\ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 13:52:28  "*(2"HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)A!T<Мe) YvװDdii,[ڭ =6c+wqLObqH j/sJ29@uS:4qBmBoH ?i-.s+]*'eY(=#%))2uUZvmlapkw湿Q+W%͡ ,vEUQͱt @9/Gl=]Ig9p?{gڟH2ZDqډSy@J p<*՟ҟ yILI$TI%"ƏvUk ;M0{q/?Rk06[5 ^]^Ws+o; 5Yd.#nsOeloH^ű߼VO.ԆKEq5?eYue6cKcͿO_'(.`_g#Y>[;gzUQqPtlp.#cf-ʠ-% C?7=7=_ѩVdTCugƺ,߷{?>o3 gۧI*c"cmkt7]v^v}=jw7ݙhX]Wn'J,cYҩ厰4 7:O[gu>+m9W+c\ƈ{n]g=9s׼cVF8l4U2*M_c?) M٧lKӶƷ#{h>1Yfh-»v[[_ge_4ʆS-]^F?6@jʷn-,k@#euWMZ޵6YIՉ̜VܺwTXwMKѾYk7WM[CqͱJAҳbd{'CޝV}?;?Q X_Ztn;%ZCNMeQ$}'P穳s/.ȥc<9ר11kZb}OY,>2}lc&E'Nwcݷ3 4gTΛ^E\[[¶S-gnv͞}R깽cSsm7?FֽuVM~)9B˜֑88h5qquloZeS\Y7SuiJZwI$TI%< =Og .%fslz\r \i }LpvDU樳8`p?nZ?P@wGVNl_҂cSw1nЯ3. \ms]ӽI_[ .w7;צ wQVclkK@lk S0?*wFP܆) ;ϧUL_y][[aSfߦbrOigOzlow ,ߴbAC@Kg{lpkrF9 ď >N~%3X7?t{/'HU$}'Toٱlg>E_g6:AZ-鹍Y^{l\yy*D'k=ng75_cŽb[gaY[om;{Y6ŏ)rzxPi^+4Ɗys2/w?&̬ qC s]{wx_6O7cVM`z7>lwOgӬ2h0RZzu}NKtk<[~;?E?nԜejkC@l/X4WBd} ~Z{Gַd?7TF3niۏpa } ?g1_Ds Ć 75WcgR=4j̠$khxѭ2K[? =;q6 p>_)FRHUs>}ͷ+N2JtE.Mߣ͏3}63gӦg/w3sK n`C^ָo\v1ɵ${][=̷/!nTPhhlkOf柳ջѽ$zĒI$?TI%܋ i{ 9s}@ޘ:`=`ɮ+]^{p5ś\;K;mulC:jlw#Ȧ3 lſ^H`11v4uޥi H/o!]f~sW/~to"Ζusuy2\jۛg=Y>Mh&}cK*? @u@w~}YY_j\[uHs;{}}6a-~eGJM9z4|R>e I$oTI%8. u+6mU\Vƒ l;O?ySՎVc|;f?W}umU4Cv:[SGAN1VgSgSnFI4j]qjRƽ|s90nMk:9Iⶓʩc4~ C5F&6bu{2H{XekZ h-{}6IoTL.ǻLʽ`6>_~?qt V6qpk@ \?EvbcEd>Hh&b{F?WŸg3] uQݯ:e>*c;vUۦg˦M-{$Kt露~ q6]\-s7w- :x;\WmnǍmXͤO+-Aƭ/d~̮Ot1gPOxc_K{_zn{=5jt:/x^ lmC{!A;}v $rTI%>}֜:Me7Lf\ǬMlkZ>gg-AοT[YMn;t%٪}Tr,, {J"d$zzĠ6\7^5s\X .nmϪd8:XsѬ޷^ij;Ͷ3~zպZd[փ;h^wfу*v C] vߛgRY"u,o*9BY kv}5Dzh jmqSdTFG*#ewNv YY}wq*#yu;U[L}81ՒIsxc@A[O6X<tD_poV..~{ٶ7-Z(Mj5^/W?DM2Cɾ,2JWBί$=uAWiTS9VUXcfnjzGYrnɬRX~D[Ek7UsW w??z$@݁hT@i-6GM˽jkƖQ֜/Wu $t]Bnu`Ïc'zSd r5,BĩtI$bTI%>q#-C^(Atڳ+SUwhnEDsCV߫r̪:xcέ-#쏩empG/֤o2vNS`ݶa qw6;e6;^_h58!9OZ'^Oʯ(Qz/zҩqx.ҭ=sw>$rGP]Sl.2i޻7nJQ@;pJ#S*wD`<Gy!vMr2ga"'.λm) kWϷx'cOWMoWC[w_VQ`$nk7zdRK}q??쵘.7mY]U]r*psK-[}tzrik`c=]v;g?}sYS NHecFv`t _ԽL K2Xݮps}F[r{jv5UԾOUGRuGW|&mc\;#v9C#9 P6?}֩QFG0(OԧK#~mgK_~LEݭ1moLuIY4P!)en+ !5[7:{q s=Vunݵuq zIHTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTVersant-180_PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM_ update_maart2018_v2-7 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM >q" Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)A!T<Мe) YvװDdii,[ڭ =6c+wqLObqH j/sJ29@uS:4qBmBoH ?i-.s+]*'eY(=#%))2uUZvmlapkw湿Q+W%͡ ,vEUQͱt @9/Gl=]Ig9p?{gڟH2ZDqډSy@J p<*՟ҟ yILI$TI%"ƏvUk ;M0{q/?Rk06[5 ^]^Ws+o; 5Yd.#nsOeloH^ű߼VO.ԆKEq5?eYue6cKcͿO_'(.`_g#Y>[;gzUQqPtlp.#cf-ʠ-% C?7=7=_ѩVdTCugƺ,߷{?>o3 gۧI*c"cmkt7]v^v}=jw7ݙhX]Wn'J,cYҩ厰4 7:O[gu>+m9W+c\ƈ{n]g=9s׼cVF8l4U2*M_c?) M٧lKӶƷ#{h>1Yfh-»v[[_ge_4ʆS-]^F?6@jʷn-,k@#euWMZ޵6YIՉ̜VܺwTXwMKѾYk7WM[CqͱJAҳbd{'CޝV}?;?Q X_Ztn;%ZCNMeQ$}'P穳s/.ȥc<9ר11kZb}OY,>2}lc&E'Nwcݷ3 4gTΛ^E\[[¶S-gnv͞}R깽cSsm7?FֽuVM~)9B˜֑88h5qquloZeS\Y7SuiJZwI$TI%< =Og .%fslz\r \i }LpvDU樳8`p?nZ?P@wGVNl_҂cSw1nЯ3. \ms]ӽI_[ .w7;צ wQVclkK@lk S0?*wFP܆) ;ϧUL_y][[aSfߦbrOigOzlow ,ߴbAC@Kg{lpkrF9 ď >N~%3X7?t{/'HU$}'Toٱlg>E_g6:AZ-鹍Y^{l\yy*D'k=ng75_cŽb[gaY[om;{Y6ŏ)rzxPi^+4Ɗys2/w?&̬ qC s]{wx_6O7cVM`z7>lwOgӬ2h0RZzu}NKtk<[~;?E?nԜejkC@l/X4WBd} ~Z{Gַd?7TF3niۏpa } ?g1_Ds Ć 75WcgR=4j̠$khxѭ2K[? =;q6 p>_)FRHUs>}ͷ+N2JtE.Mߣ͏3}63gӦg/w3sK n`C^ָo\v1ɵ${][=̷/!nTPhhlkOf柳ջѽ$zĒI$?TI%܋ i{ 9s}@ޘ:`=`ɮ+]^{p5ś\;K;mulC:jlw#Ȧ3 lſ^H`11v4uޥi H/o!]f~sW/~to"Ζusuy2\jۛg=Y>Mh&}cK*? @u@w~}YY_j\[uHs;{}}6a-~eGJM9z4|R>e I$oTI%8. u+6mU\Vƒ l;O?ySՎVc|;f?W}umU4Cv:[SGAN1VgSgSnFI4j]qjRƽ|s90nMk:9Iⶓʩc4~ C5F&6bu{2H{XekZ h-{}6IoTL.ǻLʽ`6>_~?qt V6qpk@ \?EvbcEd>Hh&b{F?WŸg3] uQݯ:e>*c;vUۦg˦M-{$Kt露~ q6]\-s7w- :x;\WmnǍmXͤO+-Aƭ/d~̮Ot1gPOxc_K{_zn{=5jt:/x^ lmC{!A;}v $rTI%>}֜:Me7Lf\ǬMlkZ>gg-AοT[YMn;t%٪}Tr,, {J"d$zzĠ6\7^5s\X .nmϪd8:XsѬ޷^ij;Ͷ3~zպZd[փ;h^wfу*v C] vߛgRY"u,o*9BY kv}5Dzh jmqSdTFG*#ewNv YY}wq*#yu;U[L}81ՒIsxc@A[O6X<tD_poV..~{ٶ7-Z(Mj5^/W?DM2Cɾ,2JWBί$=uAWiTS9VUXcfnjzGYrnɬRX~D[Ek7UsW w??z$@݁hT@i-6GM˽jkƖQ֜/Wu $t]Bnu`Ïc'zSd r5,BĩtI$bTI%>q#-C^(Atڳ+SUwhnEDsCV߫r̪:xcέ-#쏩empG/֤o2vNS`ݶa qw6;e6;^_h58!9OZ'^Oʯ(Qz/zҩqx.ҭ=sw>$rGP]Sl.2i޻7nJQ@;pJ#S*wD`<Gy!vMr2ga"'.λm) kWϷx'cOWMoWC[w_VQ`$nk7zdRK}q??쵘.7mY]U]r*psK-[}tzrik`c=]v;g?}sYS NHecFv`t _ԽL K2Xݮps}F[r{jv5UԾOUGRuGW|&mc\;#v9C#9 P6?}֩QFG0(OԧK#~mgK_~LEݭ1moLuIY4P!)en+ !5[7:{q s=Vunݵuq zIHTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$<%i؋-;C$v<[$ئm\ac}Ɩ--;,8´l-;YI Mb'~<%iٿDO><iٿD\xH~<<.ǍWA]x A](^Q1s>|2ux2Ouq-=q8T\I<2aNӳ}U:cKNZvW$Džiپ)iF\iiپӳ}]-;7՟eW;ѕ*]SvlU٩51Wf*]SvjbC51Wf*]#$Wv6SvjbLU٩51Wf㊻51Wf*OLU٩51WfqWfqWe8;SN!cez-)~b (i^醖߉ NKNZvoELiibfKNҧU4Ɍdd"Kn<eL ~{#&] }8 )4+#q\З>Ȉ~{8KHQR>x8MZ/"N |߆eGlHciلLMZv_ӱӲ&i~acZcKN-\KNxJӱP})@f|`ߍ-;+eBZ҃Ɩ|߇;,iœA^+kO ]6V!E*7bBb -k"'vW4L qWf*8Svn'vjbLUي51WfqWf N*q]*Bƃ*' +q8٩51Wf*ثWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v^*UxWeLUٱWf*O*O*찌z/aӳzOv8[JwqJWcJ Uقb~UF6Aһ7WeOƕٌN?diلL{Ck+JG*쿩oӳ}Nn}+N9f8Zv_n:opN<%h7.N]8xJvo\VƟpzD'S]\lG-|A]O݂ޓWfO݁]?vZva?v4?+oӲ'?v)epoӲ&?v(vW4SvV*UX銻+v]1Web͊.SvlUX銻+v]*]F*UxWe͊51Wf*ثSvjbLU٩6*]v_qM;7qZvn qE;7=*6qWf|*ޛxUٸ7Jޛx7ӲN;;+ob>7≠KŔaS Ef8f8fS78W1޿xJvWԧ} EiFU>ez)Rӳz)+}iF'T)'ӳ'ӲqCfث'ScJޓ)Wfav_'7'voBO?vWf$S`vWxM;mec+Nm%nii„uLU٩51Wf]vjbLU٩+v]*]Sv` 銻1R;bLUـ'*]SvlU٩+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*b]v^*]SvlU٩LUxٺbe0WeMKtF)Ǯv>>v,hf\R]eh7Y$ nE. Ļ.18&}v9bFLD; RKݐAv +Ɉ;eR0WOl_2pw߿r V3O885~Y` 1yDדqI˭rX-mH\q-h~NcrzN98v4+Ux<(C]98.ǁ;Av9~bCf1CbeSva͊]vlP쳊51K*u1CWet.ء.Tx`C#vlUٱCRŋbe;6*Uو]vX]6eRegwp.EvȡI]īJSeP=0]mǢ R{aWaG2-v k\%•:R(l=JIʁ S4gqJO98<+(4"welNzWV~2p.6T1㒊]$vn,b.aNʏ ,KN eܟ|Cpv,FIXTabj !KTrЗb-㷎T9̵ӆ\ٗӒ,ݗ۷C.NKKx6DŘ75Q.jy3¥X6*]0]fw]*쳶*쯞*ثӮ*]Ê]qWeUن(v^*쮘f#vQ;+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]6*ثb͊/6(vjb;We.])XdQFp w+.Eڵ-ؗbst%.VRG"ص`6Q%N(6`&Uز'vaCnpROn!!Tgy2.q ]F\pBM&O&дAad۷|]^WvQ/bSh;l*֗;P%æujje`WfC UvUiL죰%ؑ?0c8mV)ǯ_]#\Xӱf1C)vlU٩beb]])vX]F(vQ]텐v5p!ثlU؎*ءٱWeRUمqCu.͊/v`6͊.SvlUb "쿞'e.cf!Jb]M~Xf.M)"U;tī~"f]}#7cAۮDsArO~q8; L}_GC-MAx3꧛GqMaY,r:v4p= 9)Ajj iUj2%&.);{ v>>bsw:xx’ZOJPav+I!4d"dN؍V亳vf4c)،m^yš|3u-Drb]!ٱWf.\UٱC6*졊*lUCv^*|C|R*p$|UXg|UXKbeUXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*]v^**vc0]vjK‡eJ+VqC„cJwqdT;P.RK;2up)v 1rv(PGw)v*d l1 v +~j[%Hv2L[[v>=_]P q[6Eb>:dr  s.8xWAdH.D6XG.uj 2RdNQL#aǥ1KcMO|l٫H;c(E]٫;O1b]SCًnp!Rݰَ)vc\ UxٱWe ]F WecHvS v>g%ٶ4-(Nԭ:<]~`v+d@P]U |ٖiҧ)iv!Jˠʦv]1WeS51Cbʮ*4+6vj͊-1Wbj 6(va*p+u]1We0Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX]]v^*Uـ—fN]0JզvjeUt]8آxbrNlW`ݗlz} ]}AmKMAR]ƒ`"ز—ce`*ekJ5bWn1.PKWlWeqWpzw$G&8 v8ӏ__z-O$::ݍ$_1»c%-,ڬump3RbȫNWf`i%(HT9v4xKïӋk '`Ywc QC*Vݛ 0FvV51C+b00\i]HvjcJieێc)5p!٩.́qWf]]L(vVt—f0+,WeWvlUCcZT`v9E>x$ۋ쵭>)]g̿f|]UicN)vSJz)v/M4نø$ZZ r푽KA!q,n9ru8| ݱCZҀSʦyi0o$ nW%؅kʠ1'00>~Q].Zִ:e؄ڇ` cv?~XHWb`hv>.FI.Hĭ5!GH)!ؤD%m]?rgwι>-c|þF]=vS}$9RSJ UۦHRb:SeGN F;0?y'ja "˭E2Wdí>XO5v4\V{Rf+WeY;|K4ݷʼnv&F٩,t®]p!ٱWe$vY]0vX—eUXē] U]+qWe 1LU٩qWf8]ٰv^+ *1Wf Uت  7ex3Xe|,|fQCC R1CeڕmJn0v,2-AHvin+ea;Qv ;o`N8+N8 ׿V2F>!@~g'.hd-QؙȆ`枮'. 6R`;Ӿ%]mQvĕv5;E]y‡bIKէ_~Uj .c_w6:&쾢?ޠnOjHulBavF90tQ&~=h*e'f0+\waWc`K:)]QӑCmK4kL퀱vc]vl]Mp+50+*!. (Uc;\/v(+;(We *]犻.늻+ثpUٰ;0WeRo1Wc!رڿ,0"P]u;0.ʗ.̣c&uȡ٘WœacTT"Ym1ve>#a\x(fE#bM<08‚$N+#YLwH9:|D:*bZ9+ڞ(VY,T֔2%.ljٱWf9$5r(vQ*bf%vlUَEʦ*v)*|1K aWf®p;(WeֻbvnU]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*+-Web͊6*UXb͊6*ثb8+b8Wf];*1WcqWc!ظ$mnLR$98.\2}Ry o:v=r,]r#.nʓn¹Lv'\ ]=S"QK5h1v46%. 2IvfWb{Waӓ 9j{e%dXnO,۟# 凣hh=:n0e-xxnrW-epĒ:#%ؤ`z8Yoגs1rrmpO0Ê55'c e(f=%.m0G\WcGL*r;H~#a8죊/lUD]*챊5rJl(]b8*ث늻1KcG\UxU٫]]We]ؔ;+v]qWeTUx+Cv Gl7e2%ٗJa v`(<0`b]A;1*䢮ƹo ]5] zWaDSfvñ+7{G*y5Z$!mOo}Q>a58㤻SWHv}"Z6vRx f52ħ? +.aqCClm];C*X`Cͺ/ӓvRĕv+OX:p(ڇVQvQ Ɣ45݉>v~`˒Hr$8cgQY)''a;[K1/犻(b]qWe Ux UgvP4]LUٱWea v)Q]\tK99%v^;(Web]6*kb]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*rōI6NĤ9c0!ٱWf]vlUٱWf]vlUٱWf]늻+vjb*vjb˧|UXvjjhzbظr턫\=wcdc—aeȡJ )C'QO'`MIv9Hv#C'.).#hvE džݲe]liw캃v]u938A{'] sDn壘~NƫT# NR(1v&I—f*ZNH+ڗc—b)ʺGZmLTvZl .ţ~6Lvv( cN˂9rؤsv/CO|$I~)]>;]بt=+AkW6߾@sse}N9p62´t[v+v#ǾG ׎b͵+E7wKdIWc5vm WcA8i.ƍ#;ncڞ;}qC ]G`]f1]vlU]1WevlUGvX]JUU]|U\qWe+U]5;bʦ*8UL<0+We.8*ثٺ`Cb8Wf]LU)O\7eµK)LRO1,Kါ. '$VݏCTצJ:GkNy]Qsv=6#r6 qHc:$"kSf팍)*=cݕ ׃j(=tAl`75#)<؇eCODӲֻtFav)v-CJlU؅))ؽ0mUهl*V6&2v9'eP@v84sd$PtL2vY)\a͈Aӑ?K"t-#Sr ȁZ̄a)|sO_ SzniW3ub]_ M\hNv\}9YjbUxWv^)v^vUG|U\ m٫]ٱWf=)]78K)v8vWlUcvlUن*U٫)lUUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v>.بzdbUٱWf]vlUٱWf]vlUٱWf].,b*ݱWf*ث UUGv-œPNJ,ўktӰlG}ά:;UvĤ; %5ʊ #CK~Aĩv #$QNpl݌pv*;xaWer*2eHvz]_Uc+)Q\CWcw68AZ+ԟz {{ uuKQh~CѮ݊k|"Z' 5V2<P75faiFcO_f^˯K( a>945jiȔ;];-v?N;3aP /Ȱ.bebˮ*]vV*ثb˦*v;vV*v^Ԯ*Uؠ8؝qCWvV*͊/vUqWevV*UٱWf8WeqWfCbj75Z`* ]v 4h`AvZcC4~dRWeCA.]P-Jml"zzSDsA㎩ƣF?I@v[z}~ 9ew=u`Z=rC6qvWf=$̻0ϣtOGf;m |'E.~(v+8UN*D^رv+CBb';-Oay =Yc\&,)lzz9v 0So,P፸QY xRN™:MnPUٱWf*vlUٱWfWebLUcvbqK;b 98Wf]Wf+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊Ͷ*f*ثb͊6*ثb͊6*ثb͊/v^*].b\Uن*L)cl 쳊0v+އwv 90w.=ueO7` `^;2`?aN>!v%_B]lpJq>-ؘ5ⅲ+j=D,sveRJ{`*.Z؎;o] a+N"ؘqRX O)dJ)Y Waҟ! {ӦHJCu7E;. < 2b;Llq.vlHB;|?K#jPe)xd7b 2gk;(^ ArlaaN!GfvY$ 5v]1WcaWcȩJ`Ko—`yEc:C]vnٱWfثbLUَ*Ԧ*إX٩LUcvV)v(ÊTfوˮ*b8LUو]UXӳW Ӳ]W)4R ]d҇ ( btl)v(=cjE.v*<2(v8 bztɄ`zfg9;P}9u b=%TڸcbhCdN%y w`Cv#v锕!٣(.~&@v9pL݉!Cp7jN;d-]o햓3f |bx\m]l݊׈8 oeZA"zDUk_@M;0=?0vh6ۦHR@KTzi\03 qKs;7AWe~=2A]\ cˎA.&:`Wf1R{W`yLP]LP)vX0!C;51Wfl,f]qK.́ʡ]]]F;(WeaK`b죊1Wead/v]qWeV]|Ut..́آ.dQzbwdWfJ *sץNĻ]xnWc٩0]`vZ|Xo]yGzo0qv M7ؤ|F\UniA8>==J;Mo Czҹos!nz X`7rS1GCWe> 2}CC=1v&zpهlUر8vR6Իdأ mu@v\}:a'fH%iqAv'_"y"?kݖE1ǏXp$ .6s_-Nj2*bP{ UeRٱWeS0]b7;b]KS)bUN\Rbx—f;v7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]qWf]6*ث*]qWeSv]qWed챁b8Y;08\.=p;mdXi.іC`} Lv#ڍCҹ%nK2졄Iv(J4ȕ.!ig_EicEٗr=OvvUA<Z N3q-OljN6.5;ңdeipT;B+brW?cד 2 I>8vUwq*]tȫl!].vY8M]〥p%cR 1(.ƌ Kb—ePU}v]NŋWeCaRvV*v*dc7‡f—f.ʮ*uqKaK1v^*qWe5qWfqWepvlUنeT;ء.7vZ1We7F&NǎwjS$4v;s̛䂻! ӧ\ɿHmï>a{~8ÛpʌA z]9$㏚CcJuDuFNgw1$92vP5;tG~_~A>P|{V;b—c?pcv[ +v+>.ǵrv;E0lGM.˧Fwsc؛L%* =vˇ&ȸeϹːk.†Ĥ.Q˥:N*mqWfxbqWfxbeUM2 !!حLT8(d6;1Wci ]CvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث銻+vlUٱWf]vlUt]6*ثb]*ث*챊]t¥ـژRث.:tTAب;$; d!4sc'bL; J`cl(v>*rĻ/9(d8Iv1H9+AJv3`8|y%=zu~߹.p]]^HKLߡ]({YUi]ɣJ9z;)tY;)cd8˱Ȼo\Lñ=N Qr\00 V)vX|vQS˧]vS*1K.8-*1؈p1vP`ˮ*UUcf]Ǧ)vU7®;`CWf]\Rkb]N*.́](vY8)v^.͊,]4—f]ٱWe]cŐ e&mZS / P?Fve8إh;1WcvX]q< )z̼|f{wȓRCؓLWu2÷mȞhZW½}ϛ;-ɠrhS=ͱlbrNW?`'wƦ2v^l#Wc|TP spF ]Vv`w] v:1U9 e(ȡج]wer͌]|;iMACK07dd;8 z{ XӦVZC;t'vcLUGlUٱWfF(v`.͊(0eҽ1Wf|1Wf4ʆ8G"]iF=qZvPVsbsؕaSnaAv͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb˦*ث㊻51We, K0)vc T;0 D;"آҤrqfq-N6IENTTpصJEFLdlJ0O%v>%v9zu|2qCǦE]})"-{]0}5elTTMdԉ5qQ9zG&.=lXR*~er<eHA4,lڣ#L&#rh7'F'Kh%LVGҮH0Kv&: ǧ\ vY]aU$;0ZiKe79\;+Q\U]2iEWq׫#ҵdtX;}ɗG l[ rv Hva*]]b#vn?v*bF.W|Uف*ǥ1PIldEdFӰ B1eN1VVHwS8NXISNzE;͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊.6ثm6*]v8.ثLUT]PLU٩*vU1Wc*va7|UٽWc1Wcآ-7!jFXY`H0cd; 2"Ļ-M(v ]׮,̈́%ؖݲCc+ψWciZrȩvJ _ff%OMWcj~?nŔ:,\qfܚWY(POV=鐈pI.SOmiңd}MjܽzTdg.r%#Wf|*Mv]F(. bP]`U,0]늻*t]vXUGvV*\R|}qWc(vc*b͊7LU`8We]6*챊0vjb]anǨz. -1Av&`>)v?jSe%vStv9:`We]zu=3]{fN.R2##`]w،1.ǓQ.l:>ХONS#]"/ LNZm,O7c7\dhFDcnu N{ʠ®Uؙܟlvjm+p+>$;2n0)v=6>lRY{Te=XEٔZ:lvP®ˋtȔ;xaN@gѱDtz .|0vo])o]G2!]Rȡ٘m ]MH``..*]N*]qWeu]bHKbeb͊+vlUxUCvX늻6*]b]u]vV*r`TV,k!tlIIvTG\v5NuɅv9P*{Wc8vXJkL ]:yނm/s8v O!Y; zdz74C*j{_S"(6qzS)j2WӖMn㍘Qzec`J:'fb

YeErnǦ͐`]>`C K~*K*kv+W`wZٛ$ %]؞] 2pAvML=G9(xu읖ʛaI|%v.Aۿ:M5 s;-~;V%^21 ]m[ȯגsNNM-(—eDGebeWcWK0ePN)K4|hŋ6)K@UٱWf*ث,Uvc51Wf]LUؠRf(vU1Wf'vUqWe͊1]b1WfqWf]JLUهLUٱWeV;;u 7evڃCӦ(T ٦?U$]>b=D]ָ$8:fW6b^W Nw{`mG zӮ zN9NFHoWbTwL^ )߷Rz{d&nV5#NJ,(vZu]|]PkWbc쏧&y$;04ؤ;}'bzʢw9;fv]~70ǚB2C~rLgj6$I۶W[-l`ce&,iؓ[Vv$-rKNǬj`!K;]XPUXڹ&N2dCvQW +:Se l)vo7v) T/l!mحT)pb 1vPoUU]\P.˯lPM͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊,b7LUUٱWe]6*p8o08v_=])vbqWe]qLUdѾRDI.ǮB]Oᑒ tm"QGݖv((v9\!]ݎN0&c0v;pv[vR+nw5b]Ol \QӀݖ˱TϾU.8?IR)di.9-vemS)TS"ho(tZ~nOAϣc+(bUٻbcb͊` v^(vQ9vS7O%Lv!-ibC>#lUي.˧.Ǿ*8'v]1Wf˥qWci5+.Pv-ݱKqWc*n*1Wf]vn'v]1Wf*죶*|Uxw8q=Wf*E afbT-Eٷ 3cTd]\PB]ƃ+S.ǧLOH$; ^Q{Ҵ9Y=ɓq\sޙhGSlX: SolAiؑ߾0T=@w*v\O4HرaMvn558v(rE&!.\bt`W| CiLHvR |2EvWl*m#"j|O5.֭K)?cɰ5MGC 0(ba~)|^Y朜X0K1We LK~8b߯݇]\PdUٻ8k6S>8Vݎa nǜJ]n'.J6ȡحk^3d{ҦLXex亲v1m6]]+n[[~dM|mܖ_ՕakL+rS~nnĚbQ Iv$E(إM;AU٨i\)vP|0![bVa;FXJ+!Ei*ثhb.7˘g.Nyf]bʦ*ثw]~b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vY;b͊,bbqWe*^ث銻/UXWeteRR+a. ȕ. rWbZW*=kb"i*+SL]a]=pJƴ8/sWe tߴ, jdžXԠ3v=~ӄٺxV6])ޝqyo|敠ebW ,t bͶ*ƛb b@W煓U4#v8 R];,uĤ*BD?N,]%ذB]JSqWc*0ҽ3){1{'e;WdiJdJr>> }J\r;\UoݒX2nTupЮF]nƞR"و޸2ݕt;M+!٣늻8*PSl,f;(t r$;c)<ӱуJt8K'e|jd .RN,5J oj 508m]GÀ"fqWeL*Jm]Wc.Ɲf L ]c8ر?6tvneb1We]51C6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*]]vX]Q\U@bL*ٺva,vlUj1WcmcjqKh.ǞRzb]v]!n2%؞;oBhR쳄J.#KvXȡebt. Hv.zW$?S0uOO6챸a[vaQH!'aui^إN@KǫMk?VNvb a ;*pDg׵:dlaa0\wcI]*!.(qWc_ayl ]\PM;*rm@A0`bƝ鎸 )ٚ1*ސRF=i]`<\A4%]cv4&N*A]+@®›WeqiقM-;,F0Hq8Y;Њָ+0Qvnq1Wf*i0_|U₞|*#(*찴]—eӱV5 ]޾"Q'ee8]KO *l{0Q2A.aPE]4'ޘUؠ^7=3Av,FLO7f$1 !y숸e4j_eG \VNN4`vewXuqϢ:Tuʥ̱5=J<[2ɍ!v ay&i"]c*pKKA^öFV['psW)6;#¸zc_߯erOmp?+z e ;i;2&](trM+2(6jϵ2%ʮٷ]wJiWf!]$jl w:(bbLYc5HNȵ6*챊1]6*ث7]]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWeb͊6*ثb͊,]6*U٩,t]vP8bqWe]EV~#۲C`~,ݘo(vA퓉Wcm,W`+]1vZmSdq8Uָv]*} v]HC:WcԂqWcI]'®7+H[)v>Sl]o|,ݘ;zN'ti!.9O&LSɡZ}-dU؛tʓC0+VlUپxU٪0+*vYv4 {b]!O_ ,>eb\Uَ*ثw]v&b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vlUXWf]vXWv_\U@b˦*ثWf]56] U*1K*|cjR&N/LKBuv(j |K+dp!