TExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 13:52:26  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$RI$I%)$IJI$RI$I%)$IOTI%)$Ā$n JfI$$oP.ɦkO$ [a$'AZċts@WsisZgb[qe֔K}wsls[o[Zrmӵ\Y9x6[jAl~k=;)?E7Y9? $͵OՓܯNE}&4f?M?Uh;kVI #̐ߖ̀ T[_Kհ?s\vPAϲG[6m߳s=wQ8HRE /P˯/Fy 4KwUP$qsp&Kwr~l^>۸6f6[\ki&Ʉh^"ƯT́vK\(N_}˕Վ5-k0ߒ7]_ 1#{u2w\_`{)Jl)hԌOF>G:gcf/m5=GEʭs5߽!td"q=8Ӳy'34INX6?j&|wklqRT(lI%?U}zȣ"{ZW1itwV5}f{l=bA2ݭvy′_,HN_fC\Ea$Ͳ ;Pߤ殙ֶ`4KL{hd-krX H-nw9~m952M[Cw\>h,+by[Zj-Vi:iemH1|~#ZaqjhSIpCCoE/k5$󳣋K@f7I Np#s=ayֿ1dR2EGkLKC>2z_\BwUahsF޻Mȫ"*uI >7zM7coʷ,K8{c 42=7cԦmf,c-]^sp6@:oA];+A0iq"5BoJ㹠a}O^@G,gFNc@=C#ڗ=sklYvay"#@W"wZݯhse%m[=:l+窠}`Л1 ', IbVsWxu 9B#{?k^F=Kowm˻I⭏ځbayʪuOǬ9]g_KO@TGӱjF+oKϓ)fAZ#4$J[5VX{9״ivʕk=\HГZ(&f|'' *y][I$諳*]cwאFGwr* 0cIB;1TƵs$qS}="OՇr;!̤k. K{\& ծMQZq{.sOZWܥWm gXIv~~XoDsp҃Ou۳Xu9?<w[i]"cT*ǭVDUrNf@U@$?TI%)$IJI$RI$I%)$IJI$RI$I%)$IOTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTVersant-180_PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM_ update_maart2018_v2-9 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM 6q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$RI$I%)$IJI$RI$I%)$IOTI%)$Ā$n JfI$$oP.ɦkO$ [a$'AZċts@WsisZgb[qe֔K}wsls[o[Zrmӵ\Y9x6[jAl~k=;)?E7Y9? $͵OՓܯNE}&4f?M?Uh;kVI #̐ߖ̀ T[_Kհ?s\vPAϲG[6m߳s=wQ8HRE /P˯/Fy 4KwUP$qsp&Kwr~l^>۸6f6[\ki&Ʉh^"ƯT́vK\(N_}˕Վ5-k0ߒ7]_ 1#{u2w\_`{)Jl)hԌOF>G:gcf/m5=GEʭs5߽!td"q=8Ӳy'34INX6?j&|wklqRT(lI%?U}zȣ"{ZW1itwV5}f{l=bA2ݭvy′_,HN_fC\Ea$Ͳ ;Pߤ殙ֶ`4KL{hd-krX H-nw9~m952M[Cw\>h,+by[Zj-Vi:iemH1|~#ZaqjhSIpCCoE/k5$󳣋K@f7I Np#s=ayֿ1dR2EGkLKC>2z_\BwUahsF޻Mȫ"*uI >7zM7coʷ,K8{c 42=7cԦmf,c-]^sp6@:oA];+A0iq"5BoJ㹠a}O^@G,gFNc@=C#ڗ=sklYvay"#@W"wZݯhse%m[=:l+窠}`Л1 ', IbVsWxu 9B#{?k^F=Kowm˻I⭏ځbayʪuOǬ9]g_KO@TGӱjF+oKϓ)fAZ#4$J[5VX{9״ivʕk=\HГZ(&f|'' *y][I$諳*]cwאFGwr* 0cIB;1TƵs$qS}="OՇr;!̤k. K{\& ծMQZq{.sOZWܥWm gXIv~~XoDsp҃Ou۳Xu9?<w[i]"cT*ǭVDUrNf@U@$?TI%)$IJI$RI$I%)$IJI$RI$I%)$IOTʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$X֟4f/lWߏ#MLFCbz8]]xnݸE akbL,|֝ 9P*)?}V}@鹯Jd|JZvq4Y\=Y%Ɵ:G`8?kaϵ2X̣+f@5 Ą'=y hZ֖VԞQTzo=>!)}㫌f]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثrA$*iA/s' ___U0+`L?roleI4 8[D׈j%<^NØm9d)vE lclMj?=;,G@P ?u0Z]#n+ӧG*PB6r6ߦbd[vJtm)]iQPZ 6Wl>󶤺v!fzDřǖZ2\ju|+OO掇0_?y><;eسLiV>$uZTk|?Yc¶!O 0LĂ>Ȅ^yZ&9]oKg2Hjv˕ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbɷ啱ig _.iN[CANhٙE*H WFܽ?a/Xb+' ][ԮKSi lFfC???+?-ſ ǯ.?Wa-ޝqfxFџxL6*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgQфS]7H;(۟ܟ9Rv --.Il~)5U?[*c*v@uo&jzg&".Z6ۯ,ac$; 31]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbV^!C$Q\ .G+sX .: 4S1tU7Ӵ}=vѬi(O̟K, aaP;צcGqε 2%!ٜy 0rƴ=n=^р2Ic%Hz5&[L̻!FS;BwQ?,$%`eR6F `}G\L36lqih:oNVg)3|M?fb2!_+n};~jQ6ֵD *yb>/lɥs?\?[gT-t} E$Vf٩Vyu:f9.P۷,.3͡sE N=俆v:D;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWgN~Hs}/]41vKio %aH?Nؐ(*G|]R܀G M;4%i;{86]O+?54ƧL_w 5$!4@k&_閝|֐tuR"7\¨5eC2GK']r~PG-= \3(v4I` %59["N?Y|{oJh"m i4 ~!H>bٳūŗe iJUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWe$ U*-*oHOʎXf?5vv?ٶq')W`cZYA,=aZv.ꈿ6+Tv(-按l_k Ƈq[s|*6834xaf^͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*^{7H8T'1R_WdEޙC'AJ v"EIdJ&-lGq~)_9f.&/T?+&;U$MJ ~le5ԮȆQ$u6X_m?Pa$ߗڢ*gNp%]n[ GeqKޟJ.I%Z2021)R -Web͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb U,֤U?OeGhG:~m(Ziݿk3<WaRcrK3Hv*O?~Uv-SLQ U!bi~B~̩`&<㋆h%2Ph$Е6-4^aYd"]rj~?υإibKRetQƿF3Q_Ռh;"z槕jZuzi6+Qr94&AСҭ8€ &f?Q呔8Y9ݩOL2gNd?d 9!#5jEɮNf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*>^t(mTz9$rL˽{*OS!2G$9+IZvX#o1rJ샰ܨPW a|1*ױ+!BGoP?jcv %v+toԯ]r*jY$硯Ŀ:W`m!O7 2f)sk"Խ #bO)imhEbkn`t+yĻ9n{jl"1' kt;G.=z)"kI^9cġ ռ[Z0?jSqf~ҫ2Xb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*4QS1;+O00_G=3&9v~V]A#4">eoB*l-:`_0gڲ OJmn#քWaHv.qӈGrn5?x8 mتLLSnmק$ѫђT {v.B%(vrX+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]\U#Ѽi)׈ pcӂ_΂&?憟ro޻ҟ|_K\ݗ8_vKaYcjPQDc*U"e5_ n@W`pH+R׉׺e"$0Se9\~j'K>N3#??{-&b}iEj)^>9)v]~Q ܚm&$!J+SNp#O<.-ZwHfQ ~j.+M\Web͊6*ثb͊6*ثb͊6*ثb͊Z-֫/hs)˚8ȫys6Z>Ǒ/6sSMC] C)#nNj%*a\Qy(|ƞxGܲ.CY B@K5>Zd|k"k}ĝzq4WBY!iIJ3U|erz~e_1tk.XVY|?:\~dģ4[/+Zm ^\v>.c?/ xܤȕB+k#/O39#?6x$#؏\Gk -mc|c2#_/Lj?7|Ik׌VF)(9f(R-dZQw+!ŏٲDp K}QVPco5)sGH/T:t?{88wnk|_g1['@;$ ]lFd0 I:;poڻ]M0 C2S_ėgUK PLN…c&v=s>Di.SBvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*R y.Ev8 U8D ,{N1M;:m"?楓_H_S ciъ=rY `@7~%.Ŝ;qmO ]NIf@6)؍ Fes4HuV+a\#d.`bױjIn)H'8ׂ݆Bԟ1 W`mR)*eanijP6/EjU5-g7Vṳ֚̏T]fDCxoZ?:rњ*F.8:j(w+s(f4yYVRjO/c?kJ?W?"]vծ&!]mg:,yo~?a.f+Wf]vlUٱWf]v]1Web]6*ثb͊6*bDg!TO@1?h=4𹁓]SNn[mzT|eIQ?줴i-UVl~n&iev[|J6;z)%-" tO)c:230ACY{bUHr7`i߻Gʕfhz Sw!|WbEU7+;BK|Dmc#JԀk׎Hv*/P#iv/kMi@Mv 祵sB@u?^$;8 틲Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]\U7J֮=k9 7q--]p"aGi3vG\g+q:~ $4!I}@?j~%e$ 6Qοp!29Lb=ᔑiv3jCFm2TN](#҃}2~%H5o>9i.,XaF.( 21g(dgQӦ< MO!zlL}@O*Ӳ'Tꖠ'%W`,]vlUٱWf]v]1Wbv3!TR\ .GI]3 ^rf/kn?$Ӱ*׷,{D~s79?Lk?NÄ 6-$?GbH-5nN;}kە_5p/vHl|xv'/kjOYF1x6W$_u,GnT@4+ 0y OSMyY`ofcMjD`iBϢZz"#@gd'xh7g8oޅoD Qi/,;y7x#/Tҵpļy%f?xW\2'\ءf*UٱWf]6Rml2r#qH]oʟ? FUƄv|[<5},z1L2ž&f]'rA+K\z+zvMqJҽF߀v~v$ޞײIJC~;o5ӏ`BIdu$i6)y?rdkL'Oĕ;h6+n0*FZ?7_천2t TdʔYww9oNI˖v9Z&*áU*2M8,S7a]^T&O57MǢ_M:04a9_J? OgŸzL. j>sSu] kNG>xWVF x Uد+E;9iKZvާÓUzSp?jtȠH^C ac":֕")#E6<3mrc?k? s@EoǐoWb~VjNHҴ%_ L`,zUhV~)Zv#5y[CJ9k1+NFG,4vq$#2f/kj3w*E;$v>@mZ(B;ܫ<ӌ~,O2KKԴ 6&>?5|_H@d#v&_Şקo+{d!B|eA #?[ZzePw$V@ ~t8|sғN9p]LbyV4@MYv?*1Md4~# aM'zB20 Q5_VA[#aڔ_ݪXl=L !x"ky MbjjSmL| o9)m ʿX\[: /kbkӲT،ܱv7vlU`WvI<{11~Ԍ*+~] 8?5!|MBx?iMیj R16XJ55 S}rb~DfNR쩣uOZe'NRtMW}IyGMҤ10 V-VE7~ɐ\w_?]52}^&=Tp΃fcǹ_OD;"o#HK1$=sk͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊-T늻$'浬  vNhmNeZO\=Z sFbY斃.T"YSf19^^hy*i&E=Bn?R|Ifa?[s4h/fa'/i/r <}^I4R?1W6XKmLEF\?irvOb?dD=WШvfkųO]o]BH!QXΫI~w#vG'vG잼2ȽPiZ\;𓢵V[{~,Ɉ uL6fq@1'E& 7OtCxl7yv>9,)D]˼`y6:7Dޡ֔Hcde+-M7$WZQEaݥ;T!W'd~P(-4f|;)KS'd[֮5 8c<1Xeثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثEۣHd'1 Wa~FބAjC:JU/c5q=W`,5W} ?W`(uwڿi挨!M;)(u*#sS!Y^kV+=:֕Oq̬}fz?+?R?^f$eȉ+>M]vlUٱWf]t?7z)vTd| ӗ?bgc+hv0B*JsQ,;ӵ+Z/Vd)SCB?O.950``^=u-]S47ᓎv!%)5ɅvֵZ8-TdIKcnwvCӲ5>h7=OlFM$ $Jbn-v%*Y0Xk`YTqu,v4f<^y9Otgw?F^$(44v\&Ӱ]@pn) ]z359(v>ܟ-o|t7ÈVÜxx] KX$y?F,mq G `JUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbO/Y]܈ L1 _7Nqqvw-LUk HQ+MW!S\3OR}1K@;%gP^\QAHn?j3}Ak/~]72P/ɱlpz9Oǝp'0^C\ghG՘S'g,wYXjƤܜO 6*ثb͊6*ثb͊6*챊%^t7C Kl#Z('Qj0pUּa~SBƤgWWSǼ?{YV@:DZP2&w9ӌJYMd\Qb6?3RwU m4~6ȒbRH+}TNuq1oBi֔8-]nSߵrqH1BEvePG_wÅE”#Rv9iY%IeClĐ@?]Y,,({zt\7ͱ;v$n<q Z=i+҅L?1$S|,݀H2DJ3OKtt "uڟ/|žpxˎY<~I,Dn,Jq1XJ+i8Oo9(dbUC!=H uvW yen,5c䅲HT"ƄZD쪓Yl002@ϯe4#[ST0c9ڽ,zQv"Zm(ťzAlirW ϙow!"p3c h=6Φ u n~mX:oSd'5vt}]Źqe5oӰFR@0gL;KA?42 U|_ wg|_3/x@:Ma #?7g}#e"(*l~wp;|mzJPJk#6zbsoz͘yp)6dOGGR:0LLy W2SJubZ;!:A_71*$f?i>!~ ;NG'4ڠӏڣdh E©4١$Ċք_j=9ʎ[w :#rV|ևp vN zwv3_fA)I @oʣeo'-4S<2S_Xc3ܩIPє;dٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgSNiǙ?I λ/B?$(s}yWa՗^XRqid\ԩ 9)f4x1'bφ#}J3Pxr9gkp_౰iwZxiGJsS|_^3HaƍzJ?U\Ŏhr>6L]-q4eb4muJmHz1z U9bTrb-?/K̖`)጑dUYjCJaԟXq!ND1֕jצő?3yMU 7v$֙`|7Rn)]p ᮟkwfA59Q›S0Nwe'SFvZ"˘B;mUa (wvS+VֻS -` %o_%:QL%V;#b'UUádrLٺ ̨xUqRjQ=x+׏? អ.A?E #Q+1y5B@OdR ^D!'q- FS3L|A=U"ߴ~?BT|gi heQڟh]oٛ?QgΫZR//9"h'{YfԨ,0wl VbE ߧřwUhö\H1.śrjjv[2mT(9x aܙM)^;M; ݶ>]E3˹4Nv׾0t6*zەd2*Hב5S,FXTm]oQKE3tyn"oAG}%?'_;Nӈ@Ϭ1wZ[q,U=zs%OBz7.S(->_dmEN?k ۰Rr`G *9Qٝ;ZOlCO~OFQd$n'JJHv;L5i;>*ze N._iءE$]@+N8yF5GckMb9һ׈4~D·w-H/Z X"['o'˨hȡ"agՌ[ {8KxsvrCMOҹBڽGt1K vvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWbVy2[ǻNFr6bVg"&p/(Q?F3< =i]P0 $kƜW|MCN.}G$rvB1p^?ƙv~-9Gs`\UwY=ܱӷ*m,§]m;WJ&^Kŏ/!# VLJ4͏+jUKNy~Rk2F|Ia* N[խԠrcY_9-6x?}j)oy,^RCu~s4OZM+n0,$?Dl=NLy"{ jէM?,(e$(Z +bGwLbVx'$TKCKg` =0c?Lff)K_%v]~Ohm&%?Y9S=ESSiVogGD%aAZoipn?2zm_ G']3ze[GwH@ִfT (KIvv!hhEMV*۲d+g(zln?E.ΐcE.tg;Sg8*t ƵyA2QaAyg_ցITp#oq`dK3jǩ=sn6bn*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثUqxxFA9\FQxeN嶥8 7AMO-G6k8qdΠ?*[嘓)saqQ2)SLc.3_r:} vV[)ʎg?728!Q(fE;*Nr'pE4@)ZN4=2&!AnZ>[)]HhLSƥ[cza 0%[!ڗ彃9(A+s?hl\ h1KW`h)-f"I#Aӑ9eʒfX%NOymMg*\()ŏ˪fN>Ӊ5!r<_]\Il)TPEm!!aؖIb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*UuyFZ5N1w_a7|M?JB#_/ko?͊$JWqڻx淚]*;}9 esؚJkHT=6]OQzWKu}=+d`EA֟r+P{ C4DԉՃEURűl^+:PӾ+ :Mkn[צ.S=pN:{~8M\+t˲PliB8W]x]:T}~a<. } sYNFUBGlܴC+ï./Z.@U^S!Rȵ:!W_A{B }I8]/(4(/`hh*v+kj`}ZrNSv/ MjhM]VW~v+M+L+QrҞI4;:A802Ă#ozgzO[%,jH[uO˻$Š2P+:}'hG/^ޫ=(!S6ΡXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbGͿx#jW5* 􇑴FݨKr}ٷ^̼Ga_lyIkvXkL11hMo3ثb͊6*ثbí:k]IPj-𹍛K7ɮ9 VSp!Q^O4;qC ağjQ?4sGόaƗ9 ߏOZ )Ȇ6my} JOZ8WdPΰ=}+PU>}=> 90gb$?Ώ7`kwOdUbQ"\dj)-n]?ˑd`]\ sK~&g c܎u6:hc!yFrg⠮5O0@nkGɸkQTty_AG5?ᰪSPmV Ol2Q]X2MJJqn+Ol(]\iݿ\AO_8V|1)Е'Ͳ~{QO݊dSiN?ӹ)eNn~Y^ _NtWJA1#r"厍1uۻw+si2!)5;VcfV1~- ke]6wQ@YMWBG?v $ cKN+,Dn:fC؞, fU?:9*M ڛaEAێ-z 1k+? :PhhFgi' .&Mѣ vq˫Y-dhf]Mζ27&3y56*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊ /3RƀROHvt)~YWѿO/{WÏV+z % tPxP|9$Wb*6%Z!.B$ؓ$߶H!Ъv߿Ӆ]v +ӯȥԓ>]EI$C\+o1vdp74w$+DsrO B$@zO|+5]w1Wbԓ)؃ovPC-I~j TTӦDLH OrRZ0PReguvItMmY:TT}..&@; yv2ƣ&6f*6ksȿWm@mE j+ O'De&/*Jo ܳ7|c< e / ?? S\2)޻ƕJ嵊]6z?ob1xEGK-qw11=gTaHH4_^hËcE.##e(~>yNk?S(~_m_+4??ܦi),K)Yȯcε,Z 7/yǧ9 qUczG?Ek&(Ӿy*m?t?̑8O__+J2SVѭ&#c.g =(gV?M]ģh}T7%+E5eRmӉW?Sñܓ찢|qdJl>R촠!ĥ.**^-2VfZJ֛ Ԩ0- hUzrNӧFontݤauڝ r=}M/Դ6C=c9c^k6 b5 ͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbΞuympF˷-W4> 7!EVP=5?可IL_ɤmCԹI{4FVں 4/O Σ+#+y: b/[irw,qMú_h"eɢ+e/Wzܯ_yeF<[kI*: N b-gr>1dxԩņTfe 5J{%&Ȝ62p9"S!g5O1 xiBK"D_m$*"R$kJr9e3ˉ+SQS"bWZ5b+WcRYV&WIi1,+) /.JAۏHG<*|ʡܒ(*_8I<.[pUA5,Ėb{܏~}ޣ eFI3 c(`YnW-;$ⓉS:fv(L{{`K1I| QJ v VaTCC핔,NX6Dž]Y@T?uq7zש.z݆05S}=vWĊVKéߍ0; dAbrPxJ `k}YԡƟ3wYi)ʍ]O5z~+QڸHvS~SkUbV8.82vjJ, '棘̼zY9J?1v$R;C`]®͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWaKDoǯйU{}RvnϞ]Ϣ.Γy.NPCH 6?W<C;$`-:vK,8e4ҽ$p-]u2Zhj>'ݏ6̬:ye;85?An2+Ր̩vvJv3q\8N7ʫ0pc=ZB)O쌐dA[O'ّj(߭eQcaFP3׻">_'?''jΦG2ybdt-穙. G!Q7L Қb4O&tXO_ S$攩*Gƭ ?Aߗ9\=o:.Β.*5k#pGoshDطbp TScd dSrFzevA24*FCe=<?ÛϹ]ja?/9omٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbVS^J^G4d'1g:ߓ|I[A^riͰ  L%n6#j|^Iv)^;w/ԃxcJmjEkWf)S=M%.Vu|P}X 4omWcҴ_Ʊś~!.r HO!]ZiZWbu탒8փ +oWE;FܙG]dsZzwW`@T+eJZj@HrW`Sž甕v,4b(OKE=E@c=cjFxĹ45JytaЎ)̈́зv%3 Z;Yq)1PxГ?mo׻Gss=:zIEٯC j;%bV:uaCz~+> -Zӭ}fF)e kQƧ+ .ˈ :r=:ePQNk*:xmSEgAaM/.rmPicRHrU+?LQda]Sm0603iLԈ؞,z\gPkJWsݙ](' v *xƕK'`&5)eiv;0qOo.ʚBT5a^-0F8"H$DGӧL)ao|~l7H6Pa|b#(u`EASv=0WUc;kM%ʼn SjX") ˶5Sb,&8 ..rk6jI? xr?3v_\g7˻9\:a38]&UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg[mZ&,&#Xl}5#?tEFU?NA~<K=_]2N HI9D1?-@?"4]n-]$NWe֠w`WcI`%.ʍQL+OP+o4cmE]umω'늻(7=sJLcO 0j{w0T{*5~U>ث5rJaSv5?#q}ʖ<|e9#3=Gqq4jZEF; :/nݷsTg=8U?2E; 厯coo0,R)d*HaB:T;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbmyGc nYf.ɿc]2R\i%GW#}g#uyk mF,CxCf,⓰Zثb͊6*ثb}4tR_'46 =;7Wc×.z߻jG}e" YX CKXb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثVML-ד8 Wf'QAM\SP ƕ4`k^We'ُ]:RG㊻1QZr S߭iTm#j2 pRfbkd)]V'a;dRNV`{Pt?\W`rc^ݾ.=?%]`(7*]@TBcfh܏}l$XkFCv1҂]ە+>`{yYOj8%= FOa8Ibw,+R`B e %8 ĀfF?^t|!y=G|=đ?͛ Fx>1 hM_yC%,8"~shq#^O]jX/5 u?2jcvF|ag|ȷ ;Tl;d$U֘)]5ۈ v% y Ǐn!Wl.ݹ<kk qlVAHC%+bN iպ5b`* 9CGL 7W`.80nWȠ\$8AQҿ<1pZu~ҿNdKՓr 뜳ZD9ISFtu_SvaHȆ6(6@ۣ".Cb͊6*ZkH?VFSi]DAɠAX?5v"]\PI=$һB_o'J~ :](VR7]*H*`j Մj/ٸNיԮIJJUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vtǽD[O`K!