҟ(q9hBU%#l O z>̈;50&.Cb͊6*ثb͊6*ثb͊6*3ҷIū/&=rD"VeJ eS3-.bAZ'5(j1WWQߦثuG1†bN/hN*c Z'*qEPE{ Um tjH=5޸8m-۫Smn#f~UcAwĕu1m2z M&[ǝvP/|PWV[8jw鑵pƇZ=1v(Wjv]MV$XbEi(uq99*{7 OaV[u-VaCxc\i-Q銵\9do-eБ*p*짠\21We*981V® o[V2w-lezbӱ[v8UYoO㐗%.ONB*Wf]vlUٱWeQv-mbY*>9e82V"m58PkI2G\\hN}XTVlr-a Z hpJP\T\cE7  튶ĭEI55 9Pi;n+7Wz(^i\A \q{H0ZCGݽ)1Y}p8HGQSV˓b0%@53[2bqJ{\j&wOArJcQ&Pf##ӬdoVBLDN{?Z ǯmU> p,<+bd,(l)Itv3?qK-:=rv$li:<Ui޹7S0Wo\-`nQȔ4cs Cf q#P fb׮_FB~XLUn7$v%q 6R~ h> g:i*S GvGr__7'BZ쭍#wԩտ O?O^3~?<˨tO^#ܷя? M@ufXQQs> ZHeDFQ!Wp2QcOLpA=~6e?`|GOҏ1j}cH=~qtK';N/8|@oGoӋxz[hxs8ߋc{Ɣ.8$ݭpe,9Qִ5cFDMΈKHc? HҺ_cqܡ8͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثbo*F/_GBg:2HU⮮lUن*^*ثb͊6)vlPثbf͊]LثbZG.;6*إٰ+S5LʦLUٱKYc͊W50+U*s)jX5LR*njPj`VN< Ui9``UTMN9EqUq|Uhc@+ )XǾ*NkPp đ}*`4)(Xkq1[q9UHU G,NPDTdw϶-y2_%Wdmsie@㉤eD6f U?YY@4ޛxmhH+rvSd0ĥg"e **eWlثlU͛ ] , 31½V(6~BqJ83,zB8/ɼH#PvUO'zv*f\sbͅ]vlUٱKblP3VoIPUHt5BAWuyMc}'dT]~ gЯ,۔'e`akp8byRGB%S-4Ůmp>C KҮ!?gN7# %Hڤe5ǶE- Up8cppƜReUff]WS6u3b]\ثusb­u5[ilC}YJ\5A#S̢xB/ y6gD! ӢfR7qTI '|!voRSu~ZNax ɀib~nEALkX, n2cN؈ X!$B8 a<9vh .=j"tj8E)SVC(ħ;2Н[)\US*c51VSZM2V*u\ f*1\6銴Al lULU5q Vѩ*^|*\˯(+QQ,-㊭[/hZl*sSvjbLPUxrWf†lUإثQ808[>Zh#g%g'Qk$lUZ#6(k.—fS7,UF86 Vˮ(kht\*gh Ur;4®TM,=YdN% i6-R=Eq/)龙w?6j,_W%@Hb&S|G!mGc҃ }rTL+ɡW6*ثb͊6*ثb͊6*ثb͊iF"C^AL0{/?%cX&N5b[lp;oZ=Pv1Q↲WڻaV"銷-[zBk-↠jFZSfe8tKN'G R[[.ءa*z :8*EݓzT⭌f늸;jL (*ݲ]tb` %W$e{̤}4qV_w9 ⠐)VU~; WI[Hݰ+iZXl ㎦5ܺr \4lUTLUٖ劸;,o]ث| w[n=Kx8l 8(*m**^*酞ex_d9 rRc^T_6*ثb͊6*1W%{e4Tޝҿkv e9JF\jqW|e8hr-aN[el e:hZm &NWQJv#o)SV34x40^D(vn6);u8u5=d-@U4k?l,iV1ATiJצy 'b2bf.v; PN}VIfOa" @p͚w񬼘E=Ha&ar[IQQ {M6C72@# 0 ۼQA|tywE?hlˏɡgA6Y5w(*RcKgGVFXo>e泊ܚ"^?1?G>\b ƶOҨ$b~+qU{){w,Eq/OP^nOa>\,gRތW#oıATӏ C>!EJ-(Ce"F=bZdsՏߋ@b~|ZlUثbgQjy10^1bjbW*LRb.Yv;~"djjbLRm˦*Zʦ+mWJc%Bç?k@nxL/ P p=!j#| ˊ Hj^&e@|U1z6:u0MW4xI4 LkVצP\Uw.Z@w]ZzWmU4b5rInM-Tc*;8'U(3SMsu 1n|WWc{)`f]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb*J/_GBg:\L ͊͊6*챊6)vV*bf]vlRثbf]6(vlU,`KYc rWf́.ͅ]0+aKbeURP챁]Zͅ]0+G51VqWeS [ r.'51CGXN;* Kbp*=F*[1JlT-vL(X\8Q]U`K[L]8Fzo8k,mڙ}rJ2Wi~'r5-*8u"UbU# ?#pcswzfsDBEp2k/P ~#1IJY^vɂRĔU,8 bebDӮծ~l0YTN:}*[}?_ʍGOђ JqP%]2*ءxTͅZ9WlU͛5WUثEZtZ=+ |w/ڐn8BcZ=,YLSY%QHk>sc*Cvl*k0]vlUٰٱWeC- dWr7\Uԯ|w/ k\BI0Q q)Fn`a} Ƹ醨ZzdR|te Ub͊6*ثb^q艶[X8PRdz T;baI*M>Yj(kr Ӿ:B()w0\M72MraU$ =U@|rHrm+du尦?+)ZTl*\t~E, vonUMzǶe;"vA\0d1Q E*iŚ +DiJKMs0cһ(gQwWSxaSIdNe( 2 /%EhTvO8LM .[A߭=v0+>'c 1BlX=u:|Ch6uژM\2_IZŨǡ./ը zw9dsXX3U"|f_.EZF]J9bOr%ګMXa}0~#+ORlQͥIs#a_8 vUM nIn9^7]p\IiquϒT\JƼj "6`rMȳAnrb8ړ́ ' Li8`cK`JY)zuGrU_ 鑳;l܂d4l0֬2΂T[dHX;l1r0$_iTnz1K;'٤>'OGط@~7F#._, ؒ"GėkstH@OIp7>6L;qBc]AbAL6W*9rm+vlPثb͊6)vFC-oK\:.cI03C]vlUٱWf]"_1@<~ѨHy?%XWf]vlUٱWf]/?a yV]7?<d|CyWf]vlUٱWbw '(ߨr}X~+򉮗?bXÒJYWf]vlUٱWf]_*ZMÙD}L`lCf]vlUٱWf]o"RX9&"kKhȶi3"ks\/G][ 1ܘ9! XJ K6q\x_N_V/z :SȥU96H#UAT~p3AqbS@ҩ?$ 7J%J*6U+E?y?lRh ܮ9B%hXR_2|N~Qyu'SD(<81pjMr8ڊ f$|oaGqL*cO_ Rk1\4 {usqWW+|Pb`RƑ zb o^5@qKuF*N70Nb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb)J_GBgyi@+ vl v^*ءٱWf.͊6*UvlṔ]vlURثWehثWfvlUr]\­fWfZ9Web뚘-9xث˦*sS /8eZ',s#X7\ iE6((SfUT(w+%mP1UU˥p!b-!1Ju0cqC`b"|K)\ HڙHkClOP2qbSsT`ԓ]p@CQ u;jIC j7hj%,nM꽏vryA8!̅iP!u3Ƥr"cn ݕH RFtJD jvY@m]NZZ`㕥 +劺^*إP\iWq#m܌5!f?,5-jv's JQ5 CȫWVlevl 8 (vlUٰG6*f9­fռثT_JĎjT[ YUbNשB6 TV};?JԳ$xd1Rf]qV0\w8\NٰnX6)o(\jb9cXٰW6)usb6 _ i8?fjÜTr0XLhVf®͊6*ثb͊Z͊6*ثb́]vlU٩ +p8U݌,9-7 4R/jNjaVvlULq9ժ`bLmZ'/(V^)N9Umjm~0; -sy%FrB&Ɣ"^@G(q鐟sj \Ek-jSRPv­Jo㎧ o-64銭qQq" =VF(A#9hHTn(ԩNǧ7 /ƒ~eMYK<=jkJ/ P @"' fՑĿeF J}el4 A;W#p&Xҋ@2iXrO(/WCCߩ4gdm!4ic;SyNV}ZrETz_~S/! mMԓWݲ#vǸZ!&Ċu-k,KPJFxS\5-7r#UDyF@vaD 0?{LT8QS71V3A?p†U##I$HOpԷq8~N.lU2[5ɍCj+laΟAFiAP[-m9Xbfb?-R}`BL4#M~bWkR"_MiC갈Q>^L;Aڧ H-#N/+Zt;x1^۽>Xjjg~G6*ثb͊6*îϒ!t|eHAy_l`mC͊6*ثb͊[?G@j?R%?s`lB]vlUٱWf]vDxבe_Gk}ڄ] ]vlUٱWf]7![_>cW?bXÒXq%,ثb͊6*ث 1K'sxľGK06b͊6*ثb͊[Pd+>C%C"؆\Ri,8R!0JHè#jE &q]O7 Oi+nNT1?.!Vo#yʋ,bSp^h"'Jfz0U7ca>5FA"7N ~9dTUwoMIZt$re˃I/( H @<p*w2gKGxk *)bOª=qWPWlkxUrx㛥FEKC14]ثyC-W(ֿ,UevnkMtʥqVLk1 \ 1 ~G8T;͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb)J_GBgyrI~jb]Svjb͊6(vlRثWW+ v]0!٩\.jbbeZ9xo6*r]\bU͊\]\]\ZLRsaVLU˦(hk)usSk1†lRsSuqZ&|}+c1dI*.|LP `U"ܳ(ާ*;b ,r|Ǧت]qU0­jbS N*NNq+kDҿ3ቁ_ٺS MT11r֕bHze)PqR~0NE2[qIH2u9de'~$`aG#'hu$ W_7emrb`F&o&hO: jS1[ U>qg[yoe'*YqJk0#+A2c]rVeޘǭDjz`>cOSz~ي}j'5͊[́Z͊6vX_, f^*lmZ#6(klR[L5ra] xZS e+T"lT'W3$h+$ЀM13Vؐygw82*3/Ƨ0*JHw\UƕZͅ-6*`;0-]qVW cZ\Ufq͊cUc R[7dsPYn-da9nc?rRZfpǎPl|q&ȥ<C($2+G?