-OFI.nz%v69!]+ aH >$;.(5*3Q:w?zxHk)kkN9\Yus9ۿ|~NƩ ^߫/Zv3R]m' "#kˎ7e6ecb͊(41Wfȫptؔ,K*bfWf8銻6*Uv]1Wf*UcvlUaIw]V-qu4hv _%jG`hHf'y~ xI%9q)0 K2(v`hq Uٗv1ث )+ى]Xbu\Ug;*b\UXWf]vV*ث*b͊G]2GZRqbثWf*ث*졊5+/vlUن*bv^*죊CdXvȕvQ5—e*]d@{bǮv*'eM%"LvjW$7~k^3+ؠrhI<ݗmdbؒ}4.3N[ϣGf=Feeb[I\}`WQZe̓t'|RJP׉Kɀ޸ؖahwĻc3.\v(T fmL3vf`S_yؓJfWEnzmm<2ڪrU$qዱ&ġDӦve늻-lU\qWf]u]1We:vXGFwv>|K'b#l 1]./v&qWcqWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]]v^*ث UO +6*ثb](]LU]bžK(v=}rIR |e\).1<]7_ؘȄ:S$WcGLUPW`˃'eO}ı.N!نžSn^&N8!w$b8WLc5r؟Tphp^.̟ikmLEe>Gcl]?*ʦ*늻)'8|,a偋<1Av#LUXvV*pR죁]LUb]6v/as^Kjq^|&ķV?!Q9Q'ғ;ÅߔE3{ 7+~F G#l의h֒\F-ܭ>NygO%rvDH_?N O9#J.A~?ɂQ,;/|3#YOؐy'/c ]L;#嚙$C؟SƻdLK4+EvV*U٩LU٨qM;7\Po1`beSvaNدEL 1 wIv9qb]Av8N*@2A.]A!]rCuv?*s/){&େaSnNaݗۯ݉掮Z}Sd6RhQEC5 Ar_=8ٶSPqC*`E;1iS9'f?ACl$ƩAv*0+2>-^''vnWc9(سOVe# lv4dfMNP]; lG FvJ) H޸Šw /as!"P];(m6*i]ʘRb۾*f*o*v/#b.=(1Webe͊(ƿLU؞*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWeb͊/vjb\UٱWcۉ 𫲰+6*v^*UU], U]\UتUݰأm*GlUR; f$bb6P]ɑv6$jy+Rd eZv*OZƴ콆xY[HWQzPz`|qөlpωQїt?imجN+MWjyF)v4 `CWf*]mUئA]N*녑vfp1`yĻ*bG|PvU1WfaK]:]v^**7Νwܒ)`#r,,UK ޖ% "rđ_Op)&; ıy(A]4)>|G#WpEčG[` :UqR-F;X퉖*jh?FdYjBmcҼ  mOF! M7gI. R:|,Ibu_ 8ovk3a64SS>!_q`bBSzxtS/urWe⮮c*bu]\]vnb2LݏڙeB]] ]J۲0v]'٠\*쾧"c*LK0)v\dĺS]6Ԥc^A]+NrCCjwD7S1A4)/'Be-E6၍ iݔn!6m*kL;$vTc9vY$ĻNvZAv)?ddvWg RN*]#lvfqӳ4%hv&)MvHv]ە5ΉZN\[]#JODvSWe U٩51We]1銻(q/ /*'酑v`bqWfvb1Wf]qWcv3vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWf]6*ثb͊/vlU٫6*ث]\U٫51We͊.b),Uk]0AؤGmذ+.%.ţ;v,ƿ[hv`}E“*?r]sHh!.AWe-X]πm݆QZOcHm9(&NU&O9V+_a $~xlau;P$;GRGup$,f͎H̠Nqq8Z\z0k-6rwhru.M[7̂icĐ]xo۵?~^<?d5ձ)h0c8 v-}c⍊8ſm|\;w}?.GcxH )̎ò9+bzNb@ӸA!#_%*r4OsKݦiumsN#7೨eǿi8!s'aRt. I^#r 39F'<>JIVqQS4DŽ6HDx? ?EQeIU2B \&2< ;ʺE r q?oo\#~g8;{M%lbde$W rq2Y>>UP\vf^ESߛ}+L k2?>.\[KeИ((4Y&tDug.Qo?1gN__8*5$6o?m兂;NKBzJ|ky`;ܣ?SLNZOW%GGòkDWyߕ5KTnR5r=f)=& ~NG.;MRF1Yx A˱uV#eE"\u;y|XGش>AԤqԳ2-*>.4Ų^,%ژWOsj~Z޳Ue4K1Ԍ~EM4\+oR&oxx1\j0aӗv'~ڧńb-g~h/ONG%K>Äc)j*s`i q I^g$qY]eGή$߾RS6<!ᛧ$!vIm|)X˷Ge91_"}?WVa & _X {:\ǩ&ۛwI㪿{)dCf%K("^Y}޳x\rHajLaK룆6=R잏"i,߻ޫPӪ;lGR9T/&W1Hmc%ZrVoD䧴s@)}kp hAȂĚ)|_%M+KF^<9gr:D8u-1<+ ޢ4VUo9oxO-.(R!&2?q+ԍ]xUTo^p]{WO~uf6m$iʦ(s>_2DrI [ [#$IS)?G-ʟ-Sc+HtHv+ zu[IJ\'&MفR|UىqWf>UOl*W )vZ3o\ ]bcvQ]vm10gvU0!ٱWf8һ51Wf]vc*:򌾕*r<psS^KNlǦZ tq4E2?E/2^BF4cڿMQ!FI7SZcW6Մ{幚zC- crVT<+꬯GՊTbWZN4T.7_N4]on̬D ?UB#LKR)wt O^(1 QnJzG'Y8(Gy|_~kվyqH*1B8Tөw]+PPHY O˕_JK+G-szQ98:Edy~ *)Oۍku㣤` =eMen`7rB ۏSk/b (uer-br(?6kFw@4A]+̳ʲ/CЃX|?YpZakeT6N$-%nRЯ!_e6^גnwiXY#LoQA6*ͭ³z"r liT׉?mf$#b9*ևu…J:L'TcPT PQm'#hhd1Ht˹EbFaD$odSEkLOJJ:[JTWp|m%c^BHaߦu&;R€ @œJco鍭:/Ax`N& *+e"OJ1d4M:5ހx/9W8i@=6MI"ȨQ"#~Y#~WP*>8- .#J+$$u<|> R+G&R=sB]eEX2A-Y-֜OBc#q(>'+Q^ʣFY %K' Wqnj>mCgTޣtNɡ^Y]qcxt'0#nH z}OIсIVP~*>%NPAS>2jGa!> z$rk3q,1!$~w.;WeSv_A*ثMWe.ʮ*i]]1Wev9 qWb1K=+b͊1]v3vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*UXWe͊+vlUٱWeqWf7WcTxJ7vaxxJ1B;+Q18bv^*w^@Wv-|RW0vMrCqɱvZ]QR>x.H>#+~$9%ٻb]-\BG ; V)r<γ$}GQvA[MdO[⭋o#I'&‰OQ-izg❑)x*a؊BBðF%Ƙx/'rBTG/j*BR1KÖn&#b=?'aXX4^; Q5-Q825#oWa UL/\-mI AhҜscw/4p r:_pb)0Vv./l.&8݀E=9<@a,ЎQM *Ȗ B` 걃\QL\^_'F*H )> 4c9G3=q`BЖ^bqk/yvHE[Dr'1EU"K{{ܨlɄyaHHcžK\k׏:G'<.r˱<2c굋ˡ_Z']JLNQR̹-j2cˏ;_CVzmji*.9\N;<]&07C/AFX;ar̆:Re>G Ե{~gvĚg*<d%I9SF""~67#Veah`E:0smKn$>_P\[K7`ts3GW?g28Gܻ"p;^D~+gmx~K]3gD7&~/r,?;y:rjvϹRk1_fHysgb=pi:MMٌ{/bR~?S opdp#ꏇl1ng!V?nFo ;="oOK+[4]8 %:/] m?ˇs7e?ShOQ8_g}w;/ aGo+pA###O=cG_靈ǮXSi(E=Q?\x4#!}?ا1iЇZ_ <@z'?Nk:*_]Gf!>bMw>Ugҩen]]M'͹9Ջu-uoe;&EJC?qD>$>"W ě~?+%ߪlgrWwU_eCR#v 뿺߱wG?.zVڌonU J2d 6@℄(ǝ+ Au@w K&F[`O/2d2NҡA?ap}_?\C6|1/Pݏ?s "7&M5ͻZtW_,ld uqIR5AMk$a?ĺ=8Xpi_U#_& p~\q9^/HqvOx6505^I4f Π'ipRQjߦF?=U "Ƨo[' h V!(oTOS,]v,V$0p:^B];6*(bUdR8RFN(.#bf)vQUX1qt/Ǭ r˿D/eХUߵ jT:QhAo|s_|"2o%l-T`!BcnOGǫư7N.]'lx`k۸Kt k7BiĎU]wHV@~QؕݔV}T8?_L"c6֤ZM7=G;`A@#n_U@#cP?BBXJV0 p^2[mnPXnԢ/ˁ2:C 'z-MR`lY@wڢi6Mo=ݱc#MωpS|ej~|qXJ?+Mm t?luPB,m!PrO[,[ןU{,GEqh ┥o??`J'j+^9,}caUKCRߴ6bs[pG%*S-QODMw+U(Re"iZ>ݸOo-.p#"jSRM֊z7ƿ6p!jg:r,Zʀ*r-yMڣ1cL)oTfQ?,Pl!aKocLC #&e' rD;s_)"u>d֦vj|'G4;GJdB`iɬ>!I9m0!@{̫/lU@]1We UK( Uو*vjNKpvĻ+;.G;.Svb1Wbo6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*ثb͊1]vlUٱWf UٱWfMUV?Nl]O3! I[ PH9]bEzT@K'1d).dٱWeRxv9@]NCY;0ߦ)v_!_a߶X |끋R]l!C22C] Jxdڕd-}2=QbE_;<⿯lohG}HS`a6Ck]h%Z;/#e5/vX[kOz7qo_LȆI`ߏd+ZLF6\w3ðԖ ab.B07J"BɞHZv cV3?T~vMj&eUrT'wSdP,.r2_ϋde" }s«JiQO fQ2WS#a,bkG&}& m6<2{[;FE;:1q՚2Y-l^o]ٗv?d!oV†&.N3{bK 9yh?̛FEᅘz&.?^)~8ؕY_FC Vِ/k75=d'-4vw3us:lƉ }[0cPup[IVxj:Nt$(nέ/;[k,0Wz??9 [h%,VGR˹x;?#!n\m#ck+vX4]A;U/튻|SN<,qWbxcv k2a=a׸#i.2U|4[? Ldv7Le+%yX5_.os8%߶L&>Wl:=vc?8},k1q˕W'eyiq?(`SF[69Amc{DmF^NlƸ@NqLt#s8:]G(nJci^s!)qe4k~0Gk}Z Iq vF㪇aeM_~vF d2K-sB}H?lJ{UO~8]w5jq!VvqY1HJ~ԧ b)My#~?ojX%' N"`~;:>l+dc"v'g-6Z9c&;~8'F` RyQQB*Y/siNG聿90y)7w+y9:m!:#?8 P\VnnsLOSSjrOF2?sO:N%hqS[7 &xǎ5^oMSk[`VѐI3$9%e? 1 O~8#>xZ]tgA4G1 o3 6'ќxWg *>M/!CÈcG7h ?@ "7Z)DoLx c#dJO_ cۧeY2tA7d? L%DA! mqJzoC7η ȷH1VQW̽3&7UcZ^2;_|WYIygc^r9yVqPB/&I~H0 ?ޟ?6rm?:[Z$M˗v|G qK튻zK^2e=QKrPWbN(E$dʻ)zja㇫ ^ۍ]kz`?H o|˱ eUن1Weʠ*zbVvP]7}bF*v]\Uطb P;͊(b͊7vW\U͊6*ثb͊6*ثb͊6*ثb͊6*ثbb͊0]vlU٩6*b͊1]PX:vHl( pR$K1Ïsv@"`;݉FGL`8݌,<2&ݔ7zWeLUٱKb*v*a;\RrR^. ]M߄C|@aC[~T1NƜ2Wb?Q=f!ɼ~/"RB@44:ٰU>i' ށĝhvޱȠ??.+zi1+k^-i?lPWC|hj<<27yDc}Nj0UIG|:F\ ~O -O\Pfm ƣ߻S'iD"BQ0f֬SҫAǰwȦdb uy2L")Gl:dZWm9">uENGr$ )xuŦihx Qjʳx/j8yBSt hG&yȦ귚_'Vleok B3\HNy$. WF+qZ,zsz7-ūuAe>([#gW45+q҄:ɺV֬\UY V$G䓮uh;b(~sgOI]nX2H Y)J\~Æ#CwQhο8C^O-zzg7d >ɣ?1*-$w Lц쳊I,p>t ;p S6lEtxKy-%h] 64HdH4s[\K`5n"ߠZe^"#HХԃ*b{UZ{lAQɿaKh\@6iȴRʾz\ kt[aM&GgM3@GRa_i%1"Sn ~@a9Si^Ⴠk?Jpln[߉ !.F}f?Q~rʹN֎bA+mȷW-P@o=R6 sƿkklUd =E0‚S#[6/w84>+ƟnN\(CNe}tO^u+fnycK!?q;"ko"ð$Wo$Y\,Tw끵#%[J;F13ӊ[ZC©^?YߛF=Gêڿl 5uGkNpO?pjWrq)tUiNos]K]R=GDIO+C8K! HRL H%M=_bZZ[9JC C ~F౎mfIKX=h⫫p>+曭}y0V; xſ_*h9= ahd Հ_gAVΑ_A Վ.IͿr_m [~Du~[U(T sׇZ,$GmM|wrT"H;aTvs_IhJYi1]HJIVał[}TB &i_$"ͱGJӉS\b!j-Y}Qs07;KQ$blžtAPivodnM@HvSߧ|0Ɋ-K*rcv9Hv^Dc.N$9TV.ʧ+㒋7e6 5>uߦWc V`80TWz;.V)ɟL)jv4PS,m6*x銻21WeWe㊻(o+ثn1Wea-I=qWb֘ؕ !آdY;,ՊR\@vӶVB]cWRq8R%vZ>3j ҈.&iW< >r{Xc}Ycӻ"$LL'`͋\ݸդo?Ŗφ|0_tjolM(2wX4]g)VK1I;`; t-\_wUn&mTqKŌZlb tݛW-:,Sr>5f#p{Gr..qx&c̰gxm,aYQjh_jz}5;%&Xej֦߾c郲wt6au+vh^YV8+׹Sj {Tݝ.=rK-ቸ( jW2DyyddHꓱ+=E%^=4;!vKWÑDz/̏\qZj Vn7*}__$eh?u1}w:}fVct[%,z}IKp?k7u"Eu˶z"}f3olˎ1;Ry  %)c2mRssMV%c(ZrwNSBO.6Eґ?__o*LS̜r.h]\K5 ~Yz~~!~fsg /pHiG5i/c:}C{4p8?"GeƧa2;tikon*zϞ8c'dSOw?,^eɹW/1 {Ń!{9ZG :kZ<\to0gE݀幖UTwfXMZ/ op]j-"RjO6N14u8vvk/iٮʢ>4AB3fi0A_vqm{DE{K[eG{>9d5Ӽ`hN|W]}64]YI=. 4.eKC@o9tqطI<R_"v3ihIbo9H4%4wvu/6W6W˵E7s$Ho)M8Ngjou&܏¿ʣc{FDK1A?_j3ςnYֿGS&uX9%۔$/Kb%QBU;V%GqiȊWk[3bǞ|+NPmʧ.~S>$ e5ʻĥ1=z LF/؊MA;?SӢqh/W3"^'Re!7N/|uG0]GSrNCp68O[}Xp:(1Xf"7ǧ d.:>:Zr'#:jQ"!iRx(Rus^kߔUҽG$Ƚ$"O)Z׮,rE:KOħ#X d懾aWQ{gJ@Q$?W 䒓Aר$Peiz.jM59q=OZx(+G|v¼Dߵcbqde՟ia/oV<-{+n?e?edF$S~_Nsaז|yN>7?C8ȎH[(Sp/tuA ECxrCa( f)bаjT}3k|Vooo*''&I ev4e(Ǩ= \ثb͊6*늻,V~"QJإ RwZ5G3)vK~b* &QOI$Ÿl\_OtR0j#ͶRH< }9SaY@zF|}idV)!V=X8JQd=튁heX*:;MAyi ӂ_p oR.[аPNP9%?gwbf2Mv?.y;HKe;S]IGs1$^2^4BAؑ"*3ʾ_F{şNLG ZMz56ҭqK4Or۩u=:-znc{.,4cn-!, V#b0+jsRFQ 5o-#~q"(hI5&=Z}fy6?HXXܫp9Og3Qi| )ڵ]SmAW&"NyO˯݈w#xeRoV/PxЛ=hu/|TJLwc𷿆@tFM>a<[$ '$-ռvb[vQW7l BjYmizřo"4? z;) جw?07uH>Fy7+M /w[n3p vMj3tdRm4-AlqUrqjCS4: E&$^ 66?)E~xk po|j7YAqxcW`1^6rv!ڽ7،iA,cqUmt{cfPxAC+*&1 $TXS믥BG2nqQgLe*W%߈6%c#Ƥ])-,'op4T1{Nˡ% 9=A}d-ɤp74֜@\y]ʺv4+#)oʶ (gP+FAI0Zur3RH{tdBm 4Ud6[ȍU?cnMf\ZȬ+r1O 4)͞ ?^?9yH9#@bד{/ŶrvRM2VVz7*8qWb K(vQ늻1銻,m+vV*ء]]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*UٱWf]/vV*UcvҖd?6̌#t`` cᕔc c[ iI)c{LRwu—c+SHv? 'cъbwɡج@vV ]Q0!!+bc$ؘ5%vXȄ;\U-Ρ%͉@`5,wXNk1Xa+pќNUܗrfbIʝ`"(;izMƥ'lSmygF|e@n->ԍAn^k6zpV?Nȟ+k0bS#*F*Y?ܻ"+vn]vlUٱWf]vlUٱWf]Z=Χ(91{v8@٣\^RУ79 HE@P Bw6Z?v}^V{:DE 7ȿv~Ό}SKdDYSvI|&Y'b *GjdanU-Bh?z1(ݒ~ɛ2@k&OO>zE4oepZ %@pǯ~_5QӍ ֣.o3`h3>T?O8`/1y-6mR Š8+S,wN9OHiR7yK7km)--Z372G'WE0qjsKzҟ)rZZrM5i>bk+ﺚ 9hS͈vH|[nٍY)5\KS/1vs3덬^58>_Ɣ6v+FЕe5v#"{gGү-|jlȎSؾ̹*{͎Z9qG|_k%Ɠrmg_Of&5hG:4|2&o:'ec"S[fy}8❜X5HIiQy)mh ^q}.ZyK'yr>cd? )@OBGcLWaϔ"?l#k5Con,e4>@Bӥ~d9*ScQz>b~Zk;BQG54Yr#N}?ϳkdfnJ\k4oP2ȁ5&S+vlUٱWf]vlUٱWf]+v Q s~@ Nt/)Ǧ/B;p .DBA=xK^əyeSƖY:=wZI J9BYԒjI4&a΅Y"$z'Gm# S`ΙEki USv?!?A ·cv<َ=A`YX ?~ӿT5KJލ^~+JⱥR[SLUFgΡ),u~aoZ8d]ǿ-Tc ڭ*ʀ)M?9+xt^tfe8C\G^+\Rc3dt t m~*[(?YTHÏ|yˣRUS^ld|#'ђM+ODrQGS0B[pOp dӠg1595+ern<1 E 0wtxMWo0)gxRHrn=|z [-Q 4t_tu7`_?yGu+@>!~ѱ![hڟ-}U׸ 4~Vkp'?5\-{zJԑ_k]jIbA Q8lp}L-ҍ~?9K\u==IƐ dUsy v1)F4VDj៓ڴ[h{ ĖP^-LBKU@ =1a m}X^<}T$ &l9 `wYmJZD+T'e+i('~Z§SD~pRkUc?=OoD)S'XN4QZ]`WmlӂtZ29 xN-~>:w4v0hX(3hq :Az__'/[{n] tx^ )BT2n=RxpzS&/"1D-ࣣ#M&ԗ4֏kKmƬǠٰZ2-!]ڟdmXJ,u揲6xcZMO?kvmb*)?_pSda kG0ݘ{c֟-{TSZOT[57A,lR ;HTAg8hM'S0\B>g[:5]в QNHʊe{j.b1f~yD? .<"{dF?JPCr?欤։/L%MFd]SyƠ qke:FKxz_.ɴZ|W"7V濲e7tg!?_bJ?2zsHEn'nDn?\]vV9 ?"L/lZ{@x w2R;6OivE\vN/gV54/?F,st]_TM?3\*<,^RHNƿ̙y<F6Koqj'q G2~.DlęFW"oK/AqVOƿz_R1sjerxuȗ@R(; ?NAR݆YF9T?-j<_dibHeGv:Q=.;fNw-#ʥ#'飀TΓUٱWf]vlUٱWf]vlUٱWe 4rJKhwM?pN>l*C)Y [GF?X_2KbھΞ-q>jo[I_Nc^J}gIR=QgtNO*EszlycqDEg7^hO~(ۡT\]Vǫwvu-#zoBbR7//e ͥɦ5_'gP\3q ϩM+ya_?ꜿZ;oOɩ)]rʮMQ1ɴ2\*b`д1%Ts?[+0vXҚ9!4݋S~.q {TԮ{.7p8GGN]v/e{%<'8A<1y[!Y}99J:6‘1'+v1WbW̷RD5aNb^Ԭ|lpn,:ٙu8>w?kgзVQAvoC/+d2)wn_-}na'GN̿4.nMDxOvt_0fEiWb{`dy(qoMGAyUɺ\vJ3}?)Kee/u3)%IIϘf:Er FOOoˡt=5~] mGeh CrkSK~DKvL5[O$iIoneVoڙW/:L0)'g)RzY=Ͽ0לbQvu J:uh1׈#Neq'!1rFn6{` q;;LsKS^_[i8ֿgo\]nZ8vG?6\ݍZMv]6S)wx4QÌ/4TCx#մ5?b9N#WQpiN~Cmo\x6BcbM}OMe]ZN~# +vU]'88ڻ2/Xة5Y;/OcsPg˶!"疇cd:qӶBGfa]DH.ːb]Lvjm51Webv]UXv4튻,Svnvav 1K)4ck/vlUXCv^*k]͊6*ثb͊6*ثb͊6*ثb͊6*ثb]6*ث*Uxb],W]jޚl (SM'hv2JNAƜT;N,+'cNQ%v:S7eC8RP-ERďcA;w2H.ʐD`jJ,Khz0A٘d쮃c]0+Qk{vהpyRWr2mCN8 ”=^ӑo3wg-sF9&)#Hդ$2)1H4ԋR֝}aG!d6EP`P;R[#KX6˒r[?-xyڻhŠ\o uX~#z&("RP; RE"Ut(qη;m%-M8󞟼/OPWi)@P$ 8ڝ78ܤu?;V?X?uS ivN  f ύDڜA$oegw)j}Qf8QQ0IT(|rYl:OctݺacSҪ0BAKzuS,Se_ Ewyn-Uv\۬E 5~c4)Z*-ֈ*{ |UٱWf]vlUٱWf]vlUٱWewkFڽkp <4gq'֡ySVkCVro#$m>J2ОGQc/+\貕./OCr`ҍ'Wkuj QHѰuٔ}X+t)yՀ oHr#4Xҥ{dm=Z[ZI 72?rGbmKENzP7m{Rg7aEGJY#?/G5gseeT}*}6;,?~j?oFu2Mp:.d+$7k"MIukoOP?:6pw*2n16[ p(T]O(XI{;14-lu_׊"%ُҸF#Y8Z#6*㒟%y2}Zk!mX}ayG76O&wR˫ iwTa~p7ro25QF&#m9^ɭ}" R+:җQe*V2ߴLD%{X Z!amjki MO,clN=kp˱Z^[$maX'+>Vd(%e_nPk?-eD<ɸ"e (ۃΑ5^r҄Qn&XuOr 9p#zuc=+:Jȧ~",Lcf+s,>`mpʙdyHJt&)a;+^Kkm|=+Et)2"-+2qyl[} 5}m8G)ye˞n)LaVԯ>gv;(G|,Ut1rƿg* tm=JG^rHVik ?&_XRVj 6͟H8=ɸ F@O#ӡ7O,S(D"M_;aVmi6/XxT2_N$luj- K'Ď*/ a[qrG^^FmKy Ӵ Kg$Z@i2HBs%t ɷҾ&Cj"UZUm?~fQim/2)=keVhmGtfu !ؗ~HƊm݋V^=g.(PRODĔJ:iB>J!cA{`!41u_O.ry?w,3bu+nXsqsGC$!Fd?NC'Y`ũ5m)/uZX-1ܤoIKC~vX,yiR-nǧWe g v! O:j7/,~aiQvQH6k y~s-~|'pkVYTljی%v0tǮJE٣xPbKd%/.0JP"c(&^>dSҮ4=;+^T$SŚ9ئhzmCЩXx2ጌX4:n1 R+CQpd <}<vI̔ 2t_S x_v짱hP*µd_?>rƩԯN_Yxh]IHf+D Ȧ,6*ثb͊6*ثb͊6*챊,U'-r~G-CUfz'vt(o:[}Ydx5|Sm2ld;,y2s/4~_^hgACN]v^*UٱWeU/Mn4ɾh9"AMYqG(⋰+7-k*' VZmGP{:{pvjd'a_5ǻ`MG\m'a^Av9 ]o?OI.\[..;2e6v}(FOg4׵fsIHz>'ap9!$?yY*m<<$a1τ~?;:75?-ڵͪ%ҟH?̩H@mO5U.}?m8;K+v$z/k2#Nˡ^MUPD(e?lΉV|r}2~?~boU>z1) 24G'r]q1_}^voq اEŇ'dPMX*iG2 Cwrjq?r=oYW{˓aʾ0.#ep`P[ݝsF}6hǤùCiݡ ?q\:-Z9v?~d'>痍shMsߠjˢ{?3>$eug)oJLrd#b4|OlĜh4cOa&q* }'enN΁B:}B7?xi嵸eDe%u2>e@ې띁tDvU*M:]*6̫{ej0ޘPib*cnqWft}I c v*qhv`~.6`Wf .1 6^J(ت!jmjҧ@xq$ZWɏ(?g9%(^+hi1UqMԧf6REG#jxu) 䧶u.KҪz1_bI-}4/.d]v5?ϒKX>CMD_K*z?TxȿZ5Nzoi?2y:_V >W| "uIl[кms||mr$N E2IPH=,#??~'C(ʖ\[ O[HG`]F*CB7isy{ MAwS~BُhN'_ݹ9Ưͪ\>Y7OmHG *aߕ<&t&0(?C8˅ -F3 Zɭ ?9[;E3j]]7'oʾcMkxR(:uɧɤʴߩQ_x@ H;wo  ;~x[7M[+-_׭Oڙ_I v>pg~vO9d4dsVbI'97ÿ&藂G'|2ٿ[d%PǷ! 6zN5B$Y#x~D6 5q1oUOv)`8M>v;x&ȚOHp'tI=t:GX[j1E*IW ? -$Ye Ө?bJ*Q̹Lbvʊwu9%ٷ ȎJ /M+L*;b=A®+;qWc]b";)'rv_mAKWeRIv0a]Sùr}\0#PD$׾e7EͿ|P1Wf"].8We*80(P츺N.}bU`銻(UXWc$]]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWf*UٱWf], U٩+v^*lM`WcɢvlPvVDv4Iv7dc;//v=!ؠ䙻0غn+CGml]+*]Ȱv=O*_~G CN;BZdEueVź?|G\y=#__vPGSauN_?]WVR}ZCʻP}o9*sp%yzcJ:Ƥ˗aU wvH;06Nɗs;0!Ytq]OhFcqvtyKx,gmrf/?͙&AcR;m/]YbGӊ?58'6@ky?c.%Gw$*7HߏN8ɀ_%k'u(ZK'i K9P?p/s#$n$Ph0^g`_Ѧ߉;0; 2q&xg1vu/־j=6XH,Gڊ_-xdd&7SU|Q8NzYS\G=U?bO_~Kȸ7>wXg--z~W^ 3a?]O4~]J~t=e{m9beri-$h'R!S!1!qEGG+muYo_t2pogG7>j\W&_|Ȕ#=âêɣ'W9fh}^xՇa&<޷9,ȹ͊6*ثb͊6*ثb͊/vjbÿ-yJ^p$r7S 8:d43:+M#xE9']GyyO.U ϼh6^,oWf4=_דpE/#Nr#^VXsэ*"a\*ZֿN/hN}wiOV_Kxw3䤿TT/2{0h,1DkŸ/O瑍q"5Ԧ,q'ΗRVp?z^kزvlUٱWf]vlUٱWf]vlUٱWeUٱWebv_,UDvV*iI‰X =1'bUœ U2VOQ &c ɮebYް׏ġjPMY)H˛O7>-ȹ.1W`#]$il' &#TŻ;%ԓU`v U٬Qۻe j8e^v mZa4=<[p9:^z׭zėaHI<G?ז O.8fq42q~- ȔeTTR>'Wfc>ZOp|*qS*i늻0ۮ*w*r(vR./\Y;'e(NHvXLƃS$;(&h%E?Ļ^xǮK52(v4늻6(vc(V{\U늻1]|UK*\UUu` Y;ىʮ*]vX®>*f*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWevjUGv^*4˱C"V*죕ɓ+*{e2njf)vX;N)䢇e9$U jj]X߅]!WA٘dKc)vbM0+N,ENS퓥א_8Cm7۟\OL|L6>5}u}4^ƽWkc jՈ0Km(/m47 Ff3^*(I&ш8u(qꖭYO &bJ|c_["[ YGv[i~ AFOj}ȷiwu=Gclt3$taԗ"ZB'Ue#Idt.OaE/v3sBTUk5O?oe-hǡtFzp#ze!6רRu)O#~KbĀyiBCBq9wudQoor`ۍ(,57u=G6ҵ{*aqhu#|P$Bź\!ANu 6j)11Q7j!&=uO?%Gp?c">ien,5pĿ_ంR )̦7Vjڝʿ Mq(xPb'oKԯ7/Â8R uO8Zѣ+vyg\m.JtuS|F\%}h.1i6t2B VR;DD{g @1WzM~$*zW=>u2ı5>8Z,b>sb~P}݆ܛiL mG8n~bVMƿi*)pRNʼnlLKm$$l==%-di~5^˧*cS.)aM~EvS+C+>ث=N*qL!CaCֹ1ɑv8Xb+KPky3v0Ǣ%'шu(v)($'dz=]ϑ,K<vV*vbO\U٫(u8늻]Wf LUM- Upف1b^쟣N;(P'vj8~b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊1®* Uـ]1Wf®́] Uw .`(vZ%]ˁWf®ͅ\Uٲ%.ƜӔǃ\0]4cIbb;,W`Iѕb56]Rd&NE+h銗aoyUӨb7 WMrqJq<;k>l()朄hã^;7cA $5aPGhC/:>ҼcBc,Tj!O;U=AupBnXah8'/ùkcc/ήZABw5y7o??RLQPg&C_2@ͦR>^:_;+;˱c )l}MI/bmn1jo1e3.oW8 ('qfc@'啹vO`ժw'̘ao;aN=n# =.5#VOFu8i[з[ RO'FS9mMI>;zy9~?~`)؆*ثb͊6*ثb͊,br UUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]1Wd-2]bjZdMElƇ"=͠nŤ\~E22b]"!)]NCh>إ6?< cdm|7cK҇;0 zb%k<٩`(v3tY;(ȲV U>E]xՕx.G|PnEF*vlU[R*SWf2*h]ʧ|Uـ]b(bUٱWf]2IvQU`C9c[>WV*^ $c_Y[kd!