|XoJog"!oR~9˛]wsu!OCr/o'8O%MC#(Z7\hˎ?GE3<~i|e?|?gyzG̗#6JUٱWf]vlUٱWe$[hҁK&cNg̏Ԛvv)~]h[EIv_gGW9u.1liO^9knē)+?iJ?˰y "3$/S6(Oi]1aTJ]zUID6'J]zjGOƽrl6}]V"7ol6:aWe}GS6Ǥ,kʴ퀕v=S" ƇU){Wn wmK!4WcӿjvOjVv*vڝE]'k^𸫱ۊ`v6?=mq)hǾp =We}ʕzv'jڤp!أ EO8viv HTr?UeJJOw>I+ ޽? )v$ޞlJ"efgN2(ͦ[<P~h5ԷηK_C:s=]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]l,$Cb~2xbOњ F?^MRvF7ܚӽ=vk  _VjVB]o6tX4ݶ!?.l?/uku?_g3wK3ܜ@FF˱<,]vlUٱWf]vlUٱWf]g#(6{^gMf.1/Ļ O[[8M_^E?'dy-A@R]Ȧe|.U:"UIP}O5v mO_cQJm f r]oWbmv d;Fvz nuȕv a+)v*q^q -]E+S#]g܊;Avi߯q.h`mKX?S,vvC'ZSr)mؼUZT(vʫ@=Fh,ִ(5M)-ǐE62y&NPy[785 K2zf7Ӱ.~ ~ P=4Rߖ;{Fߎ#̟*VuC}͝zMCJܹFNҜvJ-UHXӯfY & Z'aWĮ&<i\!ȕv+? *OdNBy}[^$/rMc6aJ L8NwFN9LN%Sq*QSnY~`TuS!Y?喞4@219|%]m,/*K*a}ahISd$)f# PS=Į'4nl ;cf%߉۷M:pvP㙑C3~]L_}F͛<}?KA*Z4de`~*`2.<ێRX\#b?F_vr?*m'?)2c2DBb+v^*ثWf]LU7DamM&=>MrXRWo-Ũ[ G]!Į̭5.yfO\Qf]9, "+ %!ᅦ1Mn8N[pFY'd0) x^@MS+׳ܟLHvr3b]NvXcP 8&'- cinN.VK4a"97ܤ|Umwgۡog+J䩭  ] ֯`!Pr@i2aԻ^3Itܘ{eaVڤ .7Wb4=h~WbIq=Í6c| :{bUl (A+`+1v"Sp~|ztivb5^ڻ\We,d 9R:~Z(^MUد^ǨF٣9mR ąv\k:WGcB))vPçء٩T nWcl"'v`_s*H$ČJ1oM)vjRǒ3n+튻(We`}^])^Uز =XU$;b]⇾G-;-g֛Hvdm'bwztW8 ӳy鄰լ'u*mo @~S'D;+vlUٱWf]vlUٱWf]vlUt]($b/T=%r T2%] ȂtWf,5i]jT ]2J4So]QOQOWb/ A޽+%ؓh}Hcd*6zo|!] ǪG逫H]O}dB]Gov/l>@v sZP7 Qޚ39cN쑏2m!U֝>o5 * S6 m a}r=7Lry}bI+_~Oɶ#rO6y! B[3pyzoW pQ$7tO!ZZѮ*}> ztl@WeHJ֕nG*( 5*z. ])c^ƃ"Jv HÞ"A?VM% ėc5OWavCKS׸?iJ 8d']mִ4le!*HiB͞(!A.Wf]vlUٱWf]vlU`WvL4KN1s3-V~ц3=rv{6SGӲ]]vmIA\z,/v?1?K]R(B>E22#/#+L%Ò q?¿LVMhTzEv=Ko%Zvo=o_4",{g#<ߣ#oLmY(+TEА=g/k~׌ w*Ϧiuc6L&T?٘TC`Kxe4dV,( sG=i @>Ŕ\K@7#r0RJr#i\98p̗İ~܇=?::hd1w]nQ֊?9e:uߧ1'* 5M +,ZV[hv$О;%L;h; HcMS"6i^j=C/AU;ʻ0v%b544=Zh8ϾDv76Dm|m]mJSWc}M%v8Fw#\ m]1ۧ_?kjhNT5Tav*"=:d-]5m.̨[nǥ>KHGx @?#jm:sw—b~v#4P]`TP;E]OZ~8BMɦvYۭ(1Wc޴^U`~}Jue  يSѼ?Wf"3'sS86ڿ)vX5#v+)vAt7WcYG7]kzj\'_QSh~/MCW&Gj[*STxT+0"86EMNMcn̐C# gH9F%jnk0yX))A[|![n 8ut:K"K- nUiyR9%oNse 2#S\_i]y͓G1`._=A$5w wH2r'3"c\.3Kl:`o?a <9wc(fsƳYxG:-,ew|^(En7Z6aBvD Ǧ̔;;xHзLE;1Wj$JRr#հ笍F,lW7.t<>wZϷlJd׉j$(}uW'lJB"˳yͩ7V?Noasy]n<1?ݻ39;+vlUٱWf]vlUt]SvV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb)GV#)}(%֢E)? b@AA]tI n"ҟM>؜*Wa\WcjOZoS}ƗwJ8һf`h7"dؕZ?ϯ~sWbñmVF$Wb4Zn?k ̴nT֔%. ]<;v]QNs*mnbPTI;n}+׍k#PҔ#Ƿ|KDǶ9vjPmWbTR{ vSbj{4 uo9Wc4n?Ͱwһ0`=i0mzcԒ@N21B]-^[j=:w`v]z`KS*S }ɯёC6dLQ@feNCAPҼQbY 鰨8Yf"޷!4\-r1M;++_F`.9Q|E?_UӰtN=3&]6`uxCa3bZ͡KBޕ gEw DmQv 9(C_<+&#"E a)$Nf( UyOٚ&+>anPG+Kn߲s$w1sgZJ6mieIۥ:@FAU{G+(6ڔJ V-]mkN ^4#aZv;vpvխ-GCu O]a7C;3ٯB#+?/a=0Oo+.˲P b 1c6Λd\76Di:tmXJY.:; Ćd1֌3$ bGGa;0"Ļ 0e૰3$vAً]c]c5t=\ICbAO^F )^5|6eaU!k;+獡AJm}pؠ_mdUQ??l\Jciv70zW}r4Ơm ]LU5]@£ -Aj|%Wo,m eWö6QyveaJОXڻnKs(>Wf@mO׉Wc]7#"eNFWcBjӦ0G/o v総 Cjt>uauvj1Kuw;Sdm]W rJ콨*9`K$J~ӧщ*pӷO5v[Sqs\U+qWfoOoޛaKnwvX}߿]=W|f4]?UQoWfPq!]#Xڻ,k4tkMCUB;_*]~[eeLQ;6TJiزjNHPv4-Vuǒg(}K;k)HP/vZd0vlUٱWf]vlUah)gj+#FS()7arF.'Ceny;sj<[q2#)E0k52]/VQ V *aB{0R_B~Տ?ɛ{%ꖖճDMOS~?t?kA ~>g15-w#яO?.#۽3v$샽G|]3-B^jl_V+7MT+x}svBuTյw joYq8sP3?IoSz5c ;?/wc7/wPy.!?;c2GSz:C?NLwv=<9iP|D[eK'`j;'_c~?v?d'¿ك1٘v.MK$ ugn.Na򵥥o &[tJ`HXጘT|서ܼӲWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWf] R~B ]4ad? rDu6$GPTh:[LL"`/׭yx>,{v%&sۉdHv T&ٱWf]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb"!F%vv,詥X _޵ ܞ9s'a(^Asƹ#Av vܤd{;5 }Y 좡5cfWcc<(wwWb{$Ʊ%ZԚӶ;ǧ::x+v?v.s^v=[+&+)v)͘P'i]] _~ʁva S7ivW;C)\mƳzpNFs;w'8)m\^n;i]}`*[=)شTf ץ.)Z Uv= ;QS@}v;ҵR\Uqw!<cPFU5a%R&8ACUb+RTSmyc]AX)]Xr:\Uejoد#tc>0%t ޸R튻j8'Jwexv:KvL75g-ȍs?~skQzOSF65.1pgk n cӰlVaF6r4Orɴ#11 `w®QJ5>c!NrFbRc>ڐ$?":b쨥?+%7"A_R)ػvm8toP~棅4pH)tmq\k ʛvʧe\hA5_|(WatU, KEVKСBSBk99|(pKuem vrcn]9D3\ (xý?U+5pkQ1{. c4[neӱ +㔹ъR6Aʆ~5Ӧ[IO"[q\gz;I4PNWZ v!S4!vKZ[FYO-Qnlóuw}v٣PrYŠw.,/DT-zr3n@`?'vi>Ap&%!il#v5t[!‘VbG)'rlvH57=:C+c2fWD9z oo$ϥN1)m/xD95F, OJJ<+KypHq]\4m]V堢o hEw?K3w'}hvfIa]®Ƙ)@kB~m]zoB)‡eڻ3b*DPTUU~ث+S? yPASЊWenhA"®qB:uA^?نl*v?ϾƃZSml)zT8vPpʬT9Rvf!ZWsb좧N?#2JE:}>;3%+x1L;!ࣥ{WeBcL|Ƽъ,G_]vǩ 6~bߨi\MsǷݚ{9Hh+!mE1_~ rm34[ 8!IyƟ͝*b ?Yhb"\0짌u'm.I_;R#M"S5|Wc7~*åwV ona~GPwmŜmWa!RZQdSF_!Kf,#,g̗\ti,xOv6yx>~? īܞ/dCG?.4<"}PsBïz~KN1lm]H?B{LIHý"h9P|ƙA4`5 <\rol.6)Xs}L"Q RdUc6\+k[n&V,67e?vR nVw0繐v.eI]Nx }>֝-TE;.Ry ʖ:uD)qCRmp5d?V}$I=~bJїO PdvOKy.3b;L82gv/4fC^ihJ\ d;7zqYثy.қ[0~v]d>?~ledSvSCyg]?("R'/kqC>B!n4V5K3 ˳2\.G{4̟ptzGem"!GTZC1k`o3$u6#, ]͚3vG.fBK ۭؔv=|*KM@v1;ֽ)ӧL W*W5IJ<;ڍEbiQFHI]UHqJ(b0GQO 6Bhn4 +^[Wl$Z]I þ]I@֤-i @We n+r;mWKȘ؅}bX iwf?L,xG]xeb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث銻YhBSO.T 3}DE{cgݑX zafCzUŞzU{m5r³ܪ Cڣ~]:a6pL| q[1ey%ˆ.$FgEsXvAݹs:̇vƐBNQ,ӗ3/L\̾nҊ 2jf1>|w!X(\mWM*iAQ")W-P={^&Λ =ز7s'nۜDs,;تRh%vr'W]?o.р*wG 5QlhA[@K 5e%v7bO:>A-@Iv@v(<^2I6YFزId'\T|X~/&'SORمO^ ˖V18}J9(߭n9YƤ;k@oJuqM\/!ޤWrdrW\yZ=kٿ欗(`e\` /t9mA1 Wm01o2xW`x<ʠRAs2"Z oGJpiԎ}<>?IbS}%/~8+N.Oե0=)Ces8dC|<: &k HI$Tv?d9*hɊ9IsGb7V+yT4Gb~ JPۃː"d5%Oz8Dn>zbk/Ke;(ʹ9F?Y 0QSΏeIc݆RvАgk{<~D(3on强}9̄+ņVqϸy5UJJn`"iD5 a.N6\v w'+TԚ+-$vPT{@Ę\1&Ԧ$F>_A5u]|}jþ9mA"cME wwpk@2Iz`Wu`:ǔDHR5usK[ ًz5ZC]CS1uؑO֙;bI#?&` ߥ2Fwĕva֤MCxԐ}U Z1 H߿Rjs㒴;;]OZ8匿C]7Jh]vRhAFUaZ}8-]%TʿE@12>jRoצE.)QǸPaB@ :v;5y5F]MƱ ]5= WfVOcSC].Rwؚ*O +O|Ȟ*w @ޝO^]̀RH8һ2i]!iZSO{dق6${`;1jB*O`,t'wbƸUs÷ú2MCLIWc+ntvW+lUٶ? ]cPzw W㊻6M7,6 qWe7Up+l++*qR Udm]C|odo~ؠ@O#iv ԍodY`;oqrRVllmqWf*O(j{»(CMzt>%v:]-RdUXv̝4rDN?{YPqݕ6*ثb*iSBܙ(S9 ^sњ&a+ʂP'V~ U^Vy)ʢd.!9oSe~7(A~<13P}Zw @Ƽrc`I *} V~lr h(E6ϮDΙ;UeR|ťv!.u(:nLdiصԶWav 'Qx' BI"C[ x5R~ۖq- ##I-nZ m~,3Ds|.nvQփj9!1o sII֙W"t#z(]'(|Ϋ洺E{YRdU5?&M48zNZ)EpW`cD)ߥs @oI󵜣ACr~tGdYv4ˡ.r%p)Q@wㅷ:ƇgN#oG͕Eu$OfQͅG!3P')u1M^L{299{ȤسBOG,IX_UX8qk[I ' ˣF_~FGcP<ܱoU3\~s\)okJzr$QOO͏]c=J9=KVyGq, =jw 1W0p~_Di[p{O&FHc*SjE.cY< 8yN֗E/"dڿSQ(?4M:n49qo#0&ۮ6 (AC v49R64bf;0+#a`ju+Tl*{]Y=6q,oS Weo]s0sC+g KSZSiJgN=TCu,csOvΛj#9`\vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb]RڇfS43Zq?7ZGvAsh-O~f9 C&:8(ug6IV$e1I:q;C9v:\zza{#< {PCZg]~LT3ےO6Oid/Y;5\z8ړ5(iɨ__ z²{d,_'Wz-hAL#G䣴y|.?'4yѻ|J\=1GljsvI( ^Q}2jGrڿeۋ|_ʟeusʑ`*ov?X*Gu5ot {X7u_ŨO򴻢SOɋQˆ)F?*`iBX2Lt{Xu!/FŸv)uNT;CX; <ۊg5dك>Ӝprv*'dObaEQ_v|zϙ.h㲀mF=0 WcZZWc“NUU 4i㍫* ޴ ZXv4Jۧ\m\q^iF9)\a m$URG^dZ݇Lw*I;g\f1}bXf#NW%i H؃^c4A 5!@OO_ϖ_6LIK+p\nN,jߐhX6YVWM@>Nv>pJwk;WHۄ? 𙛏]}xsY]gF\\Klѣv*>js:2op0Xb͊6*ثb͊6*ثb͊6*ثTXK_ZtDz:E$tn4 6 M&Y`*P? *, DPu!iv$ ޙ.$;281v6 r6 |;duPu&g~C$& O 8P|v(YM :~ybE]?kVbٷ]8jqJmzH0+e5z{ 44&qK܅iֽ2<ت5Abd Ktტmt2%.$zl v]S>b-ۥqWb ǩ R2v{kvH!؋9NxjRASjK8{+_v!ٜnWc@IJ;Ǫ+S0ڻ6u!Ju׭0%؄mZ.dK*|EF\-P9F<p(.tvhd g=էYhvGov}̈́ d~u-^?6صP *2 oA㕖Neʛ}N)v%袯&ZnI-,{Wӡ _S>Ȏǫ9a=ߙ?I$ߪ/j? v8J_]ЅϦC Iّ../#s`z`58rWqAE;>||!.Ew\3u؊4uQŔW@‡$XW\ei*Orm&IS 4Of?kޞQb)GgR 5Tƿv[$¾FCw\?Kh:~ Ǡ;~,DiSf&VN%ԡ1gc*E.eפ{lNDu2@t^8Gs'5N$g05 ?R~/~JːǓ?(βE ۉ?Z' 9l79H! ءzs4_$c&NqZGпNGiupՓ@h;E-]W7?(bUXxT֟J8/E ԅ+ђKH7*թX .6X"FWC$H<."iJ-;mC2VV."Xp;XY {P<1Z-&SsR{ ssjQުƢ䝎S=CNde74Z JX˘Hi9(j Rcjےj) v$Hyl{TC":/| d?H+(W(v77޿Zv[iBM~tpZӱXl'OmJi9Tr ٍOA^ث2lm.Ǝ  =G]d'aА6VC鰥v ,FJA഻/ (qWc hh;,R<OKq,(hvYRIvXZHS1v3MWbNȫ'R(SHv1~1Uڧ$vWcҝvmyv] ኻ/Pz>8WcA +ے ?SѪ*vt*T덫ǯ}$q ݫJ»T{톕ٚ2{}1|ٽ56̴'pGӷR~ fvYC*N)S:ӏ_-M:t1.yS_Wc:+v,{;6`ᠠo̙;Ơxv Zl}YZ @8(ƕQ*WeQCSmQ4掄0"J K7y-FXK?v!Wf]1Wd~E[DMaM>iS6].Ex_O];/,[Yv̧đZu/%.rwX?Ds|KW5|jv[i$: f#ҎD;eG/KVM)BNQ>Hb聨?J*l ~8ՒfH[=8LƵ5K\r}DZIc_CY6RbKb]]OՐOKN俸h{~B̉" 4*r5ZM> T;Ee } p=[&rv79":AvTK c?[$%Lkn-- kd%IF]|,1o ^n>O)n%E *rb` ;4%4Uj#"tMp)PDƭ6քE%y"fFAT?'&'!eu`k6IYZb |2'O(qd 2'PV\ǯB?rbeU|0Tld(XqB[>3x'0ɼZccI$:ӷ 5ibSY r3D滩*~Yl[8*_G*Miy}*E* (u2v`tZcd.]srS1'ӛv,RykDb#S|֟KvAߓ\?h.-Ӻ1_|]:ޯ&g/+?'q!=1_`>d@>%*Ay߭YS|K$z?p2vIr㧶BpqJfnƐ16:ש?ocDqDdC>mrQ$:ƌǦWLWWį"\㷆,ai@O W,B$ S -Or8̊0٘¹MpRȎ )|܁?N»a3NnKGrǭ|{C $^Ϳ:zy՗Q&=.;ɝR&HNƥOī8J?v0c nƦ[W`;Ge.rʎO6uH)fHȏ2D!6nLU٩51Wf*]9Oim!4>25|9b9CL~Vd4[I[ᕝN?G0k9:7ٶ#jLav!j:cJ~XkmEIhORu_!?)u9xLhvSmXdOjC;~`&g?]"QQMGA,?vX*Guشt(Ѓڇ#{~?ʲIwb7jƸjϺ?Z)Ϻ.ʚxզx?2wGR?)S:e?vQ2*d/)Ϻ?oS?ns<sfo/O:LR;*Oɭ-zM?gQs.nH{z3YGλ'i青/Țe??q̚ܓ͏}k [*Rz '0\N@zCfd?.qfN6Hwdmmذ. uq[G˩Ӓ*Lޝ*E6Ir)q>9#]t;^ߦS2HAƂZl}P4w*[YoՖۿR1K^2N؊@A 5E+1KqTԃJCP4-T*QSPw1〵_,إs`YEG % IliCQ֔{)K4UO^lq/?.hYG%hHYw(ߑkʟUͦ-\2r?1aGEpFinJV*ثb͊6*ثb͊6*ثbηWoLi?f?r+_`]WڛS tK'bKn?DK_ $~zedAM%Įh5Wbo 7?Ι PLJђWbl;~5j{]!@ڝ{}Jٶ^,]'bw"U>_X1`F*좥I"WcEr]MӹSJmOy`WbVo"|,)M$ %h7=Ū?hv:Y aTYSl@`gO&d@mr{G $`%y7O⹽D";ܘz;&pOQ]"y^N>g;<E2@Gn s$}InXNL!%=@`-e5"Iڧ:{hѕ)u}I_xYp+SV]#%Oʥ|D&SE,Mw+X`k:DpKϥCİ2?}Ej=@|FmRUM ?ay2f4".2& 0kȎZ(%˖]gj$SSLqJHJWoA-*I?AȃQ]ar-W_jHJ<@BDwBiC]Ek.t,Iix[Ƌu^~-;EƝ] m؁W I>=;Wv<0ov$wc@5?$$e\P0W$vr._)laSfz,Ae4PHzwb>%]:|`rO?ONrD-; ]@`xܼ\9,Ktv^ֽM90 1g 'F*9=%dsi{Luu ăʿsc)Dd)AM#v)JSb~mnk{C1ZZv0߷ӆD }®nkWWc Aaq}Weޜ~Gv3N? @V;,5ӊ]BÑܚ:SڀWf@gv\8sk\((wdzbJT)z}A#Ɵ~Y;F7?KdKqߔI7'b+ڴ*ujp@Aaq ;_l+`v2AĮ A6Z Pe5E+q!͋g #8lWf][ȱ>ef8im0(0{W?T8@~h@=6_aVH"}YDJ]}qڕPT?NYKnMԎOQɫ#J/@ =:S+v/ ziH7Hһ u *E;9vTr5*>U=XO;Oo"4 F~6J M]rC`b`M'fqdC_ vH/эo8L%.cJӪ1ROnBϦ#wz"{՘MsZ' <;ryN/hV `;?vcQ?LDLKxW$=WfvnU[]4v`[eN~و5P)JcM;7?6zeaء#w> vng+lv},10R<߮(0l4LQ?_sv]vX];3[y> 3- ~7/[1e.?s!9c׋'c]pFi҅ltz9Cccr{ol'wK:yְ0L%;Z=v8y˼Rm˾,/0CB]ʰOnzhOV(fnْNX/7ĒKhNK۹cJ-ծiT彸R\-6&RWmdZL@= [uF;Zץ{}Mc[&(tLWĎUzBL>W׏̘j":Do?)( {+m%lˇisᓓИRv7ݐW2j?kx#}«+&\$̘:ohvYQUDqWv25Nq)Չf^X5%qv \fSz|R/j[ {GO%:Oj*d~l<>j=}NzvdP2$mSAKpc˱97cO(i=Xb͊6*ثb͊6*ثb͊6*ثb͊6*ثbEHV4 >ni˚8LT>?"J?њĺ?vK)kin"~&Iȯ e{7s úq-دj |_6$-6y-;)@A] BEa RU*t#%a3S]0XKDg4!CSy]%_iw8y+SփoƕJӭ;`v,P+JTZ] bv*(m;bo].T]֠vُ*PbǨهP{_c1F$-]]:~ӸL2j|U%_v2n*7!LIn! Շa.^h7;1QN%@?FE;(vSE$S2ByDxӭ~ǚaE]Ora.c7c r\!&\N)5xة~\dV@+]dʻ-4ۿM~wbzjH&:};`;0qKHE _ӑ2W`;p5?);nCd#Y,72*V;Jv0[v TǦۏY*0;wcb?2•x9."? ??Ruh53.nCwso'?sO? `c!d &v1}X^El*?ಏqrusN%b\qE#5'ϫ z}0?:Ƅu?cl{;imCWb*W eY4f?ItӗC(; X!_R@7j;WG,asq.b.^r*yeF87?;ɵ:>m]oUڔlm]}Ƞ4_lUӱu' l=O >=p%(OcGV0E )v,o{qrWbȕ4Ei9Y` n^#:P*T~`K唒(_oد MH;.I{ЎiĀ$`[> $nF[ yg~#h\rjv+m'") ]S$fR rQV; envMϦZ"f!FvǒE3TW eIv ۯTfb޽ fއuʥ+K_)Ss+1bBXd݋Efd'F"eKn,xhڤ"9a'_yGˉ nVFj_ "1< Hf`6­SW190ȯ|4Sڃ_0߹ӹ?:em_ <ө(.JDA njRǶTxdvO32HL$W\φWWIz^*(m:;Xvޕx 0YN4IV)ox yPvkjypFWb`S$fk%;/ҙ`EL',W`@$ݼr; /e#VLP?bU_ZF%qSbZ=Xqf8d`e;9d?TBٚ_{Yť1/2-!(:;lz(G"7wn&'0@N`£bNMi%/AOz8i.mϹ‡f uG{]Wمl;vv8R@R=]Abc ]}:aWeZttһ vj};3J>}v5Ia2a;$w!)1ѣ49MG* Zu#8 Ae]z?~N$ǖгv V68)1m>EqXxzdsx\G>i4t 8+U;nFoW-8YcޘZm_qRA~H۰,zSX ꧾLm1yzG Y[h>@Ts;49wjW݆S.Rp+efv2; t߸#ljQC G"|C;*#Eê,C_^8VQBJۜeO\NJ9k͒ .KY`CcK5rˆĵ42zaVV"V"k!?h6[9]Z.NQvs>A3{>Аv~Vc[vbڿCYTt ӳ`}cjN$7#Jm܌HnإaPxw؝ٹ ~_K zfZ]J,u lƝ_0 )_f;⧍@%ZW;WeN+O}XPgA˰Wc:,UM6>; U٪h6'nH6ۯ_ㄥىQ1\ WqSvWP^;MW] t؊?C:($JAKɡҵvSG4;Op>)v8kCBv[:b 3Jm%˿LU Q|w$|$J~?\WbkH+d}S*zywg`?\*V0dQCzxU*ݒCCӡOaC;<9WfwÞ?9o-͊,bΑv-CO Dҫ_?WWԉ@}P &njKstv$G2epVVqd[ 🱬vRPǗdzr']r|?❀ذQY,{rGeL\s$ s/zZ"ۗ]+q,cXIJHC7SvZKQEM̈hqCGޯN:}g9Gh&y)=d,J*(?fY.2EkBʸ-_} ۱ޑp@(W"dhW7;ւ;\p \ ezHh؞;MkQMOKn囀iP6۫h9 ',%Ez%]]p Cŷ aCPA@N*C@ zB9W<+JbZd,-NcGSӿL i^`ShIc}*I7 p{m ZR폊Ve|>y!5({(Cm4|;mou%pBvy&V厔#4VGq֛Wqc߯r+k lE~ኴj2ܚԝ\2?hY9:N-ƍkdR\t; 2z[,$xtBGnڟN(&k+}\A Z7s*Rjzmc~_ޝFM}%Y}k]zl*@?qZfA2cqޗmRf#),# *zc^jJv"}Lwr;U >>rOE>?JK_靮Д6++w8ǘ|{\5eH? ՇF3}4r bV *0b͊6*ثb͊6*ثb͊i7WǍ/)?Ȥs}DEy#:$/8M(?ڱ@qJ_OWQ#g :}3AN6P®GOcsO4}F]}\G%II=Sv v8W5I_7G"d`Չ>9Y+f0==.op6\`u`pf"r+#W`LhĚ1'Sn[[bݷ=p q;J++n8Z(b%$N[v_0-#G#6e^ƤtR}ƓncFvQ=cJHI ^G| lWoaW-bA',#!ꆸޘE[O%lxVbn1S1SJ0_`Bc_ Q0(+VN;>,WzXr#$۔Gkh4;Jh6`SIt86Z^Hj8oN$9!%ڽVr(z xAۨ=q/u>m+eTlWߧ\!-bc?[qN_ %JC~N۟>) ;~nmYQ]  S|-I TѪ7F+wn8lHĭ_Ӟ_ykY pEK{a:m6_;O[L˺ԭfcnG!ٔyWf]vlUٱWf]vI?/H}'ޛ6bY_B־&&܏G<5piߒ"W -|,^P͕FG/Se>`42Eڕ;aӐW,zaj(:3A~nkxBWPSG߾\|w-xdm'޻ƒ \LjWZG.J'.ę& NJrt߶ fquv'"=.e V>~EjiP B5;?>ى-@h R족; WeR:,]*(k`Wc م!