Ďdb=IOD\b];6*ثb͊6*ثb͊6*ثǎvBK'!qS-Z6|j iVœZ\ru-c]*J 5zPb*b/A늮=p%v.…&_ƒert_`U'tJ F6yU@ʼn?o.6˄,726mkźqBqKC" x[S75ܷdKҴ?$5c_qUWf]vlUٱWb7~TN0ɂr{~%9*}aJWf]vlUٱWfF<)=}M%ߴ>Y'ڇ͊vlUٱWf]vEx#L=ԉV lثb͊6*ثbǝMd?>?㒆p6AvlUٱWf]v߅:?SɵKx?˃M,a}|ÌY)]vlUٱWf]vE|ra-pꈹ(}J6!b͊6*ثb͊]}5kL-CDɴ {`lCe qnjUinj\*!dQxãY%"ܬnyFtk!גʽOKrT=)@%:c-2?\ *x~!E| ߈98'9y>&S-x׳oA=6~|[xdJb.¬눰,O(W]Z>Uh9x8lkC8M42r4Jev`6P]\xCY]q¸ڶ1vjb\R̿h|W7Oʘ'yWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb)J_GBgyѲI~c2Cbf];6*ثb͊\r*^(vlUٱWf.9tZlusbjaKU˦*V#ur\N]1VZ'51VLULUsS Ze-)a',`WeRZS U .jaWWX)XN(KTSALi'}*,/sP S1b*­S5\w[+.7 AKˌq`BO*W,1޸‹eŅ $_N=RV- g Nf]QMƫ;*qF{򼒧eVsz*Qvĸҝ1=5סSX =S%@HUO,&|%Ron}LȩiNZmjTx^[bJ-W-1ZSo_Օ 3|P^ 8≁UE( mei8=1ܫvqpʖ{Џ՗e43&#&9\3 l*lUٱWe ثWc(hv^*U+e|m./5\Alrj*~7c|f@ke>rzK~`XƧ$'|PJ^**usSur\UٱWf]vX͊]=qV1]pk5^eNè̌a)j ]0GxFӑrʩ듖"!uRn(^2xp')AӭAƂ."D72CXy9XV٨|2dUq,z~@{NNTXxf/8Myx ˧#}kַt'ʌB[)c0wS_VIU |VWe͊6*xUc&am @^` |Xo?(?Ngr M WsDe@v)ҖfcՍpJ&4PNFظ㒤ZK독dCU}HB] ţE0AV̈iPcR+)bB(!%|@;BWN!VcTXv_lo^Z+2NSh08U+]yJwHd^q$<ۿ8ռFPyGP'1)lUx]\UkثBG\ 3S\l lثG50rU6vV*V21 ]ڣfT9!hrC^I!AUbw S6*]\ثU͊vlUٱKbͅ]usb͊3aWf\O[ G,/V/0)JH:fhcj2K]LPv[cJ2WS6)k,u2늺U],Uk.bqV(4p*L*`>geӟ-ZV/㗠#qOlW*uAL m׎B&Qdeݙ FyGvctMaO9)s5f1bf]vlUٱWf]vlUٱWf]vlR1d$5C*Wj.#Xcjɣ;aKXኸ 0ZeP*)\U#\bS:f{[1Dq9a@ZRq„ [N(vaJo;W)t0WLJ3*S*,[CM J˸aV) *KQ0ƭ&2k3 oVJG۶E[.!㊇aZ9J ɫX"ώ*b8u@G *E_W bphRXdL7Ŋ\pQbW6銴qqCC7u]6bʐl1V(#nÍp\Rs\2ybm% urv;8 RlU UdF*S_Ir䫐|CnTlثb͊6*ثר\zgxck CAh18?N9w-m@S [mS1R78R ~Ue{bҴzd{uV`1o_WjeZK\2]Vo [˥M{Jހj:픛3vXGP6 VQ > .WӎӮf1F8DY$YA(7:F'MO2>j7gol+[Pk/*OqZo4ZMYYb~m5>@Pt4XI=^ۼzQ :9 Tt警3@;}HQP1k, UiI/+=O^|8h >[X P!ֹ'.EjJ ?olL)Ҁx}ܛN(xsEJ&2SĒ|x~^CJ"T-TzGe9՛xedX1 W.Up%xU[u8+HPw|[؀2A]N-m#HZG'mw<%scby5 *ޭğiZGQC#J<3P,XD8V [ƓW i8vl*ByKoz1 ӑehT/: r;6*ثb͊6*i7BKkYb>%G cJo2Q͊6*ثb͊0dkckirE. ءثb͊6*إ0 QXƹ"أvlUٱWf]vlUz_0"Y%=N8;6*ثb͊6* WOby6iK9p%?VO6*ثb͊6*죊[yz-PU~db6*ثb͊6*إӅ5Ŀ/F"$~$xVp8bq+e-+4«+kcmr90Y?<'Y$UI$ #96beVt#2C %'cO mYn4TVSuF>M[P&vmoG˻R|IojoPR~ (z~ @*-ڴb S|U_\A 4K\PPqKt4C}s & kFڝU-횵Ȕ7LBJW]Lwo vaZ')BVM)ȪsWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثbÏ)J_GBgyѩ.86o6*ٱWf];6)v;5p͊/k6*إLo51KaVqVثb8Z9xG+v]1KSv^(usbW*J△Sv]1WeҘYxUTb)jtZ9W *N;'S-((Rs.*`WZ*[۩.*9e47'.Uo-310 ?,o| 5*6銹9.h48JѾP;\QQP btme5v$C| Fu-P#ɷiPC.9͸-r.C",zDv.;L*nql*j/mH+A2C!J2V~Ysjy[5G\21k088ר8衵={dP>@TliimBPwYVHKMg|E4r2JX2$o18Y[9XUث6v8`CG5p!U]v^(vVq•Npn :V2C(`)JXۋxV1ۮcj'3L׶/Tr5LUeZ ٫]6*ثb]C Uӊ[|*F۠VC1:Av́\v ePA93[‘|'ucsg2)Z2*rUcX`Ue6%W  6n  |kuV`Bῖ1 S?rQj /9NHT9~|?\X 6Gg{MZ$9!xX*lu劻/51WӉmPRV!Jz7Kdo/M k<sNĔ[h+4҇4r컶lyAoYlj8,F2\kyzUW-pd;⋅P >8% ON ?x1LJ r+q=\Bch'JyTϦҥ _l|Ꮟ*rȕ\QL*ͅVثb*2bUsbI͊NlUlVvG5?/ɇ$20_R9Du(}{ _">l*9]\usbW50+aWW/jW5)\a]*bW6*­1 F[Yk/@? r!oF~o%"G/\[lRUqLm]\RlU1(heġȫD(@{cBy [EJ@230nN# h8SHD[9v™hO\MA]% Ln9޷;Zt )krhTU0+bf]vlUٱWf]vlUٱWf.ּ}90upŇ");@NIӋTt8t۶)qv(0LU\R5E7qCuHS 9RV8 klUr8S/]\k '\ZƖ[9ek R+[%{V0e % "(Jvb9|YuWbw)ȂNqUjlza4M]R 튻T늭QK|kSd$WJO (jRrU1zbWZjo*e\Pᗰ\k )JaVn % ˮ4Å[\Utf]vW-]*c)O*h( PS@~2%r}9 ʐvlUٱWf]vZw GZA˩ZC6Ua&E:Z;e*= {0y8Xt+]Al=2OPfݰW ›s*h6e=UørF)\H܃lI%e$.s1/K Ҭ Ezz?v,!Hj}h{>.E:¬s|'xw8ofa1ƔQҙ M'oZ;OAj鍡 P~~Xs~3Ȧa &kվY$=NE@t͊ͅ6*ثb͊ja"؄M_^Q\?mD9*\xpJYWf]vlUٱWf]*  k25Ddb6*ثb͊6*إ4~jR!j,b hBa7T/*Vy/_ ^]dj҇}v-Y͇p?m?盟pla |?ਫ਼y >AO͊B^)"$2`1)mĤHG&/% +c/ j1\_]Dqڃ >& kE=֣*^=[\iE+50rƆlءʮ4X퍥(lئb.SjbMԮQ8R2Wc-~!2s9Ʋ lUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثbÏ)N_GBgyцZ.F*ʦ**r+WW6*͊] f]v^*lUٱKY+yck.Y`bD*jbW6*UZlP]0%٩]LU[jbb1KZ9t…ʦ*rV, P8หEʸcxqbSR'(XN=qU6XZs1VS֙@׮\(똯|UjHkMqJ*NXflbl2Ql]p*瓰 lRc2CL6) cD+>%[vA bZoB?^|qK 1 ւ7qA7Q/Ć {Q|P;Rڹ\ 7L!]J\%\ñ޹Kt?݃O.B?`~8owYVL W-=˷vgԷnKne`Ja|'Oh?8+a-䠘>=}XþAs )P3@8?SVbe R챊3S(PP쮘Ӿn>nDZQ:|^i#>]دD22 jݶ296VI.͊9ul ↩ZˮjLإٱWf]\ULqV6vjx⭌[a/=}wsYZSmדi+s~tMlr^?~㘩HX8ᕊӁWkaJ8L  VZbUW`k N|Wj?eި5o;=ĨN7P\?;Tm{N9m$2 =iv6Ij] ݍnʜQ}B~p1 'm%좿:fhRy n,]8-(}J6Ƶįl6rZ*qO)LJVh:"KX{D"JVo2/ {SǃLMh:cª!8r#.H,oN`gjuyRT[1L&,i+ ?>%䁁ۮA)MQLq8U\5NC 8iJUT˦)w,qC\S\ثULUܲ鍡ٰZ]\bSaU0ٱk()\b60U˦lab d&~Ӧ$U/~'R ߶C.$2X,#v76*ءٱWf]vlUٱWf] X7,lKk,rpuu.PG N>%ZTu ra1|#qň W N[v481Woʻw9*ᔧvSlcE~5\ oAk,v%|4Pr3bf Z[= ݈k:W,fu lU)]\gN+`aZǵI2J.b60Fͱژ;ኹNQ4Skqإ*Ssv8oZZ*a*lUU­ baC*qTT↎]kZp+;jcjzaWcl U٩]o]F*n[\s1W ddA[n[s'K?>eHW͊6*ثb͊-zU;XVb+Lm-)6*]i IVq.bNb÷LkFD9ELU}9{PZcl \)J^o-ZE_j3Zr \BBX*m$ hboo=j"m9H%av T~?l$Ŭtp5ZZ٭1dz{qJlzaJTUzi)]v"29qF> !^z@ܱ1B~gol 0iy pp{XV C@w=#6`h2ͤPj6D#դnp" iEWeIXͭ><$Qs ,kKxž' SyOIX$`U<Ưkl7T®.ha~%9l nle[W i8yXUَ(vD5%b: A|Yq0T%&lUٱWf]vlUٱW`M_2N*y.