/G1D`b2I /_6ڣFH(WGCL5#7>DLGdNRoHC߹iWZۖnàQ,q̭>xDn#AmW_1%e6NtZd?QC'odmHn/5"cA1m%cw~܁vȳK.Gթ$=HfʖT% 4ڃ_V<T$?r3k->k"\hIg;s+ s4)5{r: T~+&͊6*ثb͊6*ث;b]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثʥ]vӌ)ŶKPW 0Nj]Eem&صN~2d͹lL]:9%׾VГ"`‡eK+Cc77| w|U;1a r c*pRO+Wc_2]PINA.jz|Oŧ]ŀv?\ iƶf8w]*h®˥qWe h7]]v\}qWb؇\ ]͊6*.+(v&b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث ثb˦va]6]vlUٱWc1WeWe[;2fɄ;/$f]K))v4RC2Nbt*zu5P ,ݙqWb7!ؤev*).``]|0doKD+85k*(6O/iW?T$)*Cd-8ᯫ]ޕH9z:e cM:}\sr_vO%4G#EʔDgG⹥Ds[.d'{4ՏM`0]raMS+_廭 iܾ"BGB:7K~ҶN5pr"-  GoG2???z_oWOl叹ue9$Gn Ywo[ʼnbKnNc=H149ui 1ޮf'%8ڍ@#gηycMR"զaV`oWU.GDKYk *?_S/%K>^wWcR6RѡȿqIY)?>_OHZfyݿɍȿl[qcz{g1Oo5Pa?wo92eOs#M3YRszxDP;'N]vlUٱWf]vlUٱWf]^y{J.nv$V=ewi`?&Z|~}S1ѯ:hv#0Jxx;:4m5ԐBT~9 &VeMN91"^D/Ĭ]/:^#DǦ?/LOki.p-WI ̿kcg/[}:R($xw\5&&hFeDdOl⑐J2t]:!{$5V5/ØbV|&&?UF@3߻]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeUؠ EqW_DbEp7KW#c?/j:'ޭbRmEAʌ0<݌'RM2ݕQtȲv?Uؚ ߮v&|)vU1CAڸѝ1We)Wc, W!hcr%.m.SlFv vރ'A#"Z)]u8KlvQ=Wcp!gva*h8r]N*rFv0U٫.]1W`)v2HvQf]Rء銻]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeͅ]]0]Uc/va6*v]]\*r(v;,KL1vl*ث@ӕv42Wbw2vY]65]v(`}A1drUش;avS¡\v#R1CX}8d;d\)vY9f00C PqY% Ƶw"4J8jmDdb#bEP` Kw?߉[$k'C"C[/mmkVVJlobA;)xi^?,i5#ZbuӱEv'ƿȘtbP=_Q?c {r5Xл"_dJ,jr>W}y(mH>c ґ'QM Ge0cT\o6/ 2șZjy/{nA'̳1wnƤ'$Л"Vh ޯ( f1'vJh?^t6:b䬳 |n>?/_k"K AwOz}+u*a݇% DRF[%>EV5%u_?G71`dyvTr?w[o)C2ɂ?6&mK{D޿JNs3`jUʰ[ M>SNѣI>9|{欉ƍ#@I& 9&ǦOqˍެ(:zO,-ޒ:Zm7N]@WRGK(+U 6s R\tY.׻'sZ9ײ\#uf597Oc^(((]6*ثb͊6*ثb͊UG4kd`t:?/i='HT3%Ɇ:cҎDni¯97k4{q?e ϠEz$J!?1v,ƤIɴ')cFVxM IJd;jilWdKӖ٪ |]cqWfvQWvU+]*h®U)WeW*qC)v\}qWbӊ m ӊ1KPn*vK!1Wc1Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثvQWevn]6*U]]v8eC֗ffɫdJL쬭ˌL.ǎxO_|Uت~;-p+`w! Oݓvm.CC_qKcKcWf;\U%MMs/#ŕ> "iU[Jf0_8]=;F†Z|?)w.o3\Fxe_K/;#~b?iD+6~m_P촽bx2/Nuqm%R:9OI ywΗ:U";呟 6?;:F5Kr#!<_~fHp#,>ckL/k1+_o 60DG?8JaO $'&ty;8)~%f"4z=M?ye;jߧ/lg=*= U#1^bTht;zrX?mY ձygeq\zc1'4¢ sϙqe/}_k4Q͋znƄ Y_]q$p?ri^c_G D>msOLxx/'8g+?4) o*M 5 3cu&q܋BSqPA# .ίyOm܏NGZ4e_x0LLnY4r㏨ 9g.tj30<h>ѓc"]SvV*ثb͊6*ثb͊6*챊Y_e 9FSC908T]W[+Lsw֧Uǿ❇t1E$mhi~e[Zܺcd-K߈?k?i1zm7hcϷ?K\ʝH4g+GJ֪OrBDrqiTvk[X :k5 O6d[xL/#f8yxi< (#?˅_N|96aVUn0g0Diื gF]:NI N1r=d~W u㱘b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbq87]]4}{;`ߊG7A\ÔM. ?j7п%aCR3$]k!$h-NQǫk.d@݅;( q/㊗bm]a$e R1C/CQA7c.HAӾ;3 ؄Jޙ l_nWh.lcH1Wf8ٺbc@*®̻6=r*i]b]]GR w f8 UٱKC,bv%6*ثb͊6*ثb͊6*ثb͊6*ثb]LUGvlUٱWf®x UٱWe1]]Wc_;a 켒vVcPUG+CQ]^*Q;Nv/ Cc|C2b5;WbKLLpv?]8*y67^l#0G9W,2"proI8KzTk6M>hƯZe5b>'쟧j\lQVzJh>[Y;G"e48jDWXy~fȬj6lG1n;ҋ/#VvSgC^+CuHHŶ ܲ HoV+ExrF&)?mL-!%m?l~mTiI,TSe~l8ʴ- AoJ]{ u8X"2Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]LUeh++vy^5f-Ŝ U BOl\*щ*pG7nFEZdW'&qze=XcTwWf;A\<cXl~YnU~;v'$ey).q:A^;`dkaKN8W`!$w9gFȻy7dzw5%{`C;,b늻5h1WfqWcx銻+ Wc:UXٱWf]bMpuK..qWeRvU+vX]v3vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊,b58 Uَ*],bqWf]8Wf]dUc.v;&e +"Uʊ+ SCص;cdY;/*U&Cb(Oѓ 6ߎVU؃j),wɫ\]F(v4 bɟLJcmR9?K9~8cW6}P\#.OU`O|.xO)+z~PNLǑQƧ+Sh.\rI^_d#>`.G.Wdd/W( ]g;9s蝂JNnmv#jˊ9 ]w͏GCiwga>m?i?w9,u#jIernWHxNgG]\wM^ETPsQ1}Lsx'~oМ\mO[J1jhߏ:ibwQGcU0HOL9dzd8/~=MSDmN_*F7!/=H7,OG׏G_]3@م9ڇgODŽq./bN',h5?yNGڷ+?ۮs ]OȂ?Sf/'؇gAyZ&J S=}&I5}X_Co/-8~rS{/i?ok9RȦXP-SBbbxٱWf]vlUٱWf]vlUٱWf]1Wd sEXиŜ,  7dkϨ M2z _9|Yu?\85oΚss?7f 'gaɊ56?;SgOo ,83vq!-[EVdx,x߲TWs*`فz#TӤ2'&OVrb>EO7'sG3Nb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث“vX8xhF)ejVUk_٫}pCE9&Տ8`mQ VZ$}6ͬNFpˌ?TS_?tH$#4t#j Y w`??.A!BX¿/0TsPDrŽR #QZԮs8vZle^Lw_aƜ@One[26q-aMeFEJDi}Qצ(E\zoSj?a_J"ige&I+чZwni[{'n@v&h|UGݏh,ep]uH$?7XxцLH__sm05ՙ2̿dh:':n$F "֗Yȳ۹E5 $ &p 3sYUdmpo_dr#z,GQ'%GִhneO)06" ߲2lQK`CG`c_(m`1_} *Yy ~Sz,ƸA&H}Bm8C[~:Ήu`^'2R}ku~8]hI߼dtFĄt}v>1Gï|m QJt=ߴnwZ;o"~4s1yVCp" mQ!}NCAv{ɗV5##\ N9Ȼ:^7щdeF<_Qɩ4=1d߻ j X|dw_Ed.'?K?aoFZ[ n?aGl+RɹC,?k.KC-f]} ?#5=__# '[@zStȏ?3 k(wzƿO2[q?V_O?S9di$=K)6b8C˞P$ !aE/oW%8d4GEޝQڠ.%7|ˌ?y5GO\NKlcU-QJ'F?ɑ|w8г?8Ŭw6m$aF#?T靄,,2 ն_K rjD]V&nQM0l#Dcɼ0ה/5)RS{d'Uo3ΝwRH~5;keXX0lD`:,h?V99ziCsMV;6*ثb͊6*ثb͊, IvM|ksq& s_a?cfሞnYq釮"r]I_REiit?qaeˎgYuvY]Xu6UU3R2X4*#9KC/h9T `eɎU sh>LY"kVǹq!5:D??Z;J Ղ"ĕ_~)|y/W?H5 ʂ*BWį$6j-(j'w)rîOң4n?j|rhltbԣfvjvqO9 G4ν>a=xUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]$$]W`D`YLPJ|XUUoW |~ 8s[ $:Ã/!DE>$dwFͪb.6=J[BEucnʭ:cv5vC‡e.*]Ӂ] ]1Wc e cdاqVc#'e7o WcGWeo U.8ji]vcv4e]qWc)\UU1We]$U$Pv#w`U٫14]|1WevW|UX銻]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeU٫/va1vlUx UxLUUٱWf]B\+4*$;5qWfȕv0E]r+ط\RpLULYcdž,:ߒ(vV}CHGLUؼcl40N=1Wc銻Mk5p+G:pG)) E!е~*1)wr@cw11NŸb4/MC(og ބώ@u H'j))朘 2JoeCm}?vȳMNx#@՛e4-Ǵ*719Hmӹ΋~^Yi\_4*ymmHg>*~?SNBب߮(kZ5S6,IIJПTU)|_*ynHHS*?co1G֦ _4 ZhO(ۙB̈́>b´Wѱm d*B󹪡5.{ɞZsO aj-S2 xbK tM ?rbsl=zb Y5,rTq;-0Vbnv4!Ǧ=>XUؑ,v]lvnءxd]Jvɕv<+cNv\ ݍc享)O*hm I!Q .Y{VeJmcIIC*1WeVbcK 0j퍫MqWeث*#*Xkإ;0]+158SvQ͊&*f*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثث Uٻ\Uٻb]blUUٱWf],e`WeٱWf]lJ쬬VRR30%F!{x.O`i++Iv"F,bظ6eRSWeS \yySނ&!ZMicfTak| A4%͓ yvGN2af,<#}\I*fsq!Wi61Ԝ׆?`i-}X'XEllLD*qX[^Ԏe'`bo |2N7lg&In177MstPӏO}N‹xEZG!TxҼ\qN }%#e{j\N._/\NLbi#UV( m_M_s1$6d!.UjԒ"O_ǗMk???N񡴌_kTZI'UrR<?Y/K]_ކk~oyOC¥/!F0Y*If;2Yvt?,~X}kZDoUs&z[O?̋m5>;.܀"ClZt,-?%o9 ^W5,z)6ሠ@ ݕ6*ثb͊6*ثb͊k*b},aN|ӹU@Go{dL4e RHw%ݎI9&/Y3̷nu*F6v"dIm;:CTǰ~,=a͆Ҡ  ? 1HK]&{sjZΥ)C#{; M@(HP; V*ثb͊6*ثb͊6*ʶ^F;@J)w4QԜ^^j:vo Ku מ 0J?g 6ETyo%[O_]я /4YX,jOP%^Usk\" hUM\S?`%0@jԅlit1mk =WF˒DגW"+go[\\5y)eOVb^`T1)L?oU~ 9Q-?iSO\ fIc]4Y6P??V~ 6̿~0vmB.w/s LbSW]08e2`]N1v5+Cpف])vX늻k]?g$آ"c' cbn=]UٕkīHv g')RM?.PIYAWeWe6(v5)zw8bS-zblP^,1Ct86*UP]*f*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWv4,b]\Ux UDWva!UWeV_o܋v_eSb+nOrCWf\v?vO[vc E+RiD+We ŖS>(v=z}N>8آb o `i<2v#N$r CeG,%؅v8v;^TM6?t9u7]kl SkrK9-n3ymmGE/_G̨-7 <9qO*Jzr﵅aczo?d߱WXW Gr:~Ns6OwF :&B{2Sc-/gMl 5qP{hTZ?G4L[㗽&nH?N~K+ML}nP"aHeՑr-%$֟NQ ༞5YӚ#oN 8I!a'§\6 \,֎F+BqUѭu%$+0۬OkoM,u #S|0iPv-Dj2Ļb9 ;(\YadPz e*q21Wcv:> W|!]QK@(@<0+7uWf^vU7<`60egNŊՆ?$z0)m;>8죊+vjb2K;,beq]qWcqWeSvX]1WeqWb.'vlUc6*죊b߮*n*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWeUن*UٱWeb\UتO"Fi.Fp.cƫt?ݍ.;]jzHpKǍ~~Ɨz\F;Gv:?1ǟz`n%pƍL|i2L $,dn0;.#??I5-|(;?q_|u.GpApZw8*\{o3FJ>pQKUcWc0+w—cԜ  ,ݘxbTWo!$Έ+|rA ^;S]MI.c;1WcK|#dQu+x,JdFH%N_˙2&G2p\q ~̣zSxcŝH~8/Vua,m۞|rr6}qWCH/2lqd Wy\1ʱsA XT.WG^22(NʲUsjNK8  <o{nM k%[31ϋbӞ(KL~;p~Ú2兿ݟ6L]|@k_YWdY  _ղU1:O_3ᅺc戚+)<'eHe_odş&YGsy>_qQcDw$fIޙ]tM~G׳~'uaˑߟOH:+2*p= +]١eb|SQɦ7^?㇒F+JvG?>2ӶuYz'/fZ [sjJJ Kc/ȗ/mupC,r5NHٿr;7iK ˸g/>S4r)9><8xJqq{2|2uˎ_T=a?;$ǔ5CLRc՗ S6[( VfM! :-g2K&_B3vB/s'1q.M݋h#*_˓xԍ\e*1 f>jwf2Sm6k `7mVNJ$ŃwQ2mX$y&S}Vz%w5SlRimz+$r,]ۦ(v5˦*}1Av:>vn ɥب?3\bWeڹ]-oeǛG, ~dO)|\ؗ`Leb|Uv68ى1We\UU|UDbvUqC(U/1d [,]jP]vlUٺbfh+͊6*ثb͊6*ثb͊6*ثb͊6*ث*UٱWebvj]\Uف],:r@]C~ t UotpQE;]J۽dj]NϽ_jB#p`w-PI=*2'0=1+{Ua8ZӺzOd1pCMP=>m]4wD䇚i^ٟ\}|PZoh _ x|NPj2v8 raWbdc*V>CeH?JIv+Av&vtCHL>Y;3 %]iIv=z 1Wa-P%iGj"R9_Jb^3rR-MSW37rK!rYQ@| ॰V1lw?o8)Kx9@x잟O\.?_?⿴͏$D[@+@qFr˗4ѱVn@ek#M lJcׯ\yk N+gS_D!-4X~4e: ͶҤTO_ N_ ̀kzmGlzqU_Ks/7S8y+~ [}dk.y{?s$e*X:K7$ ~R,zzV_T_.L![RLд$bGSVӼo$Jޤ@Ҡ~ˏ&{Kd7ﴖRTT}k,EZ GFrn,2KA$f_ t KHaOjsΐBWrshM:!ZCܞ<ܠXڳM7 ?/(YfsYT~?a$:~ДkKChNZ)bܜUEs;ʑhAc`5H5=E궿0<':Wj?eqCHV^%G_5d$SQ[v4u$Ӑ`;Vigbmo(+ScU[ +v;wJzs|_?khhMi?Qє(Om.1$gcXaߕ<&t#@276oV3!_ O\I#`CBchMWVM'Kž tMOW4ZUc3nǢd{I$qLim:\Fj*1.U+M3s7yv k@%XV^@I(Y_xHMTCx5OL-e;&v 7XǕ6J-sZ+LFfV|P!#6xoơq}8e/2'l'P9d 6*'wy 5\ӓD zCtSw%e^ 6ͱtȑHv|,;*\UgTaWfv(KlrtcjvK/`E2="M]E;;*I ;V[!HQ'Lkv$qCUJqWfcv3۲*늻LE1d ZvŋUٱWf]va]P]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/*b˦*U٫51We͊,b](Uu]X'0jgm7l|N0%vv%5 abK<]* ,p;(7cvY`MpCQ—f#|RzBlFV*0.6ȡ)XVvUkv4o](vX#v merӈ<ˋ9τ~ER|| ܤ`llü?^O1G%<1<ݹl=J|BO1^_dW?pDG8u_Tw;}7dH,?3jZ֦ۙl+l&&,1*" C$(~X{2ɒ8vto.Uv4'7 2cyOk-/W% #q@yL,o)_;wVJYKv{XC&L}0l"^a´tuY%]u@O~S,vn̞cǗ"g4Ե+NcqvIs?f)$zxpp%έ?m g!k;J8}1a;%ڟ&ll#?tS]g#l>-.]aKGsY0kRz׮XFʣIHoOC"+vlUٱWf]qWb[*v)Ơ]xb$-#rv4 7$bhYurkV+-αUJTD=?\ɆzkA ?]Tk$(m 2jOL'ZqyV׿àEYH˛ "8]L[EmaQ?p\:`#g;:67%?oʎ1o-Ԟc&:$7ST%jk~_ONV\l<0&y/WpMPVo ;$vyjŲxO3C`ZK_^v"mSOp4WiYZi#!4En%c1G,o&^H @f{#S9<:]i=kX !psjrke@y0XS#9T\s⣢\Ĕ/UxcI;S̲7buBHԿ׬ҍD+_vt8r2&Ӆ 4OfNHq9,Yu{OE}q⿬!emd9CtԊig#I1ɌV?_vJm-^B~ccC'Z_KntQJWտA*6t=?dz4>kӗ[TaGĽʯB??gȘwG2xY>_՛Q६FƉY p˝Z pG}_ЏT\KϾl}boBя;SL2ql.a>ɬ@G*nm6s@?eVHpxe&~[w&K[aIMfPie1D\:ޥg[ {U^r9źz3 0O_3#C)r9刦k]@N>$z?򲼰 7TAr}q??9.Α1ө4X# ׀y`ilBfe.I:sS /<򞴬I!XrӖpMUIF~y􅖂:>嬝Kir]2!]"|0]G"e Uv5w]qWcG\Uhh1Wel6c ح7%. iL ϵA#h6KMcD4_HזG+Ѽt9Tv!C(vUF)vPaƓNi]NPƘaeW1vj7VjNi.8قe$vnvWӲp]!Av%vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWeUgvP]LUU]qWeb8bb**ثbzrrq D1=r%]b)v9F*)04]AN$٧E.?2.c1.!I.{]\'b0ȫu酓q\U@PIv;l yNX*!'5!x,:ϡ h $QZgAۧdt(Y'__9!!h%[;3`k/2N=#Q_M =I̸שRIs` `t5= >38 %0~s#n P|wcY-Dc.>e2S-b=Os$#Kt *O݅*.}&_,ړP鏶L-ޕ_y8j{9[]=Eb6!:;/nrJ[]T;]Ocx\H/DSBqUV4+Q#O~z_?K“H7ڼ#|1[0&6V0VE Pԍ:ί>pW4{@aqAmA:^5?.kCƴ.vUYĕwZy =S|Ax$vކ洞ɌxR 5& Xz3t`bio.iǽ*+=d]_Ȩ*)bzmׄ^kRSv¿-䴝doQpxPj2 r?Hf-jُ3O''4Q@+7Lcɷ @ }R?8 l AV |Ndu|3c専y ¨ O_mB)ڄT_F2kP6b3jw592dc@#1Bثb͊6*bţ/Cv G,ةRe1$M1WL{|Z*|cDqJȭ|cC̺O*zi, -6S֝{?@53$tvQ~)TdJ}gf) О?6=QҲc67A:B!WA.t.6}ߟ-4\vmz M4b0a "=4Qb~?y>۲FIZ'~ku$7x+OuR~YnX7хQP?rQ-9Kko!!@I 9//W' 4,Yy^{}"ɏ6iDw,PQoBOC_%} 'YـRTN.y/qZy*P\!E_|̻0>wQ/[Sna?X$YR-;{z$ߥVkq)?M!n[3Ξ[!i皲꣨Ae8:>?.v~=r#i2%?p"Z{FSEQSZՠz}  #9-'Xپ;]܊B6 qZ8ieEnG?`O{w;#l;9{l(CJ˓o5;oZ¬B S͙<#gɖYʷu@*m=>0W58?WLu-Ҁ,>? m< =9,` x?,wco]4[W.$xNeq>B$K63yη#zP?wY)=C Ǫ_ϗ#9 ];:?-mR&vs/̼$nҗ'u%\5!/*q~,|?ȍ|A J^?W%}_k+K)yO ]ݾ9?^Mr)}o;nmhRfա4?'O<;X,r3Z27sy 4 st޻t yJTוn.H㉔: 3}4#QTJnx2GrzўCK5~fM|M0?_lyoTqz; ŷ&;v7vlUٱWe̢1Wb_~ؼ\SNjc]d5y­zb5kne߶B3>o 8#Q as8sXYOُ' |N6_8'?+ķrE$H߷ɊNS??\A;X#9$(.Λoo.$^HW3(e~o-.ʑC|]UnuYpʣ<^ Ck˟'ue+.\G>Ï)vEɴm/ćx߳/?k)xKjFCIï8~W's eNihac.t쾔5KH_k$t:Y!cc$A[4;37c׌;[AZZ6\[t\~W ?/|*_ݵ-$5 aol\nx?G]<)5ٽ~8?#|MݟqgO|қڊV>+J͸qkxcK^=iJuthgB$'M&Y_WyEyn> '9kw6hoA()q/GpC}1q;$:ƛ%KJ)AOfY,D u;N92}1'/~?|w\g'㲟ٓj'9~g#_iI?0|'L`U:w׏~Y'@7BI2%x[ʞRפd@K9O?rCjQ󙩁z%x-r?Irx: ,ɦYUY!Bݔq,j9ⷕ3*hO;q  UOŪ[2 &c"̟+%sC6?5Nh^\}e\x7.S-a9+L9w5/%٘+_)qKJ)4Il]WihljqEg/m$B\/+?8 e^?_SZb8R=iğەyh8KY_GƊSDEsWٽv ف=Ąj>qtDq_fD{Up'>O:oisB|g:5bd|'lrɼ,CۯlzcJ'?<(PbeN)vSPmqWbmK(]wآv(dٔ wv]QLٜlpEC]&)(xغM}%H91롼 -]} %#nöWThHoǶI.D v8DM6즈aWeV=0)v&.t=p!؃E,L:0›v(+Ǯ;1S 'ez"WLv H]@[l\;_H1|@ޘ]t.ljWc $rOvٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vX]=We]qWf]qWfvlU]ٱWeb;%V<BHzIs\x#-[*X"vb< koO,D J)Ӆ +v s*bC.Uؠ\f*UF؆AY;08Uج B'4J c;|8Y;3FH`oL ]z UG]?6;i9SRnhܯBMҝz>4'#q,uQٙbE*UUr< J,MԒJ7?,5 \zs?ietd+M: ]_ P_-yZAp]c样ˀ?ZTԄ`K·D(}iHP~ӱUcr6ϩrZ{(hOs_J#D4j/k2P$no1ԌG"`ExQZ+srdSǁ-BCa@NGN>ة .)ǣa;Ӷs1~`j\ŹڀDǔNhm?hTdbwĥݍk,l={B+J=,tqkFodij ?_iEy%21.wGb?\re|D;soث am+J7iZQd>?maR?jE1.oAcXm~W%N<_$N#[;)eX-#&-15,::{mo5V)R~?d-Bzލ-]Ssc }[GT&B>/o%_a˿9敥c$6R~BtPc1Vb],bڕثL݆)25 NœĀRR(v|y-V}mƫB$o,הO>4,//49I yFTs*?YOnE)B߶?Y!kDLc>dBk.~[KsRoNR 5|[-|ҫq"&8)Đh>~98P]6 G%SUSFmJ")d.āR?,t}iq#uJn=4no?~]H)[9q*T~ chc,|SIKkzu8#G?W jiZgDOjl %!ovr >)XԞfq̗Zܾ|(>oY:qe"YV1'ż;u<_lILajwVkY>Lii7/ip>%GBF\PE+%k,ek5>?ґm *PԴQ]kC3kg"7$+LWVfO\7]XGOog(յ{VsstܜUcM-q*;a͗olZv'l3VW9ֻGđ-h޻<]b^Y-e_yHnt%xKUP<Or 7IDHCr@4Nvb٭zE.%&]PTHiՍ`JN+F !vpKRXA5a׬zԵlt~y)lflHY>_8MnSDz\ oif?YB$P"APV2@jj0*۱ļɢ]U5ą{hn:ui*HUi?r t[~MOrˍb)2\J@ªw,(-< o,y;"PHWۤK?o g.in7v^ȥs4 xXb 3cbH.'?OXܚZM+XƏYTW֓֋NÒ$?dyЎSkM Ñg0/.ǔvUcM{kxcXbE+Z%ߩBQW&U2FoۯU>'W~K/b-6r_&F黂H䱅g Wm¯0,.h#:#U?X@c34QQ^>FtNm:n?'璦kt.heV94lƱŠ2!~i[LI:}?6:6׿$PX{KbwLG;˧կ?ܡ=ԟFs=OR ۍ>_eӌIdQ[$QT|2pV=i.n>Cr`MXI-})? Fq <)I!>h-6i7KxrjmN94Y ҴѦlS_7M0 փ.qQ@HJ8łbo(4θ^hIdJE'9ϘyZcxaPi\]Ƙ|1CR쵌wP]"q}OVݏ_c0zbG އ+N rTlz+#h^Ȓb>E.XQN6ӳ V.~tV(R)b]f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*늻0]+vV*]+v;vlUٱWf]&k}8@F{h,NRR?!JOJA)v"k UغN{hF(v_O <7R慇.$o%maJ>\_}Nα0\JS?з?Y@Rj3QC'8\Ώյ#$|Gx<zLO"n?Kk!c q9?O]ޗeOlg>o'_FcDD\??J6ՂS4]Vq_MB^5cvDGx[VI@Ǜ0.ku>\ԷnPVSS2Q&VǜshcUx^=GO*f\d'y\\m/IaTJ([+ƿP?y/)8opI/=.ۆ[鹥\ #v/IXG=RO?z1YEr[UolXwn1Ouqk5)գ ;Fc*QqmmXiA _?̈fnW"^^7]L4cCGDdW}m䥌Kx;Fxaq?Nmiwl r/cb\ޛXM`Ru좸dǬUM1Kx-bv/É]41Wc q55;$']sMWbœn{cCƭ!l3n=ctTzdԦH2e_3#7CO_a>/hn5_i.cO0˱ܿUI۾Bٓ^S!~J|&mF`'՗1Sp˼w?]L:vynN*O}ls. _OɪdA,rW/t`dceCŴ-}&"%S$gv\Mpxo|a+J5A?VkPpzY!yJx eR=2=W.R ߴ?y >Ryj]V*Пa_|nx}8^sު,VT~jmyfO>\vC̽SoTk+=m:@Gdl$@?Sm@I>Y%4;yU,BTvt'4)"Q3_S2\;ɛqt *o~Y~wF cSG- ƽQ~<rtΚ|_/pĸgwx0HN&/7gB6o1:~ieGί --kY p~`^FS KՓ_N!iifrox2p'SiW/gr)"aI FÚ9%E}%/qUCfq:~`]^5iP%A:ӈ}/6eDrN_W]o%comɠM\??F_Mg*Tl{V~_=lkzՉOjoZV8Wik sq9:&u@0Pj?\h??9G|׫~ CQNa%{?YƏ%FM\Gij*~?ir/g?6Q&R4ץ[.}ٟqVoNJ&g[˗Ƒ?3?L0~P.;_2eY#ŻW. }%rC;3w8ߦz ScGYUe{AZ?uGl:dz\]䄓Wq JtBQ?LV9\w: +]@>̭[ĽQ XPAm.rByO3P{V9QqaZ:}|k0<o#c ?W$(</|ĔxKBg+\wuUAW 5itQ#!o#֖0 pGњV )O%Euj?OWWD׷? ?\!QQ?rAo?ĖgiG3/ek8qc_u2=gZ%qZyˋw`""?ݸn)2 BN:"=gZeTDh6 /ƹ:f%Eu_fqˡ']hyK'~X}+zr/0qR08Owm>:lC" E]LpI7B7ciP J9Xr˱Ӧvc|dR kbevQ]]]A]\]+D䤗eW!]W呒:d'e9;?N7AeغMB^e~X`).Vػ{!]VȢݍ2۲ح+x! ]gҐ5۲Ӧr[v$T`J&]WejvZJP`M[vž'bm=Mr`#r߲6E+Wq랧 +#"e b]ɩ—e X֘9+CҸvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWcv_*bʦ*ث]/v^*b\UٱW`* q riqێ0YBl\73B Hv9EqCWc0ݗ@+n `WfqC2)ف ]iMv5ȮNiv VHo.ǧ;AAL!$R. P`M&o3m/3d`h[l`k,jGBEAX}73\Z-gxx?lIDPJNWXAyOײ+(>~l6P2X>,=?Ak~[tg]%nwԎRU7_ Xh7HcsC!9ϯmdJ8(rm'AH #hz.L]m?pRDP|C΅MQxIBӐ& IqYVؖlJ-Ǖ999١xq_N'ђ/*M 2+G2¿/H̹%4nT⎣!.IS_ȥŭ̌BVT#;qޭϘ%T $gƠr?<..No+W&Ffd~8/u;~:3 );Z*4s$mK!vuX?.E&0 ەNNyD_2[)~(޿QE0uB@UЃ،LMEAyH;1^nΉ"@#=ʓ\-nRmKWgoYԽhX&]pI 'fYr gDnsH.@?1_4ȹIf?r~.? ~g2E\}jik):#wO$ 8捩}r>.z}\Ƅ+փ$i;ѼQGZH)= r!ܤnF{{X{ pNcV (ɟ<Ԑ%_οg" dCkq^{)O*KM_Ak䈶ʓM[KMB.&u')O5rB4g;YiP㡑oo^^"(l$cĩj2 Ӳ6vdȇƭ6y.