ބ!.R#ğضŸ;b)]z튻+eOJN*ƒN;(RMFTuú3EƧ~:Xv4Wl6l]Ri=^QҞw$kVw銻7#_ SMqv5WZa N(>E;Kf>F-ۭGߑxȒ`Tr4*Kh5*U}?ȔDE.ţ㊻Ud\q˰Zxڽ|sWj-W_: JjB)bހ䱂Hvx.$ǖzck!Wf]vX4]U- [Ai1~9wcMo#Du6C.Ǧz*%O'`91yF_Kzy/Vr[ghr:~C/~b=FLT?/ՇP.WCd7e0.ERH~ kb:Iv^N.$ X=Ibr#__%OoJ aOWPܰ)!kis6RORpIǦ#tQנ?\F ox[*\"݁n(+~< v-?dY;8B=i]$]JpgjP)vj 銻 moLP'mbecj#C;+FvaqKw,;WCN?@c,-w~P<;WcTbQNz*N])J׉We]Y Ne*:T ^p:ƛl>)u3sf_Q6vX]?#i*4Wrj+m]]1@PTPwpUUހ(hpZ`CDU\J|֔ژU^ٕ5S49{ u4L4o?d8QKM+R)IO>`cM<[mZ T)@CZtšG n({Jl ڃ(65S1*cF;k[9a9%+s.(Y B: pHZ-RbU #`+^R eژ-KC_Ɣ(6o6Ɨ\k%~G^1CM_j%k5:t 7H[cdSzx` HA $dԜTV|oʿ $PA2(v>PtweD bj:mt܁B5X׽:dPe F5&rngnF%]%~ESQoUij`Non&#J^ozHtk߶O`UA_+Lc8qWc0*XثwJa 9T5Wcx|cj](@?i]\_OR)dN97=zamVeڿ=.@WrO0smƠWuzt5mRb_Aژ@e/qu.jO ۘ90Tl<<178j+RiZ_@5ԓ_-O=*ӸQޤTm[&MO +QQSzR0lv#盍j?^%\ r:Po׊R㊑Z|AT-9h0hmw_*sQSAcxP\kU?I̩Z}M|Z~"$| Gzo@ַ, V{q!3qٷScfF7ɩtkKDwu__n-:n{#`Y=^TхͻW7vlUٱWevjb^{g+*ɖ8VLvN joN^꺬{?=riv "ϴypdM* r~MfIszܸSd2]\iGA]@˛ q~Ua\1^ x|CM;m'pSH#`* cհ2-_(2P(3^9]ŽX׷MqlP1v/~n[vn#JTOθB]IROaV N"m=V ğK'4A_Չ(.cCGlı @9*ʊ7=~IqcwZbQmp1X1 w[h6W4ZRrMFIihiEVAlHV)Mlzӯ݁]ʽ;bª~Rb:^6qߍ!JEV ' =FBEVq zW SSNT}؉x>d\U T\>MTImY.1ĥh WxQDU.~ I%BzVMY7HHHVNѺ6)HV@Wo^>4dtU͖/'gΏ,uEuI6܎c4=C?Xb͊6*ثb͊,bWT׭FtվA~tGKNܖٷWhV^Q 3@ Ҍ@9"[ooWciNm߅.ŒzTGA_r)v*%TxlR]Y+q4e`HڟcJR*@,K:߿ !؏xXQAA߷^w MwH7>,,f!+)v<Nۚ׿CIivZxA]P5Pvȫ$pv9QzxL$k{`Wf @Iէ|UةExmE !}vZs9Hڞ8%vf ||F!] i֦||8]i}2&ت:c bʬO|v<N߅x 7ө߹ǐM}nEPwz4;2Pu=ĥFM>8Wf z፫ʂN %٨$׶ƃSzt5®Jg %DLI& ]Zs0@eyKpDE}˟E9szKM\D&MrPvZqo{,%nkN8 S dfQG 5kzsDg@%"?4Jmm2RGKb.|<T%!a.elyHzKvdae) 'mo1l?kM\:ŔJJ;TpLtqz;{ $R:lVCÐN >-בw OjpS)ʩTQN#PHt'Zv/;$6@,{(5$vnN BJsf,m 5A{)~LKPPd@l:W.>%'`$bA-|Cӥ+#LOaژWb #WOYhva+RR-\xRCՈK%Tbݺ dQWl v4]WbmC_lb|Cۮ*OWc|J]ߧ.ZuH};,u=|1KiJmCߠ0A9{m#|m]P)(o].oSA ({{ )v<%:u۽1Wc7dUف'qC P]N(k٘TZcv-ёW`hj: v;=OR+g7ފ,EBMf/7xO/-:~ q\غf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊|[z_N~~'mk|l/G^Re-HzW:f;?꥘G0ɦ0+v*oPiڣZj^4k".'h?$hכ|C3RZCۍ!dr=ϮhMn[oՅVqw~߾XB6aB@liZ eEǿEh¸zmMS+1@Tbą6&T?.Ņ6@}4ИVLH tr:ʚ 2dMvlH T-L^p?#6'8=TQXքֽ@[FK%m^6SZ5! vC\$f]Ӧz=evWrHHٶ)R~[`,U#z~ȶ&1KsB탙ve6jk >$HJg  BAMOnD#Wh+ĊM;u)uqQ트qH׮**85Csh*>#L3'_ U2)o(ESڂEpһEpRn+OaZ8+OZ& k_auq@m*ښffe8d!`7spkdcƔv\Ym q OZE- ֍ rXQvQ]k"ݗz}8J|f5jzcE~ -B+Ef#;+n)϶I69B$?_\V\@=?ϾE-,#m]cI$RSȔ.~%Tfwm*ECS [}i)ԓ~[6n> OIl94;ԟV1xlht4.@w4K82v<|1jYA0m5=^V 7_ qmx/K 21'zҟ 90w$]b)ۜjVǚW92R2Dθ<Cuq Qc_EO )[@V_( i^8B Z$n?_vQZ|0œtm㡸}6z}8i܆4Yx t_m9‡ X_~uT-Gۏ_yKvJZ _??(Qzō?쿤|~*+T=`eb͊6*ثb͊6*aOΗVc3Xu!c^]ܲ׊X_BUH,b͜hv<\cNO!XBE~ %AvG.\%pBߏPNu 7 FH(.V䧹~{ UتPA6|V@Kg:~, v`My9R}We g}-]Pqz׶Lv&JRS.ĸ<2j젠A]Poኻ)r+}snM+Zݰl{(>}vUKSnUdQ]$|8cph*+!ِԅzwī6iv:4;z~ WcI?| v;j v=]WUدB;] }n2ƽӷ.}];|]E=RV5M+C{}Z]`>gjo"#q$aKM"7]!aQ^MH5' YWN3+U^3?U?T''Oĕ;9+ne2zI)9Ő 8CҌ\E@|ɴi;Iߨ ӲjNAeà)6ei_ƒpbvONr/CC ex֛tأwp+1ڔŶ$ wqWc[Wcr# pR]OWc3-^?, v<v] x`Wc04=We s\(vQ.RTr犇e7XbʩJ (vnAKjz`CATj֞ث iנ U;`Kxֵz};v0~FR50)JpӲ ~-]Ƶ+_ UF*kpٸu,]v5PҔ1vR mmߦ$;,HHƿ%ϷCa%ʴԞ`eH`txjceNntԒ@%.#ӽ3 R+$~9/qou"8$Br"Xw;ZYnUA :Lgu׵%`&(:l?71Zy)M] r@tO"<X֛Zr= \Suv~i+GP:OI!= u"\GJt.=}2 v57ӓ_]_1ie'?'sķ!uRm'M?qvWOEA5{ciO.fanbz8?$x2v>-BhdF$VzxN)Gbqtv.ׯؘc VE;4vnڽ!Ɣ2VđMu>-.4 v&-kJt۩k%{+E ֛qm)Tu}+N02+MiWcZM;3'Zl'v])PN=C{CCM+k.;;aWcH?p{B:ovW v&ju.XQ+;a s~تHȕv5W?#]I4$lOUز[r%.DQ߯ϯlKdQMA'ݑ%]Eޔ&`)v.@@V]}=1 v. Q M+D#a†L+U)~K5(<+ZZ* {$w G.ܦo"7An"yC2|^ut\%9̫aoUz4w:}?}.qH``lU|-yWw~k5R4lSr<4z(3[ّNA}y :)-e$3*;2ZK^@j?[0vId`'z Yb~ })v;(=v$2Vc($fǡv9~]Nc8آ.'qfJ*v2|:Ӿ3We5,]'x|mS]ژ٩^;bp+—fqSLm]]CEp%Dj(~ՀoB߆)v`SL qn<c һ U<mڧ"UЧ<* SlUcpkJ@v,M*UvP:Wc٥vF; 1uK9-J=}#OÐ?鿪jp1vrB hFtőNCb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث銻&LWEvgW^\1zcY֌^?ǧPi#ʿg19?SO!B SSFj 2v&҆$-7Iu1E)NGIKbfEO$ùk9VGc:ز5ETm{ds zknPGu\|5h\OK! m9FAp?džوPP{图& Wi#keZTOZ1j7,zF1"=xQᕅXփOp> |?-8J>4ʙ-u48?,4mlOIքNܥ$S{aH\`krH$]w@GP1ݼ<$Cb-EzW|Uà#kaʟc#M:a Z$.J8%hԚՊJbTb|~Yt߆hc~U&ִT>=~9#+m A!O^Jv61`crmp#lze54h޻l+I+}Aw?ye\ k% {fe߾4[pHoJRGUHSeKFZjk#цl+jb[[2Gp Z|M^ysˇG@~((*v_G^C?O,fD_+Cyjӧ3 qӔN?fie"?q{K1ľiB]ߧT F-g*HD*{Dzl2ڦ16P<јr6[DH#PːB7xѮ`$3 n$@BS}k16Z sɅ~goRTjk_%#-[T1tܚݑ ]7?.Ko$ݍҀm\m*v"$[XJUzzSD=Qk5 i\$Sb}}#৾ar|FPM<>$`щH+l ;G+o5X֭6;uHl),.̣rAٿ_w-ѥa8U[\W}yqˈ2❆7rzDG -T;|-JtlׄбF:HHXzHXzwGpp&IlUٱWf]vlUٱWf]BA1Wgm&ZIN%TY8eG)/j-s0;3P-NM04yO#q)X2+$ֻeV[Ty2R++DU!.C*Q+ߧLK2ٍw]kZ+Wb-r: JHVc@E;vV(7@7ǚ#% zཕٸ#i]yvڸUW޽Oׁ]䭵M|Ool4"ژ Wb̵e=`]%sצG]G=W RuiJ^]+H(Oo'uv,Q {YKD"=.Ǫw֝GE0+X*HSZZ$; :V0b(iǯ7+?O*z& v2%]*>jwdNH߀ 6ܮW6l~&Rz~C)b6۰ZE=㙸Mۻv陁؟ޘU؋1MƟ8݊|WȫGo Sn P=GB늻( PAm1,cJz|]l ]zWc5=R0;s׷х.:aWe½*:`WcӯSO]bcT#®']Z4;ث:ti.cDٹU5?l4cCP{S|+]璵vQߠWe!ek1vfZ5?,Uه׿+NQB)mO]U*?S*>x xNv4o(>GS1oab޵A$W޿@ïN,K梃rLM 5Ap$S~OS,w!2L|}# jv!>";ɬK /-5a8bRkihXF0" %93&؈܊׵rJʧıeR);0Z /^f)ׅh{bep욚~iࠝǦ O ڔ#kH&aO |KR)~GV @<Ŵ=6eԡ)/(8Ļ -uAJ<1<mHeP2N_jmKDG"ټsbDNf,H#RGcԻ_5wWp~P˳G{1CB=ȒX#~\8Rv[yOx8Mniif -$-݂)KMS* k:ia5* 픴eP뀚ٍ;-yt=`Sr5A~Xڻ3+q }/ 7ҞD;)ӱ_!y;v/<@Ҕ9xxLv1|ŧYi^MGM>WݑΛנr. mgn1=,",e [!7iieV]L;t5޴wM;68- v$.cg13/:TaZxi!2^w. muaD[(\ 4to-:,ߕ]\JzL Dr4:keug.OlyJ]@2k'>, լ:~Gߙ `y7YvvۘΙůx10'M"o/yfSp$PĤ*y9?w9Caɱ~}bPjxA6ec";D9xG @V;%IB Ի۬*SqtÏ2VWnOmh〉*)Wd90\$(ic3ggγ.?KJy-j/d@ٲꃉvk=۷0îO)y-ŔN*k@j2 澹tg/*7q)،RҠxy2;ǧS퐦V ?)Ydvk;)۠2vr)P Zv*(:"NR|U[M*Bijn`f}WfV]|%d;/vQWv4y5J`KWe j}إBpk`Weu+TbeA\*:cR*:Axuœ?;0'{W^&1Kv}-]Sv=I}oN,6jWeZRʕ>;W֞;;,R)ؠXYe;!'sӨ5۫:^ K[~?:-^8"~|un͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*rmΡ?2oaR __˜/ӏ:f0M1)A4Гn#q=X84|:x;+Xz{9HJ'*N*R xoAM2\ǔc1;tP<ʄ7mRūSԓ AF'aoL"-)O`%F?t@_R@Xԟs*K4+@?xFR;ZȓwCZnjk&@UƂz.÷ u7frMX|B[ wgvW]%n P:8)Ơ܌ֳ=sgXv"y[(+u;{Ӊ,"0CuPqE>)M?lYf94mIv[:cKwƝ Gw5{6S1F=ңRhwSAf^#kOx)b)Tbre6p,T{W0;nK=f){a*$ M@:6unGUāZ1aN !Lq i]ܸ8'? U=oh()n+P6߾2HӶDڵ1;}4]k(5j? IA)O*79J*+߿фq;b0?~0Z ?,dLzS )?[#.p1 6,(aU2jF1׏N!\-|UČk|u-aA>1*} F~*7>?u)צ5U]i`Vb6s-Q'EX՘PzJWz?50IuwhHM(om^D / q`|>ylE!q&eB Ա1K_!W,~=O 'x<1Foct%x2p@>w6PCԃ߾Hd+a_smY[=!o)=BI5#M#,1KlO@*|,{Hۨw-PGZl#5݅vqt>]7j$`+ZPS Q5w:d>hMsqO=~{[Rƀ|2|Br6dm6>=VݩS~xQVkꂇ 8wUj>x)HԳ! FM8>EC@~bąZdǥ*{f߾*АCҵюJƐr ;}>l}㛍㊮2ljMFz*n'5+1JjoNmg[7]S5RH6&jI؝u_w:xK`\{s깗KvZ-W-}IdojeRGM&T),J)!k!1" D|vأ>WM,d̒ y€|+_v4#2tWJ7-4nv njwRq~!i,~^\کTngjo^gpM2%l$z]*LeO wcSr ʔhidom_?֏NX?֋5C7?`U?+grsb͊6*ثb͊6*챊=e5m֯qW<==2`}VU¾qٖԃC;\L6p{ڽv6j--B~CˆD ^Չ"@o=jz,OZO%v_ҵP%/഻) m*K%w'2VB']a]Pv>@! V44m]Z`Rk^!Rw۶A]PM+PBE]_@czwKhǍSo@MAnۅ5#jYP#z Nv[G4s÷7+]\&mN9XK@!6:Uu>X).>#McIv<j*(Ȥ;aƠێ5Wg/M׫H"+:}4+L(;Q-cR_oG!RvSݶ3S2גؚWL6ep^m]piKnhBhMiؗvfGwb@攦GD@ v=H"WcA{ )vWB:m;ƴ8ف}\ n˨>Ut5#Kn˯݊3PTxإǩwƕؠ`E]zqCKZvUE7v`+7 ,ou#o c?&> G` {^OcIƵ3P'ibi!vB5N[L+WP"x6{q,.5fNͮŅm=|C'A>[xnĞUPvEv2I ̊ЧARa[upFo-߾PMoًeP&vF"SNQrKLi#GɡWgv4nr8@kK"t aج_U"Oߑ'c qP);Mzx cg ;%n=pS'`reQ_sێ9-;O *|md~q1^38[i 4 6'1e L0&Q+LŎaNFs`ߐWe9> a hU&ق҂]{`ZvPbMO늻5Iރ\*m1KvX#]ZbҔ(0وP—e7ͽ)ӊ2+)v9Wݷvj{xw®oA\ k@^v-G^1KN+׾)vX5WcRvp+*v ۱ S/4ۦ(v`65+ua]B`;KžWثq"5lyQaC@KT;| V(.BoQ\yzc2Z&zt3;G>[{C?z:vV*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊TDDYA .˘W{؈7_?͜Ƴ\r ݼ֯ZrzcvtM+:e<:$<֚:+f[RN>=۩4sqc?уc]H=ze4q7Aqc 67N~ cdCI 8mj@J Bwkp#͸쮧Ji'nPx&BYGtȣ0W`H>DenE( L:pR]l-EH$ݑLQLN>6=iڽ!Q wߎ&A-S*N$6In/Ѯש[uF[@~#U`Gl4Yȏc@w1EXCZ,*0뎌;'-a^֞n2rXֵ$+UlP+=k| j[e4D^.@݊BN:;U`lƔۯLh `G\m"ML(8V̏${+A*og P^j)VāɦXw}aLoI#aB=Q>=eبˎ1x,:y.|7"a!lݷ_ v9TD2Xo׿XAU2Y W҇?FXOF?@⧿(m7WW>w)LPqF>W6V8$g;17C\ oPZC/݄kI8#I7+FAV{wтqZߵ~gW//؎Q8J [8frJ6C]rRdڧ=I*dA\[!钤)4urv~MX w=IU+g\8xmin}jrjM?$R@\ǵ2xoSd \#g xƻ;\kJ}>,a;cE o|e~V;d O8^& ^'*t^&ez@ :1Z+F4NH.敦$p')SJ]:c$]+A4ˍ$mVBnq(w;|emV,{KZ.?4֙M;E<6"K761em8܏ᆕZm 7}[-nE7Iw9Oe؀TxwSn2)jmdDlŁlU%7R@x ABjR{V[oq5dAՁƆmr05?GA&? =N2s&>I&-JJaS۹ l)-$R v@+*Lܪփ5kUvw:IJQCzQrʡ5®.!zO6mb#‡:vŷf+]P1Vfj.*H5En- \$];g'9J `>ʘNb-vO+ő#V$A:D iZ1_xCaefA8!vbZ{f= xj[QvmǢosOV.Lj*;M aZ8jP\qB(L jiwUA݊HxTSn4rqʴ uƖbs r74nb>RI5ㄯ Ӧ5kѓ-#Qhku¼KLݶ2v@R81a_xQ^>@Ei\iZƖ֘i@Nح4=rB;o|O[l{mۯl-խ7S”FCPsqOO^#z9^AZo׾Ca?NRj~Fn#P)_m>n〄;kdQއ\e7'Pѿ)/L*Wg~{n> 0D C[ؐ5|yaGtx]QPбZ2q2ql fv'TI-Gۣwsȇ:gz]vlUٱWf]vlUgMoPMf׭Wo)V}Fag=om)(|#Q,DػGAB+rK&j},؄ wU ^jx4Y`W`kVU lε[R]6j{TfLf(;\Hve$5k]Bv^|عZ eH` +"zНIęAUOɫ>u;mav)@`WcQhE:6XUKR7>ԯLJ.^Fi:ثE>@٣r*U$o=z{ƣ"QQ R We A QLłZ ?B铱]nWeV`v=CRWB/aPlRdQ}Ii?(4 vqW72Ipd9Lp?8ҽnЧaZMƭ9<ðz}q݁*.=<2vǤ*wtK*v+6vi" :W!Ъ`k$;1%jFHBРoX$G,lh*?YM7ڣd 'ePSbenثV^)˩u* v89i{vY6.ʯZ1Sv^_;(zPO]4?cvtvQzbN(vYj&a￾vXZ Vvbj|1vn*mWcHȫT4jmPv@=tMJn v8فF]T vb*(7_|Uٓ$wPjv4—fSM%zש9=v}=WblzuCWΣ ņtqE;dBalɋ`q=RyޝN` rR+\C~hva-1epރ|6f);Ezxxc26uj]WeRZWc_~B2^L!wRӱ'^ Ƃ:Ǧv=OJl0;ƄWfM۾Zv=ւXӲ^TpHGLZv47&.cL0v4֕ wŠ.נš.TB7 b,)!|+DVآܖ?j2=̝T]Ͼ ]Mzoӱ":цhR:X(}pت]:Hv,n}Qņե24'b$rKnĘZazT0vli6w8һ(6x1K@ S~؟ZS ,f)vb7]TZӱP<"D8chiJmav)ēdY;hj7?!&A|",~jMd|u?FjsD6ZLpzҵWWc2q K)ǩ. ^Fvjm]z~ 6)vYo?ہ.N?F*vbhr;WeVvY]rH'銻/vWe1xS® 6] ഻- v®)(vQ,}}Rv]߷]A] u0cß7+S ?z.Apk>oRRYie4^1oNI1[U>?Ν1.[? {@+]q0R=6ᵧSEدn KAՉ t-ā(ZPvr",mYhMiBϦ:{a-&7 .{ijm֚}վRx U(rOP~U/~ǷIcQU'oE;SmrZ٣Z_ (s~Yeъ+MB=CzSpxvKTwЊq4QPKpB~m|gb0>^@U}RC-\ykŨ9C߾nm{pA2q%4y;+X^U*(:;㩵;W#J̬q瘁Nb9SMA>FDT`rq|F!QS0)CM邉A풤%J)+/:""Y:l+Ĕ|% vxŸ銵#pcZɡ !R)P)sMχRjhRK:sS)eU-ÇQSU/>kw5a(ѠaГvxiKv)ʧOokiQT;`wR;gáI<+#<>hޘ{f>%ƻW+k>5U=p_zӦH5\2@!rnOKSry|[१b5w' +}3( y :ثMҘ(;䕦4ǻTE~W*(%68R7﷎e=lR2T Zr=.v@H-\udA)(AZuMrEHY=qr1X*6 V׶%"+EIemӶ5eX]WMT{w›quQ6# { b ؑ~$ɵlPI}RW\h=y@I24AuԨR:B[OO&H>=_lbk4\KkOk)& ot/>)Vcwr ,M$7e4{1Xy9}z*$ M)O ~CV$17l.׭>uMN.]0!R"J:B(4_wWUMOWy(\ 2-;C%lYIGO76q;uUhXSSҵFLl\5Nm)X@a]aK O=qWc#Nʻ|U4j ieؑj=OU1eB@$҆ moB(\4Y^5HƖݍ v6 '3t 6Ԛ׿QCLoBw'ǷKR]R\`֝}b#Xn'::hqZⅩxaJ 3Iȟr>RЎ|7VS~}Rvpժ@Ei]J>25Szn>G#IƵZΕqik-B~{Hbži4&I>40'~8ܩ~ǥ*)Ooc]^ mھ#+u )$q` yBFJ W& 8xR1du&= YUc&A}m"h:o MİlL}=y)eJV%=B=p `+,Cm2P9q6FU܃_ 8}UO_,t[Y͔j'O'}mB"p9(*iʝ>Q](iPFJ-Ph?KzGZЖeڻT׶8R1tcm2crZ$W 0ߥx:yVSH⑹rXIa܇OWf];:k_^]vlUٱWf]vlU? d6|@ANiDƒ hw= W` KdD]Jjn(>Xb>.q<u$)v.wlZu6W`g;vAƲr5<~u(v=܁vU+6no~Jg˜y+Ji1WbU d~ $>v!]*𯀧o8UؠM#iv>5-FUآ.Đ? v-d 24JWQ\m.Dž 7AZv U ĿMO_+;rdq@O$;iv*=Bb/ +8=8WbВBW`E?ι &KpU^EwtŐޠ]@2vym̫1Bq$8DyG'nA4֧o3˻AjEEO|mvK7Vd\r?J写nUtص:NE}Z(v1ϟE=d*Ri'>B!F-hR;o&|(Ppj(I;)I]uy|V|;}#UMw#n<1WfaZ㊻5H޴GΘr*v97RWf}θq*qz>'JRi\U{oWcKToNUmGߊ,9`WcगbGABJ;z.cO$;6ՠw*p4.<;oL0]hzw]()J*x5| s J{Q؛j7 ]Q\J%\W`qvsŅ;i?ՔObZ Pt?O\.ƩNa*q{`WcCuOӲ]Ot]AJՅ.Ǐ۷jWcKqw?ऻ.kߡ֔E{aCяS׿06Fؙ_+3Z6JԮ۶(v(RWcvfRA#Jj|@`SLv5;AWb,INOOR\;(ߩ,;,'aep 6~8miE 'ď።5m]}ibLA_q!.ŌiJ8?\읈{L%kN P+$;G<4pZ~,Pa]S(R—bmZ 74c鍭;lUٔq5=.Ztv;w=6qvPZkNp m)hZr{(oVY;4|G+Г튻~jRViS,s䋐_e{q˒jc34uMB=䈕z/Y^' O)n xSg0on钦`m `Hv8T*vjZ.ZoevYTwqWcXSM1Cw*j6bR}@&+A]Ek_ U݅MkL*qZveۮ;zxK۷L ;m5~{bP 75®;S*܁,%kۦMN? QKXw_!ih?v^wE-;m?$|{eւU__ }0b@ڞ=CDuǀ)ㄅSvS@;.;: v>Rb~o#s+h1{u4`+h;oPmxqֹtV,*k )611[md#lRsZcZZlAZm )D1HJx [/PPL^;Sl!֞iv[621-4t2J4]8Mma0Ӭiv)<ڞM0JnvIV\ O*^?USZف6kǯb4\`o~8q]oኸfD,30+L`>Y!E S䩍W |G k- _JSYkJ ۦ_]Hw@G_㉚/Nƙ/ȔbWr+,+q-Qg6GFO Zږ5Ӧ"nr93uG`@N$iLMx lGN7?s1-qz u?wDa}#K+ldJ C#ZaŐl(i^$)DVzRN*W+/ d8J\R?ًR*:c)>^5$T"bEu$WPQ^1޳l*w4^-?mTv( %W1޿-5bi?]w=){0Hv@̶PS7 'Gʙb>;cž6 h׿ gƸ\SJJzP,׉@EpUۧ%Ej0t'm|ٷ(T>noPZK0*9'p(>'̈́ĄYT|3.d5q⍽ʘ3Zwrr=K5==5+}ס亪A(JN{7nɃHS--A;Tnłe!R; %F=wF 4Vz~_q5_j؂Ȫ">?|7X4-Be;iٕz^|HU%i۸Ȑb(M|;Yv#4@w8vSHub 1)CZlU\zSPQI5ۧJYG|^?xbتիTTw+=qWeJͿ^`*rWWbX({x ]sQ,~'&Tr'iز/ǭ{r9m]G v~g v X{ZrSNPN{WZv5ոڝv] -޽p%ؠQMǀdJR((iO/!Iv;S4R%ݑ,xYGoin 9f!s':c{v@X: 7z;ل*Zi@EzǖeA]8ӵweڻx3cJ߰pRI'k&JI k^߆HcCSs*e ] /jzȫC]{ﷶE-zPEE70R]om/Ji{~SLCSc(vP#~%.H_U@jEi.ǩ]_鑤;Sv=C")`ov.H!zҿr)vP$ءٹG;cJ uqWe!܁ㄨv(CޛRۥ~_OLP!io`Rr@݀;ߡ=E.;\BI>;]4*^W21\).Hj偋Sl$!تt]O"R>߫*?ۅ]b1C.‡jwV)]5+MdPm+Wc7?l@ve,J]NǦF٘8Sv"¤iO&jz,(v>&.}+ïdHKp+톕zS˽M7]oL(vWaWc@mvSPb{WciS´pC،첡{bF*wZTvڸcj£q߶JPE|Dآڧ dhjE;m(<ewbjP ٚGNݰZiKS㍭;-TTUEA;֝ƛ ڻ2zjL^,w?x.