`/(.6XÒÌ b͊6*ثbqVyX-:}`XG>XG6(vlUٱWf]vlRjf`_W Y?\ Wf]vlUٱWf]9fC ڝ%=N+;6*ثb͊6*Oby.U{].6Ģx~9ŒlUٱWf]vlUٱWdgʵ^m&esl |ثb͊6*ثbͻpT 4?rMlCXZ8Vp p+fG'It'3\$36h7 t?ٯk\q KpV4V'8qpJ5T_iR(x/l7GOįHd U%-M}ei9=F#$ VĽ#C#WF*?<ڧ O{PM1+5G*W.ن*l]LUā*cs Z4b[t]aU{eaKVu늺(1Zr'ʚӼثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثbÏ(NGBgyivf[XٱWeUXb͊6*X\rCYWf], U٩]k*9`bW/ka/͊\bL usSurVWo,bc\1KD UűZ:i-ZN]0!qqBqbI˦)ZNXVcPUL|UM1bNZFn[b2W6;)\w-\Uh^9Ulo[JCG!<|`~]pP)S`\nV)/«9c2E U&|]fY?h ~fYKF][@/0~{0I)vS6@bدL1Q afCJaZ9Wp냅mF+[1"`u~WPvVj?Vi;DYU{=yS+Z+sѶ[;^a$'P0v8IT!*Uhn5CVme}嶸ެ 7v̀1; Zy*ix~v~`()8lDК{u 67#!ިc|'Li]ʝ1)lUܳb6*s`Wfb9mH9*o@~)[߫n?m9%jn}I=1aT}*l*]pnlUXT S5p]A |*r\.XyLU[[ȏyws+GFc~_TT&lSl0nV88N*W +U1Xb֛t/,K0 j;p0OVo-Z樨56]/]ٞey\&$~[CĞkj{Y&5ǃ*m=;^"Ј}1iT%yOLϬ'2JjW"\Ŧ6, "s_6jNH$oub}#,ؒukHŋkfES.R,6)Ba/ E0+܌??rۏ$N:J)CAעZLj G*S0Z#so5L xN˧e Bd[6**r[*0UiaEl8Uo,Z,2Z-ᛎ*8 ro6L9uI^`O[/P|%#+#Xr9F0> L2hL3!V?2}c07r^ [ =KG7zO.n{cXn{WbX?*W+jrJ8ǀâro[of x mߠ7kx 4+-oVƇw_-cUw˅skJj VXj22BZ46$ࡪ[&ѮWu+ǀ.G /C}[&EʌK0S[X"a}ޥgqCH4έ"70b;xikG+Jbb|p%UٱCb͊6*ثb͊6)vِЕ90bGUJV3d80€a —e$mLUXWw|j*fb( *[)>,\qFh h;aKy.ƈ)A늴qƆ= @yTdʯl2ԜUآҕRˮ*jaWW-ҫE®7 q[<1CU v:~K]k+kW*81V(v>8G. ZW m)]\FXP1LeqWf]v6Ph1V;LUء٩\UҘvY*g=[#l+>+cVTFlUٱWf]vlUkb96v˦j6­kWTq–cU;^:{*뙆NٖSnj1Vo0a?YnN_큊o!C+<\K*hZPȆpEqJLO4 {톒:Eo![Gu"8АiɿLnN< |@nHo+ GJ Mۦh?F)Z P*Jt5B(ƹh¨v 7wR:7_omNե*+fkj$?zbP}noᕳr [o0XvyN$ykS|ZtVK|Rv?쿆T Z4Q ƒ,&*1LPש 9~K-OXZ1Qaȶ +aV1Ji­a[͊ͅ]+T<# 'mjR->ג܋j6(k6*ثb͊6*78*y/U<? cK?GÌ b͊6*ثb͊*/Ws aTlPb/{}iZ{ .aj~H z)puS쳷i^-A)qxwԏof?6K(~`_ /<ȓP q8's,LD+6`b+V_-0 t'f4#WGcZ8_cIkG sZ PXxh݈|k#4^6{¿0kz!P!{c)ZSPv*b=?LŰqN&sl?I4?'}X80}a'4grŗ%K/ro[ O^3/qI['?O^?'}UӘyZVn?/?}WmKibkyTl@$u8ҙ-x`ЎB4v6QۘercV'li[r܀g㵬q_\ٍ/_T}۔uǜGKw;4~MOnoݬuFэ#ɿ/bm繗[ShƗu0o dH W/Կ0c$k0㑦 0H:̒,au}anjUinj*k _T?ƘHVxa$ Z偊NiҔdjRG*쿗 b.XJ%I`0߱e D tˌy<ӵ-?[SXWm4Ey(j>"ݾ,"ZU^p'#Awk(+87S[•|:WI«rEWc{b޸ΘQkRQָj| Z㚣b[#"ż..匂l9TVi Fw< QU?#[(jOb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثbÏ(NGBgy)K2CWebqWf*UٱV1V]/h ͊x˦(jtZ9VLRxUxG/iXPl* \N8b́.X8u3 *LU%LPxa9xU R9*q-xSmZ2\3!\c1U匊WLr7ªo!2Uѭq4z*2PؠLc_ Jǐ)R`\rUȻoC)Sj)ȁE(Z[([(:22k''+4]%ՔS8Y 1] Ḓ;⨅@ABO:Ƿ\V{mAEhsH^bwklb:Q~#ާ᥍]/`=YDLKu:K'%P#6 lA!ICDwV =MNpYYdcTd]3&4r.H #AoBwOBP ÛmF~yD%OoJdHWr1[KkA!z]VHVMgaMbdc˭NXȱo6"wBDf*ثWu«iq^(Zv9cj1+Mp\=J"S!OQ1ՍC#zbAmn{Pd€l: ƪI6)lӁ+Q8iUp8R\3`VQyXtͅ\ 3`VrVɮ_*`yRW,!U.)Wz/5s ֛e7aH41Cez֣JO7'on[]cqSؑ$1)ЂH${a%EFYe ӿbQj2t +q4Zf98o\c&+C~;L+% N]qhnXצ1!FXIb:2}(З־Ts­ui'?lU2c#o,jw^:Uao!w6Qal$G+_n2/˺cZƒ-H0^}Q`1'z*2v$ڥoՓ*4{}q  2EnxL]ope[>\Q8iTO.z}Gy=_7+`'a`:yF W-GLs~F ac쇠jj7'u|0p-]ns5^_^6rz70T]Gq黟ULOyĦi_ykEVbJD dICW/L@.-.O7kcp{ Z/RLUt{A?mS'y%}6?aKǘ9y񅦏mf +Z,y~s~ m6Z]?~}ò0a?cL:鏈m BE7q郌*a7?9|/r0qTǏ/7vƪmD?.q gǎ]NNkQ?oP|B=⋟lcPyㆍn?g88ïܟYGD? _0܎m϶̷#7=*O7x|BQ^'P42|R #c+MAcJW4J?`}_JS7.8yv!GUTȸ_X%I!+TE1B:{э~*WpK\R\j=cDgq6?])F.Ji~ⅥX~fI_?md4#m朁LEg ty-QZJGjc0Z7j&%Ej0HhN< :Se.Wf͊6*ثb͊6)vX&-Oҵ UK-W0 |*J]J\N<U|UbS(ZvS\(Ui_1Wf"X{aV늻-rIv2Q6$M2WcKW$̬EqKd&Ui8o0cm.3qU$aV6[i;\*L ᙣS=kJaJӎ@ZP7]\k튮`mY +|)v8R|8dZuZ-wUeb͊( bz2LUu*zV8X݁[a_*i[l*?/K>r!vlUٱWf]vZw<2M$)h'.Q\o:  튩–S\m7]j去b7A^dhf!,Uj(o "fZ@eu*GrȦ\=5s N+["QRu10?XaOolQZO-~C>U_OpBn^%VO?_̞XD4~m^eSydo۞ g,Hbm׀-7r_(i͛j̞? MJZxCFw=ˣY/Kxh4fs[H$_im8(..ǩ?~FOHmOV?f+p璎mp6x7]|ݛo|N*]AxUFnG2;[?5{a9!أ5LRrCYWf]fJA q<@9/E+ӟI,aR~sYPfqWS7#UUʮ*f;Dܵ %"'%8٪|qWS5O*f]AͼOߊPx/o0 ~{⫇":RkD6QUٲM$zQ]po'in#)_crlq޸""RwN[ç?q&د?0XK_SM)pv+kiOgA )DaøY:EA8!v>ՉY~LU\Ho݉+L ?NFAX;$Y%ua@ꎧE,9XQK*~%*ieEi0?#d%e4=C+$I[OLXk"N!;*4K qWi .={b+ma-=h121ZT2bʸ)RJo.^*VLUҘ^kZ#p8Pq $i>8ki>hse-IlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثbÏ(NGBgy2Iv5VV*UٱWf]51Wf*]51We9cZr%ثءb9ta*VX+N]1WW.S+ 9d`VSlRe\q1Uc[UW, ⮮jb\+\N8.(XN8 UL1V', Ui9gኩv*qVP‡6?#7.\܀CcPҙvLUĨrBڔrm5 fAC5|G7|PWZ>զB찡l.Z|אܐY=P{r XωY^q,n}JPBMN?)rb EA]WՉc?I 0P{GAF4{ 9-|;SCh_s{5'?@m--<ρ? kEx hvڏa?:Vv&"!ЁAAHa=sK.ފ\iVeqU s*TbN9a1[Y뜾Fl)cHxjO*Zf%53m" XMQ‹+1#iM-"|9{U&֤e (5K{@}.\Z""`ipN6> ὧ-䠔p'lXʥGScE:L9DCc\!&*}=UUqW5[kn铀V`#~[vT6 p~&$"Xkc\*S,`Cb͒Vl*UثvX69up*pY}+`ck[/n]SL)mBҙhvެީ0?#\dˢa58yR@o Rf[Ӂ+U0*ᕊӅ[qK`b͑CuLU®8b́]o4 {b>9f(Tfv,i+y9PJ.J2GSkc}?)R$t;T>;u͟Ǖ;pnZWM7-@2'"۞q~'vO]nv?w`8¶s~~f Lvo1Xlc Rg y1Jvh|AR5K8 3-[/2zZ|@2BݱiAqC*e;̾_oZf_/<^X|N⋠Cާ┩7'2ƃ~q9Jo3vCbOqS>cm?(]_P~1UtQJs8lHjr1(#7ewULhㅺ_?v?~myEP:{e橗ǯF={"qrNbЏ;u5߶Ibf=PUjzcJr3J*H>|0ҡSPiQ[|P&O Ԩq- RV6gV'lm\3*}hu1Ir܃Ho`9cIo>?~X zNXo (YR/,mKbVCMM95 q582SfYWa茩)Ƙl/Laƕ.֕b.+8iW Ƙ\.雁|q&ኮlK eSlIUܲ[ u# [l ̌hd^UZ1`<'5@k]`r~`cN'$uIn\(85NIl Ր2ҸՔSq.