-S[ӒMzZ2dP9#eʮCluZecU 7LG6qJܩ^dc Zgt(X> 5J0߲؀JV3 뺰? y cv(?l$ l H!APBڜ$Pa |2Vh4Y@?m7e+]~jrH!1uo j] >bcpI逫!]CbePw—c| q>UٗCQ^($`)v8cHvQ`ٔK'ck\G$ambr= 5- |B'ԷH7ᔁbql1v$H7Dv2 EQ_lR;~'A.r{dL-#(jv95Wbㅐ.v-O^+[v 5#25; .w-0o޸ȫ Wc}a޻aM0li+n._]f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊.]1WfvQ8b͊5i2튻.*qWf;bï-[:zxe4iH'6͛kQ|p [)VUAl.3l)c ve.˓cǃ\,ݘ Ǩ9ؤ M]>TH,]NN$0Ȃbx( Gr]=/SH==n9dqsv,|x&qɘ٣Ӳ_r鰙?͗_1tqa/T _#^H[ A(>% M4$`nSd9aS=m0YiЕԕMWY?g ]4;1kKkS<#O@OqsncNQJ0xWSPAqvt5-'Bd^<ݥŏ/?q}IeIEֱҪ> E_.#96#_;Oręֳ̏݁eWˀGv% &ZƳ ~Uiճ9 a??E<-[I?6=&XOg'iGJx\I*j4 p@"#.{ \@w~_Y!;!C\rarX[T;W UO/.'_^YQBsN@}E[ Vf"W>ጿA +?3r!dkm#㉿\r1j'DGwۮr1hݵ̓HzlZ\l-Wu?!UӅ%_? v+y>ż KO^%1y4S ]]:M2 x?ÒXuY#Ňe?$ g#joX^'*A,y v.[k:EkiOI6̸!_F>JlnˈT3IGRHn~ѕL%"6ϒXj_J˯rx t*> =&*ƭ!( 9z}\ꌿpXZN+qJuo:98G뗪sq\%ݸF`Sg#_9\W둧G/oHt ~?ŢpȚ}ޤɐS7_P+6C_87%%Zu='po\q2Fy\fW)[78TvM?7\ Q0>v + ߑ',7mǘ◉ 0| ?W?KLjismE/jvOdN+?wXHzalpF-IO' I#~?٭M#DNIYG_꟏2Jрܝ#)~gQՀeFŻE:USEnLqÄYGhkiD!Km S$k1n?|_Usu\F_OD t¯1hZO ?e[7G/!`E3YvPYB}WŘB6i'qgSJJ ofg^Y29'ciX\/;IO=6\H,1 3y˒7fzP2KY8𽶓T5WEMޡ"$!o}4^iNgfaam\~5_^ux?T_OJEs4yk: B yR~y*4Mbԥv!UGެ`*Ԭ(xb*?}>_B +R:/ wÚ9p={13ث*{beC.̠tUآC qZ ـ0ZdmU.́~.ZltMXh2@?^ ţje,$etjm KتXc.<ڹl1]]\1p!~ͤqFb}fOfa\3K /ԕitsB_HjjTW=,kΟk5s6?c BuBP1ع+bN%]A+7LHM[.81zpjk+(v`qKSv6fqWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU8Wf1We*mqWf]vbk,b]U٩08M[/M^hq_s ,:9Ol2}gm«@.;0C`4\9Z]ء`LUdv]Qߊ]]Wc}pe]EZ0ƷrRETؑ,oCd8Y;+H;0*0/afSc7\*vJ|䋻Kqz#QjMFJ*A+ d%bP@7+iL.I}P啾|M,dk\}9]\P[GuP@q$xJ|_K}v&^2"Rq;~EvqVFy2?4{~ږU^هɺ?\y&}->soeX=?]g!'RQNschiM z{]aח{$?#d!o4v9tnkۖ0 {}L $WWݺ}׳`뛁2jJnh=J|& __\ ⋛%e_خ_nK*{Z<]'[aG%'ԤR0$yZńSA QKFU c2Wń7 MB>Ď>Or4=wҀJM~!$3RР'/d9t7[n=Kݴ'G>5SN #I8{aܐm3'^Rq7א(v4&kzJX?i lB^iFaaA0qʥ[KqGV \{F,d8PwJ)O&$![lmwC&}qwS'Zy<P*:I{x,ܴ`N>a}v[ۜ˼?ܭ[ɂђ=S&½g"6tC7ZG]m,>ᝒ,M:Xn_7ms+c kˑPj/[(:0߶Aj- 7[y ax}ifGyq^MOiS^2K}Jx.|M~el,{JsyGmf QM>COr|ŲIM6&tmn]6py#+N+D;iuơ(6CFDv 2ዳw+uβoQV5̨ayOk[Kura H--  ') hOT5=I[)Tj| wя\gc.s:JjRxyL '7=N?4ѾXn(k[I$1ܝ'1\vMe= >|,Ȇy-_kFc) ?TcQ$aOv'dmLx9N?Jm)+[;B?#0HK-BO^k2jA"?+&C֥z)hk\RھA1KQ E]6\ViKo]k(ثR۱a|ئ݂,tROF {t+ ӛ4q)Lh:T_\֙d&5Tq7yGjO)8cK$z`2j_0 MVvyi(V_R\9q}+\\Vܳ&&n=}bXF= 3Pd+[pg>U)"OQ{7Q,Kqe;,=S c.~;}$'@_O!xvBu~H0 G ꌿ/& es\!UEio_˃Ā8G;Z QǨ ܷb,ǃSnCjqOi^?͕C-ݮ<|PJ?KNLQ~5RS$?s|.8}-f0[V6`OE?kj/K]8\%Of`~Saasgd^͕ot-kx_n铨gMB;#ʫo%ä3sU .-$%jr!/4U[x$~o:v<}G#3BjCB~=ʧW'(Z;;7ec&OklG\y&g*_}C't4HW`-W޼g_>'x'5Q#jWm1TOSǓjQ'?\?NCg~`KZCFդEʆ9wM~'?eøձ|MSt4)![d !HDz~hp/4X__IG\uT)?qiɖx2t?T/.1yO5ܠִ ƍ d:vr d4Nl[ oֳ>+Sc=/_N6~-ioHg!z}+W3B>l|8O]VGn*]Gng7~aۙ!ŎRy\ʹmp~9S/lyoԭq}J_k8-_V&H?eeR}Km3Uc) W@`یc$nyfZo?#Ė ߮?D["TS@(>.&'sgT)t'C(a֔$Nbrch?JxvILAaQx?u>#BQs4ig,t COb?}_(/yC 昴蚱l?OF.=j GN@vUr(vZF_| gSj(i;2(;[]q,`$N<kYɱ"vւkgu*7 A@d5#o1 6q_&\HƟy'_W˭Ohwlsp4ݧ鑃8Y+n$h=Nm>9, . \.ͨSNGjWIoK;XnaOV4*~ȫadqJ =EF\P|sCp4&3nM02ӰGBE(' qa.G$4#l\+7Sَ(v`qWf]'LU؞*ثb͊6*ثb͊6*ثb͊6*ثb͊,bqWe]1Wf/vPWfٰu'v gTv̜yXJ60`N(ztr4ӆT˦Lvv'bdM ]+ce. Kc(늻! Y;/;fc]~3]THc?)v(l!.ͿNJ\pw3"p}6AAҥ#rkZ`fn@jzLHzݿlæELI=w8J!@b>{Hџ/sW,ne}mڧƋ 9+~P8 cȺ \Ug+{zda^]7w E5s7m12D\YJ97^j1 {ߵ̔!P)R;&'qfc@?@•~9唳qT>%_?_m8ҋ0$u[7dmZ/+[W6EPZM|x |D?ol|n9?⨻.Ԛ[(%6$q|w-BNءbI_ Ȇ=C=>~Gl 5K%rL47k5=W&s^}!Iv5ɴiQ,JUu<ж=E"Kdq4EiTt=6IDb]q4ȹ%Ynv"NC*G׸&wdUZUe5UFRuH[ R# ?YLo} @ Y/ma,g;}?ϐ[xi%sTIjHQS@g@v.Z(dIo:_kğJjҿ80~blEPv%?X.ϫxy7?@..%ƥ9&4TPeƦuWb=:.64]h]0$7|QNh#]0*Y.{~R]/Q+LSn~.*1K$YP)y쫹ōw-y } cM%;G17c0X V+~`lY6vOb 5wv?>˜Vo5g/d2USA$ְ-!Pu4K^_F DmԔQCӔϩ;"_6`sHnj צc&zU$[(?S"[mkECUk&?$zޤ V_$OM6 qzIXrWEޞ?8>0>7mLB-2&X|?aGoooi|Q-m+ʿʘC;345Rq(uͻՇq ?q ?eK/ÊV6>(%pce] ^o?PEk# ??_xE6ĿZwh\Om'G <_:0B$=OJ isM ?Y'_Xv$4E @d#_ey?ݾ+U랇_?-f-ci/I3Y\IPksXUQM D}?LS0M+ht/vہj;("΄\xv̿kW2Mm-4>uPobW@DqTw~I] .,-Yݍ?gǂ6ѵ- i[ JWM/[?'C1hvUӐ?زRBTX#!ǩx|y_~ԍTcJ[Qp%kI ɫܱJM*Acq|/aۅ_ E ҟ&nUF #;T$-_p8~?ZF {vnp4(Zw?~*HT5i?ioP$LHp7PJ-> ;!XnAaZfN+Vgu 4`8ȣn.ԇHO?;U_?zڪGƥ9?&}xs^_@ >'q923HޢHt'?P"R=dq? G-|[FVZ4F4MJD?\VH"Si}8`)4BVWl)2Zu? .Mܣw_ sg։"=HM SL&fPVBZwf LkU.GlcA)jWSH>?gO*[% ˻Y6+­QE zR^\r@Kfĝ?qbEGp`J-Wm"ɾEI8I)loqQA/l{_ x5aB7KfPc&N*69 GدZ'?̹dd(Fe>?<1kژZӡv`7lqWc vR]|Uç]ᓊAA)v8cveQLL)m"Y~Q|_bTu2Y7O(j(;2n;]AQ]6A.87[w$B0ef(&\]9۟4q+ojcW, I,*;es"kO/':g喰rVd4'@ eWj@#^2ah*h(me@z\fa/-S4 ?2ۮ7L7#ld$׉irC'eS+W`2EؚmLj]]ץq-Oc*kvbqC늻+v^)v''\Pf*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Uxw]v^*UٱWft/vlUO,a V) t̸Jno/i"ƹ@v 0w|;c[W1nءa,]\RY/v(C +D{({=28K[~!:EcUQ .yG[N#­a_&EcvdUM켟+L 6O ?!*V`OM P٪S6sy\䙭jO?vfI:|"K1A=o_bn#ҸrO=x.8v^Z٥7>Y#|(cQoӠIoy?d28gr4=:˖o*|<sdI˟wՂsyQԯY5^h#lœZ<8ǿ 'W ӲPq1K0@+ ۶(v }dU\+nثWGSEZmSP7>GAA?[\rQ=LqI;D鶌T)j m6=/ g,Q1^ܴZ(ʟ*`D{M&p8-#UVFnWo]i -<O._ t4>ÏR?W[qΑШAAEh۝?̹9(){ڴYjF(?ӽg$f_Z*ʏ\Ĕ 4p7*j 9wgef`{@W=?/7fv) '4}@'cee#kn6pɌd^?/A]2Zyf>s5䃥~#?\ie4=8:lg#ubssv* ”/gO#? h{ovvO#e.3'p`G_~]u!rEFtK͒' |$KqYO.'\UAod/jP W+Oݳ&N;?U۾skisiZS/2*W$VrG?}˱χgOZ?tw=I{*0e+(] Nh_=O p^j#_+d8;S" T??8៦Ps;'o +^4.דևG͹ ˄9-7gg~8 ?dg+ILN&F*5w0ĀEH;gVW])n7ʽ7ٙ XGS2x3q_A kpB{_kɚD"tMԧ :UY&D /?vh֑䠊0ʕI'lyKye5sv9WG﷩_1|cvQ\o?'gC I<즡R?`/F% }9a-S4$9b&o ߊq }SIa ,Zқ|ngk*/?aєp>R;MG;[WyZũ5ej|jVَm4Lqq7QL+N Il8/\k {`錚"n7A\K+aWf]^eSWecÈ; G]vKi^T3_UBbbx=f] bm*z.We.*zKa0I]o (We ]:[v %elџ܁I[5jl2XMZ+,⁦n(+DA]t =\ڧUP=1aEخICĪ~8vׇM}N&}>a$J9aF6De!9#<\LPJ]?li?Aצnq0l%J?4qooNlh2{=UvSp)?sIQl oI8Ip2B*+"MY@,:rV& 8v J'^2ehEFH-2d/ӂTDMGxp@FdEd[bј#@C0"[ Dy5#m)żZJ)Qg%}?qC<^MZKVݾOBs[Ya0ss˙#S;S3)f 34(46U'FXK$!ғ)j]v5Wbxb͊6*ثb͊6*ثb͊6*ثb͊6*챊/*ʦ* UٱWf]LUgvP]0]c*n*rd"] +]2D|Hv"]9-dʠo1;]\U4;'e(v+vSEv|ؘŋѝKL^%/E@K ia3Y""+3LRuX\,8w v5gH+HCDSa`d}lU[<2Ž܍ھʿGƂ&fŸР{CiwcS)UPq Ws{Q <&gS BS=z3|n;oȡ5;䚓*y>]ysXCB- SԒAe,Ǡ?೤m̐$\б'#EELې""=Ω 惧lI.0Mݟxزn#U޿?,lWOt 8Gb7R?WƐHKsWwkƩZVXty$sJ,)ςOꖰK^AcAl_e@:F 1Ӎ)Y' ll-74 եFڼ@KC*j*F~d rcl~[V࢓@{a.zv)~ *~,puO6\3skfiH?N ..&} ~a׭%Ľ+SS$*7c)pIaMSW/fOZD*0s"S[HP$B,jmvэwv'p?Oؕx%fGSΐ-4%ٙ؞%Vbzf5?!ȡ '֥ z4>eHWiZ_:hOtz7F‘CJt8k*\PQLRY{bbyTR)v("6.-$aoN~,`*_`S)iph" Z0m : FX;\4Ȓ}-鱊S0el#Up#g͗"ܖt7wl+v'S.(euTlƽ+ic]1_FzJl~#}ɬ8z/\J8v V5NJ`5H-B[;lR#.Wr|)M'o^4 ]8F/c6L1^ki.Bnƿ-wƻ(S)hc2w?N;aDYxE_22_)sfnolcQl)~ZjK:R+_?_[k\z0k]a%Ӎ˅^[:]γ7t>ʏFM2%ZGjB}y__}nd_q" pkw {;ƗGT:n[De.~_oUg[. œO\PԀ$Pnr/6MVOɀ9'zF-]#jȴJAOwd#u-k rMGٕr OS}.ԅk tj3z#uM>?o> c#z5xC>HtgTjI=Q- ]~/[hN6)^M9/tԭ~a,u5eȑMUqfm6'kUe/XRRz)Y$yB=Հ/lO1Dܞӗd2v䉋-;~*=Xఏ^q^3l$0F^}H$dR@_OHVFHz(k}؃(m_Mo_6Ûx aER.ZV#i)_RQ8wpZ|[R1ݿ9$'+!%թC'-mC=,U\yFFa`JIo!p/LUNcp2ًu5ZXz ebb==_/UdikvGj~2Ƚ ?BckeJ O| cu—e Uئ;,;0;o])])r]`WcOlz9$7qW`?d| (k.oіKxS8'+L+ ĩveRƃ٪GY+,Cwh=eI+Yw1gjFeeYrAR]ERܴM'81KPbQ!u*~%%a88el5A.&[b ]\q{9<nN Dag'hlL[E~ɯNC3Xy^[ ojjZ9 M🴍+'p5:(gEgBִo8-/ QI_Ge F|g&.\QV ętWU?oS&_J($+3TPݓ)za:g1I.FNazLb~NK`򛨈şR2_溹C<ۺ|)q\-uY hfSd#.aτfyRKU1lM~ɮY'/VO-S[3wTq*3#"jQ[$6\E֘,lT$T{sfL(<_(d_訬9321Fe${~OcD\M}eG_͖G`2q%n r=0G'n>lG7Y\be'Eqj8 }Fkm Awb=_\G>ӽ6U:E֭4H%&9![;;YG_\?E5|灢#Z]ǓC/N7?}2kO.AjR^|,`WÈbrQA-im=)y `)U?̺8:|Ö}3Ac9 LjZ5ؕk B+  cBk=tO O-X Nesy=/Cpq:2T=3 -#:sviO-hl8Hğ!J<=>:k ~*oY]n~0s"ؼEq\vĿ2Y&l@yV;8rʅ093_'uWY`*s=a5ͼy7͡IMWK׉u,>sFX$~E؅ЙmE5x'mc z2?0ytmf),Ju mey8<|/>;/qKI]r)L`QUf=1شQoL}'ɶ Icdg̱;%Z~c񹢔Sѿsu a3NYHO)5)YDAS߭gBi dI 횩ejC?ɓkX2ۯa(͖Cr?쿠Pk(+oi ƩAmMit?>֞7ȤA}9ǔ[G%I\X9[WW2,ˎRz~Cr2G[jd [Jsu_s;]nC]DH`̀h._ ㏪O%a<2/}!d;\-&(Mr1#tҸļ bZHafﴴ(&v4~P'<> ]̭]#'۱%9.e!X}OKq6g1ߟ?cf& r8dc` ~ǶjOFetH +6*Q EqWeƿLU؞*ثb͊6*ثb͊6*ثb͊6*ثb͊,b]vlUxWf8v8Wv&qWeaWcPpWbFkY .[aڍ صL."1Wc*zbv= pNˮ(v(}v[?|mnWo=UgdIr!]ԋ7բ;/>?Y26d/k6*.Xm]n7 .#}yX "GۅmUՎ7SZbNxaWx&ow*ɓ+dYH ]ѿ 6.\wCo9޵]'u?V㘐Gp5=p%2 w _,I(+ =2~f'oQF2'1oN!Z߉+u?"ͦ:kX?W?WmKd3T6aYdu/ ҂@'fO/Kt>JD\I#$-8Zʼn|I(8Գb Wq~"aY4E}6;WZLl?wv(O5[Y 3Ib(FM:FWԂyo N+ g%Ȑ%$W?uP\ZmݶҤW-[Ӑ'-5b:#XFW$KnlА)OyXϧmP2n9*̂Hd;0vjcm?pS(ȅn&>=ip|qO+ToI'4e^ONp4svǰo'.-S`z*iȖ\sq~姎W%xsbi|vy> ?'毞/$ /2q '>K{_(${8ơ1ጲzl6^I@G@:aƣ N*9 J>Fٜd CAC<5a߱d$֋忚 N4W'Sl (״"}eƿjۇ~k󭾌nOui/u[}.֤{*/PpIOSqCk@GJt~g 7}{K7 'k(Nf_<6DF4sbg+JŨf>Z̥W7w=_Lc W5Hɹ;*g/).==׋Q.}JKA2A 4-Rm&nbޛ22!Muw42tn&dմY~7}+ 6ZKym^G ~?oiƏ>0*X䉦ZsjXf쎀w'X%͘󇛖/lW+DSz֏]P@?e-yv]bGB Jx/͒%ci&V0W[[)09{/Ց:]]⸅0k#}7AMͣobY6r6 Kdi]]z1BƼS95srܝ_K'KxQ*=_˗ZuWVJUF y`F5Ui-i4 wyFkXU!% %Kgë$^r֗H&oRk%^_:ɺ"=s[kgesg4XdbRBv`+ZFc#;Tw_pUQK7N!I}^c+YlpY+Lъ!'ir.?o 9%0-;/YfI7SU#&0 (wu*uHDzCwVǵ<@Z⻩?.T8?Ze[r-nle7-,?#Cn,a^pyt_frQay"MX9Olv_#1sNu&I, 4=t3JV{mQkI~W;AxZ:]NbQj܅rVbM N9@daBB1V6 P|3yF}*#mF|T?g,Ɛ_^-"Aµ녊'1Wblhi.Bi*t!ؤ~j]T ݎSQ\7fl*48UL(AW`ՐK(k/%7™ɀ9'b1Bgq};d#A.H&lnMsQT{qG3rJ>8qnyW\ޡGJJg-ZcA*/lV0pvH"͗7/wm{[gZ)0UhqK6MԖ6//=x u'45Z]ZIv+:PsLXykRWԭ[r`s_ 'u3cq= D..h } fev|FL9.BKJqQ mCᚘL׫?en,e GC9V|KOf_y;ۅ,}EkOf9'y[Lr|HܲD ?(&iyFPݔƦWcp+] Wf]o6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊,b͊7MWe\UX]S *gaX"eUˀE,.IP.,m1bA-؛edV1'eMqWet@z)vX;*RvbqKD;bVF;|S]1vOFM^m$ Rp?gۖN1N9!vvj Af< L(vlUٱWf(dwAޣy<&؋XeI4e0%jt./\81^?]2%Onid璔@qRv)5'둁SAQNk&,c zv_?;\VayH60o'M6Dɾ#^O[|_ sQPƒvsN?'KA˒<^^'gbLw޻??خ`J=ޜnl韗22ZpxfV.'HG@P?[/1]o^?b[A['NCoqD~ߗyzj T}n/>R/>K_CmyJF|otL=a}͟az\S~[|dVjR@~/xs'O&^oGp6kIeݨY^7bߓ8EKS-v#!!}I*o_SĞc܏D?kL왵CoP~z#ݜq`GB^_g8ߘ{LV=U`0AxN0_ȅۮaVyB fܒhv}6ĝrc+'f7xAY'+S-_͗Ze="#S=?,'gC|&ܷ4okBnqZv&oZQNRFv]#:ҽqKX]jzة`/7vmLűWb.|1CasvtO"K<=;p_7v<1>u?UhQ"-co,r=Xvv\P? c9 R.'-3#e4#le1DqE;5}I#-OTYs&22_ҊIM89ǟ }OdcUwC ?Q_*hiU? 2](r!uwIo[jZ\̄9O'KTxcMuKz/~GV pBG%oV}G\4/woZeY+1+Nӧg[kT/+^L8xb>W򅯖WDIx'!3!<~[-QᏧ7[\Ȧpi2ag_ϫ=?R/#hqyO1*9!=Q` |dwEz"DQ~s(w|ַ-J7=+]S XOnN|J~񐘰\.S$d?E|s\3x;v$R{ *+- v?A7HvQ4~ec_| ^]Gu9(seզv>Lr?b[}3v#eN=v2X1ʘrv/~Zءon 8)eMheM[DgHij|RLEfkM$z{Y5AFf VD|^6_ FI|[s#Ì=?G%}L;u$޽NX h?d&YV@wSX.lҜґz9_1Ryc047|?8$};syNԴsof[#_󲟱̀0G!7H!-,n<`vJP/I87Vڧ8s$#Sr {ZeRhss2鏣eB! ƚʱ&Gǎ8RqKuqǖ6Y'㨠9ڝ0x5Z4OmL4\QzGa]1VFٽacg?֊ eoG~YOx"`(d(6#ҐFB5.8[qzsgL192)p5N٤^v7 ǣv8v'6*ثb͊6*ثb͊6*ثb͊6*ثbv_lUٱWeb͊6*Ucv;)vU0;50+1v21v8 ErtݏU$ƒ.X&N\bƝbJbRtY;5qWbњ!nw?U~a(krK-"{|C€m$W:awFڝU؜^I,ׅwf\6*czr5(56X-գ (m`VHXpcR-8QEf8JGh~(|_z{f`֦?n0~ZOq(cup,}Ȼ00v 9% *;7DwS\H+XWsyo__2@}{r{J$ˉY xl~K;Ru;(5WMy)G^ru":DhqYmE)qĭ-7aL,>[|m G5Ҏ8S%E}6bu}g*tmnz/ۗqed7&!#!{bu dh^_ 4$R@OPEsyW[]bPwVC|ضhlKi~2~wi[ Pl̍ =97'd@6"e ~#\*nz"܂GćIW[hO.<.7lu8Ҩ]=. AT@Τ/W/vE`꤀ q_Ǧ\P 'oz( &)E ]2$6#:&Z떢[/$rOkl&m@hVQZ 2 ZP!"e(T큍SjQK?IXv,~?,RXH@u]#F)v)n)v*e^1Wbr(=Av1sSiZ+ncm\% 0듽>ͶU w)irmE6/'a_yȟռ@o??Hj:Mcg)R>e$ҙu?}9? W&GmB47_6w$yNmL(xL%o]Ρoc<5ثrNF3HbHE _'W}]1>D"S{au'jʙ"o8ѷ> 06s@lmYd)5 xa |QLq4w`x'F(j0DmfC ywXԳܓKMА]RK'c rc 7cDN w$r(ceev/%`l#ZYݽvQFB1|K~,~a$:AԃH~%>mJw6_-eiB+?U+-6ZluoF)]۝&-#[0Pl۪Ӵo/7,~^%ة#> o7?U/->W5#9nɦ\o',f}^³vo8/NP[>&"R7]{wfiMlZf RوvW+-S mFCusUvU/GFIG?? 8vxi$_z蛣Oi".n%241)V'=}FyM ZD:l+eh(Norn5SDJ?3ңGkR-ֲ-(~W5-M>ff_nfcL;h%a_WuI _bM&16.be'32oiEH@و}h>KLM7WˣS(M$ \{6lzgtjJ!& `5+MOFoS"Kl#{ug m_˓qxSm(*mnz -2?ݙ<4[yFm?BF-"U%Ӻp(ZVIM7;{Ț"u;ň!9v_ړltV;]@E~*x\C][Ωb qOQ ~kQ8~5}J~Wmby{͓NG ,?mQ ki(Pч_qu1,kp=踑cP(Pl7Ȱi=S=r$Bm[[6,qP݁OsWNoB)*H2ybS+i⾋|H-OȞmUzGsuxjV<\Da[jPIn WZYrh+ .%tt%ni?./Qc+A PXHeqH@M9!^C[D~[j +O"Yom'Yi)V(G˚t{v1nIՍщ ֝!aw_6*3boNWmMrQj-q/?S S9ڞ؋)va]#;2ǮXǓZeli2vf5—e+aWfF|[m7D-c$!1S,B1ƣ`ּlSwJgIVM7W-S$V?eX7?k99O%<+qBKI5?,44P(F7G>?+][D% , c^rmٗ$_S/6m:]*j]A% =@LAIl2^#ӪB)؊f؞<*);,΢I]0\c݉?]5^v*P1؜ΞC>1[v sTebA]&*f*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*UcvlUٱWev^*ث U٩.8sR찹ݏX6Ub1c`C2L-;>Ǔ'c2v8UٱWe\Uءv9|}Y/v9N!Ŝm;I\g@D{$3RۏY~!_!&0q΋nIy}wa%fi)ȁ^݈ɨAp0qc 0$ږcFgS$.xZ91@.k hGqA?f6 䜛ʪ݇Uo%Rܟw>N??q8yUTCVS?\ !3V_OV썆Xğ2=˓MOnoO;^k?k#dNΆ :_:FuJ-27zt+'4q h:~+-ޢi Hٕb;a/1Q3dA-?WQ̨?M{: G/Y_  y}p6zusHyzPXǩ}_ͶZ,5?Q^Y>7?0h'7?D??9֯j`: <ޟ vu$Tqaw$mכ ׿g' dZ|0OK%T>-Ҽnm=ڕg0eˊ^;'9; ^`o5}KAW_13.oE9~? 5)U#)v8] {b,LUU ǧZc]]#|Vݙf.zV݇:ﵳBi\]FGK^UN4*i^XOȭ vI@ilْ #y̺l?@za4^Bi*>Ϫk?6囹vH?IR8݇#v5%Oߔ]wlU?&mC+l\=FN':N-3@_^8%?nY1^k7hGasInHz#k}>dI4nG/NS `d{@& un$ܷr;ro؏,uFvoc܉??Ǫ.oY]I4V[7;ohMbм eZ9(W}7ۍͳÌc?GY {z[@o8dO<OS)^]4ZWe0h7`>?rmh ~EE s"Acb=8KRk$@D9RBWs9)"^hC8B335sPdBMaBP}8ɞwgE']@C\/QO+#U8?˫Z2m4 Y&G=?k#9L'$ SoTJ=̻(vH%H?ICQq6 $ Z HXI_~k֏_-TS|KBs+m_s?[}>ҽbO4.Zh5ͺs5BzDŲ<"*Y稡/xBjZD2\~8`XW.@)?dt< =?-*ko !kWGۆ#C$Ѝa^[n&V?,"ujM?EiڲtFяRK7~5M#5rpXVcb~*~l?%m\WG-z%{xW7?M7󢏆C'Fgiܿ%?g8EDf(zjOA~\@XLj(;O7axYHQRuNp׉Yg cņS$imx%&T1ö,Q,qH/nJ̴pXwM? *4~cԏfɉ80UƆY.a4!ۄbG6{s(pJP9ZxeR8*.,*=Fn8qxskr& ۅ8TK=V>fH{P+ʝ—ebǎ.^r,KB*)"Px44ȫc(Al@0Dm;7%l㭏K0. TYD'"7n8DGR'blxf.vS31ȶ<˧2X@+ޔyaiԛQoQ(G9=bh(ib9,28 tiG"X#?\+Ggaad1-2 5>aÐ(4$Zvg<J/隀O(re5+p DAH'G}INl=DE JԓSZX$ V:r/޿5@YxnX*vv-0/s?[U:i[H.gyPe1 ܘW0!l݊ib/E ~!f:!WN .DZ?0.u% 6cTP3K1FʝF(=IcM8sUr*ث銻-bWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUcv_\Uف]vY]1WeLUxb\Uxf/[v8&H$XL-cd۱";6Dc1تʒث]|Uv9Hv\r`($:y-4܋jIQurni`i5(PҼ8PIڟm$I@LG hH=~S?蒆Fz[ q}.5eawsl(Jۻ~KoH&ԜI(|Wq7dAGڧ?{5"ؒ@.ُ+o^dK''Wo9G6Չo+&B(l.531Bg:}+Q>%N9)՞Dnǩ>{V 7@0bRh΃hmk9rzM{JnT,W;@6V1R!%ϩ!ܠ5,~dh}[?w/5 ܞvlGPniAe$FE6I8Fvm#W ^a֦ 0Zo\ 2iΟGlIGwQv6J RNobaR:?Jn˿ f? Klq6=7 >ܩT͒& F64+mJ-1O^MoW+*ۉS*yHw¿W>)nq&Ǖ>e_op.Ynn?h' IZeް"S-kZ֬7¦6ɀI,L8D:'r~gNY<byvĕ-GYZF93i>O{z ٴR|? }?ZՏsRQw#J'~se>xF[R_F3#lv\TFڞ;u+_T"Y:RBr6]Xo<-M}r FTe.T7t/5~M!*4O/hVzJ{n#J")_3TC׷ᩤMqjWz?p3B VC3iE3NeKm9!I/xW-iq'~3RP9% mNRM_7/5i;6iW9;qY VHv=)?,Z>gڡ{jw'q[ ~]B$ ~U )2py5B=jFŚ&U)Ż5ŭje.lFf*nCAĪol~')bjDb9Fv5G rPZZj" Hr 7sa-q^ X^fߠY'io)n(𩕹\.To>4Xh~yA((ɇDX]m#iyۍ/Vk+Ś6 GFm1Y]$ c'0Q <M&JQ夋F=r0b 9x֬1UN´ʸ#Vː4\I^/-1XOOV.ý;x*vޓ njB[[\lM)]5,fVcKOƿ~m4܏'FbRt w'o#>d{I(TRzxf[Cѓ6w3Vgfa,qyG_[a7O"f,@+7s3;{fwiKƑT5+ 'ebUآw]*f*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊, UglUـ*Wf#vlUن*U}1Wf]['*eN42ڝX0.Lj01\(v# 2bg('ei\KLUD 'c]0!?V)v?N.ǯLCb*Ӗv ❲v"4XNF.έe٣ݳ&Se29VPo\q!v'6?^,IW-|Lz|+uZ0V_Ӄ|EdjZB4%l# Phߟ/rNQ1"8QMRJi-FI@#W@! ^i󖩨V.م9:M,@J?[FNT]>UK.Wj -/^YDt鋎v[XmzR11eś z^s3{Xɢ3M}_GSn@j?kG)v7*YQ~2_Q֍>|r>[{#"Xr>+U?$w1PAq8g״mF醦c^lj__ Atq?[2zu"ӳ/SFыI5|VO?|Yc'2#7PרãS=fSH*4Y˟`F> wgY(6.mGqY]:'ч2|?bE pO_(B_%Jm} mdgSfd_oض'6l| J#$~!