(vj RY TJ] 'zodUL8(v7(;xRr$;$~Yn1r lFtmBo S_?k5rSJ17.խx#?FtpuO4F"%bAمjF*xUفa..lqWe  *zء`cKSC )w®5UF쮂Oa ߡ*S L H?(vX`Wf>`̟ RQR~TȄ;5GJ7œz`Wc]'t;|TF*G®ͱ=c1N޾v(v?z E]B6=E*GӁ]  }7~XCV/xꁹ$g)󈦩0_I<~r6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*챊:凐VZNw ]?{ U~ -IC'~m(Bw#Lx[yQ#aǍ.*o 7(z႘2詮¾ck|,x> O}2¨{o 8(N•JZ|"ڝͰPOlIڄz'uFIq 4pc1CDD OWJR2q}JTT 6ω1^F$,ȧJfIZS.$(<=CEDžVb z1BP=|2k=pک)i;t?9t,f4ߧ'(:7Ǧm7 H*6'\a$IW1P )C%T^W7l5Km ^i'(T=A®jZTb6Zx횃Ll@5߯'mn$ P>׉@SVYhAJы%@MToӾ) =L&Ǹ?,l%C_iRcp'lh1[j v?p0[uU-G݊;n?b(66h* 9|[EEhG\Q=B}^ Z,z!g$ʿNX`Uu#]MCO v1k(kgԮw0|74r UORyHK ;'jY m b>Zނ(EL~o ۫d *z%6Skn9c`+Mӯu]\nkM-U7'Z&s_ n0կLZny+GLʆF^CJH>rqڧ,wƖV:bƚ"$DP}CS|1X)X'(q`15u1Cf1SO_lUOlVSZa$6T49 Y-`\R9*)܎c"|1XjxCByzS!LW#xoH5= o#ni$As=ZJw=engHjGOu7*7 \Ptm-㡥2J %܍ߌ)]EsT6Ґfɹ(ȎHS4tP{{7!2e-ktӏO2lid-ZB@PYv#"yn:ҹTPm^P:֘H,vfJɐ)'݇aU3\ J \N??㊻ >[%[44^`j p+߾YK)2\ེߏŧn+MxЁ(y;l }džJlu?-4Î*7XxF2(+pc4񟅃/rb}5N6ǛJ#͓#7R)MkM_|<7Ɂ &9bZzS}k`1d]y.i, t^v_Pnkbܯ`!*Xӥ|q"-S%S"li tJ^=z]ĵۿJhx|9¿*rP~tYZ2+x`Y i*kZ\ * V@e'%lu*j ]mrXx+D폌V:`ՕnV]P6A6䗧(iZi?Ï $ZUWM |_{1PP6Zbmu=?ߒ:a jW.#CVy0cL<{ VdUklgW{Rcv]ݵ-j'#^Cվ&_q,k݇_7O$'ka,$5> 1^ ? =聕6*ثb͊6*~J\RSzk"揶p`#0},e :Mu[+}K+ȀvSkO{告]^BۧݖU+܁鷁ĝҵ]`Y7^- |])cOɅjj7;Cʤ)> h;u:˘xPNbxٜ܁K H”?$f.ūV݌V=w®hO~j)aKSB(ޘ ],6ĥ? ؗ_|L],=:es]˾90٭ G=kBku(ٗ`7]?\b,'l]2)n>}zfrv+( :Pr vY]'}Wcz}ZcS  =w=غI B]"> NE?I]Td>'v=GWfO\UZ|] WEb~U+sb(v[;}1qWet;~UفvӖݫbt'+! @?!(.ͱ$wXeN{S7V;(58 itp'®q҃,t{x`Wc®ěI]Nõr)v(u0+vYie](vir06;:Vt%k;{f iQFs+Yח_#+VE6 v_Jqbe߱;®a]Iׅ]j]j~C7vjm;-#O+(@qKTo늻3n+㊻,Z|ʧծ* E{bvXA-]N]mJwvn ЌU٫N࿵_}*ukkA;v ?(| *vjoӧ~}!پȨp;׭weq]A7vXWb@\ P|4 ZjSCƀb<{]TS(N!SOH1.MtqΛL*uIQb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊/vtO/" D^knhr?io/9j ~j=-rޙ*9v4C:clD䵏lL7R?|9kY9=&#i܂7=ws~mB+6b5Mi׷%,]bSCMd8JZ{6wَƐK\FL1֙Le̲ELrxW UQaf?C*H?[[OJm\XS(P{S[h5 c^V)`&qW|M)knʌ zSۉY]#L!m_P5Sm z-\GJU\SnDŽ+) Nӧ^ ۅ: T??sNM7#?(WJ qbm!ZZȓV""߿iޟe{~QN CL46l_ E5]2"c~RըcM$.dUNʷb};dY,jڞ8 -ww8ZԥP(^FXZtr$!iGY\>V4jq9Wj7nbk~bЎIƘ-6jnc +kyCݻ iA jjEsv$ aSB)>\+mWR,h-5_޴iZ|C1r\ӎKeڔ||p'A`MqM_W1`Ai@(;]o旉?N -+ZVڤ0A)-m^0-4]k>yzPo6nbMЌސaНw&c4 !I=θ).]EI}`j8гأ#=pw_}'I_2 8ڢז(˿)? b ,AF4{u\-w)ƴ"` w_@zM F`;e|z`Un'؊{fZGJ`U%(V3* ND2Z\oc%Ӹ=~ /d/l@?0(ýv=ȚlDY~]%#cNC7ߙ0 gW?JԌ`WKK]mFN\FJFC̋ < PiU#qY(XdK)J >$IF` ZhФW巀xrayz8MC֎683X~YP޶=4'?h[6N]vlUٱWf]vu/4P/ӜoK ;;g*ibjx\4G# *XnrG jSa҇6Exv!-d Ӡ0S'bW0J1KxWfHzcJGn1KZmӏ$;E U?: c>xUGm Rp0sCFB]wE]\(vQ5Wl*p%w)J`e hzu1@+@Ao*OLU;gӄ*+Hv<7fP4a v"E7bfQNU؛7~Mlk.D<~g|;`ITCױ2XFeڰ؝늻JG*c,{  ڿ7v.Ͱ>UcZI? ӯ`;p!R u\!]In4bvl-: e{v2}aWcэ;D]4+JvB]4iOWc`v1GzNBƾ^`w|]qF0qZ`Kn|J.£oo Rk]ٓ'̢,:늻5; $ew8Zv*Nb_ۯݑvBnCu4?=JzZ-k\ X0+qͅ.Eznȫ;Wb`xn+C~I]7;NWcN>xRMc߅]`OJlUد^L]$Hv[t!]—`1mvɘvt?-?( { e sS 3×\U3/=[oڕfz"cznG1WePMٶ]@(vj`{bt86槸44bToRk1K&֧(v<_lk‚{|Kߧ*; iZtVkQz]'|Ua}K&+|.FM;:lvuVm%d~p!nbFaWe@T:TcTW)vYN SA5'pZiNlUزoJ =SWfF?0v;~߶*p3C\ oPFKYvq{yZgNŏ̚Z xi'bXX;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊xok mNo .?/&{khap% g!9/I^jj*+  h0; .GZW|M*uj*~ʸmeb{0%jVzo)[e&n䕮g'm[1Ğ?- Tź}m[ n:{uU|z%({vakȀla.5M0?B<%k{ 1ҝC2s"o]'`IZ^qnxMUYȢq_=:/ |n}3P`|Oj H_OpR6je)Q텒sOnY*1ߧ\qZۯ݊RM;Š<;TUoje*1 ,xsq~uƕ|IoO3xҸiVrmOeZ ;}JPN(vǩ_척iэ҇~w>TFdR1ڧwr3 $)ZTkOשČD""Rv"[vhćzx|\]% Aڥ]OWN`Mf䐨\#fY暅G^¡ o0@1Ȇ{WW,T–<("78 \u *Gʵ‡W.npk-aJt]\rC<:PszlS]܆;^~ * Ua -G݁66¦LiWᘀ6Ӧ)vf` ~^b"R]LUz(j+mhH PZ0lG@*1[Zhk/nt=E|=ߥ)x'e~)ڧ06`CڻeӦ5Λ;JwLxf JָɄH!##; J{ N-CS>9Tc$؁˱,۰Vk=z~70^|? UlƤI4ⴧt)i;UE;S+.ũZTT}8߸놕b7;oT*[X,t>ت$BM~s:KF=a7|åzfк) ?/36WNIvC֫5}ꘕ-9 yS=:rTj5zoJ@Bp/MzP`ic!xtڛW"*W$|E^ !c7eB)?>P, * / %JIiiH2q-cH?LE*N@ŏA@}I4 X)N8}Ϯ J/5?| stRzLI!V&qPh:V[==Aڝjsx"S"W~K5Nd-:P ܃ ̒!J= XQ<oAVrG#i\BJ{hVA =p&TufZz{\DfY6c%kAH^)ҽ;odp-hXJө1PhKPn"JޘJ[^17_5@E7?A LDJ;*JXʱ M2 Q * j*j7+$ Qۅ)^+t+mp*kJm|`Q($v۷^+MG\19'mS6쵃ȟ6%iSr;W0m)Sjx#|=8iU۷Rmr>2rcz?bE>tpL#;nuFeR{?ڌJr#ă9p.Ǹ9} tˍ7o90:~47'Soߎ L&& M?͚Sj,QPw9E9QGP2a-/粻U']Q9NƽvVK'cd؞DD+ ]WAF]P찓ޮlK7Zֵ} ]RܭG9vYVRۮ<'-ܮ:'ޙ KeWb~T9Kj q#Z 49nNoMS-bxJ W!lV n:Xز/?(+j>;%DW+r0H$tۯP^h>8 KfZZ];1߾EvA4uK{ZV^Eo9j;-Fo'wP>S p, @@qwXopJq;]u7Wu{LE5n;N}hhO}Ki@FN8m]Q@0R۱JAu?C",cF㹭?ߦ;1Z1WbHݾ󐴻- RG]LUX-?=%cmw';.i]~cK*w5gژUـ~UٙzWeTSzv*$Ё`Wc{ $;j|UٹliÿOiK;NRl^]Fpv1I 7gB;m['bw_ju+ ¢jO$م(ǂM |]v v®MEiOc6Wcp+֥|7R첽j;WN ^vj*)P+ۦ*UX)Ǹ9q؋(; c >XX2e"kJb\=pѱ"%ا~vmى$vX5)vcwWeЃ=7(;]aǷcZl:nb*|z"Uх]9 1SC9!غ xJ0dc7s£|)vX4;14?)v3^$emъRwFqKG;w®̆&?bU{lUN`Wc}w}HWev bj;?9\0 h7kf# ˏ~%?d c#V@}MB4>to%\Rȥ۩]1Wf+M]$҃®m(_vQxve ubǓq"؍.&v8ӯC3uL 줥wMa*T0+{l+|Uq?*r6o\]*R<1WeSoP챱^ޣaDzm]is :ָUتZv8Tvn$4*[}~=0"=qWcrzv8Nݲ*Q~%Uؠ=MkcWcz|bcH=QR+c#f-?fA\_t?r7.UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb~O$IrW 5xO-yx?Mu@?NjwLUx({W@QP;;l}?̀D!zmAS[ű6`7Lxt49T7B*ORqSZr1V+֝_ˊQ]<ᆕi4Z<^K ̑NJ ?jXljjv̒n\k-RƃV߈`S)KESSCDbOJvH[wcёN/0ߧᄭE7 {㩵:`V_v6B[9R' ހЏQU.Wۧ2hu5#߯\OJmL\XwWsO+ޛSLiZU h[6XON}Q7nY =?۶Jȓǵi܏9JZ,V؞+a; fb@{mc9B^?d,k2eHBUIa5ߡ2TIJҦ-w,f)L^BZ}vU`ӓ]VC1O|@TppuNSIL kצ Wc?aVlQmr7?q5 נkhǪR1BGlk1_qC7snO˯bjvtԦ2Ͽ-վ5w­S`fM:8-"RiKz?1A֔vqO@v4wpXf'oo~ixY -iZnkZuxo$-odu>e'˜-ה}RmPtO6l+k}:|wۏ!)]ֻcž&qSj @Nƃo#* zdi(һm\DnN%mUb|+1i>ڧЁ\QnwwmVJpkcs AMa$, d~U 8_o (b>V)S#v$!n:`wË0BslIҟ6VS*PVA T Z{Sj bwؓOpw|U;E }ȖaR76 q$wڴ2ƒQmb:(?Ͼ=TPВw{Ǡ(kA$qZ z ȋ-2h!Ѷ#8̮m [Nxo_EW Pxܙ=]6JvzEm n`JO0~*ר[$~ٓRr;ޱ'!Ž]Q J&l0T_-ډ@\z{#;K.ahRϿ87o 2 xTRڿqրLy Bر=XWy ʛclǬ .S)ҧacmLݏO"cBO \4R8dSbM66#[SW~pAEcNPTl)4q|P[[\|nUoimo톩Qb>Cǒ\x>=+W(႒*)E 7"p`I9B0F|~Y 4c_׈en$|ĚhT`!8ׁ;jb6d&ˮ03ޥzf ti> ,:u>Z÷lukZ#.JJt W-j{dWo%nk^;WPc#sVv\Z2JR$ J\ox '}~y4_=Ԡ ؎|:ak9T{ c:`$Sl^?M& Q٪vb2H1 nk/ ;E.\vnҟb.niҙ]S`29trV&}7]c~6$~WSrra4rM;[$r@D>f,jiyWMv5$UC)i6eg>P anޤ0x1.6& H=,g!b`f28}>!3=6%يkJO6behvP *Nǿ.I.̩%xEz 69HkƻIK"j)^Uز НwKѐĨ#jȔ;FۓB@sL*~Aڿ*oqIPIWzr]#c=)_W*,ݏBIO44dTaT;`x~"Aԝ_90cR $lGn>9 dzHQ' q4-5kjR]>i0?4b7DQ^?Qs[YO@h{fH.ĤX;WedJ+TwIvň㗀KSmrJ콼 zmO2vSF6]eW]J(<0Z]iJ`{Kڴߠ.Ӯڻ7R +nثG]n,׷b)R(vʦt M6K)o(vX()C_lRQRFFaWcO d?\]mSb)]{'.*:Cl{Jǩኻ*NvU{|(v8nH8u@#cj`K;C"oq:bZWfG\T-쓊COa"c9Wsp4b=^8UٽM0R]Pwvb1݉O]?~MIzko÷V@b+xdb7S]AZWlUj)ۿNֿ, ߾v8SvRqK*}WeMW|PK=;S v97?|!ؽi@FA.9޽Oo Wc)o ̦S UٙGzbLw4߯lkԮ~E.ˮk%].(Uu"qWeBi5o킕٩t u ]GjvX`C)>]j=]ɹɄ;$&݋ Ct?}r]ZRv7]銻-5hv`I ]vO^ԧo ] IʦiWf ˦(v3+Awثb uFhjP2ӣ,òy`A/vqa4DT4\JR؇zgBIФ+eKn|𫲅GMn|>xPmazfbvvjlv]7](ҢU٨lUيTjWe:Wم)A;iԠ߷*ip"5Z𫲖#"`WcNl vW퍡ى۱P{**U_N:C?v=A<|0+| \ ^!niL.ۮ ww;#֟*w ǕJ}4]̻&xaQJ{۳D2b%{vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb:u^jjWT6?/c7cFێ@Kr1=I7/p zE@<;9bZ?d|<1CRozA+m>|1*NnGO Ƈ @W޿|x''$ Sl; %@?Aڟf ®k1i jnM1^Prb<i͎NBH5}e?o+JbmCPzc~G*r6dj bLd8TFG@1OL^2oZwU\->>JG~{,EåkMXҸ,xdB|zCScWu5l$+ۮKh()@i|iW~h4Fx:b7A4)ŽE$8xX,h |1扶J,G`*v0M75?~ZE#ڿ< ǩ0}GcE@`""TӄwoiQ,&pZ;{mk vڝq V5QZ̕4w€r[!YdؗmF"T)\aviS5pQ h *ppTЎ{ |<.ȻbЂOAx\UqhSzp8[o-Mjhzv#HlV#|KZiS') ߿7L,X k܏W6 7rluzՙ Aiî? u1Zh z_t,hqW/l *}ZO)jw*rIq4C"B r4{|#}1#b G1u޸ly8r:;t??,MԦ:S#MJ2.$Rkzȑmq0rIwƛ4}L *>y(I].f&1ByFŸJX%ETlkMf6겻x(~M>$Q5'Z"59ʩF:1/]_v?K+[Xl-<3۳lثb͊6*ثb8~ FAW9hsvv[jn~nB;pG-#烉< '! JF۝.MiրW.d$aOm؉P-.Ǭtڇa]m!F2jh)EآwdJ)+Ei] C#$Xܸƕت7-ڡ>/ȕvZI: VX:9 Kq5]QB:TAW`QH]?-mp7p%tSB7]J+n.=ƔA,ˮW`:W9Y**{Sӊ][5۷rd4>S+%.x$ȑ;mzIv A؏Riv+#w'94bN¦Kv( mGёKA ԚaWeS۽[] ֤&On($~a~*]Y)^Uقjk8-u'"R|߆)v8[KMWmdPA55jWcS76һHڿ̽k{ezwLUWA2Hv86Q, 8PoR(>Tp+Pvzv&XTxuӒ,{Ҟ8թ bmPkL]cB#7aWc wl+OQ|6iO׊]=v!ؑlgjٻٶlRx%L銻)]*xoebAl ƴjE<~xv]HM;,I.?Sǀw~!]6#`v?*첣za˩p%^]0צ~dWኻ :_`WcTWbkA"Uغ72*} ۷cg϶*z0bPP_;®qnӭc}Bf^Lbq=]_Ə9aT79a2 lY{ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbɗF/5݅VZS| ;kd;{F|8Ls rO(y;0ۀغ!GڹnIYu{ N ׮Jԟ4 mVC+ qVӦ5uul K}z`I$w=`7Fp\uwڃLPk+!گኺ+W~=2@E)J>*Vթ54Y]:O+N#Y}M&ǦXu;q!==p}VS_ 6Z8ө қ)]o|z\0o N[5p7,<(NԮPbMkS(NCqDždT qE V:(4"cLUԀQq\ _nq>„V?Jx\(ZnE_lc6YFR7WVcd G)oS1Urnۅ+eR]Vԙ AFQnBm"3iF&~2>bYnACJ9{b tDNm~؄6䍾}r?0۾HJ~B|4W<,}+i ? hJ|b뱯CQVqGndo_a^u_nJ6A?R吚ƕZgaBjI&wxejI;4$m4)L) RbO%5>wP9P8{r!m=uQb[7*h;?:q>lAc.G!AmMlwN]GP1[Eh5Ԃ^)5c+z? a;n)Tnԯ퀡r [mM-Mr>Dx aKLv={bW)WXYpzdT^eM f< I=aRrRP[)rG}7dy@|ʆ_xP%)r?[[@yue'?lqH*A4oȜ8ͷu+e k?$v5vC%C&CJO2/)ؑS op3*:mXRNn|ҟh >yq, d%Pٴ`荶m-k_*~ooqn]*3-S@w%hUvFGj\ր׽ 2@EE7Iꦿw ߲k=6TҘ SSCJ|N0*@MrA T\ 'eS_+mS]ig$X[j?_(E}H1(9\zWRk% = g֢omHsaNH:oC[,'CXJyV ЎcL`^*$6=W-$j>T?F8^SIk׈;%AҴ`,FO0@\]6 ԁ톐.q$m^]jϿoTMxv2QzFz 5;t?,(SU͸%+lnSzw=q4) ZajwCL."tUcQW ը5iw\hI Ɔ4CS#~Ƿ]럋 =FjO@ڟ¸{߾PC&]ޣMǍplx~wnr"RkFK7ߏs4̾I,ScP?:P9t޻NSeB6%vp++i4^#zx ͋fWf]vlUٱWf]q !?w<ƹ;}44Ax]Y~āקWݭe4=p]0nw!9J~h٘v345 ٌ4z؏]>xf0ҵJH* hݽɂcTd BGK‡cPEE hqv*T?~ȝZxNVv^,)]+ImȊ"T`iKP=lfsUoؕvmڼ^Weqyt=z.DzRP*j=p+;Wc5#`Nm]<7ib^-A=C9IdQS6b: f:5V$V! A;znQ+א N ڻkQO2,ܚӮ v1z QHJw#߷Kš5}l{GoTHd0ZӸoEػ!ؑz%ib W& *(c8Ѿ!o$`MbiAZuP{$3mMzhij<+0S*;uqvfQZ]қu$vZz`WcH(=A®Zz RCaو4;b5 yCvbkkNٜN*JR,Uꁰ;CSO40%zQcTc'cQWeҕс.̍MCWb=hE]AZVWc}8@SA퍠eXS%ٚz;We858BRJ˷K}ϹUؠO?/l].:ojaKn(vR>a*QEAzdJ]tȫ2 +>Y:XMv~_ׄ+SQ]PN)`Wc"pv& &;jXِ.+1˦cǛ9; UW~կqd5u=|:ZAҴ8;OS04इezu[u’aGQ.˭>~w*O>N…Hv,q݋+A]-: *|B]WcG;aWcGĻÑ\6DŽaORw?kvX4ژnp+@6޾K^;CT} vZRP'WcLRw׿̤ӽ+bQƘ)])HvQ5.ƊԷn *On *|w9V؃NtȔ;1v4mUٗ4;6*rR ᰭHmULh@ޕ)<l<z]ITa1}8)] 5݅]A*lNK }جJ޽>ya悿>զc2Ǝ@]}͘Ra%9&M Ȇ9O.1T7sp $Wt퓱[PjOp)4Weъ1u8A;w4;( ?6ci]HJWeWJ]8:iƣSېī5ܟE>.˯߁]R`K贯N;)KN 0#]ZW}<{C(m~]1K5z`K-w^b5'r RPy6*zdUT좄uqWc]w~ث5@"?N;OU=]vePmOՊ,m]~XָYPV]9vCѪLPxZm^Ӿv=%z(uq@M;t+꧿~ hh b,MLQlg.Ke@jDI8) 2ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbΉ*@ԧ=Lv??j}ߡG~mMZ|{ݫQ}r*`B*v)Đ {W)jb:6k ^(M6 YikPxAz(z"ztƒDOL6s0q&~Z•|i*Iv+hGL*V2SXc"C7N[%kJf[?CZ}ZP[17?8m^ bѝ<u;Oc(G4UR6ON(=w a܀vn7=xXλN"[TtئB>]!޸4iQC^SŠSU |~r• Uo2*R(W5?M3{ UO,۾)iКR˧|)Nׯu 0%d(v߫\ָ N_ώ7Ŋ;v$o.~f?(7߹>u:S|,4O*FW  6#sFW`mh!&2lkZljkcm/vm߯C($ VH ʼnߎ0v'"y1O%JHý?ϏӅ8k3Ys?/'C¿2&梆0 j)Oxԙ f4ąt[tۿaMZ`JSH%UV4]ӿ" 58֔,cU}cޡ0 eفJ5R'2@sz'W o7_ TG&3?HLPy~)Oޠ9PoRga)Z^yMioq >|hocIouDŽV#-k7-ׅXGYF1? wįОYBԂ>G [o"q?aJw$$UA+;WߓJ'_}jz o%4BmGolPOL܆o v4kTun<p?qXhmb#QE._?8JǮb!rw^Ez J䔒}ʥF۟\ƌ q*O逥Rޜž˂;huSïՃUSƤxK+~a[ iS3Ru$ZM6LiJ-6vLRo HL(+kPwIZ]ڙ`q4:K bEG]rE|p& +N,Cr;iÑ4#}Jgfd+CWUBl;u\Pq"VREFFպ(;i4&.\=Ɵo۾ KR{XbB3Ӡ7 PP HkQi6͹ۭGJ)O3ߧjPj:0^$1'SLWg""كJHmMAĦCwyH[SH'*:PuW*ͽ9 >惏316XxkUvg}?皿9SykT ro(.58~c{?P+v9̧1>͊6*ثb͊6*q!ɿ;|z"| 8,qP5)_8!ajonv=Ezz7U &5 9p!!bڧzk'cš(9w44 ]k3-wK z W*zHB*6tۮDآ;@'r6˫ʆAJbe*@*ߧU&A.7emUʙ;_ ivشdw >.JTv?T;D h:]@v(x N k{w7C!RvڸYݤE[?͔[qvp4;gn.F(I]jq,݊F}ѐWc}$4Vd9v9ev0/#NP̾xBiMڸv€p| $~-ZUٻ|[P*:`NʪӯCNUٸ|T'cPmθ9كP0qkA鍫 o`G.[jB|vءn }p n;xoCly%eN=0R*l)‡e*87>)]h;).6˜Uت; Rp7+ N,}?WeN:hzv6B6[v(OߑK8ۯ?VFMCㄭ05V~*hz8PzМo< r cv aJk$:{Vݎ?$41Wen;xe9=1!؃0-Y6'?ƻWd*Lfi]ųl{EGc .~MCU?;-Nկi|87ھ8)]w6^Iv8J"e&TxxҒ$SZoWch*{ CRۡ*jA\Jb VF;S*1aWc4B'm]|L vX'zxC@F u#]J{Wcw5ث :WeR>WePMǒ?ف]Q*vUF;m+ڄTCcSWe/WbUقCe4 p;obWf*쳷qWf~ޛOl v8Uv˩.w8Mw;-ڤnğ vQ"{Cmv]mゕz{aWcθٍ:Wԯӊp| UO]8ڻ2(v 5\dLWnr%U qCD|\Pǭ@߭v7cx WW(~V"|2~JǬoZժNjpV"5h)FM|<0{X>\D?X@[SixW(JV?Q B *ӘB| ­),u _ ~jOP]Vv4HJ՚U{ cIk4~CաX * gp8Sp-JE'oaW=_S} S0촩{elk(J|NNԟGU|0m?/~cHvWmqA/1CbZ\a|iɁw:f+S_ikrUxִ65=r eN'9@q4$i /vCOcl0Drڞ; ^BƤ׾;jX1Q>vlUMp߯_e†I çـLR F5ۤO_ p=N47jPv&׷nBj:~=qp!!{SC3-Չ޹ khwJM(|q|RAE?|?PڹlFLrI| TSƕCj2"6SR;e(dRI=j`mϓs´6ߦۮQLO071E)։ @0Y([̟@;q.GJOUWxtȐ6ьm!پPCP;Wq+-=/0G:cD/#=Ek2w)3)AC"lM1ޘ*?Y*[w!H~=km{DG - mJv,mC2ŷ64Sm,C&.cn-/FI\N;*:-|zcGSA[s7~0'M-䞞b?J֖Ǵt?5Q0)5Om{xf ҝGs&,Fv1' u eli$\ZʇuĢt hi(ۉMZR: ?1ASmBGo턅+H{ jGߙA5;wm6x|Al=wt;aOTmA 8 _lmST :6\3& Mg -FǶYOA%%,}uƎʴ461i BOS]lYwۦ%!7=v;bA۶I]q3-խ7A_k׮I9)6ۯp!"?X7k<ؕsV2nk|\!Bb!1)= IJRFP>[m@78[6!ؒz`;4H68DUX /)Y YbHݖ#!