-' Z #eoLoLjZ Xgj`K31dHRn;6*ثb͊6*إg `p\ RVW, @PraWWq \e(E)v+Jzbr7¸< RWzu#)7[@bXA3Pg1v5SUȔ7e낒sP‡c!Z[lRC ٻ;C˾([Zʦw®)OlezNVUcL ]@#lflUt=k5Hg ]C 떄Zq. ͊6*]q*j[*cLUcyb,WSN*3b>gxu9 rWGӐثb͊6*ثר\zg|&Rxm{fmư`BrRT J£ªE)WS+,UasWcX7NNRԊ(mcˀ)N)lZlUpby|]rn)[f5(mmB;T֧\v[0=: cBҸ;8RÐ|[vkװ$׏Azbp(mǏ|#+a˗fcX[G'Z ƋM~ꓲFK >YjeeSiW!f߮xᥴ%$zՙf MφbJ_km.TȕTvh;mdOɂg_ jTmPxlB b]l!-lcN*l*lUd_ʋ_ j24%Wj[}"'Ƒk1k06ON?0md=#VӁږ16i-'Gקol&xoFb&_:եy*@RJ\PArEr@4.rK<[E3F6Kq ;oy;M XgC>aق?AW,39HP~Rbz~T:bWPf];"K52)dZ^n#jlPثb͊6*إjK_0Z/Q?%ءvlUٱWf]vlU-^a5{^##lPCb͊6*ثbFBi_ׄ~HČl%9+]yd5 ثb͊6*ثbdCɿ}Za̢n~dj6*ثb͊6*إ_mdԉSrP2-|Z8'qg AP>XWd&O.u6MTѰ8{( >T?~8_^i ~76Kds[G9"ſ螒⁕B+~+l%BfRxW#JvD'* '#Gro51uȡZ4Ol-u ©H()]0xbP`B[|Uq.qC`+\M2q8lhVY{p;BbܱԨ•||U15)]Lru<Z |qLf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثbÏ(NGBgy2Iv4⭌ثb͊6*UxٱWf]6*U9xY``W[ bS ZX/k/h╹XثSusSWcZr(k/N^)k0]', >LpU偊c*NY@[:iaU,eZmNU͸>fZ؜npq\x5T(qNUD㊺E2x`U1(_ N>*@Slbo(lKcS5ŀ !ZFa0 ym'^M :\?&MfG$և T'[W,"pG*W#5qCG4r2n U"2pOcb#xR R=KBU H5)*\ VKcq+JB: KKP~cizFN=Ɨ*ޙ=5v8T #F'2S "9Q\iOQ-!Qo X^U_n'ïFTpk|@ en@6֤}h*bT\i{:w~dN;UXtpVǁeRh]Ք,Q+帢B[B@ytW2RdrB^tòsR1KdS65vl*ثaV͊#.yUZ]pDebS5qWPc9D⫆V*9wvBjr%n=$ ʀj4 no뒈!F/EncNfs!XJ3dU2ӊӁW8c(Up80.F)\j`ClR9+yCbL![//tRX!KԀ ߨfR8ۤJ ܟ>ƑP,!$vA$,~&֚B+s(?Hľ3V /22 Hx2f ~Xa1EЦqSQ`x ?殝 a_.7vHxs1nqߊK4cƋ BIkTQO/,~G) +ƺ?4Hڧ_i-G$1إJq+%U~  G"ގc5•dcY ҸJ( UCLUp5LU/1/ +v1p^NG'4|?+T,Ubj`BB}&zs gvAm7,y)Û9&Uc.4v3BsU> atdV2Ǒd$LY`fZ`dL* ءٱWf]vlR2L.6~K%鋨LK+qirP`+.8ۮ*^ثX=1CzmȤMiߡ\rŸUm8W*rSvjPbe*oN]*Q\q9lp+`BpKT銻('8UaoN3늷RfjcMEqVe b9n| 0V`)h|UrU]*fʮle)`I\rSW"eWqSk7`0|U٩@*])qqCYT*]Yl+ex_d9rU^T|ثb͊6*ثר\zg}l``Wu5–xާ =2rӯю*p*78RZ*]{7"(pQR:M<0i++r(ZVm'nL0'PPѨ R+)` ΪT1؜MԎЩ],qJ@U=?QwƐ"?W!트{SNǦ)oz0dž4VzccZX+qjUOpuZ遲T*cO8O1y=xƗ`112}D@{E8V?F,-x`i%P//2^=LPjakYnmyzۂ?0PyWMqcğxഈs!O M61D5"*XdcԟU |VN^)j5uESr}ׅOjC0t)!ì sb͊6*ثbR_$%xȿL%U<)ڡ;6*ثb͊6)o#Bv+GH6(f]vlUٱWf]vF-τ˄0"שS: Pثb͊6*ث+Hd??DK!*b{}0rV@9#ءvlUٱWf]va">MB/. ϓa-0扺+ lثb͊6*ثb֠)_x~B%T8 UiǁVxDdN< sC+4zOAĿoI%OUB=KUFh~$}z#ӗS qn]Ȁ3=I9 5? d'F 3QN$InV3o U7Li\:1UzeKنdSjMW2qW m;bR rp{TWe^+WV5/QS92CvlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثbÏ(NGBGy)KkF*­ͅ]+v^(vlRثb͊.Y/1CG, 8 R9VSZr銻,bfثU]1Jf(o6)q04q[Z9K(h'VXNXUmr**x{? +jP~/o831[v-(Ta0a6Dݒ}d4Wq7GlU^O|M_i,A#bU`[Q:هc& =1!53Em)w+kܑ@Q7Ji8Aܯ_c"m\C.Kza5ϔ*ѷ%"*S[o1) NL0n'zm]*;;~[UQۡYQzLwMC֘uk[\|$osP(K.t7_az~Y'P}\X)\ثu͊o6jJf ͒U+W LUP /~ ,^*~SZ2n$ߏvC[MۏF!{ڞ(HxS6o[X`cNX8sUp9DaUƜV(Reblle f*Ul ^;woJʪ7 zwFbu GWj.G%4E.tTP`6 }ܒIƐd9f2XQlq$!n}FX҃+-$PJuh(!I~F/)BNٲVNC Z#/]oo$io;S |&"͑ښT:yU~^T[VLmWsLAKLj6.|&²KRy*X{dUDpVP#pҵꁾ8G*܏xmTZ]EAl|0QT Yڠa tKfjcҁ8AwPF^=6~vcdמpf#֥G7Lq ?Aa_)P?\ܭ N-'@PFJ'85J؄ڭ<+揲V]YXHᆙPN,*{ L jWLM-XΜ&dH%mFẻ}t3T27j~pn_+is)I P?PyUoჁ,vG̱I$D\gZQ6GO?䳗& 1fİ͸N_G׏?0:p"vz?<ƽxW-Oo G̲>郅x62?q!>Ňoxavj>'o?V9<0)=7حOl+RIXsOjSdn?FDHG//-O><02LIE 6IOt2)ŸOdL)|0 e5c_2ϛ8݃|?7G 95kNi,< ¢~Bț#n)weM+hܬ~U* e ɭ12;Px$P|< @";등<(#Sb2js2\!6?pp?)ܻ} !0M60?RG?yƓk_Ii !?Z7L^\y/KInq1/fJ`VH? b̈́zչhONdހW"ÄW^_-r`Od$[8ﺰƙ M,ë3A'5p,uO,>s}03ض)10;ٲ8i/ч߉smb#4 ,B #2,{`kB›W 9cn߿7g3BgfOGQx p dH;a+;6*ثb͊]$+-7989z`2Eo(h2Ih|Uծ*qSc%^[-[9v:k,F*vnT1acj# (⭌)q$wQ@p%nquZ'+ثU|PnGLUU*cZ1@+aQAhcR۶*㏦\|R娠 !NUV.F*e®Ǯz`V[ e<0ڮ&)pSNUkjL|1CyIv9NZ"0!iK+4t[1WW.®;Vb8پX |?r䫗Ӑ Wf]vlUٱWeQX96 t$u9aNN.+A⮩?,Pһ`.]iNNo4cC]#l)CLq4Vsji/;wA;elqnl W0P9AENm]n:Kf>^)]A)-q+OGm#q 4?~,Mvܟc\R*X4=21_7c/Ւ-PD^~6>lPثb͊6*ث6"p<'_xU]9},!Rϣ3Q͊6*ثb͊04#^MPxrZtk lP͊6*ثb͊1-^o;2a~uyb6*ثb͊6*ث9OH0"өdEzeb͊6*ثb͊VvD2[r}X~-bMC%wч(]vlUٱWf]vE|/`$K\9MOJ6!b͊6*ثb͊":大 𵟨"aՒ)q`U0ӊ'09cZq]T Hr=y_oSlE"jDv~F~EGG0ǒi*>/*~' . 7Ƹ6{fU =⿎){]XU<N`D>쳣EP7sxv;812lp2EOz{w+ 5Ȗ/EќqCI- :1W|U)*@cJ8S*tˡV;e^D2eS#jUEa6W5 b*qxyTnRq܉>) 6JlQiQ_zZlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثbÏ(NGBGy+KicU­]+/vlUٱWf®U1K*U1V8`JqbkDUxG6v]0+G/k.—WYʦ*^*4N]0+D偊N:YVD)XUiӎ*pq-'6*U183nNqFYQ\:`BL&`VcRCٺbg..ˍBB4Z^h]+kL]Krm;ba^8q X+*324`R7A|P=;Z2 z d-Z , qP^eP#V#r.vy .2<\\PSWVⅥqEqUqB1+DcaB1@qJ1Hǃ#*86*85~xң6ۮN˺#L)-RE 2^eؐo16yvNPH}Vq-Цx$<Ƹ.2o !TAD{) ~NSJ[mr/lxևjKon߷rQ6nd/SdoFnnTݲʂmbsm (hOL\iu9@ ;]R V\U7/c'-/;1nW56ڍA_2J,McuOO׋h>rT'ТxXՆv}2@Oź14H*rB?>7_lU8[S6uNllUpͅZ9nlUٰ%٩7\5^n?