\zw0v?e#cg6 Q~/0C^ےqUr\z/-< Cn iƠ2fbB;>ziqHqhN/%$!'ߞ1g롟a?P\T>+bj n:W omӱUH}qbѺTzG*H] j N+Nり6)v䱵jq4t⦔>?jM=iͧvU U>s8!eN/j%ż?N9f,W@AL V+v #Zhw5? }_.^?'u]Gׂ YF:~rO, ޥ#[[R뙞dO/MßYgzk?e%? wԒ^N,@!CW[|ke 1 Z46@r#nw ]KӾkfH|p)FT9 HC5_?5KkX'8io;aÔNK?Sv7Эͷ2@ [XcB_O䋳Ex Zۑ??i}+#.H0PY P=$AUџ/90 rnT#~*%1;M5×^o K,L}92nPpet~hpN~AsC"9E?hw}ݲQ8Jqm"^oK7Ͳ?…p7>JAmBړߗ&zGё2cŦʶZR iW>S<;<S/.JhZ|͜w F?d= ?AQ31e_ |U7Ь*n=|/{~c b%??z*\JdB_$}[?)|5sYXSlwjFR^O-Tzq~Nzv]26sA#fSr{+4^ a%6`IީvLwџLP'Hnk͓er|[D'5qN_jpɨkZWĿxE3C9~8$'[smFy,S1&:Ox挫Kػ-vc?asf{di6@{_Yx C[7\J9buzC:*#%o-aBG?~?yL%6v?zԨ/dI\8i qSJ.s(t?50;q*,ػfJGW?Rp|IwuATj?~?EVNZ@@H#Z~Ӿ#KzTC B^OLƴʃ&\"Ӄ F;G"4^r YGBhvR.?e)Fk +`}xJpÆ?XROVDMEѯq?ݏoYZ $-LF)9~) .(ʑ01_Fqn_qz1M4f,3"'@P/.}XÑ,XHLJSoG eGK%>!w:bfd HO5O x<4CQJb E -<5(cMTt;Rya4}a$=x6pqc@ӶΪ2⑜w𤲬>ƴ=Vj}9>.4ߨWw$@Ԯ'BAcㆺ-z>;?:`)?&msn*x5>/aܣ)낛ǔ.VUZl߁'d_-R}SG !pO#tۅ Ϲ,0QrLż|h;X1 H)KE1/Ps2XcWhcR2ЃzOvk:qHex\q3-6_靄 jO|rĉx]j~KI#xO?˝v gŔ#?)Id;D|`d{RSGՍFC)k.LN5Pj+s&}q=9Z>&uVYzYFLdwwO<Ƒƥ*1FAfiB! ]y3O/khGEY1ɗF8cNyvc~sAv͎ ͼL1 쬂MWf~#(!d ')$wo|Ѭ[ze?UG$kjr|9=Ρ)G'8l( P; 14觙OF#֘[p9赥~6iW5wsT[=ד,M俵)d;gœG)3~.́+Bnjʐɿ-ǩ1[췁gr9_|g/Z/5˨oOOҎ%GB%}?T{N4]j[!k?'N1,Mx=~(2TTo,~_vu{*ujD$ "?k&M$ZyK+(f*>.k'K )$ sq!Omqd(yvnԦ?\){zVn՛Da$eT9/PQZ%'`a_oĚK4);sK;ZuOPjiV[]Y"'Q.nf9<=/b5pzvfvkQpr%/BؙR"N}ZZcSƞ;~s"1ښrwx6m}JW @+y$҄i6 ׾{ ȌvVO+I}gvbr 8E5wbGV?\5aVnS(˄ A4i'Q-``ASq['4MukTAkm* paSIYw7T\VZQ ?ҶlBOĠ%AO H+U^dV"|LǧR7sG5r\y$[˭-#d1*Fp۞QKwO%Rx145I?gAZUT|?o¨ pRܩ/+daY"~$Tl%̋-7y?ٟOwtO1݉‹JC-܏4 @TLX[WnڿοHJ-Fj#~ё&DZ*̾+د% Id^z+ģ o 㔯S1NJU3Hcy{Ic1"a u'#╲_éGU(cyYH\Pi)Jv*ȼyv[Z~ ̈́"4.cKi`21[ddZ o?g<^Ȥ2Т???*h=;rLъ?c/tخ8d!u?e}{e,-3hWxMھ#a`c WvP]SvZ! >Ućb |r]צvf5=pE:jr?l" `.UF`hZhs0%X-YM u~_˙r8}XԿ{>>Ij-GƼPPayΫx@q1][ !Qn$ eM hR4בbHC|ʄj@KBSD (ù1+^eYpW9zF=-Y+c5y0τz~@I9(/^5_Q]s༇$ϫa/af hyItgOWv֞_MUPP$' 3JgP;}8[)]F̊Y9\CI;I~BsĆ9$3.a!A.h;I\LV".l3Ke?1|^V4X!kaemhNH^0&h;56KkWf+6]~b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊F]Z\U٫6*UٱWeUٱWeU+O5r#ev1fxC,(Dž]8UAL]$YbmfPb.Jq1Wf+OlRśثCvS}9`C4eE.3]=<|1;t9N(F?|NL={w݆:u0d#qnbRaҙ2Z,TĴ ߖF!Ytv ɴ;/.>hjKppvyow~ѫN_F96?T?JG)2EydYA\p<=_'Uo#͉&wt}PIC׶nVz}%Z/rL%l'O:>RKN?+.mT˦(_ǖ9==uky-2uP;ðBE\TcW'quHg!w:V7\OޅS2UQ%y}Gf~8~V.[̲u>;?!{W0N:_6<- ռ-gL`Mgg_, &`ՌK?҇wzr^嬐V},o yD4%OO:/l|r4ncY]Nw}J˝:^$ko] :}WfG&ܿIB{`ۮ'rjzd,_w=2x2;AIs+R~I6 Sz 2nX6,[ylVg_mv:g?.L@u3թC~QaבC/AHz~O˻ sz.e(xd&Fht*B%Ͱќj|ۉBUVdUN1z[siP:']nIn\2T dd=a4hf~1j?Oܸ5zaeLצD$e#gC{ LHY?%62(Dؕ[s"[tx c}1Ga)#}U[~ۂ??Ook_\#E7?@:^𼩰:>Q'@??̈́Ujw# j)Q=cO2HOfQK/*xO/1ۮO{9̑]&A{8-JYɢcQ"&?€:R*h솙8`2[`yCwQ[ƻqPoڥ]NwnG”̷/cӌ1鿜V% 7=M.e*\Ȇ`gN&2%$J6:js {0H}f,sx K{2b$R>`2I{x=$v+$;TWQWzᜫ~cmrrA+nasQIψ=^J0GgdVvSKH;2d"':5Ef`ʝC%?k3.1ڭ)?SbI-bk'V-OODCh7K5C|Ŭ-< n^Bt=d҉/)̧7K[- p MB.|C -3J@Es<7.NA/@c^]Eoc.6KCFэUpB<$#g3=o2-ţzP>dx/'~Ä5f8ghB2ckLdzd&;[#54,"mvrTVbQx6'rH* ,/ЌĮ'"?H$[d'!!$I.mʹ }S+CL> q/zN˦*wA\Ute&b)OWcr iv4vcWbq9!͗WuD7HK2^ 5`M\LOWcz{[DaӉ&n P(zZΟWhD*G }?ž'x hq@ET1z}9!0"/,I@(!̽oa1(SxglOQp"d b{d6q6ggbWQEt$yE_TolY6ehsv]iu!qCpG7C2 1ĘQJԎCM/Goc\7KЅFdak?Mza I|nu(%2bE"M#r)}Fr\<-_OOz<9I@}ogoa%AbT噙qqOT/7aH$ei_-疴_z}4 [eWpnjDz.6F0yG4izѵ&tU)Sme䬼ז6?,񮪖*Χ"WˀèL1=k'u?4۱0Q 9?~S6 eHZ#'("ďˎjWߞ׶hg`j2ͳa0-Qijz&˖%x\zzg{DiO+ w!m3UE2 `2v$pNi]~06)[j}ᥭq`M%wz1>j*@:Rɏ#ƼPqP*{pY&0@)׭ R$0RW+,8[|U6\DnR|#NBYHWqïVswtM_ٮmPZ2mAU'>oqGmme֯._I"zN Spq_ݹ߳$ T&6^a&r Sn=oztlAsN`&^qeBA=rJ 7,I2pOPr}sÁ=$A4r&-ޒ{O?[o It+ڌ?_ѿ$IJ # |I Ho?oW\$a,Cm'#? AsPz`>1>"JoN_'??M SSua9 O Q_ 0 fFK/rvoq|i7:[u?dk"%7@۷ѵ˽)[7۲6! * ulFO0Ykcjt7 Z?rMVKs6#l30txIl 3,GӘM>[-VHOjdoLf6lƣ9+2A?6G'_C8I5e8)+V$[Բ|@ }"-کQR{6,..XMH,▂kr( 쟴ٿ tLji_|Avr`4[/1PVy(ѵթ;WO'r5MV]۹%+kO7<}ClV0._kaM*?g+Qpe;"-i1~~6!В)'PpK[OB= \Z e[7~˿jW)NE-v=S{\8EرMgdF{R:-0Lm0fN[2ƹFWN,qԝ)0xGtDo/x̸}UWJIDT_(ʱן$E s,pjsMqQ#F\4r+Fx59L$<2ousyK˷iY dI# !. /_|~C&7o;:+HH`U*o⪿VyA[nJ6>(3o?xE[MO淬 Ke_IVՠUnNyz'4cg $o/iF)0yz}It˿/VGumF> Q zNj3XOr6=Xܞ}-cռfg;zCE=&WÜK} Hc{tf*#BFċ˲;_HC3V[n[ FUV#VaO/?f*?Wjs~si8,@ "Nj7K\&;] 0Ӣ?Wr(e*9 yiٚi\ķ~@]Y~[qlXh5NʮWjr p+bb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/vXWe]*Uc 0NBʵYiu \%HurxP%Z`*&v"nwȖMlRء]\Ukv8ҢB)vၐv/N&Nʦ;\Uء;+IvtM*?,pXca_1(~"EZPluI̜n錇廚S1͔Q"hfC/y-&9n 6?ʨBms:ܻ\:S_kv~j1I 梮*'JSV?/ gq$}/?S <4BC!=_TxEz8KuieuW]}ԯ|PݪTO_< SCr-H6pvhi~˟{ sm0)0k ӍEh3A0$j0N3_L\2 -h7k =K󐓹mţ[ _?⸿mϊ"A*?<Ԥ4|n4:kxl12OFHpGsww{HӷB|_'a,0QS ~VlkقD@G2qo1TG1_bC(HaܟMan?E~72n1P_#E( y{mo6zb$)BXթL_jF6)Rr?U,i6:/J)e#V*W#ɐa~?8z!W^s篨[bѢ#S7,#e㇁ /Dxiph{[ڨ#.3 J"?WD=é_KV9lHf&LG(|5 9!Ӣ2߀#*=>iĢt+);'Fۣ&mcʟHKS=Ʉ?E+D}#Sؘ8ԝn2 op{/"9CO{)G;'9.uMHIPtI?Ed˟e8+^P֟3n\[uxj>d9d)t[bjC>Xxז?x&3ɐRUnGZN2~E>90'#Xiv)#z=-64P6:?''sٽrJ_u%PwȓyT3o'ٔWqG^ S%G ~QP_rt,xZZAy^B7uh[$rb]η.Cl_qq Ӡ[8~ybe\Ƚ9<2Aګ?Og c̓)~?2jT};6ҝ'u܀ TUONn= 6gZ r4Y=] <;/.+1Ǧ^,. R<mu؎lf1/ t\gw15V1zJy iL r\J=ڑr~W }vHtfVe/?W&*V\2_ĺZ،zn7C2ߺ_ޖ{>fvg\B>O[JbcM|y^{ֶGQۻ{/.Lws7*H@9M^G~">M_'s$q)J^rVsm4Flvi'IA@iڍp>׵>fO+dRcoqӴ/<+\Yqܽ?d&Yt2x#^S:)#lz}fr<<3R4x $lƝOVo+mu3qnG1]}1W&NAkܵ+hӟ Y\}v'bc|1zr[@}Փ>捏QӽetϞj7VFCa/Nh?ъc诨z|+kWKalhrvT[9H#o)ϧ.o4< 9iXg<@ZsG[%(0_|1Ĵ0$1zF2OJl@O8_ܝ6Mh|Gv>nfL3ƿ׫P7윔yZK{kv |7eO% sGDWIf‹.s779^nF @=~͖íi?nnJzp49 lj _'|./hhqqO\vz%/>-x]% r1h8.}-ė3Hŏf2x1D}1^1 lJH!uA;'iZVo/N< N?3Kr\+x7~rۣ̙ l^K]np7:MJUldb{pH_fe}_Rîe UҔsQȿgoS]db`(&9yvjkSDfb]֫I/?Fw&VĻ=G'fDnVxeOyl_R)Okà%mnҼ#0VQ0J,;"5]vr-_L>,hd|L|[aR: .ˮvZZKوjqWc@vWbxCuq˵P!`:o\I؟櫰)'0́vSBV%KaJfMŬm7$n:|kWq("*^HbKc,S/ PK\/L! ?>[[oٸȒ> qI?6E/..A7Nm%;G"*ii y1G 'SP8P@ .e5^5bq;"4ʡ>9"6XA?#?E:u{+_Oӧf<%P! 3 3d(`iiRvB4@;3Gcꞟ&nM.u'~ZyR9` |?ʕ DD2q0֮$nC amu wGyy50_=ͽ;IVH*ź }Fn9PU12 E&3dUCZUURt]b͊6*ثb͊6*ثb͊6*ثb͊6*ثˊ1]aK]*aWe ث銻 q9$6v(nޕzdһ)]d[@bg1dز ]"Wf+7sCv>?|Yb ]`CT;!%5գ_˺/an'ߗ%l.H>9y7Tܲ-߸K*@$w Ũ9ur;b .c]\eތm%9q d֕=|0WB]IN?˷p.IXѷر $YRi҄R6_¿e>$NL?k:[5+~|Q=1_zմrDoϏU8f7;7JC}QK&.W}3jEoaF7;:0^{;Җ wmtl! ua*b!ం,iE2UU72&М2)WzYz`BD)\ZE8"|v//_ɬZz}~/ \6' M1*9^)6eB~%?=S|xXHJ" 3W#%';v?kPpM$Ӑ}'Vko$#J4v5Hb?_9^,Ň3 vO_X l k*#V2W־  7q6R [@,_yZ4%~WJ~ڨ3?X,IM7vO$+o1Șϧ"? /AV*cRx' 4@ݼw&Ԃk&ASKu/[շWvo ra jz?9RQgYЬ̎ſ'<\k-AXmz%?@k1~ԟ/C؃#w4 /6,IEOus?^_ KLCW+(VWiu+CظmȾ+5/UċL%V٭f6;mtvXp^\ ɐrK=+eh*C2{͞}kl4V0hҮď<sh~);͑+=E5-#75pHT7$@)*u؃˅\R;2OII(Eoe%%`ճ?:L2(+h(z_r kcMGN> ?1kO 87ɕhz9 [pO_AagaUO`"1? [ii;Cq@S6 MiomYF>x3W_P1v<EҎ~e]PYCɾt[k(@GS_Sm/;Ӭlʵ׊MmF]Bc4_/H4t؄ hc.˗Vv(ju ,#G#I¶zJaE3Jgljz?e24z5'/g|u~n&&Y_4脲;5aͫ X T=*G -4/#3\v -iٱaUmc53Uat ˿9n)r%,[ζ!mQ ;w…_ɷ6T<`9-^}iM>eX#4 C_e\Lh *mKIkyOiV^C} >͒,zB*(_9XǛl>SZazbwӶ- wK^oT;ij.$9DhIjYܚўC,w1BmM:ּ#qHE"CtMR4+5I|%Zgo?,ug.P#^t >gI䳱'9cl@zW.4و Cly)][Gt)@e9ִ]jj}gElG3qhm{&\/0KWJ" |??YV[(& yHç/m;VKKЄ-׉~ӓ6CejS/s?g <)v۷ێFT4׋7/ufD7Qy$c9oFrVu-x+l0{d=BN+?8KD݂zվ%=A+X5lCVD1Zzk?N;$;5lGO+][["M;嘧+G7S%|?X^nď~9`$7-2RLo$  TvVa P[֤-#s)W ;WVT2\$ SNpKYWB=)̾?SM/DIw?| p2iw9*2壯@`GF$ ݕ O1eYF݋X{8 IN[W"b=?‘sJ)yTI2U>ȡ@.j3?7<1.?7mɬM}[]xFe4Wf ;ϑ<oRYdp:3z_O;qvmJ)*U~_k$E.+X[,~j` Y}Fp67mǘo5Jb2,QFin%9`K6!^O) AhAHч_nU ٮéjVVH9 x_EsEڙD9AV.Ue*BC?ɗ74XtRfx,'^F\_9* o{k;Er0h$ZVߔ??~~u[IalTlˎCiǸYN@P4{*2ȞT)ˇ;Fm-\|{w><Ӑ^0rzf&() $fK*Q\U*f*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊/v8b8We͊, UUن*]$&Vq%Xݲ.ds);Ab͓P6Vf'$ٻ E0!Q퀤;MG|Uث{ɒ?#+&A&G]R㵷_ݢ۾e )29IbwsQZ׸Iatk[DXD\I'c%L k0vhrQV=ڿʹ\%_Lca_!̪Ez+0 iO L,Wa%~/ᙞQx/^O/"Ś,5뙦VD+T#̰3?r~?x"cVd~eFcGn0}rw#^`IJUfk^?ݩ_(r|Y?z={6LGLY!ݷ؟]T3"_dhɾYqiE eTPQE4CKssxHCf ds KĻiKI6=hƆ:6D97e8r{Y@,W бZ7N_7ϢczeSzbrzt}`3n.ΖMx?;!1s\Z<ߩ')dc7.eμXς)op]>NֈE?vG,]hRa#d^ioU(Ӳ꣘m]4VOnVWuenɆ9;'~k}{,(R'1p<MXʡ❑0y][H=(ROgoRi ;T/&qݺ(Y؈ߛS "һ&?pzn[^0,O=#ߏC̟zgm\AM>%YG 7KP˴w?.ȴ3InHؤv ЃyDHQ_w[4YdrSٱx?ܻ+Sølb켅XeӋbKOs=I¤e\ݤa hBzU?9t1N?/wSc]?mT.rSimߒ)6 HoꋲO`ZzXQѫſG%:ݛo M `2#/KvU֣ 6zY dbx]8T\j Rh 2F`ӌupH!!K Mӯ, s6S&G~>4#y5 sr#6w-?#ޝNӏ/ѴJ-9nfLglyJNC;35+ɀ?ݖиOTZC,~{!Os $8Kv~dž\>AMh0k4pF;'S7/'L0y~%$\;|?s20ԛ>#4`f^5W8aZn. DLJ?i%|sjps YPҾ#/9(a )# ׮>t=&&)YT m2(*&"R'Ikw io#Ofd٧Qc" 36KeK\]>>b5_@o50"a#Oyv/#q)>GTXPOld֬ Gqe~zeV{vۨ'0Uge ]bʷ=7o/CUJ#11n؎ڌUf l$V[?(CI0f֮.?˵e`8Щ;rSѳ Q4mLsÌ=' 7q{\tqZiWX{V"5Xgs' :jc ^=I pZ)}K"~>./t)GIrxFD%qW K1C\Ɏ=nZ3?WI1FGBcĽz%hmR*Ԍ0?/ĄooGbz cQZ >*HZtΓ}wkv]/#oobPH ?(ˠQI{y+/6aN/aՍD{?J[X{ݹ۫߳_kG7,Ounװ(ܜo]4欵sJ 8hF\9HT VZUHS#\`s=: Ĕx^KQDZEvn@w)Mfcry+b{CC }_rӢiwlu;ٯr./?~D5")1p{C[p+aNuBxV*_\.:\y/ nj^)+Y~(FlB)+1<Cxqw\ؑ1vIt%?0Iʉ( \==@ I3(,iĈl?݁jw7 oM) )f'U3^P gmn~5;owM]̆{drsnNK cN+A vů &N_&Y{)$'ɏ 7lÔ!a7vfV+cLcssenM4x$V"=XNy?k5C$T$v+#׈G}`qJsxc㳴[m:Eʫ3M!SUVP]_DrU.;u+*@`~,VQ*J0}h`(i >Ͼ-Tp>f`y\@a)p=_.L`Oy_~$rF$ \ܿvv{UQqH_uzQ>ԍ",ލ'Ows$(0O~W?+ RWٯ?of>nӼooۑIK)x!]s~Y=;Y2^kRso}]}*hOml^1I~x@$е>tQbJ#y7uy󙂯3Q|uy ޜAשl7 DG.u#Y*:e0՜8Krh80,Uu?UyRleK")n?GXѢR̰(9R&8g?8ՠY%3JY^אW=^Fg<-g(<~0D^>\el_yT$"Z_ 02Nltm2>1WpilE2M|HVhcc*# :@jX^.d/f}{IC/F}7Z\Ud(M7E-=`׻;W24__Y tJWD;Iu_j3;] 4dQBaL }#/hiQ?CZsˆ pW J" TmOѓFKzn|2OsylwZy|l[=Uwbv 2cmo?dSdQnKge5diQ\,",;Ψ!-r6'k`iodr[)Z )"rMdR-:SU=~kǦ@-C3!N{US2]mM#R^S? _j~,C=E.-sQת&Hp 7^iBD~LSd|S{%Io,>Ma Nn5ny,cь^?pU-#-́nI8Z$>iSWPThޗͮ@ GZ}얰1tBc \G[d;$e(YjwE-%a|Ԯ9<:ƹմìj>OOOr@ےAl?sC n/,AxZui%z0o[ ) ؎cLH"^mV{6vW`+bC0Q̊WvPk2*IxvIJKn.R #x=Id,{D6L+X:aP!C^ 7*Wjp)%@@?yJ_Nv)Z(FJx$*OCL~k\\ @ݩӖ IʔVؒ+k4Qpns@? 1S,IDśGe9 OS X/aOjG1ۋa[!t=SՄ51km9Qrً0974Dx)Q(5 rr].mcُ_ٶ'_ (AQ?::q  ^q7[ Oo1?l͜M'@`+ٻ\i1f~_imseOb?drƜ8iM2xWŢ2ȶy|NgK*ĭ,~Y<+eJV=rjr4DpƤ֊M "1Yu_ AR>Qdm\mZo K7Pl$!A1 n~2ܙ'*(DmM1򥸶O𴂢"Ykl-%^bjޥp"` wQ ъ膷fǏ|$#B;fحhoFke{v#w 4*:Qz8g8~{=.jO/Wn8c/.r35w eh7L3)? kC .MRx}aq!Iwcp̧_xIRn,~rKXȳVݗ ,o!F% E"ĭ#*IOv'gVġY?dAo=H42nM!+-.u8Wm&ST:uY\1r͞?\r9uѶ?~G1t0o+6~ݼ\Hŷ;'eP (8af4x~˃"GD cd]湞Hd-l X?eM>ēզ0z]~a/9mU)DN_Uˆi`qm{Nr7p(^$!cb (s7\@^MZK']>?@}WCKK8jO?̽y_VyH_$1kYinu2$~>[S|Oᇦ[#Ziu;]MFeJS4* >J~)5"';xr>2r=7m.Ms%oUu۷J7Vx<q`39;I@ E0z.q`$ч<?,35+p-qnp[麸$7VO:zQoငA9J#W&u0Y}jt]kqqܙacRj=#O{p~"N^Uwj{@B>\.*x,b:dj6'TvIm2x^qCǐM/ĒIfVO+)F#o$+tocAjw0/?'Wt׬ݨu2_6LHq wgΞ\2$}_Лu_rZmGOiHzTpG_Iش& +/3݈ۛE~,C`yKS.)}c;w 3nGjc6ɍ\y>CǫMb ѯ~Y?L]_/ a]ZD_o'oYNxw='/T ׮Dq Bzj?j㧍vv(-M/M |x#߳ٝUx'&OO1X&)uV=N$(kfOFB^/ #r#m$8~zVg8uX]VZ,(^ďrV~^~KdUrXrvp>[u(zd[9>)[oˀ,b8 ?ST&jY *Q.οcp)c<2e欏LOY"EzSQ_|ݠtv&:뱨q7rtZ}3S7Ve"(f'j~s4:X/mbN>^?ؗ ɿg3*=g/W'&mR;W\/ϟlVJ ^&_nȑűoǔW\Ѧ|K=)DOqy׼/R>|+fc1xfc˷A l[ǜtH qgq&o-R&dt,FX`",#$?br]KJԣ_2^Gx7jwEG@>d^ 8 ܰ#΍k?X+%oXSS?32@ryYLAO6RoP,_BDTvǼ=$1<$-s 鏮?*@qQRM݁|tG)ɇHf|G^ S9o~'/{dP}KWXݿ&ˏCᜣO&-B~p1z:ܑr:rb>I?DiKt䬲)QOZGgWj,Zݺ[kr> t'r6F_qg8$e(Kɣ{=Wu+BBH>ïl N,(~?qlcSpxȇ>s*2ap.thԊa0=ru71k086ygrZ;cph[)?.u?g}y ˾_a-"{Sɗoإ?خkrc;^?Tqo/8ko}FhÏ5+XCX֌a\pxyE޳wuZO#_']rH 5FqL Nt'aphG]`g:>h̊〥OF-W!C_ֈWkJ?]ͨgy$LdnGc_Xq:fR ]d;*Nؖ*ثb͊6*ثb͊6*ثb͊6*ثb͊,b|Uӊ(bWe]6*|r`t쑤E7|ij塋H! vA[r@F6U&fT)K\)e\Vݏ\ DHv*O-\g n:ZƩL ʑR~?/ڦKjmtSƼR/E-6»*e|qM"?jkFoS(cͱbM/Oyd Or}?91. m6hKXh|oGƛ]ATOJ X6N(֝ÒBWI!*|8DT qp$iζ^EOF[,Yy3ZF e0ؾy ۙU9$ 9J &v˽6Vz)q(!thVgXi=;WKX+SEQ/bHrя.S%JLZGT?y pXzP T|?YӵLHE!~ҷō1{5cӪs5Ɠ9Z7PGB?rn<'N'45(u҂@?F(#q <勽mȀ~ԍM d"JVCנNtM˶^N {v8#n@ D@{op١JudSFo?Ki}+ u(Yy?FڇْToo00UU9$C['9hktarN9'V1 #Q}pv`@*uɗ.' sJFl?LGzY} 18ڽ?Ɵ +}&TCFyٯەYd`^HC<<;ܟ'\M)j<:'f_?-K+-aP TExN[i17l7*`,:Y82/ddfK"P| [_Tnm7STDDd;7!.lf>'] ?E4[֛w˷Z"SE$l7b):'ſ6-kDǠ?ec'OlStIBc0Ei_ȏtc#R$ Z ?Մ4B?NefW(M!ݏSVXZ r: ]17>?$m &!Ju?ƿ Ԕ\R?h옥Fie*5SQNgnSc-XBR&2^1U /֣X8_n?g-ǕC\zW?朘.,Ix^\k7{&qiX_;P%i%悝XZ 2wO!Ϻ}Γ8v[itVɇ`ٖ!>#j>Jn5˺mĚD%WVp6c>i'qi(Jv_ٌOCd _?ıK$b*>ڏZ*~0ed?Ͼ^{Kil _8 Ԧ'cEcFsXcE*(&O ;t:;dtvn(1YrhIA"+FEhIw_?߇/qM,k-Ÿ6FpӀn T|EZ7NOa^[r<NF6Ȗvr&5>=~&ctC-B^fUݿ\\)mՁX+_9l[OxBMOd ξRڝFR}ʝ26HË0̀s݁jA^0N:n;q z{:[B*0Q[R:ƥ`ih֐Bh?i$[(ܯy]JtUך}לt"=fOV \| QXAty!2QO qqh$Y8Ƚ*,2N=V Hb1HU|(o`+L Gi2 TTX}[7;%(h0ȗ|8QnZ.<-R#5f kN7x3]+Rori~ /R^O]EZq@YT}?`_:\ZTenKLPRLV[l/850;:d@QUmSFqwH}*p7SةGG-r)ݭBUx0W8k®̧"bҸB,*콩;(VNƿC >KoN# vb`c]nk z\_ӖI+̏XxQc3g-$d{0d/c ŔH?{|,S̙jaYيeȚ4#* 4q[:kP)6Ӗ3qK'T1p;[rQ)n-,r)\ExI'si A$oBvVTsˈy77]mfݲ"E5U ?oXo@\i|45\sfu<Ę~]F~>TVSGpSRxI;7 xfiX~_qqC󃵸s218Ibm DŖHԪ+ϗ~:x[kK|ݕ%}2A"m4iZ՜3)"x1VorO%;z7~kTQ@UrFZ;u'ƹFXTfZ0cO4|-u0,b٩*죅]v2^؞*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*]],4]*vX8Web]v ӧe'cc W9sC0\&텋,Uy6d3meE."|,]S](vX)v9]Cfu1Weءoi_:_g.ޜ=^:w1C ƃ̐iH26y%qp!D{&2D9 OM@qdl‡f_v!{sj|ҡNt$ӏc Y-47~|E6h2q?NɄzyIĞB8@/-3',?v2OZ_Rp$?઻dO<\Ezd^fsv &'PUǧ8u5~vtk}a_ {5?_lsuqi,]iF>'#C.#;/N0KV Xado`h@Jw\g+yNtyȫ'~GEr~qdg?'"k7bN+zA/TYt]§%\?Ҵ[+Zr西nGQ_gVvc mž|z{ScWRqXgz i=KOY莿 ^\pnwl8 O;ְD2[2ȄJȍ#I+! r-%Ǿct۩4kUsN__&?r_?W]CUK *//YT|.Ԕ1O[!44"Ŀ?m6\Mllc_/>cäs@O}\MEC&(~?ӸMۢ~5x~?~ '_ǥ#,~/OV!-SѾ$_g2+;gctxUj 0?ݩ>9`97̓z}PR2>oe?rrvB?a,ͩKTn2;c#J<'x@9v>k+cg` O~~& c3n#y9'9`~2H3:Hc5al&aD G-?$%$yO#O?\?-,د(ZH?lxkpɴ·(L>bUPcTr.;L,e=4z&??eeEmx@8;xOS-G~ AjN紓W؁| TnOw-pT K5+O3 cS2G۱gѭLEI,z$SE#"=_fHð?qK}PQ4e>(AiYCvKxvڔUA%?en?kdȃ[LqCҏ6.[yd7Zvd`$?Ο7,|X\ CeSs m|2I#qkZ e!+ M"D2p9o_4蛜(Z#Fm8j(YQ3$bjST#˷;/'B8lOMNPZ!ш?k|rO_*]wy(CZ"8*}eihQX~"XjF{/rsq e?W1SCBLz78l i+W*)},x?.5&Xo8q' ?rp9#KL_iHmn'9)"SCmgA@ vI|'`)o2xc C-#Re=M?iDo>ϧ?_Jw贑O>9 B(j=?To)7+7HB*FY]xQI2(?(M&z^.;2폟Ř)>' I(;+}$ӣȯf>_e2 pl$91=?[QԖ4,{Ӣ'{L?N}8'eKoDZP?xm Cg{e)h$rV]HV~^G9]^f5{pq!ߋo\;Hn)a ;4A $'1س?9RH?Wcgc,}F?of鎸QrzoE"6`;nzG}VS7ԧɤ?fOna؟NkW K](MsaZCfɿXhD/I~JOn~){)_,#}7W)4qk<ˏn*/<)9h1Sk#z0EǛ' ykz}?kl3NAdw7 l㤒to0s_B/#_Z8Ȃc $#Rm_+eǏ-TcO;9#"~ݏA\0_NXuc-~H}{/'ʿyMS3yp g$8~r]ZᕵW<+-cO?q%>~L .^c`~ǫ5~6 -b#ĸ?ct] d쫟?oE<(?AcKKE5o/VWe^vHedL=҉Dx_Vwu1#_VO4rO #hq`z~̪o*hqg'Zwe2}26iC7ዺ`":jѻ0mLeqO3hz_'+um!J@(?a߶9H'vsLxf<<Jl%PVA:Xjtzr0y&$93Kp'|9shTwC3\Kn:†RIĪO|PNh#Fe 2`"eO[{55X܀OU3]!E}6oxEv::TWf AC,)v_NDveJHvSby]W)ϐl^nyqƵ(" U` v:L o fl5pa>"O?.;CM61gU,!r6GeaK;5qCAف8]'LPKvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]\Ux銻51Wf*lUن*v*ثb͊0.Í"~qU|30 /aS$`9S>@vc\mv4dz-c%>|Ut]-WcoǃLB\?o}Vc'rS;3r!