ִLJہŖ@w'۾^&M:i1s]QM 68k}Ϧa jҽᥦڀ4? OJ JU@:dUy5̋QQV1Z Ƕ5T Sǭ7?R[OW}|RU9Ew 8ڝ1m+J8ЬhRo-1[ȊSo|̔t` DП9b5A_ LI=vF=n=b`$Tl;НǾ;2&pʌ@OoQ4:,5 Z|@4Ael0〗`m_uʿ l4cToFs_ol)v&bG~dIOH. AMXcx:pI Vzb5߾epjN Mip+.Mzu=5.H$Ve35߹X@K'-O24Sۡ2Pnm ~ +އ~1M(m<ciA8)NFi(ۿ-Nq 챶p+)x;wSKz`Weӏq]q[v5ݺb`nde Cu>cKՎ5: Uө]3v?vM]ēSMxPA߮*>?~)v(,(n~+n 7Lj1brӷ ]3*} Ͼr-]5$oCpB|'w՘lc}]{Se5;3(}ؔR)&h;nh0,n8)LJڞ).kҴ8OliRw6}>إ݈u;a[v8}KV+1>ƾ+bc|[Y\t9;CѷG"vK҇1KmQq;H=07M[JvjJcS_| w]>@cj쵧j]#)vXS߶<쭇/0r~.pR-sE?ΘvX`WfZӗm]#.݁*īh9;b;nE]ON*O`UaNoz R춫c~WIZn϶)v=z)v5>Hvan0+ ѻ Ƹiƶ~o]jVlvPMR*]Iޛ[vmvexw늻(5>*MЊv9*S`;(v8tvbfGʾ89%T?B)](cIvY:qSWz]G vQ8hS=3moUGO,M~{~i)S1Aoq$So0vjce4 8Eik ;MFEx\bon w88xBM4')rB^H &'oՕFaу/Lr8< 8OԨ>J-do|(~cq qZ`oJ׻23ٿ欴ޠ}du2+SF#PRZ~_셄s A@oqe0! ,~Um VWۯR۞Cj F.0^%wZw7UEuaWzmNث|"@,աǦ<(QfH=+ۦQޛª&?c)*B;RG+O\$b+]m{|?nqVԒ Tt#l犞z{׿Әu8m$5뉑ҙ&? j*'Ӊ/~ ܡ5h@6 .~:u5?G2MҿjO?#2etf@i?>'Ym ͽi˯,R5?/`%BQȎb6;|V)e'UEK!*7 R ,f#l(z}a=>; G`ĈMF~0#<Ӓjh6嘞ADRZ$}\VTDk`Auqyn@7mDžB6rvc/jm/ߦ?j>T rzPS‹hqGZnmtʕ6',ԯm@c!? \Hzu߹qj_E6i[Em,Ź b+QJ zaUSo#LijƄzѺRItAZP[a˵qVkA)e#+6^OJH Sjo knj;bi(*iq ]7(|K?h Qn'jĚ,[3 u3+L4ѓ -҃`[j7Ryw;jӦⶽ~]17PAS+knkNLRiJ;mG-VoMk1O۶ovƗaZbmkUz7 GCAA]W mљj#|aIN,J՗c*H&=BIwlc$j)ޟӯ`~^90R{V w~>lQEv?v!&p;CuFY*8 4=.PHeB)߉LJe9e\ьz]#_&p}ZT9W6xa2ETݤc۰dajNnOܓֵs"y#VPtb ouq1c@?dCU W"W%9 Z2jFh喩cO5Iv,#Zc+rGLU2,LVZ{eb49[c0!m0#߯LpƔ ѩRzVcӦU,T^0]u CJ~7Zur¬<{w;el)pZW޸8 ,'COAv^ZFn6mCAQO c/z?,Sk[ZvqFw;P gU~/qߎYaLR@JmSoVN}*`{ vqKڵۧ)w3PT҆ G+erop S0R7"嫷,C_Z,Ƃ[ƕqI\?&{}1WqCރL Hbic Cݕz Qql:{ؤw_bA;L4Bۿт%A^D0B$_z"ɧAieW"C0il3:2@? ǣ,:*LĠdV4·0?v~n!z'V28YdzzYXb͊6*ثbÏ(AխuE-W`:$_IrF/+eNjW=+#u;'lƋHKb$oԯDK1mN9WT<kulDO^&xʿjxr| v0E)zJC?j$;S,B]T4ᚧrk\4 A Z^G]u$s"v屒`~qw% u=ƹxWc#x`v&xu (v* {tg"RXGZlh@'fx4>/avS;cmT ;9斐ȰꐁƋ W I:wxw:,+ǿ\jө9j=EH_בWe䎽K;؃> ` ]_'}PWc[czשuW%6൧cCrWL*KS_ 5+; 즧Rp=P:~߆v4jM}v`zg^m~;Ӷ6cJWcPkpR)B>[ƐN=:aC24^*6Ʃ]W6be}jE)Ӑ%4REWqZa]"B1WcĞ8)]k^KE^|mvb(*k*Ԣֆ)vn\ר=;(ר'z찤EiR;ʝf=k$;.6Z -GQ zW"UؔBOrk Nā-Jd֝Tkve* ץ=OLPTӠ;v4#}QNvmH*iQWc(6v<'v<)"@5ȡLM+*xV KIXPx  Gˮ-.ƕxS0Tһ"m]ƱjuvbGс.*mkp+\ߦU&auÑטWd&pOV*rWƹdR k zQE)6x6 [;Sҟ˒Aݺ?XcAaB7)vPf iC| }8J]ӯO!i 0MZ||1 S)vn"ۦ*/}է#J}1We ۠?ݰ%׷Lv0tzW0|WciZ5‡c"cxw CA'd/1n)v]A=GCN'E޸DZS"ְ5??vO; XS Kh smϹ=γv͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbΟ'7D5f9oF?z׌S|lb6 \ "Ke.L7|;#JQ]z6Uاwbz CmZL$]퓻UcPiZUnazO)qZ1സ1Oۍiu>\0WS7Q} H8lR!|oREj)mC2!I!qʂ#lQo]NH~ PJA?#"-MzHr{I1d˜.;Z!,xn!j@"FRƐ"{P8UNnAJr[ V rBg$IJ"ƕߩ?5;U*Ƨo p)T uڝ7/\2%Cڟi_by?GƍI`Ug5P|-|?rOU%R߹?>{֘Ǜ rRrb5V:ໝ^C1BOG*(~ n^r0 -ZZIpkPڝ_2R$ |ٌdNm,[^ S?›ca5\-",Mm+ҦS_,Laf17(bzWn']jT mc@ua(F"() 6xڮ?ۍ+mcDGjuOLԣv1Eڽi᥵>"U↫UV۾a'dJlA`*GOlU^*wգ {cӿJ׸ȫMv߾S;-}4~L(\6ڵI'8oLMN/ǒ:P-(cؕ;{֕¶O~/zcH仑SQ`>* ۅN|7'jbBk@:Rma5X$ҽM?V9S,b iʠfjִ!Le9l^^Q^C{ⶫӸ-Mֻ8ћ-p~-v4X { imkO1;AJƖ.@0%k~J>#"ĕkq~8H@7 8IVE L7)߯әbn"M]`B7W|S}?PiFX@#M'QuU?;k"><1 DFiT+(EE+{%ns?/Wc)mʌy3;KӅ`Sbrsbj3(סPӯ˨)k"l,O6k@h+%ZЀkGaF)Ҕ;ھw j:fKmu1[m[XS3.mEmpثdH&r;RwߦN,~*?~)rTPN>Xf}6ס-# ҿň? QANUy1z+vlUٱWf]vlUٱWgIi-azoHVy59Z_{K *v3R]L4' 5rِ 8_ƍGڛq8A&p%p[$S?wшC,BH?x2Ln+BzNIO >ug5-l+(߱}&+aǿErǕ<{y%ؑaO].ꦕ\M.R2&:n^$c8)Ă]iv=ÉzȎIv:'wSQ},HKDR7߾%ia#B OaA!)J=TB4_O%h=~J "xlk҇,Kx$f@]D#cQ"K ^(+_o)v*Q@ە)]v) è]R@ dQ)K3FCP?%l]Cҵ=Z]M6;Wa`WbZ1 +O]5 E ̝>cb_r0φ@TW|L)x$vcgm4'l:C4nY;QһcO\W`V \3ҧ2Hv[%l#ֆlULܨTۍ%٘ }?[+뀊Wf-ǡ%v_~/aQWf_o!k h=6hB~}6`Wc\ vY|V*8`, wjAߦ*E¦8*1<Wc€Wbr$;`KqC+zV]~‹vPсkJ KBAȫ],*Tlj@ۭ;b`We(O]jn*v8 ̃Z] We?L* .ZTT|X@Ʀ~$UؠmMR]EFukP6،U{| zZk~89ovVSvQ l)v[ =jFfU4"8k"`M]9\za~KIz'jmje4԰)jw32 C<j* jz~r]xS a?y0Eju(vo]'cߦ6˥k\ uo0v1ڟ,Ajm.= 0߯S"RP< 0٨Xvo,y%٘Њl6t‡e zWv)vZ6=$;yWfj.B]]OjC+QߧR*k%]E."79+)=+q-w%yTu )v:?ՁZRa]⿎%] G_"J]Ux_q>8Ue (;h=Wcާ;鍡ֵr6eIR(L*'ȊoفB?p А4Pݘt}{f睛vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb3le`yG?gqdwS%GIR]j t,{lG@=Oۊ-mi ;.IUmب^[k B-wd4ݩI P u85q/(5FI4iRiנ=ZydރT($ ,m?+mkLhA–'N v#;W[[cnv=pZu̩QֱimźaJG">G1ޠA[wpE>|]:xm6᷹qӧP0b8VQR*}Bm隕؞btruؑ68R7p )ҿAȪFЋʋ4U'-s"-O].>Sĩ;k,k8xq!O[ZqWۥp\2ʭE?wȪJ}8zW/cH??^?zoR ^CzP; oj䐠ZJw?,rsBӵMa3Sb]MɭF#:ZWDۑ;]kڸj P{#|=`U=a be2$( $~뷍>,&@6Az9 3kKhB#8P;S1)VڸT&ڪ~"yo_l\?e |X|P֣alxqpqo+C jiӾ:-]b'qVۯᎠ=zCm +=0wNF;q[1]\NXQZׅ65@ ֛vrQ~XJӠu9iKlM;?*QҼu|2H߭)œ{Vǥs6'Ƕ*҄t똵z?M6H`;M3/_YW-:〡J8Bj:~蟥Ek`U(eLL\_ ᵅ#:^ZL=+ؑI~"۹#.hhi"DFfLyL`z.OoZ0GJt"+f]vlUٱWf]& ,hܒp[v{Gw4{)ёgj#!RՏiusQI'(ebpmDJF}NfpN}MѹTd2T 1'=Ni[ ]CH"UxR%ڬ+MH2Ă}$@]H?E2E.ĘTPA+AZ(NYjvF+ .(ۑNYRsB(|J-I>{,؀0һ@Ya.Ǣ?=M~]$v (z+,.IA]( M |+bboBh;tGϿ`fzbJ~ kg  tU?dR醦UN|?gKU+ǰCQuƠ4%1*O ?Ͱs( xrxe0^Oa<7EzNJc5ԡK_Wb.Gɀ`e-Zr;6v7b v4VKq$֟qv<=}+ǒӳ)]^tj})Z]+ATĕvPp@ƕЪ‹Z}p]POCC\v5 q߮f{wǒӲۯߊYG] Hڀ|B;dUKmxJ-+BN=v;ۦCMv P:UCjWcaN\RxR^6ۏ8ى 7>R܇Ѿ*}vSn(̠chv:=}\!ؠ'GE.5ZT(v! L+a0Zf۶*^T~?)OUJN퍢|$tjǾL1vw]HcNƙv^TAJ|LLJ6v9,w5 <%q\!.B5=(vbhW70C‚0+*{ l=X]z#vYM]nI}8ݎ#;`WeA؞0v&ɵi> (vXs~).ǯJ\ v ]jvw c](~]v?/8U ZJ)v[w?+2M~w ֧"RkZeZbU"7 ?"`Qd:{+sK$oXkܟ| % x~vS.K0 PibOb@1v9hf)>1WeO`WeE*6|U؛mWe]J 1WcA We8آҾ'dIen̵ {WfsOx%؝( bd—c$]˧ƴ4 Oӊt] ʽA+܊*S!ٻx}P~{bU*KQ_+&)ߏWbUA=)^Ovbvi]]iSWe7=b]l+ӥkƻTALPI?%Jklj?θB_kxn{{dک;HO43>/I EqSE2@"9(;+nk)cj>V\0ZVۑ@wП]VmsL+m>, w8m.M^#rPn;mW)wcMM4zkR:Kn\J tߧmһۮl7~+Ny GXcv!?w|ƾlL@yzdh= L2by8 QպF:81$VQHkHYNj7Rdl*\@v/NHU.ji6ZӧOkcOq(EAe#!"ݼq[{&I0'6{31gfL XF)]Ϲ)%jmS*H֕>բڮ*Q># "N;OϦknu z i |VCupo.N[8ҭf8Bi]~Y%H?mӦ&~xPb`ק84;lv8R- VO Q>!Ar@!MۉǑJAj- );|߷ъv}r+4񠎤l0]S_𝾀qsGˠkZ;dLrڕ Vǯq\U)ǐaQ۵p%xNVvo ۩ǯ`*wQ|Ug.0~NZ̢8GjΝ*>_ J*o(5_>>Uq^~9aG5Q^ mE mZw,Y-Eom1U}ڴ0%x nzuŊR=`MOс =@U~ ٺp~R늩ִP{,؏6⑩MY*Vp:oOOZ*#5|zNTpcDE޸kB& i≑)P'7`Hks`)N߫/8c4rP*@u޿+ )r$IiڄnĎU;uS Ek]ǿCuᕔZ=HY +kcхGcjAQ%ڴo/n-(w|6h( lP*zӮI@\v]"jhM:TܞSUuO`*2\m_V P.å{b5XէL*zLQ -dZk1^BZJn3q$7;|VS۶4yzr*[˭I‡v RZZze&Np= riCJnw–}>p4;vN,{ @A%hև̋M'o  3cAS7\)lo8l L[ ~p63V3-׾/;ש0vX~~5M ~|R$H |#|%WZӮ6˧aK|Sח~?<4QFk}q)pߡ|<2v-Pn~Xҹn ~]>R{LgQ*e {lG\ ]^;c@%AP6]rZ`+mǩo0P;\mqr~_)W2ܪ*s4[OǏزZEzmV+DWcX!:6 '|$o<*I#< Ys.@+ȭ5 FT1v6vlUٱWf]vu/)nHX&ιƧ?2.'=/4JH># Ŝ=[Z)( ܚ{%WSY=wmS#Fv5UĠZbZ0d$R&]+J0ֹZUrlش`Tk_Ր,ðBڃJ]hAJҟU|O~u1v/ 6z5|8CDxO4ofyBn"SvۈJ JӭvjA}NkaKU( 9~_!..`*9O8Fcw*mu%w1vdK76wB /OAv:C+nn?]sMa hӦZLž;x|v~cjlpvS  B( 1K[vXOK%]fÁ.P>_qWcB6L2vU*iaClӲ(:be Pu5We7&%e :8RܪG-^ءl) *챱(j:@<@? `Wfd#qp`æ)v9aߠ]7?WcoӃ2}] 7E]QO`C@>Wgf!1We`: ൷eWa^<*ʠuzPm<[cP[u+KёMU؄)u iZn>{ᵧfcjR1ZֻĻSdjo ث/`YPY.-%6v\GAC~`fMFƽF*vZR{bEL w -+Jx`WfP )vZӥ68v_`{m] kO] N )n+b`ևnl~YQ,b Pʻ-:])K)Ïz|'f4|Ur~9 Wbܼ26`AƥvA cml ]W?FثHkJZǧj8- NϮc=]=^Cru1Kr;OwiZ_1vsO?zOjo: d=N6|%$ {'8iɧb sp!*:-"Sw_FnUGC֝2Lmا +YE6w8i-cD<]6+1ʤ~u iIؚVTV4Y$-Ɖ6}#֧cvq>/6ƣIo/ EMI=ckYiB~GPPPW$A=e 6>'%w#|qlzn-< "e? su RC^z$V-BHn;WbkUi^GƛW'juڸ-> Ԋ}zmNyo}8yym_$i48JmTM:׭E\ԍCR ;=߅+ ڟE<QVϷlP8}ӮXӾjZ||joO96692*6;ZîeJ7rCOc|U_cYN{W)b2*{y*v#ԏ6/ Q*׷|P@ڝ{ BVC(Xӥ; [RquAJ*Ew M>eO_–ڝ0!wdmWֹH)gh0{~_חSƧCm ې<N1UFN`{84$ |7>4^F8ڧ^vkB:}@OČBHrVڣ Wnh)־>UqzSorUAE52֢?,U#: i J㔧z{mVި:Q1({95R+׭:uǥۧ`,ǭ Z.>_r)]A@+ .籭71PA|~g5^aޤaVz u|:l~~:$c: c"i n6SX)V~Rf5$tWDHx~ce6W bToO@A>Sւ~fRɇ~`t^T,U>=!z ˙h=Yo\-Ma̋6VbMHS nm L7;?WA9K$ҕp+Z`WNocUN=Ս+m^+QBE;5^Q1L6]-ƽ3P6㧇`)r*c]xmg , 6nsTӯo${aq&oc0XƊYOAƜ:C+dr5ri6r|H5،!m~-5 /;vqWWtߠeN_~k7_.&4{bs)ڟsx,@«xRv؜Ċu;| kMl4?':oJmOb^ثAyT  *jҿǝL 5(n`TwmZ&)Ҕ ҕdöX,)Qߦ-uV$)ӯ޴5dJ[n?s ߧm1dր(?ӯz05IhM+hG!" '(pA8֝Ͼ^mj}85:ѕEcO ^>m =^D`d;_| RVEmF5'zmQߟ]oa}7ۣٯ?:~z;KU-Mf͊6*ثbߓ[eUU&!'CZ>?d]S]UGSJ튻I=”ȑa]r)RT;=lWcZ0`A0$ב|;T  dZC x# `ZVE"mӔ.`MV aW`p~}v-aZ#2(viPRӡw_Hv%Z½>_Y` In{Zٻ)Q/]l@#RWkOpچ낇RGjJFh*;l_ȓ&\P ~BZ87(7&ħ@< 5 jDRSnYn-=?¤~9J?VwW.XdK:{9bƕ~d]tBHc,;civ41z֕҇e5XoN[$;5 5"clFZ;"Uٛ-M*AUvfR:t*AhM/"zP8-.@=´좢F>דݕ" ңoƥiم@>q %mLAڿqE;+ M)۷4NHӾDLl=JĎ<1CȤiVvjiPxv^'c Ȅ0@i6ǚPI> :mbcП]4SO->JHvjo^Zx{vg(Iaـ5A5oڽ6.oaE ɩj+#r־ )#Z i.ĔSCitPVPx@Klq rסqKRPWf+F&}ثo\]E ƃ}b+Hq#dvJVڄsf]A'e;v4hEi (PPqCJp C+~qKSNIvQn] uzu -w4$w] ox lw(v00eczd]`7ge=:O1WbH2)v9i*Ϲ~8q^>>ف~LUإIL I;v]|RZNcj}ɦv;zvZ$Vpvha*y&0+|J26:n*moovb|\B2#nؕvZuӧ\UL_n(v^1=+ޟCvRT}KZ_v8I>Dc@60%ȝv4v+Wp*79Ʋ-{ua| }%"$N秶@أ?~!ZҿّvhjxbB d Cߧ_)*5E?1c̱vssڙK7۾)vS)'4~xPK (v>nՁ.A?뀤;3^!؉zVMV |d찦U5ծ0Z)~.݄-;*k^cQQMOL(vXZi_v(UuK*v*x)5#ӄ(v4ۑZK&5"1vbĞG4ւ]vp%\EMiVݙH;lp;}v)BE"dzn낕U>ثʜvi.c4 C'bR:vJT1"Oߑ(vY4'(1WcՆ[%J€RWbe%GR]]_sPһ۶!>)b]5~=7N¬vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**h1Wga=ƒ^3JQ)C|_?eG9;'P1;5IUi゘U?dTS‡eQJo ??ՊZ oi3gcqO&\VM5uEf=umn(# 1+[|QǰZ06hETҤM%R8vwNDY3$B,)ӽ1ʠ}ZMR ^4'}eB7LUNݱSGFa j^|X%GCdE̵4Wµ@=[v4=jz`MB]5ܝ[UPeGΘmjPW/44ֿ XFƝ)ӌv+,RT"$PtȔ돎޿jzdimkudEZ&ێ]rD/]_ MMv)mP:8;ŕ/zʡ]ߊ <3.}Osم6'ژ$f϶caNqMY )Ħ#׷O_-sOV6.?Ι`>I-Th~RiM(=3Ry}1EhIq1rz/s2,L"eoG\Z*ZMQ9o7dR*i潣8{Eı@g`*q$|oK1Fō:c킘WO)$mTo?, Xg#B(uBl20={\R$ h:xOLBGZ,:₝{䶰vkױ +zT+öb:8*q6 1=(\x;TT݊]ZP-cթOp{8BNWrv."v'lWhwF)XClihr?%Aj3PthMN㧆pj rymڟN %÷θ|Fy9dm˦![$V7>h2Z};blO%Vjn618ژo8Pm`AhnUiRQ}WjZq\W;=2áLUp'ǐiU@4ʩ|A[qC*Rr f<7\i޿NY43%r@Q}s3nH?«vf I61C+]G~]puvڛ8jA>F(X)zרcB6  0ݪ«U`:xTtQmXVKmhw?pzuҸu  ]K6Էcd85Hǚ_LS@pGJ}+=F)\PTԑ2Zp%u:ǥ<>Uzݗԁ_&VjJ-T.}3*w]8"v)o4?~^zW1 _,R jz}̾#rNE-) 㗰F1bE{*A\ik]Ͼ,;t>FG0|{G RtJW_2Ue+هyYRA،6*ثbm3HGpJilHT@`yCfˍl: $Ոopa.[V P56lm+B;:})6Y?hpjG5H_m;+|`zvxI]WL3⭽)SMǷMNPn]4\A4%Q D)ݗCiZabXB) K3~V:?R`EaN";*HdJҔ_XJDFAmH;VV56K|E% ϷYA4啔Ph @6PD@=HSDJj7CLUʂXSj|K0]\Pԩmbɪ*h?[,JюCSm_C|!zW~txd IAz8w1[}(^7Š+Zr?KL}l1$Uw~/ N  PIn?𸝒s-b6kyT7S1 )Rbxz ~eꂸ}ZvȆ%؅vڟ,.$:L+"n_.?&eTs_ ]O.(vn[{bep-AjV1WfV.wE]Q.=:`C^?*w+ĥHԍ>xi58R⛏e(D)8mƱck m:n]܊{Evۮv`iv_.zmv(7ȝz`K 55'ZbUjz{צvXΟ.w={`WeWbҤmL vPw}]67]X"*'Wc/v?$R͸Cc.vXMم;mZ~8(v}‡eЩθ쮦 o]hOQZ`WfSN{턡ꓹO({xSӳmKىw\]~gv* jJ`K=:Wc޻tA)!xv P}Wc~ iM8iجlKāOĸs%hvXi]v~'+)v&ǓPm^3nWaΗI A%$k4cc GKa e߭>%p+Cq,(:v7?hC*{ ~Wc%s ]8ht܏ d_qȲo~q|UT>=68wEr\`~O]v4P|64'Vطu>C5]] iSJ,( t_ UkZG}+>DxvR#ڻ Ӂ] .~SQ@;뀅v+zPfDM~v8#]LRYd`~G!o "bM0R+m42:aWbAe V$~~bʼN?;,A}vSxbuzLz:tn,>:-,C]]6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊-T'vu ~Q+qi}[_}kxN 9t:攺2O! %آ!i;)]\ ?^*쪳ODE@U1==rlZ8ڦ+I4+^)fX0Ҷ7큑 ke`{+&2TpJ&:mKkI\W4ޕY4Zk㊁BlQjdVz_ WWLzn{|諱0XI(PdWژh ƻ}#P=צ*ڦ"JBG#э;ִ҃nFbv~إOwq&+ۧU??&b2{dJ>  C)cEŨ 2T*OZ|@$-BSzzuĥ|q=鉗_2)Wu9@5~x mSNLx?╭5픨*>u3&֟M>YN+SZeS۷*0s! *R:~=sqmu޽~x?k텒w'e Tx5$jK3/vw#A^emJ~1Ҝj^'MĿJхĞН$Tr;]̬9l/i,h)!n3 U`֜UE):W߾j*hNɴ6-ڻk]EqZ|dj zJ5:8s}J%LZu:dnQqڇ7 (}R֘ +L``…ۨRsASW!i^VU큥b!Q nQֹ/8U ' B448ބJ䨭6:c&"`(w  rli6$ >ڸ@r۽?SM[Wx=똩i v}Zm8ň +#sק_+?=9)RzRF l!_ 6jO~Ȇ,kbV̠Zoa|{,xetcO)O¹I 7?G|,=)D|U9o*A;a ӱ$^ nI5G?6^ͱƿW!Ҵ#mç%p55#8mjUH&SnwZY%] `6'-v4ߥ7 eԓM늴H&w9f|+*Tx,FR:~i ݚ?.ٛmK'~Njl6}`z|c`)qpO_l%iJ55o$v;u,u?l;=Ehq*+of4>B|~āö!V9֧mSIVB:ֽrצ}R-uF|  v9dsB` kZ-J)ִ1J>l~}VU;W7]\U~*~x锻Ҿ%6J14$LUxcvNݱC]~MpS^8T^-& \~L]jW(lR[{a)Vڛfoz a\SnFM2ׯ^Oj)Q;r72ȭ1HlT_덡K5OE-Sc\Ҵ/­3v&'@n2,i+hr9-fN~!Nk7?ҽF'TlMAȎg9Kb͊6*(mBhC+qR6>羭 P(:?j=? K A;{SeBA#:ҍ%%Cv)NoSxtR8"֝OZ=1Y]WWbztt%lqkņ@mR;)ߊ$UJw"}ZX pZ+9Ҿ mIP*|56?V'2I w'~NJh ;S{ȖHw)ZuXmccsJrQ{ded{Pݎw/L.;~ ؙ;g|]|!ؕ9@<!lkQj7?u.ƀX 3 "؅v_AOovj*7 S] 5ڻ._nNi?lU٫ޛUHI!Nō^%. +Z[֛w.mق.ۡvfZv (iPwvU)ҕw®U|Z/p8oqK؝4ؠqBߑK<~c,P]6]ƇO ovP*? R(Br vaVz|aWcW]EE:PWfQn¶j x{bAI>}%vRңڧM_ 6;Snï S+rO 4-Wfi]L r@{mWehp%qġبkT a\{Ԟ2Ce+N<=Hvd4+AlJi.ewOUl; ֛Zvb+4cnI߭:drzm]ŔSߧ݊+A? *y4. AրSlvgޣߠM;05#]*~cmA]qT 4;wĥzӅBv<mN0 Jv[R!C:v덫vJ uk`dOnv9 1 !.gj|}%dio+F-OHC+L ܿX|Ud@k{WeR}®ƥ;ߠVݎAv;~;u#UvP?1Wf#c^WfH B>m̫Ro)v85w=7Iv[ l?0+qvX8w]7N튻P'%vRqKT4dJ"i:b j ;( AM݈o\%ٔօWWa愿6Di38P}%Tl ehBkOj} BxdU+(5Zzavb8{~ءSzU̿d=7JА@܎ڻ9E٫Oa;15]v?c Y%f"wo0%ذA.(*(z=إF@?*iC?tɠ-@(vXNw?OmWc*쪒vnv:zt Weo=, 찴m7iv9  vbXءN[$~*R3ǽ>]$}Jh' Wf ] <7>tڣ`Wchw1\زj+"c=Wb|2Hv"u&]/`VM?OcS.ȶlKb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb~[[յ%41l6>C[}?/sko*8Uߠ#vX4v)N5/۹ŋ}®iŸSKP9x.-.