_uBuZO~iڋ{qQ6T͕@>v\J662+c+G2*F*lR9!Uur\4Ux81Jsbp*ᕅ]LU߫"^qԹ:ک~&?2qƷTMͺᗔۛM@m+4&:/\¥r)I +Ӯ.i @k\uhGƸ B;NѿtCLaߛ}ol ฾D5eŕ 1ȡI5q[L(jͅ-r`d}'))L1uzLX5>FRL+*=2Jѓ(@W,FkUĬ 9LjӹuJi)XٍcH9.yAI#q{T Sy#;rV ":o) >4&>i2O?h8)bQk"SHEJngf> U8xa[G &'k|[VM65jRqp 8JuWa H#;zz㲹D cg#Biѩ9!d&Pԧ8O|^occª >MLWu_[Ē3GAm+O@L I8"5Y@]Ig31t 6ǩ4o8U[(`O],:̭´Wl!AnZL52Jj lNW*J:b+3mܙ&~Ȳ Η!eVGfԙP1ڰ=(M^٢V >r={C#s,Ϋ(X_2J5\R|끱S02vm%ؑ];6*ثb͊]Z>rQqJdL N<(–jfPv`ث Lc/*ڸE`lf-5)k1];,;ZqVRaVPbLUٺ]P0%Z\v[']]\wRr↎dqۃLUVKD9 㔞XqWe/SLU☫c ثxqWZ[Lա]Lo늷k4R8UWvXWWL URjS[ъ\U\2A\wA*$b]8-G]BI\m~eHW͊6*ثb͊-zU;$݁ li|m )_Ɲqm_|  i'[P).b|*R5msKcqKxӊG + F)id[ȆN"z`mCf͊6*ثb͊j_,'¯%9l%9/ sb͊6*ثb͊[x[a-pu>Y"أ5vlUٱWf]27v?c0FL=X?X& ثb͊6*ثb眅cpDZ?#C[‡f]vlUٱWf]apx!E]GzL?̈́ܚ}%ثb͊6*ثbc_e IÙW)>>lUٱWf]vlUٱK1# j0W\ ckc«9:\7n:턷î3Vs;ܭIۡ%Y970 5|a |g)]Lj1VZղxcjLabAN*~=]O|K -r|C,?V!VNH`7ȫ{<0+9Nn(p!kʚlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثbÏ)NGBgyIvQ[Wf]vlUٰb͊09\]0­, xiZ*bW.bUbf RlÚ^)h 4N8`KG.ӗLUn]1V0+D僊VvZqتqS9c*U\Ԧ*8Rrm!|mVSTaC\cTiƀ{CL ]xk)EVvۮ[-«"jqQA=^^þ;*cUy U8 z)S^@⫛qSS,{e =EzBǐ&̀Y)j <7D>]&,UI%nL$e$b.(ZWYqE-+ 1BҸ&*\QdVǬڭ+ J)+VdžVWZPeZ*lpnVӦzdiV=d#*PP3'F$x}Z ]]* G, rm yfȻ~8KKy  -6K"%^pzZIfC&0_M@e!R`ؐ1cU.~)!mN{}Kyf۞^-{Қ6>Y5>(Z\1VZ8>?ۃ|ю7 Qң(>B\hg?a|9A Oe4;x`T(`z7­ثsbث͊AjǧS0PKtUʼ +TwUSlm[<@«W6*򩊷Zn+*|srUR{TxJ9EZwzO"4UKYuSLkFi4 ቶߕ~U<%tu?PSG/Tma@}Tt^W2?ZI/jd|@_~5p>waz!0 @vƾ*F^˓1S r[j.~~q~mҮ?}v/xJїw0ot9]01l^ƗҨU`w0훗|mVA…":Rh2[v7*o%6S/@qB٦5pZF|jqH/^OCj:7  k˸mԎ6K}2K#t4]1Tl f vgR'-NŸxT.?طӛVWTƕhEDvpq!G 5=:N|9!ni'/je@ڌ񬘃jS vLALr4^ĵ[i$öBPgl8oJhH1ڝ[ZW1bvCKrZ܊"|s!7ERq!Y0}fF7`Gbg ]͊6*ثbMy>J- s},ҩe↲֘զX4Wur}`bG|*qbj 6|R`|p^Ļ):+c*®4/R]\jU4WS5(vGUE1C03^UR1%cLPƑ;q-S(ZUfhui6h`\U1V A\U̻b8 U(޸v6mRaVDq>| ޘBI[XWkleX]h*w=zbA^ثXV똨;ip" ?L%tfNA(ثb͊6*ثר\zg}Fcs P(mʮ*eZd AN٣JlN32@OAC+WsC>#Z1F)\h1Jm:ѩM&'(~8^m^l|*ڵ˥Eq[kǵ2nmWV|j6Vhw2iJ 7m-:͊~A?lPlUٱWf]vlUTcO%}+WsvxKr_u sb͊6*ثbqK;#W'l% ], 9CYWf]vlUٱKa˹?ZXsc3Q͊6*ثb͊6*h^ &'rFz e镊͊6*ثb͊yyi+'rT 1?M('\7~S͊6*ثb͊(F($ E/P|遌0k.;xUFE%Y )  w)Œi@45a]` rL.NCli\.\* M:䐬,eAJ1wDUX/l*q61)^XjukNJe*34Ulp𒕧;'"*㏏\ h;y[[!͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثbÏ)NGBgyIvQ[Wf]vlUٰb͊0\r+Y*b͊rVhZrLRXi9WW,b9xhثcl*́9xRءpY4N8 Jܰ1Vb ˦*NX­UaqU×\* F8)VNY`VتӍ;aCh9h1U雖)H5|1W0qJ7T~,D SWBT>WmaZme`Rv隔–cBAp(p"x-"zm2(Z9bE;b6(j͊ӊ6(+JlP(↊\Ui\xZWV\P*8>XW )Vǫ}c!1EzbF#]$-=6s!x0 = ieƐYTrX^Q5Gpz$S$R^-ڝ%n H4Ȕ6֘Ɠ\zr cq`|qѽ3IV/[RCO(Lmu` s -?LiLf'V{eMl1Pc*KzxeaVb́ W "ps[U1VF*V*6*8Ӂ[ӊUqUck7*N6voTl !^]eW\CVR#z=BrZ][Z!F&=>X .5["Lq!dtHez0).q>'acLF'DCZȭ#ALz…5njUA 6Bf•c !#~b45qB*)r9@dw1-~Y'!mi-ޒi8h-%1@ a|4T}*U|䫸x>\6-W&W()UTª2ت9U«Vp\F^(h\wZW(H#k?(87B>쯭;+D\{dxx UO.ܸ@6AOUw G#zcWa/ Pݛ:W#TRyB:u'O鉾"r",[PqGP||bp ]98xC@u޿G#Ӄ) ƗE` |Y1J(/tD?1O'% #_b .kT}5*c oOl|E)Imna3_?$cALX[PSĒ)l˄*6֟m#i~c/OG= F2hHrW#ɟ_09_5Oi'!цg19}ؤzsrӇŗrx䵘t1qh9!|pX\hsm8'>\%/eF'򎥆x ٢oP)KvYk([}>;5Nw)0$]01dS 8UM2v~]8RvlUٱWf]dah-w=+dKG}T-/R˯wʨ_(u9lVp4?}FF^:Q_¶])"[U9yn,Q(P[f2Le%[#JM"2AVc{|-'Ac@,?lx{k*Au+M>4Pz y.SSSXx`*9TڛqF8B ~?^9x8Ɍy+ߟap3C+Li8R⭌iW i®ͅh|Xj*@ H|dAp|h|O ;6*ثb͊6* VsN*y/ag4fg aK?FfvlUٱWf]vlU燭[ aEDdb6(vlUٱWf]vlR#ס?߮A|WXƸylUٱWf]vlUٱWds<$6h?~Y$o~xebb͊6*ثbZحbՈAy] |,>aD97q|i%<ثb͊6*ث)ldS}vKτÙD\}dj6*ثb͊6*إFVՑe%k SǮ,8IRl}p!e1KD`CO$X]ol 0}MdkN2/.?ݽMC#Ky#5W4ǐI0>F)V=Jm'KUy =6퉺М,@R+5;:`C7/ ]zUdaK#5H#ћ'Ǹ*C 1CL;O-\)qvlPӽ3b])(^\7۶Q1l lU`rje4s'`sƙmʦ(ñV Nf2(SJ3F{t=P+s=\̜rfZ#WpNGC8|*zL(v(QfZ(5LQgō:h=gii\Yf(b1US)Ⅵ1LUZS)b c╥qUqc&(T1E| Ɋ+(ȕѐhF$Znlu1+u ⿎qC2&nKSٔr_=km8oJC׃m!S#$u=2zdq5@2|0j+i8Po@i6vn-cxL|ra5畢z Sz~e*[yD4^_iiP =!%MQ[yN;Jh%ޜ[aů-l|zeG \hFO/ㆨDKU*ѣ4pTm ]p+ӶDvg`>xd5&Gʞ;2;%n}kdv6)p9Mʦv^vlUp9G(UL \6EqUb͊+c)T #|Ni.dd A9o6ReD:4QFevJv$XW/+Ӯ*~rQ,h 2/9M0ֲPoD5 8OM+ǥvZ|Itg]W,E:r'XjwY<BwytG_jdM4ѣ *9o-VyTSº}.(co  `;ʼB0Bҧ˯Z+p3?޹/RJոF8ҒwqK"} q|޵Ğr&4*X=>jeWP=>>|%h,Ӿ}x>_6x8IWFkAą#޸Dk ɓsQV",GQ^7C( <=CƸ`@O Fj| )nbBxq$?F]P|F;aLSFP9P^08[7nWt*1!Qn\hP`!UUnG0vKLw 0˫;SzS$3rY6JeM(hmz–n``V0Nءpa*]qWc)hkpc)Rd⮮b[R׮*vaSSu3bpRkLU0^]qWeV:bƵ bcqǃZq j0!pLU<1CxU**c@ɬp[k*Ѝ\b&ث[Lk/jbc*kC74];QLUi5AM+TaV#*­0 cb-w銹;Uq ZsqVV⭌b * ?둗$폧 KNlUٱWf]vlUkb9A&[XAZov16Dw*)9'|apF-hF8U!5QB]+Zu4-Ei-C@q9{SC§E1ǧ\Pғ^)Ze5lũkH~cZW" PlsrBS2BRӁZԯlZM雕*;qxbn7*!JtU^*ōe=qyK`(kCoS~|8K5Y"<*z)5MㄔYMH-zU+v?Jl)עWU8U"ō{e nDp*qG߶H"\mEe_a ݚ`f2opJ8®ͅĮ!#~O1?)׏,lC]vlUٱWf]vyo8+/~+kc?.05*f]k6)vj\Pإm}{P~Zt~dPLP3D*z0Wq>~>U8yȃm ~죨[F>npo?qRkQKꡏU#c KO9͉ gaK?vo6=~K?>gofqq)Ś_?э/k)?(fT\/~Ɨ6-_\xvxW~Fdz\C#KaOp ,nDHWSAFc0k@C6ɬ؂IpV4ψ(nF~bM577 TF ^ '\OY@Gk)?(d[}<\iǧFc)bep;ZoUc,QBҽWV#(hL*l2DaQZW8rާqB"s$71PL8JE4z~#1% q|PU gXa1,vv\'P֠䄷dB.dJ( h1_L %#Չ_…78 rbdW1UW<Qu#,aB9xmV'~فZ++V=]<0K+]qJN5TTUY-cERN30ȧM'%qZ%q6>3y>IJiUho"W¸2?