=@':R]v8͹//"C9L1$M|rVb}1i0y"98vӈk_~^_M'EuzZ1AOoŌh#/VH=]UeR \MhHaV)j~~,)֮5*PIB]N9 5fվ*yFrf,d.Z@0ʾ\m^Fg>w?\1;TN868 >߶,RkՇm߭aՄ\Of3*~RAɅUNŇsgpZx tQ I8uTM?>?V>I,5LR FViqZg77^3>G~tJS8e_'_ wHt?.[ R&[#‘}>%WEބ1?pZr?]⾘%V oǹeű&v1Rt^hZHxcF ~KS?dG:EGO_Zk%)*bTMR:ZfTo??lOSmnFZcˊV̲'ե`wF=,C[ѭ|fI( KJy̧+a<5Cp&GnW$)k>0-2E,"Vl5E/EQ?kg4(Q,O-UlV-PpvgqM)ne&yUC}61^Xkznپ?c}zakY#Q+xm * vXb10ec/-% g$k.[f+~'=πVd$*6ʪ?a?5P6tg B'७~4Xho湂Y}57n?/ſgpM媙-k${?u'N$lnjh7^x{sZSFVSﺺ+bj۶6q0?%lmI$zN@%=baPIIkufΛ|J ?Yd 0 OǖIJ~w$nHby*N8uokX``NJ?cFC=ʺ&'l~qY4m:(M.$Fx#J_lESZyVbEM+6{a"5`s B+T4QWjאodK VMXȡ/Oe,&_Ȝ=U!A.5_'$l?7"b'>(arڮu Wbh_%h"F[ޝ2\@۫# Ɲt4hPVHd{77'CaO1+PZ׈2\I#_2{4hosi+k_b$W#D]7s˘"s@p?J~0ljY?8 SrnW$cm?MA'֧K!A6&)G֗6?4҇Z) '?~9*4\FN!dU]~)8s`EH)Yna0?m?l k[B-NQWPf#Sbb n VK{v]ѫ a8Pw=3j9P|l4keٿoSNy(~Y9p^TRUo!ԁ[%-N$W*wiV6x4mˉ|^_[XAAUqPnY[R27v$wݿ_ky-eaAOP&6rѹo'+/yQ$?vq>'4~_ЌI?إm P `?x8Icx,sE famB&֚kODxAXQ?l К<$x 2|Q1?ȿN(n8"HM.yǖ oWGj?jο)h)?.Oj?߲B|%u]5jN'mpMS;Z\l`O|_K Lr$P@7?Z!"$vH!21ey/"o *)&eP&ꇥɅ[+TA cUa<M2;, p#fK?Z F 03{o8_wk/o&4R:1gı]!T۵>y7IbԎ?+ "ܕe$P,Ay;oNȿ\7p?ldW/_k6Ukl'^Q5 +0R^X oɔ Cc !-'nu2޲0#Ijw2Q-Hcv3I'vuX~gOrylZ Ĥu3ngZV mʟ_ Q >;hg-3J`퇡}Jjw\ cexÌԄdZxGufgey//Бobyx+5+%Z+lczC_sQOlgY6Wd{zL_^Yi~9 XJ6hw DM$ |rG\~)v9GÅ];j䢮ǯJdeh{]׮ !r]Rk@b!{9scNȡث)vQ`E\];ɗ7m学z]m4PѾN5O}B5֔3rD@V>cz@ak@JՎG]3Ccvvrp1_!~nyR7w5$G!~~g :3;$?s`4S%"V+?ģu?*=Ķbk>)D_DAmKo7+xiOk99dX3Sj wЁAۦt=Hp̻{HpK?z^k{Z]NR~Ғs֛f1}-Z.˧6LɖX9TS̶hmΤxNbB<OS9~ꞅum q"}=ǚޢuKBݤ: NIݾ,ŕVKcT z##sq ]eCbʭ0vX؜UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*r]bLU٩51Wf8We] Ut#]]F 3ˈ5Mדl Ei(0\['fUiLث |.Sv0adTl0!`c2 T;CR^U ==/F'_e?KKm^q:+|.08eG'SѢ鱞&(.w/Je>Z{7rFg?S[x}WP֜cȟ[; /DI:_󝍎d\Վ&,GP}(~e&C'l[zdwO2T'er~C:7Lk$2A`^:HUup[I1!/e|k.amBTUvhm7 8h e{tnwˋ8 Z_#[NU?GO bx}(K+U䑻?}|,8NSg~;29^E9T&ln,9?Yς}A,vdR9 w\f v7pzL^r=`+E2\*'9>,[jPBn_SQ,';I Q&" Oٗ6CWؽ 6@+|1/oZ9#.k;=_+`e=厅kL#YY۩'oq)ɨ#.y'ׄZ_-oɇ6~tAFSrHɎzy?Kzܡ4E=9d?_|Ai]?9wrE+_Xq@%,w/É#A!?Njt?LuG7YBpue7. u?WS7XɆ _ϴ|_f"0eocG5llƑB"4Ie~~-15HM+l ?cl6FpOLfaK>H}۪`ˆzi'S-nEv%窟4Ê.>ŏJ1[_ٰKUaΟo:J2(V_qEmlǜ7VcM"@cC_L P֟fYj8c?lt8cꔾ¯8- d;SOO-rr]sS9և+.Ù}Srh?򿕿g1c2 &}2Æx~u3enQp㍾?%O-̓T~K. ?iieg1e}3gإ1\"vGZ"#S?_l'}F>gp˛PJ!G>ݿlIXbI:RžRE p#?y?xYȀ8![?L'Wi`kKK-9Nwg5>`k>ט;'1Ӎ<8(p5gBkF9Fil9Uٜh;8X) ͙ +}?ab21=T/+D#cAZyjJ\6C%)q/bL=@2^+z4B}y~Ɵɛ#m_aM;…W<ǏLKṾ cg\^s~@z/UɆ5_n̟4X#x*jkN3/'0N̞ݪʭɹ5E v_NT2rvfF?}+Y5ѝ˚DgB%}]1}4̘LKGcG6b[;~bw$qΓMpJY 127#D_TkgiBt,\E;qZ2U9-! Z xJD1D_FEyI:}nb<m"IN,%6n؜QĞ12Y75-a QlItV8VP)J{|YzM뾙x !?`mNm/ˑ4;vH#)9Zm qe[V6A0fy_[5͓wb  Ox'9qOwPt!.Zk»GLn,.-xx֌?gq;T%/{?7ۭE?4bjztAZ0o]'G̞]hK!e7>$?ɯu,40x~~l?"򑝹0?4ݟ8\?G+JWεn")1!ս'I"G'AzkeCo=C(]Z}fh*xjoM_^X|-'eGd R~?WÔ'$GoG󝔵 q8NO/®jcz^x+¶$cӜp}(o0Y]m Zq`~0 jo,k;x* |?zbӠs#.3u\+AS],(qa15uǛ4 @v?ş1qw-$ےZ$_'v?LcSnǤY2FE*x//S -tM.F7>q2;@e/0c׺ёcgWDx YC#wlt.\`è@9WM[Yu}iM7UejN!~ 4gJDpVn*3$F lx^;U9?^~a8 kH˪YO!i֧  |)9 ~hP> I=2UOkٙ\B?}e!O-$3vee _Uىf—f:bbXb͊6*ثb͊6*ثb͊6*ثb͊6*rUٷWevlUCv: U{ UٱWf"s t98Kڻ lrBGɱvZd @`Vjda9Y;-W&R{.˭qWc;dPc3ǭ:brt]PR 1:n& ~6ioInvgo@|?`-݈Y`d.gᅴ!wCB[w1j5FZ~|3OO/,4eqsŶnTpՒk9{(2??pTvՕGB ^^<iEcFƝad,X5}?IR?s€i^)kKe]WLwNMn7*?E^MK=g4wF$?r(Xg6rjT=Ǘ0[ɽ`%5EIeKk`x;njQ>iԭ3b7%n?O5kEV" gq*͂=kmAe䲪7e[D?iOp=e j$B}Xlsܩb7j%?ܩٮbZTQR 45?ٯL!F'cCƘƣobQOsOZ~tT!Ҕݛ3I@^Y[`M^G>Q1G&7DiW kּvct#P~=97GWu/0[ԣ lVg@l&G!a[\h'/ؿf)75xx4sl9@icXxo}Q$]SRSB-'OƖV~)P?"c'*EuQS5~bN7*NûiH-27Nvb|q[hoTP 6U˄_p֮'D?>a>/nlCweA#dYؿ!W$4W "*Pl?eǣdZ4dmXvn洬Z#y.Oȑ ݼ#RO78[q~F@ԝkOGٻ?/hf~WO'Tg FiȞ} >Dc4yz?w|W¶ÜB_CYllTl)K?o6 Z ]kc.؝a71#$23| >ɯDj+ ##ܯK)bsqbBƯ};o7,ew !IEsˎ{}VUH#tn6sC-ѱ*:4SS'#5ǽ嶕ƪi^(*})Y9SܓN#/;Fܒ1^ $P_MLV(M4!ѫ]bNB 3kZ&5ڀ?l\rC7H#?YؐAnN$ԍ?q_k$/ 30$R: dY$M4^\[K#*y }x 9.(l[s 8CPGTved Mv1]q'VTp%|k{Q ZʵoXFj\E*>ۓ|_ %<Χjԏ]gsu,-Uo"3|M ՊEY1{O\m 4, nCoO iLH(wçğ}©y,2g~ /%?_.L۳$ӑ;}X7mo$@TUBk@q&l v (`=\Z]o-Uta0Hn_X-4ƛy{ޜG5v*+ͫռآ풊MIv8;(UؚL%Rtȅ{Vvl`Ăʺ5%m8O4Ļ,`Wcbdchg{XсTaO3ewCZaqIO^3Gz+.1!q16?/"I* "0S"v=\0>}OMKt?c6^VJi6 w+S CL ءGثS ]0!؜qCb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*r]*]vn*]v)oo$0I8- [tg(g4QS\7F=X pb냍vc:keWHdaGvm݁YEofab)NOݑܳf~xJI)v+"@9iv)n]NvQaS>[vcmN * cKL۳ ƒzm;+K.uqQvLexx4 2 wt2$>(6o#yyfiU c34WR mG{+ǎPfz;a;?50$v6ǘv kXeN|s$Q,sO7YLCOurw(Ǡ@& %ANX÷k>o=֝Aw\=8/{5X ʯ:LC7'?N/6 y*I<[p QWw|G#Z ?'f+rrSXm&7zcثAg/Gdc$xgGSnz}R'/$Ȩ_eWbO+EctO8y?.,~;ƿ?lðv-ˊ[cu3]Is#M;K66vuO Bs Xt/'Z vr4%EP?eGwÄqQSn.u x( =*hahU9G](S}o6 e/@wa\A<ָaty_/r佃vpc1g1ށ<Enhҁ?}g4bĈ;!VIVʫNL dU9/ˆUSrGWQig g{|_qly|ʮwOcJ\GD_rܢR# IQ3M\5XIHtQ5'a-FAvN<&Nrcj,Ld!?v9΋4WW:4Cuj?x>V۟ط× G gu1 zl`}8/ nĵ[?/ڙY9)5goc?"!9%C;._k:rT}`Nr:.uZ?Ӓ%qTutO2ۚo$J<}$ɻoG$Zju-4&kxoo4ݎdȒJZNT$_3psP'OJ?3y-"3k荔_iYiK1Q}ML7.^Wܓc1C >sL.-wVc*q`aR/-5ȌjZ cfDiܾ'Lط)ݎR9̵zF?g3ф0f~#'zb\}cI4s'NG*>Fg!qk|AW2ͭ]ُck1e.'iW}R|Fo+}BLOQ5/ᄸWW.^Fq0MF;E ɳ<;SL!^u6߯9lGxa"c~?[(^WamA9 $cW?4P G8"#,Ff~*d'3 ?O˄j: cwKEB ==Deqa~\_ ;݆\1[)=H.[$m1G__ e;Ei}-x _WS]KkSNƟkXCV81O&]Dȡki쮽W`k3NyIk-NJ;O)H HVcG?"в#'O[+u !Mml7Bbe|r? Ur5opUEk ˰PT~'=㔬Oă)6'sU}Q +sٿeock@d$dS777oQCoN ΋Xad+{$j@) ]~]'HQ(ڽٷW-Cԓ7?k/o)[(9wkۗ*9[5e"G"?1VX刵#hȨj|/͐1sj?cgVpUЃrma 9_Vy.X*r6Rab?͔kɸ adUPHhoۧ6>"*(ў. v,;00%٪jqCrQKe8J]SWeUÒWc_lz[ 0ǚq˵4 v2' EbeR1Wf銸kZG؅X嘅|^oXt'zthw-qFm'/* \LfqAj$+ƾ?njMWFU?aJ?0z81#oڢ8d/^~%v¹v8zQׇ9J>28s(m8_25F?Xjڟi7!AR{$S= t/{X}>>h-E- k~Ě7\DElOՀSk q<9OdN,gWM>3! BIL?ٯ{ =9z5dž;] ]+N+N0!:bbXb͊6*ثb͊6*ثb͊6*ثb͊6*zb]銻1]8 Ugv:4i@`՟TWi'N Ey;(LL>l/7xE!G1Cea$zuT"Aܷ\6;r 2|Ĕfb"P쯫?B1*Uz֘۳4- C}eF<%mF f"ר‡b𹍃#Esr5@#'9QDՏթEvTL45;sGl.Do6TQĄ5:WH_89 d4 __2ɤM=ho?~qM Fݿ@ .-ԠF#x)IeC [m ԦBln?]ob*Ձ} o X7WH_1JDʹk@ƾ7a|v`56p?~:Di~⾙# Oo,oҳ;0#rT$m:h} QiL^g'R .OfX,qbm;v`ʰr#ځ״K~q,?vpgӹȐ+Ǚ?ɯLQT1)JҴۑlthtWDz/R4bn @=(+7''g|ZLj'Gu? 3raN*BdOC'VSJN?FT\%f)έh$J4n7U4?싕v%${ͧԧG6-U,v.?k@*Fԍ@' :Dv>;vv zY *Xg4ŦחmR!U_iV>[(;(O\b]ְ1)n'N4iͭ[|]ώIݨzv#[,AibY Ωkbi#;l9QKqnתb5iؐvSO\,߫{Ow/!mk*<[LRЅeWr`MCSܤ$;v6('R8~%isW:Ծ戻*\I[/=CQ c+~agYI$$7'zU{R%\[0jW*,m((_F@]kO|֚r#IƔ(ڏ_6q[.@V$G(CL8Z)J?u1.+Qa6H)n+y,A#|(:o' e*jJv's)'&k/#u' MF(D@08 NƇՏuȐ W"Z#+so e.!I~[Jd3FTAtlM< )[N"limͥqH\c"^P!!OgܿFS<%>l٩izׇp)%{-+&sy]RrN:lao%TiĚّ!借SF|Ln8^t7&|bPbG^xIccS/&+n6*z=Gj,s7;}??isơDk{̞w1VɃ9+ rBçAYbIcԝI=*jzqd%M2SWΟgoВ^8MaVKZ/5M Ѷ&-7n?_+}ˆ-t e@a0y-w;|[$Tܯef1ع,Ƥ' J mFIt;]R ݞƦΐt3̊XMwWVXnnBPj(E:~r}lDwre Y;#[il!Y.y xԸn{Lix~h^bV<翲**IgEi_a2 gdHEE?g"a^LuD$J+i6ʖrI97`_+8iAvx2ߎ4_"D= 蚲2 >+A[ȘQT)42ʰ)^՗)G;ū$v 0ZncP}/WMRdO0<ZJi_jrfd1H 'g¼BF A/ӡK n>"ū_p(pKf,O?8ABʯYnFpx %bǏ&ZYPn:0&xSQ7í=E:-|s{fg Iƹ&0sFټ1=ͺ̽8=YOHQ`e@OB>M$yq'"ګb iբGnt>?djky!bF`VTtZJbbra.pvQgbae (>5=d6bxq n`D܊d*{D 9^Ҭ[i/2e/ \ ahn~e:>TX҂?5rQFɫUΣ b}Q&52ʋ{FN GSAG Ifn#.j)F΃.#AazטU#&v9ORik&l;:|XbC67Bp?*s ƶ;.́]LV\*v''\Pf*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*r]늻51Wf] bMWcTvaph!;/#})xXnu8x6 We 1vXBpvc3"6Lj\'"Lj=*q!Lĝ\,IvlPtr<vF0C7gBxc_I6=~ʷ'M/"}T#Qs'W V=_~wT=>]w滦6WV1Vmi~5sGԟ$㯬SکqADwڟjDc72 zKb9 @] #"MʟJ[1K?kI9"~-rGd~?ep_V/HxL(IEv*cB"˲}gS,|搥 ?o|vy8tˍ:cmt9?eswز ⏨;Wd YjEd^[r*]*(t#*¡e˙vs<_P+?.Lga絮c *N Vݒ?.!`Iiok-[Ob *vwbwʷRT5 : 0A/Pvu(yZQ a{4fn<\7[cՋSEonТb>9meR؟=T2/#Z5feH>/HG%g[waH{[ RFƆӊ;$IaJG/O|u,y_vtyitVYք'/L$<9Y?TE`쌅ǧ ml?HXFYUq=J]F5CS=`{,cxG(E&*ji$(:5"+Mh7 OTo2xKUspyov]\(Iv~%zroA/o'Oab]mfnW¿F[cmEM=sFbQ3\2?ŵSGƧwcV{OY-f7Kdvie(㟗":5}H@;oO"MRCЭ>3.#ei *O{i2-*j AaxgheʾMtP1 v<fڶWqpb 8n8WYM._sC+sS(nyɩĞi]] ]t]N®ߦc01vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]LUU٩1]m(b8 YPve5m4R{1eN?Od2죯.:ǰpp/]:ǰqG]ɪJȞx??]I;(\?#$,ݹ#dy+Jxzx6~ðxvQ||Ev;Ꮘ8|Ev0Ol")ٕX 9Q`;\i݂nMB7ф2w\Xj(AE~ ZDT.#ONQQ/DmBAGu+1ȧ(Jޖpnu3nѭ /?hGRޖ13?,Z+K}Vڿn؃$toK9y%~Q|3i7{ɹGObB۹T?I/&gkruCF*5?q[Ožf Lʽx$n]!Zb:ۗO/1&hIR`xG?H2 &9' t+ cxEAoB#;jD19)m\oWIo1-*!?~4S[&BV Byǿ*'`,I|{(;a&h~|WrȎL%.Tzw\6v Yn$H'97MB`6 $S;zRY)8Cd%HkE厇:<hLr.I6ȷKD Q iU>m9یZD&QTly΂5iG~+GO\ 3~c>ۿa 9&up^bF'_Twj C:j<J7OA罞R^#X`Ң{@ԔZ~ʯF,WK__ ?r5yMjj-RɀVȬ,V;7? u,h$`gT 9SE*hA*Pp^Ϥ۟fM ̼_qN\#e7ed99 Q(kI*Nk؏f[~כ:ZL_('t*nIxaS.5)L,YO?FM&hHPb85,hܜP7m(%|7zS*ݧB*6,iesc`xaxŊrW_8 ZޒmdR04%Րf/ 4(#mlV֖d=Bx %:䋰g"I+&s$'I [Nӧ&[ke#tbZ,J]a(F,hI-WjP48׉=0!3??,# O0\i/X(ɫFzŔeJs u ] Fq^NHr!{ƿy#C魤("Ҟ4hC0%咅o~T_P)7r6 `K6ݿK\ %9q(A2w4#aWΥ}n1[]FjmZTÐ!ʌ[>gD;[9ZiJa}0~9`I[@% ;[B3p@5__ -U$AݏqisVrI>|ALyS/INIn`!=堝vCt+n>+*߶"ޗ3O %M''h#ԧv)RiSM/[+N6Sqӷ7xV蟉ryUDM~v}:XittD[sᒽ2]>de\6hYAI{ƿ,$fF3[J?e\)rP#mѪUdY`GH0nOCs {|.MJh{"lW,Vۗ+}'h~mi+@ǏI?+.\Cd~A ƛ^?aWIb ft2݂wYW3ض@LK|+/O8B +s1Jn&ƢXQƿv;~|EyoF"6WkT[f{qp9e?| u$^䎈/lGIB=H~_\j{Y#VHMI4E]ΌIͶE[j՚>.,N3F{fE32%ve~ldo\HދJr+<9E}; k|_s/ O\Ge˦TYSqWcN*쯧 ]K*lUؓʼnv7vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ru]mv_ ]p!x}-cm?IȓL q4ip%'ו\TqHע]L vF=V痸v]cԟez ۳s8كP܎)v=XXSn bʦa8Txb6늻dڸؙqWcq`$7A4,:.dځȨj?0z WkDF_:9 em6ٙne!d v+?/k-#:ޔH~?~NؓEf|<~q]C꺄+Qu;#{bH!9e_΃m5K u>@LrgT?K)atsȅ&?d;l'lD;]_REQm_JIt1q;9I\=̻<2mo+_VQgzech?d%[Q(}9/iPª(s_O$x˂?I8ֱ˪5i3 po$yb//[>+B'_9v<\N_#8ɖk+HiuYrƎqه+bxMc&2Mb!if TL{,yxEك◮d6(wnΝ? cleiaki.X!R9N@ ɜG;;/|g~9-d/QWlφ1 j˄}Ylʅ'U2v&?^@efr6BAc湃8p[D-#⫾Vo+AķR4(,k0mxGv)Z/)Ǡُvc4p\^WJJSMmЀrʏ+CIuӚk X7Gz?h1^xe~??qm%RD4*z$SbcndrL2U i5.-Zkݘ,rq6S_⓳-enOJflb />zq8khmM)#Q^${X 4{or@ka?4.h0zv $=Z9rxFz\͏\N1{JeI#z~Lj> aC? VvڴRBG*| O[\ 5JA:g8Ėe4 V<?&*=>ONO6AccgE*B*Aθ+L.5 ?YUeQ⑨;J=A_O;>{ku_q8gwAҟ$fq!?OSc5 6ND"ѿe6x5KoO/<+N2p1!$W'0e#m!C7\#da>cѴalSO.HH8@όaq5ȹ.ˎ6v ;:[gYGFK@آ ?n^G_>/GO:r]6o m,K^ NeN8AMdk@X qh+ΤW_2bNE2闫,usj:mƝ3[]!IW?xa\XQ7\ Pၰ%~djRX&jƆo:xOx*v?-hrk7Gэ\>d#N.8#oX򅮡=F#jcO],y8ϫ]\SX VX9El8 J;Nɟך4֤.tX%_} ='#G ے g\IYxqՓyKvHnwoūS>ns/Öd uYN/­/SLKsGC[Ùr.γӚ j2-o ea-/z.86 ش@x g1`w43;$&{jo)F*?*@ӵ&%OŽۊ9=ˡ>?]LG BMʞ77ZvuG)ki4²*'F?Qd#d}?Ou}g2z<ʽ㘯a*˾eXmn׃Sf_ʟi?k/gi<d=X.Dbv#G~Ln?v'`A%leUG? eIy)?d\r-M evLIbT?~;I bH;dwdp"V|E\QMQZ{Sq|5"t"_b kA}nl$ w3=Fo鞗E2GLLW?tiи׽>/ǒ]B/-䴒%FCNaMxu]|N#_-omm0Ҫj:d'q~I\6?k\tطlDku(q~u爼gl WWߵPOeN9]К hYggVIʋn4~%_y`ƣ#W9ߴ*,/*zwM]*.1WeUt]8ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v=*xbvjbNhRNĊ倖q.&lUA1Tf1;x/7V4JaPe?OS#mT_ (vn+|1Wfኻ/_ Rޒث+.*ovQS4m1bUٱWc@QRz'>Qդ7jcߴʿq3FھUN?96Ao$&[(ԄP6j~ %Y[rP*0 7.G#G/xf(S ԯv)c_*Paۧ/?/鲛hTo.*vV?FBsm{-*j 9v?*iVh$wٗ)G[ 8U_pFqV[M{vhl$S*VK%ƹ̯量x&ij8cleOqqt>ب4(aCΙF=n".idKė^?Ոcvֺ޺#eR|zE~,Ou%?2?lڎ.;\Nj_aq5 8$N<WUKPzw+"Kd!{5MYm>#|syGqumSUgVpݤj\Rz䚓 yhF~Bvr$7}^ֆP;lOξw7獸l_1ĿNwɽ'J%Nï!y&H?:dt-U$[Ww0[fo.ZPbӷb 2C_ꞥ-5qщݽc $М;ͯbh䣱t+ =5n`=AI??1y[+?uGV4H[#v}% I UEKαo'A''e{7sQ_%ʌ8X桫=[ɣUCyj@jqѵ_Sv'2ѱGXlA#&5"aqOC!a2PKt#`}[VUn[7AQ6h6ZN>:[/'cฬc{:y2Hh:̃m0O%QC2!F[8e^ q.s-픓MG1K(ljF;e2Jh:?/[J@Oҿʹ *1c7wjqPo$OYH?/[❊I\9[vWe#ͤ1[C{ǖ:?udvdW$ԏ8:]d_kpS!"䶊FWe*<嫍vN/%r%cą2oSkO|m:F>'=Xirܠcs\jPU胠?Ŭ |Qʴ%Oq?(6ʹunJ̇`Goc9yӅaRGG& D ƓzA?@ $қ/LZ+ɢc($OMȬA"t>(\6M˷z̢;d<+Fr>e(]El4ּ{M iH#s49 r-nxϮ+h(rbil,Qe=Aw-(v*\6lXm2k"g$Ԙtq"z8D:JڂaU@&dnh0%Zom:meol-]j4 仍Dۍ(S%ӵD r#Zѣ|;.I^'c6d!47fFI<.- 3<;!/ ܁?EF~t?6@ $4'GhPr/,#Pڅഏܝ>=l _ppG=Jjm2ųwdYTE)zzݨO")NBˉRNUN9ǝ'r$j*1I9VQT oly#͢FpO/ N(MF|}Y5KfeErhփd^ޓ7Wd.SS8L-m 4P{mA~gH$Q_o9Qɸ6qL'>̧Ő4<+2}t:bn2++\ lݽ9*zc/I+;Y9|8n( :0L F~'%Q K7&>,sRVWR:xCՉ?~ȹ@ܸ"GD]7rƕ>XOJ};S?lQFT.G‚h*7$4hbU)ڏoŌekҫ.a͌bzžXʀOټ1D$JT";6 DPN:pٛ~Aç1Ǵf2f涠4.8Fm*f`.;V\)7A&KV'ƴ?=nEϛ=4DˏO?)0yb ٛ9{ e8SN͊].;R OvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ru] %`aWeS"®(@Ȳ=6:Kw&!سXlٍqaND{ Y9; Z;+vb1We*Uَ**u+]Ʊ]]\Ucv?*LX 廝nmR]>HN&S;Et'BZȢG"?ݿgfPøy|q/'=M S7?XO]x?J_?'ws^60P_r>5u$ז)Ξm}z?)s&N'膞;y/%0GG[GcOeеt|~Γwudp9)Z|,5<q?TWYmmKV6Pjϗ4f%_#[33~8(,/_ZN-Di?n)Yz.`saד/WF _ݐ(X~q8:}0vG5}".IԠe_fʤ(Ӳ9%W N!:[+[ !?oY#+ #(dȞM:ԿZYw-{;e:x?\/tdX=5 W˽<9OQJi4X+nA|Jߴ\Gfs8Q~|]$~ XJ|.;;.2ou(e Fas*!@; U5 J V8?̼Xr}~gru%23j?]OW+OˏYc)6?MbW &_„A2/x\"?};eKڥ/3f60Q=FNA:]\<M7RLӯcb=`[=&&N˰羘[ڡF؁|$q)g^m]ݲT'k3ae㵺jeq O:ܩHG0qoL' Dc1RTRs}i; V6GpKg/GmZ<2 #+,CPe`8g_4 ?  W8p#\7k_ݔ3dc&F8#/6i{"K՞*7Q3:1 W6O\fY=9(~>sZ.tͭqa{11ؽ (?4򏒮59b_!ɏſ98c2q5}Y?r(Q+6 $fmSJ" rHo=Dg+S6S<TabmRDyS\@j8eA?]94r^i,Uۋ*ːy}-C>ӓr_LeZ%8IŃ *Е?̇ $OV6tt7/-]hsn o0eokGQOu)[a,ur7oho3'Yo'\Ql$h*_i!ɞ\GKcq2//wQzod6"7e,OS?;m,$ٿj$촋 'O!/8c[|JjZhNLA_See]Zy(؂(H -VOvu{MW@3faTke.=1ۍ޿k|_炌_U?Һ.U*7z"M'6qM/KV1_BX挃P|fXo&6d829=vk}EzsEa^7"] (z}ȿ?.cK^iԎԲR3|?LPC)Wuk-gB)V#0#!1c~Yֽ?r\]V:x6qɡh n)^F,Ot""6xFZ\͋UĞU-};~m7/̆8~Yr2! OvcNkœEƞCܿvOFCnX%?/3q91\N: _R|Q߳R)? P.eyduoa`S=A$1W\i,,@^!~?ߟmo ?G\,lJ5Ec(HUi(#O[ ĸg7nt d̹(]TurcI4UڼЖ|g>ۨ_~8Px~x/鸜s{#j6XueQx`oَvLs,_͏?ynHP7/Po 8NVt/nǧKw1JM B0^2c\Rރ*żXrp.5~6_OS]ٔbd|?f79N5~D:Q7 ?SLq?oD둭[ѮVц{0F\<}νa?,ʧő_n۫Lx72v |ɥ.Dй)C.r<{a6-G }_Q8(?2vt{k]ٟRٷu?Oxo38.zf?~?lHllğ ҵ|M_|yR&l'f8rlKjȶ0=_ىgbX݄7r?:nheDSǒ9;mCkJث[I%C]=#O'Y.L -2,]8*UtqΩ83v;OҴ|ncOd% ܷ2h-?zn>sakr;}c)`Jd|¯26A,#.>Hzo+ЂOϖ)V UQNO6_Ϗ1GJ4F ~ LjOA_5 Z!QϟIaԣi`bHLXL`hoTq!ao|$^)͕\ـ$e<97~&l3ffB8p'zmjPq!sH>,=+&*g C]˥1KWlUzbGf]vlUٱWf]vlUٱWf]vlUٱWf]vlUؤcv>R]-Vf/ZadYvMe $AW8>$ݑq:ץ]+&UXثWf]N*vUَv0UqWfv^*ҊW`seba^j^[3tŐ*77Q[r3yK, ~Wn^/~.DbGߵ\?:g-]dsb}X$?N?ab}W~oLNK}vvTrRFďga[F[tɳ b-]9\uみtIɀJvS-2;hT &]׆tu5(r4ZaN+5g RBL6?#?6)i/Aӗ?oFn恜__V2%GN4izjj{^w:{ꑨSzW }_WHRP&ž6?R0Dji7 unhwwV%2+uC{3mzpR$Di}ٱ2`iw' |㪸C?G8 eZWEoosGNEwbX_r.E$;tKtUz/k-ZYx%ZKJ+\y/5uJá?O/uYBcPɂ4,/9 pDI4':_oR3> ?d ra jIAз\ PPAFS6˴lz 'e3ݕ7 d_|TP q"'Xu_sy?bO-n#V^ 9&V[hmHꠖ4V|X<+5w=*~@*1cz a$}KcL:GO*9Z/ &#e=?ClmHйcvo۷?o* 7* 3Ȟ?bI&_%n9 Ӛk:6-c6*6F(&20k t[^qmh'`11+)FgZ/n!߫;~ʨ)krxXTmY_z"j _objYOP/LkHnsJ?I>ܲ G؃_Cӡ'_tl)- R~%A}7݅dddh:'^4Z,d0Jh0ʾQ$ +J§6Y5[w#eOgT@fcCB,qRT`˂[WÏX!˒K _*ܓ$ a5N䯂ı{<\$МyW䁈1ڃIOTf%0&GfRWMbzq.~&9ZP?+Awz8A [4lSVi0iA>S%QU㉏ >xldn,8;me[I- +#`͊޺[Tm(/K_E|,ĒցOoZ#w#;5\U*hAM#$֘O=cv~x m-f(iOE-t^*VY G&6LSw|OϪ75!}??Y $U`XbBULeiN=>eY$ n!/sR9,u{?&rDvsF4=~$ÚTu;ė SOiO՜~S2ol.4C&cZwSa!n}+eE9*=my{sv:iGk!7ҿ-ˌi_j2] U|2_P>~ IeibqE%jU_S ıF e[~_clg)K0Pʷ$qoWfeut"ֵ+JVO?