`>0Œ0F%Hlp +Uթ…b\Ӡ$|I zqs"VImw 0RG_l>ےkxSۮX^*_mY%Sf og ʝzp=cJu8;kR-HHx;=M@v!N@jy֝G3 ҄vxhMA&|? ZWn⢇j㘓Pz9]hGϾ$EUԏH$@4VbMB j@w'cHJ )$nqHZ`;PL  3A?cyڕ/9qۭijƵD(Zmxm>$(t~a VPTpP)Ҵֻe6ƒ !`kv t1)kԦ?O%A$ۤG&S^oUXy0ڵ0gc رE0U1]'x?OSv'91 I%׮Qۦ8bHzf`\fEWjTbK˚9NY3,h>FȩKaLtH96~y6Nغ)CASZP2A+\v۶X-A?Hq! cp!JxV]~k(j4&ZBCRxR&J,8t"GosR)d!OcR(M+.bj?pmN),NEOtȤ/2w;}B3oOqUmzRn o&?!;ОD|wBIW%`䫏\#QiTYsi^4&a yvoixSHR ZE};*oo(Eh+C M^~IZjК}L*:KOCN18uME;?*V? ORLGooe?~Uf)ƛw;X~-zJC`j8e'Z4I#mrO8;~JC}m^v!A 6Uw"Ӡ1Vˮ_ +T܏\+δ*xթ+L+Lz½{bY#jHS1ï-=(ww!L0'n6߂m$z$ Ek>*a+Uw#3qA3C zL/aCCM8Nԡ>;PtsGvL%"#m2OJ{:ǒ ݒwG'vIomBiMq}ų ݎ%KL6mM) 61nZw%5߯MsNxcՈ~Y|]E?|*ʽ?`*W$Sߐ=;iZv '@61*V^Hx|!Z15jlvEWk|qڕܒWpMM+Oׅ]Z>Gct-ǭ>YijKN( &oOewW"z~9r;T h rB l;P{Hq$fj7-ImM(w=ҵ%VOu? u;}VÒ]2qv5KnV席|Xڔڧ~U#z]Nb 6WKA44 Sۨ ִq j5VM Tm]vߥqV_l*I?Zۯ|hTzW_r>XH$~hZc܎u•SAܞ5kպPRߊZv;jSc(orl p+bSSkOpxF7Z)ӯli--V*܍JWTAZ~˵z 1?)kJOcUN8elQ $~ 5ja ꖡ;Wa_Q Ws\ ~Aw4{qcГ!n1F?bɠt;~~QupR\TS0 OU˨3I7=>yo~F]I$݋%Ac܁XI2$3 ɨzo˦JUG;7'86n{+/ .A󕭤!qΥ"Wf]v $[財d&,r sg<gVaʡBvhߵ)blJRS,hoXY7E*<2)LiQ)Xra&T-tCZ?1|R"m09kQb2] v#Ȳ Zq+_| %ֽ7RQ">fJoÿG @1 % JmJ*?K##rAR]W)v`;v v0F_o׷jN@r:aWbRՋ|a]. 'bִ;!]+iXMEzԟd CR,?k(N)@ -7LCC) RF*NHMiۥp4}~VR@RrLWmހe#fQقC>߮ f֣bz @[}_JR`ia1тnqY%kCtƨfu߱RWrXEA'+\%`_r㌩-R^İh)JTSڿ3R3Bj(\ 9:T<< #t4|{4;ӁwUڴޞNX dCPFvhR"G;Rt߷n+Kzֽ;5HbcCS5A]JwlJ]NҾ;+`)! ho(vU+ОmL)v8n7&.ˣTrM>-NGSn dW4f k>xv]QdmqWeһDž`|(~썡I#V6vRZP[j쯉o$prA,(C]{{;2/˹4=R1K ?N;J;uWc ~m]PxG.Mq{ߦvQSN+vjȭ;.C_K&J_ٔxm6쵌hvb6[WfE^uؼdb?@v e*9b|]W ƧqfLw`]Z:ei4QRwq2sIv6.C` j=6족ګ;ރcUGoc]TacsNzHvZԚ(v5Jpd$;ip!a^nīz0M(vb)v5 vU(aQlUqcZ|q*KAZ킕~vGӍ$;/k߂`;LU`Szl7cup+1rîn(v;Ju0%z(%jmT޻bZ;`KhjzlPۑo.p+5B{tkQNN›IJv^lm*S;Vvq7mfڦ;W,7t<=+ފ9o)vmT)O銻7`We)_銻.;*zիj,3=KD w*Y6T"e0wq{a5:kOWcڵ5>xB]S۾$TԐtݘ$m`oُۢju9I%껪SͿFK&dRaJb̨(ztvfjn>x ' lG&nDSZwȖAzRU;Co ^'í?%ZPZ5=jSl*쵭66, PUyj;P (6]݋|]:V V;v9i__l'cS;3lGLB)O7^v(MmWbkSSCё okS}1KAՁ]s,Me5\ WeqZvM]xv4fWPq6l v=W㋐w_|LPnXWa"JX!8UƸh]4 V.oMq,K`fxfBw.#..m}ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWdeV#)f5|?Yj1vv Ez9v= |*Aȱ..:ԏ;vW2wnجvY>;[+Fr`0P~Ւ[Ȝ$bVx6Z]݆>y$ \RAݶmO ]*zn?&\]W !c9t>? $c (N-5Ԟ(O߄ RqԊGZr g ?+VI@:mm>. wf$&ۍV]삅װ7"71WW"UJbH5iN=0b)_ǶZ!fnFנRiRvO|lO%V$ xb % |@CjH:Y.`ӘqR}8%H *@>4j;@`KLxS:W}[Zh6A:Tm֧_:SH(mrj;b¦8vjl7?!%F[){"`GL@ia5f;a#LηbR)N[;;/ÛQ"S}*g8( 4q!)ߵ?pCNV{h(R4w2"F(S˷\P!RJdFMoWQO0AV71"~ 1!o%wIv 6` %1u6Z틁tpw׿fRM:npha@{PoAiO(¢31(\FP&8ҮbX|N-W޾IpVQP_+(@{e"nCt7KLԦ R(@5P"qS ӧ`* 7iSGZp!UzmVP9WB-4Wl66U^$1Uaч_U2:}@ =raKۿ&׶PҒjV&m펨aAMJj{x@qVz}9 *qljoAmLrێZ=ȯj}wE4r񪎽q*cS+_85Mf4]JP{8IQҘ QAriVOϮ>8lo«khi ?~IT|;mP34#.zLwl V>#@Tx֙&)#`XW-V)m,(A͸bq#̠r׶߷߀5(&Zzp |GTjk:lS͓EGm,)*S;ؔJЮ1dw.لڿ<]&@lf=BH޽z7rm5JGOQ.@B?a֘44(JosUa$=-FZ5Zۮ7 imw#RiW0?qJV4~X ╥H^Ǯj-6=QӾ)w]ݔMإӨӮإwBkǶf$u8ӁZu=cMLRUEʂE|k冦Ǯ]㚀  mF{O4H\;u2ߎJ_Dv->1dD=6xEYa8>ѓS+!!>'H#n&y#Yү&hªiQA"C2A ,dثb!ïU qϠVs$$Г0NyAF;)j@Č-iNIJf?.s]T4=ֵ́킐)Fkcj^xU|؊WM/4>~89W]& 6;qRi~FvRa=ƀ>G_RQ፭;/qݾ7v(v9|+)~mSo;1v]$ZWWc_٦}FU#~N@=;8cv@>÷$U؋L] ҔlЂiC_ʋ'e0'"vM]Smlp6hvXR1dLPuㅍ;CN:|%dQoe!%Wx*w:fTKI@uW$Qnʨ+}ŮxCrȻeo\U"$\$1~o[cMAm}@PH4ve B>ݙh6s!iق܂GAb>-w#iv0lHvf#|B G0+ Ԩ%v2 :®a7ݍ;-(H'ev8 kX'."~vmo]%5| 챸)AC_Jcn$TnmlU"{]ڟ?~xW v`7=)LV4(GƝMSK۰®P>!O|U c)jMEzާ'Fo] \U٫b >xBTE] Jr]j}9c7eGWf`@-`C&M<+]2|E4%`>]$s^Dx{fkYtR[xkZ#agA9VmABR7>E|RI;n_ c\Pa Iv%U€zu]Ry?dE=;!\ jG*TU:iL N7ڠoߥ~+NjS0$P6;|*첔Xӕv>`Pרڝ2+?ҹC ]0ڦWǮ<ؓLVޢ,+% ኻ(J ?:$;-4}(vC1]?-m}Γ>o]7/6ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثz٭BY~ʏU+19j3 12?;VqX;qrO9.uTdHk.3}%̏ԑJw'o]_ǥ)Ov 4?݉-R0,s^Mᒤ,s_}w=6TiL#޴߆Ur G))Re{T  ( U0 Z_גAZz|X*n*EkM4mk]«jxڙ ֟}N<|Q#_W-L(l1ƒ`*SXqWOE6kaL{呵U859Jƕ{6|ŏNuP6ۊg߸J}4Vv,Xm+J45GQ_,Bk֟,Y`Џ ?,c1* ԁ$ANY6li|N]JdR֘c߶HQpo\|`qUo،pNS}wSCޕ!Mԕ :uTVeS_8N$u}fTSt@>;c@?1W0#~f銺18vxeAq cΛdbVsD'd8@}A/*P`wQTO]w>'eYNLK/ qQJPC EGR1 Ub\UoJ6j_ !h`hk zЅ?ՅT'¸ca}?!T54qA_, T\ӮNzfdn%[ZPw85zL\¿CR(OуW}Ԡa֝RA~=Y#}^iAY:JSvz{b)5+Q?|)i^+xn+%Q? *+ĪBNH%kpJ-:9%CTt]RIO`G^ױl $P*Xu5 ] %a]@RኩȤc *qI׿OcAFnrOє~+*]_6ߧ.cY4!بw)n=Y z&ƣ4q̸IO2OQNu>'ᄋTˋP;BqE7?I)GOј\'zǮzVil-טdC܎'ӕȳb M)9G\Bq߾Yt D+mt#B Hh$O|'BHZ.إkR)=fۿm\ǷOja\Hқx뚀u߰w;~m5q~*Kkޣ(V߾81В ߵ+ VvUAf<9@'" ;9Ux h-ilo­|';1UxcLh Ƹ&/` : ҝezLU]=*Rצ`q^UQ|Y7ğOmTPmڅrժ|q[jEV?(|[o=QҙNh>Kn|zXqjzZ5M }8ކ;|dZ3`UkQJȔ-v$UL*u t+X==ԧN"SnSS_)ju߶E%Ҁ(FmOXK*~,+)8O2ItSQ6Usܻ\ثb{[grYwP$?\Is|LրM!*~#oca~K$NpV i]_\daMw)1f %Ӽڮj؏6^|?ˀ. ?:Wc[*5H@#jJO8[-N묄6uawxv$6+Ҹam6wۏ%nGֻVRhF}UքAMp]ui[%)КUjn?Wc(vnv07:9$g iZWn )]]u:aWcDl$%wU}(yS?X).jwWf1jEGr{ɓ =%vWB7]F GcF߭h>|*-(6ٕP£Hvƅ ؑJ@KoQWr?.e\_sCQZ:FWU M VkF8ҵ4?|*8#j㿆AFqAҿEzoaoQxiȶ N{րwO 풶$+7-8#К_¹P& SzW;+JsJN; J>R"<{v:|})#;%+E^q0l;Y8z\WezVTSbsx%@7Ko燒QkNNWe = Wf; Rc):d @+]{xKҟN(vZ;b캁5qKi^qWe8{h`Gء5=aK4~_ۊm@=0%jZ}p!wi`Wc+ 1ڝbf f SCHڇ4=}A#v<-o0+ƄbiAZθmrNNWe .ƆHVvZ1l+#ۧ|RGB0sWfb=zĕv`C^Weӗ_ cjw 4;mAiKva_*ǻtWc:֞װ>?,½}d|qWfPQQإT—b/!·DC2ǥ *pw;<~p+t?)v0ЃN1vPI5 Pdح\+d<z>5$/\c]zF1ƪfi#9WE":|6E7d~"1 ij\4b, b]!RQJ)Kr(ji]W$k8:ačI䘻 GJ`W`=z|0Ol v&i;E~W$8OA'b|SWblF~H!WHvRRN8بmv9KBzm2*ھvj*6®C֦f$Ov;.ʠkve;-z]QGbT1=9b~#vyotv?K?T®)\(vSv$ۧL(v(GMAة4؁1`K taSS 5fAevGd6ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*r/#A]>R]]/.d_Oo9 fD~j|imGvITЁF5νءQؚbOȫRq^qA. mv40ɁLmLztǁ6,>y*E-eaCdscRXr%܉HFU!ڽqbfWa Ҙ=#7x{ lmHYSLw? «v6WW6=rHSzC־ m(7;aB+߾XF)VZ zȪ<m6-J1н/Mq`UN;{ᔭu3NVbAI5;*BLW XPKAE4,&~sIET 4CTxdTmX'` VaҸ;T(# `]džb7NT'5zw2JP-OBk_j=?oĐ:v}4Z ak9L-:%>}G#Ljf4X@+|M+pZ}t[8b1"=qeiҚ J{{CVu8֔t\U)-N8U?O>#S$0۸O)dУ@lq~s+Bu :GH0(yN0"Z]AT"z9s4J*t 7'1%V*62ҝG^VH|FqO@NvO@~bRa?v9Y FIm;Sj W$ژ'$BMhG&Fۊp<”4?*AqO}Tbk]&b鸩pRozbȭ+*l݊ !H!׌xPkRU,IރiS3+^p^^ـ}8tصߎQӰ$"j{Vۧ9`WP?O(n+U4O9Gq+ PR1@BY\MwENaVl))j(ij⇯oUi:#HOL*ND}uI܍*d~m xo\ݮ[!jM4+31Hm6N~;56OI͘ypy|`lGSb[9>cSڵHd;צ\z:${ل\k69KZin. hMaZmbz^9|B*@ޙ]j;Cڇb|;*ҍ3cZUDP>ĝAMbU`w>\y8rY\{ SUܾ}1mWpcĵzUox3'ZV|*;\m~\+QOAlUm(;cM? V={훘kJ` \uE@>4V¸l*%O]^|qW5N ğ[o_n lE?hFƽ7-p,j8ڵB xL\)oph{eTtz`WqӮQ&~ݿj?Lo}VȧcXC]za%V񩡦ƻe+ֵ8ڸ:iDU#Jm߮)i;PUkAڇ(X؊li02m҂F`rwҴ"):|tܝ<: ~4}p%pOp޴lREyeAڢTƕw?^5SߊUmjp$ mOzWޞCJ,?Z-?|ARz|Hd JjkR|vLn+rà8^vf5z`JsN, \JsFz.;-IڽNm;bu܉gJs^/vu?/i-K߉eͯfe_Ļ]J9m4S=Y(_k?,f ;l;cJEv5z⢡;R,O^1UiSFȥ?/׭Fw\ *2iR@$) 76A@e i~]0 AP+QE^ӼTcq0'N]>~؆(y8xv?,IG:ִ? )j|P*€ul*DF۞ nҞXHJ'S^#GrJj6}!~t=xwZE4A1_M?sWz}ٵv8ƶ>R 5Z5ylR ͰR~:v5ҕjiPhG`:oA ]:tƟ]͹ !JbR쯴NFSaƕٷ>;F)vZNFīnMh*COvmPz4?vX¿Gl]/Z=z`KDr>b"T;-JL mmo׿݁.˯Ӎ٘W̦?*젵v]Rp+qxrpiSvn=ۯo׃]:M,Pƿb(v|0!g,Zv&E0S6?]+JobcYa%@"mҿ+KPmߵ};(G]ֻݘׯ|mmT޽k]Dv} vz)d x[vYlK/GPEw26:R;v-v Ad»,v+NZ)ڛ}8L+"+.oZbe@N7cbV߮IvY5 /ٮ!E—c%n ;dUٶR +G;Vߖم]R6cH~*܊i^ v_S߷ߊB(*i5|{{Wezv8ҧ+QN;Kxө!ٸGJ}qOp--GbURAӑ)c ƊT׽cJ`KVj;b~q,72R5®Ǹ5;tS.ˡ4î] Juv?G*G]4We;WaCCæE.̂AZWe5B)v ]PAXDJ]Vu" Q)ܝb۶JV6f?ʃ*b~~wݮJ2s5-Ƨs(#S~eL*܈UQA\+Gz0-Cv0îIaZt@ b*^+ ;]E\Z`We7@E@*Kᅋ'`On epbꌔJӷݲ.[6-eZH!ؗ2hIȠn60bmNE.6?F)v6lƴ‡cC܍|>XjS /j}+QJFfA.;o.*u6c]F^ՠbư:br={vJq8idSWeqCBv}+T!ڟvD"r)v?=}`v1z_熕ה;xxIvPr]Ӷ4˷႕تE݊Fcna$j7B5#MO_2@iɐ@Yvr]oU}Rdt1ƃgrˈ ٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*~YytꚘDӗ7q#5+u(}SvwFWև\ɻȯJ׶FWLcyCm.'ӓf#Su4d=zr E$-&~/UNPnNîIV N#m#K5Na nvBL\(,1Qy:qڣ2}IHo*ZmA$f"Ǧ-)68RjIlUkgRE+@?!VWiZ}׭XSB We_| G_(ևU(|}pkbP5?,oS"Up{To \@ 2N- ":,bSSƟ79P ҟ+Jcm8HA5?j-˹)J|ZGaGM r\ŇQ▕ 5µ?lmZc.rzb뷆*E(j9%Pxv1hMqZiUnn*GAۯ|0XzvΣ&$"]=n*9)|XrxfԠ0HA)"=S˅'Z4U@4w={eJ؀v;tv+A54 ԞI%pO[cjeW:ePvol*&#=HʘB "8]QjEϯݍ`XQGQ^m)4 tZSZu H#lZ٪)^{ҕPƙbOƇ{t`dZt?ۊJ4@5friRvQQ|iSLTF>*o=ȏ.Šwد|zTo|BVmZiɥ †JRW5VA _ U"SJʦA o@)|c%; iqWr8uiZ{ۦH*a=\)ZGq4U¤xNl:? ̝BWg&S4?,Q~;Tv2%Ux{qn5;튷$S-߯)R`}3wCEG!Oq0v߮SWL \a4XۦpPzvq.:mֹGe VVi~t'2]Z"1Ċ$uGn9h)>U=Uj?_%Q"eT|U&&r7?rqjiȁ Ab+ۿjfl$níz`5$sxa>M9}cd\92|*+Zw;tXY;qTl;ei-~#{‡cS)6GvFÒ?WPҟx}R Y*+Je)CJڙj?V*4RG\ܩ1[ʊI_ SkLg*p*N\`p(q_,Ԓƕvv+hN5EM~{tȡW*N )n,>#_a 7īahkSRnWl ;K\2Z !4햤ZVNrٶ ࢿ*cM[o⭝]l)kҿVQANF*ujR.͖R Uȴ:Sz~)WOmL­g`qWڄVZڄoNثA ymc-)f =klU;m*}M7q`>b:aW;9kзrvՙo –Н Ͱ%p+ܜx@ zCNm0[R$x5JT Wze!k/A^)CNjA\ tju^\[5C OAfj 퀥mʕmEw‚ACMr>bT4 &`OcO;mOO}0ڃnArɿ*ס߾wm8қ;oj){|2l5_D6>-oJnF-X EKicYb$bl9F֣U^uxTӮRX]'=zț#C&M]vzcqѧcS ɠ AOw;m%W@OnIF u {}++mPAڽAH"GۘgLX7, *+X_g8Oji914m6 21O =ʪObj$qjϏe*ZqeHgJ f; B~EUk?,p(N5ڟ |pJtzt aX߭9V¿~ +kąAE'6jSjQ+kZֿ?)j|›UKu Wnytjܑ]%6z\hk*2/OT cD L &iTi޹14{7⽷\& cI+e )=\5v8kZ.N$?m.7x„ PHmwKDmڟ bݍAG]GJ_]d;u&N>8FA49 ֖ۉzdEdw؞IJXVCnS ߚ??^H7nO]k"(%E G K :iWT*OeI{n$ǐf5VX^q"Sk[B EM:ֻ%3 <)?N h&sKcSN[1 ?߾c n!aӦ)AaU9+ƽȠ p(Y!ym8$궱wH~t·|ހzOSt063^p pPfԻ&EM52vbEkM=b^ =I*ƱP+QuGQl2Z?Ϧ*%Kuv0zWfؓ5]g\PҔbP| δOoK7"=:ޘר,kĥ?J~ኻ2БB<ΘJcQ" i\ ֆ;a;"{*ѨZPĔ@ m" u'^w#KmӠv88).L v=(v5P(FaeTTbfzB>נHv9$u HIWf%THe$u]$PP ]@:3"mqv1 $Z*P VPdPvڽ|p+ zRm›x!v<-}߮VY;7.kS ȣaJLR LU~9Ɗ8R{UvlsR@<~c(5<%]6߯ȡEE:mbvfJ]c0hjqWe0ڻB:] h ]GN+R* -Ez*rrwFvm<1WfBCSīE5{ v]{Ѓ"2.$ZE: ?zV0b.qɱj5 Za%.Ε9H6XzZx(3Kۍ9*Аh~cv ǩ9 ]бɡآխ=2%4xmte(@*aZզP]2 m;a6b_wv@kAޙYd7v+&nk ]zɅv%ϑڕbZ5pQT  )vbvZb½@!Mj6‹v=HN;(0=[oov9R%;P0oOcA1!Nn2, Z[կ4cwrc]',njh˔c'\dUη'OTPTU?\!j52wWy;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*Ҵف\~}ܟrZ$ruټL>d>_q٪[dy1Z+pS7w`di =k `;(O;{90Cw?% $$Zlp%Oui㉕$**T׾#T zDV bEQ^1$cbU `4c_Ul(+XIw:{֢w_ P;m"#{`U?=:`_C߭s{`?)caM71'$w?p/E8cvݰBnjv=Z+(y߯.ݠ_Qvܚ|Įș*"Տ}.AThL#J vǫl@O WS} \O\TtxæqlPv䐦w_,Ԯߊ\fח|*ߧlxh F鷉ȵ=GP_jd _d ELD^GV_K$LqOE"Y~Bc0+>clFT0}zad *Xn▼GQ݊9$P)㖵|Ui|v%W%8eđ+*Qn@ҸKn:0cN*?j|T4s*z$qJSlBQZdU^! &'t[Q v—bQIl8RP*E>bWC~{}ِm]0ҭgo^ Z{); R[zc p~ ː#Ɠ^b>'̦? V i!*f;,wg(S;+jؠ;S]}϶1"`*v1,xݽH}V}*=VoՎh AU06'7PoC9$(IA:٪H;d?݊KX$n*AVn/|T3 ;m׽*qWR+NÿbQU|0%q|j?\å:VQ.$֔,J~M>*au; `V珨$*̣g}횄 |Pkl j 0ѷ\hڄRj8UQN(8[iJӨ 9iP?Θ-[rKU_07kvLB!*G$:e x(l~Ʊയ Fla`jPKMվ=ӯjs1;(kCS\Ӧzm bqCz>fݍ0%rE|wXz_n|0EyTW̦q$.1*_{*EJ1--'oNfC~5e)lI4zc^pS5^lBNZq>XV܏S]U{~ǥGiM05SmZӾn$$CP?/&E.$Zu;;wŠke7*=0y8ZzЀ~x{q>_]+ B6~Y|{إhūNdf i*ҵ#uXjG\2^Sx}"[p)qUZmm nHijͿ/0=YGsgwf_zM_Lm}G9S6*챊=I8ɠ=&qJ^JZ1J~'Y3L.?Ss]x5=F29Ii5CKF1; ,ԇP=';)|m,ޒ5j }\[;H5ܐ:]ey_ uM3`, M_?Dz&=@BrlR"Ө1qỉU!alQG~%ƤþVd[Mk7?-|̴b쁘TRX~F{cRxڟ*v:}6`jN`JWY)B$l£|>$Z@$-6Q@)&O;=}RfwRjj ]aU#VrDz ҝT̡}n6 ^2ڛq37mAk?g,Ȥ'1c:ﰦ,Ĭ?d^?, "xEzT@޻||g.Gc|NLRw [9$K:>ПO_HPz 9ʕ^+vjqHl>]rA<Aی(v*:ueUe +.e4Ev^Яm醩Tڠ]v80'n5RC߯\(eG;W]Ei#/vlƼT4c߰‹vP%O#B} ]USa)v(A@9b߽?ϦB;7aӷmiٸTWzchclǪZ)nzWz{vZֽh|zNJ߱XR wpZ]һTnuv4:U٘T ;ݱK)qC1*% OOWe1v ]ݺ8-]eޛ *wI(> KJ:m ҬnqKJmE;aǮL bt5R$;@•>ʤ`}ʻ{ɫZu)]>ڣm*h~61Z6;-??#auHzo ]vOL(v>cߕv1Avc!zPvX%&+: 즫|Fv6bLj, ׮h.'Hmݘ^;*®NM|0!G᏷'cЃZw%%Iv\l+ZwCr#޿F´늻3Zֿ,BF~R_~eCJPx^fZ2."r01̠TR>+(đҝ[v:Til&MNv= E(?E]N,Be=h70+AڔKju]B:rdY֫S ]H4ޣdA_Mُނ߲ordMR4R8#)ĭ|/~B+*;v[נޠb 4X zza%@v-R+ƹNSֆ Jmנ!ؑ ,bP ʉHح5Y;vFL-riR6=Aʄp['bl]ۦ!]f$PaIW'L]?}>ثsbrCۧj11jx۳#qVv4콼}bP)*  q'b7An$vaN8:\]7Q?cB":1Xznul*GEVtpBg,)U˜web͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊.ONcjrP%eKn>.|5ٔTS_2NPACS_|YK81n7H)H{2D-mJw[ Iĕ {EGo}|PwdSy8ƚZw.{,p-uF{WA[Z Yjxt떍5!># 0>6îM 7=O_{めQJz@H1Qw&S MaL˾%$ԯNlD MENn׿|k8oi9A@{| { cjzˍ{7Az`e*782W?\!.p‹w18POaNغ6,)CWsL81`[sҽ(ƕڥw[Ǣw${X(9vޛFG2W+IF)HY^T@tl>xc~?F^BC$TJA+;1PRo N"~>@~ҤoN?}7朲LnIDZ==&aa#_BS6іbFš,lZ:=q~|Nd-QWlr&OB*ɥAX4 (+Y`{rMJ0441Չ 7&aF@'E|Tdn S7>ծ JE7 AV;{aUyu>>Yt8Zwb'zwDDDIߧ݁jkB4!T;Q0ɾ ZraTX$  _2*OJh6; "1~߳\1HZn6KGXZwa Uߥ<}3ڙ=|>*M<~զ;(EhNEUvޕ~'L^Ĝ @Fzo28J Ol|r#qN%XV|jH=EpS$`3LUs+ ң*isQSwۦ*li OŊt#נ9 VZu UI;tfPթƻ)ujZPbkɅPopL ~9`iA\cRzz0ٗIEUMZm/!1ZSܚBzD{_f&MAĬ{u2 ]ZV?FD2֛ TڍC] h=@ $"n[۽pZh1˵Gp]̕-*Ө)e7=Vrh}YJMKF*6,n*H놕jwLcJVkVf 5;WS+^B:jPnUoLڃ-iڤu1V<2T)pCW bML-ۖ_p #zxbOM݅V2ǧ0*q_l*ni0+_h^XtSkרatZ,nzc$4|FFM rNuڃJe3cݶPkN~m7^rTi_ @=}ȊWXJ_c`VOՖLU6ME~R Ԁ|iVM~_\p#ol(hk1VC@:VDzdY.^Y8~XHg$L cTgm|(-Juox0rՀ'Ƕ<Չ" Z5+mAmE`mُ_RpkݱvJJUOmLzJvn]) ;n(iJQZ?O,SPۡ5̠T 1mS0\q6!