&MwPƌʱGM|VVr˄Tz{LvKusKtQE;eADH*veZOIQV[߮ 7/HrZs\eT $1l:xdULƧlUq͊f{fZʧ*ثlU͊͊wƕTm状I2Wvc1,oG+0>9]Y?QT6ORt*?V`j2qUٱWf]vlUٱWf]vlUٱWf]vlUٱWf\FT,8]̩ >MIs$}̓EUsCF]>Y(~QvlUٱWf]vlUٱWf­ᕁZlUACcZ R45͍!4#Z0R8kA11a6] D\znwr]/TԂ!P}͵pHhSተ~ yd6 s?7:E*%}qؤ[8,3zO3lxOMc)ho2\v$_"G{%>+_~lWQ0Uvĥ_Ċ0vj~9/XtcdbwZDJ8,%Cg%eF`.k>ayS^ҧe"rQ.X$7l &cJfb0pp!ԧ|p!ʧl*Xv0]Lx8/q[ZǶ*c(銶/dT`Cc1jZ—**q+ykRrV81V5^,1VU_, 1 ,ada;7]KJw48eUcqq☥i®X5wZ8h)#1'*l-.-ثS1트eiLY\\iUk–ZK+rk S,9dmZ)LUu3-W-jxu9rJ~r *+6*ثb͊6*1WclGlpo|UaAEqU喨(Z^+|$ jWlF_\R2`Ver\W}B*:|8=*;p|U"ezX GsAQZC(1V'2׶qBࠌkwU|d jnxbZ>/Viif?!8B76‹.|iYZENÂB{Ȓ)*+ɹ3_9M;{ cUcr p.WM{(KWBN|JcɫY\ *c(N* R4⭌i­k KiO Bƣa7)`[cK /+`hآoRIS]GōޓxgZ\il8D;c cK_Zz>ixS>fӇ#;/ϛo[iKyxՔ~Ƙj ]'[9 O%7U[ cP_3}bO0GL|ÿ׍o2724;X}fOcɚi&o덣7_&飬dٿmx8Ok272=䑱 *E>"?d\@%ZiUH;#mG273t;x}bOYcZ`t' }bOc-0X ?GgmxYb-8V&h m‹uq^1oD ^l%2Ђ&Lm zb" 0(3ƞ14 -((O!)))dn@xlpPt$diZPjzeŐC)V5S= ȭQb ;v*!  Uj7;ƺ/ޙAbcc_z)ZAE*u0;▩6*rb kNu;Wc`x2&*2)7z`F .3^X=#5EWd)m0Pq%Q y\p+f\gUDˊUVQ @׾U 1ULF{8AA!U؏nog(ʓOBI?4^tY+tg @zmS 8_ A+Ñ$cYxԀ?߃LH)bFn 'dFTi6bou[W#WeaekZƘ|Ojh'X\L]H;_P UI= 繭r`o|զ(|r]\یUVr銷uQ\Fy޿QR<[F%Fco o8r/>}9#RA]vlUٱWf]vlUٱWf]vlUٱWf]vZU9l}fc61*݋ٍ1EPx᯾AT2Wf]vlUٱWf]vlUٱWf]vlUٱWf]o+ݱW;kv\zD鯳#xVANhN>NjvlUٱWf]vlUٱWf]vlUٱWf]o,;qȞl5jv#Y|HXOM/![ˀ~DHe1?T:}EV^]>g) r:\rblxU)iz:Lr%>[7ecB9-ӊ'p/~1q !t}HXH*j2fAMSCP}b7Ȩįm#7N Y]>% Jadz??HဟB粍/z᜶,[&3d* 4~FF%tq0Iʒ>H zst7=p V]6␮h8N*f)uj1Z18)#uFWa(TWK*ǞRp٩7ezbqL raWuj1Vo5"qWk. \aK|WeP.ʦ*JbZb8 ZƑqK.XhZ9OLUD&U7☥͖V>-V ܼ \2Kuҝ6rlR桦(hpMZ'\)[,Z}CC?rV/>ID]vlUٱWf]F*;Xr+Wfp!/j}0NlM/EМk@/k5qWS0m銺ghcH•4m(p0%kWǦ`7 ]W (>UxSW TM1ъTqC{ 5BLuKQEiLst\T?`gcd2?o^x Mp_Ah#&O0%b)Ɲ; *6I UUq)Wfy9.H0%{?WX?O^6/k2 %5v>8n5"cEIb'Ww}>fXVWƘwi>SO'`fH]G <QZfzGl,#b> SQ,1{6>zv8k/J1Mެ?=" IW cPAnU, gtd9dp]ck1>enOo0:_Ղ׀4nd=5ck2=,'}G cZ1?{K_ D|?c_?X( *JJ.рp}8ȠHu$t΅1cRPr8f-5^*?مfrP)Jmb@X7*FzoeLC m ڀauG\OlX#0\IU@H>x@<æqF*c P vS\$h1{ K)EqVJ[7lmZ2㊮F)h6#jԃM|q]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثbÏ)N_GBgyIvQKy*ZL X­ jaV땊u0+YWW.D*r)h* q1VRءٱVb)h rVLR]0+G/vX e Zq«k1KD,T؜zRbd«O]w8UUeb9 jeV'.h9E) ,Vbt.Ds'l_JvRP®`T)Ю)i!ˠ8`q6jJ؜PaR*Ek*qi[Qµ1B$ تh1mtDj:=X\ 0`h)Rs8.L@ҵPzdnyXٱWf®ˮ*8`UuqWcت֝$ \Ub.+N=e  qE5A,i\Ue J.*ɋMI1B&.b&,:b&)P:]!LY$Ic\Y$ŠBK"t(7Sie攒`QqQ$~1Ho%ݱ6D3\7xb@?v3W+Ozun:`VTQ9DbD`U@+f}*߇n'o &Mߙ%ik`_b@cCn fǯ1na mn64^YSS}IfZ-6W?`1vׂ}ZyHֿO'М6nv *8Vˍ&^<ڤnBA'!źKlU͊r-`V#+aWl ] [fzMEVe:kV^gl$fIΧ1HdBIKJ.6 ˾U1V뚛W :␏~X 9_6pFߍ(e@[I`ڥwW^9`Ⅶ:Zd_h3Iq?:~G#l h7m!_yK!N@wyTC4kreg+1&Z/8%يHeg#02-*?0M&үdL`{_^ .I; 3;=.EmVv?V36V)~D0`nRo 9٨rCe-eaV!eb]vV)nxثyV*OM<}YٚKAbG*l]75 O **"]vlUٱWf]vlUٱWf]vlUٱWf]vlU|hZ,tqb1O?䇒v -T02\s* Z͊6*ثb͊6*ثb͊6*ثb͊6*ثVHSJ%EU-ݑO$nͻlSFQaQWrONP*rWf]vlUٱWf]vlUٱWf]vlUٱWeb;7K{H*mFy+OM^FviWnxm_]XMQ2oN%t(%(2;ͅ.́\3bpQo(vԠ fagmIa_$чLoEO]5Wp1h#ǡN/m%Z#W[|LJxO 9wy,Vep. ZTaw]fڄ_#unAgWrRP\iG^>xf 2O&%=z&4+ZNI^/b9p$-0Jx+/2gU.lv8떸Ԩ7r#]Ltlh+\liZ10I>تA*4«L" SLU"V=v2l)*s]\76zeZ@NlU|1V UUSp+G#4U2I.jbƜ*ƽK8beJb_"pG6)vX4^2MVh wƽ%.c¦r|)urP챊6!딠•ϗMBܼ \U٫LԮ7E6] |)`?F\R/>eJ͊6*ثb͊-zUǦwk6)[XYzCc7VW Z6 \` U ^8ҭ)y-_UݳU0J*]^4|jdJa]FإO߾^4>}8`wVjEIm-^qVnOjR64̀r:BxЊ]lQm ~9@; ɦ)l0KL?^fE*n%ktƱ)Գٱ sGt_Va@"XUcb*xبj:xK_vQl kF*mmO,pʃ‹]g#^jmeUFῼ-s;#lq vG\}FERڧD%$?"K JR{, w\SEjӊTlI? 7EGai8cZ T \Y?~( )Z|qƌ~qŧ8U !ʶ~]_ǒۃY qJlUٱWf]vlUٱWbsV*: 's2E0*y5 ثb͊6*ثbd{ʫI^GK\:ܟ>Y!ء;6*ثb͊6*&"k<6?M vlUٱWf]vlU0ah?~Y$=p6!bf]vlUٱWf]508Kk l%RBp%,ثb͊6*ثbϕ}P=Ĵ k2?{`lC]vlUٱWf]o#^fOWQ1?s/ӄ008끱 qJ[\)XؠS'si^Ju8REM ~x_LWOe3<'^&@ǟᇁ0@įG[qA]l߼odVʳrT?>-DcfGhc_ba*)M -ĚSnM1dTQL.=OCkdz}hrAOcTx`gn0"z⭃^)銯VƸ6E>XUbr\ .;x4NI+;0 ^2"+H_֟,y\R?lAlTq⶿9@m4=>c|&8Vsb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثbÏ)N_GBgyԥGr8r*lUx*ثDUـNXYt]hKG,`KG1CG/ZrWfLUٱKG/9xmr)jc-f.l إ1U/ *U1V(SluqU28U)`V0h4Әr*^*7Ʃ]MJ\k{aUD8'_;nrHsz`,(TU^[m(p„OQB RSRSa|(l Z  sbs|+G^lUFnP!%$ -h7_Z;[D[d#qOx#+b͊6*إٱWf](v_,UXRz(v*vƐQ[;Y0Yp1\*1E:KLQKJ,+$ 6*I0MŒLRhuRtRLUEŒLUAT$bB^8*#I0AoG9QN-m,p#(vʌY{\xN#-GKMǦ NLTtDWT u)}wqצJ;DӢO#~_2z_\fjу*nJ[JP92,0{f&LKjx-*i6ˣ24LZ?e<CUĔAi_LP[ I(m/E_86U!nRwcL9.r@\8ʌHTxOĦ `)ݡP ;S vaKg/Uw8ʨ2nI*Uֆ5u^ۜ=` ទkUR>& oo=iLt|VG+bW-HqᆕBƒbv tɹp 98BC: TUUk]މv2DXpK<Ҧs/s b v~yQlH3t{O|"V4Wbm%|ё$꽪r7s[~UŠuGє1vǦn[:9ǫ<kR?-D ݒxbđ@2 ȱ8 Uثb͊6*ثb͊6*ثb͊6*<+2qت! $'[![R_1҄lUثyVb͊6*ثb]vlUٱWf]vU1VuYJ _'EWeS)/NTŅGܯ$#: -VvlUٱWf]vV*UٱVb͊vlUٱVblUٱV=1WWsfJō>[33P%W0,|Uxb͊6*ثb͊6*ثb͊6*ثzlEfXHI8 t:ĩuIr}. z"">6N=u){ @øWG9X9!S'1&+!