¯5" `54gX4iOS5zLjɸS$dT#bpJYԜSV(,zwέ$G;x'%Ʉ+յ=Ofj:DUQ- Sg3%u< O 4`gPGW g⴪o,KWX*P/ ~'@?/Ê=[*5G]gJ+UܼU?,}Λg )I9 M+U43yWAB sTs# SSk5ַwT,TVGٕe_/? {Ur,_o/sy-Mۂl? Jo& 8Ryjb}Q6zŐqnQi{ qBoI\rarWl-iv X)=Ou MEAX߸f! "I&~ C8ͧN+D;8S(TDFL祵Aa5"Q!OȐ )^ַ⴮Eǭ>{% QGՄ5HL텴K8_oH9;rpUf V;*rSo!ͤ[DȁGKw#+lдX}_TЩ[$FM ̥mSEQoOBzV$YUn_MIzq/o/!!LtcvvdN(S0YM9&-X. '&(k/C(ʔnuهC Y)B$ Fȹ pegP~wB T╪G+7a 2g>Gd`H`j8'["m ?kڞ>+Yr#+q QQWOJ<'#S*A;2iRFƿ"iFr%0S roُć㆚c*EI\(ݏK+B9nq{.HSɠr(iOOvH;=*Gl 1LO$*WD+eӐ`.ōJ_F*s\ؗbtȡ]6*㞞bh[Wxn'2VH˾OyVug#5KfyX;Dk a}ͳS m-7"@v`M߿,oaG`X$k 4Fࣳ#¹͏x,ꇇ~v`SQm7JuyS4oߙ)ƹ7QU[(`orCN-:7\U+d`Wfv:\Uؔqb]Cb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ru]aKuTt8٫vU̻%VM5=2ʋ~!St~c.VNNLvlUٱWcbf];2]]/LUُ*i8qWe!h7KS>#}%-1|Ymzn>c! w/Жe wS2+~_ea+ge/T$e_Ώk/nV *slc!l"Wϛ}QJ?음qaZ5D֟vw9U n?Oovr8~궧#QStf&Yrzx1r#)wb΅{nF!?1O\Œ/;]_^{F4ds;?CG_K')>r%*i_Mopc.x侏W:֪DrJZ!?.Uya99_t?p?dvA0<#KGLs^h~c;\K?nu#G(P/g,Ǐrk@Y?up$Yia?eWؿ>uy_s_8ijp)Ey)m#O~?#e"8}S__gt)um𺝄imI9qW?DK& Vp>x5Oo_`m;k|0G[pdKNhw_ֽeb\Xb Ӕ* jOU?/]N '\\^ $P}&>_aZeX ~y?cehT,5ɣX+/cf^.~_M֚e\dvR9 t1$dć?'ÍU?(J}M*9ۚGO c\%cG2: 6N C(- ,t(cc(248MЬj"I.@&yX"eu=Ƙ&[bZlLʟwl\^cz3Tn<Ͱ&_uvFńǹA<^?#V ztdo\-Jq72~.riqGՏq1vܲT(GGpo_Ki7ն_OO38K˶aU b$e;[%h)k/UxМ^HaӖ;+XiK~ӟOvcub09t.[GeUQ}xBO'%~Gye3c?E9O!iaIrb58?a.Idoׁ6'ՋmZT-)Cѷ7$ r25_~q38;r%'cA (?[V^F'&n4r+VbDa?vnm:YhOR"x8Hă `/GZ}@˹Xl-NR0ki /!Ĺ'r\m#]%/#,l)6SFHNkߡ?͂̓]%ѭ%`N=%!. }r$v9ik.?Ygdoff;O;XUr47.o,K)p?bP?$Q/O&O|z:k2 ހ?θ%c,'H}?_T3}-=%R(jH<\;,pK!2'o/p}dIwJTWW¿)?|@~19?~(:Jyfx?fˀ) d/TaN?l pN}S<%okke??L??}i_dG:Y )$ne#/UooK ,S ?LX\$fQWJߑſm?oYz27O6_\%Su\XHz@Kty4#_%LoemZ "'`;1"y敟\@Ki>˜ ⯴-}>_O.0}ZtjքDAVc#Eы Kw!@K~VLp~3)}dxx.Om?}8_CktEs\(=86cϗ1_O\ q[5nYn`NV"?"#&7V<QSx-[}*աSD2ɇn(?d=A֙HM+e3{kCӓ+yN 0sېUT',1W ?'F+ <ӏƧX>8LX8}X/NѓOFXsGcVc cM9rK!ߧ0Z UJ r}?_dxrrF-wwR1Ta'9I$K_`}~QU] m4`?ߋ_mq%N3GIiG5y!Ǹv: q/?uS L?xOf=t"8/ܼ8@@dNTǀ<9qŴgQ4nO;aB5T_cYZg -dv?zٿ\~LClKGo;9_mÇO<ⳏꭽAI|__J2p5.V?r+i3 ~Ym:5=1o_5JJo7c`$>)e;viiSޢ7dV5įX}x?${Z%\,3FwFZVV#\аHˁTq-;oaB!5ZN}3M\zP-#TWf#GG4i H jddkGjw ulxR )Ά7Vd|m}qHNOا?rr+݊i"݁?yMq=|O0yˉizpFBk\/,$|i8jz֣H =ΥmsܠT ⟳Ug+rAżRI_ճɟSfԬT rG4C+?0\y·O4mX\ u=ՐsiMÿ*f]v Gmg!u 䳌nz*#}GN4@(??!ːrrO/IfcPoOqHYy?IƆ{7.+v۽_^MJJ_?]m"JUVݗZf އK6t -il&]M 9]Mk xNev_~7V3i>-|Zkg *QJ7ʍmqS՚9ֱ·3Z\ IRXeؤo,(MQ9Ϙ.t2A3Q|SC \ycI喹񖘈Xx}˖\/JFU-шQy'xϊ`LQ(Dǿ_Vo'}O5M`nr6!*iI]8T ]jiвd*\jȧuʸO UGEbk$$ꎽbv-kpKWә_?ݟ⁲ܣ\B(ƿ4#!CWnl14f-rlo84_.Zb@zفA5ԺTOƒ6 I>yNC#5~~eJrƈ $MJ?Sͨ )4y4pG5gGA"2:x4G4[ˣԂvhVG"sL{l,аIV9F?~ؤPRbQg]Lo::aqP{۹U@DKfC#Z兵ޔHstj1VA@6o$:dkovE?FdHKi#}mHd7wŊWzQD^ /R]&]}Oe}`R?Ӊ D SJ8eyا,T<m '_ʟ3Va.6j:Q$ ,|&'+Y q0#CBUҴxQ$y屐8jTUz0t2CtKۓDzO#0\4wՒq ch5'Yk$)IYv,?G66]eIj= 4"e$U_o+gft?1(4Aq|}YA( i(jm=IM>%s]j/}Z=i'eym'-?i6$^C)]oR?qX)yըQOO+h|2??Tr84ԶʦkRYF?i+.}6Hױ"7]$xJbw\:0K?hu8:0Hd5'ı,RZ,MU;Cɐ| hƥH%o\MG^dQdRdC4G *OON DK{ $v"?I4V VI?jO04Ie$T'\çCɨ7>Ɵʫy!KԓՎ)0i oO[c5%(O0#fHne[p2*Ifն"v#rI--vmH~__~,(/R9Er?%4[=v߄0 hH#,B Dn}JsCmo5Df@rvg"VX Gݝ>Q2%?r$Z%«e[j.}FƍpEYi?HkLSjvUbV/e+FI9fW>K.nZEvU$xCfxbi-c<^eܢ}#Otp-Xi]ª&o71X?o_ߵyA<֌Tm^[kC@elQkdS-%GN5'K7yuז'E,w랈OvnNsIm0JdSBo\TJjCȞJk2gkmW r! ܤZ֮x7D'"q`B-z/C_0}}V?S5XRW^蒰 ѶST`b&twoEJnFԍ_o~8Qb"e'q]+͞UB 󷒥5o`ۍ8p=;P[lm½7OPKX)$4 ,yH抢kCXR8Wz{[TKKZ6 JN놑Co`z}TOYiVK_[(yT5pV' u?ԁ4[c߅i/ \yèNt_פ o 6ȶ\i ujqvaN-2}Ͳ\QU8O%̟nF,~\(&"AP}0ZkafS"[q +ЎNkZ{QcXDQO(OùWǡ1^j}Q{G?,$0}b.ᢸ3jIr"brޙn*IywJ:VsFqce}iOGϰ^dƃ8ZjO\ci8VXGv꧶H樯-u.>P ?`!3իZѾp7E+=Fv_zR ;!q0Df4Qi䦝6l 1S%h~2yjIyt6Liſ_~m"n2mxs#z W'ŁiqTQe;S}&?Xm8Omҩ*^pU-ׅڎ=P u[of$RF`< ƞXw K(QUy nG3\ԻE]vjbb8p٩RE_|'/*η㌿?B_°Ʊ'@|_|USpCeWf ]6c;(v'vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ru]1]c=Q|lIw!?B^9DF6.˟AcQ1]\:HbUH4+J!MُDžo$I5,&,; p?mۏ]tmx k]md]䨱!^a*iQ CxJ]|i])`Er%4 MbM\UDWvX_ UFv@PHaާ.­rUJ_IOkXcuF?wWdlMNV] y:#>#Vg_GN#:] 3Q"~recq=B_/_փYQ'-;'Fҟ 2tKvnd"[ضdW0.U#͏ڇln4Ѧ¢6V9s3%UO;iWmZ\P/"Q"Q]Bp7:i/k"Sj?Qqu:\@]+O_IG9b+N]7o_˙[C9x6?pZX`H#$d__͒r ǪWF_..SC ,ejFDRu_.Y,{=QkJ;M_0[z[%PZ2oű&Z-Lp(?Н|qgCOPn$;4WW pӒR39D!/-_RkU~*]B)$?L7[o?ZKJؤ6g$ ?iFcȸv91л **J{Z6%? )Wqsd 2 s'?gV}}I*FUXѨȧua]<?q>8e/B:ued9aXo_w͖M0O3?e59OW~])ጋN:'ZY"7F.Dz-7NmYJ6S>ɗ%nad1y[ĩMLjVk oo& `ORI龘WiSz|]֝ Q)W׸%m?k D_gAIhn,ȇzKѿoAhɏO[_d+FV$v?igҐ-eAb } i͸.?.ov`:ذ38TcB?x|Y<;C}k?HqM=q&ꄨy)5_q/O _s§C}a|ĚB}^ ڈ<\W#<;/E9wrjzoRHFw?'hiek.Kw$_Dn$c#6lU_օɛu٩)y`'-?ikESş'k" s/iq?Opr3^]~k3$q#/gCEFb6ߒ/~O(yRgqK5Nb;Gl ?4CF $#ex\Y>wWZ@D@z[BeՔLE!jAdS1㐃t'GPwV"awmm#2H<*>F_L⠒-ܩ2q;YP|WcYOPS/˚iGor%S=*3}jm_g Ď8glSr_r\l;,R 8ti?HIȋc9??M=ù؂@$JZ0Sbl5hy??!|Nv51х:kHUJ#WP~`n5GMrdFt0Kк7< Cc#?/ec/VO?;'qC??y0hU 5(mWn?)ĪB'>W_Ebeç ԝ3 L^ (21hbpp(ѝ2P$gR˸^5}^ec,ת_˒yrqer?g өr'ؼ|:,ҩ"l=VUb52WHIAYhSS$A(u968=SdcExv>Vu݁!?qp_w՗T!oO?JJ I+qiAQtcVHD4ʾIlZ72Hƀ{/1jJoG1'4Ch"U's%-]KMՓ^_b Wv…Y(.\GqAE湐E$&aC#I.MAW`ObwÚ!_NqX4MKOlD =qed_g@В[mV4lGqHI xe_a/m=CB߉ib<;,[,x}_KQku !ڹ2jnI&Op /Faɔq >}Ï_3~"Zx<(P{=Ϲld%/<@* ]dCCb_i'}_ribHPQ۶N)OUəPqYeC))%Ԓ7Ė;=b:#BpXfa<2罖ÉF"]:1Nv#DW p_?̎8KO* '٠=i^ V ã䖟m?>ᐳao%Sbi:b~mJV\87?s_2cu+ &#^iOle* Os}RL4/12ryd; 5WEs\3Q}02>XaR\qN'76,xG?O}?SnClWOrTH t7><(~y78F/)= _nMnjcӏC:av gm9"ԟ8cK>_7,Ɣ퉋}F$:G+$ɂ\^e?Er!+ۨ,V+IQא}K^Wb\~p?mu  kʉmZw +Of#Ş:;=x_⼷Ьth|! VjnOVo,zedl] N,hWӞm]/oI61,s<11/oIƱ [d'F~' XԇeG2`-gyON1Uo? /H l[peGՎ_T?lH:_ѮhpGFNaJ<&a"0=3V\RK{"nMXcB[qπvaa"JɎDLK|RL#r򓌈J^_:]gA[*`)_q3afQضK1?O7\s[ a˘rj#6פ$ټW&$5KC\jOXT1j^,l}\;"Z-9E74=zl9qE''uq˶J& F$P)vmcOLUن*U|Wc0L.X}+VӨ`UA3۞_L:i*QJޘxO-SCyE;Mde8=Gf |{[7EAp[jP@xߦUMlŮ\&ތ)О_ z#"jY +rvR9_yG֍0*A!Z0a܆.r9/C[,h&^Sevv-qV`Rt*P JރhK9av5;s7M p)ٔG}_Of3SASd1ik5F6Ei\cٙN|,'8##X &9W)u5+yZFG١9G-:; x X{(U#|G1:fw]Ͽ\U`bMМU؆(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]Ev)\Rf.* (vTYnll8\!ً'bLG"|݅6fvX)v^(vlUـ.銻,b1WcI]5]b›v8Tl0+ 0P*ƀ*߶ Դh!^6*>t__2;)8⎆? NVD5pK̦7SSi=˕N\e5dd d%F̤SG?䶐H];M7k_<\Ҭ(-wOO\ @i:W>^G|ˏF/5G=_ʸKlj}|q}t"鱋83@jV~s\^MA!MِiMAbXH(▙A44>[%֮*#~S8F6PiiГ!`xEJ}?._o܊U+ݿ⥧,VLKl};o'Drx|QJj5u+_ dxNK߉?$q[ں:(tqn'̆3!L~?w?SHcdOhXO+%ZRVić;"~9/ُmK\^܏ݮv'wo|)V+@$OOoqet$&騌ON>_6k iZf?|0x8-iISꉔ(P:m?֍~__Cwrjoͦ)ڳ:eSPjQޯ)W?G:[xK,>.-ڸdNOc W2H#]ܸ'l(['}ɧ]ZNmnڎ/C'~8֓L q)z:T]b>U A4ЬR{_-c$_(3 R?+n\}J'z7ÂROg!Zr>ˏ_??qTxoQq(Q_qU9}>E ?Oi7I?9ͯQL#L}Q*m.~-ڿh47}V $q) +ƒG".C߽H!R#SF7ohP%QC'WW AWc/Cֵ4i)F61iWFnuy V*՜'+XC̅5>/Y"'AԱ$8dn`$q*e?r,:ZBѓFj?̍ C{ -߲ûGOW/mX 6e=>k%cGHO_o_(uԠ%ӧ6|k~$cM!fQ)wſC85 lFR}*şϊǦ ܕuWZ~WV}:C?O$(QLɾ"w^yץ ۃ/.Jq'}b:8dZy /Iҭ6{؆K=6e6?^S*UgEi#N_7:Z^𹉊ȣc-_VF=M A WF˴BDWIZ }oѾӹ5b(+#mՆ[$`cKzqWlQ Sq#UmC‹KSb}Z{Af2HǠ' '?ji*+5/$AQ@UP,7)c6'ܜ6 U^"ḩ$lmZV#eweoqe &PE(W<<.T);-N!&ch xXIBV=~Sv+kEwy?OÊ>ofUZ$k?f`h47Vด u/jkJkl(8cOOz3M{7Ԙ4ڐZ?M!4rv#u V5j/~6-xԒЭ-W?=_mpɾ@mIn'`QfK‘ϙT@,N/pM?VAp3#HP g+S,qK2ȶ_;=OZDO䷲ҧWkV*ւ`87_ˊoRZ~蚫v'#~Յ>f>cbb_ Cc6_J]j7ø x9|}q~4B?ʣg'm$ڔA@EAsIi6 O% DY!Ţs}?,K3vwUW.٬/pGՒVGEW7sp.% @"gX9YIxW~K2UUdPә>/(OG^qWèMhL~9vI6vO*Y.\lxO2ˈu9 H=+8'4g}oN9}-9UO7Ooy)SJjG?pM;T,V&oY9&gC۩"%k$a#tMMjl+˩@xȿgŁ<,EOB쯿&s?4J}R OWFdǔNF;Ũp[3`A>-( ;.N0©doYYCjs`cZGӓ2vX&&uKеCޛKQXWtcHt -X_u8Ħ:m) ߘ_Gc_?N l>9P"W^gb7RIEbf6/Џ|R 98Λ02*|}Ȗm }\_|Hk]柵A ڇL!_'WodȦ.RQ\kogmW0A]b˨]#Xgmːex>l$# O{|fzyWԿұ>h˫RۓÇ ꥨ M+]>g4<ÓbJi7,A?+=_X4>/y4 ?i_D ˾;w]lQnmt] m`C<(v3vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*RF =)Û-DCs [;hZ6X7O tFYL ƖLk](8n#a3۱pƐiC3 0݈K=6lb%'`fq!.ĝǎ;ö;CN*dcHtE;1#JK19 rapvY]t"W[Z!v=|gn˒lhϚ8c/Ky>յ%>8ͷ9:R:}Hl L~B/.f5'x*.cd^\̈́5]&Kk["ve=հѢۇ,rNJ?K'LsP}_Mz”7.[W??; 4O/\Ign>&OE͐mϘa,\G`v+) :W'؎7˒Zq?#jo:&M2Qkp-#X1?}O<<;"XQ*9#c!28"ļ[񍽿lHq9:I_\ߨA 涾MkiqR=Է9"nYaq]"HRÇu'BCT@,ԥi) 7fdGfsGO[erhRT*_ڙ^AVr5ɴo}9U'xz:5&dⱓ(~Jv=p}&5GC8%/#PF=Gc`ƓPiPwb)t{[CƮSO؟丨x\qm,L/1(${އ+.@[QPmeVĐy"@f˥A(&vw:D mB*ȃ|?lLfp3_{QV1ƳĊOh֍oJ)$+yS:.-?!swܷr" Do-vFv;ts1If;I{n^]їҚEx쿴$d 8!?T|!/[ڵ`7'?~UӠ@ ':W_ڍk'9)넾[d?0_ЂɤRG/?G-`݊7c KМTN<ۨZσ-68e:R؝b߲ I?X8j6ֵv,~.k`$&oF>+Eajo iQpkۮF:t5$ikBj|G<+c2F&_]y(#Qqj<7;ydkPO2r.L%Ub0E>b6 s_b2`rJP҇>1ON.Ә)WO2G QVbё+}D Cq__MZR z5ȱj-ZG,zԐ( ?Yur)BaG$DCT ?rDq}|_VN$/_9ޫwfeGI*ى Td!̯_ }f4q/P=frea2H~vҧoε:S.[\.]Pz5ꎄjVۺki~%[3,!cWJbҵSƃWĈ# fihZ_. 8qa~?Z8P)LyONM,6PkSguFx#?|?DnA0S@0_  O:=4(V,|wkf2=K&ݐ lt7kҽqXYW.N5Ԝ7) ~#ƒgN-X/Of c^Nzі!OǩAq bqdlog<T?QDu;-BiޔCYȄj?O/ꮗE^<ޝmݏ99=C[?+;x*ros:v+pl?l}  }w01ܲīUqs81_?KqWa"kj%{TRHٔ# -Q 0_'WU男 !MCZ_$9x ~ R1M݇ԏ֗E䬞\{~_hB [՟GUOM'o\Rvm6]NF?N sCr8̡O@uo=[To0T*\Ŕ^pOQl8"Pz掫"XkS֟OjtϹz.4kSB󥷘"훌1K_u2'9*|c7<3P =IlN@~3; Yƫ#x7xE1ԘOoI,_ Em'i#!Z )]xә/R8"m$jo\,|N?*oJӷE?F1A2kO+_yUϨ'tGM=59UiZT=Oc!/A2?,]g#M~ 9)eMVZP{ar9{"&cƱn h} 䲊vаٶ?̎"y:A8Y8cP~cӘ/lv`9IBlo\,B/8~Cĉ_vZYBRGߖk".S fouM>bI<(_O}x4rזE碮s˦Hk׉4^d4<)4sAW+oX.A3 v RdP$@R RE`ko.vI{C! s0)9qʘguPWztf}NۇS@<JФ*88U)źH/X4ǿ8;Ib?̦2vOC/,}K88@*"@j9d=VT0?%'cS8|/7??e2 n\N8 ?ToA"Bÿ jr$+ݾ_VKOsQ1n).Ol>/7‹Ptտ)LȽK?;TZ.zOGէemٔaWgG8&B(GB;gFo3eI:9`;?Ώ$kfW>y[ĒAay},8]7'ud+>?_Xj1էOo a$eXXlz2e-INvtP?eUɗ}0}Rn[pPt7 E3/wٜ#ӋO5?[8:-=y6_aOpdi|yCV,̠7k[0 c}oW} :>C>ba?X|'vl?E:s?)XC+O9g_._9,ioo5eK Ώ^+#<ay&5<2,"r x?o)5iWr~8@旤BoZ7s'U229]J)4$_؏`e#)º{:'W%ïUߣ lߓI FO?2\ZƳ"ټ0G}Nsf,VlZjpzJ?.uc/jh_nc( }^O  H>{s0<8/O]/1'~/RG"?o)>&W1?ϫuE21:6+>p+IGS%$+z8EX#g27/Lx7rp?NcuM njRr.]Kձn3\p?"V(9.Ů,V,mcV?')#ęn=SUnrkx:Dc |8e73?;.W"ƀnq5@1TzRTV[OY G8 _舏RWj rj,)f]dd,Qm3xUoSy#͡Z|_{C0L+=eoUSR!"6v.;"}9. =LFLlr1A~~q Du=:G|=AfOۏ3j~89͞+FQHپyV(Qv38 paNiqur?ki>;rk˂9>2rd+:N3m XM>(WvE&'Ү͵У%Hó)ʄLei8H8ޅ }^;lW\ PvnZWdAb̲*T?UٽXq[qO=ܥZ321?~i%53^y6o:1P%7&W =C~#ciQ L(KP<-$EgȈعޥA>O.Q6{j#t߄Z_6-3HwcFj|X#Iz32 (XnS"iUPŸXo|9 n>9PdU AV'1m;;3J\beԜk4n‡eb^>pGcqHspeT2ߤ.|9<ۨ@Z[,8BR5Ƈ=Nҿ6>&jQB6?C.iiزn39._^-] bS@mK%nm/1 OVE4= Y~Ǣl-Qcwvd6εa~vrZ9 rLjkcuxJQR6X̷*#uSѕ\ KV #3ȇOZZH{~?-ƟZ/7WՅ__QKx,s?iX#bP~=u}/,"Q.w>Ƌ7ev&&%Hnҽ'l%!;v*v.'}߲إJ=@mF+mlmX8"sM}V5Y^R;Ũ? j%ʊF:r1^UZ#+F*v!Uo㊪JRbDAyz_/ [y-ӊkw&W7pݱå;STx/bww%9)ݾ4;vuTWQ{*Y|snQI ;* :qU F[yHHRXUXo7k?YQhRK[ `zH,j%2]Ŧ> 6~.ur}5CWT,^gҴfh'lfkwkKv@(FlU#^ }[袁%٨^Xٺ߳|[xeA:t̕gyMԢqhAy4㹺}bQ_"5?N{^%_ZiS5Fc@ Q?Vl5>Ƥ?J,`eS%(>-Ru}G!Sp;2ݳ+0Pwc_kjmR7<_B?kY"6}V oT59]^? r{(_lKy<6N䟛dp4tآ  /cay}} Z|*,>͐qygLyTof.?ٵ[[evom7cJDBG'OQQ4[Ne V`KTYfeVj9./HV @W "$M+m"^)!݈?E+'dꝉ;??•]@N) iUϖA -ܴ1)o_5д`݀Z @<(+_,+@aZGYNmo-&3t7hCKq5nm޽:)Z7wh,Ѳ6ּ[o~)B=Oo{nH!M$C6,Cӷ*W+=kVY)k(Tl It_'}R&U bUW)<(Ul0~hazxې75?pre 7u(#jd )yaƁklYdxkZwOʚXCO0<[V 7-Je+YY0eYZCdTMAqPե~,t_[%VdqEGOS4k c%b Ԑ{Ik g JEB qU`'άp5epRZܬmQ ~1i knA쟌gFEOo\+i͍cԐ4> ~Æ \;}'^^cKյм~ 34j1=CEU nP3m͎57Wiz. M?V=%OT;(,=?nF#\mieY2*HبUGK u-]Pæ۳ @' a~ کr#9;''m\%yLe+PR nM<25;Sd,!;=?X^I*zT:?_̹7 Z@GEE}rف0?>NTrIeD<&%7U?+o :/dLZ*imi\mPP4%VV֪cZ2V]AC}\Q8q N/jriY*I|ޭ}8Q`peL^Ӟ+('d6c>7n91ܓݎ@uf}J_P+|5=#CLPQW46l ]'Ղ E'ZOnoӒ;!=$:`fm5'2 x+VAV& Zna^/\U~.Ikbvc)'e?jkiFƀ6?1B0 _*#cH>l??)=GWj;|l2+&/JiUWA=Og& D ro]2=_#Dդ>~-\\G!j-Y:sNa#g]{Iyu#[?6M\R=u7t*6ܨ]aeJ{=top1[w2r,">l_V7q6sv=2]C-Teqn'dt<Eb0*ۃZMOs9h cwji<<ɍsv,Lx'1 ȟJby~?k̐{wk`IEH6Z2i @ڀU9jlh21&}\PքqXaxOwi}pQgq#fPIxm E%D'Iip;=> O{@w8V.UQ@5'7#^\;ҘSk ?Of2'|ͫL^;&Z(:2~?XvPkx-[ZƧ8dKEYNf;2р]x:]OUclUؔݱWbxٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*|rM2UFؤ;77qOvay0ix?f+]_OoE_]8voMEٍԧx/.Eپ/^"s!E+sƗ>8vng"v(&ڔ0izH&ݍXvi:%֮;8̌N\AXs=©";v4ߨMo/䭼T0k?Y4#A@7FfAn@C$X6h؍mb`!)"x0>M@ -?^9~?8~M ZEu"R6a Yꯧ_3ŘGnk+?6sBh<eRv4ɼw$' 殥vM1:*#2+im7 !OYME}c .i*zRBhFu_,ÓM.{Ķ-T|kCyݩ¯V߰Z6$ڸ!P} 8U kkV[X(A9?f4tx|Y.UT0˺"+_ lq9zt4wl~P0vs=e2C2S `Hrx#C%r.}=+d.aQ9&gcv6*G?d?0E$f`.Ry@:g;o4mgh VTMU%syxIрHO?]%k#B?!ط$`%,CgUs)B_O?7`T+;%JYLHu?̟[' q_u0g25 mbmW_,&'e#ZFw w?deB$l8k-Ι\itBMSש$ Z|Y\J~nz3YOb2J O;yɷ rz7IWɿ3bݤCP6iڕƛ29UG># rs2A!q.Ϋ; b?{fdrl^GS8Φ_4:xk $ۊe[#d]w-[ؑwV?es7?MqqKQQ{X~X钉#pOčOӌI%aǫIB?t}]C>@G'zV8Cuw6+kG ~))Fj~e92qrw:? !JM=eFa|B:5AqrXUcj֟ 9!dB\4gJ]uwa0G(&kkȽB?[(+bjakl8frTW*b<ȇ":%kGSWɬnouOTS}Ñ;c%?G%Z  ^ E5VVQR4qAq6}0fn5d ȏd@ѨIo^BK1V"rc mNo.,<9~e=Q/W[%8${_sjNi~(NS;}W_~8_YnQ,l&O~ g &\LrH}?~֟CpCΈuO1f$G[BZc185xΈy_%jH2%Q<Iիk(1wIQGKfI8"R30IB)xv<~ 8q/+Ŧ=B;w^@Yk_*݊eV߼>nI; G(oCwS{K0vFfwdnRYcvTePHpF2ax#JRk; 땐-hM*+B9y>G%ڟf^v72'f*~{+.mȘWQL$|?D`IQR?v+1kvyʘi0۴p\GCsxb~ϻ '*uZ+W#vYDc/O? 9G`+ߏp-(ld+ O㑔b`ќĈtrs^_hנ Ab?7,Rd e1Q˰@w|9"lSH}B?,W־u~D\̌ /Ë]Y8s{7srrBя ^/=Z\ʁEMPڸm-!REIQOn_dޘt?`ZaARd<.y˓hr m.?g׭j'k9܄XK~KS|FGH,]#֔f5]׆ P?Ԅ~9Pc.,䍕ejH6z rt_~X?NjV u?/jW)R}a~WgG/K'vXdAM@aoe P{*2͛I%] [Crw=_*> =Q?LʢuI'8wObo> _CRYP<.xɍƲ"Tڱ_j'.9tM9ie_?}N8CqM`Uaч!qga; Z$[˰FӗO ) *G+V{dbi-gm'M(6dIqeؚm>/ 6XKzF2K u #Z{`!j~B"T?ʌVroK) k%}v}x~=N=_~SW<'?*! CrCW[y+иn;4u21sբ1>XI]>ΈͶQhZҊ^#Hd{S؂ت N{zhCO-yiUԥe2c%0b:mVީ)v8H1M?v0ܹ*18!AdL}l؛98 XHޛv.f)lcs@> SD$*sY^_hH9O)ٛSo_[+r(D1׹ĿƑ'Pf%'c?\rLyknP'ef=1Ρ-ۛu!z}?r6F4u~kTE? <oAfm%d̿\ OrM]ns&(#qd&4<5om'n ˸ci`FoD-,Դn}mDS ՟Qf!-ܟ_~~ނ+R=~6f_ ..Ld%T+I~ J@.`U +S/8Zȭiq 0<Qs@rΘs!YdR7^$-CjV[\Ng(lXZX #߈a>"Ómk_^,仜rD(膟̎jmC8 9l|~NJ6$B8dkVհ[+Y(8i?"\ܪFVI~a8~ҥLB?EyX(jPHf֭F-$j<Pk_ȲHְ}d aR18|cȎH8zfWimy/YJ_<&FM{4WZPJ)%ݿ}q.t_0k?O,@ ?`?:a:kt$hb4\6cyֿµඌ#c=5"^jZIHIl?iX$PFgiw\iPm%̋im4Q6SfҼk~Y mױ;ԼC}pdi㊾tNW##6 ]~BOʫ߉ v?iV^Wm"v> U HfN *>$ܕ1 x?hsp~5~j[D 3`,N}ݿ<e2p3 w`>Y>(z&wcD!7'ŏ|S@(N~?d`1Q?ʻI@(FqUig&PpF_r4ܕyZZej;aE=u@oߟM><~_ 挴򥳷,M/쿛^y 7 VS| L'6~D֢}i:WdWsg$%8ȏ:l<o2q?$~cUӵؚG!{#ƭ!:=b@;oY5+^ww2pcDoEWmtKxJ` ?7yyoiiG'S%ǖK>\~G麾kjM pS;mAX~K.rB?ّv_Xb V](# !.au9]]MAbʼ)؃:k%HE ?v< Cݍh/o7;DU'#k7H:eV8?ay/`t5m-ʊHMd#R:ޟW P}Gv?j61$Ur&9|wM/~ˏD+>x [9V)"0UE(ªF:&_oV#yJm0ڂxK%r_ip%a^Og9u{Rcqv*6INHӌqQb>y2&f8-Dm)X-zx |[1?R^ 2:7lcZdmISPw)ʟBja@R7kȐC'zMh!-zh3:E@-xd[M%iqrS'S9gW2ۑhlf"5=?l 2ܚy}Vu7^5M3IXRrM%9P l<_n-fnJi*C “^:4lU 6 AXora>j6 ՓjO_Ȑ-um'~~g@[Km@}bZC/d~ҿfe-su-Jng ^hݾSӸ;} N咹"KjCog/I3HŤcRǭNM%*PP \pBۯ~i$-̖V~j2( /7-eUXP#C兾daڟS;VI^ XV_@KVEoՂdSR'z,q<Û]=yD6i++?ah9MNnl ~jfpdOnȠHS?-a̬P>*g #HA?0XpI;HtUbSSU.4ȚF^~i!Gɳj?i5ǩ xWsxG4Íi:Tr!VY _yq{nI,GhK%/@p7ȶ]1N졢$[b?