&:o !B+RVq9~B+L=T?rGuU SJؘy*F?gsUsN9WeU=U[a?ѵ;kğ8t!\IZA8-1U$a@ Zwfi}k2xƿRk_3m|& ^ f=1qJqAҙLX-Ak5?pQ7=$)p.6u8iҕ||?LdGlA5*n>Uʤ<ԩ4>?#r6=Qƃ~<+n<˿JJIII;2@+!p~UYnu"¾)o6OLKZJ堪Uer߰5 @wGo*yTeۯx*Vvȑmowb6]2H+Vč,0#u#Zb-3 EEA=v?pbqa׸PO"YI7Rgvg.h*|6_iwG*6;VX]= s БYH8UrcNql(va]zdHHvU8.o#˱`KÉZ7VƛC@߯ђ ]cbfoFvW cEhFtTڿ:|HMzқdC94k ]E)wbp:#ˮiNp q `׷anz_v;s;`WcTTz15T;DAJ?\v#2FE*S;q=)\E~XYSW~vHo *#;aNz UbAvP>نO}Wfd+㍡;TWc#Qԟdq5)ڵ%L> N^R)Zv C5}]J(QJW CJW" SN*M+p ڧU)ש-]6]p vD+o =ZHvg= 쳽M);-AڿdoJh>XGq^®AkAx()N;,P.Iv?߿N.֛`Kқ_׉WfVOvYR _|iQJإdSENv`k劻3oF?MiR^8U|v^, v:>CoӮc#`K:{v*z|%]>?iWGIڑT>.U#–t@> T ŀ28S^爢FWLV< e5>yQ+Nl9&G&o:%M}QP&bĺ7$ vP>9b2D}|QekdnT#eѕ?fQKq$PVb'f0q69]\N!+Y ** a&<2 F1_ĝ4^mJ Cj =#h_x~)[ڸ*XT߷U0QS`ȣL)(;8Հb>o&(CǨ5;+%ajI5yB(Oab|fF;|i-Sҷ\xm?▨: ޯMޞ { R0HbX)hiCҴ \>|8iȪAc8yDΫ$ңq^ ޙh|0ڑYEW Zָׯ)SuVH=f(:~KD*AN0 j>)ZVH?sN:o)rJ+ !5|7̀$UHo)KkGQjpʕO>,r* vƆ]čڇ] <U:{iz|VPz4+J+U WOإL?Ϧ!w 1*֢Y7=RMQ=e“Mq@H zwq\D 3Za- -@H^- +~1"%  xBX~!mJvmedSE ~YbU"cqkUYrHh t8Y-'jj6 mUV>Y;U ;ïaV Oaƕ'FE+ÝUq7Q]LF }Bҵ߯L*=" Wo mUwI4?jv8 Z_2PUWƃS*vH=~a n:'lUƴm"WP})b6CU޸栫?r잹j ۨkiKS~pAH!]q;rA*r-*F>آ wMT$$.0lO塨zl*~^amJk;KZt?9Mo Hn?SLn9POŦFڞ8!ZTռ;fl,yH|;orWj+[{W 8-]%Oz(GTᨥ;dik-pt))\T<с !CQX) ڵ18Jڟv4B:_W$8;n탚B;Ap?{m3Ho r\;H|k-]yu=ev&Ǐ>'ju ?`Wf$[;(&*g:sM +^ۧk]X(_PxU+t9oNc퀨vn'|mƘSFlUp{BCu~_1c-.{Q\Ԏ"B]E @`*Ws+;%ٍ5Ǎ.č;Vr|Li+P6X$ćb&"*7ڕ'hvPjjtŋF=1M-@'<<:`[vZ;cWe0ޕ"Fvb޿bVb{mT;ZoQbƓACZ ۳zu].Ɔc\ v;=;-)޻GR좀Mu t Un}r`4!`{wrbҐTu9b@뿎I]+QN`CJiv Fs|3 60; &VQ]:Ҿ9];I"~NzfޝBQM—f :xe5LX0; v`yBipٸ卫MIfٔPm㊻,+'vWۀ)ӧ^i]Ͽ㄄;(E`7M~XCЊ1bTSbVݖ ڧِS'uv8F:AvaS oNJol6w]o_3n\*v<ʽk]RHx .?*ܚ 'f_rGwġءbH)cE** ]TӮvZPmV|)(wejlNƻlfs^K"EOp%٪~kC^IpWW!8/+ń}-Ytkqj .GQ^] o~ٗ"q῎A$A@`C.j?cuJKJjE bu4M2Lim߁.ٹo.J {eR,ñ5piLjO-;4*(9 K*v.z C4؊q v$dq'L-#B h~*W 0;Fv^`k}Wc~1[vYU5 ޿`5l>X{Zt*zV1 6;)2Б]%Kڴ]#ncSBv]jkvYZ]Eٽ>*1v(R"ŕ@ =0(v * +MJdm]:_$m]\cZTtد&$\yʋvujgfn6mUzetF: m}0DTbG]rVH1)ێo`6Z{wq"崊v V70*xS?|Ul Z>'$$uVN%*^1;{6W|4V:hN Jb$y Mx҂HWܜeѕ`V?J-!^kd 0^?NE(+JyA:Wb ~[?5z}٘Oh6q;o۷U@1D5῎4tMtriCUSOfb.B𑰧nH=ؔMw^˜|LI&K^Ў;ۡ7vC%nwߚH—;8iր|B+^; OnۊڔB ~XI>kIJ6㠡z][>2hGpkSompPVaP?a̹|…);T2wd$@;{*FWTPQ#ZJb ˫V? KEz޸m1tƦaTk L*A^1U?ɪoB<צyz[#Ƈc66TҠִEAM"Pn (N*r *S5;ֽ1\7y܏ qВ:aWFXSP0!T ܹ#ӵ1UPM]]PwZIlUpw һVvőW$cWT$C? Z9?,i*i2I.j ߮qhJf|Mq)(qҼ~ck uh= f^NN4W99CP_/\&/ϡ0Y}>W=QEie CV)Wye6߆bn%2C밨=w2kٞbıl*Rޣ늷@hy0%i1 єJXj1=GB z] 8ejPO_l4Søii؟kkl08BBnSV$Ƕu)+Z9 ~1\[aN;mӧ.8Hԡs$5W8v~B ;m_ׁ\vz{o,)O=aUVbHm Th@,VmZ#r4|V{* k UlJxTJArצPl> 1h0%H1 SM銷O6An<*bNv+^qVt9C=<0+t#~e\}:s튵JlVO^8U=z0a͸Q˨"m`_ǦZ4|B +Ҟ\h~:}L p!^~XbB9m ,w={tU}v)MҗsWZJңI\AkNzd6ئoJm|;eS"TSbwy6Z04'8"8þ l4#G؍AZ!E.ƠtES$%$~xF4 E(* N-7Tф_ I?0Q!\2 E aLZ:\bilWsol1g-Jh C>q"gF\,6A>tʖq DȤpA Oca*FYK8V ќ~XTpO7ȚZ$wed*FOn*6AV N=!]rTmNu;K3kNըΘUؙnmUJw02A]{ώN`>(_|xU3'? $D]cIvXnyb]v -A"~ř+JB A@ wټ:dX+sҬuz/6)]зM 1${tG 0"B ?X U&;mĒI Y %hGħoWY N[MnwJ S;gǸSDW^N* NW`97. virؒ׸NHRӁ.KoCn:xĘ܌;v=6x%.}6P:#lز:{mq2e_@-iآyn Lvah;`*캂ĊZ8;7"ͱWf|R]TX)Zj~Մ-Z zC? \ vm--Gv9YE +&e1 ҵ f-wǒ^ <;fb~cq ws^u+oB|zSC 78ُȊxUdTXnU#kĚ<%];|HvZ=.WeTRt(v(;"ƕ (avS@z0v8:m%lE|p+ihvv9TDveZF;JP ]v[|M]Nv]7}`We#5`KP|+-^i]CEGZ8xcN[vc$)ddl]^rN5vH`ʝO$Al|_9'w`ꏁ2FaցBu}Jlo+Pp 奃mj:R2;-|I." PP2Gf.ˏߡ%dzրv5Wc"Z:}"5*6Y~2Ȇ%ؚ&A=%ؠ v~x;Ȓ)4LA{dײnbiL(v81K2֣2k3/7hQy~K}3tf{vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثF0D nFysGI1OM'6SFGjr2.ů;Z+'vl18iS}0l\5QPk)Zs` Q `SY-Ɲw8᥺I,$.\k'2i%_ )_XN^FL.܂{z)Rr ?~rQ*-A?vm[" r$ O~U MAt1$I$Sw1)Iڔ߶DU=ֵ딕Eڔ3vR0<]һB.K#iv/J]+V(m_j{䒰 QnEzl$ݸH-A\%jZi+ow> Y'#'Q(,Q`Sr kA4I xdWsSi\UإH>5 xfjS0 ­Wo*[xo­LA E)_8-.^˕XR}Rq܁ZҔݰ4w9M74Z"tŔcJQ<2hP5.V!$E٠pi? -[78MӾ:aa_& VJaw=v2@c72j6qBZe) (-ZXS~xe|)E~d… ǯjN5C-K>W_e2R`&׮j2. Nj 8+݀ Cq\oAJOkbùL;|ī]N#PčVJ|YO[|z)'4 #֟WO•6M}y`…F!)NSp $75a(A^ t$0Qcb7=w6̹CQI\i֛%ݾƕ!M)yp(Zxc*mEhRƝXiT=Z 3Ǩee+\A۾E Lv w5w|7jM7jLRi={aۦJ#d.2 ר0^4{]c;~;Ҟ8dķNO_cӱAeߗC޽94Ul iQ܃r"iجV޴_Liاԋn{m?Ěv ۦRd.\j wޝzaV3rF 6o$#JFmx i!%ǯ&UǯZP~\pJ[n6w-ـZm` ֣nD{u\iU@AZO~o~aڛ0ZW $Ҟpރ6~I=_ǪJm۷ŠP$?cӱ6.*GJSlAsP k_l^Bn1UmNT<ʅVo,V#P24TZJ " m^',P%oOs~g[?jSׯaCC0O{}>JCኻs]߶Hv2޵}$;?.M; 6=$bA܃Ju}Lv+4xd M;x\b0 7;Fٽ0 'WeAhw Pr%v'*d)j|~,x]OSc-bbau;F cCN![v,O#'bޭA"DyEv߶V`Y[ okڕQ(da$؂7Rԯxއat ~/DSgliewjeD(O*UP=(#tckZM4'с]ȝ߅]mӿٔ\U R? [v`щ)v(5=<6ȫw; a/rrJ]CS=rL]m[oLlː(|]ӠPj)NpЏKT;Qee.:zatCr?dİ.@T{d;+L).iSA%ٸij% A)NW W`A5Nnp;J\4˯Sbe {Wf=CCRNWftߑО;]Nۮ*m|':L(.?Θ^}vZ|T;5I;um]i45iM}nc<(~xHR.̣-ϱ*ݼ:tco'eҴ>ءtHvb6lm.PڠmqC^G|֝Z]:P֛v®ZBF~R$FvߡN*zRG\]4v]@Aq2Pzx튻*(zt\ixv_C^S ] hF%]R:oE!^b@vXtcƄ~9#m?,..޽e31rzMj]GhIO|8:/s< ܷ?lF,iMN#4D0.ʌq;n};f9w)ؑ8PN&p\Ek kZ:;P)Ozz;cAĝ vXkL p mWf?u.ǩӧ݀يTo m._]2|;x ǧZȥ٘ͿCC)v[(;))J]"oA"U.AZS|~u2ADO;^*z/?$X"kO놕USZ㷷8v<2ҽ;1WcFa 55uKG~7\_V1 1vqB oE;͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث]e6ոohe_?OS\sqڃrOM8QZ}݂I bO C+Q w\Ub294'Ȫ1 ,mI=7+$4kK7+N5'߆ka+g2BIק``:H6yvƿ1cbڽ; 3T 0>]sRZ(.A)ʻOK8v9:Ȇ?JaxJ]b#}`bPw'sEj<mF ~Xmj)LJ&%+4NYB!RE(@mP7>x;kRIP_o$:"vV1ؼJH'oҡ+ iw.)m܉CB)>w6J'm+W|+e1T$)jߧl+A4ڸiV֔ 1Z_1~APZ#(92nUrZ֧jc%KP5+QJ\*>XhAMUɕ(hۊۯ{qC]0B1+A&I;]2jԐ7FkȠ_o]2V>j)ylFV9+Jk!jjGR`fB6(H IGp:oCa yTSPi2%U'ȁޝ]+~l,58:/6ɄLǎ#q~ԎTw;:erA(sPp lbra6H@_L)Ro}9>8J\ W1?lNP5mLUԧˮ6LU ~Z 4;xcS*'aFEr=ؓlBU^2T `CRz|E@~\ ) b^1W]DlfEv4lL\ι.iCR-{=pzSnn;% p0RB{ԮثЃֿ %qtbR:djq$JB)\u'VoQcASP(EH4)k~zuۦ ai\Ά}l*jljO~}c\AAP*=dWK= |U)46Uу#,4~ O|1(IO ^3";4I.j?PrbMt5ZǷQp%Jo\2%8$:,%KUާmǷ0'̖aڔ{Wh7'VHشH pWT6.i 8-lۡ xvC@05qbEi[v=)l_K;P5 AwciwLolFcjslJ=<6ҜIP;{cj;a n~v)Z0+U=s +ԭ=EO`h \TV1k%\ZOoUuhہկL|I_ ؎ -RN-oR)ǷIJj)zD#憣\*vL,LAwOfJ()CP)ڿr>;rX۶;g2a1<˳9|Κ֓.t |GӖeq˄eLupX劃5{H|{Ÿ7?RE.$;w_o |d/ӹG?EIڧ`OpmK$bT؍.Pөd1j9tMj~tQB6R͐ZLڄ}?rzKp? &; p 1?RE2d6nNaRjh*{RR},޿E;9bqBHlJK„6cXz*InkM۶Ng]%* =X1'm4zBc<j|?M;*N#2e}^jwYv,&ȝزƇd|;o0&݋@A5Rk]0&7"}XN vY Y)!Y& I T2JePoA7~*]q N1vTB޵5_őҟ=R)ESޣnՊPkC_jO+BAzvk1P@? mT_pbI$!]oZ 5ja- ZniXO`OQO_6n:jWaˏ|Xz0 9Rw?e;뀅s9*>[Pq5ڻfFmg$b`TPUEM; ODɘ⋎jx{vbtTd d]8;^~43qs˛9"EGA&<p- ֻ~34[Nܗs2;a|A Fd 0!`P@vPCSaKE>*r4] hG=VݛWv8wM6c$Uتڛ5?g"UT5 %ٍI*+]Sc5p=C1ǰ+l;E4Ʊ5~RR*@"U j<]i®`]xQB >X  )QEa)vS=G)v[PWbf-5'1CtެIOve=(;] ~ܟ;,h7=`We(*7t—e6!]7q0oኻ{`Wf)vX z(@۽~WcnFve906ot*K"F*z b[|@j|xd: 4/9ھ.4$o_pj8jT)BWƕ۾آl~rR{j|-P~]|xӏÏQ_[LcT ?<' TԐ>].4Ol4 R44kx`)^7=kNqyК,R+Gfk)t=Ha7(ɭ5nŷ4"Y6ʸ)4B"fOqU[sQiL(zo!j_$69~׳~+J{2o`|v+CR70"G_ou\]HOkM&? t!#9>9?F 7Az~z;K_<\`WmkSyzT8 QW~ Yܚ04'?¾c͓)%@$T@YE5 Tl)9"qZaQO=I5{{ }9#'j,Xx?g:%ɐ\ )B 7Ο <4$5ed*c j4JNVDx"⽇ RbRGbSɅv?$T Ǎ0%؞j~{V-O W߿žIʆV~mٚARIS:1c ZݒM7MP ]o|۱ƣ})+M]Rd0Iz2)v-=:{i]uF6,pӵGKDWG05?ǮkH8Jz?ramIÞ8* vx_g TdO.;'µeBh^;bt Zr qJi $TW{;ME+XH <ņM@ny|둥r=8XimQxqT@/ËkM +O!J@I!*7?%R*jk1Bt~^=_,'REH 푤U`AaJUXې}TðmʴآcJV<" G@U{9T0rB|,*b:tCzJB S 5{lƃ|!!LZ S<= F![z&hF;XƞoLWPzOɅv&UH+iv!3Kzcn<XŐq Y zd 'b@-ȥe|O'cdb(EwE6M.8knƭj6&(v5s 1.,@Iv_`vbE)lm<ݗA@v=a`*Fu0c*7=dm]Uk G]PnT wݖ.Jpp,ܐ:kX&ݎAcNmMʵEAؑ"6;$7CO՚# xقҸv=z'S {QXۘbvC?hs+kM-N1! ~ ˁcN̯+m-ؚMO#Jx#zbvXޞ v8$nEۮv9(M] .ǠAUf'n;/㱧#MNĝKWnFHb &d1m|{Y;Gڥ 7C: t̓cH=Nŀ"; ӱae;Rj.Mkl]!vϰ S~B3=]+O WcSOՋvP) H(vqWbj*çA഻0 E@>F>zzVNH"7JB@]Ug4K;P{c]"Wf@w߮*€rbzv瀫TA{ȫRM71]deY#V244ƃ$7"e %.䖑 ARZ -}>9[-;Sno BK +%ː +_@Ĕ;O U+]qLWbE&ڣ+d4JT@A.ht-br2%vS]$ԂGZ!d*ؓciZiWc v7B@놭ʪbHQ/U=Ac;31Z=%f4,Pq:R|K'bO]Yv]9 /cP*1Ǩe &}7qz˶*9==xW\݈j m .1ʑJ*;Б0j_\U ݲV.^`^vM*Nw8!H$SqҠhA4H´cdQkJV.(\iloAצ5,"wR5*) uɡj+\ҵ9 ^mIʘ+/SSIJȆANo 5wɥL_3\Ҫ&xZJbFIۧ! 61ƘR9qֿ )i-7e@"sb:ت UMqz#?cjkJD]uf@BtS!&2K0ao"sZ &Xu,;ֵf< d ֝ oQ*c<fclØWF9ni^倲PS(4R>-EkJS;IiZ1Zڇq\![oqT}iE$)0L߯_ᰔ8fcV#"xPW_-ǀ@ uXUeGo|qcOmǚiҕBᅥ%ȓ?lJw18 oқݱxdz ֣ z֝i.)lLvΌ?9 R~ֽ?!{ +/~3ۡGtU >kO!n[.@b>'j|@9bEȵ$+RƇ}3H%Ƨ smU݄2ۏpWfl{'M40$ *]eȯ"9*H|B]@v4|0+Ba]8Qa%Z6栅SBztژ퉢Ҧ%] E55؂i" j)QHOד膆&^[a۠Ƅ w$7nCq;?^%.%퀕v(nGnF(Dc 8ִp+g] `ONV\55j){ƸJ|2̄PWӒkQ j?6SW6U|B@"U3[lBeFWbE?qV XQڝW qMXUdFs Wj/N {p?*A{ZӶ6Z_<ִFJ,6 Һ$ҵ#lD# ( >bK'!k#Չ;@v K85\! Y,(T~cJҸ5jֽG˿)oUv鉘:HS~bSj֘1xj:f m pdٮ%(J Z bh~4iUzo߹qu2me*!(zI} W,2*蚐Bğ Sz eEeWnnO prhp@}4tZC׏~1#NY55**6WU;|3R`v]ۡح*Td |?E o5?lg ^)S\jv܍7#jƹBs} {,7% b6RE;3w!7hgށ*bNK?O.s>d[] #bSW>OGH mȹeǹuwIE˚MzFz ٪(S.@U5%Oq[ax^s fyȮv [],69 *7~h6= ֐*4;l v+Jnvl"%]%RWKTW{]?rA- o*`Z{:=SyvT޻vRq^qJۓA:޿1i-DPКS aBS%&ટW.+|*rH* S}XoV$+3tka 1jTzy{?N>aMQN?&ΧK+K+g P+72G?"=)keߑd q'N׮YJ*;%]{]6 en40R]O1۳U|ޓPJxeZӐ߯X-]}YRr`n~lv++Z൧cj/_*쵌VkvZ)O〕vcJT;,*=kC)v5,NWc k](!_V{צ$p~2\KL oq1bm mqS ӭ1SIj}]OݑOP NRC;vGOP_i $Zw e=h?ž406$d#ďd1]\zub>3;Zo fDKb rjP |]^vSv?=We=Ev=KWn%ـ+#(n@bŕ:Wj]; TV PvUصiZSOW Ev'`WbКk+*Gǫ'auڱ&O˦d@b)҂!كUWz]jn;~ĩVS1CܐGS~5]5Hq;8-‡e*֡M~|6f-Z= Wbm#s|We5qNثDRbf TM61  7|.hx]:Nv=ցE6`ON1+LFԡ5ˍ(iąv8 RF첧۱LUDv*Z)Nǵ PNo+w{E`ԩbz`(vn#w"Kjj|G8]mvj Vk-)\Jڄue)ǀ=~x;nAPىA vȔ;6KuQLRP ;UAƣ}mݕMt0%(>XC>Zs]]NvZi]ũMrcT $U!N"b, @xN!vA|(j~\SN^oh\zƿ ʟC6OI_&,ZFSR v{ -_r Rd%v; .B_zw:bvCVPQؘvZ2HvQ;Pn;;-EOWn݂ݕzVPf]}rYv_acivX )?kI;{+NƑ]vabzQ\Ro@ޣ]r|j8v>Lv' UU#2v9 j\]_ 촠/{bUjW]F*xw?GÑ" U-`;@‡bdC̰uӢ2= V/;9A΍㝕6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ٛ-@"/i Ihk.@(35=;`kkB,mػ44]H40MqcCh{cmqELFC»Jou5a`j\!dL2i@IL=44͎!J.e4~3Uو N 6ּsCjreVZ$oJlkucL/ś}m*d)M9(PlO#-BZAM 6hx}Θn+FF7h~U ProQoY$8Ac۽kOjaWw!b+UV6!䭒-k^6Ʉ!ïjm֙b!܆=)A m2RZ=N緾VXF1H&np_rAIM–#|DY +Sbcwp+UP|0ڴF=QM|R)w}ϖ)lf~$q6p1u2ѩ))Mߒ NSF߶6 P:W )_ xҽ1q0jv8na?eZFZzl:*kraAU[/ T7=rAV0JG &׶cV*;z}ث_,Tt E,)B|Wzn8ccJW-rGP J{ @NTSDSq7vE6Ɲ6ߑBHN( 1lWeďpM=Q7dyA1*:OLҤPx bK LΥ $p GAQlbFX]1ÏVx îbl,(}'?k#bZ#r(iڿkg<{|BJ}=JG2цgTEp+!ZP.F|SMT_Y~kޜf|}L2 ~*1υs#ѵ:)8\wK#Jm\jRgX^ JQ_~?eco02DAi7 ÊS|!҆7M2Bܕ><[c>#  l&;֕i&qiFU&LO#+ǖb=[ɒwkQZ:JL2Vvܾy]ZS(SUْQRT!.yRb$OS`vPj , ޣzxUا Ph6i.Cq:i.ŖP~v,$4j\R]R;V`޽E)Z+@ 94JE;oA늩A˧4E:J\7qEP{UOzSb-XJxw1U9XP)cO f5@߯qHq oSN<VM7]Rv55aRzt6Ā$CeJzyF+ CZv xdU ,&ڸrOw¨iۑҵg$4'zb.WZAW-j;9R 6K+/2gE2,2r>5`>@{3fu8]m# M;3XS^5d^bGdvdUgc"bva9EF8Y[>c^8Sn |#傓n4kAヅIvY8(N+Q-3J*:DWٖqֿpƗٖM)Ą۲@w'n0v$H"PP޸XS;Ȳv)ҝDv h UPiZ1ĵ{12cR㆗z|7])㘶bp4ȖjPfn<MjV篶eFH!؁A׾YlMEI`We/SQ]v8ҽ)v;j)v9Tn|LUkֆ;`Wc?WbTr>Yv~<<),WbhX 2D+|-yub>YAd̵JV8PDm0LCa)!\,K8(zmڻ䤀y1K.X;*5PH"|0!ـ؏Nmm.SA>rJa&7;\/э *@+B۱ 9%v<6> ) ;]](}v:*CH5,*aZׯjҭMǮ)ًmJ]ƟO* ). ]JWeҤijjvxdRL((|kDZx0vQqQRiBN+;צ{IWe.4NOv4 נSL]>R=}WcJPcMxz} v<ۯ+-p+ b"؝)v8u뿆)vn??,-:W]cJKEZCsZp%إ ZE.Ŗ~cP PI֦a, ]OP'Nٍݮgd5Z9T eļ3%؉k95vd5;%.S]c7Mw!٫J^ݚmaZvPZew 2xIva$;1^/n1]g]-jX҆*S#JeI~$Ǭ{4逅vUAz*UHiZOא hn2IvzRY6͋yPPۭ6W6-M4;BO(GS1m1hpP;aCvOf 9A\sWs}>r nݳ['jɆ+\Tv'iC,JA‡(1֟(Vv遜BM2*ۗmndN)5)k]:uq;{SH(ZwoD@I* k׶+^J%PwboI wz-J+Z#)@:mSd-d6+7m*UF }O]I; 6!I`yq5CZlL˶o ѐ6ޭӍ:xdE+m5'&M<|8]ZऻUyPԂuR-܅ p1VƷ;To koJrlj2#iA}'eSSV`F x >=>:\z14 m%*]1ۧ\ 73Ʀޙ7@Uu~쒵Ze*I\(:cٙIp i_  _|@^p|u WgG, ^v%|v'ut1\ eV uTĻI+ Wp9D*OZNHM :SH[L c6q8;V F1hhrJ n9+J5C'~YīDurT iᐒFZvC 3a|UjGˏ&]y }LWH_6Vv>it@洭cbjk6p7T^ȳo@?FYǯl]mK>XQ@v>p"Aj4sA|2,<JPEG+I  Њ}?nrJzv)qhyoޝJv]|Aaִpo?N9Ho}9$-Pv5ڵe+*v8S`U,MTTY[nJ~E-Mw j WH e{`*CӭIl(j  i5jpG="~(*|+r%i   :TB{u"'TSHN*.{uwYD!nkmLt+?ם.Pu6^]&5ۯEwb ZA]xn#&^2IP݁ 7~=s74=)ze+Pn;إMw޴?)u1Pj1sGZ-EN܋SxE[bϿ6xي:&tUڿ\}|{_Xf ¤SƍJqAAni-'&${F$Tu +zm]r/Q_~߫lhLTܟ­ߦaV5TnkjW.#['BwY`zJx @ VJfe]WÊ\[*cHwS@P( W-v|@/C|r~UcM*iqj㋊¸U"NOnXNZOj,4V~:7۾ت#jii x٩W:mڸlm\(6 EQ~LZaű^}aSÖ»buqsrIY_@GTmնT؞U=((&5gK1*q_d;eSPrijtچ6G]&*֠5nkCqCJl{8V YcQ@>x*݆WȷD+ݎtO@V9lZ7cz.XȭFPGA=o՗lw=U?X@N0W3;w=?Ru: 2{' /-=~BY N#<)l9JdPMaSFۢ)qp˙A PO(_)wo'\J]({6%b }p4[b~ckmJjzIkl|E߽|sF˛A^ndA~bi$/Zx6` o^_'wݞxp: 7eTj9Ep3IZTִ++!U8w]g ǎ#ƴ=ё#d1 Ez]tč*ájdNƘ 'èFKS^ק$<\H"J$ u~Lva7 m] 5Zvb ;^.*>4]Zҽ{dKdn@}y-.HkZn B]$P!L#pR|E+qRji׷&2>$q =|~,EM lOd*4c ƝHJқt45O#^=_^Uq?