ܤnDlztQscz8^':7\j@*'3X=6YƇ+ =}PxajO uG>x!,K {aMńU#20]~L(X )+Ciʡ遌h•A08XZ@+\U\aኮD*\Rq* \Pj:be7q*Yۦ)o( ]LU/8U *urWUq#]j-RO6J_좟/:t..d@F><]2U? Uo;x[zAQdqBƞ~8CTl1%ԃbG O1KC(UG [ӅKc2Hv^*ye?l!NH!i(YJ/ׂqJثb͊6*ثb*{R Ⱦ-X+llC]vlUٱWf]9mU{$83bf]vlUٱWf]d:8CY扃VI6!b͊6*ثb͊#~v!"lI[؆V(vlUٱWf]vlU [xn?B%wra,aR폖`fvlUٱWf]vlUP#K\9EO6>lUٱWf]vlUٱWdwPD=LO,ԭqC.IWbxUanj 0x81UpNi[PGnv=d8$TŒL(h]%ō4F,XWYp*¸MT1u)A.R^9HH4ҾmoaG}jNTBtbʁ(q崕(É~'eu)}ѭ7d} *2Tlv?ۄ>]ZىmrS2|d:2=`UI4khad<VqKn4 5?+7|J^h :etw.tĪcHWL`_Kceuc+(|XIW̹Ep俎aQCquhIj`4_i].bw~dא$2o e4~B4?&bk!1Q4fOELI vrd,k#H[Eh!776*ثb͊6*ث|^4T2uMo\EQ=(h|2p歘K⫲Vb͊6*ثb͊6*ثb͊6*ثxVORe$<®Cy/o-GUY+9BPxb͊6*ثb͊)8:x0qW ..B;vkw=А-xō*, =]ix${H{u~L_o4HHLy9WоoJ:qX1ɕ{SQ(&$)*{ۍFjd§zeQN4Gbq.eC7G .sbBG<$}˻먃&LH>m\2сCdbr)\U\r銻1qWKқdPrXOLUi=Mp]27S+ \ps]LM e>1V\)qj|1WW( UኴrJ 1צnvXbƯz We5LUpv^*9F*V8ڢ.S0_ eaWS.f#lP3 V昤8 R2`+U˦ء@LUu]pơ5\zaG]F\|_l}9ʕvlUٱWf]vZwc 8 $k~v )mab}8Ǩ«‚i雩[#\ a5^Z} OQ ZߦbOA$ȪۦX'*:blaBz m"+b)A W r59B!Qcn mB>T.3<ӦV[My@ȁ`B#;ʠP~ı2Q. :X|}cZN?,m5ޥ'#҄c?X$`* dK&Hު~y+؅͊6*ثb͊6)vF{k.>lPثb͊6*ث/W>%G6.aO`lCf]vlUٱWf]vGD~V ?FK|o>d4>lUٱWf]vlUٱK) wzGB>.J6!sb͊6*إٱWf*z7NA?y?5 rq@0a8\Uc6()8b1Sfz@'jH|)ydݲ:9toհ*p\ z3!nݜظYmZtZ6#;} -E 8> :aDvh^J28 &'ڊ&'}Saŋ-Y M)?Ra nCb9 CbNjrA)b-U aP*X>특lbDžsS,F/*WEPn^k";kQQ9U#\6cL cNUH8uVJ0RkseMl6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثbÏ)NGBgyԥو.eSv^*Rn^v^vc*rU 9t†)j]v;LءpZ;僊j, R9xb ͊ʡ8횘DS0\U51U*1╴.)Xs=Vf5\p…TǪV3lpªfp*WoZ ce-rv8X4M rS)i I Vǝ0\B훉銭1OCWې̿ ^ Ԕ:MWM>"q­MSc"Hî3-:a ߨZ|G([)W͊rޣq(~48 P1r=s8zi.K m qF رvlUٱWf]vlUٱWf]vlRUqWe1Zv=_;bx|Pplm]E;WUKT,bR\QKJ&(XWIi2):b&QtLPGYb &BK.W„$,PR׮|C0Dw[_}$$k&İqڿ:bRFQh;O<𷣨=Y VKIM>;oKҤ !*0nc+HFf)悐}FiV$,МesRFGCL0ZЎLo:cJ4`zSjr֋PIR2@k[euW1 Ia2WJ;9؜.ݬƩT>2^)پ<,J۔?j&QdU R>̓irVM&'ËMbZJ*[q_qJYH*?%(8xiFk't[}1DQMp$XF64vVZtejݩ#!HVQ1ܑjm"34|(=IlI~YoRƢ麞y}D>`ʹ =.3o?' Ydvo9 Kp q HU]b XdAk|UثYWf]vlUٱWc.$1+b7R=jJ۝2r#o=^L(Uxb͊6*ثWe]\U\+/劻7{`k6x*P#䕾TtNδN'̹n)prsu >%BcpbӽFo8ioQaPZLz1'#5x^kms݉7GڿcO?1&̟jx^hO^ajcy|xWӧC:q8|m 9Gv8yۼ>{'(ۇ[w?}Gv|%~ݍ>} _n>ۿG|޶ݏy|?6ۿGIy,I,>~ycL?яE9j_\kcZ~9|EN Sl$$>_!4ر'|n`QfcM={1N_35?f|%G>{qm+|GHG/?|%~_9Ǎ,`ns/|mKm~(o??>ۿG~G2{ ?> ۾_Zte/,#mȜ%mP݋/ԑ#Zc/WͺY)[iᕵaڸyL~·ÒZ6'1OӺywE[O¯3Y_Y)CHCMY,Ny.bIbwkQ_8rhn&4uIݺJ~QE6hu0/0U<2e?j8'>պ(F®p ͅ[rWPVbeaC`Wf]6*w.j2q2|(IaN^ٕ&jC^7 /vlUٱWf]vlUXlRr;U_1hb}vV!!rʶ`Bp<t/dvP^mȎhWC ƭc- KEcOVS@JYbaÃ@ƒ R[f# )MG8l4nVx0rq cEGub>$1D,6MTav5.ڽCD_j|GllBX|])su`JmSmֻf LP9gk(]nӊ(1Kx­\Uiʮ[lU-@;b')*<1V*wl i트b`Wsn`qo,UثJUvZgRLm"`ur b`i]Lp햤ҸlS+|PwQ(b(ot*h DW%5隝!QZBƜ$~rEi?,> bM4`Jb Ui­i] O!\!"&˩d3U!zVb͊6*ثb͊)A[dGmr-Xur_ vlUٱWf]vlRyEx_/, CYWf]vlUٱWdW؟&0s?Y*؆͊6*ثb͊6*y>Z/Oa '^9 F/k6*ثb͊6* k)}? _a/ SL%>J$Wf]vlUٱWf]O(/uE\^.lR3Sk.ytZ_Ui8E|:0DA2lȲAKX)pVpqB{].> rSp 2.?')AT``MIG\Z ?/AȫyRhT?e'<NF4Г*Z(H!h+Yٿ7JɄ0VC;559y&#ehinOp1d60T,{[ES[j k@J1.byQը9Y c֡k&U?sp_v*9M['xOXj7>clzcw9?iӭX#xzԓ&ɺ1=Qc{ޫ3}mlG=xzDWstEZ[FcCiac}(ic^kN2?7ߑ<٨XB~#QvX}G9c{wUf]֠hrIEeR_ߛvE[ߘ%ޣx(chw~O*U֟v6UU~n?IwssOlWck$+)w$cmɺŸ#W ?ttnj |qZ}a+MnQ~9CwhWnjw%8WǎKM}n:wLx:ʚqucQ}]?ӏSA}(_3KM*F܀ۧӈB(4ד)Ƈr!qx-n*v33Ȥlʤ\K}8؏(xPK{3Oo"Y˸4J8B|㨮oR á1񼗅GCa7';fJWwa%iv$Ͳg)dr;8?7]V'?/㐘;9oA*^Cb͊6*ثb͊6*ثC)qGfҦId lM?#"A*_û+"[¿#Cʈ=YZCɷiK*G  P<L.]}:bP%2v65\]{c_mҟtǨ[s@J_mֆ*H05>6 rZm# u tyzYO[X$QN'vu8Aȡv<C}GZ9{LU7 A A­Sƛb)*[ L |WrDblUXNSn*zb{bjTuvX5j Ӷ*hqUR=1VV銻0b8bNf1WK\ 5ث]r=Wf*5VVڃsp N>U\*MWW*VaGrU*TVlUٱWf]vlUkb9ɶ0.1W5h*zbRH;)^l er* eVfGثJ(+e)\Uozeq޸|U+l*oz bPSK lwǡ=0!k(4?dzԝ^n~XQ|qVQCQT;74_ m9LMmRFhAǚtr%-CE&VJ 9j^)OdQGR)QwnMGw6$*Go*\a BdUW6;#vxr_a>H<~o" :cH«PmvWL*nvQW i[ͅ dWYXC^DM9' zVb͊6*ثb͊0"GKH}"ow*~y(؆͊6*ثb͊6*Xj.2a,#̫GdblPlUٱWf]vlU7u,?_ rv#SvlUٱWf]vlUM CV4 ᕋs&E?xJr}_[vlUٱWf]v2xđ>Vby){$Wf]vlUٱWf]+!Is(, \eZn8UqZn8U Z'|_ؿd}p&A2Gb r(ScIǁ-ZN;BĭPWaM=(9bߩw ´9P!-]u*׮6ڡX C'ZdǏ)BmInY&*xN-i!}ÝT5RqpIyڑ[5 |UOl3W Jlm/Յˑcl`H0*yorJɄ&;USueVvWS|m9{_cXQ޸% mz U{똂,U 6aUԡߦQ" b^SJנ=qUH´quNT)l5:eS f]:iڵIaA-ƨ +%52,ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثbÏ)NGBgy2IvSbC^)vXN^k,bUn]1WfZ͊]*b]1Uqءثb/9,Z˦*Z1Wf~)[jb wQ«jK:UC,8%0+Y[qB+eZKS, Ӷ=p;,Y-m"B;*aJ╲0:g6$d \Y@n44r4z^wiW“$ebf]vlUٱWf]6*ثbf.͊6)vlUP챊0T8زv=rJUN%آUCL(haŗ,8UMB(Rl]*C8ŕ*.,T1e|(CIŕT+NJG+BN?PxN<9ƑJ&)==qE q==&6Hg5#,Z?CݕNė nO>>ɂwlnfih6q!SH#KwcDqi).M!B,lșt0mN޿V Ю}e"$lz]dw'؊~IYȠj|HNFK_wbqDvѧP1#Tf[&sbTSk6*]pn;C̗^hH>WG/xEDWL: %-_e2҃rX|UٱWf]vlUٱWf]vlUU[^*2u4]5x AiOO)U =2V2B78!=ZaZh0= qVY pfS.܋\-f=3y3H$1T@b'W3enox@s)^4a1*_D#wm?~oȏTn rhK0($Jy]45.-8Ep/NTWiȜON4pl:%?b>o)2T`HP,6[lX8I늮cه)$̑ov㙰62wYQ Đ=+\*yVɮlUbS51WS6*UٱWf]Lث+;/vlUٱWf[v.;4UVѸϒ'=XS9~Qarp„ J`Wf]o6*ثb͊6*+k6*^*b^*U1Zv^*qҴ\9cip:2 y\JRƣ[ͅ[VuN^*Xb:`h=r̬E WdQIcW4M0^ dʪ-ӨSciE?91Ba?,|skdPyUHg״>!