#J5VVxZTE'R;5ehUa|X+O޲K !4^ kHo/X+iVoXa田AC4¡|22h}/~yTl,7B!Kf' 8WHg33Dy1%W/-F]ȗpĩ \<`UF` (%~Pyc+annHṊ]xcZ%E$R~"[7/ŋI&VYb(Aꭿ(+_#jo7>UVbHeyNDZ\J2yQ& 2qofS"HF4oƖl4bi: oOm<`ctM(>XU61iNI4EG,>,fKg5ާXSzW, 1ƩAڵ?_"+i$z;P7 Tmo`A1LJQ_/щD'ž8B_յasxL dV5&kW A@H\ggs!$3IA_kZdB`Z2=O9vOœFdwKl@-P+GB[m=x'u?XP +Ƹګi~zJZ\[;+U:r8LЕ%e$Kİګo[ ߏy.#yM+HPlUMFp.$fNJVHÑo5:F与2`GOTuvJ%NNDj ~IJ8,N]?$[=*JRkH}`M*?J}d^X7OKRF}ڑxJy0_.fVBMOOTKK̡|XKtʪ}ݾGQ["`KRB`$ ~tZCX"T)F?j&Z;9LJ=~-04L ֭UeaR??OPQ ǘz@p~Y;VUi_}O<_ "OMízNOAj#^ \Orܥ5#aFa!6: Q^~IX#p k~^{݉-5$}σY+hkpE/#Ņῗ<ȢV vqqq̌͢ï[Vҥ95@[ cANj\?g' 0 cӑ+ GR:mK]0q4xo|l?jOLx˹w,VcLxCDuH\y M& +@ĊzƧ34 AxNrd2y[PeK+ra%F8?5;qf>K!/ZFao8 BRN'U-ݣ[ȇg<Ҡ~"Z;7yv3>,f6]T&)l B-k":@~dCW<f!Aa ;|Z<z_n3hw(*|F*h2vc]ɋf;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*5͔7Ȭd1"t Bò)%w~^-&B7q6F7Zd;S!ҤD-i\ xżzf ni컈: (`;Nx852p!-k~~,0i Sxچz֛pl.(rƗf(qWeQ|0eq_ P*튻TUXb͊1SG wA-vMo3(3~ㅿk6H?zGU^#G4`VJ_5uϪ@oWMZQ>d*u΅kF"xdiI_G{ OЄ+J V% *P?bMʏSD_ZY z#e#sQ:~_u Z+\udoÖ#aqR%kJU^]G@j?de/_I2kzČ$TNGpU*iPY~J~?#(Ď9!e?pwm2"2#tpt*f>|߫ݾtف1{m$XX*hDYf٭Hf#{N8'֒^,1hJbjy:"nd14ˊGqu0N}#\c:4\^0_\OFߎ./8e?}qW~?b <`OŏOv ;+Dg))k?\iLy/}s`bkv f T^?Vv~^7d_Fъkf?rByd_鞃MٜC/sL|dlĄqW_𹑎|A봇%~?1heU)O݉JȿE}//U&Ss* Xl.ч:ߙ֬Ph.$޿~9kg0CQRy ֵ FƢc-Z~}5\DntZ##~!k'M~4),.;;Nѐ%UH6()-֪sv 6zfQOA[eevpc?qΡ `-D<)JfXHq,sZty$,:N?ƻHOΏ]@G>{۳EL4??GܳeKJ^o4j܈eק r]tz?[r-COOThA"8 ;ĺjrqt7E .x3学\yR5]k2,;keTӕD" 4l3o/JMeiq2HK%?o?[#q1qB~GĬ((O""Q;ѓQpMo%hL]mQIWه(~] @lr?`'Fզ,27zt%lsgs<.Ν~^Xh/5YeAȗ F\qyMGi9\eqQ'l̹:KRbRǮ!+/lЩWw靜_k[%KŹxSsxkpz_/[MDr#H`S\X?߁[ahTa4_s+.uݩ~_!&Z성!}b*찭G/___}'kZkj[6'}gNhvs4~Y\>YO_xNՌ_-rkKIo%X-мhEI1gW-Dr'G7/l1^CY2x!}?I213>W[Gy~>Xc{\`]BR:j hXډX+o~3^?|V@epD"_\!h4wъkuQg}n;Mjs‚QA';YOu?5FD8G0N[dgFD:%em6&?//?K괹0?C>l…Pfp-*XَOgKp!0?F+4U* xE7v# ه'wO+%rHEMMw;+)V-ROk7KU+R"`E@@>]l@^i\E sK<^icie%Y"XP 印 S .mӉƿVfWOx3OMZQB}T.!>'{VcR"gNҸf'?32d_6xBM G_c [ː]ȷrH(+P-HFiG GeߊcOչa@OsTuoW,2LG1d L10*Y-D?f_SW nNMC'u 5-[1~MvDziJ`f3*U.+]~e11zHONWn V MloÂ8sw;֧ WPN 9Rv|ڛCu%I>?L %ZOvPtھ%?ᦲ+SLw&C!jr@4HW u3Wvj͊6*ثbLU٩6*ث)v/^]b!ͨI/USj7m# Hi kT, 9%':=Q~CW <峧[ FE wpOe?? e}bgr+ ƝT^OW,m$G#}Vaݺqꇳ׿͆~\k[duJ[ :U(Wrxn',iC_KivInc Z@/G$V~8Q=䂄G$Z`f6cj~oNb$ ]ٿm%F_|MV"-OR>/k  )Ѽ~ u&q:\ɶYN)V []_]-Y` Cj[0򞈻dMm`PzxW?r-ROss->RZ"=.hn-Q%(}! eILrSap6(OV5aw*j+piWsP_^jQ7[y\6]MH-aLI4 FWIp;n-!+N r5?%7I v㆚@w7H%Wk7ёרaFE[mdGJ)?i)ᄍ9E6>iKa* OQAl+cR ȃ=x|?Jin@_k#t 7 7W@k9EO ( 7K]=/rU(*4YEhb^OsnwN60t؎[ RxP*FsiZ혚#7]OcH]9`bW6'OTVjh,fgd_*U5eˏ4{X8O* z-M( #×l4fJokAgs_[zO854G?X(B_T O'Х|vOWXRWfGkEu7ږjlqK JܰS12!g OVE/Kƞtr!Q:@2[˺(ϧ *#Wd}uKz6ԗt/{7cEJ~Jߴ-’ PRH Հ:YH':FmeLE72LNA_^ n@aıildS*qd_ʿZD~(ueS)`k[% I}=a/j]i*D؏ T&ZnXH С* >97qwn$mZF0??IgSec5 d/#tb[cRh9^-*FGЅOT?|9nEQpܾG|{mm~wܟ?PH^[6%Woq5.s;:Ot9c0ɸR0  8]}[&F.\+qMzҕ K@I۸@YTySQtԸ_O7*d rc ܤ:Fڼ[j_"jM*.m׻i?&#L i?e)~_(Ѥߍ~R>G\ J2oA=i!4<,gT89ECw:$S$b֘ҒKqĨK(seR9 mI"ĥ܅QT Pݕ{0scׇфLNB׈agaRa?F|RE,w_S#~\[ިѝT6 _ᶩcIJHaԁ :qm{MNb&PAF>V8nei!D z`I$ ,nw:,hI…`3/ QmN\Bcwя6Һֿa̼S42Z%Md]]~NЖ(~#Q\h ]擐[[[эx^X}]r\ !4 mN/*^Ѳ_~m$Q >nAKdL[FTpq'vFi.}*i3,+X* 7QZYWnv ?FI']+5a kuJ!'mF} ^E@ĿXLX$Xh:~/iԚ-7"{un'J>_ _C$ ֫X>~A@{3@3)i@Ӯ$uzsFrkcBjJbdcM?\[bZ6v.O?4 Gs+V&܃E!$0?7y`}x2U)>Ǘ0RR#df?_~|ysJl8GT,4~_]ܙ!KT?ً?GLriSP#idV QPxp׹ln 2!& Cm/`^cX QEZW[hs@Q5(xԃ|'6+JulTfsTH>$^QƏW#͌TIY#=5\(BXH}Kn)Q43<.}ԘD`^?k-+7/xmMNcwF 6q~PƾT0'/;ҥc$h5"fV7­"%y/7_N>kn͆Ҭ]i/#XI ^DH&Sjw=pT̃&+,d.TasOrkd8rgUtgr:z H˓8sq.9 NP )Q̗\݌b/`): vhܩ9T'a9a;Cdrv3]—fm!و]LPإَU؛LP+51Wf銻}8mV __#e;8. {Of%,;I'lS&D-HhHuy;B#h/.ɵc_ۍٺ1kC3?ŌڌxG?1#Y`Eb;xsVcSM~?%e3(SEU´µ*k]C+&[B16͐#v U[V7Ⱦ ]OyvelZ>6Vv5Ӑ'FUwxSQwLFF'q4&ex`J`diCM|+`?r?Jd{4Nvv,ҏ>r}'8D 9ڦ9,,Vh`Ր7+ϟDC`|?x]LJKWjC1^%_ٗkb( Ӈ7Lti$j?ƈr ULCQt3[̥g i)eQK"7HԴ5~%?4NCHC_*_ZQսKWg_ێFI9 dHpNeQggc)HQ{N?(qLXv>KU;t;8%T0_<7M$QߏQf;qWc-]ЎU~ ݔ{bq}Y??[ ]4CMsU|i?g'n`gœא ImkREn$0h7o'V则>`['fy. ]cF>?0cϒc#xgSW'b۟VޕOľ/2qɉ"|3w#2FnȆ榬n4}CJ{ez.ZR?#|y] j/Y@I`s9cvY m@OY$o?8sOU+?oupTvR\?/R#BMWO| ^kAS!N Ԉj'F}^?ob' sn~EVSʿc1ˑ9/-OMpэlO2?ɀE22 Ǯ.McN~jmS@fZ<'sjbco򏒠R%5ȠQG.6cܱ륨zaY 6KZ6ڐU;dqfk­>/ ؉e/L$!YezqjYtߐPI??bAE[w/Wv#oLqv0BÜM8X=̤zLoHvz;7dQX>~FQ2inykifuПu?⣻_0[JCadG@dzv+|9q']N88 eJ>VH eQWv>-ݾۻ Z_~>a?}p{lO?џ2NX-W.pUa"O23\?u/_Ŀ[ћ͸PA`?"f4uGP}9w1:^Zi~),Oo>3N?^D [՗#}2~>}Y8tcZ"-ZP>eWWHQB"qgN~?ܵ/Xꃆ ; a_Iس`A߃S<[ӣA+:7cK_,Fc,g?w27\^i|-.#>~ "f$z&9rGK y$XbI nrD\cn-t%XbE,d$,rv] o`qȖcb*)N }NUH0|Z&1BNsMB MmuŐ aӳ4vZcrv<{X۳0›v76vb(zi;C0&ͳ\2%HKiHE۟RIk/֜~M1#[\;$ռONJįtEմ2.4ZaQSW [zcdZ KPثb͊6*ثb͊6*ثb͊6*ثb͊>9E*X>smr 헨jRי۰퐉ݴM7l7bw=FRvI-e.CN; u˗C&ؤ;*8R]LvQlPثWvS-zu.ıCb]vf 6xAV3!ugȤZd~UU(#n_Gz?B7KMP[ۊ ?:H0AeYq4qWcCn8}\ZMϹQQ%(}+4!wlhxyrpݩѰ/o3Ng=.A r@[\qyjXEիI1MND,<ۭkw5*\k%ALRU ƫ GItHdfRcHz*)6Hi2*FG%?ӟclƶ:Hu8dTE}˵!/J&V#=vDUjZ@Myn_Klycv”E,iXd36i+q+S^ $V*@:K+;A-% km8?l!ܤbqvVB6 Ok~_gاV2+]jQyMyDzE_/bfZ\Rv.Qˏ㐯4y}con?np)eIiV'푚䚑Υu-%?huc\TKم hu0#ė>;E`!~uoX-D[-֝gcw(y\7$_I c'[[܏Ïqr=D%Wƿ'&(Hs'b$wo,D!uI= mRONO/떍PVD?i$X59lfadsK\j2 Huw#% `sGϭMrvUO$FNR.b*?bO} ۷5w=ZybF:G))R9?,&0V2ٺdOУ~'jiS" L=$!" /lm^o_?*F4?c'%<c?XөO+X 'V ?ݴ`x P7욟G$17lX,WihR:WvW^Z[kQ-J0W}ݐIIr.( K[#7(SYg=/,&U q @ 4[hP. o]C-osܼy'ٕWMj0[)բSbRK'Yr [ZSO?X9.&cMlȥ_ݿ9*74k>&샸S|B/5G> u}jbUy%"?gA4=4kvO_!\^mm~Z-])baz"A.:yaӡHK$cvo+bMF]H3qg=عQyc/.FءRV_u2o' 둝wȖ3X]R ?!NIy#mim(.?y@}w^Z܋)a;i͒h1)wȞ)^މbӜU7berʌh1}BTxw,-{˔v:2 ?gTslVH":f?hS~2 =+[jwpF߱׏z|[T,IXo6Njl,k%#7:CX9#@}ɝ WKc#!3$cJ: (GђiMc'(c& ?}ƿY7TW|Umڝh:}MKŶ5+]h;ȷoiTpp+NiXKNV<ӏjſM2(+b)kc :^iOgA)W6ڊq8?z[kW 12kkhPG/ŊJ|[bս3ZDl[_[lqKxeX]؎_VZ"zũ\yVHJ8zO]T {&?||7@7s?xX0k5pKeidr;mW¿k y'["[댂e}-NXx1 [ yNԜ̫LztCt/~bj꾌?@ŸH ZIoʊxx?&Ӝj6u(~E]Rd$hH*.?m{aN|5j/ Hu G Hy8C~;+1IAPF蟴~Xml| _4ۘj,Q4l˿bdu=ˁoS =Gj1BKٔnOٓU7@L8(ÌtV*3/dkGKW6%9fAj/6V(NG GmKY(RD;(A Z9'*j*7s#ICxkvH|? 4}#I59֫V,iIy9Ե) L2EV[aZo!A4qZvWioSo0/afWf0ٖ=G〫"S@peN91mCj 9xm$׆6+N Ƿ?,m=@$u>#$Ki_:oG/olYjί U1joㅛኻf(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ZVAeɜ9+P)rn?od8؞,]['Q^d[1ӕ3'`hpj6tk1WfqWeLUن*1Wf*}1Wbs.(vM|t]N gh_ |[mgh2Epp'/FC5@v\~Gbu??ĸ8=1?/yz]JdP?J)ܓ?$(K[,}ץh֑VNnwUQs, y23?Ho5j5pUu쑯nM͑2gO8/?KuB\:ڻ[iij7*W~879J:awh1ٓ3V%}g?w/q"{0cA^L~?|YXdxQ'KSjdK=,%V #SVo~.La<ޯv^ZKicO`by1ô?vUq s)eȏ7`X6oPsb+'rWƩψ7ai QVj=yEG64QK fЙ o"7^Hf1B}Q:}w"SvlC^|^$L]_ͶVUvfzLã;#&]W_?% `we{iXM6:AO\2R~<&.yDCsYP{VG␓ 9WSBc=x"BðG$"KW \dO򝍉VGk'?읆\0ZPwn DN-(H)?.m^R]XN?n .vv/T_ nH8tH0yJ-ZEVFQ67ͥzkbi,@O&?N.>.QVBkɶUɿk @=[g-սc,ñ? |Xreb6~7+"[uاRG_N siHu8Rh$#z ]JZyApe]uV7/ +̿❌[uDJ}+*'!p_g| a戱cm;Eb.//Iܻ"Ǟ" m(>2'rs2dIzh7L^uzJ~V%ͤH?[kvq;ta_𮹑g `JRm.Gv ۏ5KQc=t";e2KҤ˂_de+m67n^"ؓ\c,bk{ԗҌwMOR.g/; ZM\ZGf_Nv\18d-|5Uѝ@ˆN-k4Rӛ;7k2+-wc_W| 8'oKImkv>Z+ʆc!^Ct JC- g;!_h_P*fq_ mG:_SW煙6>fXo?LEG?bUk&"+ v3SI;OK.ȗ?1a4;4zd;}frO?]Xɺ@ГoUcv\rDS:&ugi3߶uV)$w7?O-3GqHAq8jgқbؒŀ;oV?T#]IJM9&(^/톫rnjpGK+cEW  ?g`͑Ŵ7SW]8~bEi|3^LvZ.9=Y=0oۦC|iNyJHǩr1wzǘm:?.t+\YK\u?xk2yyc.&-A>*/ i̗:gx 27 O~R5JoSKN<G㉬R֡XؒY4o$aFs?\=?b___#lx@?~bqz7 1-+C!W1"ȓO_w*X VP~aH=~fZk`Q:SP cn?@yK ?GdSK]=7{U?9znXV&>D>QΝVi q/^gofp))>#ImMdt@?̝?g+V\ d///; |a)%A??된/kg12_\?lg=tuG[Fb xw\Z7w4@YKxb.\ykk2^+ۗ n-D`q?.[Uȧtja..@&pǫI?dt) ]{ 8ɿٓYZISG:C|Lkݽ]H[O://w`5zaKou"42 ] [i9LwZ=x=z%6ywj!?Wol,1Ѱ=BbǨ3J15O=~Ŗq;_d-?g'ّ [ټ_JĎ+ߗ%tW7Sr>?̏g<_.+.XFaJȟ_bX rNQ!7AMS e숅Y?W yN_˵ 2OvV1Aq-?erk P;"րc$XR-\0  8we Թb+3`%B/"3U{i4@-TnYߴd@OKߎJ\Tĵ N헨$F_{㊞K`1]I7r9p`?l*eQyJLeT| i oNCVPRGAFID" U*^c6c=/" GL:5kK'IPTaCr ( <}kȼ8 #, j22#ڛtoy>9+s hJ/^, 1/>i*BűGk(СBI Ev[c!y-UsA?P[ڋi_ƟG!Hx/)??v@)NiZ\~XtgRZzԭߐʴ?E^k5֚;zzU_Y+i0G% k_-[X7^b );7Z >=H)WjI-*WWo>=a7 Rvz.?dow?Fhn$ U&K,sKJuG˖kA#SO5pËt|1hoRqHԳj)ďOmcrx39xeT )neG(&D8DM51=e#;n{fEa=xֶKHm`O%5Tku R`>ï##8b9BU؏<#/9?sjӗ+O\U=6ANrӑ?{-If߇ 03";6)~V?W`5( glHD'޶V>t{&i`FYӸ'GPl>V=\p%q#X9/EO6b: x)13\AG_?g6`@ s5//1s!@Xu/ƱSϏ_vFI~"GGUۼ=+쪁er%ީ(fPcݝOTͨik S'v ?ːcJR=:0}a9*i9{_.ƻy~p&Ug". d>`ʭ v$[8JʖU2O9fz MPOاmb"}b{Pk2+,[)c8iB}kyn?{+AZ~qƤx|\zDCybѴA؟?Or?yi 4tw)_kQ)1lq)liHy??yZtCM} 7xI<äieP{?ఀSH7G{OQoJO6#XU@M|! ֑=I+Ԏ=$&GD}?`m@j0̠J?8GzsXڴW~.?ɋ3ޝsj7?dIk-m?wԹpoլn ߠPq<֖49Px-?c?oq[Y ׉+ʿۋ=ѥjI5gc8 PҴ:JnOKA)oSywG͆@yhS[%Ԏ-d3%Kg: S$r^}A LNG lҐ64|THj$COi?o\rq8rڐUG2N?qu? '_߸y[gwcSZ m@@*k+i z(׀?qPJt I=X7ʸO3n GCD'/>a-]1sP3,8ZJ*}?2 _Hxo>×U< c_%P QeqKB.DlHOE5ıR&tiJp+Gc|Hq+]DK}*VĠ{쯾k,Zآl-j?ʬs \3\1I:ܟ|K̍wF?*)"/ޠF:kql&MY~m_es,}6C m,8;wTϊF !{vysi ӊbd qVĬ幺\+/DHF̋,788*J[ս@fSߧ86ޟ dXS6+7yS-{~sm&>2,}ɍVm_^'yfPtѲQM4ᶡ WҢ`3n"J$7=NC19d{K7z{0KC[!VhvM-hg/ g"QEjn9׼qbw`X}?̿+cI7(1Ӊ_2ILu{7gbC(jWrN":.s%;dI5>ʊ 1B-B-L#,-+;%  O_2Z\2 0?c-ԛp>.۩Ώk ܟzrVH/.Bj~D~MZrxտ_Zj-D>M@WFot_JW R$/o9<31z8X Tz<ǦޠQUn7ejΕ}uLe5CѾ|E5>8Itn哝6QԵFq&BA?rZH+|*:'c򭾸݂\De @{>}Oq]3|F5_Ux?p~? j~6@DѤ[1I j,-3':m֗q@ <j}2R->^4v*8"g<;mퟣ&lZ 7cJUEwP{ `lX c׷|4vW3&OS"޸ӲOl,?@`Pe-%+(rr2Vp4*p"B;=3yKuDݝ偰MW Ԇr;1YW)JǦkIQ*;;OkP!w= Y%g"y_~N覊?LGfzc6.O pdTSTȟŖrujRg?; .-"G?,5 \9 k?QX0[}CQvGݴfYTGTt_F`1/Ea%w%]}@)dҗvzB(hoI+ ORN:dء<10K߯;~?ј2?s و?_?`#E#)tu8Zc#Qv1~^mSJ ?kq柧l:ib$Y$S›Ў"eMt8bK|}~"(j/Z{Vf] 1K.$с# nǖmo%ٽ[-E/$vi.yaκ(QC8]/ZMBtQ#}j>_dOXPُ?r'oC/\݄z}۩,,76y#n_ T- ?+$ 80?%Ҍq_LzrG^+eb2bΌڧmtZ&K+ǹ]eώDZig3 V4jvjeice~X(Ͱ>㈍mT1lNvK @=EHXLXX$rN?N>}'e@g) VI] *;a֓YXnzxL@6ػkZƑ uecNF Ds 9&##"bSJ>%'ᒀOdG'{j7ՌmA[(y7HcZ@u^&2~dRHoJ+Wʥwz^'St=ײKA6ayj[rUie6ɣQ?%>3[]!I?{`"y;5&_Zf Dl*BݝCAUcr*b= ?j6' s*3ؼG=1O❇?$;O|n|.9a?W#48Hi c?e$z5>,' NnV(o):K+0oڑX2_9|6mdLV}^z&\QV&K;sv42OJ6Ȩ :l$SV<.'7C=նѷSvc21jiaz/<M“F?t̑!7Ϧɦ3ᜰE{{)bQ8UZ-^oܸG'#Gpq?"OWC|~7%VϦNFiVFN %xf8<_Nr@4+>/vReW+O?g!5n]i*?FaJF\OΗ"u Y؀NEȔENs`~^8H#^<.'!%V;7ƒ[:WfC.swu3ƝV]:S?8R_/2bD5M>Pclj>Lq/o\Mp*EE?&mRO0[?ӖQƟ>L)`g7Škf[K#)]vx6/IFR'pUnONr .J>wصLk~bmomwz~Q?0l ]Io"MC)@wRnև(PGT|J'[2#·?eW kA,z<){e' -˄V^7yD$^oq#z1BG?2dcr}rKTմK- {t=v}!՞Ů|xuuKi%nUF|sݽt9!ĤL̻{1k cl K9Aj;*P?rqɊJYYV'HɼtQ'?LOgSԢ}pj T?2mі9C˜qOTחi< 1ʢ2kD rJ'`K kCԸ~SJK4o^ E̶8#OJ_ISg"" M?1<@Կ$8=7P耼B?mT_1狨z=/i]9?p9Ҵu'\ 4d~;ޙE[GgļEG(Yk "{6fX}?ܙx~V HK#_n<;%M:,=sxwI<2el\0\kmT?VZ Zk;(OՏ.멅2Q:+C)۵(pWnm"C[9Ӈ/)U<¸PHcܟ {Ήh~љ>R qe:䏂Ә'Cj_.36\9vc tL)N1mM&5<\Pa`o;!-GYf?B 'ݿeq&Taڦ 7PnfJ=/yDZY̟xSql' 20p+b* /SE1HhK(H%r 7c~ lRiwMP #8&HpJiNv޵{/?Xդv9#,*KӈU`lC7O\]$ LGÓu?IU [a~ֱc2eտqZ bOSM{HdF_z{e^c=G#Ԍw?+iī6=f&E/;=izl4rw+%w59솸v"M0jʪdI6 qO__"p6=DNA\þ,1q[Z":R2k;]OSSz$O|ʗ$r9 ?ySkT͆%2QV#QPZ}pF0b:򧛽n6W+D+Ȑ uiD12FtҲI6RMJt 56(_ _a)C!ِۨkJwOJxd j"ALuwrX"wE$gTА 4;p~n[;|C(ΐz] uֺ qv4t'd¾EҧK6 ЏaVZ|!T'sHMOG6oVXiѬ9EH C7Q95kE+WMSHHE#P! $VtVeAV ٢`J6#8zd_,mO{K?kl џz[y(M.Pn_~ŋ["W.K5/8 Ot_LR}FQG[ u4X)DC߳ C HMׇ QX=MTj1{?~,UjJMlwe\YFD)L\T~zlIzOpT4\ 2Mlt KF~iL+ks%abbb8 'WZ'2/oD佊Yq-D>]ϗ`W5ϒޓm`LpWwBSI Ҧ|R8e4mŁVq|sOn"/, \+?F=Ӯu%zTKXe_uȷ$e7];7q`gG7w:$`~Яşol+u?i%r/T5HSMПO,ɶ% :Ƨr{1:(vR644k/;D'/Z?o);. I_c7gAѼ. ^̿!M@6@)>$Seh/f5D?jTT<_,Ae_T|mڶe`_ji#c@.mFNUڻ?sƵpn. tQ?feȭ,ABx?N,UgF=C!dBՔWKE|t=~}+-i@KRKӑ\S2E]ԊѲE,6[ToA@M06r@*[ugg#IY5Xǂ3<>oso9IN'J _Peb :x|^|1n~ @h(~wnVV>.'yKnw~X̅׺TW'΅kFOG)J$׶)tvz?X)*^}9|__Ze0]x˱ (ݔ{Vgč(KGUA<>[KOV+Caر `lr T{l1Rh,g۳7L/#yta?g%MޞԶ> ie :GZk" s$?Q9/BQ$^*2cf MPu{&"f[?j_ŏ3JcLTtC?QP4eQf;"/ؤ솵72؞u8 cbgMК|JmQ 2F6g0y*WbZ8=~_+aĊԥ<>_Cii:T G+w7OmtFjފZ&|}l[hV6'?ozVM@ܾF3$zMcȶ_]Vv"?I|5I-[Ѽ^AoIJ3f1P 4?I-pj1F|mOL>ůp1EQʽӒS Hn|$yh8_yZ=QDtXLX ~^[O<^xC |y}o$aWW\M6|w,5P14~::AFxf]Շ^'V0lڴ$S}'XWR'f.?[$6i-zCJ'?F #Zʨ uǣ?o4Vz#3RT W/Wm[h8N6M#W}'#R}/<< 1~_ xSjᣲ}4p8 h;Ɍ>h`Xxd1SlRqWeWe7ci, P+]AvW^ء٩]qW^52.iU}dmka*( ~~@7\S3"w[*`M;ؖ(vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*^'ɜ9 uHr ̗v+n?z Yno>ɻrn'`r,ݎ]jSJڲrvq.qJ!]WedU٩51Wef]46T--hgabih%CiX $4[r.#O?$u=2Ecs୻ O:ĭXe R۳n;cȲ,yG^ojf=C5 #/ԓ9$dOhGlrwOMer7fc5B K2o[+4ACտiJs):[3DFͤ$ն⪃,CJlu7-{J:mARSv|,xvLCo0wenF xhY֓\OE&ϫ3>CI:$HP|nhP3w_Noir Bտ:c_]HX=șRedwt+l_6l9$/Odx%9}9hJ&62zhX(=ؽżw2ASAC215_v@OTT_ɑ%ÊY9vE?8\JE};\Zyz˲>XcRz׮Av/ʳhqcgM5xuHHO>?_>/lt"K5QO!O`p]7GLCvG5O<]]`D(v$>+3gAvA3lYra5'H`oȏN<Ԏy_L]\#uy;FLiЋH#1 Uj(ƌ~&o%?Q<_]7HB6\zPvBT]u y $i_tѓrd>bVW Hw91r5|Pey;) .E_,_ޤV @은娵x'=X mM8NG]Kg1Lzb( ӰHުp4.v1sk}{O\ҜrO~ .^;U7._݆I-̫#; w b#fݍ"US⍺ЯU-1# :?O.7.ֿU(S]d\ enثK*Hʂ $q" n]Σ 6πl [c\ y{;f, BA-k2cyOj  ӠP eU?6Xs^kvPC+D>m@g.M,u?H9oy92RvF&FIjޙ3;d2A-k{B,敌H)[v$fj\zLp]AI4r.[a˛D o ?6] DmWiŧH-j]ݏǓL)džՏ $Xy~h);:Yc9z}|džC?͗_9oF)_ua⭘h]iz֕(B:ӡYz6 6!nŵ2^krzP:(GeͯDNt"UAhG=i=pɳ6h#_vuo-y>qf v+1v̸Gr:l'77/akOP>OQ6?rf7XO3pg>'֞ $|`>Ɩ"9=#i_v^RH`j+EQA?SVHȖx!#nĬl'mP#t +c&A\vuO,y*@O_2,a?կO2ᏇrZ|G#j2۝d9cd: r.}ntkw%Kp0v;9ƭ^i.czl11u.'^M§鑶׫N8F ,`87vto'~[+{XOs*o]ڟNMPŭ,110, {qL'o.B3챠jο2|X3ǏG̟@aWq|__g1t _M#:̈́i@ӱɎ9Hqcoo羔\Vq& q8c鋲4BQoj$b&QqH׼47e"ȠA%y |<7[ӏ5 =V3K3?->5__Ds\cU7+MΐgqT!I[1冹;7k zr ;Bd^2eAVESAN?8zfIFص>:'׏O\;[zN?rjorpO?WGӭlSO *I?~%4El>_[Th ;'-dyaz ?k(:r%c_hwgU?FLKɎF~>dN[9?N~d|@N"x O,za`OFerG:P%^c*HjuF,xkrĺ w\f#̩[ jO63=;i䐸g!_j`%؄{Q2{f)RviMtt^aP'?bV_*Y "Lo/cWdgAR>T'e_|2c[;='h~?vsK>Cm "F<.';6 !؎Z":ה=ɥ MP$/Y~~fDe3aDŽ0RCDpJTnI l4zb؃3=6iL F:d&P#_`}eok)6qCW:̼x( (ao /_ܯ˟/̡RdƥO?jFᗣ t@BQ@.RnG/71t&-41^K2f4;'ee?Ȧ@2C5=a,;OA( 9Z]g]_U@®&=1WW7"v;`[p5'ur‡e?'={>p$ *7w oCEQcvBbgcar`S ffi D eNxe>#H`<*>-%X*7TqU߽0]ճz~ 8AYp*YDMVfc;tif4Uݽ踭}4p[!.GZl^S?g8T9a1و^V_ό{/Q_| /&,kW.TGWzԚQio$"Kr*X9u [zAGTǏ&Ĩ[%pY<|urh2E2N:4e!T;n<|%￾ l%LDjF|=K꼝}5bCkm9[EpՠZ]q6Qug@iddj[2&Zɵ`/*ye?;+\6Bj7r^0Mx02[);lzBkm0E I ki|NGu;8.r(wEk3U~R|G#[]qNRzkO%]c;u+%j,w"/n蓝[6(_%K{+)k{)"$E#uqMF)jdո;TjhU _ڨpek ddJm#/ `qJ]@py φMp[Uѭ*oȒ}]洩G>=ɝ4x x׳w#_ȷ9%%MȀjvTdGEkuGV?$ T#5sPJ0!hMkM!!$FNT Ќ20. g[xƙK!*6Lp|MGď;dTurE$^jeqnKd`JRc(|hߓ7Ƿ)F&mf*~?|yz~C/.Hc!6I)ۉȺ7p#y5п2_KPS2Ea@?trW4CbZ#j滽m15Xנ3aJ*;@ [{d/#t -ZYV%/!NߒH~UXj]7kPJVib>qWo??# Xзv>զaO0]#G އE'Ȓ8%eyF!`ГSn?. euc#c5]kMI>Aƽ?3bDme  -%`KFb;t,y )E_? KW4Uiso^$ҽ uM#L&Ҫz5|iF"JPs"d`?{-=haZG& Djq\s'a6O.-\"# i,K2S3ּD\(#V e)kjKF7=A+'~T7]j