Ϯ( )ڝ- S4nX8p!KϏb;RˁhcŹzl~wP\roN1JݶNwÏS@iaFDB :*EjOO|mҊQh7?O]nf;FƛRA9nGК$&^[.feo]ּ#3ozVwb^N;KaڸS*vQ/ ?:Zv$tj~ x]-fܚ\.WCr$x"cBZjoLf SQF~uv&Z(zҝ[IxDnti]ܰE\Hjyxnb 3+mzOu$%BF#r~$(. F݊,GM!$}) We?,Rh=ƭ]G0R ukJcV즐邒쪰pһ)Ӹ=C$+$n:JbRM:K.ƣ+vX P^9!.3 Nz<+ӄhiJ~`;dJ]"5\AC=iRIGXb⧏H3GO㕄;1ОϮJQ7ߦ@ٝWu뮂8 $eJdj1;8HPmK ]$PMp+n AWck9kWc;(:d~vȡ@I"7*PR 7]~T֟NJ9ҧ,W.Ư;W ¢_ P]ONv<--.Z~  ]vjZE;튻,v8 l|qE;5]A=eȓӷʸRq MNP.€S6v8 *7zZvY޽O)ӱ:ro^¡(~oeujq;,vNF*VLUٷ4]M[*rE*ioCש.@Fv<]FWpq*=qWc RwIJВWcp;|B]*vJ`M@.LarȱvO|M Gu46beE'rQwI%N2E5w&kC02v-<Y ZFM .(޵Xkpv9#-zo^YiY]wڙc[~,x8ݍ$F]e6鍢޽w—e5u;5{]4=0{N-m;oC:WjvnuӲ~-N%ChL.ƤׯQOnn=64vZQ72(M(AƕQGv[-j<\ |6e R=WfZRؕvUd$~c+ƒNdƵ'Wer{bZ(v8Rv`K„F~czFY[v:~%ؚA@GO&@~F?p9v=l Xb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*CYzU~眿iOrOjy2Zڢmぃ@ʧm]\8buΕ!sB>]2\6l =1 @>(:y`qm7'æ! }l"2H +_,I@HA4C -*l4hϸaIhLy L+R`{q+}2M@+^T";rw=j{3A9Yrv4)AIr63M(ZVKA4@-C4gũmJwwZڏ aC#v=0,z!%D*ӠĚRQPmxBxִl%[ŗkZ~Ra5zܟ\*/iW+@=G4>9$$W&MK+{a۱Nm<)LAJ.ܚ煎T Bћu_90XWo]*^Jk]qE-ִ­r~̡qr%W!~xu5k/x~)ZM:*F5FnEiRP}KQƣrixZIu$MN[QLj;rPkO n_VD*BX!CcZ\ ;4)ǻaJpۂ_f SaP>]ir߈pAJw; UJ3 H5j+O=3)SC~ u^wS6IasU>Kx%4%wdB6*4?_N$>7 9t#4wGĜTøZJI=q(f{d)WXN;(޽=Kpjt# I-r$O\ݎ]+튴wc@ S['ŏOэ*a@zҮ%)U5N)\"iN{|pJw={*N%(?,kmI=ir)^ 2I-Zבçit?eᅗ,MVCϸ,@*;gA`0KȨ5kk}[W6\HlwGnYsr`>#8w)YSsD9ҞcA  aW"ɓQw$ڛ-nj?!\ +4аMo54SoIwLuyP{Ň\WW2eFMrTòӕGQXceڧa^U7H@ڴ\1u]nvVG:iRCWȮ.\?M:u39$+cr*젆N'5;;2Z%)P}ڴqtR)^7CEmքJo_?l*~v5^? u1;| B!0nGpEplAU45L!#5>k%܎RԚW{Ӡl*C*ӵK"wK=1B*BĞ啦4pJ: ̠$L!qTjmrGWoI.,{,m:ŋ / Bo| j7,u#>P$Į*G,I! |ؘ*[d؃N&F>>fs$zM ֟,7=fn!bW"HJ.|MJm~dV( (kB?k09}kmإ Okh}Ϧ@)q1 ;u߯F?\Os톙$ Sʞk`TY1Fo_k/$ֹeJT폎@uF4IB~&zxW#k]@n%zHҝ;w5`MFQvZSӜCrB]Z3źFc gip{Cg52_fcW:)_pp.eSldWV5an=b 4bn VS(n]OH1~ܝG_v囤ͲZ9,X;;0({f`JV*82 ŬkRVV$Ss *TE(WmNr͑iVGMToPE?𼱒|5qjTO/7;m# ;Q]ɑW%ɡ"܊;Ƥ<;E,Ê5wSAjĂ|TĥnÈ،M (vS))L4ۥ:se(UiC@oShT58NđK M+cH؍zOwһ2Tӿp~4cd @wRJF ʴT|$cyv#l4c T{~*L6] W!iv+N/l Zv#jҕ99r뿽rdQ`׾V`4'{4V *;{oV(!7NvS,zS)9I'jxtb ZӈoXJS/z HX V5R(7>4\h7>?DDOlI' Z{|4h{o銡Sz 5;|?9Z'P0'a-.Ǡ^EHcU?zte ڲ@If~u99TѺZN`E<~._z͹粁ޙzD&2M Sm+9[J c+ڸ q5EI$p[ M#Ԓz{2@%{/U im4`II"j;ӎZE'ɍ]ECQoՓyMHaBzbhFkJᰇcU"—bM6&"6S&f^?+r'|OcJPUw#o0$cj֠]޸94ʩնvR jHָ).ˮ|~Gv`vzxbxߧ߁9dy~; v7vWc<2)v*`Uc[z5ʥd7dKIH$ zfLVi`qS("#:-Lǔm aWeFH!ؐRz:ػ)V|m]D, NOWblA^FjV8"뀕$v vX, X}bU5#+Aztʭ%AaN§ڹbs7}ώ<0_ry-)ӭ2"Ļ>W c$l0;SƟ%]ME:{*Q- Ȓç!ؓ4RvɆ.A;P b\(zڻ1CS鍡І)ޘ]_s܍Wc;*Vw؞w\(v8!f6]@m%voH v=ic@-Z6v;'pq&FNEw0q"!lxNƴ|GJ ڻ)@=pNZ푺E;2鍥iJaǠ|5vڴ] VSCޙ?^O\Fzv`x:`Cኻ`)?VWcXOq) qJc(p$w41vnxv< vY; qK蠮߁c!{~8| v(RzRK7`yքV,OPa!ؒ)֝G_$J۰R|sxtY.ΛoLyj;&VXiv[TzF]{֝(TPZ,~å+N. ewez)Sۮ(v1kcMvbVt?hzҸ[. zw8ӲzS?F*p~66.xׯQWbFd;4vޞ4 ؗc; |/|"#|3'N.cjc?vrS#;+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊2_\GkGr& g4h8(gFdeg##KIWdh%كR:`ۦ8H@E푻VXԨAoCZ_釛Yj(A:.Ʀ{Iv +٧aS4Sb{  |Tn4ą DW R܍O,saZ9o:!lq߰pώ4hI>w̷ku>fWS8 z冄EE~}>\r%}r{@4oz$KL+mƫRzL Їn"T%Vl k dV)܆;oՀ6 V| a}+ʨcI\qEY>*,mqo7[v$V{*`%C TJWrZt'Ʉe.qڄl2HR f5>+a\Zo1N8H@+bo®\)\Q8Ҁ$ɫ]P$m׵pxb-?IXBك-(x PrCx(P&Qe M*Gp M|fUzҸڻeՈ)C+O4)q )c$ĜyIꢻN|NF 6(lrJÑlPl}J|]X(kO$e+ׯ| Son ^cU*:z7LlwաCkmJ!ϰ8'jqCƢL*:z8$JF=GN~ qK קtͦ8m_Hcڠ;S@flSOjم6qDh^[c<~DtWdPN 6sA'4=vݹ//~Ei)TY\sw4GLUXLj4߷okW}n6J(b?^hbe|)5J7?_UpƀVqOuqMIzJ`T ZcMrwP'-4$uh85#p~)-6?|I~T;aM\q=:ױ…}|h0Rۉ1z)m~-L̥HpjĀkQcuOLQGGQA׭k1 ѭ<:^Wƞ;b?-}3P~* ƧWsrP:ta PT)"OV֠"/I\s&=|4fH&֠LjRt; ZzGCQ9MMkQ?˹zE{wD`ϱ:u)}ˆ>;;tojcR@SREMzw,I6;0,IS@"?kq J]WMG댍543-Θ72dU>gHqѶDsr&@j)tV΁rk( vU}FUg6\r4 ֕BPICHi%UJ='ÈaegvYLQ{kӧqA9.7[Q{x cT%s/k>Ͼ4G1Qj =WKU;SV[ej>_Mr/&QÎ$[^HxPP5ȶ|oG%t?hGnGZ7-&-8I?[nXGsб1MQh:3'pA0˶q] aSУ7-wۗ]~ujs,V=%4>7&pIvp'wP7$ C (|rLQ؂v׷0p N5}"+p Z?GN%v$Xt:$wJ~@K&*JxBϿ NBP; 푴 dO$WP7JWL"4EH\d P@PGG_%: @ք08.6帩?rqJZ=_pLծ ZSjo!RԊo_U 5#p** n;H j7"BƇ|MX 7;_ |'iwƵ8:Zu vB =54SsS)3bƾD)vNؕY#>t7$ A¾8A@EAKkjv3Xx̎BFߎ[F2- W}`A E~9s֠#~uWzKO|3MۦRJ]*GR= f Ƥ8 |8; q.G|AɎɋ(`9/l|A$>\"lj؍yu&%ڝ:S W We >)vRҕ] #ݶcQ4Wn!]cCZF WfBO(v8-M@;/¸PRpRmP ~i]E'jWKSWfN´;]=Vv;dUk^v9N?`WfjSbc5{`WcZou1Wc'.a5]|r$Zm!ӵ!ySzB>Y('Dd prR>lǔ/F_ufxa y = CҔ#3!hRZ )i ;E n+qQT$l;߀v) -GD%ؗkM_%tb\( }Vbqmv>n>K?dR~Y1ӽF2v8 TdI9r$>_Yhev'pk_Յ]Ƶ5.,`zjWZO|r* aPMVv0~Ċu+ ()51CSmjkaWeOji|B;v`9SmbSM]GoAU4rLv8CRE $ӱO@xSOKxaҝxr[ Szt0q"M8m4gNƘxoӱ2ToWejqE-]$*r)Ӳ>~܏z{Cp#fևWe^&qWcJm *t1 i1C| BvO1UJx.þ|qC6-w?~)vYZ |X*:VOJ2*(i*pP;W呴;@=zxБ_Kp nE.̃PU FDQzRF Wbtrv8JH9خn&D4b)ɦ4kodGb[w4.ֽz@ }1Wf~8ڻ IK`zSWfU^,T;h(4iv,#^TiާWkN;PRy]ޮ܃OvkR6heԁkM;-"=GO;7+Ǹ1eW}ljiF߈^ӳzTB;W6ibIm˹]LcMcQ?, &BA<6ƕDz74.868ꡫ޹1H`RRH((OZųriH;4!A$װg>[#P6G݅l+ B ߓnwvI6zbInѝ: uq?_ ]\}:–Z^THhiS]LNöwgoڠr[:=pJ X*@19Rw,%W/\I~:r*!+V$t+HXOaJSMk׮(!Et]NDn@E[mSIޟI#( W-)7=͸SnũRzzm&Vh ޟۊM+I\1tiCƒ1PtJӷÑ7qƊAoWbscCƄmk"*I:w5J\20G?q;nS؏qv9 (Hb#oH*|q)WM7iUpƸ #=vdj ‡\y~p픕,*A;K)ՍkMut*6qlۮQ؊vk)m|qJ~],:ps];uVݒR\w]rmzb@;}4 c a6`:C듈HQm}{ ~W|U88T˹=O(5 Wjȥ|vrT:5v?@R̬JҔc1V.BLUٿcj­.\NT4;)&A[;*qj\n&%$S*^F*6kt hwYі!TB:/4l\1bYI=<;S*,J)F0",(7̓1v5!O2l ^4MX'S3jqOK$) w?~L9|rt2݆[(4'b$TbȡzNEOȥu2|]w+H J6(xK޹Zޝvh A+A~N@lc[V*ơkCv8FM+߶: VأQġ2XѫZnjrnI®0D`~ 0ؚmA+^2a'E[8okxA+Hdߧ\7]w9R-UR@x.&@1 <@A/@x) Ŷ ʶVWzR(},j-(7fnL^c C֘ jE<*lD~*>Mڠ/n8U-~BSCUEj &ƸBjvƕ?qV;T҃sKXJ, 1*[Ѯ*{V&#=vauX gcQP–CE<>xU>d{ UƊ 5@*ARJ9|vaT") -AO¹7ńD{v? -XyPzl47ˑ/NW+RҼ[ tڛ@4}C)ӿp. L- :o-+0`nvJkZSsS݆݆=I5nをPsr֝kN0RӾ›̱RSmBk4]2TA$>t JZ ^==,||Gȥ4cA{⭣TP9\6ƕCկzaZ-c)^& ǔ?iJ k-v^@`KPv|IF;)oli*SAU }rT 5Ȍ[_ ;ڛIJTW &2 IoYD`)ֽLB<ѳ|جM; 6&6#mO]!i]n;=i 9A'ZBH_<6cxPcj*;U֏biҸm]a znF6tӧlia (civT!{ v3' ;ÿs0ڻ(\(vSWeڝNWe}5ف]ހl>X-.ƆT v4;+ *j=|1Wei߯1Wc6 C)P;ڂ!]RCJ@$=ҟz+Nbv9zӸL]S})v=Sg6*r>bZ~g6ȕv<7]һUo%.H* mb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊;/l l%f%%iC1h3LjܑC_1y]ڸD"v Z,G!u"@K8QBztxcbNW*Mq$W4;ڍp!1 @O?!D4QT+cDs a(nD%+t' `SW2#΋ %7(848}[m7 8Zk?3|tXryw\ۀ樬~?dSS{TS^j*~)qsGoa  ɦn3c=U#l;vmYm) AV>4^ K\tևzإz׿l #PcKUdbWjRO Kx؁}5O;aqPTԂE:L ";:0)g=bh9m(m6=%2"r="z {`JR Ov 閆Hc bКmªFzS~ۍ#sES~U| Z `M}?^QLvA]ˏ,] |1KQUxoœACB7~Bֻ|Y*Ȕ޴Ǣ|k@:60+1W!Z$ ?^!49|LF?bC4^k8e~0OW~w?uk"/݈V qOx͸Id2`B/A^n5܀i:Ӯ4Ɗ jWk.ńu'|6HơS~4 {džޕ; @{ēJWb[$7) k+Gn|uN0CIN46} J7F9v=:uF[oUd!V&,j11-\J TR:T |Q~#» R~\?7^;$:*= Y l V%zW+ bD_4Ɛ1hU2@S ŭt4LRu1"Ze1v'b: )X1`I4oՀgP cJyA L;AL/wʉbQ0 㰮-,Ej~*O|YTT)5 KUDBGrOQO+J4F0ԝ{qQ,iF߁RFқBJn) 11@ylWq n=1d4LH+pB4 G]m60$mᱴ[DS|Ou"JTզ\p~@|[ [EequOs'HA^'T[ʹW>5̵ ZS]ʻWK\衅HXWTd%V^\ѿ"HsWo azÒPn)QCOE6icf٫zSv6f1s#; \W.e;7O@U>In~dbuj?fmg idqTԩSop9n%':?Ah0كu|GV[q=ۧ]^4XUm-(1JkuqhbMxM{ņڮ5,ocKn,*q2ynڝO˯,-sEC_P0Ow4z2ZLj'~CCNW{, q_FO~IMh+ԏ?g"@iP6oƸUM<:o\ )lX" o+:z S´*U0V;cR*hR<;`[AҾVFDOS@悛N q ?ϾXV)vbڢ="֣jmiͷ:lT/@*MF(YȒH޸Vz?1JkOl'Zu *%F2+Zam(n5SLH-9WjPq@I4~));x{t̨[m Co*S۷zǹ#RT&h:|1W~ҷ +Z!b߉߶H( &µۮ+13|$uYn:=|)C'N2U4h|BX\.j OP$RN4$>-~A# a45 ~!wqޱn7$bv)RZ*GA Qr:S9Xҕ`BJ@UWqJRZ>Jl*7J?SĤoc]~:UO¸Tcͺ;!oMђGOpDHZC~[M~x7L~;ہ4feJ$r^&⸛-vzf,R Sm"JpE:Xi BNǭ?(,’2A+N;v-Hv͛^НDtEjڅy1 9#6c$Pl# 8G'0/#l$3r$t%WĴ'S^3.&mE ׭hmq(~ x9(fVdZ.%r! Rz\@Daaˋ5'YOj$ģ y4Sߔy^SUVN ͓G'aXƶ^4Ԟ]漳Ol_FBsb̫NZ T|AĝwXq eR )PzʈHNmg*n_؃e*Sn%aYq$$qZb_~,a֣ZץG%9Y Maۚ Ï>X-zxu1j,Ifw}_SJr;^UWJRZC 8R T1HvbH,=e~M߆)e_`;*=0܂8)]~:We7%ٔV|4onؔecZP~ !+K'f|@=xPRWe5v<#тj )Mۃ0;]W5n+.Jƀu݀hA2)vjnqC=Z(SQ.ƃ+nCӦæ W`ׇݺe3vAz$:t?1Ӱ+ęxJؑaTa^ n fbhrzk6O*s(N'25Wjɝ] ?r |vMA?OVr6`s^zx.Œxg+*Q;Ơ5 PtC$a}t/RNWXbfGmay|qWbF=7ޙv(FFDnb7;o\!Hv#BvS'ǪUnv?aHeN2M@4`v б묨4OC_ eFL;\EW`;|بunƽr()F{v1j>i.5۽2\,mٽ`Fƾ?&ݖ.@5;LxVݙN xbVݗNj}R۳‡/j)CҸR!Ӿ RT,!,pWbt0ٽ0H$SavQ߮*]k‡eJRͰ'j<֝T ‚;{v;'ZҔ5T*쭛qV<쾀>N'@k\Ub:)jz߾;,/ivYCJwov5ߦm]E&ֵ]]R*{ v+ަDآ!#a!jU=75Ȕ`k֝qvJn#i9NFh2结sEwH*ߎgiQTQ@F&3& L[ }8F-Rj{y1bClj] b~tɫ0H~2Vc_vYR QAv`7jxtxm֞~8;*5‡eP^6‡eOZĄO(.Nht®;Vo jc5~y%v]hZۧ\ Wv='í;`*^4)(:Wd A~[m.ǰw5| v8E:ҧ1dIdz$rϒ/O| J֝(k[vWm_fA*wGN"/Oo}[v6Iڛ xcy1  +Po&S *SQ1We5e4}CkNǪ鑴; VJAA=}Ͼ;aZWɱ._4\_fxkm܇Eڑ7d7<ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊:mb).hPn{f?IZ#K{|H{f%4k]4=`1uvSF(iVT}>v4Tl$=̧t(8d<(Zqax W 4Oéˢw!Zmiru4"!EꚄvFG$ 훼0#Z}ZKvg ,ho)b[{sV'pX}?+ 9ghc (63rUt`18,kJ`V'5®zJpcJpxSWVqd ֵ%JCLq@H???\*bz ҍ=~X)&6#îTUXmހ;Jb=:{w?HpjJ;HPpz5}qTҞ5J7\NE.SH#PƇ{,(؇<OefZं+5*>mqC @-AM #ݺ@;S%JKDŽ~"AQƑm\pABMA;KmT$ )>G邓kTaZ}8-Wbh*w"r*RWcJtPiޝqKx/Ɣ;$'#oBO}gHLCBirB-,{·mʀ=GqG#fy-[,*G~_,ma4oSh'uj|h Tҕ|{`MH*xֿ:9h(kjǮ[ZƻS2ljk)Gִ5]*悾$n6R; Vƭf\0bPNփoգFkdyN+ʵp= [uqeH"5ʝrIC Sƕ{=+ &^^j+݀˜Ҽ W TjmAJTHƖ׶%.5a\S O]欰 ǥ )`?Nۈq&+i/V#c)VUz Ioׯo(P|r{ 4*1sS~]v;P޽tNe$*N'B6mJYPSCmHRpr^JDd:>U H%PcV݊`ztɀITw>Xi+}o 2({ѝKrQCۭ;W-`*T|i\)CQM@7؏VƠXeϠ̰\9%UJXml6ɨ03\v^(caAɰl&< 䁸(+"O<_%YvBo}vbA'_Q^2eV_ 3*5hHj7RZcrT(nCeW:4q-HCPj4I> U4X=9ö4Aޣ}?bR fxdݩՊdZ#<ʝ~~9% f?;~r|xT$҂]^TXצ)N~y`\ܓOߗiM5HR7= kߦY) q Fǀ{׶MbAw&mUD<6ʻTnMV VENi ] @T@m&@*l@DF;f?.n}J]b~Mhv %6⣋Plwmj?ˇsRO\*:Q7­J4e=I9;>miIGXzxȳi؞4ߨ~7I! "{u)"ݱ?s|im/Z\Tq76-&GkQ7HH!9 Ju;׆ҧ]P텘Rw?,3Ona#J clUX Lr+Jmӵ}嫳u9p6Ʃ/2Mh|<;cH7ģ޽ݎ޹\A(u5;oqڽ p N_'wrF^COݙpfi{}u(|_~۲_I%;)gf`=FyOٹ|ƱoM~VfA5}¿7r`(eeh: e+ %~Օq#PTB|1g$Wb !&'Z|Ku+.+kߠY*,KdhY@'6C]&Mj)V#}<izmؤd-?>c2p@24.c'buU*8(5Gjg- 9Kpr n+kɠA:c"Fah3g-Xu(l$75~# qש3Q%%T 2j$Mi@Ő ey!5$E~N`C0é ˠ,j6R6w%@'NqJnH u'%,loS &p l6hā^0n 5ʊu! K7z^֤ %))L)F-PI]?~?쿗-71-0IB@?w!oWå1E)$+5b{Ƹ *-AGȔ!ҕ) z<ۛCC7Z9TmYڰQ˸뷷фwI .c]LTS":T(zd[D$w=ؑ**:_٦I]aP{H+q T c]bAbH4]FTJԊ\R:r'am*|lkr؃^UXC*ig"cwZS.Q<{xtb(%; y`>#Q=rvڄiRTV- oQrIZFF;PדU")׿|Vhi!+jMM6Ǘ ;PvVqznWcN>ǯ ? >"UqQJ o2mԝxxTNi_mbf!AI9(ʕ*6?o╫xm @ R#X]튬g wԊu`!=ȧ?9I}G]늚']$(dn$R={l>mV'ᘺijŗ ^!؏GN߶]VP6̸rWSZE$- E;C6;v'Ȋ{V+2J]VW8iؙ=;pFzuve\˭7OӋ'cU$S; *A;T*A`P֕%tvxnw]Wezma-ԂژPej v8=v>٩Oz`+jJW vb;Ws]ZowKWƇv[ ~8٫nzҟ(v=ޛ0`{=묪Pf#ݯ ~2;eMH J$%.G ;#jV%ܮԧeHD;^?FHdlKt?;\T+AJǧG 4E #lAv9aF<_R;aWb5&v?"JM1co|.$)ZĻ J}$b!J t6ؼVjd Slv@e&lRAj^,]~?^cV݈I~AtNLDbR\3}LEIv"jfd[fb@jn4,QA޴xR]Z^wDž]-%Oi0PWc=iE0<8h%Ϯ釁N[swe&݊C1z1ݐ1*7oJd 'e#pkJx`We@9mNզ*ޛ;([?1;EA'LUٷb}6=v0FAjvZH4ٸO](Uvۨ|V!ٍ[5be*wCE=O Ivj㊻/ph* Wb PC*?]Z]ZV0+nb7ȡ٤ EzCgfz5$lTc?/qӛS3kp3 Pk׾ȲpCo/bO5OaZ&vKBZm&؋]䀴;b~Х+'Hv0'*r!mtc{ ]ө)v5L!Ʒ®J;xӾ(vW.jU=ڸ€NF6e{m.+]ƀbހ%٫zbNDزHt9ʝRFqv/j9SJsHԓJ|iv9}Mn; 2\*X8)]אHv4);6ekGicCƔj{*)WeJC"ݔ$ We+ p-q߷۲oCx Ju J]ԁ>C£m;,׮{]AvGh'$42{g%S?]fX}N_ɻ+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊:7cHFx7j@.z\s,T.9*&@O`*Mv~Vhkv۽NFr-0<@( ޾F3TF<6n}o+X"0 jS{5Y#qËX2q؝}F 7olk͎qKoi/2R8>KRa>9K-V`3ZZ?͹'E]n^#MxJ $> ^3X͖MI ]nDA4_h( cdZ8Ǎb|{ȥDzG`vӈb̝o3W>` sQXHLw2 UxdBW߿Z5@^rAVS߾A l)҇ڣ—eFqC؟ثG'¢AJSŃ=~)Jqv7IZVd$TdSn `9ԃAUmeQzcfQ7–:8@}[28PpڵNBHt߶q\jI5{uZS M};B~j{or)lb|4n+`× {O(n𫱅Kzu]\})]N?$kӾ=U\.*|k*@A' e!@߯)\m-T/Bv'o]҇fX’C^tR;b9N冕$W8߶Jk5?$)|wj6:*o_)pG߁;SL7' )د:Rz2Xqh4;\(ZXt㸯JxƒTc]+ԝ~{Jnf{81OQ4o::ɳ($bR ⦴!hm0 P ipn9*)OƘiZc]:5T1KLk1Xڇjx %FGtޙ8APjһtCL[y1|ʋRX*эo|pS3ͥk3}voɲgB͹= M|)ZZք邐vSv@Ġ 2Ej(;xp*jJ1vTA^æ-ڇ\2ҠMd ֤|B)tބ8T{J{bէcWB|;_!ZE+]OP{kVᤡ5"U>=)A-=ٍXSEW^GjvdnO_ J)@8 ߳H"vĶ*7|Bh|[!j`SO0EWnشJfIQwHھ>a>%եӊ'5nOʽMHqE"/'˃OrZ edBȁU{t.hMCl wނq]]$eTnkLÄ"#x̍-ߥ|T4QQn99%3tS~?td!P}\"ʹ-z$uXW-1Mc)lKoj )~>+ޝӔH)6MOBScQv"Gڇ$Uؔ#=2AH, I@$'=rJ철 A獥؇kllWdcƔ*k?a]V@@*Rihݎ:86%.~kP7r!.ūoЎE2v-}|2.M )v, t2)v |^=iv &$BV{r;GVT֡5%MaW6M…7kھ# <:bdrR;%. 0 q!=Aa,uA(Y;ҵ5?8bFߠ8낭 DuԏI-ZӰ VNS^oN'f!:AOU\lqՑU7GpC4?lyZ(^@|$|ÞP\ { O^ɼ剴{ An4Bi2rLj"6o߭=bRj)7L u?i;kIK&czAW`;f2? u!٩P)vSM!]ʛSa۲$j`WeT^ՈOvS5)0һ,|CR1We2Ptq]Q;,KR)ڣ;Ol v`6ƅGZS)v8Co :إfP `WcnWcM\ vY߿P7eԟ*ܑL캀7.4ZWeҝ~};;&]# w|%6Nʤ[ Kƻo,1`/=QbCwvߧ!;wWN @c=rRL2Z[6j9i v tj*!&==jr(v,sl Ƅ+lMIv>#M}lK즟= @2ӯ&jī2 ]v+N">* (6=e&l1vT1$* pwQƘbڲ^\ TjxtT Dq ~]Y ?J쭩O]ޘٕ@*Pm] SSӫvڻ) t=p]~v;av]F}C=; 6ve75_ޣ v?cE@өyJ] ׉cwm] ZczjQP]<xS)v:mu+ʔu/뀔 IߧBآu& HYUE)W$6C