}ky =X )tr,n*i">G0ܽO}#("U5ɧ]l lUٱWf]vlUٱWf]vjWleWSRW)PӸݏo sjQҧˉlSjO,{<1j;dK$qjC`w G¿!Pr $Q`*azi8x82*U |9Gn2!Z~śaƙAopleT*\r/d$rDY}%k؇'-TcZUO@P v!ݍ:,cKaޛx0-XKn);UfEzoğ]N Ɨ.9i'0}ZOXIV] ;:,j %q,# Rp7on/4cL—դ_cǚ4_ix'#bۥI Oh?gb[;4AEㆯdz\C#Ka?d7{/hF/Ս-q˩ڷٚ3ul6b?vfxP- QtZ̪)*v"Y~ %Nc2ӊ71xƕNWu4r1K|8JЃ↩.ȧNee'" Y&C0Sb_\cKn|ݛ\V+cKm>?߉1q>۸ EJZ|4p_)l'@ˁ r,!/H -]D,־u(vXo_[cIr1Wq9'~L1[w~QdVH?#.2 }89hS犸$JfHJO-px aO 0Sj'5>RZbP}ޢqϕ_Is*&J Nc E\Ui݇ߊrTaJSЃxRqBXE5_X6za $'ӛ_r@|FH2/+'Ǩ*bk\@Bq2Tln7<=7O+GU7ZTh3]D=HT:9X?FھM}Is֧ h_2AT`=^My(~~_ Z[Z?RQG~X)?jEH|c+ɩIM"- 0 [|VH6Q76=[W6ubF_/k6*ثb͊kz7}8J1EH\!=y>Z/ϿK.ke:F:+>:Pc6*ثWW/vlUٱWf[ʯ|*r%lpcjUi//B p Ld ڢJS3-;r^UElRFW~Uۙ$5L6 rDeu$S ݚEisJ q ȪlUٱWf]vlUٱV͊@rV3i]O bhz>8~~]+ZV[S aDHfç?rU5 "߮kZ}hs5Q(q[y18Poҟ,%עwcho\b)lRͅWF,|p+uRJb 0*5銵\5[WeG/c=WeaVP$t[҃o(MA]LqW k,*쮇o**RUSLU٘TiMhÊNlA\2*Ok5<0­M+|bfv)k14—e.Ln;yeWӐlQYWf]vlUٱWeQla@c~cA5%{ )LU}y ~P)c+ wrV\ҴV)^) 2 |w]J$•7?(m UN8T]Vq>4V O|U; UwH8րb:nGƀ/,8W#p>⁩Tʖm){T5qB7b-GieRBL ɿݘD!QQoQfUx|r)D߮hJ|Q6,RJv@} `J:WA sUcf=6%J.t#YmU|2mFkFXT myOL@'"02 +k!)3UcLLT[遤0ok,{!T~KʼnXW&/V}5Owգ_05l?~s1c_sCOcN,GcV]_m|0x݀ǯ,VᆾO&ifx۟ocV ^2_-i( J{m'>B4ck ii%i qoOm|07Q i$?m|0﮷4p(1pBZ^FV ak(Ej+߼~0[/ gO^~鍧 }x Wֿ?鍣{og_ _o~cyim~?>c~]F~W?m?qo5ckua~sw=QXڬ&4W O'\?!Τ2 '۸`㒶\m~#F5|+GM0[_%[Yc{I'4wwQy6.>x;Jp u/EEkMa Liezn9TF-k-I\xߦ\c7ck7t_يoO Zڌy~z;QE%9j{ZXd~QHG Sa%|Q*2ʴ_͇H*z8Y$\j6 g1Tla=层 d}8Kn )_$6+YL/SV::}ρdZMl->)ӊBojClAw؛tH%QkZcSBoCW3?cZĕ?Np쩭f]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثbÏ(NGBgy2ii9M63 U/h XZ9`bD㩊LU1CG] Ui8aKqi9*W+;,b9tV51V R99xW;5qWf*إgN'\تӏSZ#.>8ЌثƝp9ApeWlR( P7V,\n4T)rʥqU2W prx"E9tĨWcX)2Bڙ-℁B1T8F8GVVI7UTPѺcxl)U"}mUePEq^$a2+ RTMѻ1goenzF}[iAS޽ eDL|+{^g7Wm]݁'r&WCO)`~U)؀i*<1* 7 ҹ ɧD#RXMGA"\8XH\m~G|S K]o*͊6*ثb͊6*v+dm6X}B=JEsSv2 ob]U^@ `T{ҧ1ȣIBʅo-Z6́Z͊6%]n}v ~ˏ~~_= ]}6-gx.*Ls%9<SHf24﬎Q̌y{ {<4#2GLU$wCCF*b bw[ZbVޙ$bo,bf481Å[.트YnثC.n;KU \+#Wfh啦|qWek(Vl)Vrj?,*mTVYS6­VpVmHo08p9}qKY.ʮ*ثLvyPoeU clQYWf]vlUٱWeQƹck ^t͹ۦ(r Ɲ}媊bXZf2aU{)B>xyS7$,8m9ns-5U*=;P{rOLUc)㊴li)트MrӮ*6?F6IZG% 8UM :%+֧)SlUK T!ҽ+T^2WuZ~21a$>ta.2?W"EfQc,d1nqPNIQ}6q5iMh W12ndP@:F]WQZZҲ dJUNG%Hh#?O|S2Z}b]@b:m>YY..n%>[#xWpVЭl = ;~֟مO̓8>WZhTՁ+ u$8#ZEqF*1. jbE0,_a Y9",|H7:" E)Zl(k6(vlUٱWf]vlRGSyqIlkAY!C6*ثb͊6*إ#[뺃/넵ǙW(=H03P͊6*ثb͊6)vEA_0["?o%8Wf]vlUٱWf]5ee:<0$-^܇Nݏ}p2Q\RثSv]1WW51Wr G|{6uV4 ' nYJ,8eZ \8i yf2w,~#J#䩪<. !L4|p\R8.,/ Zۋ*,8yV?$ +U27LoҸ8&B.XLi+Lp,2p$%~U$@5#q) QgF=Nؓ1ˏU3@ 'yIx<6nʇ̍j"WE+Jˢ_u%a] 2Q=ʞth(m:c:G%XFlg(hJ~XI*խWLHh5{@TTSqO)Mcj 1Ι$B{txZ-uE>Wq7I_{ڽ3;n_%I>8:׮/JtʩUSjv 9)35+lUbv8U0]iLi)rzoMC`oe ד%U _}d⟨.Zi |,enKv@z0ZĔ9i5FW$'Ų)47_"rdNBSkXPQ}ikQId M)47jAȪ9G+GM C#0.^ءvȷ_xSkPQzo'ue?PdwJɬp^RV*UٱWf]vlUٱWf]vlUٱWf]dmo??ƹQZq/ja:z/7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]īs6-/*eiҏa,-9+cOTFD]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWdSϣ5fFFF\T3b͊6*ثSvlU͊WW51Wf]va\R2w, "H%-{HQhiV0;*8?1 r;M0_)z,fӦ18);,;JyQIWqYt߆/]lQDImm x 2r7J-Km${QeH-*Au⫊o^*lUٱWf]vV*lQ ѵn718qW/KI!4#eZ";䞔^(vlUXUW^6^6qyq=! >L2N?iF)U=n]#ŸSoAO"xةk ='^^BbVR`CucMpVq rʱ5-W2s9veT UOC\6m\U1CY*f;cYG\)mN1wqkV+]\̴][ʡ;⮮Xq\U4銵Lq]\e) 2N*㏯cZXajثDeL h[ e 1V51Wf˥zba/ :{{:e }9ʕvlUٱWf]vZwlade+kL1VcXU+劷Z퍭6«|xV7MbԎNP<@q;kn]L Z偷*;P[-h+SqkUR1҇ "wZFqП P xI\Uh`hh5F)sE;z}|UI=lR$[#dz~uH'pnŹMݤBs_MgXjY rJlf&$$?oqZoM?,FUR1% `),arX:dR\i8o, r(q iC#k0SVҘT®T8L0k[LPbǟ$_je$[u?3ɬb͊;6*ثb'273SՏ_Ip6!b͊6*ثb͊]*)όuD] 2E6*ثb͊6*إVIQ)>6lUٱWf.͊5qWf[/GсU0y<ずr㊵\8U Z ,.*lYB 7|kTE|A"lB50LiZ-k8&(Z_[, բlK(D_$p3K㆕a|0EZ/*n8Z~oH0e?XxøT2,}UqBt*eV㩍!i|PaU c=Ɵ*%sU?H# p(T FH=ʹV# ;}% X}}_o4In`xУBo_e 52NVF ĸ(q-p[9,0z,J-"m1RE= D$H=h)c51l2­ĈŊ*uˮ)[JcZhvǺvB~N6Z훏c5Λ{+JF0!\WJfvoGLҵa+7jq0 qU@̋V\UW|R?,c;⭁L' YZb (*vV2u5|1WeRWf(usSur*9x8 b9`Nc트 pV6_LN;Z/劬', UkcT1]4w8J7̽1Km.o,n^Y]*Ǖ'lP%1EN*uciLc+@@;`Vv#mCۮ)P@Y10'BqǏL ”tHJa#R@©l(#ªp+^B Il,ASjF? ]y=*hpLF8%q;,Ec`^bX}G?Y'RmF1ҿ@ DAop#1(Ol]l-ݹ ~>m\O$ fFs`&-@iPO?丒z3]j~@Se- zF(8x"EWڴ5R mL(|s=I-q[olحlث2Vb͊6*ث̺Oy\)AePJy>яXE bz63Vg}ÎrJ;5k.69Cb͊6*ثb͊6*ثb͊+v8!;(?~?eؘul7 tdJurWf]vlUٱWfһdGYS rԟr"LNȻR&>%GC1h )핊͊6*ث {W:pPxOZrQ4 |@;Q2q]̧nTvGk$V#}ooVr]rYkg >-œNmzduӇurb2 61We5Zf }ثW(]\h6 5=Wf#|Uٚ1V_ ReqVlU –cE*qʸr*rr­b|VRp+~G1Q(m-qW bVUAYjU:W08G(hi\R3R:t-f(q*1V*챶*WvjWa] )`9rB?NA2E]vlUٱWf]F*齲`609JF*]W=pb=2ɨ.~ Uq僅ZS|[Je3mTv)i`w†rmr'q#8J֔V1*X8Dm8 Lc!;UzrշVM7'p6:b6Ƙ8KAN6}k\zW:lUOmU5q`6H*;?g ÒC8=O۸dvQRV!FH6r3~Ѧ`XK^>Hޫ9)؆͊6*ثb͊6)vFո_ kTMOIp6!bf]vlUٱWf.1z5\ l[LU._PY|qV*X Xq~LZi߯ cJ}xh~YaqVeZ` \1VeG4귐U